diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1000_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1000_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fa3167212d29c2dd2bd6479336849297f76fd947
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1000_en.txt
@@ -0,0 +1,6 @@
+On July 10, 2022, a 40-year-old woman was admitted to the first affiliated hospital of Xi’an Jiaotong University due to intermittent fever for 2 months. Two months prior, her temperature fluctuated between 37.4 and 38.4°C in the afternoons, and chills and a dry cough accompanied this symptom. She had previously undergone examination and symptomatic treatment at a regional hospital. However, the treatment was ineffective. Furthermore, arthralgia and fatigue gradually appeared, with no chest pain and tightness, or rash. A month and a half prior, she was diagnosed with depression and treated with escitalopram oxalate, and magnesium valproate sustained-release tablets at a hospital. The symptoms slightly improved after treatment. Half a month prior, a B-ultrasonic examination showed lymphadenopathy throughout her body. Therefore, lymphoma was suspected but she did not get any treatment. One day prior to her arrival at our hospital, the patient suddenly developed hemoptysis of approximately 2 ml, which occurred four times for no reason. Past medical history revealed that she was diagnosed with chronic hepatitis B (CHB) in 2014 and developed cirrhosis a year later. Her CHB was well-controlled by a long-term oral antiviral treatment with Entecavir. In addition, she had lost 5 kg over the past 3 months.
+On admission, her temperature was 37°C, respiratory rate was 19 breathe⋅min–1, heart rate was 70 beat⋅min–1, and blood pressure was 103/72 mmHg. The liver, spleen, lymph nodes of the neck, and axillary lymph nodes were enlarged with moderate activity and no tenderness. Rough breath sounds were detected in both lungs with dry and wet rales. All other clinical examination results were negative.
+Laboratory examination revealed inflammation and liver dysfunction: red cell count, 4.27 × 1012/L (4–4.5 × 1012/L); white cell count, 4.87 × 109/L (5–12 × 109/L); platelet count 89 × 109/L (125–350 × 109/L), hypersensitive C-reactive protein 9.81 mg/L (0–3 mg/L), direct bilirubin 6.2 μmol/L (0–3.4 μmol/L), aspartate aminotransferase, 54 U/L (13–45 U/L); alanine aminotransferase, 20 U/L (7–40 U/L); alkaline phosphatase, 164 U/L (35–100 U/L); γ-glutamyl transpeptidase, 82 U/L (7–45 U/L), albumin 33.8 g/L (40–55 g/L).
+B-scan ultrasonography revealed bilateral cervical and axillary lymphadenopathies. Chest computed tomography (CT) revealed multiple pulmonary nodules in both lungs, with a small amount of pleural effusion and enlarged lymph nodes in the bilateral axilla. To effectively confirm the nature of the lesion, we performed needle biopsies of pulmonary nodules and lymph nodes. The results implied an infectious disease, while the detection of T cells in tuberculosis infection was negative. Therefore, suspicions of tumors and tuberculosis were excluded.
+Interestingly, we noticed that the patient came from Ningxia province, which is famous for animal husbandry. The patient reluctantly informed us that she raised cattle and had come into contact with neighboring sheep without vaccination. Consequently, Brucella infection was suspected. On the fourth day of admission, the serum agglutination test (SAT) result was 1:800, and the rose-bengal plate agglutination test (RBPT) result was positive. Furthermore, the blood culture for Brucella melitensis was positive on the tenth day after admission. Characteristic rod-shaped gram-negative bacteria could be observed under a microscope. Subsequently, the patient was definitively diagnosed with brucellosis.
+Following the brucellosis diagnosis, she received antibiotic therapy with rifampicin (600 mg/dose, once a day) and doxycycline (100 mg/dose, twice a day) for 3 months from the fourth day of the course. Furthermore, due to the poor medical conditions of the patient’s residence and excessive complications, including multipulmonary nodules, arthralgia, hepatosplenomegaly, and lymphadenopathy, moxifloxacin and ceftriaxone sodium were added from the sixth day of the course to prevent the possibility of developing drug-resistant brucellosis after discharge. During treatment, the patient and her family were highly cooperative. At discharge, fever, cough, arthralgia, depression and fatigue were relieved. After 2 months of follow-up, the fever and cough were gone, as was fatigue and arthralgia. In addition, the number of multiple nodules in both lungs was reduced. At the same time, liver function test results also indicated that the patient was recovering well. After 3 months of follow-up, her weight had increased and her depression symptoms were alleviated. The entire process of diagnosis, treatment, and outcomes is shown in .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1018_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1018_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f26c6a874f23cdfc972a0ae0712082d06b3f9f81
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1018_en.txt
@@ -0,0 +1,6 @@
+A previously healthy 12-year-old girl presented with a 2-year history of chronic progressive bilateral knee pain, worsening in the preceding 6 months. Her symptoms were episodic and variable in duration and severity, with difficulty participating in sports. She had a 2.5 kg weight loss over 2 months and low BMI of 14 kg/m2. She denied any gastrointestinal symptoms, oral ulcers, skin changes, or ocular symptoms. She had not tried any specific treatments or interventions. She is of South Asian background and the product of a non-consanguineous relationship. There is no relevant family history of CRMO, autoinflammatory disease, or IBD. Examination showed fullness and tenderness in both medial femoral condyles. Her abdominal and perianal examinations were benign.
+Initial investigations showed a normocytic anemia (Hb 112 g/L, MCV 79 fL), raised transaminases (ALT 84, AST 81, ALP 227, GGT 146 U/L), and raised inflammatory markers (ESR 94 mm/hr., CRP 15 mg/L). X-rays of the hips, femur, and knees showed distal femoral metaphyseal lytic lesions with surrounding sclerosis, and MRI of the lower limbs revealed multifocal distal femoral bone marrow abnormalities with regional edema pattern, cortical thickening, and periostitis . A whole-body MRI revealed additional bone marrow edema pattern involving bilateral medial clavicular heads and right acromion.
+The patient was treated with a single dose of intravenous zoledronic acid (0.0125 mg/kg) with significant clinical improvement and improved mobilization, but demonstrated persistently abnormal liver enzymes (AST 71, ALT 67, GGT 124 U/L), anemia (Hb 106 g/L), and raised inflammatory markers (ESR 82 mm/hr) and gamma globulins (IgG 30.1 g/L, IgM 3.3 g/L). Conjugated bilirubin was < 0.2umol/L, albumin was 42 g/L, and INR was 1.0. The patient remained asymptomatic without abdominal pain or bowel alterations, jaundice, or pale stools.
+Further workup with pediatric gastroenterology was concerning for Type 1 Autoimmune Hepatitis (AIH) with Anti-Smooth muscle > 1:640, ANA negative, Anti-LKM negative, and ANCA negative. Abdominal ultrasound showed mildly heterogeneous liver echotexture but a normal biliary tree; magnetic resonance cholangiopancreatography was normal. Transient elastography showed increased liver stiffness (8.8 kPa, IQR/median of 7%). Liver biopsy showed features of both small-duct PSC and AIH, with interface hepatitis with plasma cells, concentric fibrosis of bile ducts, grade 3–4 hepatitis and stage 3–4 fibrosis. Other diagnoses including hepatitis B/C and tuberculosis, Wilson disease and celiac disease were excluded.
+Although the patient was asymptomatic, given the strong association between PSC and IBD, the patient’s fecal calprotectin was measured. This was elevated at 615 μg/g, and so she underwent gastroscopy and colonoscopy. This showed chronic mildly active colitis (non-granulomatous) from cecum to rectum with normal terminal ileum, and normal upper endoscopy, leading to a diagnosis of ulcerative colitis.
+The patient’s liver and gastrointestinal disease was treated with oral prednisone (35 mg oral daily), azathioprine (75 mg oral once daily), and ursodeoxycholic acid (250 mg oral daily) with sufficient adherence. No reported adverse effects were reported. There was normalization of liver biochemistry and liver stiffness (5.5 kPa with IQR/median 19%) within 6 months. The patient’s musculoskeletal symptoms remain inactive 11 months since initial therapy with zoledronic acid.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1025_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1025_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..823e9cecc772e95684b6c0fbe938e1c433dae1b6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1025_en.txt
@@ -0,0 +1,3 @@
+The patient was a 34-year-old Turkish woman, gravida 2 para 1 with a normal vaginal delivery 15 years previously. Although she had not used any contraceptive method afterwards, she had not become pregnant. She was transferred to our hospital from her local clinic at the gestation stage of 13 weeks because of pain in the lower abdomen and slight vaginal bleeding. She did not know when her last menstrual period had been, due to irregular periods. At admission, she presented with a history of abdominal distention together with steadily increasing abdominal and back pain, weakness, lack of appetite, and restlessness with minimal vaginal bleeding. She denied a history of pelvic inflammatory disease, sexually transmitted disease, surgical operations, or allergies. Blood pressure and pulse rate were normal. Laboratory parameters were normal, with a hemoglobin concentration of 10.0 g/dl and hematocrit of 29.1%. Transvaginal ultrasonographic scanning revealed an empty uterus with an endometrium 15 mm thick. A transabdominal ultrasound examination demonstrated an amount of free peritoneal fluid and the nonviable fetus at 13 weeks without a sac; the placenta measured 58 × 65 × 67 mm. Abdominal-Pelvic MRI (Philips Intera 1.5T, Philips Medical Systems, Andover, MA) in coronal, axial, and sagittal planes was performed especially for localization of the placenta before she underwent surgery. A non-contrast SPAIR sagittal T2-weighted MRI strongly suggested placental invasion of the sigmoid colon .
+Under general anesthesia, a median laparotomy was performed and a moderate amount of intra-abdominal serohemorrhagic fluid was evident. The placenta was attached tightly to the mesentery of sigmoid colon and was loosely adhered to the left abdominal sidewall . The fetus was localized at the right of the abdomen and was related to the placenta by a chord. The placenta was dissected away completely and safely from the mesentery of sigmoid colon and the left abdominal sidewall. Left salpingectomy for unilateral hydrosalpinx was conducted. Both ovaries were conserved. After closure of the abdominal wall, dilatation and curettage were also performed but no trophoblastic tissue was found in the uterine cavity. As a management protocol in our department, we perform uterine curettage in all patients with ectopic pregnancy gently at the end of the operation, not only for the differential diagnosis of ectopic pregnancy, but also to help in reducing present or possible postoperative vaginal bleeding.
+The patient was awakened, extubated, and sent to the room. The patient was discharged on post-operative day five with the standard of care at our hospital.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_102_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_102_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..17a4ac41053680f45f759fe9f3a9f2b62ff402ad
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_102_en.txt
@@ -0,0 +1,5 @@
+A previously healthy, 33-year-old white female was presented with headache and fever for 3 days. She did not used to smoke or consume alcohol. She gave 3 live healthy births and 1 year ago bilateral leg swellings and high blood pressure were noticed close to her last delivery, but medical investigation was not performed and her symptoms disappeared soon after the delivery. Her mother succumbed to a sudden disease, which was characterized by acute renal and neurological injuries, but further information was not available.
+On physical examination, she was good on appearance, and temperature, blood pressure, and pulse rate were 38°C, 160/100 mmHg, and 110 bpm, respectively. Bilateral minimal pretibial edema was noticed.
+The laboratory tests were consistent with thrombotic microangiopathy and severe renal dysfunction (leukocytes 5800 cells/mm3, urea 255 mg/dL, creatinine 11.8 mg/dL, uric acid 8.7 mg/dL, Na 133 mEq/L, K 4.9 mEq/L, AST 43 U/L, ALT 105 U/L, LDH 1248 U/L, total bilirubin 0.03 mg/dL, CPK 37 U/L, C-reactive protein <3 mg/L, 2–3 leukocytes and 8–10 erythrocytes per high power field and 3+ proteinuria in urinalysis, 24 hours proteinuria 2.4 g, serum haptoglobin <10 mg/dL, Coomb tests negative, reticulocytes 3.68%, and 5% schistocytes per field in peripheral blood film). Plasma ADAMTS13 levels and activity were within the normal limits. Antinuclear antibody was negative, C3 level was 80 mg/dL (85–200), and C4 level was within the normal range. Left renal agenesis and enlarged right kidney (145 × 55 mm) were detected by urinary ultrasonography.
+Genetic analysis revealed a novel mutation in exon 21 of complement factor H (CFH) (c.3454T>A; p.C1152S), and the same mutation was later identified in her asymptomatic 3 (males) of 4 siblings.
+Daily plasma exchange using 40 mL/kg fresh frozen plasma and on-demand hemodialysis were started. Markers of thrombotic microangiopathy did not consistently normalize during 22 sessions of plasma exchange; therefore, PE was replaced by eculizumab within 2 weeks of vaccination against Neisseria meningitides (900 mg/week for 4 weeks, 1200 mg every other week from the 5th week on). Thrombocytopenia and elevated LDH normalized within 1 month along with gradual improvement in renal functions and the need for dialysis was eliminated within 2 months of eculizumab treatment . Eculizumab was discontinued after 1 year of treatment, during which creatinine nadir was 1.35 mg/dL, and the patient was set to follow-up. Thrombocytes dropped and remained below the lower limit of normal from the 7th month (January 6, 2015) of follow-up on, but LDH levels remained around the upper limit of normal . Multiple peripheral blood films, serum haptoglobin levels, and reticulocyte counts were found normal, except for thrombocytopenia, since detection of thrombocytopenia. Levels of creatinine slightly increased but remained <2 mg/dL except for a few occasions, whereas the levels of proteinuria remained <0.5 g/day (385 mg/day at last visit) . Informed consent was obtained from the patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1040_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1040_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..148bb4920a55d55ed7a3eb9e455c6281f9a216d3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1040_en.txt
@@ -0,0 +1,3 @@
+Our patient was a 75-year-old Iranian man, admitted to hospital with recurrent upper abdominal pain for the past 18 months. A common bile duct plastic stent had been inserted based on the results of diagnostic investigations, including an obstructive pattern of liver enzyme elevation, dilatation of extra- and intrahepatic bile ducts revealed through ultrasonography and heterogeneity of the pancreatic head (likely due to cancer) in an abdominal spiral CT scan with oral- and venous-contrast media . No abnormalities were found during a physical examination, with the exception of mild upper abdominal tenderness and vitiligo patches on his neck and hands .
+An upper gastrointestinal endoscopy, aimed at controlling the presence of occult blood in his stool, iron deficiency anemia and heartburn, showed lower esophageal ulcers associated with diaphragmatic herniation. A pathologic evaluation of the ulcer biopsy specimens confirmed reflux esophagitis. A colonoscopy was normal. Mild dilatation of his extra- and intrahepatic bile ducts was seen in repeated abdominal ultrasonography procedures. However, an endoscopic ultrasound showed a hypoechoic area, 2 cm in size, in the head of his pancreas. The pathological and cytological results of an aspiration biopsy of the lesion revealed fibrosis and inflammatory cell infiltration without evidence of malignancy .
+Once AIP had been diagnosed, prednisolone was administered. Two months after treatment, a reevaluation of the pancreas head by means of an abdominal spiral CT scan with oral and venous contrast media did not show any abnormality, and the common bile duct stent was removed because of the positive therapeutic response.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1053_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1053_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..798bb41378aedc5e612463216822ff5a5362cb0b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1053_en.txt
@@ -0,0 +1,6 @@
+We evaluated a Comorian girl aged 3 years 6 months with neuroregression and seizures. The child was third born to second-degree consanguineous parents by lower-segment cesarean section due to cephalopelvic disproportion. Birth weight was 3.1 kg with uneventful perinatal history. There was maternal history of normal healthy live birth in the first pregnancy and spontaneous miscarriages in second and fourth pregnancies in early trimesters. The fourth pregnancy was associated with Down syndrome. The mother was given antenatal progesterone for excess bleeding in the first trimester.
+From 2 weeks of age, she presented with lethargy, sweating, and breathlessness on feeding. Later on, she presented with recurrent episodes of aspirations with severe lower respiratory infections. Cardiac examination revealed a holosystolic murmur suggestive of ventricular septal defect (VSD). Chest X-ray revealed cardiomegaly with features suggestive of pneumonia . Echocardiography (ECHO) showed moderate VSD (6–7 cm subaortic perimembranous VSD), dilated left atrium and left ventricle, trivial aortic regurgitation with aortic cusp collapse, dilated pulmonary artery system with flow acceleration across pulmonary valve, and half-systemic pulmonary artery pressure with normal left ventricular systolic function . There was no pericardial effusion or right ventricular outflow tract obstruction. She was managed medically with decongestive medications and antibiotics for lower respiratory infections. She was noted to have laryngomalacia. At 3 months of age, decreased motor movements were noted. She was gaining weight till 5 months of age, after which there was flattening of the growth curve and failure to thrive. At 6 months, she had developmental arrest followed by progressive neuroregression. She also had severe startle response since 8 months of age. Then, she started having generalized recurrent seizures from 9 months onward. The epileptic episodes were mostly focal with secondary generalization, with the most severe event reported as having frequency of ten seizure episodes within 2 hours time period despite anticonvulsant therapy. She had also macrocephaly with coarse facial features, persistent laryngomalacia, and hyperacusis. There was no muscle atrophy. Central hypotonia, peripheral hypertonia, and a positive Babinski reflex were elicited. Organomegaly was absent. Ophthalmological examination showed bilateral macular cherry-red spots and an inability to fixate the eyes. At 12 months, she developed gastroesophageal reflux disease (GERD) as well as reactive airway disease. Gastrostomy tube feeding was also commenced. She had frequent episodes of hospitalizations due to repeated aspiration pneumonia, reactive airway diseases, and other central nervous system complications.
+History and physical examinations pointed toward the diagnosis of GM2 gangliosidosis (Tay–Sachs disease, SD, AB variant). In view of cherry-red spots and coarse facies, GM1 gangliosidosis was also considered. No significant abnormality was noted in complete blood count, electrolytes, or renal and liver function tests. Ultrasonography of abdomen did not reveal any hydronephrosis or other anatomic abnormalities. Computerized tomography scan of brain without contrast was suggestive of mild bilateral symmetric hyperdensity of thalami . Electroencephalogram (EEG) showed slowing of delta frequencies associated with drowsiness. Video-fluoroscopic assessment for swallowing function was suggestive of aspiration on both fluoroscopic runs. Magnetic resonance imaging (MRI) of brain revealed extensive high signal within the supratentorial white matter involving subcortical and deep white matter structures. There was evidence of T1-increased signal in the thalamus and a relatively large head shape. Bilaterally, the thalami demonstrated symmetric reduction of T2 signal and increase in the T1-weighted signal. There was marked delay in myelination as demonstrated on T1-weighted imaging. The corpus callosum was markedly thinned in its anterior body and genu. There was mild hypoplasia of the posterior arch of the C1 vertebra causing minimal narrowing at the upper cervical spinal canal .
+Magnetic resonance spectroscopy (MRS) trace did not reveal high creatinine or N-acetyl aspartate (NAA) peaks. No significant lactate level was demonstrated .
+Metabolic workup revealed a serum finding of trace-to-absent total serum HEX A and HEX B (0.0 nmol/min/ml; reference value > 20 nmol/min/ml) explaining the deficiency of the β subunit of HEX and consequent deficiency of HEX B. The serum HEX A percentage was 100% (reference value 20–90%). This biochemical findings of low total HEX and deficient HEX B activities, with high percentage of HEX A/total HEX activity suggested the diagnosis of SD. Oligosaccharide urine screen was positive in the urine sample, and genetic testing confirmed the diagnosis of SD with homozygous deletion c.(445+1_512-1)_(669+1_1170) in the HEXB gene. The parents were advised to consent to genetic analysis, but they refused.
+The patient was maintained on decongestive therapy (captopril, frusemide, spironolactone, and digoxin) and antiepileptics (levetiracetam and phenobarbitone). Fundoplication was done owing to her symptomatic GERD during infancy, and she was started on regular esomeprazole and domperidone, after which she was fed through gastrostomy tube. Fluticasone, ipratropium bromide and salbutamol nebulizations were continued in view of reactive airway disease. Iron supplementation was started in view of anemia. The clinical course is complicated with recurrent aspiration pneumonia warranting frequent hospital admissions. She also underwent multiple bronchoscopies. At 3 years of age, she had adenoviral infection on respiratory BioFire assay and then developed Pseudomonas pneumonia. Despite treatment with piperacillin–tazobactam, ciprofloxacin, tobramycin, and clindamycin antibiotics, her cardiorespiratory status worsened and she became ventilator dependent. Tracheostomy was performed at 3 years of age. However, despite the multimodality care with cardiology, neurology, pulmonology, physiotherapy, and nutritional and ventilatory support, she died at 3 and half years of age .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1057_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1057_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..21e21b88ec637e0f2476992f2fe275cefad07b42
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1057_en.txt
@@ -0,0 +1,4 @@
+A 72-year-old man (height 168.5 cm, weight 72.4 kg, and body mass index 25.5 kg/m2) had type 2 diabetes mellitus and stage 4 chronic kidney disease (estimated glomerular filtration rate [eGFR] 28.0 mL/min/1.73 m2) before X-47 years. Other medical history included heart failure with reduced ejection fraction due to acute myocardial infarction, right lower extremity atherosclerosis obliterans, cataracts, and osteoporosis. He had no family history of diabetes, and no history of allergies and side reactions.
+He underwent an emergent percutaneous coronary intervention at Mie University Hospital in X-5 years but did not achieve good glycemic control despite taking glimepiride 3 mg once daily, sitagliptin 50 mg once daily, and metformin 250 mg twice daily (fasting blood glucose level 327 mg/dL and hemoglobin A1c [HbA1c] 7.8%). His primary physician changed his antidiabetic medication to sitagliptin 50 mg once daily, mitiglinide 10 mg three times daily, and insulin glargine 10 units once daily, and he was subsequently discharged from the hospital for regular visits.
+The patient’s daily dose of insulin glargine was increased from 10 to 12 units because of poor glycemic control (X-4 years; HbA1c 7.9%). Nevertheless, he did not obtain good glycemic control in X-3 years (HbA1c 8.2%). His primary physician confirmed negative findings of anti-glutamic acid decarboxylase antibody, C-peptide level of 2.9 ng/mL, and C-peptide index of 1.6. In X-2 years, voglibose 0.2 mg three times daily was added to the present regimen (HbA1c 8.1%). In X year (day 0), he orally received vadadustat 300 mg once daily with a diagnosis of renal anemia (hemoglobin 9.9 g/dL and HbA1c 7.4%). His eGFR was approximately 30 mL/min/1.73 m2 during the follow-up . The blood glucose mean (± standard deviation) over the last two weeks (days -14 to -1) was 108 ± 14 mg/dL before breakfast, 122 ± 24 mg/dL before lunch, and 158 ± 39 mg/dL before dinner . The prescribed medications on day 0 were sitagliptin 50 mg once daily, mitiglinide 10 mg three times daily, voglibose 0.2 mg three times daily, insulin glargine injection 12 units once daily, aspirin enteric tablets 100 mg once daily, rosuvastatin 10 mg once daily, esomeprazole 20 mg once daily, furosemide 20 mg once daily, carvedilol 10 mg twice daily, eplerenone 25 mg once daily, perindopril 2 mg once daily, and minodronic acid 50 mg every 4 weeks. There were no significant changes in medication history and lifestyle habits, such as diet and exercise, during treatment with vadadustat. Self-monitoring of blood glucose showed a decreasing tendency on day 18 after the start of vadadustat administration. He developed asymptomatic hypoglycemia on day 23 . The blood glucose level of the concomitant vadadustat period (days 0 to 23) was 94 ± 16 mg/dL before breakfast, 109 ± 20 mg/dL before lunch, and 126 ± 30 mg/dL before dinner . He called his outpatient attending physician and visited the hospital on the same day. This phenomenon was considered to be a result of the drug–drug interaction between sitagliptin and vadadustat via OAT3 inhibition, resulting in an enhanced hypoglycemic effect of sitagliptin and mitiglinide.
+The blood glucose recovered to 121 ± 25 mg/dL before breakfast, 147 ± 38 mg/dL before lunch, and 161 ± 36 mg/dL before dinner after discontinuation of vadadustat (days 24 to 37) . On day 56, at the regular clinic visit, his medication was changed to the alternative HIF-PHD inhibitor, daprodustat 2 mg once daily, and dipeptidyl-peptidase-4 (DPP-4) inhibitor, linagliptin 5 mg once daily, which is not transported by OAT3. Thereafter, the blood glucose remained stable at 111 ± 19 mg/dL before breakfast, 119 ± 13 mg/dL before lunch, and 134 ± 32 mg/dL before dinner (days 57 to 70). On the drug interaction probability scale (DIPS), the drug–drug interaction between sitagliptin and vadadustat was scored at 5 points, classified as “probable” .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1062_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1062_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..252c90fe53b8fd264745800af91fa55b7810bd5e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1062_en.txt
@@ -0,0 +1,9 @@
+A 66-year-old man had symptoms of abdominal pain, distension, and weight loss (from 62 to 47 kg within 6 mo).
+The patient complained of abdominal distension and weight loss and had visited the hospital previously. Esophagogastroduodenoscopy (EGD) was performed, and an advanced type 3 lesion was detected on the lower part of the gastric body with stenosis, causing resistance to passage of the scope. He was then admitted to our hospital and underwent a detailed medical examination and treatment.
+He had no specific past illness but had a current active smoking status [Brinkman Index: 920 (20 × 46 years)].
+No family history to note.
+Mild tenderness was noted in the upper abdomen.
+Initial laboratory data revealed a hemoglobin level of 11.0 g/dL, white blood cell count of 9700 cells/µL, and platelet count of 3.17 × 105/μL. The creatinine level was 0.81 mg/dL, total bilirubin level was 0.3 mg/dL, direct bilirubin level was 0.1 mg/dL, aspartate aminotransferase level was 43 IU/L, alanine aminotransferase level was 72 IU/L, and albumin level was 3.5 g/dL. Tumor marker level of the carcinoembryonic antigen was 23.00 ng/mL, and carbohydrate antigen 19-9 level was 53.20 U/mL.
+EGD identified stenosis caused by a large tumor . Computed tomography (CT) showed lymph node (LN) metastases at the station of the lesser curvature (#3 LN; 11.8 mm × 8.5 mm, Figure ), right greater curvature nodes along the right gastroepiploic artery (#4d LN; 10.3 mm × 8.4 mm, Figure ), infrapyloric nodes (#6 LN; 21.6 mm × 14.7 mm, Figure ), anterosuperior LNs along the common hepatic artery (#8a; 14.0 mm × 13.4 mm, Figure ), and suspicion of metastatic #6 LN invasion to the pancreatic head (the names of the LN station are provided in Table ). There were no findings of distant metastasis.
+Biopsies were taken, and the histological examination led to a diagnosis of adenocarcinoma (papillary and well-differentiated adenocarcinoma; Figure ). Additional pathological examination revealed human epidermal growth factor receptor 2 (HER2) positivity based on an immunohistochemical score of 3 + .
+The clinical diagnosis was gastric cancer LD circ cType3 cT4b (panc) N2M0 cStageIVA according to the Union for International Cancer Control Tumor, Node Metastasis Classification of Malignant Tumors, Eighth Edition. The lymph node station was defined according to the Japanese Classification of Gastric Cancer, 15th Edition.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1073_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1073_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9124cbb50745c8a8d755a83854d18cad6617fba6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1073_en.txt
@@ -0,0 +1,3 @@
+A 72-year-old man visited our hospital complaining of gross hematuria. There were no GI illnesses in his medical history. Cystoscopy revealed multiple bladder tumors. CT and MRI showed stage cT1N0M0 disease. The patient underwent transurethral resection of the bladder tumors. Complete resection of the bladder tumors was not achievable because of the extensive lesions. The pathological result was high-grade pT1 urothelial carcinoma. After pathological diagnosis, the patient was treated with two cycles of a gemcitabine and cisplatin regimen as neoadjuvant chemotherapy. The patient then underwent laparoscopic radical cystectomy with the creation of a U-shaped ileal neobladder and limited dissection of the lymph node. Pathological examination showed high-grade pT2 urothelial carcinoma with negative resection margins and pN0 (two lymph nodes). Recurrence evaluation after surgery was determined by FDG-PET-CT due to reduced renal function. Three months after surgery, FDG-PET-CT taken to evaluate the effect of initial postoperative treatment revealed a new appearance of abdominal lymph node metastasis . Due to reduced renal function, combination chemotherapy with gemcitabine and carboplatin was administrated. However, enlargement of lymph node metastases was identified on FDG-PET-CT after two cycles . The patient began treatment with pembrolizumab (200 mg/body administrated every 3 weeks) as second-line treatment. FDG-PET-CT after three cycles of pembrolizumab showed a marked response with the disappearance of FDG accumulation in all metastatic lesions .
+The patient had no adverse effects, but after 10 months complained of anorexia and upper abdominal pain. EDG demonstrated diffusely erythematous and edematous gastric mucosa covered with a whitish, fibrin-like membrane . In addition, diffuse erosions were found in the gastric antrum .
+Biopsy specimens revealed inflammatory cell infiltration and apoptosis in the epithelium. High numbers of lymphocytes and plasma cells were observed infiltrating into the lamina propria . In addition, T cell infiltration and apoptotic bodies were observed in the gastric epithelium . Immunostaining identified these lymphocytes as CD3+ and CD8+ T-cells in the epithelium. No histological or immunohistochemical evidence of Helicobacter pylori or cytomegalovirus was apparent. However, the serum H. pylori antibody concentration was elevated (15 U/mL; normal <10 U/mL). The clinical and pathological findings were comparable with lymphocytic gastritis induced by pembrolizumab. The patient received eradication therapy combined with the administration of a PPI, amoxicillin, and clarithromycin for 1 week. Eradication therapy and cessation of pembrolizumab led to improvement of clinical symptoms and findings on EDG without steroid therapy in 4 months . The patient has since resumed and continued pembrolizumab administration while maintaining CR for 28 months to date.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1075_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1075_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1be0c2982dc61113b6bbf950f6027947af7a1da9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1075_en.txt
@@ -0,0 +1 @@
+We introduced a 34-year-old man with a definitive diagnosis of KS from two years ago, with a history of trauma to the ankle from 18 days ago. His family history of venous thromboembolism (VTE) was negative. He was hospitalized in the cardiology ward to treat chest pain and dyspnea, with the New York Heart Association Classification of Heart Failure (NYHA) class III. The clinical examination at the time of admission in OR exposed a drowsy patient with a history of twice syncope from the day before, palpitation (PR = 120), sweating, chest pain, blood pressure at 80/55 mmHg (with invasive blood pressure monitoring IBP), SpO2at 85% in ambient air and 92% under oxygen, and two-sided crackles on chest auscultation. In paraclinical findings, a D-dimer test was 1700 mg/mL, ECG revealed tachycardia with RBBB, transthoracic echocardiography presented a D-shape septum due to high RV pressure, moderate to severe RV enlargement, moderate to severe RV systolic dysfunction, hypertrabeculated RV apex, at least moderate TR, TRG = 40 mmHg, severe PAH, PAP = 55 mmHg, dilated IVC with respiratory variation < 50%, visible fresh cloth in main PA, and proximal part of branches in suprasternal view. On computed tomography angiography (CTA) of the lungs, a massive embolus was reported in the main pulmonary artery as well as in the right and left main branches. The troponin was negative. The lower extremities venous Doppler ultrasound revealed normal flow and no thrombosis. Because of this massive pulmonary embolism, the patient was a candidate for surgical embolectomy. After general anesthesia and placement on the hypothermic cardiopulmonary bypass (CPB) in the 28-degree centigrade, pulmonary embolectomy was done . After rewarming, weaning off from the CPB was easily done, without the need for inotrope. After four hours, the patient was extubated and weaning off the ventilator with a stable hemodynamic condition. The congestive signs were retreated well using diuretic treatment. The patient was discharged from the hospital in good general condition after one week with a warfarin prescription.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1076_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1076_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..26500af5f1948d18289ba4874536881a3f578915
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1076_en.txt
@@ -0,0 +1,6 @@
+A 71-year-old female with a history of acid reflux presented to the emergency department following a syncopal episode, along with progressive diarrhea, weight loss, worsening jaundice, and fatigue. She had been undergoing outpatient evaluation for elevated liver enzymes over the past 2 years prior to admission. She was trialed on ursodiol and low-dose prednisone without much benefit prior to arrival.
+In the emergency department, her vitals were remarkable for hypotension with a blood pressure of 72/53 mm Hg and a nadir HR of 62. Physical exam was significant for jaundice and cachexia. Blood work demonstrated leukocytosis 27.7 × 109/L (normal 3.4–9.6 × 109/L) with neutrophilic predominance. Hepatic function panel showed an aspartate transaminase level of 85 U/L (normal 8–43 U/L), alanine aminotransferase 85 U/L (normal 7–45 U/L), bilirubin 9.3 mg/dL (normal <1.2 mg/dL), and alkaline phosphatase of 2262 U/L (normal 35–104 U/L). Gamma-glutamyl transferase was elevated to 494 U/L (normal 5–36 U/L). C-reactive protein was 52 mg/L (normal <8 mg/L). TSH was elevated to 22.8 mL U/L (normal 0.3–4.2 mlU/L) with undetectable T3 and T4 levels. Review of a 6-month prior outside liver biopsy was consistent with periportal fibrosis with lymphocytic and scattered neutrophilic infiltrates in the portal tracts. No infiltrating histiocytes were noted in the biopsy.
+The patient was admitted to the intensive care unit for vasodilatory shock, requiring vasopressors and chronotropic agents along with antibiotics. Computed tomography (CT) of the abdomen and pelvis with contrast illustrated diffusely heterogenous liver parenchymal enhancement without ductal dilatation, duodenitis, and diffuse colonic thickening concerning pancolitis (shown in a). CT chest was performed which showed centrilobular ground glass opacities bilaterally with mild pulmonary edema. Echocardiogram did not reveal any cardiac abnormality. Brain magnetic resonance imaging (MRI) with contrast revealed abnormal enhancement and thickening of the pituitary infundibulum and stalk most consistent with lymphocytic hypophysitis (shown in b).
+Given the cholestatic nature of liver injury, magnetic resonance cholangiopancreatography was performed which showed multifocal nodular hepatic steatosis and hepatomegaly without any focal liver abnormality; in addition, multiple indeterminate bony lesions were read as non-specific focal sclerosis and cystic lesions. Autoantibody screening including anti-nuclear antibody, SS-A and SS-B antibodies, and anti-smooth muscle antibody were negative. IgG4 subclass levels were normal. A bone marrow biopsy showed 40% cellularity and reactive marrow changes without any blasts or infiltrate. Subcutaneous fat aspirate was negative for amyloid deposition on Congo red staining.
+The patient was being optimized for a possible esophagogastroduodenoscopy and colonoscopy once more stable. A repeat liver biopsy revealed histiocytes infiltrating the biliary tree with chronic biliary tract injury. Tissue stained positive for CD1a and S100, markers of Langerhans cells, and BRAFV600E-mutated protein, commonly found in various malignancies (shown in ). No evidence of IgG4 sclerosing cholangitis was observed. A diagnosis of secondary sclerosing cholangitis and cirrhosis secondary to multisystem LCH was confirmed.
+Treatment was initiated with hydrocortisone and levothyroxine for panhypopituitarism. The patient was eventually started on dose reduced b-rapidly accelerator fibrosarcoma (BRAF) inhibitor, vemurafenib, after multidisciplinary discussion. The patient’s hospital course was also complicated by acute necrotizing pancreatitis, poorly controlled blood sugars, and new onset central diabetes insipidus that required treatment with desmopressin. Repeated hospitalizations in the following 3 months prompted her to opt for comfort care with palliative measures.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_107_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_107_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..744fc05788aec1927d1074731eb6f6c822dc7b8e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_107_en.txt
@@ -0,0 +1,8 @@
+An 18-year-old male, healthy collegiate sprinter, presented with a chronic tear of his right rectus femoris tendon. A year prior, he was running high school track when he felt a pop in his right thigh and developed an obvious deformity. Physical therapy was attempted with incomplete recovery and continued thigh and groin pain, resulting in an occasional antalgic gait. He also felt subjective limitation in his athletic ability. Due to his continued symptoms, he sought a second opinion with the primary investigator.
+Physical examination of the thigh demonstrated an obvious subcutaneous deformity, similar to a “Popeye” type sign seen in the proximal biceps, with a palpable defect in the quadriceps tendon. Knee range of motion was 0–120° and he was tender to palpation along the distal tendon stump. Hip range of motion was 110° of flexion, 15° of extension, 35° of internal rotation, and 45° of external rotation. Internal impingement sign was positive reproducing the patient’s pain in his groin.
+MRI of the right lower extremity and MR arthrogram of the right hip demonstrated a complete tear of the rectus femoris tendon without atrophic changes, a CAM lesion with an alpha angle of 70°, and anterior-superior labrum tearing.
+A trial of conservative management was attempted with activity modification, physical therapy, and an intra-articular hip injection for both diagnostic and therapeutic purposes. With the injection, we attempted to isolate the patient’s symptoms as coming from intra-articular hip pathology or from the rectus femoris rupture. The injection relieved his groin pain for approximately 1 week with continued irritation in the thigh, especially isolated around the tendon stump. An attempt was made with the patient to elucidate the true nature of the symptoms. He sincerely felt that the groin pain, which was temporarily relieved from the injection, was significant and independent pain from the pain, he experienced at the region of the tendon stump. The pain at the tendon stump continued to bother him during the week of relief from the groin pain. Furthermore, after the initial response to the injection, the patient felt that both areas of pain were significant to his overall limitations and symptoms. At this point, the patient had failed conservative therapy with both the intra-articular pathology and rectus femoris rupture deemed significant sources of his persistent symptoms. Surgery was recommended for both hip and tendon pathologies.
+The primary surgeon and patient jointly decided to address the rectus femoris rupture with reconstruction and the intra-articular hip pathologies through hip arthroscopy. For the rectus femoris, the patient was positioned supine on a traction table. A midline incision, in line with the quadriceps tendon, was made at the site of tendon rupture from the tendon stump to the proximal patella. The distal stump of the rectus femoris was isolated circumferentially. There was approximately 4 mm of relatively thin rectus femoris tendon stump remaining. The tendon stump was sutured with multiple loops of Fiberwire (Arthrex, Naples, FL). The Achilles allograft was then obtained and sutured medially and laterally in a running Krackow fashion. The Achilles graft was fanned out and tacked to the rectus femoris muscle belly utilizing approximately 15 simple interrupted #2 Ethibond (Ethicon, Cincinnati, OH) sutures. Fiberwire (Arthrex, Naples FL) was utilized to connect the tendon graft to the remaining rectus femoris tendon stump in a Krakow fashion medially and laterally. Attempting to balance anatomic location versus graft/tendon tension, the rectus femoris complex was pulled over the distal intact quadriceps tendon. While maintaining tension, #2 Fiberwire (Arthrex, Naples, FL) was passed in a running Krakow fashion medially and laterally through the graft and quadriceps tendon from musculotendinous margin to the proximal patella and back. Once completed, the graft and rectus femoris had excellent stability throughout knee range of motion.
+For the hip arthroscopic procedure, the hip was placed under traction. Three portals were utilized: Anterolateral, mid-anterior, and distal anterolateral accessory. Diagnostic arthroscopy demonstrated a labral tear from the 12:30 to 3:00 position. The acetabular rim was decorticated. For the 1:00 position and 2:30 position, knotless Cinchlock anchors (Stryker, Kalamazoo, MI) were utilized to affix the labrum. Traction was then released and restoration of the suction seal nature of the labrum was confirmed. Attention was then turned to the arthroscopic femoroplasty. The convex protuberance of bone consistent with a CAM lesion was noted at the 1–3 o’clock position. A burr was used to recontour the femoral head-and-neck junction to a concave structure. This was confirmed by direct visualization and intraoperative radiographs.
+Following the arthroscopic procedure, the rectus femoris reconstruction was rechecked and intact. All skin incisions were then closed and dressed.
+Postoperatively, the patient was placed in a locked knee immobilizer and recommend toe-touch weightbearing for 3 weeks. Physical therapy was initiated after 2 weeks with a gradual progression of weightbearing after 3 weeks. Knee flexion was initiated at 2 weeks with 15 degrees per week until full motion. No quadriceps resistance was allowed until 3 months. Six months following the operation, the patient was cleared to return to sports. There were no complications encountered.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1082_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1082_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ba7bb1fbfe667f6647415ebf7ebd95176ad7732d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1082_en.txt
@@ -0,0 +1,6 @@
+A 64-year-old woman was admitted to hospital because of dehiscence of a sternal wound, after a mitral valve replacement that was performed 2 months earlier due to severe insufficiency. She presented a clinical history of rheumatic mitral stenosis, which was treated with closed mitral valvulotomy 35 years previously, resulting in a mitral insufficiency. Twenty-three years previously she had suffered a bacterial endocarditis due to viridans group streptococci that led to cerebral embolism.
+On examination, a white material was found to be exuded from the sternal wound when pressed over the wound margins. A computed tomography scan of the chest showed a dehiscence of the surgical wound, with swelling of soft tissue above the sternum and osteitis of the sternal bone. Apart from a C-reactive protein level of 2.6 mg dl−1 and an albumin level of 3.1 g dl−1, laboratory studies were unremarkable.
+Empirical treatment with clindamycin (300 mg/6h i.v.) and ceftazidime (2 g/8h i.v.) was started. The treatment was changed to imipenem (500 mg/6h i.v.) and ciprofloxacin (750 mg/12h p.o.) after a preliminary microbiology laboratory report of growth of an actinomycete with presumed susceptibility to several antimicrobials. Surgical debridement of the wound was performed. This treatment was maintained for 3 weeks, but successive wound cultures continued showing the presence of the actinomycete organism. Because the symptoms did not improve, sternal cerclage was removed and antibiotic therapy was shifted to teicoplanin (400 mg/24h i.v.) plus ciprofloxacin (750 mg/12h p.o.) and rifampin (600 mg/24h p.o.) for 2 weeks, followed by ciprofloxacin plus rifampin for an additional6 weeks, resulting in wound healing.
+Culture of wound samples on chocolate and blood agar plates for 72 h at 37 °C in aerobic conditions yielded creamy-white, dry, wrinkled and non-haemolytic colonies. After these 3 days, a colour change was observed in the colonies from white to yellowish. Colony appearance showed synnemata and no aerial hyphae (see ). Gram staining yielded Gram-positive short coryneform rods without branching. Modified Ziehl–Neelsen staining confirmed slight acid-fastness. Both conventional Ziehl–Neelsen and auramine stains were negative. The micro-organism was non-spore-forming, and catalase and urease positive. Casein, hypoxanthine, tyrosine and gelatine were not decomposed. Arylsulfatase production was negative within 3 days. Nitrate was not reduced to nitrite and indole was not produced. With the API NH strip (bioMérieux) acid was produced from glucose, fructose and sucrose. 16S rRNA gene sequence analysis using the blast algorithm showed 99.9 % similarity to G. bronchialis strain DSM 43247 (GenBank accession no. ).
+An antimicrobial-susceptibility assay was performed using Etest strips (bioMérieux) on Mueller–Hinton agar with 5 % defibrinated horse blood and 20 mg β-NAD l−1 (MH-F; Oxoid). Readings were taken after 48 h of incubation, and susceptibility categories were defined according to Clinical and Laboratory Standards Institute (CLSI) guidelines for mycobacteria, nocardiae and other actinomycetes . The isolate was resistant to clindamycin (MIC=8 mg l−1), and susceptible to amoxicillin/clavulanic (0.016 mg l−1), ceftriaxone (0.5 mg l−1), imipenem (0.008 mg l−1), ciprofloxacin (0.06 mg l−1), amikacin (0.06 mg l−1), tobramycin (0.12 mg l−1), clarithromycin (2 mg l−1), minocycline (0.25 mg l−1), linezolid (1 mg l−1) and co-trimoxazole (0.03 mg l−1). Although no susceptibility breakpoints have been established for vancomycin and teicoplanin by the CLSI, MIC values were low (0.25 and 1 mg l−1, respectively).
+The isolate was analysed by two MALDI-TOF MS-based systems, a Bruker Biotyper (Bruker Daltonics) and a Vitek MS (bioMérieux). Identification of G. bronchialis (99.9 % identity) was obtained with the Vitek MS (saramis 3.0 software) following the procedure recommended by the manufacturer. Briefly, target slides were inoculated into the spots by picking a freshly grown overnight colony and overlaid with 1 µl matrix solution, α-cyano-4-hydroxycinnamic acid. The same result was attained with the Bruker Biotyper (version 3.1 software), using a complete protocol of protein extraction with formic acid and acetonitrile, following the Bruker Biotyper instructions, but the score value (1.72) was lower than the one defined in the manufacturer’s criteria (≥2.00) for acceptance of identification at the species level.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1089_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1089_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5f392675646c317a53ac21196686265402bf74b1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1089_en.txt
@@ -0,0 +1,4 @@
+A 25-year-old primigravida with no significant past medical history at 22 weeks and 0 days gestation presented to a local hospital with sudden onset of right-sided back pain radiating to her right lower quadrant that had persisted for less than one day. She denied nausea, vomiting, fevers, vaginal bleeding, and dysuria. Her pregnancy had been otherwise uncomplicated. Her pain became uncontrollable with intravenous medication and localized solely to her right lower quadrant. She was transferred to a tertiary care center for further management, given concern for appendicitis and possible need for surgical intervention.
+Her pain worsened on transport, and on arrival to the tertiary care center, she demonstrated severe right lower quadrant tenderness with rebound and voluntary guarding without costovertebral angle tenderness. She was hemodynamically stable, but intravenous hydromorphone only provided transient and mild improvement in her pain. Her cervix was found to be closed on digital exam, and no abnormalities were noted on speculum exam. Initial laboratory evaluation demonstrated a normal comprehensive metabolic panel and coagulation studies. Hemoglobin was 10.7 gm/dL and white blood cell count was not elevated (9.9 × 103/μL). Urinalysis was negative.
+She underwent an abdominal MRI showing a normal appendix. However, in a verbal read from the on-call radiologist, concern was communicated for right forniceal rupture given the constellation of radiologic findings of hydroureter combined with perinephric and retroperitoneal fluid, highlighted in . Her left kidney and collecting system were normal in appearance. Renal ultrasound was therefore performed, and it revealed right ureteral tapering between the gravid uterus and right iliac artery with no right ureteral jet visualized. Given these findings, the patient was subsequently managed by a multidisciplinary team consisting of maternal-fetal medicine, urology, and interventional radiology. Three strategies were discussed and included conservative management with close follow-up, placement of a ureteral stent, and placement of a percutaneous nephrostomy (PCN) tube. Patient preference was for PCN placement. Of note, urine culture collected prior to PCN placement was negative.
+Following its placement by interventional radiology, her pain was relieved, and she was discharged with follow-up with maternal-fetal medicine and interventional radiology. Her pregnancy was subsequently complicated by readmission for recurrent pain and pyelonephritis with culture isolation of Enterobacter cloacae resistant to both nitrofurantoin and trimethoprim/sulfamethoxazole (TMP-SMX). She required placement of a midline IV for daily infusion of ertapenem at her local hospital. Her pregnancy was also complicated by fetal growth restriction, diagnosed at 35 weeks. Uncomplicated vaginal delivery occurred at 37 weeks and 1 day. Her PCN was removed postpartum at which point antibiotics were also discontinued.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1094_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1094_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1392928f9caf2ad43a3825b156f52bd51d3e3781
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1094_en.txt
@@ -0,0 +1,2 @@
+The patient was a 66-year-old man who underwent rectal resection and postoperative chemotherapy for rectal cancer. Bile duct obstruction due to a liver metastasis caused obstructive jaundice and acute cholangitis, which resulted in emergency hospitalization. On magnetic resonance imaging , a 3.5 cm mass in the biliary hilum caused type IV biliary obstruction according to the Bismuth-Corlette classification of hilar cholangiocarcinoma. Despite several attempts at biliary drainage (branch of B3 and B2, B5, B7) via ERCP, obstructive jaundice was not improved. The patient was emergently hospitalized again because of acute cholangitis with a 39 °C fever and epigastric pain, although bile duct plastic stents (PS) had been placed in the left intrahepatic bile duct (branch of B3 and B2) and right intrahepatic bile duct (B5 and B7) . Repeated ERCP and biliary drainage were performed, had no effect as shown on the CT . In this case, many of biliary branches were divided by the obstruction at hilar biliary. Only by 2D image, it was hard to identify the relation between dilated biliary branches and drainage tube placed. Given that selective bile duct drainage had proven extremely difficult with the conventional procedures, 3D images were created from preoperative CT image data using a 3D image reconstruction system (SYNAPSE VINCENT version 5, FUJIFILM Corporation, Tokyo, Japan). We used the 3D images for preoperative planning and performed biliary drainage using them as an intraoperative reference.
+Residual dilation was observed in the left intrahepatic bile duct (B3). Although the PS was allowing slight decompression of the left intrahepatic bile duct (B2), marked biliary dilation persisted; thus, the PS was deemed ineffective for B3, while no biliary dilation was found around the PSs placed in B5 and B7, so these were deemed to be effective. Marked dilation of B6 and B8 was noted, and drainage was deemed necessary . On the basis of the above findings, we planned preoperatively that an additional PS would be placed in the deep part of B3 and several other PSs would be replaced (B6 and B8). The entire ERCP procedure was performed under the combination of fluoroscopic images of a standard side-view duodenoscope (EDT-580, FUJIFILM, Tokyo, Japan) and the 3D images. This procedure was performed using a multipurpose imaging system incorporating a C-arm (VersiFlex Apla, HITACHI corporation Tokyo, Japan). During the actual ERCP procedure, endoscopists could see the endoscope video (a), the 3D image of the bile ducts that rotate freely (b), and the 2D fluoroscopic image (c) at the same time . With the 3D images for preoperative planning and intraoperative reference, biliary drainage was successfully performed without complications . Postoperatively, the patient had no further cholangitis or need for stent replacement up to his death.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1103_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1103_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..065974fd15ae956765eb4c49215b732c33f47bfd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1103_en.txt
@@ -0,0 +1,5 @@
+A 75-year-old Japanese man was found to have a pancreatic cyst in 2006 while undergoing postoperative evaluation for colorectal cancer. The pancreatic cyst increased in size, and surgery was recommended, but the patient declined . In 2015, the cyst ruptured, and he was treated conservatively . In 2017, he began dialysis for chronic renal failure. The same year, he fell down on a road with a fever of 40 °C and was transported emergently to a nearby hospital. Laboratory tests showed elevated levels of C-reactive protein. Serum levels of carcinoembryonic antigen and carbohydrate antigen 19-9 were 5.8 ng/ml and 131.3 U/ml, respectively .
+The patient was treated with new quinolone-based antibiotics for 3 weeks as a conservative treatment after hospitalization. Bacteria were not detected by blood culture examination at admission. Enhanced computed tomography (CT) revealed a cystic lesion in the body of the pancreas measuring 119 mm × 100 mm and an adjacent left renal cyst measuring 63 mm in diameter. The wall of the pancreatic cyst was thickened. The pancreatic ducts were not dilated . Magnetic resonance imaging (MRI) demonstrated a liquid surface in the pancreatic cyst . Magnetic resonance cholangiopancreatography (MRCP) did not show pancreatic duct dilation . Endoscopic ultrasound (EUS) showed a liquid surface in the pancreatic cyst and did not show nodules in the cyst . Gastroscopy showed an elevated mass in the posterior wall of the body of the stomach with intact mucosa . In addition, colonoscopy performed 5 months before admission showed an elevated mass in the descending colon with intact mucosa .
+Pancreatic cyst infection was diagnosed as the source of infection. However, identification of the organism was difficult. Furthermore, due to the increase in the size and wall thickness of the cyst, it was unclear whether the cystic mass was neoplastic with malignant potential. For these reasons, the patient underwent distal pancreatectomy and splenectomy, with deroofing of the left renal cyst. Intraoperatively, the pancreatic cyst strongly adhered to the descending colon, so partial resection of the colon was added.
+Pathologic analysis of the resected cyst demonstrated a simple cyst lined by mucinous epithelium . There was no underlying stromal condensation or epithelial dysplasia, and communication with the native pancreatic ducts was not observed. Pathological analysis of the resected colon adhesive pancreatic wall revealed a fistula-like depression on the mucosal side of the colon . Bacteroides fragilis and Streptococcus sanguinis were detected as a result of culture examination of the pancreatic cyst contents. On the basis of the operative and histological findings, a final diagnosis of MNNC with colon communication was made . The small colonic fistula was presumed to be the source of infection.
+Postoperatively, the patient was treated for a grade B pancreatic fistula. On postoperative day 12, emergency surgery was performed for thrombotic descending colon perforation. On postoperative day 94, the patient was discharged on foot.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1138_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1138_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1b30df71e25edbf60f6e45c7f4095375af1e8ae8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1138_en.txt
@@ -0,0 +1,2 @@
+A 3-months-old female was referred to our department because of suspicion of child physical abuse. She was born at term, a product of uneventful gestation. At birth her weight was 3310 gm, length of 51 cm and her occipito-frontal circumference was 33.5 cm. No irritability, feeding or pulmonary abnormalities, and fever were recorded. The mother was 29-year-old-gravida 2, married to a 33-year-old-unrelated man. She had no history of spontaneous abortions, stillbirths, prematurity and or polyhydramnios. No maternal use of medications or antenatal illnesses was reported. Physical examination of the baby showed normal facial features, no blue sclerae, normal nose but swelling of the mandible was noted. There were swellings of some of the long bones (right leg, and radius). Neither feeding abnormalities nor fever was present. Her chest was noted to be symmetrical and of normal appearance. Hands and feet were normal. There were no associated signs of abnormal skin stigmata such as fragility/extensibility and or ligamentous hyperlaxity was noted. Hearing, vision and neurological examinations were all normal. Laboratory studies including metabolic tests, which aimed to tests calcium, phosphorus, and vitamin D metabolism were normal. No specific genetic test has been done for this baby.
+Anteroposterior radiograph of the skull showed massive sclerosis of the skull bone associated with significant cortical hyperostosis and enlargement of the mandible secondary to cortical new bone formation . Lateral skull radiograph showed sclerosis of the skull base (arrow) and hyperostosis of the calvaria . Coronal MRI imaging showed significant calvarial/facial and mandibular hyperostosis . Anteroposterior radiograph of the radius showed cortical new bone formation associated with subperiosteal thickening. Note marked bloating along the diaphysis with sparing of the epi-metaphyseal components associated with expansion of the bone marrow cavity and a persistent-like deformity . Anteroposterior radiograph of the tibia showed a thick and broad ballooning occupies the diaphyses (proximally and distally) there is gaining in the diameter comes from subperiosteal new bone apposition by intramembraneous bone formation .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1140_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1140_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..583b941b63eff889c2993e427db4c4fd3b02d37b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1140_en.txt
@@ -0,0 +1 @@
+A 55-year-old man started to receive hemodialysis because of diabetic renal failure 2 years previously. He underwent renal transplantation 1.5 years previously, and had been receiving immunosuppressants since then. Eight months after transplantation, the serum creatinine level increased to 4.4 mg/dl. He had CMV enteritis with occult blood in the stool and an elevated CMV pp65 (C7-HRP) antigen level in blood mononuclear cells. Intravenous ganciclovir (150 mg/day) was administered for 11 days, followed by valganciclovir (450 mg/day). Because the enteritis was very severe, ganciclovir and valganciclovir were not reduced to maintenance doses, which are generally half of starting doses. Two days after starting valganciclovir, he had unsteady gait, but could walk unaided. On the next day, the patient needed assistance with walking. His consciousness was mildly disturbed (E3, V5, and M6 on the Glasgow Coma Scale). One day later, he became delirious intermittently. Two days later, he was found on the floor after falling, without major injuries. He was suspected to be irritated and exhausted because of severe enteritis. Nine days after starting valganciclovir, his level of consciousness worsened (E3, V3, and M5), and he could not receive oral drugs, including valganciclovir. Neurologists were consulted. Encephalitis was unlikely, since no meningeal signs or fever was noted; the cell count was normal (0.33 cells/μl) in the CSF, and the protein concentration marginally elevated (54 mg/dl). CMV, herpes simplex virus, varicella-zoster virus, and Epstein-Barr virus DNA was later found to be negative in the CSF. Ganciclovir-induced encephalopathy was suspected, and the drug was withdrawn. Because of the risk of further falls, hemodialysis using a VPS-15HA membrane, a vitamin E-coated polysulfone membrane (Asahi Kasei Kuraray Medical, Japan) was performed twice in 2 days. His consciousness improved considerably after the first session of dialysis (E3, V4, and M6) and was completely restored on the next morning after the second session (E4, V5, and M6). The trough levels of ganciclovir in the serum and CSF were retrospectively measured and are shown in table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1147_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1147_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..960084ecba809567fda3eff7b107706112908072
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1147_en.txt
@@ -0,0 +1,9 @@
+A 5-year-old Persian, female cat was brought for investigation of progressive behavioral changes (loss appetite, loss weight, imbalance, and lethargy) at Albaittar clinic in Tripoli, Libya. The cat was mated 1 month before it was brought to the clinic. It showed vigorous behavior in a male during estrus. The cat’s owner visited the clinic for suspecting pregnancy. At presentation, the cat had a body weight of 2.5 kg and a body temperature of 38°C. Physical examination revealed an enlargement of the abdomen, with a palpable irregular-shaped mass on the right side of the mesogastric region. Abdominal Ultrasound examination (DRAMIŃSKI ANIMALprofi L, DRAMIŃSKI, Poland) revealed the presence of an echogenic irregular mass in the right ovary.
+The cat subsequently underwent therapeutic ovariohysterectomy (OHE). Ovaries, uterus, contralateral ovary, and fallopian tube were fixed in 10% neutral buffered formalin within 48 hours and submitted for macroscopic and histopathological examination. The cat received 20 mg/kg of long-acting Amoxicillin for five consecutive days after the operation and the wound was dressed with wound disinfectant and antibiotic powder every 2 days. The cat started to eat on the next day of the operation.
+Macroscopic examination revealed a uterus measured 11 cm in length, convoluted with corkscrew appearance, soft in consistency, and intact serosal layer . The right ovary showed an attached ovarian cystic tissue mass measured 6 × 5 × 3 cm, rounded in shape, dark red to tan in color, soft to firm in consistency with multilobulation and intact capsule . The specimen was inked and serially cut. The contralateral ovary measured 0.9 cm and fallopian tube measured 0.5 cm in length.
+On cut section of the ovarian tissue mass, a well-circumscribed multilobular tumor mass, solid heterogeneous, greyish white to tan in colored areas with multiple foci of necrosis and cystic spaces were detected. The capsule is intact grossly. The uterine cavity showed thickened wall with variable cystic dilatations. The other ovary and fallopian tube showed no obvious pathological abnormality.
+For histopathological examination, serial sections were taken from the ovarian tumor mass and from the uterus, as well as, from the contralateral ovary and fallopian tube, and were fixed in 10% buffered formalin for later processing and examination. All histological procedures were performed according to . The tissue sections were stained with hematoxylin and eosin (H&E) following the standard procedures. The stained tissue sections were examined under a light microscope (ZEISS, Germany).
+Histopathological examination of the ovarian tumor mass revealed a malignant tumor composed of diffuse atypical granulosa cells with spherical to oval nuclei, distinct nucleoli, and scant eosinophilic cytoplasm arranged in different patterns (micro follicles, small nests, acinar formation, and alveolar-like) . Regions of the tumor exhibited Sertoli-pattern (Luteinization), while others showed sarcomatous spindle cells arranged in tight fascicles . The cells were separated by connective tissue septa along with areas of hemorrhage and necrosis . Mitotic count according to active foci of the tumor showed 2–3 mitosis / 10 hpF. The fibroconnective tissue capsule (FCC) revealed evidence of vascular invasion which showed blood vessels lined by endothelial cells .
+The endometrium examination revealed thickened endometrial lining with elongated glands and prominent stroma. There was also a dilatation of glands with formation of variable sized cysts . No cytological atypia was seen, nor evidence of complexity or tumor deposits or invasion. The contralateral ovary and fallopian tube showed normal histological findings, with no evidence of malignant infiltrations.
+Based on histological findings, the GCT of the ovary with evidence of vascular invasion associated with CEH was made and the contralateral ovary and fallopian tube were free.
+The surgical intervention resulted in the complete resolution of clinical signs. However, 6 months following surgery the cat was brought to the Albittar clinic again with complaints of weakness, cachexia, ascites, off food, and lethargy with the presence of abdominal mass. Sings of pain were determined on palpation of the right abdominal region and ultrasonography examination was performed. According to the ultrasonography examination, a clear mass at the mesogastric region attached to the right kidney was determined and was suspected as a sequela of past tumor metastasis. Since the poor prognosis surgery was not performed, the cat had paralysis in hind limbs and massive weight loss after one week and eventually died. The owner of the cat rejected the euthanized decision and the postmortem examination.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_114_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_114_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..460e600857f88801022f31a51f9f5e2540866fd9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_114_en.txt
@@ -0,0 +1,5 @@
+A 50-year-old man presented with positive fecal occult blood test results. He denied any previous medical or surgical history. On digital examination, a solid tumor 5 cm from the anal verge on the posterior side of the rectum was palpated, and there were no anal fistulas or abscesses. Colonoscopy revealed a rectal tumor below the peritoneal reflection, occupying three-quarters of the circumference . A pathological diagnosis of the biopsy specimen indicated a well-to-moderately differentiated tubular adenocarcinoma. Computed tomography (CT) and magnetic resonance imaging (MRI) showed no significant regional lymphadenopathy or distant metastasis. Therefore, the clinical diagnosis was rectal cancer cT3N0M0, cStage IIa (UICC TNM classification 8th edition) .
+We indicated preoperative chemoradiation therapy (CRT), comprising 45 Gy in 25 fractions; tegafur/gimeracil/oteracil potassium (S-1), 80 mg/m2/day at days 1–14 and 21–35 (2 cycles). The patient did not experience any significant adverse events. Four weeks after completion of CRT, a follow-up CT and MRI showed that the primary tumor had shrunk with a partial response as defined by the Japanese Society for Cancer of the Colon and Rectum (JSCCR) , but a small liver mass highly indicative of metastasis was also detected. This was later diagnosed as cavernous hemangioma using gadolinium ethoxybenzyl-diethylenetriaminepentaacetic acid-enhanced MRI 3 months after CRT initiation. We then indicated consolidation chemotherapy, consisting of capecitabine combined with oxaliplatin (XELOX regimen: intravenous oxaliplatin 130 mg/m2 [day 1] followed by oral capecitabine 1000 mg/m2 twice daily [day 1, evening to day 15, morning]). His tolerance to chemotherapy gradually declined due to peripheral sensory neuropathy (CTCAE Grade 1 to 2 ) after three cycles. As such, we excluded oxaliplatin and continued consolidation chemotherapy with three cycles of capecitabine alone (1000 mg/m2 twice daily [day 1, evening to day 15, morning]). Four weeks after completing consolidation chemotherapy, follow-up colonoscopy showed that the primary tumor achieved a complete response based on the JSCCR guidelines . Since a follow-up CT simultaneously showed thickening of the edematous rectal wall, we planned to perform low anterior resection as a radical surgery after neoadjuvant therapy.
+However, he presented with persistent anal pain 2 weeks after the last chemotherapy session. Anorectal examination revealed tenderness and rigidity around the posterior side of the anus, which was distant from the primary tumor. MRI revealed a high-intensity mass behind the anus, suggestive of an anal fistula . We considered the differential diagnosis of a benign anal fistula or implantation metastasis into the anal fistula. Coring-out fistulectomy was performed, and the resected fistula was pathologically diagnosed as tubular adenocarcinoma, which has similar morphological characteristics to rectal cancer . The resection margin was deemed positive because of the cauterized margin of cancer cells. This result suggested an implantation metastasis to the anal fistula. Therefore, instead of low anterior resection, abdominoperineal resection was performed to resect the primary rectal tumor and metastatic lesion simultaneously.
+Twelve weeks after completing consolidation chemotherapy, we performed laparoscopic abdominoperineal resection. The postoperative course was complicated by a perineal abscess requiring percutaneous drainage. Otherwise, it was uneventful, and the patient was discharged on the 25th postoperative day. Histopathological examination revealed a well-differentiated adenocarcinoma, ypT2, INFb, Ly0, V0, Pn0, pPM0, pDM0, ypN0 . The therapeutic effect was grade 2 according to the definition of the JSCCR .
+Subsequently, we investigated the origin of the tubular adenocarcinoma from the resected anal fistula by immunohistochemistry and found that it was CDX-2-positive, CK20-positive, CK7-negative, and GCDFP-15-negative . These findings implied that the anal fistula adenocarcinoma was consistent with metastasis and intraluminally implanted rectal cancer. The patient declined to undergo postoperative adjuvant chemotherapy. No recurrence was detected until his last follow-up 21 months after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1157_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1157_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d763d77b9764196fb6929ecfd0626c61a3403c3a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1157_en.txt
@@ -0,0 +1 @@
+A 40-year-old male presented in casualty with a history of seizures that let to fall from 10 feet height resulting in injury to both hips and left shoulder. He was diagnosed with cerebral venous thrombosis and started on heparin. On X-rays & CT scan (, ), he was diagnosed to have bilateral acetabular fracture and three part left proximal humerus fracture. He was operated for bilateral acetabular fracture using modified Stoppa’s approach and fixed with buttress plate in true pelvis on both sides . On post op day 3, he had fever & discharge from suture site, dressing was done and pus culture and sensitivity done. Wound wash was done to eradicate infection. Culture showed growth of Klebsiella and anaerobes sensitive to cefoperazone sulbactum, clindamycin and amikacin. The pus discharge resumed again after 3 days of wound wash and antibiotics. This time culture sensitivity tests showed resistance to cefoperazone sulbactum so chloremphenical was started which decreased the pus discharge but could not stop it. Based on the sensitivity tests, meropenem was started which stopped the discharge for 5 days then again the discharge started. At this time about 2 weeks after the first surgery, it was decided to start irrigation with Qurion solution for an hour and then continue Vacumn assisted suction (VAS). At both ends of the suture line single stitches were removed, at one end infant feeding tube was put for irrigation with qurion solution and at the other end infant feeding tube inserted for vacuum assisted suction . Daily Qurion irrigation was done in morning and evening for one hour during which vacuum assisted suction was stopped. After one hour again vacuum assisted suction was started. After 2 days of starting Qurion irrigation & vacuum assisted suction therpy (QiVAS), the suture site became dry. We continued QiVAS therapy for 2 weeks with antibiotic meropenem. Blood counts and CRP were within normal range after 2 weeks of QiVAS therapy and patient was discharged. Patient was followed up at 3 months and 6 months with no evidence ofinfection .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1160_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1160_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0b156cc2a183bc7d5db0a23c827790db540be2af
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1160_en.txt
@@ -0,0 +1,4 @@
+A 61-year-old female, known to suffer from chronic hepatitis C (Child Pugh A), presented in Jan 2001 to another hospital complaining of abdominal pain. CT-Scan of the abdomen showed a solitary 5 × 5 cm mass in segment VII of the liver. Fine needle aspiration cytology (FNAC) showed features consistent with HCC. AFP level at the time was normal 2.23 ng/ml (normal < 5.6 ng/ml). She traveled abroad (outside Kuwait), underwent resection of the tumor and returned back to Kuwait. A brief report stated that the tumor was resected from segment VII with about 1.5 cm safety margin with an uneventful postoperative course. Histopathology of the original tumor proved to be a well differentiated HCC with clear margins and no vascular invasion.
+Upon return to Kuwait, she was under the care of the hepatologist who treating her chronic hepatitis with Pegelated Interferon and Ribaverin for 6 months. Unfortunately she remained HCV positive.
+In Oct. 2004, three years following her original surgery, she was referred to the Liver Unit, Mubarak Al-Kabeer Hospital with an abdominal wall mass of one-year duration. On physical examination an obvious 7 × 5 cm smooth oval mass was seen in the right upper quadrant at the lateral border of her previous right subcostal scar. Clinically the mass seemed to be within the abdominal wall and the skin over it was free. CT scan of the abdomen showed a round well defined enhancing soft tissue density mass measuring 11 × 5 × 5 cm within the anterior abdominal wall with no intra-abdominal extension or skin infiltration . The liver was free except from signs of previous surgery in segment VII. Tumor markers were: AFP 6.23 ng/ml (normal < 5.6 ng/ml), CEA 1.5 ng/ml (normal < 6.9 ng/ml) and CA19-9 15.9 (normal < 43 ng/dl). FNAC from this mass, was consistent with metastatic HCC . En-bloc resection of the mass (including the mass, overlying skin, abdominal wall muscles and peritoneum) was performed under general anesthesia with primary closure. Histopathology of the removed specimen confirmed implantation of HCC in the abdominal muscles with free surgical margin and no peritoneal penetration . The patient had an uneventful recovery and was discharged home on the 7th postoperative day.
+To date, 20 months since resection of the metastatic mass, she remains well with normal AFP and liver functions and no evidence of recurrence in the liver or abdominal wall.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1186_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1186_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..31d9f6bc63c63716da330bd8f850225aa43a55d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1186_en.txt
@@ -0,0 +1,4 @@
+A 35-year-old woman from Haryana presented with generalized tonic-clonic seizures. She was treated with antiepileptics and became seizure-free. She had also noticed swellings all over her body which had gradually increased in number and size over the previous year, and there was proptosis of her right eyeball. She also had fever and arthralgia. On examination there was symmetrical generalized hypertrophy of the limbs, most prominent in the calf muscles, and also affecting trunk, neck and facial muscles. There was muscle tenderness with increased pain on movement of the joints.
+Investigations revealed hemoglobin of 12.5 gm%, total lymphocyte count (TLC) of 12,800 and differential leucocyte count (DLC) of P80%:L20%. The erythrocyte sedimentation rate (ESR) was 40 mm/hour. The level of serum creatinine phosphokinase was 150 (normal value 200). In addition, urine tests showed the presence of proteinuria without any active sediment on microscopy. Routine biochemical investigations revealed normal glucose, renal and liver function tests. The tests for rheumatoid arthritis (RA) factor and antinuclear antibodies were positive but the patient did not have any other symptoms to suggest a diagnosis of rheumatoid arthritis or lupus. Tests for HIV using enzyme-linked immunosorbent assay (ELISA) were negative for both HIV 1 and 2. Electrocardiogram (ECG) examination revealed a right bundle branch block and a right axis deviation. An echocardiogram failed to show cysticerci in the heart. X-rays of the skull and extremities were normal. There was no radiographic evidence of calcification in the muscles. Ultrasound examination of the orbit and neck was performed, revealing multiple swellings in the orbit, thyroid gland and strap muscles of the neck. Fundus examination was normal. Perimetry was also within normal limits. Magnetic resonance imaging (MRI) scan showed multiple cysts in the brain, scalp tissue, orbit and neck muscles. There was no evidence of hydrocephalus. Biopsy of a subcutaneous swelling was taken from the right forearm. Cysts poured out as soon as the skin was incised. Histopathological examination confirmed that the cysts were of C. cellulosae.
+The patient was treated with prednisolone 1 mg/kg of body weight 1 week prior to the initiation of albendazole therapy instituted at a dose of 15 mg/kg. The patient was observed for 5 days prior to discharge. The symptoms improved and albendazole was continued for a total duration of 30 days. There was objective evidence of improvement with reduction in the size of the swellings. There was no deterioration in neurological or intellectual status and no appearance of new crops of cysticerci. To our surprise her fever and arthralgia disappeared without the use of anti-inflammatory agents. This improvement lasted for 6 months, at which time there was an increase in the size of existing swellings plus development of new crops of swelling. The fever and arthralgia reappeared. The patient was again primed with steroids and given praziquantel therapy. The patient responded and was discharged after 10 days of observation in hospital. Antiepileptic treatment was continued.
+On followup after 1 year, no new swellings or any apparent increase in the size of the residual swellings were reported, there was no further fever or arthralgia and the patient remained seizure-free.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1187_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1187_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ec9ffb52c4e245fccb00b777968e103c8385a461
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1187_en.txt
@@ -0,0 +1,2 @@
+A 27-year-old male, victim of aggressive, blunt trauma with a 4-day history of symptoms was admitted to our surgery unit. The patient presented abdominal pain, was hypotensive (100/50 mmHg), perspiring, and drowsy. The abdominal examination revealed diffuse tenderness and rebound tenderness to palpation, 2 periumbilical ecchymoses of 2/2 cm, many others within the left deltoid area and on the lower limbs. Abdominal sonography revealed peritoneal fluid in all spaces with fibrin, chest X-rays unremarkable. Laboratory investigation showed hemoglobin and white blood cell count with normal values, creatinine 4.04 mg/dL, urea 209 mg/dL, mild acidosis, lactate 21 mmol/L, creatinine-kinase 1910 U/L, lactate-dehydrogenase 451 U/L, and ethanol 34 mg/dL. During laparotomy, we discovered 2 perforations on the ileum and general peritonitis with pus. We performed an enterectomy, about 20 cm of ileum, and an end-ileostomy with a mucous fistula on the distal ileum, saline lavage, four drainages, and a laparostomy. Following surgery, the patient was admitted to the intensive care unit (ICU) with septic shock and multiple organ dysfunction syndrome (MODS). We initiated empirical therapy with broad-spectrum antibiotics with ertapenem and vancomycin. The antibiogram from the peritoneal liquid revealed S. putrefaciens, S. cerevisiae, and Candida species susceptible to amikacin, gentamicin, ciprofloxacin, third-generation cephalosporins, and fluconazole. On the second day following surgery, we intervened again, and we discovered multiple intraperitoneal abscesses. We washed the patient once more, drained, and treated him surgically with a laparostomy. From the peritoneal liquid, Acinetobacter baumannii developed that were susceptible to colistin, and the same bacteria was discovered within the tracheal secretion. The patient remained on mechanical ventilation, inotropic support, and sedated. Fever (38.5 ºC), leukocytosis (22850/μL), high lactate (31.5), very high inflammatory markers (presepsin, procalcitonin, C-reactive protein), and higher inotropic support (from 10 to 25 μg/hour of norepinephrine) convinced us to repeat the intervention including both washing and laparostomy with negative pressure. Until the 11th day following surgery, the patient remained intubated, with inotropic support, had high fever (38 ºC), and very grave general status-MODS. He also had septic shock, with a positive antibiogram from the venous catheter for Klebsiella pneumoniae susceptible to sulfamethoxazole with trimethoprim, and for Staphylococcus hominis susceptible to vancomycin and levofloxacin. From the tracheal secretion, the bacteria found in the peritoneal liquid (A. baumannii) was sampled analogously. Every other day, we repeated the intervention to change the kit for intra-abdominal negative pressure. On the 12th day following surgery, the general status of the patient had improved. Thus, he no longer remained intubated, was hemodynamically stable, without inotropic support, with spontaneous respirations, and had a functional ileostomy. We changed 6 kits of negative abdominal pressure, the antibiogram from the peritoneal cavity was positive once again for Klebsiella and Acinetobacter with antibiotic therapy . During the last 3 interventions, we progressively closed the abdomen, and upon the 10th repeated intervention, we closed the entire abdomen, after which the patient was discharged from the ICU after 20 days where he had been administered many doses of antibiotherapy. The patient was discharged from the surgery unit on the 30th day after admission and had completely recovered.
+After 6 months, the patient returned to close the ileostomy, and after another 8 months, he returned with a median postoperative hernia . Given both the large defect and due to the weight gained, we chose to resolve the hernia with an intraperitoneal mesh. This method was unsuccessful, and even the antibiogram was negative; the patient developed ulceration of the skin which was resolved surgically. We removed the mesh and performed a muscular-cutaneous flap . Written informed consent was obtained from the patient who participated in this case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1191_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1191_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2e80ec79d563f3e83a2b809fbd70eac497b5ae65
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1191_en.txt
@@ -0,0 +1,3 @@
+A 40-year old woman was referred to our clinic in 2003 after detection of multiple lesions in both hepatic lobes during routine ultrasound examination. The patient did not report weight loss, night sweats or fever. She had no flush symptoms or diarrhea, only a slight postprandial discomfort in the right upper quadrant. Apart from a moderate hepatomegaly, physical examination was unremarkable. Routine laboratory findings were within normal limits without indication of liver disease or advanced malignancy. Likewise, chromogranin A, serotonin and 5-HIAA were within normal range. Sonographically the lesions were of high echogenicity with a hypoechoic halo. The largest lesion found in segment VI had a diameter of 6.8 cm. Multiple additional hepatic lesions were spread throughout both lobes with a size of approximately 1 cm. A CT-guided core biopsy was performed to establish histopathological diagnosis. Histological analysis of the biopsy material showed a G1 neuroendocrine neoplasm (NEN) with a low proliferation rate (Ki-67 < 1%) .
+For tumor staging, abdominal imaging by MRI and a chest CT scan were performed which confirmed multiple bilobular hepatic lesions with no option for complete surgical removal. Somatostatin receptor scintigraphy (SRS) showed a positive receptor status of the hepatic lesions. Colonoscopy identified the primary tumor in the rectum: 5 cm from the anus a polyp with 1 cm diameter was found and endoscopically removed by snare biopsy. Microscopical analysis confirmed a G1 NEN with similar histological appearance as seen in the hepatic metastases . Due to the positive somatostatin (SMS) receptor status treatment with octreotide was started. 6 months later, however, a restaging revealed progression of the liver metastases. As there was no evidence of extrahepatic manifestation we decided to perform a transarterial chemoembolization (TACE) of the hepatic lesions. The patient received in total 7 TACE interventions without complications over a period of 2 years. Over a follow-up period of 7 years without further anti-cancer therapy up to the present, MRI revealed stable disease according to RECIST criteria.
+In 2013, however, the patient presented to the general practitioner with hoarseness as well as tenderness on palpation and stabbing pain in the right lower jaw, the mandibular joint and the right part of the tounge. During the course of several weeks, additional symptoms like palsy of the tongue and dysarthria emerged and the patient was put on an empiric antibiotic treatment with a cephalosporine. With increasing numbness of the tongue and on the inner surface of the cheek, pain of the tongue, worsening dysarthria and dysphagia the patient presented to the emergency department of our hospital. A thorough neurological examination including cranial computed tomography, MRI with MR-angiography and a time of flight (TOF)-imaging as well as ENT examination was not instrumental to establish a diagnosis. However, a lumbar cerebrospinal fluid (CSF) puncture revealed a pleocytosis (19 cells/μl) as well as an intrathecal protein synthesis (IgG), both in accordance with an inflammatory process in the brain. Unremarkable CSF parameters included negative PCR’s for herpes simplex I and II virus, Epstein Barr virus, cytomegalovirus, varicella zoster and toxoplasma as well as negative bacterial cultures, cryptococcus antigen, and cytology examination for malignant cells. Transcranial magnetic stimulation showed an increased latency between the primary motor cortex and the left arm, whereas the right arm and both legs showed normal conduction. Serologic investigation of onconeural antibodies showed a highly positive titer for anti-Ri (1:2560, normal <80). The positive indirect immunofluorescence technique (IIFT) was validated with immunoblotting, which substantiated the isolated presence of the Ri-antibodies . As a result of this the diagnosis paraneoplastic brainstem encephalitis was established. An intravenous methylprednisolone therapy with 500 mg for 5 days led to rapid improvement of the patients neurological symptoms with concomitant decline of the anti-Ri titer from 1:2560 to 1:320. On follow-up 3 months after steroid therapy, the patient is currently completely asymptomatic. A regular methylprednisolone therapy for 5 days intravenously every 8 weeks is planned over a treatment period of at least 2 years. Since brainsteam encephalitis as paraneoplastic neurological syndrom have not been described in patients with metastatic rectum NEN before, other tumors were ruled out including a normal gynecological examination and a FDG-PET-CT without evidence for a lung tumor.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1197_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1197_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e6f1acd871fc3a0584de3dedf993be7e8076c9ed
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1197_en.txt
@@ -0,0 +1,7 @@
+A 38-year-old illiterate housewife from rural southeast Mexico, with bilateral urolithiasis attended a urology consultation at a highly specialized public hospital in Yucatan Mexico, as she had had a fever between 38 ℃ and 40 ℃ for the previous 2 d, accompanied by severe pain in the right flank irradiating to the ipsilateral suprapubic region and reported changes in frequency and quality of urination.
+She was admitted for in-hospital care, and abdominal computerized axial tomography was performed, along with blood and urine tests, including cultures. Tomography indicated the presence of gas in the right kidney indicating EPN Huang IV and confirmed the presence of a nonfunctional left kidney . Blood culture was unremarkable, while urine culture reported S. fonticola as a single pathogen, sensitive to most antibiotics but resistant to trimethoprim and nitrofurantoin.
+Antecedents included that she debuted with symptomatic bilateral urinary lithiasis in 2015, and she was diagnosed with chronic kidney disease Class Kidney Diseases Global Outcomes 3A that same year. Left renal exclusion was confirmed using radiotracer mercaptoacetyltriglycine gammagraphy.
+In 2016 and 2017 second look percutaneous nephrolithotomy was performed, finding right ureteral stenosis due to lithiasis; JJ catheters were temporarily placed in the right kidney and removed after treatment.
+Fever and right flank pain irradiating to the ipsilateral suprapubic region persisted.
+Diabetes and hypertension had been ruled out at every hospitalization, as the patient only registered normal values of fasting glucose and blood pressure. The patient was treated with piperacillin/ tazobactam; a combined endoscopic intrarenal surgery was performed to place a metallic catheter and to treat with percutaneous drainage. After 3 d of antibiotic, she became afebrile. The gas presence due to anaerobic bacteria reduced according to imaging, and a new culture was performed on day 4, which was reported negative. Her white blood cell count improved markedly. However, after 8 d her fever relapsed, and new studies were performed, finding Pseudomonas aeruginosa as a single pathogen in her urine culture along with an increase in neutrophils and white blood cell count in general. She was therefore treated with meropenem .
+After 10 d of treatment, with tomographic and laboratory evidence for the resolution of the acute signs and symptoms, she was discharged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_11_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_11_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..716518baaeac2270d232db8aa2c69fa46f17068d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_11_en.txt
@@ -0,0 +1,4 @@
+A 40-year-old white American woman presented to primary care with a chief concern of nontraumatic umbilical bleeding that began 2 days prior; she woke up and noticed her shirt soaked in blood from her umbilicus. Upon applying pressure with a rag, she was able to stop the bleeding. The patient continued to experience intermittent umbilical bleeding associated with nonradiating periumbilical pain that was exacerbated by movement and associated with nausea and emesis. She had been seen for non-painful umbilical bleeding 5 years prior when she had been occasionally cleaning her umbilicus in the shower with a cotton swab and peroxide; this would sometimes leave small spots of blood on the cotton swab. At that time, no imaging was performed; she was prescribed bacitracin and told to apply Vaseline for what was presumed to be superficial irritation. She had no interim symptoms and discontinued cleaning her umbilicus with a cotton swab.
+Past medical history included hypertension, gastroesophageal reflux disease, class III obesity with BMI 45, major depression, and generalized anxiety. Patient is a G1P1001. Surgical history was notable only for elective caesarean section 12 years prior without complications. The patient was divorced and worked in retail. She did not smoke, use illicit drugs, or drink alcohol. Family history included diabetes, Crohn’s disease, diverticulitis, and breast, lung, and prostate cancer. The patient was taking multiple long-term prescription medications, including losartan 50 mg tablet by mouth daily, propranolol 60 mg tablet by mouth twice daily, escitalopram 20 mg tablet by mouth daily, bupropion 450 mg tablet by mouth daily, gabapentin 300 mg capsule by mouth three times daily, norethindrone-ethinyl estradiol 1 mg–35 µg tablet by mouth daily, trazodone 100 mg tablet by mouth daily, and diclofenac 1% gel topically four times daily as needed.
+On the day of presentation, the patient’s blood pressure was 125/81 mmHg with a pulse of 65 beats per minute. She was afebrile. Inspection revealed a non-distended abdomen and completely normal skin without erythema, fissuring, or visible discharge, though there was some dried blood. There was mild periumbilical tenderness with deep palpation. Deep palpation around the umbilicus produced a thin, watery, serosanguinous fluid directly from the umbilicus. The remainder of the physical examination including cardiac, pulmonary, and neurologic examinations, which were normal.
+The patient was referred for CT of the abdomen/pelvis the same day, which revealed a small fat-containing umbilical hernia with a likely small area of fat necrosis just superior to the umbilical hernia . Laboratory workup was notable for a mildly elevated high-sensitivity CRP at 13.8. The remainder of labs, including complete blood count (CBC) with differential, electrolytes, renal function, and liver function were within normal limits. No coagulation parameters were checked. Four weeks later, the patient underwent outpatient open umbilical hernia repair without mesh and umbilectomy with open wound packing. Dissection was performed down to the level of the fascia, and a 4.2-by-3.5-by-2.6 cm specimen consisting of the hernia sac and urachal remnants was excised and sent for pathologic interpretation. No cultures were sent since there was low suspicion for infection. She had complete resolution of symptoms and bleeding on follow-up 30 days postoperation. She did not receive any antibiotics or other prescription medications for this condition. Surgical pathology interpretation revealed ulcerated skin with abscess, umbilical remnant, granulation tissue, and foreign body suture material. At 1-month and 2-month wound check visits, the patient denied any pain, nausea, or vomiting. At next follow-up 6 months postoperation, the patient continued to do well without recurrence of her symptoms. A timeline of the patient’s history and care is presented in Fig. .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1204_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1204_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6fae08921e2a6c99d2189df99f3181ff8dac9b7a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1204_en.txt
@@ -0,0 +1 @@
+A 66 year old woman with floor of mouth squamous cell carcinoma (SCC) presented to our institution after her second relapse. Originally diagnosed in 2006, she had undergone a composite resection with a flap reconstruction and bilateral neck dissections followed by post-surgical adjuvant radiotherapy for stage IVa (T4aN0M0) disease. Immunohistochemistry (IHC) staining for p16 was negative. In May of 2009, a resectable locoregional recurrence was detected and consequently treated with a composite resection utilizing a pectoralis flap reconstruction. In November of 2013, she presented with a second non-resectable locoregional relapse. She received carboplatin and paclitaxel for 4 cycles with a partial response (PR) after 2 cycles. The patient subsequently developed regional progression and was treated with weekly methotrexate and cetuximab and she achieved stable disease (SD) for 6 months. Later, she progressed locally and was enrolled into a trial utilizing single agent pembrolizumab. She had SD for 6 cycles , and then suffered from local progression with a significant increase in the size of her neck mass, with painful ulceration and bleeding. Pembrolizumab was therefore discontinued. At this time restaging studies revealed no evidence of distant metastasis. She required multiple transfusions secondary to tumor hemorrhage and as a result was treated palliatively with radiation therapy to a total dose of 30 Gy directed at the mass. The patient experienced an excellent clinical response. Bleeding had resolved and her pain had greatly improved. A significant radiographic response was also noted on computed tomography (CT) scan, with tumor dimensions decreasing by 60 %, from 7.1 × 7.2 cm pre-radiation, to 5.9 × 3.4 cm, 6 weeks post-radiation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1207_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1207_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3cf15e7e3cacba5b2a66a962879a5b949dede10c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1207_en.txt
@@ -0,0 +1,6 @@
+A 37-year-old woman was admitted to our hospital on September 15, 2020 due to recurrent cough for more than 10 mo.
+The patient developed a paroxysmal cough accompanied by a small amount of white sputum 10 mo ago. She had no chills, fever, chest pain, hemoptysis, or shortness of breath. She received symptomatic treatment such as anti-infection at a local hospital but her symptoms persisted during this period. The above symptoms recurred 1 mo ago with a little yellow sputum. Fever and hemoptysis were absent. The patient was admitted to our hospital for further treatment.
+The patient was thin and weighed only 40 kg (Body mass index: 15.6). Her temperature was 37.4 °C, pulse rate was 99 bpm, respiratory rate was 19 breaths/min, and blood pressure was 100/63 mmHg. No clubbing of fingers, icterus, or generalized lymphadenopathy were observed. Clinical examinations of the cardiovascular, gastrointestinal, and nervous systems were normal, but crackles were found in the lower lobe of the left lung during lung auscultation.
+Laboratory studies showed normal white blood cells (8.6 × 109/L), and the neutrophil ratio was 83.0%. Erythrocyte sedimentation rate was 26 mm/h (normal value < 15 mm/h), and high-sensitivity C-reactive protein was 8.2 mg/L (normal value < 8.0 mg/L). Arterial partial pressure of oxygen was 91 mmHg (partial pressure of oxygen/fraction of inspiration O2 433.3 mmHg), and arterial partial pressure of carbon dioxide was 41 mmHg. The 1,3-β-D-glucan test and galactomannan test were both negative.
+Enhanced computed tomography images revealed a honeycomb lesion in the lower lobe of the left lung, and an enhanced vascular shadow was seen in the descending aorta, which was consistent with pulmonary sequestration .
+We also performed bronchoscopic alveolar lavage in the posterior basal segment of the left lower lobe. Gram-positive bacilli were detected in the bronchoalveolar lavage fluid (BALF) . The modified acid-fast staining of BALF was weakly positive, and the possible presence of Nocardia species was considered. Following culture of BALF, N. cyriacigeorgica was identified , which was confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (matrix-assisted laser desorption/ ionization-time of flight; VITEK MS, bioMérieux, Craponne, France) .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1208_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1208_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c2caf42d3ac0cfb53433d79c2e6e97bc528d0c84
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1208_en.txt
@@ -0,0 +1,3 @@
+A 62-year-old male patient, known to have primary hypertension and type 2 diabetes mellitus, presented with a brutal onset of loss of consciousness, muscle pain in the upper limbs accompanied by increased movement impairment. In the emergency department a rapid antigen test for SARS-CoV-2 was performed which was found to be positive. The patient had not been vaccinated against SARS-CoV-2. Clinical assessment showed no significant changes: BMI = 32.41 kg/m2; BP = 140/85 mmHg; HR = 95 bpm with normal rhythmic heart beats; SpO2 = 97% (room air); no fever; no pulmonary rales. Initial lab values showed increased inflammation (CRP = 59.5 mg/L), increased values of cardiac enzymes (hsTnI = 8248 ng/L) and possible sepsis (procalcitonin = 68.03 ng/L). The ECG showed no acute ischemic changes. A CT angiography of the pulmonary arteries was performed with the following result: cardiomegaly with contrast refluxed into the hepatic veins, pulmonary arteries with dimensions at the upper limits for normal values, homogeneously opacified, without acute pulmonary lesions. Considering these data, the patient underwent a standard cardiac ultrasound examination revealing concentric hypertrophy of the left ventricle, severe hypokinesia of the interventricular septum, of the anterior and antero-lateral wall, and hypokinesia of the inferior and posterior wall with an estimated ejection fraction of the left ventricle to be approximately 34% ; global strain was −7.7% ; systolic pressure in the pulmonary artery was 50 mmHg. Approximately 2 h after admission, the dynamics of myocardial necrosis was entertained, enzymes registered an increasing trend (hsTnI = 9755 ng/mL; CK = 51432 U/L; CK-MB = 189 U/L). As a result of the accumulated data, an acute coronary syndrome without ST segment elevation was suspected. The patient underwent coronary angiography using the right radial artery approach, in which the coronary arteries revealed no significant angiographic lesions. and show the dynamics of hsTnI, CK and CK-MB.
+Considering possible sepsis of unknown origin, antibiotics were initiated with ceftriaxone. A sputum culture was positive for Klebsiella pneumoniae spp pneumoniae, and ceftriaxone was continued according to the antibiogram. Blood cultures taken consecutively were negative. During day 3, a thorax CT scan was performed, which showed fine areas of ground glass arranged peripherally and classified as minimal lung damage and small bilateral areas of pleurisy with a maximum thickness of 10 mm in the right costo-phrenic recess. Methylprednisolone was given, with progressive decreasing of the dose over time. Standard medication for heart failure with a reduced ejection fraction was given . The serum level of interleukin-6 was 2.32 pg/mL, which was considered to be normal . The evolution was favorable: cardiac enzymes, inflammatory markers and procalcitonin continued to decrease and eventually were normalized. Kidney function was preserved. The muscle pain in the upper limbs subsided, with full recovery of functionality. Patient tested negative for SARS-CoV-2 infection on day 14 (RT-PCR).
+Corroborating the clinical, paraclinical and biological context, the panel of IgG antibodies specific for myositis was observed, with a positive result for anti-PL-7 antibodies. We consider that the episode of myocarditis and extensive myositis was clinically triggered by the SARS-CoV-2 infection, possibly linked to his autoimmune status, which was unknown to the patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1214_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1214_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7d1d084bc5ba4910638772d70d27ab2d0427d0e6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1214_en.txt
@@ -0,0 +1,4 @@
+An 8-year-old girl fell from a height of around 1.5 m and injured her left elbow. She was examined by a physician in her village and diagnosed as having an elbow sprain for which limb was immobilized in a plaster cast for 3 weeks. The child sustained another injury to the same elbow following fall on her outstretched hand 4 weeks after removal of the cast. Again the elbow was immobilized in a long arm cast for 3 weeks. After removal of the cast, the child complained of persistent pain and discomfort in the elbow. She was then referred to our hospital 3 months after the initial injury.
+Examination revealed a stiff elbow with a painless range of motion from 45° to 90°, with only terminal limitation of pronation and supination. The ununited fragment was palpable separately from the rest of the distal humerus and freely mobile. Valgus instability was also noted. There were no signs of ulnar nerve irritability or deficit. An anteroposterior and lateral radiographs revealed a displaced fragment of the medial condyle involving the trochlea .
+To address the limitation of movement, articular incongruity and elbow instability, open reduction, and fixation of the fracture was planned. After obtaining consent from the parents, the patient was administered general anesthesia and positioned supine on the operating table with arm abducted on arm board. Limb was exsanguinated and surgery was commenced under tourniquet. Incision was made directly over the medial condyle fragment. The ulnar nerve was identified and protected with plastic tube. The medial condyle fragment was found displaced proximally and anteriorly. The fragment was rotated with its cancellous surface lying anteriorly. This surface was freshened with a curette. Fracture surface on the humeral side was identified and freshened. Medial articular edge of distal humerus was identified for accurate reduction. Without any undue soft tissue stripping, the fractured fragment was reduced to the best possible position with approximation of articular surfaces. Fixation with three smooth Kirschner (K) wires was done followed by suturing of surgical wound. Long arm cast was applied with elbow at 90° and forearm in mid-prone position. There were no post-operative complications.
+Considering that the fracture was already 3 months old at the time of surgery, we anticipated that a longer duration of immobilization would be required; hence, the cast and K-wires were removed at 6 weeks under local anesthesia. Active and active-assisted elbow range of motion exercises were started after K-wire removal. Radiographs taken at 3-month follow-up show union of the fracture, with an irregular medial condyle. The patient regained an active flexion arc of 25° to 95°, with complete pronation and supination . Passively 20° to 100° arc of motion had been restored. At 6-month follow-up range from 10° to 120° had been restored and there was no coronal plane deformity.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1218_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1218_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6860787d2cfd4c10ea3246b5b6c87bceb969bb41
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1218_en.txt
@@ -0,0 +1,4 @@
+A 53-year-old man (85 kg and 170 cm) was admitted for rupture of spleen caused by an accidental fall.
+Emergency splenectomy was planned under general anesthesia. Preoperative emergency ultrasound examination including the heart, chest, and abdomen were performed, and it was found that spleen had been ruptured and was accompanied by active bleeding, complicated with progressive hemochrome reduction, which was the main reason for the patient to undergo emergency surgery. Preoperative ultrasound showed no heart or chest abnormalities. The patient did not complain of dyspnea preoperatively, and preoperative CT showed no hemothorax or pneumothorax . Initial vital signs before anesthesia were a blood pressure of 126/82 mm Hg, heart rate of 75 bpm, and an oxygen partial pressure (SpO2) of 95% while inhaling air. Anesthesia was induced with sufentanil 0.3 µg/kg, rocuronium 0.1 mg/kg, and propofol 3 mg/kg. Tracheal intubation was successfully performed with video laryngoscopy, and positive pressure ventilation was performed with an airway peak pressure of 14 cm H2O. Because the patient's thick chest wall, breath sounds were difficult to auscultate. About 2 min after tracheal intubation, it was difficult to ventilate. The airway peak pressure increased progressively, reaching a maximum of 50 cm H2O and SpO2 dropped, reaching a minimum of 70%. Because of obesity and the thick chest wall, the cause of respiratory failure could not be determined by traditional auscultation. Following the BLUE protocol, a recommended area of the chest was scanned by bedside ultrasound. The pleural slide sign disappeared in the upper and lower blue points of the left lung, and in M-mode, an obvious parallel line sign could be seen below the pleura. The boundary of pneumothorax (lung points) was rapidly confirmed by ultrasound. To avoid lung injury and secondary pneumothorax, a closed thoracic drainage tube was placed in the area guided by ultrasound. The interval from suspicion of pneumothorax to placement of the drainage tube was less than 3 min. After many bubbles had emerged from the water seal bottle, the airway pressure dropped to 20 cm H2O and the SpO2 returned to 96%-100%. After the patient's vital signs stabilized, the splenectomy continued and was successfully completed. The patient was sent to the intensive care unit (ICU) with a endotracheal tube for further treatment after surgery. On day 1 after surgery, the endotracheal tube was removed. On day 6, the closed thoracic drainage tube was removed. On day 9, the patient was discharged from the hospital without any complications.
+Anemia (hemoglobin 85 g/L).
+Focused assessment with sonography in trauma (FAST) has been extensively utilized and studied in blunt and penetrating trauma. Following the FAST protocol, organ damage can be rapidly evaluated by the amount of free fluid in the chest, abdominal, and pelvic cavities. In this case, preoperative emergency ultrasound examination of the heart, chest and abdomen found that spleen had been ruptured and active bleeding was complicated by progressive hemochrome reduction, which was also the main reason for the patient to undergo emergency surgery. Preoperative ultrasound showed no abnormalities in the heart or chest. Following the BLUE protocol, LUS confirmed that the pleural slide sign had disappeared in the recommended area of the left lung, and in M-mode, an obvious parallel line sign was seen below the pleura . The boundary of the pneumothorax (lung points) was rapidly confirmed by ultrasound .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1230_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1230_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6d275cf6e37d77c2ec93e7341c63d1b7af994ecb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1230_en.txt
@@ -0,0 +1,10 @@
+A 53 year old Pakistani lady presented to the Medicine clinic of a local hospital in 2004 with a history of heel pain and lower back pain for 5 months. In this period, the patient had sustained a rib fracture and left humeral fracture. There was no history of diabetes, hypertension or any other chronic disease. She had not been on any form of medication, including steroids and traditional drugs widely available and prescribed in the region, prior to the onset of pain. At the time of the fractures, she had been placed on non steroidal anti inflammatory agents, acetaminophen and tramadol. There was no history of illicit drug use and she was a non smoker. Family history was unremarkable, particularly in the context of bone disease, and malignancy.
+Initial laboratory investigations had shown a mildly elevated total calcium level of 10.8 mg/dL {2.7 mmol/L}-(no albumin level result available from that time for correction). Parathormone levels (PTH) had not been determined. There was no vitamin d or renal function report available from that time. X-Ray pelvis revealed lytic lesions in the right iliac bone . A magnetic resonance imaging (MRI) of the lumbosacral spine showed some signal changes. The differentials based on the MRI were metastatic bone disease or multiple myeloma.
+Serum protein electrophoresis was normal. The patient then got lost to follow-up. Her work up was resumed 4 years later when her bone pains had started flaring up. Bone marrow examinations done back in 2007, and later in 2009, were negative for multiple myeloma. A bone scan in November 2009 showed generalized increased tracer uptake over the skull and both the axial and appendicular skeletons- findings in favor of metabolic bone disease . An initial planar parathyroid sestamibi scan requested by a general practitioner in November 2009 was negative for any functioning parathyroid adenoma in the neck or superior mediastinum. No serum PTH report was available from this time either. Following this workup, the patient was treated empirically for bone pains with calcium supplements, an empiric vitamin d injection, and intravenous zoledronic acid 5 mg (without prior bone mineral density assessment via DXA scan). This empiric treatment was instituted by an orthopedic surgeon whom she had been referred to. The patient experienced only a slight improvement in bone pains with this treatment and also developed nausea, vomiting and anorexia. Subsequently, she sought care at the National Institute of Diabetes and Endocrinology, Dow University Health Sciences, Karachi, Pakistan.
+At presentation, the patient was well oriented and of functional class 3 (wheel chair bound, able to walk only with support). Her blood pressure was 110/70 mmHg. Neck examination revealed no mass or lymphadenopathy. She had a significant proximal myopathy as well as curved thighs. She had shortened fingers, and spinal scoliosis was evident. Severe generalized bone tenderness was elicited. There was no focal deficit. Laboratory investigations at this time showed a calcium level of 15.1 mg/dL{3.775 mmol/L}, (corrected for albumin of 3.6 mg/dL{36 g/L}); Vitamin D3 level of 33.92 ng/mL{84.664 nmol/L}; phosphorus 2.3 mg/dL {0.743 mmol/L}and alkaline phosphatase of 1298 IU/L {21.633 µkat/L}. Her 24 h urine calcium was 155 mg/day {3.875 mmol/day}, with urine calcium to creatinine ratio of 0.02. Her creatinine level was 1.3 mg/dL {114.92 µmol/L}. The estimated glomerular filtration rate (calculated through Cockcroft-Gault equation) was 50 mL/min {0.835 mL/second).
+Following these tests, the patient’s PTH level was ordered and determined to be 2105 pg/mL {2105 ng/L} [Table ]. Ultrasonography of the neck showed a solid hypo echoic, well-circumscribed mass lesion, measuring 1.8 × 1.2 cm at the lower pole of the right lobe of thyroid. There were no calcifications or lymphadenopathy. Appearances were suggestive of parathyroid adenoma. Both lobes of the thyroid appeared normal. A repeat planar sestamibi scan, (requested from a different institute in the city), revealed areas of tracer retention over upper and lower poles of the right lobe of thyroid. The intensity of retained tracer was more over the right inferior parathyroid gland. The findings were highly suggestive of hyperparathyroidism .
+A bone mineral density scan showed a T score of − 2.9 in the spine, − 3.8 in the hip and − 4.5 in the distal forearm, consistent with severe osteoporosis. The Z scores at the spine, hip and distal forearm were − 2.0, − 3.1 and − 3.6, respectively .
+Ultrasonography of the kidneys revealed a single renal stone (0.6 cm) and no neprocalcinosis.
+Based on the biochemistry results of hypercalcemia, associated with elevated PTH levels, a diagnosis of primary hyperparathyroidism was made. Subsequent sestamibi scan and neck imaging facilitated us to localize the abnormal parathyroid gland. The DXA scan was useful for evaluation of the bone mineral density. In view of the phenomenally high levels of parathyroid hormone, (more than 10 times upper limit of normal), the pre-operative suspicion of parathyroid cancer was high [, ]. The patient was rehydrated with intravenous fluids. Subcutaneous calcitonin injections at a dose of 4 units/kg every 12 h were administered to tide her over until the surgery. Once her calcium levels had come down to 10.5 mg/dL {2.625 nmol/L}L, she was operated upon. At surgery, right hemithyroidectomy and inferior parathyroidectomy with level six lymph node resection was done. The lymphadenectomy was performed as there was evidence of enlarged lymph nodes at neck exploration. The size of the lesion was measured as 2.5 × 1.5 × 1 cm. Histopathology showed features consistent with parathyroid cancer . Capsular invasion and focal vascular invasion were noted. However, margins of excision were tumor free. The excised lymph nodes did not show evidence of tumour infiltration. The patient was not given external radiation therapy postoperatively. Literature review revealed that post operative adjuvant radiation therapy may only have a role in the management of patients with a histologically positive margin following en bloc resection, or in those with lymph node metastases [, , ].
+Postoperative PTH level, performed on the second day of surgery, was 59 pg/mL {59 ng/L} (16–87). On the third postoperative day, the patient’s serum corrected calcium declined to 6 mg/dL {1.5 mmol/L}. This was associated with paresthesias around her mouth and carpo-pedal spasm. There were no seizures, although there was some confusion in terms of time and place. Intravenous calcium (2 g calcium gluconate, equivalent to 180 mg elemental calcium, in 50 mL 5% dextrose water) was infused over 20 min. Re-monitoring of calcium levels revealed persistent hypocalcemia. A slow infusion of calcium was initiated at an initial rate of 50 mL/h. This was prepared by adding 100 mL of 10% calcium gluconate (equivalent to 900 mg elemental calcium) to 1000 mL 5% dextrose water. The infusion rate was adjusted, with a goal to maintain calcium levels at lower end of normal range. On the fifth post-operative day, the calcium level had risen to 9.0 mg/dL {2.25 nmol/L}. Neurologic examination was normal and she was tolerating oral diet. Oral calcium supplementation was initiated (Qalsan D four times daily-equivalent to 2 g elemental calcium per day). She was discharged on oral calcium and vitamin D supplementation with active vitamin D, (calcitriol) 0.25 µg twice daily, in a stable condition.
+At follow-up, her appetite and mobility had improved significantly, although she continued to experience bone pains. Corrected calcium was 9.5 mg/dL {2.375 nmol/L}. A repeat skeletal scintigraphy done 3 months after parathyroidectomy did not demonstrate a significant change in the lytic lesions . A repeat DXA scan 2 years down the line revealed a significant improvement in bone mineral density at all sites, though more so at the spine and hip, than at the forearm . Thereafter, we followed her clinically, as she was not keen to have further radiologic testing done. We have been monitoring her calcium and PTH levels on an annual basis. They have remained within their normal range till date (2018). She is now functional class 2, (no longer wheel chair bound), and on regular calcium and vitamin D supplements (patient perspective, attached as Additional file ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1231_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1231_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..444fd95f391d01109638c7639a768c7998a6b89b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1231_en.txt
@@ -0,0 +1,2 @@
+A 39-year-old male patient with MEN-1 who had an anterior mediastinal mass was referred to our hospital. The patient had undergone total parathyroidectomy and auto-transplantation of a partial parathyroid for hyperparathyroidism 6 years ago. His vital signs showed no abnormalities. He had a temperature of 37.2 °C, blood pressure of 117/72 mmHg, heart rate of 100 bpm, respiratory rate of 16 breaths per minute, and oxygen saturation of 98% in room air. Laboratory data revealed a serum antiacetylcholine receptor binding antibody level below 0.2 nmol/L (normal, below 0.2 nmol/L), serum cancer antigen level 5 U/mL (normal, below 35 U/mL), serum α-fetoprotein level 3 ng/mL (normal, below 10 ng/mL), serum human chorionic gonadotropin β subunit level below 0.5 mIU/mL (normal, below 0.5 mIU/mL), and serum soluble interleukin-2 receptor level 292 U/mL (normal, below 475 U/mL).
+Chest computed tomography revealed an isolated anterior mediastinal mass on the thymic gland with a maximum diameter measuring 22 mm and without invasion into the surrounding tissues . Thymic carcinoid is classified as MEN-1 and has a poor prognosis; thus, we decided to remove the tumor. The patient was intubated with a double-lumen endotracheal tube for one-lung ventilation under general anesthesia and positioned in the left lateral decubitus position. A 5-cm skin incision was made at the fifth intercostal space (ICS) in the anterior axillary line, and a wound protector (Gel POINT Mini Advanced Access Platform, Applied Medical, Rancho Santa Margarita, CA, USA) was placed at the subcutaneous muscular layer . Through the wound protector, an 8-mm camera port was placed at the fifth ICS in the anterior axillary line as the second arm. Two 8-mm assisted ports were inserted at the fourth and sixth ICS on the anterior side as the first and third arms, respectively . The distance between each port was about 3 cm. After the da Vinci® Xi (Intuitive Surgical, Sunnyvale, CA, USA) was positioned; a robotic arm was mounted to each port with a bipolar fenestrated grasping forceps on the first arm and a monopolar spatula on the third arm. The rigid 30° oblique viewing endoscope was used. Carbon dioxide (CO2) was insufflated at a set pressure of 5 mmHg. Depending on the situation, the robotic instruments on the left and right arms were replaced and da Vinci® Vessel Sealer Extend (Intuitive Surgical) instruments were also used. Part of the thymic and pericardial fat including the tumor was dissected from the inferior side, and complete dissection was performed from the cranial side, resulting in the removal of the tumor. To prevent robotic arm collisions, the left and right forceps were moved vertically with the endoscope in between . The final histopathologic examination diagnosed the tumor as a thymic carcinoid tumor . Hematoxylin and eosin staining revealed the presence of a number of atypical pleomorphic cells. Immunohistochemical staining showed the presence of neuroendocrine markers chromogranin A, synaptophysin, cytokeratin AE1/3, and Ki-67 (5–10%) . Thus, confirmation of a thymic carcinoid tumor was obtained. The postoperative course was uneventful.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1259_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1259_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1f6e47e0a279d726d0a69740fcb57f897241050c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1259_en.txt
@@ -0,0 +1,4 @@
+This 28-year-old and 20-week pregnant Chinese woman with genetically confirmed alpha-thalassemia trait and a current obstetric record of gravida 3, para 0, artificial abortion 1 and ectopic pregnancy 1 (G3P0AA1E1 by Gravida/para/abortus (GPA) system) presented to our emergency unit (EU) due to headache, chills, fever and general soreness for one day. At our EU, her physical examination revealed a fever up to 38.5°C, mild tachypnea with a respiratory rate up to 21 breaths/min and bilateral lower back knocking pain. Her obstetric ultrasound revealed 20 weeks gestational age, normal placenta location and a fetal heart beat between 140 and 150/min. No vaginal bleeding was noted.
+Her laboratory data showed pyuria (urine white blood cell count 30 to 50/high power field) and severe peripheral blood pancytopenia: white blood cell (WBC) count 2200/mm3 with an absolute neutrophil count (ANC) of 1780/mm3, hemoglobin 5.5g/dL, mean corpuscular volume (MCV) 119.4fl and platelet count 116,000/mm3. Aggregation of erythrocytes and low reticulocyte percentage (0.1%) were detected in peripheral blood smear. Both direct and indirect antiglobulin tests were strongly positive for antibodies against erythrocytes. The autoantibody was found to be of the cold type. A subsequent laboratory investigation revealed 1:32(+) of cold hemagglutinin titer, raised lactate dehydrogenase (314U/L) and low levels of complement 3 (55.5mg/dL) and complement 4 (10mg/dL).
+Her initial bone marrow cytology showed myeloid hyperplasia and only very few erythroid precursors with erythroblasts in abnormal megaloblastic change , some of which presented with pseudopods or ‘dog ears’ , and almost no erythroid maturation beyond basophilic normoblasts. Her bone marrow biopsy revealed scattered erythroblasts displaying homogeneous ground glass intranuclear viral inclusions and positive nuclear immunostaining of B19 virus . Polymerase chain reaction for B19 virus DNA was positive in specimens from her bone marrow, plasma and nasal cavity. Antibodies against Epstein-Barr virus (EBV) were not checked because she did not present with the symptoms and signs of infectious mononucleosis or lymphoproliferative disorders present in most reported cases of EBV-associated hemolytic anemia.
+TAC caused by B19 virus infection in a pregnant woman with cold antibody autoimmune hemolytic anemia (AIHA) was diagnosed. She received intravenous immunoglobulin (IVIG) injection (CSL Limited, Parkville, Australia), 0.4gm/Kg/day for five days, for eradication of viremia and prophylaxis of occurrence of hydrops fetalis. Although her peripheral blood reticulocyte percentage increased dramatically after IVIG treatment , her hemolytic anemia did not improve much. In order to control her autoimmune hemolysis, intravenous high dose dexamethasone (Astar Chem. & Pharm., Hsinchu, Taiwan), 40mg/day for four days, was prescribed. This treatment was repeated every two weeks for four cycles and then shifted to a monthly oral schedule. She was discharged in a stable condition after the fourth intravenous treatment and received careful follow-up study in our outpatient clinic. No more erythrocytes were transfused after the fifth course of high dose dexamethasone in spite of persistent mild anemia. During her hospitalization and subsequent outpatient clinic visits, obstetric ultrasound did not reveal any evidence of fetal anemia and hydrops fetalis. Four months later, a normal looking healthy baby boy (Apgar score 8 at one minute and 9 at five minutes, body weight 3240gm) was naturally delivered with vacuum extraction aid. After delivery of the baby, her AIHA quickly resolved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_125_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_125_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4f9b226ab5f5c47a745f77cce4bd35962c358894
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_125_en.txt
@@ -0,0 +1,3 @@
+A 25-year-old woman, without previous medical history, presented for infertility lasting for more than one year. Clinical examination was normal but abdominal and pelvic computed tomodensitometry (CT) revealed a cyst of the left ovary associated with abundant peritoneal ascites that could correspond to mucinous material. Pelvic magnetic resonance imaging (MRI) confirmed ascites and showed a heterogeneous mass of the left ovary measuring 8.4 × 6.8 cm with adipose, solid and cystic regions that were suggestive of a dermoid cyst. The right ovary and uterus seemed normal. No other lesion was seen in the rest of the body, notably in the digestive system. In this context, surgery by left oophorectomy with appendicectomy and omentectomy was performed 3 months after the first consultation, without resorting to additional hyperthermic intraperitoneal chemotherapy (HIPEC). Intra-operative examination revealed mucinous material inside the peritoneal cavity and a normal digestive tract with a normal appendix. There was no complication of the surgery. The 5-month follow-up based on clinical and imaging surveillance revealed no complaints. Without relapse, the patient was able to pursue her plan to have a child.
+Macroscopically, the left ovary was cystic measuring 9.5 × 7 × 7 cm and weighing 305 g. It was ruptured on 4 cm. Its cut section revealed a heterogeneous and viscous mass with hair. The appendix, measuring 6 cm in length, and the omentum were macroscopically normal. Histologically, the ovarian cyst corresponded to a mature pluritissular teratoma with intermingled skin and pilosebaceous annexes, serous and mucinous glands, respiratory epithelium, adipose tissue and smooth muscle . The organoid areas with the aspect of a colon, representing about 20% of the ovarian cyst, were composed of colonic mucosa, muscularis mucosae, and submucosa from the surface to the depth. A thick muscularis propria was also observed. In the colonic mucosa, some glands were elongated and layered with moderate proliferating epithelial cells with minimal atypia, near to mucin pools stained with Alcian blue. The colonic epithelial cells were immunohistochemistry stained with CK20 and CDX2, and showed heterogeneous staining for CK7. These cells were negative for estrogen and progesterone receptors . The ovarian surface was covered with hyperplastic mesothelial cells and presented acellular mucinous pools, also found in the omentum. The left fallopian tube was normal. The appendix examined in totality was histologically normal besides mucin deposits on the surface of the serosa. It did not present any mucocele or LAMN/HAMN. All together, these data suggested a diagnosis of acellular PMP (according to Carr classification ) caused by a ruptured appendiceal-like mucocele associated with LAMN, in a left ovarian teratoma.
+Next generation sequencing of the LAMN of the teratomatous mucocele revealed an activating mutation of KRAS gene c.35G > A corresponding to the p.(Gly12Asp) substitution . Complementary molecular analysis by SNaPshot showed an associated mutation of GNAS c.602G > A resulting in p.(Arg201His). No mutation was found by these two techniques on the other tissues of the ovarian teratoma (squamous, respiratory, adipose or smooth muscle elements) or in the normal appendix and ovarian parenchyma .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1261_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1261_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..99b9b7c283a4d562ebc1240522a677f97badc16a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1261_en.txt
@@ -0,0 +1,4 @@
+A 71-year-old man was scheduled to undergo total hip replacement surgery under general anesthesia to fix malunion of the right hip joint. Two months before the scheduled procedure, he had undergone left bipolar hip arthroplasty and right acetabular fracture fixation due to bilateral acetabular cartridge fractures. After the fractures, the patient had been prescribed oral polystyrene sulfonate calcium because of hyperkalemia. He was diagnosed to have PNH at the age of 60, and the oral administration of prednisolone was initiated. The therapy with eculizumab was not initiated.
+The preoperative blood examination showed pancytopenia [white blood cells, 2.100/μl; hemoglobin (Hb), 12.7 g/dl; and platelets, 100 × 103/μl]. We suspected a hemolytic reaction due to the presence of a slightly increased aspartate aminotransferase, although bilirubin and lactase dehydrogenase level were within the normal limits. The hyperkalemia improved with the polystyrene sulfonate calcium. The irregular antibody screening was positive. Therefore, 6 units of packed RBCs and a blood salvage device (electa™; Sorin Group Italia, Italy) were prepared. No other abnormal results in the cardiac, liver, or renal functions were observed.
+Figure a depicts the intraoperative progress course. The Hb and potassium (K+) levels after the anesthesia induction were 11.5 g/dL and 4.6 mmol/L, respectively. An hour after the operation started, the same levels became 9.6 g/dL and 5.4 mmol/L, respectively, due to unexpected bleeding and presumably intravascular hemolysis. We initiated blood salvage procedures and started transfusion of 2 units of prepared packed RBCs using a potassium adsorption filter. After that, 190 ml of the first salvaged autologous RBCs were re-infused. Blood examination results to check K+ concentration levels in the transfer bag showed a high level of 6.2 mmol/L in the salvaged RBCs. Because the patient’s Hb became 7.6 g/dL due to continuous bleeding, we transfused two more units of packed RBCs and re-infused 90 ml of the second salvaged autologous RBCs using a potassium adsorption filter. The value of K+ in the transfer bag of the second salvaged autologous RBCs batch was also high at 6.0 mmol/L. The patient’s Hb level recovered to 10.5 g/dL after the RBC transfusion. However, the hyperkalemia progressed to 6.8 mmol/L of K+, and we administered 850 mg of calcium gluconate and initiated glucose-insulin therapy. Although the operation was close to being finished, we transfused two more units of packed RBCs anticipating the possibility of intravascular hemolysis after the operation. The surgery was performed without complications. The value of K+ at the end of the operation was 4.9 mmol/L. The amount of bleeding during the operation was 1900 ml, and the infusion volume during the operation was 2400 ml of crystalloids, 6 units of packed RBCs, and 280 ml of salvaged autologous RBCs. The duration of surgery and anesthesia was 140 and 215 min, respectively. Postoperatively, the patient was transferred to the intensive care unit (ICU).
+Figure b indicates the patient’s progress after the operation. Glucose-insulin therapy was continued until the postoperative day (POD) 1. The patient left the ICU and restarted the oral intake of polystyrene sulfonate calcium at POD 3 because the K+ increased again. At POD 18, the patient was transferred to another hospital for rehabilitation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1270_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1270_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..74bf8f5aa257762761e7b4e161d6321356377a0c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1270_en.txt
@@ -0,0 +1,2 @@
+A 77-years-old Caucasian male with past medical history of hypertension, iron deficiency anemia and gout was admitted to our hospital with scrotal and bilateral leg swelling along with a blood pressure of 257/117. Labs showed a BUN of 29, serum creatinine of 1.96 and hemoglobin of 10.2. Further testing revealed a low serum albumin of 1.9 and 4.2 gm/day of proteinuria with no RBC casts in urine analysis. Upper GI endoscopy with small bowel biopsy done for evaluation of anemia revealed villous atrophy with intraepithelial lymphocytic infiltrate consistent with celiac disease . Anti-endomysial antibody was positive whereas ANA, C3 and C4 were normal. Hepatitis B and C serologies were also negative. No monoclonal protein was detected in serum and urine immunofixation electrophoresis examination.
+Renal biopsy subsequently revealed stage II-III membranous nephropathy. Immunofluorescence studies showed granular global subepithelial deposits which stained 3+ for IgG, 1+ for IgM/T/IgA, 3+ for C3, +/− for C1, 3+ for kappa and 3+ for lambda; supporting the diagnosis of membranous nephropathy. Electron microscopy showed 2-3+ global subepithelial/T/intramembranous electron dense deposits, 100% foot process effacement, 1-2+ segmental subendothelial fluff and 1+ segmental GBM duplication consistent with membranous nephropathy . Review of patient's medication list did not reveal any drugs causing membranous nephropathy. Patient was put on a gluten free diet and started on amlodipine, hydralazine and clonidine for blood pressure control. He was started on irbesartan to control the proteinuria and furosemide for the edema, along with allopurinol for gout prophylaxis. The patient was initiated on steroids (prednisone 60 mg/day) as well as an additional immunosuppressive agent (cyclophosphamide 75 mg/day). However, within a period of 2 to 3 months of starting therapy, patient died due to myocardial infarction.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1271_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1271_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a731501e782690aa24cf6bb4df2f0a75dc7d7666
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1271_en.txt
@@ -0,0 +1,2 @@
+Our patient is a 39-year-old Caucasian woman, with family history of hypertension and with hypertension herself since her late 20s, well controlled on amlodipine 10 mg once daily. In addition, her non-cardiac history includes keratosis follicularis (Darier disease), with frequent skin infections, treated empirically with minocycline. She suffered an acute aortic dissection type A 3.5 years ago and underwent surgery for aorta repair with a 34 mm Dacron graft. Her immediate post-operative course was uncomplicated and she was discharged a week later.
+Twenty-five days after surgery she presented to our institution with fever; clinical examination was remarkable for red keratotic papules of forehead, neck, and presternal area, in addition, fine left lower lobe crackles were present. Her fundi were normal. Leucocytosis with granulocytosis was observed; renal and liver functions tests were within normal limits. A chest X-ray revealed left lower lobe pneumonia with ipsilateral pleural effusion and an echocardiogram showed moderate pericardial effusion. Her blood cultures and Bronchoalveolar Lavage were positive for staph hominis and ciprofloxacin 500 mg BID was administered for 4 weeks. One week after completion of antibiotic therapy, she was re-admitted with fever and malaise and had negative blood cultures, but PCR was positive for Coagulase Negative Staphylococci and ciprofloxacin 500 mg BID and vancomycin 1 g IV BID were given for 4 weeks. With the suspicion of graft infection,—relapse of fever, despite previous appropriate antibiotic treatment, soon after urgent surgery, in a patient with skin disease—an 18F-fluorodeoxyglucose Positron Emission Tomography Computerized Tomography (FDG PET-CT scan) was done and showed uptake in the aortic graft . Daptomycin 500 mg IV OD was initiated for another 6 weeks and fever and inflammatory markers subsided. During a 6-month period, however, multiple relapses occurred, each time following completion of antibiotics and a subsequent FDG PET-CT scan showed increased metabolic activity in the graft, pleura, pericardium, sternum and substernal fat, lymph nodes and spleen . The decision to re-operate was then made; the infected Dacron graft was removed and a bovine pericardium graft was inserted, 9 months after the first operation. Methicillin Resistant Staphylococcus epidermidis (MRSE) was isolated in graft’s cultures and IV daptomycin was administered for 6 weeks post-operatively. Patient remained asymptomatic at 22 months follow-up after second surgery and 18F-FDG PET/CT scan showed significant reduction in FDG uptake.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_127_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_127_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..742e68567f5ee9d975635a3a0f0b692ec1810968
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_127_en.txt
@@ -0,0 +1,4 @@
+An 81-year-old Caucasian woman presented to the outpatient clinic of our hospital with nasal obstruction, headache and diplopia. She had experienced nasal obstruction for over ten years and her headache had worsened for three months. She did not have epistaxis or epiphora. She had been treated medically with antibiotics, nasal decongestants, and nasal steroids. However, her complaints were not alleviated. Her otorhinolaryngological history was unremarkable.
+An endoscopic examination revealed a massively large middle turbinate on the left side. The mucosa was normal and no infection signs were detected in the nasal passage. The enlarged middle turbinate contacting the lateral nasal wall and the septum was the only endoscopic finding. Our patient has proptosis, but her ophthalmic examination revealed 20/20 visual acuity in both eyes and normal intraocular pressures.
+Computed tomography (CT) scans showed a homogenous fluid or soft tissue density lesion surrounded by a bony shell in the left nasal cavity. Erosion of lamina papyracea and ethmoid roof was determined from the CT scans . Neoplasia and mucocele of CB were considered in the differential diagnosis, and a biopsy was planned under local anesthesia.
+Intraoperatively, when we removed the lateral part of the CB for biopsy, a yellow-white colored mass was found inside the CB cavity . The mass was totally excised. The lamina papyracea was found to be defective but no erosion was detected at the ethmoid roof. No further treatment was performed, and the cavity was left open without packing. A histopathological examination showed submucosal chronic inflammation and squamous epithelium with keratinized debris and diagnosis of cholesteatoma was made . Diplopia and proptosis healed after surgery. A follow-up examination 14 months after surgery showed no recurrence of the disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1285_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1285_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..904c92816e13e2c719a6dd161ca7b666ad1003d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1285_en.txt
@@ -0,0 +1 @@
+A 65-year-old male farmer was admitted to the dermatology department of Lishui Central Hospital in April 2016 with the chief complaint of erythema, pruritus, and ulceration of the perianal skin combined with cough, which lasted for 1 year. One year ago, patient had perianal erythema, accompanied by pruritus, ulceration, exudation, and pain. Further questioning revealed that the patient had been coughing several times a day. The patient occasionally had white sputum, without any hemoptysis, chest pain, low grade fever, night sweats, or any other discomfort. The patient had applied a variety of ointments for external use, without improvement. The erythema gradually expanded, affecting half of the hip on both sides of the crissum; an ulcer developed at the center of the erythema. Past medical history included hepatitis B for more than 10 years, and hypertension for about 3 years. The patient had surgical history of cholecystectomy at 39 years of age and denied previous history of TB, tumor, being engaged in risky sexual behaviors, or similar family history. Physical examinations included body temperature of 36.9°C, blood pressure 133/86 mm Hg, pulse rate 86 beats/min, breathing 20 times/min, double pulmonary breath sounded rough without obvious rales. Physical examination by specialist showed a large erythematous plaque of about 20 cm × 15 cm around the anus, skin ulcers could be seen nearly 4 cm range at the perianal area, and the base could be seen with fresh granulation, and few purulent secretions (See Fig. ). Blood routine test, liver and kidney function tests, treponema pallidum particle agglutination assay (TPPA), toluidine red unheated serum test (TRUST), combined detection of human immunodeficiency virus (HIV) antibodies, and HIV antigens were all negative or within normal ranges. The detection and screening of alpha-fetoprotein (AFP) tumor marker, carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCC), total prostate specific antigen (TPSA), and free prostate-specific antigen (FPSA) were all normal. Blood sedimentation rate was 50.0 mm/h, TB DNA was positive, and TB antibody was positive. Acid-fast bacillus detection in sputum samples was ++++. Histological examination of perianal skin showed an ulcerative and necrotic area in the perianal skin, and peripheral epidermis had keratosis and hyperkeratosis. The stratum spinosum was proliferated, accompanied by intercellular edema. The whole dermis had epithelial-like cell mass, Langerhans giant cells could be seen, a large number of infiltrating lymphocytes were observed, and anti-acid staining was positive. Pathological diagnosis demonstrated (perianal skin) necrotic granulomatous lesions (TB). Special staining demonstrated acid-fast bacilli using acid-fast staining, periodic acid-Schiff stain (PAS) was negative (−), silver hexosamine stain was negative (−) (See Fig. ). Chest computed tomography (CT) scan showed symmetrical thorax, trachea moved to the right, and double lung marking increased and disordered. Diffuse nodular, flocculent, and striped high-density shadow could be seen in both the lungs, the edges were blurred, and the density was uneven. The partial lung tissues in both the upper lungs were consolidated and the cavity was formed. Hilus of the lung and mediastinal lymph nodes were not enlarged. The shape of the heart was not abnormal. There was no pleural effusion in the bilateral pleural cavity. Intrahepatic bile duct showed dilatation. Chest CT scan showed secondary pulmonary TB with cavitation in both upper lobes, and part of the right upper lung was damaged (See Fig. ). The results of abdominal enhanced CT showed intrahepatic bile duct dilatation and pneumobilia, gallbladder was not shown; splenomegaly, and multiple renal cysts in both the kidneys; possibility of duodenal descending diverticulum, and a little pneumatosis as a partial small intestinal obstruction. Admitting diagnosis showed perianal ulcerative skin TB, secondary bilateral pulmonary TB with possible cavity formation in the 2 upper lungs, TB bacillus was positive (+) in sputum smear. The patient was transferred to the infectious disease department for treatment, and was given with regular anti-TB treatment, which included isoniazid tablets 0.1 g/time, 3 times/day; rifampicin capsules 0.45 g/time, 1 time/day; ethambutol tablets 0.75 g/time, 1 time/day; pyrazinamide tablets 0.75 g/time, 2 times/day. The patient was discharged after 8 days of hospital treatment. M. tuberculosis in sputum smear was negative (−) at the time of discharge. Flushing and exudation of perianal skin were better than before. The patient was recommended to take regular anti-TB drugs for 6 months after discharge. After 6 months of discharge, the patient was followed up through telephone and replied that the ulcer had healed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1286_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1286_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..590505e37db995d6b1c1c7ecc3dd41d87105df0f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1286_en.txt
@@ -0,0 +1,7 @@
+A 26-year-old black African male health care worker was admitted to the clinic on 21 July 2022, with a significant chief complaint of headache, loss of appetite, and watery diarrhea. The admitted patient presented with a 2-day history of hyperthermia, headache, loss of appetite, and watery diarrhea, as well as back pain, joint weakness, and insomnia. The patient traveled to Malarious area for his education 5 years ago; once upon a time, he bought overripe mangoes from a vegetable vendor on the street and ate them there. The patient ate mangoes at 4:00 a.m. and began experiencing diarrhea at noon, at 10:00 a.m. The patient had taken ciprofloxacillin at 11:00 a.m. from the student clinic without any clinical investigations based on his clinical manifestations due to the inaccessibility of laboratory investigations and diagnostic equipment, and he recovered totally from the illness after 2 days. No one in his family had previously been diagnosed with typhoid fever.
+Recently, the patient traveled to a desert environment and malarious area for work and stayed there for 1 year. When he returned home after 1 year, he bought pineapple from the vegetable seller on the street, ate it after 3 days without putting it in the refrigerator, and experienced the above clinical manifestations after 12 hours. The patient said, ‘I was suspecting typhoid fever because the pineapple I ate was overripe’, and then the physician decided to identify the disease type through laboratory investigations and diagnostic criteria and started undergoing it. First, the physician had performed a laboratory investigation to identify malarial parasites in peripheral blood via thin and thick smears, and no malarial parasites were detected in the patient.
+Second, a physical examination was performed and revealed a high-grade fever (40.3°C/107.4°F) (normal value: 37°C/98.6°F), slight dehydration, tachycardia, or a heart rate of 114 beats per minute (normal value: 60–100 beats per minute), a respiratory rate of 15 breaths per minute (normal value: 12–16 breaths per minute), and a blood pressure of 112/71 mm Hg (normal value: 120/80 mm Hg).
+Third, laboratory investigations were performed and showed a white blood cell (WBC) count of 3160 cells /mm3 (normal value: 3200–9800 cells/mm3), neutrophils of 47% (normal value: 54–62%); eosinophils of 2.1% (normal value: 1–3%), monocytes of 4.8% (normal value: 3–7%), basophils of 0.3% (<1%), and lymphocytes of 43% (normal value: 25–33%), a platelet count of 125 000/mm3 (normal value: 130 000–400 000 cells/mm3), a serum creatinine level of 0.9 mg/dl (normal value: 0.6–1.2 mg/dl), an aspartate aminotransferase/serum glutamic oxaloacetic transaminase level of 68 units/l (normal value: 0–35 units/l), an (alanine aminotransferase/serum glutamic-pyruvic transaminase) alanine aminotransferase level of 95 units/l (normal value: 0–35 units/l), an erythrocyte sedimentation rate of 9 mm/h (normal value: 0–20 mm/h), 45% hematocrit (normal value: 39–49%), hemoglobin of 15.9 g/dl (normal value: 14–17.5 g/dl), mean corpuscular volume of 79.8 fl/cell (normal value: 80–97.6 fl/cell), mean corpuscular hemoglobin of 31 pg/cell (normal value: 27–33 pg/cell), and mean corpuscular hemoglobin concentration of 35 g/dl (normal value: 32–36 g/dl).
+Finally, the physician performed the Widal agglutination test to find that the patient had active or previous typhoid fever. According to the Widal test, the H antigen titer was 1 : 189 and the O antigen titer (TO) was 1 : 137 (normal value: 1 : 20–1 : 80). Herein, the admitted patient had a past history of S. typhi and no detection of active infection with S. typhi because the patient was discharged after 5 days from the onset of fever, and O agglutinins can usually be detected 6–8 days after the onset of fever. The H antigen titer was positive, which was 1 : 189 greater than the normal range and showed the past history of S. typhi infection. Because active typhoid fever infection is not detected until 6 days after the onset of fever, laboratory investigations are used to identify it. The above TO titer value detected was a false negative result because it was done before the 6-day onset of fever.
+On admission, ciprofloxacillin 500 mg was given orally twice a day for 7 days to treat typhoid by inhibiting the deoxyribonucleic acid replication in S. typhi and preventing S. typhi deoxyribonucleic acid topoisomerase and deoxyribonucleic acid gyrase. On the same day, paracetamol 500 mg was given orally three times a day for 5 days to control the fever by inhibiting prostaglandin E2 secretion, which elevates heat secretion and lowers heat loss. The following day, 22 July 2022, the patient was free of all clinical manifestations except fever and sent home with ciprofloxacin and paracetamol.
+The admitted patient recovered from a typhoid fever infection and was discharged back home with prescribed medications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1292_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1292_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7a1cdd5bf109c6dc5025586d65f2472d54cd2731
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1292_en.txt
@@ -0,0 +1,2 @@
+A 32-year-old woman, gravida 3, para 1, was referred to our center at 26 + 3 weeks of gestation for further fetal cardiac examination for suspected cardiac anomalies. The patient was in good health without any maternal complications or high-risk factors (e.g. diabetes, hypertension, amniotic disorders). A detailed echocardiogram was performed to find any potential cardiac anomalies using transverse and sagittal scanning. Conventional 2DE was used to show fetal anatomical structures. Color Doppler flow imaging (CDFI), together with HDFI was used to show fetal hemodynamics. The sound beam was continuously moved upward along the vertical axis of the fetal thorax to perform the transverse scanning. The four-chamber view (4CV) showed a symmetrical left and right heart. The left and right outflow tract views showed normal ventriculoarterial connections. However, a small-sized ventricular septal defect (VSD) was identified at the 4CV and the left outflow tract view with the communication clearly shown by CDFI . An additional movie file shows this in more detail (See Additional file : Video). The pulmonary valve annulus (PVA) was apparently wider in comparison with the aortic valve annulus (AVA). The ratio of PVA/AVA was 1.6 in diameter. The size of the pulmonary artery (PA) was also larger than the aorta (AO) and the ratio of PA/AO was 2.1 in diameter. At the three-vessel trachea (3VT) view, the widened pulmonary trunk continued to be the ductus, which was connected with the descending aorta. At the same time, a tiny vessel was found located at the right side of the pulmonary trunk, with no convergence with the ductus . An additional movie file shows this in more detail (See Additional file : Video). Under normal conditions, the aortic arch joins with the ductus to form proximal descending aorta in a characteristic “V” shape at the 3VT view . The echocardiographic manifestations in the current case thus suggest the possibility of an IAA. Sagittal planes were also scanned to obtain more information. The arch did not present, instead, the ascending aorta was visualized going straight upward and then branching three brachiocephalic arteries in a “W” shape . An additional movie file shows this in more detail (See Additional file : Video). A preliminary diagnosis of IAA type A was then reached. The 3DE with STIC technology was then used to obtain 3D images of the great arteries to confirm the 2D diagnosis. A 3D motorized transducer (4–8 MHz) was used to acquire cardiac volumes when scanning the sagittal planes using HDFI. The acquisition time was set to 12.5 s and the sweep angle was set to 30°. Cardiac volumes were acquired automatically and then reconstructed to display in a cine loop in multiplanar mode. Volume post-analysis was then performed using an off-line software (4D viewer, version 14.0) to obtain the 3D reconstructed images. This could be achieved by properly adjusting the direction and size of the region of interest (ROI) and the rotation of the images in three orthogonal planes in the volume. A combination of smooth surface and gradient light algorithms was also used to enhance the 3D effect of the reconstructed images. The 3D image demonstrated an abnormal angle of attachment of the aortic arch to the ductus and descending aorta via a slim isthmus . An additional movie file shows this in more detail (See Additional file : Video). The final diagnosis was CoA at the isthmus.
+The patient refused a chromosomal examination and did not go back to the following-up echo four weeks later for personal reasons. She came to the hospital at 31 gestational weeks as she could not feel fetal movement. Intra-uterine fetal death was demonstrated by fetal echo and proofs of intra-uterine infection were found during the induction of the labor. An autopsy was then performed and showed the great arteries in detail. The spatial relationships of the aorta and the pulmonary artery were normal. The size of the ascending aorta was approximately half of that of the pulmonary trunk while it went straight upward and gave off the innominate artery, left common carotid artery and the left subclavian artery, in turn. An abnormal angle of the connection between the aortic arch and the slim isthmus could be appreciated . In addition, a perimembranous VSD about 4 mm in diameter was also found. The gross findings confirmed the prenatal diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1321_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1321_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5ceff6fb040ddfc8dd82a17d56e72de967cdbf05
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1321_en.txt
@@ -0,0 +1,3 @@
+A 42-year-old Caucasian woman was admitted to our hospital because of fluctuating diplopia, ptosis, dysphagia, dysarthria and fatigable chewing at the end of meals or at the end of the day. Also, she would not answer the phone anymore because of her fear of not being able to finish a conversation. Her medical history included APS (that had led to three spontaneous abortions) and transitory hypothyroidism. She took acetylsalicylic acid 81mg daily.
+On examination she had dysarthria and weakness of facial muscles, tongue and neck. She displayed progressive fatigability in upward gaze during the Simpson test. Repetitive ulnar nerve stimulation showed abnormal (>10%) decrement. The results of tests to detect antibodies against AChR, MuSK and titin were negative. A generalized MG was diagnosed. Her thoracic computed tomography scan was normal. Thromboplastin time and activated partial thromboplastin time were high, as an expression of the APS; anticardiolipin and anti-β2 glycoprotein-I antibodies were elevated. Laboratory findings are shown in Table .
+She had a good clinical response when treated with pyridostigmine, prednisone and azathioprine.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1338_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1338_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c7d7b6ee6fa2e6deda649af5bb9eaf2c27fadfda
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1338_en.txt
@@ -0,0 +1,5 @@
+We describe a 57-year-old right-handed female presenting to a neurology outpatient clinic with a chief complaint of weakness. She initially began to experience hypophonia, weakness and subsequent difficulty walking approximately one year prior, with hoarseness of speech starting even earlier. Initial onset of symptoms also involved bradykinesia, including speech and ambulation. She noted that her left upper and lower extremities were predominantly affected at onset, with subsequent spread to the right upper and lower extremities. In particular, she had difficulty typing, especially with her left hand, and over time developed micrographia with somewhat illegible handwriting. She experienced impaired gait and balance with a tendency to fall backwards and reported difficulty lifting her legs getting in and out of vehicles. She also endorsed stiffness and cramping in her legs.
+Review of systems was notable for vague lightheadedness, which she described as a "fuzzy feeling" or slowed mental processing. She had a history of constipation with infrequent bowel movements for several years and exhibited frequent episodes of yelling out at night for which the patient was amnestic. Remarkably, within about six months of disease onset she developed laughing involuntarily out of context. Throughout her symptomatic progression, she did not experienced fevers, chills, or other constitutional symptoms. Past medical history was limited to a diagnosis of shingles several years earlier without residual symptoms, and family history was negative for neurologic disorders including motor neuron disease and movement disorders.
+Physical exam included normal orthostatics. Hypomimia was observed with no abnormalities of eye movements. Cognition was normal by Montreal Cognitive Assessment, but speech was hypophonic, slow and mildly dysarthric with hoarse monotone quality. Jaw jerk was absent, and there was no evidence for tongue atrophy or fasciculations. Power was normal without muscle atrophy or fasciculations. Hyperreflexia with Hoffmann's and suprapatellar reflexes were noted bilaterally. Mild bilateral lower extremity spasticity was slightly greater on the left with bilateral extensor plantar responses present. Gait was slow en bloc with bilaterally decreased arm swing. Mild bradykinesia was seen in the upper extremities but without cogwheeling or resting tremor appreciated. Subsequent further evaluation showed severely impaired finger tapping bilaterally and moderate postural instability.
+Laboratory studies including routine blood work and other testing were negative for autoimmune and paraneoplastic processes, vitamin deficiency, and metabolic disorders . Genetic analysis revealed a variant of uncertain significance in the PSEN2 gene . Electromyography was completely negative for lower motor neuron findings. Magnetic resonance imaging (MRI) of the brain both at nine months and two years from disease onset revealed atrophy mildly greater than expected for the patient’s age, particularly in the frontal and parietal cortices bilaterally symmetrical with a normal-appearing brainstem, including pons. Neither a hot cross bun nor putaminal rim sign was visualized . MRI of the cervical spine was essentially normal with minimal disc bulging and no intrinsic cord findings. A DaTscan roughly one year from symptom onset was markedly abnormal with no activity in the putamen bilaterally and diminished uptake in the caudate bilaterally, moderate on the right and mild on the left, confirming nigrostriatal dysfunction .
+Follow-up 2.5 years after initial symptom onset, the patient’s clinical course has been a very slow progression. She continues to have pathologically brisk reflexes with spasticity limiting functionality and increased tone impacting her dexterity and gait. Neuropsychological testing reveals normal cognition with exception of mild slowing in verbal construction and cognitive processing. Ocular motor function remains normal. She continues to exhibit mild asymmetry with both spasticity and bradykinesia slightly worse on the left, still without tremor. She ambulates independently and functions well in her job though challenged by hypophonia and difficulty typing. She has not developed orthostatic hypotension or other signs of autonomic failure. Treatment with tizanidine has helped symptoms of stiffness and cramping, and her bradykinesia has subjectively responded to levodopa titrated up to tolerance.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1342_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1342_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..67cb5654e8c6a96f45387639f427ae38e8557146
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1342_en.txt
@@ -0,0 +1,2 @@
+A 25-year-old woman, gravida 1 para 0 with satisfactory antenatal progress was admitted for an elective cesarean delivery by maternal request at 39+ 1 weeks of gestation. She denied any medical history of chronic disease. As requested by the patient, combined spinal-epidural anesthesia was administered for cesarean delivery. Fifteen milligrams of 0.5% ropivacainehydro chloride injection (AstraZeneca AB, Sweden) was injected into the subarachnoid space and 5 mL of 2% lidocaine (Shanxi Shiyao Yinhu, China) was injected into the epidural space. Cefathiamidine (1.0 g, Shandong Luoxin, China) was administered intravenously as a prophylactic antibiotic. During the surgery, the patient started shivering, but the vital signs remained stable. The operation was completed successfully, and she was monitored in an anesthetic resuscitation room.
+In the anesthetic resuscitation room, she continued to shiver and complained of general numbness and breathlessness. She was febrile with a temperature of 40.7 °C. Her blood pressure dropped to its lowest point of 78/44 mmHg, she had tachycardia with a maximum heart rate of 177 bpm, and she had intermittent vaginal bleeding. However, her oxygen saturation remained at 98%. Hence, septic shock was suspected, but we were unable to rule out anaphylactic shock. Resuscitation was initiated with massive fluid replacement, intravenous dexamethasone (Sinopharm, China), and a uterotonic agent, namely, 250 μg of intramuscular carboprost tromethamine (Pharmacia and Upjohn company, America). Concurrently, a Bakri Postpartum Balloon (Cook, America) was placed. Despite these treatments, her blood pressure remained unstable (< 90/60 mmHg). The blood investigations revealed metabolic acidosis (a pH of 7.252 [7.35–7.45], a serum lactic acid concentration of 6.52 mmol/L [0.36–1.25]), a raised procalcitonin of 94.5 ng/mL [0.0–0.5], an increased white blood cell count of 15 × 109/L [4–10 × 109], increased neutrophilia of 96.1% [50–70%], decreased platelets of 83 × 109/L [100–450 × 109], a hemoglobin concentration of 105 g/L [110–155], a hematocrit of 30.7% [35–45%], coagulopathy with a prolonged activated partial thromboplastin time (APTT) of 91.3 s [22.3–32.5] with low fibrinogen (FIB) < 0.25 G/L[2-4], and hypokalemia of 3.26 mmol/L [3.5–5.5]. The sequential organ failure assessment (SOFA) score was above 2 (oxygenation index ≤400 mmHg, platelet count≤150,000/uL and mean arterial pressure < 70 mmHg). A central venous catheter and a femoral artery catheter were inserted, red blood cell concentrates and fresh frozen plasma were transfused, low-dose noradrenalin (Grandpharma, China) was administered, and the antibiotic was changed to 2.0 g of ceftriaxone sulbactam sodium (Pfizer, America) at 12-h intervals. Five hours after surgery, all vital signs except her body temperature stabilized. Eighteen hours after surgery, her temperature decreased to 37.8 °C, with a raised white blood cell count of 23.13 × 109/L, neutrophilia of 91.7%, procalcitonin above 100 ng/mL, a decreased platelet count of 64 × 109/L, hemoglobin of 71 g/L and hematocrit of 19.8%. The antibiotic dose was altered to 500 mg of intravenous imipenem/cilastatin sodium (Merck Sharp &Dohme, America) at 6-h intervals. Five days after surgery, the results of the blood culture and microbe identification confirmed R. mannitolilytica. At that time, the patient’s body temperature had fluctuated to approximately 37.4 °C, and the hemogram decreased significantly (white blood cell count, 10.43 × 109/L; neutrophilia, 76.9%; procalcitonin, 11.6 ng/mL). Treatment with imipenem/cilastatin sodium was continued because the drug sensitivity test of the bacteria could not be carried out in our laboratory. Eight days after surgery, the patient’s body temperature returned to normal. Blood analysis showed a white blood cell count of 12.09 × 109/L, neutrophilia of 76.6% and procalcitonin of 2.26 ng/mL. The antibiotic was changed to 2.0 g of intravenous cefoperazone sulbactam sodium at 6-h intervals for 6 days. All the blood results had returned to normal, the repeated blood culture was negative on day 14 postoperatively and she was discharged well on day 15. No abnormality was found during follow-up at half a year after discharge.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1349_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1349_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e32a2c07fc4c287b7bb67a51efe8645f7adf68ff
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1349_en.txt
@@ -0,0 +1,3 @@
+A 65-year-old white male was referred to our Vitreo-Retinal Surgery Service for a retinal detachment (RD) in his right eye. On examination, his best-corrected visual acuity (BCVA) was 20/63 in the right eye (RE) and 20/20 in the left eye (LE), with a small refractive error. Intraocular pressure was 15 mmHg OU. Slitlamp examination revealed quiet anterior chambers and slight nuclear sclerosis in both eyes. Dilated fundus examination of the right eye showed an inferior bullous RD involving the macula with no evidence of retinal breaks, while a large RPE tear was detected in the temporal quadrant . There was no sign of uveitis or vitreitis. Fundus examination of the LE was unremarkable, except for slight RPE distrophic alterations at the posterior pole with RPE mottling. Enhanced depth imaging optical coherence tomography (EDI-OCT) revealed a pachychoroid pattern in both eyes . Moreover, OCT scans of the right eye showed sub-retinal fluid (SRF) reaching the macular area from the inferior quadrants. No SRF was detected in the LE. Ocular ultrasound showed no mass lesion . Upon questioning his medical history, the patient referred a history of central serous chorioretinopathy (CSC) in the RE and the recent use of intravenous corticosteroids for bronchitis. Fluorescein angiography (FA) and Indocyanine green angiography (ICGA) were performed, revealing hyperpermeable and dilated choroidal vessels and multifocal and diffuse leakage in the late angiograms of the RE . No disc leak or vasculitis were detected. Swept-Source OCT angiography (SS-OCT-A) confirmed the pachychoroid pattern and clearly demonstrated the mid-pheripheral RPE tear in the inferotemporal quadrant . Axial lengths were 23.63 mm (RE) and 23.35 mm (LE).
+Based on the clinical features, a diagnosis of bullous variant of CSC with RPE tear was made. Oral therapy with eplerenone at a dose of 50 mg/day was initiated. However, no improvement was detected. In fact, two months later, the exudative RD increased with a worsening of the BCVA to 20/80 , despite the continuing therapy with eplerenone. To prevent irreversible photoreceptor damage, management with observation or eplerenone treatment continuation were excluded, and alternative therapeutic procedures were discussed. Laser therapy was deemed inappropriate because the leakage was multifocal and diffuse, with multiple “ink blot” focal areas of leakage at the superior margin of the detached retina and other poorly defined leakage areas in the attached retina. Photodynamic therapy (PDT) was not applicable because of the extension and elevation of the RD. Therefore, the opportunity for surgical treatment was considered.
+Written informed consent was given by the patient, after a comprehensive explanation of the procedures. Under general anesthesia, the patient’s eye was prepared with povidone-iodine and draped. After 180° inferior conjunctival peritomy, bridle suture was passed under the inferior, medial and lateral rectus muscles with 3–0 ticron, and the sclera was exposed. Two 4 × 4 mm almost full scleral thickness sclerectomies were done in the inferior quadrants, taking care to avoid the areas close to exit sites of the vortex veins. Finally, the conjunctiva was approximated with 8–0 Vicryl suture. The treatment resulted in complete RD resolution as of the first day after surgery. Upon follow-up six months after surgery- complete SRF resolution was confirmed and BCVA was stable at 20/80 .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1356_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1356_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..09fe15fe290c0b2c76a5c1d9dde6d98b31b464ed
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1356_en.txt
@@ -0,0 +1,5 @@
+A 47-year-old man (body weight 62.1 kg and height 166.8 cm) was reported in our hospital with a past medical history of tongue cancer that was operable. The preoperative spirometry test, electrocardiography, and transthoracic echocardiogram were normal. He is a non-smoker with no history of cerebrovascular disease. In his thirties, he had undergone resection of the mandibular area with plate reconstruction for treatment of tongue cancer; however, the site became infected and the plate was removed 8 months before presentation. The patient returned for reoperation involving a free abdominal muscle flap with vascular anastomosis and partial mandibular resection with tracheostomy. After surgery, the patient was in the ICU for deep sedation and ventilator management for 48 h, until the vascular anastomosis stabilized. Initially, the iASV ventilator mode was selected to change only the percentage minute volume (%MV) automatically. On the postoperative day 3, the patient’s oxygenation worsened, and purulent sputum increased; fiberoptic suctioning of sputum was performed once along with sputum culturing. Although no significant organism was detected with sputum Gram staining, Klebsiella pneumoniae and Pseudomonas otitidis were detected in the sputum culture test. We therefore arrived at a diagnosis of VAP and changed the patient’s antibiotic from ampicillin/sulbactam 1.5 g per 6 h to meropenem 0.5 g per 8 h. At the time of entering the ICU, his PaO2/FiO2 ratio was 462, which indicated a good oxygenation capacity; this decreased to 171.5 at the time of VAP diagnosis. At the same time, the other patient entered the ICU with a severe respiratory emergency. We continued the iASV mode as we judged that the respiratory condition could be improved. PEEP and FiO2 were selected as additional automatic settings in iASV, %MV was automatically set, and the delta P (ΔP) approximating the driving pressure did not exceed 10 cm H2O. .
+Arterial blood gas (PaO2, PaCO2, and pH) was measured every 6 h to confirm that his respiratory condition was within the expected range.
+Once the patient’s oxygenation capacity started improving, the INTELLiVENT®-ASV started to show a decline in FiO2, first until it reached 0.3, and then reduced PEEP from 14 to 5 cm H2O based on the lung protective ventilation strategy. Two days after changing the antibiotics to treat VAP, his WBC, CRP, and the sputum secretion from the lungs decreased, indicating resolution of VAP. Therefore, mechanical ventilation was successfully withdrawn. During this time, the ΔP obtained by subtracting PEEP from the inspiratory plateau pressure was kept below 10 cm H2O .
+We used dexmedetomidine (0.2γ to 0.5γ) and propofol (1 mg/kg/h to 3 mg/kg/h) for sedation during his admission in ICU. We continued the same sedation dosage after VAP diagnosis, and after stopping ventilator usage, the propofol administration was also stopped. Dexmedetomidine was continued after extubation at night for the purpose of sleeping.
+Two days after stopping ventilator usage, the patient’s respiratory condition was stable and he was transferred to the general ward.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1374_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1374_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fd051fbeba6a0b500c912e4afd3f086884fbb1a5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1374_en.txt
@@ -0,0 +1,4 @@
+An 87-year-old Asian woman in good general health presented with a progressively enlarging mass located in her left preauricular region. Fine needle aspiration (FNA) cytology analysis performed in the clinic suggested malignant cells of uncertain origin, but the tumors showed a rapid and consistent regression after FNA. During six months of observation, the tumor regrew and the patient was referred to our hospital.
+A physical examination revealed a 55-mm tumor located in the parotid with extension to the retroparotid area, and swelling of her left laterocervical lymph node. A computed tomography scan showed a peripheral enhanced mass in her right parotid gland. Magnetic resonance imaging revealed low signal intensity on T1-weighted images and iso-high signal intensity on T2-weighted images. The images showed the lesion to be clearly circumscribed, with homogeneous hypo-iso signal intensity on T1-weighted images and heterogeneous high signal intensity on T2-weighted images. The tumor demonstrated circumscribed and heterogeneous enhancement on gadolinium-enhanced T1-weighted images . Computed tomography scans of her thorax and abdomen did not reveal involvement of other sites.
+FNA was performed again and a cytological examination revealed a Papanicolaou classification of Class V, suggesting SmCC. A total parotidectomy and modified neck dissection were performed. On histopathology, the tumor showed diffuse growth with confluent necrosis in the salivary gland. The tumor cells had scant cytoplasm and hyperchromatic nuclei without prominent nucleoli. Mitotic figures were frequently observed . Neoplasmic elements reveal positivity for cluster of differentiation 56, neuron specific enolase, synaptophysin and a dotted staining pattern with cytokeratin 20 . Based on our histopathological findings, a diagnosis of a Merkel-cell-like SmCC of the parotid gland was made. Additional studies were positive for Maspin.
+Our patient’s postoperative course was uneventful, and no postoperative radiotherapy was administered. The nine-year clinical follow-up, which is the longest follow-up of head and neck SmCC in our knowledge, revealed no locoregional recurrence or distant metastasis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1383_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1383_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9f4ca157d854908f414e0c3ed5f3041e8ed25075
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1383_en.txt
@@ -0,0 +1,2 @@
+A 30-year-old woman visited the hospital due to right lower quadrant pain over the period of 1 week. A laparoscopic myomectomy was performed 4 years ago because of a broad ligament leiomyoma, which was about 10 cm in size. Laboratory findings included a routine blood examination, and a C-Reactive Protein (CRP) test, with tumor markers all found to be within normal ranges. The pelvic Magnetic Resonance Imaging (MRI) scan showed some nodules at the posterior margin of the bladder that were considered to be endometriosis, and some pelvic effusion that was significant on the right side. It was also noted that there was a mass shadow at the lower right ureter (medial to the iliopsoas muscle), with distention of the lower right ureter . The patient also underwent computed tomography (CT) scans to enable the practitioners to observe the size of the abdominal mass and its surroundings. The CT images revealed a region occupying the middle right ureter that was considered to be a retroperitoneal aggressive fibroma, which led to severe hydronephrosis on the right kidney and upper ureter, and a right pelvic effusion . After more detailed examinations were conducted, there were no obvious abnormalities detected in the brain, heart, liver, gallbladder, spleen, pancreas or blood. The color Doppler ultrasound demonstrated that there was a hypoechoic mass next to the right iliac vessels that was closely related to the adjacent ureter. This resulted in severe hydronephrosis of the right kidney and a right upper ureteral dilatation . Ndzengue et al. reported a case of a pelvic desmoid tumor simulating a uterine leiomyoma recurrence. The patient that presented at our hospital had a history of uterine leiomyoma. We subsequently organized a multidisciplinary consultation to determine the next stage of her treatment plan. According to the patient’s surgical history, the next step would be determined after reviewing the results of the last surgical pathological wax, because the pathological nature of the retroperitoneal mass was uncertain.
+Consequently, a laparoscopic pelvic tumor resection with assistance from a Da Vinci robot was successfully conducted. A local peritoneal protuberance was observed in the right iliac vascular area. The parietal peritoneum was incised above the mass and it was carefully freed along the edge of the mass. The size of the tumor was about 6.0 cm × 5.0 cm × 3.0 cm. It had invasively grown and it was wrapped around the right ureter and the right ovarian arteries and veins. It was stuck to the psoas muscle and the iliac vessels. According to preoperative preparations and intraoperative conditions, a decision was made to cut off the right ureter, the right ovarian arteries and veins, and completely remove the tumor and the two masses that were located in front of the broad ligament on the right hand side of the uterus. The sizes of the masses were approximately 1.5 cm × 1.0 cm × 1.0 cm. The right ureter was anastomosed and put into a double J tube. A pathological diagnosis of an intraoperative frozen sample determined that it was a spindle cell soft tissue tumor, and the two masses were leiomyomas. Postoperative pathology tests of the pelvic mass determined that it was aggressive fibromatosis that had invaded the ureteral wall . The uterine surface nodules were also leiomyomas. Microscopically, the tumor cells were arranged sparsely in a spindle shape with blood vessels of different sizes found in the interstitial tissue. Immunohistochemical findings were found to be partially positive for smooth muscle actin (SMA) and desmin, and less than 5% ki-67 of positive cells were seen in the lesion. A detailed re-examination was performed 3 months after the initial surgery, to determine the structure and function of the ovaries. The transvaginal color Doppler ultrasonography was able to determine that the ovaries were normal in size with several follicular echoes. The blood supply to the right ovary was good. There were no obvious abnormalities in the uterus or pelvic cavity . The pelvic MRI and the CT scan of the whole abdomen determined that there were no abnormal lesions in the pelvis. Simultaneously, the endocrine function of the patient’s ovaries was found to be normal, and she was able to self-maturate after removing the double J tube.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1389_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1389_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e34683f5c28ff5ab814c80e1b96f965227dd371e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1389_en.txt
@@ -0,0 +1,7 @@
+A 15-year-old female presented with 3 d of seizures.
+Three days prior, the patient had two episodes of tonic clonic seizures, with a loss of consciousness followed by falling and tonic muscle spasms, a gray face, and jerky movements of the arms and legs, which gradually disappeared after 2-3 min.
+The patient had no history of epilepsy or psychosis.
+Both parents were healthy.
+The patient’s body temperature was 36.5 °C, and her blood pressure was 116/80 mmHg. The findings of brain magnetic resonance imaging (MRI) and computed tomography (CT) were all initially normal. Electroencephalography (EEG) showed diffuse slow waves on basic activity. Our hypothesis was initially epilepsy, and we started treatment with levetiracetam (17 mg/kg/day), after which the seizures disappeared. Two weeks later, she started to experience behavioral problems and speech impairment, fearfulness, and auditory/visual hallucinations with an intermittent course during the day. On physical examination, the patient remained unresponsive to external stimuli. Then, she developed laryngospasms. When the laryngospasms occurred, there was an obvious tracheal pulling motion, accompanied by inspiratory stridor, and the patient’s oxygen saturation decreased from 97% to 70%. These episodes were initially self-limiting but later required aggressive pharmacological intervention, including intermittent intravenous diazepam injections at a dose of 10 mg and intravenous lobeline hydrochloride injections (3 mg/6 h). However, these drugs failed to suppress the laryngospasm episodes. Because the patient’s symptoms worsened, she underwent tracheal intubation and tracheotomy successively to help reduce airway irritation and reduce the administration of intravenous sedatives.
+All listed blood investigation results were within normal ranges. For example, her white blood cell count was within the normal range at 7.2 × 109/L (normal range: 3.5-9.5 × 109/L), glucose was 5.8 mmol/L (normal range: 3.9-6.1 mmol/L), her triglyceride level was 0.90 mmol/L (normal range: 0.00-2.26 mmol/L), gamma glutamyl transpeptidase was 37 U/L (normal range: 10-60 U/L), thyrotropin was 1.36 mIU/L (normal range: 0.55-4.78 mIU/L), and creatine phosphokinase was 51 U/L (normal level: 0-171 U/L). Lumbar puncture examination of the cerebrospinal fluid (CSF) revealed a pressure of 200 mmH2O (normal range: 80-180 mmH2O). CSF analysis revealed the following: 12 nucleated cells/mL (normal level: 0-5 nucleated cells/mL); glucose 3.8 mmol/L (normal range: 2.5-4.5 mmol/L); protein 0.38 g/L (normal range: 0.15-0.45 g/L); and chloride 116.7 mmol/L (normal range: 116.0-130.0 mmol/L). NMDAR antibodies were detected in the CSF.
+The findings of brain MRI and CT were all initially normal. However, upon re-examination 2 wk later, a cranial MRI revealed abnormally high signals in the left frontotemporal parietal occipital cortex and subcortical area on T2-weighted images and fluid-attenuated inversion recovery images . A 4-h video electroencephalogram showed nonspecific slow activity without epileptic discharge. Chest CT, pelvic and abdominal color ultrasound, and MRI did not reveal any tumors, including teratomas.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_138_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_138_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c6b246132133b4d3e3d079fe3a073e75d27942cc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_138_en.txt
@@ -0,0 +1,5 @@
+A previously healthy 45-year-old woman had an cesarean section delivery. She underwent total abdominal hysterectomy, bilateral salpingectomy and adhesiolysis 3 days after admission because conservative treatment of adenomyosis was ineffective. The patient had a positive cephalosporin skin test and was given clindamycin to prevent postoperative infection. However, she developed a sudden onset chills, a high fever (39.0 °C), and a fast heart rate (115 bpm) but had normal blood pressure (118/69 mmHg) 14 h after the surgery. Laboratory blood samples obtained when the patient was febrile showed that the patient’s white blood cell (WBC) count was 8.0 × 10^9/l with 94.4% neutrophils, and the serum C-reactive protein (CRP) level was 7.0 mg/l. Levofloxacin was added to expand the antibacterial spectrum. However, these symptoms did not improve, and she subsequently developed nausea, vomiting, abdominal distension, abdominal pain, diarrhea and oliguria. At that time, the serum laboratory tests showed that the WBC count (1.9 × 10^9/l) fell below the normal range, and CRP (152 mg/l) was further elevated. Twenty-four hours later, the patient showed anuria. Physical examination detected tachycardia (152 bpm) and hypotension (72/39 mmHg). The patient’s hemodynamic parameters, fever chart and antibiotics administered are shown in Fig. .
+The patient was rapidly admitted to the intensive care unit (ICU). Arterial blood gas indicated high anion gap metabolic acidosis with respiratory alkalosis with a pH of 7.33, anion gap of 16.8 and lactic acid of 4.4. Her laboratory tests showed low albumin (22.3 g/l), high serum creatinine (251.9 μmol/l), dysfunction of coagulation (INR1.97, PT22.4 s), and markedly elevated D-dimer (13.477 mg/l). Computed tomography (CT) of the abdomen and pelvis was performed to rule out the presence of a possible occult abscess . She was instantly placed empirically on imipenem/cilastatin and linezolid, given fluid resuscitation and started on noradrenaline via a peripheral intravenous catheter. Afterwards, she received intravenous infusion of albumin (80 g) and virus inactivated plasma (300 ml). Three days after surgery, two sets of blood cultures were positive for S. mitis in the aerobic and anaerobic bottles with a time to positivity of less than 72 h. Antimicrobial susceptibility testing revealed resistance towards clindamycin, moderate resistance towards erythromycin and sensitivity towards penicillin, levofloxacin, vancomycin and linezolid. Henceforward, the patient was diagnosed with STSS caused by S. mitis. Frequent replacement of antibiotics may lead to the emergence of antibiotic-resistant bacteria, so we did not use penicillin immediately.
+On day 4 after surgery, the patient developed moderate acute respiratory distress syndrome (ARDS) with a PaO2/FiO2 ratio of 162.5 mmHg. Pulmonary edema and bilateral pleural effusions were observed on chest radiographs. It was necessary to intubate and ventilate the patient. As the PaO2/FiO2 ratio increased to 377 mmHg and pulmonary edema and pleural effusions were improved on day 8 after surgery, ventilation could be stopped.
+Due to new-onset thrombocytopenia (48 × 10^9/l) thought to be associated with STSS and continued fever despite receiving adequate antibiotic therapy, linezolid was discontinued, and imipenem/cilastatin, vancomycin and penicillin were administered on day 5 after surgery. Two days later, her temperature dropped to the normal range. Additionally, there was no evidence of gram-negative bacilli infection, so we replaced imipenem/cilastatin with levofloxacin based on antimicrobial susceptibility testing. However, her temperature rose again 1 day later . Soon afterwards, her temperature fluctuated between low and medium heat. On day 13 after surgical intervention, physical examination showed that she developed skin redness and subcutaneous induration on the upper left side of the incision. We considered it to be cellulitis of the incision according to ultrasound imaging and the clinical manifestation, for which she underwent debridement. In addition, we used piperacillin/tazobactam instead of penicillin and levofloxacin. The hemolytic streptococcal spread of infection to the incision cannot be excluded, although the local secretion smear and cultures were sterile. Her temperature gradually dropped, and her blood pressure and lactic acidosis recovered to the normal range; hence, she was transferred to the general ward on the 15th postoperative day.
+One day later, her temperature suddenly rose to 38.8 °C again despite adequate drainage of the incision . We considered that the reason for the fever was still related to cellulitis of the incision. Therefore, linezolid was used in place of vancomycin to increase the drug concentration in the skin and soft tissues. Her temperature no longer rose to 38 °C 18 days after surgery . The antibiotics were stopped on the 27th day after surgery. In summary, the patient was treated with antibiotics for a total of 4 weeks. She was discharged when her vital signs were stable, and the incision healed on day 40 after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1394_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1394_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..008b3f3687a5a85b947ced186595b7ae7f72098e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1394_en.txt
@@ -0,0 +1,8 @@
+A 62-year-old hypertentive man was admitted to a local hospital for persistent chest pain lasting 1 h. The patient said he had a heart murmur during a physical examination at age 8 but was misdiagnosed with mitral insufficiency, so he was not further treated. The electrocardiograph (ECG) demonstrated a significant ST-segment elevation in II,III,avF and V7–9 . A diagnosis of acute inferior-posterior myocardial infarction was made. The patient was given 300 mg aspirin,300 mg clopidogrel and then intravenous thrombolysis treatment (Reteplase 18 mg*2). However he still had chest pain and ST-segment elevation 2 h after treatment. Then, he was transferred to a regional percutaneous coronary intervention (PCI)-capable hospital.
+At admission, his blood pressure was 126/62 mmHg, and his heart rate was regular at 122 beats/min without cardiac murmurs. There was no systemic or pulmonary oedema. The cTNI was 6.64 mmol/L, NT-proBNP was 664.8 pg/mL, and D-dimer was 37,180 ng/mL.
+Emergence coronary angiography was performed and showed a 50–60% stenosis in the middle left anterior descending artery (mLAD), and the left circumflex artery (LCX) was normal . When they tried to perform right coronary artery (RCA) angiography, the catheter could not enter the RCA. Ultimately, the physicians were still unable to observe the ostia of the RCA .
+Echocardiography revealed a giant right coronary artery- right ventricle fistula. A computed tomography angiography (CTA) scan 7 days after admission showed that the dilated RCA opening was approximately 30 mm , and the widest segment was about 97 mm . The thrombus blocked the artery flow, and the contrast medium filling in the distal region was defective . 3D reconstruction of the heart showed a dilated and tortuous RCA originating from the ascending aorta and traversing through the right front the heart, but its development stopped because the flow was blocked . The 3D reconstruction of the heart and great vessels showed that the diameter of the RCA was almost equal to that of the descending aorta .
+Therefore, a diagnosis of congenital right coronary artery-right ventricular fistula complicated with coronary artery aneurysm and acute myocardial infarction was made. The patient had discovered a cardiac murmur at age 8 but had been was asymptomatic for 62 years before the acute myocardial infarction occurred. After tortuous treatments, including intravenous thrombolysis treatment at a local hospital, coronary angiography was performed at a regional hospital. He was ultimately transferred to our hospital for complex surgical treatment.
+After 1 month of medication, he was admitted to our hospital and underwent surgery for coronary artery fistula repair + coronary aneurysm resection + coronary aneurysm thrombectomy + aortic sinus plasty. During the operation, the RCA was tortuously dilated, with the widest point > 100 mm located in the right atrioventricular groove at 120 mm in length, causing compression on the right lung. Many red thrombi intermingled with white blood clots in the lumen were observed after the RCA was cut open. The dilated segment of the RCA was cut and removed, followed by opening of the RCA and the long axis to the aortic root. The ostia of the RCA was expanded approximately 30 mm, with a longitudinal suture line, cutting and forming the right coronary sinus. The distal RCA in the right ventricle was stitched. The right crown was small, the lumen was approximately 1 mm, and it was not treated.
+The occluded part of the middle of the RCA was sent for pathological examination. Images show the formation of atherosclerotic plaques in the intima and partial organization of the mural thrombus, and lymphocyte infiltration was observed in the grossly dilated segment . The three layers in the relatively normal coronary artery wall segment are shown in Fig. b. The middle membrane of the artery was hypertrophic and atrophic, with partial replacement of collagen fibres and fibrous thickening of the outer membrane . The internal elastic lamina and external elastic membrane in the relatively normal coronary artery wall segment are shown in Fig. d.
+The patient was satisfied with his treatment and outcome. He had taken aspirin 100 mg once a day, atorvastatin 20 mg once a day, isosorbide 20 mg twice a day, and atenolol 25 mg three times a day. After a 3-year follow-up, he had no angina pectoris, myocardial infarction or heart failure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1398_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1398_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cd2babf278be98fedd7ddb3986baf7e2520650dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1398_en.txt
@@ -0,0 +1,3 @@
+A 53-year-old woman with AIDS of 6 years duration developed progressive weakness, dyspnea on exertion and constipation. Her symptoms also included decreased appetite, weight loss and episodes of lightheadness. She had a history of drug and alcohol addiction, seizure disorder, stroke, pancreatitis and chronic low back pain and she was known to have been Hepatitis B and C positive since 2002. Antiretroviral therapy, consisting of abacavir, lamivudine and zidovudine, had been started in March 2002, when she was found to have Pneumocystis jirovecii pneumonia. She had not developed any other opportunistic infections. Eighteen months later, in October 2003, her HAART regimen was switched to tenofovir (300 mg/day), sustiva (600 mg/day) and Epivir (300 mg/day). At that time, her creatinine was 0.8 mg/dL (71 μmol/L). A recheck in December 2005 revealed a creatinine of 0.9 mg/dL (80 μmol/L) corresponding to eGFR 75 ml/min. She had been on this regimen without any change in the dose of tenofovir until she presented to hospital. Her other medications included aspirin 81 mg/day, folic acid and hydroxyzine. She had also been started on trimethoprime-sulfamethoxazole but discontinued this herself in April 2006.
+On admission, clinical examination revealed signs of mild dehydration. Laboratory tests disclosed the following concentrations: sodium, 134 mEq/L; potassium, 3.4 mEql/L; chloride, 115 mEq/L; bicarbonate, 8 mEq/L; BUN, 57 mg/dL (20 mmol/L); creatinine, 9.8 mg/dL (866 mmol/L); phosphorous, 5.7 mg/dL (1.8 mmol/L); CPK, 119 U/L; uric acid, 4.9 mg/dL; lactate, 0.63 mmol/L and albumin 3.8 g/dL (38 g/L). Arterial blood gas showed academia (pH: 7.15) with appropriate respiratory response (pCO2 21 mmHg). In a urine sample, sodium was 44 mEq/L with a FeNa of 4%, potassium 39 mEq/L, chloride 43 mEq/L and creatinine 82 mg/dL (7249 mmol/L). Urinalysis showed marked glucosuria (294 mg/dL) with normoglycemia and proteinuria (124 mg/dL) and an absence of active urinary sediment. Urine pH was 6.0. The rates of fractional excretion of phosphorus and uric acid were 58% and 37% respectively. The findings of renal ultrasound were normal, as were the findings for all serologic tests. Her CD4+ lymphocyte count was 241 and her viral load 460 HIV RNA copies/ml.
+Tenofovir therapy was discontinued and her HIV regimen was adjusted to abacavir, sustiva and epivir. Intravenous bicarbonate therapy was initiated with simultaneous potassium supplementation. Within the next few days, there was slow improvement in serum creatinine and bicarbonate levels but hypokalemia (minimum 2.5 mEq/L) recurred, requiring discontinuation of bicarbonate. Five days after her admission to our hospital, the patient discharged herself against medical advice. At that time she still had hypokalemia (2.7 mEql/L), low bicarbonate level (16 mEq/L) and a creatinine of 6.1 mg/dl (539 mmol/L). At follow-up at 7 months, her kidney function had returned to normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1403_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1403_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..599c92d0288496f6ada5a4f1f205b41654f49339
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1403_en.txt
@@ -0,0 +1,4 @@
+A healthy 19-year-old male college student presented to the emergency department with acute pain in the left foot after sustaining a sledding injury. While sledding in the sitting position and with legs extended, the plantar aspect of his left foot struck a tree limb at high speed. The pain was throbbing and did not radiate. Weight bearing was impossible. Previous medical and surgical records were unremarkable.
+On physical examination, localized swelling and tenderness of the dorsal aspect of the midfoot prevented weight-bearing or movement of the foot and ankle. Circulation and neurological examinations were normal. The skin was intact.
+Foot radiograph demonstrated a Lisfranc fracture dislocation . A subsequent CT scan is shown .
+This patient underwent an immediate open reduction and internal fixation of the Lisfranc fracture-dislocation. A postoperative radiograph is shown . He was treated with a non-weight-bearing cast followed by a weight-bearing boot. He was advised to refrain from strenuous physical activity for 6 weeks after removal of the boot, after which time, normal physical activity was resumed. A non-steroidal anti-inflammatory drug was prescribed for pain. The patient had only mild pain with weight-bearing at 6 months and was ambulating without difficulty; he was pain-free at 2 years.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1414_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1414_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f8b0939a85c561ca6829e6ca07dba95c2622a6f0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1414_en.txt
@@ -0,0 +1,7 @@
+A 19-year-old young lady presented to our cardiology clinic complaining of shortness of breath of 3 months duration. Her symptoms were progressive over time, and on presentation, she was short of breath on minimal effort. She also reported two attacks of hemoptysis, and each was about a cup of fresh blood. She denied any history of chest pain, palpitations, syncope, or lower limb swelling.
+Six years earlier, she was admitted with generalized anasarca, rapidly deteriorating renal functions, and nephrotic range of proteinuria. Renal biopsy showed focal segmental glomerulosclerosis. She had two sessions of hemodialysis and was kept on immune-suppressive medical therapy, and her renal functions were then stabilized. Furthermore, 2 years before presenting to us, she had a purpuric eruption and was found to have severe thrombocytopenia. Her platelets reached 10,000, and after exclusion of all other possible causes, she was diagnosed with immune thrombocytopenic purpura (ITP) and was kept on steroids. She also reported a history of previous right femoral deep venous thrombosis 1 year ago for which she was anticoagulated using warfarin for 6 months. The patient denied any history suggestive of an autoimmune disorder (e.g., arthralgia, skin rash, mouth ulcers, hair loss), and there was no family history of any similar conditions.
+At the time of presentation, her blood pressure was 110/70 and her heart rate was 100/min. Her resting oxygen saturation was 88%. The rest of the physical examination was unremarkable apart from abdominal striae (steroids use). Her ECG showed normal sinus rhythm with no abnormalities . Echocardiography showed a huge right atrial mass (about 8 × 7 cm), filling the whole cavity of the right atrium and oscillating in and out of the right ventricle through the tricuspid valve . The left ventricle appeared of normal dimensions and systolic function. The right ventricle appeared dilated with impaired systolic function. Laboratory findings showed marked thrombocytopenia (30.000) and severe renal impairment (creatinine 6.1 mg/dl and urea 176 mg/dl). Troponin was positive. Anti-thrombin III, lupus anticoagulant (LA), anti-cardiolipin (IgG, IgM), compliments 3 and 4, and proteins C and S were in the normal range. There was a hypoalbuminemia (albumin 1.9 mg/dl). Lower limb venous Duplex showed old canalized femoral deep venous thrombosis (DVT) with no evidence of acute DVT. Trans-esophageal echocardiography confirmed a huge right atrial mass that was extending from the inferior vena cava (IVC) and appeared to occupy the whole atrium. A small patent foramen ovale was also noticed in the inter-atrial septum . Differential diagnosis of the right atrial mass included thrombus (pulmonary emboli-in-transit), primary and metastatic cardiac tumors (e.g., right atrial myxoma), and vegetations on the tricuspid valve and intracardiac electrodes. The huge size, extension of the mass, and clinical context suggested that it was most probably a huge thrombus. The patient was admitted, IV heparin was initiated, and a heart team discussion was held regarding the best way of management. Urgent cardiac surgery to remove the right atrial mass was proposed as the best option for the patient taking into consideration its large size and risk of distant embolization. However, concerns were raised for the risk of peri-operative bleeding due to thrombocytopenia, the risk of renal failure, and the risk of recurring thrombosis post-operatively.
+A few hours later, while the patient was in the intensive care unit (ICU), the patient arrested in asystole. Cardiopulmonary resuscitation (CPR) was immediately initiated, the patient was intubated, and she was resuscitated after two cycles of cardiopulmonary resuscitation. After the return of spontaneous circulation, she was vitally stable; the blood pressure was 140/90 and heart rate was 110/min. However, ECG showed ST-segment elevation in anterior chest leads and bedside echocardiography showed impaired left ventricle (EF of 40%) with akinetic mid and apical anterior septum and anterior wall, i.e., acute anterior STEMI, mostly due to paradoxical embolism. Recent updates were discussed, and a consensus was reached that surgery, despite the very high risk, will be the best management strategy.
+As the patient was hemodynamically stable, we transferred her to the cath lab. Coronary angiography showed normal epicardial coronaries with mild haziness at mid segment of LAD artery with mild slow flow in the artery (canalized or dislodged embolus). The rest of the coronaries were normal (Additional file : Movie 3A, 3B). Multislice computed tomography (CT) pulmonary angiography was then performed (to exclude massive pulmonary embolism) and showed normal major pulmonary artery branches with occluded some peripheral pulmonary branches . The inferior vena cava was clear of thrombi. No suspicious abdominal masses were visualized.
+After a discussion with the family and explaining the high risk of mortality and morbidity, open-heart surgery was performed to excise the right atrial thrombus. Extra-corporeal membrane oxygenator (ECMO) was used as a support during surgery. At post-operative ICU, she was kept on IV steroids and had three sessions of hemodialysis. After 5 days, ECMO was disconnected and her vital signs stabilized. Two days later, she was extubated. A good urine output was maintained, the acid-base balance was normalized without the need for further dialysis, and creatinine and urea returned to the same levels as pre-operative. The platelets were stable at a level of 70,000. Oral anticoagulation using warfarin was initiated reaching an INR target of 2–3. Post-operative echocardiography showed borderline left ventricle (LV) contractility with regional wall motion abnormalities and mildly impaired right ventricle (RV) contractility with no evidence of mass residual . The patient was discharged on warfarin and oral steroids 3 weeks following surgery.
+She returned to her daily activities with good functional capacity within 2 months after surgery. She was very happy and grateful to the whole team. She was referred to an immunologist and nephrologist to continue the treatment regimen of her underlying medical conditions.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_141_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_141_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b9eaa20fe1618b4c4224f8d9cc59d1f4ae263ee6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_141_en.txt
@@ -0,0 +1,3 @@
+A 2.5-year-old boy presented with a 6-month history of penile enlargement, pubic hair, frequent erections, and rapid linear growth. Delta height was + 1.19 standard deviation score (SDS) in the past 8 months. Previous medical and family history was unremarkable, and exposure to exogenous testosterone was excluded. On physical examination, his weight was 19.1 kg (+ 2.5 SD), height 101 cm (+ 1.7 SD), systolic blood pressure 138 mmHg (> 99th percentile), and diastolic 75 mmHg (95th–99th percentile). Tanner stage was A1 P4 G3, and penile length was 6.8 cm. He had symmetrical prepubertal testes (3 ml bilateral) without palpable abnormalities. Skin and oral examination were normal. Repeated blood pressure readings in the following weeks were all above the 95th percentile. His bone age was 3.5 years, as per the Greulich–Pyle scale. Serum gonadotrophin levels were prepubertal, while testosterone (9.9 µg/L, ref. < 0.12 µg/L), androstenedione (2365 ng/l, ref. 100–900 ng/L), and dehydroepiandrosterone-sulfate (DHEA-S) levels (1.49 mg/L, ref. < 0.02–0.15 mg/L) were elevated, approaching the adult reference range. Serum electrolytes, 17-OH-progesterone, adrenocorticotropic hormone (ACTH), renin, aldosterone, and cortisol levels were normal, as were repetitive 24-hour urinary free cortisol excretion and urinary catecholamine levels . Testicular ultrasound was normal. Abdominal ultrasound showed a hypoechogenic ovoid nodule in the left adrenal , which on magnetic resonance imaging (MRI) was well defined (26 × 23 × 31 mm) and hyperintense on T2 weighted sequences. Contrast accumulation was limited and homogeneous, and there was no evidence of invasion into adjacent organs or vessels . Chest X-ray and liver ultrasound imaging were normal. We decided on laparoscopic unilateral adrenalectomy on the basis of the hormonal findings and imaging features. Two days after surgery, blood pressure normalized, and normal prepubertal levels of testosterone, androstenedione, and DHEA-S were found.
+Macroscopically, the tumor was well defined and surrounded by a thin capsule . Histologically it contained areas of nuclear pleomorphism but no necrosis . There were no signs of capsular or vascular invasion. The tumor stained positive for inhibin and Melan-A . It was classified as a cortical neoplasm with a favorable prognosis on the basis of (immuno)histological characteristics (Wieneke criteria, score: 0): tumor weight < 200 g, no capsular invasion or tumor necrosis, mitotic activity < 15/20 high-power field (HPF), Ki67 index < 15% , and strong and diffuse P53 expression (3 + intensity, 100% of positive cells) . The comparative genomic hybridization of the tumor revealed a complex karyotype with multiple trisomies (Chr 1, 5, 7, 8, 9, 14, 16, and 19), monosomies (Chr 2, 3, 4, 10, 11, 17, and 21), and loss of chromosomes X and Y.
+Massive parallel sequencing was performed on the tumor, analyzing a total of 165 cancer-related genes (additional file 1: Table S1), which identified a pathogenic TP53 gene variant NM_0000546.5(TP53):c.473G > A, p.(Arg158His) (conform ClinVar database ), at an allelic frequency of 71%. Targeted Sanger sequencing on DNA from a whole blood sample subsequently confirmed the heterozygous germline presence of this pathogenic TP53-variant, confirming the diagnosis of LFS (see also Fig. A–C). Familial screening of the proband’s parents and brother was negative, indicating de novo occurrence of the variant. Two years after the adrenalectomy, the patient is in good health, and whole-body MRI cancer screening remains negative for abnormalities. Of note, there was no regression of the penis development or pubic hair.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1442_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1442_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..34f798e93d922fec04b4e4079853f361fb205b1f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1442_en.txt
@@ -0,0 +1,4 @@
+A 37-year-old female presented with bilateral mandibular swellings with associated progressive facial asymmetry for 10 years. The swellings gradually increased in size expanding the buccal cortex. She had mild difficulty in mouth opening while movement of temporomandibular joints was normal. The patient developed pain on the posterior aspect of right mandible for one and a half years which became intense with time. There was no history of trauma. Clinical examination revealed a well-demarcated expansile bony swelling in the left lower tooth bearing region extending from the left second premolar to right mandibular canine anteriorly. The swelling was firm and tender with pinkish appearance of mucosa. A clinical diagnosis of ossifying fibroma was considered. Another well-defined painful swelling was present in right posterior premolar area. Orthopantomogram revealed a 7 × 5.5 cm well-defined, expansive radiolucent mass with scattered radiodense calcified areas involving the roots of the first and second left premolars, right and left canines, and right and left central and lateral incisors. The right posterior mandible area showed a 2.5 × 2 cm well-defined radiopaque swelling distorting roots of the second and third molars. There was a visible thin peripheral radiolucent zone surrounding the radiodense area resulting in obliteration and deviation of the roots .
+The patient underwent complete surgical excision with piecemeal resection of both lesions at a peripheral hospital, and the two specimens were sent to our center for processing and primary diagnosis. The larger specimen was labelled as “Left mandibular swelling” and the smaller was labelled as “Right mandibular growth”. The larger specimen contained two grey white soft to firm, multinodular tissue pieces, that measured 7 × 5.5 × 2.5 cm in aggregate. The cut surface was tan-white, lobulated and gritty. The smaller was comprised of three bony hard, tan-white tissue pieces that collectively measured 2.5 × 2 cm.
+Microscopy of the larger specimen demonstrated a fibro-osseous lesion composed of hypercellular fibroblastic stroma with scattered calcified structures. The stromal cells had hyperchromatic nuclei and moderate eosinophilic cytoplasm. No significant atypia or mitosis was present. The calcified material was comprised of variable proportion of basophilic cementum-like tissue and osteoid bone. Curvilinear woven and lamellar bony trabeculae rimmed by osteoblasts were seen . Histological examination of the smaller specimen revealed a lesion composed of interconnecting thick trabeculae of cementum-like material rimmed by plump cementoblasts in a loose fibrovascular stroma. There was no atypia or pleomorphism .
+Based on all these features, the larger specimen was diagnosed as COF and the smaller specimen as CB. Additional surgical intervention was not required, and it took six months for the patient to regain complete jaw movements. No adjuvant therapy was given. Recurrence was not observed after a follow up of three years. The patient’s consent was obtained for publication. Ethic Review Committee (ERC) exemption was not sought as patient identification was not disclosed in the manuscript.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1445_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1445_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..21e567dd91b71b58bf1e6a49de92532906b68bc8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1445_en.txt
@@ -0,0 +1,4 @@
+A 21-year-old male Japanese student, an active member of an equestrian club, sustained a right toe injury during an accident in a club-related activity. The injury resulted in the severance of his right toe above the interphalangeal joint . Following initial wound treatment, he was directed to the rehabilitation department 2 weeks post-injury. He had no remarkable medical or family history. The patient agreed to provide the case report and consented to its publication, including any accompanying images. The ethics committee of our institution waived the need for ethical review, as the patient provided written consent for the case report.
+Initial assessments indicated pain localized to the injury site, primarily during walking. One month post-injury, the patient also reported pain in the right knee joint while engaging in riding or walking. The pain in the area of the hallux deficit hindered his ability to apply pressure on the thenars. Diagnostic tests, including walking cycle analysis, temporospatial gait parameters, foot pressure distribution, ground reaction force measurements, toe grip force, and one-leg standing tests, were conducted. The foot pressure during a comfortable walk were recorded using a Zebris plantar pressure platform (FDM; GmbH, Munich, Germany; number of sensors: 11,264; sampling rate: 100 Hz; sensor area: 149 cm × 54.2 cm) [–]. The center of pressure (COP) during a comfortable walking pace was captured using force plates (Kistler Japan Co., Ltd., Tokyo, Japan) at a sampling rate of 1000 Hz with a low-pass filter set at 20 Hz . A diminished foot pressure was observed not just in the hallux but also in the metatarsal head of toes two to five on the injured side . The left-foot COP shifted toward the left toe in the late stance phase, while the right-foot COP transitioned toward the second toe, exhibiting greater spatial variability . Assessing the walking cycle using a Zebris plantar pressure platform , the load response and single-support durations were reduced, while the pre-swing phase was extended .
+Vertical ground reaction force during the second peak of walking was diminished on the right side (right 599.8 N, left 660.3 N). The patient was unable to maintain a one-leg stand for 10 seconds on the right foot. Pain levels for the toe and knee were rated 5 out of 10 on a numerical rating scale (NRS).
+On the basis of these findings, a rehabilitation protocol was designed to enhance medial foot loading and improve foot pressure during walking and standing . The regimen included balance and trunk strength training. Starting from the fifth week, the focus shifted to lower limb strength training. From the ninth week, dynamic joint stability exercises were introduced to enhance neuromuscular coordination for movement stabilization . After 3 months, foot pressure and COP movement during walking improved, as did pressure distribution across toes two to five and the metatarsal head, with negligible discrepancies between the left and right sides in both the vertical and anterior–posterior directions . The pressure was consistently distributed from the second toe of the right foot . Notable enhancements were also observed in the pre-leg phase . The second peak of the vertical component of the ground reaction force increased (right 647.5 N, left 639.5 N). One-leg standing on the right foot became stable for 10 seconds, even on a balance mat. NRS scores for the toe and knee pain reduced to 0, indicating a return to pre-injury levels of activity.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1459_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1459_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..310572862935a7cd93cf5428f0c6f62cd512d38c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1459_en.txt
@@ -0,0 +1,6 @@
+A 63-year-old Caucasian man initially presented with an asymptomatic 55% stenosis of the right proximal ICA to another institution. The left ICA was found to be occluded; the vessels of the posterior circulation were not examined. Our patient underwent an endovascular procedure at the other institution, which included the deployment of two 7 mm/40 mm Wallstents (Wallstent, Boston Scientific Corporation, Natick, MA, USA) . The reason why two stents were inserted without balloon angioplasty remains unexplained. Then, three months later, our patient was referred to our hospital with clinical signs and symptoms of a transient left hemispheric ischemia, including global aphasia, right hemiparesis, and paresthesia of the right upper extremity. His cardiovascular risk factors included arterial hypertension, hyperlipidemia and non-insulin dependent diabetes mellitus. Our patient was a non-smoker. Our patient's history included severe coronary heart disease, cardiac insufficiency (New York Heart Association stage II) and recurrent atrial fibrillation, which altogether resulted in an American Society of Anesthesiologists (ASA) physical status of IV.
+Magnetic resonance imaging and angiography including diffusion-weighted imaging did not reveal any ischemic lesions of the left hemisphere. Digital subtracted angiography (DSA) of the supra-aortic and intra-cranial vessels confirmed the occlusion of the left ICA and revealed a highly effective mechanical obstruction of the right ICA caused by two stents deployed in an overlapping side-by-side position . Further atherosclerotic lesions included significant stenoses of both proximal vertebral arteries (V1), a stenosis of the entire left V4 segment and a focal stenosis at the junction of the right V4 segment with the basilar artery. The anterior communicating artery and the right posterior communicating artery were widely patent and the left external carotid artery contributed to the supply of the left hemisphere via the ophthalmic artery. When giving his informed consent, our patient was informed of a peri-procedural and post-procedural mortality and morbidity rate of between 3% and 5%, and an increased risk of peri-operative bleeding due to the antiplatelet medication. Our patient accepted this, and the off-label use of both the Coroflex (Coroflex Please, B Braun Melsungen AG, Melsungen, Germany) and Enterprise (Codman Enterprise, Raynham, MA, USA) stents.
+The first step of the treatment strategy focused on the posterior circulation stenoses in order to improve the potential collateral supply during subsequent stentectomy and CEA. Dual platelet antiaggregation with acetylsalicylic acid and clopidogrel was initiated. Under general anesthesia the stenoses of both vertebral artery origins were treated with short drug-eluting stents (Coroflex), followed by the stent percutaneous transluminal angioplasty of the left and right V4 stenosis using a combination of moderately undersized balloon dilatation and deployment of oversized self-expanding stents (Enterprise).
+The surgical stent removal from the right ICA combined with CEA completed the treatment. Stentectomy and CEA were carried out under regional anesthesia.
+As routinely, we operated using ultrasound-guided regional anesthesia (MicroMaxx, Sonosite GmbH, Erlangen, Germany) of the cervical plexus using 20 cc of lidocaine 1% (Xylocain, Braun Melsungen AG, Melsungen, Germany) and 50 cc of ropivacaine 0.375% (Naropin, Astra Zeneca GmbH, Wedel, Germany). The dispensation of analgosedation allowed our patient to be awake throughout the operation, while neurological function was monitored by assessing the level of consciousness and our patient's motor function on the left side. At first the proximal ICA was dissected circumferentially beyond the level of the carotid bifurcation after uneventful clamping. The removal of the proximal stent from the common carotid artery was then possible without any neurological deficit, and we decided to proceed with the eversion technique. The simultaneous removal of the two 'hugging' stents together with the atherosclerotic plaque in the proximal ICA was possible. The ICA and common carotid artery (CCA) were reanastomosed using a 6/0 polypropylene suture in a continuous fashion. Intra-operative angiographic assessment was performed to ensure patency and in order to control the distal end of the plaque removal. Our patient made an uneventful recovery with no additional neurological deficit.
+Histological examination revealed a thickened layer of arterial neointima. Duplex scanning was within normal limits after five days and three months, and was confirmed by DSA after six months . Follow-up duplex scanning surveillance and neurological assessments were unremarkable after 12 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1462_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1462_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5e4d782375db307fba9b360cc918b65b7122a338
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1462_en.txt
@@ -0,0 +1 @@
+A 51-year-old HIV-positive homosexual man, who has been followed at our hospital since 1992 for HIV, was admitted in June 2004 for persistent low-grade fever, night sweats and a 12 kilogram weight loss over one year. He was treated with antiretroviral therapy since 1995 and HAART since 1997. Unfortunately, the emergence of HIV variants with multiple resistance gene mutations resulted in a high HIV load and low CD4+ T cell count. At the time of admission, the patient's CD4+ T cell count was 8 cells/μl, and his HIV RNA level was 792,000 copies/ml. The body temperature ranged from 37°C to 38°5C. Physical examination revealed an enlarged liver and an extensive well-demarcated, violaceous plaque on the left ankle with 5 additional small violaceous nodules disseminated on the head, trunk and left leg, suggesting a diagnosis of bacillary angiomatosis (BA). A chest CT scan revealed a left lower-lobe density and sputum smears were positive for acid-fast bacilli (AFB). Pelvic CT scan revealed an inflammatory swelling within the right gluteus muscle that was biopsied as were the cutaneous lesion of the left ankle and the bone marrow.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1475_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1475_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5c0fbc9f299e8477da228c943eb1381d1ef0b88e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1475_en.txt
@@ -0,0 +1,7 @@
+An 18-year-old man was admitted to the hospital on February 5, 2021 with a history of intermittent wheezing for the last 15 years, which was aggravated for the last 9 d.
+Fifteen years ago, the patient was diagnosed with bronchial asthma. He regularly received salmeterol and ficasone inhalation (50 μg/100 μg or 50 μg/2500 μg, 1 inhalation bid), but acute exacerbations usually occurred 1-2 times every year, typically between the months of October and December. Nine days before admission, the patient developed wheeze but had no fever. His white blood cell count was 10.56 × 109/L, neutrophil percentage was 45.3%, and eosinophil percentage was 17.6%. He was treated with an antibiotic (moxifloxacin) for 3 d, but there was no significant improvement in symptoms. Two days before admission, he had cough with a small amount of white colored sputum. Chest computed tomography (CT) showed consolidation in the anterior basal segment of the right lower lobe, and there were multiple small nodules with fuzzy margins around the periphery, some of which had merged into small patches of consolidation . Therefore, he was hospitalized for further evaluation and treatment.
+The patient’s past history included congenital hip dislocation since childhood and developmental deformity of the lower extremities, due to which he was relying on a wheelchair for mobility. The patient was diagnosed with neurogenic bladder 6 years ago due to dysuria and obstructive renal insufficiency due to urinary retention. Cystostomy was performed 5 years ago. Hypertension was diagnosed 5 years ago (systolic blood pressure up to 160 mmHg). His blood pressure was controlled below 130/90 mmHg after treatment with oral fosinopril (10 mg, qd). Scoliosis deformity was discovered 4 years ago. He was also prescribed oral sertraline 50 mg once a night for treatment of depression 4 years ago. Two years ago, he was prescribed oral omeprazole for treatment of reflux esophagitis.
+There was a positive family history of bronchial asthma (the patient's mother and grandmother were both affected).
+Physical examination on admission revealed the following: Body temperature, 36.7 °C; pulse, 104 beats/min; respiratory rate, 18 beats/min; blood pressure 131/87 mmHg (1 mmHg = 0.133 kPa). The patient was conscious and had no signs of cyanosis. No dry or wet rales were heard in either lung. Cardiovascular and abdominal examinations were unremarkable.
+Laboratory tests after admission revealed the following: White blood cell count, 11.75 × 109/L; hemoglobin 159 g/L; platelet count, 201 × 109/L; neutrophil percentage 41.7% (absolute value 4.9 × 109/L); eosinophil percentage 24% 6% (absolute value 2.89 × 109/L); serum procalcitonin 0.056 ng/mL; C-reactive protein 1.43 mg/dL; T-SPOT, G test, GM test, Mycoplasma pneumoniae antibody, and Chlamydia pneumoniae antibody were all negative; antineutrophil cytoplasmic antibodies and antinuclear antibody profiles were also negative; allergen total IgE > 5000 KU/L; Aspergillus fumigatus (m3) 66.4 (grade 5) KU/L; Aspergillus antibody IgG 276.2 AU/mL (reference value < 80) .
+To further clarify the nature of the lung lesions, bronchoalveolar lavage fluid was examined. On cell count in the bronchoalveolar lavage fluid , the proportion of eosinophils was 35%. Further ultrasound-guided percutaneous lung biopsy was performed; histopathological findings were presence of alveolar structures, mild widening of alveolar septa, and infiltration of a large number of eosinophils and a small amount of scattered lymphoplasmacytic cells in the alveolar septum; interstitium. small amount of eosinophilic exudation was seen in some alveolar spaces, with no signs of necrosis, typical granulomas, or vasculitis. Based on the history of asthma, peripheral blood eosinophilia, significantly increased serum allergen total IgE, and positive Aspergillus fumigatus-specific IgE and IgG, a diagnosis of ABPA was established. After 1 mo of prednisone treatment, a routine blood test showed that the white blood cell count was 9.13 × 109/L, and the eosinophil percentage was 0.4% (absolute value 0.04 × 109/L). Chest CT showed resorption of shadow in the right lower lobe; only fibrous cords were seen.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1481_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1481_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8cde9b22884ce0a8da462c09ea385fa32f616848
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1481_en.txt
@@ -0,0 +1,4 @@
+A 68-year-old Caucasian woman presented with a rapidly progressive severe sensorimotor paraparesis a few days after having received the first mRNA COVID-19 vaccination (BNT162b2) in May 2021. The patient’s history showed the suspected diagnosis of a secondary progressive MS for over 40 years with unknown date of transition. After having suffered a severe relapse in the early 1980s the patient had lived with a residual mild paraparesis. The patient had never received a disease-modifying therapy (DMT). Relapses had been treated with intravenous corticosteroids. Regarding her vaccination history, the patient had regularly received the vaccines recommended by the German Standing Committee on Vaccination without any relevant side effects prior to the following events.
+In April 2021, the patient first suffered a deterioration of the paraparesis shortly after having been vaccinated against tetanus and pneumococci. She was admitted to an external hospital. Spinal cord MRI showed signs of atrophy of the cervical and thoracic spinal cord without Gadolinium (GD)-enhancement. Cerebrospinal fluid (CSF) analysis did not show any abnormalities. Due to a suspected MS relapse the patient was treated with intravenous corticosteroids. Subsequently the symptoms receded and the patient reached prior level of disability.
+On the 5th of May 2021 the patient received the first mRNA COVID-19 vaccination and 23 days later developed a severe exacerbation of the paraparesis with sensory level of T8 and inability to walk as well as loss of bladder and bowel control (EDSS 7.0). A new spinal cord MRI now showed T2-signal alteration ranging from C4 to T10 with GD-enhancement from C3 to C5 as sign of an acute LETM . CSF analysis displayed pleocytosis of 340 cells/μl (51% lymphocytes, 49% granulocytes) and disturbance of the blood-brain-barrier with elevated protein levels of 2590 mg/L. There was no evidence of oligoclonal bands. Also, there was no evidence of bacterial or viral infection. Cell-based assay showed positive AQP4-antibodies in serum and CSF. The patient fulfilled diagnostic criteria for AQP4-antibody positive NMOSD.
+Initial therapy with intravenous corticosteroids for five days was followed by seven cycles of plasmapheresis which led to a mild improvement of sensorimotor function (EDSS remaining at 7.0). Considering the highly active disease progression, DMT with eculizumab was initiated promptly. Since the patient showed deterioration of symptoms both times she was immunized, required meningococcal vaccination was not applied for safety reasons and prophylactic antibiotic therapy was initiated in the induction phase of eculizumab. The patient later decided not to receive the vaccination at all, hence therapy was changed to satralizumab. In the follow-up period of six months no new relapses have occurred. The patient also declined the second COVID-19 vaccination.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1484_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1484_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0c963c1c104b0927b6a77d5b4f355008f22b75d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1484_en.txt
@@ -0,0 +1,8 @@
+An 11.7-year-old boy was admitted to our hospital due to headache, vomiting and altered mental status.
+Two days before admission, the patient complained of a headache without obvious inducement, accompanied by vomiting 25 times. The headache did not improve with cold medication. He became unconscious 12 h before admission, and relevant tests were completed at a referring hospital. His blood ammonia was > 500 µmol/L. He was referred to our hospital for further treatment.
+The patient was the product of a first pregnancy and first birth (G1P1) mother, and delivered by cesarean section at term with a birth weight of 3.0 kg. His perinatal condition was unremarkable, with no history of asphyxia. He was generally healthy and developed normally for a child of the same age. Prior to this episode, the family was not aware that the patient had OTCD.
+The patient had no significant family history. No patients in the family had OTCD or symptoms associated with the disease.
+On physical examination, he was in a moderate comatose state [Glasgow coma score (GSC) 6] and was unresponsive to sound. His eyes could not be closed, the pupils were equally large and round, about 3 mm in diameter, and light reflex was delayed. There were no significant abnormalities on cardiopulmonary or abdominal examinations. Muscle strength in the limbs could not be tested, muscle tone was normal, and all pathological signs were negative.
+Laboratory tests showed a significantly elevated blood ammonia level . Liver function and coagulation times were abnormal. Blood tandem mass spectrometry showed moderately elevated glutamine. Citrulline and arginine were in the normal range. Urine organic acid gas phase mass spectrometry showed that uracil and orotic acid levels were elevated. Blood ammonia levels during the first week of admission are shown in Figure . During the remainder rest of his hospital stay, levels were in the normal range.
+Whole exome gene testing revealed the OTC gene exon2 hemizygote variant c.119G > A (p.R40H), inherited from his mother. The missense mutation was located in the well-studied exon functional domain without benign variation [Pathogenic moderate (PM) 1]. The frequencies of all normal population databases (dsSNP, 1000 genomes) were less than 0.0005 (PM2). This is a variant with different amino acid changes at the same locus reported in the literature as pathogenic variants (PM5). Pathogenic missense mutations of this gene are common, and benign missense mutations are rare [Pathogenic supporting (PP) 2]. The literature reported that variant to caused impaired gene function as show by in vitro functional assays [Pathogenic strong (PS) 3]. In summary, according to American College of Medical Genetics (ACMG)guidelines, this variant is likely pathogenic (PM1 + PM2 + PM5 + PP2 + PS3).
+Brain magnetic resonance imaging (MRI) revealed that large patches of symmetrical high signal shadows on T2 weighted imaging (T2WI) and fluid attenuated inversion recovery in the cerebral hemispheres, and diffusion WI (DWI) revealed a significant high signal, more pronounced in the bilateral dorsal thalamus, caudate nucleus, lenticular nucleus, insula, cingulate gyrus and frontal lobe into the cortex at the falx.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1510_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1510_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b0a9c9681b5eb5e555b9172e096f2edab08bac4a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1510_en.txt
@@ -0,0 +1,2 @@
+A 45-year-old male patient presented to our institute in December 2017. He suffered of kidney failure and multiple myeloma for about 10 years. The patient complained of dysphagia and respiratory difficulty. Clinical examination showed a big swelling of the neck. He had not shown any signs of systemic amyloidosis. There were no symptoms suggestive of hypo- or hyper-thyroidism. Ultrasound showed an increased volume of the thyroid gland (right lobe 49 × 38 × 100 mm; left lobe 41 × 34 × 51 mm.) with involvement of the mediastinum. No lateral cervical lymphadenopathy was appreciated. CT and MRI showed diffuse and multinodular enlargement of both lobes of the thyroid gland, no lateral cervical lymphadenopathy (right lobe reaches C2; left lobe reaches the brachio-cephalic trunk). Fine needle aspiration (FNA), performed in one nodule of 2 cm in its greatest dimension, showed the presence of colloid and histiocytes. The patient underwent total thyroidectomy. The post-operative course was unremarkable.
+Grossly, thyroid was diffusely enlarged with a nodular external surface (A). The cut surface showed a soft, irregularly nodular and salmon in color parenchyma (B). Histologically there was a diffuse stromal deposition of amorphus eosinophilic material, reminiscent of fibro-sclerotic changes (C and D). Residual normal-sized or cistically dilated thyroid follicles were seen (C and D). Notably some areas showed a variably fatty stromal component characterized by mature adipocytes (E). This component was interpreted as a fatty stromal metaplasia. PAS staining was negative or only weakly positive in the amorphus eosinophilic stromal material. Conversely, a positive staining was obtained with Rosso Congo stain (apple-green birefringence under polarized light). Based on morphological and histochemical features, the diagnosis of “amyloid goiter” was rendered.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1511_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1511_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..24b5294e94e6f88f2ef60f909a94bf0c267b46c0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1511_en.txt
@@ -0,0 +1,2 @@
+A 39-year-old woman was admitted to our hospital for a laparoscopy-assisted vaginal hysterectomy under general anaesthesia (induced with midazolam, fentanyl and propofol, and maintained with sevoflurane in oxygen/air mixture). The patient reported an unremarkable medical and family history and stated that she had never smoked. She also denied the following: (a) regular exposure to environmental tobacco smoke (at home or at her workplace), (b) abuse of illicit or recreational drugs, (c) food or medication allergies, (d) recent camping or wild animal contact. A more detailed history revealed that the patient was otherwise healthy and had taken no medications prior to the present illness. Three days after her surgery (with prophylactic ampicillin/sulbactam administered as i.v. bolus), the patient experienced acute epigastric pain with vomiting and diarrhoea along with dyspnea that gradually increased in severity. The patient had a temperature of 38.2°C, blood pressure of 90/60 mmHg, hearth rate of 120 beats/min, and respiratory frequency of 30 breaths/min. Inspection of her thorax revealed decreased movement of the chest wall, a hyperresonant percussion note, diminished fremitus and reduced breath sounds on the right side. The abdominal examination showed distension, guarding, and diffuse tenderness. The patient’s physical signs and radiographic findings were compatible with peritonitis and pneumothorax; the laboratory examination revealed a leukocyte count of 2,100 cells/μL, with 84% neutrophils and 3% eosinophils. A laparotomy revealed purulent fluid throughout the abdominal cavity, which was associated with fibrinous plaques covering most of the abdominal viscera; these findings were the result of a rectal perforation. A perforation closure was performed and peritoneal toilets (a 9-day-toilet plan) were initiated. The pneumothorax was managed with a thoracostomy tube drainage. The patient was admitted to the intensive care unit (ICU) and began an empirical treatment with piperacillin and tazobactam. On the day of admission, an arterial blood analysis yielded PaO2 of 67 mmHg and SaO2 of 91.2% on ambient air. Non-invasive ventilation was started under moderate sedation with propofol. In the meantime, Enterococcus and Escherichia coli were cultured from the peritoneal exudate. On the seventh postoperative day, the patient’s clinical condition worsened, with increasing intra-abdominal fibrinous adhesions and paralytic ileus; the previous treatment was discontinued and an empirical administration of imipenem was begun on the conjecture of possible resistant enterococci. On the tenth postoperative day, she developed a new spontaneous pneumothorax on the right side , with respiratory rate increased to 28 breaths/min; the pathological event was managed with a thoracostomy tube drainage. Because the patient’s clinical condition were worsened, imipenem was discontinued on the twelfth day and substituted with tigecycline based on the antibiotic-sensitivity results for Enterococcus faecium isolated from the peritoneal toilet on the tenth postoperative day. On the eighteenth postoperative day, the patient’s respiratory distress increased (34 breaths/min and SaO2 of 88% with 6 L/min supplemental oxygen), her temperature was 37.6°C, her hearth rate 110 beats/min and her leukocyte count 19,400 cells/μL (neutrophils 86%; eosinophils 2%). Computed tomography (CT) of the chest revealed an abundant left-sided pleural effusion pressing on the lower pulmonary lobe, and multiple areas of alveolar infiltrates in the upper and middle right pulmonary lobes. The serology (hepatitis B virus, hepatitis C virus, human immunodeficiency virus, Cytomegalovirus, Chlamydia and Mycoplasma) eventually proved negative. Antinuclear antibody, anti-neutrophil cytoplasmatic antibody and rheumatoid factors were negative or non-specific. The levels of immunoglobulin [Ig] G, IgA, IgM, complement C3 and C4 were within the normal limits, and the IgE concentration was 112 kU/L. The CD4+/CD8+ T lymphocytes ratio was 1.7; since this value is usually significantly decreased in patients with various types of respiratory viral infections, the presence of influenza virus and/or bocavirus was not investigated.
+The blood cultures for aerobic and anaerobic bacteria remained sterile. No pneumocystis was detected by polymerase chain reaction. The patient was then empirically treated withceftazidime and clarithromycin for atypical pneumonia, on the basis on the radiographic findings. Despite these measures, she did not improve and continued to have fever, with a temperature of approximately 37.5°C and mild leukocytosis. On the twenty-fifth postoperative day, a chest CT scan demonstrated a left-sided pneumothorax with dense consolidations of the left upper and middle pulmonary lobes along with multiple areas of alveolar infiltrates in the upper and middle right pulmonary lobes. As the patient gradually became more dyspneic and hypoxic, she was placed under ventilation with continuous positive airway pressure. Instead of previous antibiotics, rifampicin and moxifloxacin were administered because of a positive test for Legionella, which, however, was refuted by laboratory on the following day. Because the patient’s respiratory failure further worsened, the previous treatment was discontinued and empirically substituted with three broad-spectrum antibiotics (linezolid, meropenem and moxifloxacin). Eosinophilic pneumonia was suspected when she showed no response to antibiotics within the next 2 days. Bronchoscopy demonstrated inflamed mucosa in both upper lungs with thick secretions in both lower lungs, and many nucleated cells (including 56% eosinophils) were detected in BAL fluid. These findings unequivocally supported a diagnosis of AEP, and parenteral methylprednisolone was initiated. Significant recovery occurred within the next 24 h, so the antibiotics were discontinued. The clinical symptoms further subsided and the patient was successfully extubated within 2 days after the initiation of steroids. The laboratory data and chest radiology revealed marked improvement. After 20 days in the surgery department, the patient was discharged with a course of oral prednisone that was tapered for 14 days. At 1 year following surgery, the patient did not have any recurrence of her pulmonary symptoms or infiltrates.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1514_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1514_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3ddbe62836c2af97e26bdeaa7f442c9bbe688ecd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1514_en.txt
@@ -0,0 +1 @@
+A 42-year-old female patient was referred to the Department of Gastroenterology at the Second Clinical College of Yangzhou University, for long-standing complaints of solid and liquid dysphagia accompanied by episodes of regurgitation. She underwent two upper digestive endoscopies, on which the presence of food residues in the esophageal lumen and rebound passage through the gastroesophageal junction was observed. Gastroesophageal contrast radiography showed slight dilatation of the esophagus, an absence of primary peristalsis but presence of aperistaltic waves, and a narrow distal esophagus with a ‘bird’s beak’ aspect . A CT scan was performed, but was unremarkable and did not reveal any esophageal lesion. Esophageal manometry demonstrated a hypertensive lower esophageal sphincter pressure in conjunction with incomplete relaxation and isobaric aperistaltic pressurizations, all consistent with type II achalasia . The patient was counseled regarding the diagnosis of achalasia and scheduled for POEM. Informed patient consent was obtained before the procedure. The patient was intubated and brought under general anesthesia. Subsequently, upper digestive endoscopy was performed by using a conventional endoscope. Carbon dioxide insufflation was used throughout the procedure. At the esophageal mucosa, 10 cm proximal to the gastroesophageal junction, a 2 cm longitudinal mucosal incision was made using a Hook knife to serve as the entry point for the tunnel in the planned POEM procedure. The mucosa was then separated from muscular layer starting at beginning of the tunnel and the endoscope was then used to enlarge the submucosal tunnel by further separation of mucosa and muscularis. When the channel reached the proximity of the esophagogastric junction, however, a white band of potential tumor tissue became apparent. On encountering this structure, it was decided to resect the putative tumor by separating it from the surrounding muscular layer under direct endoscopic view using an insulated-tip knife. The then mobilized tumor was excised out of the tunnel using a snare through the mucosal entry. The endoscope was then withdrawn from the submucosal tunnel and was capable of passing the gastroesophageal junction without apparent difficulty, thus the myotomy was aborted. Several metal clips were employed to close the mucosal incision . Subsequent histological evaluation combined with relevant immunohistochemistry produced a definitive diagnosis of leiomyoma . Now, 10 months postoperatively the patient is largely asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1529_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1529_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..34e4949d76167022868177d6ad2762e4436f71d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1529_en.txt
@@ -0,0 +1,8 @@
+We present the case of a 28-year-old Hispanic female born with severe Ebstein anomaly of the tricuspid valve. She was initially palliated with right ventricular plication, tricuspid valve repair, and atrial septal defect closure at 5 years of age. She subsequently underwent placement of a 25 mm Hancock™ valve in the tricuspid position and creation of a superior cavopulmonary anastomosis. She developed a high-grade heart block for which an epicardial dual-chamber pacemaker was placed, also at 5 years of age. There was no history of atrial arrhythmia. Her surgical intervention culminated in tricuspid valve removal with patch occlusion of the right ventricle and a fenestrated extracardiac Fontan at 12 years of age. Due to hypoxia, her fenestration was occluded at 25 years of age with a 6 mm Amplatzer™ Septal Occluder via cardiac catheterization, with resulting improvement in oxygen saturations by ∼15% .
+The patient presented to an outside emergency department with 5 days of chest pain, progressive dyspnoea, and fatigue. On the day of presentation, she had become short of breath with minimal exertion. She denied recent illnesses or travel. The patient was hypoxic on arrival at the outside facility with an oxygen saturation of 78%, which improved to 88% on 4 L of oxygen by nasal cannulation. On physical exam, she was tachypnoeic but comfortable appearing without accessory muscle use. She had a well-healed median sternotomy scar. Pulmonary auscultation demonstrates clear lung fields with good airflow. Her cardiac exam was notable for a single S1 and S2, and non-pulsatile jugular venous distension consistent with her known Fontan physiology. The remainder of her exam was benign. An electrocardiogram (ECG) demonstrated sinus tachycardia at a rate of 117 b.p.m. and a right bundle branch block that was pre-existing . Her laboratory evaluation demonstrated a haemoglobin of 14.8 g/dL (normal range, 11.5–16.0), haematocrit of 45.3% (37–47), and platelets of 203 K/μL (130–400). There was no evidence of infectious processes. Her international normalized ratio (INR) was 1.15 (≤1). Brain natriuretic peptide and troponin were not elevated. A helical chest computed tomographic angiography (CTA) was obtained and interpreted as showing a submassive pulmonary embolism (PE) with no contrast filling the proximal branch pulmonary arteries.
+Her non-cardiac history included hypothyroidism and polycystic ovarian syndrome, for which she took levothyroxine and metformin, respectively. She also had a history of COVID-19 infection, 11 months prior to her presentation, which did not require treatment. The patient had a history of miscarriages with unknown aetiology. She was on rivaroxaban, a direct oral anticoagulant (DOAC) for chronic thromboprophylaxis in the setting of her Fontan physiology. She had recently become pregnant but unfortunately experienced another miscarriage; in this setting, she had discontinued and not reinitiated her anticoagulation.
+The differential diagnosis for hypoxia in a patient with a Fontan includes the presence of a Fontan fenestration, venovenous collateral vessels, pulmonary arteriovenous malformations, PE, acute pulmonary processes such as infection, and anaemia.
+The patient was haemodynamically stable and was started on an infusion of unfractionated heparin and transferred to our facility for further management. On exam, she was well-appearing and remained short of breath with hypoxia, though she was able to speak in full sentences. Her lungs were clear bilaterally. Her cardiac examination demonstrated a regular rate and rhythm, a single S1 and single S2, and no murmurs or gallop. Her capillary refill was <3 s, and she had no oedema. A D-dimer was obtained and was elevated at 8.48 μg/mL fibrinogen equvalent units (FEU). We reviewed the CTA . She underwent cardiac catheterization to better elucidate the cause of her shortness of breath and desaturation. Her Fontan pressure was noted to be elevated at 21 mmHg (previously 14 mmHg 2 years prior). Angiography demonstrated a large thrombus in the right lower pulmonary artery branch, with additional thrombi in the subsegmental branches ( and ). The proximal right pulmonary artery and the entire left pulmonary artery were free of thrombi.
+Following confirmation of the right lower pulmonary artery emboli in the setting of elevated Fontan pressures and significant symptomatic hypoxia, it was decided that the patient would benefit from embolectomy. Using the transcatheter Penumbra Indigo™ Aspiration System, the larger right lower pulmonary artery branch segment and three additional subsegmental branches were addressed. A significant clot was removed , and post-aspiration angiography demonstrated resolution of the filling defect ( and ).
+The patient tolerated the procedure well. Following the procedure, she was restarted on rivaroxaban and her heparin drip was discontinued. She was weaned off supplemental oxygen and discharged home 2 days post-procedure with an oxygen saturation of 92% on room air.
+The patient remains well in follow-up. An outpatient thrombophilia workup was obtained and was negative for antiphospholipid syndrome, factor V Leiden, rheumatologic pathology, or other known causes. Given her Fontan physiology and PE, she was instructed to continue life-long anticoagulation and has remained free of further thrombo-embolic events since admission. She continues to be followed by adult congenital cardiology. In follow-up, at 1 year after the event, she has remained well. She remained on full-dose anticoagulation, which has been well tolerated without bleeding complications or recurrent thrombo-embolic events.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1534_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1534_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..412f60042a6dea26236f69adc4fc4df34911e753
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1534_en.txt
@@ -0,0 +1 @@
+Following a motor vehicle accident, a 25-year-old female complained of intense neck pain, but remained neurologically intact. The lateral cervical radiograph showed an oblique fracture of the axis; the fracture diagonally separated the vertebra in two parts and extended from the body of the axis to the posterior elements. In addition, the computed tomography (CT) scan revealed several craniovertebral junction (CVJ) anomalies, which included spontaneous KFS fusion of the C2-C3 disc space and the C2-C3 right articular facets/laminae. Furthermore, the anterior C1-arch was bifid and there was a partial agenesis of the posterior C1 arch [Figure –]. Following immobilization in a halo vest for 3 months, the fracture fused, maintaining adequate alignment . When contacted by phone 2 years later, she was asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_154_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_154_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d2fbf414689ea0219a650601a6c212eed5ce932
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_154_en.txt
@@ -0,0 +1,2 @@
+An 85 years old woman was brought to the emergency department after collapsing at home with breathing difficulties. On arrival she was dyspnoeic with oxygen saturation of 75% on room air and a respiratory rate of 40 per minute. She also had minor bruising to her forehead as a result of her fall. She had a past history of a porcine aortic valve replacement 17 years previously, hypertension and atrial fibrillation for which she was on warfarin. On examination she was tachycardic, hypertensive and her jugular venous pressure was elevated. She had coarse crackles throughout both lungs. Arterial blood gases on 15 litres oxygen showed severe type 2 respiratory failure with pH of 7.15, pC02 9.12, p02 10.22 and bicarbonate of 22.8 mmol/l. Laboratory results showed a haemoglobin of 11.9 g/dL and INR of 4.9. ECG showed atrial fibrillation, right bundle branch block and widespread ST depression. Findings on chest radiograph were compatible with pulmonary oedema. She was commenced on a nitrate infusion, intravenous diuretics and Bi-level Positive Airway Pressure ventilation. Her condition improved rapidly and the Bi-level Positive Airway Pressure ventilation was discontinued. An hour later her breathing deteriorated and she newly developed stridor. She was noted to have developed bruising of the neck. Urgent nasoendoscopy showed a normal larynx with a slight bulge narrowing the trachea anteriorly. She was immediately intubated and ventilated. An urgent computerized tomography (CT) scan of the neck showed a large retropharyngeal haematoma causing anterior compression of the airway, extending into the posterior mediastinum and terminating behind the left atrium. Evidence of pulmonary oedema and a right pleural effusion were also seen on CT. .
+Intravenous Vitamin K at a dose of 5 mg and Prothrombin Complex Concentrates (PCCs) at a dose of 50 units per kilogram were given on diagnosis of the haematoma for the reversal of anticoagulation. The INR was 1.1 when repeated subsequently 2 hours later. Due to complications of a ventilation-related pneumonia the patient stayed in intensive care for 10 days after which she was extubated uneventfully. A decision was made not to recommence anticoagulation with warfarin due to the past history of recurrent injurious falls and the high risk of complications from future haemorrhagic events. The patient was commenced instead on aspirin and was discharged two weeks later to her own home.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1552_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1552_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c9c2305ecb2d2f915ec44baebe9e7a647f3aab3d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1552_en.txt
@@ -0,0 +1,2 @@
+A 35 year old woman WITH no significant past medical history. The history of her illness goes back 2 years marked by the appearance of a left parotid tumefaction. The initial histological study by biopsy revealed a mixed salivary gland tumor of 28 mm without signs of malignancy. The patient had a large resection of this mass with negative surgical margins. 6 months later, she presented with a nodule next to the surgical scar at the subangulomandibular level of 6 cm fixed firm painful on palpation without inflammatory signs associated with left peripheral facial paralysis. Examination of lymph node areas was normal. A parotid MRI revealed an expansive process measuring 42 mm, poorly limited, moderately infiltrating the masseter and pterygoid muscles with heterogeneous spontaneous signal with dynamic enhancement according to a type C curve and a very low ADC (–).
+The extension assessment made by a thoraco-abdomino-pelvic scanner and a bone scintigraphy requested in the face of bone pain, was without abnormality. The patient underwent excision of the mass with extemporaneous examination suggesting an infiltrating carcinoma from which the surgical procedure was completed by a wide left parotidectomy with ipsilateral triangular dissection and preservation of the left facial nerve. The definitive pathological examination showed an undifferentiated malignant tumor proliferation whose immunohistochimical profile suggested a primary peripheral neuroectodermal tumor or PNET. Tumor cells were CK (+) and CD99(+), on the other hand synaptophysin, EMA, NSE, chromogranin, and vimentin were negatives. The study by Fluorescence in situ hybridization (FISH) confirmed the presence of a specific EWING/PNET type translocation in 60% of the tumor cells. The diagnosis of extra-skeletal Ewing’s sarcoma was retained. VDC/IE type chemotherapy (vincristine, doxorubicin, cyclophosphamide alternating with ifosfamide, and etoposide) was indicated followed by external radiotherapy on the operating bed delivered at a dose of 54 Gy in standard spreading and fractionation (1.8 Gy/session and 5 sessions/week). The CTV and PTV margins were 1.5 cm and 5 mm respectively . Treatment planning was performed on the Varian AAA 13.7 Eclipse TPS via a Linac-type linear accelerator. The tolerance of the treatment was good with maximum toxicity of grade 2 mucositis and grade 1 dermatitis which progressed well under symptomatic treatment. A clinical and radiological follow-up by cervical MRI was done every 3 months. The 10-month follow-up showed no locoregional and distant recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1561_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1561_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8c6102dd6e65706518f98f8ebbb20baa366611f2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1561_en.txt
@@ -0,0 +1,6 @@
+A 58-year-old housewife presented to our hospital with five days' history of fever and polyarthralgia involving bilateral wrists, elbows, ankles and the right knee. She had a past history of osteoarthritis of both knees for 10 years not requiring any regular treatment. On admission, she had a blood pressure of 128/68 mm Hg, a pulse rate of 94 beats per minute, and a temperature of 37.8 oC. She appeared comfortable and not in distress, but all the affected joints were tender, swollen, with limited range of movement, especially over the left wrist and right knee. No cardiac murmurs were detected. The initial laboratory results revealed a normal peripheral leukocyte count of 7 500 cells/μL (77% neutrophils), hemoglobin level of 11.9 g/dL and platelet count of 191 000/μL. The liver and renal functions were all normal, and the urate level was 180 μmol/L. C-reactive protein was elevated to 38.3 mg/dL. X-ray of the left wrist and right knee did not show any juxta-articular erosion or loss of cartilages.
+The patient was empirically treated as gouty arthritis with colchicine for four days without any clinical improvement, and the leukocyte count further increased to 13 700 cells/μL (91% neutrophils). Arthrocentesis of the right knee was performed with 20 mL turbid synovial fluid being aspirated. The total cell count of joint fluid was 14 850 cells/mL, predominantly polymorphs; no crystals were seen. Gram stain of the joint fluid showed regular Gram negative bacilli and became culture-positive after 48 hours of incubation at 37°C in 5% CO2. The organism only grew on 5% horse blood agar but not on chocolate or MacConkey agars, with characteristic pleomorphic filamentous Gram stain morphology and central bulbous swellings arranging into coils upon subculture . It was identified as Streptobacillus moniliformis with compatible biochemical reactions (negative in the oxidase and catalase tests, unable to reduce nitrate to nitrite, and failed to produce indole from tryptophan). Upon further questioning, the patient recalled being bitten by a brown rat five days before the onset of joint pain when she traveled to a village in southern China. A healed wound with hyperpigmentation was noted over the right thumb base, which indicated the site of rat bite . The patient was treated with intravenous ampicillin 1.5 g every six hourly. Her blood culture taken before starting antibiotics remained sterile after seven days of incubation. Due to persistent swelling and tenderness, an open arthrotomy of the left wrist was performed two days after starting antibiotic, which showed acute pyogenic synovitis. The patient was given 21 days of antibiotic. Upon discharge, she was afebrile, and the arthritis resolved completely without any long-term sequalae.
+We searched PubMed (January 1970 to March 2006) for English-language articles that addressed streptobacillary septic arthritis. The keywords "Streptobacillus" and "septic arthritis" were used. Relevant additional cases were included from secondary references. Our reported case was also included in the review. Patient demographics, underlying diseases, types of rat exposure (if any), clinical presentation of the streptobacillary septic arthritis, site(s) of positive cultures, therapeutic interventions and outcome of treatment were recorded for all cases.
+Twelve cases of S. moniliformis septic arthritis are reviewed including the present report and 11 previously published cases [-]. The clinical details of these cases are summarized in the table .
+The mean patient age was 72.0 years (median 72; range 12 to 79 years), and only two cases (16.7%) were under the age of 16 years; the male-to-female ratio was 3:1. Five patients (41.7%) had underlying diseases, with three of them reported to have osteoarthritis. Other underlying illnesses included carcinoma of the breast and chronic alcoholism. Eight patients (66.7%) developed streptobacillary septic arthritis after being bitten by rats, one patient acquired the disease after a rat scratch, and three patients could not recall any exposure or contact with rats or rodents. However, these three cases might still have potential contact with rats as two of them worked in rural areas (one as pig farmer and one as warehouse fork lift operator). The other patient was a chronic alcoholic, which could have exposed to rat bites and scratches when he was drunk. The most common cause for possible rat exposure was occupation (5 cases, 41.7%), followed by keeping of pet rats (3 cases, 25.0%), One patient sustained rat bite when the patient tried to pick up a rat near trashcans bare-handedly. Our patient was bitten by rat when she traveled to village in China.
+Joint pain is the most common clinical presentation of streptobacillary septic arthritis in our series (100%). It is followed by fever in seven cases (58.3%). Two patients also reported to have skin rash, and another two patients had skin pustules (16.7%). Ten out of the twelve patients (83.3%) had polyarticular involvement. The most common joints associated with streptobacillary septic arthritis were the knees in seven patients (58.3%), ankles in six (50%), wrists in five (41.7%), small joints of hands in four (33.3%), elbows in three (25.0%), shoulders in three (25.0%), hips in two (16.7%), and sternoclavicular joint in one (8.3%). All patients had the bacterium isolated from joint fluid aspirate or synovial tissue, but only one of the seven patients with blood cultures taken had simultaneous S. moniliformis bacteremia. Three patients received arthrotomy together with antibiotic treatment. Details of the antibiotic regime was lacking in one. Seven patients received intravenous penicillin G (58.3%). For the remaining four patients, one received ampicillin (our patient), one was treated with nafcillin plus gentamicin, one was given ceftriaxone, and one was treated with flucloxacillin and then vancomycin. The outcome of the disease was good: all patients were cured without any mortality or long-term complication.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1564_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1564_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..70d5e8a9cd4ae099abf663b0008240d429f1b494
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1564_en.txt
@@ -0,0 +1 @@
+A 74-year-old male complained of blurred vision in both eyes because of senile cataract in October 2015. Visual acuities were 6/20 OD and 8/20 OS with a normal intraocular pressure (IOP). Slit-lamp examination revealed mild cortical cataract OU. Fundus findings showed nothing of note. The initial ophthalmologist planned to perform cataract surgery for his right eye. His medical history was prostate hypertrophy, while he had no history of dementia. Viscoelastic materials with high-level cohesion were injected into the anterior chamber to dilate the pupil due to miosis following hydrodissection OD. Severe thermal corneoscleral injury occurred soon after beginning the phacoemulsification. The wound was tightly sutured by pedunculated conjunctiva; however, viscoelastic materials were injected again since the leakage was not suppressed. The next day, he was referred to our hospital. Visual acuity was hand motion and IOP was 3 mm Hg OD. There was marked corneal stromal opacity with intraocular fluid leakage. The scleral wound was found to be opening following conjunctival incision . Since mobility of the sclera was markedly involved, it was impossible to conduct direct suture of the injured sclera. Therefore, the patient underwent transplantation of a donor scleral graft using 10-0 nylon to the burn site . After the transplantation and confirmation of the absence of intraocular fluid leakage, the lens nucleus was extracted from the newly formed wound on the temporal side of the scald. Histologically, the injured sclera showed coagulation necrosis with eosinophilic materials . Attachment of the transplanted sclera was favorable and IOP recovered to normal. Three months after the surgery, macular edema occurred due to intraocular inflammation caused by the remaining lens cortex. Therefore, anterior vitrectomy was conducted leading to the resolution of macular edema, and an intraocular lens was eventually fixed in the ciliary sulcus 7 months later. The visual acuity improved to 2/20 OD with stable IOP and a reduced corneal opacity in October 2016 .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1570_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1570_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..03e297048b59e4c90109c51abb91ab9d15cd46d7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1570_en.txt
@@ -0,0 +1,9 @@
+The proband of this family is a 5-year-old boy from Zhejiang province in China. He developed thickening nails and oral leukokeratosis at birth , and began developing palmoplantar keratoderma at 2 years old. His sister had similar clinical manifestation characterized with thickening nail and discoloration . No abnormalities in the teeth and eyes were noted in the two affected children. There were no unaffected siblings, And the phenotypic features of PC were not found in any other family members including their parents.
+After informed consent, genomic DNA was extracted from the peripheral blood lymphocytes of this family. DNA was also extracted from hair bulbs, buccal smears and sperm cells of the proband’s father and hair bulbs and buccal smears of his mother using a QIAGEN QIAamp Blood Mini kit. This study was approved by the Ethics Committees of Shanghai Jiaotong University School of Medicine and conducted in accordance with the principles of the Declaration of Helsinki.
+KRT6A, KRT6B, KRT6C, KRT16 and KRT17 genes of this family were analyzed by direct sequencing using primers and reaction conditions as previously described. In addition, samples from 100 unrelated population-matched controls were sequenced to exclude the possibility that the variant was a polymorphism in the KRT6A gene (GenBank accession number: NM_005554.3).
+The exome capture were performed using Agilent SureSelect Human All Exon Kits (Agilent, Santa Clara, CA) according to the manufacturer’s instructions. Sequencing was performed on a HiSeq 2000 platform with read lengths of 100 bp. The mean coverage depth for each sample is 100 × . The sequencing reads were described according to NCBI human reference sequence.
+The entire coding and flanking intronic sequences of KRT6A, KRT6B, KRT6C, KRT16 and KRT17 genes were screened for mutations in the two affected children and unaffected parents. A previously reported heterozygous mutation, p.Ile462Asn, was identified in KRT6A in the proband and his sister . This change was not detected in 100 unrelated, healthy Chinese control individuals (200 alleles). Sequence analysis of the four other keratin genes failed to detect sequence variants in either affected or unaffected individuals of the family . This mutation was not identified in the parents, in DNA derived from peripheral blood, hair bulbs or buccal smears . The sperm cells from proband’s father were also wildtype . Since the two affected children harbored the same pathogenic mutation, we postulated that one of the parents was mosaic for this variant WES was performed on the two affected children and their parents. Approximately 5 billion bases were sequenced with coverage of 100 × . Consequently, the variant was detected in one sequencing read from 86 sequencing reads from DNA derived from the mother’s blood . The mutation was not identified in DNA derived from the father’s blood by whole exome sequencing. The frequency of reads was 47% and 49% in proband and his sister, respectively. The results indicated that the mutation in KRT6A may be from maternal mosaicism in this family.
+To confirm the question of somatic mosaicism in the mother, the analysis was performed to quantify the proportion of cells carrying the KRT6A mutation by using SNaPshot (ABI Prism SNaPShot multiplex kit; Applied Biosystems) on an ABI PRISM 3730 genetic analyser according to the manufacturer’s instructions. The proportion of normal and mutant DNA was quantified using GeneMapper software (v4.0; Applied Biosystems). To get mutation ratios of 50%, 25%, 12.5%, 6.25%, 3.13%, and 1.56%, a genomic DNA sample of a heterozygous proband was serially diluted with a sample of a wild-type family member. All experiments were repeated three times.
+SNaPshot analysis revealed substantial mutation-level variation in the two affected children and their parents. SNaPshot sequencing revealed mosaicism at level of 2.5% and 4.7% in DNA from the mother’s blood and hair bulbs . No mosaicism was identified in DNA from buccal smears from mother. A non-mosaic wild-type state was found in the healthy father (Data not shown).
+Besides, we also performed HiSeq deep sequencing. Firstly, We diluted the DNA from the patient’s blood with the DNA from the normal by 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, 1/128 based on gradient dilution method. Making a standard curve. Then, We designed primer detection mutation site KRT6A (NM_005554.3) c.1385T > A; p.Ile462Asn. (F:TTCCTCTTCCAGTGCGCCAA; R:AGCTGTTGAAGGAGKT CGTGT) And synthesizing fusion primer. (F1:ACACGACGCTCTTCCGATCTT TCCTCTTCCAGTGCGCCAA; R1:TTCCTTGGCACCCGAGAATTCCAAGCTG TTGAAGGAGKTCGTGT) Next step, We carried out the first round PCR. (3min96°C; 15 cycles of 30 s 96 °C; 30 s 60 °C; 30 s 72 °C. End with 5 min incubation at 72 °C; pause at 10 °C.) And the second round were carried out after screened and purified. (NNNNNN was used to distinguish between different samples. F2:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACA CGACGCTCTTCCGATCT; R2-x:CAAGCAGAAGACGGCATACGAGATNNN NNNGTGACTGGAGTTCCTTGGCAC CCGAGAAT) (3min96°C; 10 cycles of 15 s 96 °C; 30 s 60 °C; 30 s 72 °C. End with 5 min incubation at 72 °C; pause at 10 °C.) In the end, Sequencing the PCR products from last step after purified by Illumina Hiseq. And analyzing the number of T and A at the site to be tested in the total read length of each sample.
+We sequencing the DNA sample from patient’s younger sister and parents in the same method. Calculating by Y = 1.0007x − 0.0036 as Table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1581_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1581_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3ad3a599e2eb96aa13d91d09727e82416fb7c852
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1581_en.txt
@@ -0,0 +1,3 @@
+A 72-year-old Caucasian man with a history of prostate cancer, central serous retinopathy, obstructive sleep apnea, type 2 diabetes mellitus, hypertension, and mild chronic obstructive pulmonary disease but no known coronary artery disease or history of neurologic disorders was first diagnosed with left lower lobe non-small cell lung cancer (NSCLC) in 2013, for which he underwent a left lower lobectomy that same year. On surveillance imaging in 2014, he was noted to have a right lower lobe nodule and was diagnosed with a second primary NSCLC, for which he underwent stereotactic body radiation therapy (SBRT). In 2017, he was noted to have an enlarging left upper lobe nodule that was treated with SBRT. Surveillance CT imaging in September 2018 was significant for an enlarging right upper lobe nodule with right paratracheal lymph node involvement. Subsequent positron emission tomography (PET)-CT revealed several FDG-avid mediastinal and right hilar nodes concerning for malignancy. Metastatic bronchogenic adenocarcinoma was confirmed via endobronchial ultrasound with transbronchial needle aspiration, with pathology showing 5/5 positive lymph nodes. PD-L1 immunohistochemistry 22C3 (Keytruda) testing of the lymph node revealed high PD-L1 expression with 80% tumor proportion score. MRI of the brain was negative for intracranial metastatic disease. He was diagnosed with TxN3M0 stage IIIB adenocarcinoma and was treated with six cycles of weekly cisplatin and SBRT. He then initiated adjuvant durvalumab for maintenance therapy, receiving two cycles (10 mg/kg) on treatment days 0 and 15. Our patient subsequently presented to the emergency department on day 18 with a 4-day history of shortness of breath, weakness, and chest pressure. Workup on admission was significant for lateral lead ST elevations with an initial troponin of 7.1 ng/dL. He emergently underwent a left heart catheterization, which was negative for obstructive coronary artery disease. Transthoracic echocardiogram was significant for a normal ejection fraction with mild left ventricular concentric hypertrophy.
+Admission diagnosis was myopericarditis of unclear etiology. On hospital day 4, he was noted to have persistently elevated levels of serum troponin, peaking at 12 ng/mL. His levels of serum creatinine kinase (CK) were elevated as well, peaking at 9262 U/L. He had persistent mild hepatocellular transaminitis (peak AST 72, ALT 531). The use of corticosteroids was discussed with the patient owing to concern for irAE; however the patient declined on the basis of his central serous retinopathy. He was noted to have dysphagia on admission with regurgitation of solids and liquids. A barium swallow study and esophagogastroduodenoscopy on hospital day 3 did not reveal any structural abnormalities. On hospital day 9, the patient developed progressive axial weakness, with increasing difficulty holding his head upright while seated. Neurology was consulted, who had a high concern for myasthenic crisis, which was subsequently confirmed by decreased negative inspiratory forces and elevated acetylcholine receptor binding and blocking antibodies. Due to his declining respiratory status, he was transferred to the intensive care unit (ICU) and intubated on the same day for airway protection. MRI of the brain performed on hospital day 10 was significant for 12 new metastatic lesions with surrounding vasogenic edema. The patient was started on high-dose corticosteroids at 1 mg/kg/day and underwent plasmapheresis on hospital day 10, completing 5 rounds. Unfortunately, he was unable to be weaned from mechanical ventilation and required tracheostomy placement as well as percutaneous endoscopic gastrostomy nutrition.
+After multiple goals-of-care discussions, the patient was transferred from the ICU to a long-term acute care facility owing to mechanical ventilation dependence, on hospital day 36. Diagnoses of myopericarditis, myositis, and myasthenic crisis were attributed to immune-mediated response to durvalumab.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1598_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1598_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e980b99c0286b047d8a14c7454098646f7e639e9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1598_en.txt
@@ -0,0 +1,4 @@
+A 76-year-old female patient was diagnosed with a left polycystic VS Koos grade D in the cerebellopontine angle in 2011 [Figure and ]. The patient suffered from severe hearing loss, which was also the presenting symptom. Because of advanced age and serious cardiovascular comorbidity, a wait and scan policy was followed.
+The medical history of the patient included hypertension, hypercholesterolemia, thrombosis of the right carotid artery, acute myocardial infarction, total knee replacement, thoracic and lumbar fractures, diabetic retinopathy, aortic valve replacement, coronary artery bypass surgery, and postoperative arterial fibrillation. The patient used an extensive list of medications, which included anti-coagulants.
+The VS remained stable on follow-up. In May 2016, the patient presented with a severe headache and a facial palsy House and Brackmann (HB) grade 5. Computerized tomography (CT) scan showed an ITH . The patient was then hospitalized in a peripheral hospital. The anti-coagulant therapy was stopped accordingly. After a couple of days, the facial palsy improved to a HB grade 3 and the patient was discharged. However, 1 week later, the partial facial palsy progressed to a HB grade 6. The CT scan revealed a second hemorrhage in the tumor . The patient was then referred to the Maastricht University Medical Centre for treatment. Neurological examination upon arrival revealed an optimal EMV score with a facial palsy HB grade 6. Other cranial nerves were intact. A few days later, the patient deteriorated to a score of E3M6V3. The CT scan showed another bleeding resulting in a strong mass effect on the brainstem . In addition, there was a bilateral dilation of the lateral ventricles and the third ventricle consistent with hydrocephalus. An emergency retrosigmoid approach was employed to evacuate the hematoma and resect the VS as much as possible. In addition to these measures, an occipital external ventricular drainage was applied. During surgery, the tumor appeared very necrotic. One day following surgery, the patient recovered to an optimal EMV score. Approximately 36 hours after surgery, the patient deteriorated rapidly. A CT scan showed another hemorrhage in the same area, however, more directed toward the brainstem . Unfortunately, the condition of the patient worsened quickly and the patient deceased.
+Histopathological examination confirmed the diagnosis of VS. Furthermore, it showed an extensive hemorrhage with small focal fragments of fusiform proliferation and thick-walled dilated blood vessels. Immunological examination showed a positive S100 and a low mitotic activity (MIB1) in tumor areas. Glial fibrillary acidic protein (GFAP) staining was negative. The tumor area showed inflammation and contained eosinophil cytoplasm with elongated nuclei.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1612_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1612_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..42da73c70e56b48d130f31bcdebfb1a68c18dd72
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1612_en.txt
@@ -0,0 +1,5 @@
+A 40-year-old female presenting with mild hepatic dysfunction was referred to our hospital. She did not smoke but had a drinking habit. At age 28 years, she had presented with elevated platelet counts (> 100 × 104/μL); ET had been diagnosed based on bone marrow biopsy results. She was prescribed aspirin (100 mg/day) and anagrelide (2.5 mg/day). She had also been prescribed ebastine for itching a while ago.
+On admission to our hospital, laboratory examination revealed slightly elevated alanine aminotransferase (ALT) levels (82 IU/L), although the patient’s ALT level had improved from that recorded previously. Her platelet count was slightly elevated (62.4 × 104/μL). Prothrombin time and activated partial thromboplastin time were normal. Abdominal ultrasonography revealed a cecal tumor. Colonoscopy revealed advanced cecal cancer . Computed tomography (CT) indicated cecal wall thickening .
+The patient recovered from liver dysfunction without treatment. She stopped taking oral aspirin 1 week prior to surgery but continued anagrelide until the day before surgery. To prevent thrombosis, she wore elastic stockings; furthermore, intermittent pneumatic compression was performed during surgery. Laparoscopic-assisted ileocecal resection was performed. We used a soft coagulation system to achieve complete hemostasis. The operative duration was 202 min; blood loss was 34 mL.
+From the first postoperative day, the patient started walking, drinking water, and resumed oral anagrelide intake. She resumed oral aspirin intake on the fifth postoperative day. Her perioperative platelet count was controlled to approximately 40–60 × 104/μL . Prothrombin time and activated partial thromboplastin time also did not show abnormal values during the perioperative period. The postoperative course was uneventful and she was discharged on the seventh postoperative day.
+The tumor pathological stage was T3N1M0 (Stage IIIB). The patient received intravenous oxaliplatin plus oral capecitabine (CapeOX) as postoperative adjuvant chemotherapy (oxaliplatin 130 mg/m2, capecitabine 1000 mg/m2). However, after one course, she again experienced liver dysfunction (aspartate aminotransferase [AST] level, 388 IU/L; ALT level, 531 IU/L); because of anagrelide, her platelet count decreased to 17.8 × 104/μL. Therefore, we asked her to discontinue anagrelide and aspirin that day onwards; 5 days later, her platelet count recovered to 50 × 104/μL. Subsequently, she resumed taking anagrelide and aspirin; however, she refused to resume any adjuvant chemotherapy after this incident. Her liver function normalized gradually in 4 months. There were no clinical signs of thrombosis, and there was no appearance of a new thrombus on contrast-enhanced CT 6 months after the operation. One-year post operation, she is well without tumor recurrence or new metastasis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1614_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1614_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..633bb9a7cc098d23dd8afca126b3cc77184dd08d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1614_en.txt
@@ -0,0 +1,4 @@
+A 40-year-old man with a history of MLS in the right thigh was treated with wide excision at our hospital . At the time of diagnosis, he had no distant metastasis. Histological findings of the resected specimen revealed a round cell component of 10% and a negative margin . Adjuvant chemotherapy with four cycles of doxorubicin (70 mg/m2, every 3 weeks) was administered.
+Two years after the surgery for the primary tumor, follow-up chest computed tomography (CT) showed a low-density area in the left ventricle. The patient was then asymptomatic. Contrast-enhanced CT showed a mass, measuring 4 cm × 2 cm in the left ventricle . Transthoracic echocardiography also identified the mass in the left ventricle, which was suggestive of a neoplasm . Clinical images revealed no evidence of local recurrence or distant metastasis other than the cardiac mass at that time. Given the risk of valve obstruction, he was immediately admitted to our hospital for cardiovascular surgery. On magnetic resonance imaging (MRI), the left ventricular tumor showed a lower-signal intensity than that of skeletal muscle on T1-weighted images, higher-signal intensity on T2-weighted images, and slight enhancement with a contrast agent . Considering the clinical course, the mass was regarded as a metastasis of MLS. He underwent surgical excision of the lesion in the left ventricle. Intraoperatively, we found a reddish-white tumor arising from the papillary muscle without invasion of the interventricular septum. Histopathological examination of the specimen showed a mixture of oval non-lipogenic cells and small signet ring lipoblasts in a prominent myxoid stroma, which was consistent with the findings of the primary tumor in the thigh. However, the proportion of round cell component in the ventricular specimen was increased compared with that in the specimen of the primary tumor . A negative margin was histologically confirmed in the ventricular specimen.
+Six months later, he complained of back pain and developed metastatic disease in the sixth thoracic vertebra. Conventional radiotherapy was administered to the spine lesion, which was delivered as 50 Gy in 25 fractions.
+Fifteen months after the cardiac metastasectomy, he presented slight dyspnea on effort. Contrast-enhanced CT showed a tumor in the right atrium involving the atrium septum . Our cardiovascular surgeons decided that the lesion was not amenable to complete excision with an adequate margin. The patient was treated with surgical excision of the tumor with R2 margin (macroscopically evident margin positivity) . The histological findings of the specimen indicated MLS with hypercellular lesions with a round cell component of about 30%, which represented progression compared to that of the left ventricular specimen at the first cardiac metastasectomy . Radiotherapy of 50 Gy in 25 fractions was performed for the residual disease of the right atrium and atrial septum postoperatively. His ejection fraction evaluated with echocardiography after the second cardiac metastasectomy remained 40%, and he could perform his daily activities without difficulty. There was no recurrence in the heart after the second cardiac metastasectomy, although multiple metastases occurred in the abdominal cavity, lungs, and muscles. Despite palliative chemotherapy with trabectedin and eribulin, he finally died of the disease 2 years after the second cardiac metastasectomy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1620_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1620_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6be66e41585b850e234f7467a607907a280ab631
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1620_en.txt
@@ -0,0 +1,7 @@
+A 62-year-old female presented the outpatient department of our hospital with the symptoms of stomachache, frequent micturition, and urination pain.
+Patient’s symptoms started 20 days ago, She had no symptoms such as lumbago, dizziness, headache, palpitation, chest tightness, nausea, vomiting, fever, chills, or other symptoms.
+The patient was diagnosed with high blood pressure 1 year ago, administered Amlodipine besylate tablets 5 mg po qd occasionally, did not check blood pressure; terminal gross hematuria was observed once 4 months ago, the symptom disappeared, and no treatment was administered; denied any tumor observation in the family history.
+After hospitalization, the patient’s temperature was 36.5 ℃, 80 pulses/min, 20 breathing times/min, blood pressure was 159/108 mmHg and oxygen saturation in room air was 98%. no bulge, pressure pain or percussion pain in either of the kidney area; no pressure or percussion pain in both ways of the ureteral region; no bulge in the bladder area but light pressure-induced pain.
+Fasting venous blood glucose was 8.34 mmol/L, and other indexes were normal. Chest X-ray showed mild interstitial changes in both lungs, ECG: 102 times/min. Color ultrasound of the urinary system showed a 38 mm × 34 mm hypoechoic mass on the right side of the bladder with an uneven surface and a large bottom; multiple strong echo masses were observed. CDFI: in the masses, blood supply was sufficient. Cystoscope showed bladder occupying lesion . Biopsy diagnosis: papillary polypoid cystitis was suspected as a malignant change . Computer tomography urography(CTU) considered bladder cancer .
+Cystoscopy and biopsy failed to define the nature of the lesions. the urethral bladder tumor biopsy was performed. During the operation, the right bladder wall adjacent to the neck of the bladder showed vegetations with a size of about 4.5 cm × 4.5 cm, with a broad base, easy bleeding, and local surface tissue ulceration. The tumor was found to be hard and calcified during electrotomy. The histopathological studies revealed a large number of tumor cells proliferated with abundant cytoplasm, tumor cells were arranged in small nests or strips, and the blood sinusoids between tumor cells were abundant . The immunohistochemical study was positive for the expression for CD56, chromogranin A, neuron specific enolase and synaptophysin. Immunostaining for the polyclonal S-100 protein showed a sustentacular pattern, thereby confirming paraganglioma. Therefore, another operation was needed. The patient regularly administered phenoxybenzamine 10 mg po tid and metformin tablets 0.5 g po tid for 2 weeks. Before the operation, laboratory workup revealed elevated plasma renin activity to 8642.76 pg/mL, elevated angiotensin I to 16113.5 pg/mL, and an elevated angiotensin II level of 252.91 pg/mL. Partial resection of the bladder was conducted, and the focus was removed. After the operation, the patient stopped using phenoxybenzamine and continued with metformin tablets. Consecutively, blood pressure and blood sugar were monitored. the plasma renin activity, angiotensin I and angiotensin II were within normal range (56.83 pg/mL, 447.46 pg/mL, 79.04 pg/mL, respectively). When the patient was ready to leave the hospital, her blood pressure was 128/86 mmHg, the blood sugar was 7.0–9.4 mmol/L, and the symptoms had improved.
+Three and six months after the operation, no discomfort was reported. Blood sugar and blood pressure were at normal levels. No obvious abnormality was detected by cystoscopy. However, The patient was advised regular reexamination and lifelong follow-up, with respect to blood pressure, blood glucose, urinary catecholamine, ultrasound, CT, and cystoscopy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1626_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1626_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fa426df313fbfbb3fb7ef63313e8e1049bd9beaa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1626_en.txt
@@ -0,0 +1,9 @@
+The case in question concerns a 64-year-old Caucasian postmenopausal woman presenting with pain, abdominal distension, and an altered intestinal transit.
+Thoracic and abdominopelvic computed tomography (CT) scans revealed massive peritoneal carcinomatosis, extensive ascites, involvement of the major omentum, extensive involvement small intestine mesentery, diffuse involvement of the parietal peritoneum, implants at the bottom of the Douglas pouch, and probable implants on the ovarian surface, although of normal size . Her plasma CA-125 tumour marker levels were 1,110.9 U/mL, and those of the remaining tumour markers fell within a normal range. An omentum biopsy was compatible with high-grade serous carcinoma, with positive expression for WT-1, p53, CK-7 and negative expression for CK20 and TTF-1, with tube-ovarian-peritoneal origin.
+Given the confirmed diagnosis of a primary peritoneal carcinoma of gynaecological origin stage IIIC and after assessment by a multidisciplinary committee that considers unresectable disease due to mesenteric involvement, neoadjuvant chemotherapy with intravenous (i.v.) paclitaxel 175 mg/m2 and i.v. carboplatin AUC 6 at three-week intervals was prescribed. The patient received three cycles of this treatment, showing a significant partial response on the follow-up CT scans, and plasma CA-125 tumour marker levels of 65 U/mL (levels at diagnosis: 1110.9 U/mL).
+Surgery was subsequently performed, achieving optimal cytoreduction, and the patient had a catheter placed for the administration of the intraperitoneal chemotherapy. The pathological study of all samples obtained during the procedure revealed a high-grade serous carcinoma.
+Following the intervention, a total of four cycles of adjuvant intraperitoneal (i.p.) chemotherapy consisting of i.v. paclitaxel 175 mg/m2 (day 1), i.p. cisplatin 75 mg/m2 (day 2), and i.p. paclitaxel 60 mg/m2 (day 8) were administered. The patient achieved a complete response, although she developed grade-2 asthenia and grade-3 neutropenia due to treatment-related toxicity that mandated a delay in the dosing and support with granulocyte-colony stimulating factors (G-CSFs).
+Seven months after receiving the last cycle of platinum-based chemotherapy, her CA-125 tumour marker levels were 104 U/mL, and mediastinal lymph node and peritoneal recurrence were identified in the follow-up CT scans. At this time, a germline mutation study was carried out in BRCA, being negative. Given that these findings were considered to be indicative of progression after a PFI of seven months, second-line chemotherapy was started with i.v. trabectedin 1.1 mg/m2 (day 1) in combination with i.v. PLD 30 mg/m2 (day 1) at 21-day cycles. The patient achieved a partial response after the third cycle (CA-125: 11.8 U/mL) .
+Chemotherapy with trabectedin and PLD was continued; however, given that the patient experienced haematological toxicity (grade-4 neutropenia), the dose of PLD had to be reduced to 25 mg/m2 and that of trabectedin to 0.9 mg/m2 during the sixth cycle. PLD was subsequently discontinued altogether due to the onset of toxicity associated with this drug (grade-2 mucositis and grade-3 asthenia). From then on, she received i.v. trabectedin 0.9 mg/m2 in monotherapy at 21-day cycles, with good tolerance and referring only grade-1 asthenia that resolved within two to three days and did not limit her during her basic activities of daily living.
+After ten cycles of treatment, and specifically four cycles of trabectedin in monotherapy, the dose of trabectedin had to be reduced to 0.75 mg/m2 every 21 days due to the onset of grade-3 neutropenia and grade-2 thrombopenia, which mandated frequent delays in the dosing and even G-CSF support. Nevertheless, the subsequent follow-up CT scans performed periodically continued to show evidence of complete response. The patient received a total of 35 cycles of trabectedin (six in combination with PLD and then 29 in monotherapy). During this time, she maintained an excellent quality of life, experiencing no late or cumulative toxicity, and being able to perform her usual activities.
+Because peritoneal progression was subsequently detected after a PFI of three years, a third line of treatment with i.v. carboplatin (area under the curve [AUC] = 4) (day 1), i.v. gemcitabine 1,000 mg/m2 (days 1 and 8 of every 21-day cycle), and i.v bevacizumab 15 mg/kg (day 1) was started. A subsequent follow-up CT scan carried out after the third cycle of this therapy showed signs of partial response. Given that the response persisted after six treatment cycles, chemotherapy was suspended and treatment with bevacizumab in monotherapy was started. The patient has received a total of 12 cycles of maintenance treatment with bevacizumab in monotherapy to date, having tolerated the treatment well and maintained a partial response.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1645_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1645_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..42084afc22de743fe13034ba402e18727be0c993
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1645_en.txt
@@ -0,0 +1,8 @@
+A 63-year-old woman found a mass in the superior lateral quadrant of the left breast, with no obvious discomfort, and she paid no attention to it.
+During the next 2 years, the left breast mass gradually increased in size and was painful. She developed discomfort in the left upper limb and visited a local hospital many times (without an examination report). Surgical treatment was suggested, but the patient refused.
+The patient had a free previous medical history.
+The patient has a history of good health, and there is no similar patient in the family members.
+Physical examination showed that the skin in the outer upper quadrant of the left mammary gland was obviously sunken, and a hard mass about 5 cm × 6 cm, with an unclear boundary, irregular shape, and poor activity was found on palpation. No obvious enlarged lymph nodes were found in the axilla.
+No abnormalities were found in the patient's laboratory examinations.
+Ultrasound showed a solid hypoechoic mass approximately 3.5 cm × 5.3 cm × 4.5 cm in size at the margin of the gland at 12-3 o'clock in the superior lateral quadrant of the left breast, and several hypoechoic lymph nodes of different sizes were detected in the left axilla. The largest lymph node was about 0.6 cm × 0.6 cm, and the lymphatic hilum structure had disappeared. No abnormalities were found in the right breast. Therefore, chest computed tomography (CT) scanning was performed, and the left breast mass was diagnosed as breast cancer, with no abnormalities in the lungs. Other results, including abdominal ultrasound, bone scan, and laboratory examinations, showed no abnormalities. There was no family history in genetic disorders.
+The patient underwent core needle biopsy of the left breast mass under ultrasound guidance, and the histopathological diagnosis was apocrine carcinoma. Immunohistochemical analysis showed negative expression of ER and progesterone receptor (PR), but positive expression of HER2 and AR (approximately 60%); gross cystic disease fluid protein 15 (GCDFP-15) was also positive .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1650_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1650_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e4c86466c7b34726a1b10cc7492f94889a76708c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1650_en.txt
@@ -0,0 +1,2 @@
+A 37-year-old woman presented at the emergency department (ED) with exertional dyspnoea New York Class Association (NYHA) functional classes II and III, syncope, and new onset of T-wave inversions in the ECG . She presented in a clinically stable condition with a blood pressure of 130/80 mmHg, a pulse of 90/min, and an oxygen saturation of 96%. The clinical examination was unremarkable. Her only significant medical history was Crohn’s disease, which had been well controlled with adalimumab for 3 years. Computed tomography (CT) ruled out a pulmonary embolism and parenchymal lung disease . The transthoracic echocardiographic (TTE) findings were consistent with a cor pulmonale without signs of an intracardiac shunt or a left ventricular (LV) pathology (see , ). Right heart catheterization proved a precapillary PH with a negative vasoreactivity testing (mPAP 33 mmHg, pulmonary vascular resistance 4.8 WU, pulmonary arterial wedge pressure 7 mmHg, and central venous pressure 4 mmHg). Perfusion–ventilation scintigraphy displays small peripheral perfusion defects .
+The presence of peripheral perfusion defects in scintigraphy was initially interpreted as possible chronic thromboembolic PH, and anticoagulation with heparin was started. However, the findings were later interpreted as in context of PH Group 1. Therefore, a PH specific therapy with macitentan and tadalafil was initiated under the continuation of heparin. The short-term course was then complicated by a heparin-induced thrombocytopenia (HIT) that was confirmed by a positive antibody test (HIT antibodies: IgG 6.96 U/mL) with otherwise normal coagulation parameters. Shortly thereafter, an episode of haematemesis occurred, and gastroscopy revealed a gastric adenocarcinoma. An escape chemotherapy regimen was launched before completion of tumour staging. Staging CT revealed subpleural nodular ground glass opacities with ‘feeding vessel sign’ compatible with PH but no metastatic spread of gastric cancer . Consequently, oncologic treatment was changed to a neoadjuvant chemotherapy and subsequent gastrectomy. The patient’s symptoms improved shortly after the first administration of chemotherapy and resolved completely within 2 months. Retrospectively, we considered a pulmonary tumour thrombotic microangiopathy (PTTM) the most probable cause of PH. Follow-up after successful oncologic treatment and cumulative 10 months of specific PH medication showed an excellent clinical response; hence, specific PH therapy was ceased (see , ; ). A subsequently performed RHC confirmed complete remission of PH at rest (mPAP 17 mmHg, pulmonary vascular resistance 1.6 WU, pulmonary arterial wedge pressure 9 mmHg, and central venous pressure 5 mmHg).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1652_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1652_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6003911122c8fcd74ebd010df875a2c771be0ac7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1652_en.txt
@@ -0,0 +1,2 @@
+A healthy 10-year-old male patient presented to the Department of Pediatric and Preventive Dentistry, M.S. Ramaiah Faculty of Dental Sciences, Bengaluru, Karnataka, India, for routine dental care. Oral examination revealed mixed dentition, with deficient space for eruption of second premolar teeth ( and ). The treatment planned was distalization of maxillary first permanent molars by intra-arch pendulum appliance developed by Hilgers. Both the maxillary first permanent molars and first premolars were banded and impression of maxillary arch was made. The pendulum appliance design consisted of anterior acrylic nance portion with two posteriorly extending TMA coil springs made of 0.032". The plane of the coil springs should be parallel to the maxillary plane; the extensions of TMA wire are then soldered to the molar and premolar bands . The appliance was cemented onto the molars and premolars. The appliance was activated extraorally and was cemented. The appliance was monitored at monthly intervals and the appliance was removed for reactivation and recementation.
+At the end of 4th month sufficient space was regained and second premolars started erupting into the space gained. At 7th month with the complete eruption of premolars and canines proper maxillary arch alignment was achieved ( and ). The results of this case study have shown that the pendulum appliance is an effective and reliable method for distalization of maxillary molar teeth.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1660_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1660_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1c41845c820a7d9e0256093708c6b1b589d23e28
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1660_en.txt
@@ -0,0 +1,4 @@
+A 28-year-old female with no significant past medical history was apparently healthy until presenting to the emergency department with 1 week of worsening diffuse abdominal pain. Her intermittent pain had suddenly worsened over night which prompted her hospital visit. This sudden escalation in pain was also accompanied with multiple episodes of vomiting. She had been constipated with no bowel movement for the entire week prior to presenting to the hospital. The patient stated to have a well-balanced diet and live an active lifestyle for most of her life.
+Upon physical examination, the patient was in serious distress due to pain. Her vital signs were within normal limits. Her abdomen was very tender to palpations in all four quadrants. Rebound tenderness was also present. These signs and symptoms were of major concern, as they pointed towards the patient having developed peritonitis. A computed tomography (CT) of the abdomen and pelvis was conducted and was highly suggestive of a sigmoid colon volvulus. The CT showed a largely dilated colon with a pathognomonic “whirl” pattern present (see Fig. ).
+Clinical suspicion for potential bowel necrosis was high given the patient’s peritoneal signs and sudden worsening of symptoms. Therefore, the patient underwent an emergent laparotomy. A sigmoidectomy of the distended portion of bowel was performed (see Fig. ). The remaining proximal and distal ends were inspected to be clean and a primary anastomotic continuity of the bowel was created. Intra-operatively, we noted an abnormally redundant sigmoid colonic mesentery.
+The pathology report of the resected specimen revealed necrotic bowel with evidence of ischemic changes and focal ulcerations. Ischemic changes seen on microscopy included mucosal sloughing, mucosal hemorrhages, and fibrin deposition (see Fig. ). The patient recovered without complication with return to enteral nutrition and resumed bowel function. She was subsequently discharged on post operative day number five.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1668_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1668_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..be981ed1f7349610529e45b6ccc714d12a83a0db
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1668_en.txt
@@ -0,0 +1,6 @@
+A 41-year-old Malay gentleman who works as a hospital porter presented with a long-standing history of left plantar heel pain.
+His gastrocnemius was also noted to be tight with positive Silfverskiöld test. He was treated for plantar fasciitis and tight gastrocnemius and underwent extensive physiotherapy sessions targeted at gastrocnemius stretching. He was started on anti-inflammatory and analgesic medications. However, his symptoms persisted, and he underwent left gastrocnemius release and endoscopic plantar fascia release. This provided temporal relief of his symptoms, and he was able to return to work.
+Two and half years later, he presented with similar symptoms of left heel pain. His gastrocnemius was once again assessed to be tight demonstrating limited dorsiflexion in the absence of ankle osteoarthritis. A repeated minimally invasive gastrocnemius release was performed. He underwent a prolonged recovery with enforced rest and time off work, which improved his symptoms. However, his symptoms quickly reoccurred upon return to work.
+He is obese (BMI: 31 kg/m2), has hyperlipidaemia but reports no history of diabetes or gout.
+Patient ambulated with an antalgic gait. On physical assessment, his gastrocnemius remained tight with a positive Silfverskiöld test. Tenderness around the plantar aspect of the calcaneum was non-specific and found along the distribution of the plantar fascia insertion.
+Foot and calcaneal radiographs showed normal bony relationships of the foot with no features of arthritis . No fractures or obvious lesions were noted. Magnetic resonance imaging (MRI) of the left foot was performed. It reported the absence of plantar fascia thickening as well as no signal alteration in the adjacent soft tissue or bone marrow. MRI did reveal a pedunculated bony protrusion arising from the posterolateral plantar aspect of the calcaneus measuring 1.1 cm × 0.9 cm, which was consistent with an osteochondroma . Computed tomography scan was organised to better evaluate this lesion .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1669_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1669_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b4c99a0cdd1e7596bde34178d95dae3513cdb0f6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1669_en.txt
@@ -0,0 +1,10 @@
+A 29-year-old woman with stage I grade 1 endometrioid endometrial carcinoma presented with lung metastasis.
+In 2015, the patient experienced abnormal vaginal bleeding. Her BMI was 20.3 kg/m2. G2P1+1. Ultrasound examination revealed a 3+cm mass in the uterine cavity. In February 2015, she underwent curettage and was diagnosed with FIGO grade 1 endometrioid carcinoma. Magnetic resonance imaging suggested the possibility of cervical invasion. Thoracic computed tomography (CT) was negative. She subsequently underwent comprehensive cancer staging including laparoscopic radical hysterectomy, bilateral salpingo-oophorectomy, pelvic and para-aortic lymphadenectomy, with pelvic washing. Postoperative pathological examinations showed the followings: FIGO grade 1 endometrioid adenocarcinoma infiltrating the superficial muscle layer, and no lymphovascular space invasion. The ovaries and fallopian tubes showed no malignancy. Left and right pelvic and para-aortic lymph nodes showed no evidence of malignancy in 26 examined nodes. Peritoneal cytology was negative. A diagnosis of FIGO (2018) stage I endometrioid adenocarcinoma was made. Immunohistochemical (IHC) staining showed that the tumor tissue had a high expression of estrogen receptors (ERs) and progesterone receptors (PRs) and normal DNA mismatch repair (MMR) protein expression . IHC staining for p53 showed a wild-type pattern . Notably, clustered nuclear staining of β-catenin was detected . A postoperative CT scan of the chest, abdomen and pelvis was negative. According to the NCCN Guidelines at that time, the patient did not receive adjuvant therapy. The patient was followed up regularly in another hospital. In June 2019, she returned to our hospital with an irregular cough without apparent cause. A pulmonary CT scan showed multiple high-density pulmonary nodules in the anterior basal region of the right lower lobe and right middle lobe of the lung, indicating metastatic tumors . She then underwent thoracoscopic resection of the affected lobes. IHC confirmed an FIGO grade 1 endometrioid adenocarcinoma infiltrating the lung tissue. The patient was then treated with six cycles of combined chemotherapy of paclitaxel and carboplatin. Combined with the computed tomography scan result and the cancer antigen 125, complete remission following treatment was confirmed. The patient was followed up regularly for 18 months after completing chemotherapy, and no tumor recurrence occurred during this period.
+The patient denied a history of systematic diseases and a history of smoking.
+The patient denied a personal and family history of related diseases.
+There was no physical examination.
+Routine blood test, liver and kidney function, and tumor markers like cancer antigen 125 (CA125), cancer antigen 199 (CA199), carcinoembryonic antigen(CEA), alpha-fetoprotein (AFP) were normal.
+A pulmonary CT scan showed multiple high-density pulmonary nodules in the anterior basal region of the right lower lobe and right middle lobe of the lung, indicating metastatic tumors .
+To gain further insight into the driver gene mutation mediating metastasis, targeted next-generation sequencing (NGS) of 688 cancer-related genes was performed on both primary tumor and lung metastasis specimens (Supplementary Table ). DNA was extracted from the paraffin-embedded specimens and blood samples from the patient to evaluate somatic and germline mutations, respectively. The variant frequency for each sample was calculated as the percent variant reads from total reads. The data showed that there was no germline mutation in this patient. Somatic mutations of 44 genes were detected in primary tumor samples. Mutations of PTEN (p.P248Lfs*8), CTNNB1 (p.D32A), BCOR (p.N1425S) and CBL (p.S439N) were detected in the lung metastasis, which were shared by primary tumors . Exonic sequence data across all genes showed no MMR deficiency signature, ultramutated phenotype in POLE or TP53 mutation for both primary and metastatic tumors . According to genomic classification, the patient belonged to the CN-low group.
+IHC of the postoperative sample after primary surgery revealed the following: ER + + + , PR + + + , β-catenin + + + , PTEN + + , P53-, and Ki67 25% . The expressions of four MMR proteins (MSH2, MLH1, MSH6 and PMS2) were retained in primary and metastatic tumor tissues, suggestive of microsatellite stable carcinoma, which was consistent with the NGS results . IHC of pulmonary metastatic lesion was as follws: Napsin-A (-), TTF-1 (-), PAX-8 ( +), Ck7 (-), ER (+ +), and PR (+ + +).We evaluated β-catenin by IHC in primary and metastatic tumors, and found clustered nuclear location of β-catenin in both the primary tumor and lung metastatic tumor , indicating high β-catenin activity.
+Screening of gene mutations in endometrioid carcinoma was performed using the TCGA. The results showed that there are 130 mutations of CTNNB1 in 399 cases of endometrioid adenocarcinoma, including 2 cases with mutation of D32A.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1688_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1688_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..728172df3b7c30c920d5639c07538f71a1636e39
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1688_en.txt
@@ -0,0 +1,4 @@
+In September 2011 a 51-year-old Caucasian woman with a history of psoriasis and type-2 diabetes mellitus developed a mild psoriasis together with dactylitis affecting the right fourth finger and arthritis of the fourth metacarpophalangeal (MCP) joint of the right hand. In November 2011 she was referred our outpatient clinic. Dactylitis of the fourth finger of the right hand and swelling, redness and pain of the distal interphalangeal (DIP) joint of the second digit of the right hand were noted during the physical examination. Laboratory results at that time included: Erythrocyte sedimentation rate (ESR) = 100 mm/h (normal range 0–39 mm/h), C-reactive protein (CRP) = 3.99 mg/l (normal range 0–6 mg/l), gamma-glutamyltransferase (γGT) = 237 IU/l (normal range 3–45 IU/ml), and alkaline phosphatase (ALP) = 201 IU/l (normal range 53–141 IU/ml). The patient was treated with methylprednisolone for 6 months; treatment was started with doses of 16 mg/die that were tapered to 4 mg/die. She also received 15 mg weekly oral Methotrexate (MTX) for 6 months beginning in May 2012 with poor results. In March 2012, hand X-rays uncovered periostitis of the proximal phalanx of the right fourth digit; ultrasound (US) and powerdoppler evaluation revealed flexor tenosynovitis of the fourth finger of the right hand and a small erosion in the head of the fourth MCF of the right hand. An US-guided corticosteroid injection of the tendon sheath was adminstered.
+In April 2012 the patient presented to the Gastroenterology Unit of the University of Padova Medical Centre. Biochemical testing confirmed abnormal cholestatic patterns that had been persisting since 2009 (γGT 229 IU/ml and ALP 201 IU/ml). At that time the patient showed: antimitochondrial antibody (AMA) positivity in immunofluorescence with a 1:160 titre, immunoblotting positivity for M2, 3E and anti pg 210, total serum cholesterol = 240 mg/dl (range ≤ 200 mg/dl), serum IgM = 7.31 g/L (range 0.4–2.38 g/L), normal transaminases, negative hepatitis B and C serum markers. The patient showed no symptom of cholestasis; the liver and spleen were not palpable. A liver biopsy, which was performed in May 2012, showed marked fibrosis of the portal tracts extending to the parenchyma, interface hepatitis, and a vanishing bile duct picture with the remaining ducts showing regressive alterations of cholangiocytes together with biliary metaplasia. The histological picture was compatible with stage III PBC. Ursodeoxycholic acid (UDCA), which was begun in April 2012 at 10 mg/Kg/day, was later increased to 15 mg/Kg/day; a partial reduction in γGT and ALP was recorded. In July 2012, the patient underwent Magnetic Resonance Imaging (MRI) cholangiography of the upper abdomen which revealed a marked reduction of the right segmental duct extended for 2.5 cm, with upstream dilatation, and pronounced stenosis of the biliary tree in the 5th and 6th hepatic segment considered characteristic of PSC. MRI typically shows multiple strictures and dilatations of the intrahepatic biliary tree in PSC patients. In our case, the coexistence of a liver biopsy compatible with PBC and MRI results typical of PSC permitted us to formulate a diagnosis of PBC-PSC overlap syndrome.
+Given the absence of both the histopathological features of IgG4-related disease and abundant IgG4+ plasma cells in the liver biopsy material, the hypothesis of IgG4-associated cholangitis was excluded. Furthermore, there were no signs of synchronous involvement of other organs.
+In October 2012, arthritis of the fourth right DIP joint and severe nail psoriasis were two new symptoms that were added to the clinical picture . Hand X-rays showed new erosions in the fourth right MCF and DIP . Adalimumab treatment (40 mg fortnightly), which was begun at that time, led to notable relief of the pain and stiffness. Three months later the painful swellings of the second and fourth right DIP joints showed marked improvement, and the nail of the fourth right finger appeared normal . The patient’s Health Assessment Questionnaire (HAQ) disability index score fell from 0.750 to 0.375, the Disease Activity Score 28 (DAS28) fell from 4.25 to 3.18 and the Disease Activity in Psoriatic Arthritis (DAPSA) score fell from 17.37 to 4.29. Liver function tests improved, the ALP normalized, and the γGT and IgM improved (respectively falling to 124 IU/L and 5.35 g/L). Twelve months later, the HAQ continued to fall reaching 0.25, the DAS 28 fell to 1.80, and the DAPSA to 2.69. Hand X-rays showed that the bone erosion infourth right DIP joint seemed to have disappeared while the erosion at the base of the first phalanx persisted . Unfortunately, we do not have Computerized Tomography (CT) or MRI confirmation of these findings. Twenty-eight months later, the patient’s HAQ and DAS 28 values were stable, the DAPSA was 5.29 (low disease activity), the γGT and serum IgM had fallen even further (respectively reaching 98 IU/ml, and 4.93 g/L), and the ALP remained at normal levels (107 IU/ml) . At present, the patient continues to receive Adalimumab and enjoys good health.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1692_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1692_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c901c900baef3c35548ca50988ec34e32e36fa3c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1692_en.txt
@@ -0,0 +1,3 @@
+A one-month-old girl of African origin was admitted to the local emergency pediatric unit for high fever, trilineage blood cytopenia and hepatosplenomegaly. Natural killer cells analysis showed a lack of perforin expression. The diagnosis of hemophagocytic lymphohistiocytosis (HLH) was confirmed by Next Generation Sequencing (NGS) analysis on peripheral blood DNA, showing the presence of genomic variants c.50delT and c.1130G>A in PRF1 gene, both heterozygous. NM_005041 (PRF1): c.[50delT1130G>A], p.[Leu17ArgfsTer34Cys377Tyr]. These variants, both homozygous and compound heterozygous, are described as related to HLH., The patient started treatment with dexamethasone and cyclosporine, followed by emapalumab, a monoclonal antibody anti-interferon gamma. She underwent HLA-matched unrelated donor HSCT at the age of 6 months (HLA-A, DRB1, permissive DPB1 allele mismatches). Conditioning regimen: busulfan (3×3,2 mg/kg/day), fludarabine (3×50 mg/m2/day), thiotepa (2×5 mg/kg/day) and rabbit antithymocyte globulin (ATG GenzymeTM) (3×4,5 mg/kg/day). The patient received 4.14×108/kg bone marrow total nucleated cells and 7.37×106/kg of CD34+ cells. GVHD prophylaxis was based on cyclophosphamide (2×50 mg/kg) and cyclosporine and low dose of prednisone (0,4 mg/kg/die). The pre-engraftment period was complicated by Pseudomonas aeruginosa sepsis (day + 10) and right lobar pneumonia (day +13). The engraftment occurred at day +16 with no sign of aGVHD. Therapy with ciclosporin was interrupted three months after HSCT, and she started therapy with tacrolimus. The prednisone given as GVHD prophylaxis was interrupted at month +7 post-HSCT. Full donor chimerism was found at day +50 and confirmed at month +8 post-HSCT. At 17 months the child was admitted to the hospital for lack of appetite, elevated liver enzymes with alanine aminotransferase (ALT) 850 U/L and aspartate aminotransferase (AST) 499 U/L (normal value 5–45), and polypnea. Presuming GVHD-related symptoms, she was treated with methylprednisolone at the dose of 2 mg/kg/die with no clinical improvement. The child rapidly developed respiratory failure that required mechanical ventilation. An extensive diagnostic work-up was performed: blood analysis revealed an increased value of creatine kinase (CK) of 13830 U/L (normal value 25–190), creatine kinase (CK)-MB 555 ng/L (normal value < 6) and troponin of 2601 ng/L (normal value < 45); tacrolimus through blood level was in range; immunoglobulin levels were normal whilst the peripheral blood lymphocyte subpopulations showed an increase in the content of B-lymphocytes (2544,34 cells/ul, normal value 123–349); echocardiography showed a normal biventricular function; electroencephalography (EEG) revealed no abnormality; serological test and polymerase chain reaction (PCR) assay revealed no evidence of recent parvovirus B19, Adenovirus, Enterovirus, Cytomegalovirus, Human herpesvirus 6, Human immunodeficiency virus, hepatitis B virus, hepatitis C virus or Epstein-Barr virus infection; cerebrospinal fluid (CSF) findings resulted negative for bacterial and viral infections; electromyography (EMG) showed a normal pattern of the motor unit action potential (MUAP) waveform with normal values of F wave and only sporadic myopathic MUAPs were found; an extensive screen for autoantibodies related to autoimmune and neuromuscular disease was negative. In suspicion of a GVHD-related myositis, a biopsy from vastus lateralis muscle was performed showing necrotic and degenerating muscle fibres, basophilic regenerating fibres and inflammatory infiltrates predominantly around vessels .
+Inflammatory cells were predominantly composed of CD3+ CD8+ T cells; some CD4+ T cells and a few CD68+ macrophages, CD20+ B cells and CD57+ natural killer cells were observed; only rare CD 138+ cells were present .
+These findings indicated immune-mediated polymyositis; therefore the immunosuppression treatment was potentiated with methylprednisolone 30 mg/kg for three days, rituximab (105 mg/m2 once weekly for four doses); tacrolimus was replaced with sirolimus because of its potential neurotoxicity. In the following days the clinical conditions of the child improved, with a decrease in CK, CK-MB, AST, ALT and troponin values; she was weaned from mechanical ventilation after 25 days. In the following weeks the girl presented a progressive clinical improvement with complete normalisation of the neuromuscular disease in about two months. The girl was treated with sirolimus (ongoing), and low dose of prednisone (0,2 mg/kg/die) gradually tapered off over nine months. Currently, after 15 months, the girl is asymptomatic in very good general conditions without any neuromuscular alteration. The values of CK-MB, AST, ALT and troponin are average while CK persists slightly abnormal (1.5 times above the normal upper range).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_16_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_16_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8ddaaf8465fbd4a4d151342a061da54d98d4fd3d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_16_en.txt
@@ -0,0 +1,6 @@
+A 33 year old female patient, known to have microscopy positive pulmonary tuberculosis (MPT+) complicated by a left pneumothorax, under anti-tuberculosis treatment having received two months of quadritherapy based on Rifampicin + Isoniazid + Pyrazinamide + Ethambutol and then during the second phase of treatment with dual therapy based on Rifampicin + Isoniazid (one month), referred to our department of maxillofacial surgery for two swellings, one fronto-glabellar and the other posterior right cervical, progressively evolving over the last 4 months, initially frontal and then secondarily right cervical, evolving in a context of asthenia, anorexia, evening fever and weight loss of 13 kg in 6 months.
+Clinical examination found two swellings of soft consistency, fluctuating on palpation, painless, warm and fairly well limited . Examination of the lymph nodes did not reveal any cervical or distant adenopathies and pleuropulmonary auscultation found bronchial rales on the right and an abolition of vesicular murmurs on the left as a consequence of her pulmonary tuberculosis.
+Cranio-cervico-facial CT scan showed two superficial subcutaneous collections in the fronto-glabellar and right posterior cervical regions, with no intracranial abnormalities suggestive of fronto-glabellar and cervical abscesses .
+Chest CT scan revealed a sequelae lung, with parenchymal dystrophy with excavations and para septal emphysema on the right side and a medium-sized pneumothorax with underlying lung collapse on the left side .
+An exploratory puncture of the two fronto-glabellar and cervical swellings confirmed the diagnosis of abscess by bringing back a purulent fluid . Cytobacteriological examination of the samples confirmed the tuberculous origin of the two abscesses by the detection of Acid-Alcohol-Resistant Bacilli (AARB) on direct examination, followed by positivity of the Xpert gene by polymerase chain reaction (PCR) and isolation of Mycobacterium tuberculosis hominis by culture. The diagnosis of multifocal tuberculosis was retained in the patient, and then a human immunodeficiency virus serology was carried out on the patient, which came back negative, proving her immunocompetence.
+After the results of the cyto-bacteriological analysis, the patient underwent surgical drainage of the two abscesses and was referred back to the pneumology department for further management and therapeutic readjustment. Anti-tuberculosis treatment was maintained in the patient for a total of 12 months. The follow-up at the consultation was done at D-14, 1 month, 2 months and 3 months by careful clinical examination alone without imaging, with a good evolution without signs of local or distant recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1715_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1715_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bfdcdc973a7db06f57db6d6c21e591fefae59a3b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1715_en.txt
@@ -0,0 +1,8 @@
+A 43 years old female of Han ethnic group from Northeast China, farmer by occupation, presented to the Department of Oral and Maxillofacial Surgery, Hospital of Stomatology, Jilin University, Changchun, China with an asymptomatic swelling in her anterior mandible. The swelling had started 1 year previously and since then, there had been a gradual increase to its present size. She denied experiencing any bleeding, pain or sensory changes. She also denied any history of trauma and the past medical, dental and family history was insignificant.
+On physical examination, facial asymmetry due to swelling on the left side of the face was noticed. The swelling was oval in shape crossing the midline thereby obliterating the labiomental sulcus.
+The swelling had smooth surface with normal overlying skin but stretched. It was non-tender on palpation.
+The intra-oral examination revealed a large mass approximately 5 × 4 cm in size, extending from lower right canine to left 2nd premolar buccally. Buccal expansion of the mandibular left and right symphyseal and para-symphyseal region was evident. The overlying mucosa appeared normal. There was labial displacement of 32 .
+On palpation, the swelling was found to be firm, bony hard in consistency, non-tender, non-fluctuant, irreducible, non-compressible and non-pulsatile. The teeth in the vicinity were non-tender to percussion; there was slight mobility of 32 and 33. On electric pulp vitality testing, all teeth in the affected area were vital except 32 and 33. No lymphadenopathy or fistulae were present.
+Radiographic examination of the mandible revealed a diffuse ill-defined mixed radiolucent radio-opaque lesion extending from mesial surface of lower right canine to the mesial surface of the lower left 2nd premolar with an approximate size of 5 × 4 cm . The lesion resulted in the displacement of the roots of 32 and 33 without any signs of root resorption. There was loss of periodontal ligament space on the involved teeth except lower right canine and lower left first premolar. There was loss of lamina dura around the involved teeth. Computerized tomography (CT) of the lesion showed a multiloculated lesion 5 cm mediolaterally, 4 cm superoinferiorly and 2.5 cm anteroposteriorly . Areas of calcifications were present within the lesion giving it a soap bubble appearance. The lesion almost involved the lower border of the mandible.
+A provisional diagnosis of a fibro-osseous lesion of the anterior mandible was made based on clinical and radiographic appearance. The lesion was non-productive on aspiration. Blood profile showed no abnormality except slightly raised levels of serum alkaline phosphatase, 148 IU/L, suggestive of a bone forming lesion. The final diagnosis was established through incisional biopsy performed under local anesthesia. The histologic features were corroborating with those of desmoplastic ameloblastoma.
+A segmental resection of mandible from 44 to 35 was done under general anesthesia with proposed incision as shown in Figs. and and temporarily reconstructed with 2.4 mm reconstruction plate. The surgical specimen consisted of a segment of mandible with the lesion and the associated teeth. The frozen sections were found to be free of tumors. The post-operative period was uneventful. The patient is advised for routine follow-up and has no signs of recurrence so far for a period of 10 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1741_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1741_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c7f3c68a16a6a165a543729bcf960320123b4ad0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1741_en.txt
@@ -0,0 +1,2 @@
+A 72-year-old male was transferred to our institution presenting temporary dysarthria and consciousness disorder. Diffusion-weighted image (DWI) revealed several small infarctions and magnetic resonance angiography showed a decrease of flow signal of the right intracranial arteries , which was due to partial disappearance of the high cervical portion of the left internal carotid artery (ICA) . Furthermore, a three-dimensional computed tomography angiogram (3D-CTA) revealed an elongated styloid process stenosing the nearby ICA . The arterial spin labeling study revealed a remarkable decrease in cerebral blood flow (CBF) , with mural hematoma around the stenotic ICA on thin slice T1-weighted images. Angiogram examination again revealed severe stenosis of the left ICA [ and ] at around the elongated styloid process. The final diagnosis was a case of carotid artery dissection due to the elongated styloid process (Eagle’s syndrome).
+As the patient’s neurological symptoms recovered during the initial assessment, medical treatment was chosen, and the patient was treated conservatively by aspirin (100 mg/body/day). Oral administration of clopidogrel (loading 150 mg/day, maintenance 75 mg/day) and intravenous infusion of argatroban were added later on, as the patient suffered from repeatedly appearing transient neurological deficits with no change in DWI. Systolic blood pressure was also maintained above 160 mmHg to counteract the cerebral hemodynamic stress. CAS was performed 15 days after admission. The procedure was performed under general anesthesia, and an eight French temporally occlusion balloon catheter (OPTIMO, Tokai Medical Products, Japan) was delivered proximal to the stenotic lesion. A micro-guidewire was passed through the lesion right after balloon inflation. The blood from the distal ICA was flowed out through to the femoral vein. After percutaneous transluminal angioplasty (PTA) for stenosis, A 6 to 8 mm tapered Carotid WALLSTENT (Boston Scientific, Boston, USA) was placed at the stenotic lesion after PTA . MRA 3d-tof improved the signal intensity compared to before CAS . Post stenting angiogram showed no distal embolization at the intracranial arteries and postoperative iodoamphetamine single-photon emission computed tomography (IMP-SPECT) showed recovered left CBF . The blood pressure target was decreased to under 120 mmHg just after stent placement to prevent cerebral hyperperfusion syndrome, and the patient showed neither hyperperfusion nor ischemic symptoms. The patient was discharged to a rehabilitation hospital at a modified Rankin Scale of 2.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1746_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1746_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..135a892e4fa7d369194fd00f0b81ae105b25fe23
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1746_en.txt
@@ -0,0 +1,6 @@
+An 87 year old woman patient reported to the outdoor department of our hospital with a history of having sustained a fall in her bathroom. The patient complained of tenderness and pain in the right hip and thigh. The extremity was externally rotated and shortened. Movement elicited pain in the area of the right hip. Radiographs of the right femur revealed a transverse fracture of the right subtrochanteric region. On assessing the trabecular pattern of the trochanteric region the patient was found to have Singh's grade one porosis with near absence of the trabeculae in the femoral head and neck.
+The patient was put on traction and advised to undergo surgery in view of the nature of the fracture and the requirement of early ambulation. Dual X-ray absorbsiometry showed a T score greater than 2.5 standard deviations below normal.
+In view of the extremely thin cortices of the femur, it was felt that the oft required schanz pin assisted reduction, needed for guide wire insertion in interlocking nailing, could damage the cortices at the insertion site. Besides this the possibility of cut out precluded the use of dynamic hip screw fixation. The DCS along with cancellous screws was chosen to circumvent these problems.
+The fracture was reduced on a traction table after opening the area. Fixation was held with a dynamic condylar screw [DCS] and 95 degree barrel plate. In view of the tenuous nature of the cortices the plate was affixed with four cancellous screws on either side of the fracture.
+Post operatively the patient underwent supervised physiotherapy over a period of six weeks. At ten weeks the fracture had united and the patient was allowed full weight bearing. The patient simultaneously was put on treatment with bisphosphonates for the underlying osteoporosis which was primarily of the senile variety.
+At the last follow-up [3 years post operative] the patient was pain free with full range of motion of the hip joint. The patient's cortex thickness had also improved at this time as seen on radiographs. The patient was advised as to the potential complications of removal of hardware after which she chose to avoid removal of the implant.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1764_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1764_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aefe81020cd39bb0ee62d778b05539d1e6b94c9f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1764_en.txt
@@ -0,0 +1,6 @@
+A 44-year-old man without any past medical history or cardiac risk factors presented with retrosternal chest pain radiating to the left arm and jaw. An ECG performed by the paramedic ambulance crew showed sinus rhythm with hyper-acute T-waves in the anterior leads with borderline ST-segment elevation . On further questioning, the patient denied any chest pain symptoms prior to presentation. Suspected as having an evolving STEMI, the PPCI pathway was activated, in line with the 2017 ESC guidelines on management of ST-elevation myocardial infarction (MI), and the patient was transferred as an emergency to the cardiac catheterisation laboratory of our heart attack centre.
+On arrival, the patient was haemodynamically stable and the chest pain had subdued to 1/10 in severity. Systemic examination was unremarkable. The patient was apyrexial, with a heart rate of 90 b.p.m., with a blood pressure of 110/72 mmHg and venous pressure was not elevated. Cardiovascular examination was normal with an undisplaced apex beat, normal heart sounds, no murmurs or pericardial rub, and normal breath sounds on auscultation.
+Subsequently, there was recurrence of severe chest pain and profound anterior ST-segment elevation . Emergency coronary angiography showed unobstructed coronary arteries . Emergency coronary angiogram showed all three coronary arteries were patent with Thrombolysis in Myocardial infarction-3 flow and there was no evidence of dissection or thrombus. The ST-elevation and pain resolved spontaneously over the next 15 min . On-table echocardiography showed no evidence of pericardial effusion or any ventricular regional wall motion abnormality. Troponin-T level rose from <3 ng/L on arrival to 549 ng/L at 12 h. Blood results were as follows: haemoglobin 139 g/L (130–170 g/L), white cell count 12.9 × 109/L (4–11 × 109/L) (differential count of 73% neutrophils, 17% lymphocytes, 7% monocytes, 2% eosinophils, and 1% basophils), platelet count 302 × 109/L (150–400 × 109/L), C-reactive protein 83 mg/L (0–5 mg/L), prothrombin time 13.5 s (9–12 s), activated partial thromboplastin time 40.4 s (23–31 s), lactate 1.4 mmol/L (0.6–2.5 mmol/L), urea 3.2 mmol/L (2.5–7.8 mmol/L), creatinine 55 µmol/L (59–104 µmol/L), eGFR >90 mL/min sodium 138 mmol/L (133–146 mmol/L), potassium 4.4 mmol/L (3.5–5.3 mmol/L), bilirubin 5 µmol/L (0–21 µmol/L), alanine transaminase 17 U/L (7–40 U/L), alkaline phosphatase 132 U/L (30–130 U/L), and albumin 42 g/L (35–50 g/L).
+The patient was transferred to the cardiac ward and managed as a possible acute coronary syndrome or coronary artery spasm and initiated on dual anti-platelet therapy with aspirin 75 mg o.d., ticagrelor 90 mg b.i.d., diltiazem 90 mg b.i.d. and atorvastatin 20 mg o.d. Transthoracic echocardiography was normal, with normal left ventricle size and function, and no evidence of regional wall motion abnormality. He was discharged after 48 hours of monitoring, after he remained stable and symptom free.
+Given that there was no evidence of coronary artery disease on angiography to explain the reason for the acute coronary syndrome, a cardiac magnetic resonance imaging (MRI) scan was requested, to look for evidence of MI, fibrosis, or inflammation such as myocarditis. An outpatient cardiac MRI showed a structurally normal heart but detected an incidental large mediastinal mass , measuring 90 mm × 31 mm × 74 mm that was lobulated, containing multiple cysts. The mass abutted, but did not invade, the great vessels in the anterior mediastinum. Inflammation and oedema of the parietal pericardium was observed anterior to the right ventricle confluent with some of the mass. There was no myocardial late gadolinium enhancement. The patient was reviewed in clinic where dual antiplatelet therapy was stopped and a chest computed tomography (CT) scan was arranged.
+The chest CT scan was requested to better characterize the lesion. This showed a poorly defined anterior mediastinal mass with cystic areas with large area of contact with the great vessels and infiltrating between the ascending aorta and main pulmonary artery . Adjacent abnormal lymph nodes were also present. Tissue biopsy confirmed Hodgkin’s lymphoma and the patient was initiated on chemotherapy (Adriamycin, Bleomycin, Vinblastine and Dacarbazine, or ABVD regime). The patient was seen following five cycles of chemotherapy, 7 months following the index event and was responding well to the chemotherapy with no further symptoms of chest pain.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_176_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_176_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..776dbf23d11e75ce288d84c90a8f6efe9bcf47df
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_176_en.txt
@@ -0,0 +1 @@
+A 38-year-old woman with a medical history of type I diabetes mellitus and SPS initially presented to inpatient rehabilitation with intractable and painful muscle spasms due to SPS. The diagnosis of SPS was confirmed by elevated anti-glutamic acid decarboxylase antibody levels (>250 IU/mL). Her symptoms were episodic in nature and triggered by light palpation along the lower limbs. Emotional distress also worsened symptoms. Episodes would last up to 8 h per day. Examination was notable for severe and painful muscle flexor spasms, which were clonic and diffuse. The spasms were particularly notable in her left lower limb with corresponding left ankle inversion, and right upper limb with elbow flexion and forearm supination. The patient underwent serial up-titration of oral baclofen up to 15 mg 3 times a day and diazepam up to 20 mg every 6 h, with concurrent IVIG cycles, with only transient symptom control. Her symptoms made her non-ambulatory and limited her tolerance to using a wheelchair for mobility. She also required moderate-to-maximum assistance for bed mobility, transfers and lower limb dressing. The patient was subsequently referred to the spasticity clinic to be assessed for ITB therapy. She underwent a trial of a single bolus of 50 μg baclofen via a lumbar puncture at the L3–L4 interspace , resulting in a significant decrease in spontaneous spasms, which lasted for hours. She demonstrated modified independence on transfers and ambulation following the test dose procedure, without requiring an assistive device. The patient was then referred to neurosurgery and ultimately implanted with a SynchroMed II intrathecal delivery system (Medtronic, Inc. Minneapolis, Minnesota, USA), with the catheter tip placed at the T8 spinal level. Her post-procedural course was complicated only by a transient post-dural puncture headache. To date, her ITB has been titrated to 186 μg per day with simple continuous delivery. The patient was weaned off oral baclofen and required only intermittent oral diazepam, with 5 mg once or twice daily. To date, she has mild allodynia in the left lower limb. She attained complete functional independence with ambulation and continues ambulating without needing an assistive device. She remains independent in bed mobility, lower limb dressing, and transfers. She continues ITB therapy with occasional IVIG cycles, directed by neurology. Her baclofen dose has been stable for 36 months following the titration phase of therapy. She has experienced no lasting adverse effects from ITB therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1791_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1791_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1266864cca247190d3ec6ad956f46ef27ef61c42
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1791_en.txt
@@ -0,0 +1,3 @@
+A 40-year-old male presented to us with right flank pain experienced for two weeks. Pain was colicky in nature, radiating to genitalia, associated with vomiting. Bowel habits were normal. There was no history suggestive of any other system involvement. Examination was unremarkable. Computed Tomography (CT) of urinary system revealed right hydronephrosis and a calculus measured 0.9x0.8x0.6cm located in the right upper ureter, and the distance between the stone and renal pelvis was 7.44cm (a).
+Ureteroscopic removal was planned. Forceful placement of rigid ureteroscope resulted in instrument drag, which hampered its maneuverability. An attempt at extraction produced full-length complete avulsion of ureter. The avulsed ureter was pulled out of body (b), and the native ureter was preserved in physiological saline. The reconstruction treatment selection was a decision made for the patient after extensive discussion with urologists of the Affiliated Hospital of Guizhou Medical University. After discussing the complication with the patient, his spouse and his family members, we underwent ureteral reconstruction by standard open surgical techniques. About 6 hours after ureteral avulsion, pyeloureterostomy plus greater omentum investment outside the avulsed ureter and ureterovesical anastomosis were performed for the patient. A single double-J stent tube (6F, Budd Company) was placed inside the ureter (c-f).
+The patient was followed-up for 34 months. Plain abdominal radiography (KUB) and CT indicated that there was no hydronephrosis and the position of double-J tube was normal (a and b). At 3 months, CT indicated that there was a stone like-material attached to the double-J tube (c). After extensive discussion with urologists and with the patient, his spouse and his family members, we decided to pull out the double-J tube finally. At 5 months, CT indicated that there were no hydronephrosis and other abnormalities (d). At 23 months after first operation, CT revealed right hydronephrosis and a new upper ureteral stone (e). Rigid ureteroscopy and holmium laser lithotripsy were used, and a single double-J stent tube was placed inside the ureter after management, which was removed one month later. At 34 months, CT of urinary system revealed no hydronephrosis, renal atrophy or other complication (f).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1795_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1795_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0f6e130771752d510d5d475d497f8aab67cc8f0b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1795_en.txt
@@ -0,0 +1,3 @@
+A 17-year-old Han Chinese female presented to the psychiatric outpatient clinic with a one-week history of dizziness and feeling sluggish. These symptoms were impairing her ability to attend school regularly. Her psychiatric history was significant for a recent hospitalization three months prior for bipolar disorder with psychotic features (auditory hallucinations). The patient met the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition criteria for bipolar I disorder based on the documented presentation of manic episode as well as prior major depressive episodes over the preceding three months. During admission, she was started on lithium carbonate 500 mg twice daily and paliperidone 9 mg (450 mg Chlorpromazine, equivalent dose) once daily for treatment. Two months later, the paliperidone was down titrated to 6 mg (300 mg Chlorpromazine, equivalent dose) once daily. However, one week before her outpatient visit, she started to experience frequent dizziness, chest tightness, and feeling sluggish. She denied any other personal or family medical conditions, smoking, alcohol use, or illicit drug use. However, it was noted these were based on self-report only, and additional clinical documentation was unavailable to confirm past medical conditions. Prior to the initiation of lithium and paliperidone, she had no history of thyroid disease, bradycardia, or other cardiac issues.
+On physical examination, her heart rate was bradycardic at 41 beats per minute, and her blood pressure was 95/57 mmHg. An electrocardiogram (ECG) revealed sinus bradycardia and sinus arrest . Her serum electrolytes, including calcium, potassium, and myocardial enzymes, were within normal limits . However, thyroid function tests showed an elevated thyroid-stimulating hormone (TSH) of 9.08 mIU/L (reference range 0.51–4.94 mIU/L), decreased total thyroxine (TT4) of 45.05 nmol/L (reference range 58.1–140.6 nmol/L), and decreased free thyroxine (FT4) of 10.94 pmol/L (reference range 11.5–22.7 pmol/L) . Her thyroid abnormalities were considered subclinical in nature since overt symptomatic manifestations were not charted in the available history. She and her guardian denied any personal or family history of cardiac or thyroid diseases, and she was not taking any other medicines known to cause heart block. Although her serum lithium level was not measured due to unavailability of the assay at our hospital, her serum paliperidone level was within the therapeutic range . Based on her medication history and clinical presentation, the combination of lithium and paliperidone was suspected as the likely cause of her hypothyroidism, bradycardia, and sinus arrest.
+This was further supported when her thyroid function normalized 20 days after stopping these medications, without levothyroxine replacement . Bradycardia and sinus dysfunction were documented to have resolved within the same timeframe as thyroid function stabilization, with a restoration of normal sinus rhythm to 64 beats per minute occurring 20 days after medication cessation. This aligned timing provides evidence that the cardiac issues were likely attributable to drug-induced sinus node effects rather than idiopathic pathology. The half-lives of lithium and paliperidone are 18 hours and 23 hours, respectively, which explains the timing of the resolution of her subclinical hypothyroidism and sinus node dysfunction 20 days after discontinuing these medicines. Then, she was switched to olanzapine 2.5 mg once daily for her psychiatric disorder. Pacemaker implantation was not pursued because her sinus rhythm recovered with drug withdrawal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1799_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1799_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ba4119e7ca2f46761e609f3e0570e2b7aed1135c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1799_en.txt
@@ -0,0 +1,3 @@
+A 23-year-old-woman was referred to our hospital for severe pain and decreased visual acuity started one day ago in the right eye. Two days prior to this, the patient had foldable iris-fixated pIOL (Artiflex; Ophtec BV, Groningen, the Netherlands) implanted in both eyes at an outside clinic. On postoperative day one, she had undergone anterior chamber (AC) irrigation to remove residual viscoelastics which caused intraocular pressure (IOP) spike in the right eye.On examination, uncorrected distant visual acuity (UDVA) was hand motion with IOP of 21 mmHg for the right eye. Biomicroscopy of the eye revealed severe conjunctival injection, corneal edema, corneal infiltration at superior main incision, membrane formation around the pIOL, and a deep AC with a 1.5 mm hypopyon, which were thought to represent infectious endophthalmitis (Figure A). Posterior segment evaluations such as vitreous cell grading and fundus examination were impossible because of severe corneal edema and AC inflammation. B-scan ultrasonography showed no definite vitreous involvement, and the left eye was normal.
+Immediate management involved AC irrigation, obtaining aqueous humor for culture and stain, and intravitreal vancomycin (1.0 mg/0.1 cc) and amikacin (0.4 mg/0.1 cc) injection. Gram and KOH stain smear revealed no bacteria or fungus. The patient was also treated with systemic (flomoxef 1.0 g every 12 hours) and topical (fortified vancomycin (50 mg/mL) and amikacin (20 mg/mL) hourly) antibiotics, prednisolone 1.0% four times daily, and homatropine 2% twice daily eye drops for a week, then the frequency was reduced according to the clinical response, culture, and sensitivity results. After 5 days of incubation, cultures became positive for Streptococcus mitis/oralis. By day 2 of admission, the patient did not improve so that AC irrigation, intracameral vancomycin (1.0 mg/0.1 cc) and amikacin (0.4 mg/0.1 cc) injection, and subtenon triamcinolone injection (40 mg/1.0 cc) were performed.
+After the second round of intervention, the patient began to improve clinically. On day 5, UDVA improved to 20/100, and biomicroscopy revealed moderate AC reaction without hypopyon and decreased inflammatory membrane behind the pIOL (Figures B, C). At 2 weeks, UDVA was 20/40 and IOP was 11 mmHg (Figure D). Endothelial cell density was measured at 3143cells/mm2. At 1 month, UDVA improved to 20/32, and biomicroscopy showed minimal AC reaction and corneal edema.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1817_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1817_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f1242b5c841407cfc3c3a6cb59b00a3e44e3a9e0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1817_en.txt
@@ -0,0 +1,8 @@
+A 40-year-old Asian man was hospitalized in our emergency department because of sudden abdominal and lumbar pain that woke him while sleeping. He had a medical history of hypertension but was not being treated with medications. He also had a current cigarette smoking history of 40 cigarettes per day for 20 years, and had no other related familial history. A physical examination showed left upper quadrant abdominal tenderness and bilateral costovertebral angle tenderness. No cardiac murmur or abnormal respiratory sounds were heard on auscultation. His blood pressure was 215/118 mmHg, heart rate was regular at 73 beats per minute, respiratory rate was 12 breaths per minute, and his body temperature was 36.8 °C.
+A serial hematologic workup showed an extremely high hemoglobin level (19.4 g/dl) and hematocrit (54.3 %), but his white blood cell count and platelet count were within normal limits. No abnormal values of blood urea nitrogen, creatinine level, and hemostasis system function were found in this workup. His international normalized ratio of prothrombin time (PT-INR), fibrin degradation products (FDP), and activated partial thromboplastin time (APTT) levels were 1.02, 2.8 μg/ml, 26.9 seconds respectively. Only the level of his D-dimer was slightly increased (2.7 μg/ml).
+In a later analysis, lupus anticoagulant and anti-cardiolipin antibody were not detected, and his protein C and protein S activity levels were 115 % and 113 % respectively. His counts of erythroblasts and reticulocytes, and erythropoietin level were 0 parts per 1000, 17.2 parts per 1000, and 10.6 mIU/ml, respectively, and these results indicated no findings of polycythemia vera. His electrocardiogram was normal sinus rhythm on admission. Transthoracic echocardiography excluded wall motion abnormalities, valve dysfunction, intracardiac thrombus, and any other patent circulatory shunts. CECT revealed a huge intra-aortic thrombus at the level of the descending to abdominal aorta just superior to his renal artery with patchy emboli in his spleen and bilateral kidneys , and a segment of the thrombus existed just near the ostia of his celiac artery and superior mesenteric artery .
+After his admission to our emergency department, we immediately started systemic heparinization. But as we were concerned about the extremely high possibility that the thrombus could cause a further fatal systemic embolism, emergency surgical thrombectomy was performed on the same day.
+The operation was started with our patient in a right half-lateral position, and preparations for femoral arteriovenous extracorporeal circulation were completed. A thoracoabdominal spiral incision was performed, and his aorta was approached at the level of the sixth intercostal via a retroperitoneal route. Epiaortic ultrasonography was performed prior to taping to detect the exact lesion of the thrombus, and we taped to aorta at the level of the fifth thoracic vertebra and just superior to the level of his renal artery. After his celiac, superior mesenteric, and left renal arteries were individually taped, his temperature was controlled to a mild hypothermia of 33 °C.
+To prevent dissemination of the thrombus during extracorporeal circulation, we first clamped his proximal and distal aorta on either side of the thrombus, which had been preliminarily taped. After partial arteriovenous extracorporeal circulation from his femoral artery was started, an aortotomy was performed. We found a fresh thrombus and easily removed the 14-cm length of intra-aortic thrombus without residual lesion . There was no arteriosclerotic lesion in the intimal layer, but a spot of organized intramural thrombus in the descending aorta was found, and fresh thrombus seemed to develop secondary to this organized intramural thrombus.
+After the thrombectomy, his aorta could be sutured directly. He was discharged from our hospital 20 days after the surgery without any complications. He had no past medical history of atrial or ventricular arrhythmia and we found no signs of a paroxysmal arrhythmic event during admission.
+Presently, he is still undergoing antiplatelet therapy and warfarin administration. Since he quit cigarette smoking, he has had no findings of polycythemia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1827_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1827_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c23d0a11e031505e9dc1bf9401a280c8ebb12740
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1827_en.txt
@@ -0,0 +1,8 @@
+The patient was a 40-year-old man who was admitted to hospital because of increased pain in the metatarsal joints and renal impairment.
+Around 15 years previously, the patient was diagnosed with gout.
+The patient had a free previous medical history.
+The proband had a family history of hyperuricemia as his grandmother, father, two of his aunts, and two of his female cousins were diagnosed with hyperuricemia and gout. The grandmother, father, one aunt, and one female cousin had been undergoing hemodialysis and died between the ages of 30 and 50 years. In addition, the patient’s 9-year-old daughter had also been diagnosed with hyperuricemia based on her 5.6 mg/dL serum uric acid level (normal range for children aged 1–10 years: < 5.3 mg/dL) .
+The patient’s temperature was 36.7 ℃, heart rate 88 bpm, respiratory rate 14 breaths/min, blood pressure 132/78 mmHg, and oxygen saturation in room air 100%. Physical examination indicated the presence of a mildly painful nodule behind the auricle, slight pain and swelling of the knee joints, serious pain and deformity of the interphalangeal joints, and gout stones on the 1 s metatarsal joints in the feet of the patient .
+The patient had respective blood urea nitrogen and serum creatinine levels of 50.5 mg/dL and 6.2 mg/dL (normal ranges: 7.30–21.06 mg/dL and 0.46–0.82 mg/dL, respectively). The patient had a serum uric acid level of 13.2 mg/dL (normal range: 2.6–6.0 mg/dL), whereas fractional uric acid excretion was reduced by 3.43%. Other laboratory test results were within normal ranges.
+Renal ultrasonography showed that the patient’s kidneys were relatively atrophic (longitudinal image; 8.1 and 8.7 cm in the major axis of right and left kidneys), indicating the presence of cysts and suggestive of ESRD . Analysis of the knee joints by computed tomography showed high bone density, the presence of high-density shadows, narrowing of the joint space, and soft tissue swelling, which were consistent with the patient’s gout/arthritic symptoms .
+Considering the family history of kidney disease, juvenile-onset of hyperuricemia, symptoms of gout/arthritis, and progressive renal impairment beginning at an early age, ADTKD-UMOD was considered highly probable. After receiving written informed consent from the four affected living members of the patient’s family, DNA analyses, clinical data collection, and image publication were performed for these individuals. The peripheral blood was sent to CIPHER gene to perform the whole exome sequencing by Illumina HiSeq (the specific method can be consulted in the Supplementary Material). Genetic analyses revealed the presence of a novel heterozygous missense mutation in UMOD exon 3 of the patient, his daughter, aunt, and younger female cousin . The conclusion of the genetic test was variants of unknown clinical significance. According to the American College of Medical Genetics and Genomics genetic variation classification standards and guidelines, the variation site was heterozygous, and the zygote type could explain the patient’s disease. Furthermore, this missense mutation was the result of nucleotide exchange at position c.554 (c.554G>T), in which leucine was replaced by arginine at position 185 in the final protein (p.Arg185Leu). This resulted in abnormal folding of uromodulin protein, leading to its accumulation within the endoplasmic reticulum and impaired trafficking through the cell.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1829_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1829_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..33565ae4c450a66254d042e801d181853bc2fd39
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1829_en.txt
@@ -0,0 +1,6 @@
+In 2000, a 35-year-old Turkish man (91 kg for 1.70 m; BMI: 31.5) was found to have an abnormal level of serum alanine aminotransferase (ALT = 243 IU/L; normal, < 42 IU/L) after undergoing routine blood testing. The patient was HBs-antigen (Ag)-positive, HBs-antibody (Ab)-negative, HBe-Ag-negative, HBe-Ab-positive, and HBc-Ab-positive (Axsym, Abbott Laboratories, North Chicago, IL, USA). Hepatitis B virus (HBV) DNA was detected as positive in the serum. Serological markers for hepatitis delta virus, human immunodeficiency virus, and hepatitis C virus were negative. The persistence of biochemical and virological abnormalities was an indication for a liver biopsy, which showed chronic hepatitis B with a mild necroinflammatory activity and moderate fibrosis (Metavir score, A1F2). Treatment with lamivudine 100 mg/day was initiated in November 2000 (month 0: M0). At that time, serum HBV DNA load was 8.6 log10 IU/mL (Amplicor-HBV-Monitor, Roche Diagnostics, Meylan, France; limit of detection: 200 copies/mL) . After an initial 3.4 log10 drop of the HBV DNA load within the first 3 months of therapy, the serum HBV DNA load regularly increased with a flare of ALT at M10 and reached the pretreatment level at M14. Consequently, adefovir 10 mg/day was added to the ongoing lamivudine therapy in a temporary-use authorization program. This dual-therapy regimen was maintained for 15 months with a good virological and biochemical response (HBV DNA load: 4.1 log10IU/mL and ALT = 41 IU/L), leading to lamivudine interruption at M30 because, at that time, the benefit of maintaining dual therapy was not proven. With adefovir monotherapy, the serum HBV DNA level continued to decrease with a nadir at M42 (2.6 log10IU/mL). However, a virological breakthrough (i.e., a controlled increase in serum HBV load > 1 log) occurred at M48, leading to the re-introduction of lamivudine in association with adefovir (at that time entecavir was not yet available). With this second dual therapy, serum HBV DNA became undetectable at M60 (COBAS Taqman HBV, Roche Diagnostics, Meylan, France; limit of detection: 6 IU/mL). To date (M83), the HBV load is still undetectable and ALT levels have been repeatedly within the normal range.
+In order to detect lamivudine and adefovir resistance-associated mutations and to determine the HBV genotype of the patient strain, sequence analyses were performed within the viral polymerase and the precore genes using a bi-directional sequencing with Ceq 2000 XL Beckman (Beckman-Coulter, Villepinte, France). The presence of resistance-associated mutations was also assessed using a commercially available reverse hybridization line probe assay (InnoLipa-DR2-assay, InnoGenetics, Ghent, Belgium), following the manufacturer's instructions. This second genotyping assay was performed because of its sensitivity in detecting HBV resistance-associated mutations, particularly in low HBV-load samples [,]. To evaluate the proportion of mutated strain in each sample, we used an in-house selective real-time PCR, which provides a quantitative detection of the main HBV mutations associated with lamivudine and adefovir resistance: rtM204V/I and rtN236T, respectively. This method was derived from the strategy called the amplification refractory mutation system (ARMS) . Briefly, discrimination between wild type and mutant with a single base pair mismatch is made possible using a primer-template mismatch at the 3' end of the primer, which significantly compromises polymerase efficiency in amplifying the wild type strain. Primers and probes for rtM204V/I were described previously and the assay can detect up to 0.1% variants for a total viral load of 105 copies/mL . We designed and evaluated a specific reverse primer (5'-ATCTTTTTGTTTTGTTAGGGG-3') for the detection of the rtN236T-mutation.
+The phylogenetic analysis of the HBsAg-coding region sequence showed a genotype D and a stop codon mutation at the G1896A position in the precore region, confirming the serological data for the infection with a precore mutant HBV strain (data not shown).
+The viral polymerase gene sequencing before and after the first 3 months of lamivudine monotherapy revealed a wild viral strain. The two lamivudine-resistance mutations rtL180M and rtM204V/I were concomitantly detected with sequencing and line probe assays from M6 to M39 (9 months after cessation of lamivudine). During this period, the rate of rtM204V/I strain remained stable, as shown by the ARMS assay (see Table ). After M39, the rtL180M variant was no longer detectable with sequencing or the line probe assay. From M42 to M55, the rtM204V/I variant was still detectable with ARMS and the line probe assay but not with sequencing because the mutated population represents less than 25% of the total viral population, as seen by ARMS (see Table ).
+The first adefovir-resistance mutation rtN236T has been observed since M42 (after 28 months of adefovir therapy, including 12 months of adefovir monotherapy) using ARMS and the line probe assay. The second adefovir-resistance mutation rtA181V was detected at M46.
+Thus, at the beginning of the second-line dual therapy (M48), rtA181V, rtN236T, and rtM204V/I variants were detectable either by sequencing analysis or both the line probe assay and ARMS. This resistance profile persisted at M55 but the rtN236T-mutated strain proportion slightly decreased (from 34% at M48 to 27% at M55). The line probe assay carried out at M58 showed wild type recovery of amino acids 204, 236, and 181. At this time, viral load was 8 IU/mL and sequencing and ARMS detection were unsuccessful. Finally, the viral load became undetectable (< 6 IU/mL with Cobas-TaqMan-HBV) at M60 after 1 year of dual therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1839_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1839_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..81b3649ba99138b0ae45b61a88552967654b4b83
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1839_en.txt
@@ -0,0 +1,4 @@
+A 25-year-old Caucasian female with a history of type 1 neurofibromatosis was brought to our hospital with diffuse abdominal pain, nausea, vomiting and fever following cesarean section for fetal distress. She was transferred to our institution within 18 hours of the onset of symptoms for surgical intervention in view of the ominous findings on computed tomography (CT) scan and endoscopy done at the peripheral hospital. She had not passed flatus or stool since surgery and denied hemetemesis, melena, shortness of breath, or chest pain. There was no history of tobacco or alcohol abuse, ingestion of corrosive substances or non-steroidal anti inflammatory drugs (NSAIDs).
+Our patient appeared acutely ill and toxic. She had a temperature of 38.8°C, pulse of 120/min, blood pressure of 154/90 mmHg, respiratory rate of 24/min, and oxygen saturation of 97% on 2 L of oxygen. The cardiac and respiratory exams were otherwise unremarkable. Her abdomen was markedly distended. There was diffuse tenderness on palpation of the abdomen with no peritoneal signs. The cesarean section incision appeared clean with no tenderness or discharge. Bowel sounds were absent on auscultation. There were multiple neurofibromas on our patient's neck and anterior chest consistent with her diagnosis of neurofibromatosis. Her white blood cell count was 25,000/mm3, with 91% neutrophils. The initial electrolytes, amylase, lipase and liver function tests were within normal limits.
+CT scan of our patient's abdomen showed marked gastric dilation and air in the wall of the stomach along the entire greater curvature and portal venous system . There was marked dilatation of the small and large bowel. Esophagogastroduodenoscopy (EGD) of our patient showed areas of diffuse mucosal congestion and extreme pallor as well as ulceration on the posterior wall and greater curvature of the stomach. Gastric biopsy revealed transmural necrosis. Streptococcus viridans was isolated from gastric biopsy. Blood cultures did not grow any pathogenic bacteria and nasogastric cultures were not obtained.
+Our patient was diagnosed with emphysematous gastritis and promptly started on intravenous clindamycin and piperacillin/tazobactam, nasogastric decompression and intravenous hydration. Total parenteral nutrition was initiated from day two and our patient was closely monitored in the intensive care unit for three days. She improved with the above measures and tube feedings were initiated from day seven. Follow-up CT scan on day eight showed resolution of the gastric and portal venous air . Our patient was finally discharged home on oral proton pump inhibitors on day 10. A follow-up EGD two months later showed no sequelae and our patient remained asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1841_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1841_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58bf0664e1650c70e8bc9ecdecb6142b1345023e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1841_en.txt
@@ -0,0 +1 @@
+A 19-yr-old Caucasian male was scheduled for a septorhinoplasty operation. He had no history of laryngeal disorders and there was no apparent diabetes mellitus, chronic renal failure, chronic corticosteroid use, laryngeal malacia, acromegaly or other factors that might weaken the cricoarytenoid joint. His past medical history, physical examination and laboratory examination were unremarkable (preoperative physical status clasification of patients according to the American Society of Anesthesiologists; ASA I). Physical examination revealed a class 2 airway. Mallampati Intubation Score and other airway measurements were normal. After securing intravenous access and beginning standard monitoring, anesthesia was induced with thiopental (8 mg.kg-1), rocuronium (0.6 mg.kg-1), and remifentanyl (0.5 mcg.kg-1) intravenously. Complete muscle relaxation was provided before insertion of the tube. At the visualisation of larynx with direct laringoscopy (Macintosh 4 laryngoscope blade) the epiglottis was short but the glottis was Grade II (Cormack-Lahene). On the first attempt, a 8.0-mm endotracheal tube was smoothly inserted into the trachea without difficulty and fixed at the middle. The patient did not cough during the intubation. During the four hour operative procedure, anesthesia was maintained with nitrous oxide, oxygen, isoflurane, remifentanyl (0.25 mcg.kg-1.min-1) and rocuronium. The surgery was uneventful. After the operation, the endotracheal tube cuff was deflated and removed without any difficulty, severe coughing and vomiting did not occur at this period. On the first day, the patient complained of moderate hoarseness. He was discharged on the second day and still complained of persistant hoarseness on the 6th day. He had no symptoms other than hoarseness. On the 6th day after the operation, fiberoptic laryngoscopy was performed by an otorhinolaryngologist and revealed anteromedial dislocation of the left arytenoid cartilage . Surgical reduction, under the general anesthesia, was scheduled on the 9th post-operative day. The dislocation of the arytenoid cartilage was visualised under rigid broncoscopy and posterolateral reposition by spatula and steroid injection were performed. The hoarseness was relieved gradually in 6 weeks. Written informed consent was obtained from the patient for publication of this case report and accompanying images.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1846_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1846_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1099eb2a2aa9825771c390b46e92f771ae670e38
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1846_en.txt
@@ -0,0 +1 @@
+A healthy 15-year-old girl suffered a first episode of medial patellar dislocation of the left knee as a consequence of a traumatic impact during a skiing accident. In the following 9 months, she reported further eight spontaneous luxation episodes, which resolved after auto repositioning. The patient did not refer to any previous surgery. At the clinical examination, the left patella appeared to be medialized compared to the opposite healthy side; the medial shift test showed a clear tendency toward medial subluxation accompanied by patient’s discomfort (positive medial apprehension test) . The lateral retinacular showed to be hyperlax. Pre-operative imaging assessment included weight-bearing anteroposterior and lateral views of both knees . A magnetic resonance imaging (MRI) and also a computed tomography-scan of the left knee were collected. No rotatory malalignment was found. As pathological MRI findings, substantial hypertrophy of both the medial patellar retinaculum and the tendon of the oblique medial vastus muscle was documented. The initially proposed conservative treatment encompassed the use of a brace during sports activities and muscular imbalance correction. As the girl referred persistent sensation of “giving away,” 10 months after the first dislocation episode, the surgical operation was performed. It consisted in an open medial retinacular release with complete dissection of the hypertrophic MPFL and a transfer of the vastus medialis oblique (VMO) to the superior border of the patella . The medial retinaculum was dissected on a line drawn from 1 cm medial to the superior pole of the patella to the anteromedial portal. The inferomedial corner of the VMO was detached, and then transferred and sutured to the superomedial pole of the patella, using No. 2 PDS sutures with the knee flexed at 30°. The lateral retinaculum was tensioned, dissecting the two layers and consequently suturing them together in a “pants over vest” fashion. We did not perform a lateral retinaculum reconstruction to avoid over tightening. At the end of the surgery, we achieve regular patellar tracking without any tendency to medial or lateral subluxation during stress-testing. Postoperatively, the knee was placed in a knee brace, and partial weight bearing was advised for the first 4 weeks. Flexion was limited at 45° within the first 2 weeks, and at 90° within the first 4 weeks. Recovery to a full weight bearing was permitted 4 weeks after surgery, and range of motion was gradually increased. The post-operative 6 and 12-week follow-up showed promising results as far as the patient walked without pain and/or sensation of instability. Eight months after surgery on the left knee, the patient experienced a traumatic medial patellar dislocation also in the right knee, occurred during sports activity. Furthermore, in this case, the conservative treatment did not lead to favorable results. The right knee was addressed surgically with the same surgical steps already performed on the contralateral knee. The post-operative protocol was the same used for the left knee. The patient was reassessed 7 years after the surgical operation on the left knee and 6 years after surgical correction of the right one; so far, no further episodes of dislocation have occurred. In the right knee, the Lysholm score improves from 48 to 87, while the Kujala score increased from 55 to 88. The pre-operative Lysholm and patellofemoral Kujala scores improved, respectively, from 45 to 85 and from 56 to 88 in the left knee. The patient declared to be highly satisfied with the procedure, and the only complain was a slight difficulty in squatting, jumping, and running.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1847_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1847_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ff6166f6adf2b413df5a44ef8f9206e5250a892f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1847_en.txt
@@ -0,0 +1,9 @@
+A thirty-year-old male presented with fever and non-productive cough for 2 weeks with exertional dyspnoea. He had hypertension and renal impairment due to mesangioproliferative glomerulonephritis, diagnosed 3 months prior to current presentation, and was on bisoprolol, prazosin and prednisolone (0.5 mg/kg/day). Renal biopsy had not shown evidence of vasculitis.
+On examination he was emaciated (BMI 18 kg/m2), febrile (38.2 °C), and had coarse crackles over right upper lung. Other system examinations were unremarkable.
+The patient had a pancytopaenia with neutropaenia (neutrophil count 780 / mm3) and dysplastic hypoproliferative bone marrow. Peripheral blood detected cytomegalovirus (29,000 copies per microliter by PCR) and anti-CMV IgM was positive. After 21 days of ganciclovir (100 mg daily IV), CMV viral load became undetectable and pancytopaenia was corrected.
+Contrast enhanced CT-chest showed right upper lobe consolidation with cavities . Sputum smear for acid fast bacilli, culture and PCR for mycobacteria (Xpert MTb/RIF) were negative. However, tuberculosis PCR (IS6110 method) performed on his bone marrow aspirate was positive. Therefore, anti tuberculous therapy with isoniazid, rifampicin, ethambutol and pyrazinamide were commenced for disseminated tuberculosis. But, the response was poor.. Aspergillus fumigatus was detected on bronchoalveolar lavage wet smear and culture. Both lavage and serum were positive for galactomannan antigen. Therefore voriconazole 500 mg twice daily (oral) was commenced.
+On sixth week of voriconazole, the patient developed acute bilateral lower limb ischaemia. Two emboli occluding bilateral popliteal arteries were extracted during emergency embolectomy . Histology of emboli showed fungal filaments and culture isolated Aspergillus fumigatus. Trans-esophageal echocardiogram and magnetic resonance imaging (MRI) of the aorta were normal. However, MRI abdomen incidentally detected a large splenic abscess .
+Despite treatment with voriconazole for further 2 weeks, the splenic abscess enlarged and treatment was switched to liposomal amphotericin 3 mg/kg/day intravenously. Four weeks later he developed acute left upper motor neuron type facial nerve palsy. MRI brain showed multiple small focal lesions in capsular and cortical regions suggestive of fungal embolism . The neurological deficit completely resolved within a week.
+Percutaneous aspiration under ultrasound guidance and 6 weeks of amphotericin failed to clear the splenic abscess. Therefore the patient underwent elective splenectomy. Histology of the splenic tissue showed fungal filaments within the abscess as well as caseating granulomas suggestive of tuberculosis of spleen .
+Post-operative period was complicated with left Lower lobe pneumonia and parapneumonic effusion, from which he recovered with antibiotics and supportive measures. Subsequently, fever resolved and clinical status improved (see Additional file for the timeline of disease evolution).
+Due to the unusual constellation of infections (CMV, tuberculosis and aspergillosis) the patient was screened for an immune deficiency state which revealed B cell, IgM and IgA deficiencies and impaired T cell proliferation with concanavalin A . Steroids were tapered and stopped 3 months after the current presentation. Six months later above immune defects returned to normal. Autoantibody profile (ANA, ANCA, rheumatoid factor and extracatable nuclear antibody profile) and HIV screening were negative on two occasions 4 months apart. Repeated imaging, bone marrow trephine and tumor screening with tumor markers did not identify any neoplasms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1853_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1853_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..43906b61428c4065ba5b6fb6f84d95a82cdfb329
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1853_en.txt
@@ -0,0 +1,5 @@
+A 47-year-old male presented to the Outpatient Department of our hospital with a complaint of experiencing a burning sensation during urination for the past 12 days. Additionally, he mentioned that urine dribbled out after he finished voiding, causing his undergarments to become soaked. He had no associated complains of increased urinary frequency, urgency, reddish discoloration of urine, fever, urinary incontinence, or flank pain. He had no history of diagnosed comorbidities like hypertension, diabetes mellitus, hyperlipidemia, or thyroid disease. However, the patient did mention experiencing recurrent urinary symptoms resembling the current episode for approximately the past 12 years.
+The patient had an episode of severe lower abdominal pain and had previously undergone a cystoscopic litholapaxy procedure 5 years ago to remove calculus in the prostatic urethra. . He was advised for a computed tomography (CT) scan of the pelvis prior to the surgery but was unable to follow the recommendations due to his financial constraints. The patient underwent the procedure under spinal anesthesia. After proper positioning and ensuring anesthesia, the cystoscope was inserted and advanced into the prostatic urethra where the stone was visualized and fragmented and the fragments were flushed out by the use of saline irrigation. The postoperative course was uneventful.
+The patient was born at home with no antenatal care visits attended by the mother. The patient vaguely recalled experiencing some urinary problems during childhood, but there were no documented records of those episodes. There was no known history of genital anomalies, difficulty in vision, developmental delay and behavioral disorders. No identifiable precipitating factor for the formation of renal calculus was found in the patient’s medical history.
+Upon physical examination no abnormalities were detected in the patient. A urine routine examination was requested, revealing 8–10 pus cells per high-power field. The results of the renal function test (RFT) were within normal limits. Abdominal and pelvic ultrasonography (USG) detected a cystic dilation of the distal part of the left ureter measuring 2.7×2.6 cm which raised concerns about a possible underlying abnormality . Based on the USG findings, a CT urography was conducted, which was now accessible in the rural setting, to obtain a more comprehensive evaluation of the condition. The CT urography results revealed a left intravesical ureterocele measuring 3.4×2.3 cm. Furthermore, it demonstrated a partial duplex collecting system in the left kidney, with the fusion of the upper and lower pole moiety observed at the level of the pelvic ureteric junction. Mild dilatation of the proximal ureter was also noted . He was then diagnosed with a UTI believed to be secondary to the underlying anatomical abnormality.
+A urine sample was collected for culture, and the patient received medical management for an UTI with antibiotics. He was also advised to drink plenty of fluids which led to an improvement in his current symptoms. The diagnosis was explained to him, and regular follow-up visits were scheduled to monitor for symptoms and assess his RFT and USG. After a thorough discussion of the available options, the patient consented to undergo an endoscopic incision of the ureterocele. Subsequently, a cystoscope-guided puncture of the ureterocele was successfully performed without encountering any intraoperative or postoperative complications. The most recent RFT report was within the normal range. The patient has diligently attended follow-up appointments since being informed about his cause of recurrent symptoms and the need to monitor him for future symptoms and hence has expressed willingness to undergo further interventions if necessary. The patient has been symptom-free since the endoscopic incision.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1855_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1855_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..52845d5cfc9bdf7f945b75103dd48225714738e7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1855_en.txt
@@ -0,0 +1,5 @@
+A 54-year-old Caucasian female proceeded to our institution with epigastric pain, nausea and vomiting along with pain located around the lumbar area lasting for one week. No previous surgical history or commorbidities existed. Clinical examination did not reveal any palpable abdominal masses or abdominal tenderness and the patient’s vital signs were within the normal spectrum. Blood test detected hypercalcemia (serum calcium: 10.2 mg/dL) and parathyroid hormone level of 111.8 pg/mL. All the findings in conjunction with the clinical presentation lead to the assumption that the patient had primary hyperparathyroidism (PHPT).
+Then, an ultrasound was performed but it was negative for any thyroid or parathyroid abnormalities. Subsequently, the thoracic and abdominal CT revealed a soft tissue in the anterior mediastinum 7 × 1 cm. Additional Tc-99m-MIBI scintigraphy followed, which detected an ectopic adenoma located in the lower anterior mediastinum, on the left of the median line . Following these, a mid-sternal thoracotomy was finally scheduled.
+During the operation, after the thoracotomy, surgeons attempted to detect deep into the mediastinum the parathyroid adenoma according to the preoparative localization. Indeed, the mediastinal mass was detected on the left of the median line, at the anterior mediastinum, in front of the anterior surface of the pericardium and close to the left pericardiophrenic vessels and the left phrenic nerve . The adenoma was covered by a thin fibrous capsule. When surgeons removed the capsule, a dark red mass of 7 × 2.8 × 1 cm was finally revealed . The detailful preoperative localization of the present mediastinal adenoma which was in close relation with various anatomical structures of the thorax, reduced effectively the difficulty of the mass excision and the potentiality of accidental surgical injuries which may lead to thoracic bleeding and subsequent obstructive symptoms.
+Then, the operation continued in the usual fashion and a drainage was placed into the left side of the thoracic cavity. The patient was discharged the 5th postoperative day with instructions, when the drainage was finally removed.
+Histology of the mass confirmed the diagnosis of ectopic parathyroid adenoma that was composed predominantly of oxyphil cells arranged in an acinar pattern. Serum calcium level was 2.60 mmol/L and iPTH 17.6 pg/mL 12 h after the operation. Serum calcium and iPTH remained normal after 6 months’ follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1860_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1860_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a1cb13a3b42834af05d3355d0430be0f724140b1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1860_en.txt
@@ -0,0 +1,5 @@
+A 4-year-old Caucasian boy presented to a regional hospital with a one-week history of general malaise, indolence, mild fever and progressive anorexia. Three days prior to presentation at the hospital he had started to refuse all food and fluids, accompanied by a progressive dysphagia, sore throat and sialorrhoea. An otorhinolaryngologist had been consulted two days before presentation, who had considered a peritonsillar abscess. However, his examination at that time did not provide any clues for an oropharyngeal infection. Subsequently, the boy demonstrated increased difficulties with opening his mouth and experienced a progressive dehydration. Due to the parents' concern about the refusal of fluids and dehydration, a pediatrician was consulted.
+The history revealed that the boy had recently injured his left hallux. This had resulted in a small local hematoma and loose toenail. There were no recorded insect or animal bites. Based on religious grounds, the boy had not received immunization according to the Dutch National Immunization Program. The other children, including his identical twin, were healthy.
+On physical examination in the regional hospital we saw an afebrile, irritable and anxious boy gently playing at the table, with trismus and mild dehydration. After being asked to walk, he showed muscle spasms of the back and thighs evidently worsening during examination. There was no cervical lymphadenopathy and the ear and nose examination was unremarkable. Inspection of the oropharynx was not possible due to trismus. Tendon reflexes were normal, there was no meningeal irritation. The loose toenail did not show clear signs of inflammation. The heart rate was slightly increased, the blood pressure was normal and further clinical examination was unremarkable. The initial differential diagnosis included oropharyngeal infections (e.g. tonsillitis, peritonsillar abscess), botulism, rabies, strychnine poisoning, hypocalcemia, psychogenic causes and tetanus. Based on normal complete blood cell count and chemistry profiles, immunization status and the presence of generalized muscle spasms and a possible portal of entry, the working diagnosis 'generalized tetanus' was established.
+Treatment was initiated immediately with the administration of anti-tetanus immunoglobulins (3000 IU i.m.) and amoxicillin (100 mg/kg i.v.). In order to prevent respiratory failure, the boy was intubated and mechanical ventilation was started. Thereafter the boy was transferred to the pediatric intensive care unit (PICU) Figure ) for further treatment. The antibiotic regimen was then converted to metronidazole (30 mg/kg/day i.v.) for 10 days in accordance with local guidelines. On the second day of admittance, surgical debridement of the left hallux toenail was performed . In addition, the second intramuscular dosage of anti-tetanus immunoglobulins was administered. Active immunization against diphteria, tetanus and polio (DTP) was started after one week. Despite evident clinical signs of tetanus, repeated blood and wound cultures were negative for C. tetani. During the entire stay at the PICU repeated cultures of blood, urine and tracheal aspirates remained negative and white blood cell counts remained unremarkable. In contrast, CRP levels increased to a maximum of 63 mg/L at day 6 of PICU stay .
+In the second week, the frequency and severity of muscle spasms and trismus significantly worsened. Dosages of midazolam and morphine (i.v.) were increased and clonidine and lorazepam were added to the regimen. In this period, creatine kinase levels were maximal on day 12 at 945 U/mL [reference value: 15-175 U/mL] . Due to anxiety, haloperidol was started. The frequency of muscle spasms and anxiety decreased in the third week, after which gradual weaning off sedatives was started. Uneventful extubation was performed at day 16. Two short periods with increased muscle spasms occurred thereafter, which were successfully treated with diazepam. On day 21 he was transferred back to the referring hospital where he was discharged after 9 days. During regular follow-up visits to the outpatient clinic, no adverse long-term effects were registered.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1866_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1866_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ed099ae5535b871cd70806bb2503024ed4a10ef1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1866_en.txt
@@ -0,0 +1,4 @@
+A 55-year-old male who underwent a radical surgical procedure was referred to our medical facility for further evaluation and management of a local recurrence of anastomosis. The patient previously underwent laparoscopic high anterior resection and Japanese D2 lymph node dissection after being diagnosed with rectosigmoid cancer at the age of 53 years. According to the ninth edition of the Union for International Cancer Control , rectal cancer was pathologically diagnosed as pT3N0M0 Stage IIA. After surgery, the patient received adjuvant therapy of uracil–tegafur and leucovorin for a year at the previous hospital. He was symptom-free for 1 year and 3 months, and no signs of recurrence were observed.
+One year and 3 months after the surgery, the serum level of carcinoembryonic antigen increased to 20.2 ng/mL. CT scan indicated the development of a tumor at the anastomosis site that was massively attached to the upper part of the sacrum and a small nodule, and it was suspected that peritoneal dissemination was present on the ventral right side of the anastomosis . In addition, a positron emission tomography–CT scan confirmed an abnormally high accumulation of 2-[18F]-fluoro-2-deoxy-D-glucose on the recurrent lesion . A colonoscopy confirmed the diagnosis of LRRC , and histopathological examination of the biopsy specimens revealed adenocarcinoma cells. LRRC was deemed unresectable for R0 clearance and was genetically characterized as RAS wild type. Therefore, we administered systemic chemotherapy with mFOLFOX6 and panitumumab. The recurrent tumor shrank after 11 rounds of treatment, the diminutive nodule near the anastomosis disappeared, and no signs of distant metastasis were observed. However, the recurring tumor remained in contact with the upper part of the sacrum . We determined that radical surgical resection was still not possible, and CIRT facility was consulted. It was determined that CIRT could not be performed because of the close proximity of the intestinal anastomotic site. This was decided based on the fact that the dose of CIRT is higher than the dose tolerable for the intestinal tract, and its proximity to the intestinal tract can increase the risk of ulcers, bleeding, and perforation. Therefore, it was proposed that the exposed intestinal tract should be removed within 1–2 months after CIRT considering its late toxicities. The patient provided informed consent and selected multidisciplinary therapy incorporating CIRT as the treatment option.
+CIRT was administered daily 4 days/week for 16 fractions. The total irradiated dose was set at 73.6 Gy (relative biological effectiveness–weighted dose [RBE]). The radiation field included the tumor with a 10-mm margin. As a result, approximately 5 cm of the intestinal tract was included in the irradiated area . The patient was re-evaluated 1 month after irradiation with multiple imaging studies, but no significant changes in the tumor were observed. In addition, there were no significant adverse effects in the intestinal tract, except for light erythema, mucosal edema, and erosion at the anastomosis .
+Surgical removal was performed as planned 8 weeks after CIRT. Surgery was performed laparoscopically with regional removal of the intestine. Despite the presence of adhesions that seemed to be related to the prior surgery, no significant adhesions with other organs were detected within the CIRT-irradiated area. In the irradiated area, the tissue was extremely firm owing to severe fibrosis, thus making it difficult to distinguish the dissected layer. Therefore, we proceeded with sharp dissection as close as possible to the sacrum, with the connective tissue being sharply dissected along the sacral surface using monopolar electronic scalpels and ultrasonically activated devices. This dissection line was selected to prevent any exposure of the intestinal lumen. However, sharp dissection resulted in a significant amount of exudate production, thus making it difficult to maintain a clear field of view during the surgical procedure within the pelvis. We verified the anastomosis from the prior surgery using intraoperative colonoscopy. Further, we estimated the extent of irradiated bowel based on the distance from the anastomosis using the preoperative irradiation map as a guide. The physician who designed and performed preoperative CIRT participated in the surgery and provided advice on the resection line. The rectum was resected 2 cm distal to the anastomotic tumor, and the entire irradiated bowel was removed . Re-anastomosis was performed using the double-stapling technique, and a temporary loop ileostomy was constructed. No complications were observed except for a paralytic ileus, which delayed the start of meals for 7 days. Histopathological examination of the removed rectum revealed massive fibrosis and scattered small numbers of cancer cells . The nuclei of these cancer cells showed irregularly marked swelling and chromatin clumping . Because of intimal thickening that contained foamy cells, small vascular lumen was narrowed near these degenerated cancer cells . These morphological changes suggested the presence of the CIRT effect, which was estimated as TRG3 according to the previously proposed criteria . No adjuvant therapy was administered, and tumor markers and imaging were performed every 3 months after the surgery. The temporary ileostomy was closed 8 months after the surgical intervention. The quality of life of the patient, especially defecation function, was maintained. The patient continues to survive with no obvious signs of recurrence 24 months after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1872_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1872_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..40a5882fa04496ed2152b6287b8d058ceb3cf160
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1872_en.txt
@@ -0,0 +1,3 @@
+17 year old girl presented to Emergency department with fever, malaise for 3 months, left foot gangrene for 2 months, left sided hemiparesis for 4 days. A diagnosis of Infective Endocarditis was made on Transthoracic echo and percutaneous embolectomy was attempted at another hospital which was complicated by a left hemiplegia. On examination she was found to be tachycardiac, tachypneic, hypotensive and febrile. GCS was 4/15 and she had a left hemiplegia. Left foot showed gangrene of the medial 3 digits and peripheral pulses including the posterior tibial and dorsalis pedis of the left were weak. There was a pansystolic murmur at the apex with radiation to the axilla and another early diastolic murmur at the aortic area radiating to the carotids. CT scan brain was done that showed a right middle cerebral artery stroke. Transthoracic echo was done which revealed large vegetation on both mitral valve leaflets with a size of 32 X 15 mm on the posterior mitral leaflet ( Additional file : Pic. 1). Vegetation was also seen at the septal leaflet of tricuspid valve and aortic valve.
+Histopathology of her vegetations revealed moderate acute and chronic inflammation with fibrin and granulation tissue formation along with granulomas. The mitral valve showed focal necrosis with calcification . The granulomas were composed of typical epitheloid cells and multinucleated giant cells. Cultures of the aortic valve for Acid Fast Bacilli were negative.
+She underwent dual valve replacement for mitral and aortic valves and the tricuspid valve was repaired surgically as it was anatomically intact ( Additional file : Pics. 2, 3). She was weak on her left side and required regular physiotherapy. Antituberculous therapy was started with anticoagulation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1880_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1880_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..acb55c9c12d84a20851c66d6fe413ecf89968bef
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1880_en.txt
@@ -0,0 +1,4 @@
+A 61-year-old gentleman admitted 3 months ago because of multiple pulmonary nodules which had been found in health examination. HRCT showed that there were two nodules, including one solid pulmonary nodule (SPN) that was located at the right upper lobe and one GGO at the right lower lobe . Other preoperative examinations showed no contraindications. A right upper lobectomy and right lower lobe wedge resection by single-port video-assisted thoracic surgery (VATS) were performed, and about 3 h before the operation, a CT-guided hook wire localization of the GGO was performed in radiology department. According to the CT scan, the hook wire was inserted 3 cm deep into the pulmonary parenchyma and the hook-shaped tip was fixed 1.8 cm away from the GGO . There was no pneumothorax or hemothorax during this procedure.
+General anesthesia was performed and then a 4 cm incision was made at the pivot of the fourth intercostal space and the anterior axillary line. While entering the thorax, the hookwire was found still attached to the right lower lobe and the tail outside the thorax was cut off to avoid bacterial contamination. As we planed before, the first step of the operation was wedge resection of the right lower lobe. After several attempts to search for the GGO by manual palpation, the hookwire was submerged in pulmonary parenchyma and could not be touched. A 1 cm incision at the pivot of the eighth intercostal space and the midaxillary line and a 3 cm incision at the pivot of the eighth intercostal space and the posterior axillary line were added but still helpless. Then the patient was sent to the radiologist department where a CT scan was performed and the hookwire was found in the artery of apical segment of right upper lobe, which was planned to be removed . When the patient was sent back to the theater, the operation continued from right lower lobe wedge resection, then right upper lobectomy. After successfully dissecting pulmonary vein and superior bronchus of the right upper lobe with endoscopic stapler (Ethicon), we ligatured and cut arteries of right upper lobe one by one manually but did not find the hookwire. Afterwards, a second CT scan was performed and the hookwire was found in the artery of apicoposterior segment of left upper lobe . Since this foreign body could not be reached through right thoracic cavity, the vascular surgery department was consulted after the incisions were closed. Following the suggestion of consultation, the patient was prepared to receive interventional therapy under digital substraction angiography (DSA).
+As shown on the DSA images, the hook wire was still in the artery of apicoposterior segment of left upper lobe . A guide wire was inserted through right femoral vein to the target artery, subsequently, an endoloop was inserted to hitch the hookwire and extract it out . During the process of DSA, there was no bradycardia, tachycardia or arrhythmia.
+The patient was eventually discharged 15 days after surgery. Low molecular weight heparin was injected in subcutaneous tissue two times a day from the second day after surgery to discharge day. The pathological results indicated that the SPN in right upper lobe was an invasive adenocarcinoma, while the GGO in right lower lobe was a minimally invasive adenocarcinoma, and there was no metastatic lymph node. The patient received follow-up CT scan 3 months after surgery, which showed no obvious abnormality.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1885_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1885_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0bf8b1725d34f0e4e9dc1da97d58435b2f079cc5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1885_en.txt
@@ -0,0 +1,6 @@
+A 19-year-old Hispanic female with a past medical history of acne, asthma, and extensive psychosocial distress but no psychiatric diagnoses, presented to the ED with complaints of an episode of lightheadedness, generalized weakness, diaphoresis, diarrhea, and vomiting. Previously, she presented to the hospital with similar complaints two other times; however, she was not seen by our team until the third visit. On this first visit she stated that she used the blood glucose monitor of her girlfriend/roommate, who is a type 1 diabetic, and that her blood sugar reading was 53 mg/dL and later rose to 80 mg/dL after she ate two sandwiches and some chocolate. Upon arriving to the ED, the patient’s symptoms had improved. Vital signs obtained at the time of triage were: blood pressure (BP) 98/65 mmHg, heart rate 81 beats per minute (bpm), respiratory rate 18 breaths per min, oxygen saturation (SpO2) of 100% on room air, and an oral temperature of 37 °C (98.6 °F). The patient reported no pertinent past surgical history. She stated that she was allergic to pineapples and that she does not take any medications. In addition, she did not report any tobacco or alcohol use. Initial examination revealed a well-developed, asymptomatic, obese young female in no acute distress. Her blood glucose according to the glucose monitor was 60 mg/dL, which was confirmed with lab draw. Physical exam and labs were unremarkable, and the patient was discharged after being given intravenous (IV) 0.9% sodium chloride (NaCl) for volume restoration, ondansetron for her nausea and vomiting, further directions on diet for hypoglycemia (i.e. adding protein to each meal and eating small frequent meals), and instructions on follow-up with her primary care provider (PCP) for recommendation on further testing for the cause of her hypoglycemic episode and GI symptoms.
+The next day, the patient arrived via emergency medical services (EMS) to the ED after she was found unresponsive. She stated that she was not feeling too well due to a virus and became very lightheaded and passed out. Her blood sugar was 46 mg/dL at home prior to administration of half an ampule of dextrose (D50W). Her family mentioned the patient has a history of her blood sugar dropping rather frequently and that they are unsure what to do for this problem. Vital signs obtained at the time of triage were: BP 122/75 mmHg, heart rate 100 bpm, respiratory rate 18 breaths per minute, SpO2 of 100% on room air, and an oral temperature of 36.7 °C (98 °F). Physical exam and other labs were unremarkable, and the patient was discharged after being given instructions once again on following-up with a PCP.
+Three weeks after her initial presentation, she was rushed to the ED via EMS after being found unresponsive at work with a blood glucose level of 23 mg/dL. She was given 1 ampule of IV D50W by EMS at the scene and her blood sugar rose to 172 mg/dL. Upon arrival to the ED, her blood sugar had dropped back down to 61 mg/dL; and she was noted to again have symptoms of dizziness and decreased alertness with her hypoglycemia. Vital signs obtained at the time of triage were: BP 135/78 mmHg, heart rate 108 bpm, respiratory rate 18 breaths per minute, SpO2 of 100% on room air, and an oral temperature of 36.4 °C (97.6 °F). She was given one half of an ampule of D50W IV because of her symptoms of dizziness and evidence of decreased alertness with a decreased blood glucose level, which was suspected to still be dropping. She responded to this treatment with improvement of dizziness and alertness but later had a second hypoglycemic episode in the ED. At this time she was treated with a full ampule of D50W IV and was started on dextrose 5% with 0.45% NaCl (D5 half-normal). Despite a brief improvement a few minutes after starting D5 half-normal, she had a third episode of hypoglycemia in the ED and was treated with another ampule of D50W IV and her IV changed to dextrose 10% in water (D10W) at 100 cm3 (cc’s) an hour. Despite this change, her blood glucose further dropped to 105 mg/dL from 140 mg/dL, so her D10W was increased to 150 cc’s an hour. Detailed glucose readings throughout this time are reported in Table . Her girlfriend/roommate was asked to leave the patient to rest, in order to help determine whether the patient, her roommate, or both might be involved in giving insulin to cause the abrupt hypoglycemic episodes. The patient was weak, confused, profusely sweating with chills, short of breath, nauseated, had heart palpitations, and an altered mental status during all of her hypoglycemic episodes. Of note, once alert, the patient told the charge nurse that her PCP had found a mass in her pancreas that was responsible for her hypoglycemic episodes. Due to the critical nature of her recurrent hypoglycemic episodes in the ED, the patient was admitted to the ICU, where she became more responsive. An electrocardiogram demonstrated normal sinus rhythm, normal axis and intervals, and no acute changes in ST-segment or T wave morphology. The laboratory findings from all three ED visits are reported in Table .
+Standard drug screen was done to rule out any symptoms from toxicity; however the results were negative. To determine if factitious use of insulin was the cause for the patient’s presentation, further tests were performed: hemoglobin A1C of 5.1%, C-peptide level of 9.9 ng/mL, free insulin level of 370 mIU/L and a total insulin level of 377 mIU/L.
+To rule out any neurological causes, a computed tomography (CT) scan of the head without IV contrast was performed and revealed no evidence of intracranial findings or suspicious intracranial mass. To rule out any pancreatic masses, CT of the abdomen was obtained and showed a 1.8 cm collapsing cyst in the right ovary and trace fluid in the pelvis, which is likely physiological . Otherwise, no acute intra-abdominal or intra-pelvic process was seen.
+The patient was interviewed at length by the ED hospital team in the ICU the following day, and the diagnosis of factitious disorder was suggested. The encounter revealed that the patient is an undocumented immigrant from Honduras, who has been in the US since she was 14 years old. She used to reside with foster parents. However, she recently graduated from being a minor and is currently living at a halfway house with four other women. She works full-time at a thrift store. She is unaware of her family history. She states that she was heavily involved with illicit drug use in the past but does not smoke or drink alcohol anymore. When confronted with evidence about no mass found on imaging, the patient did not deny injecting insulin. She had significant knowledge about insulin administration as well as the amount of units her girlfriend/roommate currently injects for her type 1 diabetes management. She mentioned that she frequently checks her blood sugar at home, where her readings range from 30s – 100 s mg/dL. The patient reported missing several meals throughout the day due to time restraints and work. Her caregiver called the hospital to let the hospital staff know that the patient had been taking her girlfriend/roommate’s insulin resulting in her previous ED visits. She has also asked for insulin needles and may have taken insulin to gain attention.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1887_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1887_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..28d020c1a66e568b3ed8084c8d9ec150922441d6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1887_en.txt
@@ -0,0 +1,6 @@
+A five-year and nine-month-old female was referred to pediatric endocrinology consultation for central hypothyroidism, short stature, and hyperprolactinemia. At first examination, her weight was 17.5 ± -1.19 kg (mean ± SD and height 94.8 ± -4.62 cm. She had a peculiar phenotype with rounded facies, micrognathia, broad forehead, strabismus, tapering/slender fingers, hypotonia of the lower limbs, muscle atrophy in the distal third of the lower extremities, and equinovarus feet. The patient did not walk independently until orthopedic shoes and walker were provided. The external genitalia were normal of a female.
+She was born at term with a birth weight of 3550 g, height of 49 cm and head circumference of 36 cm. She required admission to the neonatology unit due to moderate neonatal depression, axial hypotonia with hypertonia of the upper limbs, weak suction with difficultly in swallowing, and frequent choking episodes with aspiration pneumonia.
+The patient was followed-up by pediatric gastroenterology section for gastroesophageal reflux disease and recurrent pneumonia. She received omeprazole to treat the GI problem. She has recurrent crises of abdominal pain since the first year of life. These crises were preceded by presyncopal symptoms that include sweating, pallor, hypotonia, and decay, which occur every two or three months. Abdominal ultrasonography and brain magnetic resonance imaging (MRI) were normal. An upper gastrointestinal endoscopy was performed and confirmed a gastric volvulus; therefore, a gastropexy was performed. After surgery, she continued episodes of abdominal pain. In the last ultrasound scan, findings of intrahepatic portosystemic shunt were observed. These findings were confirmed with abdominal computed tomography (CT) scan evidencing an intrahepatic cavo-caval shunt with agenesis/hypoplasia of the intrahepatic inferior vena cava. Liver function and ammonium levels were normal.
+She also presented signs of autism disorder, poor language development and a global developmental delay. Multiple genetic studies were performed without any etiological diagnosis: karyotype, array-CGH, and methylation test for Prader-Willi/Angelman alterations on 15q11-q13 as previously reported . Electromyography showed a myopathic pattern with continuous myotonia. Muscle biopsy was normal and genetic testing for myotonic dystrophy was negative. Genomic DNA from blood samples of the patient and her parents were collected for whole-exome sequencing. A DNA library was prepared using the Ion AmpliSeqTM Exome RDY kit (Thermo Fisher Scientific), and sequencing of the DNA library was performed with ion proton sequencing technology. The Ion Reporter version 5.0 platform was used to align the patient’s and her parents’ data to the reference genome and identify genetic variants. Variant data were filtered using population frequency, frequency in database of in-house samples, mode of inheritance, evolutionary conservation, functional predictors, and disease association, followed by detailed assessment for genotype-phenotype correlation, disease mechanism, and literature review, as described previously . After exome sequencing and variant prioritization, the presence of the heterozygous variant c.3019 C > T in the MAGEL2 gene resulting in the occurrence of a premature stop codon (p.Gln1007Ter) was detected. Since neither of her parents presented this change, this variant seemed to develop de novo in the patient. In addition, a methylation test was performed in order to determine if this mutation was present in the active or inactivated allele of the gene. The expression of this gene is subjected to imprinting, in such a way that the maternal copy is not active due to a hypermethylation of the CpG island present around the 5’ end of MAGEL2 gene. The analysis of the variant after using restriction enzymes sensitive to methylation allowed to conclude that this variant was indeed present in the allele of paternal origin, that is, in the only active copy of the gene. Accordingly, this change c.3019 C > T detected in the MAGEL2 gene was considered pathogenic and the cause of most, if not all, of the clinical manifestations present in the patient (Appendix 1 in Supplementary File).
+From an endocrinological point of view, at the age of four, the patient’s blood test revealed signs of central hypothyroidism, hyperprolactinemia, and GH deficiency (thyroid-stimulating Hormone (TSH): 6.01 mU/L (ranged 0.5 - 4), free T4: 0.74 ng/dL (ranged 0.7 - 1.9), prolactin 452 ng/mL (ranged 2 - 29), insulin-like growth factor (IGF) - 1 < 25 ng/mL (ranged 32 - 259). Upon confirming these findings, she started treatment with L-thyroxine. When she was six years old she started treatment with recombinant human growth hormone (rhGH), 0.02 mg/kg/day, by subcutaneous injection, but the treatment was discontinued after one or two months because of benign intracranial hypertension. Therapy was restarted when she was nine years old with a height of 101.2 ± 5.74 cm. The first-year growth response was the following: height 109.6 ± -4.72 cm and growth rate of 9.1 cm per year (P100). After two years, her height was 120.3 ± -4.09 cm. Adherence to rhGH was positive with a rise in the IGF-1 levels ranging 97 - 150 ng/mL. Under treatment, the muscular tone also improved and the patient started to walk. Prolactin levels normalized, but high values of ACTH (aderno cortico tropic hormone) were observed with normal cortisol values (ACTH 370 pg/mL (ranged 9.0 - 40.0), basal cortisol 11.5 μg/dL (8h: 6.20 - 19.40) in the last blood tests. The patient is closely monitored.
+In addition, the patient underwent surgery to correct her equinovarus foot deformity and is receiving rehabilitation treatment. She has also improved cognitively and is attending a special education school, presenting a good level of understanding although language continues to be dysprosodic. In sum, the patient has a moderate level of dependence in daily life activities.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1890_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1890_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f6f3b6cd6926014c81d093147c5aea6cdf72fc37
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1890_en.txt
@@ -0,0 +1,7 @@
+A 48-year-old woman (height 165 cm, weight 67 kg) had been hospitalized for schizophrenia in a psychiatric hospital. She had been prescribed sultopride hydrochloride, risperidone, and zotepine. Seven months prior to surgery, she was found to have developed dyspnea and palpitation on exertion, and lower leg edema. Computed tomography (CT) revealed thrombi in the main trunk of the left pulmonary artery as well as in the peripheries of the bilateral pulmonary arteries, confirming the diagnosis of pulmonary embolism. Transthoracic echocardiography showed a dilated right ventricle (RV) with moderate tricuspid valve regurgitation (TR) and an estimated mPAP of 43 mmHg, indicating PH . Anticoagulant therapy was started with apixaban.
+Five months prior to surgery, anticoagulant therapy was discontinued because of irregular genital bleeding, but it was resumed 2 weeks subsequently because of the reappearance of pulmonary embolism symptoms. Six weeks prior to surgery, anticoagulant therapy was again temporarily discontinued as a result of increased genital bleeding. She was diagnosed with endometrial cancer, and total hysterectomy was scheduled.
+Two weeks prior to surgery, she was transferred to our institution from the psychiatric hospital. Her vital parameters at admission were as follows: heart rate of 72 beats/min, blood pressure of 124/86 mmHg, and percutaneous oxygen saturation (SpO2) of 92% under oxygen administration of 2 L/min. She had severe edema of the lower extremities and jugular vein distention. Transthoracic echocardiography showed a dilated RV with flattening of the interventricular septum and with moderate TR, in addition to an estimated mPAP of 54 mmHg, suggesting severe PH . The left ventricle (LV) appeared D-shaped with preserved systolic function and exhibited an ejection fraction of 66%. Although CT showed no emboli in the pulmonary trunk , multiple blood flow defects revealed by lung perfusion scan suggested multiple emboli in the distal pulmonary artery , leading to the diagnosis of CTEPH, and promoted physicians to perform BPA in order to decrease mPAP before surgery.
+Two BPA sessions were performed for bilateral pulmonary arteries by interventional cardiologists in another expert institution over a span of 6 days. The first BPA for A1, A2, A3, and A9 was performed, and the second BPA for A8b, A10a, and A10b was performed under local anesthesia. After BPA, SpO2 increased from 86 to 91%. Transthoracic echocardiography performed 2 days after the second BPA showed an improvement in the deformity of the LV and mild TR, and the estimated mPAP decreased to 33 mmHg . After the first BPA, warfarin was started and stopped the day before surgery, and preoperative bridging with heparin was initiated. We could not assess whether the subjective symptoms and exercise capacity of the patient improved after BPA, since she had stayed in bed all day because of depression in schizophrenia.
+Total hysterectomy was performed 3 days after the second BPA. General anesthesia was selected because of the patient’s unstable mental status and perioperative anticoagulant therapy. Upon entering the operating room, her heart rate was 66 beats/min, blood pressure was 128/82 mmHg, and SpO2 was 92% under oxygen administration of 2 L/min. General anesthesia was induced using midazolam 3 mg, continuous infusion of remifentanil 0.1 μg/kg/min, and fentanyl 200 μg. After administration of rocuronium 40 mg, tracheal intubation was performed. Anesthesia was maintained using desflurane 3–4% in a 45% oxygen–air mixture with continuous infusion of remifentanil 0.1–0.2 μg/kg/min. A pulmonary artery catheter (PAC) was inserted in the right internal jugular vein. Transesophageal echocardiography (TEE) showed RV enlargement with mild TR and shape distortion of the interventricular septum during systole.
+Introducer sheaths were placed in the right femoral artery and vein to allow for venoarterial extracorporeal membrane oxygenation in preparation for pulmonary hypertensive crisis. Hypoxia, hypercapnia, acidosis, hypothermia, and inadequate analgesia were avoided to prevent increase of pulmonary vascular resistance . At 10 min after hysterectomy, the patient’s blood pressure decreased to 58/35 mmHg, with a pulmonary artery pressure (PAP) of 28/19 mmHg. TEE indicated that there was no observable change in the size of the RV and LV cavity with mild TR; therefore, we determined that the patient was not in a pulmonary hypertensive crisis. The cause of the temporary hypotension was unclear; however, it was restored rapidly after administration of a total of 12 mg ephedrine. Thereafter, values ranged 90–120/50–60 mmHg for blood pressure, 30–40 mmHg for mPAP, and 1.9–2.4 L/min/m2 for cardiac index.
+No vasopressor other than ephedrine was required. The operation time was 1 h and 36 min and blood loss was 88 g. Because of concerns about postoperative restlessness, the TEE probe, PAC, and introducer sheaths were removed before awakening. The patient was promptly awakened and the endotracheal tube was removed. Effective postoperative analgesia was achieved with intravenous patient-controlled analgesia using fentanyl. Postoperatively, the patient was managed in the general gynecology ward. On the fifth day after surgery, anticoagulant therapy was restarted with apixaban. Transthoracic echocardiography showed mild TR, with an estimated mPAP of 28 mmHg and no worsening of PH . The patient was transferred to the psychiatric hospital on the 19th day after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1891_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1891_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..91bef94cd9f137be0835cc1d1d725ae03a1331a6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1891_en.txt
@@ -0,0 +1,4 @@
+A 2-year-6-month-old girl was referred to our hospital due to complaints of fever, cough, and tachypnea 10 days prior to her presentation. Upon admission, physical examinations revealed a body temperature of 38.5 °C, and percutaneous oxygen saturation (SpO2) was 67% in room air. Chest auscultation revealed fine crackles in the posterior lung fields. Clubbing fingers, pigeon breast deformity, and chilblain-like rash on her face were observed . Her anterior fontanelle was not closed (0.3 cm×0.3 cm). Other cutaneous manifestations were not observed. The patient displayed a height of 87 cm (-1.08 SD) and a weight of 11.5 kg (-0.82 SD). The patient experienced recurrent respiratory tract infections since the age of 6 months (once a month), and fatigue after activities was noticed beginning at 2 years of age. Family history found that her 27-year-old father had chest tightness and shortness of breath after activity beginning at 22 years of age. The clubbed fingers presented in all limbs, and mild tissue loss showed up on his face . Chest high-resolution computed tomography (HRCT) showed interstitial pneumonia with pulmonary cyst , and pulmonary function tests indicated mixed ventilation dysfunction. Combined with positive levels of antinuclear antibodies (ANA) and signal recognition particles (SRP) autoantibody, he was initially diagnosed with connective tissue disease (CTD) associated with ILD. After receiving combined therapy with cyclophosphamide and hydroxychloroquine for half a year, the symptoms have been improved while continuing to take hydroxychloroquine. However, about three years ago, the drug was stopped for unknown reasons, and the symptoms of dyspnea reappeared and slowly progressed.
+Laboratory examinations of the female patient found an elevation in the levels of C-reactive protein (CRP, 54.19 mg/L, reference range: <8 mg/L), erythrocyte sedimentation rate (ESR, 89 mm/H, reference range: <20 mm/H), and white blood cell count (WBC, 16.3 × 103/mm3, reference range: 4 to 10 × 103/mm3). There was no elevation of hepatobiliary enzymes, and her renal and thyroid functions were normal. The autoimmune workup revealed elevated levels of IgG (25.3 g/L), IgA (3.26 g/L), and IgM (1.69 g/L) despite normal levels of C3 and C4 complement. Decreased CD4 + T lymphocyte counts and normal CD8 + T lymphocyte counts were identified. This patient was positive for auto-antibodies, including high-titer ANA (1:1000), anti-neutrophil cytoplasmic antibodies (ANCA), rheumatoid factor (RF), and anti-cyclic citrullinated peptide (CCP) antibodies. Cytokine testing showed an elevated interleukin (IL)-6 level (62.4 pg/ml, reference range: 1.7 to 16.6 pg/ml). Pathology tests were negative, and malignancy was ruled out. HRCT scanning of the chest exhibited diffuse ground-glass opacities . Brain magnetic resonance imaging showed widened cerebral sulci and enlarged extra-axial spaces. No abnormalities were found in the electrocardiogram or the echocardiogram. The results of abdominal ultrasound and vascular ultrasonography were normal.
+The female (child) patient was initially diagnosed with ILD accompanied by severe pneumonia and received anti-infection treatment with intravenous immunoglobulin (IVIG) (2 g/kg). However, the patient’s symptoms did not respond to the treatment , and she experienced hypoxic respiratory failure on Day 12, which required endotracheal intubation and mechanical ventilation. Therapies with methylprednisolone (MP) pulse (30 mg/kg/d×5d) were started on Day 13 followed by intravenous MP in 4 mg/kg daily dosage combined with a second course of IVIG (1 g/kg/d×3d). After the treatment, symptoms of dyspnea improved, and the ventilator was withdrawn on Day 22. At the same time, whole-exome sequencing was also performed, and genetic analysis by Sanger sequencing confirmed a heterozygous mutation (c.463G > A p.V155M) in Exon 5 of STING1 (NM_198282), which had been described to cause SAVI. The mutation was inherited from her father . RNA sequencing on the proband and her father was conducted, which found that the expression of genes related to the interferon pathway was significantly upregulated compared to that of healthy controls . After the diagnosis of SAVI, baricitinib (2.5 mg/day gradually increased to 3 times a day within 2 weeks) was added with prophylactic trimethoprim/ sulfamethoxazole, and the dose of MP was reduced to 2 mg/kg/d on Day 32. Under appropriate treatment, the patient’s symptoms of fever, tachypnea, breathlessness, and cyanosis improved, while the repeated chest HRCT showed a better result . Low-flow oxygen support (SpO2 at 94–95% in room air) was required, and the patient was discharged on Day 48, following the treatment of MP (1 mg/kg/d) and baricitinib (reduced to 2 mg three times a day). The female (child) patient was followed for 14 months after discharge. She was infected with severe pneumonia in the fourth month. Although the respiratory symptoms improved after antibiotic therapy, combined treatment with pirfenidone (2.5 mg twice-daily dosage) was administered due to the progressed interstitial pneumonia observed in HRCT . In the sixth month, we reduced the MP dose to 2 mg/d (0.13 mg/kg/d), which has been maintained until now. During the follow-up, the lung HRCT scan was stable after treatment ; however, there was no obvious improvement. Laboratory indicators are still positive for ANA (1:1000), p-ANCA, RF, and CCP, while high IgG, IgA, and IgM immunoglobulin counts and low CD4 + T lymphocyte counts remain. Levels of inflammatory markers like CRP and IL-6 were normal, while levels of ESR (29 mm/H) and IFN-γ (20.1 pg/ml) were slightly elevated. Nevertheless, the evaluation of clinical features showed that the respiratory signs and symptoms have almost disappeared, except for slight dyspnea after strenuous exercise. The patient’s height increased from 87 cm (-1.08 SD) to 100 cm (-0.66 SD), weight increased from 11.5 kg (-0.82 SD) to 15.5 kg (-0.28 SD), and the fontanel closed. The little girl now lives a normal life.
+After diagnosis, the male (father) patient received oral steroids and tofacitinib combination therapy for over a year, but there was no significant improvement in pulmonary symptoms. Six months ago, tofacitinib was changed to baricitinib combined with oral steroids, and the patient felt an improvement in breathing difficulties. However, similarly, there was no improvement in pulmonary imaging findings.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_189_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_189_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9df1c140f97b43f2a5ed56e5e12f0b61ea74c33a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_189_en.txt
@@ -0,0 +1,19 @@
+A 69 year old Hispanic female with a past medical history significant for hypertension, diabetes mellitus, coronary artery disease status post revascularization, ischemic cardiomyopathy and chronic kidney disease had presented to our hospital for further evaluation and care. For the past few months the patient had suffered weight loss (approximately 30–35 lb), generalized malaise, low grade fevers (99.9 F), non-productive cough, myalgias and arthralgias. She did not endorse any night sweats or recent travel history, and there were no sick contacts at home. Prior to admission to our institution the patient was at an outside hospital and was being treated for sepsis with combinations of antibiotics including intravenous vancomycin, meropenem, echinocandin, metronidazole, and piperacillin tazobactam for 2 to 3 weeks duration as she was developing fevers and productive cough.
+The physical exam yielded a thin and chronically ill appearing female patient.
+Vital signs at the time of admission were notable for hypertension (186/79 mmHg). Her eyes did not show any conjunctival hemorrhaging or icterus, however there was conjunctival pallor. Oropharynx did not show any active exudates or ulcerative lesions. Her cardiac exam did not reveal any murmurs and her airways were clear to auscultation. Abdominal exam revealed palpable splenomegaly. Examination of the extremities did not show nail deformities including splinter hemorrhages or nail pitting. Her skin had no evidence of skin nodularities or other lesions. There was a 1 cm non tender, movable left axillary lymph node. The rest of the physical examination was unremarkable.
+Initial laboratory work revealed that the patient had pancytopenia. White blood cell count (WBC) was stated at 2.4 K/uL, absolute neutrophil count (ANC) 1.92 K/uL, hemoglobin (Hgb) of 11.6, and platelet count of 39,000/uL. B2-microglobulin was seen elevated at 9.2 mg/L. Basic metabolic panel obtained showed sodium 134 mEq/L, Potassium 3.5 mEq/L, Chloride 103 mEq/L, Bicarbonate 26 mEq/L, Blood urea nitrogen 30 mg/dl, Creatinine 0.90 mg/dl, glucose 220 mg/dl. Liver function panel showed Albumin 2.2 g/dl, normal transaminases, total bilirubin 0.8 mg/dl, direct bilirubin 0.4 mg/dl. Urine analysis showed 200 mg/dl of protein and occasional amorphous crystals.
+Initial computed tomography (CT) scan of the abdomen and pelvis during hospital admission showed a 15 cm spleen which was heterogenous and micronodular, as well as scattered abdominal and pelvic lymphadenopathy . No imaging signs of portal hypertension were noted.
+During the hospitalization our patient was noted to become more confused and agitated, and there was concern that the patient was having seizures as she was seen numerous times to lose consciousness and awaken, with occasional loss of bladder function. A brain magnetic resonance imaging (MRI) showed subcortical non enhancing FLAIR hyper intense foci in the bilateral posterior occipital lobes.
+Lumbar puncture and cerebral spinal fluid (CSF) studies were further performed for further analysis, and showed: WBC 1; no red blood cells; protein 62 mg/dL; glucose 35 mg/dL; and, lactate dehydrogenase 234 mIU/mL. Most notable negative findings in the CSF included no detectable viral cultures for cytomegalovirus, adenovirus, herpes virus, and varicella zoster virus, negative cryptococcal antigen serology and negative bacterial and fungal cultures.
+Electroencephalogram studies showed triphasic morphology waves with and without sharp negative component at 2–3 hertz. These were seen in continuum mostly with subtle waxing and waning features. To 0.5 mg intravenous alprazolam, above discharges had slowly resolved, replaced by organized background that consists of 6 hertz rhythms. Importantly, there was a clinical improvement after alprazolam; suggesting a nonconvulsive seizures responding to benzodiazepine.
+Two weeks later after the initial CT imaging and after the patient was more stable from the neurological perspective in order to attempt a lymph node excisional biopsy, a PET-CT imaging was performed and showed complete resolution of the previously detected lymphadenopathy and splenomegaly. .
+Additional serologies for viral hepatitis and autoimmune etiology work up were performed. A bone marrow biopsy was performed and additional serum erythropoietin level, iron profile; cobalamin and folate level were determined.
+The patient returned to the benign hematology clinic after discharged from the hospital. During her follow up appointment she appeared in better spirits and recovering well. Physical examination was notable for an absence of lymphadenopathy particularly in the cervical and axillary region, as well as no palpable organomegaly in the abdomen. It was further revealed that her antinuclear antibody (ANA) titer was highly positive (1:640), ESR 108 mm/hr with a CRP 6.74 mg/L. Negative viral hepatitis B, C and Human Immunodeficiency virus serologies.
+Serum quantitative immunoglobulin showed a mildly elevated Ig A and Ig G level, without other abnormalities. Serum and urine protein electrophoresis did not reveal a monoclonal gammopathy. Serum free light chain levels showed kappa 96.3 mg/L and lambda 60.06 mg/dL with a normal ratio 1.6 in a patient with chronic kidney disease.
+Complement C3 level was normal with a slightly elevated C4 at 46 mg/dL.
+Bone marrow aspirate yielded a predominance of CD3 positive polytypical small T cells and a population of polyclonal B-cells by flow cytometry and negative for lymphoma or other malignant process. A focal lymphohistiocytic aggregate with granuloma formation was noted; occasional larger cells with prominent nucleolus identified; eosinophils were increased mildly in the vicinity of this aggregate. Acid fast bacilli and fungal stains were attempted; however the focal granuloma could not be appreciated at subsequent sections.
+The patient’s pancytopenia was thought to be likely secondary to systemic lupus erythematosus and she was thus referred to rheumatology for further work up, and further testing included anti-double-stranded DNA, anti-RNP, anti-CCP antibody, ANCA vasculitis panel, direct antiglobulin test, lupus anticoagulant, anticardiolipin antibody, anti-double-stranded DNA antibody, and anti-SSA and anti-SSB. All these tests were negative, thus ruling out systemic erythematous lupus, rheumatoid arthritis, and other connective tissue disorders.
+The interval improvement and self-limited clinical course in our case led us to believe that her elevated ANA titers, her bone marrow granuloma were secondary to an EBV infection-related syndrome. Monospot test was not performed and at that point we evaluated for EBV PCR and EBER staining in the bone marrow. Initial EBV PCR results were positive (960 copies/mL), while Epstein–Barr virus-encoded small RNAs staining in the bone marrow was negative. Our in situ hybridization stain is validated to work on decalcified bone marrow trephine biopsies and all stains include an on-slide positive control. As such, the likelihood of a false negative result is low. A possible explanation includes a sampling factor with lack of infected B-cells in the bone marrow despite the presence of viremia.
+Her follow up labs during subsequent clinic visits showed WBC 5.3 K/uL, ANC 3.15 K/uL, Hgb 7.4 g/dL, calculated reticulocyte index of 1.1 and platelets 172 K/uL. Iron was 68 ug/dL, transferrin 124.1 mg/dL, ferritin 2952 ng/mL and serum erythropoietin levels were 31.7 mIU/mL. Serum cobalamin was 394 pg/mL and serum folate 12.3 ng/mL. Since there was spontaneous interval resolution of her neutropenia and her thrombocytopenia our diagnosis at that point was cytopenias secondary to infectious mononucleosis and anemia of chronic kidney disease related to diabetes.
+Our patient presented 7 weeks later at the emergency room with a recurrent febrile syndrome with diffuse cervical and axillary lymphadenopathy and splenomegaly and worsening cytopenias: WBC 1800/uL, ANC 1480/uL, Hgb 8.3 gr/dL, platelet count 20,000/uL; a repeat EBV titer revealed 6580 copies/mL. CT imaging with contrast found bilateral axillary, mediastinal and hilar lymphadenopathy. Low volume retroperitoneal and pelvic lymphadenopathy, hepatosplenomegaly with numerous small ill-defined hypodense lesions was in the spleen and probably also within the liver . At this time a repeat bone marrow biopsy and an excisional lymph node biopsy were performed and reviewed. The bone marrow specimen showed a solitary large cell positive for CD30 identified in the clot. No atypical cells are identified in core biopsy as assessed by IHC for CD30 and Pax-5. EBER was positive in few and scattered cells. The lymph node sections demonstrated near-total effacement of the lymph node architecture by a neoplasm comprised of neoplastic cells with Hodgkin-Reed-Sternberg morphology. The neoplastic cells were positive for CD15, CD30, PAX5 (weak), and MUM1. They were negative for CD3, CD20, CD45, ALK, and EMA. The findings were diagnostic of classical Hodgkin lymphoma, best subtyped as lymphocyte-depleted. . The expression of PAX5 with weak intensity coupled with MUM1 expression by the neoplastic cells is diagnostic of classical Hodgkin lymphoma. The expression of PAX5, a gene encoding a B-cell-specific transcription factor, excluded T-cell lymphoma as a diagnostic consideration. It is worth noting also that flow cytometry done on a bone marrow sample with involvement by lymphoma showed no evidence of T-cell or B-cell immunophenotypic aberrancies.
+The patient was started on ABVD chemotherapy regime, bleomycin was held secondary to patient’s history of cardiomyopathy. She received three cycles of chemotherapy with complete clinical remission. Additional cycles of chemotherapy were not completed given prolonged and severe chemotherapy-induced cytopenias that eventually recovered over the following months. A bone marrow biopsy at completion of treatment revealed no morphologic evidence of residual Hodgkin lymphoma. Her most recent surveillance PET-CT imaging, nine months from completion of treatment, showed no hypermetabolic lymphoma and continuing complete metabolic response to therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1909_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1909_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..696d309314efcef6fffbce9ee0c0516e6aac38da
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1909_en.txt
@@ -0,0 +1,2 @@
+A 42-year-old man with no other significant medical history was diagnosed with metastatic melanoma that was BRAF V617F mutated, with metastasis to liver, lung and adrenal glands. He had a past history of early stage melanoma that was initially diagnosed eight years ago, for which he underwent wide local excision with a negative sentinel lymph node biopsy. He did not receive any adjuvant chemo or immunotherapy. Subsequently, he started noticing multiple cutaneous lesions that were positive for melanoma, which led to a complete staging work up that revealed metastatic disease. Patient had an excellent performance status with no known history of endocrinopathies, including diabetes mellitus. He had normal fasting glucose levels, which was checked by his primary care physician. He was started on first line systemic immunotherapy with the combination of ipilimumab and nivolumab. He completed three out of the four planned cycles of combined regimen, that was administered at ipilimumab 3 mg/kg IV and nivolumab 1 mg/kg IV every three weeks, prior to emergency room presentation. Chief complaints at this presentation included intractable nausea, vomiting and diarrhea. He reported to having more than 8 loose bowel movements a day, some of which were associated with blood streaking. In the ER his serum glucose was elevated to 728 mg/dL and he was in DKA with significant anion gap metabolic acidosis, for which he was admitted to intensive care unit for further management. He was given intravenous insulin as bolus and started on insulin drip along with IV fluids as per DKA protocol. His blood glucose levels subsequently improved. Hemoglobin A1c (HbA1c) level from admission was 6.5%, indicating a rather new onset diabetes mellitus. Stool studies returned negative for infectious etiologies and he was started on anti-motility agents (Imodium and Lomotil), which failed to provide any relief from diarrhea. Computerized tomography of abdomen and pelvis showed pan-colitis and he was started on prednisone 1 mg/kg daily for presumed immune mediated colitis. Despite steroids he continued to have diarrhea, which were intermittently bloody. He was then started on octreotide (50 mcg subcutaneous injection TID, which was later increased to 100 mcg TID), with which his diarrhea was controlled. We had planned to start him on infliximab (a tumor necrosis factor inhibitor) if he failed the octreotide trial.
+Subsequently, he was discharged home on an insulin regimen for presumed new onset insulin dependent diabetes mellitus (IDDM) and prednisone taper for colitis. Initially he had trouble controlling blood glucose levels while on prednisone taper. But, once he was off prednisone, his IDDM was better controlled. One month later into follow up repeat hemoglobin A1c was 7.9%, but his glucose levels were much better controlled. Since no testing for autoimmune diabetes was done during his initial presentation, anti-GAD65 antibody, ZnT8 antibody, and IA-2 antibody testing was done during his subsequent clinic follow up. Anti- GAD65 antibody was <5 IU/ml, ZnT8 antibody was <10 U/Ml, and IA-2 antibody was <0.8 U/ml, all being within normal limits. Though DKA is more common with autoimmune or type 1 diabetes mellitus, it can be seen with type 2 diabetes mellitus. Since, patient had no evidence of diabetes or pre-diabetes prior to immunotherapy, we think treatment with combined checkpoint blockade is what led to DKA.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1922_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1922_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fd183ba6f2484d6ab4407211feed9b269d0b5471
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1922_en.txt
@@ -0,0 +1 @@
+A 40-year-old white Caucasian man presented to our outpatient service complaining of right hip pain. He reported having experienced this discomfort since his youth with the condition now worsening, but he denied any history of trauma. Clinical examination revealed tenderness over his right hip together with functional deficits in abduction and external rotation in his right hip joint. Conventional radiography extended by computed tomography (CT) showed a bony protuberance at the right anterior inferior iliac spine with fusion of the proximal bony nucleus to the adjacent bone . This finding together with the clinical picture was highly suggestive of a pelvic digit. Due to the patient's complaints including functional impairment in his right hip joint, surgical removal of the pelvic digit was performed and the patient was discharged 3 days later free of symptoms with a full range of motion in his right hip joint. Histopathological work-up was consistent with a rib bone .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1930_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1930_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a776ae2d9e812e1ac2ad04fd5a6619191ed985bd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1930_en.txt
@@ -0,0 +1,5 @@
+A 54-year-old Asian male patient with a history of hypertension, pancreatic cysts, colonic tubular adenomas, and family history of colonic polyps presented for evaluation of a large peri-splenic and pancreatic mass that was discovered incidentally on endoscopic ultrasound (EUS). The patient had negative genetic testing for MUTYH-associated polyposis and familial adenomatous polyposis. The patient had experienced 30 pounds of weight loss over the past year, but he reported this was due to intentional efforts to lose weight. He was otherwise asymptomatic without abdominal pain, nausea, vomiting, hematemesis, hematochezia, melena, or jaundice.
+The patient’s abdominal physical examination was unremarkable without palpable mass. Laboratory examination revealed mild anemia with a hemoglobin of 11.7 g/dL (normal < 13.5 g/dL). Carbohydrate antigen (CA) 19–9 was 138 U/mL (normal < 35 U/mL), and carcinoembryonic antigen (CEA) was 2.4 ng/mL (normal < 3.0 ng/mL). Repeat EUS completed 2 months after initial EUS revealed a 12 cm, isoechoic to hyperechoic, heterogenous, cystic splenic mass. There was no abscess, mucinous, or solid component. Fine-needle aspiration of the cyst revealed serosanguinous, non-mucinous (negative string sign), and non-purulent material. The fluid cultures including an acid-fast bacilli culture were negative. The fluid CEA level was 2.6 ng/mL (normal 0.0—3.8 ng/mL).
+Contrast-enhanced abdominal computed tomography (CT) demonstrated a large, heterogeneous, hypodense mass involving the pancreatic tail and spleen . Abdominal MRI showed a large mass with heterogenous intermediate T2-signal , heterogenous restricted diffusion , and heterogenous peripheral enhancement on T1 fat sat post-contrast imaging involving the pancreatic tail and spleen. Overall findings demonstrate a relatively circumscribed, large mass with solid and fluid components and peripheral solid enhancement suggestive of high cellularity and central necrosis, invading the splenic parenchyma. No lymphadenopathy was noted.
+An en-bloc open distal pancreatectomy, splenectomy, left nephrectomy, left adrenalectomy, partial gastrectomy, and diaphragm resection were performed to remove the mass. The mass grossly involved both the distal pancreas and spleen but not the left adrenal gland, left kidney, or stomach. Gross inspection revealed a 11.0 × 8.1 × 7.0 cm tan-yellow to red-brown tumor that extended from the pancreas to the spleen and superior aspect of the left kidney . Further sectioning revealed hemorrhagic and necrotic-appearing cut surfaces with cystic spaces. Microscopically, multinucleated OGCs were present with areas of traditional adenocarcinomatous morphology . On immunohistochemistry, the OGCs were positive for CD68 and negative for cytokeratin (AE1/AE3) and CDX2 . The adenocarcinoma component was positive for AE1/AE3, CDX2, and INI-1 . The final diagnosis was UCPOGC of the pancreatic tail with direct tumor extension into the spleen.
+The patient had no evidence of recurrent disease on six-week post-op CT, and he was started on six months of adjuvant modified FOLFIRINOX (mFFX) at nine weeks post-op. Unfortunately, on repeat CT scan 20 weeks post-op, a 1.2 cm right hepatic lobe liver lesion was discovered, and the biopsy was consistent with metastasis from the primary pancreatic UCPOGC. The mFFX was stopped and the patient was started on gemcitabine plus nab-paclitaxel. The patient completed two cycles of gemcitabine plus nab-paclitaxel before unfortunately expiring 11 months post-op.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1934_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1934_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cefdf61da30fb8d00c485c68fd07b5a0606075ab
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1934_en.txt
@@ -0,0 +1,3 @@
+The patient, a 59-year-old female, presented with bilateral symmetrical low-key tinnitus and accompanying hearing loss three years ago. Over the past year, she experienced a progressively worsening blowing or running sound in her right ear, resembling a “murmur,” along with synchronous with her heartbeat rhythm. Concurrently, her original symptoms worsened, manifesting as slightly decreased visual acuity, insomnia, anxiety, depression, and suicidal ideation. She had previously been diagnosed with sudden deafness and received microcirculation treatment but did not experience any improvement.
+The patient reported that the persistent tinnitus in his right ear was seriously affecting his normal life and urgently needed treatment. The patient had suffered from hypertension and hyperlipidemia in the past and was taking medication regularly to keep his blood pressure and blood lipids within normal limits, with no history of other illnesses, no history of allergies to medications or food, and no history of such hereditary diseases in his family. We assessed the patient's tinnitus, sleep and anxiety levels using the Tinnitus Handicap Inventory(THI), the Pittsburgh Sleep Quality Index (PSQI) and the Hamilton Depression Scale(HAMD), with the following results: THI: 56/100 points (Grade 3); PSQI: 14/21 points; and HAMD: 10 points, confirming moderate tinnitus handicap, sleep disorder, and mild anxiety state.
+After admission, we performed neurological examinations: (1) intracranial pressure was normal; (2) otoscopy: bilateral external auditory canals were patent, tympanic membranes were intact, grayish-white in color, and no congestion or fluid flatness was seen; the hearing loss was observed in both ears by pure tone audiometry, and tympanic ventricular conductance mapping showed a pattern of 3C; (3) A computed tomography (CT) scan of the right ear showed: normal right sigmoid sinus wall and stenosis at the junction of the right internal jugular vein(IJV) and the sigmoid sinus, as well as a high JB on the right accompanied with Jugular bulb wall dehiscence (JBWD) . Digital subtraction angiography (DSA) showed moderate-to-severe sigmoid sinus stenosis(SSS) at its junction with the IJV (stenosis of approximately 50%–70%) and a high JB , and distal venous sinus manometry was performed. Initially, we thought that the PT in the right ear might be due to the SSS increasing the blood flow velocity creating a vortex in the high JB, so that the PT sound entered the inner ear. Two other evidences supported our diagnosis: first, during DSA venography, the contrast catheter passed through the stenosis site, and when the pressure was measured at the distal end, it changed the direction of blood flow at the site, and the venous vortex flow was reduced, and the patient's PT disappeared; second, by the right side neck-pressure test, when the pressure was increased to a certain degree, the PT disappeared on the patient's right side after the venous reflux was blocked, and the left side hearing was not changed. However, the results of subsequent interventions confirmed more than just what was previously stated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1936_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1936_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b3ee5e2c8db258e136be46eee5d82d9a04f118c8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1936_en.txt
@@ -0,0 +1,7 @@
+A 69 years old female presented with gradual onset slowly progressive intermittent diffuse headache of moderate to severe intensity for 3 years. No diurnal pattern of symptoms or associated vomiting or visual disturbance was noted. She was clinically euthyroid and denied galactorrhea, postural dizziness, limb weakness or numbness, convulsions or sphincter dysfunction. Her past history was unremarkable.
+General physical examination was unremarkable with normal vital parameters (temperature 37.4 °C, heart rate 76 per min, blood pressure 130/70 mmHg without a postural drop, respiratory rate 16 per min), normal visual fields on confrontation method and had no papilledema or other focal neurological deficits.
+Investigations revealed an abnormal thyroid profile suggestive of secondary hypothyroidism [TSH 1.2 mIU/L (0.4–4.0), free T4 0.6 ng/dL (0.9–1.7) and free T3 3.5 pmol/L (3.5–6.5)]. Further investigation showed low cortisol levels (4.03 µg/dL) and markedly raised prolactin level of 1634 mU/L (< 400 mU/L). Thyroxine (75 mcg daily) and hydrocortisone (10 mg mane, 10 mg noon, 5 mg vesper) replacement therapy was commenced and titrated with regular monitoring of free T4 and cortisol levels.
+Visual fields assessment by perimetry showed a right homonymous inferior quadrantanopia. Non contrast CT scan of the brain showed an old cerebral infarct in the left parietal lobe . An MRI scan of the head was performed and a mass lesion in the sellar region was found . The mass lesion was reported as a pituitary macroadenoma and the old cerebral infarct was thought to be unrelated. Patient was referred for neurosurgery after commencing thyroxine and cortisol hormone replacement therapy.
+However on re-evaluation by the neurosurgeon, doubt was cast on the diagnosis of a ‘pituitary tumor’ due to the multilayered and ‘halo’ like appearance of the lesion on MRI . A CT angiogram was performed due to the unusual appearance of the tumour. A large aneurysm measuring 19.9 mm × 21.5 mm with a neck of 5 mm was discovered arising from the cavernous portion of the left internal carotid artery .
+Thus a potentially catastrophic event was averted which could have occurred had trans-sphenoidal surgery been attempted for a pituitary tumor. It is also noteworthy that old infarct could also have been an embolic consequence of the aneurysm.
+The patient eventually underwent endosaccular coiling and stenting without any complications. Her symptoms resolved and made and uncomplicated recovery. However, her visual filed defect did not improve, which would probably have been a result of previous parietal infarct. During a follow up visit at 6 months she remained symptom free but required thyroxine and hydrocortisone replacement.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1944_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1944_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cbacf0427683a09d1514dc4edfe6b3d2523af466
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1944_en.txt
@@ -0,0 +1 @@
+A 34-year-old Korean male with no underlying diseases was rescued from a fire in his home. When the firefighters arrived, he was lying in his bed unconscious and pulseless. Ventricular fibrillation was observed on an automated external defibrillator monitor, and 2 minutes of chest compression with 150 J shock was applied. Recovery of spontaneous circulation ensued just after defibrillation, and the patient was transferred to the emergency department (ED). Upon arrival, erythema with vesicles was found in his face, neck, chest wall, both axillary areas, and the back. In addition, he had a low estimated Glasgow Coma Scale score (3 points) and weak respiration, so intubation and mechanical ventilation support were applied. The initial blood pressure was 88/46 mmHg. Laboratory tests showed leukocytosis, elevated hepatic enzymes (aspartate transaminase 310 U/L, alanine transaminase 184 U/L) and relatively normal levels of C-reactive protein (0.07 mg/dL) and procalcitonin (0.07 ng/dL). On the other hand, the level of serum interleukin 6 (IL-6) was markedly increased to 1328 pg/mL. The initial arterial blood gas (ABG) showed hypoxemia with a low partial pressure of oxygen (PaO2 37 mmHg) as well as metabolic acidosis with a serum lactate level of 12.6 mmol/L. The percentage of serum COHb was 59%, indicating severe CO poisoning. An initial chest X-ray showed diffuse bilateral infiltration, and chest computed tomography (CT) revealed diffuse ground-glass attenuation with an anterior–posterior density gradient by dense consolidation in dependent areas, which suggests an early state of ARDS . Therapeutic hypothermia was applied for prevention of hypoxic brain damage. Shock requiring infusion of norepinephrine exceeding the rate of 0.5 μg/kg/minute despite adequate fluid resuscitation was observed after sedation along with therapeutic hypothermia. Even with 100% of fraction of inspired oxygen (FiO2) and maximal positive end expiratory pressure, hypoxemia (PaO2 61 mmHg) as well as hypercapnia (partial pressure of carbon dioxide 58 mmHg) progressed. Prone position ventilation and application of inhaled nitric oxide were considered, but were not implemented due to concern for rapid progression of shock. Therefore, we decided to conduct veno-veno extracorporeal membranous oxygenator (V-V ECMO) via both right and left femoral venous cannulation. Despite V-V ECMO application, hypoxemia and shock progressed. Thus, direct hemoperfusion with polymyxin B-immobilized fiber (PMX-DHP) was indicated and conducted immediately to prevent further development of cytokine storm. PMX-DHP (TORAYMYXINTM PMX-20R, TorayMedical, Tokyo, Japan) was applied with continuous renal replacement therapy (CRRT) via a nontunneled, double-lumen catheter inserted in left jugular vein, with a starting blood flow rate of 150 mL/minute for 24 hours. The patient was transferred to the intensive care unit (ICU) with ECMO and PMX-DHP. In the ICU on post-burn day 1, flexible bronchoscopy was done to assess degree of inhalation injury and to toilet the airway. Bronchoscopy revealed severe edema and congestion in the bronchial wall with carbon soot deposition. With V-V ECMO maintenance and 24 hours of PMX-DHP, serum COHb percentage and IL-6 level normalized, and dramatic improvement on chest X-ray was seen within 96 hours. On the seventh and eighth ICU days, the patient was weaned from V-V ECMO and the ventilator, respectively. On the 11th ICU day, the patient was moved to the general ward with a plan for systematic rehabilitation including respiratory rehabilitation. Upon transfer, the patient was alert without cognitive dysfunction, and electroencephalogram along with diffusion magnetic resonance imaging showed no definitive signs of hypoxic brain damage. However, both sensory impairment and motor weakness were observed in the right lower extremity with an abnormal result on electromyography suggesting right lumbar plexopathy. The patient was discharged from hospital with the plan of further rehabilitation through the outpatient clinic in the rehabilitation medicine department of hospital in other city.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1948_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1948_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9b248834005b7747c3a6229253cb8635388d312b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1948_en.txt
@@ -0,0 +1,4 @@
+A 54-year-old male experiencing acute onset of numbness and weakness in his left limb was admitted to the First Affiliated Hospital of Guangxi Medical University on Nov. 1, 2020. Initial magnetic resonance imaging (MRI) of the brain showed abnormal signals in the right parietal lobe. Brain computed tomography (CT) and enhanced MRI on Nov. 10 showed an ill-defined infiltrating enhanced mass in the right parietal lobe with perilesional edema, which pointed to the possibility of a low-grade glioma. Resection of the mass in the right parietal lobe was performed on Nov. 12. The specimen exhibited granulomatous changes and inflammatory perivascular infiltrate with positive CD68 staining, negative acid-fast, periodic acid-achiff and CD235a staining. The patient consequently received antibiotic therapy: intravenous Linezolid (0.2 g twice daily for 9 days). His left limb weakness improved slightly, as seen in his activity of daily living (ADL) scores. The ADL score was 75 after the surgery in comparison to 70 before the surgery. However, the patient had a headache accompanied by diplopia and difficulty walking when he was taking hyperbaric oxygen therapy on Nov. 28. An emergency head CT on Dec. 2 showed that a new low-density focus occurred in the left occipital lobe . The blood tests on Dec. 5 revealed that erythrocyte sedimentation rate was 31 mm/h (0–15), hypersensitive C-reactive protein was 0.8 mg/L (0-1), immunoglobulin G subtype 4 was 4.04 g/L and antinuclear antibody was weakly positive. The white blood cells, neutrophils, lymphocytes, eosinophils and platelets were in normal range except for a slight decrease of red blood cells and hemoglobin level. The other tests including the vasculitis antibodies, fungal (1-3)-β-D glycan, and galaetomannan test were normal. Brain enhanced MRI on Dec.7 showed a new abnormal signal focus in the left occipital-parietal lobe, and the operation area of the right parietal lobe had more obvious effusion and edema . Lumbar puncture on Dec. 7 revealed high intracranial pressure (330 mmH2O), elevation in white cell count (320*106/L, neutrophils 45%, lymphocytes 55%) and protein (1041 mg/L), as well as a slight decrease in glucose (2.01 mmol/L) and chloride (116.1 mmol/L). No acid fast bacilli, fungi and bacteria were found in the cerebrospinal fluid (CSF) smear and culture. Despite a treatment with intravenous Ceftriaxone Sodium (2 g twice daily for 4 days), the patient still had an obvious headache, diplopia, non-fluent speech and worse muscle strength in his left limbs. Neurological examination on Dec. 10 showed left eyeball adduction, left eyeball abduction, and right eyeball abduction were impaired. Re-examination of lumbar puncture on Dec.11 showed that the CSF data were getting worse (intracranial pressure 330 mmH2O, white cell count 480*106/L with neutrophils 40%, lymphocytes 60% and protein 1422 mg/L, glucose 1.24 mmol/L and chloride 111.5 mmol/L). Intravenous Vancomycin (1.0 g iv drip Q12h) and Meropenem (0.5 g iv drip Q6h) were applied on Dec.11 due to consideration of intracranial infection caused by bacteria. High-throughput next-generation sequencing (Vision Medicals, Guangzhou) detected the presence of Balamuthia mandrillaris with 112 sequence copy reads in serum and 539 sequence copy reads in the CSF . GAE caused by Balamuthia mandrillaris was thus diagnosed. On Dec.14, the treatment was adjusted to compound treatment with sulfamethoxazole/trimethoprim 0.48 g×2 tablets po. Bid, azithromycin tablets 0.25 g×2 po. Qd, flucytosine 2.5 g iv drip Q12 h, and amphotericin B iv drip Qd (increased gradually with 5–10–15–20–25–30 mg). He did not receive a combination therapy of miltefosine and pentamidine because neither medication was available in China. The patient often went fishing in the past 10 years and worked occasionally in a paddy field. He had no known tick bites or any skin lesions.
+Re-examination of brain MRI on Dec. 23 showed larger lesions on the left cerebral hemisphere with enhancement, causing left subfalcine herniation . The patient was transferred to the department of neurosurgery and was re-operated on Dec. 27. Histological examination of the left occipital lobe confirmed amoebic trophozoite gathering around blood vessels under high magnification . The presence of B. mandrillaris with 3723 sequence copy reads was also detected in brain tissue via NGS . After surgery, re-examination of brain MRI on Jan. 6, 2021 indicated that the lesion and subfalcine herniation of the left cerebral hemisphere were relieved slightly than before . However, the patient developed progressive confusion. A repeated head CT on Jan. 13 revealed that the left subfalcine herniation became worse after medication therapy was discontinued for two weeks. A combined medication therapy was restarted with sulfamethoxazole/trimethoprim (0.48 g×2 po. Bid), azithromycin tablets (0.25 g×2 po. Qd), flucytosine (2.5 g iv drip q12h) and fluconazole (0.6 g iv drip Qd). After treatment, the patient felt better than before with a mild headache. ADL scores were 40 before and 45 after the second surgery. An additional head CT on Feb. 22 revealed that the left subfalcine herniation was slightly relieved . The patient was transferred to another local hospital on Feb. 22 for continuous treatment with sulfamethoxazole (po), azithromycin (po) and fluconazole (iv drip).
+The patient responded favorably to the first surgery in part as showed in head CT and MRI ; the lesions of the right parietal lobe were obviously getting smaller. He responded well slightly to the second excision with the left occipital lobe lesions and the subfalcine herniation was getting better in head CT and MRI . It is interesting that calcification was seen in the left parietal lobe and basal ganglia after Dec. 18 , as well as the right parietal lobe after Feb. 10 .
+At the follow-up by phone, the patient was discharged from the local hospital on April 2, 2021 and showed good recovery with a ADL score of 95, in comparison to past scores of 70 (before the first surgery) and 40 (before the second surgery) as shown in Table . At the follow-up by phone on June. 2, 2021, the patient has been taking with sulfamethoxazole (po) and azithromycin (po) and shows slow recovery with a current ADL score of 100 as shown in Table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1957_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1957_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ea62cc26a4d6594f01e5f657d61cfff1352c225a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1957_en.txt
@@ -0,0 +1,6 @@
+A 6-year-old girl presented to the pediatric emergency department with the chief complaints of vomiting blood and blood in stool. Her mother reported that she noticed the blood in her daughter’s stool three days ago and her daughter then started vomiting blood and the symptoms became worse dramatically.
+The baby was delivered at 34 weeks gestation with cesarean section with intrauterine growth restriction (IUGR), hospitalized in a neonatal intensive care unit for 1 month and treated with laser photocoagulation due to the vision loss in the left eye. The cranial magnetic resonance imaging (MRI) was performed at the age of 6 months in a pediatrics neurology clinic due to convulsions and it revealed diffuse symmetric calcifications, changes suggesting hemorrhage, dilated lateral ventricles, septated cystic lesions in the area extending from the roof of the third ventricle to the lateral ventricle and also hemorrhage in the globe in left orbit . After further ophthalmoscopic tests, cranial findings and genetic tests, the patient was diagnosed with Coats plus syndrome.
+Physical examination of the patient showed that the weight and height were below the 3rd percentile and mid-upper arm circumference <115 mm. The patient was ill-appearing. Her peak heart rate was 120/min and her blood pressure was 70/40 mmHg. Leukocoria and glaucoma were detected in left eye . The patient had hypotonia and her muscle strength in bilateral lower and upper extremities was 3/5. The liver and the spleen were not palpable and the percussion over Traube’s space produced dull sounds during the abdominal examination.
+Laboratory test results were: hemoglobin (Hb): 6.5 gr/dL, hematocrit (Hct): 21%, thrombocyte count: 292000/mm3, white blood cell (WBC) count: 2010/mm3, international normalized ratio (INR): 1.3, alanine aminotransferase (ALT): 113 U/L, aspartate aminotransferase (AST): 115U/L, gamma-glutamyl transferase (GGT): 245 U/L, albumin: 3.21 gr/dL. The metabolic studies did not show any abnormalities and the levels of viral markers, alpha 1 antitrypsin, alpha fetoprotein, ceruloplasmin, autoantibody and tissue transglutaminase were normal.
+Abdominal ultrasonography showed linear echogenicity and heterogeneity in the liver. Abdominal doppler ultrasonography suggested portal hypertension. An upper and lower gastrointestinal endoscopy revealed folded vascular appearance reminiscent of esophageal varices, as well as vascular telangiectasia in the pyloric antrum, duodenum and colon . A liver biopsy revealed portal fibrosis.
+The patient was initially received nothing-by-mouth diet and intravenous (IV) proton pump inhibitors. The severe gastrointestinal bleeding of the patient was later stopped after receiving IV octreotide and erythrocyte transfusion. The patient kept being treated with propranolol, ursodeoxycholic acid and anticonvulsant. The patient was followed in the pediatric gastroenterology, neurology, and eye clinics. She continued to have intermittent gastrointestinal system bleeding and had severe malnutrition; therefore, the patient was admitted to the emergency department and hospitalized multiple times. The patient was treated with tranexamic acid when she had mild bleeding and received IV octreotide when the bleeding was severe. The patient later was admitted to the intensive care unit due to multi-organ failure secondary to severe gastrointestinal system bleeding, and for that reason an emergency endoscopy could not be performed. She received IV octreotide and erythrocyte transfusion again; however, her condition did not improve, and she eventually died.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1959_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1959_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1b3c4d7e5169c8f22e173a27759ab1963c418383
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1959_en.txt
@@ -0,0 +1,3 @@
+A 65-year-old female presented to the emergency room with uncontrolled abdominal pain, nausea, and vomiting. Medical history was significant for Type 2 diabetes mellitus, previous intestinal intussusceptions, and moderate abdominal pain. Initial abdominal CT scan indicated a small bowel obstruction with a transition point at the jejunal area . Related to this finding were mildly enlarged lymph nodes in the right pelvic region. Differential diagnosis included small bowel neoplasm, adhesions, or a reactive intestinal inflammatory process.
+Shortly after presentation, the patient's clinical condition worsened, requiring emergency small bowel resection. Histological analysis of the resected bowel segments demonstrated small intestinal mucosa with intraepithelial and mucosal infiltrates of benign CD3 (+) T-cells, consistent with celiac sprue. Also found were medium-sized infiltrating lymphocytes with characteristic pleomorphic nuclei and prominent nucleoli. Immunohistochemical stains revealed tumor cells positive for CD-3, weakly positive for BCL-2, and negative for CD5, CD20, CD10 and cyclin-D1. Immunohistochemical analysis for Ki-67 showed a markedly increased proliferative index, with 90% of lymphocytes staining positive . Polymerase chain reaction analysis for T-cell receptor-gamma gene rearrangement was positive, demonstrating the presence of a clonal population of T-cells. The combined morphological and immunophenotypic features of this lesion were consistent with jejunal EATL. Further systemic investigations were all non-contributory. The patient was discharged and the recommended treatment for her primary condition was chemotherapy.
+Three weeks post-diagnosis, the patient received a positron emission tomography CT scan from her skull to mid-thigh, which indicated no hypermetabolic lesions suggestive of active malignancy in the skull base or neck. However, five weeks post-diagnosis, she developed new onset neurological symptoms consisting of changes in her mental status and left facio-brachial weakness. Brain MRI demonstrated a single ill-defined, irregular, right fronto-parietal enhancing lesion surrounded by vasogenic edema, with associated mass effect and midline shift . She underwent surgical resection of the intracranial lesion, and post-operative MRI demonstrated the resection of the right frontoparietal mass with small air fluid level and residual blood product seen at the tumor bed . Histopathologic evaluation of the lesion biopsy confirmed the diagnosis of metastatic EATL involving the brain .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_195_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_195_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6e752720f7e3a7724ec2ece6123f9a4b26d3fba5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_195_en.txt
@@ -0,0 +1,4 @@
+A 57-year-old female without past medical history presented to the Emergency Department (ED) at the end of May with altered mental status, nausea, and vomiting. She had felt unwell for the past week with symptoms of mild cough and intermittent fevers peaking at 39.4° Celsius (C). She had been seen by her primary care physician two days prior and was diagnosed with a urinary tract infection based on a positive urine culture for Enterococcus species. She had not started the antibiotics prior to presentation to the ED. In the ED, she appeared acutely ill. She was hypotensive (blood pressure 58/41 mmHg by cuff), tachycardic (heart rate 120 beats/minute), and hypothermic (32.4°C). Physical exam revealed dry mucus membranes, clear lung fields, and cold and mottled extremities. Initial blood work demonstrated an arterial blood gas with pH of 7.0, pCO2 32mmHg, pO2 450 mmHg on supplemental oxygen, and arterial lactate 9.6 mmol/L. Chemistries and hepatic function testing showed creatinine of 1.64 mg/dL, glucose 330 mg/dL, alanine transferase 23 U/L, and total bilirubin <0.2mg/dL. Complete blood count was notable for leukocytosis 16,300/uL with 77.4% neutrophils and 16.9% lymphocytes and hemoglobin of 18.6 g/dL. CRP was normal at 2mg/L. Procalcitonin was 0.89 ng/mL. Troponin T was elevated to 0.20 ng/mL which subsequently rose to 0.97 ng/mL on repeat. Urine toxicology screen was negative. Initial chest X-ray (CXR) showed no acute cardiopulmonary disease . Initial ECG demonstrated sinus tachycardia. Three liters of isotonic intravenous fluids were given as bolus infusion, which resulted in transient increases in blood pressure, but systolic blood pressure remained low (<70 mm Hg) despite fluid resuscitation. A left subclavian triple lumen catheter was inserted, norepinephrine was initiated to maintain mean arterial pressure >60 mmHg, and the patient received cefepime and vancomycin for presumed septic shock.
+A bedside cardiac ultrasound was performed which demonstrated a large pericardial effusion with tamponade physiology . The patient was taken to the cardiac catheterization lab for an urgent pericardiocentesis. Prior to the procedure, the patient suffered an asystolic cardiac arrest secondary to pump failure requiring 10 minutes of cardiopulmonary resuscitation. She was intubated and started on mechanical ventilation. The patient underwent pericardiocentes with immediate evacuation of 90ml of serous fluid, and a pericardial drain was subsequently placed to manage any ongoing or residual effusion. After successful pericardiocentesis, the patient also underwent coronary angiography, which revealed angiographically normal coronaries, with no evidence of plaque or obstruction.
+The patient was admitted to the Medical Intensive Care Unit. Over the following 24 hours her condition deteriorated with hypotension and a marked metabolic acidosis despite IV fluids, high dose vasopressors, broad-spectrum antibiotics, stress dose steroids, and a bicarbonate drip. Arterial lactate continued to trend up to 16.2mmol/L. Repeat transthoracic echocardiogram 12 hours after the pericardiocentesis revealed only a small anterior pericardial effusion, with normal left and right ventricular ejection fractions. Total pericardial drain output was 150mL over this time. During this time, her respiratory viral panel taken by nasal swab on admission returned positive for influenza B by PCR. Repeat CXR showed bilateral infiltrates concerning for acute respiratory distress syndrome. Oxygenation deteriorated despite high Fi02 and PEEP, and the patient was paralyzed and started on low tidal volume ventilation. Despite maximal supportive care, later that day the patient experienced another asystolic cardiac arrest from persistent hypoxia, respiratory failure, and worsening acidosis for which resuscitative efforts were unsuccessful. All blood cultures remained negative. Urine culture from presentation returned positive for 50,000 colonies of Enterococcus species; however, the urinalysis was not compatible with active infection, showing only 12 white blood cells. Repeat urine culture collected later during the admission remained negative.
+Autopsy was performed after consent was obtained from family members. On gross evaluation, the myocardium was grossly firm, dense, and mottled in appearance. Lung histology revealed relatively preserved lung architecture with only focal evidence of lung injury in the left lower lobe, but no widespread evidence of pneumonitis or pneumonia. All cultures from the lung were negative for infection. In contrast the heart was markedly abnormal, with multifocal cardiac cell necrosis and subendocardial septal hemorrhage consistent with myocarditis. The pericardium was normal. Immunohistochemistry revealed extensive infiltration of the myocardium with CD3 positive lymphocytes, and hemoxylin and eosin stain demonstrated hemorrhage and myocyte necrosis . The cause of death was felt to be myocarditis secondary to influenza B infection, given the strongly positive viral PCR.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1972_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1972_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7eb872a805d44a3d33a596dd4041b6a1d6b7e811
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1972_en.txt
@@ -0,0 +1,4 @@
+We report the case of a 60-year-old woman of West African descent, with no history of asbestos exposure, who originally presented 24 years ago to another institution with acute abdominal pain. At that time, she underwent an exploratory laparotomy and was found to have nodules diffusely covering the peritoneum. A total abdominal hysterectomy and bilateral salpingo-oophorectomy were performed for suspected ovarian carcinoma, and biopsies were taken of the peritoneal nodules. The pathology from this original surgery was interpreted as low-grade papillary mesothelioma. She then received six adjuvant cycles of intravenous cyclophosphamide, doxorubicin and cisplatin. She underwent a second-look laparotomy six months later, and still had gross disease visible in the peritoneum. Post-operatively she received three additional cycles of intraperitoneal cisplatin and intravenous sodium thiosulfate. She subsequently received maintenance therapy with alternating courses of tamoxifen and megace alternating every two weeks.
+She presented four years later with obstructive gastrointestinal symptoms and was again found on laparotomy to have diffuse peritoneal studding. Pathology from this surgery was interpreted again to be papillary mesothelioma. As a result, she began six cycles of carboplatin and cyclophosphamide chemotherapy for suspected progressive disease. Several months later, she presented with complaints of shortness of breath, orthopnea, and worsening lower extremity edema. A multi-gated acquisition scan (MUGA) revealed an ejection fraction of 14% and enlarged cardiac silhouette on chest X-ray, and she was clinically diagnosed as having anthracycline-induced cardiomyopathy. Medical therapy was initiated at that time for congestive heart failure.
+Two years later, she was found on a computed topography (CT) scan to have an interval increase in loculated subhepatic fluid collection and a lobular soft tissue mass in the right subphrenic region. She then received three cycles of VP-16 and ifosfamide. She remained well until 2000, when she underwent an orthotopic heart transplant. Upon subsequent reimaging of her abdomen the next year, she was found to have continued slow progression of the tumor and was started on single-agent paclitaxel followed by cyclophosphamide for two months. She was then referred to our institution in late 2001 with stable disease on abdominal CT and a presumed diagnosis of malignant peritoneal mesothelioma refractory to therapy. Over the following year, she was maintained on combination capecitabine and gemcitabine therapy and had stable disease as assessed by CT scans. However, in early 2003 she was found to have declining renal function and was forced to stop chemotherapy.
+She was observed closely until 2004 and had little change in her overall tumor burden, but had recurrent ascites requiring drainage by paracentesis on multiple occasions. Because of doubts about the true nature of her peritoneal tumor, a further biopsy of her tumor was performed in 2004, with the final interpretation demonstrating a low-grade papillary mesothelioma of the peritoneum (see Figure ). She has been observed closely since that time with periodic abdominal imaging showing a right side subphrenic mass, loculated subhepatic fluid collection, scattered soft tissue densities with calcification, and extensive anterior wall and peritoneal adhesive disease without obstruction (see Figure ). She continues to have chronic renal insufficiency and suffers from severe chronic abdominal pain and cramping, but has stable radiological evidence of disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1979_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1979_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c54ceccd03f77f81f65e3fe9899a9a9476dcb284
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1979_en.txt
@@ -0,0 +1,2 @@
+A 70-year-old woman presented with 5 months of progressive low back pain. She had a complex medical history including a remote splenectomy, anti-phospholipid syndrome, autoimmune hemolytic anemia requiring previous courses of cyclophosphamide, L3 laminectomy 2 years prior, and systemic lupus erythematosus (SLE) with ongoing therapy with hydroxychloroquine and prednisone 20 mg daily. Her low back pain initially manifested in the context of a herpes zoster infection and management of presumed neuropathic pain was pursued. In ensuing months, she had progression of low back pain despite conservative management. Magnetic Resonance Imaging (MRI) of the lumbar spine showed evidence of an epidural abscess at L2–3, L3–4 with vertebral osteomyelitis at L2-L3. Admission vitals showed a heart rate of 120 beats per minute, blood pressure of 121/59 mmHg, temperature of 36.9 °C, respiratory rate 16 breaths per minute, and SpO2 of 93% on room air. She had a mild leukocytosis with a white blood cell count of 12.18 k/uL. C-reactive protein and sedimentation rate were elevated at 2.8 mg/dL and 45 mm/h respectively. She underwent surgical evacuation of the epidural abscess and wound revision of L2-L3. Intra-operative findings included dark brown fluid that egressed from her epidural site, but no purulent fluid was visualized. Intraoperative cultures of vertebral bodies and discs showed no evidence of bacterial or fungal growth. Acid-fast bacterial (AFB) stains, cultures and QuantiFERON®-TB Gold In-Tube testing were also negative. Empiric treatment with vancomycin and cefepime was initiated with plans to complete a six-week course.
+Three weeks after surgical intervention, she re-presented with persistent low back pain and encephalopathy. Cefepime was considered as a possible etiology of her altered mental status and therefore was replaced by aztreonam. Admission vital signs were unremarkable. C-reactive protein and sedimentation rate were 4.9 mg/dL and 36 mm/h respectively, with notable increase in C-reactive protein from 2.8 mg/dL. Lumbar spinal computed tomography (CT) demonstrated severe lytic and sclerotic destructive changes centered on the disc space of L2-L3 and the vertebral body of L4. There were also findings consistent with a large paraspinal abscess anterior to the L3 vertebral body. A biopsy of the L3 vertebral body was obtained and showed no organisms on gram stain with no growth after 7 days. This prompted a repeat bone biopsy in attempts to define the causative pathogen and direct further antimicrobial therapy. Meanwhile, empiric antibiotics to cover typical pathogens were continued. Two weeks following the initial vertebral body biopsy there was growth of acid fast bacilli from the bony specimen, which was further identified as MAC by hybridization probe. In vitro susceptibility testing indicated a favorable resistance profile with susceptibility to clofazimine, rifabutin, clarithromycin, ethambutol, and rifampin. Treatment with ethambutol and azithromycin was initiated after receiving susceptibility results. Two-drug therapy was selected due to the favorable susceptibility of the MAC isolate, in addition to efforts to mitigate potential adverse drug effects and medication interactions. She had no evidence of MAC pulmonary involvement on chest CT and the etiology of her infection was uncertain. Two months later she was seen in follow-up with resolution of her symptoms. She will continue antibiotics to complete a 12-month course.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1980_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1980_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..069286d921ee33165f5a6b2658235364a3573161
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1980_en.txt
@@ -0,0 +1 @@
+A 65-year-old female was relatively well before and had history of diabetes mellitus without medical control. This admission, she suffered from sudden onset of retrosternal chest pain at rest and came to our emergency room for help. The pain was tight in characteristic and radiation to the epigastric area. On physical examination, she had a blood pressure of 125/88 mmHg, heart rate of 77/minutes, and clear consciousness. Crackle could be heard in both lung fields and grade three holosystolic murmur was heard in the left lower sternal border. The blood tests revealed creatinine of 0.9 mg/dl, creatinine kinase of 251 IU/L, creatinine kinase MB of 31.11 ng/ml, and Troponin T of 0.800. The peak of serial cardiac enzymes values were as followed: creatinine kinase 500, creatinine kinase MB 40 and Troponin T 1.09 which noted 24 hours after onset. Chest X-ray showed mild pulmonary congestion. An ECG showed rightward axis, normal QT interval with QTc of 422 ms, and non-significant ST-T elevation (0.05 mv) at leads I, aVL, and V5 without dynamic change in the serial follow-up ECGs. Under the impression of non-ST elevation myocardial infarction, conservative treatment with anti-thrombotic and anti-platelet regimens was prescribed. The echocardiography showed impaired global LV systolic performance with mid-septum hypokinesis and akinesis of mid-anterior to apical-anterior wall, but well preserved basal septal contractility. Cardiac catheterization was performed on the 7th day. Coronary angiogram revealed no significant stenonsis on coronary arteries and left ventriculography showed anterior wall akinesis, apical hypokinesis and slight basal hyperkinesis of left ventricle . The patient was improved after supportive care and follow-up echocardiography showed complete recovery of left ventricular systolic function without abnormal regional wall motion 2 weeks later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1985_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1985_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9f120ae02a153cb3e4551f662c0da8a41ded6330
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1985_en.txt
@@ -0,0 +1 @@
+The proband (II.1), a 22-year-old male, was the eldest son of three children born to 1st degree consanguineous parents of Sri Lankan origin . Pregnancy and delivery were uneventful. He was diagnosed to have bilateral postaxial oligodactyly limited to upper limbs at birth. Radiological studies showed bilateral fusion of the 4th and 5th metacarpal bones . He has no noticeable facial dysmorphism, renal impairments or cognitive impairments. The second child (II.2), a 16-year-old boy, was normal. The youngest child (II.3), a 13-year-old girl, also has postaxial oligodactyly and a few mild facial dysmorphic features. Both patients do not show visible lower limb deformities or oligodactyly. By whole exome sequencing of the proband, we identified a deleterious homozygous mutation in LRP4 c.1348A > G, p.Ile450Val. Mutations in this gene were reported to cause CLS syndrome.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2000_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2000_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..88d1f3ab218284c14a567f26544e760be5919e9f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2000_en.txt
@@ -0,0 +1,5 @@
+A 68-year-old Japanese male with sudden onset of abdominal pain was transferred to Nomura-Kaihin Hospital. He did not have any special past medical history and had never received colonoscopy. Contrast-enhanced computed tomography revealed a locally dilated sigmoid colon with fecaloma and perforation. Findings of feculent peritonitis (stage IV by Hinchey Classification) and free air in the peritoneal cavity were also detected, but no apparent tumor was pointed out. He was clinically diagnosed with perforation of the sigmoid colon, and an emergency operation was performed. During surgery, a diverticulum with wide frontage and rupture was found in the sigmoid colon, but no apparent tumor was observed. Fecaloma was present near the rupture site. The sigmoid colon measuring 16 cm in length including the perforated area was resected. The diverticulum with rupture was present at the contramesenteric side and was 55 × 35 mm in size .
+Microscopically, bland spindle cells were present replacing the whole layer of the muscularis propria without forming an apparent mass at the true diverticulum . Necrosis was absent, and mitotic figure was difficult to detect at the lesion (0/50 high-power fields). The non-diverticulum-like portion at the mesenteric side showed normal structure of the colonic wall . Basically, the lamina propria, submucosa, and serosa even at the diverticulum-like portion did not show any specific changes , although the whole layer at the perforation site was necrotic. The perforation was observed near the boundary between the normal colonic wall and the lesional wall .
+Immunohistochemical examination revealed that the spindle cells were diffusely positive for KIT , DOG1 , and CD34 . Alpha-smooth muscle actin was partially positive, but S-100P was negative (data not shown). Since the muscularis propria layer was almost entirely replaced by the KIT-positive spindle cells , desmin was almost completely negative at the lesion. The Ki-67 labeling index was less than 1% (data not shown).
+Mutational analysis of the c-kit gene at exons 9, 11, 13, and 17 where most mutations are detected in GISTs using macrodissected paraffin-embedded sections showed that the spindle cell lesion had a heterozygous deletion of 2 amino acids at codons 557 and 558 of exon 11 . There was no mutation at exons 9, 13, and 17. The surrounding normal mucosal tissue had a wild-type sequence for the c-kit gene . The PDGFRA mutation was detected neither in the lesion nor in the normal tissue (data not shown).
+The patient had mild postoperative paralytic ileus and surgical wound infection but was discharged from the hospital approximately 3 weeks later. He received colonoscopy 6 months after the surgery without special abnormalities and has had no diagnostic imaging thereafter. He has been regularly followed once a month by his family doctor for hypertension and was free from apparent recurrence for 41 months after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2004_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2004_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..47564fd82d8ecce1ca5c5882552076097f622176
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2004_en.txt
@@ -0,0 +1,5 @@
+A 31-year-old woman was admitted to our hospital emergencies referred from the Medical Center of Santorini Island with a preliminary diagnosis of acute abdomen, after a penetrating trauma in the upper right abdomen by a swordfish. Whilst she was swimming close to the seacoast, only three meters away from the beach yet in waist-deep water, she felt a stab to her right hypochondrial area. After the first shock, she realized it was a fish that had attacked her and she pulled it out of her body. Neither she nor any other bather swimming nearby saw any fish approaching her. However, after her injury, some of the bathers dived and saw the fish running away towards deeper water. The patient was withdrawn from the sea and, having received first aid by the local lifeguard, she was immediately transferred to the island's Medical Center by her companions. Witnesses' testimony, which was enforced by a part of the fish bill, measured to be 20 cm, found at the bottom of the sea in the area of the incident by the Coast Guard of Santorini Island led ichthyologists to identify the fish as a billfish, Xiphias gladius (swordfish).
+Her vital signs on presentation to our hospital were: blood pressure 113/71 mm Hg, heart rate 81 beats/minute, arterial blood oxygen saturation 100% and temperature 38.6°C. Physical examination was remarkable only in the abdomen which was scaphoid, tender to palpation with diminished bowel sounds and a 4 cm trauma at the mid-axillary line below the right costal margin. The patient received a broad-spectrum antibiotic and a prophylactic tetanus toxoid injection. Laboratory tests showed a haematocrit of 28.5%, haemoglobin levels of 9.7 g/dL, white blood cell count of 25 × 109/L (with 94.10% polymorphonuclear cell type), and platelet count of 152 × 109/L. The coagulation profile was within normal limits. Thoracic and abdominal X-rays performed at the island's Medical Center did not reveal any pathology whilst F.A.S.T (Focused Assessment Sonography in Trauma) performed there marked out free intraperitoneal fluid at the right circumrenal and Duglas areas. An abdominal Computed Tomography (CT) scan in our hospital revealed: laceration of right liver lobe, distension of inferior vena cava, distension of right renal vein and a hyperdense bone-type foreign body (swordfish bill tip) retroperitoneally. The latter had entered the spinal canal through the body of the second lumbar vertebra (L2) after crossing the abdominal cavity . CT reconstruction images demonstrating the tip of the swordfish bill lodged within the spinal canal were produced . The magnetic resonance imaging (MRI) scan of the lumbar region indicated a longitudinal foreign body, which had reached the interspinous space of the second and third lumbar spinous processes, through the body of the L2 and the spinal canal . Myelography showed that the foreign body penetrated tabular roots and spinal canal at the area mentioned above and further neurological examination was recommended. The neurological (sensory and mobility) examination of both legs, as well as the sensory examination of the perineum did not reveal any neurological deficit.
+After all diagnostic tests had been completed and interpreted, the patient was transfused with one unit of blood and assigned to surgery for intra-abdominal bleeding. Penetration of the abdomen was present at the mid-axillary line, below the right costal margin. The abdomen was explored through bilateral subcostal incision. Approximately 1 litre of blood was aspirated from the abdominal cavity and a large right retroperitoneal hematoma was identified. The right liver lobe was mobilized and the portal triad was controlled with a sling. Liver had been penetrated from segment IVa posteriorly and the inferior vena cava (IVC) had been lacerated medially. The duodenum was mobilized and the retroperitoneum was opened. Blood and clots were evacuated from the retroperitoneal space and the IVC was repaired with proline 4-0. Cholecystectomy was performed at this stage because of laceration of the cystic duct. The gastrocolic ligament was subsequently divided and the pancreas and aorta were explored. An unsuccessful effort was done in order to find the foreign body (sword fish bill tip) at the level of L2 vertebra, which was revealed at the CT and MRI scan. A penrose drainage was placed below the liver and the wound was closed.
+After the completion of the surgery, the patient was transferred to the Intensive Care Unit for monitoring and planning of the foreign body removal in future. She was hospitalized there for three days. The patient's clinical state and laboratory parameters were evaluated from orthopedics of our hospital who recommended the patient's mobilization. After that she was transferred to the Third Surgical department for further medical attendance and laboratory tests. On the third postoperative day, she exhibited fever up to 38.5°C which was resistant to antibiotic therapy. Blood cultures were taken and lumbar puncture was performed; the collected sample of cerebrospinal fluid was sent for biochemical and microbiological analysis. Both examinations were negative for bacterium growth. The new thoracic and abdominal computed tomography (CT) scan did not show significant changes compared with CT on her admission to the emergency with the exception of subcapsular fluid collection of increased density at left liver lobe, which was found increased in new CT examination 4 days later. CT- guided drainage of that fluid, which was a biloma, was performed and drainage tube was left at the collection's area. The Magnetic resonance cholangiopancreatography (MRCP), that was performed three days later, did not reveal any pathology of bile ducts or bile leak. The new MRI scan of lumbar region indicated L2 inflammation and arachnoiditis of some tabular roots (Arrow; Figure ). The patient then was transferred to the Neurosurgical department of our hospital and underwent an operation in order to remove the swordfish bill tip by approaching it from the spinal canal (posteriore approach). Laminectomy of the second and third lumbar vertebra was accomplished and the foreign body was removed intact easily . There was L2 vertebral decomposition as a result of local osteomyelitis. Osteomyelitis of these vertebras was the result of bone infection by bacteria of the epithelium of swordfish bill which invaded the bone directly after the swordfish attack. Consequently, when the cause of osteomyelitis - tip of swordfish bill - removed surgically, patient's fever declined since the first postoperative day and the overall condition improved significantly. Patient was mobilized on the third postoperative day. However, she was hospitalized further in order to receive intravenous antibiotic therapy. She left the hospital on the thirty fifth postoperative day, fourteen days after the abdominal drainage was taken out. Antibiotics were continued for further four more weeks.
+Written informed consent was obtained from the patient for the publication of the case report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2016_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2016_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3bc9650c76842a6547678bab5efda84bc1660949
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2016_en.txt
@@ -0,0 +1,10 @@
+A 6-year-old female child was diagnosed with acquired aplastic anemia in December 2019. Cytogenetic studies showed 46XX karyotype, chromosomal breakage study was normal, paroxysmal nocturnal hemoglobinuria clone was absent and clinical exome did not show any genetic mutation for inherited bone marrow failure syndrome. She did not have any significant infection during the pre-transplant course, except for the SARS-CoV-2 infection in June 2020. As she had no matched sibling or matched unrelated donor, she received a haploidentical stem cell transplant in July 2020.
+The conditioning regimen was Rabbit ATG from Day-9 to Day-7 (0.5 mg/kg for 1 day and 2 mg/kg for 2 days), Fludarabine 40 mg/m2 for 4 days (Day-6 to Day-3), Cyclophosphamide 14.5 mg/kg for 2 days (Day − 6 and Day-5) and single fraction TBI (400 cGy) on Day − 1. On the day of transplantation, she received a peripheral blood stem cell graft from the father with 10 million CD34+ cells/kg and 2.41 × 108 CD3+ T cells/kg. Post-transplant Cyclophosphamide (50 mg/kg) was given on Day+ 3 and Day+ 4 followed by Ciclosporin and Mycophenolate mofetil on Day+ 5 as graft-versus-host disease (GvHD) prophylaxis.
+On Day+ 9, she developed high-grade fever with the onset of engraftment. Her ferritin was raised at 65000 ng/mL and her bone marrow had haemophagocytosis. Blood cultures were negative. On day+ 13, a diagnosis of Candida tropicalis-driven macrophage activation syndrome was established on blood PCR and radio imaging of the abdomen. She was treated with antifungals (caspofungin and posaconazole), intravenous immunoglobulin (1 g/kg for 5 days), and intravenous Methylprednisolone (2 mg/kg). She continued to have high-grade fever and ferritin peaked at 190,000 ng/ml on Day+ 13. Hence, one dose of intravenous Alemtuzumab (0.1 mg/kg) was administered following which her fever subsided.
+The patient developed hypertension from Day+ 13 requiring three antihypertensive medications. On Day+ 14, she had loose motions with abdominal pain. Abdominal pain persisted with frequent loose motions and significant hematochezia. An ultrasound scan of the abdomen was suggestive of pan-colitis. Oral Budesonide was started for possible gut GvHD, and intravenous Methylprednisolone was continued considering the possibility of stage 4 gut GvHD. The patient had neutrophil engraftment on day+ 16 and the neutrophils continued to increase. However, hemoglobin and platelet count gradually decreased. TA-TMA was suspected because of anemia, thrombocytopenia, hypertension, gastrointestinal bleeding, decreased serum albumin, and raised lactate dehydrogenase. On Day+ 20, the blood smear showed 1 fragmented RBC per high power field, and on Day+ 37 fragmented RBCs peaked at 5 per high power field. Urine protein:creatinine ratio was 0.47 on Day+ 20, and the ratio peaked at 2.88 on Day+ 34. Serum haptoglobin level was very low (< 5 mg/dl), but the direct antiglobulin test was negative. Soluble C5b-9 assay is not available nationally and hence was not performed. ADAMTS-13 activity was normal. Based on the Overall-TMA criteria the diagnosis of TA-TMA was confirmed.
+Ciclosporin was discontinued, and the patient was given Inj Defibrotide from Day+ 21. There was no evidence of pathogenic variation in TMA-associated genes on clinical exome. She continued to have laboratory and clinical parameters of TMA after 10 days of treatment with Defibrotide. Eculizumab, a terminal complement inhibitor was considered. Eculizumab is exorbitantly expensive and hence it was not possible to treat with Eculizumab. Narsoplimab was available through an expanded access program for compassionate use. Narsoplimab was therefore accessed and commenced at a dose of 4 mg/kg twice a week on Day+ 30.
+The patient’s stool pattern changed from frequent small-volume stools to large-volume stools with ongoing hematochezia. Severe colitis with inflammatory thickening measuring 5.5 mm extending up to the caecum and base of the appendix was seen on an ultrasound scan. Since gut GvHD and TA-TMA are known to coexist, she was also started on a TNF-α inhibitor (Etanercept). She developed pneumatosis coli after two doses of Etanercept on Day+ 40 and Day+ 43, and hence Etanercept was stopped. She continued to have significant intestinal bleeding requiring 86 mls/kg of packed red cell transfusion for 7 days. Intestinal mucosa appeared friable on a serial ultrasound scan with a risk of perforation. Therefore, endoscopic biopsies were not attempted, and monitoring of intestines was done with serial ultrasonography.
+Narsoplimab was increased from twice a week to thrice a week on Day+ 45 because of significant intestinal bleeding. Her lactate dehydrogenase improved dramatically after starting Narsoplimab and her haptoglobin normalized on Day+ 48 . Her hypertension improved and her antihypertensive requirement was reduced to a single antihypertensive medication from Day+ 59 . Her intestinal bleeding reduced from Day+ 50 and completely stopped on Day+ 82. Inj Methyprednisolone was gradually tapered from Day+ 72 and stopped on Day+ 92 because of improvement in gut symptoms. There were no schistocytes in the peripheral blood smear after Day+ 70. The patient received the last packed cell transfusion on Day+ 70 and the last platelet transfusion on Day+ 77 . Narsoplimab was reduced to twice a week regimen on Day+ 109, a once-a-week regimen on Day+ 133, and stopped on Day+ 195 .
+During this period, the patient had CMV reactivation on Day+ 59 with CMV copy numbers of 16,500/ml. She received Inj Foscarnet for 2 weeks, and CMV viremia resolved on Day+ 73. She had a herpes zoster skin infection on Day+ 111, which resolved with Acyclovir.
+The patient developed liver GvHD from Day+ 217. Therefore, Tacrolimus was started from Day+ 217, and Ruxolitinib was added from Day+ 237. She had severe reticulocytopenia secondary to parvovirus infection on Day+ 246. Parvovirus infection was managed with immunoglobulin infusion. Concurrent with parvoviremia, she developed a second episode of TA-TMA manifested by circulating schistocytes, anemia, thrombocytopenia, low albumin, and an increase in lactate dehydrogenase and creatinine . Urine protein:creatinine ratio increased to 0.89. Hence, Tacrolimus was stopped, steroids were started, and Ruxolitinib was continued. She was started on Narsoplimab from Day+ 254, initially twice a week for 3 weeks. Narsoplimab was escalated to thrice a week from Day+ 274 because of persistent TA-TMA, and then tapered to twice weekly from Day+ 290 and stopped on Day+ 357.
+Liver GvHD resolved with steroids and Ruxolitinib. The patient is alive and well and had no features of TA-TMA on the last follow-up of D + 650.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2045_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2045_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..84072f936b7e867f937b4332d3033be0daec26b8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2045_en.txt
@@ -0,0 +1 @@
+A 67 year-old male had a single-car, rollover MVC. At the scene, emergency medical response personnel noted that he was alert, oriented and could move all extremities vigorously. No focal neurological deficit was noticed. He complained of facial pain which was attributed to a minor right-temple-area laceration. However, his most significant complaint was posterior neck pain. He was fitted with a cervical field-collar and transported to the local hospital. X-rays taken at that time revealed traumatic C5-C6 retrolisthesis. A cranial CT showed no intracranial abnormality with the absence of bleeding or traumatic injury. A cervical spine CT revealed subluxation at C5-C6 and a comminuted fracture of the left lateral mass of C6 with disruption of the transverse foramen. Lack of spine treatment capability prompted the patient's transfer to a regional medical center by life flight four hours later. Upon arrival, a neurosurgical evaluation noticed development of neurological deficits. Bilateral upper extremity weakness was described as 4-/5 in the left biceps and 3+/5 in the right biceps. Unfortunately, no other neurological examination details were available. Then, three hours later, the patient's neurological exam drastically changed. Complete absence of motor function in the upper and lower extremities was described. Additionally, he became apneic and hypotensive requiring cardiopulmonary resuscitation. Intubation and a major resuscitative event restored hemodynamic stability and thus enabled another transfer to our Level 1, Regional Trauma Center. Upon arrival to our institution, he was intubated, and found to have asymmetric pupils, minimal corneal reflex, and minimal cough reflex. These findings were consistent with significant brainstem injury. A repeat cranial CT, repeat cervical spine CT, and a head-neck CT angiogram were obtained. These images revealed dramatically worsened subluxation at C5-C6 compared to initial, outside imaging studies. Further imaging data revealed complete occlusion of bilateral VA , although reconstitution from anterior circulatory flow was present. Filling defects within the reconstituted vertebral arteries and basilar artery were concerning for dissection and/or thrombus. A repeat head CT obtained 24 hours later demonstrated extensive brain stem infarction . The patient was subsequently diagnosed with brain death. With consent from the patient's family, the patient's care was then withdrawn.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2053_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2053_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a736d6686506a2c310464085050691fb943150dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2053_en.txt
@@ -0,0 +1,3 @@
+A 24-year-old woman with cystinosis complicated by end-stage renal failure, for which she was receiving intermittent haemodialysis, was admitted with generalized malaise and weight loss. In May 2001, she had undergone trans-thoracic echocardiography because of increasing shortness of breath on exertion, and this had shown a moderately dilated LV with globally reduced systolic function (ejection fraction, EF = 25%), consistent with dilated cardiomyopathy.
+The patient was referred for cardiology consultation following a period of increased breathlessness and a cardiac arrest precipitated by ventricular tachycardia from which she was successfully DC cardioverted. Her medication at that time included perindopril 4 mg once daily (od), carvedilol 3.125 mg twice daily (bd), prednisolone 5 mg od, levothyroxine 200 mcg od, folic acid 5 mg od, darbepoetin 80 mcg per week, mercaptamine (Cystagon) 150 mg four times per day (qds), calcium carbonate 500 mg three times daily (tds), aspirin 75 mg od and alfacalcidol 1.5 mcg od.
+On examination, the patient's blood pressure was 86/50 mmHg and she was in sinus rhythm at 76 bpm. She had some facial oedema, mild ankle oedema and bi-basal crackles on chest auscultation. Heart sounds examination revealed a soft apical pansystolic murmur. The remainder of the examination was unremarkable. Echocardiography revealed a dilated LV with globally impaired systolic LV function (EF Simpsons biplane = 25%). There was marked trabeculation of the LV, most prominent at the apex and lateral wall at the mid-ventricular level; six trabeculae were more than 2 mm in diameter. The noncompacted to compacted ratio was 2.2 at the thickest part of the lateral wall on the parasternal short-axis view. Multiple inter-trabecular recesses in communication with the LV cavity were demonstrated by forward and reverse flow of blood on colour flow mapping . These features are consistent with current diagnostic criteria for isolated ventricular noncompaction. At the time of writing, the patient had been referred for heart and kidney transplant assessment and had undergone implantation of an automatic implantable cardioverter defibrillator (AICD).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2058_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2058_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dc5be09d9f8a6a39faef0fe0b68b3e8ba212116f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2058_en.txt
@@ -0,0 +1,8 @@
+A 66-year-old man with multiple cardiovascular risk factors; such as diabetes, hypertension, smoking and STEMI 6 years ago, who did not receive a reperfusion therapy. He consulted the ER referring atypical chest pain that began 8 days prior to his visit. He showed normal vital signs with the following relevant findings in the cardiovascular physical examination: visible and palpable double systolic apical impulse with a wide apical impulse area (4,5 cm in diameter), located in the fifth intercostal space of the left mid-clavicular line. On auscultation, an audible fourth heart sound (S4) was present. The cardiac biomarkers were negative.
+Normal sinus rhythm, Q-wave in inferior leads and T-wave inversion in lateral leads. .
+Mild cardiomegaly, of note, a homogeneous opacity was observed adjacent to the LV. .
+Revealed a saccular image in the LV posterolateral wall, which, due to its characteristics, suggested a thrombosed PSA in the LV free -wall. .
+Showed a spherical-shaped left ventricular cavity with segmental wall-motion abnormalities, a LV ejection fraction of 40% by 3D method, PSA involving the basal and mid segments of both, inferolateral and anterolateral wall; with a narrow neck (38 mm), a shunt of LV to PSA was observed in color Doppler. .
+A viability protocol rest imaging/4-h redistribution imaging/24-h redistribution imaging was performed and showed a myocardial infarction located in the inferolateral wall, which involved the inferoseptal region; non-transmural in the apical segment and transmural in basal and mid segment, without signs of viability in the delayed redistribution imaging. .
+Multi-vessel coronary artery disease, with involvement of the left main coronary artery and high SYNTAX score [40 pts.]. Left ventriculography was not performed due to elevated end diastolic pressure and because of the previously reported left ventricular mural thrombus.
+The case was discussed by the heart team. Due to the high SINTAX score and the mechanical complication, a coronary artery bypass grafting (CABG) plus aneurysmectomy with geometric reconstruction was considered. On-pump CABG was performed with internal thoracic artery anastomosis to the left anterior descendent coronary artery. A giant posterolateral wall LV PSA of approximately 7 cm was observed; described with a “petrous” consistency and adhered to the posterior pericardium. Due to the previously mentioned findings, it was not possible to perform the aneurysmectomy, as the cardiovascular surgical team considered the benefit was not worth compared to the risk of performing the procedure, so the surgery was concluded. The patient was discharged five days after CABG and he is currently asymptomatic, in NYHA functional class II and is followed up as an outpatient in our hospital.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_205_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_205_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5e059a5bb402e901c2661b99a5bbc185e3ecde08
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_205_en.txt
@@ -0,0 +1,4 @@
+A 68-year-old man underwent right lower lobectomy for invasive mucinous adenocarcinoma (pT2aN1M0 Stage IIB) in June 2016 by an open thoracotomy approach. Postoperative follow-up computed tomography (CT) examinations revealed a pure-solid pulmonary nodule in the right upper lobe of his lung , which was found to be slightly enlarged on a follow-up CT evaluation . In July 2019, a partial pulmonary resection of the right upper lobe was performed. During the surgery, a severe adhesion between the lung and the chest wall was noted, and dissection of the adhesion caused bleeding from the 6th intercostal artery . Hemostasis was achieved using soft coagulation . Dissection of the adhesion was performed only to the extent necessary to perform the partial resection. The postoperative course was uneventful, and the patient was discharged 5 days after surgery.
+The first postoperative outpatient visit was 18 days after surgery, and blood test and chest X-ray showed no abnormal findings. However, the patient later experienced hemoptysis at the toilet of a convenience store adjacent to the hospital. He was rushed to the hospital by medical staff who were assembled by a stat call. His vital scores were unstable; blood pressure (BP) was 117/98 mmHg, heart rate (HR) was 125 bpm, respiratory rate (RR) was 30 beats/min, and SpO2 was 70% (room air). A second chest X-ray on the same day showed decreased permeability in the right middle lung field . Contrast-enhanced CT scan of the chest showed a hematoma with a maximum diameter of 11 cm in the right thoracic cavity, a small amount of free air, and leakage of contrast medium into the hematoma from 6th intercostal artery . A 3D-reconstruction of the chest CT revealed a pseudoaneurysm of the intercostal artery .
+The patient was immediately admitted to the Radiology Department for emergency angiography. Because his systolic BP was 58 mmHg on admittance, a rapid transfusion of four units of red cell concentrate (RCC) was administered during the preparation for angiography. The angiography through the right femoral artery revealed extravasation from the 6th intercostal artery . Therefore, the 6th intercostal artery was embolized using an embolization agent (NBCA:lipiodol = 1:3) to stop the bleeding.
+After the emergency angiography, the patient’s general condition recovered. However, a CT examination performed 2 days later found free air within the hematoma. Because pulmonary fistula was suspected, a chest drain tube (24Fr.) was inserted into the intrathoracic cavity. The air leak disappeared on day 17 after angiography and the patient was discharged on day 22.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2066_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2066_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6097e8d908c26a9849f3f0c976010db1756bb0c6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2066_en.txt
@@ -0,0 +1,11 @@
+An 11-year-old male child presented to the Department of Oral Medicine and Radiology with a rapidly enlarging swelling on left lower jaw since one month. There was no history of trauma or pain associated with the swelling. Also, no secondary or sensory changes could be elucidated. His past dental/medical history was unremarkable.
+The extraoral examination revealed facial asymmetry due to a diffuse swelling on the left side of the face, which extended superoinferiorly from infraorbital margin to the lower border of the mandible measuring approximately 6 × 5 cm in its greatest dimensions. The anteroposterior extent of the swelling was from the corner of the mouth till the pinna of the ear . The skin over the swelling appeared to be normal with uniformly blending borders. Swelling was firm-to-hard in consistency and was non-tender on palpation. No discontinuity was noted in the lower border of the mandible. There was neither local rise in temperature over the swelling nor fixity to the underlying structures. Lymph node examination revealed solitary, enlarged, unilateral, fixed, firm to hard left submandibular lymph node.
+The intraoral examination disclosed a large mass extending from the distal of left second premolar to the retro molar area expanding both buccally and lingually. The swelling was approximately 5 × 4.5 cm in size, well defined, and irregular in shape with a rough lobulated surface. The mucosa over the swelling appeared slightly ulcerated .
+On palpation, the inspectory findings were confirmed. The swelling was nontender and variable in consistency ranging from soft to firm, nonfluctuant, nonreducible, compressible, and non-pulsatile. The teeth in the affected area were not sensitive to percussion and grade 1 mobility could be demonstrated in 37.
+The radiographic examination of the mandible revealed ill-defined, osteolytic, mixed, radiolucent, and radiopaque lesion involving premolar–molar region of left side body of mandible, extending from distal of erupting 34 to angle of the mandible on panoramic radiograph. A normal trabecular pattern was disrupted in the affected area, simulating moth-eaten appearance. The lamina dura was found to be discontinuous in the involved teeth. A considerable root resorption was seen in 73, 74, 75. Severe crestal and inter-dental bone loss in relation to 36 and 37 was evident .
+As a part of regular investigations of maxillofacial swellings, the patient was subjected to ultrasonography to check the vascularity and nature of the lesion. The ultrasonographic findings revealed an isodense large soft tissue mass in the involved area measuring approximately 56 × 56 mm in size. Ultrasonography also showed erosion and periosteal reaction of mandible. The mass was associated with increased vasculitis with arterial flow on color Doppler ultrasonography . Enlarged submandibular lymph nodes were also observed.
+In order to precisely know the location, anatomical relation of the tumor, its effect on surrounding structures, and any evident metastases, computed tomography (CT) was advised. CT sections showed an ill-defined, expansile, osteolytic lesion in the body of the mandible on left side with a significant enhancing soft tissue matrix. Multiple irregular patchy radiolucent areas mimicking moth-eaten appearance were noted in the internal structure. Erosion, irregular thinning and discontinuity of both buccal and lingual cortex on CT images were evident. The characteristic sun ray pattern or the radiating spicules were noticed on lingual cortex. No considerable cortical expansion was observed .
+Based on the clinical and radiological appearance, a provisional diagnosis of malignancy of left body of the mandible was given. A complete hemogram was performed, which showed anemia, leukocytosis, and increased erythrocyte sedimentation rate. An increase in the serum levels of alkaline phosphatase and C-reactive proteins was also observed.
+Fine needle aspiration cytology of the lesion showed a highly cellular smear with tumor cells arranged in groups of loosely cohesive cell as well as scattered singly. Individual cells were small, dark having round-to-ovoid nuclei, dark chromatin, and scanty cytoplasm. Few cells were large with moderate cytoplasm, round-to-ovoid nuclei, and granular chromatin. The background show formed elements of blood suggestive of small round cell tumor. We performed incisional biopsy of the pathology under local anesthesia to establish a definitive diagnosis.
+Confirmatory diagnosis of Ewing's sarcoma was made after histopathological evaluation of biopsy specimens. The features observed during microscopic examination were sheets of uniform small round cells arranged in diffuse pattern with indistinct outline, scanty cytoplasm, well-defined nuclear outline with round-to-oval nucleus, and inconspicuous nucleoli. Mitotic figures were not prominent .
+The standard treatment options for localized ES are surgical excision, radiotherapy, chemotherapy, or combination of all. The patient was referred to regional cancer centre where surgery for the tumor resection was performed under general anesthesia. The surgical specimen consisted of a portion of the mandible and the teeth involved in the tumor. In this case, patient underwent adjuvant chemotherapy treatment with vincristine, and cyclophosphamide at the Regional Cancer Centre.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2073_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2073_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e974ab47009240703ce12a42a115c8a8f14abfbf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2073_en.txt
@@ -0,0 +1,8 @@
+A 54-year-old woman was brought to the emergency department after a syncope at home. The patient had been cleaning the barbecue in the garden when she felt ‘hard heart beats’ and passed out without further warning. The patient had no memory of the incident that had resulted in a mild head trauma.
+Her past medical history was remarkable for deep vein thrombosis (∼10 years earlier), ankylosing spondylitis, depression, and a recent transient ischaemic attack (TIA). Approximately 5 years earlier the patient had undergone a coronary angiogram following an episode of chest pains. The angiogram had identified no atheromatosis. Cardiovascular risk factors encompassed hypertension, well-controlled hypercholesterolaemia, and depression. The patient had never smoked and did not have diabetes or a family history of heart disease or sudden premature death. The physical examination, including a cardiac and neurological examination, showed no abnormalities.
+At admission, the patient was prescribed the following: citalopram 40 mg/day, adalimumab 40 mg subcutaneously/2 weeks (for ankylosing spondylitis), paracetamol p.n. 1 g max 4 times/day, enalapril 10 mg/day, atorvastatin 40 mg/day, and clopidogrel 75 mg/day.
+A CT scan of the cerebrum showed no cerebral damage. The ECG showed sinus rhythm and QTc interval +600 ms . Blood tests were largely normal [serum: potassium 3.4 mmol/L (ref 3.5–4.6 mmol/L) and magnesium, 1.01 mmol/L (ref 0.71–0.94 mmol/L)]. Haemoglobin, leucocytes, creatinine, sodium, alanine transaminase, basic phosphatase, and C reactive protein were within normal ranges. Also, troponin I and D-dimer were not elevated. A transthoracic echocardiography was performed, showing no abnormalities.
+After 1 day of telemetry, an episode of self-terminating Torsade de Pointes (TdP) lasting 18 s was recorded . The patient was conscious during the episode but reported feeling dizzy and that symptoms were similar to what she had felt before her syncope the previous day. Empirical treatment with 16 mmol intravenous magnesium and 3 g of potassium chloride was immediately given. Serum potassium increased to 3.8 mmol/L on the following day but the QTc interval remained prolonged (640 ms).
+The case was conferred with a psychiatrist, and citalopram was tapered under simultaneous rapid titration of sertraline to 100 mg/day. Citalopram was completely discontinued from Day 5. At 1 week from admission, the QTc duration was within normal range , but the QTc duration fluctuated and was found outside normal range at Day 9 (600 ms), before normalization at Day 15 (460 ms). Earlier ECGs were available for evaluation; previous recordings showed QTc between 440 and 580 ms .
+At this point, it was considered possible that the patient was afflicted with the congenital long QT syndrome; even though two known triggers of induced QTc prolongation were present, correction of these did not clearly normalize QTc duration. In addition, previous ECG recordings clearly documented intermittent, significant QTc prolongation over an extended time period. On Day 8 treatment with atenolol 25 mg was initialized. On Day 9, an implantable cardioverter-defibrillator (VVI-ICD) was implanted. Genetic testing was ordered and the proband was found to be heterozygote carrier of the KCNE1 D85N (c.253G>A) variant.
+The patient was closely followed the first 6 months after the TdP episode and seen monthly in the out-patient clinic. Currently, the patient is scheduled for follow-up with her cardiologist yearly, her ICD is interrogated in clinic every 6 months and by remote monitoring every 4 months. In 18 months of follow-up, the ICD has not registered any arrhythmias.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2101_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2101_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..af042b50ab9e270afbd894ff2d359f38118b7fbd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2101_en.txt
@@ -0,0 +1,5 @@
+We report the case of a 34-year-old man who presented with a one-month history of lethargy, generalised upper and lower limb weakness and significant weight gain. He had been recently diagnosed with type 2 diabetes mellitus and initiated on pre-mixed insulin injections 30 units twice daily (HbA1c 85 mmol/mol).
+He had been diagnosed with a pancreatic neuroendocrine tumour (pNET) two years previously, having presented with jaundice and abdominal pain. An abdominal CT had demonstrated tumour in the head of the pancreas with loco-regional metastases (peripancreatic lymph nodes and nine hepatic metastatic lesions varying in size from 7–18 mm) for which he underwent a Whipple’s procedure with resection of lymph nodes and an intra-operative liver biopsy. Measurement of a full fasting gut hormone profile showed elevated chromogranin A but was otherwise normal, consistent with a non-functional tumour. Immunohistochemistry of the pancreatic specimen was positive for chromogranin and synaptophysin with a Ki-67 index of 2% confirming the diagnosis of a Grade 2 pNET (ACTH staining not performed); the liver biopsy appearances were similar morphologically. A careful family history of endocrine tumours or endocrine disorders had been unremarkable.
+On follow up imaging he had developed further liver metastases, so was commenced on a long-acting somatostatin analogue (Lanreotide), for its anti-proliferative potential, and a tyrosine kinase inhibitor (Sunitinib) was thereafter added upon evidence of further radiological progression.
+Two years subsequently, he presented with cushingoid features with a moon face, easy bruising, abdominal striae, centripetal fat distribution and marked proximal myopathy. Blood pressure was normal. Biochemical investigations revealed serum potassium concentration of 2.5 mmol/l, glucose 17 mmol/l and significantly elevated random serum cortisol of 2003 nmol/L and serum ACTH concentration 50 pmol/L (normal range 2–11 pmol/L). Basal pituitary biochemistry and gadolinium enhanced MRI imaging was otherwise unremarkable. MRI scan of the liver revealed solid and cystic metastatic deposits ranging between 7.8-9.2 cm in segments 6, 7 and 8 indicating further progression despite sunitinib.111In-labeled octreotide scanning demonstrated somatostatin receptor positive disease in five of his liver metastatic deposits but not in any other sites (Figure ).
+A diagnosis of a rapidly progressive, functional, metastatic pNET with ectopic ACTH production causing Cushing’s syndrome was made, with an assumption that the tumour had evolved in its functionality from its previous non-functional status. Treatment options discussed at the supra-regional multidisciplinary team meeting (ENETS Centre of Excellence) considered metyrapone, bilateral adrenalectomy, peptide receptor radionuclide therapy (PRRT) or cytotoxic chemotherapy. Mutational analysis of the gene for multiple endocrine neoplasia type 1 (MEN 1) was negative.A repeat liver biopsy was performed to provide an accurate histological grade of the liver metastases, on the premise that primary NETs, and their synchronous/metachronous metastases, frequently differ in grade and proliferative index (Ki-67). Immunohistochemistry was strongly positive for chromogranin and synaptophysin with a Ki-67 index of 20% (ACTH staining not performed) (Figure ). The treatment decision based on this result was to administer conventional cytotoxic chemotherapy with streptozocin, 5-fluorouracil and doxorubicin, with metyrapone given pre-chemotherapy to control the hypercortisolaemic state. Incremental doses of metyrapone (up to 1 g qds) effected a dramatic clinical response (with resolution of his symptoms and reduction of his insulin dosage) and an equally dramatic biochemical response (normalisation of serum potassium and lowering of mean cortisol concentrations on cortisol day curves) prior to his chemotherapy.Three months after starting his chemotherapy, he had managed to completely discontinue his metyrapone with excellent mean cortisol concentrations on his cortisol day curve of 315 nmol/L (Figure graph), with serum ACTH concentration of 11pmol/l. He discontinued all insulin injections with excellent glycaemic control (HbA1c 53 mmol/mol) and cross-sectional imaging (abdominal CT) showing a dramatic reduction in the size of the hepatic metastases with more necrotic/cystic contents than previously. He remains clinically stable three months later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2103_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2103_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9413294deb5dc628a5b574664f54c405f6bf8d84
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2103_en.txt
@@ -0,0 +1,6 @@
+An 84-year-old woman was diagnosed with G3 (pT>2) bladder cancer and underwent robot-assisted RC and ileal conduit diversion. She developed POP 4 months after the operation and tried a ring pessary, but it did not improve her symptoms. Eleven months after RC, she was referred to our hospital for POP repair.
+On the examination, she presented with a midline enterocele descending from the anterior vaginal side prior to the uterus with atrophic ulcerated vaginal skin . Considering the thinness of the vaginal wall and the large defect of the vaginal wall muscle layer, we chose TVM surgery. Figure shows a schematic diagram of the anterior wall TVM using mesh for pelvic floor repair. There are four anchoring points on the mesh: strong tissue around the bilateral ischial spines, the midline of the distal vaginal wall, and cervical tissue.
+The patient underwent TVM surgery 13 months after RC. We made a vertical incision in the center of the vaginal wall with a scalpel and peeled off the vaginal wall sharply from the midline to the side. However, adhesion between the peritoneum and vaginal wall was so severe that the omentum was exposed. We changed the dissection layer laterally at the turned edge of the vaginal wall and proceeded to dissect sharply and bluntly toward the ischial spine. We made a small skin incision approximately 5 mm in length bilaterally, 5.5 cm laterally, and 2 cm dorsally from the clitoris base and penetrated the firm tissue (e.g., tendinous structures of muscles originating from the ischial spine) around the ischial spine using a weakly curved needle . Then, we used nylon loops to guide the mesh arm.
+After delamination, we used a non-absorbable thread for mesh fixation over the midline of the distal vaginal wall and the cervix. As the repair should be performed within the abdominal cavity, we decided to use a monofilament polypropylene mesh (Ventralight™ ST; Bard Inc., Murray Hill, NJ, USA), which is used for abdominal wall hernia repair and designed to reduce adhesion to the intestinal tract on the ventral side .
+And the mesh arm was guided outside through the skin with a nylon loop. Then the mesh was placed tension-free. Finally we excised only the erosion site and performed a continuous suture to the vaginal wall with 3–0 Monokryl . The operation time was 1 h and 45 min, and the amount of bleeding was 45 g.
+At 1-year follow-up, neither recurrence nor complications, such as atrophic ulcerated vaginal skin related to the mesh and chronic pain were observed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2109_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2109_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a7aed0d44ab6099c498a43682a1a1d51241a1e8d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2109_en.txt
@@ -0,0 +1,7 @@
+A 19-year-old man with no medical history or relevant family history was referred to our hospital because of elevated liver enzyme levels and abdominal distention. An abdominal computed tomography (CT) scan showed that his three main hepatic veins were completely obstructed and that the suprahepatic IVC had stenosis involving a membranous-like structure . Moreover, the CT scan revealed severe ascites and esophagogastric varices. Magnetic resonance imaging (MRI) showed a lack of patency and scarring in the main hepatic veins . The patient’s laboratory findings before transplantation showed elevated total bilirubin and decreased platelet and prothrombin time (total bilirubin, platelet, and prothrombin time was 3.8 mg/dl, 150 × 103/ml, 56.2%, respectively). His Child–Pugh score was 11 (grade C), and his Model for End-stage Liver Disease score was 14. He was considered to have no blood disorders that could cause coagulation abnormalities, such as abnormal protein C and S activities. Accordingly, he was diagnosed with primary BCS and decompensated liver failure. Endovascular treatment for the main hepatic veins was considered; however, we recognized that it could be impossible to restore the patency of the hepatic vessels, and we did not perform the preoperative angiography. In addition, his esophagogastric varices were severe. For these reasons, we decided to perform LDLT 5 months after referral.
+Donor candidates for LDLT were limited in this case. The eventual donor was his 46-year-old mother, who had no notable medical history and whose blood type was O Rh (+), identical to that of the patient. Based on preoperative CT investigation, we calculated that her estimated whole liver volume was 1047 ml. Her estimated left-lobe graft volume, estimated graft-to-recipient weight ratio (GRWR), and estimated ratio of liver remnant were 303 ml, 0.49, and 71.0%, respectively, which indicated that the size of the left-lobe graft was insufficient for the patient. On the other hand, in the right-lobe graft without the middle hepatic vein, the estimated graft volume was 734.2 ml, and the estimated GRWR was 1.19, which were sufficient for the patient. However, the estimated liver remnant was only 285.7 ml (31%), which was not applicable for our donor selection criteria. Under these mismatches, neither left-lobe graft nor right-lobe graft could be selected. For these reasons, we considered her RPSG, which could provide sufficient liver volume for the patient (estimated graft volume was 609 ml and GRWR was 0.99), and a safe residual liver volume for the donor (estimated ratio of liver remnant was 38.1%). There were no identified abnormalities of the portal vein, hepatic artery, bile duct, or hepatic vein in preoperative CT and MRI.
+Donor hepatectomy was performed with a mid-line incision, and liver mobilization was performed using a laparoscopy-assisted technique. During mobilization, the root of the middle hepatic vein and the right hepatic vein (RHV) were identified. Then, anterior and posterior branches of the hepatic artery and portal vein were skeletonized. The transection line was marked on the liver surface according to the RHV and to the demarcation line when the posterior branch of the portal vein was temporarily clamped. Following a hanging maneuver, parenchymal transection was performed using a cavitron ultrasonic surgical aspiration system without occlusion of portal vein inflow. After transection of the liver parenchyma was completely finished, the biliary duct and portal vein of the right posterior branches were cut. Because the right posterior branch of the hepatic artery was thin and it was considered that anastomosis of this artery with recipient hepatic artery increased risks of artery-related complications, the donor’s right anterior branch of the hepatic artery was sacrificed after the artery blood flow in the anterior liver segment was detected by Doppler ultrasound with temporary clamping of the right hepatic artery, and then the right hepatic artery was cut at the root. Finally, the inferior right hepatic vein (IRHV) and RHV were cut, and the liver graft was harvested. The RPSG was flushed with 1000 ml of University of Wisconsin solution from the portal vein. The actual RPSG weight was 570 g.
+Recipient surgery was started simultaneously with donor surgery. Prior to the abdominal incision, 16 cm of the SFV was harvested from his left leg for reconstruction of the IVC and hepatic vein. During the operation, there were approximately 3500 ml of ascites, and dense adhesions were seen around the IVC. The native liver was dark and hardened because of the liver congestion. The common bile duct, right and left hepatic arteries, and portal veins were cut, and then all three major hepatic veins, which were thickened and scarred, were cut while preserving the recipient IVC. Explantation of native, diseased liver was completed. The diseased liver weight was 1765 g, and the roots of three major hepatic veins were completely occluded.
+At bench surgery, a longitudinal incision was made from the caudal side of the SFV graft, followed by ligation of the cranial side of the SFV graft. The graft RHV and IRHV was anastomosed to the sidewall of the SFV graft for patch plasty of the IVC .
+For graft implantation, the infrahepatic IVC was mobilized and exposed, and then cross-clamping was performed. Venoveno bypass was not used during graft implantation because the collaterals were well developed, and the hemodynamic parameters were stable after IVC clamping. The thickened anterior suprahepatic IVC was longitudinally cut and opened, and the stenotic lesion of the IVC was identified . There were only a few patent millimeters in the IVC due to the membranous web-like obstruction, and there was no IVC thrombosis. The stenotic and thickened wall of the IVC was resected, and then an anastomotic orifice was created . As the caliber of IVC orifice did not coincide with the RHV–IRHV–SFV graft, the SFV graft was cut between RHV and IRHV before anastomosis. The RPSG was placed into the recipient, and then patch cavoplasty procedures were performed. The RHV‒SFV graft patch was anastomosed to the IVC orifice using continuous 5-0 prolene sutures. After the graft portal vein was anastomosed to the patient’s main portal vein trunk and portal reperfusion started, Doppler ultrasonography showed satisfactory hepatic venous outflow, without any venous graft congestion. The IRHV with SFV patch was directly anastomosed to the IVC using side-clamping of the IVC after portal reperfusion started. Thereafter, the graft right hepatic artery was anastomosed to the patient’s right hepatic artery. Finally, bile duct reconstruction, involving a choledochojejunostomy, was performed. The surgical time, cold ischemia time, and warm ischemia time were 1028, 235, and 80 min, respectively. The blood loss during surgery was 8486 ml.
+The donor had no complications and recovered rapidly, and was discharged at postoperative day (POD) 9. The recipient’s postoperative course was also uneventful. Daily Doppler ultrasound revealed patency of the RHV‒SFV graft without venous congestion of the liver, and postoperative CT imaging clearly showed the graft RHV and IRHV with no stenosis in the IVC . At 13 days after transplantation, the laboratory data showed a slight increase in liver transaminase, and angiography was performed to rule out the hepatic venous outflow block. The postoperative angiography showed no occlusion of the IVC and RHV, and the mean blood pressure of the peripheral RHV, the root of the RHV, IVC, and right atrium were 7 mmHg, 8 mmHg, 7 mmHg, and 4 mmHg, respectively. These findings revealed that the IVC and the graft RHV had sufficient patency, and there was no liver congestion. The increased liver transaminase then normalized spontaneously with no specific treatment. The patient was discharged at POD 28. He has continued to take edoxaban, a direct FXa inhibitor, as a prophylaxis for venous thrombosis. The patient’s condition was good at his last follow-up, 9 months after transplantation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2110_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2110_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cf40db2a57405df1fdc6a0826f503c9e258be822
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2110_en.txt
@@ -0,0 +1,5 @@
+A 78-year-old male patient presented with 5 months of intermittent cervicalgia and several weeks of a progressive right hemiparesis, up to hemiplegia (0/5), brisk upper and lower extremity reflexes, bilateral Hoffmann’s and Babinski signs, left hemisensory dysesthesias, and urinary incontinence.
+The cervical spinal MRI revealed an intramedullary expansive lesion (10 mm×15 mm) at C1–C2 that markedly enhanced with gadolinium . As the differential diagnosis included potential metastatic disease, a total body computed tomography (CT) scan was performed that revealed a large mass (about 85 mm in size) involving the upper polar region and the middle third of the right kidney, extending to the adrenal gland, and ipsilateral psoas muscle . A CT- guided fine-needle ago-biopsy of established the diagnosis of an RCC, also making it most likely that the C1–C2 lesion was an RCC metastasis (Stage IV).
+Utilizing intraoperative neurophysiological monitoring, a C1–C2 laminectomy was performed. Through a posterior C2, myelotomy, and the lesion were macroscopically fully resected . Postoperatively, the patient presented a slight motor improvement, with the right hemiparesis (2/5) and left-sided hemisensory deficit.
+The histological examination revealed large cells with marked anaplasia. Immunostaining was negative for cytokeratin, GFAP, S-100, and HMB-45 but positive for intermediate vimentin filaments. Together, these studies confirmed the diagnosis of an RCC.
+The 1-week postoperative cervical spine MRI showed postoperative changes, but full lesion excision . The patient was discharged to a neuromotor rehabilitation center and underwent chemotherapy and radiotherapy for RCC. Fourteen months later, the patient died due to metastatic RCC.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2111_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2111_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9bdab61ab667b48e6f89fcab37a428f7972cf417
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2111_en.txt
@@ -0,0 +1,7 @@
+A 67-year-old man presented with a 2-wk history of progressively worsening polyarthralgia and nail dystrophy.
+The patient was diagnosed with advanced gastric adenocarcinoma with distant lymph nodes (LNs) metastases was referred to our department in March 2020. Esophagogastroduodenoscopy revealed a 3-cm sized ulcerofungating mass in the pre-pyloric antrum. Histopathological examination of the endoscopic biopsy specimen revealed moderately differentiated adenocarcinoma, negative results for human epidermal growth factor receptor 2 (immunohistochemistry 1+), Epstein-Barr virus, and deficient DNA mismatch repair (dMMR) (retained nuclear expression of MSH2 and MSH6 and loss of MLH-1 and PMS-1). Abdominal computed tomography showed multiple enlarged LNs in the para-aortic and aortocaval areas. The patient was treated with capecitabine and oxaliplatin as the first-line palliative chemotherapy for 11 mo, followed by ramucirumab and paclitaxel as second-line palliative chemotherapy. After 2 mo of treatment with ramucirumab and paclitaxel, the tumor response indicated progressive disease. In June 2021, pembrolizumab (200 mg in a 3-wk cycle) was initiated as third-line palliative chemotherapy, given that the tumors showed dMMR.
+He had a history of foot psoriasis, which was well controlled without treatment.
+He had no personal and family history.
+The patient was afebrile with stable vital signs. Physical examination revealed erythematous swelling in the distal interphalangeal joints, left shoulder, and both knees . He had plaque psoriasis with psoriatic nail dystrophy and dactylitis in the distal joints of the fingers and toes .
+Before pembrolizumab administration, the neutrophil-to-lymphocyte ratio (NLR, absolute neutrophil count divided by absolute lymphocyte count) and prognostic nutritional index (PNI, 10 × serum albumin value, g/dL + 0.005 × total lymphocyte count/mm3) were 1.1 and 50.5, respectively. Two months after the initiation of pembrolizumab, laboratory testing revealed a normal white blood cell count of 7970/µL with 72.6% neutrophils and 17.9% lymphocytes, an elevated erythrocyte sedimentation rate (ESR) of 89.0 mm/h, and a serum high-sensitivity C-reactive protein (hs-CRP) level of 2.3 mg/L. Immunological serum tests were negative for rheumatoid factor (RF) and anticyclic citrullinated peptide antibody. Synovial fluid analysis of knee joint revealed a yellow appearance, decreased viscosity, and a cell count of 26,678 cells/mm3 with 81.2% neutrophils, indicating inflammatory arthritis. Gram staining was negative, no crystals were detected by microscopy, and cultures for common pathogens and mycobacteria were negative.
+Magnetic resonance imaging of the right knee and left shoulder showed joint effusion and synovial enhancement.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2113_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2113_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..076790e03ba1515676ea0de118854636f178c922
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2113_en.txt
@@ -0,0 +1,16 @@
+A forty year-old male was brought to the Queen Elizabeth Hospital, Kota Kinabalu, Sabah (8.30 am) in a state of collapse. He was unable to give a history himself or to stand. On examination his blood pressure was unrecordable and oxygen saturations were recorded as low.
+The patient had no past medical history. He had spent two weeks in the jungles of Borneo before leaving for an urban setting. Ten days after leaving the jungle he experienced the onset of fever and body aches. Two days later, he sought treatment at a government outpatient clinic continuing to complain of fever and myalgia. A specific diagnosis was not made and he was able to work although he developed rashes the next day. He remained unwell for the next two days, when he presented in a state of collapse and had developed abdominal pain.
+Resuscitation measures were begun and the patient was immediately intubated, given adrenaline/atropine and sodium bicarbonate. On examination and after resuscitation measures his vital signs were: symmetrical air entry into lungs, BP 58/44 mm Hg, pulse rate 40-50 per minute with poor peripheral perfusion and cyanosis. Heart sounds were normal. He had generalized petechiae and his abdomen was tense and distended.
+Resuscitation measures continued for one hour, during which time "coffee grounds" were observed in the nasogastric aspirate. The patient became asystolic after one hour and although cardiopulmonary resuscitation was given for a further 20 minutes, there was no response. The patient was pronounced dead two hours after admission.
+Dengue haemorrhagic shock was suspected and a post-mortem examination was performed approximately 24 hours later.
+Laboratory results are summarized in Table . The patient was not anemic, but was thrombocytopenic and had an eosinophilia. He was also hyponatraemic and had elevated blood urea, potassium, lactate dehydrogenase and amino transferase values. Serum creatinine was not available. A blood sample taken 24 hours post-mortem showed >10% of erythrocytes infected with predominantly pigmented parasites . Heavily pigmented monocytes were also present . Plasmodium knowlesi, as a single species infection, was confirmed by nested-PCR . Post-mortem dengue serology was negative and dengue, respiratory syncytial virus and enterovirus were not isolated in organ samples.
+External examination showed a well-nourished adult male. The conjunctivae showed tinges of jaundice and the right eye had subconjunctival haemorrhages. There were multiple petechial haemorrhages on the body and venepuncture sites were associated with marked bruising. Coffee ground material was noted in the mouth. Internal examination revealed no tissue oedema or excess fluid in the body cavities.
+The external surfaces of the cerebrum were dusky. The cut sections showed multiple petechial haemorrhages. The cerebellum also showed petechial haemorrhages externally and on multiple cut sections . The brain stem and upper spinal chord were grossly normal. Both lungs were heavy (weighing on the right 720 g and left 690 g) and cut sections were congested and 'beefy' in appearance. Petechial haemorrhages were present on the endocardium with extensive subendocardial haemorrhages involving the left ventricular wall. The haemorrhages were most prominent at the apex of the heart. The liver (2640 g) and spleen (340 g) were markedly enlarged. The cut surfaces of the spleen were soft and friable. The gallbladder, pancreas and kidneys were grossly normal.
+Haematoxylin and eosin stained sections from various organs were available for examination. Parasitized red blood cells (PRBC) were abundant although parasite bodies were obscured by haemozoin (malaria) pigment. Chemical removal of pigment and oil immersion (×1,000) magnification revealed trophozoites that were discernibly bigger than those of P. falciparum. Immunohistochemistry stained sections from the brain were Plasmodium anti-aldolase positive and negative for P. falciparum- specific staining .
+Many petechial haemorrhages (up to 600 μm diameter) arising from the rupture of the small vessels of the cerebrum and cerebellum were observed Sequestration of PRBC was evident within small blood vessels . Congested larger vessels and areas of haemorrhage showed considerable amounts of malaria pigment . Clumps of platelets or evidence of thrombi in vessels were not seen. There was no evidence of vasculitis or perivascular chronic inflammatory reaction in the brain or any other organ examined (heart, kidney, liver, adrenal gland and spleen). There was no evidence of perivascular or diffuse parenchymal oedema in the brain. Diffuse astrocytosis or microgliosis was not observed, nor was there evidence for acute gliotic reactions about the haemorrhages. There was no aggregation of polymorphs in the vessels, no perivascular inflammation, nor generalized encephalitis. There was no diffuse thrombotic microangiopathy, but within one haemorrhage there was probably some fibrin at the site of the vessel. Immunohistochemistry of sections from the brain was negative for CD54 (which stains intercellular adhesion molecule-1, ICAM-1).
+Although sections from the spleen showed some autolysis, expansion of the red pulp and atrophy of the white pulp was noted. Germinal centers were not observed. Abundant pigment-containing macrophages and some haemophaghocytosis was evident in the red pulp and parasitized red cells were plentiful . There was no necrosis or fibrin deposition in the spleen.
+There were many PRBC's in the liver sinusoids with haemozoin pigment in Kupffer cells and evidence of haemophagocytosis. The portal tracts and sinusoids had moderate chronic lymphoplasmacytic inflammation. Overall the liver was non-cirrhotic but with severe macrovesicular steatosis. No cholestasis, regional necrosis or thrombotic microangiopathy was observed .
+The renal cortex showed dilated and congested blood vessels. Many PRBC were observed within glomerular capillaries with pigment deposition in the mesangium. There was no evidence of thrombotic microangiopathy (disseminated intravascular coagulation, DIC). The tubules showed acute tubular necrosis and regeneration. There were a small number of eosinophilic intra-tubular casts .
+Sequestration of PRBC's was evident in the small vessels of the heart . Endothelial cells were prominent as sometimes observed in patients with sepsis whose cells are responding to generalized stimuli . There was no evidence of myocarditis and the heart muscle fibers appeared normal. There was focal petechial haemorrhage in the subendocardium, which may relate to resuscitation, or be secondary to malaria.
+The adrenal gland appeared active with eosinophilic cytoplasm in the fasciculata layer with no evidence of PRBC sequestration or of parenchymal haemorrhage. Samples of lung, intestine or bone marrow were not available for histopathology examination.
+The overall picture was one of systemic malaria infection with multi-organ damage, particularly in the brain where there was much vascular rupture and petechial haemorrhaging.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2130_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2130_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..65d7c766f04f9a15fac69691082cfebdbd49169a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2130_en.txt
@@ -0,0 +1,6 @@
+A 63-year-old male presented complaints of weakness in bilateral lower limbs left more than right, paraesthesia in bilateral lower limbs and difficulty in walking from past 5 months. On examination, patient was found to have increased tone in bilateral lower limbs and power of 4/5(MRC grading) in bilateral lower limbs. Patient also had reduced touch and pain sensation below eighth thoracic dermatome level. Bladder function and sphincter control were preserved.
+MRI demonstrated a T1 hypointense and T2 hyperintense and contrasts enhancing intradural extramedullary lesion at eighth thoracic level. Contrast MRI of the brain revealed a 4.2 × 3.6 × 3.5 cm lesion in the trigonal area of the left lateral ventricle. The lesion was T1 hypointense and heterogeneously contrasts enhancing .
+Patient, due to his symptoms of the spinal lesion underwent excision of the spinal lesion. D7 and D8 laminectomy was performed. Tumor was dorsal placed and total excision along with attached dura was performed. Dural defect was closed and wound closed with a drain in situ. Patient’s spasticity and gait improved in the postoperative period. Patient complained of headache in the postoperative period and hence MRI brain was performed. The cranial lesion was planned for a second stage surgery since patient did not exhibit any symptom for the same.
+On follow-up patient presented to us with two episodes of seizures, 2 months after the spinal surgery and patient was admitted for excision of the cranial component. The left parietal craniotomy was performed and trigone was approached through the keens point. Excision was performed and patient had an uneventful postoperative course.
+Microscopic examination of the spinal tumor showed a meningothelial neoplasm having transitional morphology. The cells were moderately pleomorphic and were arranged in fascicles, whorls, and lobules with few psammoma bodies. The tumor had mitotic activity reaching upto 4/10hpf and a Ki-67 labeling index of 12–15%. Due to the increased mitotic count, this tumor was classified as atypical meningioma, the WHO Grade II .
+Resected tissue from the trigone showed a meningothelial neoplasm exhibiting transitional morphology with few psammoma bodies, lymphocytic, and foamy macrophage infiltration. The cells were arranged in fascicles and whorls and had moderate nuclear pleomorphism, mitotic activity of 1–2/10hpf and Ki-67 labeling index of 4–5%. There was no evidence of brain parenchymal invasion. These features were of a transitional meningioma, the WHO Grade I.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2134_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2134_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..abb204760a11d99c6622e3acaf5fce5365fc8edd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2134_en.txt
@@ -0,0 +1,9 @@
+A 59-year-old Malay lady presented with a fever of 40 °C and left parotid swelling of 2 days history. Her medical history was significant for recurrent bilateral parotitis with a background of limited cutaneous systemic sclerosis and Sjögren’s syndrome for 4 years. At the time of presentation, she was not on chronic immunosuppressants. There was no recent history of pneumococcal vaccination.
+She had recurrent parotitis that had occurred four times from 2012 to 2014. All episodes required hospitalization for intravenous antibiotics. She previously had Staphylococcus aureus and Klebsiella pneumoniae isolated from fluid culture from the parotid duct for the recurrent parotitis in 2012. A previous computed tomographyscan of her parotid area performed in 2012 showed left parotitis without evidence of sialolithiasis or abscess.
+On examination, there was swelling in the left parotid area without erythema or fluctuance. There were no palpable stones and there was no dental infection or discharge from the parotid duct. Salivary pooling was poor. Systemic examination was otherwise normal.
+On admission, she had a white blood cell count of 10.78×109 cells l−1 (normal range 4.0–11.0×109 cells l−1) and a C-reactive protein level of 14.9 mg l−1 (normal range 0.2–9.1 mg l−1). Ultrasound of the left parotid gland showed non-specific inhomogeneous echotexture with multiple small hypoechoic areas and a slight increase in vascularity representing an inflammatory/infective process.
+Blood cultures collected on admission were flagged positive after 10 h incubation with Gram stain demonstrating Gram-positive cocci in chains. Small α-haemolytic colonies with a central naval-like depression were isolated on 5 % sheep blood agar after 24 h incubation at 37 °C in 5 % CO2. These were identified as S. pneumoniae based on their being catalase negative, optochin susceptible and bile solubility test positive . Antimicrobial susceptibility testing was performed and interpreted using Clinical and Laboratory Standards Institute guidelines , which found the S. pneumoniae to be sensitive to penicillin (MIC = 0.032 mg l−1) and ceftriaxone (MIC = 0.064 mg l−1) via Etest, and sensitive to clindamycin, levofloxacin and vancomycin via disc diffusion. In view of the pneumococcal bacteraemia, a transthoracic echocardiogram was carried out and was negative for vegetations. The patient received empirical intravenous ceftriaxone 2g OM initially for 3 days, and this was later changed to intravenous benzylpenicillin 4 megaunits every six hours when blood culture sensitivities were available.
+Her fever and parotid swelling improved with antibiotics and subsequent blood cultures were negative. She had received a total of 1 week of antibiotics upon discharge. Outpatient therapy with intravenous ceftriaxone was continued for an additional 2 weeks, with complete resolution of her parotitis. Pneumococcal vaccine was administered to her in the outpatient clinic.
+A retrospective review of bacteraemia cases in the Singapore General Hospital from January 2011 to April 2016 revealed 116 cases that were due to S. pneumoniae. The majority of these were attributed to pneumonias (94 cases, 81.0 %), followed by meningitis (7 cases, 6.0 %), with isolated episodes attributed to otomastoiditis, retropharyngeal abscess, septic arthritis, spondylodiscitis and spontaneous bacterial peritonitis (5 cases, 4.3 %). None were due to acute bacterial parotitis and no obvious source was found in the rest (10 cases, 8.6 %).
+Most cases resolved with treatment and did not develop any complications (93 cases, 80.2 %). Complications such as epidural abscess, spondylodiscitis, and psoas abscess with osteomyelitis and discitis were found in 3 cases (2.6 %), but these patients eventually recovered following surgical intervention and a prolonged period of antibiotic therapy. Twenty patients died, most of these cases were due to pneumonia, whereas only one case was due to meningitis.
+A large proportion of the S. pneumoniae isolates were sensitive to penicillin, ceftriaxone, clindamycin and vancomycin (71 cases, 61.2 %). Mono-resistance to clindamycin was most commonly encountered (35 cases, 30.2 %). Resistance to β-lactams was infrequently encountered, with intermediate sensitivity to ceftriaxone in 3 cases (2.6 %) and resistance to penicillin in 2 cases (1.7 %). In addition, there were 4 cases (3.4 %) that were intermediately sensitive to ceftriaxone and resistant to clindamycin, as well as 1 case (0.9 %) that was intermediately sensitive to ceftriaxone and resistant to clindamycin and penicillin.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2142_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2142_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c00955860fe841a0a1ee0bb0115f242a1f781f5e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2142_en.txt
@@ -0,0 +1,5 @@
+Our patient is a 51-year-old Filipino female who had been recently diagnosed with hypertension, non-compliant with medication, presented to the emergency department with acute confusion for 1 day and repeated vomiting. There was no history of loss of consciousness or seizures. On admission, her blood pressure was 198/120 mm Hg, pulse was 92/min, and respiratory rate was 20/min. On examination, her glasgow coma scale (GCS) was 14/15, pupils were 3 mm, equal and reactive bilaterally. No evident cranial nerve palsy was observed. There was no papilledema.
+Patient underwent CT scan brain and CT angiogram (CTA), which showed dilatation of both lateral and the third ventricles with periventricular hypo densities suggestive of transependymal cerebrospinal fluid (CSF) permeation. No intracranial hemorrhage was seen . The fourth ventricle was normal. The patient underwent external ventricular drain (EVD) insertion for decompression of the ventricular system, following which the patient's GCS improved. Postoperatively, left facial palsy was noted.
+The following day, we performed MRI with MR angiogram (MRA) and CSF flow studies. This revealed residual dilatation of both lateral and the anterior part of the third ventricle . MRA revealed a dominant left vertebral artery, an elongated basilar artery reaching 18 mm above the dorsum sellae, which was elevating and compressing the posterior floor of the third ventricle and aqueduct, hence causing dilatation of the anterior third ventricle. The basilar artery was not significantly dilated and was slightly deviated off the midline. CSF flow studies did not show any flow in the third or lateral ventricles. Good flow was noted in the fourth ventricle, cistern magna, and pre-pontine cistern. Few incidental lacunar infarcts were seen in the thalamus and basal ganglia.
+On retrospect, the third ventricular compression and the elevation of the basilar bifurcation was overlooked on the initial CTA. MRI and MRA were useful in settling the diagnosis.
+Finally, the external ventricular drain was converted to ventriculo-peritoneal shunt and was subsequently discharged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2148_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2148_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f704773e5087dd52052dcba2fe3b04ba269628a3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2148_en.txt
@@ -0,0 +1,2 @@
+The patient was a 33-year-old female with diagnosis of T-ALL. Initial laboratory data showed increased leukocyte count of 105 × 109 per liter (L), decreased hemoglobin level of 7.8 mg per deciliter (mg/dL), and decreased platelet count of 28 × 109/L. She received intensive systemic chemotherapy including L-asparaginase, prednisone, vincristine, and intrathecal methotrexate, hydrocortisone, and cytosine arabinoside, which resulted in complete remission of her disease, and then underwent allogeneic hematopoietic stem cell transplantation. After a 15 mo period without symptoms and signs of progression, the patient presented with palpable masses in both breasts. She complained from severe pain and swelling of the breasts.
+Polymerase chain reaction analysis of bone marrow aspirates demonstrated complete allogeneic hematopoietic chimerism, and there were no leukemic lesions at other sites including the bone marrow and cerebrospinal fluid. Imaging workup included bilateral mammography, doppler ultrasonography and breast magnetic resonance imaging (MRI). On ultrasonography, lesions were detected in the upper inner quadrant of the right breast with mixed echo and significant hyperechogenicity. Another lesion was detected in the left breast with mixed echo and significant hyperechogenicity. Doppler ultrasonographic assessment showed vascularization in these breast lesions. Diffusion-weighted and dynamic contrast-enhanced breast MRI revealed significant diffusion restriction and type 2 and 3 contrast patterns. Lesion on the right breast was heterogeneously hypointense with contrast enhancement. The lesion in the left breast also showed contrast enhancement, and was hypointense on T1 weighted sequencing, and hyperintense on fat suppressed MRI.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2160_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2160_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fbf998dc2eeb40af81255ac4fcd39ea0f8ffd34c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2160_en.txt
@@ -0,0 +1,2 @@
+A 71-year-old female patient with thalassemia minor and hypertension was diagnosed in 1999 with early-stage right breast cancer. She underwent breast-conserving surgery and axillary dissection; pathology showed a small tumor, less than 2 cm, node-negative invasive ductal carcinoma. Hormone receptors (HRs) were positive but HER2 was negative. After the surgery, she received chemotherapy [cyclophosphamide, methotrexate, and 5-fluorouracil (CMF)] followed by radiotherapy and adjuvant tamoxifen for 5 years. She did well and was very adherent to clinical and mammographic follow-up until 2015, when she had an intractable cough. Imaging studies showed a left hilar lesion and multiple osteolytic bone metastases, including the left scapula, left shoulder, left iliac bone, and the fourth and seventh dorsal vertebrae. Fine needle aspiration from the left hilum, through endobronchial ultrasound, confirmed breast cancer metastasis. Similarly to the original tumor, hormone receptors were positive (ER 90%, PR 30%) and HER2 was negative. Therefore, she was started on endocrine therapy with fulvestrant, which kept her progression free for 2 years. She was then switched to exemestane and everolimus; however, this regimen was discontinued owing to grade II pneumonitis and prenephrotic range proteinuria. At that time, the patient was enrolled in a double-blind randomized clinical trial testing CDK4/6 inhibitors along with aromatase inhibitors. A few months later, the patient was taken off the study owing to disease progression, and was found to be on the placebo arm. Following the US Food and Drug Administration (FDA) approval of CDK4/6 inhibitors, she was started on ribociclib and letrozole, which she tolerated relatively well. Nonetheless, because of persistent neutropenia, the dose of ribociclib was reduced to 400 mg daily; on days 1–21 of a 28-day cycle.
+Almost 20 weeks after starting ribociclib and letrozole, she noticed small, rounded, well-demarcated hypopigmented lesions over both hands with expanding patches reaching up to the mid forearms . Three weeks later, new similar lesions started to appear over her face and feet. The patient had no personal or family history of autoimmune diseases. The patient was seen at the dermatology clinic and was offered treatment with topical immunomodulators (calcineurin inhibitors), which she refused, and was kept on topical steroids with little improvement.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2167_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2167_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6f7c049b59ebf4a832a0c40f2c6e0088d742272f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2167_en.txt
@@ -0,0 +1,3 @@
+We report a case of a 46 year-old female patient, with a cataract on her right eye with a central corneal leukoma. Patient reported during one of the examination prior to the surgery that when she was 6 years old, patient had an eye injury with corn leaf. At the age of 10 year patient reported that she had another injury of the same eye with a glass. Patient also said that she wasn’t seeing quite well after that. Patient reported that she wasn’t under any medical therapy or that she was wearing contact lenses or glasses. Three years ago patient had a transplantation of amniotic membrane due ulcer on the same eye in different hospital then ours. Now she was admitted to hospital for a triple surgical procedure.
+Ocular examination on admission day to hospital revealed patients best uncorrected distance visual acuity (UDVA) to be light perception on patient RE (right eye) and 1.0 with out any correction LE (left eye). Results on patient slit lamp revealed on the right eye corneal edema with a central leukoma, with a complicated cataract and partial seclusion of pupil and no pathological findings on left eye. Patients pupil size were equals. Patient ocular movements were normal in all gazes. Intraocular pressure (IOP) was also normal. Examination of the left eye was normal. The vitreous was quiet and retinal vessels were of normal caliber. Details on the founds of right eye were impossible to asses due the changes in anterior segment. We performed ultrasound examination and we performed intraocular lens calculation. Due pathological changes on the right eye we were unable to accurately measure the true corneal power values so we performed intraocular lens calculation for the left eye. Before the surgical procedure patient was treated with Prednisone 80 mg intravenous and as well systematic antibiotics with local corticosteroids and antibiotics . The pupil was dilated preoperatively with tropicamide 1% eye drops. Before surgical procedure a good quality donor cornea was retrieved from a cadaveric transplantation.
+After informed consent was obtained, operation was performed in general anesthesia. After excision of the opaque recipient cornea, a cataract was seen. Before the staining of anterior capsule, surgeon performed excision of pupillary membrane and synechiolysis. The anterior capsule was initially stained with VisionBlue (Dutch Ophthalmic, USA). Cataract extraction with IOL implantation (open sky) was performed under operating microscopes Operative Microscope OPMI Visu 150 Carl Zeiss Meditec Inc, Dublin, using Alcon Infiniti® Vision System Fort Worth Texas USA, sodium hyaluronate (Provisc® Alcon) as viscoelastic and surgical instruments Alcon and Geuder AG Heidelberg Germany. After placing four cardinal sutures, the donor button was fixed to the recipient using separate 10/0 nylon sutures. . Follow-up examinations were performed on days 1, 3, 7, and 30 days. Thirty days after surgery her UDVA was 0,5. The patients received topical antibiotic and corticosteroids. Postoperatively, if keratometric astigmatism exceeded 4.0 D, tension of the running sutures was adjusted after 1 to 2 months, and selective removal of separate sutures began after 2 months. Currently patients visual acuity is 0.6 without correction.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2172_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2172_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fad79fb0cfbbaff6ebb1dc45efca9113f2503009
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2172_en.txt
@@ -0,0 +1,5 @@
+A 28-year-old man presented to the emergency room complaining of sudden-onset dyspnea, with no predisposing factors. The dyspnea lasted less than two hours and had almost resolved upon arrival at the emergency room, and there were no accompanying symptoms. He revealed no medical history other than two operations related to trauma, namely, a right anterior cruciate ligament reconstruction four years earlier, and nasal fracture reduction 13 years earlier. He denied any history of medication, and underlying diseases including connective tissue disease. The patient had never smoked, and drank a bottle of beer with 4.5% alcohol twice a week.
+On admission, he did not complain of fever, cold sensation, diarrhea, or abdominal pain. His vital signs on presentation demonstrated a temperature of 36.2°C, a heart rate of 72 beats per minute, a respiratory rate of 19 breaths per minute, a blood pressure of 120/80 mm Hg, and an oxygen saturation of 97% on room air. He presented with a soft abdomen with normoactive bowel sounds, and no abdominal tenderness to palpation on physical examination. A plain chest and abdominal film showed subphrenic free air and an unremarkable bowel gas pattern . The laboratory tests presented the following results: serum total bilirubin, 1.67 mg/dL (normal, 0.3–1.2 mg/dL); alanine aminotransferase, 24 IU/L (normal, <50 U/L); aspartate aminotransferase, 25 IU/L (normal, <50 U/L); amylase, 47 U/L (normal, 28–100 U/L); and C-reactive protein, 0.48 mg/dL (normal, < 0.5 mg/dL). Given the free air finding on the chest X-ray, we were highly suspicious of bowel perforation. We therefore performed contrast-enhanced computed tomography (CT) of the abdomen.
+A CT scan revealed a pneumoperitoneum in the right upper quadrant, pneumoretroperitoneum, and gas in the entire portal venous system, without bowel wall thickening, bowel dilatation, bowel perforation, intramural gas, or any abnormal findings in the mesenteric arteries . The diagnosis of HPVG accompanied by free air was made by CT scan; however, no underlying etiology was identified. The patient denied a recent history of trauma, endoscopic procedures, asphyxia, or heavy lifting activity, or any symptoms suggestive of an infectious disease.
+Considering the stable vital signs and the lack of physical findings suggesting a surgical acute abdomen, the patient was conservatively managed with fluid resuscitation and antibiotics, including cefotaxime 2 g every 8 hours and metronidazole 500 mg every 8 hours, and was kept nil-per-os. On admission day 3, the follow-up simple erect abdominal X-ray revealed resolving free air , and no new symptoms appeared. Oral feeding was initiated, after confirming that there were no abnormalities on esophagogastroduodenoscopic examination . The patient was able to tolerate oral food intake without any complications, and was later discharged.
+The follow-up CT scan, performed two weeks after discharge, showed that the diffuse air density in the portal venous system, the pneumoperitoneum, and the pneumoretroperitoneum had resolved, and the colonoscopy and the colonography protocol CT scan revealed no significant abnormalities . The patient has been on follow-up observation at an outpatient clinic for four years, and has experienced no recurrence of symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2173_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2173_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b06944830f9c45a277bb77b79f05a5ae73b71950
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2173_en.txt
@@ -0,0 +1,3 @@
+A 47-year-old woman presented with complex bilateral renal stones and was referred to our hospital for surgical treatment due to failure of conventional PCNL performed at another hospital. Initially, we performed mini-ECIRS for the right renal stone, which was later identified as calcium oxalate, without any complications and residual stones.
+Three months after the first mini-ECIRS, she underwent a second mini-ECIRS for the left renal stone. Laboratory studies showed normal values of serum inflammatory markers, liver and renal function, mineral markers, and urinary parameters. Multi-slice computed tomography and kidney-ureter-bladder radiography revealed a stone (size, 6.5 × 2.2 × 2.4 cm3) with left calyceal fragment . Mini-ECIRS was performed in the prone position, and supra-12th rib access was obtained with a single pass of the 16.5/17.5-Fr metal sheath with a 12-Fr nephroscope under combined US and ureteroscopy guidance. During puncture, we identified the pleural space and pleural line under US to avoid penetration. After puncture, we checked intraoperative fluoroscopy to evaluate potential chest complications. Using the holmium YAG-laser through the rigid nephroscope, all parts of the collecting system and a part of the main stone were cleared. Finally, an ureteral stent without a nephrostomy tube was placed after the procedure. The operative time was 3 h, with no intraoperative complications and an estimated blood loss of <100 cc.
+On POD 1, the patient developed shortness of breath. Tachypnea with normal vital signs was noted with deteriorating breath sounds on the left side. Chest radiography confirmed left pleural collection . Her hemoglobin level, which was 12.0 g/dL at discharge, had dropped to 11.0 g/dL. On consultation with the thoracic surgeon, she was conservatively managed without any treatment for several days. On POD 5, a 16-Fr tube was placed for left intercostal drainage under local anesthesia with ultrasonography guidance by the standard technique because of the aggravation of hemothorax . A small volume of old blood was drained without improved expansion of the left lower and middle lobes . On POD 9, VATD was performed for the hemothorax. During intraoperative monitoring, some abscesses were observed in the hemothorax, which appeared to be empyema; moreover, a scar hole that had been punctured through the pleural cavity during mini-ECIRS was identified . Thereafter, blood clot evacuation, decortication, and ablation were performed by VATD. At the end of the procedure, the 20-Fr chest tubes were retained . On POD 14, she was discharged after retrieval of the chest tube. Follow-up evaluation showed satisfactory expansion of the left lung with complete resolution of all chest symptoms .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2176_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2176_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2862a5cc792e16cac8331b77b349435a824f57d6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2176_en.txt
@@ -0,0 +1,5 @@
+A 27-week four days old preterm male infant was born from a dichorionic diamniotic twin pregnancy with low birth weight(1135 gr). His prenatal examinations were completed regularly without reported complications. In the 27th week of pregnancy, the mother experienced premature membrane rupture, contractions, and bleeding. She was treated with antenatal steroids and cesarean delivery was planned due to an arrested birth. During birth, the neonate was hypotonic and apneic, requiring intubation one minute after birth due to respiratory failure with an uncuffed endotracheal tube. His APGAR scores were 4,6 and 7 in the 1st, 5th, and 10th seconds, respectively. He was transferred to the newborn intensive care unit(NICU) for further management. After a diagnosis of respiratory distress syndrome was made, treatment with endotracheal poractant alfa 200 mg/kg, parenteral ampicillin-gentamicin, and caffeine citrate was initiated. His ventilation settings were arranged to assist control and volume guaranteed mode with maximum inspiring pressure of 20 cm/H²O. His cranial ultrasound showed no abnormalities.
+On hospital day 3, he was extubated to nasal intermittent positive pressure ventilation but required reintubation for recurrent respiratory failure. His antibiotics were escalated to vancomycin-meropenem due to clinical deterioration.
+During hospital day 5, the baby had worsening acute hypoxic respiratory failure. A chest x-ray revealed mediastinal pneumothorax , with a follow-up x-ray one hour later showing accelerated pneumothorax on the left side and mediastinal shift to the right. To treat the pneumothorax, a thorax tube was placed through the left 5th intercostal space. Repeat x-rays showed an expanded lung on the left side and air bronchograms on the right. Ten hours later, he had persistent acidosis and hypoxia, with another x-ray displaying a repeat pneumothorax on the left side. The thorax tube was set to continuous suction, resulting in a reduction of pneumothorax on subsequent imaging.
+On the 6th day of hospitalization, an echocardiogram revealed a 3 mm patent ductus arteriosus(PDA) with mostly left to right two-way shunts and pulmonary hypertension. His oxygen saturation levels were approximately 80%, and his arm-leg saturation differences were higher than 15 mm Hg, suggesting differential cyanosis. These findings were suspicious for persistent fetal circulation; therefore, pediatric cardiology advised against the closure of PDA. A new chest x-ray showed a collapsed left lung, and a second chest tube was placed in the left hemithorax.
+The decision to perform a surgical intervention was made given no resolution of the pneumothorax after the second chest tube and the patient’s continued clinical deterioration. A left posterolateral thoracotomy was performed. During the exploration, a 1 cm perforated area between the left bronchus and carina was found by following the air leak through the visceral pleura. The perforated area was repaired by using a pleural patch, and suturing with 6.0 prolene was performed. At the end of the procedure, there was no visible bleeding or air leak. The anesthesiologist applied high-pressure air via the endotracheal tube to check for any air leaks. A chest tube was inserted, and the thoracotomy incision was closed by layers. Post-procedure chest x-ray showed an expanded left lung. Three days later, the neonate experienced another episode of hypoxia, which was found to be secondary to a repeat left-sided pneumothorax. Consequently, a second thoracotomy was performed using the same technique as the prior surgery, with an air leak emanating from the same area. The perforated area was repaired using a pleural patch and the left 5th intercostal muscle long peduncle . Fibrin glue and spongestan were used as anchorage on top of the patch . After the repair, no leak was found with the use of maximal airway pressure. A PDA ligation operation was also performed simultaneously during the procedure . There was no air leakage in the repeat x-ray. Both the first and second thorax tubes were removed on postoperative days 0 and 5, respectively. There were no signs of air buildup or pneumothorax on the following days. On the 161st day of admission, the patient was discharged home with a home-type ventilator and 30% oxygen support.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2181_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2181_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a876edf2c2b1177b1fe20cdf0e7819d17fcedf90
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2181_en.txt
@@ -0,0 +1,6 @@
+A 23-year-old female presented to our hospital with bilateral congenital malformed thumbs. The patient had understood her condition since she was a child and refused to undergo surgical correction. In adulthood, the patient encountered two main problems. First, she usually felt unconfident due to the cosmetic appearance of her thumbs. Second, those thumbs disturbed her activities when precise movements were needed, such as sewing. This activity, sewing, is essential for her job as a tailor. As time went on, the patient felt more uncomfortable with her thumbs since they made sewing difficult. Finally, the patient and her parents sought medical advice for her thumbs.
+Physical examination showed that the left thumb deviated 25° to the ulnar side, while the contralateral thumb deviated 15° to the radial side without any swelling in either thumb . There was no sign of pain or inflammation in either thumb. Both thumbs also did not suffer from limited movement in abduction and flexion. Other than the malformation, there was no medical condition such as anemia or a history of trauma. The Disability of Arm, Shoulder, and Hand (DASH) score was evaluated to assess the specific disability of the extremity, and the result was 17.5. The Sollerman Hand Function (SHF) and Michigan Hand Outcome were also evaluated, giving scores of 56 and 60 for the left and right hand on the SHF test, and 65.6 and 66.6 for the left and right hand on the Michigan Hand Outcome.
+Under the plain x-ray of the thumb , it was revealed that both thumbs had an extra delta-shaped bone between two normal bones at the distal interphalangeal (DIP) joint. Hence, the patient was diagnosed with bilateral delta-type TPT.
+The patient underwent operation for the correction of both thumbs. In general anesthesia, an H-shaped incision was made on the dorsal side. To expose the accessory phalanx, the extensor tendon was split longitudinally from the PIP joint through the DIP joint. Then, the accessory phalanx was removed, followed by ligament and tendon reconstruction.
+The distal phalanx and the proximal phalanx were placed close together with denudation of the articular surface. The first K-wire was introduced retrogradely to the distal phalanx intramedullary with the joint flexed to gain an optimal view, then with an antegrade fashion, advanced the K-wire to the proximal phalanx. After the IP joint was in adequate contact, the IP joint was bent in a 10°–15° flexion position. The first K-wire was the primary fixator for longitudinal alignment. Then, the second K-wire was introduced obliquely over the IP joint. The second K-wire acted as an antirotation wire to stabilize the joint . After 3 days of observation, there were no complications.
+Six months later, during the follow-up, the K-wire was removed . There were no chief complaints or adverse events before or after the K-wire removal. To examine the function of the hand after the correctional surgery, the SHF test was executed. The patient also performed tasks with her hands, such as inserting a thread into a pinhole precisely, and returned to work earlier. Both of her hands had a satisfying outcome, with an overall score of 80 and 79 in the dominant and non-dominant hands, respectively. The Michigan Hand Outcome score was 97.2 and 98.9, and the DASH Score was 7.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2184_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2184_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..45388e0d10a881147641c6b50e46b4b45834f909
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2184_en.txt
@@ -0,0 +1 @@
+A 5.8-year-old boy was admitted to our hospital with a 6-month of facial hair and phallic growth, deepen voice and accelerate growth velocity. The Tanner stage was II for genital development and II-III for pubic hair. Both side testicular volumes were 4 mLby Prader. Family history of PP was denied. The serum sex hormone profile indicated prepubertal levels of gonadotropins with basal LH < 0.1IU/L (prepubertal range < 0.1–0.3 IU/L) and basal FSH < below 0.1 IU/L (prepubertal range < 0.1-3), and pubertal testosterone level (4.48 ng/ml, prepubertal: <0.2-1ng/mL). His height reached 129 cm (+ 2.4 standard deviation scores,) with a high serum insulin like growth factor-1 level (+ 3.5 standard deviation scores) in National-specific charts . Other anterior pituitary hormonal profiles were normal. HCG was detectable both in serum and in cerebrospinal fluid (CSF), 7.12 and 15.66 IU/L separately. Bone age (BA) was advanced to 8 years old. Contrast-enhanced brain magnetic resonance imaging (MRI) revealed a homogeneously enhanced pineal mass . The elevated serum hCG level and pineal mass on imaging suggested the clinicial diagnosis of intracranial germ cell tumor (iGCT) and then two courses of ICE chemotherapy (ifosfamide, carboplatin and etoposide) were performed. Repeated MRI did not reflect a significant shrinkage of the pineal lesion although hCG (< 0.1 IU/L, range 0-2.6 IU/L) has been normalized. Meanwhile, basal serum gonadotropin levels (LH 2.96 and FSH 1.86 IU/L, separately) unexpectedly increased . Considering the possibility of mixed germ cell tumor due to elevated hCG level and poor response to chemotherapy [, ], the patient underwent a neurosurgical operation and the histological result revealed a mature teratoma. Subsequently, he continued to receive two additional courses of ICE chemotherapy and the radiotherapy targeting the whole brain (24 Gy) plus the pineal region boosting (12 Gy). During this period, his gonadotropin and testosterone levels were within the normal pubertal range, although with a transient change . After operation and chemoradiotherapy, MRI indicated the morphological disorders of the pineal gland without an enhanced lesion . The patient’s puberty progressed with the Tanner stage III for genital development and stage III for pubic hair. Meanwhile, the patient’s height reached 134 cm (+ 2.7SD) with a bone age of 12 years. To postpone epiphyseal closure and save growth potential, GnRH analogue therapy was started to suppress gonadal activation. This boy decided to return to the local hospital to continue GnRH analogs therapy. Through telephone survey after 2 months of GnRH analogue therapy, the patient’s gonadotropin levels normalized (LH 0.29 and the FSH 0.13 IU/L) and premature presentations gradually regressed. After 18 months of regular GnRH analogue therapy, the patient’s LH and FSH remained undetectable while his precocious puberty regressed. The growth velocity is approximately 5 cm per year.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_218_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_218_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d41f2630ac29b263c6115c8fd7c63de768c4066a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_218_en.txt
@@ -0,0 +1,3 @@
+A 94-year-old male with a past ocular history of age-related macular degeneration (AMD) in both eyes presented to the ophthalmology clinic for a routine dilated fundus exam (DFE). On exam his Snellen visual acuity was 20/100 OD and count fingers (CF) OS. Exam findings were significant for end-stage AMD in the left eye and subretinal hemorrhage in the right eye. He was referred for ocular ultrasound and found to have subretinal hemorrhage secondary to progression of his exudative macular degeneration. Anti-VEGF treatment was initiated and continued for several months. The patient was then found to have a choroidal lesion that measured 14.5 × 14.6 mm in basal dimension with a thickness of 6.4 mm. There was low to medium reflectivity, moderate irregularity and trace spontaneous vascularity. These findings were consistent with a clinical diagnosis of choroidal melanoma.
+The patient was referred for a liver ultrasound, which showed questionable focal lesions within the liver, and further evaluation with CT abdomen and pelvis was recommended. Given the liver ultrasound findings the patient was re-evaluated with ocular ultrasound, which did not show evidence of extrascleral extension . The patient underwent staging CT chest, abdomen and pelvis that were negative for metastatic disease. An MRI of the orbits with contrast showed a subcentimeter region of abnormal contrast enhancement extending into the immediately adjacent retro-bulbar fat, suspicious for scleral invasion and small extrascleral lesional extension .
+The patient presented to the ophthalmology walk-in clinic several days after the MRI with complaints of right eye pain that he described as “monotonous friction” like pain. Exam findings were significant for visual acuity no light perception (NLP) OD, an intraocular pressure of 28 OD, diffuse hemorrhage in the anterior chamber and no view into the posterior pole secondary to vitreous hemorrhage. B-scan ocular ultrasound performed during that visit was consistent with hemorrhagic choroidal detachments with diffuse vitreous hemorrhage. Given the presence of a choroidal melanoma, questionable extrascleral extension and a painful eye, patient and providers decided to pursue enucleation. The patient underwent enucleation OD and the specimen was sent for analysis. Final pathology revealed malignant melanoma of the choroid (spindle B-type) with intact sclera and no obvious extrascleral extension posteriorly .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2204_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2204_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d48c7add7a8ff7b69a5a107f4314d674b288948d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2204_en.txt
@@ -0,0 +1,2 @@
+A 67-year-old female presented with headache after a four-foot mechanical fall that occurred while hiking. The patient removed a stick from her left ear after a brief loss of consciousness. In the emergency department, the patient had left tongue deviation, a macerated left external acoustic meatus, and hoarse voice. Computed tomography angiography of the head and neck demonstrated soft tissue injury extending inferiorly into the carotid space .
+Internal carotid artery dissection and occlusion were observed just superior to the carotid bifurcation. Both crescent sign and flame occlusion ( and ) are pathognomonic findings on computed tomography angiography neck for carotid dissection and were identified as a result of this trauma. The patient was admitted to the neurological intensive care unit and later discharged with aspirin for stroke prophylaxis and percutaneous endoscopy gastrostomy placement to manage dysphagia from vocal cord paralysis secondary to microvascular injury to the left recurrent laryngeal and hypoglossal nerves.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2236_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2236_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..55434a97e52bfd577d5c15b5c34409b09e393f4f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2236_en.txt
@@ -0,0 +1,3 @@
+A 69-year-old woman presented to our hospital with a 5-month history of chest tightness, palpitation, nausea, and fatigue during activity. The symptoms were alleviated at rest. Chest computed tomography that had been performed in a local hospital showed cardiomegaly without a pulmonic lesion. She had a 9-year history of hypertension and declared there had been no recent continuous fever, except for “flu,” for which she had received general treatment in a local clinic 6 months previously.
+Further evaluation revealed that the patient was afebrile with stable vital signs. Transthoracic echocardiography (TTE) showed enlargement of the left ventricle (60 mm diameter during diastole) with moderate aortic regurgitation due to valve degeneration, dilatation of the right heart without right ventricular dysfunction, and moderate tricuspid regurgitation (tricuspid annulus diameter 45 mm). TTE also revealed PV stenosis with a peak velocity of 4 m/s and patent foramen ovale (PFO). Transesophageal echocardiography (TEE) was performed because of poor visualization of the pulmonary artery on TTE. TEE had revealed a large main pulmonary artery (diameter 56 mm), severe pulmonary regurgitation with vena contracta of 15 mm , patent ductus arteriosus (PDA) with a diameter of 7 mm , and a thickened, dome-shaped PV with no attached vegetation. The patient was diagnosed with multiple congenital heart diseases—PV stenosis, PDA, PFO—accompanied by degeneration of the aortic valve. The cause of her pulmonic regurgitation, however, remained undetermined.
+Cardiac surgery was scheduled after preoperative tests showed that the white blood cell count and C-reactive protein level were within normal ranges. Intraoperatively, the surgeon found an approximately 2 cm2 perforation in the PV leaflet , and the pulmonary artery had a rough surface around the PDA orifice with no vegetation. The patient successfully underwent a complicated procedure involving closure of the PDA and PFO, replacement of the PV and aortic valve with Medtronic bioprosthetic valves (#27 and #25, respectively), and tricuspid valvuloplasty with a #30 Solo ring under cardiopulmonary bypass. She was discharged on postoperative day 10. At the 3-month follow-up, the patient remained asymptomatic, and TTE revealed good function of the bioprosthetic valves.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2238_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2238_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c33ec5af0f819f86124b7a1c81068d1fbd5f1c08
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2238_en.txt
@@ -0,0 +1,6 @@
+A 2 years old Javanese boy came with complaints of recurrent fever and urinary tract symptoms such as dysuria and straining. The patient was born via cesarean section at 34 weeks of gestation, with birth weight of 2250 g and considered as low birth weight. In his growth and development, this patient experienced numerous clinical problems in the form of abnormalities in his organs, such as atresia ani and unilateral undescended testicles. During the first year of his life, this patient underwent several definitive surgeries such as colostomy, anoplasty and orchidopexy. Right now this patient came with complaints of recurrent fever and urinary tract symptoms such as dysuria and straining. From a computerized tomography (CT) scan of the abdomen, the results showed there was an abnormality in the urinary tract . Cystourethrography examination was done and showed grade 5 voiding and grade 1 vesicoureteral reflux on both the left and right side Fig. .
+Retrograde pyelography is a necessary examination to confirm the diagnosis of unilateral renal agenesis. From this examination, it was found that there was a duplication in the left ureter and the absence of a collecting system on the left side. This patient also underwent a lumbosacral magnetic resonance imaging (MRI) examination to confirm whether this patient suffered from spina bifida or not . A laparoscopic left ureterectomy examination was carried to see how the patient's urinary tract functions Fig. .
+In the end, laparoscopic left transperitoneal ureterectomy was done because of the presence of recurrent infections and visible vesicoureteral reflux (VUR) grade 5. The procedure began with the insertion of three 3 mm ports in the left abdominal hemi. Followed by opening the white line to access the ureter. Blunt dissection and hemodynamic control were performed afterward. The left ureter was cut at a height to reach the vesicoureteral junction and macroscopically no kidney image remained at all in the resected tissue . After that, the specimens were taken to the pathology laboratory for histopathological investigation Fig. .
+The results of the pathological examination concluded several things. Most of the primitive kidney tissue with parenchyma had been replaced with fibrotic tissue. In several places such as atrophic dilated kidney tubules and a small part of the glomerulus, colloid-like material (thyroidization) can be seen. This pathological examination does not identify the cortex and medulla of the kidney because it is quite difficult to process. However, foci of ureteral tissue with monomorphic urothelial cells were identified. Apart from that, the fibrous stroma is edematous and fibrotic with chronic inflammatory cells, mostly lymphocytes. The blastema component also cannot be seen, but metaplastic cartilage islands could be seen in our case Fig. .
+Further examination immunostaining using CD10, CK7 and p63 which aims to check the presence of renal glomeruli and tubules, urothelial cells and urothelial basal cells. The examination results of each immunostaining test included, the CD10 test gave positive staining results in the glomerulus and remaining renal tubular cells, as well as very positive CK7 staining in urothelial cells and positive p63 expression in urothelial basal cells. The conclusion that can be drawn is that after the initial examination was carried out and the diagnosis was established in the form of unilateral renal agenesis, the diagnosis changed because the results of histopathological and immunohistochemical examinations were more likely to lead to a diagnosis of severe dysplasia or aplastic kidney Fig. .
+After the surgical management was carried out, the condition of the patient showed positive results because there was a complete resolution of the condition of fever and dysuria which had been the main complaint so far. Video urodynamic studies were performed two months after surgery. The results show that the patient's bladder capacity is 120 cc. From the examination, it was concluded that this patient was already experiencing a normal condition because there were no abnormalities found when the filling phase had reached 120 cc, grade I right ureteral reflux, detrussor overactivity, normal bladder compliance and bladder capacity. When it was time to urinate, the patient was able to void 75 cc of urine and 75 cc of post-voiding volume. For now, the condition of spina bifida experienced by patients is still the responsibility of the neurosurgeon for follow-up and management.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2249_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2249_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a6f2d93e272b382d9f08306cfa963210b7f28eed
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2249_en.txt
@@ -0,0 +1,4 @@
+We present the case of a 16-year-old Caucasian man who attended the acute admissions unit of our hospital with a history of an acutely painful, red, and swollen right hemiscrotum for about five to six hours. No history of testicular trauma was elicited. He also complained of vague, generalized abdominal pain, somewhat worse in the periumbilical region and lower abdomen, and vomiting and watery diarrhea for about 24 hours.
+He had a temperature of 38.5°C and pulse rate of 95 per minute. On examination, his right testicle was tender and somewhat elevated, and the right hemiscrotum, red and swollen. Abdominal examination evinced mild tenderness in his epigastrium and central abdomen, and less so in the right iliac fossa and suprapubic area. No convincing localizing abdominal signs were noted. Blood tests showed a white cell count of 15 × 109/L, neutrophilia, and C-reactive protein of about 300 mg/L.
+Clinically, testicular torsion could not be excluded, and, on account of his young age and scrotal signs, a decision was made to explore the scrotum. At surgery, on opening the right tunica vaginalis, approximately 5 ml of pus was found, apparently coming down from the right groin. His right testicle appeared entirely normal. The scrotal abscess was drained, the area washed thoroughly with saline, and the scrotal wall closed in two layers with absorbable sutures. A Lanz incision was made to explore his right iliac fossa. It was found that he had a perforated retrocecal appendix, resulting in an abscess extending into the pelvis. The appendix was excised and the abdominopelvic abscess drained. Thorough saline lavage was performed, and the wound was closed without insertion of an abdominal drain. He was given three days of postoperative intravenous antibiotics.
+The patient made an excellent recovery and was well at clinic follow-up four weeks later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2255_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2255_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3fa4005be6bbc07c37ec890060b855569aede6e0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2255_en.txt
@@ -0,0 +1,6 @@
+The patient was a 61-year-old female, from Sichuan Province, China. She had a history of hypertension for five years and underwent a cholecystectomy for gallstones ten years ago. The patient was initially presented to the department of gastroenterology because of abdominal distention and poor appetite. She had dry mouth and several teeth loss. In the past six months she had lost 10 kg weight. She underwent colonoscopy and capsule endoscopy and no abnormalities were observed in the intestinal mucosa. B-ultrasound examination suggested a big pelvic cystic mass, about 75*65*64 mm in size, accompanied by pelvic effusion (depth of about 86 mm), abdominal effusion (right upper abdomen 97 mm, left upper abdomen 46 mm), and bilateral pleural effusion (depth of about 36 mm). Then the patient was admitted to the gynecological ward and received bilateral adnexectomy and peritoneal biopsy under laparoscopy. Pathological examination confirmed benign serous cystadenoma of ovary. Meanwhile, the patient’s blood and urine tests showed abnormalities. She was diagnosed with anemia, leukopenia, thrombocytopenia hypoproteinemia and proteinuria. Immunological examination showed that the patient was positive for multiple autoantibodies including ANA, anti-dsDNA, anti-SSA, anti-RNP, anti-mitochondrial M2 and anti-ribonucleoprotein. Coombs test (both direct and indirect method) was negative. Reticulocyte was normal (1.24%).Bone marrow puncture suggested bone marrow hyperplasia was active. Serum EB virus DNA quantification was 2.8*103copies/mL.Laboratory data was showed in Table .
+Then she was diagnosed with systemic lupus erythematosus. The renal biopsy was performed. Renal biopsy findings are shown below.
+Immunofluorescent staining: IgG -, IgA -, IgM ++, C3 ++, C1q -, Kappa +, Lambda ++, granularly deposition along the capillary wall .
+Light microscopy: A total of 20 glomeruli and 5 glomeruli were global sclerosis. Mesangial cells and matrix mildly increased, capillary walls was thickened . Vacuolar degeneration was observed in renal tubular epithelial cells . A few tubules were atrophic along with slight interstitial fibrosis. There were a few inflammatory cells infiltrating in the renal interstitial. Arteriole intima was thickened without hyaline degeneration.
+Electron microscopy: The foot processes were extensively fused and GBM diffusely thickened. A large number of microspheres were found in GBM and podocytes infolded into the basement membrane . Reticular aggregate was seen in the cytoplasm of endothelial cells.
+Finally the patient was diagnosed with lupus nephritis and PIG. We gave her losartan (100 mg daily), hydroxychloroquine (100 mg twice a day), methylprednisolone (40 mg daily) and cyclophosphamide (600 mg monthly) treatment. Two weeks later, serum albumin was increased to 31.7 g/ L, serum creatinine was 83umol/ L, hemoglobin was 77 g/L, red blood cell 2.55*1012/L, white blood cell 3.02*109/L and platelet 155*109/L.Then the patient was discharged to her hometown for further treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2257_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2257_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6de4757fd3e1a9f2ee568b43f1cb02fa572abe3e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2257_en.txt
@@ -0,0 +1,2 @@
+A 69-year-old man presented to the emergency room with sudden-onset abdominal pain and nausea. He had previously undergone a hybrid laparoscopic left hemihepatectomy and splenectomy for hepatolithiasis and spherocytosis approximately 20 months earlier. Since his surgery, he had occasionally taken non-steroidal anti-inflammatory drugs (NSAIDs), loxoprofen as per his prescription. During the 3 months before his current presentation, he had discontinued taking proton pump inhibitors, at his request.
+Abdominal computed tomography images revealed a deformity of the duodenal bulb and a markedly dilated stomach, containing food residue ; free air in the abdominal cavity was not detected. A fibroscopic upper gastrointestinal examination revealed a giant ulcer with a prominent crater in the inferior wall of the bulb. In addition, a foreign body was detected at the ulcer floor and was strongly suspected of being a ligature associated with the previous left hemihepatectomy . The foreign body was eliminated, and an endoscopic biopsy was performed. Histopathological examination of the biopsy showed a simple, active ulcer. The patient received conservative therapy with a proton pump inhibitor and recovered immediately.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2279_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2279_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..22212118c957f41d1d7994b6f61a54d768feaf70
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2279_en.txt
@@ -0,0 +1,4 @@
+A 24-year-old primigravida presented to our hospital at 29 weeks of gestation. She had undergone bilateral ureteral reimplantation by the Politano-Leadbetter technique at the age of 3 years for vesicoureteral reflux and her postoperative course had been uneventful. However, she had mild back pain at presentation, and abdominal ultrasound revealed severe bilateral hydronephrosis. Blood pressure was 120/80 mmHg and serum creatinine was increased to 3.57 mg/dl. We diagnosed acute postrenal failure and hospitalized her immediately. A double-pigtail ureteral stent (4.7 French) was placed into each ureter by our senior urologist under ultrasound guidance without using fluoroscopy.
+Because daily urine output exceeded 6 L after ureteral stenting, a urethral catheter was inserted and saline was infused intravenously to prevent dehydration. Serum creatinine rapidly decreased to 1.1 mg/dl and hydronephrosis improved, so the urethral catheter was removed 7 days after ureteral stenting . Subsequently, the patient developed high fever and severe back pain. Laboratory data and urine culture revealed evidence of pyelonephritis, with a white blood cell count of 13.1 × 103/μL and C-reactive protein of 11.34 mg/dl. Streptococcus agalactiae was isolated from a urine specimen. Another urethral catheter was inserted and ceftriaxone sodium (2 g/day) was administered intravenously for 6 days, after which her symptoms resolved. The urethral catheter was removed again when urine output decreased. Because there was no longer any clinical or laboratory evidence of infection, she was discharged at 33 weeks of gestation. Signs or symptoms of preterm labor, such as shortening of the cervix or frequent uterine contractions, did not occur during hospitalization.
+The patient was re-admitted at 39 weeks with gestational hypertension. Her systolic blood pressure was persistently higher than 140 mmHg, although no proteinuria was detected. After induction, she delivered a boy weighing 3140 g. The Apgar score was 9 at 1 min and 10 at 5 min.
+She complained of back pain and fever on the day after delivery, and it was found that both ureteral stents had migrated into the urethra. Her symptoms subsided after stents were placed into the bilateral ureters again under spinal anesthesia. The patient was discharged two weeks after delivery. An urologist removed both stents at 6 months after delivery, but distal obstruction of the right ureter was noted and a stent was inserted on the right again. She is scheduled to undergo repeat bilateral ureteral reimplantation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2295_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2295_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f02127190235c337db336ee52f2cfeaef9bad6be
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2295_en.txt
@@ -0,0 +1,4 @@
+A 48-year-old man experienced a sudden onset of seizures in his left lower limb. He had never previously experienced such an episode. Gadolinium-enhanced MRI (Gd-MRI) revealed a small, homogenous-enhancing mass in the peripheral aspect of the right parieto-frontal lobe. The patient was referred to our hospital for further evaluation. The results of the physical examination performed at the time of admission were unremarkable. No cutaneous stigmata of neurofibromatosis Type I was observed. A neurological examination revealed no significant findings.
+The lesion appeared as a well-defined, isosignal intensity area on T1-weighted MRI , was hyperintense on T2-weighted MRI , and also hyperintense on fluid attenuation inversion recovery MRI . The lesion demonstrated homogenous enhancement on Gd-T1-weighted MRI [-]. Curvilinear enhancement was observed beneath the parietal bone but was unlikely to represent a “dural tail sign;” however, these findings are similar to convexity meningioma. T2-weighted MRI showed definite evidence of perilesional edema. Digital subtraction angiography showed some feeding arteries (right middle cerebral artery branch) [ and ], right anterior cerebral artery branch [ and ], and right middle meningeal artery (MMA) branch [ and ]. Preoperative feeder embolization targeted to the right MMA branch was performed [ and ].
+Our preoperative diagnosis was an extra-axial tumor, such as convexity meningioma or other tumors. A whole-body evaluation revealed no evidence of malignancy. The patient underwent a parietal craniotomy, with total resection of the tumor. During surgery, tumoral invasion beyond the dura mater was observed . When the dura was opened, a well-demarcated, firm, spherical tumor was observed beneath the arachnoid membrane. The tumor was elastic, hard, grayish in color, and loosely adherent to but separable from the dura mater . The tumor was totally removed piece by piece, with the adjacent brain tissue and dura . Postoperative MRI showed the total removal of the tumor [-]. The postoperative course was uneventful, and the patient was discharged without neurological deficits.
+In light-microscopic assessments, the tumor was composed predominantly of Antoni Type A, and intermingled with Antoni Type B . Immunohistochemical staining was positive for S-100 protein but negative for glial fibrillary acidic protein, cluster of differentiation 34, epithelial membrane antigen , signal transducer and activator of transcription 6 , progesterone receptor, and synaptophysin. The histopathological diagnosis was schwannoma. The tumor was observed to be in the subarachnoid space extending to outer space of dura mater, intimately attached to the pia mater [ and ]. Electron-microscopic studies were not performed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2297_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2297_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..56e7f699405703b4adf5abf2319194ad8becfd77
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2297_en.txt
@@ -0,0 +1,4 @@
+A 27-year-old male patient underwent annual health checkup, and a hyperechoic lesion was incidentally discovered in the tail of the pancreas via abdominal ultrasound. He was referred to our hospital for possible surgery with an inconclusive diagnosis of pNEN. He has no family history of diseases including pancreatic disorders. The blood cell count, biochemistry, and coagulation tests showed absence of abnormal findings. The carcinoembryonic antigen (CEA) level was 4.4 ng/ml, while the carcinoembryonic antigen (CA) 19-9 level was 23.1 U/ml, both of which were within normal range.
+Abdominal computed tomography (CT) examination revealed a well-defined mass measuring 13 mm in the tail of the pancreas. The tumor showed slightly low density compared with the pancreatic parenchyma on plain CT , and enhancement in the arterial phase and equal density with the pancreatic parenchyma in the portal phase and equilibrium phase on dynamic enhanced CT . Tumor abutment to the splenic artery and vein without encasement was observed. The regional lymph nodes were not significantly enlarged, and distant metastases were not noted. Abdominal magnetic resonance imaging (MRI) examination revealed a homogeneous mass with low intensity on T1-weighted image (T1WI) and high intensity on T2-weighted image (T2WI) and diffusion-weighted image (DWI), and a slightly high intensity on the apparent diffusion coefficient-map (ADC-map) in the pancreatic tail . Magnetic resonance cholangiopancreatography (MRCP) showed a high-intensity irregular lesion with slightly indistinct margins without stenosis and dilatation of the main pancreatic duct in the tail of the pancreas . Endoscopic ultrasound (EUS) revealed a slightly hyperechoic mass with distinct borders and homogeneous interior in the tail of the pancreas . Color flow Doppler imaging showed abundant internal blood flow inside the tumor . The tumor had no visible internal septum and cystic components. The cytopathologic findings by EUS-fine needle aspiration (EUS-FNA) revealed epithelial cells with poor atypia showing a glandular duct structure.
+Although a definitive pathological diagnosis could not be obtained, the tumor was preoperatively diagnosed as non-functioning pNEN larger than 10 mm based on the findings of enhanced CT and MRI and EUS-FNA cytology; thus, minimally invasive surgical resection was indicated. Solid-type SCA was one of the possible preoperative differential diagnoses, since the EUS showed a slightly hyperechoic lesion that was a distinctive ultrasonographic feature of a microcystic SCA. As tumor abutment to the splenic artery and vein was observed and spleen preservation was desirable, laparoscopic spleen-preserving distal pancreatectomy was performed following the Warshaw method. The operation was carried out using the 5-port approach. No extrapancreatic invasion of the tumor was observed. In order to preserve the splenic inflow, the distal part of the splenic artery was divided at the proximal site of the root of the left gastroepiploic artery. The operation was considered complete after confirming the absence of changes in the color tone of the spleen. The operation time was 300 min, and the estimated blood loss was 5 ml. The postoperative course was uneventful, and the patient was discharged from our hospital on postoperative day 18.
+Macroscopically, the tumor was a well-defined, round, and solid mass without cystic components measuring 15 mm . Microscopically, it appeared as a well-defined lesion with thick fibrous interstitium , covered by a membrane , and composed of epithelial cells with clear vesicles forming microcysts . The epithelial cells were positive for periodic acid Schiff (PAS) staining before the diastase treatment and negative for PAS staining after the treatment ; the tumor was pathologically diagnosed as microcystic SCA based on the World Health Organization (WHO) classification.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2303_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2303_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0ac79e3ded33f5ca0385a62568284754feee7389
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2303_en.txt
@@ -0,0 +1 @@
+A 22-year-old white Caucasian man came to our office complaining of blurred vision in his left eye (LE) with night blindness and difficulty in driving. A flu-like illness was reported 2 weeks before the ocular symptoms began. His best-corrected visual acuity (BCVA) was 20/20 in his right eye (RE) and 20/20 in his LE. A fundus examination showed the healthy condition of his RE, while his LE showed only a scattered mottling of the fundus pigment on the temporal side of the optic nerve. We performed B-scan optical coherence tomography (OCT) around the optic nerve head that showed hyperreflectivity in the outer retina with interruption of the ellipsoid layers in the juxtapapillary region . An en face scan showed diffuse hyperreflective spots in the RPE slab . After performing autofluorescence (FAF), FA, indocyanine green angiography (ICG), and OCTA, MEWDS was diagnosed . FAF showed diffuse hyperautofluorescent areas around the optic disc that extended into the macula region . The en face scan showed small hyperreflective dots at the posterior pole. The FA revealed juxtapapillary hyperfluorescent dots of leakage similar to the ICG early and late phase . Furthermore, the late frames of ICG showed diffuse dots of hypocyanescence at the posterior pole. OCTA showed anomalous neovascularization as an arcuate flow vascular net on the disc temporal side. The vascular net was formed by thin tangled capillaries . The neovascular tangled net area was outlined in the assessment . Although it is known that MEWDS is often self-limiting, to reduce the possible inflammatory reaction, we preferred to administer prednisolone orally with an initial prescription of 50 mg/day for 7 days, followed by 25 mg/day for 7 days, 12.5 mg/day for 7 days, and 5 mg/day for the last 7 days. After 1 month of therapy, significant regression of juxtapapillary neovascularization was observed. Small capillaries regressed almost completely, leaving only wide and straight main vessels . Our patient’s symptoms resolved. Figure shows the evolution over a 4-year observation period. A steady situation was observed after 4 years with an absence of symptoms, and BCVA was 20/20.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_230_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_230_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ba493f7aef4319c32d849b9d6e852ff58a9f0f66
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_230_en.txt
@@ -0,0 +1 @@
+A 37 year old female presented to her primary care physician with nonspecific abdominal pain. She underwent CT imaging that revealed bilateral ovarian masses and ascites. Preoperative CA125 was the only tumor marker examined and it was within normal limits. A presumptive diagnosis of ovarian cancer was made and she underwent exploratory laparotomy which revealed macroscopic peritoneal metastases to ovaries, omentum and pelvic peritoneum. At that time total abdominal hysterectomy, bilateral salpingoopherectomy, pelvic lymph node sampling, partial omentectomy, appendectomy and evacuation of mucinous ascites was performed. Final pathology revealed low grade mucinous adenocarcinoma in all specimens, arising from an appendiceal primary. The patient received no additional therapy and was followed clinically. She developed recurrent abdominal pain approximately 2 years later. Computed tomography (CT) scan revealed progressive nodularity in the mesentery and peritoneal surfaces consistent with recurrent disease. This was further evaluated with a laparoscopy, which revealed mucinous tumor implants along the anterior abdominal wall, right retroperitoneum, diaphragm, and remaining omentum . At this time, the patient was referred to the University of Cincinnati for consideration of cytoreductive surgery and intraperitoneal hyperthermic chemoperfusion. The patient's past medical history was significant only for a seizure disorder which was managed by anticonvulsant medication and an implanted vagus nerve stimulator. Preoperative CA19-9 was elevated at 59, while CEA and CA-125 were normal. The patient was felt to be an appropriate candidate and underwent exploration. At surgery, extensive disease was noted over the peritoneal surfaces. A complete cytoreduction was achieved requiring, right colectomy, splenectomy, cholecystectomy, omentectomy, and perionectomies of the diaphragms, anterior abdominal wall, and pelvis. Tumor nodules were excised from the small bowel and large bowel mesentery. The cytoreductive portion of the operation was completed in approximately 210 minutes. Per our current practice protocol, a 90 minute perfusion was performed using an inflow temperature of 44°C, with peritoneal surface temperatures averaging 40.5–41.5°C. Intraperitoneal temperatures were measured via four temperature probes, one within the liver parenchyma, and three within separate quadrants of the peritoneum. Core temperature was recorded via the bladder and esophageal temperature probes. Per our standard protocol, the carrier solution was peritoneal dialysis fluid (2.5%). The patient's maximum recorded core body temperature during the procedure was 38.7°C and the maximum recorded liver temperature was 38.8°C. Mitomycin C was delivered using a total dose of 10 mg/L perfusate, delivered in divided doses of 7 mg/L at initiation and redosed after 45 minutes at 3 mg/L. A total dose of 45 mg was delivered in this patient. During the operation, the patient had no significant electrolyte abnormalities aside from the expected glucose elevation seen during the perfusion period. The maximum serum glucose was 355 mg/dL and the lowest serum sodium was 135. The operation was generally uneventful; no blood transfusions were required and the patient was transferred to the ICU in stable condition. Postoperatively, all serum electrolytes were normal and albumin was 3.4 mg/dl compared with 4.3 mg/dl, preoperatively. The patient was easily arousable and followed commands appropriately. However, approximately 4 hrs later, the patient complained of headache and right eye pain. Her headache was treated with analgesics, however 3 hours later, she was found to be tachypenic, bradycardic, and hypotensive, and was unresponsive with fixed, dilated pupils. She was emergently intubated and resuscitated. After approximately 15 minutes, she regained consciousness, and responded appropriately to commands. Her pupils returned to 3 mm and because reactive. Neurology was consulted and she was loaded with Dilantin due to her history of seizure disorder. An urgent CT scan was ordered. On route to the CT scanner, she once again became bradycardic and hypotensive with fixed, dilated pupils. The CT scan revealed diffuse cerebral edema . ICP monitoring revealed pressures of 70–90 mmHg. Mannitol was used in an attempt to lower intracranial pressure without success. EEG was consistent with diffuse brain dysfunction. A brain death protocol revealed that she had suffered brain death and care was subsequently withdrawn. At autopsy, diffuse cerebral edema with tonsillar herniation was noted . No pathologic findings were present to indicate the cause of the cerebral edema. The final pathology on all resected specimens reconfirmed the diagnosis of mucinous adenocarcinoma .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2320_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2320_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8e1be516df2550ec20c1350e32a1ad7d0cc713cc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2320_en.txt
@@ -0,0 +1 @@
+A 50-year-old female presented with a 2-month history of progressive left foot drop and mild tenderness over the left fibular head, with the gradual development of swelling in the area. On examination, there was a soft to firm, poorly defined swelling in the area below the fibular head. There was a weakness in foot eversion and dorsiflexion, particularly of the great toe. Foot plantar flexion and inversion were normal. The swelling was screened with an ultrasound, which showed a hypoechogenic cystic mass. Nerve conduction study showed delayed latency and decreased conduction velocity compared to the contralateral limb. An electromyogram was done which demonstrated a denervation potential the right tibialis anterior and extensor digitorum longus muscles. The patient was diagnosed with peroneal nerve palsy and was initially conservatively managed with ankle-foot orthosis for protection and expectant spontaneous recovery. The symptoms did not resolve, and subsequent magnetic resonance imaging (MRI) showed an elongated tubular, cystic-appearing mass near the fibular neck extending down till the middle third of the leg . The cyst was excised using an incision starting just posterior to fibular head. The fascia of the posterior compartment was incised, and the peroneal nerve was identified just beneath the cyst . The nerve was traced distally as well as proximally to prevent any inadvertent injury while cyst excision. The cyst was followed distally till its stalk and removed in toto . Loop magnification was used to prevent any injury to the fine branches arising from nerve along its course. The mass measured approximately 13.0 cm×2.0 cm×2.0 cm. It was then explored for its proximal extension and removed, which measured 2.0 cm×2.0 cm×2.0 cm (, , ).The peroneal nerve was inspected and found to be completely intact. The specimen was sent for histopathology which confirmed the diagnosis of a ganglion cyst . There was an immediate clinical improvement in motor function within the 1stweek. Repeat electromyography (EMG) showed long-duration polyphasic motor unit potentials in tibialis anterior and extensor digitorum and clinical recovery of foot drop. At 6-month follow-up, the patient reported full clinical recovery , there were no signs of recurrence on ultrasonography (USG) even at 24-month follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2323_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2323_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ea5464855f2fbfc196da1d846fed99c960eaafa3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2323_en.txt
@@ -0,0 +1,2 @@
+A 55-year-old female with no known medical illness presented to the emergency department with epigastric pain and symptoms of anaemia for one day duration. On physical examination, she was normotensive with tachycardia and tenderness over the epigastric region. Her haemoglobin level was 6.5 g/dL. Her serum biochemistry panel showed evidence of acute kidney injury but liver function tests was unremarkable. She was transfused with 1U of blood and repeated haemoglobin level was 5.8 g/dL. The serum alpha-fetoprotein level was elevated at 3136 g/dL. She was transfused another 2 U of blood. Computed tomography scan performed on the same day showed a large liver mass in segment 2 and 3 of the left liver lobe with multiple areas of wall defect associated with layering of free fluid surrounding the liver suggestive of ruptured liver mass . The patient was diagnosed with ruptured HCC.
+She underwent emergency laparoscopic resection of the ruptured HCC approximately 30 h after her presentation to the hospital. The procedure was performed by use of a 12 mm supraumbilical port for the laparoscope, a 12 mm epigastric port, and 3−5 mm ports . Laparoscopy confirmed a ruptured liver tumour with 2 L of hemoperitoneum (A and 3B). The tumour margins were confirmed by intraoperative ultrasonography and resection margins marked by cautery. Pringles manoeuvre was done using an umbilical tape and nasogastric tube for 15 min. Parenchymal transection was performed with Harmonic scalpel. A 5-cm incision over the left subcostal was made to extract the specimen through a specimen bag. After completion of the resection, a thorough washout of the entire abdominal cavity was done. The operation time was 180 min. The patient’s postoperative recovery was uneventful and she was discharged on postoperative day 7. Histology confirmed a 10 cm ruptured HCC with 3 mm tumour-free resection margin.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2341_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2341_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d4b82984be9e2522f4eb0804cb9bba7a08748a1a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2341_en.txt
@@ -0,0 +1,3 @@
+A 48-year-old man noticed a swelling around his left wrist two and a half years ago. The swelling gradually increased in size over 6 months. Radiograph of the wrist showed a lytic lesion in the distal radius having typical soap bubble appearance. He was diagnosed to have a giant cell tumor of the distal radius. His chest radiograph at the time was normal. He underwent left distal radius curettage and bone cement placement 2 years back. The Histopathological examination of excised tissue showed mononuclear stromal cells, macrophages, and multiple multinuclear giant cells, thereby confirming the diagnosis of GCT. The patient then had a recurrence of the swelling after 6 months of the surgery. Radiographs and Magnetic Resonance Imaging (MRI) suggested recurrence of tumor. His chest radiograph at this time also was normal. He underwent left radius resection, fibular grafting, and wrist arthrodesis one and a half years ago . Resected tissue on histopathological examination showed features consistent with GCT. He developed wound necrosis and so underwent abdominal flap cover and flap division surgeries within 3 months of the surgery. Patient now presented to us with complaints of multiple swelling in the region of his left wrist for the past 6 months. Patient did not complain of pain in the region. He did not have any history of loss of appetite/ loss of weight. He did not notice swellings anywhere else in the body.
+On examination, there were multiple bony swellings over the left distal forearm and wrist region, involving the volar and dorsal aspect, radial and ulnar sides, with the largest swelling being of the size 4 cm × 3.5 cm . The swellings were hard in consistency and non-tender. The abdominal flap over the distal forearm and wrist was found to be healthy. Healed surgical scars from previous surgeries were also present over the dorsal aspect. The fingers were sensate and capillary refill in the fingers was satisfactory. However grip strength (Left - 12 kg, right - 34 kg) and pinch strength (left - 4.5 kg, Right - 7.5 kg) were decreased on the left side. The Quick DASH score was 57.75. There was no lymphadenopathy and systemic examination was found to be normal.
+All routine blood investigations were found to be within normal limits. Radiographs revealed a lytic lesion in the fibular strut graft, causing ballooning of the medial cortex and breach of the lateral cortex. The lesion had destructed most of the fibular strut graft including the distal portion which was fixed to the carpal bones by a k-wire. The instability at the wrist joint, had caused the plate to break. Swellings were also visible within the soft tissue of the distal forearm, involving volar and dorsal aspects of the forearm. Patient was diagnosed to have a recurrence for GCT for the second time. It was classified as Grade 3 (aggressive) as per Campanacci classification system and Enneking classification system owing to the cortical breach and soft tissue extension. Further work up was done, chest radiograph and Computed Tomography (CT) scan of the thorax revealed multiple canon ball lesion in bilateral lungs, suggesting a metastasis of GCT. The patient however did not have any respiratory complaints. We obtained the opinion of an oncologist, who advised metastasectomy. We then performed an excision of the tumor, removal of plate and k-wire, and applied a wrist spanning external fixator . The resected tissue on Histopathological examination again revealed mononuclear stromal cells, macrophages and multiple multinuclear giant cells, thereby confirming a recurrence of the GCT. The patient was not willing for metastasectomy. The patient followed up with us for a period of 18 months following the surgery. We found no clinical, radiological evidence of recurrence. The metastatic lesions in the lungs were not found to have increased in number or size, while the patient remained asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2358_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2358_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d8e64f75eca8f61e255d2a402f3e20bad2c9340a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2358_en.txt
@@ -0,0 +1,4 @@
+A 14-year-old Greek male, born to healthy non-consanguineous parents, at term and without perinatal complications, was evaluated for uncontrolled epilepsy. He displayed generalized motor seizures at 3.5 months of age, eventually controlled by anticonvulsants. He showed developmental delay with head control at 4.5 months and ambulation at 19 months with a broad-based unsteady gait. He was diagnosed with ataxic cerebral palsy. In addition, he displayed a delay in speech and generalized learning difficulties at school. Tubulopathy was identified at the age of 8 years. Bartter syndrome was erroneously diagnosed at first. The patient received treatment with potassium gluconate, magnesium, spironolactone and indomethacin. At the same age, sensorineural deafness was detected and a hearing aid was used. At the start of his teenage years, this young man had infrequent secondarily generalized focal motor seizures unresponsive to several medication changes. At 14 years of age, he was a pleasant, cooperative teenager with mild intellectual disability and normal cranial nerve examination (II–XII), normal muscle strength in the upper and lower extremities, mild spastic hypertonia in the lower limbs, increased deep tendon reflexes and bilateral Babinski signs. There was mildly decreased superficial sensation in the lower extremities and no disturbance of position sensation or vibration. Romberg sign was absent. His gait was broad based and slow and he was unable to walk in tandem. Examination for cerebellar signs revealed the absence of tremor and dysmetria, while rapid alternating movements were slow and uncoordinated, resulting in dysdiadochokinesis.
+Wakefulness and sleep electroencephalogram (EEG) showed slow background rhythms and no epileptiform activity. Brain computed tomography (CT) and MRI were normal. Nerve conduction studies revealed mild abnormalities on two occasions without important differences between the two tests. The motor conduction velocities on the second measurement were 41.3 m/s for the right median nerve, 38.2 m/s for the right peroneal nerve and 40.8 m/s for the left peroneal nerve. The sensory conduction velocities were 38.6 m/s for the right median nerve, 42.9 m/s for the right ulnar nerve and 42.3 m/s for the right sural nerve. There were no other abnormalities in these electrophysiological studies. Laboratory tests showed normal serum vitamin E, B12, folic acid and plasma very-long-chain fatty acid (VLCFA).
+The patient’s epilepsy was fully controlled with topiramate and carbamazepine. At F/U, the ataxia remained stable, as was the spasticity, with independent home ambulation and need for support in the community. Episodic weakness appeared on many occasions, without evidence of electrolyte disturbance or clinically overt seizures, and this responded to adjustment of the anticonvulsants. Overall status was consistent with a static disorder of movement, with activity limitations, also associated with intellectual disability and epilepsy. Nevertheless, the unremarkable neuroimaging, the renal tubulopathy and sensorineural deafness, led us to obtain consent from the family to search for a neurogenetic syndrome, specifically for KCNJ10 mutations associated with EAST syndrome. The patient was heterozygous for two KCNJ10 mutations: a missense mutation (p.R65C) that is already published and a not yet published duplication (p.F119GfsX25) that creates a premature truncation of the protein . Both mutations are likely damaging. The missense mutation p.R65C has been also listed as disease causing in various databases including OMIM (Online Mendelian Inheritance in Man). In addition, prediction software agrees. As for the truncating frameshift mutation p.F119GfsX25, it is noted that truncating mutations in particular when occurring at the beginning of the protein are most likely damaging. Prediction software agrees here too.
+Parental testing has not been performed, and therefore, we do not know for certain whether the mutations are in different alleles, but this also seems quite likely as the missense mutation has already been described in a patient not harboring the additional duplication (and that the same mutation occurred twice is not impossible but very unlikely). This patient’s static clinical course has been ascertained for the following 10 years.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2359_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2359_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aa64c20f58a4e55452abdf07560646167fae0bf9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2359_en.txt
@@ -0,0 +1,5 @@
+A 68-year-old Caucasian male presented for surgical evaluation with a right mid-infraclavicular chest mass from referral of his primary care physician . Three years prior, the patient presented with a mass at the same location, subsequently diagnosed as a lipoma and locally excised with no surgical complications. At the time of the previous surgery, it was incidentally discovered and diagnosed that the patient also had diffuse B cell lymphoma, complete remission status post chemotherapy. Family, psychosocial, drug, and other surgical history were noncontributory. Over the past three years, the mass increased in size, but did not have any discoloration, discharge, or pain; however, due to the patient’s past medical history and immunocompromised state, the patient expressed concern and presented for elective excision of the mass.
+On physical exam, a mass was palpated at the midclavicular line of the right upper chest, within the right first intercostal space. The mass was directly under the scar from previous excision, with no skin discoloration, telangiectasia, or visible raised nodules. The patient denied any pain, tenderness, or discharge associated with the new mass. Radiological testing was performed to determine the exact location and depth of invasion. CT chest with and without contrast revealed an ill-defined, cutaneous mass, while MRI chest was nondiagnostic.
+Surgical excision was performed under local anesthesia, with a wide, elliptical incision to the level of the underlying bony structures to ensure clean margins. Excised specimen measured 5.5 cm × 3.5 cm × 2 cm with surrounding 4 cm × 1.6 cm × 0.4 cm of skin attached. The resulting wound was closed using interrupted 4–0 plain gut sutures for the full thickness, with 3–0 Vicryl subdermal and 4–0 Monocryl subcuticular reinforcing sutures.
+The specimen was sent to pathology for cryosectioning; however, due to increase in cellularity at the posterior margin, permanent fixation was performed. Within the submitted specimen, a subcutaneous firm nodule measuring 1.6 cm × 1 cm × 0.7 cm was located in the superior aspect with a 0.1 cm surrounding margin. Microscopic examination with hemolysin and eosin staining showed whorled myoid with spindled nuclei in storiform array throughout the dermis and extending into the subcutaneous fat with widening fibrous septa (, ). The specimen was also composed of uniform, small elongated cells and scant cytoplasm with frequent mitotic figures and giant cells. The sample stained positively for CD34 and ultimately diagnosed as DFSP .
+As a result of the close margin excision, the patient was referred for radiation therapy with imatinib for recurrence prevention. Upon the last two follow-ups status post imatinib treatment, there have been no signs of recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2366_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2366_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0deb1d8b5f4d09ab05ab6a1c428a9deca2c34084
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2366_en.txt
@@ -0,0 +1,6 @@
+A 57-year-old female presented with sudden-onset severe headache, photophobia, and drowsiness to the emergency department in a hospital located in Babylon, Iraq. The initial non-contrast computed tomography (CT) scan showed subarachnoid hemorrhage (SAH) in the basal cistern . The patient was admitted to the neurology ward for observation and symptomatic management, after which her relatives approached our team for a second opinion. We advised the patient’s family to conduct a CT angiogram (CTA); the patient’s healthcare team informed the family that CTA would be harmful to the patient within two weeks of presentation and would not provide conclusive results. This statement contradicts the international guidelines, which recommend urgent treatment for suspected ruptured intracranial aneurysms, and indicates CTA as the investigation of choice for cases of SAH due to aneurysmal rupture. However, it is essential to note that those guidelines are not considered standard guidelines in the Iraqi health system and transfer.
+Following this, based on our request, the patient’s family took the responsibility on themselves to transfer the patient, and a CTA was conducted in a nearby private facility. This should not be a usual instant where the family takes responsibility for taking steps in the management of a potentially life-threatening case such as SAH. In addition, more patient transfer in a nonambulance or hospital-supervised facility has its risks. Moreover, the report of the CTA showed that it was negative for any aneurysm and any other vascular malformation. This finding was a disastrous part of this case, as it will show in further investigations.
+The patient and the family had two options: stay at home based on the imaging findings or travel a 140-mile trip from Babylon to Baghdad to reach our neurovascular center (Baghdad Neurosurgery Teaching Hospital) through a personal, non-equipped vehicle . The family chose the latter option and arrived at our center. After an initial assessment of the patient and revision of the investigations, we decided to conduct a diagnostic catheter angiography, which surprisingly revealed not one but four aneurysms. Those aneurysms included aneurysms in the right posterior communicating artery (PComA), superior hypophyseal artery, intraorbital ophthalmic arteries, and left PComA .
+Due to the lack of medical insurance in Iraq and the high financial burden for endovascular treatment that can be applied in such cases of multiple aneurysms, the family decided that they could not afford such costly intervention. As a result, the only viable option left was to do open surgery. Hence, we opt to target the tandem right PComA aneurysm, the adjacent superior hypophyseal aneurysm, based on the location of SAH in the initial CT where we suspect the rupture has occurred on the right side .
+A right pterional approach was performed, and the right Sylvian fissure was retracted to expose and dissect the supraclinoid internal carotid artery; we started by clipping the right PComA aneurysm due to the presence of a daughter cyst, and there was an ipsilateral vasospasm of A1 and M1 portions of the anterior and middle cerebral arteries, respectively, on the angiography making it our initial target. However, after clipping, we were convinced that the PComA aneurysm was not the ruptured one. While trying to explore the adjacent right hypophyseal aneurysm, we encountered a huge intraoperative rupture from it that was managed promptly by applying a pilot clip followed by a dissection of the neck. Then, we secured the aneurysmal neck with a permanent clip. The rest of the surgery went uneventful, with no subsequent operative or postoperative complications.
+For the remaining two aneurysms, we decided on a watchful follow-up as a next step, with serial follow-up imaging every three months. Both aneurysms were asymptomatic and stable in size and shape at 18 months of follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_236_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_236_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c1f904842cccccfe660d00f4e1152e93ae03ad35
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_236_en.txt
@@ -0,0 +1,3 @@
+A 3-year-old girl was referred to the neurogenetics clinic, National Research Center, Egypt because of the delayed milestones of development and unusual facies. She was the offspring of a non-consanguineous marriage with no similarly affected family members. The pregnancy and delivery histories were uneventful, however small head and dysmorphic facies were noted at birth. Delayed milestones and failure to gain weight were noted since early life. Seizures were developed at the age of 9 months as myoclonic and the focal seizures were fairly controlled on a combination of valproate and levetiracetam. Evaluation of the motor and mental developmental milestones was remarkably delayed; she could only sit supported, had impaired cognitive functions with obvious autistic features, had the inability to maintain holding objects, and didn’t acquire any speech skills. Her main anthropometric measurements revealed head circumference 40 cm (−6 SD), length 79 cm (−3.6 SD) and weight 7.200 kg (−3 SD). Clinical examination showed dysmorphic facies including, round face with full cheek, narrow forehead, thick bow shaped eyebrows, hypertelorism, long smooth philtrum, downturned corners of the mouth, low set ears, retro-micrognathia and short neck . She had bilateral simian creases, vascular markings on the palm, tapering fingers, and clitoromegaly on genital assessment. Neurological evaluation showed hypotonia with elicited reflexes. Table shows a comparison of the main clinical presentation, involving cytobands, size of 1q deletion, smallest region of overlap (SRO) in the previously reported patients with pure 1q43q44 submicroscopic deletion and our patient.
+Electroencephalogram showed frontotemporal epileptogenic focus. CT brain displayed abnormal gyral pattern, hypogenesis of corpus callosum and bilateral deep Sylvian fissure . Echocardiogram, fundus examination, abdominal and renal ultrasonography revealed no abnormalities. Psychomotor assessment using Stanford Binet International Scale method showed profound retardation.
+This study was carried out in compliance with the Declaration of Helsinki and approved by the National Research Centre Ethical Research Committee.. Informed consent was obtained from the parents for genetic testing and publication of this case report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2370_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2370_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c63b60d9623a1478ea0375718fdbfb6d4a4b356a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2370_en.txt
@@ -0,0 +1,2 @@
+A 67-year-old male patient was referred from the outpatient urologist for transurethral resection of the prostate (TUR-P) in September 2021 due to recurrent UTI. After treating the patient with several antibiotics, the urologist performed a cystoscopy, which revealed a bladder stone and an obstructive prostate. Finally, the patient was referred to our department for TUR-P. The initial hypothesis was, that the obstructive prostate caused the bladder stone. During the operation, parts of the stone were smashed and the prostate was resected. Furthermore, a prosthetic mesh eroding from the bladder roof was detected. The mesh was masqueraded by the stone. The pathological result ruled out any malignancy. A postoperative computed tomography scan revealed a 20 × 25 mm mesh migration into the bladder after inguinal hernia repair on the left with concomitant stone adhesion to the mesh. After revealing patient history, the inguinal hernia repair was performed 22 years ago.
+The patient was admitted to robotic-assisted laparoscopic partial cystectomy with excision of the complete mesh and the stone . The procedure was performed using the “da Vinci X Surgical System” (Intuitive Surgical, Sunnyvale, CA). The patient was placed in Trendelenburg position. The operation was performed transperitoneal with a 12-mm camera port supraumbilical and three 8-mm trocars on a straight line. Additionally, one 8-mm port for the assistance was placed on the right. After partial resection of the bladder, the defect was closed with two-layer V-loc sutures (3.0). Lapra-Ty clips were attached at each suture for safety issues. Next a transurethral catheter was placed. No drainage was necessary due to the treating surgeon’s decision. The patient recovered well. After a normal cystography on postoperative day 7, the foley catheter was removed. The final pathological results revealed chronic fibrosis and mucosa inflammation of the bladder. After almost one year of follow-up the patient has no symptoms regarding hernia or voiding.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2404_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2404_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..32aa35de95067e6ef3c06e21d6f0682a6a8ad036
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2404_en.txt
@@ -0,0 +1 @@
+A 78-year-old Japanese man underwent a bilateral partial nephrectomy for bilateral RCC 8 years ago. The pathological diagnosis was ccRCC. Seven years after bilateral partial nephrectomy, solitary lung metastasis appeared at the hilar region in the right lower lobe of the lung; thus, he underwent a thoracoscopic resection of the lobe, and it was pathologically diagnosed as metastatic ccRCC. Eight years after bilateral partial nephrectomy, multiple metastases to the pancreas and liver occurred. Biopsy revealed pancreatic and liver metastases from ccRCC. He started systemic therapy with ipilimumab (1 mg/kg) and nivolumab (240 mg). After 4 cycles (1 cycle/3 weeks) of combination therapy, nivolumab (240 mg) was continued every 2 weeks. Three months after initiating ICI therapy, he developed type 1 diabetes mellitus, and insulin replacement therapy was initiated. He also subsequently developed panhypopituitarism, necessitating hydrocortisone replacement therapy (15 mg daily). Fifteen months after initiation of ICI, he experienced right knee joint pain, and 22 months later, indurated swelling with edema in both limb joints also materialized . Laboratory tests indicated elevated inflammatory markers with C-reactive protein of 9.00 mg/dL, erythrocyte sedimentation rate of 86 mm, and matrix metalloproteinase-3 of 999.2 ng/mL. However, RF and anti-CCP antibodies were negative, as were other autoantibodies. Ultrasonography revealed synovitis and hypervascularity in the symptomatic joints. X-ray findings of the hands and legs presented osteophyte formations and bone erosions in 11 areas. This case was diagnosed as seronegative rheumatoid arthritis according to the ACR/EULAR rheumatoid arthritis classification criteria with a total score of 7 and negative RF and anti-CCP antibodies. He had no past or family history of connective tissue disease or inflammatory arthritis. Nivolumab was suspended, and PSL treatment was initiated at 20 mg daily. Two days post-treatment, limb swelling improved, and the pain vanished after 7 days . Inflammatory markers returned to normal. PSL was gradually tapered to 9 mg/day 7 weeks after initiation, and nivolumab 240 mg was restarted. The metastatic lesions in the pancreas and liver did not increase in size during cessation of nivolumab . He remained stable after the resumption of ICI without recurrence of arthralgia or other irAEs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2413_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2413_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2ef4865f98d202e2bf86eff82d981fac403de775
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2413_en.txt
@@ -0,0 +1,10 @@
+The patient was a 34-year-old Korean man who visited our emergency department complaining of intractable insomnia and progressive dementia. The patient suffered from intractable insomnia and irregular, coarse breathing during sleep, which began 9 months before admission. He consequently developed excessive sweating, bilateral action tremors, and restlessness. Memory disturbance and poor executive function were noticed 2 months before admission. Delusions of persecution and social withdrawal were also present. Three days before admission, the patient began to show gait disturbance with mild postural instability.
+The patient had been in good health before disease onset. He had 16 years of education, majored in law, and worked as a civil servant at the district court until he lost his job due to memory disturbance.
+His vital signs showed a marked fluctuation in blood pressure, tachycardia, and tachypnea. His initial body temperature was 38.0°C, which was stabilized after controlling his pneumonia.
+Neurologic examination revealed disorientation and anomic aphasia with paraphasia. The Korean version of the Mini-Mental State Examination score was 17 out of 30. Hypophonia, dysarthria, both resting and action tremors, and akathisia were present. His gait was ataxic with a tendency of tilting backwards. Otherwise, cranial nerve functions, muscle volume, tone, and power as well as sensory functions were normal. Extrapyramidal signs such as rigidity or bradykinesia were absent. Deep tendon reflexes were normoactive without pathologic reflexes.
+Routine blood labs showed no abnormalities. Both plasma and urine catecholamine levels were elevated. Cerebrospinal fluid analysis was unremarkable and the patient was negative for 14-3-3 protein.
+The patient's four-generation pedigree is presented in fig. . The patient's mother (III:7), who was a physically and mentally healthy 70-year-old woman, had the same mutation. An asymptomatic brother of the proband (IV:12) was negative for the PRNP gene mutation. The son of the patient's great-aunt (II:1) had gradually developed hypersomnia, gait disturbance, ataxia, and dysarthria. His cerebrospinal fluid study was positive for 14-3-3 protein. The genetic analysis of subject II:1 revealed a PRNP gene mutation at codon 178 (D178N) and homozygosity for methionine at codon 129. Total disease duration was 27 months.
+Magnetic resonance imaging and electroencephalography findings were unremarkable. Polysomnography revealed reduced total sleep time, absence of slow-wave and REM stages of sleep, severe periodic limb movement, and heavy snoring.
+Neuropsychological tests were performed using the Seoul Neuropsychological Screening Battery . The results are summarized in table . Forward and backward digit span were markedly reduced. The Boston Naming Test showed severely impaired confrontational naming ability. Other language functions were intact. Gerstmann syndrome, buccofacial and ideomotor apraxia were observed. The Rey-Osterrieth Complex Figure Test revealed visuoconstructive dysfunction. The Seoul Verbal Learning Test and the Rey-Osterrieth Complex Figure Test showed that both verbal and visual memory functions were severely impaired. Frontal surveys revealed poor frontal executive function, generative naming abilities, and inhibitory control.
+Genomic DNA isolated from peripheral blood leukocytes was used for analysis. Direct sequencing of the PRNP gene identified a heterozygous p. Asp179Asn mutation homozygous for methionine at codon 129 and for glutamate at codon 219.
+The patient's FDG-PET scan showed mild hypometabolism in the bilateral frontal cortices and bilateral thalamus . Using SPM analysis, the patient's PET scan was compared with those of 7 healthy male controls . The results of the SPM analysis showed marked hypometabolism in the patient's deep cerebral nuclei including the bilateral thalami, caudate nuclei, and hypothalamus. In addition, the hypometabolism affected association cortices including the frontal, lateral temporal, inferior parietal lobule, and posterior cingulate gyri; among these, frontal association areas including the dorsolateral, medial and orbitofrontal areas were more dominantly affected than the other lobes. Lastly, in addition to cerebral lesions, the midbrain was also affected.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2441_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2441_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dacf40fc5110052c3fd6f05e4e3d825d885926d7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2441_en.txt
@@ -0,0 +1,9 @@
+We report on a 33 year-old male patient followed at our center for a unrepaired tricuspid atresia type IC with unrestricted ventricular septal defect with left-right shunting, a non-restricted atrial septal defect with right-left shunting, and a functional single left ventricle with normal systolic function . His past medical history included two attempts of pulmonary artery banding at the age of 15 and 19 years at initial presentation at our center, requiring subsequent debanding due to ventricular arrhythmia. The patient declined any further surgical interventions and developed pulmonary arterial hypertension (PAH) class I.4.4. according to the Nice classification , with a pulmonary resistance of 7.5 WU and a persisting significant left to right shunt (Qp:Qs = 2.5 :1). Oxygen saturation at room air was 86 %. The patient is also known for cardiac cachexia, asthma without allergic components, and a restrictive syndrome of extra-pulmonary origin (mainly due to scoliosis and post-thoracotomy status). He developed secondary erythrocytosis and suffered a single episode of vertebrobasilar transient ischemic attack (TIA) in 2010, presumably of embolic origin. Anticoagulation with acenocoumarol was started. In 2016, he experienced a first episode of paroxysmal tachycardic atrial fibrillation (AFib) requiring emergency electric cardioversion. At that time, therapy with amiodarone and metoprolol was initiated and anticoagulation changed to apixaban 2.5 mg bid. In 2018, a second episode of tachycardic Afib associated with hemodynamic instability required an urgent electrical cardioversion. While he was euthyroid in the past, thyroid function tests performed in fall 2019 documented overt thyrotoxicosis with a TSH of < 0.005 mUI/l (0.27–4.3), a FT4 of 64 pmol/l (9–19), and a free T3 of 10.4 pmol/l (2.6–5.7) (Abbbott Architect immunometric assays). Antibodies against the TSH receptor were not elevated (0.51 U/l; reference <1.75) A thyroid ultrasound showed a goiter without nodules and with diminished vascularity. The diagnosis of amiodarone-induced thyrotoxicosis (AIT), most likely of mixed nature, was established and treatment with carbimazole and prednisone initiated. The biochemical control remained unsatisfactory despite therapy with carbimazole 40 mg qd, prednisone 40 mg qd, and sodium perchlorate 900 mg qd. In parallel, the patient had recurrent episodes of tachycardic Afib leading finally to a prolonged hospitalization and a further electric cardioversion. The patient eventually developed persistent Afib which remained tachycardic and symptomatic despite the intensification of antiarrhythmic treatment with amiodarone, nadolol, digoxin and diltiazem.
+Due to the refractoriness of Afib to medical treatment and the evidence of a newly compromised ventricular systolic function, the indication for semi-elective total thyroidectomy was established. Because of the very high anesthesiological risk due to the compromised cardiovascular and pulmonary situation, the indication for a thyroidectomy under local anesthesia was established in a multidisciplinary meeting. Rather than opting for intravenous sedation, it was decided to use hypnosis. All procedural steps were discussed and explained in detail with the patient. In particular, the anaesthesiologist-hypnotherapist provided thorough information about the hypnosis and local anesthesia. This also included a comprehensive collection of personal data of the patient with a focus on memory, observational capacity, understanding, personal activities, environment, and sensorial aspects . The patient provided informed consent and was willing to accept the risks of a general anesthesia in case of conversion to general anesthesia would have been necessary.
+After standard monitoring in use in our department, the induction of hypnosis was performed in the operating room. Remifentanil (0.04 mcg/kg/min) was started concomitantly and used throughout the surgery. In order to induce relaxation and calmly modulate perceptions, sensations, and emotions of the patient, permissive suggestions were used by the anaesthesiologist-hypnotherapist. The operating room was prepared accordingly: the anaesthetist's monitoring devices as well as the surgical instruments were silenced, lights were dimmed, staff communicated in soft voice, and access to the room was strictly limited. The patient was placed in a semi-seated position, with his neck in slight hyper-extension. Once the anesthesiologist in charge of hypnosis gave the “go ahead”, the neck was prepared for surgery. As described elsewhere , anaesthesia was applied around the sternocleidomastoid muscle. A line connecting the mastoid process to the clavicle on the anterior and posterior edge of the sternocleidomastoid was drawn . A total of 29 mL of lidocaine 1% with adrenalin was injected on both sides as follows: middle of the posterior margin of the sternocleidomastoid (corresponding to the emergence of the superficial cervical plexus), anteriorly and longitudinally at 3 points (cervical branches), in the muscle itself, and along the cervical incision.
+Given the multiple cardiac and large vessel malformations, a possible variant of the inferior laryngeal nerve was expected. Intra-operative neuromonitoring was not used. During surgery, a non-recurrent laryngeal nerve on the right side could indeed be identified. Surgery was performed with a harmonic scalpel (Harmonic FOCUS Curved Shear, Ethicon Endo-Surgery) and electro-bipolar forceps. All parathyroid glands were identified and preserved.
+Communication with the patient was maintained at all times during hypnosis. The patient was then gradually guided back to full consciousness through controlled, focused breathing. Total hypnosis time was 165 min and surgery lasted 100 min.
+In the recovery room, the patient was completely awakened. The intra- and post-operative pain control were evaluated using a numerical rating scale (0–10). The patient recalled almost no pain during the intervention (1/10), but experienced severe sore throat (8/10) during the first post-operative night and the following day, which improved within 48 h (3/10). During the first night in the intensive care unit, no rhythm disturbances requiring treatment were recorded. He developed transient asymptomatic hypocalcemia (2.0 mmol/L), corrected by oral calcium. The post-operative parathyroid hormone level was normal (35 ng/L).
+In the immediate post-operative period, the patient complained of extreme fatigue which is a well described consequences of hypnosis .
+The anatomopathological examination revealed a diffuse goiter (5 × 3.5 × 2.5 on the left side and 6.5 × 3.5 × 2.5 on the right).
+Because of recurrent Afib, sinus rhythm was restored by a repeat electric cardioversion. The antiarrhythmic therapy with amiodarone, nadolol and diltiazem was continued. At 4 month follow-up, the interrogation of the loop recorder showed maintenance of sinus rhythm and only short runs of Afib.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2446_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2446_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d5e130966f84f26e00176c70bca69fd1939ed90e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2446_en.txt
@@ -0,0 +1 @@
+The patient was a 47-year-old male with non-contributory past medical history. He noticed weakness in the left lower extremity upon rising from bed in the morning, but the symptom gradually resolved. On the night of the same day, he suddenly developed headache and mild paralysis of the left lower extremity and presented to our hospital. On admission, the patient was alert and had mild paralysis of the left lower extremity. His blood pressure was 138/78 mm Hg. There were no abnormalities in the blood biochemistry tests taken upon arrival. The head CT and MRI showed cerebral infarctions in the right frontal lobe and subarachnoid hemorrhage in the frontal convexity and anterior interhemispheric fissure. In MRA, DAs were observed in the bilateral anterior cerebral arteries. In the 3D-CT angiography, dissecting intima was observed in the area with saccular enlargement . The patient was diagnosed with a combination of cerebral infarction and subarachnoid hemorrhage caused by the rupture of the DAs in the bilateral anterior cerebral arteries. In the left internal carotid angiography, saccular cerebral aneurysm was observed in the left A1–A2 junction . In addition, stenosis was seen in the left A2 segment and opaque vascular bulging was seen in its peripheral in the late arterial phase. Right internal carotid angiography showed cerebral aneurysm at the left A1–A2 junction . The right A2 segment was occluded and its peripheral vessels showed retrograde flow during the venous phase. The treatment plan included surgery to prevent recurrent hemorrhage and to reinforce the walls of the DAs in the anterior cerebral arteries. Surgery was performed on the fifteenth day after admission when the patient’s neurological symptoms stabilized. First, anterior interhemispheric approach in a supine position was used to confirm the presence of aneurysms in the bilateral areas from A2 to A3 segments. The arterial wall was dark purple, and the vascular diameters were irregular with bulging in one area. Wrapping was performed from A2 to A3 segments for the left anterior cerebral artery. The right peripheral vessels had weak walls and vascular anastomosis was difficult. Therefore, trapping was performed at the A2 segment. In the postoperative course, the patient had no apparent neurological deterioration. One month after the surgery his symptoms had resolved completely, and he could return to work.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_245_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_245_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4b825f773982f62577fa43a68ebf58c272f679b0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_245_en.txt
@@ -0,0 +1,5 @@
+A 71-year-old man treated for chronic kidney disease, paroxysmal atrial fibrillation (AF) and chronic heart failure experienced cardiopulmonary arrest due to unexpected ventricular fibrillation (VF). Fortunately, owing to prompt bystander cardiopulmonary resuscitation, the patient completely recovered without any neurological disabilities. Upon admission in the previous institution, serum potassium levels were revealed to be significantly decreased to 3.3 mEq/L; therefore, it was speculated that VF was induced by incidental hypokalaemia. The patient was subsequently referred to our institution for further evaluation.
+Medical history taking revealed that the patient had a heart murmur throughout his childhood, yet this matter was not further evaluated. At the age of 19 years, the patient was diagnosed with TOF and underwent palliative Blalock–Taussig shunting at the age of 21 years. Although radical intracardiac surgery was recommended, the patient refused further surgical treatment. For a while, he worked and enjoyed playing golf without any heart failure symptoms; however, he was eventually admitted due to heart failure at 50, 70, and 71 years of age.
+Upon referral, his blood pressure was 114/58 mmHg, heart rate was 69 b.p.m., and oxygen saturation was 89% (ambient air). On visual inspection, he had lip cyanosis and clubbing; however, no peripheral oedema was observed. Cardiac auscultation revealed a harsh systolic ejection murmur in the 2nd to 4th intercostal space of the left sternal border. Laboratory findings revealed polycythaemia with a haemoglobin level of 18.0 g/dL and a haematocrit of 52.6%. His serum creatinine levels were 1.8 mg/dL, and brain natriuretic peptide concentration was significantly increased at 697 pg/mL. Chest radiography showed a ‘boot-shaped’ heart with bilateral pleural effusion , and electrocardiography revealed an AF rhythm . Transthoracic echocardiography showed the overriding of the aorta on a large ventricular septal defect (VSD) that was 32 mm in diameter (, white arrow, Video 1) and right ventricular (RV) hypertrophy, along with pulmonary stenosis (PS; Video 2), all of which were indications of unrepaired TOF. On colour Doppler echocardiography, a bidirectional shunt flow through the VSD was clearly observed . Moreover, the pulmonary valve was markedly calcified, making leaflet mobility significantly restricted (Video 3). Continuous wave Doppler echocardiography showed a significant pressure gradient of 77.8 mmHg across the pulmonary valve, confirming the presence of severe valvular PS . Left ventricular (LV) ejection fraction decreased to 46.8%, and the base-to-mid posterior and inferoseptal wall motion abnormality was observed. To assess the detailed intra- and extracardiac anatomy of this patient, the patient underwent multidetector-row computed tomography, and the findings of the acquired images were consistent with the characteristics of unrepaired TOF. The findings revealed a large VSD with aortic overriding (, white arrow), severe PS (, red arrow), and RV hypertrophy. Although major aortopulmonary collateral arteries were absent, a relatively restrictive Blalock–Taussig shunt was clearly observed (, yellow arrow). Functional assessment using cardiac magnetic resonance imaging revealed RV dilatation (end-diastolic volume, 192 mL; end-systolic volume, 146 mL) and reduced RV ejection fraction (RVEF, 24%). Cardiac catheter examination revealed a pulmonary arterial pressure of 23/14 mmHg (mean, 18 mmHg), an RV pressure of 96/7 mmHg (end-diastolic pressure, 12 mmHg), and a pulmonary vascular resistance of 1.45 wood unit. Pressure waveforms and oximetry run results are presented in , respectively. Coronary angiography showed the total occlusion of the mid-portion of the right coronary artery (, white arrow) and the proximal portion of the left circumflex coronary artery (, yellow arrow) and the critical stenosis of the diagonal branch of the left anterior descending artery.
+To improve the unstable haemodynamics, electrical cardioversion was performed on the 6th day of hospitalization. To maintain a normal sinus rhythm and suppress ventricular arrhythmia, amiodarone (100 mg/day) was introduced. Because the patient had multiple comorbidities, radical intracardiac repair was not performed due to significant surgical risk. Regarding the less invasive transcatheter intervention, coronary reperfusion therapy was withheld due to the absence of inducible ischaemia on the basis of the findings of stress myocardial scintigraphy. On the other hand, because it was expected that palliative transcatheter intervention for PS could even impair exquisite haemodynamic balance for this patient, transcatheter pulmonary valvuloplasty was not applied for this case. Alternatively, for the secondary prevention of lethal ventricular arrhythmia, a subcutaneous implantable cardioverter-defibrillator was implanted. After obtaining a normal sinus rhythm, β-blocker use and oral diuretic titration, his haemodynamics significantly improved. Eventually, the patient was discharged on the 55th day of hospital admission.
+One year after discharge, his heart failure symptoms improved to New York Heart Association functional class 2.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2460_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2460_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..da33baec6cd2a252683ffa8f2381368b3fd2d818
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2460_en.txt
@@ -0,0 +1,4 @@
+A 63-year-old man complaining of discomfort in the upper right abdomen was referred to our hospital because of a liver tumor diagnosed by another hospital.
+Previously, he had undergone an appendectomy, and had a history of untreated chronic hepatitis C and a daily habit of drinking. His physical examination revealed no notable abnormalities. The abnormal values in his blood test findings were as follows: aspartate transaminase, 71 IU/l; alanine transaminase, 108 IU/l; alpha-fetoprotein, 5626.0 ng/ml; and protein induced by vitamin K absence or antagonist II, 642 mAU/ml. Other blood counts, biochemical laboratory findings and coagulation factors were within the normal ranges. The retention rate of indocyanine green at 15 min was 10%.
+Contrast-enhanced computed tomography (CT) showed a 40-mm tumor in segment 8 (S8) of the liver, which was enhanced in the early phase and washed out in the delayed phase, suggesting hepatocellular carcinoma (HCC) . His portal vein was lying ventral to the pancreas and dorsal to the duodenum (hence called PPPV), and ventral to the common bile duct . In the hepatic hilus, the portal vein was dilated, forming an inverted L-shape, and was branching while winding with an irregular caliber . In addition, there were some porto-portal communications . No anomalies were detected in the common bile duct, gallbladder, hepatic artery, and there were no esophageal or gastric varices, thrombus, and portosystemic collaterals.
+Because of this anomalous configuration, the Glissonean approach at the hepatic hilum or anatomical resection was judged to be dangerous; therefore, we performed partial resection of S8. During the operation, the liver had a chronic hepatitis pattern and ascites was not observed. No morphological malformations were detected in the liver or in other organs. Intraoperative ultrasonography showed worm-like meandering of the intrahepatic portal veins, but no occlusion findings due to a thrombus . We performed liver resection with a margin of 2 cm from the tumor without the Pringle maneuver . The operative time was 431 min, and the amount of blood loss was 785 ml. The final pathological diagnosis was moderately differentiated hepatocellular carcinoma with an UICC classification of pT2N0M0, Stage II. The fibrosis stage and inflammatory grade of the resected liver were both F3A2 according to the New Inuyama classification. The postoperative course was uneventful, and the patient was discharged 14 days after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2471_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2471_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1651ff4844a8835639a6ff54da8af848fe8b469e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2471_en.txt
@@ -0,0 +1,2 @@
+A 39-year-old male was referred to our hospital due to decreased vision and visual field defect in his right eye. Upon examination, this right-eye visual acuity was 0.03 and bullous rhegmatogenous retinal detachment was found in three quadrants, yet not in the upper part of the retina . For treatment, we performed the standard 4-port pars plana vitrectomy using the 25-gauge system. Following the core vitrectomy and artificial posterior vitreous detachment, we injected PFCL to flatten the detached retina. After endophotocoagulation was performed around the retinal break, we directly replaced the PFCL with SO. Due to misdirection of aqueous fluid into the subretinal space during the replacement, we attempted to remove the SO and exchange it with aqueous solution. However, a small amount of SO was found to be adhered to the posterior pole of the retinal surface, and it was impossible to remove the bubble of SO by active suction at the vitreous center . Although the shape of the SO bubble was easily deformed, the location of the sticky SO remained unchanged.
+The PFCL layer between the SO and the underlying retina was easily aspirated and the SO was released from the retinal surface. Post release, the SO was relocated to the anterior chamber and safely removed through a corneal limbal incision. After complete removal of the SO, pneumatic retinal replacement and laser photocoagulation were performed, and sulfur hexafluoride gas was used as a temporary intraocular tamponade. At 7-months postoperative, the patient’s retina remained attached and his corrected visual acuity improved to 0.7.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2481_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2481_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b454920d2210703ce9d7cb020b993c4c9823aa25
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2481_en.txt
@@ -0,0 +1,3 @@
+A 19-year-old male presented to the emergency department of a regional hospital with severe epigastric pain 12 hours after sustaining blunt trauma to the abdomen during an alleged assault. He was noted to be haemodynamically stable, and physical examination revealed epigastric tenderness and guarding. His white cell count (WCC) was 22.6 × 109/L (normal range 4–9 × 109/L) and his C-reactive protein (CRP) was 343 mg/L (normal range <3 mg/L). His amylase was also elevated at 378IU/L (normal range 25–125IU/L). His haemoglobin was within normal limits. An urgent computed tomogram (CT) was performed. This demonstrated complete transection of the pancreatic body with pancreatic haematoma formation . This was consistent with a grade III injury according to the American Association for Surgery of Trauma (AAST) classification. No other injuries were identified and there was no evidence of active haemorrhage or bile leak.
+The patient was promptly transferred to our centre where an on call hepatobiliary service was available. As the patient was haemodynamically stable with no evidence of active bleeding or bile leakage on his CT, he was treated conservatively. He was kept nil by mouth, placed on intravenous antibiotics and total parenteral nutrition was commenced via a peripherally inserted central catheter. Octreotide was also administered to reduce pancreatic secretion. He remained haemodynamically stable and gradually improved both clinically and biochemically. A pancreas protocol CT scan was performed on his fifth day in hospital, which showed stable appearances compared to the scan performed on his admission. The haematoma had remained stable, and once again there was no evidence of active bleeding or bile leak. Oral fluids were reintroduced at this point and intravenous antibiotics were stopped.
+A further CT scan was performed on day 14 which showed stable appearance of the laceration with maturation of the previously identified haematoma with adjacent pseudocyst formation . At this point, the patient was completely asymptomatic, tolerating full diet, and both his WCC and CRP had normalised. He was discharged shortly after this and reviewed in outpatients 14 days following discharge with a further repeat CT scan. Once again, he remained asymptomatic and CT findings revealed minimal interval change. A magnetic resonance cholangiopancreatogram (MRCP) was subsequently carried out, confirming complete loss of pancreatic duct integrity. The duct was found to be dilated to 4.2 mm distal to the point of transection with associated hypo enhancement of the parenchyma suggestive of fibrosis. Despite this, the patient remains clinically well and is asymptomatic as of six months since discharge from the hospital. He continues to be monitored in the outpatient setting.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2495_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2495_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7cf2edb5bf5074b56f4fd4913093a97a905a5bd8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2495_en.txt
@@ -0,0 +1,7 @@
+A 41-year-old Caucasian woman referred 6 months of bilateral blurred vision, more intense when she woke up. She had undergone surgery for implantation of cosmetic NewColorIris devices in both eyes 15 years before, without any complication or ocular trauma during that time .
+Ocular examination confirmed low hyperopia (+ 0.75 D) in both eyes and she did not wear contact lenses (CL). Her best-corrected visual acuity was 20/20 in both eyes. The slit lamp examination showed bilateral and symmetric slight corneal edema with early decompensation, epithelial bullae and presence of pigment in the endothelium (specular microscopy showed a low endothelial cell count in the right eye (1268 cells/mm2), as well as in the left one (1122 cells/mm2). Silicone cosmetic implants in front of the iris were also observed in the AC with a central hole of 3.4 mm that did not match the pupillary axis in the right eye . Although iris evaluation was limited due to those implants, iris atrophy was observed by backlighting.
+The position of both iris implants was assessed in detail by the means of anterior segment optical coherence tomography (AS-OCT, CASIA2, Tomey Corporation, Nagoya, Japan), and decentration was measured with several scans . The decentration of the iris implant from the pupillary axis in the right eye was 475 μm to the temporal sector and 238 μm superiorly . The iris implant in the left eye was more centered: it had moved 308 μm superiorly but only 15 μm to the temporal quadrant .
+IOP measurements obtained with Goldmann applanation tonometry were 28 mmHg and 18 mmHg in the right eye and in the left eye, respectively. Central corneal thickness was 588 μm in the right eye and 559 μm in the left eye.
+Gonioscopy (performed with a Posner gonioprism) demonstrated a tendency to angle closure in both eyes (grade II in the superior, inferior and temporal quadrants and 0 in the nasal quadrant, according to Shaffer’s grading system to assess angle opening), with a large amount of pigment at the angle, more increased at VI o’clock . Those findings were also identified by the means of the iris-trabecular contact (ITC) analysis provided by AS-OCT: the ITC index was 18.3% in the right eye and 13.3% in the left eye, with nasal areas of possible peripheral anterior synechiae (PAS) in both eyes .
+Fundal examination revealed no pathological findings and the optic discs were normal, with a cup-to-disc ratio of 0.4 in both eyes. Humphrey computerized perimetry performed with SITA standard 24–2 strategy (Carl Zeiss Meditec, Dublin, CA, USA) showed no perimetric defects in either eye. The retinal nerve fiber layer thickness measured by OCT (Triton, Topcon Corporation, Tokyo, Japan) was within the normal limits in both eyes.
+Based on all these results, the most likely diagnosis was bilateral corneal decompensation, as well as ocular hypertension (OHT) in the right eye, due to secondary pigment dispersion syndrome. Beta-blockers eyedrops were prescribed for her right eye, and the surgical removal of both cosmetic implants was considered as a further management option. The patient did not attend the scheduled follow-up visits.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2504_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2504_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1909f6d331b076736e0dc6ba54149148731949f5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2504_en.txt
@@ -0,0 +1,6 @@
+A 56-year-old Caucasian woman was referred for treatment of a local recurrence of endometrial cancer with infiltration of her sacral bone and nerve plexus. After initial diagnosis of endometrial cancer in 2005 (pT1B N0 MX G1 L0 V0), a Wertheim-Meigs operation was performed with subsequent radiotherapy with the initial result of complete tumor remission. In 2009 the patient presented with histologically confirmed pulmonary metastases. Under anti-hormonal therapy (medroxyprogesterone acetate), again complete remission was achieved. At the start of 2012, 7 years after the initial diagnosis, the patient was admitted to our hospital due to a presacral recurrence of the endometrial cancer with infiltration and widespread destruction of the os sacrum.
+The patient complained of severe back pain and a marked pain spreading out to her right leg, suggestive of nerve infiltration. Magnetic resonance imaging (MRI) showed infiltration of the os sacrum and the sacral plexus. The tumor size was 11.9 × 11.6cm in axial section and 14.9cm in craniocaudal direction .
+The patient’s case was discussed at the multidisciplinary tumor board for therapy options: due to the immediate proximity to the sacral plexus the patient could neither undergo surgical therapy nor a second radiation therapy because of the high risk of neural destruction potentially resulting in paralysis. Due to its ablation mechanism IRE was deemed to be the best therapy option for the patient as palliative disease control.
+IRE uses a series of electrical pulses of microseconds to generate irreversible permeabilization of cell membranes and thereby induces cell death in the treated region. IRE seems to be highly effective in tissues with a high density of cell wall structures and less effective in tissues with a high concentration of collagenous and elastic fibers [,]. This – in contrast to thermal ablation techniques like radiofrequency ablation (RFA) or microwave ablation – potentially allows tumor cell ablation without concomitant destruction of connective tissue, blood vessels and nerves . Due to this potentially selective cell ablation technique, IRE was offered as a palliative therapy option because it provided the opportunity of tumor mass reduction and decrease of tumor burden with reduced risk of impairment of the sacral plexus and surrounding blood vessels. The procedure with risks and benefits was discussed with the patient and informed consent was obtained.
+The patient was put under general anesthesia and neuromuscular blocking to prevent arrhythmia . The procedure was performed using a commercially available IRE system. Due to the large tumor volume (941cm3) a total of six needles were placed into the target area . The percutaneous placement of the electrodes was guided by computed tomography (CT) fluoroscopy as well as ultrasound using a multifrequency probe (1 to 5MHz). As recommended by the manufacturer and recorded by the IRE generator the following parameters were used: number of electrodes: six; type of electrodes: monopolar; distance of electrodes: 0.7cm (minimum), 1.2cm (maximum); impulses per electrode: 70; voltage: 1100V (minimum), 3000V (maximum). A stepwise ablation procedure with multiple replacements of the electrodes was performed, starting from a caudal position and moving to cranial. The first ablation procedure covered about 40% of the tumor mass and was stopped after 8 hours. Follow-up imaging showed good response to treatment in the caudal parts of the tumor with remaining viable tumor tissue in the cranial parts . The patient was scheduled for a second ablation procedure after 14 weeks to cover the formally not treated areas.
+During the two IRE procedures the patient did not have any cardiovascular events, in particular no supraventricular tachycardia and no atrial fibrillation. Complications, especially postinterventional paralysis or bleeding, were not observed. After the first ablation procedure the patient did not complain about aggravated back pain; neither sensory deficit, nor loss of strength in her legs, nor paresthesia were observed. A neurological examination after the second ablation session revealed a mild 4+ paresis of the right extensor hallucis longus (L4 to S1) with complete resolution after 4 weeks. No sensory loss or impairment of bladder function occurred. After the second intervention opiate medication could be withdrawn. Using carbamazepine (200mg twice a day) and Polamidone (levomethadone) (5mg three times a day) pain control was achieved. The patient’s 24 hour follow-up imaging after the second ablation as well as follow-up imaging after 8 weeks (consisting of contrast-enhanced ultrasound, MRI and a CT scan) showed wide ablation of the tumor with necrosis of most portions of the tumor and reduction of tumor volume to 791cm3.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2521_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2521_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2c3c0f08755d7f08d5ee573d2f3b01a0041c70d8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2521_en.txt
@@ -0,0 +1,5 @@
+The patient was a 67-year-old man experiencing abdominal distension since September 2006. In October 2006, the abdominal fullness became progressive, and he had hard general fatigue. There was no history of vomiting, fever, or gastrointestinal bleeding. Renal failure occurred due to diabetes mellitus (DM). On admission in November 2006, a physical examination revealed a 25 × 30 cm hard mass that was palpable in the middle and lower left abdomen minimal intrinsic mobility and massive ascites.
+An upper gastrointestinal barium study and gastric endoscopic examination indicated no anomalies. Tumor findings of Doppler ultrasonography showed a hypoechoic lesion with a hypervascular area . An abdominal computed tomography (CT) scan showed a huge heterogeneous mass sized 20 × 25 cm extending from the greater curvature of the middle body of the stomach . Abdominal magnetic resonance imaging (MRI) was performed, and almost the entire abdominal cavity was visualized in the coronal view. The irregular wall of the lesion exhibited a low intensity signal on the T1-weihted image and a high-intensity signal on the T2-weighted image .
+Routine biochemical investigation revealed hypoalbuminemia, renal dysfunction, and hyperglycemia. Since the admitted patient was diagnosed with DIC (platelet count: 2000 mm3, FDP: 135.4 μg/ml, PT: 1.20, SIRS score: over 3 heads) surgery could not be performed. The patient received a platelet transfusion of 20 units each day 6 times, and the DIC was treated with nafamostat mesilate and fresh-frozen plasma. Due to this treatment, the platelet count recovered to 7.0 × 104; tumor resection was performed at 16 days after admission. Laparotomy revealed a huge extraluminal tumor arising from the greater curvature of the stomach that measured 25 × 30 cm and had not ruptured into the peritoneal cavity or infiltrated other organs . An attaching pedicle approximately 3 cm in breadth was observed in the greater curvature of middle body of the stomach. Partial gastric resection was performed .
+The resected mass measured 25 × 25 × 20 cm. In cross section, the tumor appeared hard and homogenous with a small polycystic area . Histopathology of the resected specimen showed large spindle cell GIST with >5/50 HPF (high-power field) mitotic activity . No evidence of infiltration was observed in the resected margins of the stomach wall. Immunohistochemical staining was strongly positive for CD34 and CD117 , and negative for α-SMA, S-100 and Desmin.
+The postoperative course was uneventful, and the coagulopathy improved rapidly. The patient was carefully followed up regularly. Imatinib mesylate (Gleevec™/Novartis Pharma AG, Basel, Switzerland) was administered orally 300 mg per day because the patient displayed renal dysfunction (serum creatinine: 3.98, blood urea nitrogen (BUN): 41.5)
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2524_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2524_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f4c705616b835837e869f40b6c925e8894451854
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2524_en.txt
@@ -0,0 +1,3 @@
+A 37-year-old, right-handed, medically free, female patient presented to the clinic with left sided TN refractory to medical therapy. Her pain was in the distribution of the three branches of the trigeminal nerve and electric in nature. She had daily pain despite multiple medications including carbamazepine, baclofen, and pregabalin. On presentation, her BNI Pain Intensity Score was 5, physical examination, including cranial nerves examination, was unremarkable. Typically she had acceptable pain relief from medication but then the pain would recur. Magnetic resonance imaging (MRI) of the brain with constructive interference in steady state (CISS) sequence did not show any abnormal vascular compression, however, a prominent left suprameatle tubercle was noted. All the options were discussed with the patient and she agreed to proceed with balloon compression. The patient had an improvement of her symptoms for 6 months after the balloon compression before the pain recurred. She then underwent a second balloon compression which gave her a relief for 14 months before the pain recurred with more intensity. Therefore, a third balloon compression was performed but the patient continued to have pain in the mandibular distribution (V3) of the trigeminal nerve with minimal pain relief. Another brain MRI was obtained which showed no vascular loops pressing on trigeminal nerve, however, the EST was visualized compressing the upper aspect of the nerve with impingement of the superior part of the nerve (. A, B). A CT brain was completed and showed enlarged and heavily calcified suprameatal tubercle (. C).
+The EST as a possible cause of TGN and surgical intervention were discussed with patient extensively, including benefits of surgery and possible complications. She decided to proceed for the surgery.
+Other than the aforementioned medications, patient was not on any other prescribed drugs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2555_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2555_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c7bb3a09da8113c30d58e96ab9851e869513d5fd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2555_en.txt
@@ -0,0 +1,2 @@
+A 29-year-old lady was diagnosed with metastatic NPC with cervical nodal, lung and bone metastases in December 2014. Her disease progressed despite multiple lines of chemotherapy including gemcitabine and cisplatin (3 cycles from December 2014 to March 2015)cisplatin plus 5-fluorouracil (1 cycle in April 2015) which was changed to docetaxel plus cisplatin because of 5-fluorouracil allergy (3 cycles from April 2015 to June 2015), gemcitabine and carboplatin (6 cycles from November 2015 to March 2016) capecitabine (6 cycles from April 2016 to August 2016), and metronomic cyclophosphamide (from August 2016 to September 2016). Radical chemoradiation with cisplatin was given to her progressive neck nodes in July 2015. Her lung metastases later further progressed resulting in mild dyspnea and her plasma Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) rose from 4919 to 119,125 copies/ml . Pembrolizumab, an anti-PD-1 inhibitor was considered owing to very limited further treatment options. Her archived neck lymph node specimens sent for PD-L1 expression with immunohistochemical staining revealed that the tumor proportion score was 100 and the combined positive score was 101, indicating that a promising response to ICI was expected. She denied any past medical history of tuberculosis. She then received pembrolizumab at 2 mg/kg every three weeks since September 2016. Her dyspnea and lung metastases improved and reduced in number dramatically after only two cycles of pembrolizumab, accompanied by a slump of EBV DNA to 83 copies/ml . She experienced mild irAEs with hypocortisolism and hypothyroidism which were effectively managed with hormone replacement therapy. In May 2018, she presented with a sudden onset of severe, colicky and localized right lower abdominal pain, projectile vomiting and bloody diarrhea with mucus, and persistent fever (temperature > 38.6 degrees Celsius). Initially immune-related enteritis/colitis was suspected and pembrolizumab was suspended. Positron emission tomography with integrated computed tomography (PET-CT) of the abdomen showed terminal ileitis with multiple enlarged mesenteric lymph nodes Colonoscopy was performed and the inflamed terminal ileum was biopsied, which exhibited multiple caseating granulomas with Langerhan cells, compatible with tuberculous ileitis (microscopic images captured by Nikon model DS-FI3 attached to Nikon Eclipse Ni microscope viewed by Application DS-L4 Viewer Software Ver1.2.0) . Otherwise, the pathology did not show any features of inflammatory bowel disease or immune-related enteritis. Though Ziehl–Neelsen stain did not identify any acid-fast bacilli, polymerase chain reaction test for TB of the ileal biopsy and interferon gamma release assay (IGRA) with QuantiFERON TB Gold Plus were both strongly positive. She immediately received anti-TB medication including rifampicin, ethambutol, pyrazinamide and isoniazid for 1 year following our microbiologist’s suggestion. Her terminal ileitis and the enlarged mesenteric lymphadenitis resolved in the follow-up PET-CT scan 9 months later. Colonoscopy performed 15 months after the last one confirmed complete resolution of her ileitis .
+However, her lung metastases worsened again 7 months after anti-TB treatment , concurrent with an elevated plasma EBV DNA of 2826 copies/ml following pembrolizumab interruption. In light of her current progressive metastases and the prior extraordinary response to pembrolizumab, she was re-challenged with pembrolizumab in December 2018 together with her anti-TB treatment. PET-CT scan 5 months later showed promising tumour shrinkage . She is still receiving pembrolizumab with no evidence of TB relapse or other irAE.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2569_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2569_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fd743527ec3ed835b9047c0e77b2a4cd40d4bbf7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2569_en.txt
@@ -0,0 +1 @@
+A 63-year-old woman with a history of ESRD was admitted to our hospital on June 3, 2015 after experiencing disorientation for 5 days. The patient had been receiving HD since December 2014 because of acute on chronic kidney disease due to pneumonia. She was also diagnosed with hepatitis B-related liver cirrhosis (Child-Pugh B with hepatic encephalopathy), Mycobacterium tuberculosis-related pleuritis, and IgGλ monoclonal gammopathy. Monoclonal gammapathy hadn’t been treated because she was permanently bedridden. She received maintenance HD through a tunneled-cuffed catheter inserted into the right subclavian vein since December 8th, 2014. She denied active intravenous drug use. We observed drowsy consciousness and splenomegaly during physical examination. No crackles were found in either lung field, and no track marks were present on her skin. Her white blood cell, absolute neutrophil, and platelet counts were 2.86 × 103/uL, 2116/mm3, and 14,000/uL, respectively. Her total bilirubin was 3.54 mg/dL. In addition, C-reactive protein was 2.31 mg/dL, and her serum glucose was 992 mg/dL, without metabolic acidosis. Because of the hyperglycemic hyperosmotic status of the patient, blood culture was drawn and empiric vancomycin and cefuroxime were prescribed. The initial blood culture grew Candida guilliermondii without other bacteria. Fluconazole 200 mg once per day was administered intravenously. The tunneled-cuffed catheter was removed on June 30 because of persistent fungemia. The culture of tunneled-cuffed catheter grew Candida guilliermondii.. Blood cultures on July 14 and August 10 and 28 still grew C. guilliermondii, even after replacement of caspofungin by fluconazole on July 28. No positive culture result was found in sputum or urine during the 8 weeks after admission. Transthoracic echocardiography on July 20 and August 21 revealed no vegetation or congenital abnormality. On August 25, repeated transthoracic echocardiograms showed a 1.2-cm mobile mass on the pulmonary valve extending from the right ventricular inflow tract across the pulmonary valve . No other vegetation was found. Surgical intervention was suggested, but the family of the patient declined because of her multiple comorbidities. Therefore, amphotericin B 40 mg was administered once daily from August 30 but was discontinued on September 1 because of allergic reactions (rash and fever). After 8 weeks of caspofungin, the C. guilliermondii septicemia was still present and the vegetation on the pulmonary valve had increased in size (3.73 × 2.70 cm). Computed tomography (CT) of the chest and abdomen revealed splenic infarction and right upper lung pneumonia with septic embolism . The patient and family requested hospice care, and we discharged the patient with a long-term prescription of fluconazole 200 mg/d. The patient died from hepatic encephalopathy and coma on September 26, 2015.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2574_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2574_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cc152cb992a9a5d2f71873692c4f7a9abbee0088
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2574_en.txt
@@ -0,0 +1,2 @@
+A 53 year old male presented with the inability to void and bloody urethral discharge after having introduced an electrical wire into his urethra for masturbation 3 hours earlier. He had made several unsuccessful attempts to remove it.
+During the physical examination, the two ends of the wire were observed in the urethral meatus . An x-ray of kidney, ureter, bladder (KUB) demonstrated a coiled up radiopaque wire inside the bladder . The patient was married with children and his wife accompanied him. His socioeconomic status was of upper class. It was the first time he had ever self-inflicted a foreign body in his urethra and he had no history of psychiatric illness or drug addiction. After giving his formal consent, the patient was taken to the operating room. Under general anesthesia and fluoroscopic control, an unsuccessful trial was made to pull the wire. An attempt was made to insert a 22Fr cystoscope or an 8Fr ureteroscope parallel to the wire but this was impossible due to lack of space. Then a suprapubic cystotomy was performed and the wire was removed . The patient was discharged on the third postoperative day and the urethral catheter was removed on the sixth day. He was on intravenous antibiotics for three days and on a per os regimen for another week. On the six month evaluation, the patient is well with a normal uroflow and no symptoms of urethral stricture.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2575_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2575_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5f44583ab73a2a0930e229230853db57eb35627d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2575_en.txt
@@ -0,0 +1 @@
+An 84-year-old female patient was admitted to the accident and emergency (AE) department of our hospital complaining of painful restriction of movement in the left hip for the past month. She had undergone a left cement less THA (reflection cup, synergy stem, 28 mm ceramic on XLPE bearing coupling, Smith and nephew, Memphis, Tennessee, USA), through an ordinary posterior approach, 14 years previously. The immediate post-operative period had been uneventful. In the 8th post-operative year, during a follow-up evaluation, the patient was found to be asymptomatic, but signs of PE wear were recorded on radiological evaluation. The patient was advised, by her surgeon, to attend outpatient clinics at regular intervals and she was informed about the possibility of an early revision of the bearing surface. Despite this, she failed to attend any other appointments. On admission to the AE, the patient reported that she had experienced increasing restriction of movement and functional impairment during the previous year without having sustained a recent hip injury. On clinical examination, painful restriction of movement, no signs of soft tissue injury or infection, and a leg length discrepancy of 4 cm were recorded. Laboratory blood workout was found to be normal. On radiological examination, a left THA dislocation was found and the patient underwent three unsuccessful attempts at closed reduction, under anesthesia, in the AE department. During these attempts, the patient sustained an undisplaced fracture of the neck of ipsilateral fibular head. The following day, during an open reduction under anesthesia in the operating theater, a central dislocation of the head of the prosthesis was found. The PE liner was found to be worn and broken, and the ceramic head had centrally perforated the metallic acetabular shell and was located behind the shell in an osteolytic area full of PE and metallic debris. Excessive soft tissue metallosis was also found. The femoral stem and the perforated metallic shell were found to be stable. A thorough soft tissue debridement was performed, the retro-acetabular bone defect was filled with cement and a PE liner was cemented into the damaged metallic shell . The prosthesis was then reduced and evaluated for stability using a 32 mm ceramic head. The patient experienced an uneventful post-operative clinical and functional recovery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2577_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2577_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a4f012c6ab59b7fee6365ead70284573909a609b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2577_en.txt
@@ -0,0 +1,6 @@
+A 26-year-old African American woman with accidental ankle subluxation presented to our emergency department with foot pain. As a part of her work-up, she was incidentally found to have an elevated serum creatinine level of 2.2 mg/dL and proteinuria. Therefore, our patient was referred to a nephrologist for further evaluation.
+Her medical history included morbid obesity, hypertension, and hyperlipidemia. The hypertension had been present for 5 years, and was controlled with metoprolol (25 mg, twice a day) and amlodipine (10 mg, daily). Her other medications included ranitidine (150 mg, daily), lovastatin (20 mg, daily) and norgestimate ethinyl estradiol (one tablet, daily). Moreover, she took ibuprofen once a month, as needed, for shoulder pain. We did not note any personal or family history of kidney disease, autoimmune disease, or diabetes. The results of her physical examination were relatively unremarkable, except for obesity and moderate edema limited to her lower extremities. Her blood pressure was 140/90 mmHg. Examination of a 24-hour urine collection showed 11 g of urinary protein and hematuria. Her serum albumin level was 1.8 g/dL.
+A kidney ultrasonography indicated normal size kidneys. Thereafter, she underwent a kidney biopsy, which showed severe noncaseating epithelioid granulomatous necrotizing interstitial nephritis, necrotizing vascular lesion , and cellular crescent formation that were related to the underlying sarcoidosis. Immunofluorescence studies were negative for immunoglobulin (Ig) IgA, IgM, kappa, lambda, C1q, C3, and fibrinogen but mild diffuse linear glomerular capillary staining for IgG was suggestive of pauci-immune crescentic glomerulonephritis.
+Electron microscopy revealed no immune complex deposits. Mycobacterium tuberculosis studies indicated negative results. Serologic testing showed normal complement levels and negative results for anti-nuclear antibody, double-stranded DNA, antineutrophil cytoplasmic antibody (ANCA), human immunodeficiency virus, Sjogren’s syndrome, rapid plasma reagin, and viral hepatitis. Urine protein electrophoresis showed nonselective proteinuria related to combined glomerular and tubular damage. Her level of rheumatoid factor was <3 units/mL. Moreover, she was found to have elevated levels of angiotensin converting enzyme of 78 U/L (normal, 16–68U/L), but her levels of calcium, vitamin D, and parathyroid hormone were normal. A subsequent computed tomography (CT) scan of her chest showed patchy ground-glass opacities within both the lower lobes, with multifocal air trapping, as well as mild thickening of the bronchioles and mild hilar fullness, consistent with stage II pulmonary sarcoidosis. CT of her abdomen showed diffuse pelvic, para-aortic, and mesenteric lymphadenopathy. Examination of a pelvic lymph node biopsy specimen demonstrated no evidence of any lymphoproliferative disorder. Flow cytometry reported a predominance of T-cells in the tissue, with a normal 3.9:1 ratio of CD4 and CD8. Her lactate dehydrogenase level was within normal limits. Childhood records indicated a history of bilateral uveitis, which was treated with prednisolone.
+Owing to the multisystem involvement, our patient was referred to a university-based sarcoidosis center. Because the renal pathology was predominant in her case, the management of immunosuppression was deferred to a nephrologist. She was initially treated with prednisone (60 mg, daily for 1 month), along with the subsequent addition of azathioprine (150 mg, daily). The prednisone administration was gradually tapered to 5 mg/day over 12 months. Subsequently, her nephrotic syndrome improved, her serum albumin levels improved to 3.8 g/dL, and her urinary protein levels markedly reduced from 11 g/24 hours to 1 g/24 hours. After 1 year, the concentration of interlukin-2 receptor in her peripheral blood was assessed, and the findings were suggestive of persistent disease activity. Hence, her azathioprine dose was increased to 200 mg/day.
+Thirty months after diagnosis, our patient remains in partial renal remission, with stable stage 4 chronic kidney disease (creatinine, 2.5 mg/dL; glomerular filtration rate, 28 mL/min/1.73 m2) and minimal proteinuria.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2588_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2588_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5dde11461ab5dbbbf8004b1ec529daa1e2e34ac1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2588_en.txt
@@ -0,0 +1,3 @@
+A 59-year-old morbidly obese, African-American female had a history of Stage IIIc recurrent endometrial carcinosarcoma with para-aortic and pelvic lymph node involvement. Over several years, after initial surgery, she required repeated bouts of chemotherapy and radiation therapy. She now, however, newly presented with a 1-month history of numbness of the left vulva, worsening left lower extremity pain/numbness, and episodic urinary incontinence. The thoracic/lumbar MR revealed a 1.4 × 1.8 cm enhancing intradural extramedullary mass inferior to the conus at the L1 and L4-L5 levels. In addition, there was abnormal enhancement of the left-sided intradural nerve roots, and the bilateral, perihilar lung metastases .
+The patient underwent a T12-L2 laminectomy for gross total resection of the L1 intradural/extramedullary mass; the main aim of surgery was to provide neurological symptomatic relief. Intraoperatively, diffuse carcinomatosis of the cauda equina was observed along with a large lesion located anteroinferior to the conus. Grossly, the tumor appeared vascular and involved multiple, swollen, engorged nerve roots. Dissection ceased (e.g., subtotal resection) once intraoperative electromyographic monitoring showed significant changes while dissecting tumor away from tumor infiltrated, matted nerve roots (e.g., gastrocnemius in particular). The permanent pathology showed a mesenchymal malignant Mullerian mixed tumor (carcinosarcoma) without an epithelial component.
+Although the postoperative MR revealed residual intradural extramedullary tumor, the pain and numbness improved in her left lower extremity . Nevertheless, she returned to the hospital 2 weeks later complaining of increased lower extremity symptoms and the new onset of right-sided facial weakness, numbness, and blurry vision. Imaging of the brain and spinal cord revealed leptomeningeal spread of her disease accompanied by hydrocephalus and multiple, new intracranial metastases. Two months later, she succumbed to her metastatic disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2609_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2609_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a6966fe61fb95f4f03ae94ead19fff16a0a253ba
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2609_en.txt
@@ -0,0 +1,7 @@
+In June 2018, a 57-year-old woman presented with a massive, painless mass in the right orbit which had developed over 19 years. As the tumor grew, vision in the right eye gradually deteriorated until it was completely lost approximately 15 years before presentation. Due to budgetary constraints, the patient avoided seeking appropriate medical care.
+Upon ophthalmological examination, she had a best-corrected visual acuity of no light perception and 20/20 of the right and left eyes, respectively. In the right orbit, a large rubbery mass stretched horizontally from the bridge of the nose to the lateral canthus, and vertically from the eyebrow to the center of the cheek. The upper eyelid covering the tumor was pushed forward due to the large size of the mass. The vessels of the eyelids were dilated and tortuous . The palpebral fissure was elongated and widened; the eyeball, covered with soft tissue, was displaced anteromedially . No abnormalities were observed in the left eye. There was no associated lymphadenopathy and a systemic examination revealed no abnormalities.
+Orbital CT revealed a huge mass in the right orbit measuring 10.6 × 9.5 × 11 cm. After administration of contrast material, inhomogeneous enhancement and vascular-like enhancing structures were observed. The mass was closely related to the internal rectus muscle. The eyeball appeared totally engulfed and compressed by the large mass and was displaced anteromedially. In the bone structures, no evident erosion or extension damage was found; however, the temporal orbital wall was observed to be slightly thinner than anticipated .
+Orbital cavernous hemangioma was suspected. The patient underwent lid-sparing orbital exenteration under general anesthesia, a procedure that involved removal of the tumor, globe, orbital contents, and most of the upper eyelid. Using a preserved part of the normal eyelid skin, the orbital cavity was covered and sutured with a skin incision margin.
+On gross pathological examination, the orbital lesion consisted of a 15 × 13 × 9 cm well-circumscribed solid tumor covered with a 16 × 14 cm flap . The cut surface was composed of gray-white or gray-red soft tissue with foci of hemorrhage identified in some areas. Nerve tissue of approximately 2.5 cm in length and 0.2 cm in diameter was observed in the adipose tissue next to the tumor. On microscopic examination, H&E staining showed that the tumor tissue constituted spindle-shaped cells arranged in bundles or irregular shapes. Cell nuclei were oval or spindle-shaped. No necrosis, mitoses, or nuclear pleomorphisms were present. .
+IHC testing demonstrated strong and diffuse spindle cells with antibodies against CD34, signal transducer and activator of transcription 6 (STAT6) , B-cell lymphoma 2 (BCL-2), and progesterone receptors (PR). Approximately 2% of these cells were reactive to Ki-67. Staining for antibodies against P53, glial fibrillary acidic protein, and S-100 was negative. These findings were compatible with a diagnosis of a benign SFT.
+The patient had good cosmetic results and exhibited no symptoms of recurrence during the 4-year follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_260_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_260_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..59ff15be302d7bed78c4243e27963cec0f5b5061
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_260_en.txt
@@ -0,0 +1,8 @@
+A 2-year-old girl, with a family history of early-onset cardiomyopathy and a medical history of recurrent upper respiratory tract infections necessitating only symptomatic care, visited her primary care pediatrician with symptoms of increasing lethargy, cough, shortness of breath after minimal exercise (such as walking, eating, and crying), puffy eyes, and edema in the lower extremities. Subsequently, she was referred to a pediatric cardiologist, who conducted an echocardiogram and baseline laboratory tests in a private clinic setting. The initial assessment revealed heart failure with a 30% ejection fraction. Following this diagnosis, the patient received outpatient treatment consisting of oral medications (Furosemide, Captopril, Spironolactone, Digoxin, and Carvedilol) and underwent frequent follow-up visits.
+During the 7-month period following the initial diagnosis, the patient's condition remained stable with no significant improvement or deterioration until one week prior to her presentation at our Emergency Department of the American University of Beirut Medical Center (AUBMC). At that time, she experienced frequent vomiting, worsening lethargy, and increased shortness of breath leading to a state of cardiogenic shock.
+On presentation, she was ill-looking with mottled skin, cyanotic lips, cold extremities, weak peripheral pulses and delayed capillary refill time. She was afebrile, tachypneic, tachycardic, and hypotensive (respiratory rate (RR) of 60 breaths/minute, heart rate (HR) of 166 beats/minute, blood pressure (BP) of 78/31 mmHg and percutaneous oxygen saturation (SpO2) of 100% on face mask oxygen 5 liters/minute). Auscultation revealed faint heart sounds and diffuse rhonchi over the chest. Mild hepatomegaly was also noted.
+Initial laboratory assessment was consistent with severe metabolic and respiratory acidosis as shown by arterial blood gases (PH: 7.01; PCO2: 51 mmHg; Bicarbonate: 13 mmol/L; Base excess: -18 mmol/L; lactic acid: 9.8 mmol/L). Chest X-Ray revealed cardiomegaly with increased interstitial marking and EKG revealed first degree atrioventricular block . Echocardiogram on arrival showed severe biventricular systolic and diastolic dysfunction (ejection fraction less than 20%), with moderate bilateral atrioventricular valve regurgitation, left ventricular outflow tract velocity time integral (LVOT VTI) of 4 . Evidence of left ventricle diastolic dysfunction included a Mitral E/A ratio of 1.9, an E wave deceleration time of 35 msec, elevated systolic pressure in the pulmonary artery, PV A wave reversal exceeding the duration of the MV A wave, along with a severely dilated left atrium. A diagnosis of decompensated dilated cardiomyopathy with cardiogenic shock was made.
+Patient was intubated and started on Epinephrine drip, Milrinone drip and diuretics. She was admitted to Pediatric Intensive Care Unit (PICU) for extensive diagnostic workup and management where she received an advanced multidisciplinary care including cardiology, metabolic diseases, critical care, infectious diseases and nephrology specialists.
+She remained intubated and mechanically ventilated throughout her hospital stay. Serial echocardiographic assessments revealed worsening ventricular function (EF less than 17%), despite various cardiac medications (Epinephrine, Norepinephrine, Milrinone, Dobutamine, Digoxin, Carvedilol), and aggressive diuresis (Furosemide, Spironolactone, Acetazolamide, Hydrochlorothiazide, Bumetanide). Two doses of intravenous Levosimendan infusions were also administered; the third dose was stopped due to transient hypotension.
+Metabolic and genetic work up was done and was negative. Whole exome sequencing later revealed a homozygous mutation in the MYL3 (Myosin Light Chain 3) gene, associated with familial autosomal dominant MYL3-related cardiomyopathy.
+Her hospital stay was complicated by multiple infections including multilobar pneumonia and candiduria, for which she received broad spectrum antibiotics and antifungals. Progressively, the child’s condition continued to deteriorate as she developed end-organ dysfunction, including renal and hepatic failure with severe lactic acidosis and disseminated intravascular coagulation. After a total of 70 days of hospitalization, the patient developed rare ectopic beats then went into cardiac arrest followed by a cessation of electrical and mechanical activity of the heart, despite cardiopulmonary resuscitative efforts.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_261_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_261_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2b5d1cfcd01736527b796087aea4ee6fd5543eff
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_261_en.txt
@@ -0,0 +1,2 @@
+A 64-year-old Japanese woman was brought to the emergency department of our hospital in a deep coma. Six years before this admission, the patient presented at another hospital with transient right hemispatial neglect and, based on magnetic resonance imaging (MRI) and magnetic resonance angiography (MRA), was diagnosed with left ICA obliteration immediately distal to the carotid bifurcation and unilateral moyamoya disease of the ipsilateral intracranial arteries, without any aneurysm formation or cerebral infarction . Quantitative 15O gas-inhalation positron emission tomography at the time showed no apparent misery perfusion, so the patient was initially treated medically with cilostazol for probable transient ischemic attack (TIA). However, cilostazol was subsequently stopped due to increasing microbleeds in the brain on follow-up MRI. No aneurysm was detected up until the last follow-up MRA evaluation 3 months before the event described in this report.
+Computed tomography (CT) of the head showed severe intraventricular hemorrhage with subarachnoid hemorrhage . CT angiography (CTA) showed obliteration of the left ICA with a hypoplastic carotid canal and foramen lacerum, suggesting congenital ICA agenesis rather than acquired ICA obliteration . The left posterior communicating artery (PComA) was not a single vessel, instead forming a vascular plexus . The peduncular, ambient, and quadrigeminal segments of the left PCA and the horizontal, infracallosal, and precallosal segments of the left ACA looked like a network of small tortuous vessels that replaced the main trunks of the left PCA and ACA, respectively. In the distal portion of the left PCA and ACA, these aberrant networks seemed to coalesce and formed hypoplastic but definite cortical branches of the PCA and supracallosal segment of the ACA. These anomalous arteries were located in the subarachnoid space, unlike moyamoya disease or arteriovenous malformation. From these findings, we diagnosed the anomaly as rete mirabile in the PComA, PCA, and ACA. Intriguingly, the appearance of the MCA was not rete-like in this patient . There was a saccular aneurysm (4.3 mm in size) arising from the inferior aspect of a perforating branch of the pericallosal artery and protruding into the left lateral ventricle that was presumed to be the source of the hemorrhage . Because of her critical condition (dilatation of pupils and hypothermia), the patient immediately underwent urgent bilateral external ventricular drainage to reduce the intracranial pressure, but soon deteriorated to brain death. Thus, we did not proceed with catheter angiography and further treatment of the ruptured aneurysm. The family refused an autopsy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2623_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2623_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2db9edd71afd0efc5a5d4bcc2e2cf9d70538b7af
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2623_en.txt
@@ -0,0 +1,15 @@
+A 35-year old Caucasian female with a history of multiple sclerosis and atopic diathesis (including bronchial asthma) presented for chronic respiratory discomfort to obtain a second opinion on her treatment. Furthermore, she had noted recurrent coughing that deteriorated in autumn. Prednisolone prescribed due to her allergic asthma had only insufficiently relieved symptoms. Previously, she had completed a specific immunotherapy addressing her allergy towards certain phytocomponents, and quit smoking after accumulation of 2 pack years in total. With seasonal fluctuation of symptoms, spirometry revealed stable static and dynamic respiratory flow values with slight obstruction. Asthma control testing (ACT), a patient-based questionnaire , revealed eight points at initial presentation (target range ≥ 19 points), indicating poorly controlled asthma. There were no signs of acute infection and an influenza immunization had recently been implemented.
+Next to oral contraception and seasonal antihistamines, her medication included inhalative steroids in combination with a long-acting betamimetic agent and a short-acting betamimetic nebulizer on demand. Therapy with montelukast had to be discontinued due to gastrointestinal adverse effects. Her relapsing–remitting multiple sclerosis was kept in a steady state by dimethyl fumarate (Tecfidera) and glatiramer acetate. She experienced two episodes in the past 9 years and was left with residual mild hypoesthesia, gait disturbances, and chronic fatigue.
+Physical examination detected no pathologies in the patient, a medium-build [body mass index (BMI) 21 kg/m2] woman in good condition. Auscultation revealed vesicular respiratory sounds without rales. No cardiac murmur was audible. Her fingers did not show clubbing. Cardiac natriuretic peptides presented within normal limits. Besides hypereosinophilia (0.27 GPL/L), laboratory testing revealed a hypoxemia with an adequate response to oxygen (initial: 67 mmHg, with 3 L O2: 72 mmHg), that persisted in rest and exertion.
+Due to this blood gas analysis presenting relevant hypoxemia, further investigations were undertaken. In the meantime, daily self-assessment of peak flow values for continuous monitoring of dynamic respiratory function was recommended.
+Scintigraphy was performed to rule out a ventilation perfusion deficiency. For the subjacent computed tomographic (CT) scan, contrast media was injected into the left brachial veins. Secondarily to the exclusion of pulmonary embolism, venous contrast filling suspected an additional left superior cava vein connected to the left atrium.
+The diagnosis was confirmed by echocardiography: following the attestation of a normal biventricular function with regular sized atria and no evidence of dilatation of the coronary sinus , contrast media was applied via the left brachial veins. Recordings of the apical four chamber view demonstrated an instant and complete opacification solely of the left-sided cardiac cavities . The right atrium and ventricle were unaffected and septal structures were intact. Contrast media inflow originated from the lateral base of the left atrium . On transesophageal echocardiography (TEE), contrast enhancement commenced at the junction of the left atrial appendage and the left pulmonary veins as depicted in midesophageal pulmonary vein view . As the CT scan reconstruction visualizes , the drainage location site could be specified as being the left atrial appendage. Herein, the persistent left vena cava superior complied with type IIIb of Schummer’s classification of PLVCS, with an atypical draining into the left atrial appendage .
+Following the imaging modalities, cardiac catheterization was performed to assess the effect of the PLVCS on the patient’s hemodynamics. Pulmonary circulation showed normal proportions of pressure and resistance. The composition of intracardiac blood gas analyses revealed a Qp/Qs of 1.2, reflecting a hemodynamically nonrelevant right-to-left shunt, with an oxygen saturation of 69% in the PLVCS not altering the saturation of the left atrium (95%). To assess its functional impact, we complemented a spiroergometry. The patient completed the testing with a peak oxygen uptake of 23 mL/min/kg, rated as an unrestricted exercise capacity.
+Furthermore, the cerebral condition was—on account of her multiple sclerosis—frequently appraised by magnetic resonance imaging. T2-weighted sequences revealed multiple lesions of varying sizes in various cerebral compartments, mainly in white matter (frontal, mesencephalic, occipital) and cerebellar.
+The main diagnostic concerns in the present case of an atypical draining PLVCS into the left atrial appendage were to distinguish the hypoxemia and neurologic disorders from the known bronchial asthma and multiple sclerosis.
+The initial complaints about dyspnoea on exertion and coughing were accompanied by mild hypoxemia. After imaging revealed a PLVCS draining atypically into the left atrial appendage, further testing was implemented. The resulting right-to-left-shunt that led to an opacification of the left atrium during echocardiography could have been the etiology. Invasive testing revealed an oxymetrically nonrelevant shunt, which later allowed unrestricted exercise testing. In the meantime, the patient received bronchial asthma treatment according to guidelines. She especially stated a relief of her symptoms using inhalative tiotropium bromide in addition to betamimetics and physical conditioning. The frequency of her coughing attacks declined using steam inhalation with brine. Thereupon her asthma control testing increased from 8 to 19 points (the latter being within physiological limits), indicative of a correlation between symptoms and asthma rather than the incidental finding of PLVCS.
+Regarding her cerebral lesion, a differentiation between injuries from her known multiple sclerosis and paradoxical embolic insults from her right-to-left-shunt was essential. The patient had developed symptoms suspicious of multiple sclerosis for 9 years at the time of presentation: chronic fatigue, mild hypoesthesia, gait disturbances, and voiding dysfunction, but no focal deficiency. These symptoms resided from two episodes of her relapsing–remitting disease progress analogous to temporal dissemination. Magnetic resonance imaging (MRI) revealed a demyelination mainly of white matter and cerebellar structures, as represented in the reviewed McDonald criteria. Responsive to immunomodulating treatment with dimethyl fumarate and glatiramer acetate, clinical and imaging follow-ups over the past 5 years have not shown disease progression, with a constant disability score (EDSS) of 3.5. Though T2-hyperintense, the lesions showed no relevant signs of infarction (cortical location, diffusion deficiency, contrast enhancement). Typical symptoms, time course, imaging, and response to specific treatment assigned her neurologic disorders to multiple sclerosis rather than embolic strokes resulting from right-to-left-shunting caused by PLVCS.
+Proposed treatment options of a persistent left vena cava superior with drainage into the left atrium include percutaneous closure with an Amplatzer device and surgical intervention, with the latter usually being subject to complex operations of coexisting cardiovascular defects . These interventions are reserved for symptomatic patients.
+The presented case of an atypical drainage into the left atrial appendage resulted in a minor right-to-left-shunt. Its subordination correlated well with adequate oxygen utilization, quantified by spiroergometry. The left atrium showed no evidence of volume overload. Substantiated with a small shunt volume and no evidence of embolization, no specific treatment was required for the venous anomaly. This restraining approach is subject to constant reevaluation in case of an aggravation.
+The respiratory symptoms were allocated to a known and lately aggravated bronchial asthma that was successfully treated with inhalatives according to current guidelines.
+Since no specific treatment was required, further therapy of the coexisting medical conditions will reside with the respective practitioners. Nonetheless the patient will remain in cardiologic control for periodic surveillance at regular intervals.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2625_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2625_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..11b03c8bda02ca386769c90088433774038484b0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2625_en.txt
@@ -0,0 +1,6 @@
+A previously healthy 16-year-old female presented with a four-day history of abdominal pain, vomiting, fever, headache, myalgias and cough. Her initial vital signs in the referring emergency department were temperature 39.4° Celsius, pulse 154, respiratory rate 16, blood pressure 115/61, and oxygen saturation 96 %. Physical examination was notable for pallor and right lower quadrant (RLQ) abdominal tenderness without guarding or rebound. Initial laboratory testing significant for white blood cell (WBC) count 5.8 10^3/uL (reference range 4-10.5) with 93 % neutrophils, hemoglobin 11.9 g/dL (12–15), platelets 102 10^3/uL (150–450), C-reactive protein 11 mg/dL (0–1.0), erythrocyte sedimentation rate 26 mm/hr (0–20), and procalcitonin 0.50 ng/mL (< 0.09). Urine hCG negative. Urinalysis showed trace leukocyte esterase (negative), negative nitrites, and 1–5 WBCs (0). Contrast-enhanced computed tomography (CT) of the abdomen/pelvis showed mesenteric edema, dilation of the appendix (8mm), and fat stranding throughout the lower abdomen and pelvis. She received two intravenous (IV) fluid boluses, anti-pyrectics and was transferred to our pediatric hospital.
+On arrival she was evaluated by the pediatric surgery team who felt her presentation was not consistent with acute appendicitis. Further history and exam revealed that she had mild bilateral conjunctival injection and neck tenderness in addition to RLQ pain and had a positive SARS-CoV-2 polymerase chain reaction (PCR) test one month prior (she was asymptomatic but underwent testing due to several family members testing positive).
+Additional labs were obtained with concern for MIS-C and were significant for a positive SARS-CoV-2 IgG antibody test and normal troponin and N-terminal Pro-Brain Natriuretic Peptide. Given fever, positive SARS-CoV-2 IgG, laboratory evidence of inflammation, and multisystem involvement she was hospitalized for further monitoring and treatment of MIS-C.
+Overnight, the patient was persistently febrile and tachycardic. She also reported increasing RLQ pain and exhibited new abdominal rebound tenderness. The attending pediatric radiologist’s review of the prior CT concluded that the imaging was consistent with acute appendicitis as there was dilation of the appendix, measuring 8 mm, mild appendiceal mucosal hyperenhancement and adjacent mesenteric fat stranding . The patient’s care was re-discussed with pediatric surgery and together the multidisciplinary team was unable to definitively rule out appendicitis as a concurrent pathology. While a diagnosis of MIS-C generally requires exclusion of other etiologies, it was felt that she could have appendicitis and MIS-C simultaneously. Empiric treatment for appendicitis was started with piperacillin-tazobactam. The surgical team reviewed the risks and benefits of non-operative management with continued antibiotics versus diagnostic laparoscopy and appendectomy. Surgical management was selected. Echocardiogram was obtained to assess for cardiac involvement and showed normal cardiac function and no dilation of the coronary arteries. She remained stable on the acute floor on hospital day two and therapy with intravenous immune globulin (IVIG) and aspirin were ordered for treatment of MIS-C. However, given the timing of when surgery could take her to the operating room, she underwent diagnostic laparoscopy and appendectomy first. She was found to have a grossly normal appendix with no inflammation to suggest appendicitis . As a surgeon’s intra-operative “eyeball” assessment of appendicitis is not perfect and the risk of appendectomy while undergoing laparoscopy is low the decision was made to complete appendectomy. Histologic findings revealed only mild chronic serosal inflammation and edematous mesothelium; it did not show the transmural acute inflammation diagnostic of appendicitis. Piperacillin-tazobactam was discontinued and the patient was returned to the acute care floor for post-surgical monitoring and MIS-C treatment with IVIG infusion (2 g/kg) and aspirin (81 mg).
+On hospital day three she completed IVIG therapy, and her blood pressure and fever curve improved. Repeat labs showed worsening lymphocytopenia, anemia, and thrombocytopenia and hypoalbuminemia. She then developed tachycardia and hypotension refractory to fluid resuscitation and given concern for refractory MIS-C, she was started on corticosteroid therapy (2 mg/kg twice daily). She was transferred to the intensive care unit and started on norepinephrine (0.02 mcg/kg/min) for hemodynamic support, which she required for 24 hours. The patient stabilized and was then transferred back to the acute care floor with improvement of her pancytopenia over the next two days. She was discharged home in stable condition on day seven of hospitalization to complete a course of low dose aspirin and a steroid taper.
+At her follow-up cardiology appointment four weeks after discharge, she was asymptomatic, but echocardiogram showed moderately dilated right and left coronary arteries with normal ventricular function. She remained on daily aspirin with close cardiology follow up to monitor progression of her coronary involvement.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_262_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_262_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5c666481aac27dca73a90c549a9b297d152483cb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_262_en.txt
@@ -0,0 +1,6 @@
+A 46 year old Zambian woman was referred from another hospital with a 4 week history of fevers, night sweats, vomiting, diarrhoea, and renal impairment. She had been diagnosed HIV positive in 2005, and started on HAART one year later. She had previously been treated for Herpes simplex virus infection, Cytomegalovirus pneumonitis, and Pneumocystis jirovecii pneumonia (PCP). At referral her blood CD4 count was 480 × 106/L (range in HIV negative populations, 400-1500 × 106/L); and she had an undetectable plasma HIV load. On arrival at our centre, she was confused, and had obvious pitting oedema of both lower limbs, widespread lymphadenopathy, and hepato-splenomegaly. Investigations revealed anaemia, leucocytosis, thrombocytopaenia, and acute renal and liver dysfunction.
+A CT scan showed hepato-splenomegaly and gross lymphadenopathy involving the thorax, abdomen and pelvis . Inguinal lymph node excision biopsy confirmed the clinical suspicion of Multi-centric Castleman's disease (MCD) . Rituximab (375 mg/m2) together with hydrocortisone and rasburicase, was administered as specific treatment. She developed rapidly progressive metabolic acidosis, oliguria, and rising serum creatinine and was admitted to the ICU for haemofiltration. Antiretroviral therapy was continued on the ICU with ritonavir-boosted lopinavir and saquinavir. Abacavir and lamivudine, which the patient was already taking, were stopped because of their association with lactic acidosis and hepatic steatosis.
+Following admission to ICU she rapidly became hypotensive, hypoglycaemic, coagulopathic and more anaemic. A possible basis for this could have been the systemic manifestations of a "cytokine storm" associated with MCD; increased expression of IL-6 is typical of MCD. Vasopressor and inotropic support with noradrenaline and dobutamine was required to maintain an adequate mean arterial pressure (MAP). Because of rapidly escalating requirements for noradrenaline she received a continuous infusion of hydrocortisone (10 mg/h) as per local departmental protocol, to treat probable relative adrenal insufficiency. Empirical antibiotics and antifungal agents were given to treat sepsis as a potential cause for ensuing multi-organ dysfunction, and she required a continuous infusion of 20% dextrose for refractory hypoglycaemia. To treat her acute renal failure and profound metabolic acidosis (serum lactate of 18.5 mmol/L), haemofiltration was undertaken with large volume 5 litre cycles (~90 ml/kg/hour) of lactate-free replacement fluid. This strategy was adopted to target early shock reversal and removal of IL-6, increased expression of which is a hallmark feature of MCD.
+The chest radiograph progressed over four days to bilateral diffuse patchy consolidation , associated with greatly increased oxygen requirements (FiO2 0.8), and consistent with a diagnosis of acute respiratory distress syndrome (ARDS). The patient became drowsy and hypercapnic. Her trachea was therefore intubated, and mechanical ventilation was commenced.
+She developed epistaxis and bleeding from insertion sites of arterial, central venous, and haemofiltration catheters. She had a positive direct Coombs' test consistent with autoimmune haemolytic anaemia (AIHA), a recognised association of MCD. In addition she had elevated prothrombin (PT) and activated partial thromboplastin times (APTT), reduced platelets and reduced serum fibrinogen consistent with disseminated intravascular coagulation (DIC). She received methylprednisolone, folinic acid, and red cell concentrate to treat anaemia; plus cryoprecipitate, fresh frozen plasma, vitamin K, and platelets for DIC. In addition to this extensive physiological support, her Castleman's disease was treated with weekly infusions of the anti-CD20 monoclonal antibody, rituximab, for four weeks.
+From day 10 there was evidence of clinical improvement. She had a tracheostomy in the second week of her ICU stay, and she was slowly weaned from inotropic/vasopressor, ventilatory, and finally renal support. At day 21 of her ICU admission, she was discharged to the ward to complete her treatment with rituximab, and to continue rehabilitation from global muscle weakness, and reduce dependence on her tracheostomy. The patient was discharged home, in remission from her disease, after 149 days in hospital. When last seen in clinic she remained in remission and living independently 14 months from her treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2646_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2646_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..36e8f2cc291b69ea95bd973fb761224811b385a6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2646_en.txt
@@ -0,0 +1,10 @@
+A 53-month-old Sudanese female presented with progressive bilateral breast enlargement and accelerated growth since the age of 9 months. Her family had sought medical advice several times in different primary health care facilities and were reassured. She had no vaginal bleeding and no pubic or axillary hair.
+Examination showed a well-looking girl, vitally stable with normal blood pressure. Her weight was 17 kg (50th centile) and height 108 cm (90th centile) using the Centers for Disease Control and Prevention growth chart. Mid-parental height was 175 cm and predicted adult height was 167 cm using the JM Tanner formula. No previous documented follow-up growth data were available. Her Tanner staging was A1, P1, and B3. She had reddish mucoid vagina. She had no clitoromegaly, acne, hirsutism, or palpable abdominal mass .
+Left wrist X-ray revealed a bone age of 8 years.
+The hormonal evaluation using fluorometric enzyme immunoassay showed basal luteinizing hormone of 3.1 mIU/L, which increased to 8.8 mIU/L 45 minutes post-gonadotrophin-releasing hormone stimulation. Elevated levels of estradiol E2 29,000 pg/ml (5–15 pg/ml), and dehydroepiandrosterone sulfate 90 ng/mL (2.3 ng/mL), with normal early morning cortisol level 16 ng/mL (7–28 ng/mL). Due to financial difficulties, we did not measured the follicular-stimulating hormone level.
+Abdominal ultrasound revealed a right-sided hypoechoic suprarenal mass, an ovarian volume of 1.8 cm3, uterine volume of 3 cm3, and endometrial thickness of 1.2 cm. The abdominal CT scan showed a 25 × 22 mm well-defined rounded focal lesion with a smooth outline, at the level of the right adrenal gland with homogeneous attenuation, HU-7 on a noncontrast scan, and no evidence of local tissue invasion . The left adrenal gland and ovaries were normal.
+Brain magnetic resonance imaging was done to exclude a central cause of precocious puberty and was normal. Complete hemogram, liver, and renal functions were normal.
+A diagnosis of an estrogen-secreting right adrenocortical tumor was made, and we referred the patient to surgery.
+During laparotomy a 3 cm diameter tumor in the right adrenal gland was completely excised. The histopathological examination showed well-circumscribed tumor forming nests with trabeculae and sheets of polygonal cells with eosinophilic cytoplasm. The tumor was not infiltrating the capsule, with no mitosis, atypia, or necrosis (Wieneke index score = 0). Findings suggestive of benign adrenal cortical adenoma.
+The postoperative evaluation revealed normal cortisol and dehydroepiandrosterone sulfate. Estradiol E2 40 pg/mL was consistent with secondary central precocious puberty, so the patient was started on monthly gonadotrophin-releasing hormone agonist, with a regular follow-up plan for the possibility of recurrence of adrenal adenoma.
+Six months after the operation, the patient was well and compliant to monthly gonadotrophin agonist injections. She showed partial regression of her secondary sexual characters and a growth velocity of 5 cm/year. The abdominal CT scan was normal with no evidence of recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_264_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_264_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fc1d97ec6873201552c3c70ae9608d98d4aa54cc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_264_en.txt
@@ -0,0 +1,5 @@
+A 69-year-old man referred to Pasteur Hospital in Bam, southeastern Iran, with clinical symptoms including itching and redness of his eye. On further examination by slit lamp, a white roundworm was seen in the nasal subconjunctival space in the right eye . Visual acuity was 7/10, IOP was normal and rest examination was unremarkable. The complete blood count (CBC) test was normal without any sign of eosinophilia. Under local anesthesia trough a conjunctival incision a white round worm was removed. After surgery, the patient was treated with antibiotics and corticosteroid and followed up for 1 month.
+Morphometric analysis revealed an immature nematode 180 mm in length. After the parasite was removed, the nematode was kept in 70% ethanol for further examination. For a definite diagnosis, it was sent to the Parasitology Department of Kerman University of Medical Sciences where the Dirofilaria parasite was identified based on morphological keys .
+Moreover, a piece of the worm’s body was separated, and DNA was extracted using a DNA minikit (Qiagen, Hilden, Germany). A 680-bp cox1 gene fragment was amplified using primers (Forward) 5′- CCTTTGAGTGTA-GAGGGTCAGC-3′ and (Reverse) 5′-ATTCCGCTCAAACCTCCAAT-3′ as previously described .
+Amplification was conducted under the following cycling conditions: 94 °C for 3 min, 40 cycles of 30 s at 94 °C, 35 s at 58 °C, and 1 min at 72 °C, followed by a final extension of 7 min at 72 °C. The quality of the PCR products was assessed by gel electrophoresis.
+Nucleotide sequencing was performed by the Sanger method (Macrogen Inc., South Korea). Sequencing results were aligned using BioEdit (ver.7.0.9.0) and MEGA 6.0 software and sequence identity was evaluated using the . In addition, the cox1 gene fragment was submitted to the GenBank under the accession number MH920260 as D. immitis. Additionally, the phylogenetic analysis produced a sister clade as compared to D. immitis sequences recorded in the GenBank .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2663_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2663_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0c92be56ab8a641b5794a9c6154f10b88a1b7d19
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2663_en.txt
@@ -0,0 +1,3 @@
+Our patient is a 30-year-old multiparous woman with two previous cesarean sections due to twin pregnancy, and one time Dilatation and curretage (D&C) for spontaneous abortion. For writing this study, oral consent was obtained from our case. She admitted with severe abdominal pain in hypogastric area. Pain was continues and radiated to left shoulder. Her last menstrual period (LMP) was 2 months ago and her menstruation cycle was regular.
+She had the history of using IUCD (copper) since her last delivery. Because of her menstruation retardation, she checked βhCG, that was positive, she didn’t take sonography before admitting in hospital. The βhCG titer during hospitalization shows only a slow rise in the tittering in plateau form. The patient has no previous history of any medical condition, and she was hemodynamically stable. Transvaginal sonography was done for the first initial impression of an ectopic pregnancy; TVS showed a uterus of normal size with no gestational sac, but an ovarian cyst 11×11mm in the right side with another echogenic mass medially to the right ovary of 9×11 mm size and right tubal ectopic pregnancy was suggested. The first treatment plan of this patient was close observation and multiple dose of methotrexate since the patient is hemodynamically stable.
+During medical treatment βhCG titer didn’t decrease and the patient suffered from a severe abdominal pain and her vital signs were unstable; BP= 80/P, Pulse rate=120, and patient was pail. Laparotomy was suggested. During laparatomy, there was about 500-600 CC blood in the abdomen cavity, and ruptured ovarian ectopic pregnancy was diagnosed. Suction of blood and wedge Resection of the ovary was performed. Histopathological examination confirmed an ovarian ectopic pregnancy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2674_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2674_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..228d3878ca5b8e65b5da935f3418e88d9631dee5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2674_en.txt
@@ -0,0 +1,4 @@
+A 49-year-old gentleman came to our institute with dysphagia for the last two years. The dysphagia was gradually progressive in nature and was more for solid than liquid. There was no associated pain during deglutition. The patient had been treated by several physicians for one and a half years for the same complaint but without any relief. The patient lost 5-6kg of weight during this period. He was earlier diagnosed with cervical spondylosis and treated with a cervical collar, analgesics, and neck exercises. However, nothing could relieve his main complaint of dysphagia. When the patient arrived in our clinic, his body posture was stooping forward and he was having difficulty in straightening his torso over his pelvis .
+The patient was a known hypertensive and was prescribed tablet telmisartan 40mg since 5 years. The patient was also on metformin 500 mg twice daily for type II diabetes mellitus.During a detailed clinical examination, there was no obvious pathology found in the oraphaynx and laryngopharynx. No neck nodes were clinically palpable. All other systemic examinations were not significant. All the routine blood investigations were normal. Barium swallow oesophagus was suggested and it showed a narrowing of the lumen in the hypopharynx and cervical part of the oesophagus. Ossification was seen in the anterolateral aspect of the C3-T1 vertebrae .
+The rest of the oesophagus was normal. This was confirmed by computed tomography of the vertebral column showing syndesmophytes and anterior longitudinal ligament ossification at the cervico-dorsal spine. This was impinging upon the posterior pharyngeal wall and oesophagus confirming the diagnosis of Diffuse Idiopathic Skeletal Hyperostosis (DISH) .
+Upper Gastro-intestinal tract endoscopy, another important investigation for dysphagia, was not performed in this case as there was no intraluminal mass lesion detected in the CT scan. There was another segment showing ossification of the lumbar spine from L1-L5 vertebrae . We advised the patient to have a surgical removal of the osteophytes; but he refused to do any sort of surgical intervention. So we advised him to avoid solid food and ingest soft semisolid food in a small bolus instead. After a 3-month of follow up, the patient wasdoing well and was satisfied with his diet therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2678_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2678_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d7a97706578f18ef7f79b262273097ce47bae50c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2678_en.txt
@@ -0,0 +1 @@
+Our patient was a 65-year-old man who received PD for 12 years due to a 20-year history of type 2 diabetes mellitus (DM). He was under long-term follow-up at Taichung Veterans General Hospital in Taichung, Taiwan. He had also received type A aortic dissection repair 15 years previously. He presented with poor appetite and a weight loss of 3 kg in 6 months, starting in January 2015. His serum albumin had dropped to 3.2 g/dL. His PD regimen was 1.5%*2L*2 + 2.5%*2L*2 + Icodextrin*2L*1 and the amount of daily ultrafiltration was 1000 ml. Weekly creatinine clearance was 65 L, and Kt/V was 1.6. The result of the peritoneal equilibrium test was at a high-average level. Blood urea nitrogen was 91 U/L and serum creatinine was 13.1 mg/dL. Even while taking three tablets of calcium acetate (667 mg) with each meal, his calcium level was 8.8 mg/dL, phosphate was 7.7 mg/dL, and intact parathyroid hormone was up to 675 pg/mL. He experienced peritonitis three times during the PD period (all cultures grew Staphylococcus aureus). Due to no apparent cause for his poor nutrition and poor appetite, we performed abdominal computed tomography (CT) to rule out EPS. Unsurprisingly, CT disclosed diffuse thin calcifications of the serosal surface of the small intestinal loops (arrow, ). We reviewed the patient’s kidney, ureter, and bladder (KUB) x-ray from three months before the CT, and noted EPS in the wall of small intestine (arrow, ). Therefore, EPS was diagnosed by the radiologists due to cachexia, very low serum albumin, low clearance of the peritoneum, and diffuse calcifications of the intestinal serosal surface. Moreover, there was abdominal dissection with diffuse calciphylaxis (arrowhead in , arrow in ), as well as skin ulcers over the lower extremities. For the diffuse calciphylaxis, we changed to sevelamer, two tablets per meal. For the EPS, the PD was changed to hemodialysis with low-calcium dialysate and exchange of 2 L of dialysate every two weeks. We also prescribed prednisolone 30 mg per day and colchicine 1 mg per day. However, questions were raised about the use of tamoxifen for EPS, as this seems to be contraindicated in a patient in a state of calciphylaxis. However, this dilemma has seldom been discussed in the current literature.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2682_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2682_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..27e324dc2aee130c5a79c32a717a689e848fa441
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2682_en.txt
@@ -0,0 +1,3 @@
+A 64-year-old Caucasian man had severe regurgitation of the tricuspid aortic valve due to an aneurysm of the ascending aorta, which involved the sinus of Valsalva. Composite valve-graft conduit replacement of the aortic root was performed 4 years ago. The patient suffered a transient ischemic attack with a thrombotic occlusion of a branch of the left middle cerebral artery 18 months postoperatively, most likely due to subtherapeutic oral anticoagulation (international normalized ratio [INR] 1.8). Transesophageal echocardiography (TEE) did not show vegetations on the mechanical aortic valve and the concentration of C-reactive protein was 1 mg/L (normal value <5). Aspirin was then added to the vitamin K antagonist phenprocoumon, and the patient successfully self-monitored his INR values with a target range of 2.0–3.0. He did not use skin disinfectants, and he had no acne.
+A wasp sting to his upper lip was managed conservatively one month prior to hospitalization, and subdued sounds of his mechanical aortic valve were noticed by the patient. No dental procedures were performed in the six months prior to the sting. He became febrile up to 38 °C, had night sweats and felt ill. Upon admission, the patient was in good general condition. His body temperature was 37.3 °C; his blood pressure was 137/94 mmHg; and his pulse rate was 79 bpm. There was a 1/6 systolic murmur and a metallic hue to the second heart sound. There were no peripheral emboli in the skin. The spleen was not enlarged. Laboratory results showed an elevated concentration of C-reactive protein (73 mg/L, Fig. ) and a normal leukocyte count (7.3×109/L [normal values 4.0–9.8]). The kidney function (creatinine 90 μmol/L [62–110]) and the liver function tests (aspartate transaminase [AST] 29 U/L [<38]) were normal. The INR value was 2.4, consistent with therapeutic anticoagulation with phenprocoumon. The lactic dehydrogenase was slightly elevated (655 U/L [<248]). An infective endocarditis was suspected clinically, and TEE was performed. Vegetations on the mechanical bileaflet aortic valve were seen , but there was no perivalvular abscess formation. Ten blood cultures (BactecTM 9050, Becton Dickinson, Franklin Lakes, NJ) were inoculated with 10 ml blood samples, five cultured under aerobic and five under anaerobic conditions. All blood cultures were obtained before starting the antibiotic therapy. Initially, no bacterial growth was observed. Broad range polymerase chain reaction (PCR) using 16S rDNA primers failed to identify bacteria in blood samples. One anaerobic blood-culture showed growth of a Gram-positive rod after 6 days, which was sent to the reference laboratory for further testing. The identification of P. acnes was performed according to standard procedures with conventional tests. The Gram-positive rods were catalase positive, showed a positive CAMP reaction, reduced nitrate and produced indole, but were lipase and lecithinase negative. Utilizing gas-liquid chromatography, the production of propionic acid from the glucose broth was detected. In four of 5 anaerobic blood cultures bacteria grew within 12 days, and biochemical analysis again identified P. acnes; all aerobic blood cultures remained sterile. Furthermore, the antibody response to this bacterium was quantified . According to the modified Duke criteria, a definitive diagnosis of infective endocarditis was confirmed . The initial antibiotic treatment included vancomycin and gentamicin i.v. plus rifampicin p.o. After the identification of the P. acnes, vancomycin was stopped and ceftriaxone was started. The intravenous therapy was stopped after four weeks, and levofloxacine plus rifampicin were prescribed for an additional four weeks of oral antibiotic therapy. No bacteria grew in the blood cultures following the completion of the antibiotic therapy. A follow-up TEE showed no vegetations on the mechanical aortic valve, and the patient continues to be well. He consistently uses skin disinfectants prior to obtaining a blood specimen for his INR measurements.
+Sera drawn at different time points were tested for antibodies against P. acnes by the Ouchterlony assay in the following 2½ years. For the antigen preparation of the P. acnes strain (ATCC 6916, Manassas, VA) colonies of 20 sheep blood agar plates were suspended in a tube with 10 ml of phosphate buffered saline (pH 7.2) and sonicated in a cup horn sonifier (60 W, Branson Sonic Power Co., Danbury, CT) 8 times for one minute. The tube was centrifuged at 2000xg for 10 min following overnight storage at 4 °C. Aliquots of the supernatant, each containing100 μL, were stored at −80 °C. The patient’s sera were tested against this antigen with the Ouchterlony test . The highest dilution of the serum that still precipitated the P. acnes antigen in the Ouchterlony test system (ID Plates Cleargel, IMMY, Norman, OK) represented the titer of this serum. The titers decreased during the following 2½ years indicating the clearing of the bacteria without relapse .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2689_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2689_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e81d4da5e0d5789061e4d95b39de216a52b5b6dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2689_en.txt
@@ -0,0 +1,2 @@
+A 53-year-old female with a long history of low back pain had undergone two prior operations: an L5-S1 discectomy (11 years ago) and an L4-L5 decompressive laminectomy (2 years ago). Over several weeks duration, she presented with an acute cauda equina syndrome characterized by paraparesis and acute urinary incontinence. On examination, she had mild tenderness over the lower back region. Laboratory tests revealed mild elevation of the white blood cell count (12,600/mm3), a high C-reactive protein level, and no urinary tract infection. Plain X-rays showed the various laminectomy defects (L4 to L5) due to her prior surgery. The MRI showed an oblong posterior epidural lesion compressing the thecal sac from the L4 to S1 levels; it was hypointense on T1 and hyperintense on T2-weighted images, which demonstrated ring enhancement with gadolinium injection . As an epidural abscess was suspected, she underwent a decompressive laminectomy. At surgery, there was an encapsulated posterior epidural abscess that required drainage . There was also a granulomatous lesion (unsuspected surgical cottonoid) noted at the antero-inferior part of the abscess wall (at the level of S1); it was completely removed along with marginal thick fibrotic capsular tissue . Culture of the capsule revealed Klebsiella oxytoca requiring 2 months of ciprofloxacin. The infection fully resolved, but the patient's paraparesis only partially recovered
+The histopathological examination confirmed a textiloma; there was chronic inflammation and fibrosis surrounding the retained cottonoid . After the first postoperative year, there was no evidence of infection recurrence
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2699_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2699_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5c2d0c6be3466a177402f0e974012169734c8145
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2699_en.txt
@@ -0,0 +1,8 @@
+A 75-year-old woman from Ghana with medical comorbidities of hypertension (not on an ACE inhibitor) and chronic cough was referred to our gastroenterology (GI) clinic for management of suspected gastroesophageal reflux disease (GERD) as the cause of chronic cough. As per the patient, she had been having a chronic cough for more than ten years. The cough was nonproductive, without any aggravating or relieving factors. She had reported postprandial heartburn. She recalls that cough started before her heartburn. She reported using albuterol and proton pump inhibitors (PPIs) without improvement in her cough. She did notice some improvement in her heartburn. She had never smoked, and her PPD was negative. There was no prior or current occupational exposure or pet exposure.
+She underwent extensive otolaryngology evaluation including a laryngoscopy that showed evidence of chronic laryngopharyngeal reflux. She had been evaluated by pulmonologist and underwent spirometry, imaging studies, bronchoscopy, and fractional exhaled nitric oxide (FENO) testing and all the test results were normal.
+She had been prescribed various therapies including oral, nasal, and inhaled corticosteroids, montelukast, and proton pump inhibitors without any improvement in cough.
+Because of her typical GERD symptoms, she had a 48-hour Bravo pH testing done in 2011. The study revealed 4.9% of the time with pH below 4 and a total of 106 reflux episodes consistent with GERD. She was evaluated for the surgical intervention, and as a preoperative work-up, high-resolution esophageal manometry was performed. The manometric finding consistent with GERD revealed a hypotensive lower esophageal sphincter (LES). Subsequently, the patient underwent laparoscopic Nissen's fundoplication in 2012.
+After fundoplication, she was symptom-free. However, in few months her cough recurred but absence of heartburn and overt acid reflux symptoms was intriguing. She again sought evaluation for cough. She underwent EGD and Bravo pH testing in 2013. There was no evidence of esophagitis and the endoscopic evidence of the fundoplication was appreciated. The ambulatory pH test revealed 0.1% of total acid exposure time and no symptom correlation. She had moved to Ghana for a brief period and did not seek any medical attention. She continued her PPI with no significant improvement.
+Gastroenterology consultation was sought again as the cough persisted. The physical examination including vital signs was unremarkable. She underwent a repeat Bravo pH study in February 2018 that revealed zero acid exposure and the study was not consistent with GERD ( and ).
+Subsequently, a high-resolution esophageal manometry was done in April 2018 with the findings indicating ineffective esophageal motility .
+A second opinion was sought from the gastrointestinal motility expert for the medical management of ineffective esophageal motility disorder. Given the absence of dysphagia, she was not considered a good candidate for medical management. To rule out nonacid reflux as a possible etiology of recurrent cough, patient was offered 24-hour Multichannel intraluminal impedance (MII) assisted pH monitoring. However, given the chronic cough and nasal discomfort, patient declined further intervention. Repeat laryngoscopy revealed laryngeal edema. To better assist with esophageal clearance, she was recommended to take frequent sips of water. She was suggested to carry a water bottle and take 1 to 2 sips of water every 15 minutes. Subsequently, patient presented to our clinic for a follow-up visit and was excited to report that her cough after years of work-up and medication use had finally subsided. She reported compliance with frequent sips of water. Patient had multiple interval follow-up for next 6 months where she reported continued absence of cough with multiple sips of water during the day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2707_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2707_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b5f171e5f194132b5ea40f0ef84b594928f76873
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2707_en.txt
@@ -0,0 +1,4 @@
+A 57-year-old man previously known for type 2 diabetes (T2D) for 3 years, asthma and obstructive sleep apnea was admitted for an aggravation of his dyspnea. Bodyweight was 99 kg, height was 172 cm and body mass index was 33.5 kg/m2.
+His T2D was treated only with metformin 500 mg twice daily and his latest Hb1Ac was 6.1%. The patient was not on other regular treatment. In the past 3 weeks, he presented a dry cough that was initially managed with amoxicillin/clavulanic acid and clarithromycin for 5 days. At admission, he presented a normal leucocyte count at 4.3 G/l with lymphopenia at 0.39 G/l count and an elevated CRP at 58 mg/l [, ]. Chest CT SCAN showed a bilateral multilobar ground-glass opacification. A nasopharyngeal swab test of SARS-CoV-2 by RT-qPCR was performed the same day in another medical facility and the result was pending.
+Twenty-four hours after his admission he presented a worsening of dyspnea, with tachypnea and severe hypoxemia requiring a transfer to the intensive care unit rapidly followed by oro-tracheal intubation for mechanical ventilation support. A vasopressor infusion (norepinephrine) was started. A bronchoalveolar lavage was performed and test of SARS-CoV-2 by RT-qPCR assay was positive. At day 3, he presented a rapidly progressive insulin requirement at a rate of up to 50 units/hour iv of insulin aspart . Despite the high insulin doses, he maintained an elevated plasma glucose level at 270 mg/dL on average.
+His extremely high-dose insulin requirement “resolved” at day 9, and the insulin infusion rate was rapidly reduced, avoiding hypoglycemia . He was extubated at day 13 and discharged to an intermediate care unit as a step down approach to pursue a close monitoring and regular respiratory care including continuous positive airway pressure (CPAP), and 2 days later he was transferred to regular hospital room due a positive clinical evolution. His insulin treatment was switched to subcutaneous neutral protamine Hagedorn (NPH) insulin at a total dose of 60 UI per day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2710_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2710_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2198190a1887f6a8f080d7c90c9a36573365c6aa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2710_en.txt
@@ -0,0 +1,5 @@
+A 59-year-old man, who was a hepatitis B virus (HBV) carrier, was diagnosed with HCC and admitted to our hospital in June 2022. He reported abdominal distension. The physical examination was normal. No family or genetic history was found. He had not received any therapy prior to admission. Magnetic resonance images revealed a huge tumor (10*7 cm) in the right lobe of the liver with multiple intrahepatic metastases, and with tumor thrombosis growing into the right portal vein . Biochemical examinations revealed alpha-fetoprotein (AFP): >60,500 ng/mL, PIVKA-II: 18725.87 mAu/mL, and liver blood tests showed normal liver function with Child–Pugh score of 5 (grade A). With the consent of the patient, a biopsy of tumor tissue was performed. Pathologic analysis of tumor tissue confirmed the diagnosis of HCC, as indicated by Glypican3(+), CK19(−), and CK7(−), and showed poor differentiation (Edmondson grade III), and proliferative phenotype (Ki-67 Li: 50%–60%) . A 1,021-gene panel next-generation sequencing (GenePlus OncoD, Geneplus, Beijing) was used to analyze the gene feature of tumor tissue. The results showed that 20 genes mutated or had copy number variation in tumor tissues (, ). Among these mutated genes, there were some clinically significant pathogenic gene variations, such as CTNNB1 and ARID1A mutation, and MYC amplification. FANCC, a DNA damage repair (DDR)-associated gene, was also found to be mutated. No events were observed in STK11, KEAP1, MDM2/4, DNMT3A, JAK1, JAK2, JAK3, CCND1/FGF3/4/19, or PTEN, which are associated with acquired resistance or hyper-progression (HPD) to immune checkpoint inhibitors (ICIs). Tumor mutational burden (TMB) was calculated as 19.2 Muts/Mb and was classified as high TMB . We then estimated the loss of heterozygosity (LOH) of human leukocyte antigen (HLA) class I at the somatic level and found that this patient harbored subclonal LOH of HLA-A and HLA-C supertype while maintaining HLA-B supertype heterozygosity . Moreover, CD8 staining showed scattered infiltration of CD8+ T cells in the HCC tissue , and PD-L1 staining revealed a tumor proportion score (TPS) of 5% and a combined proportion score (CPS) of 8.
+After the multidisciplinary team (MDT) discussion , this patient was confirmed as both technically and oncologically unresectable HCC due to its low FLV (as shown in , the initial FLV was 351.03 cm3 and the standard liver volume was estimated as 1,049.86 cm3. The FLV estimated standard liver volume ratio (FLV/ESLV) was 33.4%), as well as its staging of BCLC stage C, CNLC stage IIIB and PVTT classified Vp3, or Cheng’s type II. However, pathological and genetic analyses indicated its potential sensitivity to ICIs, and the patient was in a generally good condition with an ECOG score of 0, and his HCC lesions located in hemi-liver without cirrhosis; thus, systemic therapy combined with local therapy was recommended. In detail, the patient received HAIC with modified FOLFOX regimen (day 1: oxaliplatin 85 mg/m2, leucovorin 400 mg/m2, and 5-fluorouracil 400 mg/m2 via intra-arterial infusion; days 2–3: 5-fluorouracil 2,400 mg/m2 via continuous intra-arterial infusion, repeated every 3 weeks) , lenvatinib (8 mg once daily), and anti-PD-1 monoclonal antibody (sintilimab, 200 mg intravenously every 3 weeks). In addition, he received tenofovir disoproxil fumarate 300 mg orally once a day to inhibit the replication of HBV. At the first follow-up in July 2022, blood tests revealed significant decrease in serum levels of AFP (9164 ng/mL), PIVKA-II (967.41 mAu/mL), and HBV-DNA < 1×102 IU/mL . The ultrasound showed that the diameter of the main tumor is 9.6*4.9 cm. In Aug 2022, before the third cycle of combined treatment, radiologic measurements of lesions revealed a partial response (PR) according to the modified Response Evaluation Criteria in Solid Tumors (mRECIST) criteria . The time to response is around 6 weeks. In September 2022, the patient had undergone three cycles of combined therapy, and radiologic measurements of lesions revealed PR (mRECIST criteria), with the tumor and PVTT shrinking significantly . Consistently, serum biomarkers of HCC including AFP (11 ng/mL) and PIVKA-II (40.96 mAu/mL) decreased significantly. In addition, serum HBV-DNA remained at low levels and liver function remained at Child–Pugh grade A . Considering that all HCC lesions of this patient located in hemi-liver and shrunk after combined therapy, we evaluated the resectability by measuring FLV and indocyanine green retention test after 15 min (ICG-R15). Disappointingly, although ICG-R15 (5.2%) met the safety criteria for hepatectomy, the FLV was insufficient even after tumor shrinkage (as shown in , the FLV was 404 cm3 and the standard liver volume was estimated as 1,049.86 cm3. FLV/ESLV was 38.4%).
+To increase the FLV of patient before the salvage hepatectomy, we implemented drug-eluting beads TACE (DEB-TACE, 40 mg pirarubicin loaded) and PVE after discussion in the MDT meeting. Lenvatinib, sintilimab, and tenofovir disoproxil fumarate were given as before. The regeneration curve after simultaneous TACE and PVE in this patient showed a non-linear pattern characterized by three phases: (i) initial rapid growth within 4 weeks post simultaneous TACE and PVE, (ii) a plateau, 5–9 weeks after simultaneous TACE and PVE, (iii) steady regrowth thereafter . Simultaneous TACE and PVE induced absolute FLV increment by 62.7% or FLV/ESLV increment by 24.2% in the initial 4 weeks of rapid growth phase. The rate of hypertrophy is 9.05 cm3 per day, with a 2.23% increment in FLV per day or an 0.86% increment in FLV/ESLV per day. In the steady regrowth phase, it induced absolute FLV increment by 32.2%, or FLV/ESLV increment by 20.6% within 4 weeks. The rate of hypertrophy is 7.72 cm3 per day, with a 1.15% increment in FLV per day or a 0.74% increment in FLV/ESLV per day . At the follow-up of 9 weeks (November 2022) after combined DEB-TACE and PVE, the tumor continued to shrink and the future liver remnant volume increased to 670.65 cm3, which occupied 63.8% of the standard liver volume, with the atrophy of the right hemi-liver . In addition, serum levels of AFP (2.69 ng/mL) and PIVKA-II (31.5 mAu/mL) reduced to the normal range. Liver function tests showed Child–Pugh A grade and normal ICG-R15.
+We considered that this patient met the criteria of salvage hepatectomy according to the Chinese expert consensus on conversion therapy for HCC . He underwent right hemi-hepatectomy after discontinuation of lenvatinib for 3 weeks in December 2022 . The operation time is 6 h with intermittent Pringle maneuver of 2 cycles. Intraoperative blood loss was 500 mL, and he received intraoperative transfusion of 400 mL red blood cell and 300 mL plasma. The pathological examination showed necrosis of a massive HCC (major pathological response, MPR) with no tumor cells observed on the resection margins . The immunohistochemical analysis of resected tissue showed CD8 (scattered lymphocyte+) and Ki-67 (Li: 10%) . The patient only had postoperative ascites (Clavien–Dindo classification grade II) and recovered after diuretic treatment. He achieved a textbook outcome after hepatectomy and was discharged 14 days after surgery .
+In the patient’s postoperative maintenance therapy, he was given lenvatinib 8 mg orally once a day, sintilimab 200 mg intravenously once every 3 weeks, and tenofovir disoproxil fumarate 300 mg orally once a day. There was no clinical evidence of recurrence at 9 months after the resection, and the AFP levels remained within the normal limit . He was still in the follow-up after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2715_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2715_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..87a67fb941e4a11dfb0a0a3a6c2bc2e2aade0a2c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2715_en.txt
@@ -0,0 +1,7 @@
+A 23-year-old woman was referred to our hospital because of recurrent abdominal pain for 7 years, amenorrhea and dyspareunia. The patient’s mental state and movement ability was normal. She had a history of fracture of both legs and skin injury of pubic caruncle caused by trauma about 20 years ago.
+Gynecological examination showed the patient had a single orifice on the urogenital region located where the urethra would be expected. There is a normally located anal perineal orifice. When forced urination, urine flowed out of the single orifice on the urogenital region. The urethral catheter was inserted about 70 mm through the single orifice, and no urine flowed out.
+Pelvic CT scan showed a large calculus and a urethral catheter in the vagina . Pelvic MRI scan demonstrated the urethra and the vagina merged into a common channel about 3.45 cm long , and a large calculus about 7.8 cm × 6.8 cm × 7.7 cm in size lodging in the upper vagina, the uterus was moved upward ; a urethral catheter entered the vagina through the opening on the urogenital region; both ovaries and bladder were normal and no other congenital malformation was noted . Transabdominal sonography imaging revealed a vaginal stone, and normal two kidneys, the bladder, uterus, cervix, and adnexa.
+Under general anesthesia, entering the urogenital tract through the median perineum approach and a 2-cm incision was performed . A hard grayish-yellow abnormal mass was observed in the vaginal cavity , and there was no adhesion to the surrounding mucosa. The tissue around the calculus was carefully separated and the calculus was completely removed.
+During the exploration after lithotomy, the common channel formed by vagina and urethra was detected, and the orifice of urethra was about 3 cm from the anterior vault of the vagina. The urethral catheter was inserted about 20 mm through the orifice of urethra, the urine flow was observed. Therefore, the estimated length of the urethra was about 2 cm. Hysteroscopic insertion of the vagina revealed thin endometrium and normal cervix, no other abnormality was found. The patient was diagnosed with a vaginal stone, urogenital sinus anomaly and thin endometrium.
+Vaginal reconstruction (vaginoplasty) and urethra reconstruction (urethroplasty) were performed. The mucosa near the urethral orifice was taken and wrapped by 20 fr Foley’s catheter, forming a urethra about 4 cm and neourethral meatus. The vaginal mucosa was pulled down and intermittently sutured with the perineal skin to form a vagina about 8 cm that could hold two fingers.
+After the operation, the patient received the treatment of estrogen and progesterone, and menarche appeared 20 days later. One month after the operation, the patient recovered well, and could urinate by himself. After 8 months of follow-up, the patient had normal menstruation and urination. The patient is married and ready to conceive.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2719_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2719_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8b639694991ef5f898c1f09eee2c6379517eb375
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2719_en.txt
@@ -0,0 +1,2 @@
+A 81 year old female had sustained a direct contact injury of the left knee due to a fall on ice. Radiologically a displaced oblique patellar fracture was proven in anteroposterior and lateral radiographs of the knee . No other injuries and/or fractures could be noted. At this time the patient was surgically treated with open reduction and tension band wiring of the patellar fracture . Immediately after surgery full protected weight bearing was allowed for 6 weeks with an extension splint (SAMA, Salzmann Medico, St. Gallen, Switzerland). Anti-thrombotic prophylaxis was performed with low molecular weight heparin. Early functional physical therapy was initiated, for six weeks with limited passive flexion to 80°. Follow-up six weeks after surgery was done with clinical assessment and anteroposterior and lateral full weight bearing radiographs. At this time the activity related level of pain was rated as none. The patient was completely satisfied and passive range of motion for flexion/extension was 110°-0°-0°. Full weight bearing with unlimited range of motion was allowed after six weeks. Three and a half months after primary injury the patient felt a giving-way of the left knee when descending a stair during physiotherapeutic exercise. She heard a cracking sound and noted a stabbing pain in her lower leg. In anteroposterior and lateral radiographs an avulsion fracture of the tibial tuberosity (Ogden type 3a1) was observed . Retrospectively a multi-lobulated small cystic lesion at the tibial tuberosity was already present at the initial presentation. After a lateral parapatellar skin incision and medial parapatellar arthrotomy the tibial tuberosity fragment was refixed with two non-resorbable sutures (FibreWire®, Arthrex Swiss AG, Volketswil, Switzerland) which were looped around two modified 3.5 mm AO cortical long neck screws . Intraoperatively multiple bone cysts were seen. Biopsies were not taken to prevent further fragmentation of the tibial tuberosity. Immediately after surgery protected full weight-bearing with crutches and an extension splint (SAMA, Salzmann Medico, St. Gallen, Switzerland) was allowed for two weeks. Anti-thrombotic prophylaxis with low molecular weight heparin was initiated. Passive flexion was initially limited to 35° for two weeks, then increased for the next two weeks to 70° and for the next two more weeks to full flexion under physiotherapeutic supervision.
+The patient had a radiographic follow-up six weeks postoperatively with anteroposterior and lateral full weight bearing radiographs. Clinical assessment was done at 6, 12 weeks and 6 months after surgery. The patient was completely satisfied and pain free at the last follow-up. Range of motion was flexion/extension 125°-0°-0°. Radiographically the avulsion fracture had healed and there was no displacement of the tibial tuberosity .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_271_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_271_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1fc865e90a75a8fb12da3bf040da6ed38cc332ba
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_271_en.txt
@@ -0,0 +1,3 @@
+A 48-year-old Chinese woman with a history of a right parasagittal meningioma with surgery and gamma knife excision done, was first put on valproate but then stepped up to topiramate 26 months later for uncontrolled seizures. The initial dose was topiramate 25 mg twice a day, which was eventually stepped up to 100 mg twice a day for adequate seizure control. She was referred to our ophthalmology clinic for dry eyes before the use of topiramate, with an examination showing a baseline visual acuity of 1.2 in both eyes with unremarkable anterior segment and fundoscopy examination. There was no family history of retinal diseases.
+She complained of blurring of vision in both eyes after using topiramate for 9 months. She was not on other medications when her visual symptoms developed. On examination, her visual acuity was 0.7 in both eyes. Her pupils were equal with no relative afferent papillary defect. The intraocular pressure, Ishihara test, and anterior segment examination were within normal limits. A fundus examination revealed there was bilateral diffuse pigmentary retinopathy . Automated perimetry showed bilateral peripheral constrictions while microperimetry showed normal macula sensitivity . Autofluorescence fundus pictures showed loss of autofluorescence at the periphery, which is compatible with areas of pigmentary retinopathy . A fundus fluorescein angiogram also showed blocked fluorescence in the areas of pigmentation . Optical coherence tomography was unremarkable. A full field electroretinogram (ERG) according to International Society for Clinical Electrophysiology of Vision (ISCEV) standard was performed at 16 months after onset of symptoms (25 months since topiramate was first given). Both photopic and scotopic responses were found to be within normal limits. Administration of topiramate was immediately ceased due to suspected correlation with her eye signs and symptoms. She was switched to levetiracetam monotherapy. There was no more seizure recurrence after this treatment change.
+All investigations were repeated 1 year after discontinuation of topiramate. Bilateral diffuse pigmentary retinopathy was still present, with visual field test showing similar peripheral constriction, although her visual acuity improved back to 1.0 in both eyes and she reported subjective improvement in vision.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2744_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2744_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..869475c049efd68f0fef0890b5cf22ec75000a99
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2744_en.txt
@@ -0,0 +1 @@
+A 70-year-old man was admitted to our hospital for obstructive jaundice. He had undergone distal gastrectomy with Roux-en-Y reconstruction for gastric cancer concomitant with cholecystectomy for cholecystolithiasis approximately 10 years prior at a different hospital. The pathological staging of his gastric cancer was SS, N0, M0, stage IB. Gastric cancer recurrence was not detected during postoperative surveillance by computed tomography (CT) imaging or blood examination . In November 2016, further examination for repeated episodes of epigastralgia revealed the presence of obstructive jaundice. The patient’s serum total and direct bilirubin levels were 4.2 and 2.4 mg/dL, respectively. Moreover, hepatobiliary dysfunction was detected and the patient’s serum alkaline phosphatase, aspartate aminotransferase, alanine aminotransferase, and gamma-glutamyl transferase levels were 474 IU/L, 264 IU/L, 496 IU/L, and 676 IU/L, respectively. C-reactive protein was elevated at 11.2 mg/dL. CT examination revealed CBD dilatation with a high-density area . On a series of surveillance CT images, a spotted high-density area in the CBD was confirmed in a retrospective analysis following the onset of cholangitis . Multi-plane reconstructed (MPR) CT revealed a CBD stone along the length of the CBD that contained a needle-shaped calcification density at its center . The patient was diagnosed as acute cholangitis concomitant with CBD stone. Gastroenterologists at our center and from a nearby hospital deemed that it would be difficult and tentative to perform endoscopic therapy to remove the stone through the Roux-en-Y reconstructed intestine. Therefore, the surgical procedure was adopted as quick and reliable treatment option and was performed using the upper median laparotomy approach. A severe adhesion, resulting from prior surgeries (namely distal gastrectomy and cholecystectomy), was found between the liver and the hepatoduodenal ligament. Even though the CBD was carefully exposed to adhesiolysis, a choledocoduodenal fistula was not detected. Lithotomy with choledochotomy was performed to remove one fragile bilirubin stone that had formed around a 3-cm, needle-shaped fish bone . The choledochotomy was closed by interrupted sutures using a polyglactin 910 suture. CBD drainage was not performed. The needle-shaped foreign body was diagnosed as a fish bone by histological hematoxylin and eosin staining and infrared absorption spectrophotometry . The patient’s postoperative course was uneventful and free of adverse events. The patient was discharged on postoperative day 21. No recurrence of a CBD foreign body was identified over the 4 years since the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2745_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2745_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..91e99ce94c1172ca8d13dde3c8c99e9cfe4175f4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2745_en.txt
@@ -0,0 +1,2 @@
+A 29-year-old woman was diagnosed with aortic coarctation and a bicuspid aortic valve. The patient underwent a left subclavian flap aortoplasty 1 month after birth and balloon dilatation for re-coarctation at the age of 8 years. She subsequently self-discontinued outpatient follow-ups. At the age of 26 years, she was diagnosed with hypertension and referred to our hospital as her contrast-enhanced computerized tomography scan revealed re-coarctation. Her height was 152 cm, weight 53 kg, heart rate 90 b.p.m., percutaneous arterial oxygen saturation 97% (room air), right upper extremity blood pressure (BP) 152/89 mmHg, and right lower extremity BP 120/93 mmHg. She had a Levine III/VI systolic murmur at the second intercostal space left sternal border and left back. The patient occasionally noticed fatigue in her legs when walking. Laboratory findings revealed an N-terminal prohormone of brain natriuretic peptide of 50.6 pg/mL. A chest radiography revealed a cardiothoracic ratio of 48% and no rib notch sign. A 12-lead electrocardiogram revealed sinus rhythm with sV1 + rV5 of 2.6 mV. Echocardiography revealed an LV end-diastolic diameter of 44.6 mm, a posterior wall of 7.9 mm, and an ejection fraction rate of 79%. The LV inflow waveform had a normal pattern with E/A > 1. The blood flow velocity at the re-coarctation was 3.2 m/s. The abdominal aortic blood flow waveform was blunted, and the systolic upstroke delayed. Cardiac catheterization revealed an LV pressure of 152/e12 mmHg, a re-coarctation area of 7.0 × 5.3 mm, and a systolic pressure gradient (PG) of 40 mmHg . One month after catheterization, the patient underwent balloon dilatation. Subsequently, the re-coarctation area expanded to 10.0 mm × 10.5 mm, and the systolic PG improved to 6 mmHg . After patient consent, we used 4D flow MRI for research purposes to evaluate the large vessel and LV blood flow before and after treatment. Cardiac MRI was a 3.0 T whole-body imager (MAGNETOM Vida 3 T; Siemens Healthcare, Erlangen, Germany). Scan parameters included: acceleration method, GRAPPA 3; field of view, 340 × 340 mm; flip angle, 8°; temporal resolution, 41 ms; a retrospectively electrocardiogram triggered. The acquired voxel size was 2.5 × 2.5 × 2.5 mm3, with velocity encoding 150 cm/s, Segment 2, and 30 frames/cycle. A workstation (cvi42, ver 5.17.0, Circle, Cardiovascular Imaging, Calgary, Canada) was used for the analysis.
+Preoperatively, helical flow was observed in the ascending and descending aorta ( and ). The LV blood flow analysis revealed 39.1% direct flow, 21.7% delayed ejection flow, 23.4% retained inflow, and 15.9% residual volume. Details of the four blood flow components and data on normal subjects are shown ( and , ). No obvious intraventricular blood flow ratio abnormality was observed . However, kinetic energy (KE) values of direct flow and delayed ejection flow decreased during systole . Postoperatively, helical flow in the descending aorta was alleviated ( and ). Left ventricular blood flow analysis revealed 39% direct flow, 19.4% delayed ejection flow, 22% retained inflow, and 19.5% residual volume . Although no change was observed in the direct flow ratio, an increase in KE values of direct flow and delayed ejection flow during systole was observed . Left ventricular function and volumes did not change before and after treatment. Two months after treatment, the systolic BP decreased by 20 mmHg.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_275_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_275_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7786a1e2d126fb6b9f2186fa8d5cbb9127aec006
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_275_en.txt
@@ -0,0 +1,11 @@
+A 21-year-old female patient without any known adverse medical background presented with a 1 month history of headache, nausea, fatigue and blurred vision. Physical examination and computer tomographic (CT) scan showed pericardial inflammation and splenomegaly (2 cm). Ophthalmoscopy of the right eye revealed papillary edema, retinal hemorrhages (Roth’s spots) and arteriovenous nickings (for further details see Fig. and Table ). Initial laboratory evaluation of peripheral blood (PB) revealed a white blood cells (WBC) of 113.2 × 109/l (72% were blasts), red blood cells (RBC) count was 2.53 × 106/mm3, with a hemoglobin level of 9 g/dl and a platelet count (Plt) of 61 × 109/l. Prothrombine time was 15.1 s (normal value 10.0–13.0 s) while partial thromboplastin time (PTT) was 25.8 s (normal value 29 ± 3.5 s). Creatinine value showed 38.7 μmol/l (normal 45–120) and uric acid value 498.2 μmol/l (normal 150–450). Bone marrow (BM) aspiration revealed 70% of blasts .
+At this point the first cytogenetic and immunophenotypic data were determined. Flow cytometric (FCM) analysis classified this case as AML-M1. The patient was given standard treatment for AML including (3 + 7) induction chemotherapy (Daunorubicin 60 mg/m2 for 3 days and Cytarabine 200 mg/m2 for 7 days). On day + 28 of treatment with (3 + 7) protocol, the patient had not responded as expected to the treatment, i.e. her PB revealed pancytopenia/cytopenia (WBC 0.4 × 109/l), anemia (hemoglobin level = Hgb: 9.5 g/dl); thrombocytopenia (Plt 12 × 109/l) and less than 7% blasts in BM aspiration. The patient was given re-induction chemotherapy (ICE protocol: Cytrabin 200 mg/day: day 1 ➔ day 7, Etobside 100 mg/day: day 1 ➔ day 5, and Idarubicin 20 mg/day: day 1 ➔ day 3) and she achieved complete remission on day 30 of ICE protocol treatment (WBC 7.4 × 109/l; Hgb 11.6 g/dl; Plt 183 × 109/l), with less than 4% blasts in BM aspiration. Still the patient suffered from blurred vision in the right eye (retinal detachment sensory serous) during ICE protocol treatment but her karyotype was normal. The patient was given consolidation I chemotherapy (High dose Ara-C = HIDAC: Cytarabine 3 g/m2/day; day 1 ➔ day 3; and Methoxantron 20 mg/day; day 1 ➔day 2). Afterwards the patient did not return to the hospital to continue the treatment for 6 weeks. Then she was referred to the hospital again for blurred vision in the right eye and a mass under the vascular arch with splint edema of optical nerve of the right eye was diagnosed, being the cause of her severe decrease in vision. While cerebrospinal fluid (CSF) test was negative, BM aspiration revealed 20–30% of blasts. In PB WBC was 5.6 × 109/l (98.5% of neutrophils), Hgb was 11.6 g/dl, Plt of 70 × 109/l indicated for thrombocytopenia while CT scan of brain was normal. Now she treated with consolidation II chemotherapy (HIDAC), 2 weeks later her PB had WBC 0.1 × 109/l, Hgb 8.4 g/dl and Plt still 20 × 109/l; the mass behind the retina of the right eye was still present.
+About 2 months later the patient relapsed and the following values were found: in PB WBC was 7.5 × 109/l with 77.7% of neutrophils, Hgb 12 was g/dl and Plt was 178 × 109/l; BM aspiration revealed 15% of blasts. The MD’s suggested to apply now the Flag-Ida protocol; however, due to the political situation in her home country only available treatment at this point was treatment with Cytrabin 100 mg/day. Again 2 weeks later the patient suffered from blurred vision of the right eye due to serious central retinal detachment; her PB revealed a WBC of 60 × 109/l (70% of them were blasts), Hgb of 13.3 g/dl; thrombocytopenia with Plt of 13 × 109/l was present with a normal brain MRI. Now the patient treated with Cytrabin 1 g/day: day 1 ➔ day 3, Etoposide 100 mg/day: day 1 ➔ day 3, and Methoxantron 20 mg/day: day 1 ➔day 2).
+Ten days later, the patient relapsed; her PB shows cytopenia [WBC 1.5 × 109/l with 44% blasts)], anemia (Hgb 9.6 g/dl) and thrombocytopenia (Plt 17 × 109/l). Now the patient stopped the treatment on her own request for 1 month. Afterwards she suffered from fever (more than 40 °C for more than 3 days), menorrhagia and blurred vision in the right eye. Approximately 8.5 months after initial diagnosis she died in her house and no autopsy was performed. Her husband agreed with scientific evaluation of her case and the study was approved by the ethical committee of the Atomic Energy Commission, Damascus, Syria.
+Conventional cytogenetics analysis on unstimulated BM sample according to standard procedures was performed prior and post chemotherapy treatments. Karyotypes according to the International System for Human Cytogenetic Nomenclature were classified .
+Prior to chemotherapy treatment: GTG-banding cytogenetics revealed the following karyotype:48–50,X,- X,der(1)t(1;2)(?;?),der(1)t(1;3)(?;?),+ 4,+ 4,+ 4,+ 6,t(8;11)(?;?),t(10;12)(?;?),dic(12;17)(?;?)× 2 , which was further specified by molecular cytogenetic studies . Fluorescence in situ hybridization (FISH) using (WCP) probes for chromosomes 1, 2, 3, 4, 5, 6, 9, 12, 17 and X (MetaSystems, Altlussheim, Germany), a specific probe for ETV6 break apart probe and a specific probe for 17p13 (TP53) (Q-Biogene, USA) were applied according to manufacturer’s instructions. Array-proven multicolor banding (aMCB) probes sets for chromosomes 1, 2, 3, 8, 10, 11, 12 and 17 were used . Thus, the following final karyotype prior to chemotherapeutic treatment was determined using a fluorescence microscope . 48–50,X,-X,der(1)t(1;2)(p35;p22),der(1)t(1;3)(p36.21;p26.2),der(2)(:1p36.21- > 1p35::2p22- > 2qter),+ 4,+ 4,+ 4,+ 6,der(8)t(8;11)(q24.3;q13.4),der(10)t(10;12)(p15.3;q24.11),del(10)(q21q21),dic(12;17)(p11.2;p11.2),del(15)(q14q14),del(15)(q21.1q21.1),del(15)(q22.32q24)del(17)(q12q12) .
+Genomic DNA was extracted from BM cells prior to chemotherapy treatment as previously reported . aCGH was performed using the Agilent Sure Print G3 Human Genome Microarray 180 K as previously described . The aCGH analysis revealed different genomic imbalances . Thus, copy number alterations (CNAs) could be grouped according to their sizes as follows:
+Focal CNAs (e.g. deletion on 14q14.3); CNAs involving variable numbers of genes (e.g. deletion on 17q21.3); CNAs involving large parts of chromosomal p or q arms (e.g. duplication of 3q26.1q29) and CNAs of whole chromosomes (e.g. trisomy # 6 -Table ).
+Immunophenotyping was performed on BM specimen prior and after chemotherapy treatment using a general panel of fluorescent antibodies against antigens typical for different cell lineages and cell types : CD1a, CD2, CD3, CD4, CD5, CD8, CD10, CD11b, CD11c, CD13, CD14, CD15, CD16, CD19, CD20, CD22, CD23, CD32, CD33, CD34, CD36, CD38, CD41a, CD45, CD56, CD57, CD64, CD79a, CD103, CD117, CD123, CD138, CD209, CD235a and CD243; In addition to antibodies to Kappa and Lambda light Chains, IgD, sIgM, and HLADr. All antibodies were from BD Biosciences. Flow cytometric data acquisition and analysis were conducted . FCM analysis of BM specimen prior to chemotherapy treatment characterized this case as AML-M1 according to WHO classifications. The abnormal cell population (60% of tested cells) was positive for CD45dim, CD34, HLADr, CD33, CD117, and CD13. Blast cell population was negative for CD3, CD79a, CD14, CD64, CD32, CD7, CD19, CD10 and CD5.
+After chemotherapy and relapse GTG-banding revealed a mosaic of tetraploidy and HH as 92,XXXX /62,XX,+ 1,+ 4,+ 5,+ 5,+ 6,+ 6,+ 11,+ 15,+ 16,+ 17,+ 19,+ 19,+ 20,+ 20,+ 21,+ 22 /46,XX .
+FCM analysis of BM specimen post to chemotherapy treatment characterized this case as AML-M6 according to WHO classifications. The abnormal cell population (15%) was positive for CD45dim, CD36, HLADr, CD33, CD34, CD117, CD13, CD235a and MPO. Those blasts were negative for: CD10, CD19, CD20, CD22, CD5, CD7, CD2, CD3, CD16, CD56, CD1a, CD14, CD64, CD32, TdT, cyCD3 and cyCD79a.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2762_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2762_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f888c141b678a021b760937a75008553e82e2cb0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2762_en.txt
@@ -0,0 +1,3 @@
+A 73-year-old, 153-cm, 50-kg female was scheduled to undergo a robot-assisted right upper lobectomy for lung cancer. She had undergone a lingula-sparing left upper lobectomy 5 years before. A chest X-ray revealed angulation of the left main bronchus with a 3.4-cm distance from the trachea to the angulation point, 127° T-MB angle, and 132° PL-DL angle , which did not meet the angle criteria for remarkable angulation. Therefore, a standard left-sided DLT was selected.
+A thoracic epidural catheter was placed. After induction of general anesthesia with propofol, remifentanil, and rocuronium, a standard 35-Fr left-sided DLT (Portex Blue Line®, Smith Medical, Minneapolis, MN) was correctly placed with the video-assisted laryngoscope (McGrath MAC®, Medtronic, Minneapolis, MN) and a bronchoscope. The outlet of the bronchial port was partly faced with the bronchial wall. Test OLV with pressure-controlled ventilation with a peak pressure 20 cm H2O and positive end-expiratory pressure 4 cm H2O achieved a tidal volume above 250 mL while she was placed in the supine position. After placement in the left lateral position, test OLV could achieve a tidal volume above 200 mL. Although the tube outlet seemed almost fully faced with the bronchial wall, the bronchoscope could be advanced into the bronchus by flexing its tip. However, as soon as OLV was attempted after she was repositioned in the lateral jackknife position with the lowest chest raised and the lower trunk lowered by a flexed operating table , the tidal volume decreased to less than 50 mL. Adequate manual OLV was impossible. Bronchoscopically, the outlet was obstructed by the bronchial wall, and the bronchoscope could not be advanced beyond the tube outlet.
+Immediately, the jackknife position was released, and adequate manual OLV became possible. The tube was exchanged for a 37-Fr left-sided DLT with a flexible wire-reinforced tip and a narrow bronchial cuff (Silbroncho®, Fuji Systems, Tokyo, Japan) , using an airway exchange catheter and the video-assisted laryngoscope while she remained in the lateral position. Further, under bronchoscopic guidance, the tube tip was placed below the angulation point and above the secondary carina so that the secondary carina was seen in front of the tube outlet. Thereafter, a tidal volume during OLV remained above 250 mL even after repositioning in the lateral jackknife position. The scheduled robotic surgery was completed within 146 min under combined general and epidural anesthesia. She was extubated 9 min after the surgery and discharged from the hospital on the fourth postoperative day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2766_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2766_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7b1d15a63f84a81712176baf70aa1267873d6424
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2766_en.txt
@@ -0,0 +1,8 @@
+A 70-year-old woman of Iranian descent was referred to our trauma unit for a major scald burn. The exact mechanism of injury was inconclusive. The patient had a history of diabetes mellitus type 2, ischemic heart disease, hypertension, hyperparathyroidism, hyperlipidemia, chronic bronchitis, glaucoma, and mild depressive disorder. She had been receiving treatment on a regular basis with the following medications: amitriptyline, enalapril, glyburide, verapamil, omeprazole, aspirin, simvastatin, theophylline, furosemide, metformin, citropram, dorzolamide hydrochloride eye drops, and latanoprost eye drops.
+On admission, the patient was disoriented. Blood pressure was 90/60 mmHg. Cutaneous examination revealed a second-degree superficial burn involving both breasts, lateral aspect of the flanks, anteromedial aspect of the arms, medial aspect of the thighs, and the right scapular region. Diffuse erythema was noted, especially of the upper extremity and anterior trunk .
+A presumptive diagnosis of a second-degree, superficial major scald burn affecting 26% of the total body surface area (TBSA) was made. Fluid resuscitation was initiated according to the Parkland formula . A Foley catheter was inserted. Local treatment included wound debridement and application of saline-soaked gauze.
+Physician examination 12 hours post-admission to the Burn Unit was remarkable for thin blisters in locations not affected on admission: back, neck, inguinal region, and both knees , ultimately effecting 35% of the TBSA. The worsened epidermolysis was accompanied by a positive Nikolsky sign.
+On further questioning, burn was ruled out as a causal factor. The patient reported that 2 days prior to admission, she had been discharged from another hospital with a diagnosis of pneumonia, and she had been receiving ceftriaxone for 4 days.
+The final diagnosis was TEN due to ceftriaxone intake. The mucous membranes were not involved. Treatment with intravenous hydrocortisone 500 mg was initiated. The hypoglycemia (glucose level-45 mg/dl) was successfully treated with intravenous dextrose 5%, and the oral hypoglycemic medications were discontinued. Laboratory studies revealed hypomagnesemia (1.32 mg/dl), for which intravenous MgS04 was administered. Local treatment included Vaseline gauze dressings that were changed once a day.
+On the second day of admission, the patient's temperature began to rise. Complete blood count revealed leukopenia of 2,300 mg/dl. Incisional punch biopsy demonstrated widespread full-thickness epidermal necrosis . The dermis was devoid of inflammatory cells. Histopathological findings were compatible with the diagnosis of TEN. The patient was referred to our intensive care unit (ICU), and treatment with intravenous immunoglobulins (IVIG) was initiated (0.5 g/kg daily for 4 days, the total daily dose of IVIG was 40 grams). The hemodynamic instability was successfully treated with inotropic agents and mechanical ventilation.
+Blood culture results, obtained during the patient's hospitalization in the ICU, were positive for Klebsiella pneumoniae, Proteus mirabilis, Enterobacter, Enterococcus and Pseudomonas aeruginosa. Antibiotic treatment included vancomycin, levofloxacin, ciprofloxacin, ampicillin sulbactam, piperacillin tazobactam, and amikacin sulfate. The clinical course was complicated by adult respiratory distress syndrome, thrombocytopenia, and hypoglycemic episodes. Following prolonged ventilation, tracheostomy was performed. After 42 days in the ICU, the patient was found to be hemodynamically stable and afebrile, and was discharged to rehabilitation. Study of the cutaneous lesions demonstrated re-epithelization with successful wound healing. Mild pigmentary alterations remained with no residual scars. Despite the favorable course of TEN in this case, the patient succumbed to intracranial hemorrhage 4 months later. This outcome was entirely unrelated to TEN.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2769_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2769_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..59d612f2414387ad6692eb55348810f8e27c1090
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2769_en.txt
@@ -0,0 +1,3 @@
+A 63-year-old female patient was admitted to our hospital for examination and treatment on July 26, 2022. Six months prior to admission, she experienced upper and middle abdominal distension after eating, which was slightly relieved by anal venting. She reduced the amount of food consumed per meal and did not experience any further bloating. One month prior to admission, she developed vague right upper abdominal pain after consuming fatty foods, which was paroxysmal and tolerable and improved with a light diet. No other symptoms such as acidity, eructation, vomiting, or diarrhea were reported.
+Upon initial physical examination, pain was present in the left upper abdomen upon pressure, without rebound pain. The rest of the examination was unremarkable. Further investigation through barium meal examination, endoscopy, and abdominal MRI was arranged. Barium meal examination revealed a locally depressed fundus of the stomach with a smooth mucosal surface , while endoscopy showed a large submucosal bulge with a smooth surface at the fundus of the stomach , suspected to be gastric submucosal tumor. MRI detected a 6.4 x 7 cm mass in the left upper abdomen with low signal on T1-weighted images and high signal on T2-weighted images, with partial intensification in the arterial phase and progressive intensification in the venous phase .
+Laparoscopic surgery was initially planned; however, intraoperatively, it was discovered that the mass was connected to the liver by pedunculi. The mass exhibited dimensions of 9 * 8 cm and had a soft consistency with angulated surface vessels closely associated with the lesser curvature of the stomach . The mass was removed en bloc with 2 cm margins. The final pathology report indicated a hemangioma . The patient timeline of diagnostic testing and Therapeutic intervention are shown in . A follow-up telephone call conducted three months post-operation revealed that the patient had experienced resolution of symptoms and reported no additional discomfort.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_276_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_276_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..387c52edd39cdf6857749f04d7d535f1c2a2f706
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_276_en.txt
@@ -0,0 +1 @@
+A 12-year-old girl was referred to our university hospital for short stature with a dysmorphic facies for evaluation. She was the second child of four siblings, of parents who were first-degree cousins. The maternal and neonatal history was uneventful. There was no history of similar illness in the family. The patient reported loss of teeth and nails at the age of 2 years and gave a history of multiple fractures of the long bones resulting after trivial fall: two of the right tibia and one of the left tibia. On physical examination, she had the following features: standing height at 117 cm (- 5 SDS), the cranial perimeter was 47.5 cm, sexual maturity rating showed pre-adolescent stage, presenting facial dysmorphia, limited mouth opening, short hands and feet with dysplastic nails ; frontal and occipital bossing; and hypoplasia of the maxilla and mandible . Examination of the mouth: grooved palate, caries of the teeth, impacted and malposed teeth, persistent deciduous teeth and missing teeth . Audiometry showed mild conductive hearing loss. Fundus examination was normal. Laboratory investigations such as complete blood count, serum calcium, phosphate, 25- hydroxy vitamin D, alkaline phosphatase, and hormonal balance (tetraiodothyronine, cortisol, and insulin growth factor 1) were normal. The radiographic examination showed a generalized increase in the bone density and horizontal fissure in the middle portion of the tibial shaft, but without obliteration of the medulary canals. . Radiography of the skull showed sutures and fontanelles closed, slight condensation of the skull base and a very open mandibular angle . X-rays showed tapered phalanges with acro-osteolysis of the distal phalanges of the 1st and 2nd row . The bone age was 11.5 years. These clinical and radiological characteristics are in favor of a pycnodysostosis. Since there is no specific treatment, and for the financial constraints of the patient (not allowing her a growth hormone therapy), a symptomatic treatment was proposed based: on fracture prevention, oral hygiene, frequent dental visits and psychiatric support.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2779_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2779_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ff02a3c8a8299584af496a8c8a897baad2a2ec57
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2779_en.txt
@@ -0,0 +1,7 @@
+A 69-year-old female patient with a long vascular history and atrial flutter, presented with acute critical limb ischemia of the left extremity after stopping her anticoagulation (apixaban).
+She had received an aortobifemoral graft at the age of 53, and had two prior episodes with acute occlusion of the right limb of the graft, 10 and 14 years after the primary operation. Both occlusions was resolved with catheter-directed thrombolysis, the last time with application of a stent in the proximal part of the right limb of the graft.
+CTA confirmed occlusion of the left leg of the aortic-bifemoral bypass, and new short occlusions of two calf arteries. There was also wall thrombus in the native aorta above the graft, as well as in the main body of the graft.
+After discussion with the vascular surgeon, we started catheter-based intraluminal tPA-administration via a crossover hook-shaped catheter, with the intention to aspirate residual emboli from the calf the next day if needed.
+After 12 h, the thrombus was dissolved. There was significant residual stenosis due to neointimal hyperplasia or wall adherent thrombus in the proximal limb, and the left groin was punctured to apply kissing stents at the bifurcation of the graft . Control angiograms after stent placement showed restricted flow through the left limb, with correct placement of the wire in the aorta above the graft anastomosis . The findings of the angiograms were consistent with neointimal dissection at two levels. At the proximal level, the stent was deployed inside the false lumen without inflow, but with the distal end inside the true lumen. The proximal neointimal dissection could only be resolved with prolonging the kissing stents all the way to the proximal graft anastomosis . The distal dissection was not flow limiting after the wire was moved to the correct lumen via buddy wire technique, and this dissection was left untreated.
+Emboli to the left calf were aspirated via a new antegrade puncture in the left groin, but completion angiograms showed some residual thrombi and a chronic occlusion of the dorsal pedal artery.
+The patient is back to her habitual state 6 months after the procedure, with no rest pain or wounds, but claudication at 500 m. Initially after the procedure the patient received dual antiplatelet therapy, but she was reinstated on apixaban from the cardiologist due to atrial flutter at dismissal from the hospital. She is currently on life-long anticoagulation and antiplatelet therapy with apixaban and ASA.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2783_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2783_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..45b2bf1a4d27044902551fb1c795add52217242f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2783_en.txt
@@ -0,0 +1,3 @@
+In a 78-year-old female patient with long history of persistent AF and symptomatic AF recurrences despite multiple previous ablation procedures and persistently isolated pulmonary veins, we performed isolation of the LAA by applying an anterior and a mitral isthmus line. Following a waiting period of 6 weeks post-LAAI and oral anticoagulation with a direct novel oral anticoagulant (Apixaban), we readmitted the patient in order to implant an endocardial LAA occluder device (Watchman; Boston Scientific, Marlborough, MA, USA). A preprocedural transoesophageal echocardiography (TOE) was performed and excluded a left atrial (LA) thrombus. The novel oral anticoagulant was stopped the day of the procedure. Under deep sedation using midazolam, sufentanil, and continuous infusion of propofol, a single transseptal puncture was performed using a regular 8, 5 Fr SL1 transseptal sheath (St. Jude Medical, Inc., St. Paul, MN, USA) after a multi-electrode diagnostic catheter was inserted into the coronary sinus. Intravenous Heparin was administered with a target-activated clotting time (ACT) of 300 s. Angiography of the LAA was performed revealing a ‘chicken-wing’ morphology . The maximal diameter at the landing zone as measured in fluoroscopy and TOE was 30 mm. Accordingly, a 33 mm Watchman device was selected to occlude the LAA. The transseptal sheath was changed over a regular guidewire for the 15 Fr non-steerable Watchman sheath (Boston Scientific, Marlborough, MA, USA), which was gently advanced over the wire into the distal LAA until the according marker was in the predefined landing zone. Suddenly the patient became hypotensive and TOE showed a massive pericardial effusion . Immediate pericardiocentesis was performed, and a 7 Fr pigtail catheter introduced into the pericardial space. The 15 Fr Watchman sheath was immediately withdrawn into the inferior vena cava to avoid potential thrombus formation along the sheath. The ACT was measured with 357 s. A total of 5000 I.E. of protamine was immediately applied resulting in an ACT of 157 s. Aspirated epicardial blood was autotransfused via a right femoral vein access, but despite continuous aspiration the effusion remained unchanged indicating a massive perforation of the distal LAA.
+In the meantime, the patient was intubated. Suspecting distal LAA perforation as the source of the massive bleeding proximal occlusion of the LAA was desired. Therefore a new transseptal puncture using a 8.5 Fr SL1 sheath (St. Jude Medical, Inc., St. Paul, MN, USA) was performed, and a guidewire was advanced into the LAA. The guidewire went via the distal LAA into the pericardial space proving the distal LAA perforation. Now, the SL1 transseptal sheath was changed over the wire for 12F steerable FlexCath Advance sheath (Medtronic, Inc., Minneapolis, MN, USA) which was advanced to the base of the LAA followed by introduction of a 28 mm cryoballoon (ArcticFront Advance, Medtronic, Inc., Minneapolis, MN, USA). The cryoballoon was gently moved over a guidewire to the base of the LAA and manually inflated using the cryoballoon manual retraction kit (Medtronic, Inc., Minneapolis, MN, USA) . Contrast medium was applied over the Flexcath sheath and demonstrated complete sealing of the LAA . Later the epicardial blood could be completely aspirated resulting in haemodynamic stability of the patient.
+Since emergency open heart surgery in this older patient would have been associated with high peri- and post-operative risk, we decided to attempt epicardial LAA closure applying the Lariat epicardial LAA suture device (Sentreheart, Redwood City, CA, USA). Another anterior epicardial puncture was performed, and the epicardial magnet was introduced via the epicardial Lariat-sheath while the endocardial magnet was advanced over a second transseptal sheath and across the temporarily deflated cryoballon into the LAA. Both magnets connected and the Lariat device was brought into the pericardium and gently advanced over the LAA and over the cryoballoon to the LAA base . After echocardiographic and fluoroscopic verification of the position of the Lariat snare, the snare was closed and the cryoballoon deflated and pulled back into the LA which resulted in complete closure of the LAA . The Lariat suture was tightened one and a second time after a waiting period of 5 min. A final TOE evaluation as well as another contrast injection via the transseptal sheath demonstrated complete LAA occlusion, no further pericardial effusion occurred. All sheaths except a pericardial 7 Fr pigtail catheter were removed and the patient was transferred to ICU for further monitoring. The patient was extubated 2 h after the LAA closure and after exclusion of further epicardial effusion during the next 24 h the pigtail catheter was removed. She was discharged 10 days after the procedure. Three months from discharge the patient had one episode of persistent AF requiring electrical cardioversion, and she had no further pericardial effusion.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2797_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2797_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0ef29b7bc9c26372bfb7213839c81cf5449424df
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2797_en.txt
@@ -0,0 +1,2 @@
+Our patient was a 70-year-old Japanese man with multiple hepatocellular carcinomas who required repeat multiple transarterial chemoembolization and radiofrequency ablation treatments because of recurrences. Repeat hepatic arterial infusion chemotherapy using an implanted port-catheter system had been planned for the patient in another institution. Since the replaced LHA arose from the LGA , arterial redistribution by means of embolizing the replaced LHA had been attempted. However, despite three procedures, the LGA could not be selected using the catheter, and the replaced LHA could not be catheterized and embolized. Therefore, the patient was transferred to our institution, and arterial redistribution and creation of the port-catheter system were planned.
+First, conventional angiography from the right femoral artery was performed so that we could visualize the anatomy. According to the celiac angiography, the LGA arose from the proximal portion of the up-swinging celiac trunk at a sharp angle, and no vascular stenosis was observed in the LGA . We attempted the following methods to catheterize the LGA: (1) turning the catheter tip to the up-swinging celiac trunk by pulling the 5-French shepherd's hook catheter (Terumo Clinical Supply, Tokyo, Japan) and trying to select the LGA by using a coaxial method with 2.1-French or 2.5-French microcatheters with or without the steam-shaped technique (Renegade, Boston Scientific, Natick, MA, USA, and Sniper 2, Terumo Clinical Supply) and 0.014-inch or 0.016-inch microguidewires (Transcend, Boston Scientific, GT wire, Terumo Clinical Supply); (2) inserting the steam-shaped 5-French shepherd's hook or Cobra catheter (Terumo Clinical Supply) into the common hepatic artery beyond the region of origin of the LGA and pulling them back to select the LGA; and (3) creating a side hole in the top of the shepherd's hook catheter and trying to insert the microcatheter into the LGA from the side hole. However, we failed to catheterize the LGA after trying all three methods, and the procedure time had reached about three hours. Therefore, using the microcatheter, we selected the RGA that arose from the proper hepatic artery. According to the RGA angiography, the anastomosis from the RGA to the LGA was very thin, and the replaced LHA was not visualized through the anastomosis at that time . However, we believed that the replaced LHA would be visualized if we inserted the catheter to the distal portion of the RGA and injected contrast medium into it. Therefore, we attempted to select the replaced LHA via the RGA and finally succeeded in visualizing and selecting it by using a 2-French microcatheter (Prograde-α; Terumo Clinical Supply) and 0.014-inch to 0.016-inch microguidewires (Transend, Boston Scientific, and GT wire, Terumo Clinical Supply) . The replaced LHA was embolized from the distal to the proximal portion using 13 microcoils (Tornado; Cook, Bloomington, IN, USA). The RGA was also embolized with three microcoils using the pull-back microcatheter. A 5-French polyurethane catheter with a 2.7-French distal shaft (W-Spiral catheter; Piolax Medical Devices, Yokohama, Japan) with a side hole was placed into the hepatic artery from the left femoral artery. The side hole was positioned in the common hepatic artery, and the tip was inserted into the gastroduodenal artery. After placing coils around the catheter tip to fix it within the gastroduodenal artery, the catheter was connected to an implantable port (Sadica port; Terumo Clinical Supply), which was embedded subcutaneously in the left anterior thigh. An angiogram obtained through the implantable port after catheter placement showed the revascularized LHA and a uniform blood supply to the entire liver . The total procedure time was four and a half hours. On the day after the procedure, hepatic arterial infusion chemotherapy was started and the patient was transferred to the previous hospital.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_279_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_279_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8c7a395a4a712412a49f7f5fa3e4f25790f9bb10
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_279_en.txt
@@ -0,0 +1,4 @@
+A 66-year-old woman was referred to our hospital with two pulmonary nodules that developed after PPC resection and subsequent adjuvant chemotherapy 5 years earlier. She underwent ileocecal resection and low anterior resection of the involved rectum, which yielded a 6.0-cm-sized PPC mass . The mass was initially considered mesenteric, and the lack of ovarian or uterine abnormalities or involvement on preoperative radiological examinations and intraoperative findings led to a strong suspicion of a gastrointestinal stromal tumor of the ileum. The distal end of the right fallopian tube was resected because of tumor involvement. The ovaries and uterus were considered normal and thus were not resected. Histopathologically, the tumor mass comprised irregular clusters of malignant cells with cellular papillae or slit-like glandular spaces , with or without psammoma bodies. The tumor cells contained atypical large nuclei, prominent nucleoli, and frequent mitoses. Immunohistochemically, these cells were positive for Wilms tumor (WT)-1 , cytokeratin (CK) 7, paired box gene 8, and estrogen receptor and negative for CK20, caudal-type homeobox 2, and villin. The mass was diagnosed as PPC based on the diagnostic criteria of the Gynecologic Oncology Group [, ]. Ascites and lymph node metastasis were not observed. Thus, tumor resection was considered complete (R0). She underwent six adjuvant chemotherapy cycles with paclitaxel (175 mg/m2) and carboplatin [area under the curve (AUC): 5].
+Follow-up computed tomography showed a 1.3-cm-sized nodule in the left lung with a small airspace in the posterior basal segment and a 0.9-cm-sized solid nodule in the apico-posterior segment that grew slightly during a 2-month period. No pleural effusion was detected. 18F-Fluorodeoxyglucose (FDG)-positron emission tomography (PET) revealed maximum standardized uptake values of 7.11 and 2.46 for these nodules. Both nodules were suspected to be pulmonary metastases of PPC. However, the serum cancer antigen (CA)-125 level was within normal range (11.7 U/ml). Because the serum CA-125 level was elevated (529.1 U/ml) before the first surgery, primary lung cancer or non-malignancy was also suspected. No evidence of tumor in the primary site was observed on FDG-PET or abdominal computed tomography.
+Pulmonary wedge resection is now considered a standard surgical procedure for the treatment of metastasis from cancers in other organs. Therefore, if an intraoperative frozen examination could diagnose the nodules as metastatic PPCs, we would select wedge resection. As a result, the intraoperative frozen section examination of the resected lung specimen could not distinguish metastatic PPC from primary lung adenocarcinoma. Regarding surgical treatment of small-sized primary lung cancer, anatomical segmentectomy is gaining popularity as a curative and less-invasive procedure . Accordingly, even if the two pulmonary nodules were primary lung cancers, not pneumonectomy (double lobectomies), but the respective segmentectomies would be suitable owing to the invasiveness.
+From all the above, regardless of the definitive diagnosis (metastatic PPC or primary lung cancer), anatomical segmentectomies of the two nodules were deemed to be suitable, considering curativity and invasivity. Anatomical segmentectomies of the posterior basal segment and superior division with systematic lymph node dissection were performed. Histological examination of the resected specimen revealed neoplastic cells in the lung tumor. These cells contained enlarged nuclei, irregular slit-like spaces, and a papillary pattern, similar to previous PPC . Immunohistochemically, the specimen was positive for WT-1 and negative for thyroid transcription factor-1. These findings led to a diagnosis of a pulmonary recurrence of the previously resected PPC. No mediastinal or hilar lymph node metastasis was observed. The postoperative course was uneventful, and second-line chemotherapy with paclitaxel (175 mg/m2) and carboplatin (AUC 5) for six cycles was initiated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2810_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2810_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..81628d7d3b67bed25debd3d9f68e63c498e806e3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2810_en.txt
@@ -0,0 +1,11 @@
+A 58-year-old female presented with right facial and neck swelling and respiratory distress after a recent dental infection treated with clindamycin. On examination, there were grossly decayed teeth with a firm floor of mouth and diffuse erythema of the right neck, lower and mid-face. She was diagnosed with Ludwig’s Angina and immediately intubated due to stridor and pending airway compromise. Imaging revealed extensive infection and abscess formation involving the submandibular, pterygomandibular, and buccal spaces, and she was taken to the operating room for dental extraction and abscess drainage by the oral surgery team and started on broad spectrum antibiotics. Cultures from this operation were polymicrobial and consistent with oral microbes. On postoperative day 1, she developed rapidly expanding erythema and swelling of the right hemiface and neck with gross necrosis of the skin throughout the right neck and face. The Otolaryngology team was consulted for possible necrotizing fasciitis.
+The patient was taken to the operating room for urgent debridement, which included the skin of the right neck and face up to lower eyelid, devascularized orbicularis oculi, mylohyoid, superficial muscular aponeurotic system in the midface, masseter, and all branches of the facial nerve. The debridement ultimately required removal of a 20x30cm segment of the right and central neck and a 20x20cm segment of the right face .
+Subsequent debridement 2 days later required excision of soft tissue to the level of the zygoma and infraorbital rim. Penrose drains were placed to assist with drainage and irrigation of deeper spaces communicating with the open wound, including the pretracheal space. Antibiotics were transitioned to vancomycin, ampicillin-sulbactam, and fluconazole for a planned duration of 4 weeks, as was appropriate per bacterial culture susceptibilities.
+The decision was made to proceed with twice daily local wound care with Dakins irrigations through the Penrose drains into the deep spaces, and placement of wet-to-dry Dakins-soaked gauze over exposed soft tissue between operative debridements. Ophthalmology was consulted for assistance with progressive ocular and lower eyelid involvement. Due to the extent of the wound, heavy sedation was required for dressing changes. However, due to open wound without overlying skin in the pretracheal space, a tracheostomy was not offered, as secretions would have saturated the wound bed and prolonged infection, resulting in a prolonged endotracheal intubation. Despite aggressive wound care, 12 days after initial aggressive debridement, purulent drainage continued to be encountered with irrigations, with concern for spread of infection threatening the right orbit and mediastinum. Furthermore, new areas of devitalized tissue were encountered routinely throughout the wound bed and debrided at bedside. The white blood cell count was persistently elevated throughout this time and the patient remained septic.
+Several case reports and review articles have demonstrated success with NPWT in decreasing bacterial burden and stabilizing wounds in patients with NF, even within the head and neck regions [–]. Unfortunately, given the proximity of the wound bed to the lower eyelid and conjunctiva and surgical absence of the majority of the soft tissue of the eyelid including the orbicularis oculi, negative pressure wound therapy was contraindicated due to risk of traction injury to the globe and/or eyelid. To address this problem, a 3D-printed, patient-specific wound splint was designed at the point-of-care using the patient’s anatomy to facilitate NPWT. It was determined that the patient’s circumstances met the criteria for the FDA Expanded Access for Medical Devices Emergency Use mechanism (EAEU) with concurrence from the Institutional Review Board (IRB) . A follow-up report was sent to the FDA within 5 days on the use of the device as required.
+A facial CT was obtained and Digital Imaging and Communications in Medicine (DICOM) images were uploaded to Materialise Mimics (Materalise, Leuven, Belgium). These were segmented to include the remaining soft tissue and bony structures in the nasofacial sulcus, periorbital, and malar regions. The native anatomy was then imported into Materalise 3-Matic (Materalise, Leuven, Belgium) and a 3-Dimensional (3D) surface was formed through the offset of the soft tissue and bony structures within the wound and extruded to provide additional surface and contact area. This process was performed with both clinician and engineering input to ensure correct design and adequate contact area for both the wound-vac device as well as the mount sutures. The resulting model was then smoothed with additional surface post processing to ensure fitment would be exactly along the contour of the wound and as well as provide a wide and flat surface on the outside upon which the NPWT could be secured . An open-faced mold was then designed in 3-matic to allow for a naturally smooth surface for the NPWT film to attach. The mold was printed on a FormLabs Form 3B in FormLabs Biomed Amber resin (FormLabs, Somerville, MA, USA) and post-processed following the recommended Form Wash and Cure time and temperatures for clinical applications . Factor II VST-50HD (FactorII, Inc., Lakeside, AZ, USA) platinum cure two part medical grade silicone was selected for its shore hardness of 38A and safe skin contact properties and was mixed in ratio of 10:1 A:B, degassed, and gravity poured into the mold . The mold and poured silicone were allowed to cure at 60 °C for 3 hours and the splint was extracted from the mold. The splint alone underwent an additional cure in at 150 °C for 2 h to ensure complete cure. The wound splint was then cleansed in 99% IPA for 5 minutes, before being ready for patient application .
+An EAEU was submitted to the FDA on the basis of a life threatening infection requiring prolonged intubation that was necessary due to heavy sedation requirements with dressing changes. Additional concerns of development of orbital involvement and vision loss were cited if the wound did not begin to rapidly heal, and failure of other treatment options (wet-to-dry dressing changes). Concurrence was obtained from our IRB.
+The wound splint was then placed at the superior edge of the wound bed, just below the remnant eyelid and sutured in place. A NPWT sponge was placed in the remaining wound bed. The NPWT film was applied directly to the splint, and ophthalmology confirmed that there was no traction on the lower lid .
+Since bedside dressing changes were no longer necessary, the patient was weaned from sedation, although she remained intubated. Two days following placement, the NPWT was exchanged in the operating room. The wound was noted to have stabilized, with well-healing granulation tissue present in > 50% of the wound bed, active bleeding throughout, and no evidence of devascularized areas or additional further purulence. The erythema of the mediastinal skin had improved, and the WBC count normalized. Five days later, the NPWT was again exchanged, and the dead space between the skin and trachea was noted to have healed and seated down, allowing for tracheostomy and removal of the endotracheal tube 2 weeks following initial placement . Now fully weaned from sedation, the patient was transferred out of the intensive care unit and continued to express appreciation for her customized care and device.
+With each exchange of NPWT, the wound continued to demonstrate contraction and healthy granulation tissue formation, with no evidence of ongoing infection. Four weeks after initial placement, the NPWT was removed, and the defect was reconstructed with a pectoralis muscle flap, split thickness skin graft, and right paramedian forehead flap .
+A second stage surgery for division and inset was performed 4 weeks after the initial reconstruction . Following completion of reconstruction, vision testing and patient-reported vision were at baseline from prior to infection, with minimal lagophthalmos, no exposure keratopathy and no damage to the globe.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2812_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2812_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eda25d4de24406d5e02270aadb66e8419f727ef3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2812_en.txt
@@ -0,0 +1,7 @@
+A 68-year-old woman was referred to our Nephrology Department for kidney failure and a monoclonal gammopathy. Her medical history included dyslipidemia and hypothyroidism, taking statins and levothyroxine. There was no drug abuse or nephrotoxic medications. She was clinically well and did not complain of any symptoms. Physical examination was unremarkable.
+Laboratory findings included a creatinine elevation to 246 μmol/L with an estimated glomerular filtration rate (eGFR) of 17 mL/min and urea of 5.1 mmol/L. Reports from previous years showed a normal kidney function. Calcium adjusted for albumin was 2.22 mmol/L, with a total protein level of 80 g/L. Phosphate, calcidiol, and parathyroid hormone levels were normal. Lipid and hepatic profiles showed no significant alterations. Creatine kinase, thyroid hormone levels, and complete blood count were normal. Immunofixation electrophoresis confirmed a serum monoclonal IgM-lambda of 2.0 g/L. There was no evidence of albuminuria or proteinuria, with negative urine immunofixation, and no microhematuria.
+Abdominal ultrasound showed symmetrical kidneys, with normal corticomedullary differentiation.
+Laboratory tests were repeated, showing a progressive increase in serum creatinine up to 347 μmol/L (eGFR 11 mL/min) and in the serum monoclonal IgM-lambda to 7.9 g/L . Other parameters showed no significant change over time.
+Bone marrow aspiration immunophenotyping showed 4.86% B-lymphocytes with lambda light chain predominance, and Congo red stain was negative. The kidney biopsy showed a total of 16 glomeruli, one of them globally sclerosed. There was no tubulointerstitial scarring or inflammation. No alterations were observed in the cortical blood vessels . Immunofluorescence was negative as well as Congo red stain. Electron microscopy was not performed.
+To clarify the inconsistent results of an elevated creatinine with no other signs of kidney disease, we measured the glomerular filtration rate with chromium-51 labeled ethylenediamine tetraacetic acid (51Cr-EDTA), which showed a value of 77 mL/min/1.73 m2.
+These results prompted the idea that the elevated serum creatinine levels could be spurious and related to an interference with the paraprotein during the measurement method at the laboratory. The rise in the creatinine level over time was concordant with an increase in the monoclonal component, while normal urea levels were maintained. Our laboratory uses an enzymatic method to measure creatinine. The only available method in our laboratory to verify if the interference is due to the IgM paraprotein is to perform a dilution of the serum sample, thereby diluting the presence of the interfering element (IgM molecules) as well. The IgM concentration was 8,730 mg/L. A 1:4 dilution of the patient’s serum sample was carried out by mixing 100 μL of physiological saline with 300 μL of serum, and the creatinine concentration was measured. The obtained result was 27 μmol/L, which, when multiplied by the dilution factor, would yield a result of 108 μmol/L serum creatinine. The serum index measured in the sample was a hemolysis index of 4 μmol/L, an icteric index of 17 μmol/L, and a lipemic index of 21. None of these serum indices interfere with the measurement of serum creatinine concentration. We confirmed these results with a cystatin C measurement, with a value of 1.01 mg/dL (eGFR 70 mL/min). Our patient was finally diagnosed with a falsely elevated serum creatinine associated with an IgM paraprotein.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2814_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2814_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58e063a1429fa57291e0921190f10cd7a0dcc5a0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2814_en.txt
@@ -0,0 +1,7 @@
+A 73-year-old man was admitted in our hospital with abdominal pain and fatigue lasting 1 mo.
+One month before his admission, the patient developed persistent abdominal pain without obvious incentives, such as tolerable dull pain on the left side, without abdominal distension, lethargy, cold sensitivity, itchy skin, and change in skin color, among other symptoms. Since the start of the symptoms, the patient had poor appetite and spirit, and lost more than 10 kg weight.
+The patient had no history of surgery, trauma, or other diseases.
+There was no history of hereditary diseases. No family members had similar symptoms.
+The physical examination of the patient was unremarkable.
+Routine blood tests, liver and kidney function test, blood coagulation function test, hormone-related examination, and tumor marker analysis showed no obvious abnormalities. In addition, the level of serum potassium was normal.
+The adrenal enhancement computed tomography (CT) scan showed the presence of irregular masses in the adrenal glands on both sides, with the larger one being located on the left side. Its size was approximately 8.0 cm × 4.3 cm, its border was irregular, and the surrounding tissues were compressed. We did not observe any obvious enhancement in the arterial phase, nor any obvious swollen lymph nodes were noted later on .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2817_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2817_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c40c72fbe9846262039ae7971b01c3837f5243d9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2817_en.txt
@@ -0,0 +1,2 @@
+A 66-year-old woman was referred to our hospital because of right upper abdominal pain, right chest pain, and dyspnea. Her past medical history included hypertension, primary biliary cirrhosis, and rheumatoid arthritis (RA), treated with a steroid agent and interleukin-6 (IL-6) inhibitor. In addition, LC was performed for acute gangrenous cholecystitis 11 months earlier . The operative report revealed iatrogenic gallbladder perforation and stone spillage due to severe regional inflammation. The bacterial culture of the gallbladder bile tested positive for Escherichia coli. Tazobactam/piperacillin was administered from the time of surgery to postoperative day 7. Although the inflammatory markers such as white blood cell counts and C-reactive protein were improved, she had persistent fever. Computed tomography (CT) was performed and multiple dropped stones were found. However, abdominal abscess was not found on CT. Upon receiving the culture results, meropenem was administered for the next 10 days. She was discharged from the hospital on postoperative day 21.
+Chest radiography revealed a right pleural effusion . Chest CT revealed a right pleural effusion with passive atelectasis . Furthermore, abdominal CT showed perihepatic fluid collection and multiple small radiopaque density masses . The patient was treated with an antimicrobial agent (meropenem), and ultrasound-guided transthoracic drainage was performed. The bacterial culture of pleural effusion was positive for Escherichia coli, which was consistent with the culture result of the gallbladder bile in acute cholecystitis. However, the drainage was incomplete, and the prescribed treatments did not alleviate the inflammatory reaction. Consequently, thoracotomy and laparotomy with gallstone retrieval were performed. In laparotomy, the abscess in the Morrison’s fossa was opened and drained, and dropped stones around the liver were removed . The thoracic cavity was covered with membranous necrotic tissue, and a multilocular abscess was observed. However, there was no communication between the thoracic cavity and the abdominal cavity and there were no stones in the thoracic cavity . The patient’s symptoms, pleural effusion, and perihepatic fluid collection completely resolved after surgery. The patient has remained well without complications after 14 months of follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2830_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2830_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..44adccc93ec495b1f2a4c1cb70e19f362941735f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2830_en.txt
@@ -0,0 +1,2 @@
+A 46-year-old Sri Lankan man presented to our institution with high-grade fever associated with severe retro-ocular pain, photophobia, bone pain and severe body aches of three days’ duration. He was a recipient of an ABO-compatible cadaveric LT 26 months previously for treatment of end-stage cryptogenic cirrhosis. The immediate post-transplant period had been complicated by acute rejection, but he made a full recovery with an allograft. He was maintained on prednisolone 5mg daily and tacrolimus 3mg twice daily. He had developed diabetes after the third month post-LT. His two sons had had a febrile illness, diagnosed as DF, one week before coming to our institution. He did not complain of respiratory, urinary or bowel symptoms or a rash. An examination did not reveal jaundice, rashes or neck stiffness, but demonstrated a fine tremor in outstretched hands. His right frontal sinus was tender on palpation.
+His initial full blood count revealed thrombocytopenia (90,000/μL), and, with a suggestive clinical picture, a provisional diagnosis of DF was made. His skull X-ray demonstrated a fluid level in the right frontal sinus confirming acute sinusitis, which was treated with intravenous ceftriaxone 1g twice daily. Over the next few days, his white cell count and platelet count gradually dropped, reaching a nadir by day 4 of the illness. Dengue NS1 antigen was detected in his day 3 serum sample, confirming the diagnosis of DF. His liver enzymes rose sharply until day 7 before starting to recover. His bilirubin levels and coagulation profile were normal. He entered the leakage (critical) phase on day 6 of his illness, and he recovered by day 8 without any complications with standard supportive DF management. DNA detection of cytomegalovirus was negative, and his blood cultures were sterile. However, liver enzyme normalization took more than two weeks. Throughout his hospital stay, his serum creatinine was around 140μmol/L and, together with fine tremors, was suggestive of tacrolimus toxicity (T0 = 13.4ng/dL). Tacrolimus was reduced to 4mg daily as a result. His creatinine levels dropped to 104μmol/L by the time of discharge. The day 7 and day 14 dengue immunoglobulin M (IgM) titers showed an eightfold increase. Figure shows the changes in parameters over time.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2831_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2831_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fb89ed931a5aa767500c899dc996a8a824d24d9e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2831_en.txt
@@ -0,0 +1,6 @@
+A 44-year-old woman had undergone first allogeneic cord blood transplantation (CBT, 2.35 × 106/kg nucleated cells, two locus mismatch) for acute myeloid leukemia after two courses of induction therapy that led to hematologic complete remission. The patient was pre-treated with cytarabine, cyclophosphamide, and total body irradiation conditioning. Graft-versus-host disease prophylaxis consisted of cyclosporine and methotrexate. Her medical, family, and social histories were unremarkable. The patient underwent a second CBT (2.0 × 107/kg nucleated cells) 32 days after the first due to graft failure.
+Seven days after the second CBT, she presented with high fever and shaking chills. Upon physical examination, painful induration with linear erythema along the superficial veins was observed in the peripherally inserted central catheter (PICC) site, which was inserted on the day after the second CBT. Two sets of blood samples were drawn for culture and meropenem treatment was started. The blood culture was positive on the third day of incubation (10 days after the second CBT). Gram staining of a positive blood culture revealed GPR , and vancomycin was added thereafter. Fever persisted and PICC was removed on day 11 after the second CBT (PICC was maintained for 10 days). The VITEK® 2 system (bioMérieux, Durham, NC, USA) was not able to identify the organism. Blood cultures drawn on days 10, 11, 15, and 22 after CBT were also positive for GPR. On the 14th day after the second CBT, Ziehl–Neelsen staining was performed and was found to be positive for acid-fast bacilli .
+The nucleotide sequences were analyzed using the National Center for Biotechnology Information BLAST . The almost full-length (1442-bp) 16S rDNA gene sequence of the isolate shared 100% similarity to M. wolinskyi type strain ATCC 700010.
+In addition to PICC removal, imipenem/cilastatin (IPM/CS), amikacin (AMK), levofloxacin (LVX), and azithromycin (AZM) were started empirically. Antibiotic susceptibilities were determined using the broth microdilution method (BrothMIC RGM®; Kyokuto, Tokyo, Japan) based on the Clinical and Laboratory Standards Institute M24 recommendations .
+According to the susceptibilities, IPM/CS and AZM were discontinued, and minocycline (MIN) was added. LVX was changed to moxifloxacin (MFX) based on previous case series . After 1 month of intravenous administration of AMK, the patient was discharged on an oral regimen of MFX and MIN. Although MXF had to be discontinued after 4 months due to nausea, MIN was continued for 6 months.
+After 3 weeks of combination antimicrobial therapy, blood cultures became negative. She showed successful engraftment by day 28. The patient responded well to therapy and no recurrence of infection was identified at 1-year follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2832_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2832_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..47b27ae0d10a660a0636be6f90715c9d4e22194e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2832_en.txt
@@ -0,0 +1,4 @@
+A 26-year-old Colombian male without past medical history presented to the emergency department with a 1-month history of dry cough, progressive dyspnoea, and orthopnoea. On physical examination, his blood pressure was normal (110/70 mmHg), but he exhibited tachycardia (110 b.p.m.), and elevated jugular venous pressure. No cardiac murmurs or lung rales were detected. The electrocardiogram revealed generalized low voltages, and blood test results were unremarkable. A chest X-ray showed significantly enlarged cardiac silhouette . A subsequent computed tomography (CT) scan confirmed the presence of a giant aneurysm in the ascending thoracic aorta (maximum diameter 96 mm) and a massive pericardial effusion (maximum diameter 65 mm). The remaining aorta and its branches appeared to be of normal calibre. A bedside echocardiogram indicated signs of cardiac tamponade and, because of rapid worsening symptoms, emergent pericardiocentesis was performed to stabilize the patient. The obtained pericardial fluid was serosanguinous. Subsequently, the patient was admitted to the intensive care unit for further stabilization.
+A transoesophageal echocardiogram revealed severe aortic regurgitation , with a broad and dense central jet resulting from a large coaptation defect secondary to the enlarged ascending aorta. Holodiastolic flow reversal in the descending aorta was observed, with an end-diastolic velocity of 40 cm/s. The estimated effective regurgitant orifice area was 1.5 cm2. Left ventricular diameters and function were normal, suggesting an acute/sub-acute onset. The overall clinical presentation strongly indicated an impending aortic rupture. On 4th day, the patient underwent ascending aorta replacement with a Bentall´s procedure using a 25 mm CarbosealTM mechanical prosthesis and a 28 mm Dacron aortic graft. The excised tissue was sent for pathological analysis, which revealed a thin aortic wall and histological evidence of medial degeneration and disorganization of elastic fibres . There were not intra- nor post-operative complications, and the patient was discharged from the hospital after 1 week.
+Following discharge, the patient was assessed by the Inherited Cardiovascular Diseases Unit. While there was no significant family history, physical examination unveiled dolichocephaly with mild retrognathia, arachnodactyly, joint laxity, and a high-arched palate. The Gante’s systemic score was 4. A genetic study using next generation sequencing (NGS) encompassing 64 genes related to aortic and connective tissue disorders was conducted. The genetic variant c.409A > T, p.Ser137Cys, in EFEMP2 was identified in homozygous state. Cascade screening of first-degree relatives revealed that they were healthy heterozygous carriers.
+Subsequent CT scan of the entire vascular system 1 year after surgery did not reveal aneurysms in other locations, although arterial tortuosity was noticed. After 2 years of follow-up, the patient has been managed with losartan 50 mg and acenocoumarol, with no further reported events.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2835_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2835_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e069d72dd1a4dbccd8eec70a1a334ee66b4ba7c1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2835_en.txt
@@ -0,0 +1,3 @@
+A 6-month-old female (body height 65 cm, body weight 6.6 kg) with tetralogy of Fallot, pulmonary artery atresia, and major aortopulmonary collateral artery (MAPCA) underwent palliative reconstruction of the right ventricular outflow tract and unifocalization of the MAPCA. Anesthesia was induced with sevoflurane, and the trachea was intubated with an uncuffed 3.0-mm tube. After induction, anesthesia was maintained with fentanyl, midazolam, and rocuronium. A total dose of 100 mcg/kg fentanyl and 1.5 mg/kg midazolam was administered during the operation. The operation was uneventful until separation from cardiopulmonary bypass, when her oxygen saturation could not be maintained due to the presumably high resistance of the pulmonary artery. Thus, she was transferred to the ICU with the sternum open, supported by venoarterial extracorporeal membrane oxygenation (ECMO). She was weaned off ECMO on the third day of admission (day 3) to the ICU. However, she required prolonged mechanical ventilation for the following reasons. First, venoarterial ECMO support was reinitiated on day 6 because an attempt of delayed sternal closure led to severe desaturation due to pulmonary hypertensive crisis. Second, percutaneous balloon dilatation of the left pulmonary artery stenosis performed on day 13 was complicated by severe bleeding from the trachea. Furthermore, on day 28, she experienced non-obstructive mesenteric ischemia and underwent exploratory laparotomy, resulting in marked abdominal distention and generalized edema.
+She was finally weaned off ECMO support on day 36. The patient was sedated with dexmedetomidine, midazolam, fentanyl, and chlorpromazine hydrochloride during treatment in the ICU, but the drug doses were gradually decreased, resulting in minimum use of sedatives on day 52 (fentanyl 0.2 mcg/kg/h, midazolam 0.03 mg/kg/h, and dexmedetomidine 0.2 mcg/kg/h). On day 52, she met the extubation criteria with a rapid shallow breathing index of 6.5 and improved dynamic Crs at 0.65 mL/cmH2O/kg with no clinical signs of high airway resistance. Thus, her trachea was extubated on day 52. After extubation, ventilation and oxygenation were not problematic with high flow nasal cannula support for several hours with no clinical signs of upper airway stenosis. However, she became restless with sternal retraction several hours after extubation, suggesting increased respiratory effort. The arterial blood gas analysis showed elevated pCO2 (53 mmHg), and she was reintubated 20 h after extubation.
+After reintubation, Edi monitoring was initiated to assess diaphragm function. Measurements were carried out using a 12 Fr Neurally Adjusted Ventilatory Assist (NAVA) catheter attached to a SERVO-i ventilator (Maquet Critical Care, Solna, Sweden). The catheter position was adjusted with the Edi catheter position tool equipped in the NAVA software and confirmed by daily chest X-rays. Mechanical ventilation was managed by the Synchronized Intermittent Mandatory Ventilation (SIMV) mode with pressure support (PS) and positive end-expiratory pressure (PEEP) properly applied to ensure respiratory muscle unloading. Her typical Edi values during SIMV were in the range of 10–20 mcV. Daily SBTs from 15 min to 30 min (PS 5 cmH2O, PEEP 5 cmH2O) were performed from day 53. The maximal Edi and NVE values were recorded during the SBTs . In summary, the Edi during the SBTs was higher than 70 mcV just after the reintubation, indicating a strong inspiratory effort to deliver normal tidal volume; the Edi decreased gradually day by day while the tidal volume showed nearly constant values, leading to improvement of NVE. On day 58, her Edi values during the SBTs were 10–20 mcV, comparable to those during SIMV, and her trachea was extubated. After extubation, the patient received high-flow nasal cannula support and did not experience reintubation owing to respiratory collapse. She was discharged from the hospital without oxygen support on day 158.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2842_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2842_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0b6e130da6771e2e3a2d8e18f40f4ec1357bd285
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2842_en.txt
@@ -0,0 +1,5 @@
+A 20-year-old male with no known past medical history or allergies presented to the emergency department (ED) complaining of acute, sudden onset, left forearm pain and rash. The patient was working at an eyeglasses and contacts store and stated that the pain started when he knelt to lift something up from ground level. In doing so, he placed his left elbow on his left thigh. He immediately felt a stinging sensation in his left elbow with severe 10/10 pain radiating down the extremity to the left forearm and hand. Shortly afterward he noticed the affected area had become erythematous, thus he presented to the ED for an emergent medical evaluation. Pertinent negatives included absence of fever, chills, cough, shortness of breath, chest pain, nausea, vomiting, diarrhea, urinary complaints, back pain, and headache.
+The patient arrived hypertensive with initial blood pressure measuring 130/91 millimeters of mercury. Triage vital signs were otherwise normal. On physical examination, the patient appeared anxious. The primary survey of airway, breathing, and circulation was unremarkable. Focused examination of the affected region demonstrated an approximately 1 × 2-cm area of erythema and edema over the proximal posterior forearm with an associated grid-like pattern of raised urticaria. The rash was localized and did not exhibit desquamation .
+The left upper extremity was otherwise neurovascularly intact with a palpable radial pulse and capillary refill less than three seconds. Assessment of motor function and active and passive range of motion at the elbow was normal. Laboratory assessment and imaging were determined to be of no utility and were not ordered. Upon further inquiry, the patient mentioned that his arm may have contacted a caterpillar, which was found on the ground at the site where his pain first began. A photo of the caterpillar was eventually obtained and provided on the patient’s smartphone .
+The emergency physician called the Poison Control Center (PCC) hotline, which confirmed that the symptoms were likely the result of an asp caterpillar envenomation. Of note, the expert at the PCC mentioned that the presentation was particularly unusual given that it occurred in a commercial building devoid of trees and foliage. Other diagnoses considered were allergic reaction, insect bite/sting, contact dermatitis, cellulitis, and traumatic injury.
+Therapeutic management focused on aggressive symptom management. Due to concern for a developing hypersensitivity reaction, dexamethasone 8 milligrams (mg) intravenous (IV), acetaminophen-codeine 300-30 mg per os (PO), famotidine 20 mg IV, ketorolac 30 mg IV, and diphenhydramine 25 mg IV were administered. Upon further inspection of the affected area, several spines were visualized penetrating the patient’s skin. Silk tape was applied to the affected area and carefully removed, thus stripping away the offending spines. The patient’s pain rapidly improved. The patient received an additional 25 micrograms of fentanyl IV after reassessment an hour later. He underwent a period of observation in the ED and was discharged with prescriptions for methylprednisolone 4 mg PO and oxycodone-acetaminophen 5–325 mg PO. Attempts to contact him after discharge to arrange follow-up and a wound check were unsuccessful. There were no subsequent patient encounters documented in the electronic health record.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2846_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2846_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d7f1b58c1ae97fc1cee9e7c1b458662b4d1427f6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2846_en.txt
@@ -0,0 +1,2 @@
+A 40-year-old woman was admitted for ENT, head and neck surgery emergency care with a 02-week history of fever, pharyngeal foreign body sensation, odynophagia and right-sided neck pain and swelling. She had no clear history of malignancy, central venous catheterization, coagulation disorders, cervical trauma or any foreign body ingestion, genetic and family histories were unremarkable. Physical examination revealed erythematous swelling over the right side of the neck. Nasofibroscopy showed pyriform sinus edema with purulent secretions filling the hypopharynx. Complete blood count (CBC) showed his white blood cell count was (17,000)/mm3 with predominant neutrophil, C-reactive protein was 62 mg/l. Contrast-enhanced computed tomography scan revealed Abnormal low attenuation within the parapharyngeal space and along the carotid space indicates cellulitis , with a vascular filling defect in the left internal jugular vein to left subclavian vein region, penetrated by a metal density foreign body (, ). On the basis of the above findings, we diagnosed the patient as having an ingested foreign body complicated by cervical cellulitis and thrombosis of the internal jugular vein.
+Because of the cervical cellulitis and the presence of a foreign body, an intravenous probabilistic antibiotic therapy is initiated immediately consisting on third-generation cephalosporins 2 g/24 h, Metronidazole 500 mg/8 h and aminoglycoside 160 mg/24 h, 02 h later a qualified surgeon with 20 years of experience decided to proceed to surgery for better exposure and also effective drainage of fluid collection. Via an incision anterior to the left sternocleidomastoid muscle, the parapharyngeal space was explored and the carotid sheath was opened. A 4 cm sewing needle was found extending transversely into the right jugular vein and the sternocleidomastoid muscle at the level of the thyroid cartilage and thrombosed right internal jugular vein. After removal of the needle, unfractionated heparin was administered intravenously, then the internal jugular vein was ligated proximal and distal to the site of injury. Drainage of abscess cavities and debridement of necrotic tissues were done, and samples were sent for culture. A Penrose drain was inserted, the skin was closed with separate stitches, and systemic heparinization was ceased. The pus culture did not show any organism and the intravenous probabilistic antibiotic therapy was continued. The postoperative course was uneventful, and liquid diet was started on the 3th postoperative day. After a normal barium esophagram, the patient was discharged on the 7th postoperative day and was ordered to complete 02 weeks of oral antibiotic therapy. Within a month the swelling completely disappeared, dysphagia improved, and the patient became normal. The patient is in the 12th month of her follow-up and no complications have been observed during this period.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2850_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2850_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d6357342d51b60221783c9ad317812bfc7d88917
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2850_en.txt
@@ -0,0 +1,8 @@
+A 93-year old man was brought to the emergency room for recent neurological deterioration. His past medical history was relevant for hypertension, diabetes mellitus, dyslipidemia, coronary artery disease, chronic atrial fibrillation and mild memory loss. He had no history of kidney disease. His chronic medication included clopidogrel, acenocoumarol, amlodipine, atorvastatin, molsidomine and furosemide; he was on levofloxacin since two weeks for pneumonia. On admission, the patient’s physical examination revealed obnubilation with episodes of agitation, a blood pressure of 160/80 mmHg, an irregular heart rate of 50 beats per minute (bpm), jugular venous distention, decreased bilateral basal breath sounds, no fever and no leg edema. He was not obese. Initial abnormal serum laboratory results included: white blood cell (WBC) count of 12630/mm3 (84 % neutrophils), international normalized ratio (INR) of 4.5, creatinine of 2.3 mg/dL (203 μmol/L), blood urea nitrogen (BUN) of 80 mg/dL (28.5 mmol/L), albumin of 3.2 g/dL (32 g/L), phosphorus of 5.9 mg/dL (1.96 mmol/L) and gamma glutamyl transferase of 275 UI/L. He had a positive troponin I of 0.27 ng/mL but normal CPK and CPK-MB. C-reactive protein was 19 mg/L. He had no electrolytes’ disturbance (potassium 4.9 mmol/L, sodium 144 mmol/L, chloride 110 mmol/L, bicarbonate 23 mmol/L), no hypocalcemia (corrected calcium 8.9 mg/dL) nor anemia (hemoglobin 13.4 g/dL, hematocrit 42 %). Urinalysis showed 3+ protein.
+Further investigations revealed left lung basal consolidation with bilateral effusion on chest X-ray. The arterial blood gas (ABG) showed: pH 7.27, PaO2 91 mmHg, PaCO2 52 mmHg, HCO3ˉ 23 mmol/L. Electrocardiogram (ECG) on admission showed a slow atrial fibrillation of 55 bpm . Brain computed tomography (CT) scanning ruled out possible ischemic or hemorrhagic stroke.
+The patient was admitted to the intensive care unit (ICU). An echocardiography showed a left ventricular ejection fraction (LVEF) of 40 %, ventricular hypertrophy, pulmonary arterial pressure of 40 mmHg, dilated right ventricle and slightly enlarged left atrium. Renal ultrasound was normal.
+Empiric antibiotics were started combining ceftriaxone and levofloxacin; fluconazole was added at day 2 after sputum cultures grew Candida albicans. Urine culture was sterile.
+During cardiac monitoring in the ICU, episodes of extreme bradycardia were noticed as low as 32 bpm with maintained systolic blood pressure at 100–120 mmHg and very low diastolic blood pressure of 30–40 mmHg.
+On day 3, the patient became unconscious and developed severe respiratory acidosis with ABG showing: pH 7.16, PaCO2 64 mmHg, PaO2 75 mmHg, HCO3ˉ 22 mmol/L and he was intubated. He concomitantly became oligoanuric and serum creatinine started to increase. A spot urine test revealed a sodium (Na) of 22 mmol/L and potassium (K) of 34 mmol/L with a ratio Na/K <1. He received sodium bicarbonate whenever his bicarbonate level was less than 22.
+Complete AV block was then identified on ECG. A temporary pacemaker was implanted on day 5 and the patient was extubated. Serum creatinine decreased and urine output improved considerably. Table illustrates the heart rate (HR), urine output, systolic and diastolic blood pressure values, serum creatinine and potassium variations before and after the pacemaker insertion.
+The patient finally got a permanent single chamber pacemaker VVIR and improved considerably his consciousness and renal function. At discharge he had a serum creatinine of 1.6 mg/dL and he was conscious, alert and well oriented.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2856_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2856_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..36aad2e40a6c067218cf9aca4c7cbb8e9719659b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2856_en.txt
@@ -0,0 +1,2 @@
+A 70-year-old female with a history of three years of right shoulder pain presented with limitation in both active and passive ranges of motion. Upon physical examination, Jobe's test and Hawkins test both showed positive results, indicating dysfunction of the rotator cuff and impingement in the shoulder joint, respectively. Plain radiograph showed joint space narrowing with bone deformity, sclerotic change, and subchondral cyst formation in the glenohumeral joint; the patient was thus diagnosed as advanced osteoarthritis. MRI evaluation revealed an approximately 1 cm tear in the rotator cuff, specifically in the supraspinatus muscle on its articular side, as well as tendinosis and subtle muscular signal change in distal subscapularis . The patient underwent an anatomic shoulder arthroplasty considering the functional deltoid muscle.
+The deltopectoral approach was used for the surgery. Upon blunt dissection to the subdeltoid and subacromial spaces, a superior portion of the pectoralis major muscle was released. The subscapularis tendon was released from its insertion site followed by capsulotomy. A distinct muscular structure was found at the anterior-inferior aspect of the glenoid rim , which was not determined as part of the glenoid labrum. This muscle was carefully tagged and dissected near its origin site to allow glenoid reaming. A routine anatomic total shoulder arthroplasty was carried out afterwards. The muscle was repaired along with the SM. No major complications were found. The patient was discharged at seven days postoperation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2867_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2867_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..10b149a6a1c9f221927e337dc01fb23b0b22c62d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2867_en.txt
@@ -0,0 +1,4 @@
+A 40-year old female haemodialysis-dependent patient had a 2 year history of chronic refractory severe hypotension (≤80/50 mmHg). Previous treatment with α1-adrenergic agonist, mineralocorticoid analog and optimization of dialysate composition with sodium concentration >140 mmol/L and use of bicarbonate buffers had been non-effective. Aetiology of renal failure was reflux nephropathy. She had right native nephrectomy and left native pyeloplasty performed 21 years previously. She received a cadaveric renal graft 13 years ago which failed 9 years later because of chronic allograft nephropathy. The failed graft was removed 3 years previously due to recurrent sepsis. She had been anuric for the last 4 years. There was no history of diabetes, heart failure or ischemic heart disease. She had been on hemodialysis for 6 years following failed peritoneal dialysis. Dialysis adequacy during the 6 months prior to transplant was recorded with urea reduction rate of 75 % and Kt/V (measure of clearance per dialysis factored for patient size) of 1.6.
+Computed tomography scan revealed a grossly atrophic native left kidney. Transthoracic echocardiography showed normal valves, pericardium and ejection fraction was 62 %. Measures of central vascular stiffness were normal with carotid-femoral pulse wave velocity (PWV) of 5.9 m/s (reference range: 4.5–9.6 m/s) and augmentation index corrected to heart rate (AIx75) of 21 % (reference range: 19–24 %). Myocardial perfusion scan was normal. On maximal cardiopulmonary exercise testing (CPET) , oxygen consumption at peak exercise (VO2peak) was 18 ml/min/kg (73 % of predicted VO2peak) . Following 3 min rest, pedaling without load (freewheel stage of exercise) produced a 50 % increment in BP from baseline. An exaggerated rise in SBP and diastolic BP (DBP) was recorded at maximal work load, whereby BP rose from 82/50 mmHg to a peak of 201/120 mmHg (ΔSBP/ΔDBP = 119/70 mmHg). At this point, the patient abruptly ceased pedaling and a rapid decline in BP to baseline level was documented .
+The patient proceeded to have an HLA antibody-incompatible kidney transplant. Immunosuppression consisted of mycophenolate mofetil, tacrolimus and prednisolone. A single dose of 500 mg methylprednisolone intra-operatively and basiliximab 20 mg were given at days 0 and 4. Pre-operatively she underwent seven sessions of HLA antibody removal therapy [, ] with cryofiltration, with a further two sessions (day 1 and 2) following surgery and one session of double filtration plasmapheresis on day 3. During the intraoperative period, her BP was supported by infusion of metaraminol. Post-operatively, she was vasopressor reliant for 14 days at which point the creatinine was 133 μmol/l (eGFR 41 ml/min/1.73 m2).
+Eight weeks following transplantation, her resting BP without anti-hypertensive agent was 124/82 mmHg. Graft function was moderate with eGFR 39 ml/min/1.73 m2. On repeat CPET, SBP rose uniformly but DBP did not rise from baseline (ΔSBP/ΔDBP = 19/-13 mmHg) . VO2peak was comparable to the pre-transplant measure but there was improvement in the anaerobic threshold following transplant (VO2AT, 48 vs. 41 % of predicted VO2peak). Cortisol, renin and aldosterone levels at rest were (pre- vs. post-transplant) 433 vs. 356 nmol/l, <9 vs. 9 mU/l and 515 vs. 372 pmol/l, respectively .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2871_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2871_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..297b6051358819c3e74006fd4a92239d28563074
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2871_en.txt
@@ -0,0 +1 @@
+An 81-year-old man presented with abdominal discomfort. Computed tomography imaging revealed a large tumor with intermediate signal intensity, showing heterogeneous contrast enhancement in the subphrenic area and the feeding artery originated from the diaphragm . Within several days, he suddenly experienced loss of consciousness. Serum examination indicated hypoglycemia (glucose levels, 18 mg/dL). Insulin (1.05 μIU/mL), C-peptide (0.71 ng/ml), and IGF1 (39 ng/mL) levels were all relatively low but still within the physiological range. Western blot analysis of the patient’s serum revealed overexpression of high-molecular-weight IGF-2 designated “big IGF-2” . Along with glucose compensation, the patient underwent surgery for total tumor resection. In the operative view, the large tumor appeared to compress the right lobe of the liver without invasion. The feeding artery originating from the diaphragm was ligated and divided. A part of the diaphragm was resected with autosuture owing to firm adherence of the diaphragm to the artery. The tumor was then dissected along the liver surface without simultaneous resection of any other organs, and a tumor-free margin was achieved macroscopically. The tumor measured 34 cm at the major axis and weighed 1350 g and was well demarcated by a fibrous membrane. The resected surface was elastic, firm, had an ivory-like appearance, and was multilobulated with trabeculation. The solid component was predominant, and a small myxoid component was also noted . Microscopically, spindle cells generally constituted the tumor without specific cellular arrangement in the solid component . A few areas in this component demonstrated keloid-like collagenous stroma and stag horn-like vessels. However, some areas with myxoid appearance upon gross examination revealed a multi-cystic formation by cavernous hemangioma-like septa. Karyokinesis was detected in more than 0/10 high-power fields in the hypercellular area. Necrosis was obscure. Immunohistochemically, the tumor cells expressed STAT6 and CD34. The highest Ki-67 labeling index was 15%. These results confirmed that the tumor was a malignant SFT. In addition, the tumor cells exhibited cytoplasmic IGF2 expression , specifically with paranuclear dot-like reactivity. The tumor cells were positive for IGF2R but negative for IGF1R. Since surgery, the patient has been free from tumor recurrence and hypoglycemia for more than 24 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2872_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2872_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f1886858148eab2b51b6349b0be3d46b699388a4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2872_en.txt
@@ -0,0 +1,6 @@
+Our patient was a 37-year-old, obese, previously healthy white woman. She was a smoker with no family history of ischemic heart disease. Her recent history involved 3 weeks of respiratory tract infection treated with antibiotics and bronchodilators.
+She was admitted to our hospital after experiencing a witnessed out-of-hospital cardiac arrest. Bystander CPR was immediately performed for 7 minutes, followed by advanced CPR that included tracheal intubation and mechanical chest compressions provided by the physician-led ambulance team. Her electrocardiogram (ECG) revealed ventricular fibrillation, and she underwent external defibrillation with return of spontaneous circulation. Upon hospital admission, the patient’s blood pressure (BP) was 94/45 mmHg and her heart rate was 110 beats per minute. Her ECG initially showed atrial fibrillation with spontaneous conversion to sinus rhythm and no signs of ST-segment elevations or Q-wave development. Computed tomography (CT) scans of her head and chest were reported normal.
+Coronary angiography revealed a proximal thrombotic occlusion of the left anterior descending (LAD) coronary artery. Successful recanalization of the LAD coronary artery after catheter-based thrombus aspiration, and balloon dilation followed by stent implantation, was verified with normalized anterograde flow (Thrombolysis in Myocardial Infarction grade flow score 3), and an eptifibatide infusion was instituted.
+Immediately after the patient’s arrival in the intensive cardiac care unit (ICCU), a drop in her BP to 60/30 mmHg and a hemoglobin concentration of 4.5 g/dl were noticed. Transfusion was started, the patient’s abdomen was distended, and bedside abdominal ultrasound (US) examination revealed free intraperitoneal fluid. Abdominal CT performed after initial stabilization revealed liver injury with active extravasation from the cranial surface of the right lobe and a massive hemoperitoneum.
+At that point, the patient was coagulopathic with a body temperature of 33.5 °C. Arterial blood gas analysis revealed a pH of 7.15 and a lactate concentration of 7.4 mmol/L. Angiography and selective transcatheter arterial embolization were successfully performed in combination with evacuation of 4.5 L of intraperitoneal blood through a 16-French pigtail catheter inserted into the right flank under US guidance .
+After completion of these procedures, the patient was transfused with a total of 9 U of packed red blood cells, 8 U of plasma, and 2 U of platelets (pooled from five donors each) and was hemodynamically stable. She was weaned off mechanical ventilation 2 days later and thereafter made an uneventful recovery. She was discharged to a local hospital on day 13 without neurological disability.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2878_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2878_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7f12d3fd568d2472f9bda8c4b47e1561ff24923d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2878_en.txt
@@ -0,0 +1,2 @@
+A 48-year-old Japanese man presented with symptoms of right-sided facial asymmetry and right hand palsy that had lasted for 10 days. He had a past medical history of syphilis, gonorrhea, varicella, hepatitis B viral infection, and chronic use of tobacco (1–2 packs of cigarettes per day for 28 years). Laboratory examinations revealed positivity for human immunodeficiency virus (HIV) antigen/antibody, a CD4 positive lymphocyte count of 84 cells/μL, and an HIV-1 RNA viral load of 180,000 copies/mL. Contrast-enhanced magnetic resonance imaging of the head showed three mass lesions in the brain, and the specimen biopsy from these lesions revealed diffuse large B cell lymphoma. He was diagnosed with AIDS-associated primary brain malignant lymphoma. The patient was administered emtricitabine/tenofovir disoproxil combination therapy and raltegravir as the antiretroviral therapy. Atovaquone and azithromycin were also used for prophylaxis of pneumocystis pneumonia and nontuberculous mycobacterial infections.
+A PICC was implanted, and he received five courses of R-CHOP chemotherapy (, , , , and prednisone). Five days after the last R-CHOP chemotherapy course, he suddenly developed a fever with shivering chills. His white blood cell count was 4300/μL, and his neutrophil count was 4200/μL. The CD4-positive lymphocyte cell count was 228 cells/μL, and the HIV-1 RNA viral load was 20 copies/mL. We administered 2 g cefozopran hydrochloride, which is a fourth generation cephalosporin, and vancomycin on day 1 (every 12 h) and on day 3, respectively, and the PICC was removed. The patient’s condition improved and become afebrile within 48 h after the initiation of cefozopran hydrochloride. Cultures obtained from blood and revealed gram-positive rods, which were identified as T. pulmonis using 16S ribosomal RNA gene sequencing. The colony count of T. pulmonis grown from PICC culture was 103 colony-forming units. Thus, he was diagnosed with T. pulmonis bacteremia resulting from a PICC-related bloodstream infection. Because of the results of the susceptibility test , we continued cefozopran hydrochloride for 16 days. Follow up blood culture on 5 days after treatment was negative and clinical relapse was not observed. He remains in complete remission as of this report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2881_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2881_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ba9b76576b472e382143d640c3d4d8c68c0256dc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2881_en.txt
@@ -0,0 +1,5 @@
+A 45-year-old black Ethiopian man presented to our COVID-19 isolation center with intermittent dry cough and dyspnea for 05 days associated with new onset mild holocranial headache, low grade fever, myalgia and arthralgia. One day after his admission to the center, he started to develop blurring of vision associated with worsening of the headache. He also had one episode of projectile vomiting of ingested matter. He had no known chronic medical illnesses and no history of drug intake including vitamin A derivatives and tetracycline before the onset of the aforementioned symptoms.
+Physical examination revealed blood pressure of 127/91 mmHg, pulse rate of 98 beats per minute, respiratory rate of 28 breaths per minute, oxygen saturation of 86% without oxygen and 92% with 2 L/min intranasal oxygen and body mass index (BMI) of 22.8 kg/m2. He had bilateral coarse crepitation over his lower lung fields. He was conscious with Glasgow Coma Scale (GCS) of 15/15 and all the cranial nerves were intact with normal visual acuity (20/20) and visual fields. Meningeal signs were negative and there were no sensory or motor deficits.
+Upon investigations, he tested positive for SARS-CoV-2 with nasopharyngeal swab polymerase chain reaction (PCR) and he had mild leukocytosis with left shift and lymphopenia. Lumbar puncture was performed after doing brain magnetic resonance imaging (MRI) and cerebrospinal fluid (CSF) opening pressure appeared high, though it was not measured. The other laboratory results were non-remarkable .
+Brain MRI revealed prominent subarachnoid space around the optic nerves and bilateral papilledema, but didn’t show any mass lesion, hemorrhage, or cerebrovascular lesion and brain magnetic resonance venography (MRV) was normal . Chest x-ray revealed bilateral ground glass opacities mainly in the middle and lower lung zones with right side blunted costophrenic angle which was suggestive of COVID-19 pneumonia .
+The patient initially received supportive therapies for severe COVID-19 infection including IV antibiotics, dexamethasone 6 mg IV daily, intranasal oxygen, and prophylactic dose of unfractionated heparin. Acetazolamide 250 mg three times daily was added after establishing the diagnosis of idiopathic intracranial hypertension. He was then followed clinically if he could have an indication for ventriculoperitoneal shunt but his headache and blurring of vision improved and he did not require any surgical intervention. He was finally discharged after 10 days of inpatient supportive medical treatment with significant improvement except occasional cough and mild headache. He did not have any complaint upon reevaluation on the second week of discharge and the acetazolamide was discontinued. He was then doing well throughout his follow up over 6 months in the outpatient department.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2882_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2882_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ed59fa7714ac7070c342f8193edc4e970a7c8577
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2882_en.txt
@@ -0,0 +1,11 @@
+A 29-year-old woman presented to our clinic complaining of a six-day loss of visual acuity in her left eye.
+The patient’s symptoms began a month ago, with a decrease in the visual acuity of the left eye, which had worsened over the last six days. Recently, the patient had eaten a great deal of fried food, and she had poor blood glucose control. No other diabetic complications were observed.
+The patient had had type 2 diabetes mellitus for two years almost certainly because of poor diet and lack of exercise. The patient had been treated for diabetic retinopathy and followed up at our hospital.
+The patient had diabetes for two years and denied any diagnoses of family history. The patient had normal menstruation.
+The physical examination was normal.
+The results of the laboratory examinations revealed the following: total cholesterol (CHO) level of 13.98 mmol/L (3.6–6.5); triglyceride (TG) 20.55 mmol/L (0–1.71); high density lipoprotein (HDL) 0.75 mmol/L (0.83–1.96); low density lipoprotein (LDL) 6.91 mmol/L (0–3.36); apolipoprotein-A1 0.64 g/L (1.0–1.6); apolipoprotein-B 0.49 g/L (0.6–1.1); total protein 85.8 g/L (65–85); fasting blood glucose 10.89 mmol/L (3.9–6.1) ; glycosylated hemoglobin 12% (4.5–6.3); hemoglobin 216 g/L (115–150); mean corpuscular hemoglobin (MCH) 46.2 pg (27–34); MCH concentration 548 g/L (316–354); erythrocyte sedimentation rate 40 mm/h (0–20); and blood uric acid 424 μmol/L (140–340). Normal reference values are shown in parentheses after the results. The results of other blood routine tests for C-reactive protein 4.45 mg/L (0–10), liver function, kidney function, electrolytes, and homocysteine were normal. A B ultrasound of bile, pancreas, and spleen, an electrocardiogram, and a computed tomography of chest showed normal results. The B ultrasound showed that the patient had fatty liver.
+Fundus color images (Kowa, Nonmyd 7, Kowa, Japan) showed a pink–white color of the fundus, arteries, and veins. Arteries and veins could not be distinguished by color, only by the caliber of the vessels . The fundus of the left eye was covered by vitreous blood. Only the optic disk could be seen .
+Infrared images (Heidelberg Spectralis, Heidelberg Engineering, Heidelberg, Germany) showed hyperinfrared reflection of arteries and veins, unlike the hypoinfrared reflection of the normal fundus. Arteries and veins could not be distinguished by infrared reflection .
+Optical coherence tomography (OCT) (Heidelberg Engineering, Heidelberg, Germany) showed numerous high point-like reflections in the retinal section, which corresponded to different caliber blood vessel sections . The big vessels in the choroid showed medium reflections, unlike the low reflections of normal choroid vessels. Careful observations were required to detect the great choroidal vessels .
+Fundus fluorescein angiography (FFA) (Heidelberg Spectralis, Heidelberg Engineering, Heidelberg, Germany) showed no significant difference in retinal filling time and fundus fluorescence between the patient’s hypertriglyceridemia condition and a normal blood lipid condition .
+The patient also underwent optical coherence tomography angiography (OCTA) (Avanti RTVue XR100-2, Optovue Inc, Fremont, CA, United States). The retinal blood flow showed decreased vascular density in the macular area consistent with the fundus fluorescein angiography, which was caused by diabetic retinopathy .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2890_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2890_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a0356cf7121dbb5a45a458e8a377e30b029ecf81
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2890_en.txt
@@ -0,0 +1,6 @@
+The patient was a 43-year-old woman with recurrent but non-documented right leg DVT during past 13 years. She used intermittent oral anticoagulation some years after first episode of her DVT and she complained of worsening right leg swelling, pain, formation of new varicose veins, and fatigue.
+She had no specific medical or surgical illness and she have had 2 successful and uneventful pregnancies with normal vaginal delivery in spite of poor compliance to medical surveillance and lack of anticoagulant regimen during pregnancy period.
+The patient was referred to our endovascular clinic for further assessment. In her physical examination, the right lower extremity was edematous with some hyperpigmentation and.
+telangiectasia on her right leg. Additionally, prominent varicose veins were noticed on the right side. There were no active or healed ulcers on either lower extremity. Other cardiovascular examinations were unremarkable especially in terms of right-sided heart failure. The Villalta score for the further assessment of post-thrombotic syndrome based on its latest variables was 12, indicating a moderate post-thrombotic syndrome score (Kahn ; Kahn et al. ).
+The patient underwent a Doppler ultrasonography of both lower extremities, which revealed chronic post-thrombotic changes in the deep venous system with evidence of blunted pulse-Doppler waves of the right-sided veins. For detailed imaging of these findings, we had a computed tomography (CT) venography of both lower extremities depicted .
+Unpredictably, the reconstructed image showed chronic post-thrombotic changes in the right lower extremity including right femoro-popliteal veins with the formation of a left-sided IVC after the union of both iliac veins, which extended to the hemiazygos vein. As the patient’s symptoms persisted enduringly, we decided to perform venography to determine the precise pathology of these changes. Preprocedural cardiac evaluations showed no abnormal echocardiographic or electrocardiographic findings. As is shown in Fig. , the lower extremity venous system after the iliac veins formed the left-sided IVC. Chiming in with the CT venography findings, the left-sided IVC extended to the hemiazygos vein and terminated at the SVC. On the other side, there was a suprarenal right-sided IVC, which joined the hepatic venous system and finally drained into the right atrium. There was also some evidence of compression on the right iliac vein and the proximal part of the left-sided IVC, suggesting the atypical MTS as the main cause of the patient’s chronic symptoms. We decided to perform balloon venoplasty for symptom relief and we deferred the stenting for next session if the patient symptoms does not relieve with venoplasty and compression therapy. The final venography demonstrated the acceptable outflow of both IVCs. The balloon venoplasty of the compressed venous system improved our patient’s venous hypertension as was reflected by improvements in both her subjective symptoms and her Villalta score. The patient was discharged the following day with oral anticoagulants, and she was asked to return for a follow-up the next month for the final approach like stenting if her symptoms persist.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2899_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2899_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2216b5ef06547945ab2a57b6274bc00dedf001b6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2899_en.txt
@@ -0,0 +1,7 @@
+A 22-year-old male (II:3; Figure ) from Southwest China was admitted to the Second Affiliated Hospital, Zhejiang University School of Medicine to address involuntary movements of the four extremities and dysarthria lasting for several years.
+Aged 16 years, the patient experienced involuntary shaking of the bilateral upper limbs, with gradual lower limb involvement over the next few years, resulting in disruption of his walking balance. Three years previously, the patient experienced an inability to speak clearly and fluently and he achieved only a junior middle school education. Despite numerous visits to his doctors, the patient did not obtain a definitive diagnosis nor effective treatment. When he presented to our clinic, he exhibited worsening ataxia and myoclonus resulting in impaired walking ability and difficulties with communication.
+The patient had a free previous medical history.
+The patient’s parents were in a nonconsanguineous marriage and neither they nor his elder sister complained of the same symptoms.
+The neurological examination revealed slurred speech, intention tremor, ataxia, and marked hyperreflexia. His cognition was normal. He had normal eye movement, no nystagmus, and denied visual symptoms, such as blurred vision and visual field defects.
+His routine laboratory test results were unremarkable and there were no abnormalities in his EEG. Electromyography and nerve conduction velocity examination of the patient indicated reduced motor nerve conduction velocity and prolonged motor latency in the left peroneal nerve.
+Cranial MRI showed slight atrophy of the bilateral cerebellum . Fundus photographs of both eyes showed absence of a cherry-red spot (not shown).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2905_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2905_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6f742a27f48697be941c401c0b1ef47696c36a89
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2905_en.txt
@@ -0,0 +1,6 @@
+The patient provided informed consent for the procedure and the publication of anonymized case details presented in this report.
+A 52-year-old woman (height, 155 cm; weight, 64 kg) with HAE was scheduled for laparoscopic cholecystectomy. An immunology clinic confirmed the presence of HAE at the age of 39, and the patient was diagnosed with type-I HAE according to genetic testing. Tranexamic acid 1000 mg and danazol 100 mg had been administered daily for long-term symptom control. In addition, prednisolone 4 mg was orally administered due suspected systemic lupus erythematosus. Preoperative blood tests revealed mild liver dysfunction (total bilirubin, 1.9 mg/dL; aspartate aminotransferase, 41 IU/L; alanine aminotransferase, 75 IU/L). Chest X-ray imaging, electrocardiography, and respiratory function tests were normal.
+Previously, the patient had repeatedly developed signs of angioedema at a frequency of once every 2–3 months. Nasal obstruction, edema around the cervical region, or a feeling of discomfort in the throat due to angioedema were reported, necessitating emergency infusion with C1-esterase inhibitor concentrate (Berinert® P, CSL Behring, Germany) to relieve the symptoms.
+During preoperative planning of anesthesia for the current surgery, avoiding tracheal intubation to reduce the risk for tracheal angioedema was considered. Wall-lifting laparoscopic surgery was scheduled so that surgical stress could be managed using combined spinal-epidural anesthesia.
+Danazol, tranexamic acid, and prednisolone were administered orally on the morning of the day of surgery; in addition, 1500 U of C1-esterase inhibitor was administered intravenously 2 h before the surgery.
+An epidural catheter was inserted through the intervertebral space at T9/10, and spinal anesthesia was instilled using 0.5% hyperbaric bupivacaine 3 mL and fentanyl 15 μg via the L3/4 intervertebral space. In addition, 5 mL of 0.375% levobupivacaine solution and 3 mg of morphine were administered via the epidural catheter. Anesthesia was achieved below the T4 cutaneous level. In accordance with the patient’s request, she was sedated by intermittent administration of midazolam (7 mg total) and continuous infusion of propofol (0.8–1.6 mg/kg/h). Oxygen was administered at 4 l/min via a face mask, and peripheral oxygen saturation was maintained at 100% through the operation. Blood pressure was maintained by intermittent administration of phenylephrine. A single-hole, Nishii-type lifting laparoscopic surgery, without pneumoperitoneum (i.e., gasless) was completed uneventfully. The operation duration was 2 h and 45 min, and anesthesia duration was 3 h and 20 min. After confirming the absence of complications in respiratory status, she was returned to the ward and discharged uneventfully on postoperative day 3.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2908_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2908_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3c0ac52c9443f05d789aae7d81916a568f2cfa58
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2908_en.txt
@@ -0,0 +1,5 @@
+Our patient was initially referred to another hospital with mild head injury when he was 8 years old. An intra-axial tumor located in the right insular cortex was incidentally detected on MRI. Surgical resection was waived and followed-up for 10 years until the patient was 18 years old because of slowly growing tumor without symptoms. At the end of the observation period, the tumor size was measured to be one and a half times the diameter measured on the first MRI scan. After the end of the follow-up period, he visited our hospital for intensive examination and treatment.
+The patient had no neurological deficit. Computed tomography (CT) imaging showed a low-density lesion with no calcification located in the right insular cortex . T1-weighted MRI demonstrated a hypointense lesion in the right insular cortex . T2-weighted MRI showed a hyperintense lesion that corresponded with the hypointensity on the T1-weighted image . T1-weighted MRI with gadolinium administration did not show any enhanced lesions [Figure and ]. Arterial spin labeling study suggested decreased blood flow at the lesion .
+The lesion located in the right insular cortex demonstrated gradual growth for 10 years [Figure -]. The change in lesion volume was assessed using polygonal tracing with fusion. Fluid-attenuated inversion recovery (FLAIR) signals were assessed using the DICOM image viewer OsiriX (®) (v. 7.0; Pixmeo SARL, Bernex, Switzerland) by slice-by-slice region of interest tracings. The growth rate of this lesion was found to be almost directly proportional to time .
+In order to remove the lesion and obtain histopathological diagnosis, an awake craniotomy was performed using cortical and subcortical stimulation mapping with a bipolar direct electrical stimulator at 3.5 mA/60 Hz biphasic current to monitor motor and somatosensory response, speech or language difficulties, and other higher brain functions. An anarthria was induced by stimulation of the ventral precentral gyrus . Tumor resection was performed via a transopercular approach. Intraoperatively, the nature of the tumor was gray, soft, and jelly-like tissue with clear boundaries. Fiber structures in the peripheral zone were relatively well-defined and we promoted excision of the tumor using an ultrasonic surgical aspirator. A postoperative MRI showed gross total resection of the tumor . Postoperative course was uneventful without neurological deficits. No recurrence was recognized postoperatively for 12 months.
+Histological examination of the hypointense area on T1-weighted MRI showed multiple cystic structures with myxomatous background and proliferation of oligodendroglia-like cells with oval nuclei in the wall of the cystic spaces . Neuronal elements featuring “floating neurons” were observed, indicating a glioneuronal lesion within the cystic cavity . Immunohistochemical analysis revealed intense positive staining for Olig2, S-100 and synaptophysin, and less reactivity for IDH-1 . The Ki-67 staining index (SI) was 1% . A combined deletion of 1p and 19q chromosomes was absent. The histological diagnosis was WHO grade I DNET.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2940_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2940_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2fc27be2bada891410880a9bf3221e311ceff0a1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2940_en.txt
@@ -0,0 +1,4 @@
+An 80-year-old Caucasian female with a past medical history of hypertension and hyperlipidemia presented with exertional midsternal chest pain that was predominantly pressure-like, 5/10 in intensity, and short-lasting. There was no associated shortness of breath, sweating, or palpitations. On the same night, she had an episode of lightheadedness associated with shortness of breath as she tried to get up from bed. This lightheadedness was not associated with fever, chills, malaise, myalgia, night sweats, loss of consciousness, or dizziness. She had no history of intravenous drug use, prior/recent dental procedures, prosthetic valves, rheumatic heart disease, or immunocompromised states. Vital signs included a temperature of 98.7 F, heart rate of 38 beats per minute, blood pressure of 122/58 mmHg, and oxygen saturation of 98% on room air. Orthostatic vitals were normal. Cardiac examination revealed bradycardia, normal S1 and S2, and no audible murmurs. The remainder of the examination was unremarkable except for trace bilateral lower extremity edema.
+Initial laboratory workup, including complete blood count, complete metabolic panel, and thyroid panel, was significant for mild leukocytosis of 11,300 cells per mm3 (normal reference range: 3900–11,000 cells per mm3). Cardiac biomarkers showed normal troponin and elevated brain natriuretic peptide (BNP) pro of 13,443 pg/mL (normal reference range: less than 125 pg/mL). Chest x-ray (CXR) showed no acute cardiopulmonary process. Electrocardiogram (EKG) showed sinus rhythm with 2:1 atrioventricular block on admission , but telemetry showed intermittent complete heart block. Transthoracic echocardiogram (TTE) images were suboptimal due to poor windows and motion artifacts. However, it revealed normal left ventricular (LV) systolic function with mild concentric LV hypertrophy and an ejection fraction of 70%. There were no apparent valvular abnormalities .
+On the day of admission, clonidine and atenolol (home antihypertensives) were discontinued due to suspicion of medication-induced conduction abnormality. Despite this, telemetry showed persistent high-degree heart block with a heart rate in the 40 s. The rest of her vitals remained stable. Hence, she was scheduled for a permanent pacemaker implantation for a presumptive diagnosis of senile high-degree heart block. On day 3 of admission, before the scheduled procedure, she became acutely hypoxic to 85%, requiring a non-rebreather mask to maintain adequate oxygen saturation. CXR revealed pulmonary vascular congestion, which was appropriately treated with diuretics following which she improved to saturate well on 4 L of oxygen via nasal cannula. However, she also spiked a single elevated temperature of 103F. Blood cultures grew gram-positive cocci in clusters in 4/4 bottles. Empirical intravenous vancomycin was started. On day 4, she developed new onset slurred speech, right-sided hemiparesis, and altered mental status. Physical examination revealed no signs or sequelae of systemic embolization, and her skin was warm and well-perfused. Computed tomography of the brain revealed hypodense regions in the left lentiform nucleus and anterior caudate nucleus representing acute/subacute stroke, likely secondary to emboli. In view of her altered mental status and inability to protect her airway, she was intubated. She became hypotensive, requiring pressor support secondary to septic shock. EKG showed regularized atrial fibrillation, suggestive of a complete heart block with atrial fibrillation . Therefore, a temporary transvenous pacing lead was inserted. Blood cultures were speciated as methicillin-sensitive Staphylococcus aureus, and antibiotics were switched to intravenous cefazolin.
+On day 5, TEE revealed normal LV systolic function but found multiple echodensities, including a 0.76 cm × 0.50 cm vegetation seen on the PMVL and a 1.9 cm × 1.3 cm polypoidal structure on the atrial side of the AMVL . In addition, there was a heterogenous extension of the echodensity from the aortic root, along the aorto-mitral cushion and into the IVS, which was significantly thickened, indicating IVSA . Mild mitral regurgitation and mild aortic regurgitation were noted along with a small pericardial effusion. Due to high mortality risk, she was not deemed to be a surgical candidate. Given her prohibitive surgical risk and poor prognosis, the family decided to change her goals of care to comfort measures only. Unfortunately, the patient died on day 6.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2943_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2943_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..99756336a99aa86600a228729e762a909e9ec5d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2943_en.txt
@@ -0,0 +1,5 @@
+A 38-year-old man visited our hospital complaining of anterior chest pain. He had no significant medical or family history, and the vital signs were stable. Ischemic events were not observed in electrocardiography, but chest X-ray and computed tomography (CT) showed a cystic lesion (6.0 × 7.0 × 10.0 cm) in the anterior mediastinum . Although the cystic capsule demonstrated contrast enhancement, its fluid component had low radiation absorbance. Based on these findings, we suspected the mass to be a thymic cyst. Blood tests indicated the presence of inflammation (white blood cell count 11,200/μL and C-reactive protein 3.38 mg/dL).
+Two days after hospitalization, the patient developed dyspnea and his chest pain worsened. Subsequent chest CT showed that the cystic lesion had become inhomogeneous and the radiation absorbance of the cyst’s fluid component had increased . The cyst wall became thickened, and bilateral effusion was observed. Blood tests indicated that hemoglobin levels had decreased from 15.8 to 12.8 g/dL, and levels of inflammatory markers had increased, with the fever exceeding 38.5 °C. Needle aspiration biopsy and tumor wall biopsy with a small skin incision were performed; however, we could not obtain a diagnosis. One week after admission, general condition and laboratory data of the patient gradually improved. A chest CT on day 13 showed that the tumor had become small in size with a thickened wall . The effusion on the right side had decreased and that on the left side had disappeared.
+The patient had recovered enough to undergo surgery; the tumor was resected by sternotomy on day 18. The tumor was found to be encased in a smooth, yellow, and elastic coat. The tumor was densely adhered to the junction of the left brachiocephalic vein and superior vena cava, and it was required to detach the tumor from the dense adhesion site carefully. The right phrenic nerve was preserved, and the right pleural effusion was serous. The tumor and thymic tissue were resected en bloc. The operative time was 288 min, and the estimated blood loss was 521 mL. The resected tumor was covered with a thick, fibrous capsule, and the lumen was filled with necrotic tissue and hemorrhagic material . The postoperative course was uneventful, and he was discharged on day 26.
+The pathological findings showed a fibrotic cyst wall; the cyst was filled with necrotic tissue. The slight proliferation of lymphocytes was confirmed in the necrotic tissue and around the cyst wall . The tumor was diagnosed as type B1 cystic thymoma . As the tumor did not appear to have spread beyond the capsule, it was determined to be at Masaoka stage I. Nevertheless, the dense adherence of the tumor to its surrounding tissue indicated the possibility of invasion, and postoperative radiotherapy (50 Gy) was administered.
+Two years after the surgery, recurrent metastasis of the tumor was found on the right pleura and the left upper lobe of the lung. The patient was treated with chemotherapy, radiotherapy, and local resection. The patient remains alive 12 years after the first surgery. Following an analysis of the tissue obtained from the resected recurrent tumor, the pathological diagnosis was changed to type B3 thymoma.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2955_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2955_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ad7cfc0e52c2e9d622a88a0fc710c9f518f39fd8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2955_en.txt
@@ -0,0 +1,2 @@
+We present a 30-month-old male child with a normal perinatal history who was referred to our center with a history of decreased sensation over the gluteal region along with persistent dribbling of urine for 6 months. Neurological examination was normal, except for decreased perianal sensations. He was able to walk but at a slower pace than before; however, the exact power could not be graded due to the age factor limiting communication. Magnetic resonance imaging (MRI) of the spine showed a well-defined intramedullary cystic lesion of size 12 × 8 × 8 mm in the conus medullaris at the T12-L1 level, which was hypointense on T1-weighted images and hyperintense on T2-weighted images with no perilesional edema, solid component, or contrast enhancement .
+The patient underwent T12-L1 laminotomy under intraoperative monitoring. After a midline durotomy, the cyst was seen surfacing near the midline covered by a thin layer of gliotic tissue. The cyst was opened at its most superficial point and clear fluid akin to cerebrospinal fluid was drained. Repeated Valsalva maneuver confirmed that the central canal was separate from the cyst. There was no definite plane of dissection between the conus and the cyst. The cyst was marsupialized by suturing its wall to the arachnoid of the cord to prevent reclosure . This was followed by a watertight dural closure. The postoperative period was uneventful. On follow-up after 3 months, there was an increase in muscle strength with improved walking but dribbling continued to persist. Histopathological examination revealed arachnoid cells in the cyst wall along with glial tissue which was suggestive of an arachnoid cyst.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2966_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2966_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c917775aba18dbee40f42479e33bc55b1e6a6206
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2966_en.txt
@@ -0,0 +1,6 @@
+A 27-year-old married woman (gravida 0) was admitted to a local hospital with a history of 51 days of amenorrhea, lower abdominal pain and vaginal bleeding for 5 days. Her previous menstrual cycles were regular. Her medical history and family history were unremarkable. The general condition of the patient appeared to be good, and pelvic examination revealed a mass in the right adnexal area with tenderness. The urine test showed she was pregnant, and serum β-hCG level was more than 200,000 mIU/ml. Transvaginal ultrasound (TVS) revealed a right adnexal mass and profuse abdominal fluid accumulation.
+According to an initial diagnosis of ectopic pregnancy, laparoscopic exploration was performed. The right ovary was 5*6 cm, partially cystic, ruptured and surrounded by a hematoma. The left ovary and both fallopian tubes were intact. Approximately 500 ml of intraperitoneal blood was noted. The cystic mass of the right ovary was dissected and sent to pathological diagnosis. On the fifth postoperative day, serum β-hCG levels was 14,510 mIU/ml. The patient then transferred to our hospital six days after the surgery. The pathological consult confirmed a pure choriocarcinoma of the right ovary, and an immunohistochemical panel was performed and the samples analyzed were positive for Pan Cytokeratin (AE1/AE3), hCG, human placental lactogen (hPL) and Ki-67(60%), and negative for p53. .
+At the 7th and 10th postoperative day, the serum β-hCG levels fell to 5907 and 2000 mIU/ml, respectively. Further imaging examination was proceeded ten days after the surgery. The contrast pelvic MRI showed the right ovary was 2.1*2.9*3.2 cm, at the front of which a mass of 1.2 cm*1.0 cm was observed. PET-CT showed bilateral ovarian nodules with hypermetabolism, physiological uptake considered, no other specific abnormalities were observed. Other related tests were examined: CA125 (cancer antigen 125): 70.81 U/ml, AFP (alpha fetoprotein): 2.28 ng/ml. As the endometrium thickness was only 5 mm, endometrial biopsy had not been performed.
+The patient received five courses of EP-EMA chemotherapy, including cisplatin (80 mg/m2) and etoposide (100 mg/m2), D1; etoposide (100 mg/m2), methotrexate (100 mg/m2 iv and 200 mg/m2 ivgtt), and actinomycin-D (0.5 mg), D7–8, at two-week intervals. Goserelin (3.6 mg) was injected before the beginning of chemotherapy and at four-week intervals during the treatment to protect the ovarian function. During the chemotherapy, the patient was monitored weekly for serum levels of β-hCG, and a rapidly decrease was detected. We observed normalization of the CA125 serum level after one course of chemotherapy. The β-hCG level decreased to normal after two and a half courses of chemotherapy and remained normal thereafter. The contrast pelvic MRIs performed once a month during the chemotherapy showed reduced lesion which became undetectable during the fourth course. The patient remains without evidence of disease 32 months after chemotherapy, her menstruation recovered 12 months after chemotherapy, and gave birth to a healthy baby 25 months after chemotherapy.
+Individual DNA polymorphic analysis was used to verify the presence or absence of paternal genetic material. DNA from paraffin-embedded tumor tissue was compared to the patients’ and her husband’s peripheral blood DNA. Manual microdissection of the tumor cells was performed to eliminate the contamination of maternal DNA. Following extraction of DNA from the formalin-fixed and paraffin wax embedded material (QIAamp DNA FFPE Tissue Kit, Qiagen, Valencia, CA, USA), and from blood samples (ZR Genomic DNA-Tissue MiniPrep Kit, Zymo Research, CA, USA) all samples were quantified by NanoDrop (Thermo Scientific, Wilmington, USA), and MicroreaderTM 21 ID system, MicroreaderTM 23sp ID system (Beijing Microread Genetics Co., Ltd., Beijing, China) were respectively used to amplify 10 ng DNA from each biopsy and blood samples. Amplified products were then detected using an ABI 3730xl Genetic Analyzer (Applied Biosystems, CA, USA). Electrophoresis results were analyzed using GeneMapper® ID v.3.2 (Applied Biosystems, CA, USA), and the genetic profiles of the biopsy and peripheral blood were compared.
+We studied the genetic profiles of 43 highly polymorphic short tandem repeats (STRs) in DNA samples prepared from the patient, spouse and tumor. At 25/43 loci examined, the tumor specimen was shown to contain the paternal allele but not the maternal DNA (D21S11, D18S51, D6S1043, D3S1358, D7S820, D16S539, Penta D, D2S441, vWA, TPOX, TH01, FGA, D18S535, D19S253, D20S470, D22-GATA198B05, D16S539, D8S1132, D4S2366, D13S325, D9S925, D3S3045, D10S1435, D17S1290, D5S2500). At 18/43 loci examined, it could not be determined whether the tumor contained paternal allele because the patient and spouse shared one or two identical alleles (D19S433, D5S818, AMEL, D13S317, CSF1PO, D8S1179, Penta E, D12S391, D2S1338, D6S477, D15S659, D11S2368, D1S1656, D7S3048, D21S1270, D14S608, D12S391, D2S1338). Therefore, none of the loci could be proved to contain maternal allele only. At 20/43 loci examined, the tumor was triploid, which was in accord with the nuclear-heteromorphism of tumor cells. Twelve representative loci from these analyses were summarized in Table and Fig. . In more than half (25/43) of the loci studied we were able to demonstrate the presence of paternal DNA in the tumor, indicating a gestational origin for the tumor.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2977_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2977_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cfbe001d2817b569549d1f8d204c9156f22edd41
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2977_en.txt
@@ -0,0 +1,5 @@
+Our patient was a 37-year-old, 48 kg Yoruba woman, who developed impaired visual function while on treatment for pulmonary tuberculosis. She was diagnosed as having pulmonary tuberculosis based on a history of chronic cough, weight loss, positive acid- and alcohol-fast bacilli sputum examinations and reticulonodular chest features of pulmonary tuberculosis evident on radiology .
+She successfully completed a two-month intensive treatment course on a daily four-drug combination comprising ethambutol 825 mg, isoniazid 225 mg, rifampicin 450 mg, and pyrazinamide 1200 mg. Our patient's weight improved to 52 kg. This two-month course was followed by a continuous phase of treatment. This comprised a daily two-drug combination including ethambutol 825 mg and isoniazid 450 mg. The two-drug combination was, however, substituted with only rifampicin about 11 weeks into the continuous phase when our patient reported blurred vision at the chest clinic where she was being managed. There was total withdrawal of the antituberculosis drug about two weeks later on account of persistent impaired visual function. By then, our patient had been receiving antituberculosis therapy for a period of five months, including the two-month intensive and three-month continuous phases.
+She presented to our eye clinic about nine days after her antituberculosis drugs had been discontinued on account of her progressive painless diminishing vision of approximately one month's duration. Our patient also complained of a tingling sensation in her lower limbs. There was no record of a visual assessment before and during her therapy, however, our patient stated she had had normal vision previously. She had no family history of significant blinding ocular conditions and did not wear glasses. Furthermore, our patient had no history suggestive of diabetes mellitus, hypertension, sickle cell disease or HIV and/or AIDS.
+A physical examination on presentation showed a wasted and concerned patient, however her vital signs were normal. Her visual acuity (VA) was 6/60 in her right eye and 1/60 in her left eye. She had red-green dyschromatopsia using Ishihara color plates and her pupils were sluggish in their response to light. Her optic discs were hyperemic. Her intraocular pressure was 14 mmHg in both eyes. She had central visual field (CVF) defects . Biochemical tests to assess kidney and liver function were essentially normal except for elevated alkaline phosphatase . A screening for HIV was not reactive.
+Except for multivitamins (Dolo-Neurobion® taken orally daily) taken by our patient for three weeks, our patient was not on any other medication. She was counseled and reassured of a high chance of visual recovery over time. Our patient was monitored in our eye clinic at two-weekly intervals. At each visit, aside from our patient's briefings on visual function, her VA, color vision, pupillary activities and funduscopy were checked and documented. Her VA initially got worse, declining to 1/60 in both eyes two weeks after initial presentation, but later improved steadily following the discontinuation of the antituberculosis therapy. Our patient was last reviewed by our eye clinic nine months after her initial presentation, and her VA was recorded as unaided VA right eye 6/24-1, left eye 6/12+2 and aided (using correction with lenses; right eye -2.75DS, left eye -1.00DS) VA right eye 6/9-2, left eye 6/6-3. A repeat CVF test performed eight months after her initial CVF showed that the CVF defects had disappeared.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2978_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2978_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..12e3f60d2fdead1831a996dda09c62c646f63689
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2978_en.txt
@@ -0,0 +1,2 @@
+A 39-year-old male was transferred to our hospital from another hospital. He had mild tenderness, an obvious bowel pattern and hyperactive bowel sounds; he was able to pass gas occasionally. Before admission, he suffered progressive abdominal distention and gradual deterioration, and he developed malnutrition for two months. A total alimentary tract angiography showed partial enlargement of the ascending colon and transverse colon and partial dilation of the distal small intestine . He was diagnosed with “adult megacolon” and recommended for surgical treatment. However, the operation was not performed because of a significant decrease in platelets (with a minimum of 19 × 109/L) and severe malnutrition. He had been in a car accident 2 years previously. He was the driver and was wearing a seat belt at the time of the accident. During that admission, he was always conscious and was found to have left clavicle fractures and multiple rib fractures. Abdominal examination showed seat belt marks and mild localized tenderness at the site of the abrasions. An abdominal CT scan showed a small amount of fluid (approximately 150 ml) in the abdominal cavity with no solid organ abnormalities. He was hemodynamically stable and was able to pass gas and defecate. He improved rapidly with conservative treatment, was discharged after several days and was asymptomatic. Two months after discharge, he started to have episodes of abdominal distension and intermittent mild tenderness, and he passed gas less frequently than before. However, he improved rapidly again after receiving treatment with traditional Chinese medicine.
+After admission, we first tried to improve the general condition of the patient by strengthening parenteral nutrition and correcting electrolyte imbalances. Then, a series of additional examinations were performed to explore the possible reasons for these problems. An abdominal CT scan showed an abrupt narrowing zone at the jejunum . Small balloon colonoscopy found a narrow zone approximately 40–50 cm from the ileocecal valve; the surface mucosa was swollen and erosive, and the upper segment of the intestine was obviously expanded . Laparoscopy was performed on the patient after multidisciplinary discussion and detailed preoperative evaluation. We found severe adhesion between the abdominal wall and intestine as well as a narrow small bowel with a length of 12 cm at approximately 40–50 cm from the ileocecal valve. The mesentery corresponding to the narrow part of the small intestine was also absent, and the proximal intestine was markedly dilatated. Additionally, a thick adhesive band was also found between the dilated proximal intestine and the sigmoid colon, and we thought it might be the main cause of colonic dilation . Therefore, we performed laparoscopic adhesiolysis and partial small bowel resection, and the thick adhesive bands were destroyed. The narrow small bowel with length of 20 cm was removed. Histologically, the area was fibrotic . The patient recovered rapidly and gained 5 kg in the 3 months after surgery. He was very satisfied with the treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2982_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2982_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..94cc4aa21f4aedce95dbdf44674c0979bff7c4f3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2982_en.txt
@@ -0,0 +1,5 @@
+A 9 year-old boy with severe OI and previous history of multiple fractures, small stature and associated skull deformities presented with loss of vision in his right eye of unknown duration. The patient exhibited a low degree of myopia (RE −1.50/−3.00 × 180; LE −1.00/−3.50 × 173) and the anterior sclera was abnormally thin. Posterior segment examination revealed a right macula-off retinal detachment associated with a giant retinal tear (GRT) and C3 proliferative vitreoretinopathy (PVR).
+Genetic analysis was performed by an NHS England molecular genetics service, when the child was 2 years old. At that time (2008) no potentially causative DNA change was found in COL1A1 or COL1A2, and so genetic analysis targeted regions of the CRTAP and P3H1 (previously named LEPRE1) genes, which had only recently been shown to cause recessive osteogenesis imperfecta . This revealed a homozygous change c.1914 + 1G > A (NM_001243246.1) splice site mutation in intron 13 of P3H1 gene with parents being first cousins and heterozygous for same mutation. The same change has also been reported by Pepin et al. in a case of osteogenesis imperfecta with compound heterozygous mutations of P3H1. Although they were unable to determine the effect of this particular c.1914 + 1G > A mutation on the mRNA, in the majority of the other cases of P3H1 mutations that they studied, mRNA instability was the outcome .
+Examination under anaesthetic (EUA) showed a right GRT from 6 to 10 o’clock associated with a macula-off detachment and inferior epiretinal and subretinal fibrosis . EUA of the fellow eye revealed a further 180-degree GRT from 1 to 7 o’clock associated with a macula-sparing retinal detachment. A right 360-degree peritomy for placement of bridle sutures revealed a sclera that was more grey than blue in hue but very thin (see Fig. ). Right RD repair was performed via single-port pars plana vitrectomy (PPV), tamponade with silicone oil and cryoretinopexy extended to 360 degrees. The single sclerostomy and conjunctiva were successfully closed with polyglactin absorbable sutures.
+Surgery for the left eye consisted of PPV and fluid/perfluorocarbon liquid (PFCL) exchange to unroll the posterior flap of the GRT, followed by direct PFCL-silicone oil exchange. Retinopexy was again applied to both the GRT and completed through 360 degrees.
+Persistent antero-posterior PVR meant further right eye surgery was required, involving a 360-degree buckle, a silicone oil top-up and further retinopexy to seal a leak in the lower horn of the GRT. Scleral fixation sutures were not possible for the buckling procedure, which was completed with two 5/0 vicryl sutures tethering the anterior edge of the buckle to the medial and lateral recti to prevent posterior buckle migration with end to end shortening and suturing of the 360-degree explant. Retinal stability was achieved in both eyes but a chronic inferior RD in context of extensive PVR remains under silicone oil in the right eye. Visual acuity with silicone oil in situ at time of writing is RE 6/36, LE 6/12.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3000_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3000_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d7de78c7e271e1a33e0fc437c9c38978157e0514
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3000_en.txt
@@ -0,0 +1,6 @@
+A 77-year-old Japanese man presented with a follicular thyroid tumor, and the blood thyroglobulin level was 1800 ng/ml. He had no medical history or medications, but his mother and brother had history of colorectal carcinoma and prostate carcinoma. He had smoked three cigarettes for 3 years, and he did not consume alcohol regularly. He received right thyroid lobectomy, and the pathological examination showed no malignant findings such as vascular invasion or capsular invasion. The thyroglobulin level decreased to 14 ng/ml postoperatively. Follow-up at our hospital was discontinued.
+Nine years after the operation, he presented to our hospital again with numbness of the right leg and difficulty of walk. On examination, weakness of the right lower limbs was observed but no mass was palpable on the lower back and lower limbs. CT showed a tumor 90 mm in size from the lumbar spine to the sacrum, causing spinal cord compression . Blood tests showed that the thyroglobulin level was increased to 11,600 ng/ml. Ultrasonography of thyroid showed a 14 mm iso-echoic mass in the residual left lobe suggesting follicular tumor. We diagnosed him with thyroid cancer with bone metastases. External beam radiotherapy (39 Gy/13 Fr) was performed on the bone metastases, followed by total thyroidectomy and radioactive iodine therapy (RAI; 131-I 100 mCi).
+The pathology of the residual thyroid gland was follicular tumor. Although we examined the whole thyroid, including the previous specimen of right lobe, we could not find any malignant features such as vascular invasion or capsular invasion. However, we diagnosed follicular thyroid carcinoma owing to the presence of bone metastasis. Scintigraphy of RAI therapy showed high accumulation on the right pelvis and the thyroid bed . The numbness in the right thigh and weakness of the lower limbs improved after the start of treatment, and the thyroglobulin level decreased to 3940 ng/ml. However, 4 months after RAI therapy, the symptoms of numbness and weakness in the lower extremities recurred. The tumor size of pelvic bone metastasis was re-increased, and the thyroglobulin level increased to 5270 ng/ml. The patient was diagnosed with RAI-resistant thyroid follicular cancer, and lenvatinib was introduced.
+Lenvatinib was introduced at dose of 24 mg per oral once daily, and he was started on calcium blocker and angiotensin II receptor blocker because of hypertension. Two weeks later, he developed National Cancer Institute (NCI) Common Terminology Criteria for Adverse Event (CTCAE) grade 3 paronychia of the right foot, which was improved by partial nail avulsion, intravenous administration of ceftriaxone, and discontinuation of lenvatinib for 3 weeks. Lenvatinib was reduced to 14 mg and resumed. Although no significant adverse events occurred after dose reduction, emphysema was found in the intestinal wall of the ascending colon on a scheduled CT image taken 14 weeks after the introduction of lenvatinib to determine the therapeutic effect .
+The patient visited our hospital 9 days after the CT examination as planned. He had no abdominal or digestive symptoms. On examination, temperature was 36.8 °C, blood pressure 115/75 mmHg, and pulse 63 beats per minute. Physical examination of neck and abdomen was normal, and neurological abnormalities of the legs were not observed. Laboratory testing revealed a white cell count of 4400/μL (reference range 3900–9800/μL), hemoglobin level of 11.4 g/dL (reference range 13.5–17.6 g/dL), and platelet count of 279,000/μL (reference range 131,000–362,000/μL). Blood levels of electrolytes and C-reactive protein were normal, as were results of tests for renal function and liver function. Urinalysis was normal, including urine protein. Re-examination of CT was performed, and it showed the air in the intestinal wall was reduced. Because there were no findings suggestive of intestinal ischemia or perforation, he was diagnosed with pneumatosis intestinalis and lenvatinib was discontinued. He was not hospitalized and did not need any medications.
+The numbness of the right leg worsened after withdrawal of lenvatinib, so the patient was required to restart lenvatinib at a dose of 10 mg after a week of withdrawal. Three weeks later, we tried increasing the dose of lenvatinib to 14 mg. However, we needed to reduce back to 10 mg because of anorexia . Two months after the diagnosis of pneumatosis intestinalis, CT showed that the emphysema of the intestinal tract had completely disappeared. Three years and 5 months passed since the introduction of lenvatinib; we continued lenvatinib treatment, and the therapeutic effect remains partial response. There was no recurrence of PI.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3013_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3013_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9a27b49d4275fb6f00b6c068d14abad656b977f1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3013_en.txt
@@ -0,0 +1,26 @@
+An 84-year-old man presented to the emergency room with gross haematochezia for several days and shortness of breath for 1 month. His medical history was significant for deep vein thrombosis (DVT) on warfarin, hypertension, hyperlipidemia, diabetes mellitus and chronic kidney disease.
+
+
+Investigations
+
+Bloodwork was obtained, and his haemoglobin level was 86 g/L, mean corpuscular volume was 92.1 fL international normalised ratio was 3.4, serum creatinine was 1.5 mg/dL, albumin was 2.7 g/dL and liver function tests were normal. His vital signs were within normal limits.
+
+He was transfused one unit of blood, warfarin was held and he received 10 mg of intramuscular vitamin K. CT showed circumferential thickening of the ascending colon. Colonoscopy confirmed a circumferential, friable mass in the ascending colon. Biopsies demonstrated poorly differentiated adenocarcinoma, and mismatch repair testing showed loss of expression of MLH1 and PMS2. Serum carcinoembryonic antigen was normal at <0.5 ng/mL. Lower extremity duplex demonstrated no acute DVT, and anticoagulation was discontinued. Haemoglobin was 87 g/L at discharge and he had no further haematochezia or melena.
+
+The patient was referred to surgical oncology clinic, where he reported dyspnea with minimal exertion and appeared short of breath. Electrocardiogram demonstrated T-wave inversion in the lateral leads, and echocardiogram showed an ejection fraction of 41% with akinesis of the basal anterolateral and mid-anterior walls. He was evaluated by cardiology and was initiated on diuretics. The diagnostic and therapeutic treatment of choice was coronary angiogram with percutaneous coronary intervention, but this intervention was contraindicated in the presence of active gastrointestinal bleeding since placement of a stent would require dual antiplatelet therapy which could exacerbate bleeding.
+
+
+Treatment
+
+The patient was discussed at a high-risk anaesthesia multidisciplinary conference. All attendees agreed that the patient’s poor cardiac status was risk prohibitive for an upfront colectomy and he was referred to radiation oncology for treatment of bleeding prior to coronary intervention. Because the patient was not a candidate for chemotherapy, he received a palliative dose of 30 Gy of external beam radiation in 10 fractions without complication.
+
+The patient had no further haematochezia and his symptoms improved with diuresis. He underwent coronary angiogram which showed two-vessel disease with an occluded proximal left anterior descending artery which was treated with a bare metal stent. He received dual antiplatelet therapy for 4 weeks, and then continued aspirin alone.
+
+The patient was re-evaluated in surgical oncology clinic and appeared to be an appropriate surgical candidate after these interventions. Repeat staging CT showed no evidence of metastatic disease and improvement in colonic thickening. After discussion with the patient and his family, and consultation with the anaesthesia and cardiology teams, resection was recommended due to the potential risk for bleeding and obstruction if the tumour was left in situ. Six months after initial diagnosis, the patient underwent robotic-assisted right hemicolectomy with an intracorporeal ileocolic anastomosis. He had an uneventful postoperative course and was discharged on postoperative day 3. Final pathology demonstrated complete pathologic response with no residual tumour, and no tumour in 18 lymph nodes harvested.
+
+The patient did not require adjuvant chemotherapy.
+
+
+Outcome and follow-up
+
+The patient is alive and doing well from a cardiac standpoint with no evidence of disease recurrence at 12 months after surgery and 18 months after initial cancer diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3021_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3021_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d27496708d349b65cdc5d27dd679b96951006c5f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3021_en.txt
@@ -0,0 +1,9 @@
+A 20-year old woman, gravida 2 para 1001, at 35 5/7 days of gestation presented to the outpatient clinic to establish prenatal care and reported a pruritic rash on her legs that appear only during pregnancy. She recently moved to Hawaii from Chuuk, a state of the Federated States of Micronesia, where she had limited prenatal care. The patient denied any past medical history. During her first pregnancy in Chuuk, 18 months prior, she had noted a pruritic rash on her legs that resolved after she had an uncomplicated vaginal delivery with a normal male infant. She denied any family members with a similar rash. The patient’s left leg was noted to have erythematous plaques with a few scabs from ankle to knee and a few hypopigmented patches.
+
+She was admitted for early labor at 38 4/7 days of gestation and proceeded to have a spontaneous vaginal delivery. Neonatal Apgar scores were 8 and 9 at 1 and 5 min, respectively, with a birth weight of 3,997 g. After placental delivery, intermittent uterine atony was noted requiring administration of methylergonovine maleate and misoprostol with subsequent improvement in uterine tone. The estimated blood loss from the delivery was 450 mL. Within 4 h of delivery, the patient became febrile to 102.4 F with tachycardia, prompting initiation of gentamicin and clindamycin for presumed endometritis. On physical exam, the patient was noted to have a plaque-like rash on her bilateral lower extremities and perineum and small erythematous patches on her bilateral upper extremities.
+
+On postpartum day #1, the patient was hypotensive with worsening, painful rash. Physical exam revealed urticarial wheals throughout chest, arms, buttock, and thighs, and her left lower extremity had crusting lesions with the background rash. Due to concern for a drug reaction, gentamicin and clindamycin were discontinued. The patient required intensive care admission with a norepinephrine drip and two units of packed red blood cells to stabilize her blood pressure. She was transitioned to vancomycin, metronidazole, and aztreonam for possible infectious etiology. Famotidine and Cetirizine were added for histamine blockade. On postpartum day #4, the patient stabilized off norepinephrine with resolution of urticaria but persistent left lower extremity lesions with central eschars. She was discharged on postpartum day #5 with topical clobetasol and mupirocin.
+
+At her two week postpartum check, the patient reported that the rash was improving with clobetasol and mupirocin. On physical exam, a scattered annular rash was noted over bilateral arms and legs. At her four week postpartum check, she reported the rash was still painful. On physical exam, urticarial papules, plaques, and polycyclic wheals in various stages of healing, some with scale and crusting extending down bilateral legs to plantar surface of feet, worse on left lower extremity with 2+ pitting edema. She also had polycyclic wheals scattered on her abdomen, back, and bilateral upper extremities with associated erythema. At six weeks postpartum, the patient’s rash continued with worsening pain and increased leg swelling, therefore oral prednisone was started, which caused improvement, but not complete resolution of the rash. The patient was referred to dermatology and at eight weeks postpartum, a skin biopsy of a lesion showed tuberculoid granulomatous dermatitis, consistent with HD.
+
+The patient was referred to the Hansen’s Disease Community program and an infectious disease specialist. Three months postpartum, the patient’s neurologic exam revealed loss of sensation in bilateral feet and retained sensation in bilateral hands. She was started on multidrug therapy for HD and continued on prednisone.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3049_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3049_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aacfc599fdcdbb935edd77c4b84191968a31ea56
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3049_en.txt
@@ -0,0 +1,19 @@
+A 59 year old Chinese woman underwent routine mammographic screening that revealed scattered areas of fibroglandular densities with microcalcifications developing in the lower inner quadrant of the left breast and prominent lymph nodes. Magnification mammographic views of the left breast demonstrated amorphous heterogeneous calcifications in a segmental distribution, spanning an area approximately 70 mm in maximal anterior–posterior dimension. No associated mass was identified on mammography or ultrasound. A 14 gauge (G) ultrasound-guided, spring-loaded core biopsy of the left breast lesion revealed low-to-intermediate grade ductal carcinoma in situ (DCIS) (with associated microcalcifications).
+
+The patient was gravida 3 para 3, postmenopausal approximately 1 year previously, with no family history of breast cancer and in good health. She had no history of malignancy and was a lifetime nonsmoker.
+
+Ultrasound of the left axilla showed normal morphology level I lymph nodes and one to two abnormal level II lymph nodes with focally increased cortical thickness measuring up to 5 mm and an eccentrically displaced and partially flattened fatty hilum. This clinical scenario raised the question of why this patient had enlarged nodes in the apparent presence of only DCIS.
+
+In addition, 10 months prior to presentation, she had acute upper respiratory tract symptoms consistent with a viral illness, with a negative nasopharyngeal swab reverse transcription polymerase chain reaction test for severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2). This patient had sought medical attention after she detected swelling in her left supraclavicular fossa 7 months earlier. In addition, 7 days prior to presenting with left supraclavicular fossa swelling, she had received the first dose of the Pfizer COVID-19 vaccine in the left deltoid muscle. Just prior to her vaccination, serologic testing for total antibodies to SARS-CoV-2 nucleocapsid and spike proteins were negative.
+
+Physical examination at the time of her presentation revealed a cluster of three soft nontender lymph nodes in the left supraclavicular fossa, each approximately 1–1.5 cm in diameter. There was no detectable cervical or axillary lymphadenopathy. Breast exam was normal, with no palpable masses. A chest X-ray revealed no abnormalities. The enlarged lymph nodes were attributed to the COVID-19 vaccine. Over the next 4 weeks, the left supraclavicular lymph nodes decreased in size and became barely palpable.
+
+Initial ultrasound-guided 25G and 22G fine needle aspiration of the level II axillary lymph node yielded insufficient lymphoid sample and was unsatisfactory for evaluation.
+
+Dynamic contrast enhanced magnetic resonance imaging (MRI) was performed to further assess the breasts and lymph nodes. There was corresponding focally increased non-mass enhancement at the site of the left breast biopsy proving DCIS but no MRI evidence of grossly invasive disease. In the left axilla, there was an enhancing mass measuring 1.3 cm in diameter, deep to the pectoralis major muscle. An ultrasound-guided core biopsy of this mass was performed. Pathology revealed lymphoid tissue with interfollicular areas containing small lymphocytes, plasma cells, and rare eosinophils. No aberrant expression of CD20, CD3, BCL2, BCL6, kappa, lambda, or AE1/AE3 was identified. These histologic findings and the immunophenotype were consistent with lymphoid hyperplasia.
+
+Lymphadenopathy can be caused by various etiologies, including malignancies, infections, autoimmune disorders, or miscellaneous conditions such as certain medications, foreign bodies, or vaccinations. In this case, many etiologies could be eliminated from consideration on the basis of the patient’s history, physical exam, and investigations. The patient had no known infections and no findings suggestive of an infection. She had no history of or symptoms suggestive of an autoimmune disorder. The patient was only taking hormone replacement therapy, steroid inhaler, and chronic antihypertensive medications in the 7-month period between vaccination and diagnosis of DCIS, none of which are associated with lymphadenopathy. There was no history of any implanted device or foreign body. After reviewing imaging and pathology, the clinical team concluded that the enlarged left axillary lymph nodes with reactive histology were not due to a malignancy or benign tumor. Thus the team determined by diagnosis of exclusion that the lymphadenopathy was most likely due to the prior ipsilateral upper extremity COVID-19 vaccine administration.
+
+Because of the extent of the DCIS, the final recommendation was to do a total mastectomy of the left breast with sentinel node removal and immediate reconstruction with a deep inferior epigastric artery perforator (DIEP) flap.
+
+Surgical pathology revealed multifocal intermediate grade DCIS that was positive for estrogen receptor protein and progesterone receptor protein, with the largest area spanning 59 mm on histology. The left axilla sentinel lymph node was negative for malignancy. The patient had an uneventful recovery and received no additional treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3066_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3066_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b87e26ded81f3116ff747a14b903ebb793b5d25e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3066_en.txt
@@ -0,0 +1,9 @@
+A 56-year-old male with a history of right lower limb arteriovenous malformation, diagnosed when he was 2 years’ old, was living in Tomioka Town, located 5 to 14 kilometers south from the FDNPP, before the FDNPP accident. He was recognized as having a grade 3 extremity disability (a unilateral lower limb that does not function completely) by the Act for the Welfare of Persons with Physical Disabilities in Japan. Although his right lower limb was difficult to use, he could walk using crutches. Some support was necessary from his family members; however, he had been able to live without limitations in daily activities before the disaster.
+
+On March 11 in 2011, the patient experienced the Great East Japan Earthquake while at his home with his family. The tsunami did not reach their house. The next day, the Japanese central government declared Tomioka town as part of the mandatory evacuation zone. The patient and his family immediately evacuated to an evacuation center in Tamura city, 40 km west from their home. Although the evacuation center was open to all evacuees, no space was particularly prepared for people with physical disabilities, leading our patient to spend almost all of his time in his car because he felt that his existence in the public space may become a nuisance to others. Several days later, he moved to a room in a hotel in Koriyama city, 60 km west from Tomioka town. Dramatic environmental changes from repeated evacuations imposed a significant physical burden to our patient. He also experienced psychological stress, feeling that he was imposing a strain on family because he thought that his existence prevented his family from being able to freely evacuate.
+
+Three months after initial evacuation, he was referred to a hospital near the hotel in Koriyama city, with symptoms of fever and palpitation. He was admitted to the hospital with a new diagnosis of atrial fibrillation and congestive cardiac failure. During this admission there was deterioration of his right lower limb arteriovenous malformation, located between his abdominal aorta and right femoral artery, which caused a right foot ulcer. He was treated with anticoagulation therapy and diuretic therapy, and was discharged from the hospital approximately one month after the admission, although his foot ulcer required frequent care because it was refractory after hospital discharge.
+
+The hospital admission after repeated evacuations notably weakened our patient's physical activity. After hospital discharge (approximately 4 months after his initial evacuation from Tomioka town), he moved into a temporary house constructed for evacuees in Koriyama city because the mandatory evacuation order continued. Although he could not ambulate, dress, or bathe himself without support, he did not need support for eating and using the toilet. The temporary house presented a particularly difficult environment for someone with a physical disability; unpaved roads around the house severely limited his opportunities to go outside and the bath was too narrow to use while requiring support from family.
+
+His physical condition gradually worsened. Continuation of frequent care, such as washing and applying ointments, did not improve his foot ulcer. Following a detailed medical examination in February 2012, which revealed that his arteriovenous malformation was no longer eligible for aggressive intervention, he decided to only be treated with supportive therapy. From August 2012, he became confined to bed and required assistance for all activities of daily living. In July 2013, he was no longer able to go out to temporarily visit his original home in the evacuation zone, which had been only thing he looked forward to. He prioritized time with his family, did not like being admitted to hospital, and did not seek medical care outside of periodic visits to the clinic. Although he was hardly eating, and was aware of pain in his right limb and shortness of breath from December 2013, he did not visit the hospital. In the middle of a night in February 2014, he was transported to the hospital after massive bleeding from his right foot ulcer. After admission to the hospital, infection to the ulcer was found in addition to refractory bleeding. Despite blood infusion therapy and antibiotic therapy, he died of septic shock 18 days after admission.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3068_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3068_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5fdfbd29ddebfa4de3069815787b6dd8f49d2fe2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3068_en.txt
@@ -0,0 +1 @@
+We present the case of a 59-year-old woman with a history of heavy smoking and hypertension, but no relevant cardiovascular history. Her condition started twenty days ago, characterised by chest pain, dyspnoea and fever. Based on the clinical presentation, acute community-acquired pneumonia was suspected and empirical antibiotic treatment was initiated. Although the fever and chest pain had subsided, dyspnoea persisted for another fifteen days, which led her to consult again at the nearest hospital, where an electrocardiogram (ECG) revealed poor progression of R in the precordial leads, ST elevation and negative T waves. The transthoracic echocardiogram showed a severely depressed ejection fraction with apical akinesia with associated apical thrombus. With these findings, an evolved acute myocardial infarction was diagnosed and a differential diagnosis between an aneurysm with apical thrombus and a pseudoaneurysm secondary to a cardiac rupture was raised. The patient was transferred to our hospital for further evaluation and possible intervention. On admission, she was haemodynamically stable and showed no signs of low output or heart failure. Blood tests were normal. The coronary angiography that revealed an occlusion in the mid-portion of the descending anterior aorta with TIMI 0 flow and no development of collateral circulation. The remaining coronary arteries showed no other significant lesions. Subsequently, for a better anatomical understanding, a cardiac magnetic resonance (MRI) and cardiac computed tomography (CT) were performed that demonstrated severe left ventricular dysfunction, subacute infarction in the territory of the descending anterior aorta and a rupture of the left ventricular free wall with an apical thrombus containing a thrombus, which exhibited partial fragmentation in the strictly apical region. Based on these findings, the possibility of surgical intervention was evaluated, but the chest X-ray revealed severe emphysema and pulmonary function tests showed severe obstructive ventilatory impairment. For this reason, an interdisciplinary discussion was held, exploring the options of surgical repair or heart transplantation. For surgical repair with a patch (Dor procedure), it was considered that the remaining cardiac volumes would be insufficient. On the other hand, it was considered risky and probably futile to perform a heart transplantation in a patient with severe chronic obstructive pulmonary disease. Therefore, in a joint decision with the patient, it was decided to opt only for medical treatment. Nine months after diagnosis, she remains asymptomatic.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_306_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_306_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d8d387f5a649305c910bbe0c6525e52181027cf7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_306_en.txt
@@ -0,0 +1 @@
+A 35-year-old woman presented with five days of nightly accentuated burning pain in both legs leading to massive sleep disturbance. The pain was predominantly located in the dorsal thighs and radiated to the calves. She reported some relief through walking around at night and showering her legs with hot water. Back pain, gait or sensory disturbances and bladder dysfunction were denied. Nonsteroidal anti-inflammatory drugs did not alleviate pain, neither did pramipexole, which had been prescribed for suspected restless leg syndrome. One week before she had had a sore throat and had been clinically diagnosed for streptococcal tonsillitis and treated empirically with penicillin. Her past medical and family history was unremarkable. Clinical examination revealed no focal-neurologic signs. There were no sensory deficits and deep tendon reflexes were symmetrically normoactive. Furthermore, we found no palpable lymph node swelling and no signs of pharyngitis. Motor and sensory nerve conduction studies were normal, as were F-responses of the tibial nerve. Abdominal Ultrasound demonstrated a slightly enlarged spleen. Blood sampling showed relative lymphocytosis, and elevated liver enzymes. Cerebrospinal fluid analysis revealed 18 white blood cells/μl (90% lymphocytes, 10% monocytes), 83mg/dl protein, and blood–brain-barrier dysfunction (albumin CSF/serum quotient 12.5 × 10-3) without intrathecal immunoglobulin synthesis. Virological studies detected EBV VCA IgG and IgM in serum, whereas EBV EBNA-1 IgG was negative. Moreover, EBV-PCR (RealStar® EBV PCR Kit 1.0, altona Diagnostics GmbH, Germany) was positive in blood and CSF (1000 copies/ml each) suggesting primary EBV infection involving the nervous system. Further laboratory investigations were not indicative for infections with streptococcus, borrelia, syphilis, HIV, hepatitis virus A, B or C (serological tests in blood, borrelia and syphilis additionally in CSF), VZV, HSV or enteroviruses (VZV- and HSV-IgG-specificity-indices and PCR in CSF). Under initially started empiric therapy with intravenous acyclovir for possible VZV or HSV radiculitis and analgesic treatment with oral tramadol the patient completely recovered within a few days. After receiving negative results for VZV and HSV, acyclovir was ceased on day six.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3082_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3082_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2b3db7edf0fd239e84e10ea2e3bf32f559b70b1d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3082_en.txt
@@ -0,0 +1,7 @@
+An 81-year-old male was admitted to the Huizhou Central People’s Hospital on September 18, 2022, with a principal complaint of fever and dyspnea. Three days before admission, the patient developed a fever with a maximum temperature of 39.5°C with no apparent cause. The fever was accompanied by dyspnea, chills, fatigue, muscle pain, and intermittent cough. The patient produced little sputum and did not complain of abdominal pain or diarrhea. The patient did not report marked improvement after self-medicating with oral cefuroxime and acetaminophen. One day prior, the patient visited the emergency department of our hospital. Chest computed tomography (CT) indicated a considerable consolidation in the left lung, patchy exudative lesions in the right lung, and a small amount of pleural effusion in the left lung. The patient received piperacillin-sulbactam (4.5 g IV q.8 h) antibiotic injections, but the fever persisted, and the patient was subsequently admitted. The patient had a 5-year history of type 2 diabetes mellitus and was not taking hypoglycemic medication regularly.
+
+Physical examination revealed a body temperature of 39.1°C; pulse, 95 beats/min; respiratory rate, 30 breaths/min; and blood pressure, 132/70 mmHg. The patient was conscious but described feeling in poor spirits; there was no evidence of rash, subcutaneous bleeding, or superficial lymph node enlargement. Breathing was slightly rapid, with coarse breath sounds in bilateral lungs and wet rales in the left lower lung. No other major abnormalities were noted.
+
+Laboratory test results were as follows: blood gas analysis (FiO2 33%): pH, 7.505; pO2, 53 mmHg; pCO2, 27 mmHg; HCO3, 21.3 mmol/L; ferritin, >2000 µg/L (reference range: 13–150 µg/L); blood phosphorus, 1.52 mmol/L (reference range: 0.85–1.51 mmol/L); blood sodium, 145 mmol/L (reference range: 135–145 mmol/L); and urine erythrocytes, 530/µL (reference range: 0–17/µL).
+
+After admission, the patient was diagnosed with severe community-acquired pneumonia and administered meropenem injection (1.0 g IV q.8 h) and oseltamivir capsules (75 mg q. 12 h) as empirical antibiotic/antiviral treatment, hepatoprotective medication, and transnasal high-flow oxygen therapy. The patient’s dyspnea was aggravated on the night of admission, with the oxygenation index falling to 62.5, leading to the initiation of emergency tracheal intubation and invasive mechanical ventilation. Given that the patient had a severe infection of unknown etiology, 10 mL of bronchoalveolar lavage fluid was collected via fiberoptic bronchoscopy on day 2 after admission for metagenomic next-generation sequencing (mNGS). During this period, antinuclear antibody panel, serum 1,3-β-D-glucan assay (G test), galactomannan (GM) assay, SARS-CoV-2 nucleic acid test, Legionella DNA test, and tests for IgM antibodies to respiratory pathogens (including L. pneumophila, Mycoplasma pneumoniae, Rickettsia, Chlamydia pneumoniae, adenovirus, respiratory syncytial virus, influenza A virus, influenza B virus, and parainfluenza virus) were all negative. Additionally, multiple sputum and blood cultures were negative. On day 4 after admission, the patient’s temperature remained above 38.5°C, the dyspnea did not improve, cough and sputum increased, inflammatory indicators were higher than before, and severe liver and renal insufficiency was observed. Chest CT re-examination indicated bilateral increases in lung lesions. On day 4 after admission, mNGS results indicated the presence of L. pneumophila (76 sequences, coverage 32%) and Candida albicans (115 sequences, coverage 43%). According to the clinical manifestations and results of mNGS, severe L. pneumophila pneumonia was suggested. Given the severe hepatic and renal dysfunction, the antibiotic regimen was changed to omadacycline injection (first dose: 200 mg IV q.d., second dose: 100 mg IV q.d). Five days later, the dyspnea resolved completely, re-examination of inflammation and organ function indicators showed dramatic improvement, and intravenous omadacycline was continued. On day 14, the patient was weaned from tracheal intubation, and transnasal high-flow oxygen therapy was administered. On day 22, all inflammation and organ function indicators had generally returned to normal, and chest CT indicated that the bilateral lung lesions were markedly resolved. Omadacycline was discontinued, and the patient was discharged the following day. At the 2-month follow-up, the patient’s general condition was satisfactory, with only occasional cough and no dyspnea. Chest CT indicated the lung lesions were almost entirely resolved, with only a few fibrotic streaks remaining.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3092_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3092_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..645987f1fcfa7edf5ac12ff53636188c16b25d4d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3092_en.txt
@@ -0,0 +1,11 @@
+18-month-old male infant, the only child of a non-consanguineous couple with no family history of recognized genetic syndromes. His mother, 38 years old at the time of delivery, denied use of medication, as well as smoking or drinking. Routine prenatal examinations were normal, with the exception of the detection of polyhydramnios on the ultrasound of the third trimester. The patient was born by caesarean section at 36 weeks, weighing 2,695 g (0<z<+1), measuring 48 cm (0<z<1) and with Apgar: 8/9. The initial evaluation of the newborn detected important facial asymmetry (E>D) associated with microtia grade 3 and an appendix in the trago-oral line on the right. In addition, he presented important suction deficit and respiratory discomfort, remaining on continuous flow of air pressurized in airways by means of CPAP until being submitted to tracheostomy and gastrostomy, with 16 days of life. He was discharged with 38 days of life and with need of supplemental oxygen.
+
+At 2 months of age, he was referred to the thoracic surgery outpatient department of HC-UFTM for evaluation of stridor and intensification of respiratory discomfort. He underwent naso-fibroscopy, which identified a granuloma just below the tracheostomy orifice, and was submitted to resection. In the same period, he was evaluated by pediatric pneumology and clinical genetics.
+
+The infant's physical examination revealed hypodevelopment of the facial structures on the right, associated with thoracic kyphoscoliosis, but without the description of epibulbar dermoid. His skull and face CT scan showed agenesis of several structures on the right side of the face, including the upper and lower hemibows, zygomatic arch, masticatory musculature, parotid gland and external auditory canal. No intracranial malformations were found. Urine tract ultrasound was normal, and panoramic radiograph of the spine identified hemivertebrae at the level of T11 and T12, justifying the thoracic deformity. The auditory evoked potential of the brain stem (AEP) confirmed conductive hearing loss in the right ear, and, although there was no heart murmur, the patient underwent a transthoracic echocardiography, which was normal. Finally, the cytogenetic examination with GTG banding, through temporary culture of lymphocytes, and the cytogenomic examination, using the high resolution platform CytoSNP-850®, were normal. The findings of the physical examination combined with the complementary examinations led to the diagnosis of MCF.
+
+The infant had several visits to the emergency department for nausea, respiratory distress and stridor. At 5 months, he was admitted for investigation of airway obstruction, and a new nasofibroscopy identified a recurrent granuloma, leading to significant tracheal stenosis. The patient underwent granuloma removal again, followed by dilation and exchange of the tracheostomy tube for a longer one to prevent further stenosis.
+
+About four months later, the patient presented with a new episode of respiratory discomfort, requiring admission, and was diagnosed with community-acquired pneumonia. On that occasion, he underwent a contrast-enhanced chest CT scan, which showed a trachea with diffusely thickened walls, with a slight reduction in caliber below the end of the tracheostomy cannula; altered pulmonary attenuation, with discrete opacities; and the presence of an aberrant right subclavian artery running posteriorly to the esophagus.
+
+The infant underwent surgery for ligation and disconnection of the vascular ring caused by the aberrant right subclavian artery at 22 months of age. No other thoracic malformations were described during the surgical procedure. His postoperative course was uneventful, and his mother reported that after the surgical treatment, she has not observed episodes of nausea, or even stridor or respiratory discomfort. The patient is currently being followed by a multidisciplinary team, with good motor progression and awaiting reevaluation for craniofacial surgery.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3098_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3098_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3be08c995a1fee5f5a04004c438df34c1b97ef22
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3098_en.txt
@@ -0,0 +1,7 @@
+9-year-old female patient was admitted to the emergency department (ED) with respiratory distress. She had a history of six months of less severe dyspnea and symmetrical polyarthritis of large and small joints (proximal interphalangeal, 2nd and 3rd metatarsophalangeal joints, wrists, elbows, ankles, and knees), with functional limitations and intermittent fever (38-39°C), associated with malar rash aggravated by sun exposure, alopecia, petechiae on trunk and neck, generalized lymphadenopathy, and unmeasured weight loss. Therefore, she was started on 6.5 mg/kg/day hydroxychloroquine and 100 mg/kg/day cefepime (maintained for 10 days). Pulse therapy with methylprednisolone was not initiated at this time due to the possibility of infection.
+
+Laboratory tests, imaging studies, and a myelogram were then performed. A chest ultrasound was performed in the emergency room, revealing a left pleural effusion of 0.7 cm. This was complemented by a chest radiograph that showed a lingual atelectasis. The myelogram results revealed a hypocellular marrow with <1% blasts, mild granulocytopenia, and erythropoenia. The patient met the 2012 Systemic Lupus International Collaborating Clinics (SLICC) criteria for SLE (presence of acute cutaneous lupus, alopecia, arthritis, serositis, hemolytic anemia, thrombocytopenia, antinuclear antibodies (ANA), anti-DNA, and antiphospholipid antibodies). Thus, prednisone 1 mg/kg and azathioprine 2 mg/kg were added to the prescription after these results.
+
+Three days after admission, the patient developed a significant worsening of the general condition, worsening of dyspnoea, muffled heart sounds, jugular vein distension, haemodynamic instability and intense pallor. An echocardiogram was performed, which showed a large pericardial effusion with diastolic collapse of the right atrium. The patient received a transfusion and underwent a pericardiocentesis followed by pleuropericardial seal drainage. Due to the obstruction of the drain, a new approach was adopted the next day, without major complications. A new echocardiogram was performed two days later, showing moderate left ventricular systolic dysfunction, an ejection fraction of 60% and moderate tricuspid regurgitation. The therapies with furosemide 2 mg/day and spironolactone 2 mg/day were then initiated. Intravenous immunoglobulin (1 g/kg/day) was administered in two subsequent days due to persistent autoimmune bicytopenia. The echocardiogram two weeks later showed no pathological signs.
+
+Antigenemia for CMV was requested after a positive serological result with titers of 15/200,000 cells. Therapy with ganciclovir 5 mg/kg/day was initiated. After ten days of treatment, the antigenemia persisted (28/200,000 cells), and the dose of ganciclovir was, therefore, doubled. After eight days, another antigenemia presented titers of 1/200,000 cells. The patient maintained treatment with ganciclovir 10 mg/kg/day for two more weeks, with good clinical and laboratory improvement and was discharged with oral valganciclovir 20 mg/kg/day.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3100_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3100_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..034233e3e345cc00fe49ab9716527c25d3a0d886
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3100_en.txt
@@ -0,0 +1,24 @@
+A 20-year-old Caucasian female visited the Emergency Department (ED) with complaints of fever, constant left abdominal pain and generalized profuse fatigue. These symptoms had occurred at rest few days before the ED admission. She also mentioned an episode of dysuria and fever ten days before, which had been treated with ciprofloxacin in the suspect of cystitis. Moreover, she reported having assumed three oral contraceptive pills containing ulipristal acetate in the 30 days before the symptom onset. At the time of presentation, she denied nausea, diarrhea, or constipation, contact with animals, trips abroad, insect, or tick bites.
+
+In January 2022, the patient had had SARS-CoV2 infection which had required anti-inflammatory therapy with ibuprofen and paracetamol without hospitalization need. She denied previous surgical interventions, autoimmune diseases, or chronic disease for which any chronic therapy was required. She reported no allergy toward drug and environmental allergens. Her relatives had never suffered from liver or biliary disease. In addition, she denied any relationship with hematologic disorders such as hemolytic anemia. Regarding her social habits, she confirmed no excessive assumption of alcohol, and she denied smoking cigarettes. However, she reported a minimal physical activity as well as a high intake of sugar-containing beverages and food.
+
+On admission, the patient’s initial vitals included blood pressure 100/60 mm Hg, pulse 75 beats per minute, respirations 15 breaths per minute, temperature 37.5°C and an oxygen saturation of 98% on room air. Physical examination revealed an alert, oriented female with grade III obesity (weight 115 kg, height 160 cm). Physical examination revealed severe jaundice involving the muco-cutaneous surfaces and the sclerae. No lymphadenopathies were palpable superficially. Head, ears, eyes, nose, throat (HEENT), neck, cardiovascular, respiratory, musculoskeletal, and neurological examinations were all grossly unremarkable. The abdominal examination revealed mild upper left abdominal pain exacerbated by deep palpation, without tenderness. Murphy and Courvoisier signs were absent. No flapping tremor was elicited.
+
+Initial blood tests indicated leukocytosis with white blood cell (WBC) count 28460/mm3, normochromic normocytic anemia with hemoglobin 7.9 g/dL, platelets count (PLT) 212000/mm3, hyperbilirubinemia with total serum bilirubin 23.11 mg/dL composed prevalently of direct bilirubin 19.36 mg/dL, elevated liver function tests (ALT 244 U/L, AST 202 U/L), cholestasis index (GGT 372 U/L, ALP 300 U/L), and C-reactive protein (CRP) 17 mg/dL. Haptoglobin was depleted and Lactate DeHydrogenase (LDH) was significantly elevated (3190 U/L).
+
+To better clarify the etiology of these findings, the patient was tested for various infections, including HIV, hepatitis A, E, B, C viruses, cytomegalovirus, syphilis, West Nile virus, Plasmodium malariae, all returning negative results. Furthermore, abdominal ultrasonography and CT scan ruled out biliary obstruction or pancreatic disorders. No evidence of autoimmune hepatitis was found. Interestingly, EBV serology test showed a probable acute infection phase: Virus Capsid Antigen IgM (VCAM) > 160 UI/mL, Early Antigen (D) IgG (EAG) 45.9 UI/mL, Virus Capsid Antigen IgG (VCAG) 47.4 UI/mL and Epstein-Barr Nuclear Antigen (EBNA1) 8.1 UI/mL. The infection acuity was confirmed by EBV DNA titer which was extremely high (123600 copies/mL). Moreover, the direct antiglobulin test for Complement 3 Factor (C3) and cold agglutinin test were positive. Lastly, liver and bone marrow biopsies revealed ring granulomas consistent with EBV infection and a pattern of acute intrahepatic cholestasis indicative of potential drug-induced liver injury.
+
+These findings suggested liver failure due to EBV infection, CAS and a possible oral contraceptive pill toxicity.
+
+Disease Management and Outcome
+Based on her diagnosis, the patient was admitted to the Hematology ward. For her hemolytic anemia, she underwent a first-line treatment with high dose methylprednisolone 1 mg/kg intravenously daily and immunoglobulin 1 g/kg intravenously for two days. However, a progressive worsening of general conditions occurred during hospitalization, developing hepatic failure with bilirubin levels rising to 43 mg/dL, hyperbilirubinemia-associated acute kidney injury, and respiratory failure requiring high-flow-nasal-cannula support. Consequently, she was transferred to the Intensive Care Unit (ICU), where she underwent central venous catheter placement due to poor venous access and her critical condition.
+
+Given the complexity and the multifactorial etiology of the case, multiple clinical specialists were asked to carry out the best patient management. Initially, the patient was subjected to Plasorba BR-350 treatment, a selective adsorption mechanism for bilirubin and bile acid exceeding in plasma. Then, in consultation with nephrologists, continuous veno-venous hemofiltration (CVVH) was initiated to gradually improve kidney function.
+
+She also started hepatoprotective therapy with ursodeoxycholic acid 300 mg orally twice daily, lactulose orally and K vitamin 10 mg intravenously daily.
+
+Given her unresponsiveness to steroid therapy for hemolytic anemia and the concomitant EBV infection, in the context of secondary cold agglutinin syndrome, the patient received rituximab (375 mg/m2 weekly), a chimeric anti-CD20 monoclonal antibody effective against both disorders. Rituximab treatment proved effective in depleting EBV-infected B-lymphocytes and those involved in hemolytic pathogenesis.
+
+After a few weeks and four rituximab administrations, we observed a progressive amelioration of the patient clinical condition, with no more need of dialytic and respiratory support. She was gradually weaned off oxygen therapy, and her jaundice resolved along with normalization of liver function tests. After rituximab therapy, the EBV-DNA titer resulted negative, as also were cold agglutinin levels. Her hemoglobin level gradually returned to normal values.
+
+Finally, after one month of hospitalization, the patient was discharged in good general condition, with normal liver, renal and hemoglobin values.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3101_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3101_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..14f2b02560252a43d049f083651e06e674573800
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3101_en.txt
@@ -0,0 +1,25 @@
+Male patient, only child of a Brazilian healthy non-consanguineous couple. Second trimester ultrasonography observed fetal ascites and bilateral hydrocele. Prenatal screening for infectious diseases was negative. There was no drug abuse during pregnancy.
+
+The child was born at term, by cesarean section, with birth weight of 3400 g (p58), length of 48 cm (p20), and OFC 35.5 cm (p79). Clinical examination showed hydrocele, diastasis recti, and unilateral clubfoot. There were no signs of hepato or splenomegaly (and abdominal ultrasound was normal at birth). Echocardiogram at 4 days of life disclosed just patent foramen ovale. The patient was evaluated by the Genetics unit. No specific diagnosis was suspected, even though mild coarsening facies was already present. Skeletal survey performed at one-month-old, due to congenital clubfoot and dysmorphisms, revealed mild proximal misshapen metacarpals and thickening of the provisional cartilage.
+
+When the child came back to the Genetics evaluation at 6 months-old, the mother reported she had noticed a progressive growing mass in the lower back since the patient was 2 months old. This had been investigated with X-rays and MRI in one of the patient’s visit in the Emergency Unit due to respiratory symptoms. The mother also reported that the patient had been suffering of frequent upper respiratory tract infections, needing hospitalization twice for wheezing crises.
+
+At physical exam, the patient displayed a typical gibbus deformity (Fig. 1), which raised the suspicion of mucopolysaccharidosis. Since the patient had had fetal ascites, initially, MPS VII was suspected. Biochemical investigation revealed a diagnosis of MPS type VI (urinary glycosaminoglycans: 402 μg/mg Cr, reference value for age: 133–460 μg/mg Cr, with dermatan sulfate excretion, and enzymatic assay detected arylsulfatase B deficiency in white blood cells, with another sulfatase within the normal range).
+
+Sequencing of the ARSB gene showed two pathogenic variants in trans: c.944G > A (p.Arg315Gln) and c.1143-1G > C.
+
+At the age of 7 months, the patient was brought to the emergency unit due to respiratory distress. A chest X-ray showed a possible lung congestion and echocardiogram revealed discrete tricuspid regurgitation and a thickened mitral valve with posterior leaflet prolapse, causing moderate to severe regurgitation. As a result, furosemide was prescribed. Due to the rapid cardiologic changes, captopril and spironolactone were added.
+
+At 9 months of age, the patient was hospitalized again because of cardiac decompensation. Comparative chest X-ray showed an increased cardiac area, and echocardiogram indicated worsening of mitral regurgitation. Dobutamin and dopamine were initiated, and the patient was transferred to the intensive care unit (ICU). Dobutamin was progressively withdrawn and carvedilol was introduced. Progressive improvement of respiratory distress was seen. However, a few days later echocardiogram showed left atrium and left ventricle enlargement, normal left ventricular systolic function, discrete tricuspid insufficiency, mitral valve with thickened leaflets, posterior prolapsed leaflet and severe regurgitation, evident with Doppler.
+
+With the rapid progression of mitral regurgitation, at 10 months the patient developed congestive heart failure and dobutamine was resumed. After stabilization, the patient was discharged receiving furosemide, captopril, spironolactone, carvedilol, digoxin, aspirin, and domperidone.
+
+A few days after discharge, the patient was readmitted to the emergency room due to hyporexia, irritability and vomiting. The physical exam showed tachycardia, hypoxemia, respiratory distress, and hepatomegaly. He was sent to ICU, with worsening of cardiac function. The patient used bilevel positive airway pressure (BiPAP). Because of significant mitral insufficiency, left ventricular dilatation and refractory cardiac failure, in a patient with a genetic multisystemic disorder, a multidisciplinary team met to discuss the management.
+
+It was decided to perform cardiac surgery (valvuloplasty with mitral valve ring reduction) (Fig. 5). The patient was 11 months by the time of the surgical intervention. LV shortening fraction at 7, 9, 10 and 11 months were 70, 56, 79 and 58%, respectively. ECG showed left ventricular overload and normal sinus rhythm.
+
+A month after the surgery, the patient began enzyme replacement therapy (ERT) with galsulfase weekly.
+
+The last echocardiography shows discrete mitral insufficiency after valvuloplasty and last glycosaminoglycan measurement in urine was within normal range (246 μg/mg creatinine - Reference value for children under 2y: 79–256 μg/mg creatinine).
+
+After the cardiac surgery, growth was improved (weight and height). The patient is currently with 2.5 years old and presents with mild motor delay (sat alone at 18 months and walked at 23 months old).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3109_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3109_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e3706d6a196aba317a27bafaa03a6f82291dabf2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3109_en.txt
@@ -0,0 +1 @@
+A 44-year-old woman was admitted to hospital during the 2nd wave of the COVID-19 pandemic in Madagascar (April 2021), for severe epigastric pain. She was neither an alcoholic nor a smoker. The patient did not report a history of trauma or recent surgery. The patient presented a week earlier with asthenia, myalgia, dry cough, a few episodes of difficulty breathing and fever. The Chest computed tomography scan showed bilateral ground glass opacities. COVID-19 reverse transcription polymerase chain reaction (RT-PCR) of nasopharyngeal swabs was positive. A moderate COVID-19 was retained. The patient had a favorable evolution with home isolation and drug management (paracetamol, aspirin, atorvastatin, amoxicillin-clavulanic acid, enoxaparin preventive dose). One week later, severe epigastric pain (visual analog scale 9/10), associated with nausea and vomiting (3–4 times) suddenly appeared, leading to hospitalization. General examination reported a Body mass index of 28.5 kg/m2, a blood pressure of 100/70 mmHg, a heart rate of 64 bpm, a respiratory rate of 26/min and an oxygen saturation of 94%. Physical examination on admission showed epigastric tenderness and abdominal bloating. Laboratory tests reported a serum lipase level at 301 U/L (> 3 X Upper limit of normal), C-reactive protein at 25 mg/L, serum calcium level at 2.2 mmol/L, serum triglyceride level at 2.1 g/L, D-dimer at 805 ng/mL. The other laboratory tests are reported in Table 1. Abdominal ultrasound showed no extrahepatic or intrahepatic lithiasis. The Abdominal computed tomography scan showed a benign edematous pancreatitis with no evidence of gallstones. The outcome was favorable under symptomatic medical treatment associating fluid resuscitation, bowel rest, management of pain and vomiting, preventive dose of enoxaparin and early oral feeding upon pain resolution. The patient was discharged after one week of hospitalization. We ultimately retained the diagnosis of SARS-CoV-2 infection induced AP in a woman patient without risk factors.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3125_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3125_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3ca370babf62802227aa2ba07bd080f3db2d45d8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3125_en.txt
@@ -0,0 +1,7 @@
+We report an 83-year-old Caucasian woman with a past medical history significant for squamous cell carcinoma and basal cell carcinoma of the face treated with surgical removal 11 years previously who presented to her primary care provider with left thumb pain for 1 week. She reports pain on the dorsal aspect of the distal left phalanx, including her nail plate, with mild associated swelling. She denies specific trauma or injury. Examination showed a focal area of erythema under the nail plate without other discoloration. Radiographs were obtained in the clinic with no occult fracture or bony erosion findings. She was prescribed an antibiotic and ibuprofen and asked to follow-up if there was no improvement. After several weeks, she presented again with worsening thumb pain. Examination showed similar but progressive findings. A felon was suspected, and she was prescribed oral antibiotics and instructed to complete warm water soaks. Nail plate removal was offered which the patient declined.
+
+Several days after this encounter, she presented to her annual dermatology appointment where the provider noted onychodystrophy of the left thumbnail with firmness to the distal thumb and interruption of the ulnar nail plate. She was offered a referral to orthopedic hand surgery versus a trial of intralesional triamcinolone injection. She chose injection into the left thumb ulnar paronychium. The patient was instructed to follow-up in a few weeks for reassessment and possible biopsy if the lesion did not improve. Reassessment several weeks later yielded no improvement of symptoms. At that time, the left thumb was noted to have significant erythema, tenderness, and swelling of the pad with dystrophic changes to the ulnar nail fold and distal onycholysis. This prompted an orthopedic hand surgery referral for concern of developing subungual tumor. That same day, radiographs showed new osseous erosion of the thumb distal phalanx. A magnetic resonance imaging (MRI) scan of the thumb showed a destructive mass involving the left thumb distal phalangeal tuft extending to the mid phalanx to the nail bed.
+
+Within a week, the patient was evaluated in the orthopedic hand surgery clinic. Computed tomography-guided biopsy was performed for differentiation between osteomyelitis versus an oncologic process. Biopsy revealed an invasive, well-differentiated squamous cell carcinoma involving the nail plate with underlying bony infiltration. Orthopedic hand surgery recommended surgical excision with disarticulating amputation through the interphalangeal joint of the thumb. Oncology was consulted prior to surgery and no sentinel lymph node or adjuvant therapy was indicated.
+
+Amputation through the interphalangeal joint of the left thumb was performed without event. Gross examination of the specimen showed tumor involvement of the nail bed. Further examination of the amputated distal phalanx revealed tumor involvement of the bone. Pathologic report of the specimen showed a 1.7 × 1.7 cm invasive squamous cell carcinoma with free tissue margins. Oncology determined no indication for adjuvant therapies with long-term follow-up per National Comprehensive Cancer Network guidelines with low threshold for imaging if new symptoms arise. At her 4-month postoperative visit, she has recovered well, is pain-free, and is clinically free of disease recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3131_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3131_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d2a681516742cd371c9dc9f2ba1c9491ce93d459
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3131_en.txt
@@ -0,0 +1,5 @@
+A 77-year-old woman visited her local doctor complaining of decreased visual acuity in her left eye for 1 month. She was referred to our Department for further examination and treatment of vitreous opacity in the left eye. She has been on treatment for dermatomyositis, diabetes mellitus, and right parotid tumor with prednisolone (6 mg/day) and tacrolimus hydrate (2 mg/day) for 3 years.
+
+On the initial visit, the best-corrected visual acuity was 0.04, counting fingers, and the intraocular pressure was 17.0 mmHg and 13.3 mmHg in the right and left eyes, respectively. Slit-lamp microscopy revealed Grade 4 (Emery-Little classification) nuclear cataracts in both eyes, and kerato-precipitates and tan vitreous opacity in the left eye. The left optic nerve head was vaguely observed due to vitreous opacity. B-mode echography of the left eye showed relatively dense vitreous opacity and membranous material on the surface of the retina.
+
+We considered the tan-like vitreous opacity to be an old vitreous hemorrhage and performed a phacovitrectomy. When the cataract and vitreous opacity were removed, almost total retinal detachment, except for a part of the superior periphery, was observed. Since no retinal break was found and a wide range of thin membrane-like tissue was found on the surface of the retina, the surgeon considered possible PIOL for the first time and performed an unplanned biopsy. The peripheral vitreous was collected as a sample that had already been diluted with irrigating fluid. Therefore, the subretinal fluid was collected through an intentional break to prevent mixing with other fluids. Silicone oil was injected at the end of the surgery. Because the subretinal fluid had slightly increased and involved the macula, re-PPV was performed to further aspirate the subretinal fluid, and the subretinal strand close to the inferior arcade vessel was gently pulled out and collected as a sample. These samples were submitted for cytology, IL-10/IL-6 ratio measurement, and AIGHR. Cytology revealed class II vitreous specimens and class III subretinal fluid (mainly lymphocytes with mild karyotype but no atypia). The pathologist ascertained that the specimen from subretinal fluid was class III, considering the possibility of low-grade MALT lymphoma, which suggests severe dysplasia, carcinoma in situ, or cancer. Cytokine measurements showed that the vitreous fluid was unmeasurable, and the subretinal fluid had a low IL10/IL6 ratio <1.0. The results of AIGHR in the subretinal fluid were positive for monoclonality. The subretinal fluid was gradually reduced, and subtenon injection of triamcinolone acetonide was effective for macular edema. Although the outer retinal layer was atrophic in the macular area, visual acuity in the left eye improved to 0.3. Fundus autofluorescence imaging showed localized hypofluorescent areas corresponding to intentional breaks and surrounding photocoagulated scars. No leakage was observed on fluorescein and indocyanine green fluorescence angiography, and the location of typical subretinal infiltration was unclear. The right eye underwent cataract surgery and visual acuity improved to 0.9. Fundus examination revealed no abnormal findings including IOL-related changes. There were no positive findings on head-enhanced magnetic resonance imaging or whole-body fluorodeoxyglucose positron emission tomography-computed tomography, and a diagnosis of PIOL was made. No relapse of intraocular inflammation was observed, and the patient was carefully monitored.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3141_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3141_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..816e36beb53fc22239f572d4942423531089a7fe
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3141_en.txt
@@ -0,0 +1,19 @@
+We present the case of a 40-year-old male patient who sustained a L2 vertebral burst compression fracture with a large frontal bone fragment, after falling from a horse, treated with off-label use of teriparatide.
+
+At initial visit, the vertebral fracture has been classified as A2/A3 type according to the AO spine thoracolumbar classifications system through CT/MRI, without involvement of the spinal cord canal or damages to other soft tissues. The fracture was stable without any compromission of the posterior vertebral wall. Surgical indication was immediately given due to the presence of a voluminous anterior bone fragment, comminution and risk of anterior wall separation.
+
+Initially, it was nevertheless decided for conservative treatment with rest, waiting and seeing if the fracture would have spontaneously healed since the young age of the patient. The patient started to use a C35 rigid back brace by night and day for the first 2 months and only during day for the third month, in order to keep the fracture stable, avoiding any other damages. The patient continued to work, without driving for 35 days.
+
+To reduce back pain, morphine (5 mg twice per day) was subcutaneously administered for 2 days, paracetamol (1000 mg twice per day) for 15 days and dexibuprofene (400 mg twice per day) for 6 days.
+
+However, after 40 days from the start of conservative treatment, there was no improvement in bone healing process, but an extensive bone edema was present. Thus, the previous recommendation of surgical treatment with spine fusion and later implant removal was strengthened.
+
+To avoid surgery and its related possible complications, the patient did not give his consent to undergo surgery and, in agreement with his spine surgeon and neurologist, decided to undergo an off-label treatment combining nocturnal Pulsed Electro-Magnetic Field (PEMF) therapy for 6–7 h/day with daily subcutaneous injection of 20 μg of Teriparatide (Forsteo®, Eli Lilly & Co Ltd., Liverpool, England), and with further administration of calcium (2 tablets/day of cal-mag-vitD3) and vitamin D (14 drops of Didrogyl® once a week) supplements for the subsequent 5 months, to enhance bone healing.
+
+In addition, a cane has been used as a support and to prevent the occurrence of other fractures and/or injuries to the spinal cord. Moreover, physiotherapy was performed with 10 min of elliptical machine twice a day, and 10 min of rowing ergometer, for the first 15 days after rigid back brace removal. The patient underwent periodic radiological follow-up.
+
+After this period of 5 months, complete healing of the vertebral fracture was shown by Magnetic Resonance Imaging (MRI).
+
+Laboratory exams were performed to inspect the degree of inflammation, and they showed optimal results, with testosterone and thyroid levels within normal parameters.
+
+After complete fracture recovery, the patient does not complaint pain anymore but only a moderate stiffness of the spine segment involved. Nevertheless, he was able to move as before the trauma and to return back to horse riding.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_314_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_314_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8ae8a6524c9d4f0012d6bbdce3af187a664cfaa2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_314_en.txt
@@ -0,0 +1 @@
+In June 2022, a 65-year-old female patient with a history of hypertension and dyslipidemia came to the outpatient department with a complaint of chest pain and shortness of breath. According to the patient, she was in a normal state when suddenly she started having chest pain that was sharp, high in intensity, and radiated to the left arm, worsened with exertion, and was relieved by relaxation and medication. She also has shortness of breath. After taking history and examination, the patient was found to have paroxysmal nocturnal dyspnea and orthopnea. Her pulse was 68 and her blood pressure was 140/100. Past medical history revealed she had hypertension, cholelithiasis, and dyslipidemia. In 2008, she was diagnosed with class II angina according to CCS (Canadian Cardiovascular Society) grading. Coronary angiography was carried out in 2008, which revealed triple vessel coronary artery disease, valvular heart disease, and ostial stenosis, for which she underwent CABG-AVR in 2009. In CABG, the long saphenous vein was harvested from the right thigh and left leg. The pieces were joined to create an appropriate length. The left internal mammary artery was 1.5 mm, with excellent flow. LAD was found to have a diameter of 1.75 mm and was clean and located within the heart muscle (intramyocardial). The LAD was grafted with left internal mammary artery while the obtuse marginal was grafted with a reversed saphenous vein graft. In 2013, myocardial perfusion imaging was done using 8 mCi of Tc-99m isotope, which revealed normal findings. After this period, the patient remained asymptomatic upon examination in the outpatient clinic till June 2022. Transthoracic echocardiography and a Doppler study were done in June 2022, which revealed normal size left ventricle, an ejection fraction of 55%, and diastolic dysfunction grade I. A graft study was done, which revealed left main and right coronary artery were normal, the left circumflex artery with mild stenosis and obtuse marginal with subtotal stenosis and severe ostial stenosis of the LAD was observed in the proximal portion which can be seen in Figure . The patient was found to have ischemic heart disease with an increased risk of myocardial infarction. The patient is currently on drug therapy of risek, ascard, lipiget, flexiflow, monis, cancos, and sofvase. The echocardiogram of the patient is shown in Figure .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3150_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3150_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b4c99aefd603d45de2d1f3d970983fdfe2b4a4ac
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3150_en.txt
@@ -0,0 +1,5 @@
+We report the case of a 64-year-old woman with regular cardiological follow-up for severe aortic valve regurgitation. She complained of fatigue and dyspnea with moderate exertion, dizziness and sporadic palpitations, with recent clinical (New York Heart Association functional class II-III) and echocardiographic deterioration. She had a previous history of hypertension, dyslipidemia, overweight, asthma and Sjögren syndrome, and was on diuretics, but with no previous hospitalizations for heart failure.
+She was in sinus rhythm (∼80 bpm) with a diastolic murmur at the apex. The chest X-ray was normal with preserved cardiothoracic index. The preoperative echocardiogram revealed slightly enlarged left chambers (left atrium 46 mm; left ventricular systolic/diastolic diameters 41/59 mm; interventricular septal systolic/diastolic dimensions 11/15 mm, respectively) and preserved contractility (ejection fraction 63%). The aortic valve had four leaflets with preserved opening (no transvalvular gradient was present) but poor coaptation causing severe aortic regurgitation (vena contracta 8 mm). The ascending aorta measured 36 mm.
+
+Cardiac catheterization revealed a slightly dilated ascending aorta (42 mm) and an incompetent aortic valve causing severe aortic regurgitation. No coronary or carotid disease was found.
+The patient was operated electively. In the operating room, a concentrically hypertrophied left ventricle, dilated ascending aorta and fibrosed quadricuspid aortic valve (QAV) with leaflet retraction and a central orifice were observed. The supernumerary leaflet was the smallest and the others were of equal size. The left coronary ostium was tunneled under the commissure, which warranted special care in order to avoid damage during excision of the valve or obstruction by the prosthesis. Cardioplegia was delivered antegradely, directly in the coronary ostia. We also routinely use topical ice slush or cold saline solution as an adjuvant to myocardial protection. A 21-mm St. Jude mechanical prosthesis was implanted and the surgery ended uneventfully. The predischarge echocardiogram showed preserved ejection fraction (50%) and the mechanical aortic valve with normal opening and no paravalvular leak. Transvalvular gradients (maximum/mean) were 22/12 mmHg. No other valve lesions or significant pericardial effusion were found. The patient was discharged on the fifth postoperative day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3163_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3163_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fa33a15eaf36f729e5fedf471edebdc6f6a40dfa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3163_en.txt
@@ -0,0 +1,5 @@
+We present a 40-year-old Gravida13 Para10 Abortion2 mother who presented with headache, epigastric pain, bilateral leg swelling, epistaxis, and decreased fetal movement for a two-day duration. Her previous pregnancies were uneventful with no prior history of hypertensive diseases in pregnancy or hyperthyroidism reported. Although she had eight home deliveries, there were no twin pregnancies or molar pregnancies. In addition, she had no family history of bleeding diathesis. On the current pregnancy, she had no bleeding, raised blood pressure or any danger signs on the antenatal follow-up she had at 9 weeks. She was referred from a local health center, where the diagnosis of co-existing molar pregnancy was overlooked, with the impression of twin pregnancy and pre-eclampsia.
+
+On admission, her blood pressure was 186/100, her pulse rate was 136 and her respiratory rate was 20. On abdominal examination, she had 36 weeks sized gravid uterus with fetal heartbeat of 136 and grade 2 bilateral pitting edema. On the admission blood tests, hematocrit was 32.8% with O+ blood type. Serum β-HCG was found to be 215,400 IU/L, thyroid stimulating hormone was 0.05 IU/mL, urinalysis showed +1 proteinuria, other investigations (Renal function test, Liver function test, Complete blood count, and Chest X-ray) were all normal. With the impression of twin pregnancy complicated by pre-eclampsia with severity features and hyperthyroidism, the patient was managed for pre-eclampsia and a biophysical profile was done daily. Ultrasonography revealed two fetal sacs whereby twin A was a breech, alive twin with aggregate gestational age (AGA) of 28+6 weeks with the normal-appearing placenta. The other sac was filled with cystic spaces and snowstorm appearance, hinting towards a molar pregnancy.
+
+We managed our patient expectantly for a week with daily biophysical profile, dexamethasone injections for fetal lung maturity, magnesium sulphate and anti-hypertensive for pre-eclampsia. After one week, a cesarean section was done for indication of twin pregnancy plus Twin A breech to affect the delivery of a 1.4 kg male neonate with Apgar score of 7 and 9 in the 1st and 5th minute, respectively. The grape-like vesicles, separate from the normal appearing placenta, were evacuated manually. There was intraoperative bleeding while removing the molar tissue. Initial evaluation of the neonate revealed no congenital abnormalities and he was admitted to the neonatal intensive care unit with a diagnosis of very low birth weight and discharged after attaining adequate weight. Although, the histopathology result showed a partial mole with variable-sized dilated chorionic villi with focal trophoblastic proliferation and multiple vascular proliferation seen, there were no malignant features. Post-operative hematocrit was 18.8% for which the patient was transfused with one unit of whole blood. The patient was discharged from our side on the 16th day after advice on subsequent follow-up. The level of β-HCG was determined to be normal on the 2nd follow-up at 7 weeks as illustrated in. On this visit, the mother had no new compliant with normal blood pressure and TSH levels. In addition, the infant’s interpretation of growth curves adjusted for gestational age showed adequate growth.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3170_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3170_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0ca04aa543519bb6f6116edf1d36f0ba6e464e7f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3170_en.txt
@@ -0,0 +1,156 @@
+75-year-old man, who lives with his wife, a regular patient of the pharmacy, has shown some cognitive and motor impairment in recent months. He has lost 13 kg and feels nervous and depressed. There are continuous incidents in the dispensation for not adjusting to the prescribed posology, which makes us suspect a lack of adherence. The patient is disoriented regarding the medication prescribed by the different medical specialists of the Hospital Ramón y Cajal (Madrid) and the University Hospital of Guadalajara, which makes reconciliation difficult. In addition, he has doubts about taking medicines prescribed in electronic prescription.
+
+Relationship between health problems and patient medication at baseline
+
+Medical problems: Medicines
+
+Toxic syndrome: -
+
+Cirrhosis due to hepatitis C virus: Tacrolimus 1 mg capsules
+
+Liver transplant: -
+
+Adenocarcinoma of the prostate: Mirabegron 50 mg prolonged release tablets, Dutasteride/Tamsulosin 0.5/0.4 mg capsules
+
+Insulin-dependent diabetes mellitus: Repaglinide 2 mg tablets, Empagliflozina 25 mg tablets, Insulin degludec 100 units/ml solution for injection pre-filled pen
+
+Hypercholesterolemia: Atorvastatin 10 mg tablets
+
+Vitamin D deficiency: Calcifediol 0.266 mg capsules,  Colecalciferol 25000 IU amp
+
+Arterial insufficiency in the lower limbs: Acetylsalicylic acid 100 mg tablets
+
+High blood pressure: Bisoprolol 5 mg tablets, Valsartan/Hydrochlorothiazide 320/25 mg tablets rec
+
+Reactive Depression: Duloxetine 60 mg capsules
+
+Insomnia: Trazodone 100 mg tablets
+
+Joint pain: Naproxen 550 mg tablets, Lidocaine 700 mg adhesive medicated plaster
+
+Anxiety: Dipotassium clorazepate 5 mg capsules
+
+Other: Rabeprazole 20 mg gastro-resistant tablets
+
+
+Ex-smoker and no known allergies
+
+
+STUDY AND EVALUATION
+As a patient who takes many medicines and is frail, the pharmacy offers you the service of Repackaging of Medicines using the Personalised Dosage System (PDS). The patient is informed about the advantages of the PDS service to ensure compliance with the treatment prescribed by the different specialist doctors.
+
+During the initial appointment in the personalised care area (PCA), after signing the informed consent, we ask the patient to bring all their medication and medical reports to carry out the review and reconciliation of the medication. We explain that we will prepare the SPD devices weekly to avoid an excess of medication at home and improve adherence control at each visit to the pharmacy. We ask that they return the empty blisters to us to verify their compliance.
+
+We performed the 4-item Morisky-Green-Levine test, determining that he is an unintentional non-adherent patient.
+
+
+Following a review of the medication provided by the patient, we confirmed that there were several unopened boxes of medication and medication stored in incorrect and unlabelled jars. We are currently conducting a review of the treatment with the aim of detecting problems related to medication (PRM). We observed that there was a duplication in the treatment of vitamin D deficiency:
+
+Calcifediol 0.266 mg capsules: 1 every 15 days.
+
+Colecalciferol 25000 IU ampoules: 1 every 15 days.
+
+In addition, we observed that before starting with the SPD service, the patient was prescribed tacrolimus 2.5 mg/day by the Ramón y Cajal Hospital, however, in his electronic prescription of Castilla-La Mancha he was prescribed 2 mg/day, which was what the patient was taking. This was a case of PRMs of inadequate dose, schedule and/or duration and a lack of adherence (unintentional).
+
+
+INTERVENTION
+We contacted the primary care physician (PCP) by phone to report the various MRP findings:
+
+With respect to tacrolimus, the MAP decided to wait a month until the review with the digestive doctor at the Hospital Ramón y Cajal.
+
+Confirm the duplicity and remove the 25000 IU ampoule of cholecalciferol from the electronic prescription.
+
+Following the medication review, the chronic treatment prescribed to the patient at the beginning of the SPD service is summarised in the following table:
+
+Post-operative medication of the patient
+
+MEDICINE  POSOLOGY  RECONTAINER
+Duloxetine 60 mg capsules  0-1-0-0  Yes
+Repaglinide 2 mg tablets  1-1-1-0  Yes
+Acetylsalicylic acid 100 mg tablets  0-1-0-0  Yes
+Bisoprolol 5 mg tablets  0-1-0-0  Yes
+Naproxen 550 mg tablets  0-1-0-0  Yes
+Valsartan/Hydrochlorothiazide 320/25 mg coated tablets  1-0-0-0  Yes
+Trazodone 100 mg coated tablets  0-0-0-2  Yes
+Rabeprazole 20 mg gastro-resistant tablets.
+Mirabegron 50 mg prolonged release tablets.
+Atorvastatin 10 mg coated tablets  0-0-1-0  Yes
+Dutasteride/Tamsulosin 0.5/0.4 mg capsules  0-0-1-0  Yes
+Empagliflozin 25 mg tablets  1-0-1-0  Yes
+Calcifediol 0.266 mg capsules  1/15 days  Yes
+Tacrolimus 1 mg capsules  2-0-0-0  Yes
+Clorazepate dipotassium 5 mg capsules  0-0-1-0  No
+Lidocaine 700 mg adhesive medicated plaster  1/24 hours  No
+Insulin degludec 100 units/ml solution for injection in pre-filled pen. 14 IU/day. No
+
+
+Only oral solid dosage forms are suitable for refilling in the DSD, so lidocaine patches and insulin degludec are given to the patient. We check in Bot-Plus that the rest of the medicines can be refilled in the DSD, except for clorazepate, which is photosensitive. Therefore, this medicine is not refilled and is also given to the patient.
+
+We conducted a short weekly interview to assess his general health status. He reported good mental and physical health and an increased willingness to socialise.
+
+
+RESULTS
+Following a review with the digestive doctor at the Ramón y Cajal Hospital, the MAP confirmed that the patient's tacrolimus dose was not the one prescribed in the electronic prescription. The dose was adjusted to tacrolimus 2.5 mg on Mondays, Wednesdays, Fridays and Sundays; and 3 mg on Tuesdays, Thursdays and Saturdays, and has been maintained to the present day.
+
+The patient's chronic treatment has varied in the 8 months of inclusion in the SPD service, with the collaboration of the doctor being very important to update the prescriptions. Currently, the patient has the following treatment:
+
+Patient medication after 8 months of inclusion in the SPD service
+
+MEDICINE  POSOLOGY  RECONTAINER
+Duloxetine 60 mg capsules  0-1-0-0  Yes
+Repaglinide 2 mg tablets  1-1-1-0  Yes
+Ramipril 5 mg tablets  1-0-0-0  Yes
+Bisoprolol 5 mg tablets  0-1-0-0  Yes
+Trazodone 100 mg coated tablets  0-0-0-2  Yes
+Rabeprazole 20 mg gastro-resistant tablet.
+Mirabegron 50 mg prolonged release tablets.
+Atorvastatin 10 mg coated tablets  0-0-1-0  Yes
+Dutasteride/Tamsulosin 0.5/0.4 mg capsules  0-0-1-0  Yes
+Dapagliflozin/Metformin 5/850 mg tablets  1-0-1-0  Yes
+Calcifediol 0.266 mg capsules  1/15 days  Yes
+Tacrolimus 0.5 mg capsules  1-0-0-0 (L-X-V-D)  Yes
+Tacrolimus 1 mg capsules  2-0-0-0 (L-X-V-D)  Yes
+Tacrolimus 3 mg capsules  1-0-0-0 (M-J-S)  Yes
+Lidocaine 700 mg adhesive medicated plaster  1/24 hours  No
+Insulin degludec 100 units/ml solution for injection in pre-filled pen. 12 IU/day.
+
+
+Changes in medication during these 8 months of providing the SPD service were as follows:
+
+Change from valsartan/hydrochlorothiazide 320/25 mg to ramipril 5 mg.
+
+Change from empagliflozin 25 mg to dapagliflozin
+
+Metformin 5/850 mg.
+
+Suspension of acetylsalicylic acid 100 mg.
+
+Naproxen 550 mg suspension.
+
+Clorazepate suspension 5 mg.
+
+Adjustment of the dose of tacrolimus.
+
+The patient has reduced the intake of medication, improving his motor skills.
+
+The impact of the SPD service can be summarised in three main points:
+
+THERAPEUTIC ADHERENCE
+
+We performed the Morisky-Green-Levine test again and the patient was adherent.
+
+CLINICAL RESULTS
+
+During the months of inclusion in the system, the patient has achieved good metabolic control, reducing insulin degludec from 14 IU (22/3/2023) to 12 IU (22/07/2023).
+
+She is improving her dietary control, regaining 3 kg of the 13 kg she had previously lost, thanks to an improved mood.
+
+He has also reduced and eventually eliminated the clorazepate 5 mg and naproxen 550 mg as he is less anxious and controls the pain.
+
+In addition, the patient reported an overall improvement in their health and greater control over their medication, expressing great satisfaction with the service provided.
+
+PHARMACOTHERAPY
+
+Continuous communication with the MAP and the patient's willingness to provide us with hospital reports has been key to the reconciliation of medication, significantly improving the functioning of the SPD service and therapeutic adherence.
+
+The patient has reduced the number of medicines from 18 to 16 (including 3 tacrolimus presentations), which implies an effective reduction from 18 to 14 medicines.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3171_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3171_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b2bc69dc8e0e3c58cedffe8f38739c8adecb7b42
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3171_en.txt
@@ -0,0 +1,5 @@
+We present the case of an 81-year-old woman, with past medical history of hypertension and type 2 diabetes mellitus controlled with medication, who presented to the emergency department after falling from her own height onto her left hemibody and outstretched hand. She denied cranioencephalic trauma or loss of consciousness. At admission, she complained of intense pain in her left hand and reduction in the wrist's range of movement due to pain. At physical examination, she had a “fork back deformity”, swelling, and was tender to touch; the patient complained of a pain level of 9 out of 10 according to the VAS score with fracture manipulation. Plain radiographs showed a minimally displaced, dorsally angulated, extra-articular, shortened distal radius fracture with loss of radial tilt.
+
+The patient referred severe pain with passive motion and near the fracture site, she was reluctant to allow for a block near the site and to receive surgery. Due to the intense pain referred by the patient, and the possibility of management with closed reduction, we opted for a supracondylar radial nerve block to ensure proper pain management. Therapeutic options were discussed with the patient and her daughter, and as a result of a shared decision-making process, she opted for closed reduction with supracondylar radial nerve block. After obtaining the patient's informed consent, the procedure was performed. With the patient supine and the arm flexed over the abdomen, the physician positioned themselves facing the lateral aspect of the affected arm. The ultrasound machine was placed front-facing the physician, allowing an unobstructed view of the screen. A high-frequency 6–13 MHz (MHz) Mindray linear transducer was used to locate the radial nerve on the lateral aspect of the humerus, approximately 2 cm above the lateral epicondyle. At this location, the nerve is followed distally, visualizing its bifurcation into deep and superficial branches. Subsequently, the probe was displaced proximally to ensure the correct anatomic location. The nerve (hyperechoic) travels through the intermuscular septum between the surrounding (more hypoechoic) brachial and brachioradial muscles.
+
+The site was prepared with an aseptic technique and sterilized with a chlorhexidine solution. Sterile surgical lubricant was spread on the intended injection site. Later, a mixture of 10 ml of 1:1 0.25 % bupivacaine and 1 % lidocaine with epinephrine was injected with a 50-mm, 22-gauge Stimuplex® insulated echogenic needle around the radial nerve (proximal to its branch) under direct ultrasound guidance using an in-plane technique, identifying the needle in its full length. To prevent nerve injury due to high pressure at the injection site, low resistance during the procedure was assured. The patient manifested minimal discomfort during the injection process. Fifteen minutes after the injection, the patient reported no pain at rest, and the fracture was reduced. Axial traction maneuvers and ligamentotaxis, hyperextension, flexion, and ulnar deviation were performed with subsequent immobilization with a forearm sugar tong splint without complications. Shortly thereafter, the dorsally angulated distal fragment was reduced with minimal discomfort. After confirmatory radiographs showed adequate reduction, she was discharged with orthopedic follow-up. At the two-week follow-up, the sugar tong splint was replaced by a brachiopalmar closed cast, and at the monthly follow-up, the appropriate fracture reduction was again verified through radiographs. After that, the patient was lost to follow-up due to administrative concerns derived from her insurer, where we believe she was transferred elsewhere to continue here care.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3195_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3195_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f46d839be44edf95a3e04dffb4babc0bfce5c876
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3195_en.txt
@@ -0,0 +1,17 @@
+80-year-old woman with a history of significant hypertension for 6 years, diagnosed, treated with 50 mg losartan every 12 hours, which, according to the patient, was in adequate control.
+
+She presented a 6-week history characterized by morning stiffness lasting 45 minutes, inflammatory-type pain in the shoulders, elbows, hands, knees, ankles, and feet, associated with fatigue. Within a week, she developed edema in the hands and feet, so she went for evaluation and began treatment with anti-inflammatory drugs, without improvement of the symptoms, which is why she was referred to the service. Physical examination revealed pain in the range of motion arcs in the neck, shoulders, elbows, and wrists. She had limited extension of the elbows, synovitis in the wrists, proximal metacarpofalangeal and interphalangeal joints, pain in the knees, ankles, metatarsophalangeal joints, and edema in the hands and feet with pitting.
+
+The patient was examined and found to have glucose 94, Cr 0.6, uric acid 3.5, ALT 8, AST 14, IgG 1132, IgM 92, IgA 198, Hb 12, platelets 388, leukocytes 4.6.
+
+The general urine examination was unremarkable: no increase in acute phase reactants, ESR 56, CRP 23, with negative rheumatoid factor, negative anti-citrullinated peptide antibodies, negative antinuclear antibodies by indirect immunofluorescence.
+
+Anteroposterior hand radiograph showed soft tissue edema and juxtaarticular osteopenia; there were no erosions.
+
+Mastography and pelvic ultrasound were normal; tumour markers were in the normal range.
+
+RS3PE was diagnosed and was managed with 15 mg prednisone every 24 hours. The patient was reevaluated 6 weeks later and showed improvement in the symptoms. The patient reported that 72 hours after the start of treatment, she had a significant decrease in pain and the edema progressively subsided.
+
+The control laboratory studies showed the following values: glucose 91, Cr 0.8, ALT 12, AST 16, Hb 12.8, platelets 223, leukocytes 5.4, ESR 10, CRP 1.
+
+The steroid was gradually reduced and discontinued at 10 months. The patient is currently under surveillance, with no new inflammatory events and no suggestive data of neoplasia.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3199_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3199_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b6f7f1259ffe825fae5ab0298198038df6c8ac97
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3199_en.txt
@@ -0,0 +1,9 @@
+A 20-year-old primigravida woman who did not remember her last menstrual period but stated that she had been amenorrheic for the past 6 months was referred to our hospital with a diagnosis of second trimester pregnancy plus disseminated intravascular coagulation (DIC) plus missed abortion and complained of lower abdominal pain for 1-week duration. Associated with this, she experienced easy fatigability, dizziness, blurred vision, and vertigo of the same duration.
+
+Physical examination revealed blood pressure of 85/50 mmHg, with a pulse rate of 126 beats per minute (bpm). The patient had pale conjunctiva and tender abdomen. Obstetric ultrasound examination revealed a 22-week consistent pregnancy in the peritoneum, negative fetal heartbeat, empty uterus, and free fluid in Douglas and Morrison’s pouch. Laboratory results showed a hemoglobin concentration of 4.3 g/dL.
+
+Owing to unstable vital signs, the patient was transfused with three units of screened, cross-matched whole blood. After informed consent was obtained, the patient was rushed to the operating theatre with a preoperative diagnosis of uterine rupture.
+
+Intraoperative findings revealed hemoperitoneum of 2L, 500gm freshly dead male fetus and placenta, respectively. Further inspection revealed a bicornuate uterus and fundal uterine rupture in the left uterine segment. The hemoperitoneum was suctioned, the placenta and fetus were removed, and the uterus was repaired using a size 1 Vicryl suture.
+
+The patient’s postoperative recovery was uneventful, and she was discharged on her fifth postoperative day. The patient was counselled on family planning for at least one year, and any future pregnancy would require elective cesarean delivery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3205_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3205_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..079ad80e105c078cf26bbbd83908e8c675ac9816
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3205_en.txt
@@ -0,0 +1,5 @@
+A 59-year-old male with a 17-year history of type 2 diabetes mellitus presented for routine follow-up at the retina clinic. His visual acuity was 6/6 in both eyes. Three months prior, he underwent vitrectomy in the right eye for vitreous hemorrhage secondary to PDR. On examination, he was pseudophakic with posterior chamber intraocular lenses in both eyes. The anterior segment and intraocular pressures were normal. Fundus examination of the right eye revealed an attached retina, healthy macula and optic disc, and well-healed endolaser scars. There was a small area of residual fibrous proliferation temporal to the macula, with suboptimal laser coverage inferior to the horizontal meridian. The left eye showed an attached retina and well-covered pan-retinal photocoagulation (PRP) laser scars.
+
+Fundus FA (5 ml of 10% fluorescein) was performed to evaluate the NVE regression, particularly in the left eye. FA of the left eye demonstrated multiple NVEs with late-phase leakage nasally and inferiorly to the optic disc. In the right eye, FA showed an unusual “chimney-like” SSL pattern from the trimmed, residual proliferation temporal to the macula, extending into the superior periphery. A similar leak was noted at the superior optic disc margin. In the late phase, both leaks subsided, leaving only staining of the residual proliferation. The patient had no known history of CSCR and exhibited no clinical signs of current or past CSCR.
+
+The patient was diagnosed with bilateral PDR, with active, leaking NVE in the left eye. Management included additional targeted laser photocoagulation to areas of capillary non-perfusion in the right eye and a combination of intravitreal anti-vascular endothelial growth factor (anti-VEGF) injection and supplementary laser photocoagulation to the NVE stumps in the left eye. At the six-month follow-up, best-corrected visual acuity remained stable at 6/6 in both eyes, with both eyes demonstrating a quiescent phase of PDR.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3209_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3209_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c2991f545e02879c24834e4a617662ac2b696c9f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3209_en.txt
@@ -0,0 +1,5 @@
+5-year-old girl with no relevant perinatal history, who presented with slurred speech and gait instability, with a paternal history of a diagnosis of HD, as well as three uncles and her grandmother, all from the paternal branch, with some degree of motor disability or psychiatric disorder. She had normal development until the age of 3, when she began to regress in previously acquired language patterns. At the age of 5, she added a motor disorder with frequent falls and dystonic gait, which is why she was referred. The condition progressed gradually and at the time of the evaluation she was dependent on almost all activities of daily living. Her language skills were below what was expected for her age in terms of expressive aspects (slurred speech). Her comprehension was also affected, although it improved with visual supports. She had a communicative intention and good eye contact, which showed reciprocity in her communicative abilities and interest in peers, using non-verbal resources such as pointing and gestures, sometimes accompanied by words. There was also difficulty in gait secondary to dystonia with frequent falls. She associated sporadic choreic movements of the upper limbs, with a low frequency of occurrence. There was evidence of drooling and a lack of oral closure, and slow and poorly coordinated oral movements. Her behaviour was usually calm, but she presented sporadic episodes of irritability in response to frustrating situations.
+
+Within the complementary studies requested, the magnetic resonance of the brain showed atrophy of the caudate and lenticular nuclei in a symmetrical way, and the electroencephalographic study was normal. The molecular study (expansion of triplets CAG) showed 51 ± 1 repetitions of the triplet CAG in the locus 4p16.3, which confirmed the diagnosis and showed a phenomenon of anticipation by the early appearance of the disease in the patient.
+
+The family was advised on the use of alternative-augmentative communication systems to promote communication and behavior. Phonoaudiological and kinesthetic treatment was indicated in their area of residence, and continued in the regular school with a support for inclusion modality.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3214_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3214_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c5c4284c341435e85fa4ad0874bb392dca1c1598
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3214_en.txt
@@ -0,0 +1,7 @@
+A 6-year-old right hand dominant female child was brought by her father to the emergency department with the history of a fall 2 h back, with the point of the extended and pronated left elbow making forceful contact with the edge of the step. She presented with a painful and deformed left elbow, and with inability to move her left forearm. It was tender, swollen, deformed and held in 40 degrees of flexion, with the support of the contralateral limb. The forearm seemed to be in a fixed and pronated state. Active range of movements were not possible, and trivial passive movements elicited pain. Radial artery pulsations were palpable. The hand was pink, warm and the fingers showed a capillary refill time of less than 2 s. On careful neurological examination, light touch sensation in the ulnar nerve territory of the left hand was decreased as compared to the other hand, with marked sensory diminution over the little finger. The pain, temperature, deep touch sensations and the motor examination of the left upper limb were unremarkable. Close examination of the radiographs revealed the presence of a posterior dislocation and convergent translocation of the left elbow, without any fracture.
+
+An urgent MRI scan of the left elbow was performed to rule out cartilaginous and ligamentous injuries. MRI of the left elbow revealed dislocation of the ulno-trochlear and radio-capitellar joint, with the presence of hemarthrosis. It also showed articulation of the radial head with the humeral trochlea and of the ulnar olecranon with the humeral capitellum. The lateral collateral ligament and the lateral ulnar collateral ligament revealed full thickness tears at the proximal attachments, while the medial collateral ligament showed the same at the distal attachment. Bulkiness of the ulnar nerve was noticeable at the level of the distal end of the humerus along with an annular ligament tear.
+
+Under short general anaesthesia and image intensifier control, the haematoma was aspirated percutaneously from the elbow joint, via a posterior portal. A closed reduction with a hyper-supination manoeuvre was then performed. Closed, stable reduction was achieved and a bivalved cast in 100 degrees of flexion and full supination was applied to hold the reduction and to immobilize the left elbow.
+
+The patient was reviewed after 1 week, at which the radiographs showed a congruent left elbow joint with maintained reduction. Sensations of the left hand in the ulnar nerve territory, which were diminished at the initial presentation, were now restored and equal in both limbs. The bivalved cast was replaced by an above elbow full cast in full supination. The cast was removed at 4 weeks and a check radiograph showed the presence of a congruent elbow joint. Gradual rehabilitation including flexion-extension and pronation-supination were initiated. By the end of 2 months, the child had regained complete arc of range of motion. At the 6-month followup, there was no varus-valgus laxity which was confirmed clinically as well as with stress radiographs. Additionally, the QuickDASH score was found to be 2.3, Mayo Elbow Performance Score (MEPS) was found to be 95, and the child was seen to be carrying out all activities of daily life without any difficulties [8]. A similar radiological and functional outcome was found at the 1 year follow-up. We replicated the mechanism of this injury in the cadaveric lab on a preserved specimen of the elbow with intact osteoligamentous anatomy. This was done to depict the patho-mechanics of PRUT, on an illustrated cadaveric model to understand the cascade of events in this rare injury.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_321_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_321_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7a39cc36f30f4bdf812d0318f85b021fc3c8eb65
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_321_en.txt
@@ -0,0 +1,7 @@
+A 40-year-old man presented to the emergency department (ED) via emergency medical services following a high-speed motorcycle versus automobile collision. Due to respiratory distress and decreased breath sounds in the right lung field, needle decompression was performed on scene by paramedics. Upon arrival to the ED, the patient was hemodynamically stable with a heart rate of 89 beats per minute and blood pressure 120/74 millimeters of mercury (mm Hg). His mentation was intact. Physical exam revealed extensive right-sided chest wall ecchymosis and tenderness.
+Point-of-care ultrasound (POCUS) demonstrated reduced lung sliding on the right and no intraperitoneal free fluid; however, cardiac windows were suboptimal and non-diagnostic. Bedside chest radiograph showed multiple right-sided rib fractures with apical and lateral pneumothorax. Computed tomography (CT) demonstrated fractures of right ribs 3–11 with accompanying pneumothorax, sternomanubrial joint dislocation with retrosternal hematoma, and pneumomediastinum . Additionally, the patient was found to have a grade 1 liver laceration and first lumbar (L1) vertebral body fracture with 10 mm of retropulsion.
+A 14-French pigtail catheter was placed into the right hemithorax without immediate complication. Twelve-lead electrocardiogram was remarkable for ST-segment elevation in leads aVR and aVL with diffuse ST depression in leads II, III, aVF, and V1–V6 concerning for BCI and prompting cardiology consultation . An initial high-sensitivity troponin T returned at 225 nanograms/milliliter (ng/mL) (reference range: <19). During the cardiology team’s evaluation, the patient complained of worsening chest pain and difficulty breathing, becoming hypotensive with a blood pressure of 78/59 mm Hg and tachycardic with a heart rate of 119 bpm.
+Repeat POCUS demonstrated bilateral lung sliding and no intra-abdominal free fluid; similarly, the chest tube and pleural drainage apparatus were functioning normally. Again, cardiac windows could not be obtained due to presumed air scattering. Because of significant pneumomediastinum seen on CT, obstructive shock physiology from the mediastinal free air was suspected. An emergent bedside percutaneous needle drainage in the left fifth intercostal space was performed, yielding 9 mL of blood with scant air bubbles. The patient’s blood pressure immediately improved, and cardiac windows were subsequently visualized on POCUS.
+With high suspicion for acute myocardial infarction, the patient was taken for emergent coronary angiography. Transthoracic and transesophageal ultrasounds obtained in the cardiac catheterization lab did not demonstrate pericardial fluid or cardiac tamponade. Angiography demonstrated 95% thrombotic occlusion of the proximal left circumflex artery at the origin of the first obtuse marginal branch without evidence of coronary artery dissection . Percutaneous coronary intervention (PCI) with aspiration thrombectomy and deployment of two drug-eluting stents resulted in complete restoration of coronary blood flow. The patient was transferred to the surgical intensive care unit.
+Aspirin and ticagrelor were initiated immediately after PCI. Norepinephrine and amiodarone were administered for cardiogenic shock and non-sustained ventricular tachycardia, respectively, both of which resolved within 48 hours. Following cardiac stabilization, the inpatient team addressed the patient’s spinal injury, although urgent operative intervention was deferred because of hemodynamic instability and the bleeding risk associated with antiplatelet therapy. Prior to spinal fixation on hospital day three, ticagrelor was changed to tirofiban infusion, which was held prior to the first incision and resumed postoperatively. Ticagrelor was re-started following the removal of a spinal drain on postoperative day two. The patient remained stable for the remainder of hospitalization and was discharged on aspirin and ticagrelor on hospital day 14.
+On a follow-up phone call with the patient almost six months after the injury, he reported that he was back to working full time and feeling fully recovered. He recalled the accident and arriving to the ED, although he did not recall undergoing tube thoracostomy placement or percutaneous needle drainage. He was advised to continue aspirin and ticagrelor for at least six months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3229_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3229_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b980cf029b7743a583643ae5173e7ee92539612c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3229_en.txt
@@ -0,0 +1,5 @@
+A 25-month-old boy was referred to our outpatient clinic without complaints due to a prenatal ultrasound that showed renal cysts. The patient was already on antibiotic prophylaxis and his physical examination and vital signs were within normal limits. The parents reported no family history of renal disease and/or other hereditary disorders. A renal ultrasound performed at 2 days of life showed bilateral hydronephrosis, mainly in the right kidney. At 5 months of age, a DTPA and a DMSA were performed. The DTPA showed strong retention of the marker in the pyelocaliceal system bilaterally, with little response to diuretic challenge, while the DMSA indicated preserved renal function and symmetrical distribution of the radiotracer in the kidneys with relative renal function of 46% in the left kidney and 54% in the right kidney.
+
+Based on the first consultation in our clinic, the antibiotic prophylaxis was maintained and a new renal ultrasound was requested, which showed dilation in the entire length of both ureters (10 mm on the right side and 8 mm on the left side), with an abrupt stenosis in the distal region of both ureters at the entrance to the bladder, with a caliber of only 2 mm. In addition, moderate bilateral hydronephrosis and slight thinning of the cortical renal parenchyma were also observed. These findings indicated the diagnosis of bilateral megaureter secondary to stenosis caused by OJVU and vesicoureteral reflux (RVU). At 2 years and 10 months of age, a DTPA and a DMSA were requested. The DTPA showed obstructive pyelocaliceal and urethral stasis in both kidneys, with a scintigraphic pattern consistent with bilateral hydronephrosis secondary to stasis at the level of the JVU with preservation of renal function. Despite the observed dilation, the parenchyma and the renal cortex were preserved and the DTPA pattern showed a degree of slow emptying, while the DMSA showed that the relative renal function remained stable at 46:54.
+
+Based on clinical and imaging findings, non-surgical management was adopted with clinical follow-up and serial imaging. During the first year, the patient visited the outpatient clinic every 6 months and in the following 2 years, annually. At 7 years and 7 months, the antibiotic prophylaxis was discontinued, with no history of urinary tract infections, and follow-up visits were maintained every 2 years. Renal ultrasound at 10 years of age showed significant improvement of all parameters with ureteral transverse diameter exhibiting a mild to moderate increase (0.9 cm) and JVU preserved, indicating satisfactory evolution and bilateral renal development expected with the non-surgical approach. During the entire follow-up period, the patient remained normotensive, with normal serum levels of urea and creatinine, and without proteinuria, indicating a favorable clinical evolution.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3241_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3241_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3519b8f390e147c42d5e4e15d3781a1a22182dc3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3241_en.txt
@@ -0,0 +1,23 @@
+We present a case of a 10-year-old girl from a low socioeconomic background in a Hindu family from Sindh, Pakistan, who initially presented to our Pediatric Urology Clinic and was later transferred to Pediatric Nephrology Care. She presented with a 1-week history of severe right lumbar pain, gross hematuria, vomiting, and fever. The pain was severe enough to require pain relief medication, and she visited the emergency room 2–3 times before being admitted for hospitalization. She did not report any burning sensation during urination, dysuria, urinary retention, or incontinence. There were no other systemic manifestations, such as joint pain, prolonged fever, alopecia, mouth ulcers, or skin rash.
+
+She was born by C-section to unrelated parents, and her early childhood was uneventful. She was fully immunized and developmentally normal. She is currently a student in the 8th grade. Her past medical and drug history was unremarkable, and there was no family history of kidney disease or other systemic disorders at the time of presentation. On examination, she appeared anxious and unwell, febrile (101°F), and hypertensive, with a systolic and diastolic blood pressure of 130/96 mmHg, which was above the 95th percentile for her age and height.
+
+Her anthropometric measurements were as follows: weight 36.4 kg (50th percentile), height 141 cm (above the 50th percentile), and body surface area (BSA) 1.2 m2 . She was mildly anemic and dehydrated, but not jaundiced. No rashes or lymphadenopathy were observed. Abdominal examination revealed tenderness in the right lumbar region, but there was no splenomegaly. Her respiratory and cardiovascular systems were normal, and locomotor and neurological examinations were unremarkable. Initially, a diagnosis of ureteric calculus and/or acute pyelonephritis was suspected.
+
+Initial laboratory results showed a hemoglobin (Hb) level of 12.4 g/dL, white blood cell count of 14.98 × 109/L, and platelet count of 75 × 109/L. Urinalysis revealed a reddish, hazy appearance with 150 mg/dL protein, 3 + blood, numerous red blood cells (RBCs) and white blood cells (15–20/hpf), while leukocyte esterase and nitrites were negative. The spot urine calcium-to-creatinine ratio was 0.06 (normal < 0.2), and the protein-to-creatinine ratio was 0.8 (normal < 0.2). Renal function was normal, with urea at 12 mg/dL, creatinine at 0.33 mg/dL, and electrolytes within normal limits. Liver function tests and coagulation profiles were normal as well. The serum lipase level was normal, but her serum albumin was slightly low (2.98 g/dL), and dengue serology was negative. Her C-reactive protein level was elevated at 48 mg/dL, lactate dehydrogenase (LDH) was 696 U/L, and D-dimer was significantly raised at 19.8 mg/L. Her blood and urine cultures were negative. Ultrasound (US) revealed a diffusely enlarged right kidney (11.5 cm × 6.7 cm) with patchy areas of increased echogenicity, while the left kidney appeared normal. A color Doppler study showed a hypoechoic thrombus in the right renal vein (RRV) that completely blocked blood flow and extended into the inferior vena cava (IVC). Renal computed tomography angiography confirmed these findings, showing an enlarged, edematous right kidney with a well-organized hypodense thrombus completely obstructing the RRV, extending into the IVC.
+
+Her work-up for hereditary thrombophilia (including protein-C, protein-S, antithrombin III, and factor V Leiden) was negative. Further serological testing confirmed a diagnosis of systemic lupus erythematosus (SLE), evidenced by low complement-3 (C3), positive antinuclear antibodies (ANA) with a titer of 1/5120, and positive anti-ds DNA antibodies. In addition, tests for antiphospholipid syndrome (APS) showed positive anticardiolipin antibodies (IgG and IgM), lupus anticoagulant, and prolonged confirmatory tests, which confirmed APS as secondary to SLE.
+
+The patient was initially managed with intravenous paracetamol, hydration, and antibiotics. Her hypertension was controlled with oral captopril and amlodipine, and captopril was later switched to losartan. She was anticoagulated with low-molecular-weight (LMW) heparin (enoxaparin) and later switched to oral warfarin after 6 days. Her condition improved over 8–10 days, with her platelet count rising to 189 × 109/L. She was discharged after 12 days on warfarin, with strict observation for bleeding and regular monitoring of her prothrombin time and international normalized ratio (PT-INR), aiming to maintain a target INR of 2–3. She continued amlodipine and losartan for hypertension and proteinuria, along with hydroxychloroquine (200 mg) and acetylsalicylic acid (75 mg) for thrombosis prevention.
+
+We closely monitored her for signs of pulmonary embolism owing to the risk of embolization from the IVC thrombus, but no such signs were observed. Immunosuppressive therapies, such as corticosteroids, were not considered as there were no systemic manifestations of SLE or lupus nephritis at that time.
+
+Initially, the patient was closely monitored in the outpatient department with regular checks on her blood pressure (BP), clinical symptoms (such as pain and gross hematuria), prothrombin time (PT) with international normalized ratio (INR), and complete blood count (CBC) to monitor thrombocytopenia; color Doppler ultrasound (US) for recanalization of the affected veins; serum creatinine (Cr) for kidney function; and a dimercaptosuccinic acid (DMSA) renal scan to assess right kidney function. Her echocardiogram did not reveal any valvular defects or vegetation. A repeat color Doppler US during follow-up showed persistence of the right renal vein (RRV) thrombus but resolution of the inferior vena cava (IVC) thrombus. The DMSA renal scan revealed a nonfunctioning right kidney, which was recommended for nephrectomy; however, the parents chose not to pursue this option.
+
+Four weeks after discharge, the patient contracted chickenpox but recovered smoothly without complications. We lost contact with the patient from November 2020 to September 2021 owing to the coronavirus disease 2019 (COVID-19) pandemic. During this period, she visited another healthcare center where her anticoagulant treatment, warfarin, was replaced with rivaroxaban (10 mg once daily) to avoid the need for frequent INR monitoring. During her subsequent follow-up visits, we monitored her growth (height and weight), hypertension (BP), kidney function (serum Cr), proteinuria (spot urine protein-to-creatinine ratio, suPCR), and hematuria (urinalysis) monthly for 3 months. She also underwent two ophthalmological reviews to check for hydroxychloroquine (HCQ)-associated retinopathy, which were both normal. We continued to monitor her clinically for lupus flare-ups, recurrence of thrombosis, and performed serial ultrasounds to assess the size of her right kidney.
+
+Her recent follow-up showed a weight of 56.9 kg, height of 160 cm, body mass index (BMI) of 22.7 kg/m2 (85th percentile), and a blood pressure of 120/70 mmHg (off amlodipine but continuing with losartan). Her kidney function was normal, with a serum creatinine of 0.6 mg/dL and an estimated glomerular filtration rate (eGFR) of > 170 ml/min/1.73 m2. However, she had slightly low hemoglobin (9.9 g/dL), a normal white blood cell (WBC) count (9.59 × 109/L), and a normal platelet count (418 × 109/L). Fortunately, she did not develop any further complications; however, she experienced menorrhagia, which resulted in anemia (Hb 9.9 g/dL). This was managed by consultation with a gynecologist, who adjusted her rivaroxaban dosage to 5 mg/day and prescribed 250 mg of tranexamic acid three times a day for 3–5 days during her menstrual period. We also tested her complement C3 (1.02 g/L) and anti-ds DNA levels (8.86 IU/mL), both of which were normal, indicating no active lupus.
+
+Her most recent ultrasound of the kidneys showed a small, shrunken, and echogenic right kidney (5.7 cm × 1.8 cm), with a compensatory enlargement of the left kidney (12.5 cm × 5 cm).
+
+We plan to continue her anticoagulation, antiplatelet therapy, angiotensin receptor blockers (ARB), and hydroxychloroquine (HCQ) on a long-term basis, potentially for life. We also consulted a rheumatologist regarding the duration of anticoagulation therapy, but no decision has yet been made regarding discontinuation. Unfortunately, her mother developed systemic lupus erythematosus (SLE) 18 months later, and she is currently under the care of a rheumatologist.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_324_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_324_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..06d63c2562c85bb95273942c9a06823c1b60902c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_324_en.txt
@@ -0,0 +1,4 @@
+The patient was an 89-year-old woman who visited a neighborhood hospital 4 h after developing abdominal pain and vomiting of sudden onset. She was referred to our hospital 2 h later with the diagnosis of intestinal obstruction. She had a history of undergoing cesarean sections. On arrival at our hospital, her vital signs were stable; examination revealed that she was 145 cm tall and weighed 36.9 kg (calculated body mass index [BMI], 17.5). She had severe tenderness in the lower abdomen, but no signs of peritoneal irritation. Blood tests showed an elevated white blood cell count, although the serum C-reactive protein (CRP) was normal. Blood gas analysis showed mild acidosis, with a pH of 7.383, and a base excess (BE) of − 3.7. Contrast-enhanced computed tomography (CT) revealed a small bowel forming a closed loop, with poor contrast effect, and dilatation of the oral side of the small bowel . Ascites was also identified . The patient was diagnosed as having strangulated bowel obstruction, and emergency surgery was performed.
+At laparotomy, bloody ascites was observed. Two segments of the ileum were tied together forming a knot, and both segments were necrotic due to impaired blood flow . There was a band formation between a nearby segment of the small bowel and the abdominal wall, probably attributable in part to the previous cesarean sections, but there was no evidence of intestinal obstruction. Although it was necessary to release the strangulated small bowel, we did not immediately release the knot, but first proceeded with ligation of the mesenteric vessels draining the strangulated small bowel, to prevent dissemination of toxic substances from the necrotic bowel to the systemic circulation. Ligation of the mesenteric vessels was followed by resection of a 100-cm segment of the knotted necrotic ileum, 10 cm from the ileal end. Hand-sewn anastomosis was performed with the Albert-Lembert suture. The volume of blood loss was 282 ml, and the operation time was 1 h 41 min.
+The resected specimen showed the two intestinal segments wrapped together forming a knot, as indicated by the intraoperative diagnosis, and the strangulation was released by untying the knot . There were no abnormalities on the mucosal surface other than signs of necrosis. Histopathological examination of the resected ileum showed that the resected small bowel was remarkably devoid of crypt epithelium, and there was severe congestion and hemorrhage extending from the intrinsic mucosal layer to the submucosa, which was considered to represent an ischemic change.
+The postoperative course was uneventful, and the patient was discharged on the 13th postoperative day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3252_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3252_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ff62123c48ff8ee88662404c9df08622dd6a2683
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3252_en.txt
@@ -0,0 +1,9 @@
+A 57-year-old female patient with a diagnosis of autosomal dominant polycystic kidney disease underwent DDLT for polycystic liver disease (PCLD). She did not have any background lung disease or smoking history, as shown in her clear preoperative chest radiograph. Her right diaphragm was severely elevated due to PCLD, which caused persistent atelectasis in the right lower lobe. DDLT was performed uneventfully. A small hole was made on the right diaphragm, which was repaired with a multifilament suture, and a thoracic drain was placed. Although the patient required reoperation on postoperative day 2 (POD 2) due to a persistent bile leakage, she recovered well without further major complications.
+
+A chest radiograph revealed a round hypertranslucency with air–fluid levels on the right side since POD 1, and no further evaluation was made at that time. However, because the hypertranslucency persisted, follow-up computed tomography (CT) was performed on POD 18, and revealed an air–fluid level above the diaphragm in the right thoracic cavity. The patient was initially considered to have an intrathoracic hematoma, and thoracoscopic evacuation of the hematoma was planned.
+
+Regarding the immunosuppressants for liver transplantation, tacrolimus and methylprednisolone were initiated intravenously immediately after the transplantation without any induction therapy. No mycophenolate mofetil was used. Tacrolimus was maintained with a target level of 12–16 ng/mL, and methylprednisolone was tapered according to the institutional protocol. Both tacrolimus and methylprednisolone were switched to oral administration when ready. The liver graft was functioning well with normal transaminases and bilirubin levels, and there were no signs of rejection throughout the course. On the day of the surgery for the pneumatocele (POD 19), the doses of tacrolimus and methylprednisolone were 18 and 16 mg/day, respectively.
+
+Contrary to our initial expectation, thoracoscopic investigation revealed no intrathoracic hemorrhage; instead, there was a large cystic change inside the lung parenchyma, which was thought to be a pneumatocele that had formed at the basal area of the right lower lobe. Surgical resection was preferred given the risk of pneumatocele infection due to intra-cystic hematoma and immunosuppression for liver transplantation. Wedge resection was satisfactory to preserve as much remaining lung parenchyma as possible. From a different perspective, wedge resection was a better way to lower the risk of postoperative empyema, which is higher in lobectomy or segmentectomy. However, simple wedge resection was impractical considering the thickness of the lung parenchyma adjacent to the pneumatocele. It was thought that if the intra-cystic hematoma was evacuated, the thickness of the adjacent lung parenchyma would become thinner and would allow wedge resection with a stapling device. Therefore, the pneumatocele was incised, and the intra-cystic clot was removed to reduce its size. Wedge resection was subsequently performed using a stapling device. The staple line was reinforced with 4-0 polypropylene sutures, a polyglycolic acid sheet (Gunze, Osaka, Japan), and fibrin glue (KM Biologics, Tokyo, Japan). The postoperative course of the patient was uneventful, and she was discharged 18days after resecting the pneumatocele.
+
+Histopathological examination revealed a cyst-free wall, which consisted of visceral pleura with fibrosis and microvascular proliferation. The parenchymal side of the cyst wall was fibrotic and organized with hemorrhage and bronchiolar dilation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3262_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3262_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..010b8585ff9d2ea64f24a7c1192010d9062b8d5b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3262_en.txt
@@ -0,0 +1,15 @@
+We present the case of a 15-year-old girl with no significant personal or family history and no consanguinity.
+
+She presented with chief complaints of dysgraphia and right hand incoordination with a two-month history. She had no other disorders or infectious or traumatic history. She had started taking the combined oral contraceptive pill at the time of the complaints. The patient was not on any other medication and did not smoke. On objective examination at admission, she had mild dysgraphia. The rest of the neurological examination did not reveal any language disorders. For example, she named and repeated well everything that was asked of her, with a slight decrease in fluency with words beginning with P. There was no apraxia or changes in visual fields, oculomotor or facial mimicry. There were no motor or sensory deficits or gait abnormalities. The patient was seen by the ophthalmology unit with normal findings.
+
+In terms of additional diagnostic tests, a brain MRI was performed, which revealed several ischemic lesions with different rates of evolution, affecting the left cortico-subcortical frontoparietal region, with extension to the whole centrum semiovale, suggesting infarcts of the basins. The angioresonance MRI showed multiple subocclusive stenoses of both supraclinoid segments of the internal carotid arteries, of both A1 segments and also of the M1 segment of the left middle cerebral artery. The laboratory studies did not show relevant alterations, with complete blood count, renal and hepatic function, and lactate dehydrogenase showing no changes. There was no dyslipidemia, the homocysteine value was normal and the immunological study showed no alterations, including antiphospholipid antibodies and antinuclear antibodies, as well as rheumatoid factor. The coagulation study was normal and, by a prothrombotic study, a common polymorphism of methylene tetrahydrofolate reductase was found. In addition, there were normal levels of inhibitor of activator of plasminogen-1. The cerebrospinal fluid presented a normal cytochemistry, a negative bacteriology and a positive polymerase chain reaction of cytomegalovirus, with an intermediate cycle threshold value. The serum immunoglobulins G were positive, and the immunoglobulins M, negative. The research of the DNA of cytomegalovirus in the serum was negative. It was decided to initiate intravenous ganciclovir and corticoids.
+
+Cytomegalovirus in the cerebrospinal fluid was investigated by real-time polymerase chain reaction-specific cytomegalovirus, which was negative. The patient completed six days of antiviral treatment. The oligoclonal bands in the cerebrospinal fluid were unchanged. A magnetic resonance of the vessel wall was performed to investigate further. A slight increase in the T1 signal was observed after gadolinium use in the vessel wall along the left M1 segment, corresponding to the focal stenosis point, without an increase in the vessel wall thickness. There were no other focal abnormal enhancing areas affecting the rest of the intracranial vessels. These changes favoured a primary moyamoya disease and not a secondary etiology, namely a vasculitis. A conventional cerebral angiography was performed that showed significant stenosis of the right A1 segment and irregularities of the left M1 segment (with decreased distal flow), left A1 occlusion, with some degree of collateralisation, through the pial vessels of the left middle cerebral artery. The presence of moyamoya-like vessels was not observed.
+
+During the hospital stay, persistently elevated blood pressure was observed. An electrocardiogram, an echocardiogram, a renal echo-Doppler and a renal artery computed tomography angiography were also requested, which were not remarkable, and the patient had normal aldosterone, activated renin and plasma metanephrines.
+
+With the mass sequencing of the moyamoya disease panel in progress, our patient was discharged on treatment with acetylsalicylic acid and angiotensin converting enzyme inhibitor. In addition, the combined oral contraceptive pill was discontinued and she was referred for multidisciplinary follow-up.
+
+In the study of the sequences of the coding regions and of the flanking intronic regions (±8 bp) of the ACTA2 gene, no mutations were detected in the regions analyzed. In addition, in the study of the sequences of the coding regions and of the flanking intronic regions (±8 bp) of the RNF213 gene, the variant c.12185G>A, p.(Arg4062Gln) was detected in heterozygosity in the RNF213 gene. This result indicates that the patient is heterozygous for the variant c.12185G>A, p.(Arg4062Gln) in the RNF213 gene. The detected variant has already been described in the literature as a founder variant in the Asian population, associated with moyamoya syndrome. This variant is described in ClinVar as a variant of unknown clinical significance. In addition, it is not described in the population databases (dbSNP, ESP and gnomAD) and affects a highly conserved amino acid. With the information available, this variant should be classified as probably pathogenic. The study of the patient's parents allowed the conclusion that the detected variant was inherited from the father.
+
+Approximately four months after discharge, a repeat MRI brain angiography revealed a worsening of intracranial stenosis, specifically a new stenosis of the left P1 segment of the posterior cerebral artery. The angiotensin converting enzyme inhibitor was discontinued. Three years after the initial hospitalization, our patient underwent elective surgery for indirect cerebral revascularization, encephaloduromyosinangiosis. Both the surgery and the postoperative period were uneventful. Currently, about five months after the surgical procedure, she remains asymptomatic, on aspirin, and under follow-up.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3265_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3265_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4f97cc978b56bf82befc0309d4615570cb0a1332
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3265_en.txt
@@ -0,0 +1,5 @@
+A 24-year-old para 1 woman of African descent gave birth to a normal 3100 g female baby at 40 weeks’ gestation in a district hospital. Five months later, the patient, who was self-referred, presented to the outpatient gynaecology clinic of a regional hospital with a painful growth at the site of the left mediolateral episiotomy. She had no obvious puerperal sepsis. The patient had tertiary education, but no history of allergy, nor personal/family history of poor wound healing. The pain made it difficult for her to attempt coitus after birth. She used topical povidone-iodine ointment with no success. Physical examination revealed an exuberant tissue on the episiotomy scar at the 5 o’clock position of the introitus that extended superiorly into the lower third of the vagina and inferiorly into the upper part of the thigh. The lesion was also present in the fourchette from the 5 to 7 o’clock position. No obvious risk factor for exuberant granulation was identified, except for being an African.
+
+The differential diagnoses were exuberant granulation tissue, granulomatous disorder (such as foreign body granulomas), pyogenic granuloma (lobular capillary hemangioma) that develops due to irritation, chronic graft-versus-host disease (cGVHD), keloid, and malignant lesions such as aggressive fibromatoses. cGVHD was excluded because there was no history of tissue grafting. The lack of epithelization excluded keloid. She was counseled, consented to, and underwent a cold knife excision biopsy aided by local bupivacaine hydrochloride (Marcaine) infiltration to minimize bleeding, and the surgical sites were sutured using polyglactin 2–0. During suturing, the vaginal epithelium in the vicinity of the lesion was thin and friable, as the stitches easily cut through the vaginal mucosa. There were no other features of hypoestrogenism. The lesions were discrete and sessile in attachment with a maximum diameter of 1.5 cm. Postoperatively and after discussion with a multidisciplinary team that included a urogynecologist, to treat the atrophic vaginal mucosa, she was prescribed topical conjugated equine estrogen vaginal cream 0.625 mg per 1 g, using 0.5 g per intravaginal application. This was the most appropriate available medication to assist with rejuvenation of the friable vaginal tissue. The patient applied the cream intravaginally twice a week for two weeks and then once a week for one week. This was an intermediate dose (which ranges from 0.3 to 0.5 mg of conjugated equine estrogen). The therapy was intermittent and of a short duration to minimize the effects of any systemic absorption. There is no specific dose recommended for premenopausal women,9 making its use controversial. Despite the controversy, data from a recent Danish study show a reassuring safety profile. Therefore, conjugated equine estrogen remains a recommended treatment option for vulvovaginal atrophy in women.
+
+The histological report confirmed exuberant granulation tissue. No foreign body or residual surgical suture was identified in the specimen. A follow-up review at 12 weeks and 6 months confirmed normal wound healing and genitalia function.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_327_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_327_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..59937c56907cc9505907e842c177f447c16f5429
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_327_en.txt
@@ -0,0 +1,5 @@
+A 75-year-old woman was admitted to our hospital due to a 2-year history of gradually progressive gait disturbance. She had suffered from RA since the age of 25. Because of an exacerbation of this disease, she started taking prednisolone (5 mg/day) and sulfasalazine at 67 years, and had been continuously treated with minocycline (200 mg/day) since the age of 68. She noticed a gradual increase in blue-black skin pigmentation on both legs at 72 years. Thereafter, she began to have difficulty walking, and would frequently catch the tip of her foot on the ground. No exposure to other drugs known to cause pigmentary changes was recorded.
+Examination of the patient revealed blue-black pigmentation related to minocycline therapy on the distal parts of the legs . The muscle strength was normal in the upper limbs and trunk, but she was unable to perform toe- or heel-walking. There was mild symmetrical weakness and atrophy in the lower limb muscles, but no wide-based gait. Strength testing was performed using Medical Research Council grades, and the results were as follows: hip flexion 4+/5, hip extension 4+/5, knee extension 4/5, knee flexion 4-/5, ankle dorsiflexion 4-/5, and ankle plantar flexion 4-/5. The tendon reflexes were normal except for the absence of ankle jerks. A stocking distribution decrease in appreciation of superficial pain was identified in both legs. Vibration sensation was decreased in the toes and ankles. Laboratory tests, including creatine kinase levels, were normal except for the tests related to RA. Chest roentgenogram and electrocardiogram showed no abnormalities. A nerve conduction study demonstrated no detectable abnormalities except for low amplitude in the bilateral sural nerve action potentials. Needle electromyography showed low amplitude and short duration motor-unit potentials with early recruitment in the quadriceps femoris, biceps femoris and tibialis anterior muscles. No abnormal spontaneous activity was seen in any of the muscles. Skeletal muscle CT revealed diffuse muscular atrophy of the lower extremities. Because the patient was suspected of having myopathy and sensory neuropathy, peroneus muscle and sural nerve biopsies were performed after informed consent was obtained.
+The biopsied specimens were snap-frozen in isopentane-liquid nitrogen, and cryosections were stained with a standard battery of histological and histochemical reactions. Paraffin-embedded tissue sections were also stained with Prussian blue stain (for iron), Masson Fontana preparation (for melanin) and hydrogen peroxide melanin bleach. Histopathological studies of the biopsied muscle revealed modest variability in myofiber diameter with scattered angular atrophic fibers . There were a considerable number of atrophic fibers with rimmed vacuoles , and multiple collections of granular pigment-containing histiocytes in the endomysial and perimysial perivascular areas. The granules and rimmed vacuoles showed high acid phosphatase activity . The pigmentation was mainly found outside the myofibers, but the NADH-tetrazolium reductase reaction readily identified dark-brown depositions in some fibers. Almost all of the rimmed vacuoles contained granular depositions . No necrotic or regenerating fibers were present. There was no inflammatory infiltrate, except for histiocytes containing pigment that stained bright blue with the Prussian blue . This histiocytic pigment stained black on a Masson Fontana preparation , bleached in response to potassium permanganate, and showed no fluoresce under ultraviolet light, indicating that it was composed of iron and melanin.
+Electron microscopy was performed on glutaraldehyde-fixed tissue using a standard electron microscopic processing protocol and a transmission electron microscope. Electron microscopy revealed that the pigment granules were localized in the cytoplasm of histiocytes, in the spaces between myofibers, and adjacent to small blood vessels . In the myofibers, the granules were localized in the subsarcolemmal cytoplasm, either individually or in clusters . Remarkably, autophagic vacuoles were consistently observed in association with many of the granular pigment clusters . Two distinct morphological patterns were evident among the granules found in myofibers: irregularly shaped, highly electron-dense granules, and membrane-bound vesicles of differing electron density with distinct internal structures, often associated with small lipid droplets.
+In addition to the standard battery of histological stains, the sural nerve biopsy specimen was embedded in epoxy resin and examined by light and electron microscopy. Light microscopy of the sural nerve showed a reduction in the number of large diameter myelinated fibers, but no other specific features . However, Prussian blue and Masson Fontana staining revealed perivascular deposits of iron and melanin in the epineurial blood vessels. Electron microscopy revealed a few highly electron-dense granules in the cytoplasm of Schwann cells, where the myelin sheath was disrupted .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3280_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3280_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..600ddc80bdfe403b9c88dec98eb0fddb1ad71af0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3280_en.txt
@@ -0,0 +1,11 @@
+Male patient from a rural area in the department of Antioquia, Colombia, born at term, with weight and size appropriate for the gestational age and without hospitalization in the neonatal period. Subsequently, no significant antecedents and with normal psychomotor development. He entered the emergency department at the age of 4 years with a 15-day history of vomiting, asthenia, adynamia, myalgia and ataxic gait. On admission, he presented hypotension (arterial pressure lower than the 5th percentile for age and height percentile), hyperpigmentation of skin and mucous membranes, male genitals with normal size and thickness of the penis, but with bilateral cryptorchidism. In addition, he presented alopecia plaques in the left fronto-temporal region. Initial laboratory examinations with hyponatraemia (serum sodium 128 mEq/L) and mild hyperkalaemia (serum potassium 5.05 mEq/L) associated with low serum cortisol.
+
+Based on clinical and laboratory findings, an adrenal crisis was diagnosed and a hydric resuscitation with normal saline and hydrocortisone was initiated (initial dose of 100 mg/m2/day, followed by a maintenance dose of 50 mg/m2/day every 6 h). Due to persistence of hyponatraemia, fludrocortisone was added in doses of 0.1 mg every 12 h, with which haemodynamic and electrolytic stability was established.
+
+Neurological evaluation showed no central or peripheral nerve involvement and ataxic gait resolved, so it was assumed to be secondary to hyponatraemia.
+
+The case was considered consistent with primary adrenal insufficiency and within the etiologic possibilities, congenital adrenal hyperplasia due to 21-hydroxylase deficiency was ruled out by normal levels of 17-hydroxyprogesterone. Given the possibility of an adrenoleucodystrophy by age, gender and the history of ataxia, brain magnetic resonance imaging and very long chain fatty acids were performed, which ruled them out. Autoimmune etiology was ruled out with anti 21-hydroxylase antibodies negative. The images of the adrenals by tomography were negative for lesions or hemorrhages. Infectious etiologies were ruled out (with studies negative for Mycobacterium tuberculosis, cytomegalovirus and human immunodeficiency virus). No medicines were found involved in the genesis of the adrenal insufficiency, nor other causes of secondary adrenal insufficiency.
+
+With the debut of the IAP without established etiology, it was considered necessary to rule out a genetic cause due to probable congenital adrenal hypoplasia and clinical exome sequencing was requested. This identified a “probably pathogenic” variant c.1275A > T; p.Arg425Ser in the NR0B113 gene.
+
+At the time of the report, the patient was 11 years old, the cryptorchidism had been corrected, the testicular volume was 2 to 3 ml bilateral, and he continued to be monitored by paediatric endocrinology, with treatment with hydrocortisone at a dose of 13 mg/m2/day and fludrocortisone 0.1 mg every 12 h, with adequate clinical evolution, without new adrenal crises and with adequate growth pattern. The laboratory studies indicated normal electrolyte and plasma renin values. He had not yet begun clinical puberty and had prepubertal levels of luteinizing hormone (LH).
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3287_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3287_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d6730ba2d645951ed789564b7d5004f396715f63
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3287_en.txt
@@ -0,0 +1 @@
+The patient was born at 39 weeks of gestation and delivered by Cesarean section due to polyhydramnios. She was 3295 g at birth. Although short stature and abnormal facial features such as depressed nose, deeply grooved philtrum, and macroglossia were recognized at birth, the signs were not associated with any particular diagnosis. At 1 year of age, she was diagnosed with pulmonary valve stenosis. At 5 years of age, a balloon valvuloplasty for severe PS was performed; however, it was not sufficient to reduce the pressure gradient of PS (from 80 mmHg to 50 mmHg). At 6 years of age, surgical valvuloplasty to enlarge the annulus and reconstruct the right ventricular outflow tract was performed, which resulted in the disappearance of the PS pressure gradient. She was followed-up at our hospital yearly. Although echocardiogram showed mild PR, her clinical condition was good without specific medical treatment. When she was a high school student, she discontinued regular medical follow-up, and started studying abroad at 18 years of age. She occasionally experienced transient leg edema during this time. At 21 years of age, she developed dyspnea, edema, and abdominal bloating. She returned to Japan; thereafter, she required an emergency hospitalization. She was diagnosed with acute decompensated heart failure, which was mainly right-sided heart failure due to severe PR and TR. It was thought that PR had been subclinically exacerbated after the surgical valvuloplasty, resulting in right-ventricular volume overload. She was also diagnosed with protein-losing enteropathy associated with abnormalities in lymphatic drainage. Echocardiography showed no evidence of HCM, MS, or PS recurrence. Cardiac catheterization revealed a normal cardiac index of 3.9 L/min/m2, and a normal estimated mitral valve area of 4.13 cm2/m2. On the basis of the history of PS and characteristic physical features including short stature, webbed neck, and hypertelorism, she was clinically diagnosed with NS for the first time. A chromosomal study showed 46XX with no abnormality of chromosome 12. The patient refused genetic testing. She was successfully treated with a loop diuretic, beta-blocker, angiotensin-converting enzyme inhibitor, and aldosterone inhibitor. After discharge, she resumed regular follow-up at the local hospital. Although the symptoms of heart failure, such as dyspnea and edema, persisted with a New York Heart Association class of II these symptoms could be controlled with oral medical treatment. There were no records regarding the follow-up echocardiographic findings at the local hospital. At 25 years of age, she was admitted to the local hospital again for massive ascites and marked edema and was referred to our hospital. Her height was 107 cm and her weight was 33 kg. She had a body temperature of 36.8 °C, blood pressure of 90/50 mmHg, regular pulse rate of 125 beats/min, respiratory rate of 18 breaths/min, and oxygen saturation of 95% without oxygen administration. On physical examination, she exhibited jugular venous distention at her neck, and systolic and diastolic regurgitant murmur at the left sternal border. Her breath sounds were decreased, and she had abdominal distention with no tenderness and significant leg edema. Laboratory data upon hospitalization are shown in Table 1. Chest radiography showed heart enlargement with cardiothoracic ratio of 63%, pulmonary edema, and bilateral pleural effusion. Electrocardiogram showed sinus tachycardia with right axis deviation. Echocardiogram showed enlargement of the right-side heart with displacement of the ventricular septal wall, as well as severe PR, TR, and severe MS with a mean pressure gradient of 10 mmHg and mild thickening of the mitral valve leaflets. Since diastolic function based on the early diastolic mitral septal annular velocity was normal, it was unlikely that the patient had restrictive cardiomyopathy or constrictive pericarditis. Cardiac catheterization revealed a mean pulmonary artery pressure of 49 mmHg, a mean pulmonary artery wedge pressure of 33 mmHg, a left ventricular end-diastolic pressure of 24 mmHg, a low cardiac index of 1.9 L/min/m2, and confirmed severe MS with an estimated mitral valve area of 0.81 cm2/m2. Coronary arteries were intact. There was no evidence of rheumatic change or infectious endocarditis; the etiology of the late-onset MS was uncertain. Computed tomography of the chest and abdomen showed massive ascites as well as plural effusion and atelectasis in the right lung. On the basis of these findings, she was diagnosed with heart failure of both sides, which was mainly caused by severe PR and TR after surgical valvuloplasty for PS as well as the late-onset severe MS with uncertain etiology. Moreover, her abdominal ultrasonogram findings, including irregular external contour, enlarged left liver lobe, and splenomegaly, indicated that she had developed cirrhosis. This was thought to be associated with long-standing right-side heart failure, because of the negative viral or other hepatitis screening. Results of the analysis of ascites and plural effusion were consistent with a pure transudate. Thus, excessive fluid of the chest and abdomen was considered to have been caused by the chronic right-side heart failure in addition to the severe hypoalbuminemia associated with advanced cirrhosis and protein-losing enteropathy. In addition to the abdominal and chest drainage, fluid management using furosemide, tolvaptan, and carperitide was successfully performed. We discussed a treatment strategy with surgeons, including mitral valve replacement, tricuspid valvuloplasty, and right ventricular outflow tract reconstruction; however, considering the patient’s low left ventricular function, cirrhosis, very low albumin level, and atelectasis caused by the long-standing pleural effusion, surgical options were considered to be extremely high risk. In addition, transcatheter cardiac intervention could not be performed in Japan at that time. Therefore, we continued the optimal medication treatment as well as the occasional abdominal cavity drainage for recurrent ascites. Unfortunately, after repeated hospitalizations for ascites and edema, she died of decompensated heart failure 2 years later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3288_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3288_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d1c365e34026fd90400dcbba9c66d59770ef5be3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3288_en.txt
@@ -0,0 +1 @@
+We present a 40-year-old female, a gravida-9 para-7+1, who previously underwent an interval bilateral tubal ligation (BTL) in December 2016 during a community outreach program, through a mini laparotomy. She had seven previous successful pregnancies and an ectopic pregnancy in October 2019, for which she had an exploratory laparotomy and salpingectomy done for a left-ruptured tubal ectopic pregnancy in November 2018. She presented at a university teaching hospital in northern Uganda on October 20, 2021, with acute abdominal pain for 2 days and amenorrhea for 6 weeks, with no vaginal bleeding. She was fully conscious, in pain, anxious, afebrile, and hemodynamically stable, with a pulse rate of 98 beats per minute and a blood pressure of 121/78 mmHg. She had generalized abdominal tenderness, guarding and rebound tenderness, and cervical motion tenderness. Laboratory investigations revealed a positive urine pregnancy (HCG) test and a hemoglobin level of 12.9 g/dL with normal platelet count. A trans-abdominal ultrasound scan revealed a tender echo-complex right adnexal mass, free fluid in the Cul-de-sac measuring 5.2 centimeters deep, and an empty uterine cavity. A diagnosis of ruptured right tubal ectopic pregnancy was made, and the patient was counseled and consented to an emergent exploratory laparotomy. On exploratory laparotomy, approximately 300 mL of blood were found in the peritoneal cavity. A ruptured right distal tube containing a well-circumscribed mass was also found. There was also evidence of a previous right tubal ligation and left salpingectomy with a normal uterus and ovaries. The blood was evacuated, and a right total salpingectomy was done. The excised right tube containing the mass (gestational product) was sent for histological examination. Histopathology revealed chorionic villi and hemorrhagic vascular decidual tissue in the fallopian tube, features suggestive of tubal ectopic pregnancy. Post-operative patient management was uneventful. However, the couple expressed their dismay about the two ectopic pregnancies and dissatisfaction with the previous BTL, as well as concerns about having sex in the future in fear of subsequent ectopic pregnancies. They were counseled to relieve their fears about sex and future ectopic pregnancies.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_329_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_329_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..37d98e96d166ba7326c7559e913566ba9d8c9367
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_329_en.txt
@@ -0,0 +1,7 @@
+A 48-year-old Caucasian male with traumatic epidural hematoma and subarachnoid bleeding was transferred, after rapid neurological deterioration necessitating intubation, from another hospital to a tertiary university hospital for neurosurgical intervention. The patient had a history of preexisting fever and nonproductive cough over a period of 3–4 days prior to admission and had direct contact with a person who tested positive for SARS-CoV-2. A SARS-CoV-2 polymerase chain reaction (PCR) test performed upon admission was positive. The patient had no preexisting comorbidities, medications, or interventions.
+Due to the positive SARS-CoV-2 swab, further management was performed according to the then valid institutional guidelines. Directly after the admission to our hospital, an uncomplicated emergency craniotomy for evacuation of the epidural hematoma and insertion of an intraparenchymal intracranial pressure (ICP) probe was performed, after which the patient was transferred to the ICU. Seventy-two hours after the admission to the ICU, a decompressive craniectomy was necessary due to edema of the left hemisphere with a midline shift of 6 mm. Further ICP management was uncomplicated. On the day of the second intervention, the patient developed a maculopapular erythematous exanthema, which progressed to a papulovesicular rash within 24–48 hours. Simultaneous to the progression of cutaneous eruptions, the patient developed respiratory failure and signs of septic shock.
+Upon admission to the ICU, the patient presented with mild hypotension (95/60 mmHg) and a normal heart rate of 63 beats per minute. The patient was fully sedated with propofol and fentanyl [Glasgow coma scale (GCS) score of 3 points], intubated, and volume-controlled ventilated with a fractional concentration of inspired oxygen (FiO2) of 0.55, positive end expiratory pressure (PEEP) of 7 mbar, and respiratory rate of 17 breaths per minute. His body temperature was 39 °C. About 72 hours after the admission, a maculopapular erythematous exanthema predominantly on the trunk and upper and lower extremities was noted. Mucosae, palmar surfaces of hands, and plantar surfaces of feet were spared . The exanthema was initially interpreted as a possible cutaneous manifestation of the SARS-CoV-2 infection. However, over the following days the exanthema progressed to a papulovesicular rash. The patient developed severe septic shock requiring volume substitution and high-dose vasoactive agents, as well as progressive respiratory failure with rapidly rising oxygen demand.
+Routine laboratory tests upon admission were unremarkable except for slightly increased inflammatory markers and lymphopenia. Blood gas analysis was normal with an oxygenation index of 490 (FiO2 0.55, partial pressure of oxygen in arterial blood 272 mmHg), and an initial thoracic computed tomography (CT) scan revealed no pulmonary infiltrates. Along with clinical signs of septic shock, inflammatory markers increased, and oxygenation index decreased .
+A second CT scan performed on the fifth day after the admission revealed patchy ground-glass opacifications and progressive consolidations typical for COVID-19 present in 23% of the lung tissue volume. Small bilateral pleural effusions were also described . The severe hemodynamic and respiratory deterioration (oxygenation index at this point was 97) was suggestive of a bacterial coinfection. However, because of the cutaneous manifestations, varicella zoster virus (VZV) was also considered. A PCR from a swab taken from a cutaneous vesicular lesion was positive for VZV and negative for herpes simplex virus types 1–2 and SARS-CoV-2. Serological testing confirmed primary VZV infection . A bedside bronchoscopy was performed. Microbiological testing of the tracheal secretion revealed a polymicrobial bacterial flora with Staphylococcus aureus, Enterobacter cloacae, and Serratia marcescens. In addition, a specific PCR test was positive for VZV (4700 GEq/ml). Acute encephalitis, a possible complication of the surgeries, was also taken into account. Bacterial culture of the cerebrospinal fluid and multiplex PCR panel including VZV were negative.
+In addition to the COVID-19 pneumonia, a primary VZV coinfection with possible pulmonary involvement and ventilator-associated multibacterial tracheobronchitis with Staphylococcus aureus, E. cloacae, and Serratia marcescens were diagnosed. Due to rapid, progressive hemodynamic and respiratory deterioration, COVID-19 treatment with remdesivir (5 days) and dexamethasone (10 days) according to the then valid institutional protocol for COVID-19 management was started. Simultaneously, a broad-spectrum antibiotic coverage with meropenem (for 7 days) was initiated, and the primary VZV infection with possible pulmonary involvement was treated with high-dose acyclovir (10 mg/kg every 8 hours for 14 days).
+We observed a fast pulmonary and hemodynamic stabilization. Continuously decreasing values of C-reactive protein and procalcitonin along with a good neurological and pulmonary recovery allowed for extubation 11 days after admission to the ICU and transfer to the normal ward after 20 days. After 46 days of hospitalization, the patient was discharged and transferred to a rehabilitation clinic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3306_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3306_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..41f359be5552607f2ece802cb0339fd91ec14856
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3306_en.txt
@@ -0,0 +1,9 @@
+A 29 year-old female patient was admitted to our center due to infertility challenges. She had never had a natural menstruation, with her first menstruation occurring after induction using Estradiol Valerate Tablets and progestin at the age of 17. Up to the time of admission, her post-estrogen-progesterone sequential treatment entailed taking Estradiol Valerate Tablets (1mg/day) for 21 days from the fifth day of previous menstruation, and oral progesterone capsules (200mg/day) for 11–16 days. Her menstruation occurred 3–7 days after stopping the progesterone capsules intake. The patient got married at age 26 and engaged in sexual intercourse 1–2 times a week. However, despite not using any method of contraception, she had not conceived for four years. Besides being healthy and lacking a history of surgery, the patient had the following characteristics; height of 175 cm, weight of 77 kg, normal smell, flat breasts, naive vulva, no pubic hair, naive labia minora, free vagina, small cervix, smooth, anterior uterine position, small, and no visible abnormalities in both appendices. Blood tests on the third day of menstruation revealed low FSH (0.66mU/mL), LH<0.1mU/mL, E2<18.35pg/mol, T<0.09, PRL (179), TSH (2.61 chromosome 46). Fallopian tube angiography showed bilateral patency in 2017, while B ultrasound (on the third day of menstruation) revealed uterine measurements of 4.29×4.51×3.04 cm, linear endometrium, and right ovary of size 3.13×1.10 cm, with 2–3 visible small follicles.
+
+On January 9, 2021, the patient underwent a pretreatment for three menstrual cycles at our health center. Additionally, male semen assessment was performed on the same day and found to be normal. On April 4, 2021 (4th day of menstruation), she commenced the HMG (75U/ day) treatment that lasted for 7 consecutive days. On April 11, 2021, B ultrasound detected a follicle on the right side with the largest size of 0.3cm, 6–7 small follicles, and 4–5 small follicles on the left. HMG was then increased to 150U/ day for 7 consecutive days. On April 18, B-ultrasound detected 5–6 small follicles with a maximum size of 0.5cm on the right side, and more than 10 small follicles with a maximum size of 0.45cm on the left side. HMG was further increased to 225U/ day for 7 consecutive days. On April 24, B-ultrasound detected 2–3 small follicles on the right side and 6–7 small follicles on the left side. Administration of HMG225U/ day was further continued for 4 consecutive days and on April 28, the largest follicle size on both the the right and left side was 0.45cm. On May 4, the largest follicle size on both the right and left side was still 0.45cm. HMG was further increased to 300U/ day for 5 consecutive days and on May 9, the largest follicle on the right side was 0.55 cm, while the largest follicle on the left side was 0.5 cm. Take Estradiol Valerate Tablets 2mg/ day for 10 days, Progesterone capsule 0.2g/ day for 9 days, During the 35-day period of this cycle, HMG6675U (75 vessels) were used. However, no dominant follicles were obtained.
+
+On May 23, 2021, the patient was pretreated with climen for two menstrual cycles, and ovulation induction was commenced on July 20 (4th day of menstruation). HMG (150U/ day) was administered for 7 days, from July 27. On the right, 2×0.55 cm follicles with 4–5 small follicles were measured, while on the left, 10.45 cm follicles with 5–6 small follicles were measured. HMG (225U/ day) and add letrozole (5mg/ day) were then administered for 5 consecutive days. On August 1, 4–5 small follicles were measured on the right side while 5–6 small follicles were measured on the left side. HMG (225U/ day) and letrozole (5mg/ day) treatment was further continued for 3 days and on August 4, there were 4–5 small follicles on the right side and on the left side 1.0cm with 5–6 small follicles. HMG was further increased to 300U/ day and administered for 4 days, without letrozole. On August 8, there were 2–3 small follicles on the right and 2–3 small follicles on the left. In addition, blood test results performed on the same day revealed LH: 0.26miu/mol and E2:10pg/mol. The stimulation was then stopped and the patient given a pretreatment of kelingmont for two menstrual cycles.
+
+The third ovulation induction commenced on November 2, 2021 (4th day of menstruation), with the administration of HMG (225U/ day) and letrozole (5mg/ day) for 5 days. On November 7, 6–7 small follicles on the right side and 5–6 small follicles on the left side were measured. HMG (225U/ day) and letrozole (5mg/ day) treatment was continued for 9 days. On November 15, follicle of 0.25 cm ×2 was measured on the right side while the echo on the left side was rather firm. The same treatment was further continued for 5 days and on November 18, 4–5 small follicles were measured on the right side and 3–4 small follicles on the left side. Letrozole was then increased to 7.5mg/ day and administered alongside HMG (225U/ day) for 4 days. On November 22, B-mode ultrasound revealed no change before bilateral follicular. Triptorelin Acetate (0.05mg) was administered for two days, while letrozole (7.5mg/ day) and HMG (375U/ day) were administered for four days. On November 29, 3–4 small follicles were measured on the right side and 4–5 small follicles on the left with one 0.2cm follicles were measured. Subsequently, Triptorelin Acetate was withdrawn, and HMG (375U/ day) with letrozole (7.5mg/ day) treatment continued for 5 days. One small follicle on the right side and one small follicle on the left side were measured on December 4. HMG (375U/ day) and letrozole (7.5mg/ day) treatment was continued for another 4 days. On December 8, a 0.2cm follicle at the right side of the left echogen was relatively solid. In this cycle, HMG increased to 375U/ day, while letrozole remained constant (7.5mg/ day). However, no dominant follicles were obtained, and the patient was pretreated with Femoston for 3 menstrual cycles.
+
+On March 5, 2022 (5th day of menstruation) blood test results revealed FSH:0.38mU/mL, LH:0.02mU/mL, E2:10pg/mol, TSH:1.46μU/mL and endometrial:0.3cm. The patient was given Estradiol Valerate (2mg / day) for 5 days and on March 10, a 0.3cm follicle was measured on the right side with 6–7 small follicles, while on the left side a 0.3cm follicle was measured with 9–10 small follicles. Letrozole and HMG were then administered at 2.5mg/ day and 225U/ day, respectively, for 7 days. On March 17, one 0.4cm follicle was measured on the right side with 7–8 small follicles, and one 0.5cm follicle was measured on the left side with 4–5 small follicles. Letrozole (5mg/ day) and HMG (225U/ day) treatment was further continued for 6 days And on March 23, a 0.2cm follicle was measured on the right side with 5–6 small follicles, while 4–5 small follicles were measured on the left side. Letrozole treatment was stopped and increased HMG dose of 300U/ day administered for 5 days. On July 28, a 0.3cm follicle on the right side with 3–4 small follicles, and 2–3 small follicles on the left side were measured. HMG (450U/ day) and Luveris (rLH) dose of 75U/ day were then administered for 4 days. On April 1, one 0.5cm follicle was measured on the right side with 6–7 small follicles and two 0.4cm follicles on the left side, with 3–4 small follicles. A small amount of vaginal bleeding was observed on the first day of rLH administration. HMG (450U/ day) and rLH (75U/ day) treatment was continued for 3 days. On the right side, the following follicle measurements were obtained on April 6; 1.0cm×2, 0.95cm×2, 0.9cm, and 0.85cm, with 9–10 small follicles. On the left side, follicle measurements of 1.05cm, 1.0cm, and 0.95cm were obtained with 6–7 small follicles. HMG (450U/ day) and rLH (75U/ day) treatment was further continued for 3 days. The follicle was measured On April 9, follicle measurements obtained from the right side were; 1.7cm, 1.55cm×2, 1.4cm, 1.3cm×2, 1.25cm, 1.2cm, 1.1cm×2, 1.05cm, 0.9cm×2, 0.8cm, 0.75cm×2, 0.7cm×2, and 0.6cm, with 2 small follicles. On the left, 1.45cm, 1.35cm, 1.25cm, 1.15cm, 1.1cm×2, 0.95cm, 0.9cm×2, and 0.85cm were measured with 2 small follicles. HMG was changed to 225U/ day, and was administered alongside (rLH 75U/ day) for 2 days. Blood test was done on April 11 which revealed LH: 0.25mU/mL, E2:783pg/mol, and P: 0.78ng/mol. Follicles on the right side measured 2.05cm, 1.9cm, 1.8cm×2, 1.75cm, 1.55cm, 1.45cm×2, and 1.25cm, with 9–10 small follicles. On the left side, follicle measurements of 1.65cm, 1.45cm×2, 1.25cm, and 1.2cm were obtained with 4–5 small follicles. Since double triggers are used for better follicular maturation and discharge, dapicta (traprilin acetate) 0.1mg and HCG (6000U) were administered to the patient on April 11, and she was instructed to engage in sexual intercourse for the next three days. On April 15, B-ultrasound detected one luteal on both sides. Progesterone injection (20mg/ day) was administered for 14 days, and an early pregnancy test conducted two weeks later (April 19). The early pregnancy test was positive and blood test results conducted on the same day revealed E2:264pg/mol, P: 6.63ng/mol, and β-hcg: 1123.81miu/mol. On June 25, B-mode ultrasound showed fetal bud: 0.8 cm, fetal heart: 121 times/min, and the early pregnancy was consistent with 7+ gestational weeks.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3318_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3318_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d7865b601cfaefc8e81e9104028119928099a83a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3318_en.txt
@@ -0,0 +1,3 @@
+47-year-old female patient, housewife, no financial resources and no medical services. The patient presented with pain, functional limitation and deformity of the left wrist. She reported a history of TCG resection, treated with curettage and obturation of the defect with autograft of the iliac crest 4 years ago. Physical examination revealed deformity of the left distal radius with pain on palpation and significant limitation of flexion-extension movements, with no evidence of distal neurovascular involvement and normal mobility of the fingers. Radiologically, an expansive lytic lesion was observed with thinning of the lateral cortical and rupture of the anteromedial cortical of the left distal radius, classified as grade III of Campanacci for TCG. Surgery was performed with a dorsal approach, dissecting planes until the tumor tissue was found with destruction of the anteromedial cortical at the distal third of the radius. Extensor tendons were removed from the tumor tissue and a 7 cm block resection was performed, preserving the carpal bones. Simultaneously, an autologous graft of about 9 cm from the distal third of the fibula was taken and a 7 cm molded block was placed in the area where the resection was performed. Subsequently, a pre-molded 12-hole 3.5 mm compression plate with a dorsal curvature of 10° dorsiflexion was placed to provide an optimal hand position; a metacarpo-carpo-radial arthrodesis was performed with distal fixation in the third metacarpal with three locking pins, a 3.5 mm cortical screw to the greater bone, two locking pins for the graft and three proximal locking pins. The cubito-carpo joint was stabilized and fixed with a 2.0 mm Kirschner wire, the wound was washed and the remaining autologous graft in the radiocarpal space was fragmented. Extensor tendons were rearranged and a flat closure was performed. Finally, a splint was placed on the forearm. The diagnosis of TCG was confirmed by pathology. There were no complications during surgery.
+
+At 18 months of follow-up, clinical results were very encouraging and the patient reported being very satisfied. She had no pain or paresthesia and performed her daily activities; the patient had good grip strength (80% compared to the healthy side) and had fine motor function in the hand. The wrist was stable with pronation of 85°, supination of 80°, flexion-extension of 0°, and a DASH (Disabilities of the Arm, Shoulder, and Hand) functional outcome assessment questionnaire score of 6.7. Radiologically, the autograft was integrated at the distal end and not integrated at the proximal end. The patient was evaluated radiologically five years after surgery and continued to have no evidence of local recurrence and pulmonary involvement.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3319_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3319_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f8118bfc186053679133976d6c2640030678318d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3319_en.txt
@@ -0,0 +1,7 @@
+A 51-year-old ambidextrous woman presented with neurofibromatosis type 1 and essential tremor. She was also being followed in psychiatry for a depressive disorder, body image distortion and marked fear of mice.
+
+His epilepsy began in 2008 with two nocturnal tonic seizures, with initial response to lamotrigine. In 2012, focal seizures with altered consciousness reappeared, without response to eslicarbacepine and levetiracetam. Depressive symptoms persisted.
+
+A preoperative videoelectroencephalographic evaluation suggested a right temporal lobe onset of seizures. A 3T MRI with epilepsy protocol showed a right mesial temporal sclerosis and a positron emission tomography showed a mesial temporal and ipsilateral temporal pole hypomethabolism. There was a visual and auditory-verbal memory impairment in the neuropsychological study. The intracarotid sodium amytal test suggested a memory deficit in the right hippocampus.
+
+In 2016, a temporal anteromedial resection was performed that included the right amygdala, hippocampus, parahippocampal structures and temporal pole, without new seizures and without antiepileptic treatment for a year. He associated a great mental improvement and the disappearance of the rat phobia he presented.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3325_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3325_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1abcbf851d949dc6fa1a6840c75bc9daabf0da20
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3325_en.txt
@@ -0,0 +1,9 @@
+We present the clinical case of a 49-year-old male patient with a history of hypertension under treatment and smoking who consulted the emergency department for a 2-month-old picture of compromised general condition, significant weight loss, abdominal pain localized in the right hypochondrium and a non-quantified febrile sensation. On admission, a fever of 38°C, abdominal pain on deep palpation in the right hypochondrium and hepatomegaly were evident. In the admission laboratory, a normocytic-normokromic anaemia (Hb 11.2 g/gL, VCM 83 fL, HCM 27 pg) was evident; inflammatory parameters and leukocytosis with a left shift (leukocytes 24,900, absolute neutrophil count 19,860, PCR 156 mg/L, procalcitonin 5.1 ng/mL); elevated parameters of cholestasis (GGT 331 U/L, FA 267 U/L), discrete elevation of the transaminases (GPT 62 U/L, GOT 16 U/L) and total bilirubin levels (0.79 mg/dL) and direct (0.30 mg/dL) were normal. In addition, he presented a discrete shortening of the activated partial thromboplastin time (APTT 23.2 sec), with normal prothrombin and INR (PT 13.7 seconds, 78%, INR 1.15). Tumour markers (AFP < 1.3 ng/ml, ACE < 0.5 ng/ml) and blood cultures were negative.
+
+A computed tomography (CT) of the abdomen and pelvis with intravenous contrast (IVC) was requested, which showed a large solid mass in the left lobe of the liver, measuring approximately 6.6 cm in its major axis, and associated with hepatic hilar and portal-cavitary adenopathies. The study was complemented with an abdominal magnetic resonance (MRI) with IVC, which confirmed the hepatic mass, and was also associated with minimal dilation of the bile duct for that lobe. Its characteristics suggested a primary neoplastic lesion and, as a first possibility, an intrahepatic cholangiocarcinoma. In the context of the fever, elevated inflammatory parameters, cholestasis and dilation of the bile duct, the diagnosis of cholangitis was made, which was considered a tumor superinfection. Antibiotic treatment with Ceftriaxone and Metronidazole was initiated, with an adequate response, decreasing inflammatory parameters at 48 h.
+
+In the face of the possibility of a highly aggressive neoplasm, such as intra-hepatic cholangiocarcinoma, in a patient with a low surgical risk and in whom a percutaneous biopsy with a negative result for malignancy could have corresponded to a false negative, it is decided in the first instance to resect the tumour completely. The patient undergoes an exploratory laparotomy, in order to rule out the involvement of the lymph nodes, in which case the tumour would be considered inoperable. The rapid biopsy of inter-cavo-aortic lymph nodes did not show any tumour involvement, so it was decided to carry out a segmentectomy (II and III), together with a lymphadenectomy of the loco-regional lymph nodes (porto-cavo space and the hepatic artery).
+
+The histological result of the pieces studied informs that the hepatic tumor is composed of a lymphoplasmocytic inflammatory process, with immunoreactive plasma cells for CD138 and IgG, observing > 50 IgG4 positive plasma cells per field and some areas with IgG4/IgG ratio close to 40%, accompanied by stromal fibrosis. The rest of the ganglia do not present neoplastic pathology, observing expansion of the interfolicular zone, presence of numerous plasma cells, vascular hyperplasia, zones of involution of marginal centers and in the mantle zone, in addition to lymphocytes of disposition in concentric rings; morphological characteristics that can be found in the context of an IgG4-associated disease. The anatomical-pathological report is concluded as a diagnosis of a probable IgG4-associated disease (lymphoplasmocytic subtype). Serum IgG4 levels were not obtained.
+
+As the tumor had already been resected, a wait-and-see approach was decided. The patient remains under follow-up to date (6 months after surgery) through clinical evaluation, laboratory tests and imaging control (abdominal MRI). He has shown a favorable evolution, remaining asymptomatic and without signs of local recurrence.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3329_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3329_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..15d554e1b228ec027f1660d0fbf4e4ed46e8e6a3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3329_en.txt
@@ -0,0 +1,6 @@
+A 57-year-old Caucasian man was admitted to the Emergency Department due to anxiety, confusion, tachycardia, and dyspnea. The patient did not report any significant past medical history. The patient did not take any medication, did not consume alcohol, and did not smoke. Admission vital signs were noted: regular radial pulse with an average heart rate of 110 beats per minute, arterial pressure of 180/90 mmHg and peripheral oxygen blood saturation (SpO 2) of 90% in ambient air and spontaneous breathing with an average respiratory rate of 25 breaths per minute. The axillary temperature was normal. Cardiac examination revealed a regular rate and rhythm with normal heart sounds and a holosystolic murmur at the apex. Chest examination noted symmetrical thoracic activity, normal expansion, and bilateral basal end-inspiratory crackles. Abdominal examination was normal; no swelling of the feet or legs was detected but the extremities were cold. The patient was alert, answered simple questions accurately and was able to execute simple tasks; the pupils were equal, round and normally reactive to light; the neurological examination was normal. The patient lived in the countryside and used a pellet stove to heat his bedroom without any aeration system. An arterial blood gas analysis showed respiratory acidosis with hyperlactatemia, increased anion gap, and a concentration of COHb above 15%. CXR detected pulmonary edema. The ECG showed sinus tachycardia with ST-segment elevation in the precordial V1-V6 leads.
+
+The patient rapidly decompensated with the onset of hypotension (systolic BP < 90 mmHg), worsening hypoxemia, and respiratory acidosis.
+
+He was admitted to the Intensive Care Unit (ICU). Acute Heart Failure (AHF) with cardiogenic shock and respiratory failure was suspected. A transthoracic echocardiogram (TTE) was performed and demonstrated globally reduced left ventricular contractile function with ejection fraction of 20-25% and a severe mitral regurgitation; the pericardium was normal. The patient was treated with ventilatory and circulatory support. He underwent an orotracheal intubation under sedation with subsequent lung protective mechanical ventilation and inotropic support. The patient responded quickly, and peripheral perfusion was restored. As the patient was confused and had cardiovascular failure and acidosis, hyperbaric oxygen therapy was started and maintained until COHb concentration was reduced to normal values (<3%)25,50 . Blood cell count, electrolytes, renal, liver, and thyroid function were all within the normal range.
+Creatine kinase (CK), creatine kinase-muscle/brain (CK-MB), troponin and lactate dehydrogenase (LDH) were higher than the normal value. The amino-terminal fragment of pro-brain natriuretic peptide (NT-proBNP) was slightly elevated. The ECG showed a pattern indicating an Acute Coronary Syndrome (ACS). Given the ECG findings and the increased concentration of myocardial necrosis markers, a coronary angiography was performed but it did not detect any stenosis or other abnormalities of the coronary arteries. It was supposed that ECG finding was related to coronary vasospasm related to CO intoxication. After 12 hours of mechanical support, lung function improved, and no further evidence of cardiopulmonary failure was observed. The subsequent arterial blood gas analysis was normal, and the radiogram of the chest showed no further evidence of pulmonary edema. The cardiac necrosis markers decreased to normal levels. The TTE was repeated and detected an improved EF to 50-60% with no global dysfunction; mitral regurgitation was no longer documented. The patient was extubated and discharged to the Internal Medicine (IM) ward for monitoring and care. He remained hemodynamically stable for the following two days and discharged. Three days later, he was re-admitted to the Emergency Room (ER) with the same cardiovascular condition. He had the same TTE pattern of the previous admission with decreased ejection fraction (EF) and global left ventricular dysfunction. The measured COHb level was higher than 20%. He died from acute cardiac failure and cardiac arrest with pulseless electric activity (PEA) despite prompt treatment and resuscitative measures.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3338_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3338_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..61dcfd52ffb03fcede3cd8dc4aebd1a8be2a01b1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3338_en.txt
@@ -0,0 +1,5 @@
+We present a case of a 93-year-old Middle Eastern male patient with no known food or drug allergies who was known to have hypothyroidism, hypertension, and dyslipidemia. The patient was admitted to the hospital owing to fatigue and refractory hiccups lasting for 2 weeks. He had had hiccups intermittently for more than 2 years and had tried several medications, including proton-pump inhibitors (PPIs), chlorpromazine, and baclofen, with minimal relief of his symptoms. His home medications include levothyroxine, amlodipine, and rosuvastatin. On review of systems, he denies dysphagia, odynophagia, food impaction, heartburn, vomiting, or weight loss. Physical examination was unremarkable. Laboratory studies were only pertinent for an elevated eosinophil count of 18% with a white blood cell count of 9000 per mL. Stool studies were negative for parasitic infection.
+
+Imaging with computed tomography of the chest and abdomen was unremarkable. An upper endoscopy was subsequently performed and was normal, without any endoscopic finding to suggest EoE. Given his elevated peripheral eosinophil count, biopsies were taken from the mid- and distal esophagus and revealed eosinophilic infiltration in the range of 15 eosinophils per high-power field favoring a diagnosis of EoE.
+
+The patient was prescribed a proton-pump inhibitor twice daily in combination with baclofen. Despite partial initial improvement, the symptoms of intractable hiccups recurred, and the decision was made to switch therapy to topical budesonide 2 mg twice daily 30 minutes before meals. The frequency of the hiccups episodes gradually decreased and resolved completely within a week. Repeat blood test showed a decrease in eosinophilic count to 10%. A repeat endoscopy was offered but declined by the patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3367_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3367_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..71c9a0b619ce01988486baebc3b059988115d259
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3367_en.txt
@@ -0,0 +1,13 @@
+A 56-year-old Caucasian male presented with a diagnosis of recurrent heart failure. Previously, he was given a diagnosis of palindromic rheumatism based on a four-year history of lower extremity migratory joint pain and swelling that failed to respond to NSAIDs and hydroxychloroquine. During this time, he also developed unintentional weight loss, fatigue and cognitive impairment. Past medical history was significant for a renal cell carcinoma, treated with a left nephrectomy 4 years prior to presentation. The patient had a 45-pack year smoking history. He had not travelled abroad except for New Zealand and Hawaii 25 years ago.
+
+The patient had been previously evaluated over 4 years by numerous services including rheumatology, hematology, cardiology and dermatology with an extensive work-up, including blood cultures that were negative on repeat occasions. Eleven months prior to current presentation, the patient developed recurrent acute congestive heart failure exacerbation, requiring multiple admissions with treatment involving diuretics and chest tubes, providing limited short-term symptomatic relief.
+
+On this presentation, the patient had symptoms consistent with an exacerbation of congestive heart failure. The patient stated he had lost approximately 40 pounds over 6 months. He denied any GI symptoms, fevers, chills or night sweats. Physical examination revealed the patient as pale, afebrile and hemodynamically stable. He was noted to be cachectic with a weight of fifty-one kilograms (BMI: 17.8). Pitting edema of both lower extremities to the proximal shin with hyperpigmentation was noted. As observed on the initial CT scan, there was diffuse lymphadenopathy and right epitrochlear lymphadenopathy in particular was noted. Jugular venous distension was noted to 8 cm above the sternal angle with a positive Kussmaul’s sign on inspiration. The patient had a 3/6 systolic ejection murder without a pericardial knock. There was no oculomasticatory myorhythmia or supranuculear vertical gaze palsy observed.
+
+Transthoracic echocardiogram imaging was reviewed from 2014 to the 2016. In 2014, subtle tethering of the mitral valve was noted with thickening and cord calcification. The posterior leaflet had reduced excursion and the mitral valve apparatus was apically displaced. There was the observation of subtle diastolic doming over the anterior mitral leaflet. Progressive echocardiogram findings in 2016 showed the anterior mitral valve to be thickened with reduced excursion, the posterior leaflet to be fixed and cords with shortening. Overall, this was in keeping with pseudoprolapse. Over the aortic valve, there was systolic doming of the right coronary cusp and calcification from the commissural aspect of the aortic valve with sparing of the base. Notably, there was the presence septal shuttering in early diastole with early inspiratory septal bounce/shift, indicative of abnormal heart and lung interaction. Overall, this was suggestive of early constrictive physiology.
+
+A repeat transthoracic echocardiogram on admission showed numerous interval changes including; a reduction in left ventricle systolic function (ejection fraction of 48%), severe mitral regurgitation, moderate tricuspid regurgitation, moderate aortic regurgitation and worsening pulmonary hypertension (RSVP 78 mmHg). Calcific aortic valve changes were noted that were felt to be post-inflammatory as opposed to degenerative changes. The mitral valve had an unusual appearance suggestive of prior valvulitis, in particular rheumatic in nature. The pericardium was thickened with features of exaggerated heart and lung interactions, consistent with constrictive physiology. Based on these findings, pericardial stripping and valvular surgery were proposed.
+
+Perioperative findings consisted of thick pericardium and densely adherent to the surrounding anatomy. The mitral valve was grossly abnormal with fibrosis, in keeping with a rheumatic type process and was subsequently replaced with a bioprosthetic valve. The tricuspid valve had thickened leaflets with slightly thickened papillary muscle and was repaired with a ring annuloplasty. The thickened aortic valve was addressed with primary repair.
+
+The above constellation of symptoms, in the context with prior work-up as unremarkable, lent to a strong clinical suspicion of an atypical presentation of Whipple’s disease. Two days post-op, duodenal biopsies were obtained, and surprisingly were not consistent with Whipple’s disease. On the request of the clinician, the cardiac valves and pericardium pathology specimens were examined for PAS staining and PCR. The cardiac specimens demonstrated numerous foamy macrophages filled with PAS positive material compatible with Whipple’s disease. Tropheryma whipplei was identified by direct 16S rDNA PCR on the mitral valve with > 99% sequence match. The pathological changes were consistent with active endocarditis, myocarditis, and pericarditis, caused by T. whipplei. The patient started treatment with IV Penicillin G for 14 days and subsequently maintained regimen of oral sulfamethoxazole-trimethoprim for long-term treatment. Six months following diagnosis, the patient has had no complications and is clinically improving.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3368_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3368_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c66a5a2237180c35c54ef1833d83dbe852c7ed31
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3368_en.txt
@@ -0,0 +1,23 @@
+9-year-old schoolchild, second child of non-blood parents, height 167 cm father and 160 cm mother (average for Chilean population), she has a history of pulmonary sarcoidosis. Her 11-year-old older sister had an advanced bone age of 13 years at 10 years and 7 months of chronological age, without associated height alteration. She was also diagnosed with attention deficit hyperactivity disorder (ADHD) and overweight, without associated cognitive alterations or dysmorphies.
+
+The pregnancy was monitored, without associated pathologies and she was born at 37 weeks of gestational age by caesarean section with a weight of 3,960 kg (2.25 SD) classified as large for gestational age, height of 51 cm (1.04 SD), CC of 37.5 cm (3.62 SD) according to the curves of Alarcón and Pittaluga, and APGAR score 9-9.
+
+During his neonatal stage he presented hypotonic syndrome managed with motor rehabilitation with good evolution. As for his psychomotor development, he walked at 15 months of age and presented a delay in the start of language. At 7 years old he was diagnosed with verbal and motor dyspraxia, and at 9 years old he was in the process of acquiring reading and writing skills in a special school.
+
+She was above the normal growth curves for height, weight and WHR from infancy. At 9 years old, she had a weight of 57.7 kg (2.67 SD), height 150 cm (2.42 SD), body mass index (BMI) 25.6 (2.48 SD) according to WHO anthropometric curves, WHR 57.5 (≥ 2 SD) according to Nellhaus curves, and a wingspan of 160 cm, with proportionate body segments. Her pubertal development at 9 years old was Tanner I, consistent with her age. She did not have any eating disorders throughout her life.
+
+His hormonal and biochemical tests including thyroid hormones, IGF-1, gonadotrophins, testosterone, calcium-phosphorus, glycemia and glycosylated hemoglobin were within normal ranges. He presented an altered lipid profile at 9 years of age with a total cholesterol of 196 mg/dL and triglycerides of 162 mg/ dL. His wrist x-ray showed an advanced bone age of 13 years at his chronological age of 8 years and 10 months.
+
+In the neurological sphere, he was diagnosed with mild DI, high-functioning autism spectrum disorder (ASD) and ADHD, and was being treated with methylphenidate 10 mg daily. His main neurocognitive manifestations were difficulties in expressive language with dyslalia, alterations in fine motor skills and sensory modulation. He had difficulties in maintaining sleep. Throughout his life, he received comprehensive treatment with speech therapy, occupational therapy and psychopedagogy, showing positive progress in all areas with the therapies and without diagnoses of behavioural or conduct disorders. He had an altered electroencephalogram with very frequent left temporal interictal epileptiform activity, with no history of convulsions, and a brain MRI was performed at the age of 9 with normal results.
+
+Cardiovascular evaluation showed no cardiac anomalies, normal blood pressure, normal electrocardiogram, normal Holter rhythm and normal echocardiographic evaluation.
+
+Other studies included mild neutropenia (absolute neutrophil count of 1,470/uL), with study of the V617F variant in the JAK-2 gene for negative myeloproliferative syndrome. Audiometry and impedanciometry without alterations, and normal abdominal echotomy. He was operated on for adenoidectomy at 3 years and 6 months.
+
+From the genetic point of view, he was studied by karyogram with a 46,XY karyotype and the diagnosis of Fragile X Syndrome was ruled out by molecular study with triple PCR (TP-PCR) due to his language delay.
+
+At 9 years of age, he was evaluated by a clinical geneticist and was found to have coarse features, light hair, prominent forehead, narrow temple, prominent and horizontal eyebrows, low-set auricles, enlarged orbital rim, broad and flat nasal bridge, long eyelashes, descending palpebral fissures, deep-set green eyes, bilateral infraorbital crease, full cheeks, anteverted nostrils, cupid shaped upper lip and full lower lip, and prominent upper central incisors. Apart from the facial dysmorphies described, no other dysmorphic features were found on a full physical examination of the patient.
+
+It was studied by WES in the commercial laboratory CENTOGENE through an Illumina platform, and a heterozygous variant in the DNMT3A gene, NM_022552.4:c.2311C > T, p. (Arg771*), located on chromosome 2 at position 25463182 (Reference position rs779626155) according to the GRCh37/hg19 version of the human genome was detected. The detected variant is in a region of adequate coverage and depth by the sequencing reads (> 20x) and was confirmed by Sanger sequencing. The variant generates a premature stop codon and according to the criteria of the American College of Medical Genetics and Genomics (ACMG) was classified as probably pathogenic. This variant has not been previously identified in individuals with STBR, however, it has been described associated with colorectal adenocarcinoma.
+
+Given the sister's history of advanced bone age, overweight and TADH, she was also studied by WES, ruling out the presence of the DNMT3A variant identified in the proband, and no pathogenic variants associated with the described phenotype were identified. The parents of the identified variant could not be studied for segregation, however, neither of them presented alterations in the clinical history or dysmorphies at the physical examination suggestive of disease, both having a history of normal intellectual, anthropometric and pubertal development.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3384_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3384_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..774c7b7c83cd3d8475d34b2169d51f1388c10268
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3384_en.txt
@@ -0,0 +1,30 @@
+Presentation, history, and physical examination on hospital admission
+In March 2014, a 33-year-old Javanese woman presented with dyspnea and palpitations at rest and during the night. The patient denied any recent weight gain, peripheral edema, headache, chest pain, fever, or any other constitutional symptoms. She had suffered from hypertension since the age of 20 years, which had been treated intermittently.
+
+On physical examination, she had dyspnea at rest, was alert, but anxious, and her blood pressure was 170/115 mmHg, with a heart rate of 112 beats per minute, and labored respiration at 32 breaths per minute. During her latest hospitalization, peaks of systolic blood pressure were noted of up to 210 mmHg, with elevated jugular venous pressure. Cardiac examination showed both LV and RV enlargement. Cardiac auscultation detected a fixed split S2 with a loud component and a grade 3/6 ejection systolic murmur which was audible at the upper left sternal border and a diastolic gallop that could be heard at the cardiac apex. The patient had bilateral fine crepitation in the lower zones of the lungs. Abdominal examination showed no organomegaly, no palpable mass, and no abdominal bruits. Neurological examination of the lower limbs showed muscular weakness in both legs with a reduced motor power of 3–4/5. The lower limbs showed symmetric palpable pulses, no pedal edema, and no muscular atrophy.
+
+Past medical history and previous investigations
+In 2002, she had been diagnosed by echocardiography as having an ostium secundum ASD. Hypokalemia was first documented at a regional hospital in 2007 when she suffered from pre-eclampsia during pregnancy. She had been treated with potassium supplements and several antihypertension medications. However, neither satisfactory blood pressure control nor normal serum potassium levels were achieved during follow-up, and the patient began to complain of increasing weakness. The patient reported that among members of her family, only her mother had suffered from hypertension.
+
+In 2008, the patient had initially sought a specialist endocrine consultation at our hospital when her hypokalemia resulted in disabling generalized muscle weakness and intense muscle cramps. On her admission in 2008, the following studies were performed, which confirmed a diagnosis of primary aldosteronism. The supine morning plasma aldosterone concentration (PAC) and plasma renin activity (PRA) were 56 ng/mL (N≤15 ng/mL) and 0.13 ng/mL/hour (N=0.5–3.3 ng/mL/hour), respectively. The PAC to PRA ratio was calculated as 430.7 ng/dL per ng/mL/hour (N≤30 ng/dL per ng/mL/hour). Ultrasound of the abdomen showed a mass (3.4×2.3×2.1 cm) in the right suprarenal area that was confirmed with computed tomography (CT) to be an adrenal tumor. The patient had been referred for adrenalectomy, but she initially declined surgery and preferred to remain on medication. She was discharged home with a blood pressure of 145/90 mmHg and a serum potassium level of 3.2 mmol/L with the medications that included spironolactone, captopril, amlodipine, bisoprolol, and potassium chloride tablets. The patient became lost to follow-up for six years, until March 2014. During the period between 2008 to 2014, she was admitted twice to two separate hospitals for episodes of heart failure.
+
+Investigations on current hospital admission
+On admission of the patient to our hospital in March 2014, preliminary laboratory investigations showed severe hypokalemia (2.2 mmol/L) which was refractory (range, 1.9–2.6 mmol/L) even with repeated potassium supplementation. Urinary potassium excretion was 43 mmol/24 h indicating a renal loss of potassium. The serum magnesium level was normal, while the sodium concentrations were in the high normal limit (143 mmol/L). Serum creatine phosphokinase (CPK) was elevated at 1,257 IU/L, and creatine kinase isoenzyme myocardial band (CKMB) was 221 IU/L. Arterial blood gas analysis showed metabolic alkalosis and ventilation-perfusion mismatch secondary to pulmonary edema. Renal function tests showed normal serum urea and creatinine. Urinalysis showed no proteinuria or myoglobinuria.
+
+Chest X-ray showed cardiomegaly, with a cardiothoracic ratio of 74.3%, and right atrial (RA) and RV enlargement with pulmonary edema. The electrocardiogram (ECG) showed sinus tachycardia with a ventricular rate of 112 beats per minute, left axis deviation, LV hypertrophy with strain, and alteration in ventricular repolarization consistent with hypokalemia with nonspecific ST-T segment depression, and flattened T wave with a prominent U wave. Serum potassium level was 2.1 mmol/L.
+
+Based on initial findings, a diagnosis of acutely decompensated heart failure (ADHF) with hypokalemic myopathy was made, and the patient was immediately treated with oxygen therapy, intravenous isosorbide dinitrate, furosemide, and potassium replacement. Then, a conventional heart failure regimen was begun that included a non-selective β-receptor antagonist and α1-receptor antagonist (carvedilol), an angiotensin converting enzyme (ACE) inhibitor (ramipril), a dihydropyridine calcium antagonist (amlodipine), and an aldosterone receptor antagonist (spironolactone). A serum potassium level was maintained of at least >3 mmol/L with parenteral potassium infusion and tablets.
+
+Transthoracic echocardiography was performed and showed concentric hypertrophy of the LV, with an interventricular septal (IVS) thickness of 14 mm (N=6–9 mm); LV posterior wall thickness in end diastole of 17 mm (N=6–11 mm); LV mass of 473.6 g (N=66–150 g); LV mass index of 284.4 g/m2 (N=43–95 g/m2)); and RV wall thickness of 8 mm in diastole (N≤5 mm). There was four-chamber cardiac dilatation, global ventricular hypokinetic and LV systolic dysfunction, with an ejection fraction of 17% (Teichholz method). A large interatrial septum gap was present with a defect size of 2.4×2.7 cm, with a left-to-right shunt confirming the diagnosis of ostium secundum ASD. The RA and the RV were dilated, and the right ventricular systolic pressure (RVSP) of 60 mmHg indicated moderately severe pulmonary arterial hypertension (PAH).
+
+An abdominal CT scan was performed and compared with the previous scans, and showed an enlarged adrenal mass, from 3.4 cm in diameter in 2008 to approximately 4 cm in diameter in 2014. The tumor was minimally enhanced after contrast injection with low attenuation (+5 Hounsfield units). The absolute washout was calculated as 68%, and the mass was considered as a lipid-poor adenoma.
+
+The investigations of endocrine function showed that her PAC failed to be suppressed after 120 minutes of captopril 50 mg, and the PAC-to-PRA ratio was still elevated further, which confirmed the diagnosis of primary aldosteronism. Other adrenal hormone levels were within normal limits. The diagnoses made at this time were of a right adrenal adenoma and biochemical diagnosis of primary aldosteronism, with acute heart failure, decreased LV systolic dysfunction, hypertensive heart disease, severe hypokalemia, rhabdomyolysis, left-to-right cardiac shunt due to a secundum ASD with moderate pulmonary hypertension (WHO functional class II). On this hospital admission, adrenalectomy was performed as the patient was willing to undergo surgery, and the blood pressure was adequately controlled before surgery.
+
+Surgical management on current hospital admission
+After sufficient pre-operative preparation, the patient underwent open adrenalectomy and exploration of the right adrenal mass via a posterior approach. The resected adrenal gland was a single, well defined and encapsulated yellowish nodule which weighed 27.9 g and measured 4.1×2.6×1.5 cm. Histopathology examination confirmed a diagnosis of a benign adrenocortical adenoma.
+
+Patient follow-up and outpatient management
+The patient made an uncomplicated recovery post-operatively. Immediately after the removal of the tumor, the PAC was found to be reduced to 8 ng/mL, and the PAC-to-PRA ratio dropped to nearly normal levels. Her serum potassium concentration was normalized without any supplementation. Approximately three days after surgery, the patient remained clinically stable and had adequate blood pressure control with ramipril 5 mg qd. Her postoperative biochemistry showed a serum potassium of 4.1 mmol/L and normal CPK and CKMB. The patient was discharged home and showed stable biochemical findings on follow-up outpatient visits.
+
+Repeated echocardiography in September 2015 demonstrated improvement in the LV and RV size. Her LVEF had improved from 17% at presentation to 56% at 18 months after adrenalectomy. Right cardiac catheterization showed a mean right atrial pressure (RAP) of 10 mm Hg, a pulmonary artery pressure (PAP) of 54/29 mmHg (mean 42 mmHg), pulmonary vascular resistance (PVR) of 597 dyn s/cm5, and a mean pulmonary capillary wedge pressure of 11 mmHg. The pulmonary artery blood flow (Qp) relative to systemic blood flow (Qs) was 3.8 (Qp/Qs >1.5). Given the significant ASD, particularly with a high PAP and PVR, she was referred for an open surgical closure of her ASD. However, she refused to undergo cardiac surgery because of financial constraints. At her last visit to the clinic in December 2015, the patient was still on ramipril 5 mg qd and remained symptom-free with a blood pressure of 130/80 mmHg and normal potassium level. Currently, her degree of heart failure is stable. At the time of writing this case report, surgical closure of the ASD remains to be undertaken.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3387_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3387_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6d0b64fa031d8e7c03824d83aa8a6fc8fb021ae6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3387_en.txt
@@ -0,0 +1,9 @@
+A 44-year-old female patient was admitted to our hospital due to “Cognitive decline for 4 years and paroxysmal loss of consciousness with convulsion for 2 months”. Four years before admission, the patient had developed cognitive decline without obvious inducement, easily forgotten the names of her relatives and forgot what to do without headache and dizziness. Two months before admission, she had a temperature of 39.5 ◦C, and developed paroxysmal loss of consciousness with convulsion, mainly manifesting as her eyes turned up, foaming at the mouth, clenched teeth, limb twitching and unconsciousness, lasting approximately 15 minutes. She was unable to recall after the attack. This situation occurred three times. After that, she was easily distracted and could not concentrate on work. She felt depressed easily and her speech slowed, and was found incompetent for her job. Cranial magnetic resonance imaging (MRI) (plain scan) at a local hospital showed no abnormalities. She came to our clinic for further diagnosis and treatment. She had a history of Hashimoto’s thyroiditis and hypothyroidism.
+
+On admission, her neurological examination revealed decreased verbal fluency. Cranial nerve examination was unremarkable. Her muscle strength was normal, and no other remarkable physical findings of nervous system were observed. The Glasgow coma score was normal. Physical examinations of the heart, lungs, and abdomen were unremarkable. She scored 25/30 on the Mini-Mental State Examination (MMSE), 24/30 on the Montreal Cognitive Assessment (MoCA), showing that the patient had mild cognitive impairment. Mild depression (51 points) was found after evaluation with Self-rating Depression Scale (SDS). No anxiety was found after evaluation using the Self-rating Anxiety Scale (SAS).
+
+Auxiliary examinations were performed. Lung computed tomography (CT) revealed chronic inflammation in both lungs. Cranial magnetic resonance imaging (MRI) (plain scan + enhanced) showed no abnormalities. No obvious abnormality was found in cerebral CT vascular enhancement. 24-hours ambulatory electroencephalogram was normal. The result of gynecological and abdominal ultrasound was normal.
+
+Her intracranial pressure was 80 mmH2O. CSF analysis showed normal cell count (total cell 2× 106/ L, nucleated cells 1×106 /L), protein, glucose, chloride, lactate, and adenosine deaminase were within the normal range. Gram staining, fungal smear, acid-fast staining, ink staining, and pathogen culture of CSF were all negative. Cerebrospinal fluid oligoclonal band was negative. CSF and serum samples were collected for examination of AE antibodies, including anti-NMDAR, anti-AMPAR1, anti-AMPAR2, anti-LGI1, anti-CASPR2, anti-GABABR, anti-DPPX, anti-IgLON5, anti-GlyRα1, anti-GABAARα1, anti-GABAARβ3, anti-mGluR5, anti-D2R, anti-Neurexin-3α, anti-GAD65, anti-GABAARγ2 antibody IgG (cell-based assay). The significant findings included a positive anti-GAD65 antibody (titer of 1:32) and positive anti-GABAARγ2 antibody (titer of 1:32) in the CSF, and both were negative in serum. In addition, high levels of homocysteine (16.9μmol/L; normal range:<15μmol/L), total cholesterol (5.57mmol/L; normal range:<5.18mmol/L), high-density lipoprotein (HDL) (1.8 mmol/L; normal range:1.29–1.55mmol/L), low-density lipoprotein (LDL) (3.68mmol/L; normal range: <3.37mmol/L) were presented. High level of thyroid peroxidase antibody (TPO-Ab) (228 IU/mL; normal range: <34 IU/mL) and low level of Vitamin B12 (119.4 pg/mL; normal range: 189–883 pg/mL) were presented. The results of other examinations were unremarkable.
+
+After being diagnosed with AE with coexisting anti-GAD and anti-GABAAR antibodies, the patient was treated with intravenous immunoglobulin (400 mg/kg/d for 5 days), intravenous methylprednisolone (at dose of 1000mg/d, 500mg/d, 250mg/d, 120mg/d, 80mg/d for 3 days respectively) and levetiracetam (0.5g PO bid). Twenty days later, her symptoms, such as cognitive decline, gradually improved during the treatment and no seizures occurred. After treatment for 20 days, she scored 26/30 on the Montreal Cognitive Assessment at discharge. Oral prednisone acetate tablets at dose of 1mg/kg/d, reduced by 5 mg every two weeks, were continued. At her 6-month follow-up, her epileptic seizures disappeared, cognitive function was normal, and speed improved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3389_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3389_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d0a1db4db557d26dc763921620e2836cfacdaef1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3389_en.txt
@@ -0,0 +1,5 @@
+A 53-year-old patient was admitted to the stroke unit with sudden onset of weakness on the left side and dysarthria. The patient was diagnosed with ischemic stroke after CT and hemorrhage was excluded. She had a history of TIA 2 months prior, and the criminal artery was identified by digital subtraction angiography (DSA) as the M1 segment of the middle cerebral artery (MCA) with 80% severe stenosis. She had been treated with dual oral antiplatelet agents and an aggressive dose of atorvastatin for two months before a new ischemic incident.
+
+This patient was administered Alteplase and the NIHSS score (ranging from 0 to 42, with higher scores indicating worse neurologic deficits) declined from 7 to 3, 7 days after admission. When aggressive medical therapy failed, the patient underwent PTAS 2 weeks after stroke. Predilatation was performed with a 2 mm balloon (Neuro RX, Sinomed, China) and stent deployment was accurately performed with a 4×16 mm self-expandable Enterprise 2 VRD stent (Codman Neurovascular, Raynham, Massachusetts, USA), with residual stenosis of about 20%.
+
+The patient was followed up for 2 years after discharge and experienced no cerebrovascular incidents. The patient did not undergo an MRI scan after PTAS. Repeat CTA revealed stent displacement from the MCA to the distal internal carotid artery (ICA).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3394_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3394_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..efbfe0868573404be44bd425191f231844ccf841
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3394_en.txt
@@ -0,0 +1,7 @@
+A 52-year-old patient was admitted to the Cardiology Department for the diagnosis of arrhythmia in the course of the Holt-Oram syndrome. Having a hereditary burden of Holt-Oram syndrome on his father’s side, the patient was diagnosed with the syndrome in early childhood.
+At the time of admission to the hospital, the main problem of the patient was symptomatic bradycardia. So far, he has not been treated for chronic diseases. In childhood, he underwent atrial septal defect (ASD) closure. Despite symptomatic cardiac conduction disturbances, a pacemaker was not implanted in the past due to the patient’s refusal of informed consent for the procedure. The patient was explaining the lack of consent with the fear of worsening heart function caused by ventricular pacing and his father’s history (multiple hospitalizations and device replacements).
+At the time of admission to the hospital, the patient was in good general condition. His blood pressure was 144/83 mmHg. Temperature and oxygen saturation were normal. The heart rate was 41 beats/min. Moreover, a physical examination revealed distortions of the upper limbs and a chest– typical for Holt-Oram syndrome. Abnormal laboratory results included a slightly elevated level of N-terminal prohormone of brain natriuretic peptide (NT-pro-BNP), a slightly decreased level of platelets (PLT), and an ab- normal lipid profile. Electrocardiography (ECG) showed atrial flutter (AFI) and third-degree atrio- ventricular block (complete heart block) with a heart rate of about 40 beats/min. In echocardiography (ECHO), normal systolic left ventricle function with left ventricular ejection fraction (LVEF) about 60%, enlargement of a left ventricle and enlargement of both atria [left ventricular end-diastolic dimension (LVEDd) about 6.1 cm, left atrial dimension (LAD) about 4.9 cm, left atrial area (LAAr) about 53 cm 2 , right atrial area (RAAr) about 54 cm 2] were stated. In the Cardiology Department, Holter’s EKG confirmed AFI and complete heart block. The patient was qualified for the implantation of a pacemaker.
+The computed tomography angiography (CTA) did not reveal new heart malformations, but the radiologist suggested the presence of an abnormal structure in the auricle of the left atrium. Trans- esophageal echocardiography (TEE) did not confirm the presence of a thrombus in the left auricle.
+Based on the CHA 2 DS2 -VASc score, the patient did not get any points, so he was not qualified for anticoagulation therapy.
+During the next hospitalization, it was decided to implant the His-bundle pacemaker (HBP), giving the patient a chance for electrotherapy using the physiological conduction pathway. The implantation was successful, and the patient left the Cardiology Department in good condition. Accurate presentation of the indications for the procedure, as well as its course allowed to obtain informed consent from the patient for implantation of the pacemaker.
+After one year, the man remains in good condition. The pacing was over 90%, and a LVEF was stable (60%).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_340_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_340_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ccbc095ba2459fe5646363b290d900436505ba9f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_340_en.txt
@@ -0,0 +1 @@
+A 60-year-old previously healthy man, with a recent diagnosis of cholelithiasis, was admitted to our hospital with a 24-hour history of high fever, nausea and severe pain in the right hypochondrium. On clinical examination, mild jaundice, abdominal tenderness in the right upper quadrant and a positive Murphy sign were noted. His blood pressure was 110/70 mmHg, his pulse was 130 beats per minute and his temperature was 39.5ºC. He had no leukocytosis but had significant neutrophilia, an elevated C reactive protein level, elevated erythrocyte sedimentation rate and elevated total bilirubin with an elevated direct fraction. An abdominal ultrasound revealed a relaxed gallbladder, with a thickened wall with multiple biliary calculi and biliary mud. Empirical treatment for acute cholecystitis was initiated with piperacillin-tazobactam 4.5 g every 8 hours, which is one of the options in our hospital's protocol for the treatment of biliary tract and gallbladder infections, mainly in very ill patients, and patients turned down for emergency surgery. Three days later, all sets of the blood cultures grew E. cloacae, which was sensitive to empirical antibiotics. In imaging techniques, such as computed tomography and magnetic cholangioresonance, a collection was observed in the anterior subhepatic space, suggesting an abscess. A cholecystectomy was therefore performed, obtaining biliary abscess exudate in which E. cloacae also grew, with the same susceptibility as E. cloacae isolated from blood cultures. The patient's condition had improved after starting antibiotic treatment, even before surgery, and no further bacteremia was detected. Piperacillin-tazobactam was maintained up to 4 weeks in addition to support treatment. The patient had a favorable outcome, leaving hospital 10 days later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_341_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_341_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1ff94736af5be8a80cd56686b630d5c91237f591
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_341_en.txt
@@ -0,0 +1,5 @@
+An 8-year-old female presented to the pediatric haematology-oncology department at the Sun Yat-sen Memorial Hospital for scheduled chemotherapy treatment. The child was diagnosed with acute lymphoblastic leukaemia (Pre-B-ALL, BCR/ABL p190 positive) 2 months ago and the risk stratification was set as high risk.
+The patient commenced the first round of CAM (cyclophosphamide + cytarabine + 6-mercaptopurine) regimen of induction chemotherapy along with oral dasatinib treatment. The child experienced neutropenia and developed a fever (38.5 °C) with occasional cough and pharyngeal discomfort. Chemotherapy was stopped and meropenem was used. Fever repeated with elevated fever peaks. C-reactive protein (CRP) increased to 23.3 mg/dL, while blood and sputum cultures were negative. Computed tomography (CT) scan showed multiple small patchy hyperdense shadows in both lungs with poorly defined borders, mainly in the lower lobes of both lungs . According to the examination results and the agranulocytosis state, teicoplanin combined with trimethoprim-sulfamethoxazole(TMP-SMX) and caspofungin were prescribed. Methylprednisolone (1 mg/kg qd) was also utilised. The patient's temperature did not decrease, and dyspnea gradually developed. The NGS test result indicated a Pneumocystis jirovecii infection, and ticoranine was discontinued.
+The child's dyspnea significantly worsened, and the PaO2 was 59 mmHg (with an oxygen supplementation via mask at 8L/min). She was transferred to the pediatric intensive care unit (PICU) and intubated. Chest X-ray showed large dense shadows in the middle and lower lungs . The Procalcitonin(PCT) was mildly elevated(0.65 ng/ml). The 1,3-beta-D-glucan test (G test) result was positive (634 pg/mL) while the galactomannan test (GM test) result (0.33 μg/L) was negative. EBV, CMV nucleic acid test, as well as blood and sputum cultures were negative. Considering the severity of pneumonia and neutrophil deficiency after chemotherapy, linezolid was commenced for anti-infection treatment, and granulocyte colony-stimulating factor (G-CSF) (5 ug/kg.d) was administered to promote proliferation and differentiation of the bone marrow granulocyte lineage. Subsequently, the neutrophil count and C-reactive protein (CRP) began to rise rapidly .The sputum mNGS test result also showed a Pneumocystis jirovecii infection 2 days later, and the anti-infective regimen remained unchanged.
+The patient's temperature decreased, but a gradually increasing ventilator parameter was required to maintain the oxygen saturation. The oxygenation index (OI) was between 14-and 16, implying the existence of moderate acute respiratory distress syndrome, according to the Pediatric Acute Lung Injury Consensus (PALICC). Inflammatory factor levels were significantly increased: sIL-2R (soluble IL-2 receptor, soluble IL-2 receptor) 5049 U/mL, IL-6 1141 pg/mL, IL-10 70.9 pg/mL, and IL-8 1242 pg/mL . The chest X-ray showed multiple speckled, corn-like dense shadows in both lungs with indistinct borders and lattice-like changes , T-SPOT and serological tests of common respiratory pathogens (Mycoplasma pneumonia, adenovirus, respiratory syncytial virus, parainfluenza virus, influenza virus A, influenza virus B, Legionella type 1–7, coxsackievirus A, coxsackievirus B, echovirus IgM) were negative. Meropenem and linezolid were replaced with amikacin and tigecycline. The peak and the frequency of fever decreased, but the ventilator parameters were still high, with OI values between 10 and 13.
+On the 16th day, the CT scan showed that the patchy hyper-dense shadows were alleviated, but interstitial thickening with grid-like changes and ground-glass opacities appeared in both lungs, suggestive of bilateral interstitial pneumonia . The fibrosis markers significantly increased: collagen type IV (CIV) 140.12 ng/mL, pre-collagen peptide III (PCIII) 151.18 ng/mL, and hyaluronic acid (HA) 1056.81 ng/mL. High-dose methylprednisolone (10 mg/kg.d × 5 d) pulse therapy was given, along with the anti-fibrotic treatment of pirfenidone and acetylcysteine. But the lung function did not improve, and the X-ray showed corn-like high-density shadows in both lungs with unclear borders and grid-like changes . The child's parents opted for withdrawal of medical care, and the girl died after being discharged from the hospital.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_354_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_354_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4b430dd8e92c4c35183e3ca7283a89a4fc743184
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_354_en.txt
@@ -0,0 +1,12 @@
+In august 2018, an 81-year-old caucasian man presented to the emergency department with fever, progressive dyspnea, dry cough and left pleuritic chest pain.
+Patients symptoms started 3 wk ago and worsened progressively.
+His medical history was consistent with chronic lymphocytic leukemia, initially treated in 2007 with Fludarabine, Cyclophosphamide and Rituximab therapy with chronic lymphocytosis, type 2 diabetes mellitus, hypertension, hyperlipidemia and chronic kidney failure with an eGFR of 28 mL/min/1.73 m2. He reported no smoking or alcohol abuse and used to work as an upholsterer.
+None.
+Physical examination revealed fever (38.1°C), tachycardia (105 bpm), peripheral percutaneous oxygen saturation was 100% with 2 liters of oxygen with tachypnea, normal blood pressure and almost abolished left vesicular murmur. Adenopathy, hepatomegaly or splenomegaly were not observed. Cardiovascular and neurologic examination were normal.
+Biology tests revealed neutrophilia (18.7 g/L) and elevated CRP (297 mg/L) consistent with inflammatory response, along with stable lymphocytosis (242 g/L) and anemia (7.8 g/L).
+Chest X-ray at admission showed a large left pleural effusion with contralateral tracheal deviation. Complementary computed tomography confirmed a walled-off, loculated left pleural effusion, with right lung parenchyma considered normal.
+First bedside pleural puncture showed a citrine exudate (pleural protein 37 g/L, pleural fluid protein to serum ratio 0.61), unfortunately cytological examination was not performed.
+Despite intravenous treatment with cefotaxime, the patient condition worsened with persistence of fever, neutrophilia, and severe hypoxemia appeared. Bacteriological standard culture of the pleural liquid sample was negative, as well as repeated blood cultures. In order to look for a tuberculosis etiology, auramine stained sputum smears and cultures were performed but remained negative. Spot-test for tuberculosis was not performed. Ten days after his admission, because of the uncontrolled large pleural effusion with acute hypoxemic respiratory failure, the patient underwent surgical thoracentesis with evacuation of 2 liters of purulent liquid. We chose surgery instead of repeated pleural drawings, because local sepsis was not controlled nor bacteriologically documented. Pleura was thick and nodular, with white pseudo-membranes. Treatment with metronidazole was added to cefotaxime after the surgery in order to cover anaerobic bacteria. Cytobacteriological examination and cultures of the liquid were negative. Lymphocyte phenotyping ruled out B-cell lymphoma as a complication of his chronic lymphocytic leukemia. Three days after, the patient progressively developed multiple organ failure requiring intensive care unit admission. As no massive transfusion was initiated during surgery and shock was the main matter, fluid overload could not explain the evolution in multiple organ failure. After a slow unfavorable evolution during the ten first days of hospitalization, the patient’s condition worse brutaly three days after surgical thoracocentesis leading to septic shock complicated of multiple organ failure. Despite antibiotherapy with cefepime and amikacin, invasive mechanical ventilation, vasopressor infusion and renal replacement therapy, the patient died of uncontrolled septic shock few hours after ICU admission.
+The day after, mycobacterial culture of surgical pleural samples yielded Gram-negative bacilli . Rapid identification using matrix-assisted desorption ionization–time of flight mass spectrometry (MALDI-TOF MS; Microflex LT; Bruker Daltonics, Leipzig, Germany) was performed and L. pneumophila was identified. The bacteria were addressed to the National Reference Center of Legionella and molecular typing analysis by sequence-based typing was performed and showed that the strain of L. pneumophila serogroup 1 belonged to Sequence Type 1. Urinary antigen research retrospectively performed on a urine sample of the patient confirmed the presence of L. pneumophila serogroup 1.
+We believe that chances of super infection or co-infection with another bacterium are scarce. Patient indeed received broad spectrum antibiotics directed against common bacteria causing pleural empyema (including anaerobic bacteria, gram-negative bacillus, streptococci and staphylococci), and repeated standard bacteriological cultures remained negative.
+Retrospectively, our patient presented the following risk factors: Male sex, aged more than 50 years, chronic lymphocytic leukemia with history of immunocompromising treatments, chronic kidney failure, diabetes mellitus and weaned smoking.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_357_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_357_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b4967ba9c88797ea61efb2f821c280943021c390
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_357_en.txt
@@ -0,0 +1,4 @@
+The patient described is a 28-year-old man with a history of hypertension who initially presented to the ophthalmology department with a 2-year history of progressive, bilateral vision loss. Findings on exam included poor visual acuity, bilateral optic atrophy, reduced foveal threshold, and nonspecific inferior defects. Fundoscopic exam at this time revealed optic disc pallor and a cup-to-disc ratio of 0.3 bilaterally. Given these findings, the patient was subsequently referred to the department of neurology for evaluation of possible MS. Brain MRI revealed T2 FLAIR hyperintense lesions involving the body of the corpus callosum and the periventricular white matter without contrast enhancement, suggestive of demyelinating plaques . CSF testing showed normal protein and cells (0 WBC/mm3, 17 RBC/mm3, 33 mg/dL protein, and 66 mg/dL glucose) along with elevated IgG index and 4 CNS specific oligoclonal bands, strongly increasing the suspicion for MS. MRI of the spine showed no additional lesions. Serological testing for MS mimics was largely unrevealing except for serum copper which was marginally low at 66 ug/dl (normal range 72–166 ug/dl).
+Three months after the diagnosis of MS, the patient presented to an outside hospital with a severe right-sided headache and he was referred to our hospital for further evaluation secondary to imaging demonstrating hydrocephalus and intracranial mass. Of note, the patient had not begun treatment for MS at the time of his hospital admission. At time of presentation, the patient was alert and in no apparent distress. The patient characterized the headache as constant for the past month, and worsened in the week before presentation. He denied any vomiting or nausea and his neurological examination was unremarkable. No upper motor neuron findings or visual field deficits were present at the time of examination. Fundoscopic exam showed no relative afferent pupillary defect. MRI of his brain demonstrated an intraventricular mass located in the posterior third ventricle, obstructive hydrocephalus and worsening of corpus callosum and periventricular T2 hyperintense lesions . An endoscopic third ventriculostomy was successfully performed to treat hydrocephalus and a biopsy was taken of the mass for pathological evaluation.
+Two small biopsy specimens were submitted for examination. The tumor contained solid sheets of polygonal cells of moderate size and centrally located nuclei. The cytoplasm was pale in some areas [ and ] but was more eosinophilic in other areas. The nuclei were moderately sized and showed a limited variation in size. Prominent nucleoli were noted in many of the tumor cells [Arrow in and ] and were best appreciated in the cytologic preparation obtained during intraoperative consultation. On immunohistochemistry with Ki67, an average labeling index of about 30% was demonstrated. The tumor cells were positive for OCT3/4 , CD117 (c-kit) , placental alkaline phosphatase, cytokeratin AE1/AE3, and cytokeratin 7. The tumor cells were negative for H3 K27M , glial fibrillary acidic protein, Olig2, IDH1-R132H, synaptophysin, Sox10, Melan-A, CD30, thyroid transcription factor 1, and thyroglobulin. The tumor cells were also positive for BAF47 (INI1) indicating no loss of INI1 gene. A diagnosis of germinoma was made based on these characteristics.
+The patient’s neurologic exam was normal postoperatively and he was discharged home after a 2-day hospital stay. Two months after surgery, the patient was started on carboplatin + etoposide to attempt cytoreduction before radiation therapy to treat intracranial germinoma. Interestingly, brain MRI 4 months after surgery showed resolution of hydrocephalus, periventricular T2 hyperintense changes (thought to possibly be related to trans-ependymal flow initially) and decrease in size of corpus callosum plaques . To rule out paraneoplastic optic neuritis, serum studies were performed and common markers for the disease, anti-CRMP-5, and anti-amphiphysin, were both negative. At the time of this manuscript, the patient had not undergone adjuvant radiation treatment nor started disease modifying treatment for MS as this was held secondary to initial focus on oncologic treatment after discussion among the patient’s treating physicians.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_367_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_367_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d3a2b23fb66f1d27f43b95920cf42e7e50cae62b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_367_en.txt
@@ -0,0 +1,3 @@
+A 44-year-old Japanese woman, gravida 3 para 3, who had undergone cesarean section 2 years previously, presented to our emergency room with a 2-day history of intermittent right flank pain. She had no fever, nausea, vomiting, diarrhea, or cough. She had no history of abdominal trauma, and her past medical history and family history were not significant. She did not have hypertension or cardiovascular disease, and had not taken any anticoagulants. Her bowel and urinary habits were normal, and her menstrual periods were regular. Her last menstrual period had begun 2 days before the onset of right flank pain. On admission, her blood pressure was 115/78 mmHg, pulse 70 beats per minute, body temperature 36°C, and blood oxygen saturation 100%. She was found to be somewhat anemic, with a hemoglobin concentration of 9.8 g/dL and hematocrit of 28.2%. Her white blood cell count was elevated (13,900/mm3), and a urine pregnancy test was negative.
+On physical examination, her abdomen was diffusely tender without muscle guarding. A pelvic examination revealed a small amount of menstrual discharge and a normal uterus and bilateral adnexae. Abdominal ultrasonography demonstrated a large retroperitoneal hematoma surrounding her right kidney . Emergent abdominal and pelvic computed tomography (CT) was performed. Contrast-enhanced dynamic CT revealed a large retroperitoneal hematoma surrounding her right kidney with an enhancing round structure in the center of the hematoma in the arterial phase . Although extravasation in the venous phase was not clear, findings on three-dimensional CT angiography were suggestive of a retroperitoneal hematoma due to rupture of an aneurysm of her right ovarian artery , and no other responsible lesion was seen. A transfemoral angiography was performed for arterial embolization under a clinical diagnosis of bleeding from a right ovarian artery aneurysm. A selective angiogram of her right ovarian artery revealed a tortuous aneurysm near its origin from the aorta without obvious active extravasation . A 2.1-Fr microcatheter (Tangent™; Boston Scientific, USA) was advanced into the orifice of the aneurysm, and 1mL of 16.7% N-butyl-2-cyanoacrylate (NBCA) diluted in iodized oil (Lipiodol®; Guerbet Japan, Tokyo, Japan) was manually injected beyond the distal site of the aneurysm. A postembolization angiogram showed complete occlusion of the vessel . No other aneurysm was found on three-dimensional CT and angiography.
+One day after TAE, CT was performed, which showed that the hematoma had decreased in size, and there was no sign of extravasation. In addition, her hemoglobin and hematocrit were found to have dropped to 7.9 g/dL and 24.1%, respectively. She was administered iron for 4 days, with a subsequent increase in hemoglobin and hematocrit to 8.9g/dL and 25.6%, respectively. No other surgical intervention was needed, and her course after embolization was uneventful. She was discharged on the fifth hospital day, and has remained symptom-free during 3 months of follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_380_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_380_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5a8d36279988962715af3936e6b76f1c420be8af
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_380_en.txt
@@ -0,0 +1 @@
+A 55-year-old woman presented gross haematuria for several days. She had history of storage lower urinary tract symptoms (LUTS) since undergoing quadrantectomy surgery for breast cancer 3 years previously. She referred previous treatment with leuprorelin 3.75 mg/2 ml. She was an ex-smoker with a cigarette consumption of maximum ten a day. She interrupted smoking when she was diagnosed breast cancer. She referred past episodes of haematuria and storage LUTS that she always treated with antibiotics even if urine culture was negative. In April 2020, she came to our ambulatory of urology. She showed us a recent urine culture negative for infections and urinary cytology negative for malignant cells. Cystoscopy was performed, and it demonstrated an extensive whitish plaque area on the fundus, the dome, left emi-trigone, and left bladder wall. It extended near the left ureteric orifice without interesting it . Right orifice was completely spared . The efflux from both the ureteric orifices was normal. The mucosa underneath the plaques was inflamed . Multiple biopsies were performed. A net margin separated sane mucosa from pathological plagues. The histology of the affected area revealed keratinizing squamous metaplasia and focal low grade epithelial dysplasia . With these collected data, the main objective of our case study was to describe individual situation of a woman affected by diffuse leukoplakia of the bladder ostium-sparing with previous treatment with leuprorelin 3.75 mg/2 ml for breast cancer and to show safety of follow-up by cystoscopy and biopsy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_384_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_384_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9a004f7c397c88f37bfcac647aa77726811174a7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_384_en.txt
@@ -0,0 +1,5 @@
+A 79-year-old lady with a background of multiple spinal fractures resulting in chronic back pain, poor mobility and falls, osteoporosis and mild cognitive impairment was admitted to the Queen Elizabeth University Hospital, Glasgow, during August 2015. She was found unconscious in the garden by a neighbour and the paramedics were called to the scene. She was unable to mobilise and had been positioned in the one location unnoticed for a minimum of 2 days. On admission to the local hospital’s Accident and Emergency (A&E) department, the patient was confused, dehydrated, septic and sunburnt. She had abrasions over her thoracic and sacral area with cellulitis. When her trousers were removed, it was noted that a fly flew out. Further investigations revealed maggots embedded in her vagina labia. A fracture to the right neck of her femur, rhabdomyolysis and a urinary tract infection were also noted.
+The maggots, six in total, were removed from the labia using tweezers and sent to the Scottish Parasite Diagnostic and Reference Laboratory (SPDRL), Glasgow Royal Infirmary. On arrival at the SPDRL, the live maggots were killed by immersing in boiling water for 60 s before being submerged in 90 % ethanol. The final segment containing the posterior spiracles of the segmented body was dissected using a sterile blade before being submerged into 5 % potassium hydroxide. This was gently heated to 100 °C for 5 min. Once cooled, the segment was rinsed in distilled water then transferred to a glass slide and examined under both the dissecting microscope and a light microscope using ×10 magnification.
+The second instar larvae showing the spiracles were identified as those from the Protophormia species northern blowfly of the family Calliphoridae .
+The patient’s condition improved after complete removal of the larvae followed by cleansing of the infected area, intravenous fluids and antibiotics. She remained well enough to go to theatre for a dynamic hip screw 10 days post admission.
+The patient was reviewed by the Gynaecology Team 4 days later, and there was no evidence of an ongoing vaginal infestation. The patient was transferred to a local rehabilitation centre and made good progress. She was discharged home late November 2015.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_414_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_414_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..59724a321b98b61d5c314f507cae702996240e66
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_414_en.txt
@@ -0,0 +1,10 @@
+A 58-year-old Hispanic Caucasian man with diabetes mellitus presented to the Emergency Center with a 1-year history of progressive bilateral upper extremity weakness and episodes of orthostatic lightheadedness. He initially noticed weakness in his right-hand grip that gradually progressed over the next 6 to 8 months to involve the left hand and eventually both arms, to the extent that he was unable to hold objects or elevate his arms. He also complained of a tingling and burning sensation in both hands. His family had noticed mild bilateral facial weakness, described as reduced facial expression, without dysphagia or dysarthria. He did not complain of any lower extremity weakness or sensory symptoms. There was no bowel or bladder dysfunction, and he denied any erectile dysfunction. Prior to evaluation, he had been experiencing orthostatic intolerance that worsened to the point that he became non-ambulatory. His family had also noticed cognitive decline over the last year, with frequent forgetfulness and slow thought processing. On systems review, he reported mild xerostomia and xerophthalmia without dysphagia.
+A general physical examination, including cardiovascular, respiratory and abdominal systems, was normal. On initial neurological examination, he was awake, alert and oriented to person, place, time and situation. He had a Montreal Cognitive Assessment (MoCA) score of 16 out of 30, with deficits primarily in the visuospatial, executive and delayed recall domains. On cranial nerve examination, he had preserved pupillary responses, visual fields were full on confrontational testing, and he had normal fundoscopy bilaterally. His extraocular movements were preserved. He had bilateral facial weakness (facial diplegia) and decreased subjective sensation to light touch and pinprick in the left trigeminal nerve distribution. He did not have any hearing impairment and his uvula and palate elevated symmetrically. He did not have any weakness in his sternocleidomastoid, trapezius or tongue muscles. On motor testing, there was decreased tone in his upper extremities, with bilateral shoulder girdle and intrinsic hand muscle atrophy. On confrontational strength testing (based on the six-point Medical Research Council scale), he had normal neck flexion and extension strength. He had near symmetric proximal and distal weakness in the upper extremities, with strength of two to three out of five in all muscle groups tested, slightly worse on his right . His strength was normal in his lower extremities.
+On multimodal sensory examination, he had subjectively decreased sensation to light touch and pinprick in his left radial nerve, left median nerve and right axillary nerve distributions. A sensory examination of his lower extremities was normal. His triceps and patellar reflexes were diminished bilaterally, with preservation of his other myotactic stretch reflexes. His plantar responses were flexor bilaterally, and he did not demonstrate any frontal cortical release signs. Automated blood pressure and heart rate measurements performed at the bedside with postural change demonstrated severe orthostatic hypotension with sympathetic α- and β-adrenergic compromise as follows: supine blood pressure, 142/90mmHg (mean arterial pressure, MAP, 107mmHg) with heart rate 68 beats/minute; sitting blood pressure, 97/64mmHg (MAP 75mmHg) and heart rate 77 beats/minute; standing blood pressure, 65/40mmHg (MAP 48mmHg) and heart rate: 81 beats/minute.
+His elevated serum hemoglobin A1C of 7.9% (normal 4.3 to 6.1%) was consistent with suboptimal diabetes control. He had a normal thyroid function screen and serum vitamin B12 levels. The results of tests for serum rapid plasma reagin, human immunodeficiency virus antibodies and a hepatitis panel were all negative. A screen for systemic vasculitides revealed an elevated anti-SSA antibody titer of 28.4EU/mL (reference range: neg <16EU/mL, equivocal 16 to 20EU/mL, positive >20EU/mL), with a normal anti-SSB titer of 0.3EU/mL (reference range: neg <16EU/mL, equivocal 16 to 20EU/mL, positive >20EU/mL). The results of the following serum or blood tests were negative, non-reactive or normal: anti-nuclear antibodies, anti-neutrophil cytoplasmic antibodies, complement 3 and 4 levels and rheumatoid factor titer.
+Due to his demonstrable cranial nerve deficits associated with his severe brachial diplegia and orthostatic hypotension, an infectious, infiltrative or inflammatory disorder affecting his cranial nerves and cervical nerve roots was considered. Cerebrospinal fluid analysis revealed a normal white cell count of 1/μL (normal 0 to 5), with an elevated protein level of 81mg/dL (normal 15 to 45mg/dL), and glucose of 90mg/dL (normal 50 to 80mg/dL) with serum glucose of 160mg/dL. A mildly elevated immunoglobulin (Ig) G synthesis rate of 3.8mg/day was detected (normal -9.9 to +3.3 mg/day), suggesting increased intrathecal antibody production. Magnetic resonance imaging (MRI) of his brain with and without gadolinium contrast was normal. MRI of his spine revealed mild spinal canal stenosis at C5–C6 due to a small central disc protrusion without cord compression. No changes suggestive of spinal cord or nerve root inflammation were observed.
+Nerve conduction studies (NCS; Table ) suggested a primary axonal neuropathy. Mild conduction velocity slowing or prolonged distal latency, with reduced compound motor action potential amplitudes are consistent with this inference. There was no evidence of conduction block in any of the nerves studied. The normal tibial motor and sural sensory NCS provided evidence supporting the non-length-dependent nature of the patient’s axonal neuropathy. Monopolar needle electromyography revealed moderately severe chronic reinnervation changes in his radial, distal median, distal ulnar and axillary-innervated muscles bilaterally, with ongoing denervation changes in muscles innervated by his left distal median, right radial and bilateral axillary nerves only. Monopolar needle electromyography of cranial nerve VII innervated muscles revealed moderate chronic reinnervation changes bilaterally.
+The electrodiagnostic data was consistent with chronic, moderately severe, axonal mononeuropathies affecting the patient’s radial, median, ulnar, axillary and facial nerves; slightly worse on the left, as seen in mononeuropathy multiplex. There was also evidence of moderately severe chronic reinnervation changes affecting the L2–L4 myotomes on the left, suggestive of subclinical lumbar radiculopathies (explaining his diminished knee reflexes on examination). Secondary chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) is unlikely because the clinical presentation, physical signs with preserved reflexes, were not consistent with CIDP, despite the elevated protein on cerebrospinal fluid (CSF). Moreover, the electrodiagnostic data did not meet the European Federation of Neurological Societies/Peripheral Nerve Society criteria for CIDP.
+He underwent a left superficial radial nerve biopsy that demonstrated a chronic vasculitic neuropathy with ongoing Wallerian degeneration, and severe end-stage axonal loss, as shown in Figure . This was consistent with a diagnosis of vasculitic mononeuropathy multiplex. A salivary gland biopsy (to evaluate for xerostomia) was normal. High-dose intravenous methylprednisolone was administered for 5 days followed by oral prednisone (1mg/kg/day) with strict glycemic control. A liberal salt diet, >2L fluid intake per day, JOBST® waist high compression stockings (to provide 30 to 40mmHg pressure), and fludrocortisone were used to treat the severe orthostatic hypotension. The patient was discharged to a rehabilitation facility for upper extremity physical and occupational therapy.
+At 3-month follow up, the patient reported mild improvement in his upper extremity function, evidenced by interval objective improvement on confrontational strength testing and improved facial expression. There was less orthostasis, with infrequent spells of postural lightheadedness despite non-compliance with compression stockings. The repeat MoCA score was unchanged, with stable deficits in visuospatial, executive function and delayed recall, although the patient and his family had noted a subjective improvement in his cognition. He was subsequently started on azathioprine, which was titrated upwards to a total daily dose of 2mg/kg/day alongside a gradual prednisone wean.
+At 1-year follow up, he demonstrated further improvement in muscle strength with stable cognitive deficits. He had further improvement in orthostatic hypotension, and was continued on fludrocortisone. His glycemic control had worsened with a hemoglobin A1C of 10%, and continued with a dose tapering prednisone regimen in addition to azathioprine. His hemoglobin A1C 1.5 years after hospital discharge was 9.2% on low-dose prednisone and therapeutic azathioprine. He continues to receive specialist endocrinological care for diabetes. His neurological examination at his most recent evaluation was stable, with no appreciable change on confrontational muscle strength testing.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_418_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_418_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f6dfbabe642e0d22e8a52d214ca0f92f9063b5e0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_418_en.txt
@@ -0,0 +1,8 @@
+A 30-year old nulliparous woman presented to her regional hospital with acute right lower quadrant pain. She was otherwise healthy with no significant past medical history. She reported smoking 10–15 cigarettes per day. A pelvic mass was palpated posteriorly and a pelvic ultrasound revealed a right adnexal mass suggestive of an ovarian cyst, with the possibility of torsion due to the patient’s level of discomfort. The patient was taken to the operating room and underwent a laparoscopic right salpingo-oophorectomy.
+The ovarian mass (8.5 x 5.0 x 4.0 cm) was solid and cystic, with cysts containing milky-mucoid material. The solid area had a characteristic red-brown cut surface and a tooth was also identified. Histologic sections showed struma ovarii with limited non-strumal teratomatous elements (i.e. epidermal derivatives). The thyroid-type tissue showed multiple zones of increased cellularity, crowding, and nuclear alteration (enlargement, clearing, grooves, and membrane irregularity) along with scattered mitotic figures . The features were diagnostic of struma-derived papillary thyroid carcinoma. Positive immunohistochemical staining for HBME1, Galectin 3 and CK19 supported the histologic impression. Neither surface involvement nor lymphovascular space invasion was identified.
+The patient was referred to the Gynecology Oncology Cancer Site Team at a tertiary care centre who also involved the care of a thyroid team including Otolaryngology and Radiation Oncology.
+Workup for thyroglobulin, serum TSH, anti-thyroglobulin antibody, and free T4 were performed and were consistent with euthyroid status. Ultrasound of the thyroid showed a mildly enlarged gland with a 1.1 cm solid isoechoic nodule in the upper pole of the right thyroid gland and a 5 mm hypoechoic solid nodule in the interpolar region of the left thyroid gland. Colloid cysts bilaterally measured up to 1.7 cm. An 18 F-FDG PET scan was conducted from skull base to proximal thighs and identified two low-density lesions in the right lobe of the thyroid with otherwise unremarkable uptake throughout the thyroid gland. However, absence of uptake FDG on PET does not exclude thyroid malignancy as most are low-grade differentiated thyroid cancers which are not particularly FDG-avid.
+The combined results of the ultrasound and PET scan prompted referral for an ultrasound guided aspiration biopsy. Cytology results of the fine needle aspiration on right lobe nodule of thyroid were positive for malignancy, consistent with papillary thyroid carcinoma. These findings were discussed with the patient and a recommendation of total thyroidectomy was made. The thyroid was resected without complication.
+The thyroid showed multiple cysts in both lobes and a solid 1.0 cm lesion in the lower pole of the right lobe. The microscopic features were consistent with papillary thyroid carcinoma. Neither lymphovascular space invasion nor extra thyroidal extension was identified.
+The two tumours were interpreted as synchronous independent primaries. The presence of admixed epidermal derivatives in the ovary reflected primary teratomatous origin. The thyroid carcinoma was likewise deemed to be a primary, due to the distinct histomorphology, lack of aggressive features, absence of lymphatic or capsular/surface invasion in either organ, and absence of metastases elsewhere.
+Following thyroidectomy, the patient was seen by Radiation Oncology who recommended I-131 therapy. She was treated on an outpatient basis and received a 100 mCi dose of I-131. The procedure was tolerated well and there were no complications. The follow-up whole body I-131 scan detected no evidence of nodal or distant metastatic disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_423_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_423_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c89aa6b073ae1d6e0a4c83863ab4db4702074249
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_423_en.txt
@@ -0,0 +1,4 @@
+A five-month-old male presented with a nodule in the left corner of the left eye. He was born at 40 weeks’ gestational age, without any abnormality or history of trauma at birth. The lesion was first noted at four months of age. The nodule was 8 millimeters in diameter, tan-orange in color, with central ulceration.
+His parents consulted a maxillofacial surgeon, who took a partial biopsy from the nodule. After the biopsy, the nodule enlarged and became hemorrhagic and the parents brought their child to the Clinic of Dermatology . In mean time the histological evaluation revealed ulcerated cutaneous cellular proliferation, diffuse infiltrates of mononucleated cells, some of which are characterized by their reniform nuclei, foamy histiocytes and numerous Touton giant cells, admixed with eosinophils.
+Immunohistochemistry yielded results immunoreactive for CD68, weak focal positivity for S-100 protein, but negative for Langerin. These results confirmed that the histiocytes are non-Langerhans cells.
+After the diagnosis was made, the child was treated by an ophthalmologist, and examination was within normal limits.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_428_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_428_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c4d0b98a1413cf48400b6c7de7083b128ee7781d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_428_en.txt
@@ -0,0 +1,4 @@
+A previously healthy 3-month-old girl was transferred to our hospital for severe abdominal distention, post-prandial vomiting, obstipation, and anuria for the last 5 days. CT scan done prior to presentation at another hospital showed a cystic abdominal mass displacing the girl’s bowels, bladder globus, and bilateral hydroureteronephrosis (not shown). Her creatinine level was elevated reaching 4.99 mg/dl upon admission. An abdomino-pelvic MRI showed an 8.2*3.7*3.2 cm homogenous cystic multilobulated pelvic mass in the sacrococcygeal area with a 1.5*0.4*0.6 cm dural canal communicating with the mass at the S4-S5 level consistent with an anterior sacral meningocele . To restore kidney function and prevent renal failure, a urinary foley was inserted and was successful in dropping her creatinine levels to normal reaching 0.28 mg/dl the third day.
+Surgical resection was performed on the fifth day with a posterior approach starting with an incision from S3 to the coccyx and a laminectomy to expose the sacral canal. The dural communication was ligated from the rest of the thecal sac followed by cyst cerebrospinal fluid drainage.
+The next day, post-operation echography showed residual cysts in the intra-abdominal cavity. Abdominal laparoscopy was done on the eleventh day to drain the remaining cysts which enabled urinary foley removal and patient’s discharge symptoms free.
+A year later, the child presented back with constipation. A lumbosacral MRI showed a solid lesion of 7.5 cm of height and 6.5 cm of diameter associated with adenopathies . An inguinal lymph node biopsy demonstrated the presence of a yolk sac tumor. Neoadjuvant chemotherapy was started. 3 months later the tumor was resected. On pathology, the tumor was found to be an extragonadal germ cell tumor composed of mature benign glial tissue, endodermal derived tissue bone and cartilage with admixed yolk sac tumor, diagnostic of malignant mixed germ cell tumor .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_446_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_446_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..372e447f19d5037f5b9a17a3a2d7602f1cdad3e7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_446_en.txt
@@ -0,0 +1,3 @@
+A 66-year-old Japanese man presented to a general hospital, where mucosal melanoma of his right maxillary gingiva was confirmed on biopsy. The mass was present in his right maxillary gingiva, and a black lesion was present across a wide extent of his palate . At presentation, magnetic resonance imaging (MRI) revealed a mass of 16×10 mm on his maxillary gingiva . 18F-fluorodeoxyglucose positron emission tomography revealed abnormal accumulation in the tumor . He was diagnosed with T4aN0M0, stage IVA mucosal melanoma of his right maxillary gingiva. Surgery with a safe margin was possible; however, C-ion RT was selected based on postoperative functional and aesthetic considerations and our patient’s preference . A total dose of 57.6 Gy (relative biological effectiveness; RBE) in 16 fractions was administered. Physical dose calculations were performed using the pencil beam algorithm. The clinical dose distribution was calculated according to the physical dose and the RBE. The dose of C-ion RT was expressed as “Gy (RBE)”: physical C-ion dose (Gy)×RBE. He was positioned in customized cradles (Moldcare, Alcare, Tokyo, Japan) and immobilized using a thermoplastic shell (Shellfitter, Kuraray, Osaka, Japan). A customized mouthpiece was used to fix the teeth of both his jaws and to maintain the position of his lower jaw. Computed tomography (CT) images with a 2-mm thickness were acquired for treatment planning, which used MRI as a reference. A margin of at least 5 mm was added to the gross tumor volume (GTV) to define the clinical target volume (CTV). CTV1 included the whole of each anatomical site (gum, palate, and maxillary sinus), while CTV2 was limited to the GTV and mucosal melanosis. Planning target volume (PTV) 1 and PTV2 had margins of 2 mm added around CTV1 and CTV2, respectively. PTV1 was irradiated initially with 32.4 Gy (RBE)/9 fractions, and thereafter; PTV2 was irradiated to a total dose of 57.6 Gy (RBE)/16 fractions. Organs at risk (OARs; the eye, optic nerve, optic chiasm, inner ear, brain stem, spinal cord, mandible, palate, and tongue) were outlined on the planning CT scan for treatment planning and dose-volume histogram analysis. Treatment planning was performed using a XiO-N system (Elekta AB, Stockholm, Sweden). The composite dose distribution is shown in Fig. .
+Acute radiation mucositis at his palate and acute radiation dermatitis were observed, both of which were classified as grade 2 based on the Common Terminology Criteria for Adverse Events (CTCAE), version 4.0 . His mucositis and dermatitis resolved 1 month after C-ion RT treatment. Three-course concomitant chemotherapy (Day 1, 120 mg/m2 dacarbazine, 70 mg/m2 nimustine, and 0.7 mg/m2 vincristine; Day 2 to 5, 120 mg/m2 dacarbazine) with a 4-week interval was administered, with the first course administered at C-ion RT initiation, the second course at C-ion RT completion, and the third course 4 weeks after the second course.
+Our patient did not experience any chronic adverse events, and a complete disease response was apparent 35 months after the C-ion RT without any signs of recurrence . There were no other adverse events such as dysgeusia, xerostomia, radio-osteonecrosis, or the loss of a tooth.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_447_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_447_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0f924593174aca00d048b9fd1d75e82b2fa580c3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_447_en.txt
@@ -0,0 +1 @@
+A 75-year-old man presented with fever and right chest pain. The blood biochemical tests showed the following: lactate dehydrogenase (LDH), 251 IU/L; alkaline phosphatase (ALP), 469 IU/L; gamma-glutamyl transferase (γ-GTP), 125 IU/L; creatinine (Cre) 1.43 mg/dL; C-reactive protein (CRP) 3.04 mg/dL; squamous cell carcinoma-related antigen (SCC), 1.8 ng/mL; nerve specific enolase (NSE), 21.6 ng/mL; soluble interleukin-2 receptor (SIL-2R), 614 U/mL. Computed tomography (CT) showed a huge 10-cm mass under the right diaphragm . This well-circumscribed and smooth-marginated tumor showed minor enhancement in the lower density areas close to the fat and showed a gradual, heterogeneous mild enhancement of tumor and liver margins. The main feeder for the tumor is the right inferior phrenic artery, and this tumor was supposed to be a sarcomatoid malignancy originating from the diaphragm rather than a benign disease such as schwannoma on CT. No findings were suggesting obvious pulmonary invasion. Magnetic resonance imaging (MRI) demonstrated heterogeneous high signal intensity on T2-weighted images (T2WI) and diffusion-weighted images (DWI) . Contrast-enhanced MRI showed gradual heterogeneous enhancement similar to CT findings. Findings of extrahepatic development were also obtained, but the possibility of adhesion to the liver was suspected. Fluorodeoxyglucose-positron emission tomography (FDG-PET) revealed abnormal uptake in the tumor with a maximal standardized uptake value (SUVmax) of 4.6 . The uptake was not so high, and a myxoid type sarcoma, such as myxoid liposarcoma, or benign tumor was considered. Although a definitive diagnosis could not be achieved, we scheduled a diaphragmatic resection for suspicion of benign tumors of the diaphragm, such as mucous-type sarcoma or schwannoma. However, we performed extended right posterior segmentectomy with combined resection of the diaphragm, because separation of the tumor from the liver was not possible and the tumor was close to the posterior Glisson’s pedicles and segment 8 dorsal Glisson’s pedicles . The total operation time was 8 h 10 m, and the total blood loss was 1459 mL. Although the major diameter of the diaphragmatic defect was 12 cm, simple closure was possible . The patient’s postoperative course was uneventful, and he was discharged 14 days after surgery. Pathological findings showed that the mass was located just below the hepatic capsule/intraparenchymal space and was adherent to the diaphragm, but there was no continuity with the diaphragm . Mitosis was unremarkable, about 0–1 cells/10 HPF. The morphology suggested low-grade mesenchymal tumors such as solitary fibrous tumor (SFT) and perivascular epithelioid cell tumor (PEComa) , but immunostaining was negative for these tumors, making the diagnosis difficult . We diagnosed the tumor as a spindle cell tumor with smooth muscle differentiation because of the positive results of myosin markers such as αSMA, desmin, and h-caldesmon, although some areas with high proliferative activity were observed. 1 year has passed since the surgery with no recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_449_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_449_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2634c0ffb3896e8a00a6f65f6f4579b410405a6d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_449_en.txt
@@ -0,0 +1,6 @@
+A 23-year-old, nulliparous, Chinese woman at 35 weeks gestation, was admitted to the hospital complaining of hematuria accompanied by severe pain in the left abdomen and left subcostal area. She had no past history of urological difficulties until week 26 of pregnancy when she was diagnosed with a spontaneous renal rupture resulting in acute left loin pain and hematuria. She denied any accident or renal problems at that time. Magnetic resonance imaging (MRI) confirmed the diagnosis , and that the fluid around the ruptured left kidney had spread from the superior margin of the 10th thoracic vertebral body to the inferior margin of the second lumbar vertebral body. The patient was admitted to the hospital for observation. The hematuria resolved the day following admission, and she was discharged 1 week after admission when the loin pain decreased and her hemodynamic status was stabilized.
+At 34 weeks gestation, she presented at the urology clinic with a growing mass in the left subcostal area. Ultrasound showed right renal hydronephrosis without hydroureter. In addition, a cyst was noted to surround the left kidney, and this was measured as 250 × 170 × 233 mm. The cyst was located under the left renal capsule, and the margins were 100 mm from the upper pole, and 60 mm from the lower pole of the left kidney. The medial margin of the cyst was 70 mm away from the medial edge of the left kidney, and 103 mm away from the lateral edge. It was suspected that she had a subcapsular hematoma following renal rupture. At the time, she was more than 33 weeks pregnant, and her laboratory values were normal for kidney function, hematocrit and hemoglobin. She declined further testing of the mass because she was concerned about the side effects on the fetus.
+The patient came to the Obstetric Department requesting a cesarean section when she was 35 weeks pregnant because she could not bear the severe pain of the increasingly swollen left subcostal mass. She denied nausea, shortness of breath, fever or chills, and there was no vaginal bleeding or uterine contractions. After she was admitted to the obstetrics ward, the fetal heart non-stress test was determined to be reactive. The fetal bi-parietal diameter (BPD) measured by ultrasound was 86 mm, and femoral length. (FL) was 66 mm, which were both consistent with the gestational age. The amniotic fluid index was 95 mm and umbilical arterial S/D was 2.5. The biophysical profile score was 8. Additionally, ultrasound demonstrated signs of maternal hydronephrosis accompanied by a much larger cyst surrounding the left kidney than that observed in the previous ultrasound. Over the past few weeks, this sub-capsular cyst had increased to a size of 319 × 175 × 250 mm.
+Physical examination revealed the gravid uterus, and obvious swelling over the left abdominal region. A large firm mass with undefined boundary was palpable over the left lumbar region extending to the side of uterus. The left flank and subcostal area had notable tenderness with significant hyperesthesia of the overlying skin. Laboratory evaluation demonstrated a normal white blood cell count and hemoglobin. The urinalysis and kidney function values showed no abnormalities.
+The patient was known to have had a spontaneous renal rupture and a growing mass in the left subcostal area at week 26 of gestation. The first diagnosis was hematoma or abscess surrounding the left kidney. Because her hemodynamic status was stable without anemia or fever for more than 2 months after the renal rupture, she had been followed using repeat urine analyses, which showed no hematuria. The urologist diagnosed her current condition as perirenal urine extravasation, and it was decided to place a percutaneous nephrostomy tube (PCN) before delivery or during the surgery.
+The patient requested Cesarean section because the gestational age was 35 weeks, and due to concerns about the progression of the subcostal mass, the surgery was performed. The patient agreed to receive the PCN placement along with the Cesarean section. A male newborn weighing 2580 g with an Apgar score 10/10 at 1 and 5 min was delivered. Following completion of the Cesarean section, the patient’s upper abdominal cavity was explored, and, on the left side, a large retroperitoneal bulging mass was noted with an estimated size of 300 × 200 × 300 mm. The consulting urologist suctioned 5 ml of light yellow fluid from the mass and the sample was sent for creatinine determination. The creatinine level of the sample was 2100 μmol/L and similar to the level in the patient’s urine. A left urinoma as a result of spontaneous renal rupture was then diagnosed, and a total of 4 L of fluid was drained via the PCN. PCN was left in the urinoma to allow for further drainage of urine. After 3 days, a computer tomography (CT) scan was performed to assess the effect of draining the urinoma. The CT revealed that the PCN was properly placed in the cyst, and that the urinoma had decreased in size. The patient was discharged 1 week after the surgery with the PCN in place. She was closely followed by a urologist, and the nephrostomy tube was to be removed when there was no further drainage. Two months postpartum, the CT scan showed the cyst had diminished in size to 50 mm . Six months later, an ultrasound scan was performed and revealed that no perirenal extravasation was present. The urine analysis and renal function tests at that time were normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_457_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_457_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..36d7e79f204f061412bb48487820bf8af8fb889d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_457_en.txt
@@ -0,0 +1,5 @@
+A patient, 35-year-old female, came to our clinic because of severe vertigo and paroxysmal headaches for about 2 years. She mostly suffered from vertigo at night with multiple vomiting spells and bilateral tinnitus, which would last the entire night. During the period of vertigo, she also had a headache at the right temporal site, which was present a kind of pulsatile pain and could last several hours; this caused nausea and the inability to fall asleep. Prior to the onset of the vertigo and headache, she also had a visual aura with wave sight that lasted 10 min. Approximately 10 of these attacks were trigged by loud noises or bright lights, accompanied with symptoms such as chest tightness, tachypnea, and blushing. The migraine attacks were mostly accompanied by vertigo, becoming more severe during vestibular episodes. Those symptoms continued to worsen over the next week from the initial onset. During this time, the patient suffered from vertigo for several hours daily, and also suffered from repeated vomiting, numbness on the right side of the face, and tinnitus in the ear. The attacks of vertigo had no connection to changing body position. The headache occurred on the right side with visual aura expressing as fortification spectrum during vertigo. Physical examination found dysesthesia around the right side of the forehead and unsteady gait.
+The patient’s clinical history revealed a more frequent occurrence of migraines during the period of pregnancy. The headache was usually a throbbing, unilateral temporal pain for 20 min each time. It would result in nausea and vomiting, which led to functional limitation in daily activities and led to bed rest to alleviate her symptoms. Meanwhile, the patient also had a visual aura with waves of light that lasting approximately 10 min. She had no family history regarding her illness, history of drug use, allergy, smoking, or drinking.
+A neurological examination showed clockwise rotary nystagmus when she gazed to the left side, and an abnormal finger-to-nose test at the right side. The patient had normal muscle tone and muscle strength, and no appearance of the Babinski Sign. Vestibular system tests including Dix-hallpike, Roll-test as well as a head thrust test were all negative as well.
+Laboratory test showed the HbA1C was 5.1%, and plasma homocysteine was 9.5 μmol/L. The autoimmune antibodies including pANCA、cANCA(−)、MPO、PR3、ENA、ACA-IgA、ACA-IgG、ACA-IgM、ANA、ds-DNA、DNP were negative except for the AECA(++). Thrombophilia markers were also tested, including protein C activity (130%)、von Willebrand factor activity (109%) 、free protein S activity (76%) as well as antithrombin III activity (109%). Other tumor markers regarding lung cancer and colon carcinoma were all negative and thyroid gland function was also normal. The routine test of cerebrospinal fluid (CSF) was normal, while the aquaporin (AQP) 4 antibodies were negative in both plasma and CSF.
+The electro-audiometry test revealed a mild hearing impairment in the right ear. Other Neuro-electrophysiology tests, including brainstem auditory evoked potential (BAEP)、visual evoked potential (VEP)、electromyogram (EMG) as well as nerve conductive velocity (NCV) were all normal. The cardiac and carotid ultrasound exams were both negative. The diffusive weighted imaging showed subacute infarction in the right lateral medullar on January 8th . The digital subtraction cerebral angiography (DSA) indicated a left intracranial aneurysm on the next day . The infarction and intracranial aneurysm were located on separate sides of the brain, which suggested that the Wallenberg syndrome might not be caused by the intracranial aneurysm. DSA imaging showed that the communicating artery between anterior and posterior circulation of cerebral arteries was not open, and ipsilateral posterior inferior cerebella artery could be seen clearly . We administrated antiplatelet treatment as well as Flunarizine immediately. The patient’s vertigo symptoms diminished just in a few days, with the patient being discharged three weeks later with oral medication, including Betahistine Mesilate 6 mg tid, Dihydroergotoxine 2.5 mg bid, Aspirin 100 mg qd and Flunarizine 5 mg qn. At the patient’s 3-month follow-up, she said she had only once been affected by vertigo and the migraines were less common and less intense than she was previously experiencing.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_469_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_469_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..68e5d920a6be9ae694616946ad4e714a3f1db006
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_469_en.txt
@@ -0,0 +1,12 @@
+A 70-year-old married Caucasian woman was admitted to our department following a suicide attempt by benzodiazepine ingestion, as a consequence of repeated conflicts with her husband. The patient revealed her persistent online communication and romantic involvement with a world-renowned musician in his thirties, a relationship spanning more than a year since her husband gifted her a smartphone.
+The patient’s involvement began innocently, expressing admiration for the musician’s work through positive comments on various profiles featuring his art. Over time, the patient’s feelings intensified, perceiving the musician as talented, elegant, and sexually attractive. She persuaded her husband to attend the musician’s live concert, hoping for a personal encounter. Subsequently, she engaged in frequent, confidential chats on profiles using the musician’s image, receiving positive and encouraging messages. The conversations became increasingly personal, with the patient divulging significant amounts of information.
+The patient received messages praising her extensively, creating a deep affection that she felt rejuvenated her life. This emotional involvement prompted her to enhance her appearance using cosmetics and undergo weight loss through dieting. To substantiate her claims, she asserted that the “musician’s secretary” once called her, arranging a telephone conversation during which he professed his love. The patient disclosed her feelings to her husband, who initially dismissed them.
+As the online relationship deepened, the patient began receiving requests for significant sums of money, citing various reasons such as charitable causes or covering their phone bills. This led to escalating conflicts within the marriage, with the husband struggling to accept the contradictions of the perceived “love relationship” and expressing concerns about its dangers. The husband filed a police report without the patient’s knowledge, resulting in the cessation of fraudulent profiles. However, the fraudster resumed communication on a new profile, prompting the husband to transfer money in an attempt to stop the claims.
+Despite these efforts, the fraudster held additional requests, intensifying her marital discord. The patient, fearing the loss of her “love,” became increasingly distressed. She accused her husband of obstructing her relationship, leading to threats of suicide. When her husband failed to respond, she ingested 30 tablets of 0.5 mg alprazolam.
+The patient, a retired cook, resides with her husband and reported feeling neglected by her family throughout her life. Her childhood and adolescence were uneventful, but she perceived familial neglect, exacerbated by her mother’s depression and dementia. Marrying a military officer at 17, her husband became her sole relationship. Over the past three decades, cumulative organ diseases have contributed to a depressive mood, decreased work capacity, and heightened isolation. Despite residing near her son and grandchildren, loneliness persisted due to infrequent visits, and her husband’s social engagement.
+The medical history included bilateral deep vein thrombosis, diabetes mellitus with polyneuropathy, hypercholesterolemia, spondylosis, lumbar spondylarthrosis, osteoporosis, lumboischialgia, vertebrobasilar syndrome, and tinnitus. She took 50 mg of sertraline and 0.25 mg of alprazolam daily for dysthymia and anxiety, maintaining a compensated psychiatric status since the age of 55. No prior psychotic symptoms were noted.
+Physical examination revealed moderate obesity, sensory disturbances associated with polyneuropathy in the lower limbs, mild cognitive impairment, poor thinking, depressed mood, emotional lability, slowed psychomotor activity, erotomanic delusions and suicidal thoughts. The patient reported loss of appetite and sleep disturbances.
+Initial laboratory tests revealed elevated serum benzodiazepine levels and slightly increased hemoglobin A1C, cholesterol, and LDL-cholesterol values. Brain Magnetic Resonance Imaging (MRI) confirmed microvascular lesions (Fazekas I. stage).
+After addressing benzodiazepine intoxication and improving affective symptoms, psychological tests (Minnesota Multiphasic Personality Inventory (MMPI), Structured Clinical Interview for DSM-5 - Personality Disorders (SCID-5-PD)) indicated a characteropathic mode of functioning with A- and C-cluster traits, psychotic and organic symptoms, limiting the perception of reality, insight, and judgment skills. Patient scored 27/30 points on the Mini Mental State Examination (MMSE) test and had 71/100 points on the Addenbrooke’s Cognitive Examination III (ACE-III) test.
+Examinations revealed a diagnosis of mild cognitive impairment, delusional disorder of the erotomanic subtype, and organic affective disorder with a cerebral vascular background. We consider this case as an online romance fraud induced, secondary erotomania, on the basis of another psychiatric and organic disorder.
+Treatment involved previous antidepressant medication (sertraline 50 mg/day) in combination with low-dose risperidone (2 mg/day), alongside supportive individual and group therapy. Despite the treating physician and psychologist presenting the patient with harsh facts, initially she remained ambivalent, and her erotomanic content persisted. After establishing an empathetic, accepting, and supportive relationship, we addressed emotional background, marital conflict, and previous negative events. Cognitive-behavioral therapy focused on processing the double-disappointment (deception and emotional loss) experience, while gradual feedback aimed to strengthen her insight into the unrealistic elements of the online “love relationship.” Couple-counseling resolved marital crises, leading to a more balanced relationship. Four weeks into treatment, dysthymia and anxiety resolved, psychotic symptoms improved, and the patient partially realized the fraud. Continuing psychopharmacological and supportive treatment on an outpatient basis was recommended.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_472_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_472_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b11c8acad955ec4a47549cac8a483ec98fa4e5b1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_472_en.txt
@@ -0,0 +1 @@
+S.F., A 47-year-old nonsmoker woman transferred to the hospital via ambulance and was afterwards admitted for the assessment of chronic and persistent pain in the right foot for a three-months duration associated with significant numbness on the same side. after that, the patient started to complain of acute-onset sever lower back and pelvic pain. She asserted never suffering pain similar to this before. The patient reported no personal and/or family history of cancer, any acute, repeat, or discontinued medications, any allergies, any genetic or psychosocial issues, and had a free past surgical history. physical examination was unremarkable except for lower back tenderness radiated to both lower limbs and marked lower limb weakness with estimated power tone of 2/5 on the right foot. Neurovascular assessment was insignificant. The patient initially underwent spinal computed tomography (CT) without contrast which revealed multiple enhancing metastatic lesions throughout the spine, the most significant lesions are in the thoracic area, particularly at the level of T8-T10 vertebral bodies and mild pathological compression fractures of T4, T5, T9, T10, T11 and L5 associated with a large anterior paraspinal soft tissue component at the same level ( A, B & C). Whole body computed tomography (CT) with intravenous contrast was performed and showed several mixed lytic and sclerotic lesions in the spinal, sternal, and pelvic bones associated with soft tissue component, the largest one seen at the level of T10. CT scan also detected a nodule measuring about 8 mm in right lower lung lobe ( A, B & C). MRI of right foot demonstrated heterogenous, ill defined, lobulated intra muscular mass measuring approximately 3 x 1.7 × 1.3 cm at the planter aspect of the right foot with irregular peripheral post-contrast enhancement ( A, B, C & D). These findings were suggestive of extraskeletal Ewing Sarcoma and to confirm the diagnosis, Excisional biopsy of right foot lesion was taken and showed marked tumor necrosis with numerous mitotic and apoptotic figures. The tumor cells were arranged in an unusual trabecular pattern with rare pseudorosettes (neuroectodermal differentiation) and immunopositivity for CD99 (diffuse-membranous), FLI-1 (nuclear-strong), anti NKx-2.2, Synaptophysin (weak), CD56 (weak), and CKAE1/AE3 (weak-focal) ( A, B, C & D). The diagnosis of extraskeletal Ewing sarcoma of right foot was established. Intravenous oxycodone was administrated to relive patient's sever pain. The patient initially underwent thoraco-lumber pathological fractures fixation with fusion from T2-L1 level, total surgical resection of the foot mass. The procedure was performed by a consultant at spine surgery and spinal deformities department at a private hospital. The patient was started a chemotherapy regimen consisting of carboplatin and paclitaxel weekly. The patient was followed up for 2 months and She adhered to and tolerated the provided advices; avoiding vigorous exercise and heavy lifting. The patient also had a good tolerance of chemotherapy and pharmacological agents without any reported complications or adverse events.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_49_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_49_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..14e32617cacb9606f33c2e7dd15ca29b88b8d6a8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_49_en.txt
@@ -0,0 +1,7 @@
+The patient is a 66-year-old white male with a past medical history of a traumatic brain injury with left-sided hemiplegia since childhood, hypertension, leukemia in remission since 2005, and bilateral renal artery stenosis.
+The first time the patient presented to the hospital on day one complaining of generalized weakness and malaise of one week duration. Physical exam was significant for right second toe ulcer with mild erythema and purulence. He had tachycardia on presentation. Laboratory values were significant for white blood cells (WBCs) count of 24.0 and C-reactive protein (CRP) of 13.4. The patient was admitted for infected right second toe with concerns of sepsis. He was treated empirically with intravenous vancomycin and piperacillin-tazobactam. Blood cultures from day two grew methicillin-susceptible Staphylococcus aureus (MSSA) and the patient was switched to intravenous nafcillin 2 g every four hours (12g/day) on day three. Repeat blood cultures on day three grew methicillin-susceptible Staphylococcus aureus (MSSA) and cultures on day seven had no growth. Nafcillin was continued for two weeks following the first negative blood culture. He was discharged to a nursing facility on day 12. He completed 18 days of IV nafcillin on day 21 of his illness.
+The patient was re-admitted from the nursing facility on day 20 for a large bloody bowel movement and completed IV nafcillin in the first two days of his second admission. He was worked up appropriately for lower GI bleeding with colonoscopy findings of diverticulosis and recovered with minimal intervention. A liver panel on day 21 was unremarkable: total bilirubin 0.7 mg/dl, alkaline phosphatase (ALK) 60 IU/L, aspartate aminotransferase (AST) 21 U/L, alanine aminotransferase (ALT) 25 U/L.
+He was re-admitted for the third time on day 30 of his illness from the nursing home (27 days after IV nafcillin was started and nine days after completion of IV nafcillin) for painless jaundice. Upon re-admission, his labs were remarkable for a cholestasis pattern of liver injury with total bilirubin 6.3 mg/dl (5.6 direct, 0.7 indirect), ALK 506 IU/L, AST 206 U/L, ALT 415 U/L .
+At that time his home medications with potential hepatotoxicity including atorvastatin and doxazosin were held. An ultrasound of the liver and biliary tract showed hepatomegaly with normal liver echogenicity, no mass or fluid collection, patent portal and hepatic veins. It also showed cholelithiasis without sonographic signs of cholecystitis, no intrahepatic or extrahepatic biliary ductal dilation. Further workup for infectious causes of liver injury including viral hepatitis panel for hepatitis A, B, C was negative (hepatitis A IgM antibody, hepatitis C antibody, hepatitis B surface antigen, hepatitis B surface and core antibodies all were non-reactive). A serology panel for autoimmune disorders associated with possible liver injury revealed the patient to be negative for anti-nuclear, anti-mitochondrial, anti-smooth muscle, and anti-centromere antibodies. The patient was coronavirus disease 2019 (COVID-19) negative. He does not drink alcohol, smoke cigarettes, or use any recreational drugs. The remainder of the workup was done to exclude alternative liver pathologies. Serum copper and ceruloplasmin, Epstein-Barr virus (EBV) serology, alpha-1-antitripsin all were negative or unremarkable. Magnetic resonance cholangiopancreatography (MRCP) demonstrated cholelithiasis without choledocholithiasis or bile duct dilation. A percutaneous liver biopsy was obtained on day 30 which demonstrated acute necro-inflammatory liver disease suspicious for drug-induced liver injury .
+Endoscopic retrograde cholangiopancreatography (ERCP) done on day 33 showed a small amount of biliary sludge that was evacuated after a stent placed in the common bile duct - there was no obstruction or inflammatory changes. A review of prior labs from his previous admission was significant for elevated eosinophil percent on day 25 with 11.7% (normal 1-8%), absolute eosinophil count of 1100 (upper limit of normal is 700) .
+After admission, his liver enzymes continued to worsen, with total bilirubin peaked on day 34 with 8.2 mg/dl (7.0 direct, 1.2 indirect), ALK peaked on day 40 with 865 IU/L, AST and ALT both peaked on day 30 with 206 U/L, 415 U/L, respectively . After ERCP, his liver function tests continued to worsen; the first day total bilirubin started to drop (day 37) was four days after ERCP was done. Throughout his hospital stay, the patient was monitored for signs of encephalopathy including asterixis and mental status changes, which he showed none. In addition to that, international normalized ratio (INR)/prothrombin time test (PT) was monitored daily for coagulopathy but his INR/PT remained within normal limits during his hospitalization. His liver panel steadily declined while he remained in the hospital with supportive treatment only. At time of discharge on day 42, liver lab values were total bilirubin 3.0 mg/dl, ALK 710 IU/L, AST 56 U/L, ALT 164 U/L . See Table for normal laboratory reference ranges.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_504_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_504_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b87d5d45474004534bd205fa789eed8c75855ff8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_504_en.txt
@@ -0,0 +1,5 @@
+A 18-year-old male presented to orthopedics clinic with complaint of lower back pain without any lower limb pain from past 6 months which was spontaneous in onset after trivial fall, increased with activity, and relieved by rest and analgesics, no diurnal and postural variation was observed. On examination, the patient was having muscular spasm of paravertebral muscle with reduced range of motion at lumbar spine noted. We did not observe any kind of neurological involvement in the patient. Chances of thecal sac compression are rare in these patients unless any concomitant disc disease. He had no visual deformity in spine, and no obvious swelling.
+We evaluated the patient further with radiological imaging and blood investigations. On digital X-ray of lumbosacral spine which showed irregularity in superior end plate of L3 vertebrae with decreased lordosis in lumbar region. MRI of lumbosacral spine showed anterior wedging in L3 vertebral body, erosion of superior end plate of L3 vertebra, narrow disk space of L3–L4, and schomrl nodes in L3 vertebrae .
+Blood parameters CBC, ESR, and CRP were within normal limits which exclude any infective or inflammatory etiology. On basis of all above findings, it was suggestive of atypical Scheuermann disease (type IIa) which involves only one vertebra. This disease is divided into two types:
+Typical Scheuermann disease (type I): It involves three or more than three thoracic vertebrae which causes kyphotic deformity in dorsal spine. Adolescents have more chances of this type Atypical Scheuermann disease (type Iia): It involves one or two vertebrae of dorsolumbar or lumbar segment, disk space narrowing, and anterior schmorl nodes. It is seen less commonly Acute traumatic intraosseous disk herniation (type Iib): It consists history of acute vertical compression injury resulting in severe back pain and evidence of end plate fracture (anterior schmorl nodes).
+The patient was explained about the disease and treated conservatively with anti-inflammatory medication and physical therapy. Indications for surgery include progression of deformity, cosmesis, severe pain and rarely, cardiopulmonary or neurological compromise.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_506_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_506_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..83064608861d0c90bcd0bfb7be3444cb5e128c9d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_506_en.txt
@@ -0,0 +1,6 @@
+A 43-year-old previously healthy man, a physician, living in a city of about 150,000 inhabitants, began to use a lightweight motorbike to commute to work, a distance of about 10 km, in heavy traffic in the middle of August 2006. He had previously been travelling in a car fitted with an air pollution filter, and had experienced no previous heart symptoms. He also walked or jogged about 6 km four to five times a week with no problems and was not on any medication. He felt relaxed and did not experience stress while riding the motorbike in heavy traffic. There were numerous traffic lights on his journey to work, which meant that he was forced to stop behind buses and trucks on several occasions where he experienced a strong smell of exhaust fumes.
+After commuting to and from work by motorbike for about 2 weeks he began experiencing cardiac extrasystoles, something not previously experienced; on one occasion he was unable to sleep due to palpitations. He sought help and had an electrocardiogram (ECG) the following morning, which showed PVCs in bigeminy. The patient had also sinus tachycardia with a heart rate of about 110 beats per minute.
+The patient was admitted to the cardiac intensive care unit and was examined using echocardiography, which was found to be normal, and there were no signs of false tendons. No ischaemia was seen on ECG and there were no signs of infarction. The frequency of PVCs began to decrease about 8 hours after admission. Blood tests showed no indications of infarction or infection, his blood glucose was normal and his lipid status and thyroid status were within normal limits. The patient had no fever. During the night and the next morning only a few PVCs and some premature atrial complexes were observed and the patient was discharged home. The diagnosis was given as myocarditis, although this diagnosis was uncertain.
+The patient rested for 2 weeks with no further symptoms before returning to work. For the first few weeks he drove his car to work, but then began to use his motorbike again. Having used it for a few weeks on the same route he again began to experience extrasystoles and therefore contacted his physician, who recommended an exercise test and Holter ECG.
+In the few days before the Holter ECG was applied the patient refrained from using his motorbike and began to feel better. Only a few PVCs and premature atrial complexes were found during 24 hours of Holter monitoring. The heart rate variability (HRV) showed a pattern with a somewhat high low-frequency to high-frequency ratio. An exercise test was carried out and the patient performed well, with no chest pain, arrhythmias or signs of ischaemia.
+The patient began to believe that there was an association between using his motorbike and his symptoms and decided to stop using it. Since then no symptoms, apart from an occasional single extrasystole, have been noted by the patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_508_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_508_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f8a4ba8d243c72423d88641966e93b809547f4c3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_508_en.txt
@@ -0,0 +1 @@
+A 14 years old male was admitted with the chief complaint of acute lower abdominal pain which started suddenly after he passed stools. The abdomen was tender on deep palpation in the left iliac fossa and bowel sounds were sluggish. However, on per rectal examination gut loops were felt in the anal canal and finger was stained with blood thereby making intussusception the most probable diagnosis. Basic hematological and radiological investigations were normal. Patient was taken to the operation theatre for laparotomy. A lump was felt in the left iliac fossa once the patient was anaesthetized for surgery. Peroperative findings revealed a distended and a tubular sigmoid colon (intussusception like appearance) and twisting of ileal loops around the sigmoid colon simulating ileo-sigmoid knotting. On further mobilization and gentle traction on the ileal loops gangrenous segment of ileum became evident till it finally emerged out from a longitudinal perforation (approximately15mm) in the anterior wall of rectum just above the peritoneal reflection thereby stunning the entire surgical team. No contamination of peritoneal cavity was noticed. Gangrenous segment of ileum was resected and primary anastomosis was done. Rectal tear was closed primarily in single layer after taking the biopsy from the whole edge which revealed non specific inflammation. On repeated questioning in postoperative period patient denied any history suggestive of constipation, rectal prolapse, trauma, weight lifting, rectal instrumentation or homosexual activity; however intermittent straining at stools was present. Postoperative period remained uneventful. Barium enema and colonoscopic examination in post operative follow up period were normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_514_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_514_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b6a15889251e2a78aa7910344d731b9111902f3c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_514_en.txt
@@ -0,0 +1,4 @@
+The subject was a 26-year-old male Air Force pilot and a foreign state officer. The pilot had some individual flight experience, with a flight time of 120 h in the last 2 years on a L-39 Albatros, aircraft type designation. He reported no health problems before the training, nor in his medical history. He is a non-smoker and denies drug abuse. A clinical examination before the incident showed normal findings and the beginning of the practical training was normal. Problems arose the moment after the explosive decompression – the pressure inside the chamber was already stable. The pilot signaled to stop by waving his arm, than he crouched down in the seat, holding his head. Then, he produced a few grunts or cough-like sounds. He did not respond to questions about what had happened or what the problem was. After 7–8 s, an emergency descent was ordered to access the pilot. During the descent, the pilot started to respond normally. This emergency descent was likely the reason for the mild iatrogenic barotrauma of the middle ear. This issue was resolved in the next few days and is not connected to the purpose of this report.
+Once on the ground, the pilot did not report any major symptoms at first. He said the main problem was sinus pain, that he did not feel any chest pain or have trouble with breathing. He described the coughing sounds as a verbalization of his pain and remembers us talking to him. In other words, he did not understand our concern in regards to lung trauma and did not seem anxious or worried. He also clearly stated that he did not hold his breath during the decompression. After finishing, he was eupneic, with normal hemodynamic parameters and a normal chest examination. After a few minutes, he developed retrosternal pain during deep inspiration and his tolerance of being in a horizontal position was reduced. These symptoms did not worsen, however, he was sent to our emergency department on suspicion of lung barotrauma.
+The first chest X-ray and CT showed diffuse emphysema of the superficial and deep parts of the neck, continuing to the proximal section of the ventral chest wall . Diffuse pneumomediastinum signs are apparent paratracheal right, around right pulmonary artery, junction of left pulmonary veins and left atrium further are present signs in right cardiophrenic angle . A small bilateral pneumothorax was found apically and basally with pneumoperitoneum. The pneumoperitoneum was concluded to have been caused by passing gas through the hiatus in the diaphragm. There was no evidence of free fluid in the chest, no dislocations of mediastinal structures, no traumatic skeletal changes. A bronchoscopy was recommended for suspected airway injuries, but the patient refused. Conservative protocol without thoracic drainage was followed during his hospital stay. A two-day interval chest CT scan showed regression of the bilateral pneumothorax, regression of soft tissue emphysema, as well as pneumomediastinum regression. The patient stated he felt well and did not exhibit any additional symptoms, so he was discharged. After the discharge, follow-up examinations were recommended and a 2 month no-fly period was ordered. However, after 3 days, the patient left to his homeland and a contact at required medical level was lost. Pilot reported that he is doing well, without any problems and will be fit-to-fly soon.
+A report done by the technical staff ruled out technical malfunction. A breathing mask was used before and after the incident without problem. All of the equipment used had required official certifications. There were not any suggestions of problems with the used equipment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_523_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_523_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..405e79b77539bf40e31b13b654bb2a6715465bbb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_523_en.txt
@@ -0,0 +1,7 @@
+A 5 year old girl of Indo-Aryan origin presented with one and a half month old neglected trauma left leg, managed by a local bone setter (quack). Examination revealed swelling from knee to ankle, 5cm×5cm ulceration over proximal part of shin, purulent discharging sinus and deformity. X-ray revealed non-union with exuberant callus at the fracture site.
+At the age of 2 years patient developed ulcers of multiple fingers and toes followed by their self amputation (, ). Finger and toe tips showed multiple healed scars. Radiographs revealed osteoacrolysis . In the same year, patient had trauma to left thumb which healed with a deformity . There had been trauma to left forearm in childhood; X-ray revealed healed fracture of shaft of ulna. Parents mentioned all the above traumatic events were not associated with pain.
+Around the age of 2 and half years patient developed blisters over right lower extremity, which healed leaving scar marks .
+There is history of recurrent episodes of high grade fever since childhood. There was one such episode in the hospital lasting 4 days. There is history of lack of sweating since birth. Physical and laboratory tests revealed anhidrosis. Patient feels very uncomfortable during hot weather and comforts herself by taking a cold water bath which gives temporary relief.
+She is born of non-consanguineous marriage. Family history was insignificant. Motor and mental milestones were delayed. Intelligence is low as compared to other siblings. There is history of repeated respiratory tract infections in childhood.
+Neurological examination was normal except inability to perceive painful stimuli. No pain was perceived even at the time of intravenous and intramuscular injections. Nerve conduction study revealed normal median nerve conduction velocity. There is history of several episodes of biting of tongue. The patient had normal eruption of teeth but had lost most of them; all the incisors and canines were absent.
+CRP was elevated. Culture of pus from discharging sinus cultured S. aureus. Serum calcium, serum phosphorus, renal function parameters, thyroid function tests, parathormone levels, serum uric acid were in normal range. Infected non-union was managed by curettage and debridement. Reduction was achieved and fixed using biplanar external fixator . At 3 months follow up pus discharge had subsided with abundant granulation tissue at wound site. There was callus formation at fracture site and features of union on radiograph.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_527_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_527_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d37f759b59f0479f13a0f8817f527601a876b56
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_527_en.txt
@@ -0,0 +1,2 @@
+We report a case of a 51 years-old woman with medical relevant story of ductal breast carcinoma, submitted to mastectomy followed by adjuvant radio and chemotherapy. She had remained disease-free for 7 years following treatment. After this period, due to tumor recurrence, the patient was started on hormonotherapy with Fulvestrant (estrogen receptor antagonist). Three days later, she developed asthenia, anorexia, nausea and vomiting. On day 10 of therapy she was admitted in the emergency department with jaundice, dark urine and pale stools. There was no history of alcohol, drugs or natural products consumption. The patient also denied recent travels. On admission, she was hemodynamically stable and with no fever, abdominal pain or pruritus. Physical examination was positive only for icteric sclera. No other relevant findings including hepatosplenomegaly, ascites or hepatic encephalopathy were found. Also, there were no lymphadenopathies or rash. Blood tests revealed leukopenia of 3.1 × 109 (4.0-11.0 × 109) with normal eosinophil value and thrombocytopenia of 82.000 (150.000-450.000). Immunoglobulin IgE level was normal. Liver tests demonstrated a cytocholestase pattern, with elevated aminotransferases: AST 3170 IU/L (<34 IU/L), ALT 908 IU/L (<49 IU/L), GGT 1132 IU/L (<38 IU/L), alkaline phosphatase (AP) 109 IU/L (<104 IU/L), TB 5.1 mg/dl (<1.0 mg/dl) and DB 4.46 mg/dl (<0.2 mg/dl), as well as prolonged prothrombin time: 20s. (<11,6 s.) and APTT 53 s. (< 31 s.) Abdominal ultrasound showed a homogeneous liver, with regular borders. Only steatosis was evident and no nodular or mass lesions were observed.
+An extensive workup diagnosis including chest CT, viral serologies (HAV, HBV, HCV, CMV), and autoimmune and metabolic studies failed to show an etiology for the disease. A presumptive diagnosis of liver toxicity to Fulvestrant was assumed. Although the drug was immediately withdrawn, clinical worsening occurred with the development of hepatic encephalopathy and rapid progression of acute liver failure (factor V 35%, AST 5530 IU/L, ALT 1810 IU/L, TB 8.6 mg/dl, APTT 55 s. and PT 23.4 s.) associated with bleeding diathesis. Because the patient had an active tumor recurrence which is a contraindication for liver transplant and chemotherapy wasn’t possible because of severe abnormal liver function, a transjugular liver biopsy wasn’t considered as it wouldn’t change the management of the patient. There was no response to medical support treatment and the patient died. Post-mortem examination revealed a wide hepatic infiltration by neoplastic tissue with morphologic characteristics compatible with adenocarcinoma . The carcinoma cells were arranged singly in small clusters with a high proliferation index . Immunohistochemical stains were positive for estrogens receptor but negative for progesterone and Herb2 receptors , consistent with the diagnosis of primary breast carcinoma. Unfortunately, E-cadherin and CD44 stains weren’t tested.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_530_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_530_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cc1eb7a880bdb910f2356ff8d47446642beda263
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_530_en.txt
@@ -0,0 +1,4 @@
+The patient was a 19-year-old female with a height of 163.5 cm and a weight of 21.5 kg. She was born after 38 weeks of gestation and weighed 2624 g without asphyxia, but was diagnosed as having severe MMA at 3 days of age due to deterioration of general status, and the presence of metabolic acidosis and hyperammonemia. Complicating her cerebral palsy, she was repeatedly hospitalized due to acidosis and seizures. Since 2009, her renal function gradually worsened, and in 2017, plasma creatinine (Cr) was found to be above 4.0 mg/dl. In 2018, the patient was admitted to the emergency room due to a deterioration of general status from infection, and an operation for a continuous ambulatory peritoneal dialysis catheter placement was scheduled.
+Preoperative venous blood gas analysis did not indicate metabolic acidosis: pH, 7.432; PCO2, 42.1 mmHg; PO2, 38.2 mmHg; and base excess (BE), 2.9 mEq/l. Blood results showed anemia and renal failure: hemoglobin (Hb), 6.1 g/dl; blood urea nitrogen (BUN), 56.0 mg/dl; Cr, 4.04 mg/dl; and estimated glomerular filtration rate (eGFR), 13 ml/min/L.
+General anesthesia was combined with a peripheral nerve block. No premedication was administered. After the patient entered the operating room, electrocardiography, saturation of percutaneous oxygen, and noninvasive arterial pressure were monitored. Anesthesia was induced using thiamylal (4.6 mg/kg), remifentanil (0.4 mcg/kg/min), and rocuronium (0.9 mg/kg). After tracheal intubation, the patient underwent an ultrasound-guided bilateral rectus sheath block with 0.2% ropivacaine (30 ml). Anesthesia was maintained with a gas mixture of oxygen and air (FiO2 0.4), 1.0 minimum alveolar anesthetic concentration sevoflurane (1.2–2%), and remifentanil (0.2–0.4 mcg/kg/min).
+Intraoperative arterial blood gas values were as follows: pH, 7.369; pCO2, 32.9 mmHg; pO2, 182 mmHg; BE, − 5.9 mEq/l; Na, 140 mmol/l; K, 3.8 mmol/l; and Cl, 104 mmol/l. Glucose preparation was used to prevent hypoglycemia while maintaining a concentration of 100–200 mg/dl to ensure optimal dosing. The preoperative blood sugar level was 113 mg/dl. Hypotonic fluid (2.5% glucose) was used in the perioperative period. Blood sugar level declined to 82 mg/dl during surgery, and 5% glucose was administered. The level was 120 mg/dl at the end of the surgery. To avoid perioperative accumulation of methylmalonic acid, the temperature was maintained above 36.0 °C with a heating device, and clindamycin was administered intravenously. Throughout the surgery, hemodynamic parameters were stable, and the operation was over without using vasopressor agents. Extubation was performed after intravenous administration of sugammadex (4 mg/kg). The duration of surgery was 2 h and 10 min, and that of anesthesia was 3 h and 30 min. Postoperatively, the patient did not experience pain at rest; however, she experienced mild pain during movement. The patient did not use any rescue analgesic agents in the postoperative period. Additionally, no evidence of metabolic acidosis or hyperammonemia (NH3, 29 μg/dl) was observed. Continuous ambulatory peritoneal dialysis was started 10 days after the surgery, and the patient was discharged after 36 days.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_538_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_538_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6d9440dfd0051ed63dee081f725c421a5355007a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_538_en.txt
@@ -0,0 +1,6 @@
+A 50-year-old Iranian housewife with a total replacement of the left knee joint presented to our department. On the primary examination, fever (38 °C), blood pressure (BP) of 125/75 mmHg, pulse rate (PR) of 75 beats per minute, and respiratory rate (RR) of 15 breaths per minute, along with chilling, nausea, swelling, and pain in the left knee that had started 3 days ago, were recorded. Except for decreased ability to move the joint, other predominant physical and neurological symptoms were not observed.
+In the past medical history (PMH), the patient had a history of diabetes mellitus with insulin therapy and a left knee joint replacement 1.5 years ago. Except for these cases, she had no other significant past medical history or notable family or hereditary history of specific disease and medication use. She had given birth to three children and denied alcohol consumption and smoking. For controlling diabetes, she used neutral protamine Hagedorn (NPH) insulin [20 units every 12 hours, subcutaneous injection (SQ)] and regular insulin (12 units in the morning and 8 units at night, SQ).
+For diagnosis, a peripheral blood sample and aspirated synovial fluid were taken and were subjected to biochemical, hematological, and microbiological testing.
+A peripheral blood sample of 10 ml was obtained and inoculated into a blood culture bottle aseptically; it was negative after a 72-hour period of incubation at 37 °C. A synovial aspiration sample of 2 ml was taken from the patient and was dropped into collection tubes containing liquid ethylenediaminetertraacetic acid (EDTA) aseptically. The specimen was cultured into selective media including blood agar (for isolating aerobic bacteria), chocolate agar (incubated in a candle jar for isolating aerobic capnophilic bacteria), thioglycollate broth (for recovering anaerobic bacteria), eosin methylene blue agar (EMB; for recovering gram-negative bacteria), and subro dextrose agar (for isolating fungi). Also, two sets of slides were prepared and stained with gram and acid-fast staining. Polymerase chain reaction (PCR) and acid-fast staining were employed for identification of acid-fast bacilli, which were negative. Susceptibility to sulfamethoxazole-trimethoprim (SXT), neomycin, and bacitracin discs was used for the differentiation of α-hemolytic Streptococcus species (spp.) from other Streptococcus spp.
+Lab biomarkers of blood and synovial specimens at the time of admission are presented in Table . In synovial cell counting examination, many WBC in which neutrophils accounted for 80% of whole cells were reported.
+At the time of admission, since the causative agent was unknown, on the first day, empirical therapy including vancomycin (1 g every 12 hours, intravenous injection for 2 days) and meropenem (1 g every 8 hours, intravenous injection for 2 days) were initiated to target suspicious invasive agents like Staphylococcus spp. and gram-negative bacilli. On the second day, edema, warmness, and redness declined but fever remained. The results of the blood and synovial culture were revealed on the third day. Only the α-hemolytic Streptococcus spp. was isolated from the synovial specimen, which was subjected to antibiogram testing. Based on the results of antimicrobial susceptibility testing on the third day, antibiotic medication was changed to cefepime (2 g every 8 hours, intravenous injection) for 14 days. Transthoracic echocardiogram (TTE) and transesophageal echocardiogram (TEE) tests were recommended by an infectious disease (ID) specialist and were performed by an echocardiography cardiologist, who indicated that there was no sign of endocarditis. In orthopedic consultation, according to radiographic results, the exchange of removable components of the implant was not recommended; the antibiotic therapy was continued. The patient was treated with intravenous antibiotics for 14 days and was discharged after partial recovery. At the time of discharge, the patient's symptoms were entirely resolved, there was no movement disorder, and there was only slight swelling in her left knee. Oral medication with cephalexin was prescribed for her for 2 weeks. One month after discharge, the patient did not have any specific complaints and joint restrictions, and the test results of erythrocyte sedimentation rate (ESR) of 25 and C-reactive protein (CRP) of 8 were in normal range.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_540_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_540_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..24ca148ed92b077c519816afce2ec087bed98a40
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_540_en.txt
@@ -0,0 +1,6 @@
+On December 11, 2020, a 81-year-old woman presented to the eye hospital of Lucerne, Switzerland, with severe bilateral loss of vision. Eight days earlier, she had received uneventful bilateral injection of brolucizumab, a novel anti-vascular endothelial growth factor (VEGF) single-chain variable region (scFv) recombinant protein drug, for treatment of neovascular age-related macular degeneration (nAMD). The patient had a 2-year history of bilateral nAMD, which had been treated with ten anti-VEGF injections (3 × bevacizumab, 7 × aflibercept) in her right eye, and 12 aflibercept injections in her left eye, with a final treatment interval of every 8 weeks. Her visual acuity was 20/200 in her right eye and 20/400 in her left eye. She had undergone a vitrectomy with membrane peeling for macular pucker, combined with cataract surgery, in the left eye in March 2016. Her relevant medical history included arterial hypertension, osteoporosis, and follicular thyroid carcinoma treated with radiotherapy years ago without metastasis. Current medications included aspirin cardio, euthyrox, lercanidipine, nebivolol, irbesartan, and ibandronate.
+In September 2020, her treating ophthalmologist switched her anti-VEGF treatment to brolucizumab with the aim of reducing her clinical visits to once every 12 weeks, based on the published data of the HAWK and HARRIER trials . Two weeks after her first same-day bilateral brolucizumab injections, the patient complained of a dark spot in her right peripheral visual field, which remained unchanged until her appointment 8 weeks later, at which she received her second same-day bilateral intravitreal brolucizumab injections. No additional examinations were performed to exclude signs of ocular vasculitis prior to the injections. A follow-up visit the next day revealed a mild anterior chamber reaction on the right eye, and no signs of inflammation on the left. No treatment was deemed necessary. Seven days later, the patient complained of moderate pain, redness, and blurry vision in both eyes. The following day, she presented to our emergency service due to severe vision loss in both eyes.
+At presentation, her visual acuity in each eye was classified as “hand motions”. Slit-lamp examination revealed marked conjunctivitis with diffuse hemorrhages in both eyes. The cornea of each eye exhibited Descemet folds and severe stromal edema. In both eyes, the anterior chamber was filled with fibrin and dispersed blood on the corneal endothelium, but without a hypopyon , and the iris presented with scattered small hemorrhages. The intraocular pressure was 15 mmHg in her right eye and 8 mmHg in her left eye. The fundus of the right eye was not visible due to cataract and corneal edema, and her left eye exhibited diffuse opacities in the vitreous cavity and dense retinal hemorrhages. Scanning laser ophthalmoscopy of her left eye revealed marked vascular sheathing .
+Based on the lack of hypopyon and an A- and B-scan sonography without hyperreflectivity in the vitreous cavity, infectious endophthalmitis was considered unlikely, and was later excluded since taps from the anterior chamber and vitreous cavity remained negative for eubacterial PCR and microbial culture assay. As the clinical picture resembled an ocular ischemic inflammatory syndrome, temporal arteritis and other forms of vasculitis were considered, but were deemed unlikely due to the patient’s history, lack of painful temporal arteries, and atypical laboratory results.
+With a working diagnosis of brolucizumab-related vasculitis, immediate treatment was initiated with intravenous methylprednisolone (250 mg) per clinicians discretion, followed by oral prednisolone (1 mg/kilogram body weight). We decided against a complete pulse therapy cycle with IV methylprednisolone after a reviewing the literature that did not show any proven clinical benefit . On the second day of treatment (10 days after second brolucizumab injection), her visual acuity had deteriorated to no light perception in both eyes and remained unchanged thereafter.
+MRI evaluations were performed to search for vasculitis outside the eyeball. T1 fat-saturated post-contrast images of the orbit revealed a higher-than-normal signal of the choroid, with localized choroidal detachment . Additionally, pathologic enhancement was visible around the optic nerve in the orbit, which was interpreted as vasculitis . Black blood MR sequences were also performed, which did not reveal CNS vessel involvement. Due to the suspected severe periocular vaculitis, an additional vitreous tap was obtained, which revealed elevated levels of interleukin 6 (> 300 pg/ml; normal vitreous value in control group: < 30 pg/ml) and interleukin 10 (40.6 pg/ml; normal vitreous value: < 3 pg/ml) . Conjunctival biopsy of the left eye showed edema and inflammation, with intracapillary granulocyte accumulation. In the following days, intraocular pressure dropped to 1 mmHg in her right eye and 6 mmHg in her left eye, with signs of a bilateral panocular ischemia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_556_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_556_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a2ba6e2cf96ba6db914f82f05f12c1acd3d2de98
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_556_en.txt
@@ -0,0 +1,4 @@
+A 27-year-old male presented to the emergency department (ED) with a right-sided nasal mass and associated progressively worsening lower right eyelid swelling over the course of several months. Medical history was insignificant. His social history was significant for a two pack-year smoking history with additional cocaine and marijuana use. Before his initial presentation, the patient had visited the ED multiple times for symptoms of intermittent epistaxis, sinus congestion, midface pressure, throbbing headaches, and ocular discharge. He had been treated with antibiotics and steroids without improvement. Due to periorbital inflammation, concern for increased intraocular pressure and decreased visual acuity at this ED encounter, the patient underwent a lateral canthotomy and cantholysis by ophthalmology, after which the patients’ eye symptoms improved quickly.
+Contrast-enhanced computed tomography (CT) at that time showed a 4.0 × 2.2 cm mass in the right nasal cavity, deviation of the nasal septum to the left, erosion of most of the ethmoidal air cells, and possible extension through the cribriform plate. There was near total opacification of the right frontal sinus, maxillary sinus, and ethmoid air cells with right preseptal soft-tissue edema . Given the patient’s gender, age, and imaging evidence at the time, there was a high suspicion for juvenile nasopharyngeal angiofibroma (JNA). The patient was admitted and elective interventional radiology (IR) embolization was scheduled. During his admission, the patient became febrile. Subsequently, embolization of the mass/maxillary artery was cancelled to avoid seeding of intravascular coils with bacteria, as the patient’s fever was felt to be secondary to bacteremia. Furthermore, the patient exhibited a declining serum sodium concentration from 133 mMol/L to 118 mMol/L, and syndrome of inappropriate antidiuretic hormone secretion (SIADH) was suspected. He received salt tablets and several doses of demeclocycline with subsequent improvement.
+For the treatment of the presumed JNA, otolaryngology performed a right medial maxillectomy, right nasal endoscopy with debridement, total ethmoidectomy, and removal of the intranasal mass. The patient recovered appropriately and was discharged on postoperative day 2. Unexpectedly, the pathology from the right maxilla revealed a high grade malignant neoplasm, most consistent immunophenotypically and histologically with high grade “mixed” ONB and carcinoma . The tumor was comprised nests of poorly differentiated cells with hyperchromatic nuclei, coarse chromatin, and minimal cytoplasm that was continuous with areas of typical neuroblastoma including neuropil formation. Foci of both squamous differentiation and nonenteric glandular differentiation were also noted. Lymphovascular and bone invasion were present. Immunohistochemical staining of the tumor showed positivity for the following markers, which differed slightly depending on the area of tumor that was stained: synaptophysin, CD56, chromogranin (rare/focal), S100 peripherally, Pan CK, CAM 5.2, CK7, p16, p63, CK 5/6, and p40 [, ]. After recognizing the nasal cavity mass as a malignancy, the tumor was staged as T4aN0Mx.
+During postoperative follow-up, the patient reported improved right periorbital swelling and erythema, decreased serosanguinous drainage from right nares. No purulent nasal drainage was noted and he remained afebrile. Based on the results of pending magnetic resonance imaging (MRI) and positron emission tomography scans, the patient is expected to undergo further resection of residual tumor versus chemotherapy and radiation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_557_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_557_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2fc6fba8c439084ff7edec521ea45b854b41e051
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_557_en.txt
@@ -0,0 +1,4 @@
+A 36 year old man presented to the emergency department with a 24 hour history of central abdominal pain, two episodes of vomiting and loose stool. He had a past history of Type II Diabetes Mellitus, hypertension, asthma and obstructive sleep apnoea. He weighed 130 kg with a Body Mass Index greater than 40.
+His current medications were diltiazem, lisinopril, metformin, glicazide and orlistat. The orlistat had been commenced four days previously.
+He was pyrexial and on examination was tender in the epigastrium. His initial white cell count was 20 × 109/L and a C reactive protein of more than 300 mg/l, an amylase of 136 iu/l, and a lactate dehydrogenase of 892 iu/l. a recent lipid profile was normal and his corrected calcium was 2.41 iu/l. The initial diagnosis was unclear and a CT scan of his abdomen was organised. This showed appearances of acute pancreatitis affecting the distal body and tail of the pancreas [figure ]. He was classified as having acute severe pancreatitis using the modified Glasgow Score 1984. Management was the standard of pancreatitis, mainly supportive. Antibiotics were not given. Common causes of pancreatitis were excluded. He was abstinent of alcohol, had a normal serum calcium, had no family history of pancreatitis or hyperlipidaemia, and had no history of trauma. His abdominal CT scan showed no evidence of gallstones. By exclusion the diagnosis of drug induced pancreatitis secondary to orlistat was made.
+He was transferred to the intensive care and made good progress. The Medicines Control agency and Committee on Safety of Medicines were informed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_564_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_564_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..53bf31cb6b4bb39c45501c8afa166ff9b44f9aaa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_564_en.txt
@@ -0,0 +1,6 @@
+A 16-year old male patient consulted the maxillo-facial and oral surgery outpatient clinic of the Chris Hani Baragwanath Academic Hospital (Johannesburg, South Africa) complaining of severe facial deformity and inability to open his mouth. The patient’s history was significant for bilateral post-traumatic TMJ ankylosis sustained at the age of 4 years. He was treated with gap arthroplasty and bilateral costochondral grafts at the age of 8 years. Thereafter, his mouth opening gradually decreased and multiple jaw stretching procedures were performed under general anaesthesia.
+Five years later, chin asymmetry and concomitant malocclusion became apparent and subsequent diagnosis of right CCG overgrowth and reankylosis on the left side was made. A gap arthroplasty was performed on the left side, however the patient returned a year later with bilateral TMJ reankylosis .
+The clinical examination revealed facial asymmetry with deviation of the mandibular midline to the left. His mouth opening was restricted to approximately 5 mm interdental distance (IDD). He also presented with a cant in the occlusal plane and marked malocclusion. A and B show pre-operative mouth opening at 8 year and 16 years.
+Radiographic investigation included PA mandible (A), orthopantomogram (B) and coronal CT Scans (C). These images confirmed elongation of the vertical ramus on the right side, asymmetry of the chin towards the left side and bilateral ankylosis of the TMJ (yellow arrows) with right mandibular overgrowth (white arrows) respectively.
+In view of the severity of the deformity, combined orthognathics and TMJ reconstruction with custom joints was planned. The procedure and custom-made prostheses were planned using 3D imaging and stereolithic model generated from his CT scan . Surgical release of bilateral ankylotic masses was carried out using surgical guides via Al-Kayat and Bramley (modified preauricular) and Risdon submandibular approach. Temporomandibular joints were reconstructed with Biomet Microfixation patient-matched alloplastic TMJ prostheses . An IDD of 35 mm was achieved. Facial asymmetry, occlusal plane cant and cross-bite were corrected with Le fort I osteotomy and a genioplasty .
+At the time of his 12 month postoperative evaluation, he had a maximum mouth opening of 30 mm IDD and his functional and aesthetic evaluation was satisfactory .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_565_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_565_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..74fe3d67a60b2d5093082dda77b56551ce57e24a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_565_en.txt
@@ -0,0 +1,2 @@
+The subject was a 53-year-old housewife, who consulted in December 2013 for inflammatory pain in the right hip evolving for 3 months controlled with non-steroidal anti-inflammatory drugs, with a walking distance of about 100 m. The medical history revealed that she is HIV infected and on triple ARV for 1 year, with a CD4 count of 473/ml, the viral load was not documented. Evaluation of the right hip showed flexion/extension of 80/20, abduction/adduction of 40/20, internal rotation/external rotation of 20/15, a trendelenburg gait, and a limb length discrepancy of 3 cm. The muscle power of the gluteus medius was 4/5. There was amyotrophy of the right quadriceps muscle. The Merle d’Aubigne and postel hip score was evaluated to be 9/18. The anterior-posterior view of the pelvic X-ray shows joint space narrowing, loss of head sphericity, shortened hip length, with no other signs of coxarthrosis (sclerosis, geodes, osteophytes). These findings coupled with the patient’s history of immunosuppression were suggestive of a coxitis, which could be due to tuberculosis (TB) infection. However, an MRI scan was not done because it was unavailable, and the patient could not afford to do it due to financial constraints. The full blood count revealed a hemoglobin level of 13 g/dl, however, the white cell count was 8000 with 45% lymphocytes and 50% neutrophiles. The rest of the laboratory investigation was unremarkable.
+The patient was operated for implantation of a THA via the Hardinge approach. During surgery, an incident was encountered while dislocating the hip to resect the femoral head. There was a cream-white liquid that was oozing out of the hip joint . A sample was rapidly collected per-operative and sent for urgent bacteriological analysis. The gram coloration was negative, the rest of the liquid was then sent for microbiological, mycobacteriological and histological analyses. The debris from reaming and the femoral head were also sent for analysis. The surgery was continued and completed with the implantation of a hybrid THA due to the fragile acetabulum; the stem was uncemented while the acetabulum was cemented . The anatomopathological findings showed an active TB infection . At the end of the surgery, the limb length discrepancy was corrected. The wound healing was normal, and rehabilitation commenced 24 h after surgery with isometric contractions of the gluteal and quadriceps muscles in bed. She was then verticalized the second day following surgery and walking was assisted using crutches. The patient thence continued with her ARV the same day of surgery and 10 days triple antibiotics initiated. She had a fixed combination of antituberculous drugs (isoniazid, rifampin, pyrazinamide, and ethambutol) to be taken for 12 months. 3 years after the surgery we have not noticed any relapse of the infection or any loosening.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_567_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_567_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7ca3af9f01cd2b8e6aa63182f9f7b231d3242b76
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_567_en.txt
@@ -0,0 +1 @@
+A 64-year-old man underwent video-assisted thoracic surgery, right upper lobectomy combined with bronchoplasty, and SVC plasty for right lung cancer. General anesthesia was induced and maintained with propofol and remifentanil combined with paravertebral nerve block. After induction of anesthesia, propofol was administered at 2.5 μg/mL with a target-controlled infusion system (TCI pump TE-371TM; Terumo, Tokyo, Japan), and remifentanil was administered at 0.4 mg/h. Before clamping the SVC, the state entropy remained around 50 . Because the tumor had invaded the SVC, it was necessary to clamp the SVC for resection. After administration of 3000 units of heparin, the SVC was clamped on the cranial and caudal sides of the tumor, and the invading tumor was excised simultaneously with the SVC. Immediately after clamping, the mean arterial pressure (MAP) dropped from 60 to 50 mmHg. Blood pressure quickly recovered to its previous level after administration of 4 mg of ephedrine. State entropy rose temporarily for 4 min after clamping and then steeply slowed down to a value less than 10, and the burst suppression ratio (BSR) increased from 0 to 93% . The flattening of EEG was thought to be caused by cerebral congestion and reduced cerebral perfusion; however, the clamp could not be released because the SVC was already incised. We performed phlebotomy by releasing the clamp on the cranial side to relieve SVC congestion. Time course of an increase of MAP, phlebotomy, increase of state entropy (SE), and decrease of BSR should be correctly described. SE increased after declamping SVC . We performed phlebotomy with reference to the improvement in entropy EEG. Phlebotomies were performed twice during a total SVC clamping time of 21 min, for a total volume of 600 mL. State entropy gradually increased after SVC declamping and fully recovered 30 min after declamping . After the surgery time of 7 h and 12 min, he awakened from anesthesia and was extubated in the operating room. The patient was discharged without neurological sequelae.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_569_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_569_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f1a02a40b519a8f8d8f32db74d7ba24d7bb62d70
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_569_en.txt
@@ -0,0 +1,7 @@
+A 74-year-old woman presented with abdominal pain of 1 mo duration and was referred to Sun Yat-Sen Memorial Hospital, in March 2018.
+She presented with abdominal pain of 1 mo duration.
+She mentioned a loss of 8 kg over the previous 6 mo and had anemia. Hypertension was confirmed for many years.
+The patient denied any family history of malignant tumors.
+Upon physical examination, no peripheral lymphadenopathy or hepatosplenomegaly was found. A mass was noted in the right lower quadrant.
+Blood examination showed an increase in carbohydrate antigen 125, carbohydrate antigen 19-9 level, and a decrease in lymphocyte proportion and count, hemoglobin, and total protein . Serum lactate dehydrogenase was elevated (538 U/L, normal 108-252 U/L). Blood detection for syphilis, hepatitis B virus, hepatitis C virus and human immunodeficiency virus was negative or normal.
+Hypertensive heart disease was diagnosed by color sonography. Chest radiography showed no evidence of metastasis in the lung. Contrast-enhanced computed tomography revealed bowel wall thickening with contrast enhancement at the cecum, but no lymph node or organ metastasis and a negative scan of the liver and spleen. Colonoscopy revealed a tumor of the ascending colon, which was confirmed as adenocarcinoma on biopsy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_585_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_585_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..33cd4600b8ebee63361e1612fb6c2c020f5b56fe
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_585_en.txt
@@ -0,0 +1,4 @@
+A 67-year-old male on anticoagulants for atrial fibrillation, suddenly complained of severe back pain, an L1-level paraparesis/sensory loss with urinary incontinence. On examinations, he had 3/5 motor function loss from L1 downward and a partial sensory level to pin appreciation.
+The brain CT showed SAH clots in the posterior fossa. Cerebral angiography, however, showed no cranial vascular lesions. Notably, the lumbar MR demonstrated a T12-L1 lesion that was homogeneously enhanced with contrast consistent with a schwannoma . Furthermore, there was intratumoral hemorrhage with SAH/SDH spread resulting in cauda equina compression .
+The patient underwent a T12-L2 laminectomy 3 weeks later using intraoperative sensory evoked potential (SEP) and motor evoked potential (MEP) . Once the dura was opened, there was subdural and subarachnoid blood underlying which a large tumor with intrinsic hemorrhage was identified. The rostral side of the tumor, was strongly adherent to the conus medullaris from which it had to be carefully dissected and removed. There were no SEP/MEP changes during surgery. Postoperatively, the paraparesis transiently worsened, but, over the next 6 months, the motor, sensory, and sphincteric function then gradually improved. At that point, the follow-up MRI revealed no recurrence of tumor.
+The tumor was a typical schwannoma. It contained proliferating spindle cells arranged in short bundles or interlocking fascicles containing hypocellular and hypercellular area (Antoni A and B area, respectively). On immunohistochemistry, most of the tumor cells were positive for S-100 protein. Hyalinized and ectatic vessels were also found within the tumor close to the tumor capsule, with inflammatory cells clustered around them. Fresh hemorrhage associated with focal necrosis was also found within the tumor .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_589_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_589_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ef41700efaeae2c9be93bb2fe75bd6b569c23969
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_589_en.txt
@@ -0,0 +1,12 @@
+A 65-year-old female with no medical history and no known cardiovascular risk factors presented with sudden onset chest pain whilst scuba diving abroad. She was a seasoned scuba diver with numerous years of experience.
+The dive in question was her ninth in 5 days. She had just begun her descent with an air-only gas tank when, upon reaching a depth of 8 metres, she experienced sudden onset, central, oppressive chest pain. Despite this, she continued her descent to the target depth of 30 metres. However, due to the persistence of chest pain, she abandoned the dive and performed a controlled ascent as per recommendations. The total dive time was 30 min.
+She presented to the local hospital ~90 min later where an initial ECG demonstrated a rhythm at ~70 beats per minutes with slightly widened QRS complexes and an absence of regular atrial activity, likely compatible with an accelerated idioventricular rhythm (, left panel). These modifications subsequently resolved 30 min later, with a return to sinus rhythm, but with fragmented QRS complexes, Q waves, and T-wave inversion now noted in inferior leads (, right panel). A blood test revealed normal levels of troponin and CK-MB—these tests were not repeated. An echocardiogram revealed a normal left ventricular ejection fraction (LVEF) with no regional wall motion abnormalities. The chest pain resolved ~2 h after onset, and the patient was discharged with aspirin and bisoprolol but no clear diagnosis.
+One week later, having returned home, she presented with new-onset, central, respiration-dependant chest pain, distinct in character from the previous chest pain. The patient was haemodynamically stable with a normal clinical examination. A 12-lead ECG revealed inferior Q waves with marked infero-lateral T-wave inversion .
+Blood tests revealed a high-sensitivity troponin T level of 78 ng/l (normal <14 ng/l), with repeated testing over the subsequent hours/days revealing a decreasing trend that reached a nadir of 33 ng/l. Of note, C-reactive protein was slightly raised at 14 ng/l (normal <10 ng/l), but leukocytes were in the normal range.
+Transthoracic echocardiography revealed an LVEF of 63% but with akinesia of the left ventricular mid-inferior wall and hypokinesia of the distal inferior wall .
+Given the history and these findings, a subacute myocardial infarction (MI) was suspected with possible peri-infarction pericarditis. At this stage, the possible mechanisms of the MI included: a conventional type 1 MI (i.e., atherosclerotic plaque rupture) or a type 2 MI secondary to SCAD or coronary spasm, given the context of physical stress. Other differential diagnoses that were considered included myocarditis and coronary arterial gas embolism. However, the former was considered unlikely given the context, the acute onset of chest pain, and the absence of recent upper respiratory infection or gastroenteritis. The latter is phenomenon seen in decompression sickness and thus was deemed implausible given the onset of chest pain during decent, the profile of the dive, and the controlled nature of the subsequent ascent.
+The patient was started on dual antiplatelet therapy (DAPT) (aspirin and clopidogrel) pending a coronary angiogram, with high-dose aspirin (500 mg tds) prescribed to manage the pericarditic chest pain. A proton pump inhibitor was also started for gastric protection.
+Invasive coronary angiography revealed coronary arteries free of significant stenoses except for a subtle irregularity of the posterior left ventricular artery . Given the suspicion of SCAD, optical coherence tomography (OCT) was performed, revealing an intramural haematoma of the posterior left ventricular artery with a patent true lumen, thus confirming the diagnosis of SCAD .
+Subsequent cardiac MRI (CMR) confirmed the presence of an MI of the mid-inferior wall [transmural late gadolinium enhancement (LGE)] with extension to the distal inferior territory (subendocardial LGE) . Additionally, LGE of the pericardium in contact with the zone of infarction was also noted, suggesting a localised pericarditis.
+As per current recommendations , given the absence of haemodynamic instability, and the presence of normal flow in the culprit coronary artery, the SCAD was managed conservatively without revascularisation. To treat the pericarditis, high-dose aspirin was continued for a total of 2 weeks along with a 3-month course of colchicine as per current guidelines . Low-dose aspirin (100 mg od) was subsequently continued long-term. Clopidogrel was discontinued due to the lack of clear evidence for the use of dual antiplatelet therapy in this context. Due to the presence of a normal LVEF, ACE inhibitors and beta blockers were not prescribed.
+The patient's symptoms resolved during the admission and she was discharged from hospital 6 days later. The follow-up period was unremarkable with an absence of chest pain recurrence. Of note, routine screening for fibromuscular dysplasia by duplex ultrasonography was negative. The screen was completed with computed tomography angiography in ambulatory care.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_590_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_590_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eccae331462a066fdd136ce75ee4e1107c55fbba
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_590_en.txt
@@ -0,0 +1 @@
+The patient, a 32-year-old female, was admitted to the hospital on May 17th, 2023 at 15:51 with a chief complaint of “cough for 7 days, aggravated with hemoptysis for 9 hours.” She had a past medical history of Hashimoto thyroiditis, which was not systematically treated. She had had a cough for 7 days, which began to worsen 9 hours prior to admission, accompanied by 100 milliliters of blood. Chest computed tomography (CT) showed: (1) bilateral pneumonia with alveolar hemorrhage was considered, and reexamination was recommended after treatment. (2) Multiple bronchial mucus sputum plugs were found in the right main bronchus and the middle and lower lobes of the right lung . In the afternoon of the same day, the patient developed hemoptysis again, with a large amount of fresh blood and a little blood clot. Physical examination: temperature: 36.2 °C, pulse: 128 beats/min, respiration: 25 breaths/min, blood pressure: 75/49 mm Hg, fingertip oxygen saturation: 50%. The breath sounds in the right lung were weak, while obvious moist rales were heard in the left lung.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_591_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_591_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dc9a75669ef93390ebe0ba677c111f625689f44c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_591_en.txt
@@ -0,0 +1,7 @@
+A 30-year-old man of Asian origin, presented to the surgery outpatient department (OPD) with non-radiating pain in the right hypochondrium and epigastrium associated with vomiting, intermittent fever with chills and rigors for 10 days. The onset was gradual with increasing weakness and deterioration of his general health. The patient was undergoing follow-up for a liver abscess (right lobe) which was diagnosed previously as an amoebic liver abscess (ALA) based on a positive amoebic serology report from a private laboratory. He was treated conservatively for this and discharged 3 months before this present episode. There was no previous history of tuberculosis (TB) or contact with any patient with TB. At the time of admission, the patient was febrile, dehydrated and looked very ill and anemic with a pulse rate of 92/minute, blood pressure 106/70 mmHg and respiratory rate of 16/minute. There was no icterus and no lymphadenopathy. Abdominal examination revealed tenderness and guarding over the intercostal spaces overlying the liver. The liver span was 16 cm. There was no splenomegaly, ascites or any other palpable mass in his abdomen. Respiratory and cardiovascular system (CVS) examination revealed no abnormality.
+Chest X-ray showed no lesion suggestive of TB but revealed a right-sided subdiaphragmatic pathology as the right hemi-diaphragm was raised and the costophrenic angle was blunted. An ultrasonogram (USG) of the abdomen on the same day revealed a 5.6 × 6.8 × 8.8 cm ill-defined, heterogeneous hypo-echoic lesion reaching up to the liver surface with cystic areas in the right lobe of the liver suggestive of an abscess . His liver was enlarged with a span of 16.6 cm with no other focal lesion. No perihepatic or pleural effusion was seen. All other abdominal viscera appeared normal with no free fluid.
+Routine hematology investigations showed hemoglobin 9.3 gm/dl; total leukocyte count (TLC) 22,600/mm3; differential leukocyte count (DLC): polymorphs 76, lymphocytes 20, monocytes 2, eosinophils 2; platelet count 3.76 lac; erythrocyte sedimentation rate (ESR) 52 mm at the end of the first hour; blood urea 28 mg%; prothrombin time of 15 seconds with a control of 10.1 seconds; total bilirubin 1 mg%; serum alkaline phosphatase 7 IU; serum glutamic oxaloacetic acid transaminase (SGOT) 29 IU; serum glutamic pyruvate transaminase (SGPT) 39 IU; serum protein 6.6 g/dl and serum albumin 4.0 g/dl.
+Pigtail catheterization was carried out under local anesthetic (LA), which drained 150 ml of cream-colored pus. The pus was sent for Ziehl-Neelsen (ZN) staining, acid-fast bacilli (AFB) culture using a BACTEC TB 460 instrument, polymerase chain reaction (PCR) assay for Mycobacterium tuberculosis and other routine microbiological investigations (wet mount, Gram stain, pus culture for bacteria and fungi). ZN staining showed AFB and BACTEC culture confirmed the same by isolating M. tuberculosis (by para-nitro-alpha-acetylamino-beta-hydroxy-propiophenone (NAP) test). Antibiotic sensitivity was performed with the BACTEC TB 460 instrument and the isolate was sensitive to isoniazid, streptomycin, rifampicin and ethambutol. PCR assay of the aspirate was also positive for M. tuberculosis DNA. The lysozyme proteinase K extraction method was used to extract the DNA. The target for amplification was a MPB 64 gene which has a 240 bp sized amplicon. The primers used in the PCR assay were as follows:
+Primer 1: 5'-TCC GCT GCC AGT CGT CTTCC-3'
+Primer 2: 5'-GTC CTC GCG AGT CTA GGCCA-3'
+Other routine microbiological investigations did not reveal any significant findings. Wet mount showed no trophozoites of Entamoeba histolytica or any fungal element. A routine bacteriological culture was sterile. Three consecutive early morning sputum samples were also screened for AFB and were negative. The patient was non-reactive in HIV serology. He was started on systemic antitubercular treatment (ATT) on receipt of the results from the laboratory, and this included isoniazid (300 mg once daily), rifampicin (450 mg once daily), pyrazinamide (1200 mg once daily), ethambutol (750 mg once daily) and pyridoxine (20 mg once daily). His fever subsided, and his appetite and general condition improved. He was discharged with stable vitals and asked to come for follow-up checkups after 6 weeks. At the first follow-up visit, the patient was asymptomatic, his liver size had decreased (size 3.1 × 3.8 × 5.1 cm) and a repeat USG abdomen revealed regression of the abscess.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_595_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_595_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..32222ce9420907fc6d8e9b161571202082711fa1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_595_en.txt
@@ -0,0 +1,2 @@
+A 55-year-old Caucasian female with stage IV pancreatic cancer and without other significant medical history presented to the interventional pain clinic with increasing sacral, lower extremity, and pelvic pain. The patient was unable to ambulate secondary to pain and deconditioning. Magnetic resonance imaging without contrast and computed tomography (CT) with contrast just prior to her clinic visit showed a large pancreatic mass with liver infiltration, multiple pelvic and sacral metastatic lesions, and a significant collection of intra-abdominal fluid. Of note, the lumbar and sacral epidural space showed no abnormalities or lesions. Her oncology team determined she was no longer a candidate for any further treatment and recommended palliative measures only. Her prognosis was poor with a life expectancy of a few weeks. Her pain control regimen included fentanyl patch 200 mcg every 72 hours, hydrocodone/acetaminophen 10/325 mg every 6 hours as needed, duloxetine 60 mg daily, and gabapentin 300 mg three times a day; however, she continued to have uncontrolled pain with significant decrease in her quality of life.
+Due to the patient’s poor prognosis and short life expectancy, an implantable intrathecal pain pump was not pursued. It was decided that a tunneled multiorifice epidural catheter with an external infusion pump would be the best treatment option for her pain. The epidural catheter was placed at the L5-S1 level using standard fluoroscopic technique. A paramedian approach with the Tuohy bevel directed cephalad was used to advance the catheter to the L3–4 vertebral level. Then 2 mL of injected contrast showed spread along the right L5 and S1 nerve roots. There was no contralateral spread seen and therefore the decision was made to inject a test dose of 6 mL of bupivacaine 0.25%. After waiting for 10 minutes, the patient was assessed and she had marked anesthesia and decreased pain on her right side, but normal pain on the left. To get full relief of her symptoms, it was decided to place a second tunneled epidural catheter using the same technique as the previous catheter placement along the left side of the epidural space at the same L5-S1 level in order to achieve bilateral analgesia. Then 2 mL of contrast was again injected through this catheter after placement, and it showed spread only along the left L5 and S1 nerve roots . To achieve contrast spread bilaterally, injection through both epidural catheters was required. The placement of two epidural catheters was therefore performed in order to avoid the anticipated poor bilateral spread of infused local anesthetic and subsequent inadequate pain relief. The patient tolerated the procedure well and was placed on dual patient controlled epidural analgesia (PCEA) pumps with each pump delivering a basal dose of 3 mL of bupivacaine 0.2% per hour with a demand dose of 3 mL every 30 minutes. She received excellent pain control and her reported numeric pain score for her lower extremity and sacral pain went from a 10 to a 3. She was discharged to hospice and placed under the care of the palliative physician. On phone call follow-up, it was reported that she had no adverse effects associated with the epidural infusion and continued to have numeric pain scores in the 3 to 6 range. While in hospice she was continued on the same basal epidural infusion and with approximately five demand doses per day. The patient remained on the same topical and oral pain medication regimen, which included transdermal fentanyl and oral hydrocodone/acetaminophen. Unfortunately after 4 weeks, the patient passed away in her sleep with her husband at her bedside. Written informed consent was obtained from the patient’s next of kin (husband) to publish this case report and any accompanying images.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_608_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_608_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0f5a2a807504e195918d1cbb226efb69e855fbf1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_608_en.txt
@@ -0,0 +1,8 @@
+A 50-year-old diabetic female patient, who has been on oral hypoglycemics for seven years. She had never been treated for tuberculosis and had no recent history of a tuberculosis contact. She reported the appearance of bilateral cervical lymphadenopathy two months before her admission, without any other associated respiratory or extra-respiratory signs, all evolving in a context of fever, night sweats, and preservation of her general condition. The physical examination revealed a patient in a good general condition (PS 1) with multiple lymphadenopathies of different sizes, painless and without any inflammatory signs, located in the cervical, axillary, epitrochlear, and inguinal regions. The rest of the physical examination was unremarkable.
+The chest X-ray showed a left hilar opacity and a right paracardiac opacity . The complete blood count was normal. The C-reactive protein was slightly elevated at 40 mg/l, blood ionogram, kidney function test, liver function test, and the viral serologies including HIV were normal. The search for acid-fast bacilli (AFB) in sputum was negative, and the tuberculin skin test (TST) was positive at 15 mm. The biopsy of the cervical adenopathy showed the presence of an epithelioid and giant cellular granuloma without caseous necrosis. Unfortunately, the culture of the biopsy specimen was not performed.
+The patient was put on anti-tuberculosis as tuberculosis was highly suspected due to the epidemiological context, the clinical symptomatology and the strong positivity of the tuberculin test. On the fifteenth day, she developed a generalized pruritic erythematous rash that required the interruption of the treatment. A thoracic CT scan was performed, which revealed mediastinal hilar and axillary adenopathy without parenchymal involvement and a right breast lump (a, b).
+Bronchoscopy showed thickening of the left upper lobar spur, bronchoalveolar lavage was predominantly lymphocytic (42%), staged bronchial biopsies were negative as well as the search for AFB in the bronchial aspiration fluid.
+Bilateral mammography and mammary ultrasound showed a right and left breast lump which is classified respectively BI-RADS V and BI-RADS IV (a, b). The breast biopsy was in favor of a granulomatous inflammatory process without caseous necrosis.
+The phosphocalcic balance, the electrocardiogram, and the ophthalmic exam were without abnormalities. The biopsy of the accessory salivary glands showed the presence of a giant cellular epithelioid granuloma without caseous necrosis compatible with sarcoidosis. The pulmonary function test showed a correct total lung capacity (TLC). Beta microglobulinemia, serum protein electrophoresis, and abdominal ultrasound were without abnormalities.
+The diagnosis of sarcoidosis was based on clinical, radiological, biological, and histological criteria (presence of granuloma without caseous necrosis in 3 different organs: lymph node, salivary glands, and mammary glands).
+Therapeutic abstention was recommended with clinical and radiological surveillance. The evolution was marked over two years by the disappearance of arthralgias, hilar adenopathies and peripheral adenopathies.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_622_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_622_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b038d458b5cad9936948b7bda0e9ca9749843ca5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_622_en.txt
@@ -0,0 +1,7 @@
+A 78-year-old male presented at our hospital in April 2005 with a history of bronchial asthma and pulmonary emphysema first diagnosed at age 66 years. He had been an office worker for 40 years and had never been involved in agriculture. He had therefore had no obvious opportunity for exposure to the citrus pathogen in his work environment or in and around his house. His asthma was of the non-atopic type and moderate, as defined by the Global Initiative for Asthma Guidelines 2002. The patient was an ex-smoker with a Brinkman Index of 1590. He was being treated with inhaled corticosteroids and theophylline. On first presentation in April 2005 to our hospital, he did not have asthma exacerbation or increased sputum production, but his dyspnoea on effort was graded 2 on the Hugh–Jones scale. In April 2005, when the patient was 78 years old, an abnormal shadow representing a cavity was found in the left upper lung on chest X ray at his yearly medical check-up. At the time the patient did not have increased sputum production, but chest computed tomography (CT) revealed a thin-walled cavity about 4 cm across and containing a fungus ball in the left upper lobe (S1 + 2); a CT scan taken 2 years previously had revealed only a small cavity indicative of emphysematous change (Figures a,
+b). There were no inflammatory changes in the peripheral blood (leukocyte count, 7950 cells/μL; C-reactive protein, 0.23 mg/dL; erythrocyte sedimentation rate, 10 mm/h; Aspergillus antigen, negative; β-D glucan, negative), but antigen-specific precipitating antibodies to Aspergillus flavus and P. digitatum were confirmed in the patient’s serum and pleural fluid by Ouchterlony double immunodiffusion testing
+. No A. flavus or P. digitatum and no bacteria or tubercle bacilli were detected in cultures of sputum or bronchial lavage fluids. We diagnosed the patient with lung aspergilloma and treated with itraconazole (100 mg/day) for 3 months. However, the cavity became larger and thicker-walled (Figure c, July 2005), and the patient developed back pain. He was admitted to our hospital on 25 July 2005 and was treated for 3 months with an increased dose of itraconazole (200 mg/day) with added micafungin (300 mg/day). The patient’s vital capacity (VC) of 2.64 L, percentage VC of 85.7%, forced expiratory volume in 1 s (FEV1) of 1.09 L, and percentage FEV1 of 50.9% in August 2005 was lower than his VC of 3.01 L,%VC of 95.6%, FEV1 of 1.12 L,%FEV1 of 49.6% in 2003. The patient was unable to undergo further lung function tests because of his progressive respiratory failure.
+The cavity continued to enlarge further. Its fluid content increased, and consolidation appeared around it (Figure d, October 2005). The patient’s medication regimen was changed to voriconazole (400 mg/day), amphotericin B (10 mg/day), and fluconazole (400 mg/day), in addition to itraconazole (200 mg/day) and antibacterials. Treatment with this broad range of antimycotics and antibiotics did not slow the growth of the cavity: its fluid content continued to increase, and invasive consolidation and pleural effusion developed (Figure e, December 2005; 1f, January 2006). The pleural effusion increased, and the patient began producing purulent sputum. He died in February 2006 from progressive renal failure. Sputum samples yielded a single fungus, which was isolated repeatedly on potato-dextrose agar in large quantities. It was identified as P. digitatum and had the form of a spreading organism with a mealy, grey-green colour that turned olive green in culture. The abundance of the organism’s elliptical spores was greater in the patient’s sputum culture (Figure ) than in cultured reference colonies
+. This fungus was confirmed to be P. digitatum by molecular identification. Partial sequences of the β-tubulin gene determined by using the primers Bt2a and Bt2b underwent BLAST analysis at the National Centre for Biotechnology Information.
+We found antigen-specific precipitating antibodies to A. flavus and P. digitatum in the patient’s serum (Figure a) at April 2005.and pleural effusion at November 2005 by using Ouchterlony double immunodiffusion testing with A. flavus and P. digitatum antigens (HollisterStier, Spokane, WA, USA). We confirmed the presence of antigen-specific precipitating antibodies to P digitatum by using antigen derived from the patient’s sputum culture fluid or extracted directly from his sputum (Figure b).
+To extract the antigen from the sputum culture, we added 1.5 mL of Glass Beads (Biospec Product, OK, USA) to the patient’s sputum and crushed the mixture with a Mini-Beadbeater (Biospec Product, OK, USA). It was then incubated with 0.125 mol of NH4CO3 overnight at 4°C and the antigen extracted after freeze-drying of the filtrate. We diagnosed invasive pulmonary penicilliosis due to P. digitatum.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_634_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_634_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2c15fb59974151028564dc7009563632134522b8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_634_en.txt
@@ -0,0 +1,9 @@
+A 43-year-old man visited our hospital with left facial swelling involving the buccal and submandibular areas.
+A 43-year-old male patient was admitted to our outpatient department complaining of swelling and pain in the left hemifacial area which started two weeks prior to consult. The patient had fever for approximately 10 d, but no other systemic symptoms occurred. At the time of the visit, the patient had fever with a temperature of 38.0 °C.
+The patient was diagnosed with diabetes mellitus treated with insulin. In addition, the patient had no history of illness associated with CNF, such as dental procedures, including tooth extraction, skin trauma, head and neck infections, and other facial fractures.
+The patient had no medical history other than diabetes mellitus, and no family history of CNF.
+Preoperative: On physical examination, trismus and thinning of the skin with crepitation were observed on the left cheek. There were also no pathological findings on dental examination.
+Postoperative: On postoperative day (POD) 1, after surgical decompression by incision and drainage, the patient’s systemic condition worsened, accompanied by tachycardia, hypotension, and overall deterioration of the patient’s condition; hence, septic shock was considered.
+At the time of hospitalization, the glycated hemoglobin (HbA1C) level was elevated at 17.1, indicating uncontrolled diabetes. The Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) scoring system was used for proper diagnosis of necrotizing fasciitis. Laboratory findings showed a high white blood cell (WBC) count (15170/μL; LRINEC score 1 point), a low hemoglobin level (10.5 g/dL; LRINEC score 2 points), an elevated high-sensitivity C-reactive protein (hs-CRP) level (212.94 mg/L; LRINEC score 4 points), a high glucose level (242 mg/dL; LRINEC score 1 point), and a slightly low sodium level (134 mmol/L; LRINEC score 2 points). The following results were normal: Creatinine, bilirubin, aspartate aminotransferase, and alanine aminotransferase. The patient had a score of 10 points in the LRINEC, indicating a high risk of CNF. In addition, the albumin level was low at 2.3 g/dL. Procalcitonin, measured on the 3rd d after admission, was elevated at 1.140 ng/mL (normal range: < 0.1 ng/mL). Blood cultures after admission, wound swabs, and tissue cultures of the surgical field showed gram-negative Klebsiella pneumoniae (K. pneumoniae).
+Preoperative: On facial CT, multiple abscesses with air bubble in the left temporal, masticator, and buccal spaces along the fascial layer were observed . Pleomorphic wall-enhancing lesions were also observed in the left masseter and temporalis muscles .
+Postoperative: On POD 1, follow-up CT revealed that the abscess pocket had become smaller. However, after decompression of the CNF, the patient’s general condition deteriorated and progressed to septic shock. Contrast-enhanced chest CT was performed because multiple nodules were observed on chest X-ray upon admission . On chest CT on POD 2, septic emboli and pneumonia were observed in both lungs . In addition, a lesion suspected as renal abscess was observed on chest CT. On POD 3, contrast-enhanced abdominopelvic CT (APCT) was also done, which showed multiple variably-sized renal abscesses in both kidneys . This raised the suspicion that septic pneumonia and renal abscesses were the sources of sepsis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_642_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_642_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..13b853a87c0c920f44ac413ea0f9bcc522ff0611
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_642_en.txt
@@ -0,0 +1,9 @@
+A 52 year-old woman collapsed at her home in front of an acquaintance. “Bloody vomit” was noted. An ambulance was called and cardiopulmonary resuscitation (CPR) was begun by paramedics. The patient was transported to hospital, but she remained in cardiorespiratory arrest despite ongoing CPR. Resuscitation efforts were finally stopped.
+It was later learned that several days prior to her death she had complained of unspecified upper digestive symptoms, but had steadfastly refused to seek medical advice. The medical history included bipolar disorder for which she was apparently compliant in taking her medications. She also smoked and had type II diabetes. Her medications were the following: quetiapine, lorazepam, baclofen, glickazide, metformin, and esomeprazole.
+The coroner was notified and an autopsy was requested.
+A complete autopsy was performed. The pertinent anatomic findings were confined to the gastrointestinal tract. The middle portion of the esophagus showed a prominent brownish 9 cm longitudinal ulcer, with a maximal width of 0.5 cm, situated 12 cm from the esophago-gastric junction . The esophago-gastric junction itself showed brownish steaks without ulceration, induration or a mass lesion. The stomach contained approximately 750 ml of dark blood; the small bowel and colon contained dark, tarry blood. There was no identifiable mucosal lesion beyond the esophagus.
+Microscopic examination of numerous sections (>30) from all levels of the esophagus, including the ulcer, showed complete sloughing of the epithelium with a striking subepithelial lichenoid lymphocytic infiltrate extending into the muscularis mucosae . Sections of the esophago-gastric junction showed no evidence of varices. Fungal elements and viral inclusions were absent; Periodic acid-Schiff staining for identification of fungi and immunohistochemical staining for Cytomegalovirus and Herpes simplex viruses I and II were negative.
+An extensive immunohistochemical study was performed in order to characterize the immunophenotype of the lymphocytic infiltration. The following antibodies were used: CD20, CD2, CD3, CD4, CD5, CD7, CD8 and CD43. Unfortunately, marked post-mortem autolysis rendered interpretation difficult. Only CD43 staining was well preserved , showing diffuse positivity, thus demonstrating that the lymphocytic infiltrate was essentially composed of T-cells. For the other antibodies the results were less reliable, although better antigen preservation of the deeper situated lymphocytes in the muscularis mucosae was noted. Here, a high CD8/CD4 ratio was found. CD2, CD5, CD7 and CD20 were negative, but, given the absence of positive controls for these markers, interpretation was essentially impossible.
+A representative formalin-fixed, paraffin-embedded tissue block was submitted for evaluation of T-cell receptor gamma chain rearrangement by polymerase chain reaction. However, amplification was not possible for technical reasons.
+Laboratory results were the following: lorazepam at a therapeutic blood level; tetrahydrocannabinol metabolites were also present. Ethanol was absent. Blood acetone: 10 mmol/L (normal: 0–0.34), ocular liquid glucose: 640 mg/dL, ocular liquid lactic acid: 230 mg/dL, and ocular liquid acetone: 12 mmol/L. The results were compatible with diabetic ketoacidosis (DKA).
+The final autopsy diagnoses were: 1) fatal upper gastrointestinal bleeding due to lichenoid esophagitis with diffuse mucosal sloughing and a large ulcer of the mid-esophagus, and 2) diabetic ketoacidosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_648_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_648_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1b2f725063486db18003569db6b98ba1a6535faa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_648_en.txt
@@ -0,0 +1,3 @@
+A 29-year-old Hispanic woman presented to the emergency department with a 9-day history of intense holocranial headache associated with nausea and vomiting. She was discharged home with symptomatic treatment after complete resolution of symptoms and exclusion of all neurological causes. However, she subsequently developed horizontal diplopia and gait abnormalities and was readmitted to hospital because of abnormal eye movements and conjugate gaze palsy.
+Physical examination was otherwise normal, but the mental status examination showed reduced attention. On cranial nerve examination, abduction was bilaterally limited with a compensatory abduction nystagmus. Pupils were normal. Dysmetria and dysdiadochokinesia were found on the left side of the body.
+Increased signal intensity in the right pontomesencephalic junction was observed on T2-FLAIR and diffusion-weighted MRI sequences . White matter hyperintensity was also found in the left cerebellar hemisphere; these lesions appeared hypointense on T1 and ADC map sequences, suggestive of infarction. MRA findings were consistent with dissection of the left V4 vertebral artery . Antiplatelet therapy was initiated with subsequent follow-up in a vascular disease clinic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_659_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_659_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fa7f7af7a81e194b42fb2e88e873434e73ed71db
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_659_en.txt
@@ -0,0 +1,5 @@
+A 35-year-old female patient arrived at our department complaining of back pain, heart palpitations, and fatigue due to the large size of pericardial mass causing a pressure symptom. No symptoms of hypertension, fever, extrasystoles were found on physical examination, and no arrhythmia or rhythm disturbances were found on the electrocardiography. No previous medical and family history was declared by the patient. A chest X-ray showed that the patient’s cardiothoracic ratio was enlarged and that her cardiophrenic sinus was obscured on the right side (see Fig. ). A transthoracic echocardiography indicated pericardial effusion, tricuspid, and pulmonary insufficiencies and showed a large echogenic mass involving the pericardium beside the right heart. Pericardiocentesis was performed, and a cytologic examination of the bloody pericardial fluid obtained though fine needle aspiration (FNA) showed monotonous cells with oval-spindle vesicular nuclei with less amphophilic cytoplasm, evenly distributed chromatin, and inconspicuous nucleoli that formed groups in hypocellular samples (see Fig. ). Overlapping nuclei were observed locally. During pre-diagnosis, a spindle cell mesenchymal tumor with uncertain malignant potential was considered. Adequate sample cannot be obtained from aspiration for cell block preparation.
+A contrasted CT scan of the chest showed a heterogeneously enhanced lesion measuring 12 cm x 11 cm x 6.5 cm located in the right mid-anterior of the pericardial area (see Fig. ). The mass had a heterogeneous internal structure, creating significant pressure on the right heart and superior vena cava. There was no radiological space between the mass and the right heart, and no significant vascular, cardiac, or thoracic wall invasions were observed. No lymph node involvement was observed in the mediastinal or hilar regions. The trachea, including both main bronchi and bronchial trees, was open. Neither an active infiltrative appearance nor any nodular lesions could not be seen in the lung parenchyma (see Fig. ). All radiological findings were indicative of either a pericardial fibroma or a pericardial sarcoma, both of which were noted in the differential diagnosis. On positron emission tomography (PET)-CT imaging, only the pericardial mass showed increased F-18 fluorodeoxyglucose (FDG) uptake with a maximum standard uptake of 5.3. No lymph node metastasis was detected radiologically.
+After the radiological examinations, the pericardial mass was decided to be resected. During thoracotomy, the pericardial mass was found to invade the ventricular wall and main vascular structures, therefore, the mass was resected incompletely. Due to the location, extent and nature of the tumor, debulking surgery was performed and R0 surgery could not be performed. Macroscopically, any palpable lymph node was not detected during the surgery.
+Histopathologically, a spindle cell mesenchymal tumor with infiltrative limited hypercellular fascicular structure containing a small amount of loose myxoid stroma hyalinized, and necrotic areas showing mild to moderate pleomorphism were observed in fragmented mass samples (see Fig. a). A nuclear palisade was noted in the neoplastic cells, and the mitotic rate was 18 mitotic cells per 10 high power fields (see Fig. b). Mesothelioma, fibrosarcoma, a solitary fibrous tumor, leiomyosarcoma, and synovial sarcoma were all included as possibilities in the differential diagnosis. Immunohistochemical staining showed a positive reaction with vimentin, Bcl-2, TLE-1 (see Fig. c), and a negative reaction with pan-cytokeratin, HBME-1, calretinin, CD99, actin, desmin, CD34, STAT6, and S100. The Ki67 proliferation index was increased in the tumor (see Fig. d). A sample was sent to an external center where molecular studies could be performed for genetic analysis, and a real-time polymerase chain reaction (RT-PCR) test detected SYT-SSX1 fusion. With these findings, the patient was given a definitive diagnosed of monophasic synovial sarcoma.
+Postoperative radiotherapy and chemotherapy were advised but refused by the patient at first place. On postoperative 4th month, the patient decided to undergo the oncological therapies, however, a six-week pregnancy was detected, therefore, only radiotherapy was applied due to the enlargement of pericardial mass. The chemotherapy was postponed for one year. After the term delivery, the patient suffered from the respiratory distress due to enlargement of the mass in the pericardial region to 14 cm in diameter, therefore, six cycles of doxorubicin and ifosfamide combination were administered. An emboli in the left main pulmonary artery, a pleural effusion in the right hemithorax, and a metastatic mass in the liver were detected. The patient whose respiratory parameters deteriorated was followed up in the intensive care unit. During this follow-up, the patient, who had myocardial infarction 21 months after the operation, died.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_661_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_661_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e167b5b2c3389e099ffc4c4a45ed601387b850ae
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_661_en.txt
@@ -0,0 +1,4 @@
+A 20-year-old man presented to the outpatient department with a palpable mass in the posterior aspect of his knee for the past 3 years. The mass was painless, gradual in onset, and slowly progressed to a size of 10*9 cm when he presented to the outpatient department. The patient had difficulty in squatting for the last 3 months. On local examination, the mass was non-tender, had soft-to-firm consistency, well-defined edges, was smooth, and non-movable with no visible or palpable pulsations. The mass was non-reducible and was not fixed to the overlying skin. Overlying skin showed no signs of local inflammation. Knee flexion was slightly decreased due to the mass effect of swelling with associated discomfort. Distal pulsations were symmetric with no neural deficit.
+Lateral plain radiography of the right knee showed a diffuse, non-specific soft-tissue density, with no evidence of calcifications or connection to the underlying bone. Local ultrasonography revealed a heterogeneously hypoechoic lesion of size 9.6*8.6 cm in the right popliteal fossa increased with internal vascularity and signs of inflammation. No associated knee effusion was noted. Due to financial constraints, magnetic resonance imaging (MRI) could not be performed. The patient was counseled about the importance of obtaining an MRI; informed consent was taken to proceed with an excisional biopsy.
+An excisional biopsy was performed using a posterior approach. The mass was located between the two heads of gastrocnemius, under the superficial fascia . It was encapsulated with no major adhesions, and separation from the surrounding soft tissue was relatively easy using blunt dissection considering the proximity of the mass to nearby neurovascular structures. A solid and brownish-red mass was excised and sent to a pathologist for further histopathological examination. The mass was well circumscribed and the cut surface showed gray-white myxoid change with a yellowish fatty center with interspersed vascularity . On histopathology, spindle-shaped fibroblasts arranged in fascicular pattern showing “a tissue culture appearance.” Cells were slender, and elongated with oval nuclei and prominent nucleoli. Intervening collagenous stroma shows myxoid changes with a few blood vessels and focal inflammation .
+There were no neurological or vascular complications post-operatively. Three months post-operatively, the patient showed clinical improvement in symptoms and could squat without discomfort.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_662_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_662_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d717b2699c92873ca6d5f939f97181c6b5688117
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_662_en.txt
@@ -0,0 +1,7 @@
+A 74-year-old indigenous Malaysian man, an ex-smoker of tobacco, with underlying severe aortic stenosis, atrial fibrillation, hypertension, and chronic kidney disease presented to us with a 6-month history of lethargy, subjective loss of weight, loss of appetite, and night sweats associated with a sharp, persistent right-sided headache and left hip pain. He denied any pruritus. He denied chronic cough, and had no significant travel history or high risk behavior. He had no family history of malignancy. He had no baseline ultrasound of the genitourinary tract, having refused investigation of his chronic kidney disease previously.
+Prior to this current admission, he had been admitted two times over the past 4 months for hyponatremia and normochromic normocytic anemia, with initial serum sodium measuring 120 mmol/L and 124 mmol/L, respectively. Peripheral blood film showed features suggestive of iron deficiency anemia; concurrent with a serum iron level of 9.7 umol/L with calculated transferrin saturation of 21.2%. Ferritin and B12 levels were normal while a fecal occult blood test was negative. On both occasions, he received intravenously administered saline and subsequently was discharged with orally administered sodium supplements. Tests for thyroid function and cortisol levels from a previous admission were normal.
+On admission, he was afebrile with a blood pressure of 130/70 and pulse rate of 70. An examination revealed a mildly cachexic man with generalized disuse atrophy of all limbs. Functionally, he was unable to ambulate due to left hip pain. There was tenderness at his left hip with reduced passive and active movement due to pain, and a bony protuberance at the posterolateral aspect of the right side of his scalp. There were no neurological deficits, and respiratory and abdominal examinations were unremarkable.
+On examination of the skin, there were diffuse brown well-circumscribed pigmented lesions of undetermined onset over his face and trunk suggestive of multiple seborrheic keratoses. The lesions over his posterior trunk were distributed in a symmetrical “Christmas-tree” pattern .
+An electrolyte investigation showed low serum sodium of 119 mmol/L. All other electrolytes were within normal range, and there was no derangement of liver enzymes. A chest X-ray on admission showed bilateral multiple irregular nodules and prominent hilar opacities . In view of long-standing headache, we proceeded with non-contrasted computed tomography of his brain, which revealed a well-defined round hyperdense lesion at the right high frontal cortex measuring 0.7 × 0.7 cm, associated with perilesional edema . There was a lytic lesion at the right parietal bone with expansile soft tissue component . Resource limitations precluded a follow-on magnetic resonance imaging (MRI). Computed tomography of his thorax, abdomen, and pelvis revealed a heterogeneously enhancing soft tissue mass at the right kidney measuring 3.8 × 4.4 × 3.7 cm, with no evidence of obstruction or hydronephrosis . There was evidence of bilateral metastatic lung nodules, and multiple hilar and paratracheal nodes . There was no evidence of aortic aneurysm. There was also a 5 × 5cm lytic lesion at the left ilium, consistent with his left hip pain .
+Further biochemical investigation showed increased urine osmolarity of 303 mOsmol/kg and urine sodium of 48 mmol/L; in view of prior normal thyroid function, cortisol level, and clinical euvolemia, we diagnosed him as having syndrome of inappropriate antidiuretic hormone secretion (SIADH). Fluid restriction was commenced and his sodium levels recovered to 131 mmol/L over 5 days. He was referred to the Dermatology team; in view of the findings of metastatic renal carcinoma, the skin lesions were attributed to Leser–Trélat syndrome.
+Having been thoroughly counselled on his condition, he refused renal and skin biopsy and was not keen for further intervention. Despite the absence of a histopathological diagnosis, the constellation of clinical and radiological features was suggestive of a renal malignancy with metastasis, and he was referred to the Palliative Care team for further management.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_663_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_663_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..70fc53e9149e956f96bca1783fe4854788f3a045
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_663_en.txt
@@ -0,0 +1,3 @@
+A 61-year-old woman presented with pain in her chest wall for two months, and had no significant medical history, such as trauma, infection, or tumor. The pain was located in the left lower chest in a band-like pattern overlapping the T10 dermatome. The pain was intermittent and occurred several times a day, continuing for 10–20 min each episode and alleviated when lying down. The pain was considered to be intercostal neuralgia.
+To identify the cause of the neuralgia, we performed MRI, which revealed multiple cysts at the T9–T11 nerve roots bilaterally . No other causal abnormality for the chest wall pain was found other than the cysts. The interior of the cysts showed similar intensity to the CSF on imaging. The largest cyst was at the level of the left T10 vertebra and had a linear shadow that suggested the presence of nerve root fibers. Computed tomography (CT) with myelography was also performed to study CSF communication between the thecal sac and the cysts. After 10 mL of 240 mg I/mL iodinated contrast medium (Omnipaque 240, Daiichi Sankyo, Inc., Japan) was injected into the thecal sac at L4/5 in the lateral recumbent position, the first CT image was taken immediately (left and middle columns of Fig. ), and revealed multiple cysts from T6–L2, including small cysts. The cysts were enhanced by the contrast medium and most showed the same intensity as that of the thecal sac at the corresponding level; however, the largest cyst at left T10 and another at left T9 showed much higher concentrations of the contrast medium. Three hours after the injection, the intensities of the cysts and the thecal sac were equal on the second CT (right column of Fig. ). The next day, another CT examination showed no detectable contrast enhancement. Based on these findings, we suggested a diagnosis of multiple perineural cysts.
+The patient was treated with an intercostal nerve block at T10 with 50 mg of mepivacaine hydrochloride (Carbocain, AstraZeneca, Inc., Japan) and 4 mg of dexamethasone sodium phosphate (DEXART, FujiPharma, Inc., Japan), and the pain subsided. Nine months later, the neuralgia recurred and another nerve block again relieved the pain. There was no recurrence 22 months after the last nerve block.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_665_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_665_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..236dbfdc56d3a22dad79055dc50f7bb518766b70
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_665_en.txt
@@ -0,0 +1,8 @@
+A 25-year-old female health-care worker from central India, known SCD on folic acid and hydroxyurea, was admitted to our hospital 1 year back with complaints of fever and pain in the abdomen. She was diagnosed as a case of dengue, for which she was admitted under a physician. During the hospital course, her blood parameters revealed thrombocytopenia and blood culture showed growth of Klebsiella (all sickle cell patients are susceptible to capsulated organisms such as pneumococcus, Klebsiella, hemophilus due to functional asplenia, the patient did not receive any steroids during her hospitalization for dengue). She was then managed with a transfusion of platelets and blood products and was started on IV antibiotics injection Ceftriaxone + Tazobactam 8 hourly for 3 days, following which she showed improvement and was shifted to, oral doses of Cefixime 200 mg + Dicloxacillin 500 mg that were given for a week and was discharged.
+Following an asymptomatic period of 2 weeks, the patient presented with pain over the bilateral forearm and legs. On examination, there was local warmth and bony tenderness at the right forearm, no local discharging sinus, and no clinical evidence of a subcutaneous collection.
+On evaluation, the plain radiological features were suggestive of periosteal changes and lytic lesions-osteomyelitis, although, the uniqueness of presentation of her symptoms was “Multifocal Bilaterally symmetrical involvement.” Laboratory evaluations were remarkable for leukocytosis with a white blood cell count of 18.4 × 103 (6.0–17.5) and C-reactive protein of 35 mg/dL.
+Differential diagnosis of the presenting condition was:
+Chronic multifocal recurrent osteomyelitis (CMRO) Multifocal pyogenic osteomyelitis Vaso-occlusive crisis leading to multiple bone infarcts.
+Further to confirm our diagnosis, the incisional bone biopsy by corticotomy and debridement of the lesion from the most symptomatic right forearm region (right ulna) was performed.
+The culture of biopsy from right ulna showed the growth of Klebsiella sp. and was only sensitive to Co-trimoxazole.
+The patient was started on co-trimoxazole, and she tolerated well and had a significant clinical improvement in the form of subsidence of pain, normalization of the blood counts along with the acute phase reactants. The antibiotic treatment was continued for 6 weeks, the patient was observed closely post-hospitalization, continued to recover well, and completed her antibiotic course without any issues. She has not had any more recurrences of osteomyelitis or other serious infections till 1-year follow-up ( and ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_666_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_666_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..feea49a2ef8945f7f84ddcca3d7531ac00636ca2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_666_en.txt
@@ -0,0 +1 @@
+On December 2016, a 55-year-old, non-smoker Chinese male with an ECOG score of 0 underwent chest X-ray due to fracture of the left clavicle. The chest X-ray incidentally revealed a space-occupying lesion in the left lower lobe of the lung. Except for persistent coughing for a month and mild hemoptysis, no other clinical symptoms were reported by the patient. Thoracic computed tomography (CT) scans confirmed the chest X-ray results showing a tumor volume of 41x44mm with a relatively clear margin. The disease was pathologically staged as T2aN0M0 (stage IB) after left lower lobectomy and mediastinoscopy. Further histologic examination of the surgical tissues revealed adenosquamous lung carcinoma with predominantly papillary adenocarcinoma pattern (Additional file : Figure S1). Adjuvant chemotherapy was also administered to the patient with a total of 4 cycles of chemotherapy regimen including 2 cycles of 40 mg vinorelbine plus 80 mg nedaplatin and 2 cycles of 100 mg docetaxel plus 80 mg nedaplatin administered every 3 weeks. On August 2017, chest CT revealed no disease recurrence in the lungs ; however, colonic polyps were discovered during his physical examination. Initial biopsy revealed tubulovillous adenoma with low-grade intraepithelial neoplasia. Complete endoscopic resection was scheduled and removed three polyps in the transverse colon with sizes between 6 to 8 mm. Histopathologic analyses revealed moderately differentiated adenocarcinoma with submucosal invasion. No systemic therapy was administered to the patient. On December 2017, after being disease-free for about 5.4 months, the patient returned to the clinic due to pain and discomfort in the right waist. Ultrasonography and CT urography revealed moderately increased renal echogenicity and a 51x60x68mm obstruction in the right kidney, respectively, which are highly suggestive of renal carcinoma . In addition to revealing an elevated 2-[18F]-fluoro-2-deoxy-D-glucose (FDG) uptake of the right kidney that is indistinguishable from the liver, positron-emission tomography (PET)/CT scanning also revealed mediastinal lymphadenopathy and slightly elevated FDG uptake of the sigmoid colon, suggestive of malignancy and metastasis . No sign of disease recurrence or relapse was detected in the thoracic region . Right radical nephrectomy and inferior vena cava thrombectomy were performed to remove the 55x53x35mm tumor. Further examination revealed renal pelvis invasion with renal vein involvement and presence of a 13 mm nodule in the renal hilum. No growth was found in the renal capsule and ureteral muscle. Histopathology results revealed poorly differentiated tumor cells. The new malignancy was suspected to be squamous cell urothelial carcinoma, but with the possibility of kidney metastasis considering a history of lung cancer. However, the lack of immunoreactivity of the kidney tumor sample with thyroid transcription factor 1 (TTF-1) and cytokeratin 7 (CK-7) antibodies did not support pulmonary origin . To rule out the possibility of the tumor in the kidney being another primary site, we explored the use of capture-based targeted NGS to understand its biology compared to the two earlier malignancies. The three archived surgical tissues, as well as paired white blood cell samples, were sequenced using a targeted panel with 520 cancer-related genes, spanning 1.64 Mb of the human genome (OncoScreen Plus, Burning Rock Biotech). A total of 16, 15 and 7 mutations were detected in the lung, kidney and colon tumor samples, respectively . Interestingly, comparative analysis revealed a similar mutational signature between the lung and kidney tumors, sharing 67% (10/15) of the mutations. Except for the FANCC W113X and KMT2C S321 N common to the three tumor samples, no other mutations were shared between the colon and either the lung or the kidney tumor samples . These sequencing results indicate that both the lung and colon tumors were primary tumors; while the kidney tumor originated from the lung . Consistent with the detection of FANCC W113X in all the three tumors, the pathogenic mutation was also detected in his germline as a heterozygous mutation . In addition, FANCC W113X was also detected in the son of the patient (III, Fig. ). Further investigation of the family history revealed that the father of the patient was previously treated for colon cancer with no recurrence reported (I, Fig. 3). After the nephrectomy, the patient did not receive further systemic treatment due to persistent fever and infection. The patient passed away on August 2018 due to severe infection, with an overall survival of 20.4 months. His son is still currently cancer-free.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_673_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_673_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d358f208e40024cb1b576ea7cfb326178ce58311
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_673_en.txt
@@ -0,0 +1,6 @@
+A 45-year-old obese male with Stanford A DeBakey type-II aortic dissection, atrioventricular re-entrant tachycardia, and atrial regurgitation was complaining of chest discomfort accompanied by palpitations, nausea, and cold sweats. Patient had a history of controlled hypertension with nebivolol 2 × 5 mg, as well as pericardial effusion and right bundle branch block 8–10 years prior. Previously, the patient was treated with anticoagulants and anti-arrhythmic medications. The patient was an ex-smoker for 16 years before quitting 6 years ago without any history of cardiac disease in the family. His vital signs on arrival were stable with normal jugular venous pressure, widened pulse pressure 99/59 mmHg similar in both arms, and soft diastolic aortic heart murmur. Laboratory findings were elevated for white blood cells, erythrocyte sedimentation rate, D-dimer, and cardiac marker. Plain chest X-ray showed aorta elongation with cardiomegaly and basal infiltrate on the right lung and middle segment of the left lung. Transthoracic echocardiography (TTE) evaluation revealed aortic root and ascending aorta aneurysm with mild atrial regurgitation secondary to dilated aortic root. Based on the assessments, the patient gave consent for Bentall procedure to replace the dissected aorta.
+Ascending and hemiarch replacement Bentall procedure was conducted successfully despite severe adhesion between epicardium and pericardium layer along with resolved complication of sinus bradycardia. The tear started at the level of aortic valve commissure extending to the ascending aorta and middle arch without sign of rupture. Circulatory arrest time was 30 min. Post-intervention, patient was prescribed antibiotics and antifibrinolytic drugs. Anticoagulant medication warfarin for prosthetic valve maintenance was postponed due to concerns of high bleeding risk from aortic dissection and Bentall procedure.
+7 days post-operation, the patient unintentionally strained himself while defecating causing sudden shortness of breath, right chest pain, Visual Analogue Scale (VAS) 5–7, and cold sweats with persistent hypotension (81/51 mmHg) and tachypnea (24 breaths/min), despite fluid support and vasoconstrictors. His electrocardiogram reading was normal. Laboratory tests showed insignificant erythrocyte reduction within predicted value (from 13.1 to 11.1 g/dL in 2 days), raised troponin-T marker (341 pg/mL), hypercoagulable state, and acute kidney injury (estimated glomerular filtration rate 65.9 mL/min/1.73 m2). Transthoracic echocardiography examination showed middle right ventricle free wall hypokinesis with apical sparing. Additionally, chest X-ray evaluation revealed right lung oligaemia and abrupt tapering of the pulmonary artery . All these findings were suggestive of PE for which the patient was prescribed anticoagulant heparin.
+However, pulmonary computed tomography (CT) angiography showed an enlarged heart with fluid collection in the right anterolateral-superior pericardial space of density 50–60 Hounsfield unit (HU) pushing the heart laterally while compressing posterior part of superior vena cava, as well as bilateral pulmonary vein and left atrium stenosis due to extraluminal cause indicating cardiac tamponade. Location of the compression at the level of vena cava and pulmonary vein supposedly gave rise to the findings that mimic that of PE. Anticoagulant therapy was immediately ceased, and the patient was scheduled for a surgical pericardiotomy.
+Transoesophageal echocardiography (TEE) evaluations were taken for comparison . Right upper pulmonary vein and pulmonary artery were narrowed due to an external compression compared with after release ( and ). The velocity–time integral (VTI) was also shown to be improved after the clot evacuation.
+During the operation, active bleeding was found at the distal anastomosis of the ascending aorta with 600 mL of blood clots pressing against the right ventricle, right atrium, superior vena cava, and main pulmonary artery . After the procedure, his haemodynamics returned to normal and was eventually discharged the following week after close monitoring. At 2 month follow-up, the patient was asymptomatic with improving exercise tolerance. Echocardiography revealed no sign of periaortic leakage from the repaired aorta.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_675_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_675_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f7329667d59d815d54082d64ede20ef5508f2b54
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_675_en.txt
@@ -0,0 +1,6 @@
+A 78-year-old male patient presented for resection of a cT4NxM0 left upper lobe lung adenocarcinoma. His past medical history was significant for hypertension, hyperlipidemia, previous smoking history, ulcerative colitis and proctitis for which he was receiving Sulphasalazine. The patient did not receive corticosteroids or neoadjuvant chemo- or radiotherapy. Preoperative spirometry was unremarkable. Preoperative computerised tomography (CT) scan of the chest revealed a left upper lobe mass with adjacent pleural tethering and consolidative changes proximate to the left mainstem bronchus (LMSB). As multiple small calcified lymph nodes were seen in the right hilar and subcarinal regions , the patient was planned for mediastinoscopy and lymph node sampling, followed by left upper lobe wedge resection should frozen section examination of the right hilar and subcarinal lymph nodes return negative for malignancy. The left mainstem bronchus measured 13.1 mm (anteroposterior) by 14.0 mm (craniocaudal) on the preoperative CT. Measurements were taken 2 cm distal to the carina, perpendicular to the axis of the bifurcation General anesthesia was induced with propofol, remifentanil and atracurium. After induction, a single lumen tube (single-use polyvinyl chloride endotracheal tube 7.5 mm internal diameter) was inserted under direct laryngoscopy on first pass and secured at 23 cm at the lips. Endotracheal tube introducers were not used. Using a standard anesthetic breathing circuit and anesthetic machine, positive pressure ventilation was instituted with pressure-control mode with a peak airway pressure of 20cmH2O and positive end expiratory pressure of 4cmH2O, achieving a tidal volume of 8 mL.kg−1 in a 2L.min−1 air:oxygen mix. Maintenance of anesthesia was performed with total intravenous anesthesia of propofol and remifentanil, titrating the effect site concentrations to achieve an appropriate depth of anesthesia according to bispectral index monitor. The patient was paralysed with an atracurium infusion.
+Mediastinoscopy was performed in supine position via a suprasternal incision, with dissection along the pre-tracheal fascia. The mediastinal lymph nodes frozen section returned negative for malignancy, and surgery proceeded to resection of the left upper lobe lesion via a left open thoracotomy. With the patient still in supine position, and using a bronchoscope (Ambu® aScope™ 4 Broncho Slim 3.8 mm outer diameter), a 9Fr Fuji Uniblocker® was inserted into the LMSB with the balloon deflated. The balloon was inflated with air incrementally under bronchoscopic guidance to a volume of 7 mL to achieve lung separation – within the manufacturer-specified maximum volume of 8 mL. The volume of air required was taken note of and the balloon was then deflated before turning the patient to the right lateral decubitus position. After final patient positioning, bronchoscopy was again used to confirm the position of the EBB and the balloon inflated to the required volume for lung separation. No obvious irregularity or compression of the LMSB was noted on bronchoscopy. There was no sign of blood before, during and after balloon inflation. Initial EBB balloon pressure measured via the pilot balloon was 31cmH2O. A Portex® cuff inflator pressure gauge was used intraoperatively for balloon pressure measurement. The EBB was not manipulated following placement, and there was no patient coughing throughout surgery. One-lung ventilation was instituted using pressure control with a peak airway pressure of 24cmH2O and positive end expiratory pressure of 8cmH2O. An air leak of approximately 100-150 mL per breath was detectable following inflation of EBB balloon, but this was managed with an increase in gas flows to 4L.min−1, sufficient to prevent collapse of the ventilator bellow and to achieve a tidal volume of 6 mL.kg−1. There was no desaturation, abnormal capnography or abnormal airway pressure or flow curves.
+A large left upper lobe tumour (3.3 cm × 5.8 cm) with pleural puckering and dense adhesions between the left hilar tissues was found intraoperatively. During surgical dissection around the LMSB, multiple air pockets with air-trapping were noted between the mediastinal pleura and mediastinal organs. A rupture was found in the posterior wall of the LMSB starting just below the carina and extending 7 cm distally , with the EBB balloon seen just beneath the peribronchial tissue. A large volume air leak was noted immediately during surgical dissection of the surrounding tissue with complete collapse of the ventilator bellow. The EBB was immediately deflated and removed, and the ETT guided into the right mainstem bronchus using a fiberoptic bronchoscope and the ETT balloon inflated to a pressure of 28cmH2O. Thus, one-lung ventilation was achieved with right endobronchial intubation.
+The LMSB was repaired with 3/0 Polydioxanone (PDS) sutures and tagged to the esophageal wall posteriorly. The ETT was then withdrawn into the trachea under bronchoscopic guidance following repair of the LMSB. The left hemithorax was then irrigated with povidone iodine and saline, and no air leak was detected with a Valsalva maneuver of 40 cmH2O. The Valsalva maneuver was performed by switching the ventilator to manual ventilation and the adjustable pressure-limiting valve closed to 40 cmH2O. Fresh gas flow was increased and the breathing circuit bag squeezed for 15 seconds to generate the needed Valsalva maneuver pressure. 40 cmH2O was used at the surgeon’s request. No subcutaneous emphysema was present on clinical examination.
+Throughout the operation, the patient was relatively stable hemodynamically. There was a slight drop in blood pressure during initiation of one-lung ventilation but this was resolved with boluses of phenylephrine and ephedrine. There was no significant hypoxia during one-lung ventilation and the lowest saturation recorded was 96%.
+The patient was extubated uneventfully at the conclusion of surgery and transferred to the intensive care unit. Broad-spectrum antimicrobial cover with Piperacillin-Tazobactam was initiated empirically. However, on the 3rd postoperative day, the patient developed altered mental status and severe bilateral pneumonia, worse on the right – the dependent side intraoperatively . This required subsequent reintubation and positive pressure ventilation. Post-operative bronchoscopy and CT revealed the LMSB repair to be intact. The postoperative course was subsequently complicated by acute respiratory distress syndrome, and a left lower lobar pulmonary embolism. The patient received a total of 67 days of positive pressure ventilation, of which 2 days were in the prone position. Unfortunately, the in-hospital stay was further complicated by multi-organ dysfunction, leading to the eventual demise of the patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_67_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_67_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3861caf4ee95effb93c1899ecbddca4b56b1a544
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_67_en.txt
@@ -0,0 +1,4 @@
+An 84-year-old male patient presented to our emergency department with bilateral hip joint pain and limited mobility due to high energy injury (a severe car accident). He suffered from trauma to the hips, chest, and lumbosacral region while riding an electric tricycle that collided with a truck. Physical examination in the emergency room indicated shortening and external rotation deformities in both lower limbs, tenderness in both hip joints (+), and vertical percussed pain of the lower limbs (+). Neurological and vascular examinations of the lower limbs were normal. Radiologic tests confirmed multiple injuries including bilateral intertrochanteric fractures, pelvic fracture, subarachnoid hemorrhage, multiple rib fractures and lung contusion. The bilateral intertrochanteric fractures were obviously displaced . Laboratory tests showed a hemoglobin level of 66 g/L, D-dimer of 5719 ug/L (normal 0-500), total bilirubin of 32.6 umol/L (normal 0–26), direct bilirubin of 12.5 umol/L (normal 0–8), and indirect bilirubin of 20.1 umol/L (normal 0–18). Despite no history of prior comorbidities, the patient was admitted to the emergency intensive care unit (ICU)due to his advanced age and poor general condition. The patient received blood transfusions and fluid resuscitation and other symptomatic supportive treatments in the ICU. The vital signs gradually stabilized, but he still complained of pain in his lower limbs (VAS 8). After 6 days, he was transferred to the orthopedic department. A multidisciplinary team (MDT) consultation was convened, involving experts from department of ICU, vascular surgery, cardiology, neurosurgery, hepatobiliary surgery, thoracic surgery, and anesthesiology. The decision was made to perform surgery after administering packed red blood cells and fresh frozen plasma to correct anemia and coagulation abnormalities. Intermuscular vein thromboses were discovered in both lower limbs. However, due to contraindications for anticoagulation therapy because of subarachnoid hemorrhage, an inferior vena cava filter was placed to prevent pulmonary embolism. Symptomatic treatment was provided for obstructive jaundice. The patient’s hemodynamics were stabilized preoperatively, with a hemoglobin level of 96 g/L and nearly normal bilirubin levels. Lactate levels decreased from 1.10 to 0.70mmol/L, and the pH value dropped from 7.454 to 7.382 .
+After 9 days of hospitalization and once the patient’s condition had stabilized, he was scheduled for surgery. The patient underwent a single spinal anesthesia session for bilateral femoral intertrochanteric fracture closed reduction and internal fixation with proximal femoral nail anti-rotation (PFNA). The surgery was smooth , lasting 2.5 h with a blood loss of 150 ml and no intraoperative transfusion. Postoperative vital signs remained stable, and the patient’s hemoglobin level was 91 g/L on the day of surgery.
+Postoperatively, the patient was under cardiac monitoring with normal blood pressure and heart rate. He experienced significant pain relief(VAS 8 to4)and was able to sit up at the bedside. On the third day after surgery, X-ray examination showed satisfactory placement of the internal implants . The patient began partial weight-bearing ambulation with the assistance of a walker. Due to the COVID-19 pandemic, the patient was discharged one month after the surgery.
+Immediately following the patient’s recovery from anesthesia, a conservative rehabilitation plan was initiated. The rehabilitation program commenced with isometric contractions of the quadriceps muscles and ankle pump exercises to promote circulation and muscle strength. On the 3rd day post-surgery, the patient was encouraged to stand and begin partial weight-bearing ambulation with the assistance of a walker. During the first two weeks post-operatively, the focus remained on bed-based and bedside muscle strengthening exercises, gradually progressing as the patient’s condition allowed. By the 4th week, at the time of discharge, the patient was able to move independently within the ward with the aid of a walker, including performing personal tasks such as using the restroom. Pre-discharge X-rays showed signs of fracture healing. The rehabilitation plan was progressively intensified, and by 3 months post-surgery, the patient had advanced to full weight-bearing indoor activities. At the six-month follow-up, bilateral femoral intertrochanteric fractures had healed , and the patient was able to walk and perform activities outdoors.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_691_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_691_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..616a78aa68067500886f01e144f8c032e8d9796e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_691_en.txt
@@ -0,0 +1 @@
+A 67-year-old woman, in good health other than systemic hypertension, lost consciousness soon after complaining of severe epigastric pain at her workplace. The ambulance crew found the patient in cardiopulmonary arrest and paramedics immediately started CPR by manual chest compressions; return of spontaneous circulation and recovery of consciousness occurred 4 min later. On arrival at the emergency room, the patient’s level of consciousness was 14 on the Glasgow Coma Scale, blood pressure was 102/74 mmHg, and pulse rate was 103/min. No cardiac murmur was detected, but vesicular breath sounds were moderately diminished in the left lung field. Cardiac enzyme studies were not consistent with a diagnosis of myocardial infarction. An ECG showed a normal sinus rhythm, and no arrhythmias or signs of myocardial ischemia were observed. A chest X-ray revealed massive left pleural effusion with no right pleural effusion, while cardiomegaly and pneumothorax were not identified. Transthoracic echocardiography demonstrated normally functioning ventricles and valves, and mild pericardial effusion. Computed tomography (CT) showed a type A acute aortic dissection (AAD) with thrombotic occlusion of the false lumen and an ulcer-like projection in the proximal arch, along with mild pericardial effusion and massive left pleural effusion . Occlusion of the branch vessels of the aortic arch and pulmonary emboli were not detected. Immediately after the CT, the patient fell into circulatory collapse. After drainage of bloody effusion from the left pleural space, an emergency operation was begun through a median sternotomy. No sternal fracture and bleeding in the mediastinum were found. When the pericardium was opened, a small amount of bloody effusion was present, but cardiac injury was not observed. In addition, a large laceration (10 cm) was found in the left posterolateral pericardium at the phrenico-pleural junction, through which the pericardial cavity communicated to the left pleural space . Neither injuries of other intra-thoracic organs such as the lung, vessels, or chest wall causing the hemothorax nor external rupture of the dissection were detected. Under cardiopulmonary bypass and cardiac arrest, the aorta was opened. The dissection with the thrombosed false lumen extended from the aortic root to the aortic arch. A primary tear was present on the lesser curvature of the proximal arch. Hemiarch replacement including the primary tear was performed without difficulty, but a large amount of inotropic agents was necessary for weaning off cardiopulmonary bypass. The postoperative course was complicated with severe low cardiac output syndrome, and the patient eventually died of multi-organ failure on postoperative day 30. An autopsy was not permitted.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_696_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_696_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7b132492012f18ee084f56f0530ed5b6386be869
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_696_en.txt
@@ -0,0 +1,3 @@
+A 21-year-old female patient was referred to the department of Periodontics, Sree Mookambika Institute of Dental Sciences [SMIDS], Kulashekaram, Tamil Nadu, India with a complaint of two gingival enlargements in the maxilla. The first enlargement was in the buccal interdental gingiva between the left maxillary central incisor (#21) and lateral incisor (#22), henceforth called Site A, and the second enlargement was present in the palatal aspect of the maxillary left lateral incisor (#22) and canine (#23), henceforth called Site B, of 2 months duration. Her past dental history revealed frequent oral ulceration, burning sensation, and erythematous gingiva. Hematological examination revealed that lymphocyte count was low. Her medical history revealed a history of asthma for which she was under medication.
+On intraoral examination, the lesions were mulberry shaped with a reddish color. The surface of the lesions was found to be pebbly in nature, soft in consistency, with bleeding on probing, pseudopockets were present without any surface ulcerations and was non-tender. The swelling was approximately 5mm X 5 mm in diameter ( and ). Intra-oral periapical radiographs of the area did not show any significant bone changes .
+The patient was informed about the treatment options and necessity for biopsy to be done. Written informed consent was obtained before starting treatment. A provisional diagnosis of inflammatory gingival enlargement was made. Differential diagnosis included pyogenic granuloma, plasma cell gingivitis, hemangioma, and fibroma.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_708_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_708_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..97ba82e4529d04fffaadb29e8540b32c3e1971fa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_708_en.txt
@@ -0,0 +1,11 @@
+A 75 year old Caucasian male with a long history of retinal changes was seen in the clinic. He had initially presented 31 years earlier, in 1985, with pigmentary changes at the macula noted by his optician. At the time his best corrected visual acuity (BCVA) was 6/9 in the right eye and 6/6 in the left eye. Fundoscopy showed pigmentary changes and drusen which were more easily visible on intravenous fundus fluorescein angiography (IVFA) . There was no evidence of any choroidal neovascular membrane (CNVM) on any of the images. The patient underwent multiple further IVFA examinations, each time demonstrating no active leak. His retinal appearance was monitored, with no conclusive diagnosis made, nor treatment available.
+Ten years later ongoing review identified that the patient had raised intraocular pressure along with optic disc changes and a diagnosis of glaucoma was made with appropriate treatment initiated. Subsequently, in 2001, the patient was diagnosed with hypertension (186/110 mmHg) which, at the time, was thought to be essential hypertension. Retinal examination demonstrated cotton wool spots and haemorrhages, consistent with hypertensive retinopathy . He was also noted to have elevated serum urea and creatinine levels which were assumed to be related to the diagnosis of hypertension.
+Following bilateral cataract surgery in 2003, which was complicated by posterior capsule rupture in the left eye, the patient was only able to achieve a BCVA of 6/36 in each eye. Due to inadequate control of IOP left sided trabeculectomy was performed in 2005.
+At the same time, aged 64 years, the patient’s urea and creatinine levels were recorded as 20.5 mmol/L (normal 2.8–7.2 mmol/L) and 474umol/L (normal 60-105umol/L) respectively and he started regular haemo-dialysis for end stage renal failure shortly afterwards. He then underwent dual renal transplant in 2009 and was initiated on systemic immunosuppression (Tacrolimus 3 mg/day) which he continues to this day. The biopsy results from the explanted kidneys are unfortunately not available. Subsequently both transplanted kidneys failed over the coming year, with no identified cause, requiring the patient to undergo bilateral nephrostomies.
+In June 2010 the patient was referred back to the Ophthalmology services, aged 69, with a presenting vision of 52 ETDRS (Early Treatment Diabetic Retinopathy Study) letters in the right eye and 35 letters in the left eye. He was again noted to have bilateral changes at the maculae which were, at the time, attributed to possible age related macular degeneration, and a small area of possible sub-retinal fluid. Comparison was made between the IVFA in 1985 and the IVFA at re-referral showing a significant increase in the number and distribution of the drusen, but no vascular leakage . The poor vision in the left eye was found to be secondary to advanced glaucoma and significant changes at the macula. No treatment was appropriate and the patient was monitored for 5 years with repeated Optical Coherence Tomography (OCT) scans.
+In 2015 the OCT demonstrated an increasing sub-foveal space, raising a suspicion of CNVM. A loading phase of intravitreal anti vascular endothelial growth factor (anti-VEGF) was initiated in the form of Ranibizumab 0.5 mg. As there was no response to six Ranibizumab injections, treatment was subsequently switched to Aflibercept 2 mg with three further monthly doses. Again there was no improvement and treatment was ceased .
+Due to an unusual appearance and history when considering age related macular degeneration, a systematic review of his previous notes and images was performed as part of a retinal multi-disciplinary team.
+At the most recent visit (October 2016) the patient’s BCVA was recorded in the right eye as 49 ETDRS letters and awareness of hand movements only in the left eye. The fundus examination demonstrated multiple subretinal drusenoid deposits, which were autofluorescent, mainly at the posterior pole. Careful review of the OCT images demonstrated that the deposits were in Bruch’s membrane, with an intact Retinal Pigment Epithelium (RPE) .
+Autofluorescence imaging demonstrated large areas of increased and decreased autofluorescence involving the macula and spreading inferiorly . OCT continued to demonstrate subfoveal hyporeflective areas. Pale optic discs were noted bilaterally, consistent with the long standing diagnosis of advanced glaucoma.
+Wide angle (102°) infra-red imaging demonstrates the limitation of the retinal disease to the posterior pole, involving the macula, crossing the vascular arcades and including the nasal peri-papillary region .
+The young age of presentation with drusen, recurrent kidney failure and increasing subretinal deposits , led to the suspicion of this being a probable case of dense deposit disease. He is currently being tested for serum C3 levels and C3 nephritic factor as well as genetic testing for a variety of mutations in complement associated genes, with the results awaited.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_731_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_731_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1d20057b9f338d10dc913dcd4ced767b2c2c7858
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_731_en.txt
@@ -0,0 +1,8 @@
+A 37-year-old woman (Body-Mass Index: 23.62 kg/m2) was attending the Ingenes Institute in México City for secondary infertility.
+The patient has been trying to get pregnant for 24 mo with negative results, using only natural methods to conceive. We proposed an in vitro fertilization (IVF) protocol, complimented with pre-implantation genetic diagnosis (PGD).
+Three years prior to her attending Ingenes, she had one previous pregnancy, which was resolved by a cesarean section after placental detachment. Afterward, she presented abnormal uterine bleeding with bloody or brown vaginal discharge, severe pelvic pain, dyspareunia, and urinary discomfort eight months after the cesarean.
+She had no other medical complications and was not taking any medications. No causes of male infertility were found in her partner.
+The patient underwent a standard course of controlled ovarian stimulation (Depot GnRH agonist, Cetrotide 0.25 mg daily dose, Merck, Darmstadt, Germany). In the immediate days after controlled ovarian stimulation started (9 d), we observed the formation of hydrometra. The patient was given a single dose of Triptorelin (0.2 mg; Gospeptyl daily Ferring Pharmaceuticals, Saint-Prex, Switzerland). Stimulation was prolonged until the diameter of leading follicles was > 18 mm (18-22 mm). Then, recombinant human chorionic gonadotropin (hCG) (Choragon 1000 IU, Ferring Pharmaceuticals, Saint-Prex, Switzerland) was administered, and oocytes were retrieved after 36 h with ultrasound guidance. All 14-18 mm follicles were aspirated, and 20 ova were collected. It was decided to proceed to fertilization and culture. The ova were fertilized by intracytoplasmic sperm injection, and six embryos developed (2AB, 2BB, and 2BC Inner cell mass/Trophoblast quality). With the embryos that reached day 5, a trophectoderm biopsy was collected for PGD, and then the embryos were frozen. After PGD, four euploid embryos were considered for implantation; however, it was decided to postpone implantation for one month to allow for endometrial preparation.
+The endometrial preparation was carried out with the application of an in situ agonist prior to the Luteal phase (Triptorelin 3.75 mg, Gonspeptyl daily, Ferring) and transdermal application of 17-β-estradiol (Evorel 50). On day 10 of endometrial preparation, the formation of hydrometra was again evident, so it was decided to cancel the endometrial preparation cycle and perform an endometrial cavity evaluation-closing of any ostia by hysteroscopy with the suspicion of a possible hydrosalpinx. The proximal closing of tubal ostia was performed without any complications, finding a normal cavity. A second endometrial preparation was performed with the same protocol. On day 10 of the endometrial preparation, the formation of hydrometra was again evident, so we decided to cancel the cycle, and treat the patient with progestin (Utrogestan, 100 mg every 12 h, 5 d, SEID, Barcelona, Spain). A new endometrial preparation with estradiol valerate (Primogyn, Bayer Health) was tried using 6 mg/d as the maximum dose, and on the 13th d of preparation, the hydrometra formation was again evident.
+None.
+A transvaginal ultrasound was performed, and in addition to hydrometra, the presence of an isthmocele was located at the anterior wall of the uterine isthmus. Its base was 6.6 mm and height was 6.1 mm, indicating the presence of a second-degree isthmocele . Re-evaluation of a previous hysteroscopy video was performed, where a thorough evaluation of the defect area was not performed, probably due to the absence of characteristic symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_732_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_732_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d28ed82fd98b3f9304e72eac95a6d5af13c45b1f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_732_en.txt
@@ -0,0 +1,2 @@
+A 64-year-old male was brought to the emergency department (ED) by helicopter after sustaining an injury falling over a fence. The patient reported injuring his “stomach” and feeling a pop followed by severe back pain. On scene, the prehospital paramedics reported no pulses in the bilateral lower extremities. Prior to arrival, the patient had been given 250 micrograms fentanyl, 20 milligrams (mg) labetalol, and 4 mg of midazolam by medics for concern of possible aortic dissection. Vital signs upon arrival included a blood pressure of 166/102 millimeters of mercury, heart rate of 92 beats per minute, 16 respirations per minute, an oxygen saturation of 96% on room air, and a temperature of 99.2ºF. Physical examination was notable for 2+ carotid and radial pulses bilaterally, and absent dorsalis pedis and popliteal pulses bilaterally. Point-of-care ultrasound identified a large infrarenal abdominal aortic aneurysm (AAA) of approximately 7 centimeters (cm) in size with contained thrombus within the lumen. ( and ).
+Computed tomography angiography of the chest, abdomen, and pelvis reaffirmed the presence of an acutely ulcerated thrombus contained within the lumen of the aorta and no evidence of extraluminal contrast extravasation. This information, combined with vascular duplex ultrasound of the lower extremity confirming extensive clot burden down to the level of the dorsalis pedis, was presented to our vascular surgeon and therapeutic interventional radiologist on call. In shared decision-making with the patient, this multidisciplinary team initiated anticoagulation with unfractionated heparin and transferred the patient to the operating room for emergent embolectomy and intra-arterial tissue plasminogen activator.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_736_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_736_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..df17bfe5fba36e404c07ea1bcd99a7a656993344
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_736_en.txt
@@ -0,0 +1,7 @@
+A 30-year-old Caucasian woman presented to the emergency department (ED) with right-sided facial and lower limb twitching. She also reported a headache for the past 5 days, similar to her previous migraines. She had taken a dose of sumatriptan approximately 6–8 hours prior to presentation to alleviate the pain. This medication had been newly prescribed by her general practitioner with no history of prior use by the patient. Shortly after taking the sumatriptan, the patient developed gradually worsening right-sided facial and lower limb twitching, with discomfort in the right arm and right leg and associated difficulty with speech. She had taken paracetamol at home prior to this event and denied ingestion of any other medications, including prescription medications as well as herbal and over-the-counter supplements. She also denied any recent alcohol or illicit drug use.
+Her past medical history was significant for longstanding depression for which she was on regular fluvoxamine 100 mg once daily, as well as hemiplegic migraines (usually managed with simple analgesia), endometriosis, and paroxysmal supraventricular tachycardia. She denied any recent changes in her fluvoxamine dose. Her other regular medications included pregabalin and tranexamic acid, which she did not take on the day of presentation. She had no significant family history and denied regular alcohol or drug use. She denied any regular smoking history.
+On initial assessment, she had a heart rate of 120 beats per minute and blood pressure of 144/96 mmHg, but otherwise normal vital signs and a Glasgow Coma Scale (GCS) score of 15. Temperature was normal at 36.5 °C. She had notably diaphoretic palms and a resting tremor in her right arm and leg. Initial ophthalmic assessment showed bilaterally sluggish and dilated pupils with ocular clonus. She had bilateral lower limb hypertonicity and hyperreflexia with six to seven beats of inducible clonus in both ankles. Power and sensation were normal in all four limbs, and full neurological examination was otherwise unremarkable. There were no other significant findings on physical examination.
+Initial electrocardiogram (ECG) showed sinus tachycardia with a QT interval below the treatment line on QT nomogram. Full blood count, electrolytes, liver function tests, and serum beta human chorionic gonadotropin (HCG) were unremarkable. Computed tomography (CT) scan of her head showed no evidence of intracranial lesion and was grossly normal for age.
+Based on her clinical presentation and history of SSRI use, the patient was diagnosed with serotonin toxicity. Differential diagnoses at the time included atypical focal seizure, alternate drug toxidrome (such as anticholinergic or sympathomimetic toxicity) or withdrawal phenomenon.
+The patient was placed on telemetry and was given supportive treatment with slow intravenous fluids as well as a dose of 12 mg oral cyproheptadine, a potent antihistamine and serotonin antagonist. Her fluvoxamine and sumatriptan were withheld, and she was kept in the ED short-stay unit overnight for a prolonged period of observation. Periodic reviews throughout her admission showed an incremental improvement in her serotonergic symptoms, with improvement in her motor symptoms and agitation, as well as her ocular and lower limb clonus.
+On her morning review, the patient had returned to baseline with resolution of her clonus and tremor and a completely normal repeat neurological examination, aside from some mild residual lower limb hyperreflexia. She was discharged home with instructions to withhold her fluvoxamine for 24 hours and to avoid taking any further concomitant triptan medications in the future, to be followed up by her usual general practitioner.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_745_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_745_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..98a0cba9f87c6d3fe6dae9ce536f0d8efa88b085
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_745_en.txt
@@ -0,0 +1,7 @@
+Liver tumors were detected incidentally during a regular liver ultrasound examination in a 48-year-old male patient without symptoms or complaints.
+Cirrhosis of the liver as well as two hepatic tumors (3 cm and 2.5 cm, both located in Couinaud’s hepatic segment 8) were discovered incidentally in March 2016 during a regular ultrasound examination.
+A 48-year-old male patient was on entecavir (baraclude) antiviral therapy for a number of years for hepatitis B viral infection.
+There was no family history of liver disease.
+The patient had no symptoms of jaundice, abdominal discomfort, or weight loss and had not received any treatment for the issue prior to admission. The abdomen was soft without any palpable masses or ascites. Sclera was not icteric.
+Laboratory results revealed serum alpha fetoprotein (AFP) elevated to 29.91 ng/mL (normal < 7.0 ng/mL). HCC was suspected without tissue evidence.
+Multiple hepatic nodules at the right hepatic lobe and left hepatic tip were recognized. The representative larger well-defined lesion, 2.5 cm in size, has obvious hypo-intensity on the fat-suppressed T1WI , hyperintensity on the fat-suppressed T2WI , significant diffusion restriction with hyperintensity on the diffusion-weighted imaging and dark signal on the ADC (apparent diffusion coefficient) map at the corresponding site , and early hyperenhancement & rapid washout .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_749_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_749_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3bc84566c947bdebff585a1fa214aed98a96d78b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_749_en.txt
@@ -0,0 +1,2 @@
+This patient was a 71-year-old man with a history of grade 2 hypertension for 30 years, and he presented with dizziness for a week. As sudden urinary incontinence, weakness in right lower limb, and trouble speaking, he underwent an emergency non-enhanced head computed tomography (CT) examination. The CT examination showed a slightly low-density area in the left frontal lobe and the left temporal lobe, which raised a suspicion for acute infarctions. The following contrast-enhanced head CT and magnetic resonance imaging (MRI) examinations showed no infarction, but a 1.7 × 1.4 × 1.3 cm sellar occupied lesion with heterogeneous enhancement . The patient had normal levels of pituitary hormones. Physical examinations showed the mouth drawn to the left side, the right nasolabial fold blunting, and the deviation of the protruded tongue toward the right side, which indicated a right facial paralysis. The symptoms were effectively relieved after the patient underwent the drug treatment including aspirin and atorvastatin for secondary prevention of stroke and ginkgo biloba extract for symptomatic treatment. The patient subsequently underwent transsphenoidal resection of pituitary mass on October 22, 2019.
+The greyish-white colour resected specimen was about 1.5 cm in diameter. Histologically, this tumour contained hypocellular and hypercellular areas that showed apparent geographical separation . The hypocellular area showed elongated spindle cells arranged in a fascicular pattern around small vessels and scattered Herring bodies. The spindle cell had blunted-ended to irregular nuclei with abundant, palely eosinophilic, fibrillary cytoplasm . The hypercellular area was characterised by pseudorosettes in which the tumour cells showed crowding, overlapping the nucleus with speckled nuclear chromatin . Mitoses were not seen in the tumour. Immunohistochemistrically, the tumour cells showed diffuse nuclear expression of TTF1 . S100 and neuron-specific enolase (NSE) expressed in the tumour cells and Herring bodies. Neurofilament (NF) was completely negative in the hypercellular area but had a little positive in the hypocellular area . Silver impregnation was only noted in a perivascular distribution . Ki-67 showed extremely low proliferative index in the tumour. The other markers were negative, including glial fibrillary acidic protein, Olig2, SOX10, CD68, adrenocorticotropic hormone, thyroid stimulating hormone, growth hormone, prolactin, luteinizing hormone, follicle-stimulating hormone, SF1, PIT1, TPIT, cytokeratin, epithelial membrane antigen, CD68, and Galectin-3, neither was periodic acid–Schiff. The final diagnosis was pituicytoma with a biphasic pattern and admixed with scattered Herring bodies. The patient made a good postoperative recovery and had no recurrence at 4 months of MRI follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_754_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_754_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d77027fe9f1fdab1f14deed84c2b477d5291131
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_754_en.txt
@@ -0,0 +1,5 @@
+A 75-year-old, male patient with metastatic RCC was admitted to our hospital with new-onset dysphagia and weight loss. His first surgical resection of RCC was a right nephrectomy with adrenalectomy which he underwent 20 years ago, and the second resection was a left partial nephrectomy for metachronous primary left RCC performed 12 years ago. Nine years later, computed tomography (CT) showed a 4-mm, early enhancing tumor in the pancreatic head and a 6-mm, early enhancing tumor in the pancreatic tail. PM-RCC was diagnosed. Total pancreatectomy was proposed, but he declined it. He also declined receiving tyrosine kinase inhibitors and interferon therapy was started. Although its adverse events were minimal, the patient discontinued the treatment on his own discretion. He declined any further anticancer drug therapy and was followed up every 3 months as an outpatient. The pancreatic metastases gradually increased in size and number, but were asymptomatic. Multiple pulmonary metastases also appeared 3 years ago, and dyslexia caused by a brain metastasis developed 9 months ago. The brain metastasis was resected 6 months ago. The patient also had a history of a total gastrectomy with Roux-en Y reconstruction and a splenectomy for gastric cancer 23 years earlier.
+His oral intake of food was insufficient, and his Eastern Cooperative Oncology Group performance status was 2. The laboratory tests on the day before the operation showed the patient had mild anemia (Hb 9.1 g/dL) and hypoalbuminemia (Alb 2.6 g/dL). His blood coagulation, kidney and liver function, and electrolytes were normal. Esophagogastroduodenoscopy demonstrated a massive, reddish tumor on the distal side of the anastomotic site in the lumen of the jejunal limb . CT revealed that one of the metastases in the pancreatic tail had markedly enlarged compared with previous CT. PM-RCC invaded the jejunal limb and extended into the lumen. A tumor thrombus completely filled the jejunal limb, increasing its diameter to 7 cm. The proximal side of the jejunal limb had also expanded, with the tumor thrombus causing bowel occlusion . Although preoperative biopsy of the tumor was not performed because of concern about hemorrhagic complications, based on CT findings and course of tumor growth, jejunal limb obstruction due to a tumor thrombus from PM-RCC was diagnosed. The size and number of the pulmonary metastases were stable, and no new metastases were detected.
+Palliative surgery was considered as means of ameliorating the patient’s symptoms. However, because the tumor thrombus was located at a site immediately distal to the esophagojejunal anastomosis, bypass surgery would have been difficult. To remove the bowel occlusion, distal pancreatectomy with concomitant resection of the jejunal limb and re-anastomosis were considered to be necessary. Although the patient had multiple RCC metastases, his general condition remained fairly good, and tumor progression was slow. After the surgical indications were discussed in detail, palliative resection of the tumor thrombus was chosen as the method of treatment.
+Exploratory abdominal surgery revealed no peritoneal metastases. First, adhesiolysis of the upper abdominal cavity was done. The jejunal limb showed enlargement due to the tumor thrombus, which extended from the pancreatic tail, and the jejunal wall showed thinning and pallor . Intraoperative sonography (IOUS) showed a massive pancreatic mass extending into the jejunal limb . To remove the patient’s symptoms, jejunal limb resection was performed concomitantly with a distal pancreatectomy. After dividing the pancreas using reinforced staples at the site closest to the tumor based on IOUS findings, the jejunal limb was resected from a point proximal to the jejunoesophageal anastomosis to the distal side of the tumor thrombus . The jejunal limb remnant was approximately 30 cm long and was re-anastomosed to the esophagus using circular staplers while avoiding excessive tension. Blood perfusion at the anastomotic site and transverse colon was confirmed by indocyanine green (ICG) fluorescence imaging .
+The patient’s postoperative course was uneventful except for an intraabdominal infection, which was treated with intravenous antibiotics. He was discharged after achieving sufficient oral intake on postoperative day 24. Histologic examination revealed metastatic RCC of the pancreas involving the jejunum . At a follow-up examination in the outpatient clinic at postoperative 8 months, he had no gastrointestinal symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_756_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_756_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..54db03b79469b2af4f16b9004dfa173c376d2a9b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_756_en.txt
@@ -0,0 +1,3 @@
+A 72-year-old female presented in Shafa laboratory with a history of lethargy and weakness. Blood was taken for CBC evaluation and analyzed by automated heamatology analyzer (Sysmex kx-21 N). After taking the hematology results, total bilirubin and lactate dehydrogenase enzyme measured by autoanalyzer Hitachi 917 and protein electrophoresis were performed on a sample of blood serum. In addition, titration of cold agglutinin was estimated to make a definite diagnosis. Moreover, mono test was performed to rule out causative infection.
+Aggregation of RBCs, which occurs mainly at temperatures lower than 30°C, causes invalid findings when working with automated hematology analyzer (Sysmex KX 21 N). On the other hand, few values change erroneously such as RBC count, HCT, MCV and MCHC, which two latter indices show an increase. In fact, proportion between 3 fold of Hb and HCT did not correlate and this makes mismatching of CBC results. In this condition, tubes were checked and precipitation residue found sticking to the sides of the tube. To rule out a problem, the technologist was instructed to redraw a new sample. Another CBC test was run, but the results remained unchanged. Suspecting cold agglutinins, the tube warmed at 37°C for 20 minutes and after the second run, the results become valid. However, there were large clumps of red cells on the slide before warming the tubes, which should be differentiated from rouleaux formation. RBC count decreased due to doublet erythrocytes being counted as a single cell, thus resulting in a falsely high MCV. Hematocrit lowered as the volume of doublets is slightly less than two cells. The platelet count was normal. Furthermore, mild leukocytosis and anemia (Hb = 8.2 g/dL) were present. Although in biochemistry profile, total bilirubin and LDH enzyme activity were increased, protein electrophoresis seemed normal. Approximately, cold agglutinin titer measured 1:2048. Infection or overt malignancy was ruled out as the result of mono test was negative.
+Moreover, bone marrow aspiration and trephine biopsy performed and the result revealed mild erythroid hyperplasia and slight increase in lymphocyte population, while progenitor morphology and number of platelets were normal. These findings are sufficient to exclude the case for secondary chronic CAD. The case was referred for treatment with Zytux© for a while and the results were satisfactory.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_757_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_757_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..285229319e33a9ba493e03c76218ba1cc1bf0111
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_757_en.txt
@@ -0,0 +1,2 @@
+A 49-year-old male patient from Kenya presented at the thyroid surgery outpatient clinic of our institution (Hamad General Hospital, largest tertiary facility in Doha, Qatar), in July 2021. He presented with a painless neck swelling associated with compression symptoms in the form of difficult swallowing and choking since about 3 months. He had a history of hypothyroidism and was on levothyroxine. Upon physical examination, there was a hugely diffuse non-tender goiter, with no lymphadenopathy. The vitals were normal, and systems examination was unremarkable. There were no palpitations, no shortness of breath, cough, or wheezing. Family history was unremarkable. He was a current smoker.
+Ultrasound (US) of the thyroid showed large right and left thyroid lobes (43.6 and 44.1 mm in maximal antero-posterior dimension respectively). There was a hypoechoic nodule (8 × 7 × 8 mm), and lymph nodes were noted, the largest at the right upper cervical region measuring 8.4 × 6.4 mm. Another lymph node was seen superior to the isthmus measuring 17 × 9 mm. These features suggested thyroiditis (, ). FNAC of the right thyroid nodule showed scant follicular cells, abundant polymorphic lymphocytes, epithelioid histiocytes, tingible body macrophages and some colloid, suggestive of De Quervain's (granulomatous) thyroiditis . The patient was started on conservative treatment for 2 months. The patient improved but the compression symptoms recurred, and total thyroidectomy was scheduled due to the gland's size, disfigurement of the neck, and the compression symptoms. This was discussed with the patient who agreed to the plan, and it was scheduled.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_759_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_759_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b5d983f6e5213ca8f878a6f65e554d9666eebf9d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_759_en.txt
@@ -0,0 +1,5 @@
+A 52-year-old White man presented with intermittent constipation and back pain, with a history of a decrease in lymphocyte count (documented two months prior). The patient was a never smoker and had no family history of cancer or other cancer risk factors. Initial computed tomography scans revealed stage T4 prostatic adenocarcinoma with invasion into adjacent structures, metastasis to regional lymph nodes (stage N1), and metastases to the liver, bone, and a distant lymph node (stage M1) (, ). A retroperitoneal lymph node was biopsied to confirm histology. His prostate-specific antigen (PSA) level was 1291ng/mL.
+The patient started the antiandrogen bicalutamide (oral) shortly after confirmed diagnosis and a gonadotrophin-releasing hormone agonist, leuprorelin (depot injection), was subsequently initiated to affect androgen deprivation. The patient received treatment until PSA values began to rise ≈15 weeks later and the patient discontinued bicalutamide. Docetaxel (intravenous infusion; 4 cycles) plus prednisone (oral; continuous dosing) was administered as standard of care; prednisone was continued for 1 week after the end of docetaxel treatment for symptom control. The patient ultimately discontinued docetaxel/prednisone due to radiographic disease progression and PSA progression and immediately started on abiraterone as an androgen receptor targeting therapy, which continued for 7 weeks until radiographic disease progression and PSA progression. The patient also received palliative radiation of the right femur and acetabula around the time abiraterone was initiated.
+After discontinuing abiraterone, the patient was enrolled in the TRITON2 study based on results of local genomic testing of an archival tissue biopsy (retroperitoneal lymph node metastasis, 90% tumor purity) obtained at initial diagnosis. Local testing utilized the Oncomine™ Comprehensive Assay v3 (Thermo Fisher Scientific Inc., Waltham, MA, USA), which can detect single-nucleotide variants, copy-number variations, gene fusions, and insertions/deletions in 161 cancer-related genes. This local test indicated the presence of a BRCA1 T1399I (allelic fraction [AF], 19%) mutation , a novel variant of uncertain significance within a coiled-coil domain which bioinformatics analyses predicted to have a deleterious effect on the BRCA1-PALB2 interaction. A deleterious or probably damaging ATM G1663C mutation, a damaging TP53 P191del mutation, and an oncogenic, activating BRAF K601E mutation were also detected; no gene amplifications or gene fusions were detected. TRITON2 patients provided plasma samples for central genomic analysis prior to starting rucaparib. Analysis of the patient’s pre-rucaparib plasma sample was conducted using the FoundationOne Liquid CDx assay, which analyzes 324 cancer-related genes and identifies the same classes of BRCA alterations, including homozygous deletions. The FoundationOne Liquid CDx assay detected the same alterations as the Oncomine analysis of the archival tissue biopsy but also revealed the presence of a BRCA2 homozygous loss (whole gene, 26 of 26 exons) and several other alterations of unknown functional impact in a plasma sample with 28% tumor content .
+The patient started at the recommended dose of rucaparib, 600 mg twice daily, but the dose was reduced to 500 mg twice daily due to nausea/fatigue, with the patient ultimately receiving rucaparib for 32 weeks . At enrollment into TRITON2, the patient had >21 bone-associated lesions and multiple liver lesions. Treatment with rucaparib resulted in a confirmed partial response per modified Response Evaluation Criteria In Solid Tumors, version 1.1 (51% decrease in liver metastasis target lesion diameters; ) lasting 13 weeks, ongoing as of the last radiographic assessment before subsequent anti-cancer therapy, resulting in a rPFS of 29 weeks, with no confirmed progression in bone. The patient also had a confirmed PSA response (maximum decrease, 95%; ) lasting 28 weeks from the first dose of rucaparib. The patient discontinued rucaparib treatment due to clinical disease progression after 32 weeks on study and subsequently received palliative radiotherapy due to painful bone lesions.
+Following discontinuation from the rucaparib treatment, the patient received carboplatin and cabazitaxel for 2 cycles (intravenous infusion) until subsequent scans indicated progressive disease in nontarget liver lesions two months later. The patient discontinued carboplatin/cabazitaxel and did not receive any further anticancer therapies. The patient died ≈23 months after initial diagnosis due to progression of his disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_774_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_774_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..09b068d913c73a363ae1f2fb352eef082e5c44e5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_774_en.txt
@@ -0,0 +1,13 @@
+An 8-year-old Afghan girl presented with a two-month history of edema, abdominal distension, weakness, pallor, chills, fever, anorexia, and weight loss. Her medical history was not remarkable. Physical examinations showed severe mucosal and conjunctival pallor, periorbital and sacral edemas, and abdominal distension. She also presented with tender mobile lymph nodes in her right neck (5 × 5 mm), bilateral inguinal area (0.5 cm × 0.5 cm) and left axillary (0.7 cm × 0.7 cm), as well as marked hepatosplenomegaly and ascites with shifting dullness. Systolic murmurs (II/III) of the heart and lungs were apparent.
+In this patient, Hodgkin's lymphoma had metastasized to the myocardial tissue. The tumor involved all the cardiac tissue and the septum. Metastasis must have occurred via the blood vessels because it involved the cardiac tissue itself as well as the lymph nodes. Other hematopoetic areas such as the liver, spleen and bone marrow were also involved.
+The symptoms of lymphadenopathy included enlargement of the lymph nodes, in particular the para-aortic lymph nodes. There were symptoms of cardiac failure in the form of tachycardia, cardiomegaly, gallop rhythm, tachypnea, weak pulse, and hypotension.
+In examining the patient, we used all diagnostic standards except positron emission tomography, because the patient had already been diagnosed with lymphoma and metastasis. There were no signs of Hodgkin's lymphoma in the bone marrow and bone aspiration test results.
+Laboratory findings included severe anemia with moderate anisopoikilocytosis, hemoglobin level of 3.2 (normal range 260 to 400 mg/dl), erythrocyte sedimentation rate of 50 (normal range <15 mm/hr), and positive C-reactive protein. Polymerase chain reaction for tuberculosis, blood culture, urine culture, hydatid antibody, Coombs Wright and 2 ME, direct Coombs, bone marrow culture, and blood smears for malaria and borrelia were all negative. Our patient's G6PD level was also normal.
+There were several findings that led to the identification of appropriate treatment for our patient. In abdominal sonography, her liver was found to be enlarged with heterogenic echo. Marked hepatosplenomegaly (spans = 17 cm) and two round hypoechoic areas in the hepatic portal space due to adenopathy were seen. Her biliary gall bladder had no stones and its wall had an increased thickness. An abdominal CT scan (with and without contrast) showed severe hepatosplenomegaly, a hypodense area in the liver that might be a small hemangioma or cyst, considerable para-aortic adenopathy, and dilated small bowel loops with thickened walls. Her spleen was enlarged to a diameter of 13 cm and had homogenous echo. Her internal and external biliary tract liver were of normal diameter. There were some circular hypoechoic masses in our patient's portohepatic region, which indicated lymphadenopathy in this area. Her para-aortic region could not been observed because of the abdominal gas. Her intestinal loops were dilated in the pelvic region and were full of liquid.
+Her kidneys had normal secretions and appeared normal. No other abnormalities were seen. Her lungs were clear and of normal size, as shown on contrast chest X-ray. The chest X-ray also showed cardiomegaly. A CT scan of our patient's chest showed multiple lymph adenopathies in the paratracheal and subcarinal regions.
+Our patient's lung parenchymas were reported to be normal in a thorax CT scan with contrast. There were no effects of impressed masses, parenchymal nodules or abnormal infiltration. The vessels and bronchus seemed normal. Multiple lymph nodes were seen in the para-aorta, subcarina, lungs or esophagus.
+Anemia due to tumor involved all parts of the hematopoetic areas such as the liver, bone marrow and spleen, and also due to cardiac deficiency and endocarditis. Cardiac failure could occur after a bacterial endocarditis and the tumor development. There was also lymphadenopathy, pericardial effusion, fever, tremor, and edema.
+In treating our patient, acute symptoms such as severe anemia, infection, electrolyte and biomedical imbalances and hypoglycemia were encountered. Once these had been treated, we addressed the Hodgkin's lymphoma.
+Our patient was given a high-protein and high-calorie diet, and treatment for tuberculosis was started. Gentamycin, penicillin, and vancomycin were prescribed because of the presenting endocarditis. After stabling the patient's condition, 14 sessions of chemotherapy were started. Chemotherapy included intravenous Adriamycin (doxorubicin) 25 mg/m2, Bleomycin 10 mg/m2, and vincristine 6 mg/m2, as well as 375 mg of dimethyl, triazeno, imidazole and carboxamide (DTIC) as infusion.
+After one year, no evidence of the disease were reported in a thorax CT scan with injection contrast or in abdominal and pelvic CT scans with oral and injection contrast. There was also no evidence of abnormal opacity in the lung parenchyma. The pathologic area was not seen either in the thorax bone structure or the adjacent soft tissue. There were no symptoms of either pleural fluid or pleural thickness. There was also no evidence of the anterior, medial of posterior mediastinal masses. The major vessels appeared normal. Small aortocaval and thorocaval lymph nodes were observed. A myeloma with a maximum diameter of 1 cm at the left kidney was detected. The size and density of our patient's kidneys were normal. The urine tract was not obstructed. The hilar areas were normal in both kidneys. The bronchus had normal calibers. The gall bladder and the internal and external liver biliary tracts were also normal. The spleen was of normal size and had systematic margins and homogenous density. The attenuation valve was also normal.
+After completing the treatment, our patient was discharged. Her parents were told that she should attend our clinic for follow up every three months. All the symptoms of the disease have now disappeared and the girl is living an ordinary life. She does not have symptoms of lymphadenopathy, splenomegaly or any other problems.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_777_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_777_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..04b0e943bf653736582dcd1cee88a43cf99b7690
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_777_en.txt
@@ -0,0 +1,5 @@
+A 58-year-old man underwent laparoscopic radical resection of sigmoid carcinoma and ileostomy in the local hospital in June 2017. After the operation, he underwent intermittent chemotherapy six times. His physical condition recovered, and the re-examination showed no tumor recurrence. The patient was expected to undergo ileostomy takedown in the local hospital in June 2018 and April 2019, respectively, but the operation was not performed because of the COA, which was found by colonoscopy. The patient was admitted to the Department of Gastroenterology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei Province, China in May 2019. To address the difficult and complicated post-surgery problems of this cancer patient, the medical team conducted a comprehensive and careful related examination and disease evaluation. The abdominal enhanced computed tomography (CT) showed postoperative changes of sigmoid carcinoma. The intestinal lumen above the anastomotic stoma was narrow and adhered to the anterior sacral fascia. The stoma was unobstructed after the right lower abdominal fistulation . Further barium enema examination suggested that the anastomotic stoma in rectum is completely closed and separated . Blind ends were present on both sides of the sigmoid colon and the rectum, and the bilateral blind ends were approximately 3.0 cm apart. The laboratory examination of the patients showed that there was no obvious abnormality in the general hemogram and no significant change in the level of tumor markers. Physical examination showed no obvious discomfort.
+Despite the presence of COA with anastomotic separation, the examination results indicated that the blind end of the anastomotic site grew well. No obvious defect was found in the surrounding tissue. At the same time, the additional surgical operation would bring more trauma. Therefore, after speaking with the patient and his family, we planned to perform endoscopic operation on the patient to treat his disease. If endoscopic surgery cannot solve the problem, then surgery can be performed immediately or postponed as an alternative.
+After the improvement of the preoperative examination, along with adequate preoperative communication and informed consent of patients, endoscopic surgery was proposed. In endoscopic surgery , we first observed the two blind ends of the anastomotic stoma through colonoscopy. On the one hand, the COA can be seen at about 8 cm through the anus side of colonoscopy. The closure line showed a fine line scar, and the intestinal wall at the blind end was soft. On the other hand, the colonoscope entered through the ileostomy side to reach the rectal segment. The front of the blind end of the bowel was found to also be truncated and closed with a white linear scar, and a titanium clip was placed at the proximal blind end. The intestinal wall of this blind end was also soft when touched. Second, the distance between the blind ends of both sides of the intestine was 3–4 cm, as measured by fluoroscopy at different positions. Subsequently, the colonoscope re-entered through the anal side. The hook knife (KDL-620LR; Olympus Optical) was used to slowly cut through the scar tissue layer by layer in the center of the blind end of the intestinal canal, and the yellow adipose tissue became visible. The direction of incision was determined to be parallel to the direction of the titanium clip at the proximal blind end, as shown by repeated fluoroscopic observation. The adipose tissue was carefully cut open, and the proximal intestinal muscular layer was still not visible after 4 cm of advance. Third, EUS-FNA (19 Ga, 1.10 mm; Boston Scientific) puncture needle was used to puncture along the direction of the titanium clip under fluoroscopy, and a small amount of contrast agent was injected to observe the flow direction and the visualization of the intestinal canal. The intestine was visualized after the needle touched the titanium clip, and a yellow zebra guide wire was placed after the needle entered the proximal intestine. Finally, colonoscopy was performed through one side of ileostomy to confirm that the guide wire was located in the proximal intestine tube. The dilation tube and balloon (M00558430; Boston Scientific) were inserted over the guide wire, and the incised bowel was gradually dilated to 12 mm under fluoroscopy. Subsequently, a 60 mm * 20 mm self-expandable full-coated metal stent (Cook Medical, Bloomington, IN, USA) was placed over the guide wire to bridge both sides of the intestine, thereby achieving the repair of anastomotic closure with separation through the endoscopic operation. After completion of the operation, the patency of the stent was checked, no bleeding was found on the wound surface, and the anal canal was retained. Compared with the “drastic” surgical operation, this endoscopic surgery solved the intractable problem of COA with anastomotic separation with a more delicate and subtle operation and with minimal trauma. Endoscopic stent removal was performed on the patient 10 days later. The continuity of the bowel was observed intraoperatively, and an anal tube was placed in the proximal part of the anastomosis to observe the postoperative recovery.
+One month later, stenosis was observed at the original anastomotic recanalization site during endoscopic examination, and scar-like hyperplasia was observed in the surrounding tissues. We successfully leaped over the narrow segment through inserting a new self-expandable full-coated metal stent of the same specification, and the stent expanded smoothly . After 1 week, the patient underwent stent removal and came to our hospital for follow-up and reexamination for several times after discharge. The anastomotic stenosis of the patient was gradually relieved. At 1 year after the endoscopic recanalization procedure for COA with anastomotic separation, the patient came to our hospital in June 2020 for ileostomy takedown. No related complications occurred during and after the operation. No obvious abnormality was found in the relevant post-operation laboratory and imaging examinations.
+The follow-up situation at 3 months after discharge was as follows. The patient returned to a normal diet from a fluid diet and achieved normal exhaust and defecation. The results of colonoscopy showed that the anastomotic stoma healed well, and no obvious stenosis was found. At the same time, biopsy and pathological examination were carried out on the new tissue of the original anastomotic closure with anastomotic separation. The pathological results indicated that this site was normal intestinal mucosal tissue . Further endoscopic ultrasonography also confirmed the growth of normal intestinal mucosal tissues at the original anastomotic recanalization site .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_779_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_779_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..209073d5c8c4f1db3fb8b1408b806f86b3e29c8f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_779_en.txt
@@ -0,0 +1,3 @@
+In August 2016, an 85-year-old Iranian male with hypertension and diabetes mellitus presented with a history of dysuria, hesitancy, and urinary frequency and was found to have a urea level of 52 mg/dl and creatinine level of 1.95 mg/dl. Further investigations with the suspicion of prostate cancer were done on the patient. The Prostate-specific antigen (PSA) level was 8.9 mg/dl and suggested the possibility of prostate cancer. Magnetic resonance imaging (MRI) test showed the normal size of the prostate gland, but peripheral zone lesions were suggestive of prostate cancer. Prostate Imaging Reporting & Data System (PI-RADS) score was 5 (very suspicious). According to the PI-RADS score, direct biopsy from the lesions was recommended for the peripheral zone. The pathologic study of 12 separate samples from different areas of the prostate revealed unilateral adenocarcinoma with a histologic Gleason score of 8 (4 + 4), the malignant neoplastic proliferation of epithelial cells with a monolayer glandular design, invasion of the neighboring tissues, and desmoplastic reaction in five samples. However, the appearance of the normal texture was reported in other samples. In the whole-body scan, a bony lesion in the mid portion of the left femur was described. Hormone replacement therapy was started for him in September 2016.
+In June 2017, the patient presented with fatigue, weight loss, and left upper quadrant pain. His Complete blood count test showed a hemoglobin level of 10.7 g/dl, mean corpuscular hemoglobin (MCH) level of 23.9, and mean corpuscular hemoglobin concentration (MCHC) level of 27.9, and an elevated RDW-CV with the value of 19.5. White blood cell (WBC) count of 171.84 109/L and platelet count of 644 109/L revealed Leukocytosis and thrombocytosis. He was suspicion of CML and was asked for quantitative reverse transcription polymerase chain reaction (QRT-PCR). Real-time PCR examination was positive for BCR/ABL P210 fusion gene t (9;22) (q34; q11), which confirmed the CML diagnosis. He started treatment with a TKI, imatinib (400 mg/daily). During the follow-ups, due to severe and symptomatic anemia, generalized edema Erythropoietin (Eprex, Epoetin Alfa®) was prescribed for the patient. Due to the treatment failure with imatinib (400 mg − 2 years), the patient was shifted to nilotinib (300 mg − 3 years), a second-generation TKI. After administration of nilotinib, the patient was not symptomatic. Quantitative BCR-ABL1 was negative, and the patient showed a deep molecular response to treatment.
+The patient was followed up for about 5 years. In May 2021, the patient presented with nausea, lethargy, bone pain, weight loss and he had the creatinine level of 4.73 mg/dl, hemoglobin level of 7 g/dl, Erythrocyte sedimentation rate 1st hour level of 104, RBC count of 2.4 × 1012/l and Platelet count of 82 × 109/l which was indicative for anemia and renal failure. However, molecular study (quantitative assessment of BCR-ABL1) was still negative and BCR-ABL1 transcript copy was not detected. Further workup revealed a serum total protein level of 8.8 g/dl, albumin level of 3.3 g/dl, immunoglobulin (Ig) G level of 5295 mg/dl, IgA level of 22 mg/dl, IgM level of 10 mg/dl. Serum protein immunotyping (capillary Electrophoresis) detected monoclonal IgG (kappa), which may describe multiple myeloma. Urine protein electrophoresis showed negative detection of Bence Jones kappa to lambda. After injection of 99 m Tc-methylene diphosphonate (MDP), the whole-body bone scan was done with suspicious of prostate cancer bone metastasis. Thoracolumbar scoliosis, degenerative changes in the knee, shoulders and hips was noted. The bony lesion in the mid portion of the left femur were described. Regarding no changes as compared to the previous scans, these findings were not likely due to bone metastasis. Lumbar MRI did not reveal any bony lytic changes. A bone marrow biopsy revealed that 60% of nucleated cells were immature plasma cells which were suggestive of MM . The Electrodiagnosis (EDX) of the lower limbs showed no SNAPs, reduced CMAPs of bilateral peroneal nerves, and neurogenic pattern on needle EMG. Therefore, the test was abnormal and compatible with chronic sensorimotor distal polyneuropathy with axonal features. We started MP (melphalan and prednisolone) due to his neuropathy. Unfortunately, despite our treatment, he passed away after 6 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_787_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_787_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c7f3dd16ce728bb5612b9bac0ee66ac13b7dd7ef
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_787_en.txt
@@ -0,0 +1,16 @@
+A 51-year-old Caucasian woman presented to the outpatient clinic with spinal, pelvic, and sternal inflammatory pain lasting for many years. The symptoms had a strong negative impact on her quality of life. She did not present palmoplantar pustulosis. There was no context of fever.
+She had been diagnosed with synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO) syndrome at the age of 40 years. She had received sulfasalazine and nonsteroidal anti-inflammatory drugs (NSAIDs) for many years with incomplete pain relief.
+She also had a history of cervical and lumbar arthrodesis, hypertension, and thyroidectomy.
+Total spine and pelvis magnetic resonance imaging (MRI) showed a short tau inversion recovery (STIR) hypersignal on several thoracic vertebrae (T6, T7, T8, and T9) and on the sternal part of the right clavicle. Bone marrow oedema was also found on the right iliac bone, though the sacroiliac joints were preserved . Bone scintigraphy showed anterior chest wall involvement with right sternoclavicular hyperostosis on computed tomography.
+The C-reactive protein (CRP) was found to be 89.2 mg/L (reference range, 0–5 mg/L). Several blood tests performed earlier had already shown elevation of inflammation parameters. HLA B27 antigen was negative.
+We confirmed the diagnosis of active SAPHO syndrome.
+We did not consider administering conventional synthetic disease-modifying antirheumatic drug (csDMARD) as methotrexate, which is more effective on peripheral arthritis. Indeed, methotrexate has not shown comparable activity in axial disease in patients with axial spondyloarthritis.
+Moreover, we could not prescribe anti-tumour necrosis factor (TNF) drugs because the criteria for reimbursement of these drugs in Belgium were not met in the absence of sacroiliitis.
+Given some encouraging results reported with JAK-inhibitors in the literature [, ], we initiated tofacitinib 5 mg twice daily.
+The patient reported rapid and significant reduction of pain within weeks of starting the treatment.
+Blood tests performed one month after the onset of treatment showed a clear regression of inflammatory parameters, with a CRP at 25.5 mg/L (reference range, 0–5 mg/L), followed by 14 mg/L and 9.9 mg/L after 4 and 10 months of treatment, respectively .
+Total spine and pelvis MRI performed after 3 months of treatment showed regression of the STIR hypersignal on the body of the thoracic vertebrae, as well as the disappearance of the hypersignal of the right iliac bone .
+We could therefore conclude that the rheumatic evolution was favourable from a clinical, biological, and radiological point of view since the introduction of a JAK-inhibitor.
+Unfortunately, the treatment had to be discontinued due to pulmonary embolism occurring after 8 months on tofacitinib.
+Gradually, spinal, pelvic, and chest (sternal and costal) pain reappeared along with the elevation of inflammatory parameters.
+Written informed consent was obtained from the patient for the publication of this report and its accompanying images.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_788_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_788_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5b11bb5cafde24ae12b11556ff2054778344de5d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_788_en.txt
@@ -0,0 +1,6 @@
+A 67-year-old Japanese woman underwent OWHTO to treat SPONK that had occurred in the left medial femoral condyle . The patient reported the following history of the present illness. Pain in the left knee joint initially occurred at 1 year and 4 months before admission, without any particular trigger. Her former treating physician had provided conservative treatments such as oral administration of anti-inflammatory analgesics, rehabilitation including quadriceps muscle training, and guidance on the use of a cane to relieve weight bearing. However, this treatment was not successful in relieving her symptoms, and she was referred to our department for surgery. The patient had a history of hypertension and hyperlipidemia, and she had been taking oral candesartan and atorvastatin. The patient was a housewife with no noteworthy aspects related to social, family, or environmental history. On physical examination, the patient had a height of 157 cm, a body weight of 62 kg, and a body mass index of 25.2 kg/m2. She reported feeling pain in the medial joint space of the knee during walking, as well as during climbing or descending stairs. At the time of the first admission, her systolic/diastolic blood pressure was 165/97 mmHg. Table provides an overview of the patient’s pain scores in the knee joint, ROM of the knee joint, and knee joint function. Neurological examination revealed no abnormal findings. Similarly, laboratory findings at the time of the first admission did not indicate any abnormality: total protein 7.3 g/dl, albumin 4.6 g/dl, aspartate aminotransferase 22 U/L, alanine aminotransferase 18 U/L, lactate dehydrogenase 213 U/L, alkaline phosphatase 297 U/L, γ-glutamyl transferase 18 U/L, total bilirubin 0.6 mg/dl, Na 142 mEq/L, Cl 104 mEq/L, K 4.5 mEq/L, blood urea nitrogen 21.4 mg/dl, creatinine 0.56 mg/dl, Ca 9.7 mg/dl, inorganic phosphorus 3.7 mg/dl, leukocytes 5100/μl, erythrocytes 5.00 × 106/μl, hemoglobin 14.4 g/dl, hematocrit 43.6%, and platelets 263 × 103/μl.
+The HAL-SJ treatment program was divided into five phases . Phase 1 consisted of preoperative observation from the day of hospital admission until the day of surgery. The patient’s thigh circumference and lower leg length were measured preoperatively to adjust the HAL-SJ to the patient’s physical size, which would ensure appropriate training. We palpated the patient’s quadriceps muscles (vastus medialis, rectus femoris, and vastus lateralis) and attached electrodes to each muscle to detect the bioelectric potentials of the long axis along the belly of each muscle. We instructed the patient to perform knee extension and to contract her quadriceps. On the basis of these data, we instructed the patient to simulate the knee extension training, which would be performed postoperatively. Specifically, the patient sat with her lower leg hanging down naturally, and the height of the chair was adjusted so that the patient’s feet were not in contact with the floor. The patient performed ten knee extensions with HAL-SJ assistance, using the muscle that exhibited the largest bioelectric potential amplitude.
+Phase 2 involved surgery (day of surgery). The patient underwent OWHTO using TomoFix (DePuy Synthes, Bettlach, Switzerland), artificial bone (OSferion60, β-tricalcium phosphate; Olympus Terumo Biomaterials, Tokyo, Japan), and biplanar osteotomy, as described by Takeuchi et al. . The preoperative weight-bearing line (WBL) percentage , calculated on the basis of an anteroposterior weight-bearing radiograph of the affected leg in full knee extension, was 29.6%. The surgery was planned with a target postoperative WBL percentage of 62.5%. The actual enlarged angle and distance of osteotomy were 5.5 degrees and 7 mm, respectively.
+Phase 3 consisted of postoperative observation from day 1 to day 7 postoperatively. For postoperative rehabilitation, partial weight bearing was allowed after a non-weight-bearing period of 2 weeks, and full weight bearing began at 4 weeks postoperatively. The patient received rehabilitation training under the guidance of a physical therapist (ROM exercises and muscle-strengthening training) for 20–40 minutes each day, 5 days per week, from the first postoperative day until discharge. For ROM exercises, continuous passive motion training began on the first postoperative day for 1 hour per day and continued every day until discharge. On postoperative day 7, we attached electrodes to the quadriceps muscle to detect the bioelectric potential along the long axis of the rectus femoris muscle belly . Then, the patient was instructed to perform active knee extension exercises that involved contracting her quadriceps, thus simulating training with HAL-SJ .
+Phase 4 consisted of HAL-SJ therapy from postoperative day 8 to discharge. The CVC mode of HAL-SJ serves to support the patient’s voluntary motion on the basis of voluntary muscle activity and the assistive torque provided to the knee joint . In this study, we used the CVC mode, which allowed the operator to adjust the degree of physical support to maintain the patient’s comfort while gradually reducing support as training progressed. In addition to the regular rehabilitation program , the patient performed HAL-JS-assisted knee extension exercises while sitting, which consisted of five sets of ten repetitions per set, twice per week . The training was performed six times before the patient was discharged (postoperative days 8, 10, 15, 17, 22, and 24). The mean training duration, including the time required to put on the HAL-SJ, was 15.5 ± 1.4 minutes (15 minutes, 16 minutes, 17 minutes, 16 minutes, 13 minutes, and 16 minutes during training sessions 1, 2, 3, 4, 5, and 6, respectively). There were no adverse events related to the use of HAL-SJ, and the patient was discharged 30 days after the surgery.
+Phase 5 consisted of post-HAL-SJ therapy observation from discharge until 3 months after the end of HAL-SJ therapy, during which the following indicators were assessed: EL, assessed as the difference between the maximum knee joint extension angle during passive exercise and that during active exercise; knee pain rated on the visual analogue scale (VAS); isometric knee extension muscle strength (IKEMS); active ROM before surgery, before and after HAL-SJ training, and at 1 and 3 months after the end of training; and the Japanese Orthopaedic Association (JOA) score before surgery, at discharge, and at 1 and 3 months after the end of training. Furthermore, we used lateral radiographs to measure the tibial slope angle (TSA) and Insall-Salvati ratio (ISR) as indicators of patellar tendon shortening before surgery and after implant removal at 1 year after the operation . Measurement of knee ROM was performed using goniometry, and the landmarks used in the measurements were the greater trochanter of the femur, proximal head of the fibula, and lateral malleolus. Goniometry was used because it has been reported that goniometric measurements of ROM are more reliable than visual observation, with an accuracy of up to 1.0 degree . The maximal IKEMS of the operated leg was assessed with the patient in a sitting position, with the hips and knees flexed at 90 degrees. A μTas F-1 handheld dynamometer (Anima Corp., Tokyo, Japan) was fixed to the chair, and two measurements were recorded. Each trial lasted 3–5 seconds, with 30 seconds of rest between trials. The higher score of two valid trials was recorded. All measurements were performed by a single trained physical therapist to eliminate interobserver variability. The EL, VAS, IKEMS, and ROM results are shown in Table . The EL improved from 3 degrees preoperatively to 0 degrees at the end of the sixth HAL-SJ training session, but it returned to 3 degrees at 1 and 3 months after the end of the training. When we compared results obtained before training against those obtained after each of the six training sessions, we observed that three sessions produced improved EL and three sessions produced improved or relatively constant VAS scores immediately after training. However, for the other three sessions, the patient reported increased pain immediately after training, with the greatest increase in pain reported immediately after the first HAL-SJ training session, when the VAS score was 1.7 times higher immediately after training than before training. The EL improved after training sessions 1 and 3, when the patient reported increased knee pain (expressed as the VAS score). However, the EL did not change after training sessions 2 and 4, when the patient reported less knee pain (improved VAS score immediately after training). The patient did not refuse to undergo training because of increased pain. The IKEMS value was the largest preoperatively (17.6 kgf) and decreased to its lowest value (30% of the preoperative strength) before the first HAL-SJ intervention at 8 days after the operation. The IKEMS remained relatively constant throughout HAL-SJ training but recovered to the preoperative value during follow-up (18.7 and 16.6 kgf at 1 and 3 months, respectively, after completion of HAL-SJ training). The active ROM also recovered to the preoperative value by the end of the sixth HAL-SJ training session. Thereafter, the extension ROM did not change, but the flexion ROM was maintained or improved. The JOA score decreased from 60 points preoperatively to 55 points at discharge, but it improved with time, reaching 65 and 85 points at 1 and 3 months, respectively, after the end of HAL-SJ training. Whereas the TSA was maintained at 13.1 degrees before and after the surgery, the ISR decreased from 1.13 preoperatively to 0.97 postoperatively. At 6 months after surgery, the passive ROM was 0–135 degrees, and the JOA score was 90 points. There were no complications throughout the preparation, surgery, or rehabilitation process.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_78_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_78_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..496a6056f102c5d3a80d46805e5aa3d85b1382a3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_78_en.txt
@@ -0,0 +1,8 @@
+A 59-year-old man, farmer, living in a rural area of Cartagena, ​​Colombia (elevation 17 m / 55.77 ft above sea level) was initially admitted to a peripheral hospital for decompensated heart failure. He has a history of hypertension, well-controlled type 2 diabetes mellitus (last HbA1c 2 months before admission was 6.6%), and congestive heart failure with reduced ejection fraction (LVEF 30%). At home, he takes carvedilol, spironolactone, furosemide, aspirin, and metformin.
+Vitals at the other institution were unremarkable but had signs and symptoms of decompensated heart failure (dyspnea, fatigue, pitting edema, wheezing). Post-admission day 20, he was transferred to our ICU for hemodynamic monitoring due to high risk of shock and complications. On admission, his blood pressure was 106/84 mmHg, heart rate 116 beats/minute, 75% on room air returning to 96% with high-flow nasal cannula at 6 L/minute.
+On physical examination he was afebrile, had no skin lesions, toxic appearance, or signs of systemic inflammatory response. He had jugular engorgement, normal cardiopulmonary auscultation, and Grade + 2 pitting edema of lower limbs. Chest x-ray showed signs of pulmonary congestion. Echocardiogram revealed a dilated heart disease, left ventricle with severe global systolic dysfunction, depressed ejection fraction 18%, severe biatrial dilatation and moderate mitral valve regurgitation without thrombi or vegetations.
+Laboratory tests revealed acute kidney injury and mild metabolic acidosis . His management was continuing home medications and adding angiotensin II receptor blockers (ARB) and intravenous loop diuretic.
+The patient presented a torpid evolution with the development of a febrile illness (temperature 38.6 °C) 3 days after admission to the ICU (23 days of hospitalization), associated with sustained ventricular tachycardia reaching values of 198 beats/minute and sustained hypotension with mean arterial pressure 63-66 mmHg. He was prescribed digoxin without improvement, followed by amiodarone infusion and full anticoagulation. Labs revealed severe leukocytosis with neutrophil predominance, and mild hepatitis.
+Suspecting a possible infectious focus that decompensated the patient, septic workup was initiated and a carbapenem and antifungal (Fluconazole) were started given risk factors (comorbidities and prolonged hospitalization in another institution). Finally, blood cultures in two sets at 120 hours of incubation revealed the presence of achlorophyllic algae, confirmed as Prototheca wickerhamii by MALDI-TOF system. No other evidence of disseminated infection was documented. In this patient, the suspected source of infection was his home surroundings and occupation (farmer living in a rural area) along with risk factors such as diabetes.
+The patient was assessed by Infectious Diseases who recommended fluconazole 400 mg IV/day and repeat blood cultures. Repeat blood cultures taken at 96 hours after initiating antifungals showed persistence of the microorganism, treatment was changed to liposomal Amphotericin B (5 mg/kg IV/day) for 14 days. Subsequent repeat blood cultures documented clearance of the algaemia post-treatment. Once the treatment was completed, he presented clinical and biochemical improvement, allowing hospital discharge.
+In outpatient follow-up after discharge from hospital, he remains well off antifungals and asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_792_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_792_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..18702d07ece703baa00b954960b15fba6626eafd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_792_en.txt
@@ -0,0 +1,9 @@
+A 37-year-old Indonesian woman was brought to the emergency department (ED) at 36 weeks gestation in her second pregnancy with shortness of breath that worsened 1 day before admission. She had a fever and bloody phlegm cough within the last 2 days, accompanied by painful swallowing and hoarseness for 2 months. She also had worsening gastroesophageal reflux disease (GERD) without medication, as well as a history of thyroidectomy due to malignancy 2 years ago.
+Upon arrival, she had a respiratory rate of 26–30 breaths per minute, SpO2 of 98% on nasal oxygen supplementation, pulse rate of 110–120 beats per minute, and blood pressure of 172/92 mmHg. The pregnancy ultrasound showed a single live intrauterine fetus with a normal fetal heart rate [estimated fetal weight (EFW) 2184 g], corresponding to 36 weeks of gestation, and no cervical dilation. Laboratory tests revealed leukocytosis of 17,000/µL and proteinuria. Other tests such as albumin, electrolytes, and coagulation profile were within normal range. A preliminary diagnosis of pneumonia or heart failure was made in the ED. The patient was initially treated with ceftizoxime 1 g injection t.i.d. and furosemide 20 mg injection, and was planned to be admitted to the intensive care unit (ICU). However, later the chest X-ray showed neither signs of infiltrates nor pulmonary edema, and echocardiography showed normal left and right heart function.
+We suspected laryngeal edema in the ICU due to the patient’s preeclamptic condition and stridor, which was initially treated with an empirical methylprednisolone injection of 125 mg t.i.d. and nebulized epinephrine. Pantoprazole 40 mg injection b.i.d. was also administered to overcome GERD.
+A total of 16 hours after admission to the ICU, her condition deteriorated, with worsened tachypnea, decreased oxygen saturation, and an inability to talk, so we decided to perform intubation. Mask ventilation was used for preoxygenation, and no difficulty was encountered. Intubation was facilitated by administering propofol (1.5 mg/kg BW) and fentanyl (1 μg/kg BW). We could only use 6.0-sized endotracheal tube (ETT) because of the edematous larynx. We stopped giving sedation after the patient could tolerate the use of ETT. Pressure support ventilator mode and spontaneous breathing with T-tube were used, taking turns.
+The following days, a fiberoptic bronchoscopy revealed uneven granular vocal cords with multiple white plaques and a swollen red appearance due to laryngeal edema . Due to a suspicion of fungal infection based on bronchoscopy findings, methylprednisolone was stopped and additional treatment of fluconazole 800 mg, then 400 mg q.d., was given.
+The use of a small-sized ETT was expected to be short-lived, so she was considered for tracheostomy. Nevertheless, we decided to perform a cesarean section first after lung maturation because it would be safer for the fetus, and laryngeal edema usually improves after delivery.
+Despite the fact that the patient was still using ETT, she was utterly cooperative, so spinal anesthesia was given instead of general anesthesia . Hyperbaric bupivacaine 10 mg with fentanyl 25 μg was administered from the L4/L5 interspace. There were no intraoperative problems. She was readmitted to the ICU after surgery with no significant complaints, and 48 hours after delivery, her clinical and vital signs were stable.
+Extubation was performed after a positive result from the leakage test. Stridor was no longer audible, breathing pattern was within normal limits, and vital signs were stable, although the patient still could not talk. She was transferred to the ward for postpartum care. A laryngeal lavage fluid sample was taken during the bronchoscopy for culture, and a week later, the result came back with Enterobacter aerogenes.
+After 2 days of treatment in the ward, the patient was discharged from the hospital. She returned to our hospital 2 weeks later for a post-discharge follow-up, and her condition improved. The baby was also in good health. Table presents a timeline of the case history.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_794_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_794_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0a5601d88c6f2865c390516436bfe8a4fa47dec1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_794_en.txt
@@ -0,0 +1,4 @@
+A 55-year-old man, who received LT two years ago, developed diarrhea after an unclean diet 20 days ago and had difficulty breathing for five days. The patient's history included LT for cirrhosis two years ago and postoperative use of tacrolimus (2 tablets bid), Mycophenolate Mofetil (3 tablets bid), and sirolimus (1 tablet qd) to control immune-rejection with good results. The patient had recurrent diarrhea 20 days ago after an unclean diet, with symptoms of loose yellow stools with mucus 6–8 times a day, and did not improve after taking "berberine hydrochloride". Ten days ago, the patient's symptoms worsened, and he relieved dark green stools more than ten times a day, and gradually developed symptoms such as thirst, profoundly sunken eye sockets, palpitations and dyspnea. The patient's examination at the local hospital showed a white blood cell (WBC) count of 15. 61 × 109/L, a significant decrease in potassium ions (2. 45 mmol/L), and a significant increase in creatinine level (337 umol/L). As a result, the local hospital discontinued the patient's immunosuppressive drugs and treated diarrhea and intestinal infections with Meropenem and Montmorillonite, but the results were poor. Because the patient developed symptoms such as dyspnea and oliguria, he was diagnosed with septic shock. However, after treatment with a ventilator and Continuous Renal Replacement Therapy (CRRT), diarrhea and infection were not effectively controlled, and the symptoms worsened. As a result, the patient was transferred to the Department of Intensive Care Unit of West China Hospital.
+The patient was admitted with ventilator-assisted ventilation. A femoral vein placement tube for CRRT used outside the hospital was found at the root of the thigh. Patient's general condition on admission : temperature 38. 4 °C; pulse 130 beats/min; respiratory rate: 18 breaths/min; blood pressure 100/67 mmHg (on norepinephrine 0. 4ug/kg/min). The patient had a small number of wet rales on lung auscultation, an oxygenation index (PO2/FIO2) of approximately 110, and no significant abnormalities on abdominal examination. The patient's laboratory findings showed a significant systemic inflammatory response, renal impairment and immunosuppressive state. Inflammatory indexes: white blood cell count 19. 21 × 109/L; neutrophil ratio 92. 7%; CRP: 190 mg/L; interleukin 6: 336 pg/L, PCT: 3. 32 ng/L; abnormal biochemical indexes: creatinine 170umol/L; potassium: 5. 23 mmol/L; immune function: lymphocyte count: 0. 45 × 109/L. The patient's abdominal CT suggested a high amount of colorectal gas stool and a dilated bowel.
+Based on the patient's admission examination and the external medical records, we initially determined that the patient was in septic shock caused by infectious diarrhea with abdominal and pulmonary infections and multiorgan functional impairment. The patient was then admitted to our hospital and immediately given imipenem cystatin 1 g q8h and voriconazole 0. 2 g q12h for anti-infection. The patient's immunosuppressive drugs continued to be stopped. The patient's routine stool test was sent to identify the pathogen causing the diarrhea, but no meaningful results were obtained. On the second day, the patient's blood culture suggested Gram-positive coccus infection and chest CT suggested fungal infection. We added amphotericin B 10 mg bid and tigecycline 100 mg q12h to strengthen the anti-infection. By day 5, the patient's temperature peak was gradually reduced, and the oxygenation index rose to approximately 300. We reduced the dose of paroxysmal sedative medication discontinue the ventilator and transfer it out of the intensive care unit. As the patient's lymphocyte count rose to 1. 58 × 109/L, we reintroduced him to Mycophenolate Mofetil 500 mg bid to suppress the patient's immune function.
+On day 7, the patient again developed massive watery diarrhea and unstable blood pressure, a decrease in oxygenation index(PO2/FIO2) to 200, increased inflammatory markers, and abnormal liver function. We considered a drug-related liver injury and parasite-associated diarrhea. So we stopped the patient's enteral nutrition, added antidiarrhea (minocycline hydrochloride) and hepatoprotective drugs (polyene phosphatidylcholine) and adjusted the antibiotic regimen to ceftazidime avibactam (2. 5 g q12h), amantadine (1000 mg q8h), voriconazole (0. 1 g q12h) and mucilage sulfate (750, 000u q12h). To clarify the aetiology of the patient's diarrhea, we performed a gastroscopy on day 8. The stereoscopic presentation was : segmental mucosal changes in the cecum department and ascending colon, suspicious of specific infections. Because the patient's multiple stool tests were negative, we considered atypical pathogenic infections. Therefore, we stained the patient's stool specimen with antacid and performed high-throughput sequencing (NGS) on the blood specimen. After two days, a large number of Cryptosporidium was detected in the patient's stool . NGS detection of Cryptosporidium parvum sequence number 33 with the specific information that NGS detection covers a total length of 2951 (bp) on the genome with coverage of 0. 0332% and an average depth of 1. 00X, suggesting the presence of large amounts of Cryptosporidium in the blood of this patients . Furthermore, we immediately discontinued Mycophenolate Mofetil and looked for an anti-Cryptosporidium infection treatment option. According to previous reports, Cryptosporidium infection is frequently seen in children with primary immunodeficiency. Cryptosporidium infection causes symptoms such as sclerosing cholangitis and pulmonary Cryptosporidium infection in children with immunodeficiency. There was a high degree of similarity to the present case regarding both symptoms and findings. In a case report of a CD40L-deficient infant diagnosed with Cryptosporidium infection, after treatment with nitazoxanide and azithromycine, the patient was doing well, this report served as an important reminder for our treatment, and we immediately reviewed the instructions for NTZ [, ]. NTZ is the only approved anti-Cryptosporidium drug on the market. Because NTZ is not recommended in the instructions for use in an immunodeficient population, we used an anti-Cryptosporidium regimen of oral azithromycin (1000 mg tid) and alliin (500 mg tid). Five days after that, the patient showed a slight improvement in diarrhea, but liver and kidney function continued to deteriorate, and we administered continuous CRRT. On day 18, as the patient's glutamyl transpeptidase and alkaline phosphatase continued to rise, we considered Cryptosporidium retrograde biliary infection. To prevent the development of sclerosing cholangitis and immunorejection, we changed the anti-Cryptosporidium infection regimen to NTZ (500 mg tid) and allicin (500 mg tid) while continuously monitoring the patient's immune function and using cyclosporine to suppress immune function if necessary to keep CD4 + T cells were controlled at 100–300/mm3. The treatment plan had a good effect. The number of diarrhea gradually decreased, liver and kidney function gradually recovered, CRRT was stopped on day 22, and the patient was taken off the ventilator on day 23. On days 24 and 25, the patient underwent faecal antacid staining, and no Cryptosporidium was found. On day 28, the patient was transferred to the general ward and recovered well with his family. As the patient's renal function is severely compromised, we recommend that patients regularly review their renal function and pay attention to preventing infection from avoiding progression to the stage of renal failure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_803_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_803_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cd5a1ee1756bbe40cd6eba4cb26531fdf8199ec4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_803_en.txt
@@ -0,0 +1,3 @@
+A 48-year-old man was referred to our emergency room with a 10-day history of progressive dyspnea, non-productive cough and fever. He had previously visited his primary physician, who prescribed a 7-day treatment with an antibiotic. The patient had a 34-pack-year history of cigarette smoking, did not take any regular medications and had not recently visited any tropical country. Physical examination revealed hyperthermia (38.0°C), with blood pressure and pulse within normal ranges. He was slightly polypneic (28 cycles per minute) but had no other sign of respiratory difficulty. Respiratory sounds were diminished on both pulmonary bases and no adventitial sounds were heard. No rash or lymphadenopathy was noted and the remainder of his physical examination was normal. Room air arterial blood gas (ABG) was unremarkable and laboratory findings showed slight normocytic normochromic anemia (hemoglobin (Hb) 12.3 g/dL, hematocrit (Hct) 36.1%), leukocytosis (20,920/mm3), relative neutrophilia (75.5%), thrombocytosis (499,000/mm3) and elevated C-reactive protein (155.9 mg/L). Ionogram and renal function were normal. Chest X-ray revealed a mild reduction in lung volume and a mild and diffuse coarse reticular pattern on both lungs. The patient was diagnosed with community-acquired pneumonia, and, following admission to the Medicine ward, was started on empiric antibiotic therapy with levofloxacin.
+During the first days after admission, persistent fever and high levels of inflammatory markers were noted. Given the patient's condition, an investigative diagnostic procedure was initiated. Blood cultures, HIV and hepatitis testing were negative. Coagulation, hepatic function and urine sediment were unremarkable. Bronchofibroscopy and bronchoalveolar lavage were negative for malignant cells, and virologic, bacterial, and mycological examinations and polymerase chain reaction were negative for mycobacterial DNA. Transthoracic echocardiography showed no evidence of any valvular vegetation, and a blood smear was not compatible with any myelodysplastic syndrome. Thoracoabdominal-pelvic computed tomography (CT) scan revealed several lymph nodes in all mediastinal compartments but no hilar adenomegalies. Multiple cysts and nodules, with mid to upper zone predominance, and interstitial thickening were observed in the lungs . The dimensions of the liver were enlarged, with several irregular hypoattenuating lesions and infracentimetric lymph nodes in the hepatic hilum . As a result, an ultrasound-guided liver biopsy was performed. Histologic and immunohistochemical examination (i.e. positivity for S-100 protein and CD1a antigens) established a diagnosis of LCH.
+A course of steroids (prednisolone, 1.0 mg/kg/day) was initiated, and the patient was encouraged to discontinue smoking immediately, which clearly improved the clinical course of the disease. Six months later, he remains asymptomatic, with low levels of inflammatory markers, although his lung and liver radiological patterns remain unchanged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_812_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_812_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ea9cf645aee3003deed4dc2ae536f92fd7cefd7a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_812_en.txt
@@ -0,0 +1 @@
+In 2016, a 37-year-old woman with a past medical history of rheumatoid arthritis treated with tumour necrosis factor alpha inhibitor complained of rapid palpitations of short duration and near syncope. In 2006, she was diagnosed with symptomatic idiopathic VPB (burden: 33%/24 h). The VPBs were isolated and monomorphic without any repetitive forms. shows a 12-lead electrocardiogram (ECG) with a representative VPB characterized by an inferior axis, a left bundle branch block (LBBB) morphology, and R/s transition in V4 suggestive of a triggered activity from the RVOT. The patient was treated with a beta-blocker (name and dosage unknown) as well as magnesium without any improvement. Cardiovascular examination was within normal limit. A successful ablation was performed on the septal aspect of the RVOT without a 3D navigation system. Thirty-four radiofrequency (RF) lesions were delivered at a power between 25 and 30 W with an irrigated catheter (non-nav D-Curve Thermocool catheter, Biosense Webster). No pericarditis was mentioned following the intervention. The patient did not have any complaint until 2008 when she noticed recurrence of isolated palpitations. The palpitations and near syncope in 2016 correlated with frequent non-sustained VT (NSVT) from the RVOT as reconstructed from the three-lead Holter recording (MicroPort, Synescope, MultiChannel-MultiDay Version 3.10) . The early transition in lead V2 is probably due to some inaccuracy of the reconstructed ECG, which is based on the Dower’s transform. This Matrix uses the X, Y, Z signals obtained from the Frank lead system to simulate a standard 12-lead ECG with some inherent inaccuracy. The VPB burden was 3% on the Holter recording. The patient remained symptomatic despite the prescription of metoprolol 25 mg daily. On physical examination, the patient was well-groomed. Cardiopulmonary auscultation was within normal limit. There was no sign of heart failure. A transthoracic echocardiography was within normal limit. A coronary angiogram did not show significant lesions . Suspecting an arrhythmogenic cardiomyopathy (ACM) or an inflammatory cardiomyopathy, the patient underwent a cardiac magnetic resonance imaging (cMRI) and a metabolic 18FDG-PET scan which were normal. A 2nd ablation was then undertaken including endomyocardial biopsies, which are part of a standardized workup at our centre to discriminate between myocarditis and ACM. The tissue was harvested from the interventricular septum without any electroanatomical mapping guidance, as previously described by Rosset et al. Results showed normal immunofluorescence signals for Cadherin, Connexin 43, Desmoplakin, Plakoglobin, and Plakophilin proteins that reasonably ruled out ACM . Under local anaesthesia, an endocardial electroanatomical mapping (Carto 3 System, Biosense Webster, Diamond Bar, CA, USA) revealed an area of low voltage (<0.5 mV) at the septal aspect of the RVOT corresponding to the site of ablation performed in 2006. Despite isoproterenol infusion, only a single run of NSVT was triggered which was enough to confirm by pace-mapping that the scar area of the septal RVOT was involved in the arrhythmic event. shows the NSVT run during the electrophysiology study. The morphology showed an inferior axis, an LBBB morphology, and an R/s transition in V3 that was perfectly reproduced by pace-mapping at the septal RVOT within the scar region. Because of the absence of early potentials in the RVOT, the left ventricle outflow tract and the right coronary cusp were mapped and, as shown by the poor pacemap matching in , did not participate into the arrhythmia. Ablation was delivered at the focal scar region using a temperature control system and an irrigated catheter (Thermocool, SmartTouch, target temperature 43°C, maximal power 30 W). Post-procedure, rare VPB were seen at baseline and under isoproterenol infusion. One week after discharge, because of recurrence of symptomatic NSVT, an epicardial ablation was planned. A dry pericardial puncture under fluoroscopy guidance was performed with a dedicated needle (Becton Dickinson AG, reference 408360). A pigtail was inserted followed by a short steerable guiding sheath (EPI-Agilis, Abbott). After the puncture, 20 mL of serous liquid were drained and sent to the cytology lab (which result showed only few atypical cells). shows the epicardial voltage map (Carto 3D, Biosense Webster) reconstructed with a decapolar catheter (DecaNav, 2-8-2, Biosense Webster, Diamond Bar, CA, USA). The map revealed a localized region of low voltage at the antero-septal aspect of the epicardial RVOT including fragmented potentials and late abnormal ventricular activities (LAVA) facing the scar at the antero-basal aspect of the endocardial RVOT shown in . Importantly, pace-mapping at this location showed a perfect match . A programmed ventricular stimulation with two extrastimuli initiated a non-sustained run matching the clinical VT. The VT started with a narrow QRS followed by a subsequent widening of the QRS (pseudo-delta wave) suggestive of an endocardial activation followed by an epicardial exit . shows mid-diastolic potentials (MDP) within this region. The MDP was very suggestive of an area of slow conduction. Neither entrainment manoeuvers nor sequential mapping could be performed as the VT remained non-sustained despite increasing dose of i.v. Isoproterenol. However, pacing from the MDP site reproduced the clinical VT morphology . The MDP to QRS interval and the stimulation to QRS interval were of similar values (46 ms). This implies that an area of slow conduction or an isthmus was involved in the maintenance of the VT, suggesting that the mechanism was likely a re-entrant VT rather than a focal triggered activity. Endocardial mapping of the septal RVOT facing this area showed LAVA of very low amplitude. Prior to RF ablation, a coronary angiogram was performed with merging of the images into the Carto (Carto Uniview) and confirmed that the area of interest was not in the vicinity of a coronary vessel. Radiofrequency ablation was applied with an irrigated catheter (Thermocool SmartTouch SF, Biosense Webster) epicardially and endocardially thereafter without any complication. Aggressive premature ventricular stimulation including burst pacing (up to five ventricular extrastimuli, shortest coupling intervals at 240 ms) at baseline and under isoproterenol infusion (12 mcg/min) and adrenaline bolus (10 mcg) showed the absence of susceptibility to VT and VPB. The procedure lasted 190 min (9.8 min fluoroscopy time) and included 18 RF lesions (irrigation 8 mL/min in the epicardium, power 25–30 W, total energy 12 884 J). The patient stayed 48 h in our cardiac care unit where a transthoracic echocardiogram excluded a pericardial effusion. She was discharged with a wearable defibrillator vest for 1 month. Clinical follow-up including a 48-h Holter recording did not show any ventricular arrhythmia recurrence at 4-year follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_813_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_813_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b8e88a726698930fd15bf8efa2cfd2baf563ad28
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_813_en.txt
@@ -0,0 +1,4 @@
+A 51-year-old male patient presented with a 19-day history of redness and pain in the eye. The diagnosis was fungal keratitis . Treatment included frequent instillation of natamycin eye drops (50mg/ml, North China Pharmaceutical, China) and intermittent application of intracorneal voriconazole injection (1mg/ml, Pfizer Limited, US). Following one month of treatment, examination results indicated that the sign of corneal ulcer healing, with no observable progress. However, there was a concerning sign of corneal perforation. . B-ultrasound demonstrated the absence of abnormalities in the vitreous and retina. Consequently, a partial penetrating keratoplasty was performed with a favorable outcome. Intraoperatively, aqueous humor samples and the affected corneal tissue were collected for subsequent culture and identification of bacteria and fungi. Voriconazole injection was used throughout the procedure for corneal margin and anterior chamber irrigation. The donor cornea, sourced from our eye bank, and residual donor cornea, along with corneal preservation solution (Corneal Chamber, Alchimial, Italy), were sent for bacterial and fungal culture postoperatively. The postoperative regimen consisted of local administration of natamycin and tacrolimus eye drops (0.1%, Senju Pharmaceutical Co, Japan), as well as levofloxacin eye drops (0.5%, Senju Pharmaceutical Co, Japan). Additionally, itraconazole capsules (200 mg daily, Xi'an Yangsen Pharmaceutical Co., Ltd., China) were orally administered.
+Following corneal transplantation, the graft remained transparent. However, the aqueous humor exhibited gradual turbidity, and by the fourth postoperative day, anterior chamber pus accumulation was observed, prompting concern regarding a potential recurrence of fungal infection. Consequently, the anterior chamber was aspirated to remove the pus, and a voriconazole injection was administered for anterior chamber irrigation and medication. Intraoperatively, it was noted that the anterior chamber pus was thin and watery in consistency, in contrast to the thicker purulent fluid observed in fungal infections. An examination of the anterior chamber pus revealed the absence of fungal hyphae . Postoperatively, there was no significant improvement in the anterior chamber reaction, and the cornea exhibited mild edema.
+A microbiological examination of the recipient corneal ulcer, aqueous humour, donor cornea, and preservation solution yielded negative results for bacteria and fungi, which is thought to be the consequence of preoperative antifungal and antibacterial treatment. However, given the possibility of other infections occurring postoperatively, aqueous humour and anterior chamber pus from the operated eye were collected for metagenomic next-generation sequencing (mNGS) test. Total genomic DNA was extracted using a nucleic acid extraction kit, then fragmented to 200 bp and used to build a library with end-repaired, adapter-ligation, and polymerase chain reaction amplification. The prepared library was sequenced on the MGISEQ-2000 sequencing platform (MGI, China). The reads were finally aligned to the Microbial Genome Databases, which contain the whole-genome sequences of 8,472 viruses, 10,537 bacteria, 903 fungi and 288 parasites. During the aforementioned interval, the previously administered eye drops were maintained. This was accompanied by an increase in the rate of anterior chamber pus leakage, culminating in the clouding of the corneal graft . The mNGS results identified O. anthropi, with 321 sequences with a relative abundance of 98.98%. Additionally, a vitreous opacity was revealed through a B-ultrasound examination. . To treat O. anthropic, ceftazidime (25 mg/ml), an amikacin (4 mg/ml), and vancomycin (10 mg/ml) were administered to the anterior chamber and vitreous, respectively, three times each. The oral antifungal medication was discontinued, and a cefuroxime injection (1.0 g, administered three times a day) was administered intracamerally. To prevent a recurrence of fungal infection, natamycin eye drops were administered four times daily, in conjunction with tobramycin eye drops (0.3%, Tobramycin Eye Drops, Alcon-Couvreur n. v, Belgium), and levofloxacin eye drops (0.5%, Senju Pharmaceutical Co, Japan) at 1-hour intervals. Following three days of treatment, there was a reduction in anterior chamber pus (see Fig. B). After a further ten days of treatment, the anterior chamber pus had been absorbed completely. However, the corneal graft remained cloudy , with ultrasound indicating that the vitreous opacities had reduced . The patient's condition remained stable, with effective infection control being maintained.
+Six months following corneal transplantation, the operated eye exhibited corneal opacities and pseudo-pterygium . B-ultrasound examination did not reveal any abnormalities. To enhance visual function, a secondary partial penetrating keratoplasty was conducted concurrently with a cataract removal procedure. Postoperatively, Tobramycin eye drops were administered for the purpose of prophylaxis against infection, in conjunction with Tacrolimus and Prednisolone Acetate Ophthalmic Suspension (1%, Allergan Pharmaceuticals Ireland) for the prevention of rejection. One month following the procedure, the corneal graft was observed to be transparent, with a corrected visual acuity of 0.1 .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_815_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_815_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..47b66e5a60fbc44ba29a0ea42c223a45f62079dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_815_en.txt
@@ -0,0 +1,2 @@
+A 69-year-old woman visited our hospital because of unexplained fatigue. Thoracic, abdominal, and pelvic CT showed several pulmonary lesions, with the largest having a maximum diameter of 2 cm. In addition, there were several rib masses, enlarged mediastinal lymph nodes, and a 9-cm mass resembling a malignancy in the left kidney. She underwent cytoreductive nephrectomy in July 2013. Histological examination revealed clear cell RCC.
+In August 2013, first-line sunitinib was initiated. However, she still experienced fatigue, and the treatment was discontinued. Three tyrosine kinase inhibitors and two mTOR inhibitors were administered and discontinued because of adverse events, such as fatigue and anorexia, with a 3–6-month duration. In January 2016, palliative radiotherapy was administered for pain control; 30 Gy in 10 fractions was delivered to the ribs. In October 2016, treatment with nivolumab (3 mg/kg) was initiated. Three days after the initial administration, she presented with dyspnea, cough, and low-grade fever. There was no increase in KL-6 or SP-D. CT showed a right lung consolidation with ground glass opacities in a previously irradiated area . At that time, she was not receiving any drug, other than nivolumab, that could induce interstitial pneumonia. Accordingly, she was diagnosed with pneumonitis caused by nivolumab and radiotherapy. Oral prednisolone (1 mg/kg) was immediately initiated, and was discontinued after 4 months with gradual tapering. The patient's symptoms rapidly resolved, and follow-up chest CT 4 months after nivolumab cessation showed interval resolution of the consolidation in the right lung and persistent tumor shrinkage .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_816_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_816_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1d77a08c032c8d4eb5b4d8f506bbaf18e0cbabe3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_816_en.txt
@@ -0,0 +1,4 @@
+On Apr 16, 2015 a 52-year-old male was referred from a local clinic because of a radiolucent lesion in the left mandibular angle area. The patient showed pain in the left buccal area and had numbness on the left lower lip area. He received an operation under general anesthesia because of pneumothorax in 1998. He had been diagnosed with pneumoconiosis in 2001. Because the symptoms of pneumoconiosis were aggravated from 2011, he received medications, such as ozagrel, erdostein, acebrophyline, and Synatura® (Ahngook Pharm, Seoul, Korea), intermittently. Synatura® is an herbal medicine mixed with ivy leaf and coptis stalk. From February 2015, he received olmesartan (an angiotensin receptor antagonist) for the treatment of hypertension. From March 2015, he received atrovastatin calcium for the treatment of hyperlipidemia. He did not receive irradiation of the jaw regions. From a computerized tomogram examination, we observed that the lesion was localized in the left first and second molar area below the inferior alveolar canal . The lingual cortex adjacent to the lesion showed an erosive change . Based on the radiologic findings, the lesion was primarily diagnosed as Stafne’s bone cyst.
+An excisional biopsy of the left mandibular body was performed using the submandibular approach. Yellow colored semi-solid materials were removed from the bone marrow cavity . The lesion was poorly encapsulated, and the surrounding cortical bone had become thin but appeared to be intact . After removing the necrotic tissue, the wound was closed layer by layer. The removed specimen was sent for pathological examination. The removed specimen was fixed in 10 % neutral formalin and sectioned at a thickness of 4 μm. The microsections were routinely stained with hematoxylin and eosin (HE), and we also performed immunohistochemical (IHC) staining using anti-sera of lysozyme (DAKO, Glostrup, Denmark), matrix metalloprotease-1 (MMP-1, Santa Cruz Biotech, Santa Cruz, CA, USA), MMP-2 (Santa Cruz Biotech), MMP-3 (Santa Cruz Biotech), hypoxia inducible protein alpha (HIFα; Abcam, Cambridge, UK), vascular endothelial cell growth factor (VEGF; Abcam), osteoprotegerin (OPG; Santa Cruz Biotech), and the receptor activator of nuclear factor-kappa B ligand (RANKL; Santa Cruz Biotech). IHC staining was performed using the indirect triple sandwich method. The use of the present biopsy specimen was filed in the Department of Oral Pathology, Gangneung-Wonju National University Dental Hospital, and was approved by our institutional review board (IRB2015-7). The sections of the embedded specimens were stained with HE. The specimens contained inflammatory cells and fibroblastic cells. Variable sized woven bone was observed with a cholesterol cleft appearance . The marrow stromal tissue was diffusely fibrosed and filled with fatty bubble-like materials and was infiltrated with a large number of macrophages . Most of the adipocytes were destroyed and disappeared, resulting in the replacement of the fatty necrosis with variable sized vacuolated empty spaces. There also appeared to be several foci of the cholesterol slits, where fatty materials were also removed during the histological procedures . Stromal fibrosis increased in areas lacking vascular channels and advanced to the osteolytic trabecular bones, which showed irregular and rudimentary bony trabeculae with no signs of osteoid deposition and bisphosphonate-related multiple reversal lines .
+In the immunohistochemistry analysis, the marrow stromal tissue was weakly positive for MMPs and the infiltrated macrophages were strongly positive for lysozymes . Some marrow cells near the osteolytic trabecular bones were strongly positive for RANKL and OPG, and the stromal fibrous tissue was consistently positive for HIFα, but rarely positive for VEGF.
+After surgery, the patient was advised to stop taking Synatura® and olmesartan, which are anti-angiogenic drugs. The patient’s symptoms disappeared during follow-up and bone healing was uneventful at 5 months postoperatively . The patient was followed up for 9 months postoperatively. No event occurred during follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_820_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_820_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7c103d085479394380801fdaf29ec6c003f8ae45
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_820_en.txt
@@ -0,0 +1,5 @@
+A 76-year-old female patient with exertional dyspnea was referred to our department with an enlarged calcified mass in the right PA. She had a history of multiple primary cancers and had undergone several surgeries: mastectomy for metachronous bilateral breast cancer (right at age 49, left at age 66), pulmonary resection (right S9 wedge resection and left S3a segmentectomy at age 56) for simultaneous bilateral lung cancer, and left nephrectomy for left renal cancer at age 65. She also underwent surgery for melanoma of the right finger at the age of 66. Chest computed tomography (CT) performed as a periodic examination 10 years after the surgery for renal cancer revealed a calcified nodule in the right PA . The calcified nodule showed slow enlargement over the previous two years, retrospectively and was 25 mm in diameter, located just peripheral of the superior trunk of the right PA and the beginning of the A6 branch. Fluorodeoxyglucose positron emission tomography/CT (FDG PET/CT) showed that the calcified area of the nodule did not take up FDG, but the area of soft tissue density on CT showed uptake with a maximum standardized uptake value max of 2.16 . Preoperative echocardiography revealed severe mitral valve regurgitation (MR) with P2 prolapse and moderate tricuspid valve regurgitation (TR) with an ejection fraction of 81%. Regarding laboratory data, the creatinine level was 1.22 mg/dl, and tumor marker levels were unremarkable (Carcinoembryonic Antigen: 2.0 ng/ml, cytokeratin 19 fragment: 2.9 ng/ml, pro-gastrin-releasing peptide: 72.4 pg/ml).
+We planned a 2-staged surgery preceded by valvular surgery under total extracorporeal circulation. The cardiovascular surgeons performed mitral and tricuspid valvuloplasty through a median sternotomy (operative time, 422 min; extracorporeal circulation time, 257 min). During the initial surgery, we encircled the superior vena cava (SVC) at the most central site in the pericardial sac. We opened the right mediastinal pleura and confirmed the presence of the nodule in the right PA by palpation and judged that it was difficult to reconstruct the PA, especially on the peripheral side of the PA, through a median sternotomy. The postoperative course was uneventful. Her exertional dyspnea improved three months after surgery, and the echocardiography showed no regurgitation.
+Therefore, a second surgery was performed. Following posterolateral thoracotomy at the fifth intercostal space, a right upper lobectomy was performed. The tumor was identified as a stony hard mass in the right PA. To clamp the right main PA, we tried to dissect apart the SVC and the right main PA and also tried to approach the right main PA for encircling from the space between the SVC and the aorta. However, severe adhesions obstructed dissection. Although the surgical margins appeared to be insufficient, we were able to grasp the mass manually. Therefore, we decided to place a vascular clamp forceps on the center of the mass, as centrally as possible. After introducing heparin with an activating clotting time of 200–250 s, the right main PA, middle pulmonary vein, and inferior pulmonary vein were clamped. When we opened the middle PA trunk using Metzenbaum scissors, a white stony mass that did not adhere to the artery wall on the mediastinal side was removed with the adherent PA wall. On the central side of the mass, the soft tissue contiguous to the mass was trapped by vascular clamp forceps. Because we could not loosen the forceps, the pinched tissue was separated, and the tumor was removed. The defect in the right main PA was reconstructed with bovine pericardium (Additional file : Video S1). The operative time was 404 min, with a blood loss of 940 ml. The postoperative course was uneventful, and the patient was discharged on postoperative day 16.
+Histopathological examination of the tumor revealed that the pulmonary artery intimal sarcoma consisted of three components: osteosarcoma components, chondrocyte components, and spindle cell components .
+Three months after the second operation, FDG PET/CT revealed a hypodense lesion without calcification in the right chest wall . CT-guided biopsy revealed PAS recurrence. FDG PET revealed another slight accumulation in the right PA in the central region of the PA reconstruction. Genomic analysis using the FoundationOne® companion diagnostic revealed a low-tumor mutational burden (TMB), microsatellite stable, and the loss of the methylthioadenosine phosphorylase (MTAP) gene (MTAP loss). According to a multidisciplinary conference, proton therapy was administered only to the chest wall lesion, and short-interval observation was determined for the lesion of the right PA because it was difficult to distinguish reactive accumulation associated with PA reconstruction from local recurrence. Two months after proton therapy, CT revealed a low-density lesion in the PA, indicating local recurrence . She received a second proton therapy for local recurrence and is alive independently with stable disease 25 months after tumor removal. At home, she maintains almost the same level of daily life activities as before the two surgeries with doing housework.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_821_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_821_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f3030ede79d33a0ac1e6dd295d3c1218728bf35e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_821_en.txt
@@ -0,0 +1,4 @@
+The patient is a 22-month-old Caucasian boy, born at 36 weeks by spontaneous vaginal delivery with normal prenatal care. He had no family history of glaucoma or anterior segment dysgenesis. At birth, he was noted to have bilateral cloudy corneas with no epiphora nor photophobia. He was started on presumptive treatment of topical dorzolamide 2% and hypertonic sodium chloride ophthalmic solution 5% prior to his presentation at the Bascom Palmer Eye Institute. A bedside eye exam revealed a “corneal opacity centrally sparing the periphery” and he was diagnosed with possible congenital glaucoma associated with Peters anomaly. Extraocular findings included short extremities and brachydactyly, cleft palate, characteristic facial features, developmental delay, and pulmonary stenosis .
+An exam under anesthesia (EUA) was performed the same day. Intraocular pressures (IOP) were 32 mmHg and 27 mmHg in the right eye (OD) and left eye (OS), respectively (Tono-Pen XL, Reichert Inc. Depew, NY). Bright red reflexes were noted prior to dilation in both eyes (OU). Other ocular abnormalities included iridocorneal adhesion superiorly OS and posterior capsular cataract OU. Given the absence of limbal enlargement, normal axial lengths, and an intact red reflex prior to dilation, glaucoma surgery was deferred. Phenylephrine 2.5% OU was added for optical dilation and visual rehabilitation, and topical dorzolamide 2% was continued.
+Four months later, a second EUA was performed, IOPs were 30 mmHg OD and 35 mmHg OS by Tono-pen. The corneal opacities were noted to have enlarged centrally, though the clear peripheral cornea still maintained intact red reflexes. The irides were noted to have formed whispy attachments to the corneas in both eyes. The view of the lens and posterior structures at this point were suboptimal. A diagnosis of Peters anomaly type 1 was made. Genetic testing subsequently identified a homozygous pathogenic variant in B3GLCT (c. 660 + 1 G > A splice donor; Invitae, Pediatric Genetics Specialty Practice, 60 W Gore St, Orlando, FL 32806, Oct 2017). His axial length measurements and B scan ultrasound estimate of cupping were both stable compared to baseline. Patient was monitored on the same medications without surgical intervention. Genetic screening were offered to patient’s parents but were declined.
+In the subsequent serial EUA, more adhesions between the iris and cornea OS were noted despite the generally improved corneal opacities OU. Posterior segment improved as the media opacity cleared. Fluorescein angiography (FA) was performed (RetCam3, Ophthalmic Imaging System, Natus Medical), and spectral-domain optical coherence tomography (SD-OCT) images were obtain (Spectralis flex module, Heidelberg Engineering). The optic discs were noted to have morning glory-like appearances suggestive of colobomatous changes, with a cup to disc ratio of approximately 0.7 OU. Diffuse chorioretinal atrophies were noted [Fig. a-b]. The right eye had a well-defined white-yellowish, comet shaped lesion along the superotemporal arcade [Fig. a]. A similar lesion that was well-circumscribed, oval-shaped and atrophic was seen in the central macula of the left eye [Fig. b]. FA demonstrated early hyperfluorescence of the lesion with no leakage in the right eye, and early hyperfluorescence secondary to a window defect corresponding to the macular lesion in the left eye. Late frames of the FA showed hyperfluorescence of the atrophic lesions [Fig. c-d]. There were neither leakage from the optic disc, nor vascular abnormalities in the peripheral retina. Intraoperative SD-OCT of the macula showed severe diffuse thinning of the retina and choroid in the atrophic lesions. Additionally, in the left eye oval shaped atrophic lesion, a complete loss of retinal structure was noted [Fig. ]. Written informed consent to publish the acquired images were obtained from the patient’s guardians.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_828_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_828_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..49895ca556efbb2d7ed36ca6665a9244e0a56c24
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_828_en.txt
@@ -0,0 +1,4 @@
+A 38-year-old Japanese woman, gravida 0, presented with abdominal distension and frequent urination, was found to have a pelvic mass on radiologic examinations. She had a history of laparoscopic uterine myomectomy about a year before the onset, where the bilateral ovaries were macroscopically normal . She had no menstrual irregularities or dysfunctional uterine bleeding. Serum estradiol (E2) level was elevated to 214.5 pg/ml (normal 70–160 pg/ml), while testosterone was within the normal range. Luteinizing hormone (LH) and follicle stimulating hormone (FSH) were 2.0 mIU/ml (normal 1-14mIU/ml) and less than 0.1 mIU/ml (normal 1.5-8mIU/ml) respectively, indicating E2-mediated negative feedback. CA 125 level was slightly elevated to 39.2 U/ml (normal < 35.0 U/ml). CEA, CA 19–9 and SCC antigen were within the normal range.
+The MR showed a large, multiloculated cystic mass with numerous septations in the pelvis measuring approximately 10 × 10 × 12 cm. On T2-weighted images, fluid-fluid levels were demonstrated in several cystic components . T1-weighted images demonstrated intracystic high signal intensities suggesting intracystic hemorrhage . Contrast-enhanced fat-suppressed T1-weighted images showed strong enhancement of the septations similar to uterine myometrium . The mass was suspected to originate from the right ovary because the right ovary was not identified. The left ovary was atrophic for her age . On diffusion-weighted imaging, the septations showed high signal intensity . The uterus was of normal size without endometrial thickening. There was a small amount of ascites which was limited to the pouch of Douglas and vesicouterine pouch . Any calcifications were not detected on CT images. GCT was suspected from these findings.
+Abdominal right ovarian tumor resection was performed. During the operation, the frozen section of the right ovarian tumor showed that malignancy could not be excluded due to its nuclear atypia. The differential diagnoses of the tumor included yolk sac tumor, malignant mucinous tumor and AGCT despite of the lack of any typical findings such as coffee-bean nuclei and Call-Exner bodies. Based on this report, abdominal simple total hysterectomy, bilateral oophoro-salpingectomy, partial omentectomy and appendectomy were performed.
+The gross appearance of the cut surface of the right ovarian tumor, measuring 13 cm in diameter, showed multiloculated cystic tumor accompanied by intracystic hemorrhagic foci. The left ovary had a maximum diameter of 1.7 cm, suggesting atrophy for her age . Microscopic examination of the right ovary showed round cells that surrounded the macrofolliculars with eosinophilic material and hemorrhage .The tumor cells had scant cytoplasm, round-to-oval vesicular nuclei with small eosinophilic nucleoli, and irregular nuclear contours. The typical findings for AGCT such as longitudinal nuclear grooves (coffee-bean nuclei) and Call-Exner bodies were not identified. The mitotic activity was focally brisk, with an average of 10 mitoses per 10 high-power fields in these areas . Immunohistochemically, tumor cells were positive for vimentin, calretinin, CD99, a-inhibin and MIB-1 labeling index was about 30%. The above findings supported the diagnosis of JGCT. Accordingly, the definitive diagnosis of JGCT, FIGO Stage IA led to no additional treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_833_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_833_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9af57e29a9c7b4eeacb3f49014db13553be0f405
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_833_en.txt
@@ -0,0 +1,6 @@
+A right-handed 42-year-old German man presented to our institution with convulsive seizures. There were no other neurological symptoms or signs and no neurological deficits. The initial computed tomography (CT) scan of his brain revealed a hyperdense lesion with calcification in the right parietal area. His cranial MRI scan demonstrated a popcorn-shaped mass in the subcortical white matter of his right parietal lobe. The lesion had smooth lobulated margins and no dural attachment was apparent. The lesion was hypointense on T1-weighted images and mixed hypo- and hyperintense on T2-weighted images. There were local mass effect, peritumoral edema and heterogeneously contrast enhancement. On his T2* gradient echo images the lesion showed focal spots of (dark signal) hypointense areas centrally compatible with calcifications, demonstrated on his CT scans, and a surrounding hypointense rim interpreted as hemosiderin deposition typical of cerebral cavernoma.
+A right parietal craniotomy was performed under MRI-guided navigational assistance. Grossly, no mass or any other pathologic tissue was observed below the dura or on the cortex. Using a sulcal approach, the mass reached about 2cm into the cortex, showing a good cleavage. The mass was completely calcified (like a stone) and measured about 1.5×1.5cm in diameter. A gross total resection could be achieved. Postoperatively, he had no neurological deficits.
+A histological examination of the specimen showed (at low magnification (5× objectives)) a tightly packed and parallel laminated mass of fibrous tissue . There were a few irregularly shaped small foci within the lesion, which were partly filled with flimsy tissue. At higher magnification (10× and 20× objective), many faded whorl structures and psammoma bodies were identified .
+Furthermore, the lesion contained areas of transition into mature lamellar bone and was partly bordered by brain tissue with piloid gliosis. There was no periodic acid-Schiff-positive inclusions, nor hemosiderin deposits. An immunohistochemistry analysis revealed focal positivity for epithelial membrane antigen and Vimentin . Staining the sample with reticulin did not reveal a hemangiopericytomas-like pattern. No other histological sign of atypia or malignancy was observed. The pathological examination was performed by two independent and board-certified pathologists. The final diagnosis was a ‘raddled’ psammomatous meningioma with extensive metaplastic ossification. The postoperative course was uneventful. He was discharged and returned to everyday life, showing no deficits.
+In the literature review, we identified 36 cases of intraparenchymal meningiomas, including our case report. Case reports with insufficient information and meningiomas secondary to underlying meningioangiomatosis were excluded; 29 cases were included in total. There were 18 male (62.1%) and 11 female (37.9%) subjects, with the age ranging between 0.4 and 60 years (mean: 21.2 years). Of the 29 intraparenchymal meningioma cases, 26 were located in the supratentorial region (89.7%) and three were located in the infratentorial region of the brain (10.3%). The frontal location was dominant, being reported in 12 cases (41.4%). The most frequently reported clinical presentation was seizure, being reported in 20 cases (69.0%). In almost all of the cases, the radiological appearance was a solid mass showing contrast enhancement.
+Preoperatively, three cases mimicked a glioma, one case mimicked metastasis und one case mimicked a cavernoma. Total surgical resection was the standard treatment approach and was achieved in all the cases, except in three cases involving the brainstem, in which only a subtotal resection was performed. Radiotherapy following the surgery was done in four cases und one subject additionally underwent adjuvant chemotherapy. Regarding the histopathology, the fibrous type proved to be dominant, being reported in 11 cases (37.9%). The majority of the patients had no postoperative deficits. The location, clinical presentation, radiological finding, and outcomes are summarized in Table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_843_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_843_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8f29264b1ce2a17186580e2b7387740e8b098760
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_843_en.txt
@@ -0,0 +1,8 @@
+A 49-year-old Sri Lankan man with a history of long standing type 2 diabetes mellitus and hypertension, presented with fever, loss of appetite and generalised body aches for 1 week duration. He had a past history of right medial malleolar screw fixation 10 years ago following a traumatic uncomplicated closed fracture. He was diagnosed with type 2 diabetes mellitus 20 years ago; however, he was lost to follow-up with poor glycaemic control demonstrated by a HbA1c on admission of 8.5%. He was a non-smoker and consumed alcohol occasionally. He did not have any history of chronic lung disease or steroid use. There was no recent history of trauma or break in skin integrity and there were no cutaneous lesions or ulcers evident on examination. However, he was a tractor driver and had a history of exposure to mud in paddy fields. Due to the presence of fever with considerable myalgia and exposure to mud in paddy fields, he was initially suspected to have leptospirosis and was started on intravenous ceftriaxone at the local hospital. Four days later, he developed right ankle swelling and discolouration and was transferred to the tertiary care centre for further management.
+On admission, he was febrile (103 °F) and tachycardic with a pulse rate of 104 / min. His other haemodynamic parameters were normal with a blood pressure of 140/80 mmHg and was mildly dehydrated with a urine output of 0.5 ml/kg/hour. He was not haemodynamically compromised due to sepsis and his urine output improved with fluid resuscitation. He had a white blood cell count of 15 × 103/uL with a neutrophil leucocytosis; C-reactive protein was 190 mg/dl and erythrocyte sedimentation rate was 86 mm/hour. His platelet count was 148 × 103/uL. His liver enzymes were mildly elevated and rest of the basic biochemistry was unremarkable (alanine transaminase: 252 U/L, aspartate transaminase: 222 U/L, serum creatine: 0.46 mg/dl). The X-ray of the right ankle revealed a healed fracture with two screws which were in position. There was no evidence of osteomyelitis .
+He underwent a wound debridement of the right ankle and the necrotic skin and subcutaneous tissue were excised. The pus collection in the subcutaneous tissue plane was removed. Aspiration of the ankle joint revealed purulent fluid. Therefore, an arthrotomy and washout was done. One loosely fitted screw was removed and the wound was left open. Removal of the second screw was considered but this procedure was abandoned due to technical difficulties and concern about iatrogenically causing a fracture in the process.
+The pus culture and the peripheral blood culture was positive for Burkholderia pseudomallei sensitive to meropenem and co-trimoxazole. Direct smear showed gram-negative bacilli with bipolar appearance. Non-lactose fermenting colonies with a metallic sheen were isolated on blood and MacConkey agar, and Burkholderia pseudomallei species were isolated using the latex agglutination test . The BD PHOENIX (Becton Dickinson Diagnostic Systems, Sparks, Md.) automated microbiology system for direct identification also confirmed the presence of Burkholderia pseudomallei.
+His melioidosis antibody titre using the indirect haemagglutination assay was > 10,240. He was empirically managed with intravenous ceftriaxone 1 g 12 hourly and metronidazole 500 mg 8 hourly for 7 days. This was because Leptospirosis or anaerobic infection of the lower limb was thought possible given his environmental exposure history. Following the bacterial culture reports and the antibiotic sensitivity patterns, a diagnosis of melioidosis was made and the antibiotics were changed to intravenous Meropenem 1 g 8 hourly and Metronidazole 500 mg 8 hourly. Metronidazole was continued due to the presence of necrotic tissue and suspicion of superadded anaerobic infection. However, after 1 week he clinically deteriorated with worsening wound infection, fever and septic shock. He was resuscitated with fluids and commenced on noradrenaline. He required inotropic support for 4 days. He underwent another wound debridement and the dose of intravenous Meropenem was escalated to 2 g 8 hourly while continuing intravenous Metronidazole 500 mg 8 hourly and oral Co-trimoxazole 1920 mg 12 hourly was also added. He improved after a few days following the second wound debridement and supportive management. Fortunately, he did not develop any other organ dysfunction. All three antibiotics were continued for a period of 8 weeks.
+He was screened for other foci for infection with chest radiograph, transthoracic and trans-oesophageal echocardiogram, abdominal ultrasonography and urine culture and all were negative. A computed tomography of the chest and abdomen was not performed as he did not have any clinical features to suggest a chest or abdominal foci of infection and the basic imaging were negative.
+His temperature normalised 4 days after the second wound debridement and escalation of antibiotic therapy. However, he further required repeated wound debridement and removal of necrotic and infected tissue. His inflammatory markers became normal after 5 weeks of antibiotics (C-reactive protein of 2.6 mg/dl). Wound healing with secondary intention was achieved after 6 weeks . He was given a total course of intravenous antibiotics for 8 weeks and was discharged on oral co-trimoxazole 1920 mg 12 hourly. Repeat X-rays at 2 months showed features of chronic osteomyelitis . Due to the high risk of recurrence, the eradication phase was continued for a period of 6 months.
+At 6 months follow up, he had satisfactory functional outcome with acceptable range of motion. There was no clinical evidence of relapse. However, the plain radiographic changes were persistent without any worsening.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_846_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_846_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..36460325261ec6615a636f30dccab8c501c25c96
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_846_en.txt
@@ -0,0 +1 @@
+A 9-month-old Caucasian female without any birth or past medical history was diagnosed with isolated enophthalmos of the right eye. The mother had noticed a backwards displacement of the right eye 3 months prior to presentation and consulted various specialists who stated a constitutional feature. General examination was normal with no deterioration of health status, neurological, abdominal or skeletal bone integrity. Ophthalmological examination revealed nothing but a mild right enophthalmos. There was no facial disfigurement such as flattening. Pupil size and reactivity to light, direct and consensual accommodation, fixation and following, binocular function, eye-hand coordination, reaction to patching, slit lamp and fundus examination were all normal. Before this isolated enophthalmos, blood and urine samples were collected and orbital computed tomography (CT) undertaken. Routine biology labs, in particular creatinin levels, were normal. An orbital CT scan confirmed the enophthalmos (Figure a) and showed irregularly shaped osteolysis with periosteal reaction of orbital walls, malar bones and zygomatic arches, predominantly on the right side (Figure b), arousing suspicion of a tumor. A thoracic- abdominal CT scan showed an 83 mm*43 mm*42 mm retroperitoneal heterogeneous mass located on the left adrenal gland (Figure ) embracing vascular elements and associated with intra-abdominal, left supraclavicular swollen lymph nodes and vertebral condensations, which was evocative of a stage-4 neuroblastoma. The patient was immediately referred to oncology for further investigation and treatment. The stage-4 neuroblastoma was confirmed and the patient treated with chemotherapy and surgical evacuation of residual masses. She achieved complete remission with no recurrence at 10-month follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_852_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_852_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b6efe5a126ba1832d50588c0ff379f721914305d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_852_en.txt
@@ -0,0 +1,4 @@
+A male patient, 2 years old, was admitted to the hospital on May 21, 2018 due a sustained fever of over 6 consecutive days, with his highest body temperature reaching 39.0 °C, which peaked once or twice per day, accompanied by coughing, phlegm, and shortness of breath. His local hospital diagnosed him with “acute upper respiratory tract infection” and prescribed him 5 days of Chinese herb medicine; however, his temperature was not alleviated. After entering our hospital, his chest X-ray showed that both of his lungs had an increased thickened texture. With possible inflammation suspected, the boy was then admitted as a pneumonia patient. Prior to the onset of the illness, the child’s spirit was normal, with no irritability or fatigue. His dietary intake was also normal, with normal appearing defecation. His medical history showed that he was a rather healthy baby, G1P1 (Gravida 1, Para 1) full-term delivery. He was breastfed and had normal growth and development for his age, and his parents were also healthy. As a child, he had no history of food or drug allergies reported, and no oral diuretics or catharsis drugs were taken previously. However, the child had a history of spontaneous night-sweats and enuresis according to his parents.
+Body temperature 37.0 °C, pulse 125 beats/min, breathing 25 breaths/min, blood pressure 95/65 mmHg, weight 10.5 kg, height 92 cm, slightly underweight (boy standard weight: 11.2–14.0 kg). Normal reflexes without shortness of breath or cyanosis. No rash, no swelling of superficial lymph nodes, pharyngeal hyperaemia. Bilateral tonsils were not enlarged. Rough tracheal sounds with phlegm rales were heard. Heart and abdominal examinations were normal. Extremities and spine were normal, physiological reflexes existed, and pathological reflexes were not elicited.
+Blood test showed WBC 14.85 × 109/L, N% 78.2, L% 14.6, HGB141 g/L, PLT 290 × 109/L, CRP10.0 mg/L. Stool and urine routines were normal; procalcitonin 0.3 ng/L; ESR 15 mm/h; ferritin 90.8 ng/ml; ASO normal; Mycoplasma pneumoniae antibody IgM negative. Liver and kidney function, glucose, coagulation function, rheumatoid index, thyroid function, lymphocyte subtype tests (NK cells, T cells, auxiliary T cells, reactive T cells, B cells) and immunoglobulins all met the reference ranges of his age group; repeated examinations of electrolytes indicated hypokalaemia, hypomagnesemia, low chlorine, low sodium and transient mild metabolic alkalosis (see Table for details). A further check of the 24-h urinary potassium was 57 mmol/24 h, and the 24-h urinary calcium was 2.86 mmol/24 h, which informed increased urinary potassium level; plasma renin activity was 142.05 pg/ml (4–24 pg/ml); angiotensin II was 435.62 pg/ml (25–129 pg/ml); aldosterone was 100.26 pg/ml (10–160 pg/ml); and serum cortisol and adrenocorticotropic hormone were normal. Multiple reviews of ECG and 24-h Holter showed 1st degree atrioventricular block (see Table for details), cardiac colour Doppler showed tricuspid valve, mild regurgitation of the pulmonary valve; abdominal colour Doppler showed intrahepatic calcification plaque and accumulation of gas in the colon; renal colour Doppler ultrasound and adrenal colour Doppler ultrasound did not appear abnormal.
+According to the symptoms, signs and chest radiographs of the child, he could be diagnosed with pneumonia. Analysis of pathogens and blood test results showed a high total number of white blood cells. Neutrophils were dominant, along with high CRP and PCT. According to the infection index combined with our clinical experience, these findings indicate the high possibility of bacterial infection. At the beginning of the treatment, intravenous ceftriaxone (80 mg/kg) was prescribed to treat the infection and to suppress coughing and phlegm with airway management. His body temperature dropped to normal within 24 h, which suggested the antibiotic was effective. On the day of admission, the emergency reports showed electrolyte values with “blood potassium 1.7 mmol/L” and “blood magnesium 0.59 mmol/L”. First, we considered the possibility of electrolyte imbalance secondary to pneumonia; thus, oral and intravenous potassium supplementation (4–5 g/day) were prescribed along with injection of magnesium sulphate and rehydration treatment. Regular review of electrolytes showed that blood potassium gradually increased to 3.1 mmol/L within 2–3 days; however, the result could not be sustained, and it was difficult to make it continue to rise. From further questioning of the child’s medical history according to the parents, it was learned that the child had long-term “sleepiness,” “drowsiness” and other symptoms accompanied by enuresis (3–4 times/week) and severe night sweats (parents described it as “like a shower”); he was also slightly light in weight. All of the above could have been due to possible chronic potassium loss. With persistent hypokalaemia and hypomagnesemia observed in the clinical stay, his urinary potassium excretion increased, and his urinary calcium was normal. The blood biochemical analysis showed that the PH and HCO3- were high. His blood pressure was normal, but plasma renin activity and angiotensin were high. The aldosterone levels were normal, and the clinical consideration of “Gitelman syndrome” was likely. Further second-generation gene analysis (KingMed Diagnostics) (see Figs. and for details) detected two heterozygous mutations (SLC12A3 (16q13/NM-000339.2)): exon number Exon12, cDNA level 1456G > A, protein level Asp486Asn, considering that the disease gene was derived from the mother; and exon No. Intron12, cDNA level 602-16G > A, protein levels were normal, considering a suspicious pathogenicity derived from the father. With the Gitelman syndrome diagnosis having been established, long-term oral potassium citrate granules were prescribed to be taken for 1 year. Blood potassium levels were stable between 3.1–3.5 mmol/L, and the PR intervals were between 0.17–0.2 cm. Growth and development were normal, and the enuresis disappeared, but the night sweats still persisted.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_85_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_85_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..816d5369b31bc4b1ff75192efa94e5cb0a056e7e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_85_en.txt
@@ -0,0 +1,8 @@
+A 14-year-old Chinese Malaysian boy presented to University Malaya Medical Centre, Kuala Lumpur in September 2013 with history of recurrent pneumonia, poor growth and steatorrhoea since childhood. He had finger clubbing and bronchiectasis. Later, he was diagnosed with CF and Pseudomonas aeruginosa was isolated from his sputum. He received 3 weeks of intravenous ceftazidime (50 mg/kg/dose, QDS) and gentamicin (5 mg/kg/dose, OD). He was discharged with azithromycin (5 mg/kg EOD), nebulised gentamicin (80 mg BD) amongst other CF-related medications. In November 2013, he was readmitted with a pulmonary exacerbation and his sputum sample grew methicillin-resistant Staphylococcus aureus (MRSA) and he received intravenous vancomycin, oral rifampicin (300 mg BD) and sodium fusidate (500 mg TDS) with significant clinical improvement. During a follow-up visit in December 2013, he had a productive cough but was apyrexic. He was empirically treated with oral ciprofloxacin (750 mg BD) and the sputum sample later isolated B.pseudomallei. As he clinically improved, the treatment regimen remained unchanged. Subsequently, the repeat sputum samples were negative for B.pseudomallei and he continued to remain active with good exercise tolerance and relatively stable lung function. It is noteworthy that he had been residing in an urban area of non-endemicity for melioidosis and there were no other known risk factors identified.
+In August 2014, he was admitted with another pulmonary exacerbation and his cultured sputum grew B.pseudomallei and Pseudomonas spp. His chest radiograph showed diffused interstitial changes with bronchiectasis throughout both lungs with minimal pleural effusions. He received 2 weeks of intravenous ceftazidime (2 g; 6hourly) and amikacin (720 mg; 15 mg/kg/OD). Upon completion of antibiotics, he remained afebrile and the chest auscultatory findings improved. He was discharged with 6 months of oral doxycycline, and co-trimoxazole to treat the B.pseudomallei and 3 months of nebulized amikacin for chronic P.aeruginosa. He still continued on his alternate day of azithromycin (250 mg).
+A detailed travel history revealed that in June 2014, he visited recreational parks in Sabah, Malaysia. During the visit, he went jungle trekking, snorkeling and dipped in a hot-water spring. It is noteworthy that melioidosis is endemic in Sabah, one of the two East Malaysian states on the island of Borneo, where B.pseudomallei prominently occurs in soil and water. Later then, he was admitted 3 monthly for antibiotic tuning and his sputum culture had no specific bacterial growth.
+In August 2015, there was a decline in his lung function tests with deterioriorating cough. A bronchoscopy was performed and Burkholderia cepacia was isolated from his bronchoalveoloar lavage specimen, while acid-fast bacillus (AFB) smear was weakly positive. Initially, the patient was treated with intravenous imipenem and ceftazidime for 3 weeks but had recurrence of fever. However, the sputum AFB smears remained positive although the suspected nontuberculous mycobacterium could not be isolated despite various culturing techniques. Therefore, the antibiotics were changed to intravenous meropenem, doxycycline, amikacin and oral clarithromycin to treat both the B.cepacia and the suspected nontuberculous mycobacterium.
+Upon discharge, he had been continuing with amoxicillin-clavulanate and doxycycline for 6 months, which helped with weight gain and secretion reduction. Repeat AFB smear remained negative for the subsequent 5 months. However, in January 2016, further decline in his lung function was observed with worsening respiratory symptoms. A chest computed tomography showed worsening bronchiectasis, tree in bud appearance in the lung peripheries, patchy consolidation and several enlarged lymph nodes at the right paratracheal region . His sputum sample grew P.aeruginosa and was also strongly positive for AFB. Intravenous meropenem and ceftazidime (for P.aeruginosa) and combination therapy of rifampicin, ethambutol, azithromycin and nebulized amikacin (for nontuberculous mycobacterium) was started. He improved clinically and was discharged with the above oral medications for 6 months.
+B.pseudomallei was isolated once again in April 2016 and he was treated with intravenous amoxicillin-clavulanate and ceftazidime for 3 weeks. He was then discharged with 6 months of oral amoxicillin-clavulanate. However, in May 2016, his antibiotics were changed to levofloxacin (750 mg) and clarithromycin (500 mg). Following that, for the next 8 months, his sputum sample continued to grow B.pseudomallei but was negative for AFB. Despite many admissions for intravenous antibiotics against B.pseudomallei, the patient passed away from end stage respiratory failure in February 2017. Bacteriological reports were reviewed, and over the 3 years, the patient had several infective exacerbations and his sputum samples grew Gram-negative organisms that were later identified to be B.pseudomallei, Pseudomonas spp., P.aeruginosa, or B.cepacia .
+All the isolates were found to have different susceptibility patterns (resistant to co-trimoxazole; intermediate to doxycycline and susceptible to all other antibiotics). The B.pseudomallei isolated in 2013, 2014 and 2016 (UMC083, UMC 082 and UMC114, respectively), were also further confirmed as B.pseudomallei using API 20NE (Biomerieux, France), Ashdown agar and also an in-house polymerase chain reaction (PCR) using specific primers . However, we were not able to obtain the B.pseudomallei isolated in 2017.
+The isolates were characterized by multilocus sequence typing (MLST), a method of molecular subtyping that compares sequences of seven housekeeping genes , and repetitive-element PCR (rep-PCR). It appeared that these isolates were of two different sequence type (ST); ST51 (UMC083 and UMC114), which is a common ST found widely in Malaysia, Thailand, Singapore, Hong Kong and China, and ST1644, (UMC082) a new ST. The STs were deposited in the B.pseudomallei MLST database .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_868_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_868_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..71c945c4c10327152cc232d1cc910c4e2c340963
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_868_en.txt
@@ -0,0 +1,4 @@
+The patient is a 67-year-old male who underwent surgical mitral repair and tricuspid annuloplasty due to severe mitral regurgitation (MR) and moderate tricuspid regurgitation. The procedure involved the use of a 36 mm Edwards Physio annuloplasty ring (Edwards Lifesciences, Irvine, CA, USA). Three months ago, the patient was admitted to our department with fatigue, chest tightness, and exertional dyspnea (New York Heart Association functional class IV). Echocardiography showed recurrent severe MR (volume = 36.0 mL; Vmax = 167 cm/s), and maximum transvalvular gradients were 13 mmHg. The left ventricle was dilated and showed a systolic ejection fraction of 46%.
+A multidisciplinary cardiac team performed a meticulous evaluation of his transesophageal echocardiography (TEE) scans and computed tomography angiography scans and obtained the informed consent after having discussed all available treatment methods. Since the patient was highly symptomatic and at very high risk of secondary thoracotomy surgery, it was decided to perform the TMViR due to the possibility of the need for a high-risk surgical reoperation (based on Society of Thoracic Surgery score, 11.192%; European System for Cardiac Operative Risk Evaluation Score II, 8.3%) (A–E). Meanwhile, a patient-specific3D-printed model was created using computed tomography angiography data. The image data, in Digital Imaging and Communications in Medicine format, were collected and processed using Materialise Mimics 21.0 software (Materialise, Leuven, Belgium). The software was used to segment the images and export them in the Standard Tessellation Language (STL) format. Post-processing of the STL files was performed using Materialise 3-Matic software (Leuven, Belgium, version 14.0). The final STL files were then imported into a Polyjet 850 multimaterial full-color 3D printer (Stratasys, Inc., Eden Prairie, MN, USA). The printer utilized materials with different flexibilities to accurately represent the structural characteristics of different parts, such as the annuloplasty ring and myocardial tissue (F–H). Then, the procedures were simulated during the bench test. After its release, the unfolded bioprosthetic valve was observed clearly. The information obtained was used to evaluate and prognosticate major perioperative complications. Because the area of a 36 mm Physio ring was 7.0 cm2, and in addition, because the ring was D-shaped and semirigid and had a high risk of complications for the transcatheter aortic valve-in-ring concept, we decided to implant the Mi-thos system (I) via a transapical approach.
+The procedure was conducted with the patient under general anesthesia and mechanical ventilation. Intraoperative guidance was provided using fluoroscopic images and TEE. A 4 cm left anterior mini-thoracotomy incision was made to access the puncture point at the apex of the left ventricle. Puncture and cannulation were carried out using 6F sheaths on both the right femoral artery and vein. Subsequently, a temporary pacemaker electrode was carefully inserted into the right ventricle through the vein sheath. At the same time, a 6F pigtail catheter was advanced from the right femoral artery to the left ventricle. We successfully obtained standard apical access and secured the entry site using a hexagonal suture. To optimize visibility of both the left ventricle and atrium, we made adjustments to achieve a cranial right-anterior-oblique angulation. Ventriculograms were performed to evaluate the MR and to assess the shape of the left ventricle and the mitral annuloplasty ring. Based on the preoperative assessment and simulation conducted using the patient-specific3D-printed model (A–C), the assembly of a 33 mm Mi-thos bioprosthesis onto the delivery system was performed in vitro. To begin the procedure, an apical puncture was made, and a 6 Fr sheath was inserted. A 6F pigtail catheter, along with a J-tipped 0.035-inch guide wire, was then guided across the mitral surgical ring and into the left atrium. Following this, a 260 cm Lunderquist super stiff wire (Cook Medical Inc., Bloomington, IN, USA) was then used for exchange. The delivery system was inserted over the Lunderquist guide wire and advanced in a retrograde manner across the mitral annuloplasty ring via the transapical approach, ultimately reaching the left atrium. By retracting the outer sheath of the delivery system, the atrial skirt, which was specifically designed to fit the D-shaped mitral annulus, was released. It completely covered the mitral annulus and the annuloplasty ring, guided by TEE and fluoroscopy, while the ventricular portion of the device remained partially confined to the sheath. After confirming the position and alignment of the Mi-thos valve, the entire system was retracted and properly seated on the mitral annuloplasty ring. Subsequently, under rapid pacing at a rate of 140 per minute, the ventricular portion of the bioprosthesis was released and securely anchored to the native MV using secure barbs.
+Immediately ventriculograms confirmed the excellent position and shape of the Mi-thos valve, with no evidence of transvalvular regurgitation, paravalvular leak (PVL), or left ventricular outflow tract obstruction (LVOTO) (the area of the neo-left ventricular outflow tract was 374.6 cm2). The valve’s position and function were further assessed using TEE, which indicated a mean pressure gradient of 3 mmHg (D–I, ). Subsequently, the delivery system was carefully removed through the apex incision, and hemostasis was achieved using the apical strings that were previously placed. After closing the incision, the patient was successfully weaned off the ventilator and transferred to the cardiac intensive care unit. The postoperative recovery was smooth, and the patient was discharged in good clinical condition 5 days after the operation. At the time of discharge, the transthoracic echocardiogram examination confirmed the excellent position and function of the valve. Additionally, there was no evidence of any significant transvalvular or paravalvular regurgitation, as well as no LVOTO, and the maximum and mean gradients were measured at 6 mmHg and 2 mmHg, respectively. The patient’s symptoms had improved (NYHA functional class II).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_872_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_872_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1320e6d2fa48d7062e878305636904b32a6cfc54
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_872_en.txt
@@ -0,0 +1,8 @@
+A 22-year-old woman, G3P1, was admitted in August 2021 after being referred from a local hospital for amenorrhea of 23 weeks and 5 days duration.
+Before referral, an ultrasound scan in the seventh week of her pregnancy showed she had a congenital uterine malformation suspicious of a bicornuate uterus. The scan also revealed an intrauterine pregnancy in one cavity, a live embryo, a small amount of fluid around the pregnancy sac, and what appeared to be some fluid in the other uterus. Her previous pregnancy, five years earlier, culminated in an emergency cesarean section for intrauterine fetal distress. She claimed to have a bicornuate uterus.
+After admission, an ultrasound scan showed a live fetus in the abdominal cavity with the placenta on the right side of the abdominal cavity instead of in the endometrium. We diagnosed the woman with a case of abdominal pregnancy.
+In September 2021, during the 29th week of her pregnancy, the patient experienced intermittent abdominal pain for 3 h. Magnetic resonance imaging (MRI) revealed an abdominal pregnancy and rupture of the fetal membranes. We performed an emergency laparotomy and found part of the omentum adherent to the anterior abdominal wall and a live fetus of the same gestational age on the left side of the abdominal cavity.
+During the surgery, we performed procedures such as transurethral ureteroscopy, double J-stent placement, transabdominal fetal removal, placentectomy , right uterine cornual repair, and pelvic adhesiolysis. We found that the amniotic membrane had ruptured, but there were no clear ascites or amniotic fluid in the abdominal and pelvic cavities. In the right pelvic cavity, an amniotic sac covered the placenta, which was attached to the right uterine horn. The placental implantation site was approximately 2 cm × 3 cm, the placental size was approximately 15 cm × 10 cm, and the fetal membrane was wrapped around it. The uterus was enlarged, equivalent to the size of a 60-day gestation, soft, and showed no abnormalities in the appearance of the bilateral appendages. The right fallopian tube and the ovarian ligament were approximately 1 cm from the implantation site. We separated the adhesions between the omentum and the anterior abdominal wall, carefully explored the pelvic and abdominal cavities, and found the placenta implanted in the right uterine horn with no evidence of pelvic, abdominal organ, or large vessel involvement.
+We delivered a live male infant in the left sacro-anterior position (LSA) weighing 1200 g, with a body length of 38 cm and a head circumference of 27 cm. The APGAR scores at 1 min and 5 min after birth were 10 and 10, respectively. The placenta weighed approximately 500 g.
+The placenta was attached to the right uterine horn, and the left uterine horn was normal. The fetus and placenta entered the abdominal cavity by rupturing the right uterine horn. The placenta was attached to the right uterine horn, sealing the rupture. The surgeon repaired the right uterine horn after delivering the placenta.
+The patient had an uneventful recovery and was discharged eight days after surgery. The discharge diagnosis was rudimentary uterine horn pregnancy and secondary abdominal pregnancy. Immediately after birth, the newborn was transferred to the Neonatal Intensive Care Unit (NICU) for further management. He was diagnosed with bronchopulmonary dysplasia, neonatal respiratory distress syndrome, intrauterine infectious pneumonia, premature encephalopathy, jaundice of premature infants, anemia of premature infants (moderate), sclerema neonatorum (mild), hyperthermia, and fetal growth restriction. He also had hypoalbuminemia, hyperkalemia, and vitamin D deficiency. Eventually, he was discharged from the hospital after 41 days of NICU management. A follow-up was scheduled for this patient, but she did not have regular follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_873_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_873_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e654cbf749fb4ddfd748ac62901fa540f2d7e502
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_873_en.txt
@@ -0,0 +1,5 @@
+A 56-year-old woman, of Moroccan nationality, a chronic cigarette smoker consuming an average of one pack a day for 38 years, was hospitalized for a large right-sided hemifacial swelling. Her early symptoms dated from 4 months previously, by the appearance of straight facial neuralgia, treated as dental neuralgia without any improvement. The evolution was marked by rapid aggravation of the pain, which then became disabling, and the emergence of a right-sided maxillary swelling rapidly increasing in size and accompanied by a limitation of mouth opening, and a nasal obstruction with episodes of epistaxis.
+A clinical examination determined a painful and inflammatory right-sided hemifacial swelling, right exophthalmus without notion of decreased visual acuity, and hypoesthesia at the second and third trigeminal nerve areas. An endonasal examination detected a tumor mass in her right nasal cavity, friable and bleeding at contact. An oral examination, very difficult because of the limited mouth opening, showed an erosion of the hard palate. Cervical lymph node areas were free and an endoscopy examination of the upper aerodigestive tract did not show any lesions. Otoscopy and audiometry test results were normal. Our patient was hospitalized and placed immediately on morphine.
+A computed tomography (CT) scan revealed the presence of a large heterogeneous mass occupying her infratemporal fossa as well as the masticator space and right maxillary sinus, lysing the walls of the maxillary sinus, the ascending branch of the mandible and the orbital floor with ethmoidonasal, parapharyngeal and intraorbital extension.
+A magnetic resonance imaging (MRI) scan showed an aggressive and invasive tumor occupying her right infratemporal fossa and maxillary sinus with irregular boundaries, heterogeneous intermediary signal at T1 and T2 weight, with sphenoidal, ethmoidonasal, nasopharyngeal and intraorbital extension. This process infiltrated the jugal and temporozygomatic soft parts, with heterogeneous contrast enhancement and areas of necrosis .
+A nasal endoscopic biopsy was performed. A pathological examination was in favor of a malignant process, poorly differentiated and invasive . An immunohistochemical examination demonstrated a total cytoplasmic positivity to anti-S100 protein antibody, concluding in a diagnosis of malignant schwannoma . The staging, including a cervico-thoraco-abdominal CT scan, did not find any distant metastasis. According to the clinical and radiological data obtained, palliative radiotherapy was decided, delivered by a linear electron accelerator, at a total dose of 30Gy, 10Gy by fraction, over 3 days, with one field including the tumor mass. The outcome was favorable with improvement of symptoms. Unfortunately, our patient died 10 days later after severe respiratory distress.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_87_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_87_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e3e761171337ad6ff5d93d6761a5aae03c64c487
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_87_en.txt
@@ -0,0 +1,12 @@
+A 47-year-old male patient from Gaza was referred to our hospital due to body weakness, dysphagia and dysarthria of 14 days duration.
+He was in his usual state of health until two weeks before admission when he started to complain of proximal muscle weakness that was increasing in severity in addition to fatigue, difficulty in speech and chocking episodes mainly triggered by liquids.
+In Gaza hospital the doctors performed a brain and whole spine MRI which showed no abnormality. Furthermore, a lumbar puncture was done with normal results.
+Due to a progressive deterioration of his symptoms, as his weakness was so severe he was almost became quadriplegic, his case was referred to our hospital.
+An NG tube was introduced due to his severe dysphagia and he was reevaluated with a thorough physical examination that showed: mild respiratory distress with a respiratory rate of 19 breaths/min, vitiligo over his entire body, weak gag reflex and nasal speech. The lower limb weakness was 1/5 bilaterally and the upper limb weakness was 2/5 with intact sensation and hyporeflexia.
+An electromyography (EMG) and nerve conduction studies were also performed and showed a decrement in the muscle action-potential which lead to the suspicion of myasthenia gravis. Thus a serum anti-Ach receptor antibodies titer was done with positive results leading to the confirmation of this suspicion.
+During the patients’ time of hospitalization and evaluation, it was discovered that his fasting cortisol levels and TSH levels were low (TSH was 0.35 mU/L) whereas the T3 and T4 were high.
+Since the patient was found to have findings of three autoimmune diseases, autoimmune polyglandular syndrome was considered.
+Six sessions of plasmapheresis were done. The patient was also prescribed prednisolone pyridostigmine, azathioprine, vitamin D and thyroxin.
+After we started his treatment, the patient's muscle power started to improve (after the third session of plasmapheresis we could notice the improvement).
+In addition, physiotherapy was recommended and after six sessions he was able to walk alone again, the NG tube was removed and he was started on oral feeding with a semi-solid diet.
+He was discharged later after a good response to treatment with a good prognosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_897_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_897_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e8e79563b3398d95084e7e9d3aea46450f830051
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_897_en.txt
@@ -0,0 +1,4 @@
+A 69-year-old Caucasian man was admitted to intensive care unit because of a persistent comatose state (Glasgow Coma Scale scored at 6) following a generalized tonic-clonic seizure requiring intubation. His high blood pressure (>190/110 mm Hg) required intravenous infusion of nicardipine. Brain CT scan and MRI (with DWI, FLAIR, T2, and T2*) showed no abnormalities. He had a past medial history of oral cancer treated in 2007 with surgery and radiotherapy. He had a comorbid condition of obesity and dyslipidemia. Electrocardiogram (ECG) revealed transient left bundle branch block which normalized a few hours later. Troponin and BNP were elevated to 35 ng/mL (n < 0.05) and 600 pg/mL (n < 100), respectively. Cardiac ultrasound showed large apical akinesia with altered left ventricular ejection fraction (LVEF). Angiography showed no occlusive lesion or stenosis, and left ventriculogram showed regional wall motion abnormalities involving the mid and apical segments, characteristic of takotsubo cardiomyopathy .
+After 3 days, the patient's consciousness improved. However, he continued to have persistent left-sided hemiparesis predominantly in the upper limb. Electroencephalogram showed slight slowing of cerebral activity in the right hemisphere without paroxysmal activity. The CSF analysis was normal (biochemistry, bacteriology, virology, pathology). A second brain MRI was performed on day 3 and displayed bilateral, cortical, and subcortical vasogenic edema with a right posterior predominance, suggesting the diagnosis of PRES. A cerebral angiography performed on day 12 showed no abnormalities and in particular no stenosis that could have been in favor of a reversible cerebral vasoconstriction syndrome.
+Troponin, BNP, LVEF, and cardiac kinetics normalized a few days later as would be expected in transient apical ballooning syndrome. A brain MRI obtained 15 days after admission showed complete resolution of the vasogenic edema confirming the diagnosis of PRES. The patient recovered fully within 3 months.
+In the history there was no record of a stressful physical or emotional event preceding the onset of the patient's symptoms. Biological samples and abdomen/pelvic CT scan found no evidence of thyroid dysfunction or pheochromocytoma.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_901_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_901_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9ee8795cf574cbe1bb1be9f6d8491774d5e39ecf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_901_en.txt
@@ -0,0 +1,5 @@
+A 62-year-old man with a history of hypertension and dyslipidemia became aware of visual field impairment and right upper limb weakness. 5 months later, he underwent a check-up at the hospital ophthalmology clinic, where he was diagnosed with right homonymous hemianopsia. Computed tomography (CT) showed an intracranial mass lesion, for which he was referred to the neurosurgical department of the same hospital. At that time, he had symptoms of the right homonymous hemianopsia and weakness of the right upper limb (manual motor test: 4/5).
+CT imaging revealed a multilobular heterogeneous density mass with a diameter of 38 mm × 33 mm × 23 mm, which compressed the ipsilateral basal ganglia. CT angiography showed unremarkable enhancement of the mass lesion. Head magnetic resonance (MR) T1-weighted imaging showed a heterogenous mixed intensity mass buried in the left basal ganglia, and compression of the optic nerve on the contralateral side. MR T2-weighted images showed findings suggestive of partial aneurysm wall hemorrhage, with no remarkable perifocal edema in the vicinity of the dome. Contrast-enhanced MR imaging (MRI) demonstrated poor contrast enhancement of the aneurysm wall which indicates little involvement of the vasa vasorum . Digital subtraction angiography (DSA) showed small contrast depiction at the vicinity of the neck of the aneurysm with a diameter of 6.5 mm × 6.5 mm × 4.5 mm at the terminal part of the left internal carotid artery (ICA) . Perforators originating from the vicinity of the aneurysmal neck were depicted and the terminal part of the ICA. The patient was diagnosed as having a symptomatic, giant, partially thrombosed left ICA aneurysm compressing the visual pathway and the posterior limb of the internal capsule.
+In such cases, the treatment strategy of direct surgical decompression of the aneurysm can be expected to immediately improve the symptoms caused by the mass effect. However, the procedure is associated with difficulty in securing the perforators in the vicinity of the aneurysm. Hence, we decided to perform stent-assisted “jam-packed” coil embolization with the purpose of interrupting the blood supply to the dome as soon as possible.
+Aspirin (100 mg/day) and clopidogrel (75 mg/day) were administered a week before the procedure. An 8-Fr long sheath was placed in the right femoral artery under general anesthesia with motor evoked potential (MEP) monitoring. Heparinization was performed to maintain the activated clotting time at over 300 s. An 8-Fr guide catheter and 6-Fr distal access catheter were introduced into the left ICA, along with microcatheters for stenting (Headway 21, Terumo, Tokyo, Japan) and coil embolization (SL-10, Stryker, US). An LVIS stent (3.5 mm × 17 mm; Terumo, Tokyo, Japan) was deployed from the MCA proximal to the ICA with 25% shortening to enhance metal coverage ratio. using the push technique . Intra-aneurysmal flow stagnation was seen after stent deployment, and coil embolization was subsequently performed by tightly packing the aneurysm with hydrogel coils over 50% coil length (Hydrocoil, Terumo, Tokyo, Japan). Complete obliteration of the aneurysm was confirmed after the procedure without a change in MEP. This stent-assisted jam-packed coil embolization technique, shortening of braided stent to enhance metal coverage ratio of the neck and tightly-packing coil embolization using hydrogel coils, can immediately block blood flow into the aneurysm.
+Postoperative diffusion-weighted imaging showed no new ischemic lesions and no new neurological symptoms. In addition, his preexisting symptoms were alleviated and he was subsequently discharged. 3 months after the treatment, his symptoms had completely recovered and DSA showed complete obliteration of the aneurysm and stent endothelialization. MRI performed 13 months after the treatment demonstrated remarkable shrinkage of the aneurysm .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_909_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_909_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..988452d7b5765784260618a1d62d06d8291cba44
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_909_en.txt
@@ -0,0 +1,2 @@
+We report the case of a 65-year-old Berber man admitted to our urology department because of renal failure. He had a history of symptoms of bladder fullness and emptying with a 1-year evolution characterized by decreased force and caliber of the urine stream, intermittency, dysuria, frequent urge to urinate, urgency and terminal dribbling with nightly urination (three to five times). The evolution of his symptoms included acute urinary retention 1 month prior to urological testing. During the patient’s medical history interview, he referred to chronic lumbar pain but no weight loss. During the physical examination, his full bladder was found not to be palpated, his genitals were adequate for age and sex and a DRE revealed a normotonic sphincter. His prostate was enlarged and had an adenomatous surface. The routine laboratory findings revealed biologic renal failure with the following laboratory panel values: urea 43.5mg/dl, creatinine 0.8mg/dl, sodium 144mEq/L, potassium 4.5mEq/L, chloride 118mEq/L and free PSA 4.12ng/ml. An abdominal ultrasound confirmed prostatic enlargement, estimated at 45ml with regular edges, good definition of homogeneous echogenicity and regular bladder wall thickness hypertrophy . Another image showed bilateral ureterohydronephrosis , and PVR urine volume was found to be 35ml. Uroflowmetry demonstrated maximum urinary flow rate and average urinary flow rate to be 13ml/s. Our investigations were completed with drip infusion pyelography, which showed significant dilatation of the upper urinary tract and a partial defect of the distal ureter .
+The patient underwent bilateral JJ stent insertion with transurethral resection of the prostate. The Foley catheter was removed after 2 days, after which the patient was able to void without difficulty. The patient was discharged 3 days after surgery without any obvious complications. A pathologic examination revealed benign prostatic gland hyperplasia. At the patient’s 3-month follow-up examination, his JJ stent was removed. He had comfortable urination without renal failure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_912_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_912_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2f69ee5ecf8cdeabd7acfcf633fa3473b9374833
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_912_en.txt
@@ -0,0 +1,4 @@
+A 70-year-old woman presented to our outpatient clinic. She complained of motor weakness in the right hemisphere, which had appeared 4 months before. Magnetic resonance imaging was performed to rule out the presence of any intracranial lesions. Chronic lacunae infraction of the left corona radiata was detected on fluid-attenuated inversion recovery images. The lacunae infraction of the left corona radiata was considered a cause of her right motor weakness. No edematous changes were found in the infratentorial or supratentorial regions. However, magnetic resonance angiography revealed a vascular lesion . Vascular lesions were also found below the cerebellar tentorium on constructive interference in steady-state images . Cerebral angiography was performed as an arteriovenous shunt was suspected. A right external cerebral angiogram showed an arteriovenous shunt supplied by the mastoid branch of the occipital artery. A selective angiogram of the mastoid branch of the occipital artery revealed that the arteriovenous shunt was fed by the PMA. The arteriovenous shunt showed two draining patterns, travelling through the superior vermian vein to the petrosal vein and superior petrosal sinus and through the inferior hemispheric vein, inferior hemispheric vein, and tentorial sinus [ and ]. The left occipital angiogram showed an arteriovenous shunt fed by the left PMA [ and ]. On maximum intensity projection images, the shunting point was located beneath the cerebellar tentorium, and the drainer ran through the tentorial sinus into the transverse sinus . The internal carotid angiogram revealed no apparent feeders. The bilateral posterior cerebral arteries were of a fetal type. The straight sinus flow was anterograde. The left vertebral angiogram revealed no feeders. Venous congestion was suspected on the venous phase of the left vertebral angiogram. No retrograde flow of the basal vein of Rosenthal was observed [-]. Based on the findings of cerebral angiography, the arteriovenous shunt was diagnosed as TDAVF fed by the bilateral PMAs draining into the straight sinus with retrograde venous flow (Borden type III, Cognard type III). Transarterial endovascular surgery was planned to prevent hemorrhagic events associated with TDAVF.
+Under general anesthesia, two Envoy 5F 90 cm MPD (Codman Neuro, Raynham, MA, USA) were introduced in the bilateral occipital artery. The mastoid branch of the left occipital artery was selected with a Masters HF 2.8-Fr/3.2-Fr 125 cm (ASAHI INTECC J-Sales, CO., LTD, Tokyo, Japan) and a Traxcess 14 0.012/0.014 200 cm (Terumo Corporation, Tokyo, Japan). The Masters HF 2.8-Fr/3.2-Fr 125 cm was placed at the mastoid foramen. Using an ASAHI CHIKAI 0.014 200 cm (ASAHI INTECC J-Sales, CO., LTD, Tokyo, Japan) and a Traxcess 14 0.012/0.014 200 cm, another Masters HF 2.8-Fr/3.2-Fr 125 cm was introduced through the mastoid branch of the right occipital artery to the right PMA. As the left PMA was quite tortuous compared to the right PMA, we considered that a transarterial embolization approached from the right PMA was the easiest course of action. From the right Masters HF 2.8-Fr/3.2-Fr 125 cm, a Carnelian MARVEL® 1.6/1.8-Fr 155 cm (Tokai Medical Products Inc.) was introduced near the shunting point with an ASAHI CHIKAI 0.008 200 cm (ASAHI INTECC J-Sales, CO., LTD, Tokyo, Japan) . A Carnelian MARVEL® 1.6/1.8-Fr 155 cm was also placed in the left PMA to inject the contrast medium intraoperatively. The inner lumen of the right Carnelian MARVEL® 1.6/1.8-Fr 155 cm was filled with 5% glucose solution, after which heated 20% n-butyl-2-cyanoacrylate (NBCA) was injected from the right Carnelian MARVEL® 1.6/1.8-Fr 155 cm. After NBCA reached the drainer with an injection volume of 0.3 mL, the right Carnelian MARVEL® 1.6/1.8-Fr 155 cm was removed. NBCA migrated partially to the left transverse sinus, left inferior hemispheric vein, and left petrosal vein [ and ]. The right and left occipital angiogram revealed the disappearance of the shunt [-], which was also confirmed by cone beam computed tomography using a half-diluted contrast agent. NBCA did not migrate to the arteries. The bilateral common carotid angiogram also revealed the disappearance of the shunt, and the venous flow was anterograde. A vertebral angiogram was finally acquired to ensure shunt disappearance. However, a residual arteriovenous shunt, which was not seen on preoperative angiography, was identified. Venous congestion also remained in the left cerebellar hemisphere [-]. On 3-dimensional reconstructed maximum intensity projection (3D-MIP) images, the residual arteriovenous shunt beneath the cerebellar tentorium was identified above the location of the NBCA along the cerebellar tentorium .
+On the 3D-MIP images, a dural branch originating from the SCA was identified as the feeder of the residual shunt. The artery originated close to the bifurcation of the basilar artery and the SCA. The artery branched from the anterior pontomesencephalic segment of the SCA and was considered to be the AWW [ and ]. As the embolization of the main shunting point with NBCA was successfully achieved and the shunting flow was not remarkably strong, we considered that the residual arteriovenous shunt could be monitored under observation.
+The patient’s postoperative course was uneventful. The residual arteriovenous fistula fed by the AWW disappeared spontaneously, as seen on follow-up vertebral angiography 1 week after the procedure [ and ]. No cerebellar ischemic lesion was observed postoperatively. The patient was discharged from the hospital without any neurological deficits. No apparent recurrence of the TDAVF was observed on the cerebral angiogram acquired 6 months after endovascular embolization.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_913_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_913_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bcee697b9a9f8e7a7ca79a490badfb3d5d106bfd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_913_en.txt
@@ -0,0 +1,5 @@
+A 29-year-old black Cameroonian of Bamileke ethnicity, gravida 5, para 3 with a past obstetric history of two consecutive caesarean sections done 9 and 5 years ago. Also noted was a successful trial of scar 2 years after the second caesarean section and a uterine evacuation following a miscarriage at 8 weeks of gestation.
+The patient before consultation in our facility had been hospitalised twice in an integrated health centre for mild pelvic discomfort and two episodes of bleeding per vaginum, for which she was managed with injectable progesterone and discharged with favourable evolution.
+The client was then received in our emergency department at 20 weeks gestation with mild to moderate intermittent lower abdominal pains associated to mild epigastralgia. The client however had a history of fever 24 h before consultation but no urgency, frequency nor mictalgia were reported. The parameters at entry had as temperature 37 °C, blood pressure of 110/60 mmHg, Pulse rate of 94 beats per minute. Other physical examination findings included mild generalised abdominal tenderness on superficial and deep palpation which was worse at the pelvic region. The provisional diagnosis of threatened abortion (due to malaria or asymptomatic bacteriuria was considered) with acute appendicitis in pregnancy as differential. A rapid diagnostic test for malaria was done which was negative. The team on duty directly went into management with Omeprazole 20 mg tablets (1 tablet 12 hourly), phloroglucinol 80 mg injectable (1 ampoule 8 hourly) and Ampicilline injectable (1 g 8 hourly) while thick blood smears, urinalysis, obstetric ultrasound, and full blood count were requested for the next morning.
+Her evolution 4 h later was marked by an increase in the intensity of the abdominal pain which became generalised with altered general condition. The blood pressure was unmeasurable and the pulse feeble. Immediate paracentesis revealed 10 cc of fresh non coagulating blood. The diagnosis of ruptured ectopic pregnancy with abundant hemoperitoneum was considered and because of hemodynamic instability, the patient was immediately prepared for an emergency laparotomy with fluid and blood resuscitation.
+A midline subumbilical laparotomy was carried under general anaesthesia. The perioperative findings included: an abundant hemoperitoneum estimated to two litres; intact membranes containing the foetus in the abdominal cavity; rupture line along the old caesarean scar at the isthmic uterine region, detached placental tissue most of which was still inserted and covering the internal cervical os (see Figs. and ). The uterus and the intact membranes were carefully exteriorised. The hemoperitoneum was reduced with the help of sterile abdominal towels. Careful detachment of the placenta and repair of the opening with vicryl 1 suture was done. The patient was placed on antibioprophylaxis with Ampicilline injectable (1 g 8 hourly for 2 days) and analgesics (1000 mg of injectable paracetamol 8 hourly for 3 days). The postoperative recovery was uneventful and the patient was discharged 7 days following surgery. Follow-up of the patient to 1 year after surgery was uneventful.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_930_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_930_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..899d2949326b7f8d45a9221953b69a15710adaf8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_930_en.txt
@@ -0,0 +1,4 @@
+A 58-year-old Caucasian female with a prior diagnosis of SjS and subacute cutaneous lupus erythematosus presented to our primary care office, where she is an established patient. The patient was prior prescribed cevimeline 30 mg three times a day since diagnosis. She was additionally prescribed 150 mg daily dose of hydroxychloroquine for management of lupus. The patient’s personal medical history also included a tear duct blockage 5 years prior and family history of rheumatoid arthritis.
+On presentation to the clinic, the patient reported a 1-day complaint of “heart racing, sweating, unease, headache, dizziness, nausea” and the “physical feeling of wanting to have a bowel movement” that continued for several hours. She reported that, the previous night, she had taken her usual medication of 30 mg of cevimeline, but included two gummy formulation tablets of the B. monnieri and phosphatidylserine-containing herbal supplement. She did not consult with primary care regarding the herbal supplement. Within 30 minutes of ingestion, the patient reported experiencing acute onset of tachycardia, hyperhidrosis, malaise, nausea, and tenesmus. She decided to “sleep off” her symptoms and called our office the next morning when the malaise and nausea had not fully resolved.
+A physical examination showed a blood pressure of 127/77 and a pulse oximetry reading at room air of 94%, whereas all other parameters were within normal range. She was fully alert and oriented without any neurological deficits. Pupils were equal, round, and reactive to light and accommodation. On auscultation, patient had regular heart rate and rhythm, normal S1 and S2 heart sounds without murmur, gallop, or rub. Lung and abdominal examination were unremarkable.
+An electrocardiogram (ECG) was performed and showed no acute ST–T changes and normal heart rate of 83. The patient was advised to hydrate and to discontinue the herbal supplement. On telephone follow-up the next day, the patient reported that her symptoms had subsided and have since fully resolved. Resolution of symptoms was consistent with the clearance of the drug following a single dose.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_981_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_981_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ab46cb163019f9a416f93d9af809c560b3f10144
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_981_en.txt
@@ -0,0 +1,3 @@
+A 47-year-old man was initially diagnosed as dysphagia. On the next day, he developed dysarthria and tongue deviation to the left, and he visited our hospital. He had no history of trauma nor any other significant medical history. Blood pressure was 184/126 mmHg. Neurological examinations revealed leftward deviation of the tongue on protrusion and dysarthria, suggesting a left hypoglossal nerve palsy. There were no other neurological deficits. Diffusion-weighted magnetic resonance images (MRI) did not demonstrate any lesions that could cause left hypoglossal nerve palsy . Axial T2-CUBE MRI demonstrated a false lumen of ICAD that compressed the outlet portion of the hypoglossal nerve tube and dilation of the perineural space in the hypoglossal canal . The false lumen of ICAD was adjacent to the hypoglossal canal at its distal side and protruded toward the hypoglossal neural tube. These findings indicated that direct compression by the false lumen was the cause of hypoglossal nerve palsy . MR angiography (MRA) showed dissection of the left ICA accompanied with a false lumen . The patient was admitted and we started transoral administration of amlodipine (5 mg/day) and azilsartan (20 mg/day) for antihypertensive treatment. On the 2nd day, he felt headache, and transoral administration of loxoprofen was started. On the 7th day, he was started on aspirin (100 mg/day) and clopidogrel (75 mg/day) for prevention of thromboembolism from the dissected portion. Cerebral angiography performed on the 8th day showed an ICAD consistent with the findings on MRI and MRA . Cone-beam computed tomography (CBCT) showed protrusion of the false lumen to the hypoglossal canal .
+Although medical treatment was continued, his headache worsened, and the neurological symptoms were not improved. Therefore, CAS was performed on the 19th day to thrombose the false lumen and decompress the hypoglossal nerve. A 6Fr guiding catheter (Axcelguide MSK, Medikit, Tokyo, Japan) was inserted through the right brachial artery and a 4-6Fr catheter (Dymon catheter, Silux, Saitama, Japan) was placed in the left common carotid artery. An embolic protection device (FilterWire EZ, Boston Scientific, MA) was advanced through the lesion and a filter was deployed in the ICA at the petrous portion. A carotid stent (Wallstent, Boston Scientific) was advanced to the dissected portion and deployed. Angiography immediately after stenting showed dilatation of the true lumen and congestion of contrast medium in the false lumen . There were no neurological symptoms or vital changes throughout the procedures. Pre- or post-dilation was not performed because the vessel was sufficiently dilated and there was a risk of enlargement or rupture of the false lumen.
+His headache gradually improved after CAS and disappeared on the 25th day. His postoperative course was uneventful and he was discharged on the 26th day. No improvement of hypoglossal nerve palsy was observed at the time of discharge. At 1 month after discharge, neurological symptoms, such as tongue deviation and dysarthria, improved. Cerebral angiography performed at month 6 showed well-dilated ICA and disappearance of false lumen .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_991_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_991_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..db4de7415d215941426771a5e0599e6580270e6d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_991_en.txt
@@ -0,0 +1,5 @@
+A 27-year-old woman presented to our hospital with a progressing right hypochondral pain and cholestasis of 2 months duration associated with vomitis, pruritus and weight loss. Her personal and medical history was unremarkable. Physical examination revealed deep jaundice and scratch marks all over the body; there was a hard epigastric palpable mass with mild tenderness and no hepatomegaly.
+Laboratory examination showed a serum bilirubin level of 88 mg/L (reference range 3-14 mg/L); aspartate aminotransferase, 147 U/L (reference range 0-46 U/L); alanine aminotransferase, 92 U/L (reference range 0-46 U/L); alkaline transferase, 488 U/L (reference range 64-300 U/L); and glutamyl transpeptidase 51 U/L (reference range 0-38 U/L). The hemoglobin, leukocytes and wafer values were normal.
+Hydatid serology performed by an enzyme-linked immunosorbent assay was positive.
+Abdominal ultrasonography and CT scan revealed a 12 cm cystic tumor of the pancreatic head and body with a 10 mm wall thickness . The hepatic pedicule was compressed by this cyst resulting in a dilatation of the intraheapatic bile ducts and a segmental portal hypertension with 15 cm splenomegaly. No liver nodules, lymphadenopathy or ascites was observed.
+Laparotomy was performed finding a big cystic mass causing an important inflammation with extensive adherence to the épiploon, the inferior hepatic side and seeming after dissection to be continoued with the pancreatic tail . After protecting the operative area by a scolicidal solution, the cyst was opened. It's content was a transparent fluid with germinative and hydatid membranes. After cyst content removal, a partial cystectomy was performed and no communication was found between the cyst and the pancreatic duct or the biliary duct. An omentoplasty was done and the cystic cavity was drained. The presence of scolex in the cystic fluid tested positive. The postoperative period was uneventful. The daily drained liquid contained no amylase and no lipase. It's quantity rised till 1200 ml to progressively decrease. The drain was removed and the patient discharged on the twentyth postoperative day. The patient was free of symptoms and followed up after 15 month without any other abdominal localizations. The spleen size decreased and the doppler showed no portal hypertension.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_99_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_99_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ad8a70609dc35888a7b5fb0416e0bd7bba158480
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_99_en.txt
@@ -0,0 +1 @@
+A 71-year-old female who had been undergoing oral treatment for diabetes with canagliflozin 100 mg/day, metformin 1,000 mg/day, and saxagliptin 5 mg/day noticed general malaise a month before her emergency department (ED) visit to Kurume University Hospital Advanced Emergency Medical Service Center. Two weeks before her ED visit, her oral intake decreased because of reduced appetite, but oral medications continued at their initial dose. The day prior to her ED visit, her malaise worsened, and she developed nausea and abdominal pain. She consulted a local doctor where it was discovered that she had notable metabolic acidosis (pH, 6.860; CO2, 8 mmHg, HCO3, − 1.0 mEq/L; base excess measurement, below sensitivity); hence, she was urgently transferred to our facility. Her vital signs on admission were as follows: body temperature, 35.0 °C; pulse, 118/min; respiratory rate, 28/min; and blood pressure, 111/75 mmHg. The findings on consultation were notable dryness inside the oral cavity and a cold sensation on distal regions of the limbs. Auscultation of the chest revealed no significant findings, but there was mild tenderness in the lower abdominal region. The blood tests at the time of ED evaluation are shown in Table . Blood gases demonstrated notable metabolic acidosis (pH, 6.89; CO2, 11.4 mmHg; H CO3, 1.9 mEq/L; base excess, − 31.3 mmol/L), but the increase in lactic acid was mild at 3.3 mmol/L, and blood sugar was mildly elevated at 259 mg/dL. Although hyperkalemia was observed accompanying the acidosis, no significant kidney function impairment was observed. We considered a diagnosis of lactic acidosis secondary to metformin, but the patient had not recently been exposed to a contrast agent and the lactate was only mildly elevated, making this diagnosis less likely. Since point-of-care urine testing showed strongly positive urinary ketones and glucose, and plasma 3-hydroxybutyric acid (> 10,000 μmol/L) was also markedly high, DKA was suspected even though there was minimal hyperglycemia. As treatment for DKA, an injection of 0.45% sodium chloride was given as an intravenous drip at 800 mL/h. Blood sugar dropped down to 180 mg/dL after using two units of short-acting insulin; hence, insulin was not used continuously. Since hypoglycemia was a concern, an intravenous drip of glucose was started, and around 6 units/day of insulin was used as appropriate while blood sugar was monitored. Notable acidosis continued after starting treatment, and tachypnea and nausea were not tolerable; sodium bicarbonate was given as an intravenous drip. Although conservative treatments were continued, control of the severe ketoacidosis (pH, 7.18; CO2, 13.5 mmHg; HCO3, 5.0 mEq /L; base excess, − 22.3 mmol/L; 3-hydroxybutyric acid, 9,253 μmol/L) was difficult; thus, from day 2 after hospital admission, continuous renal replacement therapy (CRRT) was started. The acidosis improved because of CRRT over 3 days. The follow-up progress is shown in Table . Hyperketonemia reduced notably after a few days, but urinary sugar continued to rise. Osmotic diuresis set in with urinary glucose as the cause and polyurea was observed; thus, fluid replacement was carried out using Ringer’s solution based on the movement of the urinary sugar. Urinary sugar turned negative on day 16 after admission, and as her overall condition was good, she was discharged on day 18 after admission.
\ No newline at end of file