diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1004_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1004_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4605bde7feb07a8a78602f4ede6a6a281d67a9de
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1004_en.txt
@@ -0,0 +1,2 @@
+A 55-year-old man was found unconscious on the street and transferred to the emergency center of our hospital. At admission, the patient’s vital signs were stable, but he was unresponsive, the Glasgow Coma Scale (GCS) score was 4 (eye opening, 1; verbal response, 1; and motor response, 2), both pupils were maximally dilated (diameter, 6.5 mm), and pupillary light reflexes on both sides and vestibulo- ocular reflex (VOR) were absent. There were no visible local head injuries. Head CT revealed massive acute subdural hematoma above the right cerebral convexity causing prominent brain shift with subfalcine and transtentorial herniation, the obliteration of basal cisterns, as well as diffuse subarachnoid hemorrhage [-]. Immediately upon diagnosis, burr hole above the hematoma was made under local anesthesia, dura was opened, and subdural drainage tube was inserted. The patient was transferred to the OR, where large size right-sided decompressive craniotomy with removal of the bone flap was done and subdural hematoma was evacuated. However, prominent swelling of the brain and its protrusion through the bone defect remained, thus it was decided to perform internal decompression with extensive resection of the lateral and medial part of the right temporal lobe. Thereafter, frontal and parietal lobes still remained swollen, thus for the avoidance of brain compression after surgery the bulk of the temporal muscle down to the zygomatic arch was removed from the skull in one piece along with the periosteum. Extensive lax duraplasty with DuraGen® (Integra LifeSciences, Princeton, NJ) was done, probe for ICP monitoring was inserted, and skin was closed. No subdural or subcutaneous drainage was left.
+Immediately after surgery, CT demonstrated significant reduction of the brain shift, “reappearance” of the ambient cistern, large area of infarction within the right parietal and occipital lobes caused by compression of the posterior cerebral artery at the time of herniation, and subcutaneous hematoma [-]. The patient underwent standard treatment in ICU, including normothermia therapy. On the 1st postoperative day, his best motor response was characterized as withdrawal to pain, diameter of the left (contralateral) pupil reduced from 6.5 to 3.5 mm, and VOR has recovered, whereas on the 3rd day, the left pupil started to react to light . Gradual recovery of the patient continued thereafter. On the 45th day after primary surgery, cranioplasty and ventriculoperitoneal shunting were done, and on the 70th day, he was transferred for further treatment to the neurorehabilitation facility. At that time, his GCS score was 4T4 (eye opening, 4; verbal response, tracheostomy; and motor response, 4) and CT demonstrated asymmetric hydrocephalus, extensive infarction of the right parietal and occipital lobes, and small epidural CSF collection in the right temporoparietal area [-]. At 3 months after discharge, the condition of the patient corresponded to the Glasgow Outcome Scale (GOS) score 3 (severe disability).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1017_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1017_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..14630cde3a767dc5ed679e910ca006b5e576d66b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1017_en.txt
@@ -0,0 +1,6 @@
+A 6-year-old boy, weighing 18.5 kg, white Kosova-Albanian ethnicity, presented with right groin pain, swelling and redness. Two days before admission the patient was injured during a football game in the right lower abdomen and the next day he complained of pain in the right inguinal area.
+Abdominal pain was permanent and increasing. The child was anorexic, but had no complaints of vomiting and diarrhea or disuria. On admission the patient was sub febrile (38°Celsius) with a painful non-reducible mass in the right inguinal region with signs of cellulitis in this area. There was a marked tenderness on palpation of the right lower abdomen and right hemiscrotum was moderately swollen and painful in palpation.
+Plain abdominal x-ray showed no fluid-air levels, but a metallic foreign body (pin) under right superior pubic bone was apparent [Fig ]. White blood cells were elevated. Surgical exploration was performed under general anesthesia. Inguinal canal is opened through transverse lower abdominal skin crease. Through swollen cremaster muscle and hernia sac we palpated a sharp metallic foreign body. Sharp side came from appendix lumen, two thirds of pin being in its apex. Dividing cremaster muscle we opened swollen hernia sac and we found the inflamed vermiform appendix perforated by a domestic pin [Fig. ]. The base of the appendix and coecum were in the internal ring closing it, thus blocking the fluid from the hernia sac returning to the abdominal cavity. Serous-purulent exudate in hernia sac was aspirated.
+Appendectomy and high ligation of hernia sac was performed. The wound was primary closed, without drainage. Antibiotics (ceftriaxon 500 mg and gentamicin 40 mg) twice a day for two days intravenously were administered. For postoperative analgesia paracetamol suppositories are given. Patient had uneventful postoperative course, and no complications in three years follow up.
+From parents we learned that the boy three weeks before the operation unintentionally ingested a few pins while drinking cola from the glass in a family ceremony.
+His mother has removed the pins from his mouth, and since he didn't have any complaints, he wasn't examined regarding foreign bodies in gastro-intestinal tract.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1019_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1019_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..02349e5d7a88f0ba5e4021de5cc8782308c23c24
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1019_en.txt
@@ -0,0 +1,3 @@
+A 57-year-old female presented with vision loss in the left eye during the restoration of consciousness after endoscopic DCR surgery for the left eye. In this case, the DCR surgery was performed under general anesthesia. Notably, 2 ml of 1% lidocaine with 1:100,000 epinephrine was injected into the axilla of the middle turbinate and the frontal process of the maxilla using a dental syringe. In this case, the neurosurgical patties soaked in 2 ml of 1:1000 epinephrine were inserted between the inferior turbinate and the nasal septum and in the middle meatus to achieve topical decongestion. In the process of making mucosal flap and incision, the patient had a higher bleeding tendency than was noted with other patients, and a suction diathermy was used meticulously for the incidence of hemostasis. For this reason, it did not lead to a major bleeding in this case.
+The patient’s medical history was notable for thrombocytopenia and MHA. Upon review, the patient denied temporal headache, pain, or flashes. When tested, the patient’s best-corrected visual acuity (BCVA) was 20/20 in the right eye and light perception in the left eye. Her intraocular pressure (IOP) was 14 mmHg in the right eye and 16 mmHg in the left eye. Her visual field test result was normal for the right eye. However, the test could not be conducted for the left eye due to the incidence of poor vision. When tested with the swinging flashlight maneuver, a relative afferent pupillary defect was found in the left eye of the patient. Her extraocular movements were noted as being full and painless. However, mild periorbital bruising and swelling were detected in the left eye. Additionally, there was mild maxillary sinusitis noted as well. However, it was shown there was no underlying disease in the other sinuses. On the funduscopic examination, there were no obvious abnormal findings in the macula of either eye. The use of a fluorescent angiography did not reveal leakage or a filling defect at the disc. The baseline testing included blood tests to evaluate syphilis, systemic lupus erythematosus, and neuromyelitis optica. Her erythrocyte sedimentation rate and C-reactive protein results were noted as normal. Her pre-operative platelet count was 61 × 103/mm3. A chest x-ray was performed to evaluate sarcoidosis. She was transfused with six units of platelets preoperatively, which increased her platelet count to 123 × 103/mm3. No other cause of optic neuropathy was found in this evaluation.
+The pattern visual evoked potential revealed delayed P100 latency . Her electroretinogram showed normal electrical activity in the retina. The magnetic resonance imaging (MRI) of the orbit revealed a focal hyperintensity within the intra-orbital segment of the left optic nerve on the T2-weighted image (T2-WI) and flair image. At evaluation, the MRI showed an enhancement on the T1 post-contrast imaging . It did not show any demyelinating disease in the brain. The patient was diagnosed with left optic neuropathy and treated with 1 g/day of intravenous methylprednisolone for 3 days, followed by 1 mg/kg/day of oral prednisone with subsequent dose tapering. It is noted that the patient’s BCVA improved to 20/30 after the treatment. Although her vision improved, she was left with a visual field defect in the left eye.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1032_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1032_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8775b90479394c9d8a415795e2a46295eaa3fc61
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1032_en.txt
@@ -0,0 +1 @@
+A 54-year-old right-handed male patient known for RA treated with Methotrexate and anti-TNF-α was referred to a specialized shoulder and elbow clinic for right chronic elbow pain refractory to conservative management, consisting in intra-articular cortisone injection and physical therapy. He complained about posterior joint pain, swelling, and a deficit in extension, causing severe disability in his daily life and professional activities as a firefighter. Pain Visual Analogic Scale (pVAS) was 8/10,[ elbow Single Assessment Numeric Evaluation (SANE) score 25/100,[ Mayo Elbow Performance Score (MEPS) 35/100.[ Physical examination showed joint effusion with tenderness on palpation of the olecranon fossa, painful restricted range of motion (ROM) with 140–20–0° in flexion-extension compared to 150–0–0° on the contralateral side, pronosupination was unrestricted. There were no signs of ulnar nerve entrapment. Preoperative magnetic resonance imaging (MRI) showed a large intra-articular multilobulated pseudo-tumoral mass causing posterior humeroulnar impingement , with mixed components including lipomatous and synovial fringes , characteristic of LA. Due to the severity and duration of his disease with failed nonoperative measures, the patient underwent arthroscopic synovectomy and posterior humeroulnar decompression.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1037_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1037_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d2b497fafed81ea6c170cac7677caf89face4e00
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1037_en.txt
@@ -0,0 +1,2 @@
+A 66-year-old female presented to our clinic with the mixed diagnosis of essential tremor and Parkinson’s disease, as she had both resting and action components of tremor in bilateral upper extremities with bradykinesia and rigidity that were somewhat improved on levodopa. The tremor was largely refractory to medication and interfered with her quality of life. She underwent bilateral DBS lead electrode implantation targeting the dentatorubrothalamic tract, specifically, the ventral intermediate nucleus (Vim), in the thalamus using the standard stereotactic protocol. A trajectory through the ventricle was avoided. Normally, we start by implanting the microelectrodes on the more symptomatic side and then proceed to the other side. In this case, three microelectrodes were simultaneously descended to target the left Vim (as her symptoms were worse in her right hand) first, followed by another three microelectrodes to target the right Vim. Their cannulas were used for macrostimulation to assess for improvement and to choose the best trajectory. Electrode placement (Medtronic 3387 model, Minneapolis, MN, USA) then occurred after confirmed improvement in tremor. The rostral ends of the electrodes were left in a subgaleal pocket to be accessed during a subsequent staged procedure for extension and pulse generator placement. The lead placement was verified in the operating room theater with computed tomography (CT) imaging before closure. Surgery was uncomplicated, and the patient remained interactive and conversant throughout. She was admitted to our neurosurgical ICU as per routine. Head CT performed on early postoperative day (POD) 1 was unremarkable . Physical examination revealed no deficit; the patient complained of headache with some nausea/vomiting. She desired to stay overnight. An examination later on the evening of POD 1 found her to be sleepy, and ultimately lethargic. Stat head CT performed revealed marked left-sided peri-lead edema extending into the centrum semiovale with cystic cavitation and trace right-sided edema . Physical examination on the morning of POD 2 revealed the patient to be alert but with global aphasia (not following commands and not speaking), right-sided neglect, and plegic right upper extremity. Corticosteroids (IV dexamethasone) were begun early on POD 2. She later became increasingly lethargic, and over concerns for airway protection was intubated. Repeat head CT revealed increased edema.
+The critical care team was concerned for fulminant gas- producing bacterial infection as suggested by neuroradiology interpretation of cavitation surrounding one lead and strongly pushed for lead removal, which was resisted. Vancomycin and meropenem were empirically begun. Systemic tests for infection, including C-reactive protein, erythrocyte sedimentation rate, and white blood cell counts, were normal, as well as blood cultures, which were ultimately negative at 24, 48, and 72 h. Such negative infectious workup and lack of change on serial repeat imaging disproved this idea. Magnetic resonance imaging could not be performed due to safety concerns at our institution with an incomplete DBS circuit. Acute venous infarction was also considered a possibility, but the radiological appearance of a cortical- subcortical typically wedge-shaped ischemic pattern was not present. This patient ultimately underwent tracheostomy and percutaneous endoscopic gastrostomy placement 6 days later. She was transferred to a rehabilitation facility on a steroid taper and subsequently discharged home on POD 40. She returned to the clinic 3 months after surgery fully recovered and ready for lead extension and pulse generator placement. Follow-up CT scans at the time showed significant resolution of the peri-lead edema and cystic cavitation .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1045_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1045_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..61af23bd6468f37ff634dfed7a9ab90f3133e8db
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1045_en.txt
@@ -0,0 +1 @@
+A 25-year-old male, a worker in a garment factory, presented with complaints of band like feeling in the upper abdomen, not associated with any abdominal or back pain for 3 months duration. Simultaneously he had urinary hesitancy, a feeling of incomplete voiding of urine along with sense of inadequate evacuation of stool. Fifteen days later he developed descending paresthesia from the upper abdomen up to the both feet followed by weakness of trunk muscles, weakness and tightness of both lower limbs over a period of 2 months, which initially started in left lower limb and subsequently involved the right lower limb. There was no loss of perianal sensation. On examination, his higher mental functions and cranial nerves were normal. His upper limb power was 5 on both sides with normal tone and deep tendon reflexes. His lower limb power was 3 with hypertonia, exaggerated reflexes and ill-sustained clonus on the both side. He had sensory impairment below T5 corresponding to vertebral level D3. General physical examination and other system examinations were normal. A provisional diagnosis of thoracic myelopathy was made and patient was investigated. His complete blood count, renal profile, liver function tests, human immunodeficiency virus (HIV) and hepatitis B surface antigen were negative. His chest X-ray was normal. Erythrocyte sedimentation rate was moderately high and Mantoux was nonreactive. Magnetic resonance imaging (MRI) of whole cord revealed an iso- to hypointense lesion at D3 level on T1-weighted imaging (T1WI). The lesion was iso- to subtle hyperintense with central flow void onT2-weighted imaging (T2WI) , with cord edema rostral to the mass. Contrast-enhanced MRI showed a brilliantly enhancing lesion with hypointense centre at D3 with sharp margins . The oval-shaped lesion measured 16 × 10 mm. The diagnosis was intramedullary spinal cord tumor by MRI. Because of worsening of the patient's neurological examination, surgical removal of the lesion was undertaken. At D3-4, laminectomy was performed, posterior longidutinal myelotomy was executed, and a well-circumscribed pinkish fleshy mass was found to be located 2 mm anterior to posterior aspect of the cord. The lesion was dissected along a readily definable plane and was removed totally by use of the operating microscope. The histopathology showed multiple granulomas comprising of lymphocytes plasma cells, neutrophils, and large number of epitheloid cells in clusters with demonstration of acid fast bacilli (AFB) typical of Mycobacterium tuberculosis. Postoperatively the patient was given antituberculus treatment (ATT), started with isoniazid (INH) 300 mg/day, rifampicin (RF) 450 mg/day, pyrazinamide 1500 mg/day, and ethambutol 800 mg/day daily for 2 months, followed by INH and RF for 10 months. Pyridoxine at 40 mg/day was given for all 10 months. Postoperatively, the patient's neurological examination gradually improved and he could sit erect on the bed and able to walk over a period of 3 weeks without support. The follow-up time is 1 ½ year.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1050_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1050_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4fba346d48ec00d21e247db9db0b31fd73c95c52
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1050_en.txt
@@ -0,0 +1,12 @@
+A medically and surgically free 6-year-old boy, with a weight of 22 kg and height of 122 cm, was brought to the ED of our hospital by his teacher with severe shortness of breath. The patient was witnessed ingesting popcorn when he suddenly started to develop cough and shortness of breath.
+In the ED, the patient was agitated, drowsy, and semi-conscious. There was no obvious upper airway obstruction, but auscultation revealed absent air entry in the left lung with subcutaneous emphysema in the right side of the neck. His oxygen saturation was acceptable on oxygen supplementation.
+Shortly after, patient became severely distressed and was intubated using midazolam, ketamine and succinylcholine. Chest x-ray was done after intubation and showed Endotracheal Tube (ETT) in good position, hyperlucent left hemithorax, flatting of ipsilateral hemidiaphragm, mediastinal shift to the right, and a radiopaque areain the left main bronchus . Auscultation after intubation showed minimal flow in the left lung (improved compared to initial presentation) with some episodes of desaturation.
+Otolaryngology – Head and Neck Surgery were contacted for urgent Direct Laryngoscopy and Bronchoscopy (DLB). After the patient was stabilized, he was taken to the operating room for DLB and foreign body removal with consent of the possible complications of bleeding, infection, inability to remove the foreign body, pneumothorax and/or teeth injury.
+In the operating room, patient was intubated on bag mask ventilation. Air entry was diminished bilaterally with scattered wheezing in both sides. There was difficulty in bag mask ventilation with obvious expansion in the left side of the chest. The patient was connected to standard monitors. Initial end tidal CO2 was 104 mm Hg, arterial blood gas showed pH of 6.87, PaCO2 181 mm Hg and PaO2 of 231 mm Hg.
+General anesthesia was maintained with propofol infusion of 250 mcg/kg/min, and dexmedetomidine 1 mcg/kg/hr. One dose of dexamethasone 0.5 mg/kg was given to help in relieving the possible airway edema.
+The patient was given succinylcholine during intubation in the ED followed by a dose of rocuronium, so the option of spontaneous ventilation was lost. The patient was maintaining his oxygen saturation (SaO2) on 100% O2 flow.
+The decision was made to proceed with flexible fiberoptic scope through the ETT to delineate the anatomy.
+First look was an unusual view of the foreign body which was seen saddling in the carina. The patient was extubated during flexible fiberoptic scope, so we proceeded with rigid bronchoscopy after irrigation with 2% lidocaine.
+While maintaining ventilation through the side port of the rigid bronchoscope, a foreign body was seen stuck in the trachea at the level of the carina, and a large right accessory tracheal bronchus was noted above the level of the foreign body . The foreign body was successfully retrieved as one piece under vision using fiberoptic forceps . A second look at the airway was done to exclude any other injuries and revealed a clear airway with no remaining foreign body and confirmed the presence of a right tracheal bronchus .
+After successful foreign body removal, another ETT was inserted and irrigation was done using normal saline. Airway entry improved, and arterial blood gas showed a pH of 6.95, PaCO2 of 141, and PaO2 of 40.3. Portable chest x-ray confirmed the ETT position and the absence of pneumothorax . The patient was shifted from the operating room to the pediatric intensive care unit (PICU) fully sedated and intubated. The patient was monitored in PICU and was extubated the same day.
+The patient was playful, tolerating orally, with no signs of respiratory distress and maintaining saturation on room air. He returned to his usual level of activity and was given dexamethasone 10 mg every 6 h (total of 4 doses). He was discharged home the following day in a good and stable condition with no need for further follow up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1061_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1061_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9c83610da6926560f4750b6b8e93a4c878eebb42
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1061_en.txt
@@ -0,0 +1,9 @@
+A 33-year-old Chinese man was admitted to our department for sustainable foamy urine for more than one year. He also complained of intermittent hair loss and recurrence of oral ulcers.
+Approximately one year prior, the patient was hospitalized at a local hospital for the same reason, and routine urine tests indicated microscopic hematuria and proteinuria. He did not pay much attention, and there was no further diagnosis or treatment because of a lack of conscious symptoms. One month prior, his blood pressure rose to 145/91 mmHg for unknown reasons; microscopic hematuria and heavy proteinuria were again detected.
+The patient had no comorbidities.
+The patient's father had asymptomatic microscopic hematuria and proteinuria, as detected in a routine physical examination approximately 2 years prior. The patient had a daughter and a son; the daughter (7 years old) had asymptomatic microscopic hematuria, and the son had microscopic hematuria and proteinuria. His son had ever been diagnosed with chronic nephritis at a local hospital.
+The patient's appearance was normal, without edema. His systolic and diastolic blood pressures were 141 mmHg and 90 mmHg, respectively; his pulse rate was 81 beats per minute, and his respiratory rate was 19 breaths per minute. No obvious abnormality, including growth retardation, was detected during physical examination, and no specific nervous system symptoms were recognized. The patient was also subjected to audiologic assessments, but no hearing impairments were detected, even at high frequency. Furthermore, no symptoms were found in either eye by comprehensive ophthalmic examinations.
+Microscopic hematuria and proteinuria were confirmed by urine tests. The results of other tests, including routine blood tests and serum immunology, are listed in Table .
+No obvious abnormality was detected by abdominal ultrasound examination, X-ray diagnosis, or electrocardiographic examination. However, heart echocardiography showed a small amount of pericardial effusion.
+To further analyze the renal presentation, a histopathology study of renal biopsy was performed. By light microscopy, a total of 13 glomeruli were observed, with one glomerulus being enlarged and lobulated. Para-aminosailcylic acid staining and Masson staining were positive, showing mild mesangial matrix proliferation. The basement membrane was thickened. Three glomerular fibroblastic crescents and pericystic fibrosis of glomeruli were observed . In addition, deposition of erythrotropin under the endothelium of the capillary loop was detected . Electron microscopy revealed obvious basement membrane lesions including variable thickness and reticulation of the glomerular basement membrane, as well as irregular subepithelial protrusion of the lamina densa. Fine particles and electron-dense bodies were detected in the stratified basement membrane . Immunological staining for IgG, IgA, IgM, C3, C4 C1q, К, and λ was positive in four glomeruli, with the signals being deposited in the vascular lumen and mesangial area in a granular or linear form .
+A considerable investigation of family history was performed. The patient’s father had asymptomatic microscopic hematuria and proteinuria, as detected in a routine physical examination approximately 2 years previously. As mentioned above, the patient had a daughter and a son: The former had asymptomatic microscopic hematuria, and the latter had microscopic hematuria and proteinuria; his son had been diagnosed with chronic nephritis at a local hospital. Thus, three relatives had microscopic hematuria. Therefore, a diagnosis of ATS was highly suspected . For a precise conclusive diagnosis, the patient and his children were recommended to undergo genetic testing, and WES was performed. Genomic DNA was extracted from blood samples; WES was performed as previously described. After sequencing, the coverage of the target sequence was over 99.12%, and the mean sequencing depth was approximately 147. The sequencing analysis revealed a heterozygous substitution, NM_000091 c.2657-1G>A (p. V294fs) in intron 22 of the COL4A3 gene, which was confirmed by Sanger sequencing . The mutation was excluded from the single nucleotide polymorphism database but was included in the ClinVar database. As this mutation is located at an evolutionarily conserved splice site, this splicing mutation is thought to lead to the skipping of exon 23. In addition, this variant is classified as “likely pathogenic” according to the American College of Medical Genetics and Genomics standards and guidelines .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1074_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1074_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5b9e4beafc8dd8a64421eace2c467757d8254c41
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1074_en.txt
@@ -0,0 +1,3 @@
+A 48-year-old Sudanese lady, coded as F83–581, presented with an abnormal gait as a manifestation of pure hereditary spastic paraplegia. Her condition started in early childhood with tip-toeing that progressed gradually in severity. At the age of 30 years, she could walk only using two sticks. She did not complain of any additional symptoms apart from occasional muscle cramps. Her parents were distantly related and had no family history of similar conditions. She was not on treatment. On examination, her lower limbs were spastic with severe weakness (power grade 3). There were bilateral deformities in the feet (pes equinovarus on the right and hammertoe on the left) and up-going plantar responses. Her upper limbs were normal except for mild spasticity and hyperreflexia on the right side. The patient (F83–581) had neither signs of cerebellar involvement nor evidence of sensory deficit. She was cooperative, oriented, and had no evidence of intellectual alteration. She could barely walk supported by two sticks, and her gait was spastic. Nerve conduction studies were normal. Brain magnetic resonance imaging (MRI) showed periventricular leukomalacia with scattered ischemic foci in the white matter, cerebellum, and right side of the pons. The isthmus of the corpus callosum was thin, but it could be a normal variant. We noted neither cerebral, brain stem, nor cerebellar atrophy, nor acute ischemic changes on the brain MRI .
+We extracted DNA from the patient and four of her family members and investigated the patient and one of her healthy siblings, coded F83–582, using whole-exome sequencing . Whole-exome sequencing of the patient revealed a heterozygous variant, NM_001080414.4:c.1993G > A (p.E665K) (rs956104232), in the CCDC88C gene that results in substituting Glutamate at position 665 of the protein for Lysine. Sift , Polyphen2 HDIV , Mutation Taster , Provean and M-cap embedded in VarAFT software predicted this substitution as pathogenic with prediction scores of 0.002, 0.982, 1, − 3.21 and 0.069, respectively. Glutamate at position 665 of CCDC88C is highly conserved during evolution. The CADD score of 25 was also in favor of a pathogenic role of this change. We did not detect other convincing variants that could explain the phenotype in our patient. The variant NM_001080414.4:c.1993G > A (p.E665K) was reported once in the gnomAD v2.1.1 database in an individual of African ancestry and had a global allele frequency of 0.0000032 . Using Sanger sequencing, we validated that the variant NM_001080414.4:c.1993G > A (p.E665K) was heterozygous in the patient and absent in her healthy family members .
+To validate the pathogenicity of the NM_001080414.4:c.1993G > A (p.E665K) variant, we expressed the CCDC88C cDNA in human embryonic kidney (HEK) 293 cells and assessed its effect on c-Jun N-terminal kinase (JNK) / caspase-3 signaling pathway according to the presence or absence of the variant. Overexpressing CCDC88CE665K mutant protein caused a significant increase of JNK hyperphosphorylation and caspase-3 cleavage compared to the wild type protein, a pattern also seen when overexpressing the known SCA40 pathogenic proteins CCDC88CD43N and CCDC88CR464H . NM_001080414.4:c.1993G > A (p.E665K) was likely a de novo variant, though we did not have DNA samples from the parents. It had a low frequency in gnomAD database, predicted as pathogenic by multiple computational tools, and its pathogenicity was corroborated by functional studies, thus, fulfilling the criteria of likely pathogenic variants according to the American college of medical genetics and genomics guidelines for interpreting sequence variants published in 2015 . We have submitted the variant to the Clinvar database (accession VCV000978819.2).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1079_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1079_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..31844677426c3ef04710e9420e52f6fc457aa848
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1079_en.txt
@@ -0,0 +1,4 @@
+A 41-year-old man with SIT since early childhood was referred to our hospital because of high serum carcinoembryonic antigen levels (6.0 µg/L). The patient had no surgical history. His body mass index was 24.3 kg/m2. Physical examination results were normal. All laboratory data were within the normal range, except for the tumor markers. Colonoscopy revealed a bulge at the orifice of the appendix, but pathological examination did not reveal any malignancy . Abdominal contrast-enhanced computed tomography (CT) showed complete “mirror-images” of the visceral organs . CT also showed appendiceal wall thickening, a cystic tumor with contrast effect, and an enlarged lymph node close to the tumor . CT and magnetic resonance imaging showed no solid component in the cystic tumor that would strongly suggest mucinous adenocarcinoma. The preoperative diagnosis was an appendiceal mucocele, which was considered a possible tumor such as low-grade appendiceal mucinous neoplasm (LAMN). We planned a laparoscopic-assisted ileocecal resection with D2 lymph-node dissection since the tumor was located at the root of the appendix with an enlarged lymph node. Preoperatively, we evaluated anatomical variations using 3D-CT, and no vascular anomalies except for completely inverted vessels were observed . In addition, we watched horizontally flipped videos of patients with normal anatomy undergoing similar operations to simulate mirror images and symmetrical procedures.
+Under general anesthesia, the patient was placed in lithotomy position. In contrast to normal surgery, the operator stood on the patient’s right side, the first assistant on the left side, and the scopist between the legs . A laparoscope was inserted through the umbilical trocar, and the other four trocars were placed opposite to their usual placement as shown in Fig. . Additionally, a 12 mm trocar was placed in the operator’s right hand, and two monitors were placed at the patient’s head. One monitor showed original images, and the other showed horizontally flipped images that looked the same as the normal anatomy . The central monitor 1 displayed the original images for the surgeons to see them easily, because it is dangerous and difficult to move the forceps while looking at flipped images due to paradoxical movement of the instruments. Moreover, the images displayed on the monitors were exchanged according to the surgical situation. As needed, the operation was momentarily paused to check for the range of mobilized regions and to visualize important anatomical structures by watching the monitor that showed flipped images .
+Laparoscopy and intraperitoneal observation revealed transposition of the visceral organs, such as the liver, gallbladder, stomach, and colon. The ileocecal resection procedure was performed using the retroperitoneal approach as usual. The small intestine was moved cranially to secure the surgical field, and we initiated ileocecal mobilization. We dissected the mesentery from the retroperitoneal tissue with a focus on the gonadal vessels and identified the transverse portion of the duodenum. Next, while dissecting along the descending portion of the duodenum , we dissected the lateral attachment of the colon to the left abdominal wall toward the cranial side and mobilized the hepatic flexure . Finally, we performed additional dissection around the duodenum and pancreatic head, completing the mobilization . Since D3 lymph-node dissection was not necessary, we divided the ileocolic vessels near its root without lymph node dissection around the superior mesenteric vein (SMV) and performed resection and reconstruction of the colon extracorporeally. In total, the operative time was 119 min, and the patient’s postoperative course was uneventful. Postoperative pathological examination revealed lymphoid follicles in the intestinal epithelium of the appendiceal orifice and inflamed appendiceal mucosa with neutrophils and eosinophils. No tumor cells suggestive of LAMN or malignancy were observed.
+Regarding laparoscopic surgical procedure for SIT, it was unclear how far the mobilization proceeded due to the mirror image; however, during the procedure, we periodically examined the mobilization progression by momentarily pausing the operation to watch the monitor showing flipped images. Additionally, we noted the following differences between surgery in SIT and surgery in patients with normal anatomy: (1) operability involving large movements such as moving the small intestine and securing the surgical field (2) recognition of anatomies such as orientation of the gonadal vessels and duodenum, positional relationship between the hepatic flexure and duodenum, and the hepatic flexure in the upper left abdomen being closer than expected as compared to the splenic flexure in normal anatomy. In such situations, we were able to appropriately address any confusion and misrecognition by checking the flipped monitor . Additionally, this procedural method allowed for safe operation on important organs, such as the pancreatic head . To enable the readers to understand the procedure, a video of the surgery with flipped images has been attached as a Additional file : Video S1.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1097_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1097_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5909e7ae041971b6ccedd3f9cd4edea7645fb873
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1097_en.txt
@@ -0,0 +1,6 @@
+A girl, now 20 years old, presented to our hospital for the first time at the age of 7 years and 8 months, with multiple-joint swelling and limited motion for more than 5 years and recurrent fever for 18 months. Her long-term history of arthritis could be traced back to when she started to suffer from symmetrical polyarthritis at the age of 2 years, and her arthritis was in both knees, both wrists, the metacarpophalangeal joints, the proximal and distal phalangeal joints. She presented to the pediatric doctors in the local hospital by her parents and was diagnosed with juvenile idiopathic arthritis (JIA). The doctor treated her mostly with nonsteroidal anti-inflammatory drugs (NSAIDs) and methotrexate (MTX). During the following 5 years, her symptoms were not well controlled. At the age of 6 years, she had repeated and unexplained fevers. Anti-infection and symptomatic treatment were given but were ineffective. She was taken to her local pediatrician many times and received steroid treatment for several months. When she was 7 years of age, she complained of attacks of redness in both eyes but denied any history of vision loss. She was diagnosed with anterior uveitis of both eyes and her ocular symptoms disappeared after receiving ophthalmic treatment (tobramycin dexamethasone eye drops). Regarding her complete past medical history, in addition to the above manifestations, she had a squamous rash once at 10 months of age, which was ignored by her parents at that time.
+In August 2009, when she was 8 years and 9 months old, the girl was referred to our hospital for the first time regarding recurrent arthritis in the absence of ocular complaints, rash and other symptoms. There was no other contributory past medical or history or family history. Physical examination revealed swan neck deformities of all fingers , limited joint mobility, swelling of the wrists, elbows, and knees, and a positive right 4-word test. No other remarkable findings were observed on physical examination. Blood tests showed a significant increase in the C-reactive protein (CRP) level and erythrocyte sedimentation rate (ESR). Her rheumatoid factor and human leukocyte antigen B27 (HLA-B27) were negative. No positive findings were found on her ophthalmic examination. MRI and other imaging examinations supported the manifestations of arthritis. With a diagnosis of JIA (polyarticular, RF negative), treatment was initiated and consisted of Etanercept, recombinant human tumor necrosis factor-Fc (rhTNFR:Fc), 0.8 mg/kg per week combined with MTX and NSAIDs. She showed improvement in her joint swelling and fever, but these symptoms still had recurred. In the following 10 years, the patient was followed up irregularly, and she had stopped etanercept on her own. Between 2015 and 2019, she was intermittently treated with prednisolone at doses ranging from 2.5 mg to 10 mg per day. Regrettably, the girl had vision loss in both eyes in 2018. An ocular examination showed obsolete iridocyclitis in both eyes and left eye cataracts. She underwent left eye cataract surgery in May 2018 in the Ophthalmology & Otorhinolaryngology Hospital, and her visual acuity recovered after the operation. In October 2019, she developed unexplained hypertension, which was found on a routine physical examination at school. She was referred to the local hospital and given nifedipine, but her blood pressure was not controlled.
+On October 24, 2019, the girl was transferred to our hospital. Physical examination revealed that her blood pressure (BP) was 140/70 mmHg in the left upper limb, 139/79 mmHg in the right upper limb, 167/76 mmHg in the left lower limb, and 165/67 mmHg in the right lower limb. Before this, her blood pressure was increased once in a visit in 2017 in the only few outpatient visits, and was normal at other times. Moreover, she had painless fixed flexion deformities of multiple joints on physical examination. Additionally, ophthalmologic checks showed bilateral band-shaped degeneration of the cornea, with a corrected visual acuity of 0.4 in the right eye (OD) and 0.3 in the left eye (OS). She was diagnosed with bilateral panuveitis by an ophthalmologist. Various laboratory tests were ordered, and the results were as follows: her 24-h urinary protein excretion was 0.19 g and her serum creatinine was 102 μmol/L. We collected data on the serum creatinine (Scr) and eGFR of the patient during the past 10 years . According to the results, her Scr began to increase (ranging from 75 to 92 μmol/L) in approximately 2017 and finally increased to 102 μmol/L in October 2019. Her renin–angiotensin–aldosterone, CRP, ESR and thyroid hormone were within the normal ranges. Her autoantibodies were negative. Ambulatory blood pressure monitoring (ABPM) showed that the 24-h average BP was 143/83 mmHg (> 130/80 mmHg), the daytime average BP was 144/86 mmHg (> 135/85 mmHg) the and nighttime mean BP was 140/76 mmHg (> 120/70 mmHg).
+B ultrasound demonstrated that the right kidney (8.85*3*3.42 cm) was smaller than the left kidney (10.2*3.86*4.05 cm). The difference in length between the two kidneys was 1.35 cm. We searched and summarized all the renal B ultrasound data of the patient in the past 10 years compared with kidney length normative values in children . The sizes of the kidneys did not increase with age, the right kidney gradually decreased in size, and the size difference of both kidneys gradually increased. 99mTc-DTPA renography demonstrated that the right kidney was smaller than the left kidney with poor renal perfusion and impaired renal function . The GFR [ml·min-1·(1.73 m2)-1] of the kidneys was 74.4 (right kidney 30.8, left kidney 43.6). A significant difference was observed in the two splits of renal function: the renal function was 41.4% in the right kidney and was 58.6% in the left kidney. Computed tomography angiography (CTA) of the renal artery illustrated that the branches of the renal artery in the right hilum had mild stenosis , and the right kidney was smaller than the left kidney . No significant abnormalities were observed in the thoracic aorta, abdominal aorta, or cerebrovascular system. No remarkable findings were revealed on echocardiography and during an electrocardiogram. To further clarify the situation of the patients’s renal vessels, we also suggested performing digital angiography. However, her parents refused this invasive examination. The patient was diagnosed with right renal vasculitis through CTA of the renal artery (mild stenosis in the branch of the renal artery of the right renal hilus) and 99mTc-DTPA renography (difference in bilateral renal function and GFR) based on her two unequally sized kidneys (the gradually shrinking right kidney and the normal left kidney).
+In view of the clinical manifestations mentioned above, including recurrent polyarthritis, fever, bilateral panuveitis and kidney involvement in medium-vessel vasculitis, it was obvious that this girl might in fact not have JIA. The diagnosis was likely an autoinflammatory disease. Thus, we performed whole genome sequencing (WGS) for the patient and her family. The results revealed that she had a de-novo heterozygous mutation in the NOD2 gene (c.1538 T > C, p.M513T) , with her parents presenting with the wild type. The M513T (1538 T/C) mutation was a heterozygous mutation and has been reported previously. According to the presentation and genetic test results, she was finally diagnosed with Blau syndrome and renovascular hypertension.
+Considering her ocular lesions and unsatisfactory therapeutic effect, we suggested treating her with an anti-TNF-α monoclonal antibody (adalimumab) based on the previous studies . However, the patient refused the treatment because of financial reasons. Finally, she temporarily accepted a low dose of oral prednisolone, MTX, metoprolol and plendil. Her BP was gradually decreased and was controlled at approximately 130/80 mmHg. The OD and OS corrected vision were gradually restored to 0.6 after approximately 3 months. Her serum creatinine level slightly decreased and remained between 80–90 μmol/L after nearly 3 months of follow-up. In February 2020, she was referred to an adult hospital after reaching the age of 18. In the latest telephone consultation with the patient in December 2022, she stated that she was receiving prednisolone (15 mg/day) and tofacitinib (5 mg bid), and MTX had been discontinued because of abnormal transaminase. There were no new symptoms in the joints or eyes. There were also no rashes. Hematology examinations indicated that the patient’s ESR (25 mm/h) and serum creatinine (138 μmol/L) had increased. Her blood pressure was maintained at approximately 140/90 mmHg without any antihypertensive therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1102_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1102_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0132f4e3c3df86598b6899d122659348422040a4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1102_en.txt
@@ -0,0 +1 @@
+A 37-year-old Japanese woman had a history of gender identity disorder from childhood and had taken testosterone injections once every 2 weeks since she was 19 years old. She also had untreated high blood pressure. She had worked in the sex industry and had a tattoo on her right arm. In May 2017, she developed a headache and visual field deficits together with elevated blood pressure and was referred to our hospital. On admission, her blood pressure was 165/105 mmHg with regular heart rhythm. She was alert and well oriented. She had left homonymous hemianopia. Brain magnetic resonance imaging (MRI) showed a hyperintense lesion in the right parieto-occipital lobe on diffusion-weighted imaging (DWI), apparent diffusion coefficient (ADC) map, and fluid-attenuated inversion recovery (FLAIR) , which were not enhanced by contrast with gadolinium. MR angiography (MRA) showed steno-occlusive lesions in bilateral middle cerebral arteries (MCAs) . Three-dimensional contrast-enhanced angiography revealed occlusions of bilateral MCAs . She was initially suspected as having PRES related to reversible cerebral vasoconstriction syndrome (RCVS) and received treatment with an antihypertensive drug and 100 mg of aspirin. Routine blood testing showed the patient was HIV-1 antibody-positive. The CD4+ T-cell count was 140 cells/μl and the HIV viral load detected by PCR was 330,000 copies/ml. She underwent lumbar puncture, and no pleocytosis was found. Furthermore, PCR for herpes simplex virus (HSV), varicella-zoster virus (VZV), and JC virus in cerebrospinal fluid was negative. She had also developed pneumocystis pneumonia when she was diagnosed with AIDS. Antiretroviral therapy (ART) comprising dolutegravir sodium, emtricitabine, and tenofovir alafenamide fumarate was initiated, and she was discharged from the hospital. Two weeks later, she suffered a severe headache and worsening of visual disturbance in bilateral eyes. Her blood pressure was 153/93 mmHg and her visual acuities were finger counting. MRI showed the hyperintense lesion had expanded to bilateral posterior hemispheres . Stenotic lesions in bilateral MCAs remained on MRA and three-dimensional contrast-enhanced angiography . The CD4+ T-cell count at readmission was 189 cells/μl and HIV viral load was 94 copies/ml, indicating that AIDS activity was alleviated after ART. Although she was initially treated with edaravone, a free radical scavenger, and antihypertensive agents after readmission, her visual acuities fluctuated and contrast-enhanced MRI showed multiple punctate and linear gadolinium-enhanced lesions in the occipital and temporal lobes and the cerebellum . Brain biopsy was performed from the right occipital lobe. Histopathology showed severe tissue destruction, astrocytic gliosis, microglial activation, and vasculitis with marked lymphocytic infiltration in the cerebral white matter in the absence of multinucleated giant cells and lymphoma cells . Infiltrated lymphocytes were mostly CD8+ T-lymphocytes, while CD4+ T-lymphocytes were scarce . We finally diagnosed her as having CD8+ encephalitis, with an exacerbation caused by immune reconstitution inflammatory syndrome (IRIS) after ART. After brain biopsy, the patient was treated with 1000 mg of methylprednisolone intravenously for 3 consecutive days followed by 0.5 mg/kg/day of prednisolone. Her visual acuities and headache improved after corticosteroid treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1107_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1107_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6d7812112a0daefa1281b0ff479b2b57f4a9fdb2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1107_en.txt
@@ -0,0 +1,13 @@
+My patient was a 19-year-old man diagnosed in early childhood with ADHD and ASD. He was referred by his local doctor for ongoing treatment as an adult. He had experienced long-term difficulties in establishing and maintaining lasting relationships and reading social cues. His conversations were awkward and restricted to a narrow range of subjects and he was frequently impulsive and insensitive during these interactions. These impairments had contributed to his increasing social isolation and conflict within the family environment. He had a low threshold of irritation and intolerance of noise, light and crowds. There was also a long history of outbursts of anger, physical intimidation and frequent destruction to property at home. He was also disorganized, forgetful and had difficulty completing tasks. He has always been overactive, restless and impulsive. There was no history of pervasive mood disturbance.
+There were early concerns about a potential developmental delay and he was referred for a pediatric assessment at age two years. He received speech therapy prior to school and also repeated his pre-school year. Although he was of average intellect, his significant and specific learning, behavioral and communication difficulties warranted a placement in a special education unit to manage his needs. He experienced difficulties in both reading and writing and he performed below all national standards of literacy and numeracy. Reading remained effortful and unrewarding, with difficulties focusing on and reading along a line of text. At the age of seven he had an occupational therapy assessment, which reported difficulties with coordination, fine motor control, planning and sequencing. In the classroom he was reported to be distracted and restless, presented with extreme outbursts of anger and frequently ran away. He had poor interpersonal skills, established few friendships, had odd idiosyncratic language and repetitive hand flapping, and had a history of being bullied.
+He commenced stimulant medication during early childhood and had trials of immediate-release dexamphetamine and methylphenidate with improvement in classroom behavior. He had little interest or motivation in taking his medication, resulting in generally poor adherence. Without stimulant medication his behavior quickly deteriorated.
+Since leaving school he had obtained a number of part-time unskilled jobs for eight to ten hours per week. He was, however, unable to maintain them because of behavioral and communication difficulties. He did not smoke cigarettes or consume alcohol or illicit substances. There was no significant family psychiatric history.
+On presentation, he was taking methylphenidate extended-release 72mg daily via an osmotic-controlled release oral delivery system and melatonin 4mg every night. He had been prescribed this medication for the previous two years.
+During my clinical assessment, he was constantly restless, appeared disinterested and was easily distracted. He made little eye contact either when listening or speaking and his non-verbal interaction was limited. His answers to questions were minimal and his speech lacked normal prosody. His blood pressure and pulse were within the normal range although he was significantly overweight with a body mass index of 34kg/m2 (weight 102kg, height 1.72m).
+Following completion of his assessment an additional dose of methylphenidate was recommended in the late afternoon to try and reduce his frequent aggression at this time. However, he stated that this suggestion was of no interest to him and he did not care that others might be upset by his behavior.
+During the three months following his initial assessment there was no alteration to his pharmacotherapy and no improvement in his behavior. As a consequence of his persistent social difficulties the option of a trial of low-dose phenytoin was discussed. It was explained to my patient and his mother that improvements in social functioning had been observed by myself and been reported by other patients who also had taken low-dose phenytoin; although, these effects had not been demonstrated outside the clinic nor was this an approved indication for the medication. My patient and his mother signed a disclosure and informed consent document and a trial of medication was organized for the following consultation.
+Two weeks later a sublingual test dose of approximately 2mg phenytoin was administered. Prior to this dose my patient’s interaction reflected his usual behavior, with little interest and social engagement. He was reluctant to participate in conversation and his verbal responses were minimal and lacked elaboration; there was only minimal facial expression, which appeared to be unconnected to the content of his speech. Within 10 minutes of taking the sublingual phenytoin he reported a reduction in the effort required to contribute to conversation and was able to sustain eye contact both when listening and speaking. He was surprised about the effortless nature of his eye gaze and also commented that he had never done this before, and that previously he had always found it easier to avoid eye contact when speaking. He was now experiencing the reverse, finding it harder to break away from the mutual eye gaze. He stated he felt more relaxed and was less distracted by other environmental visual and sensory stimuli. His non-verbal interaction, demonstrated by the raising of his eyebrows, smiling and nodding of his head, appeared to be more spontaneous and natural. During this assessment he read aloud two standardized examples of a text, pre- and post-administration of the phenytoin. He reported a reduction in the effort required and improved comprehension and accuracy. He stated that he was no longer as distracted by the other lines of text on the page, which previously had resulted in becoming overwhelmed and lost on the page. His speech was also more fluid with more appropriate intonation. He denied any adverse effects of the test dose. The following day he started taking compounded 2mg phenytoin capsules in the morning in conjunction with his methylphenidate.
+After two weeks both he and his mother stated that his communication with the family had improved and there had been no aggressive outbursts. During the consultation he was noticeably more engaged and appeared to enjoy the interaction. His ability to maintain eye contact and his non-verbal communication - facial expression, head movements and posture -were more synchronized and spontaneous.
+Over the next four weeks he became inconsistent in taking the phenytoin, and then ceased altogether. His behavior reverted to the previous pattern of poor social interaction; he became oppositional with outbursts of anger and physical violence.
+Nine months later he resumed taking the phenytoin, this time as a single 4mg capsule in the morning. After his first dose there was an improvement of his social behavior similar to his previous response, although there was an apparent deterioration in the late afternoon. The dose was increased from 4mg to 5mg and a larger capsule formulated to try and prolong the release of the phenytoin. This appeared to achieve a more consistent improvement in behavior throughout the day, evident both at home and at work. Increases in the dose above 5mg were not associated with any additional benefit. He remained on the 5mg dose of phenytoin for over 18 months and reported that his work performance had consistently improved sufficient to increase his working hours and his level of responsibility. The violence and destruction at home abated. His confidence improved and for the first time he has established and sustained peer-appropriate friendships.
+His behavioral ratings prior to treatment with phenytoin and after seven months on the 5mg phenytoin are presented in Figure . The manner in which my patient endorsed the items on the AQ highlighted a reduction of symptoms, with the most robust improvements in his enjoyment of social occasions, ability to cope with chit chat, and his preference to be with people rather than be alone. His total AQ score dropped from 41 pre- to 27 post-treatment with phenytoin; a score of 32 or more is considered to indicate clinically significant levels of autistic traits . Before treatment with phenytoin, his DASS ratings recorded both depression and anxiety as severe and stress as very severe. Post-treatment, there was robust change in all domains, with an absence of depressive symptoms and with both anxiety and stress being recorded as moderate.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1119_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1119_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..34591b82912ace32c7eb89eb65d2c07432022f3c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1119_en.txt
@@ -0,0 +1 @@
+A 75-year-old man was diagnosed with gastric cancer through a medical check-up and was referred to our department. The patient had no subjective symptoms or remarkable past medical history. The tumor marker carbohydrate antigen 19-9 (CA19-9) was elevated, with a value of 231.5 U/ml . Upper endoscopy demonstrated a 5-cm circumferential ulcerated lesion at the cardia . Biopsy showed a poorly differentiated tubular adenocarcinoma. Computed tomography (CT) showed a wall thickening of the lesser curvature side of the upper gastric body . The patient underwent laparoscopic total gastrectomy with lymph node dissection, and the pathological diagnosis was consistent with a moderately differentiated tubular adenocarcinoma, pathological stage T4aN1M0, and IIIA according to the UICC classification . The postoperative course was unremarkable, and the patient was discharged. He refused adjuvant chemotherapy and was under close observation. The patient was regularly followed up with laboratory tests and imaging studies. Twenty-three months after the primary gastrectomy, a CT scan revealed an irregular mass near the port site wounds . The mass continued growing over time, and port site recurrence was suspected. The CA19-9 level increased to 142.2 U/ml . The patient underwent mass resection, and the pathological diagnosis was consistent with metastatic adenocarcinoma in the subcutaneous tissue at the port site . In the operative findings, there were no ascites and disseminated nodules in the abdominal cavity. Macroscopic findings of the resected specimen revealed that the center of the tumor was not in the peritoneum, but the abdominal wall. Therefore, it was considered to be a PSM rather than peritoneal dissemination. Thirteen months after the second surgery, CT revealed an enhanced mass in the abdominal wall. Furthermore, PET-CT showed an elevated uptake in the rectus abdominis muscle and a SUV of 3.1 . Fine-needle aspiration biopsy of the lesion detected malignant cells with suspected metastatic adenocarcinoma. The CA19-9 level was elevated to 53.6 U/ml again . The patient underwent mass resection again. The mass had macroscopically infiltrated into the rectus abdominis muscle . Similar to the first recurrence, there were no ascites or disseminated nodules in the abdominal cavity. The pathological diagnosis was identical to that of a gastric metastatic adenocarcinoma in the rectus abdominis muscle . After thirty-five months from the third surgery, CT revealed a mass in the left gluteal region. PET-CT revealed a 35-mm mass in the lateral subcutaneous area of the left iliocostalis lumborum muscle, which showed an elevated SUV of 9.6 . Percutaneous biopsy of the lesion revealed a metastatic adenocarcinoma, and the CA19-9 level was 111 U/ml . Another mass resection procedure was performed, and the pathological diagnosis was consistent with subcutaneous metastasis from the gastric adenocarcinoma . Since tumor cells were present at the resection margin, additional radiation therapy was performed. After each recurrence, the patient did not undergo adjuvant chemotherapy. The patient has survived 78 months after primary gastrectomy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_112_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_112_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..74a8e46ef14a1abb377aacfeb42014038d06ead9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_112_en.txt
@@ -0,0 +1,21 @@
+The patient was a 55-year-old woman with a history of smoking and prolonged opium inhalation, referred to Ghaem clinic in Mashhad with dysphonia, hoarseness, and occasional aspiration since last year. No sign of odynodysphagia, stridor, and dyspnea was observed in the case.
+The patient did not previously undergo any treatment. In laryngoscopy, prior to surgery, left arytenoid, aryepiglottic fold, left false vocal cord, true vocal cord, anterior commissure, and subglottic region were tumoral. In addition, other parts of the larynx and hypopharynx were normal. The left vocal cord was fixed. In the preoperative computed tomography scan, there was a transglottic involvement on the left side, and cervical lymphadenopathy was not detected. Laryngeal cartilage and hyoid bone were reported to be normal. The right paraglottic space was involved, and the epiglottis was normal. The tongue, esophagus, trachea, and thyroid were normal. The biopsy of the affected areas represented the well-differentiated squamous cell carcinoma. Furthermore, chest X-rays and liver function tests were normal. The patient was ultimately diagnosed with a transglottic squamous cell carcinoma of the T3N0M0 stage. Moreover, total laryngectomy with total thyroidectomy (due to subglottic involvement) and bilateral elective cervical lymph node dissection level I-IV were performed. The tumor was macroscopically removed, and the surgical margin was checked with a frozen section for the presence of the tumor. The neopharynx was closed with the suturing technique. The patient diagnosed with salivary fistula was initially treated with conservative management, including total parenteral nutrition, pressure dressing, and broad-spectrum antibiotic therapy .
+Despite the use of broad-spectrum antibiotics in the 12th day, due to swelling and cervical erythema on the right side, the case with a diagnosis of infectious colonization, followed by the salivary fistula, was transferred to the operating room.
+In addition, the drainage and diversion of salivary secretion away from the carotid sheath were performed under general anesthesia. Moreover, in order to sterilize the fistula and help the formation of fibrosis to close it, 10 cc of the acetic acid solution diluted to 0.25% was orally prescribed three times a day.
+To reduce the flow of saliva botulinum toxin injections in both submandibular glands were conducted under ultrasound guidance, and propantheline (i.e., an anticholinergic drug) was simultaneously prescribed for the patient.
+In spite of conservative treatment, the fistula was not recovered after 3 weeks.
+Due to the probable surgical procedures, such as gastric pull-up or free flap reconstruction, in the final stages of fistula treatment failure, the jejunostomy was inserted instead of gastrostomy, and intestinal gavage was initiated. There was no evidence of positive surgical margins on permanent specimen pathology.
+Regarding the completion of the medication, conservative treatment, lack of response to the closure of the fistula, and risk of carotid injury with the salivary flow, it was considered to repair fistula by a free flap or gastric pull-up. Therefore, a thoracic surgeon was consulted about gastric pull-up considering the fistula repair.
+It was decided to perform fibrin glue injection into fistula tract via the endoscopic approach after consultation with a gastroenterologist and thorax surgeon and according to the successful management of fistula with the use of plasma-rich compounds, such as fibrin glue, in addition to patient's desire for no major surgery. Furthermore, informed consent was obtained from the patient before the surgery.
+The case underwent an endoscopy to locate internal fistula orifice. In gastrointestinal endoscopy, a fistula was identified in the anterior wall of ​​the neopharynx .
+Fibrin glue was prepared from the patient’s blood sample under certain procedures. The PCF tract was endoscopically localized, and an endoscopic retrograde cholangio- pancreatography (ERCP) catheter passed through the fistula, pushed forward, and pulled backward gently to prevent injury to major vessels. The de-epithelialization of fistula orifice was performed, and the fibrin glue was endoscopically injected into the fistula tract via the catheter. Afterward, a nasogastric (NG) tube was inserted under the endoscopic view.
+Following the administration of fibrin glue, the patient with NPO (i.e., nothing through the mouth) underwent pressure dressing and continued conservative treatment. Two weeks later, the case was discharged with an NG tube and antibiotics (oral Clindamycine 300 mg TDS). One month after the fibrin glue injection, no evidence of contrast extravasation was observed on barium swallow test, and the fistula was completely closed . The normal saline serum was given to the patient with a methylene blue as a surgical marker, with no evidence of leakage. When oral feeding started, the patient tolerated the pain without difficulty. The NG tube was drawn 1 month after the fibrin administration, and the patient returned to normal oral feeding without any problems.
+Fibrin glue preparation
+Two components are required to prepare fibrin glue. The first component is fibrinogen, and the second one is thrombin. Fibrinogen is prepared after the extraction of blood from the patient's vein or blood bank and a series of other steps. The second part that is thrombin is produced as a ready-to-use commercial solution, as well as being extractable from the plasma of the patient. Thrombin is diluted in distilled water and combined with aminocaproic acid as an antifibrinolytic agent. The first component is prepared by three following methods:
+• The first method (plasma): Firstly, 36 ml of citrated blood from a blood bank is evenly divided into four tubes, and the tubes are centrifuged at 3000 rpm for 3 min. The plasma is then removed by pipet and combined with 1 ml of calcium chloride solution.
+• The second method (plasma cryoprecipitate): Firstly, 350 ml of frozen blood in a bag (frozen at -18°C) is placed in a refrigerator at 4°C until it melts slowly. Then, the melted blood is centrifuged at 5000 rpm for 5 min. Afterward, 1mm of calcium chloride solution is added. Finally, the substance sediment in the foam bag is used as fibrinogen.
+• The third method (plasma cryoprecipitate): Firstly, 36 ml of noncytarabine blood is collected in four tubes, each one containing 1 ml of 10% sodium citrated solution. Afterward, the tubes are centrifuged at 3000 rpm for 10 min. The obtained plasma is mixed with 1.3 ml of ammonium sulfate saturated solution in four silicon tubes in which fibrinogen is immediately precipitated and then centrifuged at 3000 rpm for 3 min. About 1.5 ml of white sediment is collected by siphoning and mixed with 1 ml calcium chloride.
+In this study, the second method was used for the preparation of fibrin glue.
+Fibrin glue injection
+In this case, fibrin glue was injected by endoscopy. Firstly, under the intravenous sedation and left lateral decubitus position under the cardiopulmonary monitoring, the endoscope entered into neopharynx through the mouth. The location of the fistula was observed in the anterior neopharyngeal wall and 12 cm from the incisive teeth. The probe of the endoscope was fixed at the fistula location. Then, the ERCP catheter passed through the endoscope into the fistula, pushed forward, and pulled backward gently to prevent injury to major vessels.
+The de-epithelialization of fistula orifice was performed, and 5 cc of the fibrin glue was endoscopically injected into the fistula tract via the catheter. In addition, some fibrin glue was percutaneously injected into the outer orifice of the fistula. The patient follow-up showed that the fistula was completely closed 3 months after the administration. The NG tube was removed, and oral nutrition was successfully started. The subsequent follow-up demonstrated that the patient tolerated a soft diet and fluids without any problems .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1137_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1137_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1ec2d73b558c586c252878302e93b5a6934a75bc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1137_en.txt
@@ -0,0 +1,2 @@
+A 20-year-old young male presented to the emergency department following road traffic accident and on probing the patient, he had fallen with a flexed knee leading to axial impaction of tibial condyle over the posterior femoral condyle. Patient had an open lacerated transverse wound about 7 cm over the anterior aspect of the knee. The distal end of femur was protruding out along the avulsion of patellar tendon from the insertion site. Clinical examination was not possible because of open wound and intense pain. There was no distal neurovascular deficit and patient was hemodynamically stable.
+Radiological examination of the involved knee included the anterior-posterior and oblique views showing patella alta, suggesting the patellar tendon avulsion with fracture of anterior tibial spine and lateral-oblique view showing non-conjoint bicondylar Hoffa fracture. Initially, wound was debrided and an external fixator applied. The second procedure was taken after 2 days and both femoral condyles approached through the same open wound. The bicondylar Hoffa fracture was fixed with two 6.5 mm partially threaded cannulated cancellous screw. Screws were inserted from the non-articular portion of the femoral condyle on knee flexion. The anterior tibial spine fragment was fixed with 4.0 mm partially threaded cannulated cancellous screw and the patellar tendon avulsion was fixed to the tibia with ethibond trans-osseous suturing . The wound was primarily closed without the need of additional soft-tissue procedures. The patient was kept in external fixator for 6 weeks in view of healing of the patellar tendon and soft tissue. After 6 weeks, the external fixator was removed and patient was started on partial weight bearing and guarded knee flexion was started in fear of patellar tendon re-rupture. At the end of 3 months, full weight bearing was started and knee Rom was from 5° to 40°. At the end of 6 months, knee flexion further improved to 35° with the healing of the fracture .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1148_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1148_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2aad5299918c52428f1826e8bd03eb7af7fbd0e8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1148_en.txt
@@ -0,0 +1,7 @@
+A 53-year-old woman was admitted to The First Hospital of Jilin University in September 2019 because of right axillary metastatic carcinoma.
+The patient presented with an enlarged lymph node in her right axillary area 2 wk before she visited a local hospital for examination. A needle puncture biopsy of the lymph node indicated right axillary metastatic carcinoma, most likely originating from mammary tissue.
+She had no previous history of any illnesses.
+The patient had no relevant personal or family history.
+Physical examination indicated no lumps in the breasts. A hard, fused and fixed lump 6.0 cm × 3.0 cm in size was identified in her right axillary area.
+There was no abnormality.
+US revealed a hypoechoic mass 6.0 cm × 3.2 cm × 2.0 cm in size in the right axilla, which had internal vascularity. Breast lesions were not identified by US, mammography or magnetic resonance imaging . There was no evidence of a malignant primary lesion or distant metastasis on computed tomography scans of the thorax, abdomen and bone. Immunohistochemical staining results were positive for progesterone receptor (PR), cytokeratin (CK) 7 and specific breast markers GATA3 and gross cystic disease fluid protein-15. Tumor cells were negative for estrogen receptor (ER), human epidermal growth factor receptor-2 (HER-2), CK5/6, CK20 and villin.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1167_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1167_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..18cd625251f29af8b2f555b89d03be56332684a7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1167_en.txt
@@ -0,0 +1 @@
+A 74-year-old male was admitted to our hospital for the treatment of esophageal cancer. The patient had no symptoms with normal temperature at the time of admission. His past medical history included diabetes mellitus for 24 years. He underwent endoscopic submucosal dissection for early gastric cancer 4 years ago and video-assisted thoracic surgery for pulmonary adenocarcinoma in the right upper lobe 5 years ago. He occupation was making metal molds. He was ex-smoker: Brinkman index was 980. Laboratory studies showed white blood cells of 10.0 × 103/L, C-reactive protein of 6.07 mg/dL, hemoglobin A1c test of 8.8%, fasting blood sugar of 237 mg/dL on admission. Serum tumor markers, including CEA, CA19–9, SCC, CYFRA, were unremarkable. He underwent esophago-gastro-duodenoscopy for follow-up after endoscopic submucosal dissection for early gastric cancer. The upper endoscopy showed a 0-IIa lesion with relatively large granular nodules on the lower thoracic esophagus . The pathologic assessment of the biopsy revealed squamous cell carcinoma of the esophagus. The esophageal 0-IIa lesion with relatively large granular nodules let us consider the depth of esophageal cancer was deeper than M3/SM1. Chest X-Ray was normal, however, chest CT revealed a 1.3 cm × 0.9 cm pulmonary mass in the lower lobe of the right lung a month before admission . PET/CT showed the pulmonary mass had maximal standardized uptake value (SUVmax) of 3.88 (arrow) and part of the lower thoracic esophagus had SUVmax of 2.37 (arrowhead) 2 weeks before admission . Because the image of pulmonary mass had not changed between CT and PET/CT for 2 weeks and because he had no fever, even though he had inflammation reaction on laboratory studies, pulmonary mass was considered to be unlikely due to infection. Thus, he was initially diagnosed with esophageal cancer with a pulmonary metastasis or recurrence of a pulmonary adenocarcinoma. Considering the both possibilities, we started chemotherapy with cisplatin (CDDP) 70 mg/m2 day1 plus 5-fluorouracil (5-FU) 700 mg/m2 day1–4 on the day 4 after admission. On the day 8, CT revealed a slight pleural effusion in the right side . On the day 9, to rule out carcinomatous pleurisy, an ultrasound-guided aspiration of pleural effusion was performed. The effusion was serous and contained no malignant cells. After the aspiration, the patient got a high fever. Laboratory test showed white blood cells of 18.6 × 103/L (90.8% of Neutrophil), CRP of 25.87 mg/dL. Considering that fever was due to respiratory infection after the aspiration, intravenous Sulbactam/Ampicillin (6 g/day) was administered. On the day14, his fever was persistent and he also had a cough. Because CT revealed an increased amount of pleural effusion , we considered the mass was lung abscess. By the second ultrasound-guided aspiration of the pleural effusion, we got a 50 ml of white suppurative effusion. The effusion turned out to contain Actinomyces israelii , and proved pulmonary mass-like lesion was pulmonary actinomycosis. The patient received intravenous penicillin G (24 million units/day) for 4 weeks, followed by oral amoxicillin 2250 mg/day for 6 months. The patient received four courses of chemotherapy (CDDP/5-FU) and curative radiotherapy (1.8Gy/total 50.4Gy) as esophageal cancer deeper than M3/SM1. The pulmonary actinomycosis disappeared six months after the treatment with antibiotics . After the chemoradiation therapy without any complications, the esophageal cancer was in complete remission.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1189_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1189_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58470308f01ff7b74d911a343cf952ce15d2c12b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1189_en.txt
@@ -0,0 +1,3 @@
+A 73-year old male with progressive impairment of gait, persisting neuropathic pain in his legs, dizziness due to postural changes, and unexplained weight loss of 20 kg (BMI 26.8 kg/m2) during the last 2–3 years presented to our outpatient clinic. Three years ago diagnosis of lumbar spinal stenosis was made and decompression surgery was performed to alleviate neuropathic pain. As symptoms progressed, 1 year before the first presentation a second surgical procedure was scheduled and it was only in the preoperative diagnostic workup that echocardiography revealed left ventricular hypertrophy suspected to represent cardiac amyloidosis (see Fig. ). Endomyocardial biopsy showed extensive amyloid deposition in Congo red stained tissue with a typcial apple green birefringence and fluorescence signal, which could be classified immunohistochemically as TTR derived amyloid (see Fig. ). Regarding the cardiac manifestation and the patient’s age and sex ATTRwt amyloidosis was suspected and treatment with tafamidis (61 mg daily) was initiated.
+At the time of referral, the patient was not able to walk unaided for almost 1 year due to weakness of his legs and impairment of balance. Neuropathic pain and dizziness due to orthostatic dysregulation had progressed and the patient reported no obvious improvement after approximately 1 year of treatment with tafamidis. The patient’s family history revealed frequent deaths due to cardiac events in his first-degree relatives (see Fig. ). His father died at the age of 67 from a cardiac event not further specified, as well as two of the patient’s brothers. One of them reportedly suffered cardiomyopathy and polyneuropathy. The only living brother, aged 68, was considerably impaired by a cardiomyopathy and peripheral neuropathy of unknown etiology.
+The clinical examination showed a severe impairment of gait due to sensory ataxia, bilateral distal paralyses of the lower extremities (ankle dorsiflexion MRC grade 2/5, plantar flexion MRC grade 2–3/5 on the right side, MRC grade 3–4/5 on the left side). A slight weakness of both hands (MRC grade 4/5) was evident, as well as moderate atrophy of distal limb muscles, distal symmetric hypesthesia, and lost tendon reflexes. Nerve conduction studies (NCS) confirmed a severe axonal sensorimotor neuropathy with bilaterally unobtainable sural and tibial nerve amplitudes. Corneal confocal microscopy (CCM) showed a highly reduced corneal nerve fiber density (7 fibers/mm2, reference: > 24 fibers/mm2) indicating prominent small fiber involvement. Extensive laboratory testing for potential causes of the neuropathy including HbA1c, vitamin B1, B6, B12, folic acid, TSH, ANA, ANCA, rheumatid factor, hepatitis serology, serum electrophoresis and immunofixation did not yield any relevant abnormalities. There was no history of alcohol abuse or any other exposure to neurotoxic agents. However, molecular genetic analysis (Sanger sequencing, bioinformatic analysis of collected data by means of Mutation Surveyor Version 3.10 and Alamut Visual Version 2.6.1) revealed a heterozygous sequence variant in exon 2 of the TTR gene (NM_000371.3 (TTR): c.194C > T, p.Ala65Val, s. Table and Fig. ), classified as likely pathogenic (class 4) according to the American College of Medical Genetics (ACMG) classification system, which had been reported in ClinVar twice (ClinVar Accession: VCV000448841.4, ClinVar Variation ID: 448841). In ClinVar, the variant is classified as a variant of uncertain significance (two submissions) and once with the condition amyloidogenic transthyretin amyloidosis, but there is no literature on individuals with TTR-related conditions with this genotype. ACMG criteria PM1 (variant located in a mutational hot spot), PM2 (variant absent from general population in databases gnomAD/ExAC), PM5 (novel missense change at an amino acid residue where a different missense change determined to be pathogenic has been seen before), and PP3 (multiple lines of computational evidence supported a deleterious effect on the gene product) were fulfilled . Presuming this genotype to be amyloidogenic, the patient’s brother underwent targeted genetic testing by Sanger sequencing that revealed the same heterozygous sequence variant.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1193_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1193_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..34d00effaff44acbc3bb8685dca4722b46453fa1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1193_en.txt
@@ -0,0 +1,9 @@
+Physical examination on admission: Obese 61-year-old woman (BMI 30.1 kg/m2), pulse 60/min, blood pressure 120/80 mmHg, temperature 36 °C, O2 saturation 94% under mechanical ventilation. Heart, lungs, and abdomen unremarkable. Laboratory studies: Complete blood count: unremarkable. Plasma coagulation study: normal, D-dimers within normal limits, Clinical chemistry: C-reactive protein 6 mg/L (normal 5 mg/L), all other values within normal limits. ECG: Sinus rhythm, HF 60, no AV-Block, no QT time prolongation, inverted T-waves in the inferior leads (III, aVF) . Fast echocardiography: Normal systolic right and left ventricular systolic function, severe mitral regurgitation, no pericardial effusion. Chest x-ray: Normal cardiac size with evidence of pulmonary venous congestion.
+Intensive care therapy achieved stabilization of the patient’s general condition. Controlled ventilation was stopped on the fourth day. Except for a hypoactive delirium, which was adequately controlled by administration of a neuroleptikum, no neurological deficits were manifested.
+Evaluation of the 12-lead ECG did not reveal any evidence of ECG changes, which are normally associated with canalopathies (Brugada, ARVC, long-, short QT syndromes etc.).
+However, we have registered recurrent ventricular salves during monitoring . In addition, we registered a short-lasting atrial fibrillation with spontaneous termination . Therefore, oral anticoagulation was initiated.
+Follow-up echocardiography showed a significant mitral valve insufficiency with preserved left ventricular pump function. The left ventricle demonstrated mild endsystolic and enddiastolic dilatation. A severe dilatation of the left atrium (LA area 45 cm2) was noticed . The lateral mitral annular velocities was quantified with Doppler tissue imaging. The peak systolic lateral mitral annulus velocity was 18 cm/s .
+Transesophageal echocardiography was performed to evaluate the mitral valve more precisely. A high-grade eccentric mitral valve insufficiency due to a pronounced PML and a mild AML prolapse could be demonstrated . Especially the PML showed thickening and myxomatous changes . The tendinous chordae appeared to be intact.
+For further clarification of the arrhythmogenic event, we ordered a CMR. This exploration has shown a discreet mid-wall LGE in the LV inferobasal region . Additionally, LGE of the PM was visible on mid short-axis view . The right ventricle showed no pathology by echocardiography and CMR. A significant mitral annulus disjunction (MAD) measuring 11,2 mm was identified. .
+Regarding the severe mitral valvular insufficiency due to the MVP, the case was discussed in the heart team. It was decided to provide the patient with an internal automatic cardioverter defibrillator (ICD) first and to repair the mitral valve by mini invasive surgery in 3 months.
+The patient showed regression of the delirium and an increasing mobility. After implantation of an ICD device , the patient was discharged in good general condition and without significant neurological deficits. A cardio-neurological rehabilitation was organized. The first ICD follow-up analysis after 3 Weeks did not show any arrhythmogenic events. At the 3 months ICD follow up, few days after the mitral valve reconstruction, we detected a VT, which has been successfully electrocardioverted .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_122_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_122_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2e384b467275255fd859a986a765dbb4f0812569
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_122_en.txt
@@ -0,0 +1,3 @@
+A 52-year-old housewife referred after falling down on her right knee. Her initial symptom of discomfort on her knee had begun one year earlier when she attended the hospital. Although she complained of pain only on heavy activity for last year, she had not been aware of a swelling in her knee until falling. On physical examination, there was a hard mass on the posteromedial edge of the patellar tendon. Active range of movement of the knee was a little restricted and painful. Results of routine laboratory screening tests were unremarkable. There was no history of major or minor repetitive trauma in the past. Plain lateral radiographs of the knee revealed a well circumscribed mass in the infrapatellar area .
+The patient underwent total excision of the mass. The mass was found extra-capsular and it was adjacent to the patellar tendon. The gross appearance of the mass was lobular and irregular in shape. It approximately was 4.5 × 3.5 × 1 cm . Histologically, the lobules consisted of well differentiated bone tissue surrounded by cartilage with evidence of enchondral bone formation at the interface suggesting osteochondroma .
+Postoperative course was unremarkable. At the last follow-up visit in the tenth year, the patient had no clinical and radiographic evidence of recurrence with a full range of movement ( and ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_124_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_124_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..78c1e5f60d11e279509672fa64e8cebc5e67d6c8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_124_en.txt
@@ -0,0 +1,6 @@
+For this proof-of-concept study the 4D cardiac-gated CT scan from a 55 year-old male patient suffering from VT was used. The CT data of this VT patient has been previously used for other purposes in a work published by Gianni et al. . The treatment target for this patient had a size of 45 cm3 and it was located on the left ventricular free wall. This clinical target volume (CTV) was determined by electrophysiological mapping and contoured prior to the treatment by a medical doctor from the Texas Heart Arrhythmia Institute in Austin, USA. The left anterior descending coronary artery, the circumflex coronary arteries and the non-involved left ventricle were OARs near the target.
+First, the 4D CT scan of the VT patient was loaded into the Raysearch® Raystation treatment planning system (version 10B, Raysearch Laboratories AB, Stockholm, Sweden). Subsequently, a virtual representation of the prototype version of the proprietary US probe system of EBAMed (Geneva, Switzerland) was manually inserted as volume of interest (VOI) in two locations representing the estimated position of the apical and parasternal US viewing windows. A separate study has already verified that these US viewing windows provide US images of sufficient quality for VT patients in supine position . The US probe was simulated as a cube of 2 × 2 × 2 cm. It is equipped with infra-red markers such that the probe can be localized by an optical camera (see ) and it is attached to a holder such that it can be fixed on the chest of the patient allowing for hands-free imaging during the treatment. To account for uncertainties in repositioning of the US probe during the treatment, including probe position uncertainties due to respiration and breath-hold differences, an isotropic safety margin of 10 mm has been added to the union of the US probe, holder, and optical marker.
+The parasternal US probe position allowed entrance of the treatment beams from optimal directions with respect to dosimetry for this particular patient. After selection of this virtual US probe position, a pencil-beam scanned proton therapy treatment plan was generated with the treatment planning system using the CNAO (Pavia, Italy) synchrotron proton beam model adapted to the Hitachi PROBEAT gantry system with 360° range of beam angles . During planning, the solid angle was restricted to take into account the US probe, the probe holder and the localization marker. Two fields were applied both with a gantry angle of 25° and a couch rotation of 0° and 90° for beam 1 and 2, respectively. The treatment volume was planned with an internal target volume (ITV) approach in order to compensate for shape and position changes of the target due to the heartbeat. It was assumed that the motion of the heart due to respiration would be mitigated using a breath-hold technique or respiratory gating. The envisioned role of the US imaging during this treatment was real-time cardiac motion monitoring and sending an alert to the operator in case the measured motion was outside of predefined limits.
+For the generation of the ITV, the heartbeat motion envelope was extracted from the 4D CT scan by deformable registration of each phase of the 4D CT scan to the planning CT scan. The resulting ITV is the union of the CTVs at all phases of the 4D CT. Finally, the planning target volume (PTV) was generated by adding a 5 mm margin to the ITV based on typical patient set-up errors which are expected when no image guidance tool like US imaging is used.
+Dose constraints on dose-volume tolerances in agreement with prior investigators were set as planning objectives. All doses are reported in Cobalt Gray Equivalent Dose (CGyE). The plan required the ITV to be covered by the 25 CGyE isodose, which is a dose level used in prior clinical studies to achieve safe, efficacious radioablation. To achieve this, the plan was normalized so that PTV D92% = 25 CGyE. Also, in order to arrive at a satisfactory treatment plan (, ), robust optimization with 2 mm set-up error in all directions and 2% range uncertainty was used during planning.
+To verify the clinical acceptability of the generated plan, evaluation of standard target dose-volume metrics D98, D95 D50 and D2 was performed. In addition, the dose to OARs and the target dose conformity and homogeneity were evaluated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1262_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1262_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..72734784adb94cb35871de50e4f5e45709fc0876
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1262_en.txt
@@ -0,0 +1,8 @@
+A 27-year-old woman, gravida 2, para 0, with no history of previous disease and no family history of congenital anomalies, smoker and with a BMI of 18.3 received a diagnosis of spontaneous twin pregnancy at 12 weeks. The assessment of chorionicity in this gestational age was however hampered by the presence of an hematoma measuring 44 × 38 mm separating the two membranes, thus preventing the identification of the “lambda” or “T” sign.
+The anatomy scan at 20 weeks revealed two female fetuses, both presenting isolated levocardia (IL) with normal heart and situs inversus abdominalis with a left-sided liver and right-sided stomach and spleen . Noteworthy, in one fetus (A) the gallbladder was not visible.
+An amniocentesis was performed, with conventional cytogenetic evaluation indicating normal karyotype 46XX for both fetuses. No genetic anomaly was reported with the Chromosomal Microarray Analysis (CMA). Zygosity was assessed by microsatellite analysis; as shown in Table , twins share only a fraction of paternal and maternal alleles, indicating dizygosity.
+At 36 weeks one fetus was diagnosed to be growth restricted, having an abdominal circumference and an estimated fetal weight less than 3rd centile. At 37 weeks and 1 day, the pulsatility index (PI) of the umbilical artery of the growth restricted fetus, with an estimated fetal weight of 2171 g (below the 3rd centile, according to Hadlock growth chart), was 0.89 (corresponding to 46° centile), while the PI of the middle cerebral artery was 1.45 (26° centile). By contrast, the other twin had an estimated fetal weight of 2521 g with normal Doppler parameters. At 37 weeks and 3 days the mother underwent a scheduled cesarean delivery. The birthweight of the two female neonates were 2430 g and 2185 g.
+The histological analysis of the placenta confirmed the monochorionicity of the twin pregnancy, revealing the juxtaposition of an amnion on each surface of the dividing membrane . The chorion was not visible between the two amnion surfaces, thus excluding the rare occurrence of partially fused placentas [, ]. Postnatally, by using DNA extracted from blood samples, the molecular analysis confirmed the dizygosity of the twins, as already previously determined through amniocentesis.
+Moreover, the two babies turned out to have the same situs anomaly, with IL and situs inversus, thus confirming the prenatal diagnosis. In order to identify possible genetic causes of such a concordant abnormal phenotype, the twins were subjected to clinical exome analysis with evaluation of 17 genes known to be associated to situs inversus. However, according to the variant classification ACMG (The American College of Medical Genetics and Genomics), no pathogenic or probably pathogenetic variants have been identified. By opening the analysis to the whole clinical exome (4490 genes), the twins did not share pathogenic or probably pathogenetic variants. In addition, the twin whose gallbladder was not visualized prenatally, developed jaundice with acholic stool in her neonatal period.
+The complete abdominal scan performed at 20 days of extrauterine life showed a left sided, damage-free liver with regular size (lateral diameter of 6,3 cm), a reversed relation between superior mesenteric vein and artery and right-placed inferior vena cava in relation to the aorta. These findings perfectly fit with abdominalis situs inversus with isolated levocardia. The scan revealed for the first time a shriveled gallbladder, which led to the diagnosis of biliary atresia type IV associated with splenic malformations syndrome . The clinical exome analysis was unable to identify the genetic cause of these abdominal abnormalities.
+The twin with BASM at 38 days of extrauterine life underwent Kasai portoenterostomy, second-hand appendectomy and Ladd bridle dissection. Later, during the fifth month of extrauterine life, the baby was diagnosed to have a subclinical acute cholangitis, which was treated with continuous infusion of piperacillin tazobactam during hospitalization. Unfortunately, the baby had recurrent cholangitis during the whole first year of extrauterine life, and these are still occurring.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1280_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1280_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4d4fe47b3c3d49c87b52e95d3c5b2cbc06253cd6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1280_en.txt
@@ -0,0 +1,7 @@
+A 68-year-old Hispanic male with no significant past medical history was brought to the ED by emergency medical services (EMS) for confusion and altered mental status. EMS reported that they were called by the patient’s wife when she discovered him breathing erratically and could not rouse him. Upon arrival to the ED, the patient was obtunded and began to experience cardiac arrest with ventricular fibrillation. He was subsequently intubated and given Advanced Cardiac Life Support where cardiopulmonary resuscitation was administered and the patient was defibrillated. He went on to experience return of spontaneous circulation. An ECG obtained in the ED during this event demonstrated ST-segment elevations in V1–V3 and specific repolarization abnormalities in V1 and V2 .
+Additional ECG findings included the following: first-degree atrioventricular (AV) block, PR interval of 220 milliseconds (120–200 milliseconds), and QRS duration of 0.11 seconds (0.08–0.12 seconds).
+The patient was placed on an amiodarone infusion and transferred to a medical facility with a cardiac catheterization laboratory. Emergent cardiac catheterization was performed due to concerns for ST-elevation myocardial infarction (STEMI), but no acute findings were discovered. Laboratory values from the initial blood draw in the ED demonstrated the following: sodium 132 milliequivalent per liter (meq/L) (normal 136–145 meq/L); potassium 3.3meq/L (normal 3.5–5.0 meq/L); magnesium 3.3 milligram per deciliter (mg/dL) (normal 1.5–2.4 mg/dL); glucose 197mg/dL; troponin <0.02 nanograms per milliliter; brain natriuretic peptide (BNP) 65; prothrombin time (PT) 13.6 seconds (normal 11–13 seconds); international normalized ratio (INR) 1.3 seconds; and thyroid stimulating hormone (TSH) 59.4 milliunits per liter (mU/L) (normal 0.5–5.0 mU/L).
+Following cardiac catheterization, the patient was transferred to the intensive care unit where all vital signs remained stable and within normal limits. With members of the patient’s immediate family at bedside, information pertaining to his personal history was elicited for the first time. They reported that the patient had been in good health prior to the onset of his confusion and at no point did he complain of any discomfort or associated symptoms. Furthermore, they denied any significant past medical or surgical events in the patient’s history, including any personal or family history of heart disease or sudden cardiac death. They stated that the patient had no allergies, did not take any medications, never used tobacco or illicit drugs, and consumed alcohol occasionally during social events.
+The following day, the patient was extubated with excellent response and was found to have no focal deficits on physical exam. Thyroid replacement therapy was initiated for severe hypothyroidism discovered incidentally during the aforementioned care. Although no additional adverse cardiac events would occur for the duration of his hospital stay, the patient agreed to placement of an implantable-cardioverter defibrillator (ICD) as recommended for secondary prevention of Brugada syndrome.
+Further work-up of the patient during his hospital course included the following: magnetic resonance imaging of the brain, which demonstrated multiple small areas of infarct in the bilateral cerebral hemispheres and no other significant findings. Computed tomography angiography of the head and neck were found to be normal. After demonstrating an ability to ambulate 300 feet with front-wheel walker, the patient was discharged home on aspirin and statin medication.
+Left heart catheterization was performed 18 days later as recommended by the patient’s electrophysiologist. The right coronary artery was found without stenosis or blockage; the left anterior descending artery was patent; and overall coronary circulation and left ventricular function were normal. These findings, coupled with the patient’s presenting symptoms and findings found on ECG in the ED, ultimately corroborated a diagnosis of Brugada syndrome with a type 1 pattern.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1326_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1326_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fb42a94305b21345ef867a73f4fa3e742362b026
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1326_en.txt
@@ -0,0 +1,7 @@
+A 13-year-old boy was admitted to Pediatric Intensive Care Unit (PICU) in a critical situation. After waking up in the morning, he complained of left-sided abdominal pain, nausea, and vomiting. Over the hours, the pain was intermittent and increasing in intensity.
+At admission, the patient looked pale, in a forced sitting position. On physical examination, his abdomen was tender in all quadrants with left upper quadrant pain rated as 10 out of 10 in intensity. The pain was described as very strong and increased if he laid down, thus requiring intravenous opioids. Upon examination, heart rate was 92 bpm along with low blood pressure 82/42 mmHg. Diminished breath sounds at the lung bases were noted, most likely due to limited excursions of the chest due to pain. There was no fever (temperature 36.5 C). There was no rash, nor lymphadenopathy. No hematomas or bruises were observed. After intravenous opioids and liquid administration, blood pressure was normalized.
+The patient and his father denied any history of trauma. They insisted the child had been totally healthy up until that morning. The child had no family history of coagulopathies, autoimmune diseases, or malignancies. According to his family, there were no bowel abnormalities; use of thrombolytic or anticoagulant drugs.
+Several laboratory and imaging examinations were performed immediately. Given the relatively large number of COVID-19 patients during this period, our main differential diagnoses were either a splenic rupture or a splenic artery thrombosis, due to COVID-19. Therefore, a nasopharyngeal swab specimen was collected for COVID-19 testing.
+The upright abdominal radiograph showed no abnormalities. Abdominal ultrasound revealed free fluid in the abdomen, but without any clear suspicion, so an emergent Computed tomography (CT) with contrast of the chest and abdomen was carried out. The thoracic CT scan was normal. Abdominal CT revealed hemoperitoneum with splenic laceration.
+Since the hemoglobin, hematocrit, and patient’s blood pressure were normal, with no active bleeding on CT, the splenic injury was initially managed conservatively. Twelve hours after presentation, a decrease in hemoglobin (Hb = 8.1 g/dL) and hematocrit (HCT = 25.6%) was noted and the patient’s blood pressure started dropping. He received 1 Unit of blood and the decision to proceed to surgery was made. During the operation, it was observed that the patient had plenty of blood in the abdominal cavity. Laceration of the splenic hilum and a large perisplenic hematoma was noted and splenectomy was performed. Two additional Units of blood were transfused intraoperatively.
+Human immunodeficiency virus (HIV) test, IgM and IgG antibodies for Epstein Barr virus (EBV) and cytomegalovirus (CMV) were negative. The polymerase chain reaction (PCR) was positive for COVID-19, making us think that the splenic rupture could be a consequence of COVID-19. The child’s clinical condition was stable after surgery. He was discharged, without further problems during the follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1334_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1334_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..efd98c054de054bd579576e39c0b9424f1a57356
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1334_en.txt
@@ -0,0 +1,5 @@
+A 23 year old male patient presented to the orthopaedic clinic with complaints of an isolated scapular swelling (right) since 5 years . The swelling was also associated with crepitus and snapping of the right shoulder and slight restriction and pain on abduction. The patient reported no increase in size of the swelling over the years and demonstrated no increase in symptoms as well. There was no history of antecedent trauma, weight loss, loss of appetite or any other constitutional symptom. The patient wanted the swelling to be removed due to cosmetic reasons mainly as he was about to get married. Local examination of the swelling revealed increased prominence of superior angle of scapula. The skin overlying the same was normal. There were no signs of inflammation etc present. The swelling was non painful on touch. However, snapping and crepitus/grating could be demonstrated on scapulothoracic movements and restriction in abduction was evident. An antero posterior skiagram of the right shoulder revealed a pedunculated mass arising from the supero medial angle of the scapula .
+CT scan and MRI revealed a mushroom shaped exostosis over the superior angle of scapula .
+The swelling diagnosed as ventral osteochondroma was excised. A laparoscopic resection of the same has been described, however, we performed an open excision of the swelling.
+An incision was used along the medial border of scapula wherein it was most prominent .
+Extra periosteal resection of the swelling was performed and sent for biopsy. HPE analysis confirmed our diagnosis and ruled out any malignant transformation. Post operative course was uneventful and patient was able to perform full range of motion at his right shoulder after 1 month . Follow up was done till 1 year and no recurrence of the swelling was reported.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1337_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1337_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..de6973db01562bfb515a79eacaea46e17cfe995e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1337_en.txt
@@ -0,0 +1,4 @@
+A 24-year-old male was admitted to the acute medical assessment unit through emergency department with presenting complaint of left sided chest pain. Chest pain was gradual in onset, started overnight with 6/10 in intensity, sharp in character, increased by deep breathing and lying down, and improved by leaning forward. Chest pain was associated with nausea and single episode of non-bloody vomiting. Patient also reported fever, generalized tiredness, lethargy, and insomnia. Patient also had pounding of heart but thought that it was result of his anxiety. There was no history of sore throat, rigours, chills, cough, or sputum. Patient also denied history of shortness of breath, paroxysmal nocturnal dyspnoea, and orthopnoea or ankle oedema. There was no history of chest trauma or skin rash. There was no prior history of chest pains. Patient had history of insomnia, had significant unintentional weight loss of 6–8 kg over last 3 weeks despite good appetite, heat intolerance, shakiness of hands, and nervousness. He adamantly denied any visual disturbance or change in appearance of his eyes. His vitals on arrival were temperature 38˚C, blood pressure 130/80 mmHg, heart rate 125 b.p.m., and respiratory rate 18.
+On clinical examination patient looked anxious and in agony, there were fine tremors on outstretched hands with sweaty palms. His pulse was fast, regular, and high in volume. There was no exophthalmos clinically. Neck examination shows diffuse enlargement of thyroid gland which was non-tender, there was no associated lymphadenopathy. No bruit was heard over thyroid gland. On cardiac examination, heart tones were normal and no rub was appreciated. Respiratory and rest of systemic examination was normal. His medical history was only significant for anxiety disorder. He was a non-smoker and teetotaller. He denied use of herbal medicines or recreational drugs. Family history was unremarkable for pericarditis or thyroidal problems.
+His electrocardiogram (ECG) showed sinus tachycardia, diffuse ST-elevation in both chest and limb leads, PR depression in most of limb leads. In addition, there was PR elevation and reciprocal ST-depression in lead aVR. All of these features were suggestive of acute pericarditis. Chest X-ray was normal. Ultrasound thyroid with Doppler was done which showed enlarged thyroid with heterogeneous echotexture and increased vascularity also known as thyroid inferno suggestive of Graves’ disease. In addition, there was neither focal nodule nor abnormality in thyroid, nor cervical lymphadenopathy. His thyroid function test demonstrated thyroid stimulating hormone (TSH) <0.02 mU/L (normal range 0.27–4.20) and freeT4 was >100 pmol/L (normal range 11–26). Anti-thyroglobulin antibodies were also significantly elevated 58.2 U/L (normal range 0–0.99). His first troponin was normal 14 ng/L (normal range 0–14), and repeat one was 19 ng/L (only minimally elevated). His C-reactive protein (CRP) was <5 mg/L (normal range 0–9) and erythrocyte sedimentation rate (ESR) was 5 (normal range 1–13). Antinuclear antibodies profile was negative , and rest of his blood investigations was unremarkable. Echocardiogram was performed which showed preserved left ventricular systolic function without any regional wall motion abnormalities. There was a small global pericardial effusion noted (1 cm around right atrial free wall, 0.6 cm around lateral wall, and 0.3 cm posteriorly) which was not causing any haemodynamic compromise or tamponade. Right ventricular systolic function was preserved with no evidence of right heart strain.
+His overall clinical picture, based on history and investigations, was consistent with a diagnosis of pericarditis associated with Graves’ disease. Given his clinical context, he was started on ibuprofen 400 mg thrice daily (TDS) to control pain and inflammation with Pericarditis along with Omeprazole 40 mg once daily (OD). Carbimazole 40 mg OD was commenced to control Graves’s systemic symptoms and Propranolol 40 mg TDS was prescribed to control anxiety, tremors, and tachycardia. Patient had remarkable improvement of his symptoms and was discharged a couple of days later with follow-up arranged in endocrine outpatients. He became clinically and biochemically euthyroid with subsequent thyroid functions after 12 weeks as: TSH 1.1 mU/L (normal range −0.27 to 4.20), free T4 20 pmol/L (normal range 11–26). Both his CRP and ESR on subsequent testing after 3 months remained normal. Both repeat ECG and echocardiography after 4 months revealed complete resolution of pericarditis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1365_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1365_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fe3c48a13889452354b6aca5c63c34819a641862
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1365_en.txt
@@ -0,0 +1,5 @@
+A 47-year-old Chinese woman complained of blurred monocular vision in her left eye 1 month prior to her visit. She also reported that her vision deteriorated very quickly and that she became almost blind after 3 days since the onset of the disease. She denied headache, fever, or cough prior to the vision problem. The ophthalmologist at the local hospital found the visual acuity was 20/20 in the right eye with suspicious light perception in the left eye. The fundus examine and fundus fluorescein angiography were performed. She was diagnosed with CRVO in her left eye and was followed up for 1 month. The patient continued to lose vision, and the swelling of the optic disc and retina did not improve. She was referred to a neuro-ophthalmologist for further evaluation. She was a considerably healthy housewife living in a southeastern city of China. The chart review was only remarkable for mild hypertension. She neither smoked nor drank alcohol. There was no family history of neurological or hereditary diseases.
+The neuro-ophthalmological examination revealed the patient to be alert and oriented. Her visual acuity was 20/20 in the right eye with no light perception in the left eye. The left pupil showed no light reaction and an afferent pupillary defect. Slit lamp examination revealed no keratic precipitates or cells in the vitreous of either eye. The intraocular pressure was 13 mmHg in the right eye and 11 mmHg in the left eye. Funduscopic examination revealed a central retinal vein occlusion with optic oedema, dilated and tortuous veins, and extensive intraretinal haemorrhage. . The right fundus was unremarkable. There were no other abnormal focal neurological signs.
+Routine laboratory tests, including complete blood count and liver and renal function, were unremarkable. A rheumatology panel, including erythrocyte sedimentation ratio, C-reactive protein, anti-nuclear antibody, anti-extractable nuclear antibodies, and anti-neutrophil cytoplasmic antibody, were unremarkable. Angiotensin converting enzyme levels were within the normal limit. An infectious disease panel, including human immunodeficiency virus, herpes simplex virus, cytomegalovirus, Treponema pallidum antibody, and T-spot, were negative.
+The brain and orbital magnetic resonance imaging (MRI) with contrast showed enlargement of the left optic nerve in the orbit. The anterior part of the optic nerve showed heterogenous enhancement. There were no other brain lesions or masses . Chest computed tomography (CT) with contrast was unremarkable. The lumbar puncture showed normal intracranial pressure with normal cerebrospinal fluid components and biochemistry.
+She was diagnosed with optic neuropathy combined with CRVO/CRAO of unknown causes. She was given 500 mg/d intravenous methylprednisolone for 5 days and was then tapered off. Her visual acuity in the left eye maintained no light perception after treatment and the optic disc swelling resolved along with residual retinal haemorrhaging with the narrowing of the vessels. . The macular optical coherence tomography showed thinning of the inner layer of the right retina due to retinal artery occlusion. As she could not perceive light in her left eye, she was scheduled for an optic nerve biopsy. Histopathology showed that the optic nerve had lost its original structure and was infiltrated with numerous inflammatory non-caseating granulomas, which was consistent with sarcoidosis . The final diagnosis of neurosarcoidosis was made according to the clinical manifestation and pathology of the patient. She was only seen for follow-up with no further treatment due to no other systemic involvement of sarcoidosis. Her left eye maintained no light perception and the retina thinned afterwards.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1369_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1369_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0f091839020be1f114a4a2b460e8563d101adae2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1369_en.txt
@@ -0,0 +1,4 @@
+A 41-year-old woman (weighing 68 kg, 157 cm tall) with a previous history of childhood asthma became pregnant during follow-up of breast cancer. She was scheduled to undergo total mastectomy with sentinel lymph node biopsy at 18 weeks of gestation. In order to minimize physiological stress on both mother and fetus during the perioperative period, we decided to administer general anesthesia combined with continuous ESP block.
+Her physical examination and preoperative laboratory tests indicated no abnormalities. After establishing standard monitoring, including bispectral index (BIS) and neuromuscular monitoring, general anesthesia was induced with intravenous propofol (target-controlled infusion [TCI] of 3.3 μg/mL) and remifentanil (0.25 μg/kg/min). Following calibration of the train-of-four (TOF) monitor, we administered rocuronium at fractional doses of 10 mg until the required degree of muscle relaxation was achieved. Tracheal intubation was uneventfully performed.
+After placing the patient in the right lateral position, a high-frequency linear ultrasound transducer (LOGIQe, GE Healthcare, Wauwatosa, Wisconsin) was aseptically placed on the patient’s back in a longitudinal parasagittal orientation approximately 3 cm from the midline. The erector spinae muscles were identified superficial to the tip of the T3 transverse process. An 18-gauge, 100-mm needle (Contiplex® S Ultra, B. Braun, Melsungen, Germany) was inserted using an in-plane approach and in a cranial-to-caudal direction to contact the tip of the T3 transverse process . The location of the needle tip was confirmed by visible fluid spread resulting in the lifting of the erector spinae muscles. A total of 20 mL of 0.25% levobupivacaine was injected through the needle, followed by insertion of a 19-gauge catheter 5 cm beyond the needle tip. Then, an infusion of 0.25% levobupivacaine into the erector spinae plane was started at the rate of 6 mL/h. General anesthesia was maintained with propofol (TCI of 3.0–3.3 μg/mL) to keep the BIS between 40 and 60, remifentanil (0.05–0.1 μg/kg/min) to maintain systolic blood pressure within 20% of preoperative values, and intermittent administration of 10 mg rocuronium to keep TOF counts below 2. The operative time was 111 min. The patient’s hemodynamics remained stable during the surgery. One thousand milligrams of acetaminophen was intravenously administered 15 min before the end of surgery. After full recovery from general anesthesia, the patient was extubated and transferred to the general ward of the department of surgical oncology.
+Postoperative pain was measured using a numerical rating scale (NRS; an 11-point scale, 0 was no pain and 10 was the worst pain imaginable) immediately after recovery from general anesthesia and at varied intervals postoperatively (at 2, 6, 24, and 36 h). NRS scores remained at 1 point throughout the postoperative period, indicating minimal pain. At 2 h after surgery, postoperative assessment of the fetus with Doppler ultrasound revealed no abnormalities. The catheter of the ESP block was removed at 24 h after surgery. Postoperative pain did not worsen after termination of the block. The patient did not need any additional analgesics during the postoperative period and was discharged home on the 15th day after surgery with no adverse effects on either mother or fetus.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1387_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1387_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d351496c226091d064983c8b72c35af23b5cf4f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1387_en.txt
@@ -0,0 +1,7 @@
+A 4-year-old male was brought to the emergency department with a 2-week history of headache, lethargy and vomiting. CT and MRI brain revealed a 4.5-cm fourth ventricular lesion with associated obstructive hydrocephalus . Preoperative bloodwork showed no abnormalities, with normal liver function, platelet count and coagulation profile.
+A preoperative dose of 20 mg/kg of 5-ALA (Gliolan) was administered on the morning of surgery (weight 19 kg). The patient underwent insertion of a right frontal external ventricular drain, followed by suboccipital craniotomy, C1 laminectomy and complete resection of the lesion. The tumour fluoresced avidly intraoperatively. There was moderate intraoperative blood volume loss (400 mL); 2 units of red cells and a pool of Octaplex were transfused during the procedure. The patient was positioned prone for a total of 6 h. Immediate postoperative imaging revealed complete radiological resection with no new abnormalities seen. Histological examination of the resected specimen confirmed an anaplastic ependymoma (WHO grade III).
+The patient was successfully extubated after postoperative MRI on the day of surgery. He remained in the paediatric intensive care unit for monitoring.
+Laboratory results on postoperative day 1 revealed a platelet count of 5 × 103/mL with a significant transaminitis (AST 3027 iU/L; ALT 2367 iU/L). The patient was haemodynamically stable and neurologically intact with GCS 15/15.
+Despite the liver injury, there was no evidence of acute hepatic failure with PT only modestly elevated (16 s) and no evidence of encephalopathy. Despite treatment with platelets, plasma and red cell transfusions as well as tranexamic acid, vitamin K and fibrinogen, the acute thrombocytopaenia persisted and the patient’s haemoglobin level dropped progressively from 13.5 to 8 g/dL over 36 h. Liver biochemistry results had also worsened with AST peaking at 7198 iU/L and ALT at 4496 iU/L.
+On postoperative day 2, the patient’s external ventricular drain became blocked with blood clots, and he became drowsy. The right pupil became dilated and non-reactive. CT brain showed a new spontaneous right frontal intraparenchymal haemorrhage with intraventricular extension as well as acute subdural haematoma . The patient was brought to theatre for emergency craniectomy and evacuation of the haemorrhage. Intraoperative bleeding was difficult to control, and the massive transfusion protocol was enacted. Eventually, once haemostasis was achieved, the patient was brought back to PICU for ongoing management. The transaminitis improved over the following days and the thrombocytopaenia also resolved.
+Autologous cranioplasty was performed 1 month later. The patient then received adjuvant proton-beam therapy and chemotherapy. Three months later at outpatient follow-up, the patient was noted to be neurologically intact aside from a very subtle weakness of his left hand. Blood results were all within normal range. He was attending school full-time once again and had made an almost complete clinical recovery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1406_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1406_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4a4046caa1c9c0de04799bd913104cda95d85670
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1406_en.txt
@@ -0,0 +1,5 @@
+A 35-year-old male with no known past medical history presented to the hospital for progressively worsening rectal pain for the past three days. The patient stated that pain was worse with defecation and while sitting upright. He described the sensation of feeling an outgrowth or nodule present near his anus. He tried applying “lotion” at home without any relief of pain. He did endorse constipation for two to three weeks prior to presentation. He denied melena or hematochezia. The patient also complained of unintentional weight loss of 20 pounds over three months. He denied any constitutional symptoms.
+The patient reported he was seen by his family doctor four months earlier and underwent an annual physical examination, which was normal. A complete metabolic panel and complete blood count was done at this visit with no abnormality. He denied any history of unsafe sexual practices, intravenous drug use and had never chronically used probiotics.
+On admission, his vital signs showed a temperature of 36.2 °C, heart rate 111 beats/minute, blood pressure 138/42 mmHg, respiratory rate of 21 and saturating 100% on room air. On physical examination, tenderness was elicited to light touch and palpation at the perianal region. A hard, indurated region was palpated at the perianal region on the medial side, which was surrounded by erythema.
+Laboratory examination was negative for leukocytosis. His basic metabolic panel showed sodium of 132 mEq/l, potassium of 3.2 mEq/l, bicarbonate of 6 mEq/l and an anion gap of 23. His blood glucose was 280 mg/dL. Lactate was within normal limits. Urinalysis was positive for ketones and negative for infection. A contrast enhanced CT scan of the abdomen and pelvis showed a perianal abscess.
+Initial management included initiation of broad-spectrum intravenous antibiotics with vancomycin, cefepime, and metronidazole. General surgery was consulted, and the patient underwent incision and drainage of the perirectal abscess. Blood cultures came back positive for gram-positive rods and cocci, and later speciation showed Lactobacillus in both anaerobic bottles. Infectious disease was consulted, and oral amoxicillin and clavulanate potassium therapy was initiated at a dose of 500 mg-125 mg twice daily. Further laboratory testing revealed an HA1c of 15%, leading to an endocrinology consult, a new diagnosis of diabetes mellitus, and the initiation of insulin therapy. The patient continued to improve and repeat cultures were negative. There was low suspicion for endocarditis and echocardiogram was not pursued. He was discharged with a ten-day course of oral amoxicillin clavulanate 500 mg–125 mg and referred to endocrinology for outpatient follow up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1408_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1408_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cc86c738baa04a7f2c2708becb405f19cdce1a5c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1408_en.txt
@@ -0,0 +1,7 @@
+A 50-year-old female presented to the emergency department at the onset of acute severe chest and upper back pain. Her medical history consisted of controlled stage II hypertension, treated with losartan. No other comorbidities were present. Laboratory testing showed normal kidney functions. Blood pressure was 170/90 mmHg at presentation.
+Subsequent diagnostic contrast-enhanced computed tomography (CT) revealed a type B aortic dissection (TBAD) that extended from the left subclavian artery (LSA) to the right common iliac artery (RCIA) . Only the right renal artery (RRA) originated from the false lumen. The maximum compression was at T5 level, where the true lumen was compressed to less than 10% of the total diameter .
+Despite primary medical treatment with intravenous metoprolol and sodium nitroprusside and oral beta blockers controlling the blood pressure, the patient’s symptoms did not improve. Because of her persistent back pain over 4 days, invasive treatment was deemed necessary. Moreover, due to the involvement of the visceral aorta into the dissection, it was deemed necessary to treat the dissected aorta extensively. As the site was located in the Brazilian state of Tocatins, more than 2000 kilometers away from the closest vascular center, the decision was made to treat the patient locally.
+The procedure was performed on day 4 after symptoms onset, under local anesthetic and sedation. Unilateral ultrasound-guided right femoral access was obtained by a preclose technique with two Proglide devices (Abbot Vascular, Santa Clara, California). Proper guidewire introduction and advancement in the true lumen was ensured by angiographic guidance. Through a 20 Fr sheath, two overlapping multilayer stents were implanted. To ensure a sufficient healthy landing zone and obtain adequate proximal seal, decision was made to deliver the proximal stent over the aortic arch. The open mesh structure of the multilayer stent made this possible, ensuring preserved perfusion of the supra-aortic branches.
+No rapid pacing nor adjunctive procedure were necessary for the deployment of the stents. Angiogram at the end of the procedure showed approximation of the entry tear and total exclusion of the false lumen in front of the entry tear, with patent side branches, particularly the supra-aortic arteries, mesenteric arteries and both renal arteries. Total procedure time was 68 minutes. Less than 100 milliliters of contrast agent were administered.
+The patient was completely asymptomatic after the procedure. She remained in the ICU (Intensive Care Unit) for 12 hours postoperatively. There were no signs of stroke or spinal cord ischemia. Postoperative kidney function tests remained normal. The next day she was discharged from the hospital in good health. Dual antiplatelet therapy (DAPT), i.e., clopidogrel and acetylsalicylic acid, were started as per our site standard practice after endovascular procedures.
+At follow-up examinations after 6 and 12 months, the patient remained asymptomatic. Review of the CT scans confirmed that the stent had reopened the true lumen to the original aorta diameter, with stable true and false lumen diameters and volumes between 6 and 12 months. The 12-month follow-up CT scan revealed that the false lumen at the proximal end of dissection completely disappeared . Also, the maximum diameter of the false lumen significantly decreased whereas the true lumen diameter increased . All supra-aortic and visceral branches were patent .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1449_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1449_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5559562912068b3ebc2ff76899358d7576c66083
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1449_en.txt
@@ -0,0 +1,5 @@
+A 39-year-old, gravida 7, para 2, woman came to the local hospital with a complaint of lower abdominal dull pain for 3 h at 34 weeks’ gestation. Her obstetrical history began with two preterm spontaneous vaginal delivery (one at 28 weeks’ gestation; one at 30 weeks’ gestation) at the age of 18 and 19, respectively. Her third, fourth, and fifth pregnancies ended in abortion at early gestation with dilation & curettage treatment. In her previous pregnancy at 36 years of age, she received laparoscopic left salpingectomy and methotrexate (MTX) treatment due to ectopic pregnancy. No other surgeries on the pelvis or abdomen has been performed.
+Her general condition was stable. Physical examination showed normal secretions, no vaginal bleeding or fluid, no cervical dilation, but irregular preterm contractions with a shortened cervical length. Ultrasonography revealed a decreased amniotic fluid index (AFI 4.0 cm) and a single intrauterine pregnancy with breech presentation and positive fetal heart activity. The placenta was located on the anterior wall of the uterus. Laboratory tests were performed at the time of admission and did not show any significant findings, and hemoglobin level was 120 g/L. Due to the risk of premature birth, dydrogesterone was used to relieve uterine contraction and dexamethasone was administered to accelerate fetal lung maturation. Over 2 days following admission, her symptoms gradually worsened. She presented with diffuse abdominal pain and distension. She also reported nausea and had problem in defecating. Ultrasonography of the abdomen represented intestinal dilatation and multiple intestinal contents and air-fluid levels in the colon. Therefore, an intestinal obstruction was suspected. Enema was used to help intestinal peristalsis.
+As there was no improvement in her condition, the patient requested a transfer to our hospital. Clinical examination revealed epigastric tenderness and mild abdominal distension, with no signs of guarding or peritonitis. Bowel sounds were weak. Consulting with the surgeon on duty, an abdominal computed tomography (CT) was performed after informed consent from the patient. CT represented dilatation of ascending colon and transverse colon . The symptoms were relieved after a nasogastric tube was inserted initially and enema was used. Since ultrasonography revealed oligohydramnios, a test for amniotic fluid crystal was performed, showing no signs of premature rupture of fetal membrane. On the fourth day following admission in our hospital, ultrasonography showed merely no fluid in the amniotic sac and the patient complained of no complete relief of bowel obstruction. Therefore, an emergency caesarean section (C-section) was performed. A healthy baby was delivered with no complications. Intra-operative assessment showed dense adhesion between the left wall of uterus and omentum, descending colon, and sigmoid colon. After adhesion dialysis and intestinal arrangement performed by a colon and rectal surgeon, uterine rupture with complete opening of the uterine wall at the site of left uterine cornua was found without active bleeding . The uterine scar was repaired using a double-layer closure.
+Re-evaluation of the former abdominal CT was taken, revealing discontinuity of the uterine muscle layer in the left uterine cornua , which was consistent with intraoperative findings. Considering that the hemoglobin level didn’t decrease, her blood pressure remained stable, and no fetal distress happened during her labor of the birth, we assumed that the uterine rupture may occurred very early. Since omentum and colon were attached to the site of perforation, no clinical signs of uterine rupture were presented. As uterus enlarged, changes in the transit of intestinal tract decreased the intestinal peristalsis and then caused obstruction.
+The patient recovered well without any complications and was discharged on the fifth postoperative day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1451_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1451_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5d776184a3fec941c61b8aec748b898e8e8f9ce0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1451_en.txt
@@ -0,0 +1,3 @@
+A 44-year-old Guatemalan woman presented to our outpatient clinic with a chief complaint of left knee pain for the last 6 months. One month prior our patient had consulted with an outside physician, who prescribed her with 300 mg of carbamazepine, 5 mg of prednisone every 24 hours, and ibuprofen every 8 hours as needed. The symptoms did not resolve and our patient increased the dose to 600 mg of carbamazepine and 20 mg of prednisone 7 days before consulting. She suddenly interrupted prednisone 3 days before consulting, because she felt this was making her pain worse. At the consultation, our patient complained of left knee pain, fatigue, and bilateral lower limb cramps. No pertinent medical, surgical, allergic, family, and psychosocial history was recorded and her vital signs were within normal limits (blood pressure of 118/64 mmHg; heart rate of 75/minute; respiratory rate of 14 beats/minute; temperature at 98.9 °Fahrenheit). Our patient was on day 12 of her menstrual cycle. A physical examination revealed mild facial edema, multiple port-wine stains on her upper and lower extremities associated with mild hypertrophy of the calves , more prominent on the right side with mild edema, the rest of the physical examination was non-contributory. Imaging and routine blood studies were requested. Our patient was seen the next day at the office with the laboratory results .
+Our patient presented with only a complaint of fatigue at this visit, however, no neurologic or physical disabilities were recorded, and her vital signs were within normal limits.
+Our patient was sent to the emergency department (ED) for electrolyte imbalance correction and for other diagnostic studies. In the ED, a 12-lead electrocardiogram did not show any electric abnormalities, her urinary Na+ (UNa+) was 164 mmol/L (normal 40–220 mmol/L), and osmolality 328 mmol/kg (50–1200 mmol/kg). No carbamazepine serum levels were recorded due to lack of reactive in the hospital. Our patient was diagnosed with syndrome of inappropriate antidiuretic hormone secretion (SIADH) secondary to carbamazepine use, hypokalemia secondary to corticosteroid therapy, and Klippel-Trénaunay-Weber (KTW) syndrome. Patient orders were to discontinue carbamazepine, fluid restriction to 1.5 L/day and intravenous potassium (K+) slow correction. She was discharged 3 days later with Na+ 128 mmol/L, K+ 4.6 mmol/L, and serum osmolality 265 mmol/kg. Our patient was seen in the office 1 week after discharge: she no longer felt fatigued, her cramps were not present and her left knee pain had mildly improved with acetaminophen use and local nonsteroidal anti-inflammatory drug (NSAID) cream. Her left knee pain was attributed to the KTW syndrome. She was not taking carbamazepine and prednisone at the time of the follow-up. Electrolyte studies revealed Na+ 138 mmol/L, K 4.6 mmol/L, and serum osmolality at 276 mmol/kg.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_146_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_146_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7d0143224b50a2deee9d512ae99435e655bca438
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_146_en.txt
@@ -0,0 +1,2 @@
+A 62-year-old previously healthy Sri Lankan native male from Gampaha, in the Western Province of Sri Lanka presented with high fever associated with chills and rigors for 17 days. He also complained of malaise, myalgia and arthralgia for the same duration but denied any urinary, respiratory or abdominal symptoms. Until he presented to us, he had obtained treatment froma local hospital for the illness with no clinical improvement. He had received co-amoxyclav, clarythromicin and paracetamol for 4 days. He had not been consuming any medication prior to the illness and had not received any drug that would result in extrapyramidal features. Around the 5th day of the clinical illness he had developed intermittent resting tremor in his right arm and leg. By the time he presented to us he had stiffness and very frequent intermittent resting tremor (Additional file : Video). This resulted in difficulty to carry out normal work with the right hand. He also found it difficult to walk due to unusual stiffness and heaviness of the right leg. Furthermore, he found it difficult to smile with others and felt very distressed. He denied similar previous episodes. There was no associated hearing impairment, seizures, or altered level of consciousness. There were no symptoms to suggest involvement of cerebellar system or autonomic nervous system. There was no family history of movement disorders. He had been working in his garden 7 days prior to the onset of fever and rest of the past medical history was unremarkable. Examination revealed intermittent high amplitude low frequency resting tremor in his right hand (Additional file : Video) and a mask like face where he found difficult to smile or show his teeth . He also had increased muscle tone limited to the right side with normal tendon reflexes.The rest of the central nervous system was unremarkable. His blood pressure was 140/90 mmHg in both supine and standing positions, pulse rate 88 beats per minute and there were no cardiac murmurs. The respiratory system revealed few basal crackles and the abdominal examination was unremarkable except for a superficial crater like lesion suggestive of an eschar. He did not have lymphadenopathy or a rash.
+His full blood count was 13.4 × 109/L (Neutrophils 43 %, Lymphocytes 56 %), Erythrocyte sedimentation rate was 80 mm/1st h and had a normal urine analysis, liver and renal function tests. The CT scan of the brain and the Electroencephalogram were normal. We did not perform a lumbar puncture or an Magnetic resonance image scan of the brain. He was positive for Immunofluoresence Assay (IFA)-IgM and IgG for O. tsutsugamushi on the 17th day of illness and the IFA-IgG titre using Orientia Karp antigen was 1:1024 which rose up to 1:16,384 after 2 weeks confirming scrub typhus. His fever settled with oral doxycycline and azithromycin within 48 h and demonstrated some improvement in his Parkinsonism features prior to discharge from hospital in 4 days. He vistied for review 2 weeks after discharge and by this time he showed complete improvement and was happy with a smiling face .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1470_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1470_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..99192e9b8b4fa8658365615168df3e9213d7b7f8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1470_en.txt
@@ -0,0 +1,9 @@
+A 28-year-old Nigerian woman of Igbo ethnicity presented with a 6-week history of neck pain associated with paroxysmal tonic spasms of the left upper and lower limbs. She had no sphincter dysfunction or constipation. There was a positive Lhermitte's sign with neck flexion and severe burning sensation of the right lower limb. There was no prior neck trauma, cough, night sweats or weight loss and she did not complain of visual blurring. She was not hypertensive or diabetic but her father was hypertensive and her mother had diabetes. She was para 1 + 2 (1 alive) and had recurrent pregnancy losses twice in the mid-trimester period. She delivered a live male neonate 4 months before presentation and had a tetanus toxoid injection 3 days before presentation in addition to the three doses she had during antenatal care. She had a previous history of anterior neck swelling a month after delivery.
+General physical examination showed a young woman with frequent paroxysmal tonic flexor spasms lasting 2 minutes each and involving the left upper and lower limbs. Higher mental function was normal. The Lhermitte's sign was elicited by forward neck flexion. The pupils were 3 mm in size and she had a relative afferent pupillary defect in the right eye. Initial fundoscopy was normal. She had a spastic quadriparesis with a power of grade 4 [Medical Research Council (MRC) grading] and bilateral extensor plantar response and absent abdominal reflexes. Light touch, vibration and joint position sensations were impaired up to the C7/C8 dermatome. Romberg's sign was present. Her cerebellar system was normal and there was no spinal tenderness. Her pulse rate was 80 beats/minute and regular. Her blood pressure was 120/80 mmHg with normal heart sounds. Chest and abdominal examinations were normal.
+The cranial MRI showed normal T1 and T2 weighted images. The initial cervical T2 weighted MRI showed patchy ill-defined central linear hyperintense focus in the intramedullary portion of the spinal cord between C1 and C5 in keeping with transverse myelitis . Her erythrocyte sedimentation rate (ESR) on admission was 67 mm/hour and she had positive lupus erythematosus (LE) cells. Antinuclear and anti double-stranded antibodies were negative. Cardiolipin IgM was 15.0 MPL/ml (reference range 0.00–3.5 MPL/ml) while Cardiolipin IgG was within normal limits at 2.8 mGPL/ml (reference range 0.00–15.0 GPL/ml). Her prothrombin time (PT) was prolonged -PT 18.4s, control 12.9s, prothrombin time ratio (PTR) 1.4, international normalized ratio (INR) 1.6.
+Her thyroid, liver function test, blood glucose and electrolytes were normal. The results were: serum calcium 2.4 mmol/liter, potassium 3.9 mmol/liter, sodium 135 mmol/liter, bicarbonate 26 mml/liter, chloride 98 mmol/liter and urea 4.5 mmol/liter. She was retroviral negative.
+Her cerebrospinal fluid (CSF) test was normal: CSF protein 21 mg/dl, CSF glucose 2.8 mmol/liter, microscopy <5 WBC/mm3; CSF Immunoglobulin and serum NMO IgG assays could not be done.
+An initial assessment of transverse myelitis was made and she was placed on intravenous methylprednisolone 1 g daily for 5 days, thereafter oral prednisolone 70 mg daily which was gradually tailed off. Although her serum potassium level fell to 2.9 mmol/liter, she did not receive additional potassium supplement with the therapy. She was however advised to take foods high in potassium. Her drug therapy included diazepam 15 mg 6 hourly and Baclofen 10 mg at night given for relief of the spasms. Gabapentin 400 mg at night and carbamazepine 400 mg thrice daily were also administered for the neuropathic pain. She also had regular physiotherapy.
+The patient gradually improved with gradual resolution of the muscle spasms, weakness and rigidity. Muscle power increased to 5 globally and the repeat ESR reduced to 17 mm/hour.
+Ophthalmic examination done 4 weeks after admission revealed impaired visual acuity which was worse in the right eye (right eye – counting figure, left eye – 6/9). The corneal sensitivity was intact with a relative afferent pupillary defect. There was bilateral temporal pallor with slight blurring of the optic disc margins nasally. There were also nerve fiber defects along the superotemporal vascular arcade with moderate perivascular sheathing.
+A repeat MRI was done a month after the initial one and showed resolution of the earlier noticed signal intensity at the spinomedullary junction . A final diagnosis of Devic's NMO syndrome was made and she was discharged after 5 weeks to be followed up in the outpatient clinic. She has been seen many times at the clinic and there has been sustained clinical and neurological improvement. However, she did not receive additional immunosuppressive therapy after completing the intravenous methylprednisolone, neither was there a repeat confirmatory test done for her antiphospholipid status. She was followed up in the clinic for 8 months after her discharge.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1478_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1478_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3fcd53a313daa0f8562e9f265c4e5837ec073053
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1478_en.txt
@@ -0,0 +1,8 @@
+In April 2017, a 72-year-old homeless male patient was admitted to the emergency department at the Ramos Mejia Hospital, Ciudad Autónoma de Buenos Aires, Argentina. The patient was in very poor hygienic condition, malnourished and dehydrated. He presented a deep necrotic ulcer in the anterior aspect of his left tibia of 9-months’ evolution, with exposure of both tibia and fibula, complete loss of muscle mass, severe ischaemia, foul discharge and heavy burden myiasis. Unfortunately, maggots had been rapidly discarded, allowing neither bacterial analysis nor entomological identification.
+The patient had a history of alcohol abuse and pulmonar tuberculosis in 1980 which resolved after complete treatment.
+On physical examination, his blood pressure was 100/60 mmHg, his heart rate 97 and his respiratory rate 20 breaths min−1. His body temperature was 36 °C. Haematological and biochemical exams on admission showed: leucocytes 24750 K µl−1, with 92.5 % neutrophils; glucose level of 237 mg dl−1, haematocrit 40 %, haemoglobin 13.3 g dl−1, uraemia 126 mg dl−1, creatinine 2017 mg dl−1; sodium 127 mmol l−1; potassium 5.5 mmol l−1; chloride 87 mmol l−1.
+Two blood culture sets were taken at the time of admission, at two different times. Gram-negative rods were obtained in pure culture. With this preliminary report, the case was described as sepsis caused by skin and soft tissue infection. Intravenous therapy with ciprofloxacin 400 mg/12 h and clindamicin 600 mg/12 h was initiated.
+Conventional phenotypic test and MALDI-TOF-MS (Bruker Daltonics) failed to identify the bacteria isolated.
+In order to confirm genus and species identification, PCR amplification of the 16S rRNA was performed. The nearly complete sequence of the 16S rRNA gene was amplified by PCR with the conserved primers 8F (5′-AGAGTTTGATYMTGGCTCAG-3′) and 1942R (5′-ACCTTGTTACGACTT-3′), as described previously . The sequence obtained showed a 100 % identity with the sequence corresponding to the 16S RNA ribosomal gene of I. indica, type strain FFA1 (GenBank accession number. EU008088.2). The 16S rRNA sequence obtained was deposited in GenBank under number MF062521.
+Due to the severity of the lesions, a supracondylar amputation had to be performed in order to allow for adequate and prompt infection source control, and antibiotic treatment for 14 days was completed, which led to resolution of sepsis and normalization of laboratory parameters. The patient had a favourable outcome, with no surgical complications.
+Members of the genus Ignatzschineria are difficult to identify using traditional methods, including classical biochemical tests and commercial bacterial identification systems. Even MALDI-TOF MS analysis has been unsuccessful. 16S ARNr gene sequencing has proved to be useful for identification, and is currently the most accurate method for clinical diagnostic laboratories.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1488_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1488_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..01568174546f6763826708bb4f158d30e6141b52
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1488_en.txt
@@ -0,0 +1,7 @@
+A 34-year-old female patient was admitted to the hospital due to vaginal bleeding, fatigue and shortness of breath for 4 d without chest pain, hemoptysis, dyspnea or other symptoms.
+Computed tomography (CT) examination revealed a filling defect in the IVC before admission, which was initially thought to be a thrombus. Anticoagulant therapy was administered immediately. No other conditions were recorded when admitted to our hospital.
+Seven years ago, the patient had undergone a hystero-myomectomy (no medical records/pathological specimens were available). No other significant history of past illnesses was identified.
+The patient had no previous or family history of similar illnesses.
+Physical examination showed a surgical scar in the lower abdomen. A palpable hard mass was found in the lower abdomen, with poor mobility and mild tenderness. Vital signs were stable with a blood pressure of 135/80 mmHg, a heart rate 90 bpm, respiratory rate of 21 breaths/min and O2 saturation of 98%. The electrocardiogram showed sinus rhythm and incomplete right bundle branch block.
+The laboratory examinations showed elevated levels of cancer antigen 125 (47.73 U/mL), FDP (20.31 μg/mL) and D-Di (6.06 μg/mL), while the results of other laboratory examinations were in the normal range.
+Transvaginal ultrasonography showed that the uterus was 10.0 cm × 8.5 cm × 8.9 cm in size with multiple heterogeneously echogenic lesions. Transthoracic echocardiography revealed a strip-shaped mass extending to the right atrium and right ventricle, and protruding into the pulmonary artery . The diameter of the pulmonary artery was widened, and the pulmonary artery pressure was 66 mmHg. An enlarged uterus and multiple mixed-density masses in the myometrium were found on enhanced CT images . Filling defects were observed in the right iliac vein, ovarian vein, IVC, right atrium, right ventricle, pulmonary trunk and bilateral pulmonary artery branches . Magnetic resonance imaging (MRI) showed extensive myometrial thickening which was heterogeneously hyperintense on T2-weighted images . Diffuse infiltration of the cervix and vaginal vault was noted without rectal or pelvic wall involvement. Increased signal intensity of the lesions was observed on diffusion weighted imaging (DWI) . Following an intravenous injection of contrast medium, contrast enhancement of the lesions was heterogeneous and less intense than in the myometrium. The vessels around the uterus and cervix increased, and filling defects in the right iliac vein and left ovarian vein were noted . 18F-FDG positron emission tomography/computed tomography (PET/CT) demonstrated slightly high 18F-fluorodeoxyglucose uptake of the tumor in the IVC , and the maximum standard uptake value was approximately 2.8.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_14_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_14_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..26a111f49d7730ab148f40ec66f9e728e3f52fa1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_14_en.txt
@@ -0,0 +1,7 @@
+The proband, female of 1 year and 3 months old, was referred to the Research Centre for Medical Genetics because of severe failure to thrive. She was born from a first pregnancy. Parents were nonconsanguineous and had normal growth. The threat of miscarriage took place at 27 weeks. Delivery was emergent at 38 weeks and 5 days by cesarean section. The condition at birth was severe. Respiratory failure was increasing. The child was on a ventilator for five days. In total, respiratory support was required for five months. The patient was diagnosed with pulmonary hypertension.
+Body weight at birth was 1490 g (Z-score −4.50), 40 cm in length (Z-score −4.54). Head circumference was 32.5 cm (Z-score −2.59). Chest circumference was 24 cm. She had hydrocephalic head, short palpebral fissures, ocular and nipple hypertelorism, depressed nasal bridge, epicanthus, microstomy, high-arched palate, hypoplastic low-set ears, short neck, low hair line, and arachnodactyly. The baby had a pronounced progeroid appearance. The subcutaneous fat layer was not pronounced. An external examination of the genitals revealed hypoplasia of the labia majora, and the clitoris was hypertrophied. The liver protruded 3 cm below the edge of the right costal arch and 1 cm below the edge of the left costal arch. Motor activity was reduced.
+Upon screening at 9 months, the patient’s condition was severe, but her consciousness was clear, and her posture as active. The baby was responsive to communication. She had a body weight of 3.3 kg (Z-score −6.54), a height of 54 cm (Z-score −6.61), and a body mass index of 11.32 (Z-score −4.67). Her head circumference was 43.5 cm (Z-score −0.76), and her chest circumference was 30 cm. The patient’s physical development was extremely low, disharmonic. Pseudohydrocephalus, high forehead, triangular face, exophthalmos, narrow nasal dorsum, smooth philtrum, microgenia, microtia, and arachnodactyly were observed in the child during the examination. The skin was clean and dry. The girl had cyanosis of the face and upper half of the trunk when crying. The subcutaneous fat was underdeveloped. The patient’s chest was barrel-shaped. Hepatomegaly was observed. The child could not support her head but tried to turn her body from prone to supine. She had a pronounced interest in toys. Her speech consisted of babbling, with chains of syllables. X-ray showed delay in bone age – less than three months vs the patient’s actual age of 9 months. The bone structure was sparse. Valgus deformity of the knee joints was observed. Data on the condition of the patella were not provided because these bones are transparent on X-ray scans in young children, and ultrasonography was not performed. EEG recordings contained no epileptiform or focal pathological activity. Echocardiography showed no signs of heart defects. Patent foramen ovale and diagonal trabecula in the left ventricular cavity were observed.
+Another examination was performed at 1 year and 3 months was performed. The girl had a height of 58 cm (Z-score −7.06), a weight of 4 kg (Z-score −6.44) and a head circumference of 45 cm (Z-score −0.5). Hydrocephalic head, high forehead, triangular face, exophthalmos, narrow nasal dorsum, microgenia, microtia, severe hypotrophy, and areas of alopecia on the head were observed. Subcutaneous fat was not developed. The baby did not sit independently and could not steadily support herself on her feet, but she was able to stand with support. She played with toys, held objects in her hands, collected pyramids, and transferred small objects.
+The last time the patient was examined when she was 1 year 11 months old. Short stature (63 cm, Z-score −7.04) and growth retardation (5 kg, Z-score −6.16) were noted. Clinical examination revealed dysmorphic facial features, microtia. Absent patella was noted by palpation. .
+Initially, chromosomal abnormality was suspected in the child. Cytogenetic testing was performed. Karyotype 46, XX was detected. Hutchinson-Gilford progeria was assumed. A corresponding study of the LMNA gene was performed. No pathogenic changes were observed. Clinical exome sequencing was ordered, identifying two variants in the CDC6 gene. Parental examination revealed that they were heterozygous carriers of relevant changes in the nucleotide sequence.
+Neither variant had been registered in either the GnomAD database (v.2.1.1), the clinical databases (Clinvar, HGMD Professional (v.2021.1)), or the database of variants obtained by exome sequencing (WES, CES) in the Research Center for Medical Genetics – RuExac (1337 samples). The exon 3 nucleotide sequence variant of the CDC6 gene (chr17:38447363C>T) results in a premature translation termination site (p.(Gln78Ter), NM_001254.3). According to the pathogenicity criteria, ACMG is classified as pathogenic (PVS1, PS3, PM2). The criterium PS3 was used due to the previously functional study that demonstrated pathogenicity of LoF variants in the CDC6 gene. A variant in exon 3 of the CDC6 gene (chr17:38447361A>G), resulting in a missense replacement of (p.(Lys77Arg), NM_001254.3), is classified as a variant with uncertain clinical significance (ACMG: PM2, PM3).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1500_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1500_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3751e7a8ffae861fb51b20ef0ec23cb746697256
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1500_en.txt
@@ -0,0 +1,4 @@
+A 64-year-old man presented with a dark red palpable mass in the bulbar conjunctiva (diameter: 0.5 cm) at the medial canthus of the right eye. The mass was reported to be present for at least three months . The past medical history was uneventful and in particular no B-symptoms were reported. CT scans of the right orbit showed a limited bulbar conjunctival mass not involving the lacrimal gland or orbital septum of the eyelids.
+Histologic examination of an incisional biopsy showed infiltration by a monomorphic cell population composed of small-to-medium-sized lymphocytes with irregular, indented, or cleaved nuclei, 3/10 HPF mitotic rate and partially nodular growth pattern, beneath the simple cuboidal cell layer of surface conjunctival epithelium .
+Immunohistochemical staining was performed on formalin-fixed, paraffin-embedded tissue sections, according to the manufacturers’ protocols. The primary antibodies used, the methods of antigen retrieval, and the dilution rates were as follows: CD20 (L26) (Novocastra, Newcastle, UK; microwave in 0.01 molar citrate buffer; 1:50), CD3 (PS1) (Novocastra, Newcastle, UK;microwave in 0.01 molar citrate buffer; 1:200), CD5 (4C7) (Novocastra, Newcastle, UK; microwave in RE7113 solution; 1:100), CD10 (56C6) (Novocastra, Newcastle, UK; microwave in citrate buffer; 1:100), CD23 (1B12) (Novocastra, Newcastle, UK; microwave in 0.01molar citrate buffer; 1:100), BCL-2 (3.1) (Novocastra, Newcastle, UK; microwave in citrate buffer; 1:100), cyclin D1 (P2D11F11) (Novocastra, Newcastle, UK; Trypsin digestion; 1:50), Ki-67 (MM1) (Novocastra, Newcastle, UK; microwave in citrate buffer; 1:100) and SOX11 (Atlas Antibodies, Stockholm, Sweden; heat-induced retrieval with ER2 BondMax buffer; 1:100) as previously described . The tumor cells were positive for CD20 , CD5, BCL-2, cyclin D1 , and SOX-11 and negative for CD3, CD10, and CD23. The Ki-67 proliferation index was 12%. By fluorescence in situ hybridization (FISH) analysis on formalin-fixed, paraffin-embedded tissue sections using commercially available LSI IGH/CCND1 XT dual color, dual fusion and LSI CCND1 BAP break apart probes (Abbott-Vysis), juxtaposition of IGH and CCND1 and a breakpoint in the CCND1 locus were detected in 85% and 97% of nuclei, respectively, indicating presence of the MCL hallmark translocation t(11;14)(q13;q32) . The histopathologic and genetic findings confirmed the diagnosis of conjunctival mantle cell lymphoma.
+The patient did not show up in his follow up Ophtholmology visit, however after two months was referred to an oncologist. Extensive clinical staging was performed and cervical lymph node and bone marrow involvements were discovered. Gastroscopy and laboratory workups such as liver function test, ESR, BUN, creatinine, β2 microglobulin, LDH, leukocyte count and serum protein electrophoresis were in normal ranges. The patient was allocated to the low-risk group with the MCL International Prognostic Index. Combined chemotherapy with Fludarabine, Cyclophosphamide and Rituximab (FCR) was administered. After five cycles (approximately 5 months) patient showed clinical response as a decrease in neck lymph-node sizes and shrinkage of the conjunctival lesion , however complete remission workup is pending after the sixth cycle.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1550_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1550_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..802e759df9950505cc2ac2ea2e491525180e6ec0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1550_en.txt
@@ -0,0 +1 @@
+A 42-year-old man was referred to our hospital due to an abnormal shadow on a chest X-ray, which was found during a physical examination. CT scan revealed numerous vascular structures in the left chest wall , anomalous arteries in the left lower lobe superior segment of lung (Lt. S6) , and a filling defect in the left apical segmental pulmonary artery of the left lower lobe (Lt. A6), which indicated a blood flow regurgitation from the dilated left 4th intercostal artery to the Lt. A6 . No other abnormalities were found by CT scan, laboratory tests and pulmonary function test, and a diagnosis of SPAS was established. The patients was asymptomatic, but based on the potential risk of future hemoptysis, we decided to treat him with TAE followed by S6 segmentectomy after a careful informed consent. On preoperative TAE, the 4th and 5th intercostal arteries and the left thyrocervical artery were identified as systemic arteries and all were embolized with microcoils . After the TAE, S6 segmentectomy was performed on the same day. First, interlobar fissure was dissected and A6 was ligated and transected to reduce blood flow of the pulmonary artery, followed by the dissection of the adhesions between S6 and parietal pleura, containing abundant blood vessels . Finally, Lt. S6 segmentectomy was performed using indocyanine green (ICG) . Intraoperative blood loss was 30 g. The patient had an uneventful postoperative course, and he was discharged on the 6th day after surgery. Histological examination of the resected left S6 showed a pleural thickening and large muscular arteries and adjacent dilated pulmonary arteries in the subpleural area, suggesting communications between them .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1553_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1553_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f64a07d72fca39db9b19e920e90aa90021ec272c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1553_en.txt
@@ -0,0 +1,4 @@
+A 27-year-old woman visited our gynecology department because of abdominal pain and genital bleeding. Magnetic resonance imaging (MRI) revealed a cystic mass in the left retrorectal area, and she was referred to our department for detailed examinations and treatment. Her medical history was unremarkable. Her laboratory results, including serum tumor biomarkers, such as α-fetoprotein (AFP), carcinogenic embryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9), were within normal limits. Computed tomography (CT) showed a 3-cm-sized multilocular cystic mass in the anterior sacrum on the left dorsal side of the rectum. The mass showed a gradual contrast effect on the margin and was suspected to have a solid component. No obvious calcification was observed . MRI showed no obvious fat in the area . Fluorodeoxyglucose-position emission tomography (FDG-PET) showed no abnormal uptake. Lower gastrointestinal endoscopy showed no abnormalities in the rectal mucosa. Endoscopic ultrasound (EUS) showed a 3-cm-sized extraintestinal cyst near the rectum. No obvious calcification was found inside .
+With the above tests, it was difficult to confirm the preoperative diagnosis of the presacral cystic mass. Teratoma, tailgut cyst, dermoid cyst, epidermoid cyst, etc., were considered in the differential diagnosis. Because there have been reports of malignant cases, we decided to perform surgical mass removal as a diagnostic treatment.
+The operation was conducted with the patient in the jack-knife position. A skin incision measuring approximately 3 cm was made from the coccyx to the anus. We made an incision in the mural fascia to reach the tumor and enable detachment without damaging the tumor. Since it was difficult to confirm the deep part of the tumor through direct visualization, we attached a GelPOINT® Path (Applied Medical, USA) placed two 10-mm trocars and a AirSEAL® (CONMED, USA) trocar in a triangular fashion to the incision and insufflated it at 12 mmHg with the AirSEAL® System to remove the tumor endoscopically while confirming the boundary between the tumor and the anterior coccyx/posterior rectal wall. The operative time was 171 min, with minimal blood loss .
+Histopathological examination revealed a benign mature teratoma . She did not have any complications and was discharged from our hospital 5 days after the surgery. Seven months later, she had no tumor recurrence or residual symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1576_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1576_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b3f604091e30801873b258329ae8c726e3743f9a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1576_en.txt
@@ -0,0 +1,7 @@
+A 25-years-old male of Afghani origin with a history of recurrent acute pancreatitis was referred to the intensive care unit of the Jena University Hospital in November 2019.
+Abdominal pain debuted two years ago when the patient was 23 years old. The family history revealed that the patient’s brother and sister similarly suffer from abdominal pain and have been hospitalized several times. His niece died at the age of three due to acute pancreatitis. The patient’s whole family resides in Afghanistan, so neither clinical nor genetic investigation of relatives was possible in our clinic.
+On physical examination, the patient’s BMI was 23.4 kg/m2, blood pressure, and heart rate were 146/83 mm Hg and 95/min, respectively. He showed no xanthomas but did have lipemia retinalis on retinal examination. Examination of the abdomen revealed pain in the upper left area and an enlarged spleen. No other abnormalities were observed.
+TG levels were at 29 mmol/L, and low-density lipoprotein (LDL) and high-density lipoprotein cholesterol (HDL) cholesterol were within reference ranges. According to the previous records, TGs were as high as 82 mmol/L in the past. Inflammation markers (C-reactive protein and white blood cells) were remarkably elevated. There were no clinical symptoms or laboratory indicators of secondary (pancreoprivic) diabetes mellitus (HbA1c 5.1%, blood glucose 5.8 mmol/L). Other laboratory parameters are shown in Table .
+Abdominal computer tomography demonstrated edematous pancreatitis, most prominently within the corpus pancreaticus with surrounding fat tissue fibrosis and splenomegaly. There were no signs of choledocholithiasis.
+A panel screening for HTG-related genes (Additional file ) was performed. The sequencing was performed using the next-generation sequencing on Illumina-Sequencer (NextSeq500/NovaSeq6000) with a > 98% coverage of regions of interest. The analysis revealed homozygosity for a frameshift mutation of APOA5 (c427delC, p.Arg143Alafs*57) with a minor allele frequency of 0.006%. This mutation causes an alteration in the translational reading frame and results in a premature stop of protein synthesis due to the introduction of a stop codon at position 57. The patient was also a homozygous carrier of haplotype APOA5*2.
+Acute pancreatitis was treated with aggressive fluid resuscitation and therapeutic plasma exchange (Spectra Optia, Terumo BCT, Inc. Lakewood USA). The patient was then put on a low-fat diet and a combination of ezetimibe (10 mg daily) and fenofibrate (160 mg micronized daily). Shortly after the discharge, another episode of acute pancreatitis occurred. The patient was prescribed omega-3 fatty acids; however, the inability to obtain reimbursement for omega-3 fatty acids in Germany hindered their usage. The patient was regularly followed up at our outpatient clinic. A satisfactory range of TG, between 9.2 and 11.2 mmol/L , was maintained through a combination of stringent dietary measures and consistent intake of fibrates. After two years, another episode of pancreatitis occurred, with TG elevation up to 18.8 mmol/L. The patient was started on weekly injections of volanesorsen. On this regimen, TG levels were stably under 4 mmol/L . The platelet count decreased from 201,000 to 114,000/µL. Therefore, according to recommendations, we switched to biweekly administrations. As a result, the platelet count stabilized (at ~ 150,000/µL). The patient had no episodes of bleeding. Volanesorsen therapy was continued with regular assessment of platelet count.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1582_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1582_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b53bc92b6b7b9693e7fb597c2cfc4afb78258bfa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1582_en.txt
@@ -0,0 +1,4 @@
+A 67 year-old female patient presented with left chest wall sinus one year ago. Local redness, pain and persistent purulent discharge occurred around the sinus orifice. Reviewing the medical history, the patient had undergone left mastectomy 20 years ago due to the diagnosis of left breast cancer, followed by regular radiotherapy and chemotherapy for several times. At the same time, she suffered from coronary heart disease, hypertension and other cardiovascular diseases. She underwent coronary stent implantation in 2017, 2019 and 2020 respectively. Currently, she regularly takes anticoagulant drugs (Aspirin Enteric-coated Tablets 100 mg QD) and antihypertensive drugs (Nifedipine Sustained Release Tablets 30 mg QD). Due to repeated non-healing of chest wall wound and formation of chest wall defect, ulcer and fistula caused by debridement, the patient was admitted to our hospital for further treatment. Chest CT scan showed partial defect of left chest wall with sinus formation, high-density shadow of left clavicle and some ribs. According to the patient's symptoms and imaging examination, we diagnosed chest wall sinus with infection and chronic osteomyelitis.
+After admission, the patient continued to be given local cleaning and dressing changes on the wound surface. The purulent secretions at the sinus orifice were subjected to microbial culture and drug susceptibility tests. The results of the three secretion cultures were all suggestive of Pseudomonas aeruginosa. Her BMI was 18.4 kg/m2 and albumin was 24.5 g/L. We chose sensitive antibiotics for systemic anti-infective treatment. At the same time, nutritional support and correction of hypoalbuminemia were given. Enhanced chest CT and three-dimensional reconstruction were performed. Before chest CT examination, 50% meglumine solution was injected into sinus orifice through a thin drainage tube to fully understand the shape, scope and adjacent conditions of sinus. Due to the long course of disease and lack of confidence in treatment, the patients were given necessary psychological counseling and appropriate anti anxiety drug treatment.
+The operation was divided into two stages, both under general anesthesia. Before first-stage operation, we injected methylene blue solution from sinus orifice to make sinus wall fully stained to guide the scope of surgical curettage, which could not only ensure the complete removal of the diseased sinus wall tissue, but also avoided too much damage to the normal tissue and even the important organs behind the sternum. Taking the sinus orifice of chest wall as a center, a fusiform incision with a length of about 8 cm was made along the 1 cm around sinus orifice. The direction and length of the incision were determined according to the sinus shape (the sinus starts at the level of the left first rib and ends at the level of the left fourth rib, without communication with the thoracic cavity) shown on preoperative chest CT and the position of the myocutaneous flap to be filled. After incision of the skin, the sternum and infected area were fully exposed, sinus wall tissue was fully scraped with a curette, and then necrotic bone was completely removed with a rongeur (It starts from the junction of the left first rib and the manubrium cartilage. Part of the first rib, part of the lower edge of the left clavicle, and the adjacent medial end of the sternum are removed in sequence from near to far, from top to bottom, until the bone stump is fresh). When the chest wall wound tissue was fresh and there was no dye attached, we first rinse it with 1000 ml normal saline, then rinse it with diluted iodophor water (100 ml iodophor water and 400 ml normal saline) and 100 ml 3% hydrogen peroxide for one time, and then rinse it with 1000 ml normal saline again. Due to the huge wound defect after debridement, in order to ensure the cleanliness of the wound, improve local blood supply and prepare for the second-stage operation, vacuum sealing drainage (VSD) were performed after the operation . We adjusted the pressure scale of the VSD device to 0.04 Mpa, and the device was removed after 7 days.
+When the patient's general condition was good after first-stage operation, after the vacuum sealing drainage device was removed, the daily incision dressing change, anti-infection, nutritional support and other treatments were continued. When the granulation of sinus wound was fresh, the secretion was significantly reduced, the re-culturing of the wound secretion was negative, and the infection was preliminarily controlled, we were ready for the second-stage operation. Continue to appropriately expanded the wound along the original incision, thoroughly debrideed the necrotic tissue until the wound was fresh, and measured the size of the chest wall defect was about 15 × 8 cm. After hemostasis, rinsed the wound with a large amount of iodophor, hydrogen peroxide, and normal saline alternately. The patient's body position was changed to 90° lateral lying position. According to the preoperative planned flap incision, the pedicled latissimus dorsi myocutaneous flap was selected as the living tissue to fill the defect wound. The computed tomography angiography (CTA) examination of the subclavian artery showed that there were internal thoracic artery and thoracodorsal artery on the affected side without malformation. During the operation, first of all, an incision was made along the outer edge of latissimus dorsi muscle, starting from the proximal axillary apex, and the proximal and distal ends of latissimus dorsi muscle were dissociated and fully exposed in turn to protect the thoracodorsal artery and vein. Finally, a latissimus dorsi myocutaneous flap with thoracodorsal neurovascular bundle of sufficient length was formed. The size of the latissimus dorsi myocutaneous flap was about 30 × 8 cm, while the skin island of about 16cmx8cm was reserved. During harvesting of the myocutaneous flap, the blood supply should be preserved as much as possible, while avoiding excessive distortion of the pedicle of the myocutaneous flap. We first made a subcutaneous tunnel between the acquisition site of the myocutaneous flap and the sternal wound, transferred the myocutaneous flap to the chest wall defect wound, then sutured and fixed it with the soft tissue around the wound, closely combined the myocutaneous flap with the bottom of the chest wall wound to eliminate the dead space, and finally placed a drainage tube . The patient was treated with anti infection (Cefoperazone Sodium and Sulbactam Sodium + Levofloxacin and Sodium Chloride Injection), anti spasm (Raceanisodamine Hydrochloride Injection) and anticoagulation (Enoxaparin Sodium Injection) after operation. The color and temperature of the myocutaneous flap was closely observed and tested. The transplanted myocutaneous flap was kept warm, and the incision was avoided from compression to protect the smooth blood flow. The patient pulled out the chest tubes on the 4th postoperative day and was discharged from the hospital on the 7th day. At present, the patient was followed up for 6 months after the operation, the incision healed well and no malignant tumor tissue was found in the routine pathology after the two operations. Repeat chest CT showed that the chest wall sinus disappeared completely, and the pedicled myocutaneous flap fully survived.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1587_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1587_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9626b45116f0a51a77c1ad2917f11893bb43f3df
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1587_en.txt
@@ -0,0 +1,2 @@
+A 34-year-old male patient presented to our hospital with multiple yellowish elevated masses in different locations of the body, including the dorsum of the hands, elbows, buttocks and feet. In addition, the patient also had bilateral arcus cornealis and Achille tendon masses . The total number of masses was 15, and the size of masses varied from 1 × 1 × 1 cm to 8 × 8 × 5 cm. The masses were initially asymptomatic; they appeared 10 years ago, and then they increased progressively in size. The patient complained of discomfort and difficulty dressing and sitting due to large masses in the buttocks. In addition, patients also reported difficulty wearing sandals due to the masses in the feet. The patient's hygiene was affected, and especially the masses made the patient feel inferior when in contact with others. Even the patient decided to divorce because of psychological influences related to abnormalities in the body. The results of the chest X-ray, abdominal ultrasound, electrocardiogram and echocardiogram of the patient were normal. The patient's family medical history was not taken because the patient did not wish to disclose it. The low-density lipoprotein cholesterol (LDL-C) level of the patient was 10.04 mmol/L (reference value, <2.6 mmol/L). Based on a high level of LDL-C, arcus cornealis and presence of xanthomas, the patient was diagnosed with Familial hypercholesterolemia (FH) based on the Simon Broome Criteria.
+After receiving the consultation, the patient agreed to be admitted to the hospital for surgery to remove the masses. Lipid-lowering therapy was immediately administered for the patient with Atorvastatin 40 mg/day. After 4 days of hospitalization, the patient then underwent surgery to remove the masses. The resected masses had a surface of normal skin. The core of the masses looked yellowish-colored uniform, relatively solid, without necrosis, and localized in the subcutaneous layer without invading the muscle or joint capsule . The skin incision was oval around the circumference of masses with the longitudinal axis parallel to the Langer's line. The excision margins were normal skin. After removing masses, all defects were sutured directly . A total of 13 masses were removed; the remaining 2 masses on the finger were not removed because the patient still had to use the fingers to take care of himself. The remaining 2 masses would be removed during the next surgery. Histopathology showed a typical xanthoma with infiltration of foam cells . The healing process was normal. All sutures were removed 14 days after surgery. The patient was discharged and continued treatment with atorvastatin 40 mg/day. Gene sequencing test (on the Nextseq, Illumina system) showed homozygous LDL-C receptor gene mutation on chromosome 19. Due to difficult economic conditions, the patient's family members did not undergo gene sequencing to find mutations causing FH. Follow-up at 1.5 months postoperatively, the LDL-C level of the patient was reduced to 8.8 mmol/L and the wounds healed well and no re-appearance of masses was observed .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1606_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1606_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4b8c4c861f5f54401468148032477d88d1d8d4ca
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1606_en.txt
@@ -0,0 +1 @@
+A 7.6-year-old boy was referred for investigation of short stature. He was born after 39 weeks of gestation, with a birth weight of 3.38 kg (0.0 SD) and birth length of 47 cm (− 1.8 SD). Since the age of 1 year, height SD had gradually decreased from − 1.7 to − 3.3 SD, whereas the mid-parental height was − 0.8 SD. He did not have polydipsia or polyuria. The boy had previously been diagnosed with an autistic spectrum disorder, but his clinical examination was otherwise unremarkable; he had normal genitalia and there were no signs of puberty (Tanner stages A1 P1 G1, testes 1/1 ml). There was no familial history of constitutional delay. Endocrine results were suggestive of partial GH deficiency (circulating insulin-like growth factor-I 48 μg/L (− 2.5 SD) ; peak GH of 8.9 μg/L after glucagon). TSH was borderline elevated but free T4 was normal (TSH 5.3 mIU/L, free T4 14.6 pmol/L), and basal concentrations of circulating cortisol (8.8 μg/dL), dehydroepiandrosterone-sulphate (DHEAS 0.6785 μmol/L), luteinizing hormone (LH < 0.1 IU/L), follicle stimulating hormone (FSH 0.8 IU/L) and prolactin (4.7 μg/L) were unremarkable. MRI of the brain revealed a lipoma on the midline adjacent to the hypothalamus . The appearance of the anterior and posterior pituitary gland was normal. GH replacement treatment significantly increased height velocity from 5.2 cm/year to 9.4 cm/year in the first year of catch-up growth .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1613_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1613_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..795d9b912add86d116acf9b2fd3dae12bd81e26c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1613_en.txt
@@ -0,0 +1,4 @@
+A 74-year-old Caucasian Greek man was referred to our surgical clinic for repair of a left inguinal hernia. The patient had noticed a gradually enlarging mass 10 years prior to presentation. His physical examination revealed an elastic, hard, slightly mobile mass that was initially confused with a scrotal hernia, although reduction maneuvers produced no result, even after the intramuscular administration of pethidine. No abnormal dermal findings were observed.
+Ultrasonography showed the presence of a large (9 cm × 4 cm), rigid, inhomogeneous structure starting from the left inguinal space under the skin but not penetrating the corresponding hemiscrotum. Doppler sonography demonstrated prominent, rich vasculature. On computed tomography (CT), the lesion was observed to be round, with a diameter of 13 cm, inhomogeneous to the surrounding fat tissue of the anterior abdominal wall at the level of the left spermatic cord, and pushing away the left testis . No intravenous contrast medium was used because of allergy of the patient.
+Intra-operatively, the mass was found to be oval-shaped with dimensions 8 cm × 7 cm × 3 cm, well encapsulated, resembling fat tissue with rich vasculature, and it seemed to arise from the scrotal part of the spermatic cord without adherence to the ipsilateral testis . The mass was excised, and, because of the parallel presence of an inguinal hernia, typical mesh repair was performed.
+Microscopically, the specimen consisted of loose fibrous tissue in which we found a large number of fibroblasts (vimentin- and CD34-positive and actin-, desmin-, and S100P-negative), inflammatory infiltration of lymphocytes, plasma cells, mast cells, and abundant capillaries, many of which with regenerating and degenerating forms . The walls of some tissues were thickened and those of others were hyalinized .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_161_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_161_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..54a94a77bba9afe718ea9601b9c3a074545f26d6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_161_en.txt
@@ -0,0 +1 @@
+A 19-year-old woman noticed blurred vision with photopsia of the left eye. The patient had no notable medical or family history. Her best-corrected visual acuity (BCVA) was 1.0 OD and 0.9 OS with myopia of −9.0 diopters OU. Visual examination of the right eye showed no abnormality. Slit-lamp biomicroscopy revealed mild cells in the anterior vitreous OS. Funduscopic examination revealed multiple punctate yellow-white exudates at the level of the retinal pigment epithelium (RPE) in the posterior pole but not the midperiphery OS (Figure A). These exudates appeared as initial hyperfluorescence with late staining on fluorescein angiography (FA, Figure B) and hypofluorescence during the initial phase of ICGA (Figure C). SD-OCT images showed a loss of photoreceptor inner/outer segment junction (IS/OS) integrity corresponding to the nasal fovea (Figure D), accompanied by a moderately reflective, nodule-like lesion extending from the outer nuclear layer to the choroid, which corresponded to the exudates described above (Figure E). Humphrey threshold 30–2 perimetry showed an area of decreased sensitivity corresponding to the lesion area. Multifocal electroretinography (mfERG) showed decreased amplitudes at the posterior pole wider than the lesion area OS and normal amplitudes OD. The patient received a diagnosis of PIC OS. A regimen of oral prednisolone (30 mg/day) was initiated then gradually tapered for 4 months. Three months after treatment, BCVA increased to 1.2 OS. The areas of exudate scarred as IS/OS line integrity recovered. Twelve months after treatment, some of the scar lesions developed hyperpigmentation (Figure F), whereas BCVA and OCT findings remained stable.Twenty months after the initial visit, the patient complained again of central blurred vision in the left eye. Her BCVA was 1.2 OS. A punctate subretinal yellowish-white lesion nasal to the fovea OS (Figure A, F) appeared to have increased in size (Figure A, arrow), although the number of PIC lesions remained unchanged. The area of hyperfluorescence on late-phase FA (Figure B, arrow) or hypofluorescence on initial-phase ICGA (Figure C, arrow) corresponding to the lesion had expanded since the patient’s initial visit (Figure B, C). The patient was diagnosed with recurrent PIC. Treatment with oral prednisolone (30 mg/day) was restarted and continued for 3 months with tapering. Three months after this second round of treatment, BCVA remained unchanged, and the recurrent lesion had scarred with an associated improvement of the patient’s subjective symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1627_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1627_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7c37263059dba6d5f130347226882c4ea8fe9442
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1627_en.txt
@@ -0,0 +1,2 @@
+A 68-year-old man with a history of hypertension, diabetes, and chronic kidney failure was undergoing treatment as an outpatient for angina pectoris and atrial fibrillation that was diagnosed 2 years prior to the carcinosarcoma. He reported a history of heavy smoking for approximately 40 years; moreover, his father had a history of lung cancer. The patient did not have any clinical symptoms of cancer, and no remarkable changes were noted on physical examination. However, a routine blood test done 3 months earlier indicated anemia (hemoglobin: 9.6 g/dL), and the patient’s stool sample tested positive for occult blood. We tested for tumor markers and found the squamous cell carcinoma (SCC) antigen was slightly elevated at 3.3 ng/mL, but the carcinoembryonic antigen (CEA) and CA 19–9 were within the reference range. An upper GI endoscopy showed a bleeding, irregular, protruding lesion located on the posterior wall of the lesser curvature within the body of the stomach ; the lesion was biopsied and identified as a poorly differentiated adenocarcinoma. Moreover, at the lower part of the esophagus, there was a slightly concave lesion that was entirely separate from the gastric tumor. Biopsy specimens from the esophageal lesion indicated SCC. The patient was scheduled for surgical tumor excision. First, en bloc resection via endoscopic submucosal dissection was performed for the esophageal cancer, and the pathological diagnosis was well-differentiated SCC with negative margins and slight infiltration of the mucosal lamina propria. At a later date, segmental gastrectomy was performed for the gastric tumor. The proximal gastric surgical margin was confirmed to be negative by rapid assessment. The resected gastric tumor was subjected to histopathological examination. Macroscopically, the gastrectomy specimen had a protruding lesion measuring 41 × 29 × 18 mm3 . The cross-section showed a grayish-white tumor with growth mainly on the mucous membranous surface as well as areas with a cystic appearance and a translucent cartilage-like matrix in parts . Histologically, the tumor was a carcinosarcoma with mixed adenocarcinomatous and sarcomatous components . Tumor invasion was limited to the submucosa. The adenocarcinomatous component exhibited tubular, papillary, and, in some parts, solid growth patterns. The adenocarcinoma cells were acidophilic and cylindrical; however, some regions comprised adenocarcinoma cells with clear cytoplasm. The adenocarcinomatous component resulted in diffuse lymphatic and venous invasion. The sarcomatous portion showed proliferation of atypical spindle cells and atypical round cells with a high nucleus-to-cytoplasm (N/C) ratio . In the sarcomatous portion, some parts showed chondrogenesis, and dyskaryosis was observed in chondrocyte-like cells . Immunohistochemically, the adenocarcinomatous component with clear cytoplasm comprised areas with alpha-fetoprotein (AFP)- and Sal-like protein 4 (SALL4)-positive AFP-producing gastric carcinoma . Moreover, there were synaptophysin- and chromogranin A-positive adenocarcinomatous regions that showed neuroendocrine differentiation . The sarcomatous portion was predominantly composed of undifferentiated areas as indicated by unstained regions, but included smooth muscle actin-positive leiomyosarcomatous areas composed of spindle cells with acidophilic cytoplasm as well as areas of desmin- and MyoD1-positive atypical round cells with rhabdomyosarcomatous differentiation . Furthermore, a proliferative focus with atypical “bare nucleus” cells that was partly composed of SALL4-positive germ cell-like cells did not indicate any specific differentiation in immunostaining . Histopathological analysis of the background stomach revealed chronic gastritis with intestinal metaplasia and negativity for Helicobacter pylori. There was no dysplasia around the gastric tumor.
+Approximately 1 month following the post-gastrectomy, a chest CT showed a ground glass opacity in the inferior lobe of the patient’s right lung; after 6 months, the lung lesion grew, and therefore the patient underwent a right lower lobectomy. Histopathology of the resected tumor indicated a lepidic growth pattern rather than a gastric tumor metastasis. Further examination revealed that the tumor was a primary lung adenosquamous carcinoma with a well-differentiated lung adenocarcinoma component, positive for thyroid transcription factor 1 (TTF-1) on immunohistochemical staining, that was admixed with an SCC component . Fourteen months after the segmental gastrectomy, a flat, protruding lesion appeared in the anastomotic region of the patient’s remaining stomach portion. This lesion was identified as a local recurrence, and a total gastrectomy was carried out . Examination of the resected specimen from the local recurrence showed the growth of only the adenocarcinomatous component, without a sarcomatous component . The recurrent tumor extended into the subserosa, and we observed 1 very small site of lymph node metastasis . The patient started adjuvant chemotherapy by TS-1, and at the time of writing this report, the patient had survived for 3 months after the total gastrectomy. Although he had been diagnosed with three independent cancers, he did not undergo further evaluations for inherited cancer syndrome.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_162_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_162_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..60e1a6bedc1fa74c36a9a049e869b0f892f48776
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_162_en.txt
@@ -0,0 +1,4 @@
+A 78-year-old woman with an unremarkable past medical history presented to the clinic with symptoms of progressively worsening myelopathy including gait dysfunction and impairment of upper extremity fine motor skills. Noncontrast MRI of the cervical spine demonstrated multilevel degenerative disease and a dorsal intradural extramedullary lesion extending from C3-C6.
+The patient underwent an elective posterior C3-7 decompression, C3-T1 instrumented fusion, and resection of intradural tumor. Final pathology was psammomatous meningioma. The patient tolerated the procedure well and postoperatively was transferred to the neurological ICU for close monitoring.
+The patient was initially discharged from the hospital to an inpatient rehabilitation facility on POD 6. At the time of discharge, she was awake, oriented, and followed commands in all extremities with some mild weakness in the right deltoid and biceps, graded 4/5; the remaining muscle groups were 5/5. On POD 10, the patient developed progressive lethargy and was readmitted to the hospital for further evaluation. Upon readmission, she opened her eyes to verbal command, had incomprehensible speech, and would move all extremities spontaneously with strength 3/5 but did not follow commands. She was afebrile with WBC = 6.9 and no metabolic abnormalities. Given her recent intradural surgery, a lumbar puncture was performed. CSF cytology demonstrated 397 WBC, 20 RBC, 291 protein, and 40 glucose. CSF PCR was positive for HSV 1. Interestingly, intracranial imaging did not demonstrate the typical findings associated with herpes encephalitis . She was initially placed on broad spectrum antibiotics in addition to antiviral therapy. She was also connected to continuous EEG monitoring, found to be in status epilepticus, and required escalating therapy to the point of intubation with midazolam infusion. Seizure control was ultimately achieved, and she was maintained on levetiracetam 1500 mg q12H for 30 days and lacosamide 200 mg q12H for 7 days. The remainder of her infectious work-up was unremarkable, allowing her to be narrowed to only a 21-day course of IV acyclovir 500 mg q12H. Due to acute respiratory failure from encephalopathy, she underwent tracheostomy and PEG placement (POD 29); she underwent repeat MRI approximately 2 weeks after HSV diagnosis which still lacked typical findings of HSV . However, she continued to improve clinically; at the time of discharge, she would open her eyes spontaneously and followed simple commands in all extremities. Approximately 3 months out from being diagnosed with HSV encephalitis, she was oriented twice and followed commands in all 4 extremities with 5/5 strength in the bilateral upper and 3/5 in the bilateral lower extremities.
+At a three-month follow-up, the patient presented no new symptoms. The PEG was still in place and EEG revealed excessive theta waves during wakefulness and bilateral midtemporal delta slowing (left more prevalent than right). Though the patient had dysarthria and poor attention/processing, she followed commands in all 4 extremities consistent with her last evaluation. Vimpat 200 BID and 1500 mg of Keppra were prescribed for ongoing clonus spasticity. All other medications were continued as prescribed. In the following month, the patient had a normal LOC, very slight dysarthria, and improved situational awareness. No recent seizures had occurred. Lacosamide was reduced to 150 mg every 12 hours and Vimpat was reduced to 150 BID. Upon final examination, she followed commands in all 4 extremities with 5/5 strength in the bilateral upper and 4-/5 in the bilateral lower extremities.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1631_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1631_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..44e8faf8a0d950ff865d1f1ec9f65b5fa09f44a5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1631_en.txt
@@ -0,0 +1,5 @@
+A 43-year-old male presented to the outpatient Department of Urology of West China Hospital in March 2012 with severe paralytic attacks characterised by palpitations and muscle weakness starting in the right thigh and spreading to all limbs. A significant reduction in the serum potassium concentration (1.89 mmol/L, reference value 3.5–5.0 mmol/L) was found during laboratory examination, and an ECG indicated severe potassium deficiency. Symptoms remitted after taking oral potassium (50 ml of 10% potassium chloride was administered immediately followed by an additional 50 ml over 24 h for a total dose of 10 g). After the paralytic attack, a CT scan of the abdomen was performed, which revealed left UAH characterised by a nodular mass on the left adrenal gland. Laboratory examination showed a slight elevation in norepinephrine (602 ng/L, reference value, 272–559 ng/L) and a reduction in adrenaline (< 25 ng/L, reference value 54–122 ng/L) in the serum. Other data, including the serum concentrations of potassium (3.71 mmol/L), aldosterone (11.41 ng/dL, reference value 9.8–27.5 ng/dl), cortisol (7.3 μg/dL, reference value 7.2–18.2 μg/dL), renin (2.22 ng/mL, reference value 0.56–2.79 ng/ml), calcium (2.27 mmol/L, reference value 2.1–2.7 mmol/L), creatine kinase (58 IU/L, reference value 19–226 IU/L), lactate dehydrogenase (167 IU/L, reference value 110–220 IU/L), alanine aminotransferase (19 IU/L, reference value <55 IU/L), aspartate transaminase (15 IU/L, reference value <46 IU/L), creatinine (74.5 μmol/L, reference value 53–140 μmol/L), blood urea nitrogen (7.69 mmol/L, reference value 3.30–8.22 mmol/L), thyroid-stimulating hormone (6.3 mU/L, reference value 2–10 mU/L), total-triiodothyronine (2.14 nmol/L, reference value 1.8–2.9 nmol/L), and total thyroxine (87 nmol/L, reference value 65156 nmol/L), were normal. The patient did not have hypertension (117/83 mm Hg).
+Patient history showed that the paralytic attacks were usually triggered by physical labour or stress and were periodic. Attack frequency varied from weekly during the summer to bimonthly in the winter; each attack lasted 4–6 hours. This attack was the most severe of the attacks he had experienced during the past decade. Although these paralytic attacks were associated with hypokalaemia, the aetiology had not been previously established, and the patient had not received any treatment, including potassium supplement, between attacks. Two years before this attack, serum potassium had been measured several times between attacks; the results of three of these tests were available and were 3.74, 3.69 and 3.63 mmol/L.
+Because of the presence of severe hypokalaemic periodic paralysis, the patient underwent a left adrenalectomy after admission. Examination of the adrenal gland revealed a 1.1-cm benign nodule at the periphery of the gland with multiple cortical nodular hyperplasias. The patient did not have any complications during the perioperative period and laboratory results were normal (serum potassium .87 mmol/L, serum sodium 143.9 mmol/L, norepinephrine 452 ng/L, adrenaline 60 ng/L, aldosterone 12.24 ng/dL, cortisol 8.1 μg/dL, renin 2.13 ng/mL, creatine kinase 60 IU/L, lactate dehydrogenase 168 IU/L, alanine aminotransferase 20 IU/L, aspartate transaminase 16 IU/L, creatinine 81.3 μmol/L, blood urea nitrogen 8.01 mmol/L). He was discharged 4 days after surgery. During the next 3 months, while recovering at home, no paralytic attacks occurred. The patient then returned to work, and the acute paralytic crises soon recurred. A colour Doppler ultrasound examination did not show any abnormality of the right adrenal gland. The patient then asked for help from the Department of Medical Genetics. His serum potassium was monitored three times with a frequency of once per month with results of 4.12, 3.97, and 4.27 mmol/L, respectively. As shown in Figure , in addition to the patient (II2), four other adult male family members, including two uncles (I5 and I6), one brother (II3), and one nephew (III1), also had a history of paralytic attacks, although their attacks were milder and less frequent (yearly to decadal). These members refused examination to determine the presence or absence of UAH.
+Because of the positive family history of periodic paralysis with potential autosomal dominant inheritance, the diagnosis of HOKPP was considered, and genetic testing of the CACNA1S and SCN4A genes was performed using Sanger sequencing of all exons and their splice sites. Consequently, the patient was identified as a heterozygote carrying a novel missense mutation, c.1582C > T, in CACNA1S (p.Arg528Cys) . In his family, the mutation was also detected in three other adult males with periodic paralysis (I6, II3, and III1) and in two asymptomatic females (II1 and III2). This mutation was absent in two male family members who did not have a history of symptoms (III3 and III4). Furthermore, the targeted Sanger sequencing did not detect the mutation in 130 adult male controls.
+During the following 2 years, the patient maintained the same diet as before surgery. He did not receive any potassium supplement treatment and suffered 12 paralytic attacks. However, there were considerably fewer attacks (monthly in the summer and no attacks in the winter), and the attacks were shorter in duration (2–3 hours) than the attacks before adrenalectomy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_166_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_166_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ed0cbcd213de5d920152962ac7115a3fe3dfbbef
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_166_en.txt
@@ -0,0 +1 @@
+A 33-year-old Saudi male presented to the surgical clinic of King Khalid Hospital Najran Saudi Arabia, with a slowly growing painless lump in the right buttock for about six months. The patient complained of fatigue and recurrent episodes of low grade fever. On examination, there was a soft and cystic, non-tender lump on the right buttock measuring about 4×4cm . The overlying skin was normal without any punctum or discharge. Except for eosinophilia in the complete blood count (CBC), the rest of baseline blood tests and chest X-ray were normal. The enzyme-linked immune-absorbent assay (ELISA) was positive for the Echinococcal granulosis antigens. Computed tomography (CT) scan of the concerned region showed an intact cyst with thin enhancing rim containing homogenous fluid contents . Later on, further inquiry from the patient confirmed his direct contact with the infected sheep a few months before. Surgical exploration of the mass was undertaken under general anesthesia. After appropriate packing of the surgical field with 20% hypertonic saline solution, the lump was completely excised . The lump was found to be a primary muscular hydatid cyst, attached to the right gluteus medius muscle, with multiple daughter cysts . The histopathology report detailed a circumscribed multilocular cystic lesion with a 2-mm thick fibrous wall . The cyst contained clear fluid with sand-like pasty material and calcified bodies. There were multiple daughter cysts with the same histological architecture. Following the surgical procedure, albendazole 10mg/kg/day was advised for 3 months to prevent recurrence. The patient had an uneventful recovery and was discharged home in a satisfactory condition.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1687_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1687_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0c36cf7bfdb3413cbbc9cf4c0161bde4d4218098
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1687_en.txt
@@ -0,0 +1,5 @@
+A 21-year-old female presented with 3 months of severe, left L5 radicular pain accompanied by L5 hypoesthesia to light touch and decreased pin-perception, without weakness. MR showed a dumbbell-shaped, heterogenously enhancing lesion centered in the left L5/S1 foramen, measuring 4.5 cm × 4 cm . The tumor displaced the thecal sac anterolaterally to the right and also involved the posterolateral L5 vertebral body/left L5 pedicle/lamina along with superior extension (i.e., toward L4/5 into the retroperitoneal space above the sacral alar). Multiple tortuous vessels extended along the cauda equina .
+Through a L4 and L5 hemilaminectomy with a left L5/S1 facetectomy, a gross total excision was accomplished. On opening of the dura, a black, hemorrhagic tumor was visualized. Postoperatively, the patient’s radicular pain resolved, she retained full motor and regained normal sensory function in the left L5 distribution.
+Within 4 postoperative months and despite a negative PETCT obtained 3 months after surgery, the lesion recurred. The patient presented with sudden onset lower back pain with recurrent radiculopathy. Within days, she also developed a severe bifrontal headache, vomiting, photophobia, visual loss (i.e., only able to differentiate between light and dark), and a generalized seizure. The patient also developed distal lower limb weakness, bilateral abducens nerve palsies, facial diplegia, bilateral trigeminal nerve palsies, and dysarthria. The fundus exam showed florid papilledema. The emergent holo-spinal and brain MRI showed diffuse leptomeningeal enhancement along the full length of the spinal cord extending to the brainstem and cerebrum. There was also a focal recurrent epidural soft-tissue lesion within the left posterolateral aspect at L4/5 measuring 12 mm × 10 mm .
+A CT-guided lumbar puncture revealed only gelatinous material and core biopsy samples were taken. CSF studies showed high protein, low glucose, but no organisms. A frontal external ventricular drain was placed, and later converted to a ventriculoperitoneal shunt Craniospinal irradiation was administered after EVD insertion. Notably, the patient was discharged wheelchair-bound 3 months later.
+Tumor sections from both treatment periods showed a pigmented epithelioid to spindled cell tumor composed of cellular nodules, trabeculae and fascicles characterized by moderate nuclear pleomorphism, variably prominent nucleoli, and a moderate amount of eosinophilic cytoplasm . The initial specimen had scattered nuclear grooves and intra-nuclear pseudo-inclusions, with only rare mitoses observed. No psammoma bodies were seen. The pigment was demonstrated to be melanin (Schmorl’s positive, Perl’s negative). The tumor cells were strongly positive for S100, HMB45, melanin-A and SOX10 and negative for EMA, AE1/3, CAM5.2, and GFAP. The proliferative rate was 6% (Ki67). These findings were consistent with a diagnosis of a MMNST. The secondary tumor showed MMNST, identical in morphology to that seen from the primary excision and included increased areas of tumor necrosis with a high mitotic count of up to 14 per high power field (×400). Further, the Ki67 had increased significantly and was estimated at 40% .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1695_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1695_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f4d72c8b6040d59bf15191950c371f0f6b80bdc7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1695_en.txt
@@ -0,0 +1,4 @@
+A 53-year-old Japanese woman with a 30-year clinical history of anorexia nervosa (155 cm, 32 kg, body mass index: 13.3 kg/m2) was found unconscious at home. On admission to the Emergency Department, she was in a coma with a consciousness level of 6 on the Glasgow Coma Scale (E3V1M2). Her other vital signs initially recorded in the Emergency Department were as follows: body temperature, 35.1°C; heart rate, 83 beats/min; blood pressure, 84/62 mmHg; respiratory rate, 12 breaths/min; and percutaneous oxygen saturation, 98% (on oxygen 10 L/min via a non-rebreather mask). A laboratory examination showed remarkable hypoglycemia with a blood sugar concentration of 8 mg/dL, anemia with a hemoglobin concentration of 8.2 g/dL, hypopotassemia with a potassium concentration of 3.4 mmol/L, thrombocytopenia with a platelet count of 128,000/μL, and coagulopathy with an international normalized ratio of the prothrombin time of 1.49 and activated partial thromboplastin time of 36.2 s. After the intravenous administration of 20 g of glucose and 20 mg of thiamine, her blood sugar concentration increased to 230 mg/dL, and her consciousness level returned to 14 on the Glasgow Coma Scale (E3V5M6). Transthoracic echocardiography showed akinesis of the heart apex and a reduced left ventricular ejection fraction of 20%, consistent with takotsubo cardiomyopathy. She was obviously emaciated and malnourished but did not have a short neck or neck deformities. A computed tomography scan showed no vascular anomaly around the neck or thorax. A diagnosis of hypoglycemia-induced takotsubo cardiomyopathy [, ] with anorexia nervosa was made. She was admitted to the intensive care unit to receive close monitoring, correction of blood sugar and electrolytes, and continuous intravenous heparin administration (5000 U/day) for the prevention of thrombus in the akinetic ventricular apex.
+On hospital day 2, this patient suddenly developed refractory ventricular fibrillation and suffered from cardiopulmonary arrest. A rigorous resuscitation attempt using chest compressions, electrical defibrillation, endotracheal intubation, and intravenous adrenaline administration was immediately initiated by intensive care unit physicians and nurses. Spontaneous circulation was restored in approximately 15 min. A CVC was required for continuous intravenous infusion of inotropic agents and vasopressin. The right neck was then sterilized with 1% chlorhexidine digluconate, and her head was tilted to the left by approximately 30°. On a pre-procedural ultrasound (US) examination, no vascular-like structures were visible behind the posterior wall of the right IJV. The right IJV was punctured by an experienced cardiologist under US guidance with the short-axis out-of-plane technique using an 18-gauge introducer needle contained in an Arrow triple lumen central venous catheter kit (Teleflex Medical Japan, Tokyo, Japan). Although the angle and depth of the needle appeared to be appropriate if the patient had not been emaciated, the right IJV was completely collapsed at the time of the US-guided puncture, and blood was not aspirated. Non-pulsatile dark-colored blood was smoothly aspirated during gentle withdrawal of the needle, and then a guide wire, dilator, and CVC were inserted without resistance. Immediately after the CVC placement, she developed enlarging swelling around the neck. Contrast-enhanced computed tomography showed massive contrast media extravasation around the neck and mediastinum , whereas the tip of the CVC was correctly placed in the right IJV. The patient was considered at a high risk for open repair. Therefore, transarterial embolization was planned. After 6-Fr short sheath introduction (Radifocus Introducer II; Terumo, Tokyo, Japan) from her right brachial artery, a pigtail catheter (4-Fr; Cook Medical, Bloomington, IN, USA) was advanced into the brachiocephalic trunk with the support of a 0.035″ hydrophilic guidewire (Radifocus guidewire M; Terumo, Tokyo, Japan). Brachiocephalic artery angiography showed a characteristic “blush” appearance of the ruptured right thyrocervical trunk . After selective arterial embolization using a microcatheter (Masters Parkway Soft; Asahi Intecc, Aichi, Japan) and 33% N-butyl-2-cyanoacrylate, the extravasation completely disappeared and hemostasis was achieved. A schema of the operative course at the catheterization laboratory is shown in Figure S in the supplementary information file. After receiving 22 units of packed red blood cells, 20 units of fresh frozen plasma, and 20 units of platelet concentrate, the patient was returned to the intensive care unit where correction of body fluid imbalance, hypothermia, acidemia, and coagulopathy was continued. Secondary infection and multiorgan dysfunction developed approximately 2 weeks later, and the patient died from sepsis on hospital day 16. An autopsy was not performed because her family refused.
+The search strategy was determined a priori by the survey team, which comprised anesthesiologists (YO and KS), an interventional radiologist (EU), emergency physicians (NN, IY, and JK), and a librarian (MJ, listed in the Acknowledgments). On June 2022, all reported cases of thyrocervical trunk injury associated with IJV puncture were searched for in the MEDLINE database from inception using the following keywords: “thyrocervical trunk” AND “internal jugular vein puncture”; “thyrocervical trunk” AND “central venous catheter”; “thyroid artery” AND “internal jugular vein puncture”; and “thyroid artery” AND “central venous catheter”. PubMed® was used to search the MEDLINE database. Cross-referencing was also performed using the reference list of articles included in this review. The following types of articles were excluded from the analysis: (1) they were not case reports or case letters, (2) they were not in English, and (3) they did not describe thyrocervical trunk injury associated with IJV puncture. This search produced 25 articles of which 10 relevant reports and cases were included in this review [–] . We reviewed the variables of age, sex, underlying medical conditions of the patients, number of punctures, use of real-time US guidance, characteristics of the operator, treatment, and outcome.
+The clinical characteristics of thyrocervical trunk injury after IJV puncture described in this review, including our patient, are shown in Table . Seven articles described pseudoaneurysm of the thyrocervical trunk or its branches [–], three reported massive bleeding arising from the thyrocervical trunk or its branches [, ], and one reported CVC misplacement in the right inferior thyroid artery . The cases in the literature review consisted of four men and seven women, aged 33 to 71 years. More than 80% (9/11) of thyrocervical trunk injuries were associated with a landmark puncture without using real-time US guidance. More than half (6/11) of the thyrocervical trunk injuries were associated with multiple (≥ 2) attempts. Aneurysm or active bleeding arising from a thyrocervical trunk injury was successfully managed by surgical repair (4/11) or endovascular treatment (5/11). Endovascular embolization using 33% N-butyl-2-cyanoacrylate for the treatment of vascular complications associated with CVC placement has not been reported previously.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_170_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_170_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..474c9d9a00cd1b72d265c932cdf6d7b1fd64a7b5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_170_en.txt
@@ -0,0 +1,7 @@
+A 68-year-old man was suffered from severely symptomatic persistent AF for 9 years.
+The patient reported a 9-year history of persistent AF .
+The patient had a history of ventricular septal defect occlusion and he suffered from HS, which was proved by computed tomography scan of the vena cava that showed that the IVC was interrupted. The azygos extended to the SVC and the hepatic veins drained directly to the right atrium.
+The patient had no personal and family history.
+Physical examination did not reveal any abnormalities.
+Laboratory examination did not reveal any abnormalities.
+Initial workup included an echocardiogram that showed an atrial septal defect (6 mm), with enlarged left atrial size and normal ejection fraction reported. Pulmonary vein mapping computed tomography also did not suggest any significant abnormalities.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1720_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1720_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a91fd2c0f6d4503aba3e2652953727fcfea0d524
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1720_en.txt
@@ -0,0 +1 @@
+A 61-year-old Japanese man had a cervical spinal cord injury approximately 2 years previously, and underwent cervical laminoplasty from C4 to C7 at a different hospital. Preoperative magnetic resonance imaging (MRI) revealed spinal canal stenosis at C5/6 and C6/7, and MRI after laminoplasty revealed decompression of the spinal cord . He was referred to our hospital 6 months after surgery because of progressively worsening spasticity of the lower limbs. We performed ITB pump (SynchroMed II, Medtronic, Inc., Minneapolis, MN, USA) implantation by inserting an intrathecal catheter through the L2/3 interlaminar space to the T8/9 level . After surgery, his spastic gait improved and progressed well; however, 1 year after surgery, intermittent claudication was observed, making it difficult for the patient to walk long distances. Physical examination revealed numbness and mild muscle weakness in both lower extremities. No signs of spinal tension were observed. MRI of the lumbar spine revealed multiple LSS at L1/2, L2/3, L3/4, and L4/5 . Based on these findings, we planned to decompress all stenotic areas. We also considered the possibility that the intrathecal catheter inserted through the L2/3 interlaminar space would need to be removed in preparation for surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1733_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1733_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d6f54ef9510c011417e8db7fa93019a5d764ff16
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1733_en.txt
@@ -0,0 +1 @@
+A healthy 20-year-old Japanese man was trapped beneath a 3-ton steel frame while working on a crane. He was rescued by his coworkers and exhibited constant bleeding from the right side of his lower abdomen when the ambulance arrived. He was transferred to our emergency department with the wound compressed. On arrival, his vital signs were: respiratory rate 22/minute, blood pressure 97/65 mmHg, and pulse rate 140/minute. His Glasgow Coma Scale score was E4 V5 M6. On physical examination, there was instability of his hip and constant bleeding from the wound on the right side of his lower abdomen. Endotracheal intubation and fluid resuscitation were performed. Computed tomography (CT) of his body showed: splenic injury; sacrum fracture; separation of the sacroiliac joint; and fracture of the right pubis, ischium, and acetabulum. Vancomycin and meropenem were started to prevent infection. He was immediately taken to our angiography room for transcatheter arterial embolization (TAE) for pelvic hemorrhage. Angiography showed extravasation from the bilateral internal iliac arteries, which were embolized. His bilateral external iliac arteries showed thrombosis. A SAM® Pelvic Sling™ (SAM Medical, Wilsonville, OR, USA) was applied to his pelvis. Since complete hemostasis was not achieved after TAE, a vascular surgeon was consulted. Based on the view from the expanded wound on the right side of his lower abdomen, his right external artery was ligated in the emergency room and hemostasis was achieved. Gauze was packed with the wound sutured. Subsequent CT showed ischemia of his right lower limb. Despite the amount of time that had passed since the accident and the possibility of increased risk, due to his young age and the strong desire of his family to save his limbs, revascularization surgery was performed in the operating room. After crossover graft of the axillary-femoral artery, another hemorrhage was confirmed in his retroperitoneum, which was thought to be due to the external iliac artery injury. An additional crossover graft of the axillary-femoral vein was performed. Cystostomy and external fixation of the pelvic fracture were performed. On day 2, additional debridement of the right side of his lower abdomen was performed. Packed gauze was removed and a drainage tube was inserted. Contrast CT showed ischemia of his left lower limb and right anterior tibial artery. On day 3, he was referred to our plastic surgery department for blisters on his bilateral thighs and scrotum, which were thought to be a complication of TAE of his bilateral internal iliac arteries. At a conference meeting with the intensive care unit team and orthopedic surgery team, we concluded that amputation of his bilateral lower limbs was inevitable, since we prioritized saving life over limb. On day 8, a right above-knee amputation was performed. The decision to amputate above the knee was made because there was a possibility that the soft tissue could be covered with the intact skin of his thigh. There was also a risk of massive hemorrhage due to the pelvic fracture if we performed hip disarticulation. On day 13, left hip disarticulation and colostomy were performed. On day 17, bilateral ureterostomy was performed. On day 21, he underwent another debridement. We confirmed necrosis in his bilateral gluteal muscles and part of his quadriceps muscle, which were debrided . Because it was difficult to control the hemorrhage, we had to stop debridement, even though necrotic muscle was still visible. We left the wound open because of the extensive soft tissue damage . Repeated debridement was necessary because of the ongoing infection; we performed debridement a total of six times . Part of his ilium and acetabulum was left and the posterior ilium was fully exposed after the extensive debridement. On day 112, left anterolateral thigh flap was rotated posteriorly and fixed with a suture anchor with successful coverage of the exposed pelvis. Negative-pressure wound therapy (NPWT) was applied for the formation of healthy granulation tissue . On day 168, a full-thickness skin graft, which was harvested from his head, back, and abdomen, was applied to the rest of the ulcer. On day 230, complete epithelialization was achieved . Rehabilitation was started along with the use of prosthetics . He has made progress to the point where he can get on and off a wheelchair and move around independently. Currently, he lives at home with his parents. The reconstructed pelvis allows for good prosthetic fitting.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1736_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1736_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b5fef3da4d5440a0baa29e462527e8adb12a843a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1736_en.txt
@@ -0,0 +1,4 @@
+A 34-year old African-American woman presented with a giant perineal tumor associated with a 29-year history of keloid formation without recalled dermal injury or abrasion. The patient's history revealed two family members (a mother and sister) with similar symptomology, resulting in a diagnosis of familial keloid syndrome. However, neither the mother nor sister was affected with perineal keloid development. Past medical history was also notable for arthritic symptoms and diabetes mellitus, which were present in both mother and sister. The index lesion was firm, pliable growth, 20 cm in its greatest diameter, adjacent to 10 cm and 6 cm perivulvar lesions, which caused the patient considerable discomfort and affected ambulation . Physical examination revealed multiple other hypertrophic nodular growths on the posterior neck, behind the right ear, bilateral scapular regions, right flank and breast, abdomen and extremities in addition to the primary lesion. Past medical history evinced numerous heterogeneous treatments for various keloids in multiple loci; she had previously received surgical extirpation, steroid injections, and two episodes of radiotherapy to the back. Despite these interventions, her keloids have either recurred or persisted. Surgical extirpation of the largest perineal lesion was undertaken, and histopathologic examination was performed, denoting the classic keloid-associated features of haphazard collagen deposition, with nodular formations thickened hyalinized bands .
+On the day following surgical excision, the patient was treated with radiotherapy using photons at 6MV. The total dose delivered was 22 Gy in 11 days, with a daily fraction of 2 Gy. The dose fraction was split between two fields with an anterior-posterior/posterior-anterior (AP/PA) port arrangement. Maximum acute Radiation Therapy Oncology Group skin toxicity score was Grade 3 (moderate ulceration and skin breakdown), which resolved after a 3-day treatment break.
+At 6 months post-therapy, the lesion in question had not recurred , and the patient reported no difficulty attributable to the lesion.
+After 10 months after completion of radiation treatment for perineal keloids, the patient returned for additional treatment to her back and chest wall. Radiotherapy was delivered at 3 Gy/fraction with 9MeV electrons to her back, lateral back, and anteromedial back over 4 days. No complications have been noted, and the patient is currently being followed, with > 24 months since therapy..
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1743_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1743_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2affc5acf72699437d87aeca0e629249505d85d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1743_en.txt
@@ -0,0 +1,8 @@
+A 77-year-old lady presented with the complaints of a left-sided breast lump of 1-month duration. She had been a heart patient and had been on treatment for the last 4 years. On clinical examination a 3 × 2 cm firm, mobile, non-tender lump was identified in the outer quadrant of her left breast. The overlying skin of the breast along with nipple and areola were unremarkable. There was no significant axillary or cervical lymphadenopathy. The other breast was normal. She underwent a mammographic examination, followed by fine needle aspiration cytology (FNAC) that was essentially inconclusive. Subsequently, she underwent a frozen section for a primary diagnosis.
+On mammography, a 2 × 2 cm ill-defined mass with irregular margins was identified in the left upper outer quadrant. No micro-calcifications were seen. The right-sided breast was normal. .
+The lumpectomy specimen on cut surface revealed a firm, grey-white, fibrous, un-encapsulated nodular tumor measuring 2 × 1.2 × 0.8 cm with infiltrative borders. No area of calcification was identified. The closest margin was the base and was found to be 0.5 cm away from the tumor.
+Frozen sections revealed a tumor with predominant spindle cells showing mild atypia, amidst a sclerotic stroma and conspicuously infiltrated the adjacent fat. A diagnosis of a low-grade sarcoma was favored over a metaplastic carcinoma. Therefore, a sentinel lymph node biopsy and/or an axillary node dissection (ALND) were not conducted at the time of surgery.
+Histological sections revealed a spindle cell tumor showing an infiltrative growth pattern with prominent areas of sclerosis reminiscent of keloid formation. The cells were mainly arranged in fascicles and displayed tapering nuclei with mild anisonucleosis. Mitoses were inconspicuous. Occasionally, the cells were plump with epithelioid shapes and revealed mild atypia with an occasional small cluster formation. Interspersed were foci of benign ductal hyperplasia and papillary hyperplasia, including a micropapilloma along with focal aggregates of chronic inflammatory cells. The micropapilloma did not show any significant atypia. . No discrete squamous differentiation was identified. No focus of Ductal-carcinoma-in-situ (DCIS) was seen in any of the sections. The two closest differential diagnoses considered were fibromatosis and a "fibromatosis like" metaplastic carcinoma. A wide panel of IHC antibody markers was performed . The tumor cells were simultaneously diffusely positive for epithelial markers i.e. the various cytokeratins CK, CK7, High molecular weight (HMWCK) and epithelial membrane antigen (EMA), along with a mesenchymal marker i.e. vimentin. . All the cytokeratins were positive in the interspersed benign ducts that acted as internal controls. The tumor cells were negative for Gross cystic disease fluid protein (GCDFP), estrogen (ER) and progesterone receptor (PR). The myoepithelial markers i.e. smooth muscle actin (SMA) and p63 showed focal, positive expression. . S100 and Desmin were negative. Ki-67 (proliferation marker) showed focal positivity in less than 5% tumor cells . The tumor cells were negative for CD34 and CerbB-2/HER-2/neu. . A diagnosis of a low-grade "fibromatosis-like" metaplastic carcinoma, associated with a micropapilloma, was finally made. All the cut margins were free of tumor.
+A portion of fresh tumor tissue fixed in 3% glutaraldehyde was processed for electron microscopy. Ultra thin sections stained with uranyl acetate and lead citrate were observed under an electron microscope model: Zeiss 109, Germany.
+Ultrastructurally, the tumor cells embedded in a collagenous stroma showed fibroblastic and myoepithelial features along with presence of peripheral villous processes with a focal basal lamina and intercellular junctions .
+After surgery, the patient completed adjuvant radiotherapy (RT). Thereafter, she has been on a regular 2 monthly follow-up; including her metastatic work-up with Positron emission tomography (PET-CT) of the body and bone scan. Due to a high cardiac risk, a second surgery for an ALND was not performed. Nevertheless, till 1 year and 4 months of her follow-up she has not been identified with any lymphadenopathy, recurrent lesion or metastatic lesions in her body.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1744_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1744_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..56b95881a6e431235b035aae9dbaf9525afe8365
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1744_en.txt
@@ -0,0 +1,7 @@
+The patient was a 38-year-old non-smoking Japanese woman with no significant medical history. She was diagnosed with invasive ductal carcinoma of the right breast, and in August 2020, we performed partial right breast resection and axillary lymph node dissection. Her post-operative diagnosis was pT2N2aM0 pStage IIB, ER(+) PgR(+) HER2(−), and she was administered her first course of chemotherapy with (5-Fluorouracil 500 mg/m2), epirubicin hydrochloride (100 mg/m2), and cyclophosphamide (500 mg/m2) (FEC) every 3 weeks in mid-September.
+A day before receiving the second course of chemotherapy, she had a fever of 38.0 °C. The next morning, her fever had alleviated, and she visited our outpatient department. She had no cough at this point. Her blood test showed no abnormalities; therefore, we administered a second course of chemotherapy. As an antiemetic agent, she received 8 mg/day of dexamethasone on days 1–4 and an aprepitant on days 1–3. According to our hospital’s standardized treatment, on day 3, she received a shot of peg-filgrastim (3.6 mg).
+On days 5 and 6 after the administration of chemotherapy, she had a fever ranging from 39–40 °C. On day 7, she tested positive for SARS-CoV-2 by reverse transcription polymerase chain reaction (RT-PCR).
+The next day, she was admitted to our hospital for treatment. Her main symptoms were cough and high temperature. Additional symptoms included fatigue and mild joint pain. She did not show any signs of hypoxemia. Laboratory tests revealed the following findings: white blood cell count, 1600/μL with 77.0% neutrophils, 17.0% lymphocytes, 3.0% monocytes, 1.0% eosinophils, 2.0% basophils; hemoglobin, 12.6 g/dL; platelet count, 140,000/μL; and C-reactive protein 3.62 mg/dL. Chest computed tomography (CT) revealed ground-glass opacity in the peripheral lesions of both lungs . Chest X-ray indicated infiltrative shadows in the peripheral lesions of both lungs . She was diagnosed with COVID-19 with grade three leukopenia and grade two neutropenia. Antibiotic therapy (levofloxacin 500 mg every 24 h, taken orally) was administered after collecting blood cultures.
+Antibiotic therapy was discontinued after a blood test showed normalization of her white blood cell count on day 5 after the diagnosis. Intermittent cough and high temperature persisted until day 8 after the diagnosis. After confirming that at least 72 h had passed, since her last episode of fever, she was discharged 12 days after the diagnosis (day 19 after the administration of chemotherapy Fig. ).
+The patient visited our outpatient department 2 weeks after discharge for a chest X-ray and blood test follow-up. The blood test indicated the normalization of inflammatory markers, and the chest X-ray images showed benign organized pneumonia in the peripheral lesion of both lungs, matching the ground-glass opacities seen in the CT before .
+In considering resumption of chemotherapy, we consulted a pulmonologist. Since no criteria exist, we were advised based on clinical experience, to defer resumption until at least 2 weeks had passed after discharge. Taking this into account, we decided to resume anti-cancer therapy after adequately informing the patient about the risks and benefits. FEC therapy every 3 weeks was resumed on day 25 after discharge (day 43 after the last administration of the chemotherapy). The patient was able to complete four courses of the initial chemotherapy without any major adverse events, and we were able to institute docetaxel (70 mg/m2) every 3 weeks as the second regimen of chemotherapy. Organized pneumonia was eclipsed in the follow-up chest X-ray image taken at the beginning of docetaxel therapy . She completed four courses of docetaxel without any major adverse events.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1751_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1751_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a6380516ceddcc65e786a9d57b199d0e799e5e55
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1751_en.txt
@@ -0,0 +1,4 @@
+The patient was a 43-year-old female with end-stage liver disease secondary to HCV hepatitis. Her weight was 60 kg and her body mass index was 24.3 kg/m2. Her blood type was O Rh (+). Preoperative assessment reveals the Child-Pugh score was grade C as 13 pts and the model for end-stage liver disease score was high as 19. Radiological evaluation revealed partial PV thrombosis in the main trunk. She underwent partial SAE 8 years ago and umbilical hernia repair. Her donor was her 41-year-old brother who weighted 79 kg and body mass index was 26.7 kg/m2. His blood type was B Rh (+). Preoperative 3-dimensional volumetry revealed that the extended left with caudate lobe graft volume was 555 mL, which was 49.2% of the recipient standard liver volume (SLV). The donor and recipient have incompatible blood types, so the recipient was subjected to preoperative rituximab protocol.
+The patient underwent LDLT using extended left with caudate lobe graft. The actual graft weighted 467 g (402 g after UW reperfusion) of which GV/SLV was 35.7% and GRWR was 0.67%. It had middle and left hepatic veins, left hepatic artery, left PV, and left hepatic duct. Upon laparotomy, there was 10,500 mL of ascites as well as perihepatic adhesions and periumbilical adhesions. On laparotomy, portal venous pressure (PVP) monitoring was 22 mmHg. The splenic artery was dorsal to the pancreas and difficult to be approached, and finally, the upper pole branch of the splenic artery was identified and ligated at the level of the distal pancreas, by which only the upper pole of the spleen turned pale. Splenectomy could not be performed due to severe peri-splenic adhesions to avoid the ruined bleedings. After PV thrombectomy was done, adequate PV inflow was not confirmed until left gastric vessel ligation was performed. After graft reperfusion, PVP was 20 mmHg but PV flow was relatively low, 520 mL/min. At this time, we choose not to ligate the other branches of the splenic artery nor the lienorenal shunt until postoperative assessment of the graft function and the PV flow for possible postoperative modulation and boost of the portal flow accordingly. The point is that safe angiographic procedures for portal flow modulation are accessible postoperatively, such as splenic artery embolization for portal decompression and balloon-occluded retrograde transvenous obliteration (BRTO) for boosting portal flow.
+After LDLT, routine abdominal ultrasound screening revealed that portal flow was 60 cm/s on POD 1, then it kept as high as 30 cm/s along the 1st week . Ascites volume was initially below 1000 mL/day till 6th POD, however, increased markedly thereafter. Serum bilirubin levels showed a stepwise gradual increase that reaches 19.4 mg/dL on POD 9 . Platelet counts were lowest (42 × 103/μL) by POD 8 and INR levels kept below 1.5 along the whole clinical course. Considering this relatively insufficient graft volume along with the clinical and laboratory parameters suggestive of SFSS, then we decided to do splenic artery embolization (SAE) for portal decompression. The patient underwent arterial splenic angiography on POD 10 via percutaneous trans-femoral Seldinger’s technique. After angiographic assessment, partial SAE occluding the main branch of the splenic artery was achieved by trans-catheter coil embolization . Dynamic computed tomography comparing the spleen pre- and postembolization are also shown .
+After SAE, PV flow significantly decreased to keep within 20 cm/s by US study . Additionally, serum total bilirubin levels gradually declined and ascites amounts decreased below 400 mL , and then, the abdominal drain was removed on POD 21. Platelet counts showed a stepwise increase thereafter. The patient was discharged on POD 28 in good condition without any infectious complications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1761_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1761_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1f8641f0ec7d9a2112c964ff1c5436f67cb54b5e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1761_en.txt
@@ -0,0 +1,6 @@
+A 16-year-old Chinese girl presented complaining of anemia and interval hematochezia. Her hemoglobin was 54 g/L on admission. Capsule endoscopy and double-balloon enteroscopy showed mucosal hyperemia, edema and mass protrusion on the ileal wall. Computed tomography (CT) scans and three-dimensional reconstruction revealed a 10.0 × 7.3 × 5.3 cm irregular mass that had developed from the ileal wall in the right lower quadrant . The lesion showed intense but inhomogeneous enhancement following contrast administration , particularly in the arterial phase. There was a small amount of effusion in the pelvic cavity. Pelvic magnetic resonance imaging (MRI) indicated a right ovarian cyst in addition to the above mass. Both CT and MRI prompted suspicion of malignant GIST of the small bowel. Her serum CA-125 was slightly increased (50.5 U/mL, standard 0–36 U/mL), but the other markers were within normal limits. The tumor and a loop of small intestine were resected through a right ventral midline incision. The patient recovered uneventfully. Postoperative bone scintigraphy proved that there was no lesion in the skeletal system . Her chest CT scan and cerebral MRI were also unremarkable. Thus, the patient was classified as T2aN0M0 according to the 8th edition of the AJCC Cancer Staging Manual.
+On laparotomy, a large cystic and solid mass 10.5 cm in diameter was found arising from the ileal wall. The cut tumor surface showed large central hemorrhagic and necrotic changes and pseudocystic degeneration. The tumor tissue was mostly light gray and solid, with some softer and more friable reddish congested areas .
+Cross sections revealed solid nests of small round tumor cells arising from the muscular layer and infiltrating all layers of the ileum wall. Cystic and hemorrhagic changes were seen on part of the sections, as were sharply demarcated borders that were frequently covered by intact serosa. No vascular tumor embolus or perineuronal invasion were observed. The serosal layer and the surgical margins of the specimen were free of disease. Under high-power view, tumor cells were round or elliptical, possessing scant eosinophilic cytoplasm and abortive pseudorosette formation. The tumor cell nuclei were round, with exquisite chromatin, ambiguous nucleoli, and 9/10 high-power-field pathological mitoses . Tumor cells showed positive immunoreactivity for Vimentin and CD99 and moderate staining for Cam5.2, Syn and PR . Results were negative for CKpan, LCA, S-100, HMB45, Melan-A, CD31, CD34, NSE, P53, CD56, CgA, SMA, Desmin, CD117, Dog-1, ER, Bcl-2, and alpha-inhibin.
+Dual color break-apart probe FISH examination showed that 90% of the cells (100 counted cells per slide) exhibited 1 yellow and 1 red signal (1F1R) and that 6% of the cells exhibited 1 yellow, 1 red and 1 green (break-apart) signal (1F1G1R). However, only 4% cell had two yellow signals, which proved a break of the EWSR1 locus (2 F) .
+Transmission electron microscopy revealed dense clusters of tumor cells, interspersed with a few interstitial cells . The tumor cells were small and irregular, with scant cytoplasm and organelles, and significant nuclear atypia . Some cells had small nucleoli . Occasionally, gap junctions between the cells were observed , but neuroendocrine granules in the cytoplasm were rarely seen . Most cells had glycogen particles attached to the endoplasmic reticulum .
+The patient underwent an exploratory laparotomy, and tumor resection was performed along with 60 cm of ileum. The patient refused chemotherapy and/or radiotherapy as adjuvant treatments. She is currently alive (10 months after the surgery) without any signs of recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1773_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1773_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..11720274ad81f97058f8f3d68b3b09fae53c2fbf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1773_en.txt
@@ -0,0 +1,7 @@
+A 74-year-old woman who was treated outside our hospital due to complaints of general weakness, hematuria, dysuria, and decreased renal function was transferred to Chosun University Hospital, Gwangju, Korea, as her renal function did not improve despite treatment.
+Clinically, rapid progressive glomerulonephritis (RPGN) was suspected. Two days after admission, US-guided percutaneous renal biopsy was performed to confirm the pathologic diagnosis, before initiating steroid treatment. Contrary to expectations, the light microscopic examination identified diffuse infiltration of pleomorphic cells throughout the specimen. The pleomorphic cells were immunoreactive for CD20, bcl-2, bcl-6, and MUM-1, but negative for CD3, CD10, and Epstein-Barr encoding region in situ hybridization . No fluorescence deposit was identified during immunofluorescence examination. In electro-microscopic examination, no electron-dense deposit was observed, and the glomerular basement membrane appeared normal in thickness, contour, and texture. However, strikingly, diffuse prominent infiltration of atypical lymphocytes was observed in the interstitium. The cells displayed round to oval cleaved and non-cleaved nuclei with variable clumping of chromatin, and large prominent, marginated nucleoli . We diagnosed the condition as DLBCL, not medical renal disease. After pathologic diagnosis, radiologic re-evaluation was performed. Abdominal CT examination (with contrast) revealed diffuse homogeneous enhancement in both kidneys without definite visible cortico-medullary differentiation, and lymphomatous involvement was diagnosed. A few mild enlargements of lymph nodes in the pericardial and periaortic chains were identified, and such nodes were considered to indicate secondary lymphomatous involvement. On fluorodeoxyglucose-positron emission tomography CT, intense hypermetabolism (19.6) was identified in both kidneys, and some lymph nodes exhibited mild hypermetabolism . In the laboratory tests, serum lactate dehydrogenase (LDH) level was elevated to 376 U/L (125-220 U/L). The international prognostic index (IPI) was reported as 3 when the following laboratory data and clinicopathologic factors were considered [old age, 1; Eastern Cooperative Oncology Group (ECOG) performance status (PS), 1; Ann Arbor stages III–IV, 0; serum level > 1 × normal, 1; and > 1 extranodal site, 0].
+The patient had no previous renal problems.
+There was no specific personal or family history.
+The patient looked ill.
+After admission, the blood urea nitrogen (normal range, 7.0-20.1 mg/dL)/creatinine (0.57-1.11 mg/dL) levels on June 30, July 9, and July 11, 2022 were as follows: 27.7/4.09; 41.0/6.61; and 48/7.62 mg/dL, respectively.
+Radiologically, renal US exhibited heterogeneously increased parenchymal echogenicity and a 1.43 cm-sized hypoechoic cystic lesion in the right kidney. Thus, the radiologist suggested probable medical renal disease with a right cystic lesion. During abdominal CT (contrast-free CT while admitted to the emergency room), no neoplastic lesion was suspected.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1778_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1778_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..66031d7eccfb6bc9b774ff105718552d7c61a1c7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1778_en.txt
@@ -0,0 +1,7 @@
+A 53-year-old Japanese woman with no significant medical history other than chronic gastritis, diagnosed by upper gastrointestinal endoscopy 6 years previously, presented to our hospital with a mass in the larynx that appeared to be malignant. She had a 1-year history of a dull feeling in her throat and cough. Three months earlier, she had been diagnosed with anisakiasis at a local clinic and had been incidentally found to have mass lesion of approximately 7-mm in diameter at the left tongue base, by upper gastrointestinal endoscopy. One month earlier, follow-up nasopharyngoscopy had revealed no changes in the mass lesion, and an endoscopic biopsy had been performed. Squamous cell carcinoma was suspected pathologically, and the patient was referred to the department of otorhinolaryngology at our hospital for further evaluation.
+An endoscopic biopsy was also performed in our outpatient clinic , but the biopsy specimens only showed atypical epithelium, and the scrape culture was negative. Intravenous contrast-enhanced computed tomography (CT) of the neck and thorax was unremarkable, except for bilateral cervical lymphadenopathy.
+For further evaluation, an excision biopsy under general anesthesia was performed . Histopathological examination of a hematoxylin and eosin-stained biopsy specimen showed granulomatous tissue consisting mainly of histiocytes and multinucleated giant cells . Some histiocytes had phagocytized the encapsulated yeast-like organisms that were invading the epithelium. There were also scant neutrophils, but no micro-abscesses were found. The walls of the mass were positive on staining with Grocott’s methenamine silver . These findings suggested cryptococcosis; therefore, she was referred to the Department of Infectious Disease for the treatment of the residual mass lesion.
+On physical examination, the patient was afebrile, and her vital signs were normal. Head and neck examination revealed no enlarged lymph nodes, and no meningeal signs. Examination of the pharynx revealed no pharyngeal edema or exudate. She had no skin lesions. The blood test results were unremarkable. An HIV antibody/antigen combination test result was negative. A neutrophil function test was not performed because she did not have a history of recurrent or severe bacterial infection, suggesting that her neutrophil function was normal. Chest CT revealed no pulmonary findings of note. A serum Cryptococcus antigen test (Bio-Medical Laboratories, Inc.), using a latex agglutination method was negative. Serum beta D glucan was not measured. Based on these findings and the histopathology, she was provisionally diagnosed with possible non-meningeal, non-pulmonary cryptococcosis. The scrape culture of the residual lesion at the base of the tongue was repeated, and then fosfluconazole treatment (6 mg/kg bodyweight/day) was initiated as treatment for localized cryptococcosis.
+After 3 days of incubation of the separation culture that targeted Cryptococcus from the scrape specimen, white to pale purple-colored small colonies grew on the XM-Candida agar plate (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) cultured at 35 °C in aerobic conditions . The VITEK® 2 COMPACT Microbial Detection System (version 8.01 database: SYSMEX bioMérieux Co., Ltd., Tokyo, Japan) based on the biochemical reaction method with yeast identification card identified the colonies as P. wickerhamii. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS, using the MALDI Biotyper version 4.0.0.1 database; Bruker Daltonik, Germany) did not identify the colonies initially, but in the re-examination, it identified the colonies as P. wickerhamii with low probability (score 1.451). Lactophenol cotton blue staining of the colony revealed tightly packed endospores within the sporangia distinctive of P. wickerhamii .
+DNA was extracted and polymerase chain reaction (PCR) method was performed using primers to amplify the internal transcribed spacer region and the D1/D2 domain of the large subunit ribosomal DNA gene. Sequence analysis of the amplicons showed no significant results, suggesting genetic polymorphism. Cloning was performed, and base sequences showing high homology with P. wickerhamii genes were detected.
+Therefore, a diagnosis of laryngeal protothecosis was established. The minimum inhibitory concentration (MIC) results using the Frozen Plate for Antifungal Susceptibility Testing of Yeasts, Eiken (Eiken Chemical Co., Ltd., Tokyo) were as follows: amphotericin B, 1 µg/mL; fluconazole, > 64 µg/mL; itraconazole, 4 µg/mL; voriconazole, 1 µg/mL; miconazole, > 16 µg/mL; flucytosine, > 64 µg/mL; and micafungin, > 16 µg/mL. Empiric fosfluconazole treatment was discontinued after 10 weeks because the size of the residual mass lesion did not change. Amphotericin B syrup (1 mL, 4 times a day) was initiated and continued for 6 weeks instead of intravenous amphotericin B treatment because the patient was asymptomatic and could not take time off from work to be admitted to hospital for intravenous amphotericin B treatment. Although we considered additional and definitive resection after the patient was diagnosed with Prototheca infection, we decided against it because we anticipated that it would be difficult to remove the lesion with safety margins because the vertical margin was not clearly determined on macroscopic examination, and resection carried a risk of causing difficulties with speech and swallowing. The residual mass lesion did not deteriorate during the antifungal treatment or the post-treatment one-year follow-up period.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_180_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_180_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3666c94e62e2cc8dfda1c5eb203811b84a42efb9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_180_en.txt
@@ -0,0 +1,2 @@
+A 55-year-old man with no significant past medical history presented to the ED for evaluation of right eye conjunctival injection, irritation, and painless visual field loss over the lower half of his vision in the ipsilateral eye. The patient stated that nine days prior a foreign body may have penetrated his right eye, for which he did not seek medical attention at that time. In the affected eye, he subsequently developed erythema, edema, purulent crusty drainage, itching, and a foreign body sensation. On day eight after the initial eye injury, the patient developed sudden-onset painless vision loss over the lower aspect of the right visual field. The following day, he presented to the ED with these symptoms. The patient denied blurry vision, floaters, or any past ophthalmological history.
+On physical exam of the right eye, the patient had minimal conjunctival injection. Visual field deficits were appreciated over the lower temporal and lower nasal sides of the right eye. All remaining visual fields and visual acuity were intact. Fluorescein staining and Wood’s lamp exam did not reveal any foreign body, with negative Seidel sign. Point-of-care ocular ultrasonography showed retinal detachment of the right eye. The case was discussed with an ophthalmologist, who came to the ED, evaluated the patient, and arranged for next day follow-up and outpatient retinal repair.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1830_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1830_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e3ba256bfa522a5352c2b8df838a55ce33cded88
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1830_en.txt
@@ -0,0 +1,3 @@
+We present the case of an 81-year-old male patient with a history of a CABG using the RGEA. He had a past medical history of diabetes mellitus and the lower extremity arteriosclerosis obliterans. Preoperative enhanced computed tomography (CT) imaging revealed an enlarged hepatic tumor and a patent RGEA graft was observed on the left lobe of the liver . Subsequent liver biopsy confirmed the diagnosis of hepatocellular carcinoma as a consequence of nonalcoholic steatohepatitis. The tumor was located near the bifurcation of the anterior and posterior hepatic branches , warranting a right hepatectomy. As the percentage of the remaining liver was only 41%, preoperative transhepatic portal vein embolization (PTPE) was initially performed to promote enlargement of the left lobe. This procedure increased the proportion of the remaining liver to 45%, after which an open right hepatectomy was planned. The Child-Pugh classification, which reflects preoperative liver function, was A (5 points), and the indocyanine green(ICG) retention test after 15 minuets was 1.0%.
+A median skin incision with right transverse extension was performed. A wound protector was not used to prevent potential damage to the RGEA. The RGEA graft coursed past the ventral side of the stomach to the left of the hepatic falciform ligament and proceeded along the ventral side of the liver into the heart. The RGEA graft tightly adhered to the falciform ligament, meticulously separated from the liver’s surface, and was secured . The RGEA graft was taped, taking the utmost care not only to prevent any intraoperative damage but also to ensure that no unnecessary tension was applied.
+Following the detachment of the RGEA graft from the liver, a right hepatectomy was performed . The left lobe was retracted to the new space of the right temporal side, which might have exerted tension on the RGEA graft; therefore, the falciform ligament was anchored to the abdominal wall . Consequently, traction on the RGEA graft was avoided. No cardiac events occurred during the right hepatectomy, with a total intraoperative blood loss of 175 ml over a total operative time of 268 min. The resected specimen weighed 600 g, and the tumor measured 6.0 × 5.0 cm. Histopathological examination revealed a moderately differentiated hepatocellular carcinoma . Continuous preoperative heparin was administered to ensure optimal circulation through the RGEA graft. Heparin was discontinued 6 h before surgery and resumed the day following the procedure. The patient’s postoperative course was uneventful, except that diuretics were started due to ascites. The patient was discharged on the 19th postoperative day. One and a half years after the surgery, the patient showed no recurrence of hepatocellular carcinoma or cardiovascular events.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1837_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1837_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..60bc970e19c3bbca47a21ab0e0cf11ce4b26c7bd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1837_en.txt
@@ -0,0 +1,5 @@
+This present case involved a 22-year-old female who became aware of leukocoria in both eyes. Upon examination at another eye clinic, a vitreous strand was detected in her left eye, with a suspected diagnosis of PFV, and she was referred to the Department of Ophthalmology at Osaka Medical College Hospital, Takatsuki-City, Japan for a more detailed diagnosis and subsequent treatment.
+The patient had previously been diagnosed with strabismus when she was 2 years of age. She was delivered at full term, with a birth weight of 3320 g, and she had no history of oxygen administration. We did not perform genetic investigation (i.e., sequencing) on the patient in order to diagnose PFV. In addition, her relatives had no previous history of visual impairment.
+At initial visit, the clinical findings of a slit-lamp examination revealed a shallow anterior chamber in both eyes. In her right eye and left eye, the diameter of the cornea was 8 mm and 9 mm and the axial length was 15 mm and 19 mm, respectively, and microphthalmus was observed in both eyes. In her right eye, the fundus was not visible due to a cataract, and ultrasonic B-mode examination revealed total retinal detachment . A magnetic resonance imaging scan of the patient’s head revealed no calcification in the right eye and no abnormalities in her brain. In the left eye, retrolental fibrovascular proliferation was found around the temporal side. The fundus exhibited FRD from the optic disc to the inferior-temporal side . Most of the peripapillary retinal vessels were involved in the retinal folds, and a part of the nasal retina covered-over the optic disc. In the periphery of the fundus, retinal avascular area was observed over the entire circumference, and pigmentation was also observed in a wide range on the temporal side. An oscillating nystagmus was observed in both eyes, and was found to be prominent in the left gaze and less conspicuous in the right gaze when her face was turned to the left.
+During the clinical course, cataract and corneal opacification progressed, ultimately becoming phthisis bulbi in her right eye. On the other hand, from the age of 6 to 22 years, her left eye retained a corrected visual acuity of 0.08, and no significant change of the fundus was observed during that 16-year period . OCT images obtained when she was 22 years of age revealed bundle shading at the optic disc, combined with the finding that the nasal retina was overlaid on the optic disc . However, the layer structure of the surrounding retina was well preserved . On the temporal side of the optic disc, the elevated stalk of the fold protruding into the vitreous was observed at the site of the FRD, yet the upper and lower retinal layered structures were relatively well retained . However, on the temporal peripheral side, the retina was remarkable thinned, the layered structure was unclear, and the ellipsoid zone could not be clearly identified .
+Goldman kinetic visual field examination findings, with an isopter of V− 4, obtained when the patient was 22 years of age exhibited 50-degrees upwards, 40-degrees to the nasal side, 60-degrees downward, 75-degrees to the temporal side, and 80-degrees to the inferior-temporal side . The patient is currently undergoing yearly follow-up observations (i.e., once per year).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1857_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1857_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..228e63903272dd322a4ce0d049ee25b7ca8e300f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1857_en.txt
@@ -0,0 +1,2 @@
+A 71-year-old man with highly symptomatic severe aortic-valve stenosis (AS) and in acute heart failure with pulmonary oedema and dyspnoea was urgently admitted to our Heart Center. Transthoracic echocardiography showed high-gradient stenosis (Vmax 4.4 m/s, ΔPmean 49 mmHg, aortic valve area 0.6 cm2) and reduced left-ventricular function (32%; see , ). Pulmonary hypertension was not documented. He had exertional angina, Canadian Cardiovascular Society Class II, and one syncope. His medical history included hypertension, paroxysmal atrial fibrillation, diabetes mellitus Type 2, chronic obstructive pulmonary disease GOLD III, and multiple prior percutaneous endovascular treatments with stents due to severe peripheral artery disease. At admission, his medical regimen included single antiplatelet therapy, atorvastatin, a beta-blocker, mineralocorticoid receptor antagonist, and bronchodilators. Upon examination, his blood pressure was 170/90 mmHg. Baseline electrocardiography showed sinus tachycardia, left-ventricular hypertrophy with strain pattern, and AV-block first degree.
+He had bilateral crackles at the lung bases and clinical findings of severe symptomatic AS. N-terminal pro-brain natriuretic peptide (NT-proBNP) level at admission was 11 200 pg/mL (normal <125 pg/mL). After initial management with intravenous diuretics and recompensation on our ICU, the patient underwent coronary angiography which revealed no significant coronary artery disease. Invasive assessment of AS showed a peak-to-peak and mean aortic gradient of 133 and 44 mmHg, respectively. Left-ventricular end diastolic pressure was 35 mmHg. Given his comorbidities and surgical risk, he was deemed a candidate for TAVI by our heart valve team. The pre-procedural multi-detector computed tomography revealed unfavourable vessels for transfemoral access from both groins due to multiple prior stenting procedures and due to a severe calcified aortic valve with an aortic annulus perimeter of 76.8 mm and annulus area of 502.3 mm2 . Further calcification of the annulus was excluded. We evaluated the left axillary artery (9 mm) as an alternative access site and found it to be feasible for TAVI (TAx-TAVI; ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1859_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1859_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1541f93f4e74c611ad572a64fe93a65cb598fc50
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1859_en.txt
@@ -0,0 +1,4 @@
+A 22-year-old man presented with leg tremor in standing position for the previous 8 months. This tremor was initially bilateral, but 7 months after development, it subsided in the left leg and persisted only in the right leg. No tremor was evident when the patient was walking, reclining, or in a non-weight-bearing position. He denied any falls and had no unsteadiness. There were no other complaints, and the patient had no significant medical history or family history of tremor.
+On examination, he showed incessant quivering in his right leg while standing, but the tremor disappeared when he was asked to walk, sit, lie down, or lean against the wall for support (Video ). There was no resting or postural tremor of upper limbs. Bilateral tendon reflexes were diminished, and there was no plantar response. Auscultation over the right popliteal fossa while the patient was standing revealed the “helicopter sign”, a sound similar to a helicopter, indicating OT. All other components of neurological examination were normal. Laboratory tests, including routine blood tests, blood biochemistry, vitamin B12, thyroid hormone, rheumatoid factor, antinuclear autoantibody, anti-cardiolipin antibody, and anti-neutrophil cytoplasmic antibody tests, were normal. Furthermore, the tests of the blood and cerebrospinal fluid samples, including tests for anti-paraneoplastic antibodies, autoimmune antibodies and anti-ganglioside antibodies, were all normal. Brain MRI revealed mild, asymmetrical, non-enhancing white matter lesions, mainly in the right frontal and posterior periventricular regions, on T2-weighted imaging . No abnormal signal was found in spinal cord on MRI. Chest CT was normal except for a residual thymus gland. Fluorodeoxyglucose (FDG)-PET was performed, and no abnormal metabolism was identified. Electroencephalography (EEG) was normal. Electromyography (EMG) recorded from the right gastrocnemius revealed a 6–8 Hz tremor, which was present when the patient was standing and disappeared when he was resting or walking , and no abnormalities were found in the left leg. These features were consistent with slow OT.
+Considering the clinical presentation and imaging findings, blood and urine metabolic screening was performed. These tests showed a phenylalanine/tyrosine ratio of 2.06 and a blood phenylalanine level of 140 μmol/L, while there was no phenylalanine in the urine. Whole-exome sequencing with next-generation sequencing (NGS) technology confirmed the presence of a compound heterozygous mutation in c.158G > A and c.728G > A of the phenylalanine hydroxylase (PAH) gene. Pedigree verification showed that the compound heterozygous variants were inherited from the parents as follows: c.158G > A from his mother and c.728G > A from his father. The patient’s final diagnosis was OT secondary to mild HPA.
+Our patient had not received any relevant interventions prior to admission. Based on the above diagnosis, we tried clonazepam (1 mg, qd), carbamazepine (100 mg, qd), and trihexyphenidyl (2 mg, tid) in sequence, but there was no clinical response to these treatments. After discharge, the patient was treated with levodopa/benserazide tablets (250 mg, tid) and a low-phenylalanine diet. One month later, the tremor was markedly alleviated. Three months later, the tremor disappeared .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_187_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_187_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..07fea163428433f8698e541e02c1af94efa1dc1d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_187_en.txt
@@ -0,0 +1,5 @@
+A 53-year old married female, known case of Depressive disorder for the last 02 years on medication with poor compliance presented to our hospital with an alleged history of attempted suicide by ingesting Organo-phosphorous (OP) compound (composition not known) 02 months back. The patient was managed for OP poisoning in ICU following which a psychiatric consult was sought. She gave a month’s history of persistent sadness of mood; loss of interest in previously pleasurable activities, easy fatigability; significantly reduced sleep, appetite, and minimal to none social interactions since around 03 months. She would at times exhibit bouts of anger outbursts without any apparent cause, followed by periods of extreme hypo-activity manifested by sitting alone in a particular posture. Gradually, the symptoms worsened and 5–6 days before she was brought to the hospital, she had become almost mute and would remain confined to her bed. It was observed by her family members that she was mumbling to the self along with hand gesticulations in the air and had to be consistently coaxed for eating/elimination needs. Patient firmly believed that people around her including family members were talking ill about her and were planning to somehow get rid of her. On further probing, patient justified her beliefs by considering herself as a burden on her family members in view of her long-standing non-remitting illness. She also acknowledged thoughts of self-harm as her last resort to put an end to her suffering. Then, on the fateful day, the patient consumed an unquantified volume of rat poison kept in the storehouse with an intent to die. She was found lying on the floor by family members smelling of garlic odour and was then brought to hospital. She gave past history of fracture left forearm with uneventful complete recovery (open reduction and internal fixation under GA) 16 years back. There was no family history of psychiatric illnesses. Personal history was characterized by anxious-avoidant traits with low stress tolerance. There was no history of any substance use in dependent/abuse pattern. On examination, her pulse was 86/min and blood pressure (BP) was 126/88 mmHg. She was ill kempt, had severe psychomotor retardation, mutism, depressed mood with flat affect, depressive cognitions of helplessness and hopelessness along with mood congruent delusions of reference and persecution. She denied any perceptual abnormalities in clear sensorium and had poor insight with deranged biorhythms. Relevant investigations including NCCT head, renal function tests, serum electrolytes, random blood glucose levels, electrocardiogram, liver function tests, and thyroid profile were within normal limits. An impression of a severe depressive episode with psychotic symptoms was made (ICD 10 F32.3). Patients and family members were counseled regarding treatment options and ECT was offered as the first choice, which was declined by patient as well as family members. She was then started on Cap Fluoxetine 20 mg OD along with Tab Olanzapine 5 mg HS and Tab clonazepam 01 mg HS. Her family members were counseled to be on vigilant round the clock monitoring, ensure patients compliance for medication, and a weekly review in the OPD. Patient however, did not show any significant improvement over the next 1 month despite gradually uptitrating her antidepressants and intensive Cognitive behaviour therapy (CBT) sessions. The patient was still having persistent sadness of mood with severe psychomotor retardation, active suicidal intent, and significantly impaired sleep and appetite. She was hence, again offered MECT as a treatment option, which was agreed upon by patient as well as family members.
+The patient was now slated for MECT under general anaesthesia (GA). Pre-anaesthesia checkup (PAC) was done, in which a detailed history of the medications taken and past history was taken. Her son gave a history of OP poisoning a month back (38 days), and it was endorsed in the record. With proper advice, she was accepted in ASA Physical Status II (for mental illness on medication) for MECT under GA.
+The patient was taken up for MECT. The patient had stable hemodynamics. Patient weighed 62 kgs, and was premedicated with Inj Glycopyrolate 0.2 mg, Inj Midazolam 1 mg, Inj Propofol 70 mg and a subminimal dose of Inj Scolene (15 mg, ie < 0.3 mg/kg) due to the prior history of OP poisoning.
+MECT was given by the psychiatrist after complete muscle paralysis with a current constant machine. After GTCS, the patient was oxygenated by bag and mask ventilation. However, the patient did not resume spontaneous breathing even after 10 min. The expected time to return of spontaneous breathing after a full dose of succinylcholine is 9–11 min . Despite the minimal dose of succinylcholine that was administered in this case, and having an adequate time gap since the episode of poisoning (38 days), the patient regained spontaneous breathing only after 3 h. Hemodynamics were stable throughout. Her ABG was done to assess status and all values were within normal limits. On the day of the procedure, there was no ventilator readily available in the ICU to handle this contingency, since such a complication is not anticipated routinely. Hence, the patient was ventilated using an i-gel and bag ventilation with occasional boluses (10 mg) of Inj Propofol. After the patient was fully conscious and regained full sensory and motor function, she was kept admitted for 24 h under observation in the HDU. She was asymptomatic throughout and was discharged the next day. Her psychotropic medications (as mentioned earlier) were continued, excluding Clonazepam. The subsequent 06 MECTs (every third day) were administered using alternative muscle relaxants pancuronium following which she had significant improvement in her mood symptoms without any side-effects/complications. She was then continued on medications along with CBT and was advised weekly OPD reviews with the psychiatrist.
+To rule out any other cause and confirm diagnosis of suxamethonium apnea, her serum butyrylcholinesterase were checked, and the levels were as low as 240 u/l (normal reference range is 5900 and 13,200 u/l) . Dibucaine and fluoride numbers were not analysed (due to lack of testing facility). Her family was also investigated to rule out genetic involvement, and their levels were within normal limits. Patient’s serum salicylate levels were negative, and RFTs were normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1886_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1886_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9f7dfd522c2709f7c2c4a4e9c84129aedec75f92
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1886_en.txt
@@ -0,0 +1,7 @@
+A 63-year-old man was referred to our clinic for primary open glaucoma in both eyes, with an intraocular pressure of 25 mmHg in the right eye despite topic medications (Dorzolamide, Timolol, Travoprost). At the initial visit the anterior segment of the pseudophakic right eye was normal and the best corrected visual acuity was 20/200. The fundus examination showed peripapillary atrophy, glaucomatous neuroretinal rim loss (cup/disk ratio 0,7) and a full thickness macular hole in his right eye. The patient underwent an ab-interno gel stent implantation in the upper nasal quadrant (Xen45, Allergan) after a subconjunctival injection of mitomycin-C (0,1 ml 0,02%). After hydrating the incisions, 0.1 ml of 1% cefuroxime was injected in the anterior chamber and 4 mg/1 ml of dexamethasone phosphate subtenon (Decadron®, Farmaceutici Caber SpA, Italy). Post-surgery care included antibiotic prophylaxis and topical corticoids in decreasing dosage during 1 month. The IOP was 6 mmHg and 10 mmHg in post-operative day 1 and post-operative day 15, respectively. One month after the implantation, the patient underwent retinal surgery in his right eye. The macular hole was successfully closed with a 25-G pars plana vitrectomy (Constellation vitrectomy machine, Alcon Laboratories, Inc., Fort Worth, TX, USA), using the inverted ILM flap technique .
+The surgery was uneventful and subconjunctival dexamethasone was used to minimize inflammation. Topical medication with combined antibiotic and steroid drops was prescribed for 1 week.
+Six days after vitreous surgery the IOP spiked to 25 mmHg, and the anterior segment examination (Takagi TD10 Eye Cam on a Takagi 700GL Slit lamp) showed a flattening of the conjunctival bleb and a translucent clot covering the internal ostium of the XEN. At the AS-OCT (AngioVue®, Optovue, Fremont, CA, USA) the conjunctival bleb appeared flat and non-functional, and the clot stood out as hyperreflective material which we presumed to be fibrin, occluding the internal end of the stent .
+Lysis of the fibrin clot was attempted with YAG-laser (1,1 mJ of power), but the tube remained occluded and the IOP elevated. Therefore, an ab interno revision of the gel stent was performed.
+A surgical procedure was performed according to the following steps after obtaining written informed consent from the patient.After application of topical anesthesia with the usual sterile conditions in the operating room, one paracentesis site was created at 90° with respect to the tube (approx. at 10 o’clock) by using a 15° Knife (Stab 15° Safety Knife, Surgistar, California) Trypan blue (Vision Blue, DORC international, BV Zuidland, Netherlands) was injected into the anterior chamber to stain the clot and to verify the extension of tube occlusion. Viscoelastic was introduced in the anterior chamber and a careful fibrin clot removal was attempted with a 25-gauge inner limiting membrane (ILM) forceps (Revolution DSP 25+ Serrated Forceps, Alcon-Grieshaber, Fribourg, Switzerland); however, the clot was strongly adherent to the tube end, and it did not clear. A second paracentesis site was created at 90° with respect to the Xen tube position (approx.at 4 o’clock), and a 25 G straight vitreous scissors (Revolution DSP 25G Curved Scissors, Alcon-Grieshaber, Fribourg, Switzerland) was inserted to snip the proximal end of the Xen tube (a small segment of about 0,5 mm length), flush to the ILM forceps grabbing distally the tube. The flexible nature of the stent required a two-handed technique in order to both immobilize and truncate the end of the stent. The viscoelastic and the excised tube fragment were then removed, and the AC was irrigated with balanced salt solution (BSS) to induce subconjunctival bleb formation. The drainage efficiency was further verified by trypan blue injection into the AC. Finally, the corneal incisions were closed by hydrosuture.
+In the postoperative day 1, the IOP was 8 mmHg; the anterior segment examination showed an open diffuse filtering bleb, a normal appearing new internal ostium, and a sustained blue staining of the stent . The AS-OCT confirmed a functional, layered, filtering bleb, and the normal appearance and patency of the stent. No side effects from the intervention were observed.
+Topical medication with combined antibiotic and steroid drops was prescribed for 2 weeks. One month after surgery the patient showed IOP =12 mmHg, a visual acuity of 20/40, a patent internal ostium, and an open diffuse filtering bleb.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1901_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1901_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fa829e82c108d60bb231484960b96716508948fd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1901_en.txt
@@ -0,0 +1,5 @@
+A 43 year old female district nurse presented to the accident and emergency department with a 6 hour history of initially generalized abdominal pain which was localizing to the right. This was associated with nausea and loss of appetite, made worse by movement and not relieved with intramuscular morphine injection. There was no history of recent or past trauma to the chest or abdomen. On examination, she was tender in the right upper quadrant and right iliac fossa with rebound and guarding, with a Rovsing positive sign and normal bowel sounds. She was incidentally found to have some marfanoid features including the long span of upper limbs, a high arched palate and the very soft early diastolic murmur of aortic regurgitation. The patient had a positive family history of Marfan's syndrome but had never undergone genetic testing to confirm the diagnosis.
+A likely diagnosis of appendicitis was made on the clinical picture associated with a pyrexia and raised white cell count and C – reactive protein. Her abdominal X-ray at that time showed absence of gas in the right side of her bowel. Her chest X-ray did not show any obvious abnormality She was taken to theatre the same day for appendicectomy through a standard right iliac fossa incision. There was a small amount of free fluid but the right iliac fossa was filled with a normal looking gall bladder and small bowel only with no sign of the caecum, appendix, ascending or proximal transverse colon. The terminal ileum was found to run up under the right lobe of the liver towards the hilum. The right iliac fossa wound was closed and we proceeded to an exploratory laparoscopy.
+At laparoscopy, the liver was retracted to see under the right liver lobe. The proximal transverse colon was found to be running up towards the liver hilum were it felt to be tethered. This suggested a possible herniation of the right colon into the chest. The procedure was abandoned and a CT thorax and abdomen were performed to define the anatomy involved.
+This demonstrated bilateral pleural effusions of moderate size with underlying unexpanded lungs. The liver had what appeared to be a large Reidl's lobe. Behind the right liver lobe, the right kidney was markedly elevated and the ileo-caecal junction appeared to lie between the liver and the kidney. The right side of the colon appeared to lie above the liver. Three dimensional reconstruction of the scans demonstrated absence of the right hemidiaphragm. The symptoms and signs persisted and a laparotomy was performed. At laparotomy, there was some free fluid. There was definitely a large defect in the right hemidiaphragm. The right liver lobe had grown right up into the right intrathoracic space. There was a large hernial sac beneath the right lobe of the liver between the common bile duct, duodenum and liver, displacing the right kidney medially and containing transverse colon, terminal ileum, caecum, appendix and free fluid. The contents of this sac were successfully reduced and a perforated gangrenous appendix with pus was found within the intrathoracic hernial sac. A standard appendicectomy was performed. The right colon was formally mobilized, fully reduced and the caecum was fixed within the right iliac fossa.
+The patient was admitted to the intensive care unit postoperatively where she made a good recovery. She had instant relief of her abdominal symptoms and post-operative contrast study demonstrated the presence of the right colon within the abdomen . She was discharged a week post-operatively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1912_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1912_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9d17981251ba5ffc9af0d0edba2ddf91be38dfd8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1912_en.txt
@@ -0,0 +1,3 @@
+A 22-year-old woman presented with severe allergic conjunctivitis for one and a half years prior to her visit. Her symptoms included itching, foreign body sensation, tearing, and photophobia. Ocular examination revealed thickened lid margins, conjunctival hyperemia with moderate thick ropy discharge, cobblestone-like papillary reaction at the palpebral conjunctiva, and dense punctate corneal epithelial erosion in both eyes . Visual acuity was 20/40 in the right eye and 20/50 in the left eye. Apart from the eyes, she also had erythematous keratotic plaque at flexor areas, which was compatible with atopic dermatitis, and clinical symptoms of allergic rhinitis. She was diagnosed with AKC and was treated with 0.2% olopatadine hydrochloride once a day, 1% preservative-free methylprednisolone 4 times per day, and frequent preservative-free artificial tears. After 1 month of treatment, her condition had not improves; therefore, 20 mg of oral prednisone per day and 1% cyclosporine A twice daily were added. However, we were unable to stop oral and topical steroids due to wax and wane exacerbations for over a year. Her visual acuity varied from 20/25 to 20/70 depending on disease activity, which extremely disturbed her daily living activities. Other allergic conditions, including rhinitis and dermatitis, were well controlled by using oral antihistamine and topical steroids.
+Due to refractory AKC, we referred her to an allergy clinic for considering the role of SCIT. Allergology investigations showed positive skin prick tests to Dermatophagoides farinae (Der f), Dermatophagoides pteronyssinus (Der p), cat hair, and cockroach. The levels of IgE in peripheral blood were 1,636 kUA/L of total IgE, 58.2 kUA/L of specific IgE for Der p (class 5, strongly positive), 45.2 kUA/L of specific IgE for Der f (class 4, strongly positive), 0.51 kUA/L of specific IgE for German cockroach (class 1, weakly positive), and <0.35 kUA/L of specific IgE for cat (negative).
+According to the positive results of skin prick tests and serum-specific IgE in this patient, conventional SCIT for Der f and Der p was performed by using standardized Der f and Der p commercial extracts (ALK Laboratories, Port Washington, NY, USA). The conventional protocol for SCIT started with 0.1 mL of 10 AU/mL of each allergen extract, then the treatment dose was adjusted weekly until it reached the monthly maintenance dose at 0.5 mL of 1,000 AU/mL of each allergen extract within 12 weeks. The ocular symptoms and signs were significantly improved in terms of lid inflammation, conjunctival reactions, and punctate epithelial erosion on the corneas 2 months after initiation of SCIT, as shown in Figure . We were able to taper the patient off oral and topical steroids within 3 months and maintained with topical mast cell stabilizers and preservative-free tears, without any episodes of exacerbation. Her vision was maintained at 20/40 in the right eye and 20/50 in the left eye. Moreover, her skin and nasal conditions gradually improved. No adverse effects were noted during SCIT.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1950_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1950_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6fe3b74a1fc299b63d956a990db10cac67aff67c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1950_en.txt
@@ -0,0 +1 @@
+A 76-year-old Chinese man was admitted with 1-month history of sudden onset of chest tightness. A month previously, the symptom started while he was doing exercise. It was associated with diaphoresis and shortness of breath, without chest pain. The resting 12-lead electrocardiogram (ECG) showed abnormal Q waves in leads II, III, and aVF, and the cardiac troponin T was elevated. He was diagnosed as having ACS and was treated at a local hospital. Owing to the fact that the hospital was unable to perform coronary angiography (CAG), the patient was discharged home several days later on aspirin (100 mg qd), clopidogrel (75 mg qd), metoprolol (12.5 mg qd), and rosuvastatin (10 mg qn). On admission to our hospital, the patient still had a mildly elevated level of high-sensitivity cardiac troponin T (21.58 ng/L). His initial ECG showed abnormal Q waves in the inferior (II, III, and avF) leads , which may indicate subacute inferior MI. His routine blood test was normal, including a platelet count of 201 × 109/L and a white blood cell count of 5.86 × 109/L. He had no history of blood dyscrasia and denied any history of smoking or drinking. The patient underwent CAG in our hospital after admission. CAG revealed evidence of left main (LM) and three-vessel coronary artery disease . Low-dose heparin (2000 units) was given during the procedure. We consider the optimal revascularization technique for this patient to be coronary artery bypass graft (CABG) surgery and did not perform PCI. However, the patient decide to be treated with PCI rather than CABG. Four days later, CAG was performed again; multivessel coronary intervention was performed with drug-eluting stents and drug-coated balloon. The procedure lasted for about 2 hours, and the dose of heparin given was 6500 units. After the procedure, the patient was transferred in stable condition to the ward and treated by intravenous tirofiban at 0.15 µg/kg/minute. Post-PCI medications included aspirin 100 mg qd, clopidogrel 75 mg qd, metoprolol succinate 12.5 mg qd, rosuvastatin 10 mg qn, and benazepril 5 mg qd. A blood sample was obtained for a complete blood count 4 hours after the procedure, according to routine orders at our hospital. His platelet count was 21 × 109/L, which was confirmed by manual examination of the blood film. The patient’s hemoglobin level was 119 g/L. Tirofiban infusion was stopped by 4 hours, and other antiplatelet drugs including aspirin and clopidogrel were immediately discontinued. A heparin-induced thrombocytopenia (HIT) platelet factor 4 antibody test was performed, and the result was negative . Over the next 12 hours, the patient received 10 unit platelet transfusions to prevent hemorrhage, and his platelet count had increased to 49 × 109/L. Another analysis completed later indicated that his platelet count was 37 × 109/L. Additionally, immunoglobulin G (10g) was given. Aspirin and clopidogrel were resumed the next day, and the patient received another 10 unit platelet transfusions. Two days later, the patient’s platelet count had increased to 75 × 109/L. The course of the patient’s platelet count is shown in Fig. . There was a significant improvement after day 5, and the platelet count was 112 × 109/L. Seven days after the acute profound thrombocytopenia, his platelet count was 138 × 109/L, and he was discharged with no hemorrhagic sequelae.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1955_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1955_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eef865558114e02d3135ef3d1b4ab37a6647d2ab
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1955_en.txt
@@ -0,0 +1 @@
+A 4-year-old girl was admitted to Instituto de Pediatria e Puericultura Martagão Gesteira, Universidade Federal do Rio de Janeiro, Brazil, in March 2010, due to recurrent infections and severe neutropenia. The main clinical events and laboratory tests performed were summarized in a timeline of 12-year follow-up . At admission, peripheral blood (PB) analysis showed: hemoglobin 9.8 g/L, platelet count 234 × 109/L, and white blood cell count (WBC) 6.9 × 109/L with neutrophils count: 0.56 × 109/L. The bone marrow (BM) presented: hypocellularity with a granulocytic maturation arrest and micromegakaryocytes without fibrosis. BM immunophenotyping using the EuroFlow panel and settings showed granulocytic maturation blocked with the absence of CD10 expression in mature neutrophils, together with CD13 and CD64 overexpression in promyelocytes and in the whole granulocytic maturation, respectively. Further, both monocytes and neutrophils abnormally expressed CD56 . The cytogenetic analysis by G-banding and fluorescence in situ hybridization showed: 46,XX,t(3;8)(p26;q21)c [25] (A). The patient was classified as cMDS with low blasts (cMDS-LB) . Prophylactic antibiotic therapy with amoxicillin was initiated in May 2010. In April 2013, the patient had <100 neutrophils and started granulocyte colony-stimulating factor (GCSF), which sustains neutrophil levels. In 2014, the patient had clinical worsening with marked hypoplasia of all hematopoietic lineages, a decrease in G:E ratio (2:1) with megaloblastic changes in erythroid cells lineage, and the presence of micromegakaryocytes. Immunophenotyping showed: granulocytic and erythroid maturation blocked and excess of blasts (5.4%) featuring a cMDS with an increased blast (cMDS-IB). Progressively, clinical evolution had been getting worse with very severe neutropenia (<0.2 × 109/L) without response to GCSF. In 2018, the patient had granulocytic maturation with intense blockage, more erythroid cells, dysplastic megakaryocytes, and 8% of myeloid blasts, characterizing the progression of the disease. At this time, allogeneic hematopoietic stem cell transplantation (aHSCT) was indicated. Then, search in the family identified the father as a donor for aHSCT. Nevertheless, he also has the t(3;8)(p26;q21)c change. A search for an international donor found an unrelated donor, but he was not available. During this period, when we were at the peak of the COVID-19 pandemic, the patient began to show clinical improvement and the stabilization of the number of blast cells. Since 2020, the patient has had no clinical complications and continues to use G-CSF. The patient had the stabilization of the blast cells count through the sequential bone marrow’s analysis. Since 2020, the patient has had no clinical complications. In 2022, the hemogram showed: hemoglobin 12.4 g/L, platelet count 242 × 109 L, and WBC 4.47 × 109 L. The patient remained under observation and using G-CSF and clinical follow-up semi-annual. No changes in the BM analysis were in the scheme of “watching and waiting” for a possible HSCT.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1976_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1976_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5d143b854d634527830dbe1fa37650a0277483a1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1976_en.txt
@@ -0,0 +1 @@
+Our patient is a nonsmoker, 73-year-old male who came to our attention after presenting to a medical outpatient clinic with the chief complaint of right shoulder pain with a 2-week duration. The patient describes his pain as excruciating in nature, mostly occurring at night and awakening him from sleep. He experienced two episodes of the same complaint lasting about 3–5 days in the last 6 months, both with spontaneous resolution. Nowadays, the patient is seeking medical attention due to the persistence of the pain without any improvement. He mentioned that he is consuming large and frequent meals of red meats and some kinds of seafood such as tuna. Past medical history is positive for controlled hypertension, diabetes mellitus, and mild chronic kidney disease. The patient reported no personal and/or family history of cancer, any acute, repeat, or discontinued medications, any allergies, autoinflammatory diseases, any genetic or psychosocial issues, and a significant past surgical history for coronary artery bypass graft. He denies any history of trauma in general or specifically to the shoulder. Upon admission, the physical assessment was unremarkable except for right shoulder pain and tenderness with movement in the absence of redness, swelling, and hotness. Laboratory evaluation revealed C-reactive protein of 111 mg/l (normal range 0–10 mg/l), erythrocyte sedimentation rate of 122 mm/h (normal range 0–15 mm/h), blood urea nitrogen of 32 mg/dl (normal range 8–23 mg/dl), creatinine of 1.4 mg/dl (normal range 0.7–1.2 mg/dl), uric acid of 15 mg/dl (normal range 3.7–7.1 mg/dl), and a normal white blood cell count. Radiological imaging of the right shoulder was normal. An arthrocentesis was performed, and analysis of the aspirated synovial fluid revealed the presence of yellow needle-shaped monosodium urate crystals under a light microscope along with a white blood cell count of 2500 cell/μl. A diagnosis of gout with right shoulder involvement was established. The patient was prescribed prednisolone 40 mg/day for 10 days, allopurinol 300 mg/day, and colchicine 0.5 mg/day. The patient was followed up for 6 months with significant improvement. The patient also had a good tolerance for pharmacological agents without any reported complications or adverse events.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1992_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1992_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6d9daa760ea7c1e6f2b22932f430921020212206
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1992_en.txt
@@ -0,0 +1,11 @@
+A 26-year-old woman was admitted to the emergency department due to intense headache, chest discomfort, palpitations, and breathlessness, with 4 h of evolution.
+Physical examination showed tachypnoea, tachycardia (145 b.p.m.), blood pressure of 158/95 mmHg, no fever, and oxygen saturation on room air of 92%. Cardiac auscultation was normal but pulmonary auscultation revealed bilaterally dispersed crackles. She was pale, with cold and clammy extremities and decreased capillary refill time but peripheral pulses were easily palpable.
+The patient had a personal history of migraine and had been submitted to periodontal surgery on the previous day. She was medicated with amoxicillin/clavulanic acid and prednisolone. No relevant family history was reported.
+The electrocardiogram (EKG) revealed sinus tachycardia, left axis deviation, V4–V6 ST-segment depression, maximum 2 mm at V5, and an inverted T wave in aVL .
+Transthoracic echocardiography showed severe LV systolic dysfunction with midbasal segments akinesia and hypercontractility of the apical segments (, , Video S1).
+The patient underwent aortic computed tomography angiography that excluded an acute aortic syndrome, but identified signs of severe pulmonary oedema and two heterogeneous solid masses in both adrenal glands, the largest on the right adrenal gland, measuring 9.2 × 9.2 × 10.8 cm, suggestive of a bilateral pheochromocytoma .
+The patient progressed with respiratory failure and shock signs with poor peripheral perfusion, oligoanuria, and arterial hyperlactacidemia (41 mg/dL; normal range≤ 18 mg/dL), despite her hypertensive profile (mean arterial pressure 110–120 mmHg). At this stage, she was submitted to mechanical ventilation. Due to the rapidly deteriorated clinical status, she was referred and transported to the closest hospital with extracorporeal membrane oxygenation (ECMO) capability for immediate mechanical circulatory support.
+The patient remained with veno-arterial ECMO (VA-ECMO) support for 14 days and progressive recovery of LV dysfunction was observed, enabling the weaning of the VA-ECMO support from the 10th day, without use of inotropics. There were no significant changes on the EKG on the following 2 days, with regression of repolarization changes at follow-up. The peak troponin I level was 1.73 ng/mL (normal range ≤0.015 mg/dL), on the first day of hospitalization with a slow but progressive fall and subsequent normalization.
+Urinary catecholamines and metanephrines in 24-h urine were elevated . Alpha-blockade was started with phenoxybenzamine and subsequently beta-blockade with metoprolol.
+On the 35th day of hospitalization, open bilateral adrenalectomy was performed, without complications, and she began supplementation with gluco and mineralocorticoids. Anatomopathological examination confirmed the diagnosis of bilateral pheochromocytomas. The patient was discharged on the 49th day of hospitalization with complete recovery of the left ventricular systolic function and preserved neurologic status.
+After discharge, the patient performed body scintigraphy with MIBG-123 that excluded pheochromocytoma metastases or synchronous tumours, but she was diagnosed with bilateral thyroid medullary carcinoma. Total thyroidectomy was performed and the diagnose of Type 2 multiple endocrine neoplasia (MEN) syndrome was established.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2007_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2007_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ae5ea5dfcd78c3789d45a3ac204bdcb685de1cce
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2007_en.txt
@@ -0,0 +1,4 @@
+The first donor was a 40-year-old man who suffered brain death due to intracranial hemorrhage after a traffic accident. His terminal serum creatinine level was 0.8 mg/dL and his Kidney Donor Profile Index score was 27%. The first recipient was a 45-year-old man with a 20-year history of hypertension and end-stage renal disease (ESRD) due to hypertensive nephropathy, who had received regular hemodialysis for 2 years. In June 2005, at another hospital, single renal transplantation was performed in the right iliac fossa, with a cold ischemia time of 5 h 10 min and a warm ischemia time of 1 h 48 min. After reperfusion, the recipient immediately passed urine. He was administered an immunosuppressive regimen comprising methylprednisolone, cyclosporine, everolimus, and mycophenolate mofetil, and he was discharged 10 days after the transplantation with a serum creatinine level of 1.4 mg/dL. At regular follow-up over the next 6 months, his serum creatinine levels remained within the normal range.
+Over the following 9 years, the recipient showed no episodes of rejection, and his serum creatinine levels and creatinine clearance rates were within the normal ranges . In 2010, he underwent coronary percutaneous angioplasty and stent placement for coronary artery disease, and thereafter he regularly took aspirin. However, in June 2014, he suffered a right cerebral aneurysm rupture that resulted in brain death. At that time, his serum creatinine level was 0.94 mg/dL and the creatinine clearance rate was 90 mL/min. Before his death, the patient (while completely conscious) and his family had expressed a wish for his organs to be donated; we therefore harvested the transplanted kidney for reuse.
+The second recipient of the kidney was a 40-year-old man with ESRD caused by diabetic nephropathy, who had been undergoing hemodialysis for 5 years and had been added to the waiting list for renal transplantation at that time. His blood group was the same as that of the initial donor and the first recipient (A rhesus positive). There were four human leukocyte antigen mismatches with the original donor and two with the second donor . Crossmatching with the initial donor was not possible because of the long time that had elapsed since the initial transplantation, but crossmatching with the second donor was negative. A biopsy demonstrated the quality of the donated kidneys: the Remuzzi score was 1 and the Kidney Donor Profile Index score was 74%.
+Kidney transplantation was performed in June 2014, with a cold ischemia time of 4 h 12 min and a warm ischemia time of 1 h 12 min. After transplantation, the recipient was administered an induction immunosuppressive regimen comprising basiliximab, high-dose methylprednisolone, and cyclosporine, subsequently shifted gradually to a maintenance immunosuppressive regimen comprising prednisolone, tacrolimus, everolimus, and mycophenolate mofetil. The second recipient was discharged 13 days after the transplantation, and his serum creatinine level was measured at follow-up every 3 months. As of June 2018, his renal function has remained stable, with a serum creatinine level of around 1.24 mg/dL . There have been no episodes of rejection, and the patient has remained in a good clinical condition.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2028_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2028_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b4df5cb8b84e0c6c5b506089bd36ffa91e5a3460
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2028_en.txt
@@ -0,0 +1,5 @@
+A 64-year-old man visited our eye clinic with a two-day history of decreased visual acuity in his right eye. The patient presented with a medical history of hypertension and diabetes mellitus. He stated that his vision had gradually worsened in recent days.
+At the initial visit, his best-corrected visual acuity was 20/125 in the right eye and 20/25 in the left eye, and intraocular pressures were 18 mmHg and 13 mmHg, respectively. Slit-lamp examination demonstrated mild hyperemia and keratic precipitates. The eye also showed inflammation in the anterior chamber and anterior vitreous, which was scored as grade 2+ and grade 1+ according to the Standardization of Uveitis Nomenclature Working Group guidelines . Fundus examination of the right eye showed multiple and diffuse white-yellowish infiltrations combined with retinal dot hemorrhages in the peripheral retina . The left eye was completely normal. Ultra-wide-field fluorescence angiography showed obstructive retinal arteritis with peripheral non-perfusion and late leakage from the retinal vessels in the right eye .
+The patient was hospitalized for further evaluation and appropriate management. Basic laboratory test and serology study were performed. The serological tests were positive for HSV type 1 immunoglobulin G (IgG), VZV IgG, Epstein-Barr virus viral capsid antigen IgG, and Toxoplasma-specific IgG antibodies. Anterior chamber paracentesis and PCR analysis of the aqueous humor have been performed. VZV DNA was identified in the aqueous humor. But, DNA for HSV-1, HSV-2, and cytomegalovirus was not detected. Given the impression of VZV associated ARN, treatment was started with intravenous acyclovir (1200 mg three times a day). Oral prednisolone (1 mg/kg/day) was also started 24 h after systemic acyclovir treatment.
+After 3 days of the above treatment, slit-lamp examination revealed 3+ cells in the anterior chamber, 2+ cells in the anterior vitreous, and increased vitreous opacity (grade 2) in the right eye. On the fundus examination, the multiple whitish infiltrations were increased and newly developed vitreous and peripapillary hemorrhages were detected in the right eye . At that time, the patient had symptoms of headache. T2-weighted MRIs of the brain performed to find the cause of the atypical ARN demonstrated a sub-acute or old hemorrhagic infarction in the right occipital lobe, and contrast-enhancing lesions in the right basal ganglia . The spinal tapping was performed in the department of neurology in our hospital at the time when the patient complained of headache, and intracranial pressure was 31 mmHg. This suggests that the possibility of Terson’s syndrome due to suddenly increased intracranial pressure in this case .
+In view of the patient’s clinical features, immune status, and brain images, he was diagnosed as having VZV-mediated ARN with Terson’s syndrome. On day 5 of the admission, the patient’s visual acuity was reduced to counting fingers at 50 cm in the right eye. Retinal infiltration and vitreous hemorrhage were increased. Therefore, we started intravitreal injections of ganciclovir (2 mg/0.5 mL). After 5 intravitreal injections (from the 5 to 15 day of the admission), the multiple white-yellowish infiltrative lesions and retinal dot hemorrhages were decreased, and visual acuity increased to 20/800 in the right eye. The vitreous and peripapillary hemorrhages were also markedly decreased compared with the initial status of the ARN. After 20 days of intravenous antiviral therapy, the patient was discharged on oral valacyclovir, 1000 mg twice a day, combined with an oral prednisolone (tapering dose, 0.5 m/kg/day). After 5 intravitreal ganciclovir injections over a period of 8 months, there was no recurrence in the patient’s right eye, in which his visual acuity had improved to 20/60 . The contralateral eye remained normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2030_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2030_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6c0f8cebf5c74f824205a002271f46d287208bb9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2030_en.txt
@@ -0,0 +1,5 @@
+A boy aged 5 years and 4 months, with a height of 101.2 cm and weight of 15.1 kg, was scheduled for circumcision under general anesthesia to treat true phimosis. He had a history of chronic granulomatosis and had undergone allogenic bone marrow transplantation when 4 years old. Over the course of treatment, he had general anesthesia five times using propofol and remifentanil and experienced no postoperative nausea. He also had no family history of PONV. The preoperative examination was otherwise unremarkable, aside from chronically slightly elevated AST (46 IU/L).
+The patient was admitted to the operating room without premedication. Slow induction with sevoflurane and nitrous oxide was performed, and after intravenous access was established, intubation was performed using a supraglottic device. Anesthesia was maintained with oxygen, air, 0.9–1.1% of sevoflurane, and 0.4–0.5 mcg/kg/min of remifentanil during surgery. Sacral epidural anesthesia with 1ml/kg of 0.2% ropivacaine and 15mg/kg of intravenous acetaminophen was administered for postoperative analgesia. The operation time was 1 h and 2 min, and the anesthesia time was 1 h and 43 min.
+The patient complained of nausea in the PACU and was administered 0.1mg/kg of ondansetron. After the nausea resolved, he was transferred to the general ward.
+The patient was able to drink water at 1 h and 2 h after transfer to the ward, but intravenous infusion was continued because he did not feel well enough to eat dinner. He vomited after breakfast the following day and complained of continued nausea. Discharge to home was postponed, and 0.1mg/kg ondansetron was re-administered—23 h had elapsed since the first dose in the PACU. Thirty minutes after re-administration, he became drowsy and showed only a slight response to stimulation, scoring 5 on the Ramsay sedation scale. Since vital signs were stable with no respiratory depression or need for oxygen, follow-up was continued in the ward with a pulse oximeter.
+Three hours after re-administration, the patient recovered to a score of 3 on the Ramsay sedation scale. He could have water without nausea or vomiting. He was discharged later on the same day at the strong request of his guardian. Because the drowsiness improved spontaneously, no additional testing was performed. After discharge from the hospital, he was able to have meals as usual, and drowsiness was not observed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2034_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2034_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..951d1724e69f9143847713daf4a144a070cd5663
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2034_en.txt
@@ -0,0 +1,6 @@
+This 38-year-old female patient, with a body mass index (BMI) of 13, had suffered from progressive lower abdominal pain and intermittent fever for 3 months. She also had lost 32 kg of her body weight within 5 years. This time, the patient complained of progressive watery diarrhea for 2 weeks, and then visited our emergency department in November 2018. Due to her history of hyperthyroidism, she was first treated for a thyroid storm, and then admitted for further investigation due to her normal thyroid function.
+The patient’s history of past illness includes an episode of esophageal ulcer, 33–38 cm level from the incisor, diagnosed in December 2017, status post proton pump inhibitor treatment, complicated with stricture in March 2018, status post endoscopic dilatation in August 2018 . Pathologist found granulation tissue with acute and chronic inflammation with necrotic tissue. Besides, she also had hyperthyroidism under methimazole use since 2002 and history of coronary arterial disease, one vessel disease, right coronary artery, status post two bare metal stents and one drug-eluting stent insertion in January 2016 and February 2017, under aspirin use.
+After admission, physical examination found lower abdominal tenderness and tympanic sound to percussion, but no peritoneal signs. Laboratory survey revealed white blood cell count of 17,600/μL, segment 86%, myelocyte 0.5%, band 1%, lymphocyte 7%, monocyte 5.5%, hemoglobin 5.1 g/dL, platelet count 79,5000/μL, alanine aminotransferase (ALT) 9 U/L, sodium (Na) 127 mEq/L, potassium (K) 3.2 mEq/L, C-Reactive protein (CRP) 122.3 mg/L, free-T4, 0.91 ng/dL and thyroid-stimulating hormone (TSH)1.159 uIU/mL. Tests for cytomegalovirus (CMV) DNA, Epstein-Barr virus (EBV)- viral capsid antigen (VCA) IgM, human immunodeficiency virus (HIV) antibodies (Ab), amebic Ab, and cultures for Salmonella, Shigella, Campylobacter and pus cells in the stool were all negative. Positive CMV IgM, CMV IgG, EBV-VCA IgG and occult blood were noted. Computed tomography (CT) revealed wall thickening over the ascending colon, cecum and terminal ileum , a suspicious terminal ileal perforation tract with a thick enhanced wall and irregular shaped fluid and gas collection with a thick, enhanced wall, extending from the upper to the lower peritoneal cavity and cul-de-sac, which measured up to 14 cm . Antibiotic treatment with piperacillin/ tazobactam was then administered and CT guided drainage was arranged. Ganciclovir IVF was also prescribed from 2nd December 2018 to 17th January 2019 due to the CMV IgM positive, DNA negative finding. Abscess culture grew Enterococcus faecium and Candida glabrata. Antifungal treatment with anidulafungin was prescribed from the 7th December 2018 to 24th January 2019. A colonoscopy showed deep ulcers over the ileocecal valve (ICV) and proximal A-colon with ICV stricture . The pathologist noted ulcers, and the remaining mucosa showed crypt branching, crypt shortening, and pyloric metaplasia. This was compatible with Crohn’s disease with a negative immunohistochemistry for CMV, which was performed with a monoclonal antibody directed against the CMV pp65 antigen (Novocastra™ lyophilized mouse monoclonal antibody; Leica Microsystems, Wetzlar, Germany). This led to a diagnosis of Crohn’s disease with a Montreal classification of A2L3L4B2B3, a Crohn’s disease activity index (CDAI) of 623 points and a Harvey–Bradshaw Index (HBI) of 22 points. After infection control, oral prednisolone 20 mg/D and azathioprine 25 mg/D were prescribed. We stopped the azathioprine treatment due to nausea and vomiting side effects. The patient was discharged with oral prednisolone 20 mg and oral levofloxacin in January 2019. One month later, she complained of stool-like discharge from the vagina. A fistulogram through the vagina revealed peritoneal space to rectal and vaginal fistulas .
+The final diagnosis was Crohn’s disease, with a Montreal classification of A2L3L4B2B3, which was complicated by an esophageal ulcer with stricture and chronic terminal ileal perforation with peritoneal space to rectal and vaginal fistulas.
+The patient received surgical resection of the cecum, terminal ileum and chronic perforated tract over the terminal ileum, and ileo-colostomy side to side anastomosis and an end-ileostomy on the 1st April 2019. The pathologist noted that the entire specimen measured 9.5 × 8.0 × 5.5 cm. The intestine showed ulceration, pseudopolyps, and a fistular tract surrounded by purulent exudate . These microscopic findings were compatible with the diagnosis of Crohn’s disease . She had no more stool like material passing out from her vagina 1 week later. The patient was prescribed vedolizumab treatment with standard induction and maintenance dose (300 mg in 0th week, 2nd week, 6th week, and then every 8 weeks) on the 24th April 2019.
+In July 2019, the patient underwent colonoscopy examination, which only showed mild inflammatory activity over the blind end, and a lower gastrointestinal (LGI) series also noted no more fistula. Closure of the end-ileostomy with an end-to-side ileo-ascending-colon anastomosis was performed in August 2019. A lower gastrointestinal tract X-ray examination was arranged, which revealed no remaining fistula or obstruction . The patient regained 23 kg of body weight, with her BMI increasing from 13 to 22. Her CDAI dropped from 623 to 4 points and her HBI fell from 22 to 0 points.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2039_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2039_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..233d0cc14373caa4bbd723ecce520098dc202f33
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2039_en.txt
@@ -0,0 +1,3 @@
+A 25-year-old male presented to an outside emergency department (ED) with a five-day history of cough, shortness of breath, nasal congestion, fatigue and loss of taste and smell. He had a past medical history of asthma and morbid obesity (BMI 50.5 kg/m2). The patient had no known connective tissue disease or hypertrophic scarring reactions. He had a 2-year history of vaping but states he quit one month prior to presentation. Sick contacts include a brother and his mother who tested positive for COVID-19 four days prior. He had a positive COVID-19 test three days prior to admission. In the ED, he was hypoxic to 88% on room air and tachycardic at 133 bpm. He improved to 90% saturation on 3 L nasal cannula (NC). Venous blood gas revealed normal venous pH of 7.4 and increased PCO2 of 50. Chest x-ray (CXR) revealed bilateral airspace disease consistent with known COVID-19 infection. He was admitted to the MICU and treated with Remdesivir and high dose steroids. He became febrile to 102.9 F, tachycardic to 134 bpm, tachypneic to 28, and required 15 L O2 via high-flow nasal cannula. D-dimer was normal at 0.28. His respiratory status continued to decline over the night of admission, requiring BiPAP with a minute volume of 25 L and respiratory rate of 40. Due to worsening respiratory distress and persistent hypoxia, despite aggressive respiratory support, the patient required intubation.
+He was started on ceftriaxone and azithromycin due to SIRS criteria and an elevated procalcitonin. Ferritin and C-reactive protein were mildly elevated, but not unlike what is seen in most COVID patients. Oxygen saturation was 92% on 100% Fi02 via ventilator. Repeat CXR revealed diffuse bilateral interstitial infiltrates. A SARS-COV-2-IGG antibody was non-reactive, and he received a transfusion of convalescent plasma. Oxygen saturation was 53% despite maximal ventilatory support and he was transferred to our institution for ECMO consideration.
+Upon arrival, the patient went from the heliport directly to the hybrid operating room where he underwent unremarkable cannulation with no repositioning required, and initiation of veno-venous ECMO with a 32 Fr Crescent™ double lumen cannula (Medtronic, Inc, Minneapolis, MN, USA) under transesophageal echocardiographic (TEE) and fluoroscopic guidance. There was a single attempt with no repositioning required. No upper body central line was present in juxtaposition with the VV-ECMO cannula. AP CXR is shown in Fig. following ECMO cannulation. The patient was supported on V-V ECMO for 14 days at which time he was able to be weaned gradually from the circuit for bedside decannulation on POD 16. He was maintained on heparin for anticoagulation and chart review of unfractionated heparin lelvels showed that he was never subtherapeutic. Attempts to remove the cannula at the bedside failed due to immobility of the cannula. Ultrasound of the right neck was unremarkable, so he was taken to the hybrid OR where both TEE and fluoroscopy were unrevealing. A longitudinal cutdown from the insertion site proceeding caudally was performed to expose the internal jugular vein. The cannula was freely mobile to the level of the first rib and clavicle and was not obstructing the vein. An upper sternotomy, confined to the manubrium, was performed and the superior vena cava and proximal jugular vein were dissected revealing a 2 cm segment of the distal SVC and proximal jugular vein that was densely sclerosed and adherent to the cannula. Proximal and distal control of the vasculature was established, and the vessel was opened across the adherent area at the level of the innominate vein. The cannula was then able to be withdrawn without difficulty. There was no evidence of thrombosis, scarring or local inflammation at the site of cannula adhesion. The distal SVC was repaired to the level of the innominate vein entry to the SVC to ensure good drainage, however, due to the severe sclerosis and damage to the jugular above the innominate, the vein was ligated proximally and distally. Post-op CXR is shown in Fig. . The patient suffered no ill effects and had an unremarkable recovery to discharge. Clinic follow up has also demonstrated no sequalae or serious adverse events. The Crescent catheter was examined by pathology at our institution and then returned to the company, neither found any defects. At our institution, we use Avalon, Crescent and ProTek Duo cannulas and have never experienced adhesions with any of the cannulas.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2040_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2040_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f069cb3d2d85df11a7645e2af79234d62e13b512
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2040_en.txt
@@ -0,0 +1,3 @@
+A 43-yr-old, 66 kg, 175 cm man was to undergo gastrectomy for a tumor in the stomach. He had no history of hypertension, myocardial infarction,or angina pectoris,but with a smoking history(10 packs year).His physical examination was normal. Preoperative resting electrocardiogram (ECG) and echocardiogram(UCG) were within normal limits. Laboratory data revealed no abnormalities.
+No premedication was given. After the patient,s arrival in the operating room, intravenous access was established. Lead II and V5 of the ECG were monitored. Blood pressure (BP) was 128/70 mmHg and heart rate(HR) 75 beats/min. An ultrasound-guided subcostal TAP block was performed bilaterally . Each hemi abdomen was injected with 20 ml 0.3% ropivacaine to give a dual block from T6-T9. TAP block was uneventful without heart rate and blood pressure variations. After 30 min, general anesthesia was induced, then it was maintained with sevoflurane inhalation, target controlled infusion (TCI) remifentanil and given sufentanil and cisatracurium intermittently. The patient was mechanically ventilated with a tidal volume of 500 ml and respiratory rate of 10 breaths/min to maintain PetCO2 at 35–40 mmHg under end-tidal CO2 monitoring. Arterial BP was continuously monitored via a left radial artery catheter.
+Two hours after start of the operation, when the surgeons were dissecting para gastric lymph node, ST segment elevation in lead II was noted and lead V5 showed no abnormalities. The change recovered abruptly without treatment 30 s later. When it happened, SpO2 was 100%, end-tidal sevoflurane concentration was 1.3% and no obvious hemorrhage. Except for this, the patient,s course during 4 h of operation was uneventful: BP was about 100/70 mmHg, HR about 70 beats/min, body temperature about 36.5 °C and estimated blood loss was less than 300 ml. Four hours after start of the operation, the arterial BP was 88/55 mmHg and aramine 0.4 mg was given intravenously. The BP increased to 110/65 mmHg without HR change. Approximately 5 min later, the ECG showed premature ventricular contractions and a marked ST segment elevation again . Ventricular tachycardia and fibrillation were subsequently noticed with BP decreased to 32/14 mmHg, and electric defibrillation was initiated with repeated infusions of epinephrin. Within approximately 2 min, the ECG returned to sinus rhythm and BP gradually to normal. The patient remained hemodynamically stable for the remainder of the operation. Following the operation, he was transferred to the cardiac care unit (CCU) in our hospital. Serial ECGs and cardiac enzyme studies showed no abnormalities, thus ruling out myocardial infarction and CAS was diagnosed. The patient suffered no further cardiac attacks during his hospital stay. Consent was obtained from the patient to publish this case report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2041_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2041_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bd828e95abd8932172b2f131dc05d06670740c15
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2041_en.txt
@@ -0,0 +1,6 @@
+A 41-year-old man (height, 178 cm; weight, 58 kg) with no medical history was admitted to the emergency unit on foot complaining of severe right inguinal pain. A right inguinal bulge was noted, and there was no lower limb edema. CT showed bilateral common iliac aneurysms , and the internal iliac artery had a maximum diameter of 8 cm . An AVF was not detected on CT, and chest radiography did not show heart or lung disorders. Emergent laparotomy was planned for the aneurysm rupture.
+Preoperatively, his arterial pressure was stable with a systolic pressure of approximately 100 mmHg; however, there was a characteristic hemodynamic change , with pressure shifting between 95/48 mmHg and 85/25 mmHg for one or two heartbeats out of five beats, with normal sinus rhythm.
+Anesthetic induction was successful. The detection of high central venous pressure (CVP) coincidently with reduction of arterial pressure indicated the presence of an AVF. During the surgery, his systemic hemodynamic condition worsened . The CVP was initially 9 mmHg; however, it increased to 20 mmHg. His arterial pressure shifted frequently, and it reached a plateau of 60/50 mmHg. Urgent laparotomy and impetuous aortic clamping resulted in quick hemodynamic recovery, and the CVP reduced to approximately 6 mmHg. The right common iliac artery aneurysm showed a communication with the right common iliac vein. Therefore, he underwent aortobifemoral graft replacement, and no complications were noted. Postoperatively, he was not diagnosed with any connective tissue disorders, such as Ehlers-Danlos syndrome and Marfan’s syndrome.
+We presented a case of acute aneurysmal rapture into the iliac vein. Sometimes, a definite diagnosis of an AVF associated with a SIA is difficult preoperatively because there might not be enough symptoms and time for diagnosis . An AVF associated with an AAA has the following triad of symptoms: congestive heart failure, continuous abdominal bruit, and a pulsating abdominal mass ; however, these symptoms are noted in only 20–50 % of reported cases . An AVF associated with a SIA might show lower limb edema as an additional feature; however, many cases do not have hemodynamic symptoms [–]. Definite diagnosis of an AVF offers advantages for surgical and anesthetic management.
+Arterial pressure shifts rarely occur in a clinical situation. In the present case, these shifts indicated that an AVF was present and that the shunt was about to having a high flow. These hemodynamic changes could be explained by pooling of the transient increased shunt flow to a high-capacitance venous circuit and a decreased in preload, which can produce low arterial pressure at the next heartbeat. Simultaneously, an increase in venous return raised the blood pressure following a downward shift in the blood pressure. We hypothesized that the mechanical compression of a huge aneurysm should occlude the AVF and the fistula would appear by changing of lower limb posture, high blood pressure, or pulse of the aneurysm itself. The shift disappeared during the operative preparation, indicating that shunt dilation due to anesthetic agents and muscle relaxants decreased peripheral resistance, including aneurysmal compression at the vein.
+CT has been recommended to determine the subtypes, sizes, and complications of aneurysms [, –]. CT can contribute to the detection of an asymptomatic AVF associated with a SIA [–]. Although our case had hemodynamic catastrophe, the CT findings in our case were much fewer than the findings presented in previous reports. We were unsure of the presence of an AVF preoperatively because the dilated vena cava, which was not enhanced in the arterial phase, appeared to be apart from the aneurysm and the iliac veins were indistinguishable from the hematomas on CT. An asymptomatic aortocaval fistula due to abdominal aneurysmal compression and an ilio-iliac AVF associated with a huge common iliac aneurysm have been reported. Therefore, a huge iliac aneurysm could push the iliac vein aside and occlude the shunt easily. Postoperatively, we detected the enhanced left paravertebral vein and the left ascending lumbar vein on arterial-phase CT, and these were the only indications of the presence of an AVF on CT. The enhancement was noted at only the left paravertebral vein, although the laceration of the AVF was located at the right common iliac vein. The huge aneurysm obstructed the left common iliac vein and resulted in arterial inflow to the contralateral side. This supported the hypothesis that the aneurysm decreased shunt flow by compressing the adjacent vein.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2047_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2047_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fb5df5c2d81c6974c270c1382e617eadd8c72755
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2047_en.txt
@@ -0,0 +1,4 @@
+A 53-year-old man reported to the emergency room with a 2-day history of sudden-onset left chest pain radiating to his left back. The pain was intermittent over the 48 h and felt similar to the pain he experienced in a prior episode of pleurisy. It did not localize to any specific region of the chest and did not involve the left arm. It was partially relieved with NSAID use and resting on his left side. The patient had a 30 pack year smoking history as well as a history of illicit drug use. He had history of hypertension that was controlled with lifestyle changes and did not show any signs of end organ damage. The previous clinic visits showed his blood pressure to be under control and on admission it was 100/78. A review of systems and physical examination did not show any signs of paresthesias, numbness, weakness, or ataxia. Cardiovascular, respiratory, and neurologic physical exams were normal. The patient was given nitroglycerin and fentanyl, which eased the pain. Because of both his history of smoking and hypertension as well as his clinical presentation, a chest X-ray, EKG, and blood work-up including troponin I and D-dimer were performed which returned normal results.
+Due to high suspicion for coronary ischemia and other cardiac etiologies related to his history of smoking, hypertension, and illicit drug use, the patient was admitted to further investigate his chest pain. At this point, his pain was completely resolved with fentanyl. As part of expanding the differential diagnosis for chest pain, to rule out pulmonary embolism and aortic dissection, a CT angiogram of the chest was performed and revealed a 4.4 × 2 × 2.1 cm soft-tissue mass compressing the spinal cord at the level of T8-T9. To further characterize the spinal lesion, MRI imaging was obtained and confirmed the presence of a heterogeneous mass at the left T8 that was hyperintense on T2-weighted and hypointense on T1-weighted images . Axial scans showed an intradural extramedullary dumbbell-shaped tumor, characteristic of a spinal schwannoma, at the level of spinal nerve T8.
+Given the significant mass effect of the mid-thoracic spinal cord and pain symptoms, the patient underwent an open laminectomy and partial facetectomy of T8 and T9. A dark, dumbbell-shaped mass could be seen extending from the left spinal column grossly . There also appeared to be a hemorrhage within the dural sac near the T8 nerve root. GTR of the lesion was accomplished with sparing of the nerve root. Post-operative histological examination showed fascicles and nests of plump spindle cells, consistent with schwannoma . Variable amounts of melanin were also seen within tumor cells , leading to further immunohistochemical staining. Tumor sections showed positive expression of S100, SOX10, HMB-45, and MART-1 , compatible with a diagnosis of MS.
+A complete history and review of systems did not reveal any family history or clinical signs of Carney complex in this patient. He was discharged 1 day after surgery. We followed up with the patient 2 months after surgery. He was doing well other than some persisting incisional pain. Imaging did not show any local recurrence of the tumor . He was counseled on his options regarding radiation and referred to another institution for a second opinion due to the rarity of this diagnosis. He has subsequently been lost to follow-up 6 months after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2063_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2063_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f93cf72ac47e790abac3a66816b693e009359897
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2063_en.txt
@@ -0,0 +1,2 @@
+A 33-year-old woman, G2L2P2, presented with abnormal vaginal discharge. Gynecologic examination has revealed a cervical mass with grape-like feature protruding into vagina with posterior-superior vaginal wall involvement. She had normal menstrual cycles and her past medical history was unremarkable. Cervical mass biopsy has performed and pathologic examination was consistent with embryonal botryoid type rhabdomyosarcoma which has confirmed with pathologic review. Transvaginal sonography has shown a 38 × 27 × 60 mm cervical mass at inferior-posterior portion of cervix with superior vaginal wall infiltration. She has undergone the staging work up measurements including thoracic computed tomography (CT) scan, bone scan and bone marrow examination. In abdominopelvic magnetic resonance imaging (MRI), in addition of cervical mass, 2 suspicious pelvic lymph nodes have revealed. All other measurements were normal. Radical hysterectomy with lymph node debulking and ovarian preservation has performed. There was a grossly huge cervical mass protruding into vagina with surface irregularities measuring 10×10 cm. On sections, there was a gray tumor with spindle cell proliferation, measuring 8×5×2.5 cm. On microscopic examination, tumor has covered by attenuated epithelium with condensed neoplastic cells layer beneath epithelium (cambium layer) and consisted of the spindle shaped embryonal rhabdomyoblasts cells with eosinophilic cytoplasm and atypical nuclei. Final results have shown embryonal botryoid type rhabdomyosarcoma of cervix, consistent with the intergroup RMS study Group I. Ovaries, endometrium, parametrium, and follopian tubes were unremarkable. Pelvic lymph nodes pathology and intraabdominal fluid cytology were negative for malignancy. Lymphovascular invasion has identified. She has advised for adjuvant chemotherapy.
+Based on medical ethics committee of Shahid Beheshti University of Medical Sciences, a written informed consent has obtained from the patient for publication of this manuscript and accompanying images.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2065_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2065_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..81a6cdb10a86268f2100431d13b55489e6382423
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2065_en.txt
@@ -0,0 +1,7 @@
+A 65-year-old woman with persistent atrial fibrillation was referred for LAAc. The patient underwent mechanical aortic and mitral valve replacement in 1995 for rheumatic valvular disease and required a redo surgery due to an extensive pannus with two biological prostheses in January 2020; she also required a single-chamber pacemaker. Her current medical therapy included oral anticoagulation (apixaban 5 mg twice daily) in addition to diuretics and iron supplementation. She developed chronic anaemia due to active intestinal angiodysplasia with recurrent transfusion requirements once or twice each month. Her CHA₂DS₂-VASc score was 3 and HAS-BLED score was 3. Investigations ruled out other causes of anaemia, including haemolytic anaemia and paravalvular leak. The patient presented with two biological protheses (VHD) without active rheumatic valve disease and, as a result, may be a candidate for LAAc.
+Transesophageal echocardiography (TEE) revealed spontaneous contrast in the LAA without formation of a thrombus (see , ). The ridge diameter was 28 mm. One centimetre inside the LAA, the maximum landing zone diameter was 22 mm. The shape of the LAA was tortuous and difficult to assess. Although the LAA had an initial angle like a chicken wing, pre-operative computed tomography (CT) revealed an unusual LAA morphology that was horn-like in shape (due to a vertical upward axis) (see , ) with an inferior implantation and a superior axis, with the ostium close to the mitral prosthesis ring .
+After written informed consent, a first procedure was performed using a standard left femoral venous approach. The transseptal puncture was performed postero-inferiorly as recommended under TEE guidance. Nevertheless, despite multiple attempts, it was not possible to advance the sheath beyond the first centimetre of the ostium, even with the use of both double-curve and single-curve sheaths and a pigtail probe with an extra-stiff guide (see , ). The deployment of a 31 mm Watchman FLX (Boston Scientific, Marlborough, Massachusetts, USA) was attempted but was unsuccessful given the unsuitable sheath position (see , and ).
+As a result of the unusual LAA morphology, a 3D printing model was prepared using SLS laser sintering technology ( and IMT Mines Alès) using Flexible TPU (Thermoplastic Polyurethane, EOS TPU 1301).
+A volume file (IntelliSpace Portal version 12, Philips Healthcare, Best, The Netherlands), segmented to depict the entire left atrium and LAA, a part of the right atrium, superior and inferior vena cava, and aortic and mitral prosthesis , and then reprocessed offline in preparation for 3D printing . Simulation was then performed from inferior and superior access points , and with different LAA occlusion devices (see , and ). Excessive sheath kinking was demonstrated with an inferior approach, but successful deployment was feasible using a superior approach (see , and ).
+Transseptal puncture (second procedure) (see , ) was performed using a right jugular venous approach under TEE guidance (see , ). Apixaban was discontinued 72 h before the procedure and 2000 IU unfractionated heparin was administered after jugular puncture and reduced to 100 IU/kg after transseptal puncture with monitoring of activated clotting time to achieve >250 s during the procedure. A Swartz SL0 sheath (Abbott, Illinois, USA) and a BRK-1 XS Series transseptal needle (Abbott) were used. Safe access to the left atrium was achieved by advancing a 0.014 stiff coronary wire Iron Man (Abbott) through the BRK-1 XS needle and placed in contact with inter atrial septum connected to radiofrequency. The sheath was then advanced in the left atrium over the needle and Iron Man wire. The SL0 was exchanged for the single-curve 14Fr delivery sheath over an Amplatz Super Stiff guidewire placed into the LAA. Deep and safe advancement of the delivery sheath was performed over a pigtail catheter and the Amplatz Super Stiff guidewire until proper depth was achieved. Proper sheath alignment (see , ) without kinking was obtained allowing successful implantation of a Watchman FLX 31 device in stable position without residual leakage (see , ). The position was as predicted during the simulation on the 3D-printed model. No complications occurred during the first or second procedures.
+Following the successful second procedure, the patient continued to receive apixaban (2.5 mg twice daily) until the control CT scan at month 2. Between the two interventions, the patient continued to need transfusions. At the patient’s 3-month follow-up visit, and after cessation of oral anticoagulation, an improvement in symptoms was seen with no need for additional transfusions. Imaging demonstrated complete LAA occlusion and correct placement of the device along the LAA superior axis as predicted by the simulation procedure, with an adequate compression and no residual leak ( and , ). TEE follow-up confirmed there was no leakage around the device. After 9 months’ follow-up, there was no need for further transfusions, the patient’s pulmonary pressure and functional class had improved, which was attributed to the withdrawal of blood transfusion-related volume loading, as well as the cessation of repeated post-transfusion inflammatory responses and the favourable effect of normalized iron stores.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2074_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2074_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..535bbbd6deaf03cd718bd4aea8a9c20193c357a1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2074_en.txt
@@ -0,0 +1,29 @@
+An 85-year-old Chinese woman with underlying hypertension, dyslipidemia, and a previous history of right total knee replacement surgery seven years earlier presented
+with painful right knee swelling, accompanied by pus discharge, for three months. She denied any recent trauma or procedures. On admission, she was afebrile,
+and her right knee appeared diffusely swollen, erythematous, and tender with a sinus tract formation. The total white blood cell count was 7.8×103 cells/µL with an
+elevated C-reactive protein and erythrocyte sedimentation rate. Radiology findings revealed radiolucency
+over the distal femur and proximal tibia .
+She was diagnosed with right knee PJI and osteomyelitis. Therefore, intravenous clindamycin and ciprofloxacin were started as empirical therapies.
+She underwent the removal of the implant and an arthrotomy washout. The intraoperative findings were suggestive of osteomyelitis changes.
+The intraoperative synovial fluid was inoculated in BD Bactec Plus Aerobic/F and BD Bactec Lytic/10 Anaerobic/F vials, which were incubated using BD BACTECTM FX (BD, USA).
+The aerobic bottle blood culture was positive after 72 h of incubation. The gram stain showed gram-positive ellipsoidal budding yeast cells ,
+and the organism appeared as cream-colored smooth, glistening colonies on the Sabouraud Dextrose Agar (Isolab, Malaysia) and whitish colonies on the CHROMagar (Isolab, Malaysia),
+as displayed in , respectively.
+The slide culture on the corn meal agar only demonstrated blastoconidia, and it was negative for both germ tube and urease. The same growth was also obtained from bone marrow specimens.
+The organism was identified as Candida utilis (C. utilis) with a probability of 95% using the VITEK® 2 yeast identification system (bioMérieux, France).
+However, a final microbiology report revealed that Cy. fabianii was identified by Bruker MALDI-TOF, which was also confirmed by molecular DNA sequencing methods.
+The DNA extraction of the isolate was performed using the Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, California, USA), following the manufacturer’s protocol.
+The D1/D2 domain of the large subunit (LSU) ribosomal RNA gene was amplified from the DNA template by NL1 and NL4 primers. Polymerase Chain Reaction (PCR) was
+performed using Mastercycler Gradient (Eppendorf, Hamburg, Germany). The PCR protocol was conducted with an initial denaturation at 95°C for 1 min, followed by 35 cycles
+of denaturation (95°C for 15 sec), annealing (58°C for 15 sec), and extension (72°C for 10 sec) . The PCR product was then visualized using a 1.5% agarose gel by electrophoresis. The sample was then sent to the 1st BASE company (Apical Scientific, Malaysia) for PCR purification and sequencing.
+Sequencing analysis was performed using Molecular Evolutionary Genetics Analysis (MEGA) software (version 11.0.10, Arizona, USA),
+and alignment was made to both forward and reverse sequencing results using the MUSCLE algorithm. The 595 DNA bp was subsequently matched to the database from
+the National Center for Biotechnology Information (NCBI) GenBank using the Basic Local Alignment Search Tool (BLAST).
+The result was a 100% match to Cy. fabianii CBS 5640 (GenBank Accession Number KY107357). For phylogenetic analyses, the D1/D2 region
+of the LSU rRNA gene was constructed using the MEGA software, and phylogenetic trees were generated by the neighbor-joining statistical method with 1000 bootstrap
+replications using the Tamura-Nei substitution method .
+All available LSU sequences closely related to this species and other distant yeast species were retrieved from the NCBI GenBank database.
+Antifungal susceptibility testing was performed using VITEK® 2 AST-YS08 (bioMérieux, France), and the minimum inhibitory concentration (MIC) values
+were interpreted based on Clinical and Laboratory Standards Institute M60 interpretative breakpoints for Candida species . It was susceptible to amphotericin B (MIC<0.12 µg/ml), fluconazole (MIC<0.5 µg/ml), voriconazole (MIC<0.12 µg/ml), and micafungin (MIC<0.25 µg/ml).
+No growth was obtained from blood and tissue cultures. The patient completed intravenous fluconazole for two weeks and was discharged with oral fluconazole and
+ampicillin-sulbactam planned for a total of 12 and 10 weeks, respectively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2079_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2079_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b1a414438758e330b20cfc788de12cd32b6c6f76
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2079_en.txt
@@ -0,0 +1,6 @@
+The patient is a 45-year old woman of Japanese descent with urothelial carcinoma of the right renal pelvis. The family history was negative for any malignancies in first-degree relatives. She has been a life-long non-smoker and has no occupational exposure to aniline dyes, radiation, or other chemicals. After presenting with gross hematuria in November 2013, a CT-IVP showed an abnormal, mass-like infiltration measuring 2.9 x 2.4 x 3 cm of the middle to lower right renal collecting system involving the renal parenchyma and invading the sinus fat. Ureteroscopy and biopsy revealed a transitional cell malignancy of the right lower pole renal calyx. In December 2013, she underwent a hand-assisted right nephroureterectomy.
+Pathology revealed high-grade urothelial carcinoma invading the renal parenchyma and peripelvic fat without a significant inflammatory component . The resection margins were negative. She was deemed as having G3 pT3N0M0, AJCC Stage III cancer. Post-operatively, she received 6 cycles of adjuvant gemcitabine-cisplatin chemotherapy and completed the treatment by July 2014. A CT scan immediately following adjuvant treatment revealed a new contralateral lymphadenopathy measuring 1.2 cm. Subsequently, a repeat scan revealed a new nodular lesion in the right renal bed and an increase in the dimensions of the left sided lymph node to 2.3 cm including two additional areas of metastatic disease: a lesion overlying the right iliopsoas muscle and the left para-aortic adenopathy. PET scanning disclosed that the 3 lesions seen on CT were hypermetabolic. A CT-guided biopsy confirmed metastatic urothelial carcinoma.
+Molecular profiling was performed at Foundation Medicine, Inc. utilizing next generation DNA sequencing to identify actionable genomic alterations in key oncogenes and tumor suppressor genes [exonic regions of 315 genes]. This testing revealed 73 mutations among 62 genes . Additionally, 340 variants of unknown significance [VUS] abnormalities were also identified among 166 genes (not shown). Three deleterious mutations were identified in MSH2 (A913fs*2, E226*, E580*) and one in MSH6 (R361H) .
+The hypermutant genotype was phenotypically evaluated with 4-gene MMR IHC testing that showed loss of expression of both MSH2 and MSH6 .
+Germline DNA testing at Myriad Inc. was negative for all known Lynch mutations. Subsequently, the patient’s primary tumor was tested at Clarient GE, Inc. [Aliso Viejo, CA] for PD-L1 expression and found 2+ staining in 80 % of cells .
+The patient enrolled on a phase I clinical trial of an anti-PD-L1 inhibitor MEDI4736 and MEDI0680, [MedImmune Inc., Gaithersburg, MD] in Los Angeles [Clinical trial #: NCT02118337]. Within 2 months at the first radiographic evaluation, she had a complete disappearance of all cancer . After 10 months of treatment, she developed grade 1–2 uritcarial rash and polyarthralgias in her hands and a positive ANA 1:160, but has no signs of severe or life-threatening autoimmunity or other criteria for a diagnosis of SLE. She has a confirmed continuous complete remission at 11 months and continues to participate on study.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2084_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2084_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5d1c5e1400676061561c584fee50c7c47d831188
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2084_en.txt
@@ -0,0 +1,4 @@
+In July 2013, a 53-year-old man presented to our hospital with a chief complaint of colic pain in the left lower limb while walking. The patient was 175 cm tall, weighed 87.1 kg, and had a BMI of 28.4. The patient’s past medical history was significant for left indirect inguinal hernia; Gilbert/ Rutkow& Robbins classification was type 2 and Nyhus classification was type 2 [-]. The patient had undergone left inguinal hernia repair (mesh plug method) at our hospital just 10 years earlier and reported no pain after the operation. In addition, the patient’s postoperative course was uneventful. We used the visual analog scale (VAS) pain scales; 100 mm vertical lines anchored with “no pain” at the bottom and “worst imaginable pain” at the top. In this scale, 0 mm is “no pain” and 100 mm is “worst imaginable pain”. Physical examination revealed a colic pain exacerbated by left thigh movement; VAS 80–100 mm, especially during flexion; however, the patient was pain free at rest; VAS 0–20 mm and had no sensory deficits. The patient also had no signs of inguinal hernia recurrence. The results of routine blood tests were all within normal limits. We considered radicular symptoms, orthopedic disease, and urological disease as a differential diagnosis, but all were refuted by specialists in the respective departments.
+Abdominal ultrasonography was normal. Computed tomography (CT) revealed a low-density structure in the left inguinal region with no evidence of infection . This structure showed low signal intensity on T1-weighted magnetic resonance imaging (MRI) and high intensity on T2-weighted MRI . CT and MRI also showed the plug bulging outward into the peritoneal cavity, with axial images showing the inward-projecting plug extremely close to the femoral nerve .
+Following neurosurgical, orthopedic, and urologic consultations, we strongly suspected that his neuralgia was associated with the hernia operation 10 years earlier. However, we could not provide a definitive diagnosis preoperatively. Therefore, an exploratory laparoscopy was decided. The first port was inserted through the navel to observe the abdominal cavity. We found that the plug bulged outward into the abdominal cavity and that the tip of the plug had become firmly calcified . There were no signs of recurrence. The exposed plug was compressing the femoral nerve, which lay just beneath the plug when the patient moved, especially during flexion. We inserted left and right lateral ports and removed the plug laparoscopically. We then carefully broke up adhesions between the plug and peritonea, fat, nerve, and vessels using an ultrasonically activated scalpel . The abdominal wall after plug removal is shown in Fig. . We removed only plug causing leg pain and did not remove onlay mesh. We restored the peritoneal defect after plug removal to prevent future recurrence and adhesions. Once the pre-peritoneal space was prepared, a 12 × 8 cm composite mesh (VentrioTM Hernia Patch, BIRD Inc.) was positioned to cover the hernia orifice because the peritoneal defect was large and we were not able to unite the peritoneum. The mesh was fixed to the pubic ramus and Cooper’s ligament using endoscopic tackers (Protack®, Covidien Inc.). The superior margins of the mesh were then fixed to the abdominal wall, deliberately avoiding the inferior epigastric vessels. Finally, we sewed the peritoneum to the mesh .
+The patient reported that the sharp pain in his leg disappeared after the procedure; VAS 0–10 mm, and the patient started walking the following day. The postoperative course was uneventful, and the patient was discharged from the hospital 3 days postoperatively. The patient has remained pain-free for 20 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2091_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2091_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..07d7e0387c54274a3f7da87463821ae0b874e00b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2091_en.txt
@@ -0,0 +1,10 @@
+A 15-year-old girl presented with a history of progressive limping for 8 years. Another symptom was diffuse bone pain for 3 years. Family and drug histories were unremarkable. On physical examination, a large, firm, and non-tender mass was palpable in the right thyroid lobe. Left hip range of motion was limited in all directions, both actively and passively, and tenderness was present on left femoral head palpation. The rest of the physical examination was normal.
+Biochemical tests were performed and initial laboratory test results were as follows: serum calcium: 10.8 mg/dL (range: 8.5 - 10.5 mg/dL); phosphorus: 2.4 mg/dL (range: 2.9 - 5.1 mg/dL); iPTH: 2876 pg/mL (range 15 - 65 pg/mL); 25-hydroxy vitamin D3: 13.76 ng/mL (range 15 - 65 ng/mL); thyroid-stimulating hormone (TSH): 3.11 µIU/mL (range 0.51 - 4.34 µIU/mL); and alkaline phosphatase (ALP): 7410 IU/L (range: 180 - 1200 IU/L). While PHPT could be associated with other endocrinopathies, the complementary evaluations, such as insulin-like growth factor-1 (IGF-1) and prolactin measurements were done .
+The plain pelvic radiography demonstrated a left femoral neck fracture. Spine radiography displayed wedge fractures at thoracic and lumbar spine levels . Bone mineral density (BMD) showed low bone density (lumbar spine's Z-core: -3.7). According to the above-mentioned test results, including elevated PTH, borderline high serum calcium, decreased phosphorus, and elevated ALP, primary hyperparathyroidism was considered as the most probable diagnosis.
+Dual-phase sestamibi scintigraphy was performed for the patient after intravenous (IV) injection of 540 MBq of 99mTc-MIBI. The early scan images (at 20 minutes) revealed high thyroid uptake in the right lobe with a suppressive effect on the left side. Increased radiotracer uptake was seen in the right lobe without proper washout on delayed images, which was higher and larger than is expected with PAs . A thyroid scan was also done two days later, after IV injection of 185 MBq of 99mTc from the anterior view to rule out a thyroid nodule. This scan revealed a focal decreased uptake in the upper pole of the right lobe, which was smaller compared with the finding of the parathyroid scan . The discrepancy between the two scans led to further investigation into the underlying pathology. Neck ultrasound revealed an enlarged right thyroid lobe compatible with intra-lobar necrosis and echogenic regions with the approximate size of 20 mm compatible with the parathyroid gland ( and ).
+The patient was referred to an experienced surgeon for neck exploration and parathyroidectomy. She underwent open surgery. The parathyroid mass had infiltrated to the surrounding thyroid tissue; hence, right thyroidectomy, isthmectomy, and right inferior parathyroidectomy were performed. The remaining parathyroid glands were examined during the operation and were normal. She experienced hungry bone syndrome postoperatively, which was managed appropriately. Finally, serum calcium and iPTH levels decreased to a level of 8.7 mg/dL (8.5 - 10.5 mg/dL) and 24 pg/mL (15 - 65 pg/mL), respectively. The operative phosphorus level was 2.3 mg/dL.
+Gross histopathologic examination revealed a well-defined cream-colored mass measuring 2.5 × 1.5 × 1.0 cm. IHC helped with the confirmation of diagnosis .
+Histologic examination showed uniform chief cells presenting as nodules and sheet growth with proliferated blood vessels that were separated by a broad fibrous capsule from the adjacent thyroid tissue. The tumor had invaded the capsule and blood vessels. IHC staining for CD34 confirmed vascular invasion. IHC was also diffusely positive for CK in the tumor and tumor cells attached to endothelial cells. Ki67 was also positive in 2% - 3% of tumor cells. However, other markers, such as CD45, thyroid transcription factor 1 (TTF-1), and Pax5 were negative (-).
+Whole exome sequencing (WES) study was done for the assessment of familial hyperparathyroidism and MEN1. The genetic study demonstrated no mutation in CDC73 and menin genes. However, there was an incidental mutation in the breast cancer 1 (BRCA1) gene.
+We performed an extensive search using different databases, including Medline, PubMed, Scopus, ScienceDirect, and Google Scholar to find all published cases of PC in children and adolescents. We used the following combination of keywords: parathyroid carcinoma or parathyroid cancer or parathyroid neoplasm or parathyroid malignancy, and pediatrics or child or adolescent or boy or girl. We could find 16 papers reporting 17 cases of pediatric PC from 1972. summarizes the published papers.
+According to these reports, the male to female ratio was 0.6. The youngest and oldest patients were 8 and 16 years old, respectively. The most common initial presenting symptoms were related to hypercalcemia, including anorexia, vomiting, polyuria, polydipsia, fatigue, bone pain, and renal calculi. Sixty percent had a palpable neck mass. Nearly 50% had skeletal involvement, including fracture and deformity. Only three patients had experienced weight loss. Pancreatitis was a rare condition diagnosed in one case. Nearly 20% had metastasis, most common sites were lung and cervical lymph nodes, and all cases with pulmonary involvement had experienced relapse and hypercalcemia after the initial operation. The range of serum calcium and iPTH was 12 - 20.7 mg/dL and 300 - 8638 pg/mL, respectively. IHC had been reported in two cases, which were both positive for parafibromin . Three cases had deletion mutation of CDC73, and another case was negative with regard to menin gene mutation. Three patients had a positive family history of primary hyperparathyroidism. There was no predominant tumor location site at the neck.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2093_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2093_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2f138091bf68eb0d3a8583af90c7149dc3a04041
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2093_en.txt
@@ -0,0 +1,7 @@
+We present the case of a 72-year-old female GBC patient, who was admitted to our hospital due to chest tightness in September 2018.
+After examination, GBC was found to recur in situ, invading the duodenal descending part and causing intestinal fistula and hepatic colon adhesion. In addition, multiple metastases of the liver, lymph node metastasis around the head of the pancreas, severe anemia requiring weekly blood transfusion, and symptoms of heart failure were noted.
+In December 2017, the 72-year old Chinese patient underwent IRE following diagnosis as GBC (T3N1M0 stage IIIA) based on computed tomography (CT) imaging and pathological findings of GBC (8.0 cm × 3.9 cm) with multiple hilar lymph node invasion (max 4.7 cm × 3.6 cm). She had elevated levels of a variety of serum tumor markers, including CA19-9 (2556 U/mL) and CEA (607.6 ng/mL).
+After IRE ablation of the gallbladder and hilar lymph nodes, oral tegafur (20 mg bid) chemotherapy was administered for 9 mo. CT re-examination in April 2018 showed liquefactive necrosis at the ablation site. During the treatment period, the patient received intermittent red blood cell (RBC) infusions as supportive care for repeated episodes of anemia.
+Accompanied by a progressive increase in pain in the upper right abdomen, a large area of adhesion between the gallbladder and the descending and horizontal segments of the duodenum was found in addition to compression of the inferior vena cava (October 6, 2018).
+She had elevated levels of a variety of serum tumor markers, including CA19-9 (88.18 U/mL), AFP (14.11 IU/mL), and CEA (39.68 ng/mL) in September, 2018.
+After 2 wk of blood transfusions and anti-infective treatment, CT examination again revealed a bladder tumor (6.3 cm × 4.9 cm), with an adjacent descending duodenal fistula, multiple spotted high-density lesions in the liver parenchyma, and dilatation and gas accumulation in the intrahepatic and extrahepatic bile ducts. Enlarged lymph nodes (2.7 cm × 2.1 cm) were visible around the pancreatic head.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2094_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2094_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4732c33afb961727485ec326f2b40f27c9ffcdc6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2094_en.txt
@@ -0,0 +1,8 @@
+A 28-year-old lady of Southern Chinese origin with a history of Behcet’s disease (BD) presented with a new onset of headache. For five years prior, she experienced symptoms of recurrent oral ulcers and ocular findings (panuveitis with cystoid macular oedema). She had been first treated with steroids for four years before they were stopped 11 months prior to presentation in view of bilateral posterior subcapsular cataracts, hypertension and weight gain (weight of 94.5 kg (BMI 37.4) around the time steroids were stopped compared to her baseline of about 70 kg, Table ). She had been on methotrexate for two and half years before a change to mycophenolate mofetil (MMF) two months prior to presentation. She was also on adalimumab for the last two years. However, her ocular disease (inflammation and oedema) was not well-controlled, suggesting inadequate immunosuppression. Other than calcium and Vitamin D, there was no supplemental medication use including traditional medications.
+Two weeks prior to current presentation, she had developed gradual onset of holocranial headache, of pressing character, moderate to severe intensity, without postural variation lasting one week which then resolved. There was no nausea or vomiting, new visual disturbances, or other focal neurological deficits. Systemic review was unremarkable for symptoms of infection, sleep apnoea, urinary or bowel disturbances, new arthralgias, orogenital ulcers or recent vaccination. There was no recent weight gain, with her weight actually having dropped 6 kg (BMI now 34.9) over the last nine months . At a routine review, asymmetrical disc swelling was detected (optical coherence tomography retinal nerve fibre layer (OCT RNFL) disc thickness 331 μm and 194 μm on right and left respectively) (normal is 102 ± 7 μm) . Humphrey’s visual field testing showed an enlarged blind spot bilaterally with normal confrontational testing. There was a right eye grade 1 relative afferent pupillary defect. Neurological examination was unremarkable with regards to cranial nerves, tone, reflexes, power, sensation, and cerebellar function. Contrasted MRI of the brain, orbit and venogram was normal. There were no radiological features of IIH such as flattened optic discs, tortuous optic nerves, enlarged Meckel’s caves, empty sella or acquired tonsillar ectopia. There were also no orbital or intracranial lesion, enhancement, hydrocephalus, or venous thrombosis. Lumbar puncture (LP) showed an opening pressure > 40 cmH20, 151 leucocytes (mainly lymphocytic) without erythrocytes, glucose 2.7 mmol/L (capillary glucose was 7.4mmol/L) and protein was slightly raised at 0.56 g/L. Cerebrospinal fluid (CSF) screen for bacteria, viruses, tuberculosis, fungi, cryptococci was negative. CSF flow cytometry showed large B cells. CSF cytology did not show malignancy. Serum biochemistry, erythrocyte sedimentation rate, inflammatory markers, angiotensin converting enzyme levels were normal.
+The impression was that of a lymphocytic meningitis with severely raised intracranial pressure (ICP), on background of BD. Given uncertain etiology and potential morbidity, the treatment approach was broad. She was covered with antimicrobials until the infective screen returned negative. As an inflammatory, possibly autoimmune process related to her BD could not be ruled out, her immunosuppressive treatment was consolidated with initiation of prednisolone 60 mg OM whilst adalimumab and MMF were held off. Idiopathic intracranial hypertension (IIH) was considered as a differential given significantly elevated pressures and the patient’s body habitus; and she was empirically treated with oral acetazolamide. She was initiated on a dose of 250 mg thrice daily, with plans to up-titrate to IIH treatment dosing of 500 mg twice a day, and even higher if indicated.
+A targeted second LP was repeated six days later in view of large B cells in previous CSF flow cytometry. It showed an opening pressure of 36.5 cm H20 and resolution of raised protein (0.29 G/L). The cell count was not rechecked. Flow cytometry did not show clonal proliferation.
+After an initial improvement in disc swelling, the prednisolone was downtitrated (refer to Table ). The acetazolamide had to be stopped due to metabolic acidosis. An LP was once again repeated which confirmed there was no clonal proliferation. Opening pressure was 36.5 cm H20, however there were no elevated CSF leucocytes or protein.
+The differential diagnosis at this point included an autoimmune cause possibly NeuroBehcet’s (NB)-related inflammatory process and IIH. The diagnosis of IIH was mainly supported by her obese habitus. However, compared to nine months prior to her presentation when her BMI was at its peak and her steroids had been also stopped, at the time point when she eventually presented her BMI had dropped 2.5 points and had been on an overall downward trend. This downward weight trend was not supportive of a new development of IIH). Furthermore, the headache was not prominently associated with the raised ICP, lymphocytic meningitis is inconsistent with IIH, and imaging was not supportive of IIH. Nonetheless she had persistent disc swelling (OCT RFNL 177 and 163 μm) and raised ICP. Given the lack of alternatives, she was re-trialed on acetazolamide at a low dose, which was subsequently increased. She was restarted on adalimumab and MMF which were then uptitrated, whilst prednisolone was weaned off.
+Ten months after her initial presentation, she complained of daily headaches, occurring in association with bilateral mildly limited abduction, orogenital ulcers and left eye uveitis, again suggesting inadequate control of the underlying BD. A LP was performed showing an opening pressure was 41 cmH20 but CSF was otherwise bland (protein was 0.33G/L and 2 white cells).
+The decision was made to treat her as NeuroBehcet’s-related intracranial hypertension without cerebral venous thrombosis (NBrIHwCVT) given her background of BD, initial lymphocytic meningitis, and lack of response to acetazolamide rather than IIH. Therefore, she was pulsed with steroids, followed by cyclophosphamide whilst non-steroid immunosuppressants were stopped. About a month after the prior LP, she showed an early response to high dose steroids and intravenous cyclophosphamide, with pressure decreasing to 34.5 cmH20. Headache, vision and OCTs (158/142) continued to improve as she was completing her cyclophosphamide with down-titrating prednisolone. However, she still had bilateral active ocular Behcet’s after 6 cycles of cyclophosphamide. After consideration, a novel treatment approach was initiated with weekly subcutaneous Tocilizumab. After a month of tocilizumab, the opening pressure had further declined to 30 cmH20, demonstrating apparent significant response to immunosuppressive therapy, further confirming the diagnosis of NBrIHwCVT. This was associated with gradually decreasing disc swelling OCTRFNL values over the next few months. The ocular BD also showed some improvement with regards to her retrolental inflammation and peripheral vasculitis. After seven months of tocilizumab, the ICP remained similar (31.5 cm H20). The maintenance of ICP at about 30–31 cm H20 even seven months later, and a decrease in OCT RFNL thickness points to efficacy of Tocilizumab in the absence of cyclophosphamide action. However, further attempts to bring down her ICP remains challenging despite trial of multiple immunosuppressant agents. Acetazolamide was also continued however, its effect on the ICP was likely limited given ICP remained unchanged at three times a day dosing.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2099_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2099_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3e78cc47ecfc5da55187bf1e967c312617f66b45
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2099_en.txt
@@ -0,0 +1,5 @@
+A 69-year-old woman was diagnosed with suspected GBC and peritoneal carcinomatosis and was referred to our hospital. She had no remarkable medical history, but hepatitis C virus antibody was incidentally detected on a laboratory test and a suspected GBC lesion was found in a subsequent imaging examination. The levels of carcinoembryonic antigen (CEA) and carbohydrate antigen 19–9 (CA19-9) were 1.8 ng/mL and 144.5 U/mL, respectively. Contrast-enhanced CT showed 20-mm thickening of the fundus of the gallbladder and multiple nodules of approximately 100-mm maximum diameter in the peritoneal cavity . Contrast-enhanced MRI indicated similar findings to those in CT, and diffusion impairment at the primary tumor was apparent in diffusion-weighted imaging . The gallbladder tumor and the other nodules had high maximum standardized uptake values on PET-CT. The value for the primary tumor was 6.5.
+Gemcitabine (GEM) plus cisplatin (CDDP) combination therapy (GC therapy) was started under a diagnosis of unresectable GBC with peritoneal carcinomatosis. After 12 courses of therapy over 9 months, the CEA and CA19-9 levels were similar to their initial values, after each had elevated once . The CA19-9 level remained high, but stable, and the primary tumor had enlarged slightly . However, the peritoneal nodules had disappeared in some areas and had not increased in number, and no new lesions, including distant metastasis, were visible on CT . Thus, we decided that complete resection was possible macroscopically.
+Extended cholecystectomy with partial liver resection with surgical margins of approximately 1.5 cm from the primary tumor, resection of the extrahepatic bile duct with regional lymph node dissection, and total omentectomy were performed. The primary tumor at the fundus of the gallbladder had a macroscopic appearance of the nodular-infiltrating type . Multiple cancerous nodules were found in the omentum , but disseminated nodules in the peritoneum and liver metastasis were not apparent. Carcinoma cells were detected in intraoperative peritoneal lavage cytology, but ascites was not noted. The final stage was ypT3N0M1 (PER), ypStage IVB in the TNM clinical classification .
+The primary GBC was biliary-type adenocarcinoma with squamous differentiation . Lymphatic invasion was seen , but lymph node metastasis was not detected. Degenerative features such as atrophic changes of tumor cells and prominent fibrosis and calcification of the surrounding stroma were partly present . The disseminated omentum nodules had similar degenerative features to those of the primary tumor . Overall, these findings suggested that preoperative chemotherapy had been effective.
+On postoperative day 14, GC therapy was switched to GEM and S-1 therapy (GS therapy). We made this decision because of the apparent gradual weakening of the effect of GC therapy, based on the lack of shrinkage of the primary tumor; the small decline in the CA19-9 level; and the limited effect in histopathological findings. After 8 courses of GS therapy over 5 months, the regimen was changed to S-1 monotherapy because of the patient’s tolerance for GS therapy. This treatment has continued to date (i.e., 31 months from the initial diagnosis) without any apparent recurrence for 19 months postoperatively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2121_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2121_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..249410949c8fe3d4658fc77c4f0fded1a94943f7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2121_en.txt
@@ -0,0 +1,5 @@
+This is the case of a 22-year-old uniparous lactating woman who regained regular menses after 8 months of lactational amenorrhea. After a period of six months of regular menstruation she presented with a history of sudden onset of amenorrhea and abnormal hair growth on the face of four months duration. Physical examination revealed a male pattern of coarser hair distribution in the beard region, anterior chest wall and arms. Abdominal examination showed no abnormality and vaginal examination disclosed clitoromegaly. Ultrasonography of the abdomen and pelvis revealed a solid right adenxal mass measuring 51 × 54 × 58 mm with moderate to significant vascularity. There was no ascites, retroperitoneal lymphadenopathy, adrenal gland enlargement, or liver metastasis. Tumor markers and hormonal levels were evaluated [Table ] and showed raised serum testosterone levels.
+The patient underwent an exploratory laparotomy. Intra-operatively the right ovary showed a 5 × 5 cm firm, tan-brown, well-encapsulated mass without any adhesions to surrounding structures and with engorged ovarian vessels. In view of the diagnosis of stage 1A disease, unilateral right salpingo-oopherectomy alone was performed since the frequency of lesions occurring bilaterally in this stage has been reported to be only 6%.
+The cut-section of the specimen showed a tan-brown well-circumscribed tumor with areas of hemorrhage [Figure ]. Microscopic examination [Figure ] showed diffuse sheets of large polygonal tumor cells with vacuolated cytoplasm and vesicular nuclei along with nuclear pleomorphism. Crystals of Reinke, which are usually seen in hilus tumors, were not seen.
+Immunohistochemistry staining was positive for gonadotrophin receptors and vimentin, and negative for alpha-fetoprotein and epithelial membrane antigen, providing evidence in favour of a steroid cell tumor.
+At post operative follow-up, two months of surgery, the patient had regained normal menses. Her serum testosterone level had gone down to 0.262-ngm/ml, and there was regression of the abnormal hair pattern. The patient is being followed up regularly with measurement of hormone levels as marker of recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2133_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2133_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b9abebbc526cf0cec6c691d0c0c299926ae4870d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2133_en.txt
@@ -0,0 +1,5 @@
+The patient was a 32-year-old female, a native of Sistan and Baluchestan province, Iran, with complaints of afternoon fever (38°C), night sweats, severe weight loss and anorexia. She was referred to the division of infectious diseases at Shahid Hashemi Nejad hospital in Mashhad, Iran, in August 2006. A month before the admission, she had received three different doses of ceftriaxone and acetaminophen for her high fever; given her non-responsiveness to the treatment, she was readmitted to the hospital. The patient was previously healthy and newly married, with no prior history of diseases or drug consumption. She was lethargic, though hemodynamically stable according to physical examinations, and her body mass index (BMI) was 17 kg/m2 at the admission time. The significant observation was a mobile mass (2 × 1 cm) with soft consistency behind the left sternocleidomastoid in left cervical, axillary and inguinal lymph nodes; no redness or warmth was reported in the mass.
+The spleen was detected about 5 cm below the rim. Ear, nose, and throat checkups showed normal results and the patient had no complaints of abdominal pain, lower limb pain, or diarrhea. In addition, no facial or body skin rash was reported and other findings were normal. In para-clinical evaluations, the results of chest radiograph, chest CT scan, electrocardiogram and echocardiography were normal. Moreover, in pelvic and abdominal ultrasounds, no abnormalities were observed except for the enlargement of the spleen. In the patient’s initial blood test, white blood cell (WBC) count of 2000 cells/mm3 and the presence of 1% atypical lymphocytes with an increase in immature neutrophils (bands), hemoglobin of 11.3 g/dL and a mild thrombocytopenia, as well as high alkaline phosphatase, high C-reactive protein, and an erythrocyte sedimentation rate (ESR) of 48 were reported. Blood tests and examinations of urine and stool samples were all negative. The results of sputum acid-fast bacilli culture and antinuclear antibody test were negative, as well. Similarly, the results of autoimmune screening, as well as toxoplasma and cytomegalovirus tests were negative.
+After 20 days, the patient was examined by neck lymph node biopsy. Macroscopic examination of the lymph node capsule showed a creamy grey-colored mass with soft consistency, homogeneity, and a dimension of 0.5 × 1 × 2 cm. In the microscopic study (at low magnification), partial effacement of the lymph node structure and pale patchy infiltrates were reported. The number of small lymphocytes was fewer in the lesion. At the center of the lesion, an extensive coagulative necrosis composed of cellular debris and free of neutrophilic or eosinophilic infiltrates was observed ( and ).
+Finally, the Kikuchi’s disease was diagnosed based on the findings. Considering the improved symptoms of the patient after two weeks of hospitalization, she was discharged from the hospital in good general health and received anti-inflammatory medications. The patient was followed up one week after the discharge. Given the improvements in her symptoms, the medications were gradually discontinued and she started to be followed up on a monthly basis. During the 8-year follow-up of the patient, except for the mean sublingual temperature of 37.8°C which was reported once or twice a year (continuing for a couple of days), no other significant findings were reported. The patient was in good general health during the follow-up and her examination results were normal.
+Blood cell count and ESR were within the normal range. The patient had two healthy pregnancies in 2010 and 2012 and was in a good general condition during her pregnancies and lactation. In August 2014, the patient was referred to the hospital with high fever, night sweats, weight loss and anorexia (BMI = 16 kg/m2). After a one-month delay, painful generalized lymphadenopathy in left cervical, axillary and inguinal lymph nodes with soft consistency and mobility was reported; however, no redness or warmth was reported in the mass. In the second blood test, neither leukopenia nor high ESR was observed. The results of chest radiography as well as those of abdominal and pelvic ultrasounds were normal. Considering the patient’s unwillingness to undergo repeated biopsy, she underwent a corticosteroid regimen. After three months of using prednisone, the patient’s fever subsided and her lymphadenopathy was impalpable. Overall, the patient was in good general health.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2137_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2137_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e560156a476bddaddfd97965fac29f6e36f78db0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2137_en.txt
@@ -0,0 +1 @@
+A 70-year-old patient presented in December 2007 for a positive prostate biopsy. Due to the finding of prostate adenocarcinoma with GS 2 + 3 in sextant biopsy and PSA 5 ng/mL, the initial finding was concluded as low-risk prostate cancer. Variants of the next procedure were discussed with the patient – radical prostatectomy, radiotherapy with curative intent, and active surveillance. From the options offered, the patient chose radical prostatectomy, which was performed laparoscopically in January 2008. Subsequently, the patient was followed up. Over a period of 6 months, PSA levels gradually progressed from 0.08 to 0.22 ng/mL. With regard to the findings, postoperative radiotherapy to the pelvis and prostate bed was indicated. A total dose of 60.0 Gy was applied until November 2008. Grade 2 proctitis and grade 1 cystitis developed as adverse events. After the end of radiotherapy, the PSA level dropped to 0.02 ng/mL. Subsequently, the patient was followed up by the urologist. Due to PSA progression to 0.24 ng/mL in August 2012, luteinizing hormone-releasing hormone (LHRH) agonist therapy was started. Administration of LHRH was started in August 2012. Despite continuous LHRH administration and castrating testosterone levels, biochemical progression occurred in May 2017 – three subsequent PSA rises were present at least 1 week apart, while the final PSA level was above >2 ng/mL. The follow-up examination included choline PET/CT with findings of local recurrence at the site of prostatectomy and lymphadenopathy in the pelvis and left groin. The finding was concluded as mCRPC. With respect to asymptomatic findings and good condition of the patient with ECOG 1 performance status, treatment with enzalutamide was started. Already after 3 months of treatment with enzalutamide at the standard dosage of 160 mg/day, a significant decrease in PSA from 2.23 to 0.079 ng/mL was observed. The control choline PET/CT showed regression of pathological accumulation at the post-prostatectomy site and reduction of pathological nodules in the small pelvis and left groin. Due to the effect of therapy and good tolerance, the established treatment with enzalutamide was continued. PSA levels continued to decline to 0.008 ng/mL in December 2018. According to control choline PET/CT, a complete response was confirmed. Despite the patient’s advanced age, enzalutamide therapy was without adverse effects. With the help of a general practitioner, we regularly monitored risk factors for coronary heart disease and bone metabolism. Other control PSA levels showed a stationary level below 0.008 ng/mL, the last value in June 2023. Duration of complete response also repeatedly confirmed on follow-up choline PET/CT scans, the last one in November 2022. Therefore, enzalutamide therapy was continued until the present time.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2177_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2177_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a7e78ecfb082ac93a3c1482f31a7365f8ba5070f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2177_en.txt
@@ -0,0 +1,2 @@
+A 61-year-old white woman with an unremarkable medical history was referred for an evaluation of an asymptomatic retinal hemorrhage detected in her right eye. Her past ocular history was significant for a complete posterior vitreous detachment in the right eye. Her best-corrected visual acuity was 20/20 in each eye. Anterior segment examination and applanation tensions were unremarkable. Ophthalmoscopic examination of the right eye identified subretinal hemorrhage surrounding a pigment epithelial detachment (PED) located above the superotemporal vascular arcade . Spectral-domain optical coherence tomography (SD-OCT) demonstrated the presence of a PED accompanied by irregularities of the retinal pigment epithelium (RPE) profile . Optical coherence tomography (OCT) B-scan with angiographic flow overlay showed a peaked PED with intrinsic flow signal . Ophthalmoscopic examination of the left eye demonstrated a PED nasal to the optic nerve characterized by a dome-shaped elevation of the RPE with a shallow irregular portion on SD-OCT , whereas the angiographic flow overlay revealed intrinsic flow signal . Multiple, small, cuticular drusen appearing as small hypoautofluorescent dots on fundus autofluorescence (FAF) were seen in both eyes along the vascular arcades . Indocyanine green angiography (ICGA) showed focal areas of hyperfluorescence within the PEDs, indicative of AT1 .
+OCT angiography en face slab demonstrated aneurysmal dilatation arising from a type 1 neovascular network, particularly evident in the right eye with active lesions. As comparative imaging from the patient’s prior examination showed increased hemorrhage, treatment with anti-vascular endothelial growth factor (VEGF) therapy was initiated for the right eye at that time.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2178_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2178_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7233b1ff2d496aebacb518cec8257c0fd34754d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2178_en.txt
@@ -0,0 +1,7 @@
+On February 23, 2022, a 53-year-old male was admitted to our hospital because of 15 d history of progressive swelling, pain and blurred vision in the left eye, in the absence of obvious inducement.
+Fifteen days ago, the patient developed swelling, pain and blurred vision in the left eye, and was admitted to the 9th Hospital of Hangzhou. He was diagnosed with "neovascular glaucoma” and was given tobramycin dexamethasone eye drops and pranoprofen eye drops for anti-inflammatory therapy, timolol eye drops and brinzolamide eye drops for ocular hypotensive therapy. However, the disease symptoms did not improve, and he visited the First People's Hospital of Hangzhou on February 23, 2022, for further diagnosis and treatment.
+The patient had no past illness.
+The patient had no special personal or family history of illness.
+Ophthalmological examination showed that visio oculus dexter was 0.8 and Visus Oculi Sinistri was sensitive to light (mainly contains distorted light that is located above and below the nose). Noncontact tonometer showed that R/L = 16.3/Tn + 3 mmHg. There was no hyperemia of right bulbar conjunctiva. The cornea was clear and the depth of anterior chamber was satisfactory. Pupils were round in shape and reactive to light while light was mixed in the lens of right eye, optic disc boundary was clear and flat, while omentum was located in the fundus, mixed congestion in the conjunctiva of left eye and corneal edema were also noted. There was mild swelling in one-third of the anterior chamber, pupil was round in shape and not reactive to light and it was not extending to posterior chamber of eye, while the other details were unclear.
+Relevant antibody tests and other laboratory tests were further performed, and the results were all negative.
+Ophthalmic ultrasound showed a solid lesion in the left eye, indicating possible optic nerve head melanoma . CT showed patchy slightly hyperdense shadows anterior to the posterior wall of the left eyeball, suggesting a mass . MR imaging showed left eyeball mass with slightly short T1, equal short T2 abnormal signals, about 8 mm × 5 mm in size, which were significantly enhanced after contrast enhancement . PET/CT fusion images showed that the posterior left eyeball was locally thickened. The glucose metabolism of the lesion was normal . No significant abnormality was observed in the pancreas, spinal cord, cerebellum, adrenal gland, or kidney. The patient signed a written informed consent form before the examination. This retrospective study involving human participants was reviewed and approved by the Medical Ethics Committee of Hangzhou First People’s Hospital, Zhejiang University School of Medicine (Approval No. 2022-007-01).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2189_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2189_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3d2c92593f91564c216d8d09336d42a872271dcc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2189_en.txt
@@ -0,0 +1,12 @@
+A 69-year-old Japanese woman who had been undergoing cancer treatment for advanced LAC was admitted to our hospital in January 2018 because of anorexia, fatigue, and general weakness. The patient had a maternal family history of esophageal cancer. The patient had been a housewife since her 20s, had never smoked cigarettes, and did not have a drinking habit. The patient’s medical history was unremarkable until June 2016, when an abnormal x-ray shadow was found in her right lung. A computed tomographic (CT) scan revealed a tumor (3.1 cm) in the upper lobe of her right lung , right hilar and mediastinal lymph node swellings, and liver tumors. A transbronchoscopic biopsy from the lung tumor revealed LAC with vascular invasion . IHC revealed no anaplastic lymphoma kinase rearrangement, and a genetic analysis of the cancer cells detected no epidermal growth factor receptor mutation. Whole-body technetium-99m methylene diphosphonate scintigraphy revealed multiple lesions at the thoracic and lumbar vertebrae, sternum, ilium, and right ischial bones. Brain magnetic resonance imaging (MRI) revealed tumors in the left temporal lobe and right cerebellar hemisphere . As a result, the patient was diagnosed with LAC with distant metastases to the brain, liver, and bones (cT2aN2M1b, stage IV) .
+The patient underwent stereotactic radiation surgery (total, 22 Gy) for her metastatic brain tumors in July 2016. Thereafter, she received four courses of chemotherapy with intravenous cisplatin, pemetrexed, and bevacizumab from July 2016 to October 2016; this treatment regimen effectively controlled her advanced LAC with a Response Evaluation Criteria in Solid Tumors (RECIST) classification of partial response . The patient subsequently received nine courses of maintenance chemotherapy with intravenous pemetrexed and bevacizumab from November 2016 to April 2017. CT scans performed in May 2017 revealed no progression of the primary LAC or metastatic brain and bone lesions, but they showed evidence of progression of the metastatic liver tumors.
+Subsequently, the patient began second-line chemotherapy with intravenous nivolumab (133 mg [3 mg/kg] every 2 weeks) in May 2017 . Thyroid function was routinely monitored in July 2017 after five courses of nivolumab therapy, and she showed high levels of serum free thyroxine (FT4, 1.91 ng/dl) and low levels of thyroid-stimulating hormone (TSH, 0.04 μIU/ml). The patient had no symptoms of thyrotoxicosis or exophthalmos but had mild and soft struma without any pain or fever. Ultrasonography revealed rough and mildly low echogenicity in a slightly enlarged thyroid gland without a tumor , and technetium-99m pertechnetate thyroid scintigraphy revealed a low thyroid uptake of 0.1% (reference range, 0.5–4%) in the entire thyroid gland . The patient had negative test results for TSH-binding inhibitory immunoglobulin (TBII), thyroglobulin autoantibody (TgAb), and thyroid peroxidase autoantibody (TPOAb). On the basis of these findings, she was diagnosed with painless thyroiditis induced by nivolumab and was closely followed without medication. The patient exhibited primary hypothyroidism (FT4, 0.66 ng/dl; TSH, 11.41 μIU/ml) in September 2017 and initiated thyroid hormone replacement therapy with oral levothyroxine (50 μg/day).
+Because the CT scans performed after the sixth cycle of nivolumab revealed enlargements of the metastatic liver tumors, nivolumab therapy was discontinued in August 2017. The patient received three courses of third-line chemotherapy with docetaxel and ramucirumab beginning in September 2017, which effectively controlled her LAC (RECIST classification of partial response), but this treatment was terminated in October 2017 because of side effects, such as joint pain and rhabdomyolysis. The patient did not consent to continue anticancer drug therapy after considering the potential benefits and side effects, and she chose to receive best supportive care.
+In November 2017, the patient’s body weight, blood pressure, and pulse rate were 45 kg, 121/67 mmHg, and 76 beats per minute, respectively. She had normal levels of serum electrolytes (sodium 140 mEq/L, potassium 4.3 mEq/L, and chloride 106 mEq/L). However, the patient developed acute anorexia, fatigue, and general weakness in December 2017 and was admitted to the Department of Respiratory Medicine at our hospital in January 2018.
+On admission, the patient had clear consciousness and did not complain of headache, abdominal pain, diarrhea, or joint and muscle pain. Her height, body weight, body temperature, blood pressure, and pulse rate were 153 cm, 38 kg, 36.9 °C, 90/54 mmHg, and 73 beats per minute, respectively. She had mild and soft goiter without pain. No heart murmur, chest rales, rash, vitiligo, skin pigmentation, or peripheral edema was detected. No paralysis, cerebellar ataxia, pyramidal or extrapyramidal tract symptoms, visual disturbance, hearing loss, dysarthria, or epileptic seizures were found. A blood analysis revealed hyponatremia (serum sodium 124 mEq/L); asymptomatic hypoglycemia (fasting plasma glucose 65 mg/dl); and low levels of immunoreactive insulin (< 0.2 μU/ml), ACTH (2.6 pg/ml), and cortisol (< 0.2 μg/dl) . Because AI was suspected, oral levothyroxine was discontinued on day 2 of admission because hormone replacement therapy with thyroid hormone alone can exaggerate AI symptoms when hypothyroidism and AI coexist. The patient was referred to the Department of Endocrinology and Metabolism on day 5 of admission.
+A rapid cosyntropin stimulation test suggested secondary AI . Dynamic tests assessing the secretion of pituitary hormones showed the normal release of growth hormone (GH), TSH, and prolactin; age-appropriate release of luteinizing hormone and follicle-stimulating hormone; but no ACTH release following a corticotropin-releasing hormone load . A GH-releasing peptide 2 loading test also showed no ACTH release, whereas GH release was sufficient . These findings were indicative of IAD. A brain MRI study revealed slight atrophy of the anterior pituitary with a pituitary height of 2.2 mm .
+The patient had negative test results for anti-pituitary cell antibody, TgAb, TPOAb, and TBII as well as other organ-specific autoantibodies, including glutamic acid decarboxylase autoantibody, insulin autoantibody, gastric parietal cell autoantibody, intrinsic factor autoantibody, adrenocortical autoantibody, antinuclear antibody, Sjögren’s syndrome A and B antibodies, anti-citrullinated peptide antibody, and rheumatoid factor.
+Human leukocyte antigen (HLA) typing revealed the presence of A*08:01/12:02, B*48:01/52:01, and C*08:01/12:02 class I genes and DRB1*04:05/09:01, DQB1*03:03/04:01, DQA1*03:02/03:03, and DPB1*04:02/14:01 class II genes.
+The patient began corticosteroid replacement therapy with oral hydrocortisone (15 mg/day) for AI secondary to IAD on the afternoon of day 8 of admission. Subsequently, she resumed oral levothyroxine (50 μg/day) for primary hypothyroidism on day 9 of admission.
+The patient experienced improvements in anorexia, fatigue, and general weakness and became ambulatory within days. Her hyponatremia was corrected within 1 week, and her hypoglycemia was resolved. Laboratory data obtained on day 21 of admission showed normal levels of serum sodium (140 mEq/L), potassium (4.3 mEq/L), chloride (106 mEq/L), FT4 (1.60 ng/dl), TSH (3.28 μIU/ml), and fasting plasma glucose (78 mg/dl). The patient was discharged on day 25 of admission.
+The subsequent clinical course of the patient was mostly uneventful for 6 months after discharge. As her LAC progressed, her ability to perform activities of daily living decreased, and in November 2018, she was transferred to a local hospital to receive terminal care.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2193_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2193_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..03c9124c1355d6102fb40d0df9e368de38026a74
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2193_en.txt
@@ -0,0 +1,2 @@
+A 32-year-old Mongoloid female with headache, progressive disturbance of consciousness, and right limb weakness was transferred to our hospital. On arrival, she was in a mild coma with dilated pupils. Glasgow Coma Scale (GCS) score was 9 (4 + 4 + 1). No movement but muscle retraction was observed in the right limb and the Babinski sign is positive. The National Institute of Health Stroke Scale (NIHSS) score was 17. The patient was a fruit seller without previous chronic diseases, and denied smoking and drinking history, toxic and drug exposure, and family history. Noncontrast brain computed tomography (CT) and CT venography scan in another hospital showed CVST in straight sinus and sagittal sinus . Subcutaneous injection of weight-based low-molecular-weight heparin was immediately administered, yet symptoms deteriorated within 2 days.
+After admission, cerebrovascular intervention was performed immediately, and the images indicated nonvisualization of right transverse, sigmoid sinus, and straight sinus, and large thrombus was identified among the junction of the superior sagittal sinus, the left transverse sinus, and the sigmoid sinus, with severe stenosis of the corresponding vein lumens . Urokinase was injected into right transverse sinus and upper sagittal sinus via microcatheter. After the operation, the microcatheter and the sheath were kept for alternate use of urokinase and alteplase in the next 2 days. Unfortunately, the patient’s symptoms did not improve significantly. We performed a second cerebral angiography and found nonvisualization of the straight sinus and the right transverse, while the large thrombus almost disappeared. Using balloon dilation and thrombus aspiration, we found that the visualization of right transverse sinus and sigmoid sinus was improved, while that of the straight sinus was not . After intervention, full-dose anticoagulation therapy was administrated, despite large bruises on both upper limbs and slight hemorrhage in the thalamus. The patient’s consciousness state was gradually improved within 2 days. Her later laboratory examination showed that serum thyroid-stimulating hormone was low with high free triiodothyronine (T3), free thyroxine (T4), and antibodies, but she was never diagnosed or treated. The department of endocrinology was consulted, she was diagnosed with hyperthyroidism (Graves’ disease), and corresponding drug treatment was carried out. She was discharged with her NIHSS score decreased to 2, diagnosed with hyperthyroidism and refractory CVST. Three months later, she complained of occasional numbness in right limb with NIHSS score of 0. Magnetic resonance venography (MRV) showed that sagittal sinus, transverse sinus, and sigmoid sinus visualized well, although the straight sinus was less clear.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2205_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2205_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..63e325a41b3f174fa659ed59e39c62b4f31b12c6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2205_en.txt
@@ -0,0 +1 @@
+A 33-year-old woman was referred to our department with unstable angina. At the age of six, she underwent CABG to the second diagonal branch using the left internal thoracic artery (LITA) and to the obtuse marginal branch using a saphenous vein graft (SVG), as well as mitral annuloplasty for congenital LMCA and moderate mitral regurgitation. After the initial operation, 18 years passed without any signs of angina. However, at the age of 24, she started to experience occasional chest pain on exertion, which had become more frequent by the age of 32. Although her electrocardiogram and echocardiogram showed no abnormal findings, exercise stress myocardial perfusion scintigraphy revealed an extensive ischemic lesion on the left ventricular anterior wall . Although a coronary angiogram showed a patent LITA to the second diagonal branch and a patent SVG to the obtuse marginal branch , the LAD was not perfused by the LITA, and was mainly supplied by collateral flow from the right coronary artery . Multidetector-row computed tomography demonstrated a disruption of blood flow to the LAD from the LITA due to an occlusion of the proximal part of the second diagonal branch. Therefore, to improve the ischemia of the LAD lesion, we performed a redo CABG using the right internal thoracic artery (RITA). In the current case, because the distal LAD was too small to be grafted, and the proximal LAD was deep in the myocardium, we bypassed to the first diagonal branch, which was connected to the LAD. Postoperative coronary angiogram showed that all bypass grafts, including the RITA, were patent and there was blood flow communication between the first diagonal branch and the LAD . Pharmacologic stress perfusion scintigraphy revealed an improvement in the ischemia, especially in the left intraventricular septum . The patient’s symptoms also improved and she was discharged 10 days after surgery. She has been in good health for over 3 years without recurrence of chest symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2230_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2230_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..356a1a0c1bdef3445fecccb29e4c2e5187e3c002
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2230_en.txt
@@ -0,0 +1,2 @@
+We report a case of a 35-year-old male diagnosed with trigeminal neuralgia eight months prior who presented with two days of intractable 10/10 left facial pain with radiation from his jaw to his temple. This pain was exacerbated by clenching of his jaw and chewing. He described his pain as sharp and shooting, lasting only seconds, and consistently self-resolving. Over the two days prior to his ED visit, he had more frequent episodes of pain, and endorsed up to 30 episodes a day. His pain was refractory to multiple over-the-counter pain medications. The day of presentation he had six hours of near-constant clusters of severe shooting pain. His physical exam revealed normal vital signs, normal head, eyes, ears, nose, and throat exam except for hyperalgesia of his left face. Cranial nerves 2–12 were intact. He had normal speech, symmetric motor and sensation to all four extremities, and a normal gait. He had no meningismus upon examination of his neck.
+In our ED, he was initially treated with a cocktail of ibuprofen, diphenhydramine, prochlorperazine, and one liter of normal saline. The patient had no resolution of symptoms 45 minutes after administration of this “migrane cocktail.” The history and physical exam were consistent with a trigeminal neuralgia crisis. To treat the patient’s neuropathic pain, he was given 250 milligrams (mg) of fosphenytoin that was infused intravenously (IV) over 10 minutes. At the end of the infusion, his pain had completely resolved. He was discharged with a neurology follow-up and a prescription for carbamazepine. Chart review six months after the patient was discharged did not show any other ED visits listed after discharge.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2239_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2239_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..72b5d822a5f2abd549995ff6df796b60be63f614
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2239_en.txt
@@ -0,0 +1,5 @@
+A 52-year-old male manifested mildly progressive fatigue in the muscles of mastication over 3 years, without diplopia, dysphagia, or limb weakness. The patient complained of fatigue when chewing hard food (beef jerky, dried sweet potatoes, pancakes, etc.), but not obvious when eating soft food (rice, noodles, etc.). He also felt easy to cramp in the muscles of the neck, abdomen, and limbs. During the 3 years, he felt the symptoms slightly aggravated. Additionally, the patient suffered from hypertension for 6 years and pre-excitation syndrome for 5 years and accepted surgery because of a kidney stone 8 years ago . A younger brother of the patient presented a postural tremor in his hands for 10 years.
+Neurological examination revealed reduced strength of masticators after repeated movements. Weakness and spasms of facial muscles were present, and tongue wasting with fasciculations was observed (Video ). While the weakness, wasting, or fasciculations were not obvious in the limbs. The patient also showed slightly postural hand tremor, and ptosis in the right eyelid was observed. Muscle strength in his upper and lower limbs was 5/5 according to the Medical Research Council score, and the Quantitative Myasthenia Gravis score was 4 (3 in ptosis, 1 in facial muscles). Muscle reflexes and muscle tone were normal. Sensation and coordination were intact. There was no gynecomastia.
+Routine laboratory tests showed a normal creatine kinase level but detected an elevated level of serum uric acid (501umol/L, normal range 208-428umol/L) and triglyceride (4.53mmol/L, normal range 0.56-1.70mmol/L). Thyroid function and sex hormones were normal. The lactic acid stress test was negative. Tests of AchR antibody (ELISA), MUSK antibody (CBA), LRP4 antibody (ELISA), and RyR antibody (ELISA) were normal, while the test of titin antibody (ELISA) was positive (1.09 OD). The electrocardiogram showed a WPW pattern ECG with a heart rate of 80 bpm , but the patient did not manifest any cardiological symptoms such as palpitation. CT scans of the lung and thymus gland were normal. Brain MRI showed supratentorial multiple ischemic changes.
+Nerve conduction studies showed decreased action potentials in the right median, ulnar and bilateral sural sensory nerves, and the left peroneal compound muscle action potential was lower in amplitude than the right side. Both motor and sensory nerve conduction velocities were normal. Needle electromyographic studies showed high-amplitude, long-duration motor unit potentials in a diffuse distribution of limbs, tongue, rectus abdominis, paravertebral, and sternocleidomastoideus muscles, and showed simple phases in all tested muscles. Fibrillation and positive sharp waves were only observed in the tongue muscle. The above results revealed chronic neurogenic damage with both motor and sensory involvement. In addition, the 3-Hz RNS showed a decremental response in bilateral orbicularis oculi (14.9% on the right side and 12% on the left side) but did not detect a decremental response in trapezius or abductor digiti minimi, and no significant decremental or incremental response to 30-Hz RNS was noted.
+After informed consent, a muscle biopsy was performed on his left biceps brachii, and the muscle pathology showed a grouping muscle fibers, indicating chronic neurogenic damage . Genomic DNA was obtained from the peripheral blood leukocytes. The genetic analysis was performed using polymerase chain reaction and fragment length analysis, which revealed an increased number (39 repeats) of tandem CAG repeats in the AR gene confirming the diagnosis of SBMA . The same genetic analysis result was also detected in his brother. The patient felt the fatigue symptom significantly improved after oral pyridostigmine bromide treatment (30 mg, Tid), but the symptoms keep progressing in the subsequent follow-up process.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2271_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2271_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..90bf4fa433681a140dc9ae7f2dc9fcc70d34af30
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2271_en.txt
@@ -0,0 +1,4 @@
+A 25 year old male patient presented to our tertiary care eye hospital with a complaint of decreasing visual acuity in the right eye of 4 months duration. He had been treated earlier with topical anti-glaucoma agents and steroids given orally, topically and as posterior subtenon injection. His previous clinical record showed anterior chamber activity, severe vitritis and an intraocular pressure of 40 mmHg. Intraocular growth had been suspected on a previous B-scan ultrasonography. Vitreous tap of the right eye performed before the patient came to our clinic had shown atypical cells on cytological examination, suggestive of retinoblastoma (Rb).
+On ocular examination he had no perception of light in the right eye (PL –) and 6/6 vision in the left eye. There was rubeosis iridis, ectropion uveae, a fixed pupil and neovascular glaucoma in the right eye. By that time he had also developed a pseudohypopyon in the right eye resembling a masquerade syndrome (Figure ). Vitritis and vitreous condensations were noticed. The view of the right fundus was not clear. Examination of the left eye did not show any abnormality in the anterior and posterior segments.
+B-scan ultrasonography of the right eye showed a hyper echoic endophytic mass with no calcification. CT scan of the orbits and brain showed intraocular mass in the right eye without any calcification. The patient had normal blood counts and liver function tests. Enucleation of the right eye was carried out. Histopathological examination revealed poorly differentiated Rb (Figure ), showing combined endophytic and exophytic growth patterns and retinal detachment. Tumour size was 1.5 × 1.2 cm. Vitreous, choroid and optic disc were involved. Optic nerve was involved up to the resection margin (pT4). Regional lymph nodes were not assessed (pNX). Tumour was poorly differentiated (histological grade pG3) with necrosis greater than 50%. Apoptosis and calcification were also seen on histopathology.
+Chemotherapy and radiotherapy were planned and pre-chemotherapy systemic laboratory workup was advised. However, the patient did not comply and was lost to follow up. He reported again after one month with swelling in the enucleated socket. Patient was again counselled about the disease and management with chemotherapy and radiotherapy was advised. Injection Carboplatin 975 mg (on day 1), injection Etoposide 260 mg (on day 1and 2) and injection Vincristine 2 mg (on day 1) were given 4 weekly. After 6 cycles of chemotherapy and radiotherapy of 50 Gy in 25 fractions (12 MeV) to the right orbit, the patient developed sudden weakness of lower limbs with inability to sit or stand. Bone scan was performed using Technetium (99mTc) medronic acid but whole body imaging did not show any evidence of secondaries. DEXA scan of the lumbar spine and left hip showed osteopenia and increased risk of fractures. Contrast enhanced CT scan of the orbits and brain showed a metastatic brain deposit as an enhancing soft tissue mass in the supra-sellar region. Whole brain Co 60 radiotherapy in a dose of 20 Gy in 5 fractions was done. He was then discharged from the oncology unit with an advice to continue supportive care as he was unfit for any further oncology related therapeutic intervention. The patient expired almost 16 months after the onset of symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2284_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2284_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e7df8c3b3bade7883144c6471136356ef0ce25ab
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2284_en.txt
@@ -0,0 +1,3 @@
+A 30-year-old male, right-handed, manual laborer presented with an insidious onset and gradually progressive right shoulder pain with a feeling of instability for 5 months. For these complaints, the patient visited the outpatient department. On examination, the patient was apprehensive of external rotation beyond 60°. The patient had an anterior drawer test and sulcus sign positive . The patient had pain while initiating abduction. The range of abduction, however, was equal as compared to the opposite side. There was no pain or restriction of range on adduction and internal rotation. The impact maneuvers (Neer and Hawkins) were negative. There was no tenderness on palpation of the bicipital groove. Radiological investigations in the form of radiogram and magnetic resonance imaging were performed. Partial-thickness supraspinatus tear and fraying of the anteroinferior glenoid labrum were noted in the imaging.
+The patient was advised conservative line of management with analgesics and physiotherapeutic rehabilitation for a period of 3 months. After the completion of this conservative treatment protocol, the patient presented for follow-up with persistence of pain. The patient was posted for an arthroscopic repair of the supraspinatus tear and the anteroinferior glenoid labrum. During the arthroscopic procedure, a variation in the anatomical origin of the long head of biceps was noted; the origin was on the inferior surface of the supraspinatus . This tendon of long head of biceps was not found to be inflamed or degenerated and was stable on probing. Arthroscopic repair of the supraspinatus tendon and capsulolabral reinforcement was performed using absorbable anchors.
+The tendon of long head of the biceps was not operated on. On 1-month follow-up, the pain had significantly decreased and the complaint of instability was also completely resolved. The patient resumed work after 6 months of rehabilitation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2291_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2291_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d0de930278e3adc50bbb0256536279bebc7dee50
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2291_en.txt
@@ -0,0 +1 @@
+A 78-year-old male patient was referred to our tertiary, university hospital outpatient clinic with pain in his right leg. His medical history included a laminectomy of L3-L5, performed 1.5 years before his current visit, because of spinal stenosis as a result of degenerative scoliosis. This procedure was followed by the collapse of the vertebral bodies of L2 and L3 with compression of the right nerve root and spinal stenosis at L3. There had not been any wound problems or other complications after the first procedure. Further medical history included bilateral total hip arthroplasty, revision of the left hip arthroplasty after 19 years, left total knee arthroplasty, hypertension, and ulcerative colitis (without medication). The physical examination showed a lumbar scoliosis with a painful and slightly reduced range of motion of the spine whereas the sacroiliac and hip joints showed a pain-free and normal range of motions. The knee and Achilles tendon reflexes were lower on the right side. Sensation and motor function were normal. The radiographs and magnetic resonance imaging (MRI) showed degenerative scoliosis with the apex on L2-L3 with the collapse of the vertebral bodies of L2 and L3. Serum markers for infection, 2 months before the presentation at our clinic, were as follows: C-reactive protein (CRP) <1 mg/L, leukocytes 8.8 × 10 e9/L, and erythrocyte sedimentation rate (ESR) 12 mm/h. To exclude a possible spondylodiscitis, as a cause of the sudden vertebral body collapse a positron-emission tomography-computed tomography scan was performed, which showed no clear signs of infection but severe degeneration at level L2-L3 . We planned a surgical decompression of L2-L3 on the right side with a posterior spondylodesis of L1-L5. During the ambulatory waiting time before surgery, the patient’s symptoms worsened. He was unable to walk and stand because of severe pain in the lumbar spine, without signs of neurological impairment. Four weeks before the onset of progressive symptoms, a broken molar was removed during a dental procedure. The patient interview revealed no alternative explanation for his worsening condition. He was admitted to the hospital, and the date of surgery was advanced. Serum infection markers showed a CRP of 174 mg/L, leukocytes of 11.9x10e9/L, and ESR of 128 mm/h. A new MRI scan showed the previously seen destruction of L2-L3, with an extensive fluid collection in the remaining intervertebral space, paravertebral myositis, and multiple abscesses . Based on the new clinical situation, adecompression of L2 and L3 and a posterior spondylodesis T12-L5 was performed obtaining deep cultures of tissue and the abscess in the disc space. Vancomycin and ciprofloxacin were started postoperatively. Weakness of the right quadriceps was observed in the first postoperative hours, and a CT-scan showed a medial position of both L4 screws. These were replaced by using a revision procedure in the same day. Unfortunately, the weakness persisted in the following weeks. All intraoperative cultures showed P. micra, and the antibiotic treatment was changed to penicillin intravenously (12 g daily) based on the sensitivity spectrum. The pain and infectious signs subsided, and the serum infection markers improved after 2weeks of antibiotics as follows: CRP 43 mg/L and leukocytes 9.3 × 10 e9/L. The antibiotic treatment was continued orally with clindamycin (600 mg three times daily) for 4weeks. At the last visit to the outpatient clinic, at 1 year after surgery, the patient reported only occasional backpain. Blood results as follows: CRP 8 mg/L, leukocytes 8.6 × 10e9/L, and ESR 32 mm/h. Radiography of the spine showed unchanged spinal instrumentation and no signs of spondylodiscitis relapse.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2302_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2302_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..275df262e113607274c894c896e2beb7f36094a7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2302_en.txt
@@ -0,0 +1,3 @@
+A 77-year-old lady presented with progressive left groin pain, due to degenerative hip osteoarthritis. In the ipsilateral leg, she had a previous knee arthrodesis, as a result of a traffic accident during childhood . She presented with a leg length discrepancy at the expense of the left leg of 8.5 cm, corrected by an orthopedic shoe.
+Clinically, there was no Trendelenburg limp. Log roll and rotation with the hip in flexion (and knee in extension) were painful, with a limited rotation. Radiographs of the pelvis and the left hip showed left hip osteoarthritis . Previous conservative treatment (pain killers, anti-inflammatory medication, and lifestyle adaptations) had become insufficient. Thus, a THA was proposed.
+Radiographically, there was a normal anatomy of the hip joint. A DAA THA was planned, which is the senior surgeon’s standard approach for most primary THA’s. Due to the expected difficulties in femoral exposure and leg positioning, and due to the possibility of poor bone quality after long standing knee arthrodesis with ipsilateral hip osteoarthritis, a cemented stem was planned. This could also allow for correction of the version and leg length without compromising fixation. Before surgery, a literature search on PubMed was performed to look for technical tips and tricks in similar cases of THA with ipsilateral knee arthrodesis. Search terms included: Knee arthrodesis; femoral anteversion; and arthroplasty hip. There was a case of a THA after knee arthrodesis using a posterolateral approach . Moreover, a case series by Bourne et al. of 16 patiënt, seven transtrochanteric, six posterolateral, and three anterolateral approaches . No literature was found about the anterior approach in this specific case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2311_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2311_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0e16b033bceac75cd0cda53d758b238c9455ad21
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2311_en.txt
@@ -0,0 +1,2 @@
+A 30-year-old man presented to the emergency trauma room following a motor vehicle collision in which he was the front-seat unrestrained passenger. At the time of presentation, the patient was vitally stable, conscious, alert, oriented with a Glasgow Coma Scale 15/15 . A cervical collar and spinal board were applied by the paramedics at the scene. The trauma surgery team assessed the patient initially and implemented the advanced trauma life support protocol ; he was deemed to be hemodynamically stable with no other systemic injuries. The patient was, however, complaining of moderate left hip and thigh sharp pain as well as left shoulder pain. On examination, he was noted to have abducted, shortened and internally rotated left lower limb. Active and passive movements of the left thigh were not possible due to pain with no neurovascular deficits detected distally. There were no significant examination findings of the left shoulder and upper limb. X-rays of the pelvis and left femur revealed a posterior fracture dislocation of left femoral head with an ipsilateral femoral mid-shaft fracture and a computed tomography (CT) scan of the pelvis showed large and small fracture fragments within the acetabulum originating from the medial aspect of the femoral head . A shoulder X-ray also revealed a non-displaced left scapular body fracture. An attempt of left hip closed reduction was made while the patient was still in the emergency department and it was, however, unsuccessful.
+After being cleared by the trauma team, the patient was admitted to the orthopedic service with a working diagnosis of left posterior hip dislocation with a Pipkin Type 1 ipsilateral femoral head fracture and an ipsilateral femoral shaft fracture. The patient was taken to the operating theater for closed versus open reduction and intramedullary nailing of the left femur. Within 5 h of his injury, the patient underwent closed reduction of the left hip with the aid of a temporary external fixator applied on the femoral shaft proximal to the fracture . The external fixator rod was used as a handle, and the reduction was successful after the first attempt, as confirmed by the C-arm and CT reconstruction . Subsequently, the external fixator was removed, and intramedullary nailing of the left femur was carried out. After completion of the procedure, the left hip was examined and found to be stable with the femoral head fragment not affecting the movement. The patient was discharged after 3 days with a clean, dry wound and full weight bearing ambulation as tolerated. Unfortunately, he was lost to follow-up and attempts to contact the patient were unsuccessful.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2314_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2314_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b98f739cce99d15e652de95d97f4e3fe7b74f79c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2314_en.txt
@@ -0,0 +1,3 @@
+A five-day-old full-term female baby delivered by cesarean section cried immediately at birth. The mother had no comorbid conditions and described her pregnancy as normal. During the pregnancy, the mother had an X-ray of her leg, but she was unaware of her pregnancy at the time. There is no family history of congenital anomalies, and the baby is born to parents that are unrelated. The baby was born with a trunk-like appendage that was arising from the superomedial canthus of the left eye, 26 mm × 12 mm in size, with a small tract with Cerebrospinal fluid discharge. The left nasal cavity was hypoplastic with left anophthalmia. No cleft palate, cleft lip, or choanal atresia was noted. .
+A two-dimensional Echocardiography (2D echo) revealed complex cyanotic congenital heart disease, including double outlet Right Ventricle with a large ventricular septal defect of 8 mm, malposed great vessels, mild valvular right ventricular outflow tract obstruction (RVOTO) with a pressure gradient of 26 mmHg, small Patent ductus arteriosus (PDA) with a left to right shunt and confluent branched pulmonary arteries. Two ostium Secundum atrial septal defects (ASD) were noted of 4 mm and 25 mm with a normal biventricular structure and function. On Magnetic resonance imaging (MRI) of the brain, mild hydrocephalus, bilateral colpocephaly (larger than normal occipital horns due to undeveloped white matter in the posterior cerebrum) with bilateral periventricular white matter hypodensities and corpus callosum agenesis were noted. Computed tomography (CT) imaging with a 3D reconstruction of the face revealed minor bony defects of the left nasal bone, frontal process of the maxilla, and absent nasal turbinates.Bilateral maxillary and ethmoid sinuses were underdeveloped, to a greater degree on the child's left side. CT imaging of the thorax and abdomen revealed a hemivertebra involving the T10 vertebral body causing focal scoliosis with right-sided convexity.
+Our patient’s parents deferred treatment and chose to wait till the child grows older.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2331_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2331_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..784e69e8ccc64d84aa223194471d54182fcb6e19
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2331_en.txt
@@ -0,0 +1,5 @@
+A 45-year-old African American male presented with right hip pain secondary to avascular necrosis of the femoral head, with collapse . The patient failed conservative treatment including physical therapy, non-steroidal anti-inflammatory medications, and a fluoroscopic-guided intra-articular corticosteroid injection, and elected to proceed with total hip arthroplasty (THA).
+The index THA was performed through a standard posterolateral approach. A Stryker modular dual mobility (MDM) THA construct was selected. A Stryker Accolade 2, size #6, 132° neck angle femoral component was paired with a Biolox® delta ceramic 28 mm head, 0mm neck length. The stem is made of a titanium-based alloy which includes aluminum and vanadium and has a 5˚40’ taper with a smooth surface finish. The dual mobility polyethylene inserts measured 28 mm in inner diameter and 48 in outer diameter and articulated with the MDM cobalt-chromium liner. A 54 mm titanium acetabular shell was impacted into the bony acetabulum using press-fit technique and two 6.5 mm cancellous screws were used. At the conclusion of the case, all components were deemed well-fixed, and the patient demonstrated appropriate leg length and range of motion intraoperatively . Upon discharge, the patient maintained standard post-operative hip precautions and attended outpatient physical therapy. He was seen in clinic for routine post-operative care at the 3-week, 6-week, 3-month, and 9-month marks.
+At 28 months, the patient returned to clinic with “mild right hip pain”. Infectious workup was negative and a bone scan failed to identify any evidence of component losing. The patient was subsequently lost to follow-up until 4.5 years post-operative, when he presented to the emergency department after tripping and falling onto his right hip. He reported severe pain in the right groin immediately after falling with an inability to bear weight. Radiographs revealed gross deformity of the right femoral head, with fine, radiopaque particles adjacent to the joint . CT scan confirmed fragmentation of the delta ceramic head without signs of other component failure or loosening . At the time, the patient refused urgent surgical management before agreeing to revision THA at his outpatient follow-up 2 days later.
+The previous posterolateral incision was utilized for the revision. Examination of the ceramic femoral head revealed 4 large main fragments with multiple smaller pieces . After removal of the polyethylene and fragmented ceramic components, the metallic liner was evaluated and deemed to be securely fixed in place. The acetabular shell and femoral stem components were ingrown and well-fixed. The femoral component taper did not show any severe corrosion. Extensive synovectomy and irrigation were performed to ensure the removal of any remaining ceramic fragments. Trials of the original sized components demonstrated good stability. Thus, replacement 28 mm +0 Biolox® delta ceramic femoral head, Stryker Universal Titanium Taper Adapter, and Restoration MDM polyethylene liner (inside diameter 28 mm, outside diameter 48 mm) were implanted.
+At the 2-week follow-up, the patient expressed his pain was well controlled. He was able to ambulate without an assistive device and felt well enough to return to his occupation in custodial services. He was still doing well based on follow-up telephone encounter 2 years post revision THA without any significant hip pain or functional limitations.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2380_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2380_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0cefbfe5c0d6ec189487c055fc01f4a6ae0d2e0c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2380_en.txt
@@ -0,0 +1,5 @@
+A 60-year-old female with a medical history of hypertension presented to the orthopedic foot and ankle clinic with progressive pain about her right first MTPJ. She reported having a first MTPJ arthroplasty in 2004 and long-standing pain in her first MTPJ that worsened with walking. She had attempted a Morton’s extension orthotic without pain relief.
+On physical examination, there was tenderness to palpation about the first MTPJ, with mild swelling and a well-healed dorsal surgical scar. Range of motion of the joint was painful through the entire arc of motion. There was also tenderness to palpation on the plantar aspect of the second and third MTPJs, with corresponding plantar-based calluses, but normal sensation throughout the foot, with palpable pedal pulses, and brisk capillary refill in all toes.
+Three-view radiographic evaluation of the right foot showed a prior first MTPJ arthroplasty with perihardware lucency indicative of loosening components and a shortened first ray. The patient was diagnosed with failed first MTPJ arthroplasty secondary to loosening of the components, with concomitant second and third transfer metatarsalgia. After discussing treatment options, the patient chose to undergo surgical intervention involving hardware removal and first MTPJ arthrodesis, along with second and third metatarsal head Weil osteotomies to address her metatarsalgia. Her pre-operative metatarsophalangeal-interphalangeal (MTP-IP) score was 39.
+In the operating room, an incision was made through her prior dorsal surgical incision. Dissection was carried down to the first MTPJ arthroplasty. The components were grossly loose and were removed without difficulty. Curettes and a drill bit were used to debride the intramedullary portion of the distal first metatarsal and the proximal aspect of the proximal phalanx . A 2-cm bone gap was identified, and inadequate bone stock remained in the proximal phalanx to allow for hardware fixation. A decision was made to proceed with arthrodesis without the use of hardware. Ten cc of bone marrow was aspirated from the proximal tibia and mixed with a bone substitute (NovoGro®, Osteonovus, Toledo, Ohio) for later use. Fibular strut allograft with adequate length to fill the bone void was measured under fluoroscopy and cut to appropriate size to hold the toe out to length. Traction was applied to the toe, and the strut grafts were placed across the joint and within the medullary canal of the first metatarsal and then the proximal phalanx . The strut graft provided stability to the joint through its tensile effect. The bone graft substitute was packed into the proximal phalanx, first metatarsal head, and remaining first MTPJ space . Weil osteotomies were performed on the second and third metatarsal heads through separate dorsal incisions to restore a normal cascade. The patient was placed in a posterior, short-leg splint postoperatively and made non-weight bearing.
+At her 2-week follow-up, she was transitioned to a short-leg cast and continued her weight bearing restrictions. Radiographs at 1 month showed callus formation and graft consolidation at the first MTPJ . The patient was transitioned to a fracture boot at 6 weeks, but was kept non-weight bearing until 3 months postoperatively. At her 3-month follow-up, the patient was transitioned to a forefoot rocker sole shoe with carbon plate insert and allowed to weight bear as tolerated. She reported no pain in her great toe. A computed tomography scan was obtained at 4 months postoperatively, which showed continued consolidation of the fusion. At 5 months postoperatively, the patient was back to wearing her normal shoes and reported no activity limitations, including jogging. At 2 years postoperatively, she reported no pain in the toe and was completely satisfied with the procedure. Her final MTP-IP score was 83.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_238_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_238_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e0d5f8dc229b6f826d530acca33413702c891ece
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_238_en.txt
@@ -0,0 +1,7 @@
+A British Caucasian girl aged 14 years was referred to our clinic with a double thoracic scoliosis. She was diagnosed with RTS-2 on the basis of clinical findings and genetic testing. A physical examination demonstrated down-slanting palpebral fissures, bilateral proptosis, divergent squint right eye, micrognathia and microcephaly, a high arched and narrow palate, dental crowding, ears posteriorly rotated, and arachnodactyly. As part of the underlying condition, our patient had marked nasal speech and mild to moderate right conductive hearing impairment. She had developmental delay and attention deficit hyperactivity disorder. She had a learning disability (intelligence quotient (IQ) 60) and delay in fine motor skills. There was no history of recurrent chest infections or gastroesophageal reflux. There was no family history of syndromic conditions or scoliosis. The scoliosis was first noted at the age of 13 years during an assessment of a chest infection by her pediatrician. No treatment was given at that stage and the deformity gradually progressed. At presentation to our clinic, she was post-menarche with height 137cm, arm span 144cm, body weight 27kg, and body mass index 9.8kg/m2.
+On clinical examination, our patient had a severe double left upper and right lower thoracic scoliosis. Her thoracic spine across the more severe right thoracic curve was rotated to the right, with marked ipsilateral prominence of her rib cage and scapula and associated hypokyphosis. There was also thoracic translocation and listing of her trunk to the right, with associated waistline asymmetry and prominence of the left side of her pelvis. Her pelvis was level with no evidence of leg-length discrepancy. There were no skin or soft tissue abnormalities overlying her spine. Our patient reported no neurological symptoms. A neurological examination confirmed normal tone, muscle power, sensation and tendon reflexes in her upper and lower limbs, as well as symmetrically elicited abdominal reflexes. There were no upper motor neuron signs. Moderate ligamentous laxity was noted.
+Radiographs of her spine during the initial assessment revealed a right thoracic scoliosis extending from T6 to L2, measuring 46°, and a left upper thoracic scoliosis extending from T1 to T6, measuring 30°. The rotatory component of the deformity resulted in marked thoracic hypokyphosis, which in turn significantly reduced the anteroposterior diameter of her chest, as well as the space available for her lungs. There were no congenital anomalies affecting her vertebral column or chest wall. There were also no features suggestive of congenital spinal stenosis, with the interpedicular distance within normal limits across all spinal segments. Her Risser grade was 0 with open triradiate cartilage bilaterally, indicating that she had significant remaining skeletal growth.
+Because of the severity of her scoliosis, we decided to proceed with surgical correction. In the presence of the underlying syndromic condition, a pre-operative assessment was organized that included spinal magnetic resonance imaging (MRI) under general anesthesia as well as cardiac; anesthetic; ear, nose and throat; psychological; and respiratory reviews. We encountered extreme difficulty in concluding the pre-operative assessment because our patient’s anxiety, behavioral problems and poor cooperation resulted in severe delays.
+The MRI of the spine demonstrated no intra-spinal anomalies, normal appearance of the pedicles and no spinal stenosis. There was no evidence of tracheal or bronchial obstruction. The psychological evaluation concluded that our patient was cognitively and emotionally younger than her chronological age and consistent with that of a child aged seven to eight years. The cardiac evaluation, including electrocardiogram and ultrasound, showed normal function. The respiratory review, including chest radiographs, capillary blood gas sample and sleep studies, demonstrated restrictive pulmonary disease with marked deterioration of lung functions, forced expiratory volume in one second (FEV1) 0.79L (38% predicted) and forced vital capacity (FVC) 0.88L (37% predicted). Pre-operative blood results were within normal limits. At the time of surgery, 10 months after her initial clinical presentation, the degree of scoliosis in the thoracic curves had progressed to 39° and 68° respectively. Both curvatures were significantly rigid on a supine maximum traction radiograph, with the flexibility index being 7% and 20% for the upper and lower thoracic scoliosis respectively.
+Our patient was admitted to our hospital on the day of surgery and the plan was for her to receive a dose of midazolam as pre-medication before transfer to theater. However, she refused to take her pre-medication or go to theater, despite efforts and involvement of allied health specialists (specialist spinal nurse, learning disability nurse and health play specialist). This resulted in cancellation of the procedure. Additional psychological support sessions were offered to our patient and the surgery was re-scheduled with a different anesthetic plan. A peripheral intravenous access was secured when performing pre-operative blood tests that allowed us to administer propofol and remifentanil in the Surgical Admissions Unit. She was subsequently transported to theater with an oxygen face mask, where intubation was performed without complications. There were no difficulties during intubation related to our patient’s craniofacial anomalies.Our patient (now 15 years old) underwent a posterior spinal arthrodesis extending from T2 to L4 with the use of a pedicle hook, screw and single concave rod instrumentation . We performed subperiosteal exposure of the spine to the tips of the transverse processes with extensive facetectomies to mobilize the curve and allow for placement of the instrumentation and extensive decortication. This was followed by an interfacetal and intertransverse arthrodesis using locally harvested bone from the spinous processes and supplemented by allograft bone. Correction of the scoliosis was achieved through apical translation, rod de-rotation, and proximal or distal distraction of the construct. We monitored her spinal cord during the operation, recording cortical and cervical somatosensory as well as transcranial motor evoked potentials, and there were no problems. A nasogastric tube was placed at completion of surgery to allow early instigation of feedings. Our patient was transferred to our intensive care unit still intubated.Our patient was extubated on her first post-operative day and remained in our intensive care unit for two days. Feedings were achieved through a nasogastric tube with the addition of nutritional supplements. An underarm spinal jacket was applied for six months after surgery to provide additional support. Her total hospital stay was 17 days and overnight nasogastric feedings were continued at home. Post-operative radiographs showed satisfactory correction of both thoracic curves to 18° and 30° respectively and restoration of the sagittal balance of her spine .
+At her latest follow-up, two years and three months after surgery, our patient had no complaints of her back and she had returned to her normal activities. She was skeletally mature and spinal radiographs demonstrated no loss of scoliosis correction, no non-union and no add-on junctional deformity above or below the levels of the fusion. Repeat pulmonary function tests demonstrated a mild improvement in her lung function compared with her pre-operative tests, with FEV1 of 0.86L (47% predicted) and FVC of 0.94L (49% predicted).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2391_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2391_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..49a5b6f4f6b560d1b3691ab56291df08cca96a4c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2391_en.txt
@@ -0,0 +1 @@
+A 72-year-old woman presented with complaints of constipation for three months. Physical examination, haematological and biochemical investigations were normal. Medical history was unremarkable. A colonoscopy was performed and revealed a sessile polypoid lesion of 5 mm of the sigmoid colon. The polyp had a smooth surface, without nodularity or ulceration . Histopathological examination of the biopsy showed a submucosal lymphoid infiltrate with follicular architecture , characterized by large centroblasts with few, centrocytes . Immunohistochemistry showed that the lymphoid cells were positive for CD20, CD10, BCL6, BCL2, and MYC protein expression with remnants of the FDC meshwork highlighted by CD21 staining and high proliferation index (Ki-67: 60–70%) (not shown) . Fluorescent in-situ hybridization (FISH) studies (probes: Vysis LSI MYC Dual Color Break Apart Rearrangement Probe; Vysis LSI BCL2 Dual Color Break Apart FISH Probe; Abbott, Chicago, Illinois) detected both IGH/BCL2 and IGH/MYC gene rearrangements in approximately 60% of interphase nuclei . No evidence of BCL6 gene rearrangement was found (probe: Vysis LSI BCL6 Dual Color Break Apart Rearrangement Probe; Abbott). The diagnosis of an extra-nodal follicular lymphoma grade 3A with BCL2 and MYC rearrangements was made (DH-FL). The patient underwent a complete clinical staging with FDG-PET/CT and bone marrow biopsy. No signs of disseminated disease were found and primary colonic localization was confirmed. Although bearing molecular hallmarks of malignancy, a watch-and-wait approach was adopted according to the clinically favourable setting. The patient, after two years of follow-up shows no signs of relapse.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2399_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2399_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a481189c871b663d45c7c643aee1228cda08f6ee
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2399_en.txt
@@ -0,0 +1,9 @@
+A 35-year-old-male patient presented with sudden loss of vision associated with periorbital swelling in both eyes (OU). He had systemic complaints of fever and pedal edema. The patient was already undergoing treatment for membranoproliferative glomerulnephritis, and for the previous seven months was taking oral prednisone (pg. mg/day) and Angiotensin converting enzyme inhibitor. Ocular examination revealed visual acuity of light perception (LP) with inaccurate ray projection in OU.
+Slit lamp biomicroscopic examination revealed 2+ cells in anterior chamber and pigments over the anterior lens surface in OU. Fundus examination revealed hazy media along with retinal detachment in the inferotemporal area in OU. Sub-retinal exudates, intraretinal hemorrhages along with dilated veins and narrowed arteries were visible. Intraocular pressure (IOP) was 16 mmHg in OU. The patient had blood pressure of 160/100 mmHg and bradycardia. Hence, the initial diagnosis was hypertension related exudative retinal detachment, although both atypical central serous chorioretinopathy and Vogt-Koyanagi Harada syndrome were also considered in differential diagnosis. After receiving a nephrologist's opinion, the patient was stabilized with an injection of hydrocortisone 200 mg OD, frusemide 40 mg OD, cefixime 200 mg BD along with amlodipine 5 mg OD as a hypertensive drug.
+After two days, the patient developed generalized hypotony, a staggering gait, truncal ataxia, and buccal and proximal weakness with decreased plantar reflexes. After neurology consultation, a pontomedullary lesion or cytomegalovirus meningitis was considered as an initial cause. A cerebrospinal fluid tap was performed to rule out meningitis; the results were normal. Magnetic resonance imaging (MRI) of the brain [Figure and ] showed multiple cystic-enhancing lesions over both cerebral hemispheres, suggestive of tuberculomas or neurocysticercosis.
+The patient was started on anti-tubercular treatment (ATT) along with oral steroids. Four days after starting ATT, the patient had a generalized tonic-clonic seizure. A contrast MRI showed disseminated parenchymal lesions. At the beginning of anti-epileptic treatment, patient showed signs of improvement over the next two weeks; however after this period the patient started worsening. The patient had restricted abduction, sluggishly reacting pupils, 3+ cells in the anterior chamber OU with IOP of 66 and 52 mmHg in the right and left eyes, respectively. Fundus examination revealed increased exudates, increased height of retinal detachment and vitreous cells OU. A diagnosis of disseminated toxoplasma or malignancy was considered. Analysis of an aqueous tap via polymerase chain reaction (PCR) was negative for malignant cells, tuberculosis, cytomegalovirus (CMV), herpes simplex virus (HSV), varicella zoster virus (VZV), and toxoplasma.
+An Ahmed glaucoma valve was implanted in the left eye subsequent to failure of IOP control with maximum medical therapy. Postoperatively, the left eye was stony hard with severe conjunctival chemosis and a shallow anterior chamber .
+Due to suspicion of metastatic endophthalmitis, five weeks after initial presentation, a vitreous biopsy was performed through pars plana vitrectomy. Intravitreal vancomycin (1 mg/0.1 ml), ceftazidime (2.5 mg/0.1 ml), and voriconazole (1 mg/0.1 ml) were instilled at the end of the procedure and the patient was started on fortified cefazolin 5% and tobramycin 1.4% every hour and Natamycin 5% (every six hours) for presumptive fungal endophthalmitis. All tissue sample smears and cultures that were tested for bacterial and fungal organisms were negative.
+Subsequently, the patient had no LP along with severe conjunctival chemosis, exposure keratopathy, and conjunctival abscesses. Cerebrospinal fluid was negative for CMV and Cryptococcus sp. Blood tests were negative for HIV and TORCH (Toxoplasma gondii, other viruses [HIV, measles, and so on), rubella [German measles]), CMV, and herpes simplex. Blood culture showed no evidence of bacterial and fungal organism growth. A bone marrow biopsy was performed to rule out blood cell malignancy but results were normal.
+Due to the progressive worsening of patients' systemic status and severe cachexia, a repeat MRI of the brain was done, and revealed a large right parieto-occipital mass lesion [Figure and ]. The orbital region showed bilateral globe deformities, intraocular hemorrhages, and extraocular soft-tissue inflammation [Figure and ].
+A multiloculated intracerebral abscess was drained, and a brain biopsy was performed, revealing the presence of the Nocardia organism along with granulomatous reactions [Figure –]. The patient was administered intravenous imipenem for two weeks, amikacin for four weeks, and later, oral cotrimoxazole and trimethoprim. However, the patient had no LP in both eyes despite anti-nocardial treatment, probably because of delayed diagnosis and severity of involvement. Although the patient improved systemically over next two weeks, he subsequently developed phthisis of both eyes.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_239_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_239_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..93c4f4c743583354b58d3670cb77ff7c3c1a8bee
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_239_en.txt
@@ -0,0 +1 @@
+A 49-year-old woman presented with acute chest pain. The past history was not remarkable apart from being treated with thyroxine 125 µg o.d. for hypothyroidism, pregabalin 150 mg b.i.d. for chronic neurogenic back pain, and atomoxetine 60 and 18 mg daily for ADHD. In association with sexual intercourse, she developed acute chest pain associated with mild dyspnoea and some dizziness. The chest pain disappeared after sublingual nitroglycerine on admission to the hospital. The patient developed transient hypotension and bradycardia after nitroglycerine, which stabilized after atropine injection. The electrocardiogram revealed no remarkable changes. Laboratory results showed modest elevation of troponin T (maximum 710 ng/L), C-reactive protein <5 mg/L, and normal cholesterol levels. Echocardiography 1 day after admission revealed a-/hypokinesia in the mid-apical regions with good contraction of the apical tip segment (apical tip-sparing) and the basal segments with marked reduction of left ventricular ejection fraction, 30–35% (, Video S1, echocardiography). Atomoxetine was discontinued and treatment with acetylsalicylic acid, beta blocker, and angiotensin-converting enzyme inhibitor was initiated. Invasive coronary angiography 1 day after admission showed normal coronary arteries (; , Video S2, left coronary artery). A new echocardiography 3 days after admission showed a-/hypokinesia in the middle segments of the left ventricle circumferentially, with good contractions in both the basal and apical segments resulting in a pattern consistent with mid-ventricular TS (, Video S3, contrast echocardiography). Left ventricular systolic function recovered completely within 1 month from admission as demonstrated by cardiac magnetic resonance imaging, which did not show late gadolinium enhancement (, Video S4, cardiac magnetic resonance imaging).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_242_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_242_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aee37da9d6ddad986cd167497c47ddb082558ebf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_242_en.txt
@@ -0,0 +1,6 @@
+A 59-year-old right-handed Japanese woman had difficulty in writing Kanji. She could neither recognize forms of the Kanji characters clearly nor write them. One month later, she developed progressive cognitive impairment; however, her social behavior remained appropriate.
+A neurological examination performed two months after the disease onset revealed mild word-finding difficulty and constructive disturbance such as copying simple diagrams. Hyperreflexia was present in her jaw and lower limbs. Her bilateral extensor plantar reflexes were positive, however, she showed no cerebellar ataxia, anopsia, myoclonus, or extrapyramidal signs. Moreover, neither ideomotor apraxia nor ideational apraxia was apparent.
+The Standard Language Test of Aphasia, a standardized test for Japanese aphasic patients, performed three months after the disease onset revealed impaired dictation of Kanji words; however, other categories of the test were scored well, that is, dictation of Kana letters, pronunciation of words written in Kanji and Kana, and repetition and auditory comprehension of words and sentences. She scored 24 on the Mini-Mental State Examination with impairments in delayed recall, calculation, and copying interlocking pentagons.
+A hematological examination revealed no abnormalities. An investigation of the cerebrospinal fluid (CSF) disclosed increased levels of 14-3-3 protein (616μg/mL) and total tau protein (1217pg/mL), although cell counts and protein levels were normal. Abnormal conformation of PrPres was detected in the CSF by real-time quaking-induced conversion (RT-QUIC) .
+The electroencephalogram showed an 8 to 10 Hz basic wave pattern with no periodic discharges. Diffusion-weighted imaging (DWI) on magnetic resonance imaging (MRI) showed diffuse hyperintensity in the bilateral cerebral cortices of the parietal, occipital, and temporal lobes . Single-photon emission computed tomography (SPECT) scans, evaluated using the easy z-score imaging system, displayed hypoperfusion in the bilateral parietal and occipital lobes, the left temporal lobe, and in the left posterior inferior temporal lobe . No mutations were detected in the open reading frame of the PrP gene, and polymorphisms at codons 129 and 219 were homozygous for methionine and glutamine, respectively. Although our patient did not meet the World Health Organization (WHO) clinical diagnostic criteria for sCJD, we clinically diagnosed her with sCJD supposedly an MM2-cortical type, based on the MRI findings, elevation of 14-3-3 and tau protein levels in the CSF, and a positive result upon RT-QUIC [,].
+Although her cognitive decline progressed, she had lived more than two years after the disease onset.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2436_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2436_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9bca8509af251213317dc01fea4d5fdb39f3045e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2436_en.txt
@@ -0,0 +1,2 @@
+A 34-year old multigravida was found to have right adnexal mass on her routine gynecologic examination. Her previous medical history was uneventfull and Pap smear was normal. Transvaginal ultrasonography identified a cystic mass adjacent to the right ovary. Serum CA 125 was 5.1 U/ml (reference range: < 35 U/ml). At laparoscopy a dilated fallopian tube with bluish discoloration was found. The contralateral fallopian tube, ovaries and uterus were unremarkable. Exploration of the abdomino-pelvic cavity revealed smooth and shiny peritoneal surphace. Obtained peritoneal and pelvic washing were negative. Fine needle aspiration of dilated part of the fallopian tube revealed a 4 ml of bloody content. Cytological findings were consistent with hematosalpinx. Right salpingectomy was performed without using endoscopic bag. The patient was followed up by means of ultrasonography and serum CA 125 for 4.6 years. During this period she had no evidence of the disease.
+Grossly, a 7.0 cm long fallopian tube was irregularly dilated up to 4.4 cm in diameter at the ampulary region. The fimbriae were intact. The serosal surphace was smooth. Sections of the dilated part of the fallopian tube revealed a cystic tumor with focally yellow to tan, soft papillary excrescences protruding into the lumen and foci of intracystic hemorrhage. On microscopic examination the papillae were covered by serous type of epithelium, displaying stratification and budding with focal nuclear atypia . Three types of cells were recognised; ciliated cells, hob-nail cells and mesothelium-like cells. Small foci of tumor tissue necroses and hemorrhage were noted. There was no invasion of the supportive stroma of the papillae or into the fallopian tube wall. Focus of endosalpingiosis within the adjacent mesosalpinx was found. DNA analysis determined by flow cytometry paraffin technique revealed DNA diploid tumor with low S-phase fraction of 6.5 %.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2452_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2452_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b74bd3000145568899117af1098fd55050e11e5e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2452_en.txt
@@ -0,0 +1 @@
+A 2-year-old, 4.5-kg neutered male domestic shorthair cat was presented for acute-onset dyspnea. The past medical history was unremarkable. The cat lived indoors and was current on vaccinations and parasite prevention. On presentation, lung sounds were harsh, with no crackles. The cat exhibited inspiratory effort, with a respiratory rate of 44 bpm. The remaining physical findings were within normality. Thoracic radiographs identified moderate pleural effusion and lung edema. Echocardiography revealed asymmetric left ventricular myocardial thickening [interventricular septum end-diastolic thickness 5.7 mm (5 ± 0.7 mm) , left ventricular posterior wall end-diastolic thickness 7.5 mm (4.6 ± 0.5 mm) ] and severe left atrial dilation [left atrium-to-aortic root ratio 2.2 (1.29 ± 0.23) ]. The cat was hospitalized and treated with oxygen, furosemide (Dimazon 50 mg/ml, MSD Animal Health S.r.l., Segrate, Italy; dose: 1 mg/kg IV q6h), pimobendan (Vetmedin chew 1.25 mg, Boehringer Ingelheim Animal Health Italia S.p.A., Noventana, Italy; dose: 0.2 mg/kg PO q12h), and clopidogrel (Clopidogrel ACT 75 mg, BB FARMA Srl, Samarate, Italy; dose: 18.75 mag/cat PO q24h). During hospitalization, blood was collected to assess the cat’s systemic condition (i.e., complete blood count, biochemistry, test for feline leukemia and feline immunodeficiency virus), leading to unremarkable results. The cat was discharged after 4 days with oral furosemide (Dimazon 10 mg, MSD Animal Health S.r.l., Segrate, Italy; dose: 1 mg/kg PO q12h) and an unchanged dose of pimobendan and clopidogrel. One week after discharge, the cat was represented with a recurrence of lung edema, despite the regular administration of drugs by the owners. Therefore, the dose of furosemide was increased (2 mg/kg PO q12h), and spironolactone was added (Prilactone next 10 mg, CEVA salute animale S.p.A., Agrate Brianza, Italy; dose: 2 mg/kg PO q24h). Despite increasing diuretic therapy and adherence to the therapeutic protocol by the owners, the cat presented an additional relapse of lung edema the following week. Suspecting an ongoing diuretic resistance, the dose of furosemide was further increased, and its route of administration was switched from oral to parental. As the owners were not able to administrate the drug intramuscularly, the subcutaneous administration of furosemide was considered. In light of such a change, owners were carefully instructed about the technique of subcutaneous administration. Only when it was conclusively certified that owners were able to administrate SF (Dimazon 50 mg/ml, MSD Animal Health S.r.l., Segrate, Italy) properly, this therapeutic protocol was started at the dose of 2 mg/kg SC q8h. Other cardiac therapies were continued at the previously reported doses. Thanks to the introduction of SF, the cat no longer presented a recurrence of lung edema. However, although the cat had never presented skin problems before and owners administrated properly SF, multiple well-defined circulars, crusted ulcerative cutaneous lesions (0.5–1 cm) associated with alopecia developed at the sites of furosemide injections (i.e., dorsal area of thoracic region) 2 weeks later . At that time, spot-on treatment with fluralaner and moxidectine (Intervet International B. V., Boxmeer, Holland) was prescribed, albeit without clinical improvement. Accordingly, a dermatological consultation was subsequently obtained. On physical inspection, neither signs of self-trauma due to pruritic allergy nor signs of trauma due to improper administration of SF were identified. Trichoscopic evaluation at the level of the aforesaid areas showed neither alteration of the hair shaft nor the presence of spores. Scraping and culture for dermatophytes tested negative. Cytological examination of impression smears and fine-needle aspiration obtained from crusted areas showed an inflammatory pattern characterized by neutrophils, eosinophils, and rare macrophages, without evidence of microorganisms. Owners declined skin biopsies. Given the above and considering that several differential diagnoses for inflammatory ulcerated lesions were unlikely in the light of anamnestic and clinical findings (e.g., thermal/electrical/chemical burns, skin trauma/infection/neoplasia/autoimmune disorder), it was hypothesized that the dermal lesions were primarily associated with the administration of SF. This hypothesis was further supported by the use of the Naranjo Algorithm Adverse Drug Reaction Probability Scale, which led to a score of 6/13 (i.e., “probable” reaction to the drug) . Nevertheless, considering the severity of the cardiac condition and the previous relapses of lung edema, we preferred not to return to oral furosemide. Rather, we decided to interrupt the ongoing injectable formulation and substitute it with an alternative brand (Lasix fiale 20 mg/2 ml, Sanofi S.r.l., Milano, Italy), maintaining the same dose. Moreover, the cutaneous lesions were treated locally with a lenitive local product for 1 week (Douxo S3 CALM pads, CEVA salute animale S.p.A., Agrate Brianza, Italy). The dermal ulcerations disappeared within 1 month . Subsequently, the cat experienced neither further skin problems nor recurrence of lung edema, and he is still alive at the time of manuscript writing (13 months after the initial presentation).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2509_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2509_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5c7014c1759dcafb8f8a08b85ede66af524192a8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2509_en.txt
@@ -0,0 +1,7 @@
+The patient, a 29-year-old female, was admitted to the hospital with a 3-d postural headache.
+Three days prior to admission, the patient had a headache after waking up in the morning. The headache was located in the bilateral temporal and occipital areas, with persistent, severe, and unbearable distending pain. The headache was accompanied by a pulling pain in the back of the neck, which worsened with sitting or standing positions, and improved in a lying position. The patient also endorsed nausea and vomiting several times. She denied loss of consciousness, fever, limb convulsions, incontinence, slurred speech, and limb weakness.
+The patient had no pertinent past illness history.
+The patient had no pertinent personal or family history.
+At admission, the patient’s vital signs were as follows: Temperature 36.3℃, pulse 64 beats/min, respiration rate 19 breaths/min, and blood pressure 137/79 mmHg. No significant abnormalities were seen in the heart, lungs, or abdomen. The patient was clearly conscious, fluent in speech, and had normal orientation. The pupils were round and equal in size (about 3 mm in diameter) with a sensitive light reflex and no nystagmus. There was no facial tongue palsy and the pharyngeal reflex was present. The muscle tone of the extremities was normal and the muscle strength was grade 5. Sensory examination was normal. Bilateral pathological signs were negative, meningeal stimulation signs were negative, and tendon reflexes of all 4 limbs were present and symmetrical.
+The following blood tests were performed: Liver function, renal function, serum electrolytes, thyroid function, coagulopathy, markers of myocardial injury, syphilis, HIV, glycosylated hemoglobin, lipids, rheumatoid factor, C-reactive protein, antistreptolysin-O, erythrocyte sedimentation rate, immune panel, and tumor markers. All laboratory values were within reference ranges. An electrocardiogram demonstrated sinus bradycardia.
+Computed tomography of the head suggested a nodular, linear high-density shadow in the right parietal cerebral cortex, superior parietal sagittal sinus with a differential of venous embolism or vascular malformation with thrombosis . No abnormality was seen in brain parenchyma, and magnetic resonance imaging (MRI) with magnetic resonance venography (MRV) was recommended . Computed tomographic venography of the head and neck suggested a hypodense filling defect in the cortical veins of the right parietal sagittal sinus, consistent with venous thrombosis .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2516_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2516_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e7b60c49dde45e2f1b9c5d58cedc919eb069b722
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2516_en.txt
@@ -0,0 +1,3 @@
+We genetically analyzed an Iranian family with a consanguineous marriage with a 21-year-old boy with HHL. The family pedigree is depicted in . The blood specimens were obtained from all family members. All available medical history was collected. The otolaryngologist evaluated all family members.
+It was determined that the subject had sensorineural HL (SNHL) based on pure tone audiometry (PTA). There were no clinical manifestations in favor of the syndromic phenotype. DNA extraction was conducted using the salting out method. We solely performed whole-exome sequencing (WES) for the proband. DNA sequencing was carried out by SureSelect Human All Exon Kit V6 (Agilent Technologies Inc., USA) and Illumina HiSeq 4000 machine (San Diego, USA) in accordance with the manufacturer's instructions. Genetic sequence analysis detected a novel, homozygous substitution at c.9908A>C (NM_016239.4) in exon 61 of the MYO15A gene. Bioinformatic tools, including SIFT, PolyPhen-2, and MutationTaster, predicted that this mutation is probably pathogenic .
+The detected mutation in the proband was verified using Sanger direct sequencing (ABI 3130 Genetic Analyzer, California, USA). The sequences of used primers were as follows (forward primer: AAGCTGTGTCCCAGAAC AGG and the reverse primer ACAGGGCCT GAATCATGA AC). shows that the patient and his parents had the MYO15A mutation in the homozygous and heterozygous states, respectively. This missense mutation substitutes Lysine with Threonine (AAG>ACG) at the 3303-position of the MYO15A protein . These observations suggest that NM_016239.4 (MYO15A): c.9908A>C; p. Lys3303Thr mutation could be the cause of the progress of NSHL. The detected mutation information is shown in based on the Human Gene Mutation Database .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2541_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2541_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..391981f567dcbea008e1212d7d2c34349e8b846b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2541_en.txt
@@ -0,0 +1,9 @@
+A 70-year-old female patient was scheduled for abdominal aortic aneurysm resection and reconstruction. She had undergone general anesthesia for surgery of purulent cervical spondylitis about 6 years ago without any adverse event. The height of the patient was 142 cm, and the weight was 54 kg.
+A catheter was inserted into the thoracic vertebrae 9–10 epidural interspace to enable analgesia prior to sedation using propofol. Anesthesia was induced with continuously injected remifentanil at a rate of 0.15–0.3 mg/kg/h, and propofol was started intravenously at a target plasma concentration of 3 μg/ml using a target-controlled infusion (TCI) pump, followed by 40 mg of rocuronium bromide for endotracheal intubation. Anesthesia was maintained with 70% nitrous oxide, 30% oxygen, and propofol continuously injected at a target plasma concentration of 1–2 μg/ml.
+The abdominal aortic aneurysm, which measured 4.9 cm in diameter, was observed from the infrarenal artery to the level of bifurcation of the inferior mesenteric artery (IMA), while the renal artery and iliac artery were not clamped. The peripheral anastomosis to the aorta was possible above the IMA. The operation time was extended significantly beyond the scheduled time in order to control bleeding due to a lumbar vein injury, and the anesthesia lasted 5 h 38 min. Total blood loss was 3424 ml, 1159 ml in the blood loss was returned by the autologous blood collection device, and 6 units of red cell concentrates mannitol-adenine-phosphate were used. However, abdominal aortic aneurysm resection and reconstruction were performed routinely, and the patient’s hemodynamic condition was stable throughout the anesthesia course. We confirmed adequate arousal after the surgery, and the endotracheal tube was removed in the operating room, after which the patient was transferred to the recovery room.
+On the second post-operative day, oliguria was prolonged, and her respiratory frequency exceeded 45 times with respiratory distress appearing due to pulmonary edema. Therefore, we decided that re-intubation and a ventilator were necessary, and propofol was used for sedation. Prior to endotracheal intubation, 30 mg of propofol was injected, and sedation was maintained with propofol at a rate of 50 mg/h using an infusion pump instead of a TCI pump.
+From the following day, a fever of 39.7 °C and a decrease in blood pressure appeared. Blood tests showed that platelets had dropped to 26,000/μl, and creatinine phosphokinase (CPK) had risen to 57220 U/l. A blood gas analysis during propofol infusion showed pH 7.40, PCO2 23.4 mmHg, HCO3 14.2 mmol/L, base excess − 9.0 mmol/L, anion gap 22.0 mmol/L, and lactate 1.5 mmol/L. No significant elevation of lactate or acidosis was observed. Metabolic acidosis may have been compensated by mechanical ventilation .
+We suspected intestinal ischemia and severe infection, and immediately started treatment for disseminated intravascular coagulation, stopping using epidural anesthesia. Colonoscopy revealed mild ulcers but no intestinal necrosis, myocardial infarction was denied from echocardiographic findings, and skeletal muscle necrosis was negative according to clinical findings. Thereafter, a fever of 41.1 °C and high CPK persisted, and her hemodynamics were disrupted, so we finally stopped propofol infusion to maintain her blood pressure. Continuous hemodiafiltration (CHDF) was started for the oliguria due to deterioration of the renal function.
+From the day after the propofol infusion was stopped, the fever decreased to 36.8 °C, CPK started to decease, and the hemodynamics improved dramatically . Two weeks later, her respiratory condition improved, and the ventilator was able to be removed. The urine volume and renal function had been stable, and hemodialysis was able to be discontinued. However, the patient suffered from prolonged consciousness disorder. Neither computed tomography (CT) nor magnetic resonance imaging (MRI) of the brain revealed any particular lesions causing prolong consciousness disorder other than a small area of cerebral infarction in the subacute phase. Concerning the continuation of consciousness disorder, an electroencephalogram was conducted, which suggested the possibility of seizures; however, the details were unclear. After two more weeks, the level of consciousness gradually improved, and speech and spontaneous movement became apparent.
+After normalization of CPK and improvement of the general condition, re-examinations were performed, including CT and MRI; however, no disease other than PRIS causing an increase in CPK or a disruption of hemodynamics was suspected. Immediately after the injection of propofol was stopped, her condition improved, which eventually prompted our diagnosis.
+Ten months after the operation, the patient’s communication level had improved, but hemiplegia remained due to cerebral infarction and muscle weakness due to disuse, so she was transferred to a rehabilitation hospital for functional recovery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2559_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2559_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..89044f40ce59fcf52afab2ca513bc0e12b695646
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2559_en.txt
@@ -0,0 +1,5 @@
+A 66-year-old male with a history of type 2 diabetes mellitus and osteoarthritis, on no prescribed medications, presented with haemoptysis and chest pain. On examination, the temperature was 36.7°C, the blood pressure 84/69 mmHg, the heart rate 130 b.p.m., the respiratory rate 18 breaths per minute, and the oxygen saturation 100% on room air. Cardiopulmonary exam was overall unremarkable. A mass was noted in the right deltoid muscle region.
+The ECG at presentation showed sinus tachycardia with a heart rate of 117 b.p.m. and marked convex STE in multiple leads including V2–V6, I, and aVL, with reciprocal changes . ST-elevation myocardial infarction code was activated. Emergent coronary angiography showed no significant coronary obstruction . The STE was persistent on subsequent ECGs and blood cardiac troponin I (cTnI) levels were within normal range (<0.3 ng/mL). The complete blood count and basic metabolic panel were unremarkable except for mild hyponatraemia with sodium level of 130 mEq/L (normal sodium level 135–145 mEq/L) and mildly elevated fasting plasma glucose level of 7.1 mmol/L. The chest X-ray showed a right upper lobe wedge-shaped airspace consolidation.
+The transthoracic echocardiogram (TTE) showed severe focal wall thickening and hypokinesis/akinesis in apical, apical lateral, anteroseptal, and anterior wall. The thickened wall is characterized by heterogenous echogenicity different from that of normal myocardium. Mural mobile echodensities associated with the hypokinetic/akinetic wall were seen in the left ventricle, consistent with mural thrombi . Computed tomography (CT) of the chest showed a large partially cavitated lung mass within the right upper lobe. Given the haemoptysis and cavitated lung mass, thus bleeding concern, anticoagulation was held. Ultrasound-guided needle biopsy of the right deltoid muscle mass was performed, and the histological analysis showed infiltrating squamous cell carcinoma .
+In further delineating the myocardial damage, cardiac magnetic resonance (CMR) was performed, which showed focal wall thickening with regional hypokinesis/akinesis due to infiltrative masses involving apical, apical lateral, anteroseptal, and anterior wall, consistent with malignant cardiac metastases . An 18F-fluorodeoxyglucose (FDG)-positron emission tomography (PET)-CT imaging showed large areas of hypermetabolic activity corresponding to the myocardial metastasis as shown on CMR imaging and a large hypermetabolic mass in the right upper lobe consistent with primary lung malignancy .
+The patient was seen by oncology and diagnosed with stage IV lung squamous cell carcinoma. Palliative chemoimmunotherapy was started. The persistent STE was still present on the follow-up ECG obtained 2 months after clinical presentation and the patient remained clinically stable from a cardiac standpoint.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2584_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2584_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a32864c998954172173fa73e3023b205297f07ca
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2584_en.txt
@@ -0,0 +1,3 @@
+A 56-year-old man was referred to our hospital with a 6-month history of abdominal distension and discomfort (A). He had a medical history of schizophrenia. His abdomen was markedly distended, and severe edema was present in both lower limbs. He had no symptoms of gastrointestinal obstruction. Neurological examination findings were normal. He had slight anemia (hemoglobin of 10.5 g/dl), and other laboratory data were within normal limits. A computed tomography (CT) scan demonstrated a 30- × 18- × 30-cm giant mass located between the stomach and transverse colon. It included a large cyst and solid component that showed enhancement (B). The main feeder artery for the tumor seemed to be the right gastric artery. Magnetic resonance imaging (MRI) also showed a huge heterogeneous soft tissue mass. The solid component showed high signal intensity on T2-weighted imaging and diffusion-weighted imaging (C, D). Upper and lower endoscopy was not performed because the patient declined. CT-guided biopsy was not performed to avoid dissemination. Our preoperative differential diagnoses were sarcoma with a mucinous component, gastrointestinal stromal tumor, lymphangioma, and mesenteric cyst. A histological diagnosis was not obtained preoperatively, and the tumor was too large to identify its boundary with the surrounding organs by radiological examination. We expected that the tumor was arising from the stomach, transverse colon, or mesenterium.
+We decided to perform surgery because the tumor showed the tendency to grow. During laparotomy, we identified a huge encapsulated tumor. The tumor occupied most of the pelvic cavity, but the caudal side of the tumor had no adhesions with pelvic organs. We gradually dissected along the capsule and moved the tumor outside the body (A). Finally, we found that the tumor was adhered to the stomach and transverse colon. We resected the distal stomach and 15 cm of the transverse colon with the tumor. Reconstruction was performed using Billroth-I anastomosis for the stomach and end-to-end anastomosis for the colon. We identified the resection margin of the tumor, and we did not perform intraoperative histological examination or lymph node dissection because no enlarged lymph nodes or disseminated nodules were found. The tumor was completely removed. The postoperative course was uneventful, and the patient was discharged on postoperative day 17.
+Macroscopic examination revealed a 38- × 20- × 19-cm tumor weighing 13,000 g (B). No abnormalities were found on the intraluminal surface of the stomach or transverse colon wall. On histological examination, the tumor was composed mainly of short spindle and vacuolated cells, including lipoblasts and mature adipocytes, with a myxomatous matrix. The main mass was located in the abdominal cavity, but the tumor base was broadly adhered to the gastric wall and seemingly grew from the gastric submucosa, suggesting that the tumor had likely arisen from the stomach . The transverse colon was intact. Immunohistochemically, the tumor cells were negative for smooth muscle actin, c-kit, and MDM2. These features were consistent with myxoid liposarcoma. The patient was still doing well 2 years postoperatively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2585_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2585_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8635afbb84a0d41915890966401f3768963c5047
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2585_en.txt
@@ -0,0 +1 @@
+A 25-year-old woman was admitted to our emergency department after a fall from a chair onto her outstretched left hand. Due to mild alcohol consumption, communication with her was unsatisfactory. She complained of pain and inability to use her elbow, while no other injuries were found. She had a clear medical history, with no comorbidities, except smoking. Physical examination revealed swelling and “dinner fork” deformity of her left wrist, tenderness over her left elbow without any bruises or open wounds, while no obvious neurovascular injury was recognised. Frontal and lateral plain roentgenograms of her left forearm revealed a type-1 Bado Monteggia lesion accompanied with an ipsilateral type 1 Frykman distal radius fracture (Colles’ fracture) with dorsal comminution (, ). Fortunately, no other fractures were found around her elbow, such as coronoid process or radial head fracture. Presence of such associated injuries compromises the final outcome. The patient was operated on within 8 h after admission, under general anesthesia and tourniquet. At the operating room, the neurological examination was repeated, but no neurological disorder was indicated. The ulna was anatomically reduced and fixed through the classical lateral approach between flexor and extensor carpi ulnaris. Osteosynthesis was performed using a dynamic compression plate (3.5 mm limited contact dynamic compression plate [LC-DCP]). Intraoperative, fluoroscopy showed a spontaneous reduction of the anteriorly dislocated radial head after the ulna’s fixation. Subsequently, through a Henry approach, the distal radius fracture was reduced and fixed with a 3.5 mm T-shaped buttress locking plate . Intraoperatively, after the fixation of both fractures, the elbow was found to be stable in all directions with a full range of motion of wrist, elbow, and forearm. The post-operative course was uneventful, and our patient was discharged 2 days after surgery with a dorsal plaster splint. The cast was removed 2 weeks after surgery, and then gradually the mobilization began. The range of wrist (arc: 108°) and elbow (arc: 0—°) motion, as well as the supination and pronation (overall arc: 175°) of the forearm recovered completely 2.5 months postoperatively . Roentgenograms and clinical evaluation showed completed bone union of both fractures’ sides 3.5 months after surgery (, ). The patient returned to her daily routine within 4 months following injury. At last follow-up, 6 months postoperatively, the Broberg and Morrey (98/100) and Quick Dash scores (2.27% of disability) were excellent, without any decline in motion, strength, and stability, accompanied by no pain.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2599_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2599_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8c829b496f1c0265228dc7ff5230a367aef93c69
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2599_en.txt
@@ -0,0 +1,9 @@
+A full term delivered, previously healthy, 5-month-old boy presented at our Emergency Room Department with fever for a total of 4 days, diarrhea, cough and irritability. He was being treated with oral amoxicillin + clavulanic acid prescribed by the pediatrician for a left medium otitis diagnosed two days before. Fleeting hives was reported.
+On physical examination, he presented good general condition, body temperature was 37.5 °C, no signs of dehydration (capillary refill time <2 s) and a reduction in air penetration in the lower lobes on chest auscultation. Normal physical examination of heart and abdomen. Blood tests showed a very high value of C-Reactive Protein (C-RP: 49.32 mg/dL); hemoglobin (Hb) was 8.8 g/dL, white blood cell (WBC) count was 11,080/mm3 with 79.3% neutrophils, and platelet (PLT) count was 429,000/mm3. Transaminases were normal, while gamma glutamyl transferase (GGT) was high (126 UI/L). Chest radiograph showed peribronchial cuffing and we started an additional therapy with oral clarithromycin at a dose of 15 mg/kg. Resin blood culture and serology for Epstein Barr Virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, type 1 and 2 Herpes simplex virus, Parvovirus B19, Coxsackie viruses and Toxoplasma Gondii ruled out infective origin of symptoms. All serological tests were negative except for IgG anti-Cytomegalovirus. Abdominal ultrasonography showed a focal bowel wall thickening, mild edema around the gallbladder, mild hepatosplenomegaly and a lymphadenomegaly near the hepatic hilum.
+After 3 days from admission, the infant continued to have fever and presented erythema involving the palms and the soles. Suspecting a KD for the presence of fever (>7 days), changes in extremities, history of rash and high C-RP levels, we requested a transthoracic echocardiography, which only showed a mild mitral valve regurgitation but no abnormalities of the coronary arteries.
+On the fifth day of hospitalization the infant presented a subsidence of the fever and blood tests showed a reduction of C-RP (6.2 mg/dL), GGT (85 UI/mL) and Hb (7.3 g/dL), together with an increase in the WBC count (17,180/mm3) and platelet (594,000/mm3).
+In order to rule out an early onset of inflammatory bowel disease, we performed fecal calprotectin and fecal occult blood, both tested negative, and a second abdominal ultrasonography, which showed an improvement of the picture (reduced bowel thickening and no edema around the gallbladder). Moreover, the infant had always fed willingly and his diarrhea had gradually resolved.
+However, on the sixth day of hospitalization reappearance of the fever was registered (38.0 °C) and blood tests were performed on the eighth day showing an additional worsening of the anemia (Hb 7.2 g/dL), thrombocytosis (platelets 751,000/mm3), high WBCs (17,920/mm3) and an increase of C-RP (15.7 mg/dL). Serum iron, transferrin, lipid profile were within normal limits. We performed a second echocardiography, which revealed a fusiform aneurysm of the right coronary artery measuring 5.4 mm in diameter and an ectasia of the left anterior descending coronary artery, whose maximum diameter was 3.7 mm with a z-score +9.72 based on international standards . According to the American Heart Association (AHA) criteria the diagnosis of KD was made . He received intravenous immunoglobulin (IVIG: one bolus of 2 g/kg) and high-dose oral acetylsalicylic acid (ASA) (100 mg/kg/day). However, after two days of persistent fever, a second bolus of IVIG was administered.
+On the eleventh day of hospitalization, a severe anemia occurred: red blood cells (RBC) 2,660,000/mm3, Hb 5.9 mg/dl, Ht 19.8%, MCV 78 fL, RDW 15.2%. Bone marrow examination showed mild eosinophilia (5%), and a RBC transfusion was necessary. We reduced ASA dose to 5 mg/kg/day to achieve an anti-aggregant effect for the presence of a severe thrombocytosis (PLT 1,147,000/mm3).
+Forty-eight hours after the second dose of IVIG, due to persisting fever, we started intravenous methylprednisolone at a dose of 30 mg/kg/day for three subsequent days, with initial benefit. However, after three days from the last administration of corticosteroid therapy we recorded a reappearance of the fever (38.0 °C) together, with a further dilatation of the left anterior descending coronary artery and we started oral prednisolone at a dose of 2 mg/kg/day for 30 days. Fever disappeared after 48 h.
+The patient was discharged after 26 days of hospitalization, afebrile, with oral ASA. He is being regularly monitored to check the size of the coronary arteries. The last echocardiography performed 18 months after the KD onset showed a mild reduction of the aneurysm of the right coronary artery (3.6 mm) and of the ectasia of the left anterior descending coronary artery (2.5 mm, z-score +2.46). He is still on therapy with oral ASA.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2620_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2620_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5aa559db97db1644b38de0b0d12517e6be0c24e9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2620_en.txt
@@ -0,0 +1 @@
+A 67-year-old man with permanent AF and haemophilia was referred for further evaluation to our cardiology clinic by his primary haematologist. His past medical history included hypertension and heart failure. Recombinant factor VIII infusion was prescribed regularly and his baseline factor VIII activity level was kept around 10% by his primary haematologist. The CHA2DS2-VASc score was estimated to be 3 and the HAS-BLED score was 3. Due to the high risk of bleeding, we decided to perform percutaneous LAA closure. Pre-procedural cardiac computerized tomography angiography and TOE were performed for measurements of LAA dimensions and exclude LAA thrombus . The procedure was performed under mild anaesthesia, with the aid of TOE and fluoroscopy guidance. Additional recombinant factor VIII was administered according to the recommendations of haematologist before catheterization. Based on measurements, a 28-mm AmplatzerTM AmuletTM device was chosen for occlusion. Initially, trans-septal puncture was performed at the posteroinferior interatrial septum using the right femoral vein as the access site, and then 5000 IU of intravenous heparin was administered. The trans-septal sheath was exchanged for the 12-Fr delivery catheter which was subsequently loaded with the 28-mm AmplatzerTM AmuletTM device. The delivery catheter was advanced up to the LAA ostium and under TOE guidance the lobe of the device was carefully pushed to the landing zone and deployed at that level. The deployment of the proximal disc was then achieved by advancing the delivery cable while unsheathing the disc . The final result was excellent without significant residual leak, pericardial effusion, and embolic complication .The remaining hospital stay was uneventful and he was discharged on the following day. Clopidogrel 75 mg/day and aspirin 81 mg/day for 1 month with adequate FVIII prophylaxis and then only aspirin 81 mg/day for 2 months were recommended. No antithrombotic was given after 3 months. The patient did not report any thrombotic or haemorrhagic adverse events and there were no complications related to implanted device after 1 year of follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2624_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2624_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c675e5f867d8cbfeef38f281e0f0586cde34e9fd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2624_en.txt
@@ -0,0 +1,3 @@
+A 31-year-old man has been reported to our clinic with symptoms of blurry vision in the left eye, which occurred during the past year. We started with essential examinations such as visual acuity testing, intraocular pressure measurements (IOP), slit-lamp examination, and indirect ophthalmoscopy (fundus examination). We found normal findings of the anterior segment: clear cornea, deep and clear anterior chamber, normal iris and pupil reaction, and clear lens. Distance visual acuity was measured using a standard Snellen acuity chart at 6m and presented in decimals. Corrected distance visual acuity (CDVA) in the left eye was 0.55 Snellen lines, and IOP was 15 mmHg. In the posterior segment, there were no signs of vitritis and retinitis. The optic disc had regular sharp-shaped borders with no edema; the macula showed no clinical edema, blood, or exudation. The OCT (SOCT Copernicus REVO, Optopol, Zawiercie, Poland) scan showed significant edema that measured 397 microns in central foveal thickness, with a slight disorder of the retinal pigment cell layer . Macular edema persisted during all control exams, with slight vision deterioration with a CDVA of 0.35.
+We treated the patient with topical corticosteroids, Dorzolamide, Bromfenac sodium-sesquihydrate, and periocular corticosteroids (Triamcinolone acetonide). Therapy was repeated for nine weeks, and there was no improvement. We initiated laboratory searches, such as blood, serology, and immunology testing. Testing was done for rheumatoid arthritis, paranasal sinusitis, HLA b27 typing for ankylosing spondylitis, testing for venereal diseases (VDRL), CMV, Toxocariasis, HIV, and EBV. We got the results Reactive 20.96 S/CO for Syphilis, Toxocara canis IgG:11.5 Positive, EBV:). Guided by the findings, we took the best decision and recommended further treatment with the intravitreal application of a sustained-release Dexamethasone implant in the left eye. Seven days after treatment, we had satisfactory results: macular edema (central foveal thickness of 288 microns), slight retinal pigment cell layer disorder, and improved CDVA of 0.75 Snellen lines .
+OCT imaging was an essential and central significant diagnostic procedure. In figures one and two, we can establish and monitor the stages of macular edema for an extended period and evaluate its treatment by showing how it affects improvement. However, this doesn’t show any other significant diagnostic feature that can be very significant to assessing other treatment improvement signs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2680_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2680_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ce24ae694ed8243a66657f2b122694d15be1d3df
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2680_en.txt
@@ -0,0 +1,4 @@
+A 50-year-old male patient with mitral regurgitation (MR) and MAD previously diagnosed with CMR was referred to our clinic due to a recent syncopial episode. TTE revealed severely dilated left heart chambers (4D left ventricular end-diastolic volume (LVEDV) = 218 ml, left atrial volume index (LAVI) >48 ml/m2) with an LVEF of 57%, bileaflet prolapse of the mitral valve, severe MR [effective regurgitant orifice area (EROA) 60 mm2, regurgitant volume (RV) 117 ml], and a 12 mm displacement of the hinge point of the mitral annulus from the posterior ventricular wall . Further complete 3D-TTE analysis of the patient was performed to demonstrate the imaging findings of MAD syndrome . A previous CMR examination of the patient had reported LV dilatation with almost identical volumes and EF to TTE (EDV = 217 ml, EF = 59%), the presence of MAD of 10 mm displacement, and the presence of myocardial fibrosis of the basal inferolateral wall . Due to our protocol for patients with syncope, we performed a 24 h ambulatory electrocardiogram (ECG) that revealed episodes of monomorphic and polymorphic non-sustained ventricular tachycardia . In accordance with the management algorithm of the recently published EHRA and EACVI consensus document for MAD syndrome , the patient was treated with surgical mitral valve repair and implantable cardioverter defibrillator (ICD) implantation.
+The 3D-TTE examination was performed with the GE Vivid E95 echo machine (GE Vingmed Ultrasound, Horten, Norway), using the 4Vc probe, and all data were stored in the EchoPAC v.203 workstation.
+Advanced LV assessment and 4D strain analysis values were performed with the dedicated AutoLVQ application, using a full-volume apical four-chamber view, focused on the LV, with a frame rate of >25 vps. Global LV strain values were overall normal. The longitudinal strain was measured at −21%, circumferential strain at −20%, radial strain at 69%, and area strain at −40%. The strain values of the basal inferolateral segment were reduced, confirming the presence of the fibrosis detected in the MRI examination of the patient. The segmental radial strain was measured at 35% (normal values at 43.2 ± 4.5%), area strain at 24% (−36.5 ± 3.9%) (with adjacent segmental values of −47 and −56%), and circumferential strain at 18% (−30.3 ± 4.0%), while the longitudinal strain was preserved at −22% (−21 ± 0.6%) due to the hyperdynamic motion of the basal posterior wall .
+Advanced mitral valve assessment was performed with the AutoMVQ method that provided the measurements of the leaflets and the annulus, using an apical four-chamber view, focused on the mitral valve with 4D zoom and a frame rate of >12 vps. By default, AutoMVQ creates the mitral valve model using a middle reference frame between end-diastole and end-systole. Since the requested information for MAD syndrome is the dimension changes between diastole and systole, we had to manually adjust the systolic and diastolic frames twice and provide two different mitral valve quantification (MVQ) models. A direct comparison of the systolic and diastolic models allows us to understand the dynamic annulus changes in MAD syndrome. In our patient, this method confirmed (1) the flattening of the saddle-shaped annulus during the systole and (2) the systolic expansion. In particular, the annulus area increased from 14.6 cm2 to 23.2 cm2, the perimeter from 13.7 cm to 17.2 cm, the anteroposterior diameter from 3.4 cm to 4.8 cm, and the commissural diameter from 4.2 cm to 5.5 cm. Meanwhile, the annulus height decreased from 11.4 cm to 7.0 cm . The disjunction arc of the valve was easily demonstrated by an “en face” 3D ventricular view of the mitral valve where the extent of the arc was assessed by measuring the circumference of the posterior annulus involved within the disjunction. Volume rendering views can reveal the actual part of the free posterior wall of the left ventricle that is separated from the annulus and the atrium .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2728_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2728_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..51c93f409b862812408b7e789033d2c5edc3f281
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2728_en.txt
@@ -0,0 +1,3 @@
+A 64-year-old Caucasian male originally presented to his primary care physician due to gradually increasing right hip pain for more than two months. He denied any significant weight loss, night sweats, heart palpitations, or other systemic symptoms. His past medical history was significant for a parathyroidectomy with resection of a single parathyroid adenoma and well-controlled arterial hypertension. Family history included prostate cancer in his father. On exam, the patient had reproducible right hip pain with passive and active motion. Due to concerns for musculoskeletal pathology, magnetic resonance imaging (MRI) of the spine was obtained and had demonstrated mild degenerative changes in the spine and an 11.2 cm mid-abdominal retroperitoneal mass. Contrasted enhanced computed tomography (CT) of the abdomen and pelvis was obtained to characterize the mass; this showed an 11 cm ovoid, solid, enhancing mass in the right mid-abdominal mesentery with no associated lymphadenopathy . Given a low suspicion for a catecholamine-producing tumor (which would have necessitated further workup), the decision was made to proceed directly to an image-guided biopsy to establish a diagnosis and guide treatment. The biopsy demonstrated an atypical epithelioid and spindle cell neoplasm. The patient underwent an elective exploratory laparotomy for removal of the mass. Intraoperatively, the tumor was found to be adherent to the head of the pancreas and to the confluence of the superior mesenteric and portal veins. The tumor was resected en-bloc with a margin of pancreatic tissue and the portal vein defect was repaired primarily.
+Histologic evaluation of the tumor showed evidence of neoplastic cells arranged in nests and trabeculae within the tumor’s vasculature. Round to oval cells with moderate to abundant eosinophilic granular cytoplasm were found within the tumor bulk. Tumor was metastatic to one of the lymph nodes. The tumor immunohistochemistry demonstrated a Ki-67 index < 1%, positive succinate dehydrogenase subunit A (SDHA), SDHB, chromogranin A, and S-100 stains, and negative cytokeratin CAM 5.2 and human melanoma black-45 (HMB45) stains. These findings were consistent with a PGL with metastasis to the lymph node.
+Once the diagnosis was obtained, urine catecholamines were immediately measured. The patient had elevated urine metanephrines 382 mcg/24 h (normal range 44 - 261 mcg/24 h) and urine normetanephrines 650 mcg/24 h (normal 138 - 521 mcg/24 h) demonstrating a functional PGL. Gallium-68 DOTATE scan showed no evidence of distant metastatic disease. Genetic analysis was performed on a peripheral blood sample using a hybridization-based protocol to enrich for regions of interest. Amplicons from the coding exons of 34 genes of interest were created using real time polymerase chain reaction, and subsequently sequenced using Illumina® technology. When compared to a reference sequence, a RET gene variant of unknown significance [c.731C>T (p.T244I)] was identified. Screening thyroid ultrasound did not demonstrate any suspicious thyroid nodules. At his three month follow up, our patient reported full recovery from the surgery with no further symptomatology and his metanephrines had normalized. At his one-year follow-up, he reported he was doing well. However, a suspicious left renal mass, concerning for renal cell carcinoma, was seen on his screening CT abdomen and pelvis. There was no evidence of recurrent disease from his metastatic PGL on imaging. At this time, patient is undergoing further work-up with urology.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2771_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2771_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9936983a96c0a3c3e36373e34caa69be935950bf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2771_en.txt
@@ -0,0 +1,4 @@
+A 74-year-old non-smoking woman was diagnosed with the right lung shadow following a chest computed tomography (CT) scan . She was admitted to the hospital because of coma after misusing hypnotics. Primary lung adenocarcinoma was diagnosed through radiological examinations and a lung biopsy in the right lower lobe. Immunohistochemically, it showed TTF-1 (+), Napsin A (+), CK5/6 (−), P40 (−), Ki-67 (<5%+), and AE1/AE3 (+). Surgery was not pursued due to concerns regarding age and tolerability. Enhanced CT scan revealed a 35 mm * 25 mm mass in the dorsal segment of the lower lobe in the right lung, accompanied by obstructive inflammation. Multiple slightly enlarged lymph nodes were observed in the mediastinum and hilum of the right lung (cT2N2Mx). At that time, the formalin-fixed paraffin-embedded (FFPE) tissue was examined using an NGS-based assay (Covance CLS China) and the METex14 splice region mutation was identified as c.3028G>T with the abundance of 18.81%. The woman began orally administering tepotinib (Merck-0.5g, once daily). After 1 month, a CT scan revealed that the mass on the right lung lesion had decreased in size to 14 mm * 13 mm. After nearly 5 months since the discontinuation of tepotinib, a chest CT revealed that the mass had reduced to 13 mm * 11 mm, marking the best response. However, the lesion in the right lung increased to 18 mm * 12 mm after 7.6 months of tepotinib treatment, indicating disease progression. Afterward, tepotinib treatment was discontinued.
+Additionally, at this time, radiological examinations confirmed the diagnosis of NSCLC, with enlarged mediastinal, right hilar, and bilateral inguinal lymph nodes (cT2N3M1a, stage IVA). In addition, a fine-needle aspiration re-biopsy of the lung was performed for the NGS-based assay (OncoScreen® Focus panel, Burning Rock Dx), which revealed the same METex14 splice region mutations as previously identified, NM_000245.3(MET): c.3028G>T(p. Asp1010Tyr), without any newly identified resistant mutations. The patient was then enrolled in cohort 4 of a clinical trial (KUNPENG, NCT04258033) and initiated on vebreltinib (200 mg twice daily) as a second-line therapy. The patient had stable disease for 6.8 months.
+The woman achieved her first PR after 6.8 months from vebreltinib treatment, and further reduction was observed in the size of the mass in the right lung (10.5 mm). The most recent chest CT shows an overall decrease (10.3 mm) in the size of the mass in the right lower lobe, and the treatment was ongoing for over 20 months. The DoR and PFS exceeded 13 months and 20 months, respectively. As of the latest visit, she maintained the response without any Grade 3 or above adverse events (AEs) and serious adverse events. No treatment-emergent adverse events led to permanent treatment discontinuation or dose reduction.
+The woman developed Grade 2 bilateral lower-extremity edema, which was managed with spironolactone tablets. The patient had mild peripheral edema before starting vebreltinib treatment. A grade 2 AE of anemia was observed twice and recovered after intervention with traditional Chinese medicine. Grade 1 AEs of hyponatremia, amylase increase, and lipase increase were also observed once each, and they recovered without any intervention. A Grade 2 AE of ankle pain was still ongoing but was not considered related to the treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_277_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_277_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e4b7ad23aa06a31c24780606eb14d233ee1bd425
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_277_en.txt
@@ -0,0 +1,12 @@
+Male patient aged 45 years at the time of diagnosis.
+Chronic fatigue and pain in both shoulders and the lower back.
+The patient visited a local clinic due to headache, dizziness, malaise, fatigue, and pain in both shoulders and the lower back. Symptoms persisted for several days and did not ease with medication. The patient underwent a complete blood count test; his white blood cell count was elevated to 34,100/mm3. The vital signs of the patient were normal, and the patient was stable without any fever. The clinical impression was leukemia, and the patient was referred to the hemato-oncology department of a university hospital. After admission, he underwent a bone marrow biopsy and a cytology exam. The results are reported in Table . Based on the biopsy results, he was diagnosed with CML and was started on chemotherapy.
+The patient had never smoked and rarely drank alcohol.
+The patient did not have hypertension, diabetes, tuberculosis, viral hepatitis, or human immunodeficiency virus infection.
+There was no family history of hemato-oncologic diseases.
+The patient started his job as a diagnostic radiographer in November 1990 and had continued working until he was diagnosed with CML. His job history is summarized in Table .
+The patient’s main jobs involved obtaining simple radiographs, including chest and abdominal radiographs. He also performed special radiography such as gastrointestinal series radiography and measuring bone marrow density. The working environment and the equipment he used are shown in Figures and . The one-time exposure amount of the relevant diagnostic tools are listed in Table .
+The patient’s work profile also included fixation and development of the exposed films. We investigated the chemicals used to fix and develop the film, but we found no known compound that could be considered to have initiated oncogenesis.
+Records of the patient’s personal exposure dose from 1997 to 2012, measured by the TLD, were available. This is the official record provided by the Korea Workers’ Compensation and Welfare Service .
+The patient mentioned that he was very stressed specifically from 2002 to 2006 because several cases of radiography had to be performed and there was no assistant to help with the workload. With regards to the missing records from 1990 to 1996, the patient estimated that the accumulated radiation would be comparable to that of 2003 to 2005, or even higher. Conventionally, younger workers tend to take more jobs than senior workers. Furthermore, the working environment then was worse than the present working conditions, and past radiologic shield methods were not as effective .
+Based on these assumptions, the PC was calculated by applying both the highest value (17.48 mSv) and the mean value (6.02 mSv) of annual radiation for the period of 1997–2012 . The PC was calculated by the Radiation Health Research Institute-Program for Estimating the Probability of Causation (RHRI-PEPC), under the consultation of the Korea Hydro and Nuclear Power Company. The results showed that the point estimation of PC, i.e., the 50th percentile, was 58.83% for the highest estimation, and 57.28%, using the assumed mean value for the missing records.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2786_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2786_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3f5debd01458b6558339ddcfde2270e46ea6c311
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2786_en.txt
@@ -0,0 +1,7 @@
+A 27-year-old woman presented with progressively worsening chest tightness and shortness of breath on exertion.
+Six years ago, the patient began to experience chest distress and shortness of breath after activity, which was relieved after rest. The patient had occasional tussiculation but no paroxysmal dyspnea. She had low energy and lack of appetite, but her sleep quality was fair. The patient’s growth and development were within the normal range. Over time, the symptoms of chest tightness worsened, and were accompanied by dizziness and numbness of the extremities.
+The patient had a history of incomplete abortion one year ago and had been treated with induced abortion.
+The patient had never smoked and had no family history of heart or lung disease. She had congenital heart disease since childhood without standard treatment. The patient stated that she had a "cold" once a month. Symptoms such as shortness of breath and weakness appeared after walking up one flight of stairs and the symptoms were relieved after rest.
+On admission, her blood pressure was 100/64 mmHg in both arms and her heart rate was approximately 74 bpm. Physical examination revealed that her heart rate was regular, and there was a 3/6 systolic murmur on the aortic second auscultation area. She had cyanotic lips and clubbing of her fingers.
+Routine laboratory examinations were within normal limits.
+The patient underwent multimodal imaging. A transthoracic echocardiogram revealed that the main pulmonary artery was dilated with a diameter of 54 mm. There was an abnormal passage between the descending aorta and pulmonary artery with an inner diameter of 9 mm. The entire heart was enlarged. The continuity of the ventricular septal outflow tract was interrupted, and the defect size was approximately 14 mm. Doppler ultrasound evaluation found bidirectional reflux of abnormal channels between the descending aorta and pulmonary artery, which was thought to be a patent ductus arteriosus (PDA) in the interrupted region . Chest radiography showed an enlarged heart shadow, a prominent pulmonary artery, and increased lung texture, which was consistent with pulmonary congestion . Computed tomography angiography (CTA) showed enlargement of the right heart and absence of the aortic arch. The descending aorta originated from the pulmonary trunk, and the junction was 13 mm wide. The diameter of the main pulmonary artery and the right pulmonary artery were thickened. The main pulmonary artery was 54 mm wide, and the right pulmonary artery was 27 mm wide. The ventricular septal wall defect measured 17 mm at the level of the right ventricular outflow tract. The aorta was shifted forward and to the right, straddling the two ventricles . Ven-triculography was performed via the left femoral arteries. Right ventriculography showed pulmonary artery dilatation with residual lung signs. Contrast medium was abnormally seen simultaneously in the left ventricle, ascending aorta, and descending aorta .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2790_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2790_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fd7bb89a06ea2e40768d3ee050f93fbd58d6b211
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2790_en.txt
@@ -0,0 +1,6 @@
+On March 11, 2020, a 68-year-old woman attended the Tianjin Taida Hospital surgical Clinic mainly because of intermittent cough for > 1 month. She had a 2-year history of hypertension controlled by medication, and no history of smoking or alcohol consumption. She had an intermittent cough with white sticky sputum, without any other symptoms or signs. On the same day, the patient was referred to the Fifth Central Hospital of Tianjin. Here vital signs were: body temperature 36.2 °C, pulse 86 beats/min, respiration rate 18 breaths/min, blood pressure 142/85 mmHg, and she was fully conscious. There was no visible enlargement of her superficial lymph nodes. She had no cyanosis, percussion pain in the sternum, or abnormal respiratory movements. She had coarse breath sounds in both lungs, no pleural friction sounds, and audible inspiratory crackles in the left lung. Heart sounds were strong and regular, with no pathological murmurs in any valve auscultation area. Carcinoembryonic antigen (CEA) was 8 ng/ml (normal range 0–5 ng/ml) and non-small cell lung cancer associated antigenCYF21–1 was 13.31 ng/ml (normal range 0.1–3.3 ng/ml). Other biochemical indicators were within the normal range.
+The patient underwent a series of imaging examinations . Chest radiography on March 11, 2020 showed several nodules in the upper and lower segments of the left lung . Chest computed tomography (CT) on March 12, 2020 showed multiple solid nodules in the upper and lower left lung . The nodules had irregular outlines, with a maximum diameter of 65 mm, and some had a central cavity. A diagnosis of lymphoma was considered. Enhanced chest CT on March 16, 2020 showed multiple “cauliflower like”, soft tissue masses in the left lung, partially fused, with a maximum diameter of 71.3 mm and a CT value of ~ 36 HU. Enhanced CT showed enhancement with a maximum value of 60 Hu. The boundary between the mass and pleura was not clear, and the mass could not be separated from the pleura. There was irregular thickening of the pleura and no enlargement of lymph nodes. A malignant tumor could not be excluded.
+To clarify the pathological diagnosis, the patient underwent ultrasound-guided percutaneous needle biopsy of the left lung under local anesthesia on March 16, 2020. After consultation with our own and other hospitals(diagnostics were performed by Tianjin Fifth Central Hospital, Tianjin Cancer Hospital and Peking Union Medical College Hospital), the biopsy specimen was finally diagnosed as BA according to histomorphology and immunophenotype.
+Wedge resection with safe margins may be the best treatment option for BA patients. However, if the lung is full of diffuse nodules, the whole lung may need to be removed, which seriously affects quality of life. Our patient was treated conservatively and followed up regularly. She was discharged on March 28, 2020.Her symptoms were managed through regular normal activities of daily living, strengthening respiratory protection, avoiding respiratory infection, and drug treatment to relieve dyspnea and cough.
+To clarify the diagnosis, a double needle lung biopsy specimen was removed, 15 mm long, 1 mm in diameter. It was solid and gray white. Microscopically, there were irregular adenoid structures in a background of fibrosis and inflammation . The lesion had a two-layer cellular structure consisting of a basal and luminal layer, and had a lack of papillary structures. The micropapillae occasionally formed by non-ciliated cells germinated and burrowed into the alveolar cavity. The luminal layer was composed of type II alveolar cells and club cells. However, ciliated columnar cells and mucous cells in some flat areas could still be identified .The appearance was similar to adenocarcinoma in some areas, with alveolar destruction and stromal widening. Through careful observation, we found that the main reason for the stromal widening was edema and inflammatory infiltration. Unlike adenocarcinoma, there was a lack of thick collagen fibers . Tumor cells lacked atypia, mitosis and necrosis. A layer of material resembling the basement membrane surrounded the basal layer. The most important feature was a continuous layer of basal cells around the luminal layer.
+Immunohistochemical staining for p63, p40 and cytokeratin (CK)5/6 clearly showed the continuity of the basal cells . The luminal cells and some basal cells stained positive for thyroid transcription factor (TTF)-1. The luminal cells expressed immunological markers of the terminal bronchioles (CKpan, CK7, Napsin A and CEA). A small number of mucous cells stained positive for periodic acid Schiff. The tumor showed a < 10% Ki-67 proliferation index . Finally, the case was pathologically diagnosed as BA of distal type.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2805_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2805_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4774be70c7fb9d7c916a5765b97f377594504607
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2805_en.txt
@@ -0,0 +1 @@
+A 73-year-old male (174 cm, 47 kg) with the American Society of Anesthesiologist physical classification of 3 was scheduled for elective left nephroureterectomy. A left calyx tumor was incidentally discovered during a routine medical examination, and a biopsy performed 1 month ago during ureteroscopy suggested a urothelial carcinoma. Past medical history includes intraductal papillary mucinous neoplasm of the liver that was surgically removed 6 years ago. A preoperative evaluation was performed, and chest computed tomography (CT) revealed pulmonary thromboembolism in the left lower lobe. A lower extremity ultrasonogram showed no evidence of deep vein thrombosis, and arterial blood gas analysis and D-dimer were within the normal ranges. The patient was instructed to fast for 8 hours (nothing by mouth) before undergoing general anesthesia. Premedication involved administrating an intramuscular injection of glycopyrrolate (0.2 mg) and famotidine (20 mg). In the operating room, noninvasive monitoring devices were placed on the patient, including a blood pressure cuff, electrocardiogram, a pulse oximeter, a bispectral index signal device, and a quantitative monitor for neuromuscular blockade. General anesthesia was induced using 80 mg propofol, followed by 30 mg rocuronium for neuromuscular blockade after confirming no response to stimuli. Then, sevoflurane (1.7%) was used to maintain the appropriate anesthesia depth after intubation. Because of the risk of bleeding from renal artery surgery, an arterial line was inserted into the right radial artery. Furthermore, right internal jugular vein central venous catheterization was planned. Real-time ultrasound-guided catheterization was initially planned; however, the hospital’s portable ultrasonography device was in use in other operating rooms; therefore, a blind catheterization technique was used based on the patient’s anatomical structure without ultrasound guidance. The patient was positioned in the Trendelenburg position with the head 15° below the horizontal plane and tilted 40° to the left. The Bermuda triangle, an anatomical structure formed by the posterior margin of the sternal muscle belly of the sternocleidomastoid muscle, the anterior margin of the clavicular muscle belly, and the upper margin of the clavicle, was clearly identified. The carotid artery pulse was palpated at the superior angle of the triangle and followed to the center of the triangle, where a 10 ml syringe connected to a 23-gauge finder needle was inserted perpendicularly to the surface while aspirating. The presence of dark venous blood was confirmed at a depth of 2.2 cm, and no pulsation was observed after separating the finder needle from the syringe. Then, the 18-gauge puncture needle connected to the syringe was inserted toward the nipple at a 75° angle from the skin while targeting the finder needle tip, and the aspiration of venous blood flow was confirmed. After removing the finder needle, a guidewire was inserted to a depth of 20 cm from the skin through the puncture needle without any resistance felt during the procedure. The puncture needle was removed while leaving the guidewire in place. Prior to inserting the dilator, the practitioner and colleagues, experiencing a sense of unease during the procedure, attempted to investigate the anatomy of the puncture site by utilizing ultrasonography to detect the previously inserted guide wire, prompted by their concern that the depth of the finder needle, measuring 2.2 cm, is deeper than observed in other patients, which contributed to their uneasiness. The guidewire was found to be located in a vein as which we presumed the vessel based on its location that was lateral from the common carotid artery and collapsibility when pressure was applied using the probe. However, a larger vessel presumed to be a vein was located superiorly and more laterally than the identified vessel. Real-time ultrasound-guided guidewire insertion was performed at the same view in this vessel using another central venous catheter kit. Both guidewires were left in place while the probe was tilted to visualize their paths, and it was confirmed that they were both descending toward the right brachiocephalic vein . The first guidewire was removed, and manual compression using sterile gauze was applied for over 5 min. No resistance was felt during the removal. The second guidewire was used to complete the central venous catheterization, and free regurgitation was observed at each port. The central venous pressure (CVP) measured using the central venous catheter was 15 mmHg. The surgery was successful, and the patient was transferred to the post-anesthesia care unit after extubation. A simple anterior-to-posterior chest X-ray (CXR) taken immediately after the surgery confirmed that the catheter tip was located near the right atrium, following the superior vena cava (SVC) . We reviewed the contrast-enhanced chest CT performed for preoperative evaluation and confirmed that the right internal jugular vein coursed laterally to the right common carotid artery on the axial view. A large vessel was also observed behind the common carotid artery and internal jugular vein, and it was traced upward and downward, confirming that it enters into the transverse foramen at the level of the sixth cervical vertebra and drains into the right brachiocephalic vein, consistent with the known course of the cervical vertebral vein. The same findings were observed in the coronary view . The radiologist indicated this vessel as the vertebral vein. After considering the ultrasonographic findings and the radiologist’s official reading, we confirmed that the vein that we had initially punctured was indeed the right cervical vertebral vein. On the third day after surgery, the central venous catheter was removed, and the patient did not exhibit any complications, such as bleeding, swelling, and neurological symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2806_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2806_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..165feddb4351182ff06220e9111334d38400dda7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2806_en.txt
@@ -0,0 +1,4 @@
+A healthy 41-year-old woman was referred to our center after the 22-week gestational ultrasound revealed short ribs and a possible craniosynostosis in the fetus on the second trimester ultrasound. After detailed genetic counselling, an amniocentesis was performed at 24 weeks to investigate the etiology. Array CGH was normal without any unbalanced chromosomal rearrangement, and so were FGFR2 and FGFR3 recurrent variant screening (to rule out FGFR related craniosynostosis syndromes), and the 7-dehydrocholesterol level (to rule out Smith-Lemli-Opitz syndrome). At 26 weeks, computed tomography confirmed short ribs with irregular ends but no craniosynostosis and overall renal cortex echogenicity was noted on ultrasound . The association of bone and renal abnormalities led to an initial diagnosis of a skeletal ciliopathy spectrum disorder such as Jeune syndrome (asphyxiating thoracic dystrophy). Pregnancy was then complicated by hydramnios requiring amniotic fluid drainage at 33 weeks, which triggered fetal bradycardia and the need for a caesarean delivery. At birth, the new-born male measured in the low normal range for gestational age with a weight of 1800 g (32nd centile), length of 43 cm (39th centile), and an occipitofrontal circumference of 30 cm (26th centile) without craniosynostosis. Soon after birth, he developed hypotonia and respiratory distress requiring oxygen and non-invasive ventilation. Except for a bell-shaped chest, the rest of his clinical examination was unremarkable. A chest X-ray showed a narrowed thoracic cage with short ribs and multiple rib fractures. Subsequently, a skeletal survey revealed diffuse osteopenia with coarse trabecular markings, subperiosteal bone resorption, cortical dualization and metaphyseal corner fractures . The initial laboratory evaluation revealed severe hypercalcemia (ionized calcemia: 1.66 mmol/l; reference range: 1.17–1.27), a slightly low phosphate level (1 mmol/l; reference range: 1–1.95), normal alkaline phosphatase levels (387 IU/l; reference range: 122–469), abnormal urinary calcium (calcium-to-creatinine ratio: 0.78 mmol/l; reference range: 0.2–2.0), and an increased PTH level (325 pg/ml; reference range: 15–65). The diagnosis of NSHPT was then suspected and confirmed by a phosphocalcic NGS panel which revealed the pathogenic heterozygous (PM1, PM2, PM5, PP2, PP3, PP5) variant c.554G>A p.(Arg185Gln) in the CASR gene (NM_000388.3).
+Calcium metabolism tests and genetic screening were then requested from both asymptomatic parents. These analyses revealed hypercalcemia (total serum calcium: 3.32 mmol/l, reference range: 2.2–2.6 mmol/l), low phosphate levels (0.59 mmol/l, reference range: 0.84–1.4 mmol/l), low calcium-to-creatinine ratio (0.16 mmol/mmol, reference range: 0.2–0.6 mmol/mmol) and hyperparathyroidism (PTH: 42 pg/ml, reference range: 15–65) in the father who harbored the same heterozygous CASR variant. Mineral homeostasis (25-hydroxyvitamin D level: 24 ng/ml) and CASR sequencing were normal in the mother. The family history revealed that the paternal grandmother also had FHH discovered as a result of recurrent urinary lithiasis . Similarly, FHH affected various members of the paternal branch.
+Initial therapy included hyperhydration, phosphate supplementation and a low-calcium milk formula. Hypercalcemia did not improve. Therefore, treatment with pamidronate (0.5 mg/kg intravenous on days 9 and 14) was started. After a moderate transient response to pamidronate, serum calcium levels subsequently increased and were associated with very high PTH levels (1671 pg/ml). Clinically, the patient had persistent restrictive lung disease caused by significant rib fractures requiring oxygen and analgesics. Therefore, after confirmation of the genetic diagnosis of NSHPT treatment with calcimimetics (cinacalcet) was initiated on day 22 at 0.5 mg/kg PO daily and progressively increased to 3 mg/kg in 2 doses. The cinacalcet dose titration normalized the PTH in 25 days but serum calcium remained at approximately 3 mmol/l .
+Hyperparathyroidism control provided significant improvement in clinical signs. The patient was discharged on day 73, and oxygen therapy could be discontinued at 6 months of age. Psychomotor development and growth were normal. At 6 months of age, X-rays showed complete normalization of bone abnormalities and ultrasound revealed nephrocalcinosis. At 11 months of age, parathyroid gland ultrasound showed no abnormality.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2807_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2807_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4405f87ccc52b31d0ee4d39896e5043dda285df6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2807_en.txt
@@ -0,0 +1 @@
+A fourty-year-old man with DEB diagnosed at the age of eight was admitted to the department of gastroenterology because of the dysphagia for two previous months. The diagnosis of DEB was established due to the presence of single blisters on the whole body since the sixth month of life. His sister was also diagnosed with DEB and had similar symptoms of the disease. To our knowledge, the presented patient and his sister are the oldest diagnosed with EB living in Poland. At the age of four the patient started experiencing heartburn occasionally. Five years later dysphagia appeared for the first time. It was an episodal and periodical ailment. He reported a deterioration of dysphagia at the age of nineteen; he mostly consumed liquids and soft consistency meals during that time. Nonetheless, the patient admitted that this esophageal discomfort still was not a constant one and there were time intervals without this ailment. In the past there were also episodes of mild esophageal bleeding. The only one endoscopic esophageal dilatation in this patient took place in 1997; a stenosis was located then approximately 18 cm from incisors. The performed procedure ameliorated swallowing difficulty. A barium swallow test obtained one year after the endoscopic dilatation of the esophagus also revealed esophageal constriction on the same level. In 2014 the patient was diagnosed because of hematochezia and pain in hypogastrium. Tissue samples obtained in colonoscopy revealed the presence of nonspecific inflammatory infiltration in the ascending colon and terminal part of the ileum. Interestingly, 3 years ago he complained of hemoptysis and there was a suspicion of bleeding to pulmonary alveoli in the course of DEB. However, a CT scan did not confirm bleeding. On admission to our department the patient was complaining of painful swallowing of solids. Two months earlier he was diagnosed in the cardiology unit because of the chest pain and elevated level of troponin I. An electrocardiogram did not show any abnormalities. The patient refused to undergo coronarography and no more cardiological diagnostic procedures were performed Additional file . On admission to our unit he did not complain of the chest pain. On physical examination he appeared comfortable, afebrile with pulse 90 beats per minute, blood pressure 125/90 mmHg, respiratory rate 19 per minute and the body mass index (BMI) was 24.7 kg/m2. The patient presented blisters, skin reddening and crust formation on the upper and lower limbs. There were also contractures and disabled movement in his hand joints together with a loss of a finger and toenails . The apex of the tongue and left palatine arch were covered by superficial ulcerations. During his hospital stay, performed laboratory tests did not reveal any abnormalities. A CT scan of the chest and abdomen showed a thickening of the esophageal wall at maximum to 7 mm on the level from the fourth cervical vertebra to the fourth thoracic vertebra . A probe of gastroscopy under sedation with benzodiazepine failed due to an esophageal stenosis. An attempt of examination with paediatric endoscope was also unsuccessful. A barium swallow test revealed a narrowing of upper esophageal lumen to 7 mm along the length of 4 cm together with two diverticula on the right side not emptying of contrast. During swallowing other two diverticula appeared which were emptying of contrast . A barium swallow test also showed a noticeable weakening of the esophageal mucous membrane. After the performed investigation the patient was qualified to endoscopic dilatation of esophageal stenosis and endoscopic management of diverticula. However, he did not agree to undergo this procedure during current hospital stay. In our unit the patient was treated with proton pump inhibitor (PPI) and prokinetic drugs administered intravenously, which caused an amelioration of esophageal discomfort. He was discharged in a good general condition with a recommendation of a diet based on soft consistency meals, oral PPI and prokinetic drugs administration and the next follow-up in a month.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2815_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2815_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6a3fee468658748b8211f8373a5506e13fb53f29
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2815_en.txt
@@ -0,0 +1,2 @@
+A 27-year-old HIV-positive Chinese Manchu male complained of intermittent headache, nausea, and vomiting (non-projectile vomiting three times in total) for two weeks in January 2022. No fever, amaurosis, or unconsciousness were presented. He denied preceding travel or unusual animal exposures. He was diagnosed with HIV infection five years ago and nadir CD4+ T-cell count was 79 cells/μL. He initiated ART with tenofovir, lamivudine, and efavirenz, but treatment failure occurred one year later with plasma HIV RNA 2.19 × 105 copies/mL and CD4+ T-cell count 14 cells/μL. The local doctor shifted the ART regimen to tenofovir, lamivudine, lopinavir/ritonavir without a genotypic drug resistance test, and his plasma HIV viral load was well controlled thereafter. Neurological physical examination showed no abnormalities. The brain magnetic resonance imaging (MRI) presented bilateral multiple white matter T2-weighted hyperintensities especially in the FLAIR sequence , without T1-wighted enhancement or mass effect. Lumbar puncture showed high intracranial pressure, lymphocytic pleocytosis, and elevated CSF protein level . CSF HIV RNA was 774 copies/mL, while plasma HIV RNA was undetectable. The following blood tests all displayed negative results, including the T-cell enzyme-linked immuno-spot assay for tuberculosis, the syphilis rapid plasma reagin titer, Toxoplasma gondii IgG and IgM, cytomegalovirus (CMV) IgM, herpes simplex virus (HSV)1/2 IgM, Epstein-Barr virus (EBV)-IgM, galactomannan, 1,3-β-D-glucan, cryptococcus antigen, EBV-DNA, CMV-DNA. Besides, the CSF tests which detected acid-fast stain, India ink stain, cryptococcus antigen, culturing of bacteria and fungus, and CMV-DNA were also all negative. No other pathogens were confirmed by the next-generation sequencing in the CSF (using the MGISEQ-2000 platform in BGI PathoGenesis Pharmaceutical Technology, BGI-Shenzhen). The pathological phenotype of encephalitis was required, but the patient declined brain biopsy. CD8 encephalitis was suspected, and thus prednisone and glycerol fructose were prescribed empirically to reduce inflammation reactions in the brain.
+One month later, the patient presented headache relief, and obvious improvement in MRI performance and laboratory tests in the CSF . Then, prednisone was tapered (60 mg daily followed by a reduction of 5 mg per week) and discontinued in May 2022. However, he complained of a headache relapse in June 2022. MRI showed the increased area of multifocal leukoencephalopathy . Moreover, increased HIV replication was observed in both CNS and plasma, and further HIV drug resistance tests of CSF and plasma (Sanger sequencing in Dongguan Medical Laboratory of Micro-scale and Presicion) presented identical results of major protease inhibitor (PI)-related mutations, nonnucleoside reverse transcriptase inhibitor (NNRTI)-related mutations, and nucleoside reverse transcriptase inhibitor (NRTI)-related mutations . The encephalitis owning to CSF drug-resistant HIV escape was considered. Thus, ART regimen was switched to zidovudine (sensitive), lamivudine (highly resistant), and dolutegravir (sensitive). As well, prednisone 60 mg daily was restarted. One month after that, HIV suppression was achieved in both CSF and plasma , and MRI displayed moderate shrink of diffused white matter area . Then, prednisone was tapered (the same as last time). A complete remission of brain MRI lesions was achieved in December 2022 . Meanwhile, prednisone had been withdrawn. The timeline for treatment adjustment and follow-up of this case was clearly outlined in Fig. .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2825_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2825_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b83970d824b0f2e0299328af6a17a68b2d0a305d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2825_en.txt
@@ -0,0 +1 @@
+A 75-year-old man presented with a chief complaint of abdominal discomfort and weight loss. His medical history included hypertension, paroxysmal atrial fibrillation, and refractory pruritus. He had lost approximately 10 kg of weight in 2 months and was referred to our hospital because of abdominal discomfort. At the time of consultation, his height was 174.8 cm, body weight was 56.5 kg, body mass index was 18.49; his vital signs were as follows: body temperature 36.1 °C, blood pressure 128/79 mmHg, heart rate at 77/min, and oxygen saturation at 97 % (room air). Hematological investigations performed on admission revealed carcinoembryonic antigen at 5.1 ng/mL, carbohydrate antigen19-9 at 0.1 U/mL, and carbohydrate antigen − 125 at 7.7 U/mL, indicating no increase in tumor markers. No abnormalities were observed in the blood tests. Esophagogastroduodenoscopy showed a wide, shallow, depressed lesion from the cardia to the mid-body, with an ulcerated part, which we diagnosed as a type 3 tumor . In addition, approximately 40 mm of the entire circumference of the esophagus was invaded . The lesions were diagnosed in Group5 (por, sig). Based on the biopsy results, all lesions in the ulcer presented as a wide shallow depressed lesion in the mid-body and lesions at the esophagogastric junction. Upper gastrointestinal examination showed that, on the oral side, lesions had an irregular wall and poor progression up to approximately 40 mm from the esophagogastric junction. On the anal side, they extended around the mid-body . We found an ulcerative lesion near the cardia and suspected invasion at the depth of the muscularis propria (MP). Abdominal computed tomography (CT) showed an irregularly thickened wall on the upper body and lesser curvature of the body, and an increase in the concentration of fatty tissue around the wall was also found in the mid-body . Therefore, the degree of invasion was determined to be at the depth of MP. There were no findings of suspected lymph node enlargement or metastases to other organs. Considering these facts, we preoperatively diagnosed gastric cancer as T2, N0, M0, StageIB (according to the UICC, 8th edition). We performed a total gastrectomy with abdominal esophageal resection, D2 lymph node dissection, cholecystectomy, and Roux-en-Y reconstruction. The proximal side of the invasive esophageal area (40 mm from the esophagogastric junction) was clipped as a marker preoperatively. Intraoperatively, it was confirmed that there was no cancer at the esophageal margin and that it was resected, including the clip. The excised specimen showed a shallow depressed lesion of 90×55 mm from the abdominal esophagus to the lesser curvature of the upper stomach, and a type 0-IIb + IIa + IIc lesion (according to the macroscopic classification of the gastric cancer) with esophageal invasion up to 30 mm from the esophagogastric junction . Histopathological findings showed that all widespread lesions were cancers that remained in the mucosa, with por2 being the majority and some sig being mixed. No submucosal invasion was observed, including in the ulcerated area . The pathological diagnosis was gastric cancer: T1a, N0, M0, and StageIA. The postoperative course was uneventful and the patient was discharged on POD 11. Five years since the operation, the patient is surviving without recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2833_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2833_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fdd5e25c1523dd492fa4e6581d6f9eeba950a494
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2833_en.txt
@@ -0,0 +1,6 @@
+A 53-year-old female patient presented with a 10-year history of enlargement of right heart cavities with mild elevation of pulmonary artery pressure and mild dyspnoea. Her baseline electrocardiogram showed normal sinus rhythm with incomplete right bundle branch block, cardiac auscultation revealed a fixed split S2. First echocardiographic cue of the congenital disease was a partial reverse flow of the RUPV and evidence of relevant left-to-right shunt at the level of the SVC , as assessed by transoesophageal echocardiography. Her past medical history includes dyslipidaemia, arterial hypertension and anxiety disorder.
+Cardiac magnetic resonance imaging (CMR) confirmed right heart dilatation with normal biventricular function and showed dilatation of the pulmonary trunk (38 mm). 3D magnetic resonance angiography (Golden-angle RAdial Sparse Parallel MRI) demonstrated a large side-to-side communication (cavopulmonary window) of the RUPV with SVC of 19 mm resulting in isolated PAPVR. The RUPV retained its connection to the LA and as a result forming a PAPV drainage.
+Flow measurements were done of the ascending, and descending aorta, as well as pulmonary artery (not shown) and showed a significant left-to-right shunt with Qp:Qs of 1.6. Approximate (no axial correction) net forward flow in the SVC distal to the cavopulmonary window was markedly elevated (113 mL). It was much higher than the usually expected backflow from head and upper extremities (difference of net forward flow of ascending and descending aorta: 96 mL − 63 mL = 33 mL) and further confirmed significant left-to-right shunting.
+At right heart catheterization, the anomalous connection of the RUPV to the SVC was confirmed by a jump in the oxygen saturation of the SVC proximal to the cavopulmonary window of 76–96% at the level of the cavopulmonary window. Angiographically, there was evidence of significant left-to-right shunting with a Qp:Qs of 2.2.
+Given the haemodynamic significance of this patient’s shunt, right cavity dilatation, and mild elevation of pulmonary artery pressure the defect has been repaired using minimally invasive axillary thoracotomy . An atrial tunnel patch was inserted through a patent foramen ovale (PFO) to redirect flow from the RUPV to the LA .
+In a follow-up CMR 7 months after the operation, it could be demonstrated that the cavopulmonary window was closed with unchanged normal connection of the RUPV to the LA. Yet, there was evidence of a post-operative interatrial shunt (Qp:Qs = 1.2) in proximity to the ostium of the inferior vena cava. Right ventricular end-diastolic volume (RV EDV) was in the upper normal range (RV EDV indexed 106 mL/m2).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2854_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2854_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f8e29d4604db45cb05e4b794834b14656a9f1e98
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2854_en.txt
@@ -0,0 +1,12 @@
+A 28-year-old female patient of Indian ethnicity was referred to our specialist gynaecology clinic after presenting to her general practitioner with a few weeks’ history of right-sided lower abdominal pain, radiating to the right flank. An ultrasound scan performed in primary care showed a right adnexal solid cystic mass, initiating urgent referral to the rapid access gynaecological cancer service.
+The patient had no history of any medical conditions. She was nulliparous with a BMI of 27 and no previous gynaecological or surgical history. She described an unremarkable menstrual history with regular cycles, and no menorrhagia, dysmenorrhoea or intermenstrual bleeding. She was not using any regular medication or contraceptives, and had no family history of gynaecological conditions or cancer. Her 3-yearly cervical cytology testing was up to date and unremarkable. She was a non-smoker and consumed alcohol socially.
+Abdominal and bimanual vaginal examination was deemed inconclusive but revealed no obvious abnormalities. Vaginal speculum examination demonstrated no abnormalities of the vulva, vagina and cervix. A transvaginal ultrasound performed in the expert, specialist clinic showed an anteverted, normal sized uterus, with an endometrial thickness of 16mm. Anechoic areas with Doppler colour flow were seen in the endometrial cavity, suggestive of endometrial polyps. The rest of the endometrium was regular and well defined with preservation of the endo-myometrial junction. . The left ovary appeared normal. In the right adnexa, a solid cystic mass measuring 74 x 58 x 63 mm was seen, with the solid component measuring 40 mm with shadowing . The mass had a colour score of 3, suggestive of moderate blood flow through the mass .
+According to IOTA simple rules, the mass was indeterminate because of shadowing, a benign feature, and colour score of 3, which was a malignant feature .
+The IOTA-ADNEX risk model was subsequently used to evaluate the ovarian lesion. This suggested a 44.2% risk of being benign and a 55.8% risk of ovarian malignancy, of which borderline was 36.7%, followed by a 12% risk of being stage 1 ovarian cancer. Risk of stage 2-4 ovarian cancer was 5.2%. Risk of metastatic ovarian cancer was 2% .
+On subjective assessment, the mass was suspected to be a sex-cord stromal tumour.
+Following initial assessment, due to the indeterminate nature of the adnexal mass, a plan was made to obtain serum tumour markers, perform magnetic resonance imaging (MRI) and to discuss the case in the specialist gynaecological cancer multidisciplinary team (MDT) meeting.
+All tumour markers tested were normal (CA125 29, AFP 1, HCG <2, and LDH 153).
+Pelvic MRI showed a polypoid lesion in the uterine cavity. The left ovary appeared normal. The right adnexal mass was identified within a pool of free ascitic fluid, which extended both behind and in front of the uterus. The mass had bright uptake on T1 weighted series and featured small cysts, suggestive of an enlarged, torted, solid cystic right ovarian mass . The MRI was inconclusive of malignancy because of the distorted architecture caused by the torsion. A staging computer tomography (CT) of the chest, abdomen and pelvis did not show any evidence of local or distant metastasis.
+Hysteroscopy unveiled multiple polyps in the lower uterine cavity; the endometrium appeared normal at the uterine fundus. Transcervical resection of the uterine polyps was performed. Laparoscopy confirmed an 8cm right-sided, cystic and solid, torted mass with omental and peritoneal adhesions and minimal inflammatory ascites. Following removal of the ascitic fluid, careful examination did not reveal any other abnormalities inside the abdominal cavity. Adhesiolysis followed by uncomplicated right salpingo-oophorectomy was performed and the specimen was removed inside an Endobag without spillage. All the specimens were sent for histological analysis.
+The endometrial polypoid tissue showed changes consistent with grade 1 endometrioid endometrial adenocarcinoma . Sections from the right ovarian mass showed features in keeping with a well-differentiated endometrioid ovarian carcinoma . Possible endometriosis was also identified. It was uncertain as to whether the endometrial and ovarian lesions were synchronous tumours or represented metastatic deposits. Immunohistochemistry for mismatch repair proteins (MMR) was undertaken on the right ovarian mass and the tumour cells showed normal nuclear staining for MLH1, PMS2, MSH2 and MSH6.
+The patient was re-discussed at the specialist oncology MDT meeting. Based on the histological findings, the MDT consensus was of a diagnosis of International Federation of Gynaecology and Obstetrics stage 1A, grade 1 endometrioid endometrial adenocarcinoma, and FIGO stage 1A well differentiated endometrioid carcinoma of the right ovary, incompletely staged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2865_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2865_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..653798ff73c485560a28debe45706cf4e05d4851
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2865_en.txt
@@ -0,0 +1 @@
+A 34-year-old Caucasian woman was admitted complaining of a 10-day history of acute thoracic pain, progressive weakness of both lower extremities, worse on the right side, a ‘pins and needles’ sensation in the abdominal region, and bladder dysfunction. A neurological examination revealed spastic paraparesis, symmetrically decreased lower-extremity reflexes in her legs, a bilateral positive Babinski sign and decreased pinprick sensation below D6 level.Our patient underwent an MRI scan of the spine, which revealed an intramedullary lesion at D5 level with high-intensity signal relative to the spinal cord on T1-weighted images, spindle-like shaped and 1.5cm in diameter . An MRI scan with angiographic sequences and selective spinal angiography did not show vascular blush or abnormal vascularity.Our patient underwent D4-D5-D6 laminectomy. At the operation, the dura appeared intact. Once exposed, the spinal cord appeared normal on the surface although it was swollen at D5 level. A midline cordotomy was performed and a well-circumscribed dark-bluish lesion, measuring 1.5×0.5cm in diameter, was revealed deep within the spinal cord . The lesion was carefully dissected out and totally removed in one piece . A histological examination revealed the typical features of a cavernous angioma.The immediate postoperative course was uneventful. The paraparesis and sensory deficits gradually improved and our patient was discharged on the 18th postoperative day. A one-month follow-up spine MRI scan revealed no residual lesion . One-year post-operatively, our patient was able to walk again.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2868_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2868_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ebcad20457ec08a090b81131d56fb8374cfdc7ab
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2868_en.txt
@@ -0,0 +1,7 @@
+A 48-year-old woman was admitted to our hospital because of a palpable mass in the lower abdomen.
+She denied the presence of abdominal pain, abdominal distention, diarrhea, or dyspepsia without weight loss. Her appetite was not affected.
+She denied any history of hypertension, coronary heart disease, diabetes, or coronary heart disease. She reported no history of smoking, alcohol intake, or a hereditary disorder.
+Abdominal examination showed that her abdomen was diffusely soft, with no distention or tenderness. No other positive sign was observed.
+Upon admission, her routine blood test results and blood biochemical parameters were normal. Her serum carbohydrate antigen (CA) 19-9 level was 251 U/mL, and her serum CA125 level was 412 U/mL. The levels of other tumor markers, including CA242, carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), and CA724, were within the normal ranges.
+Abdominal enhanced computed tomography (CT) revealed a low-density lesion measuring 5.9 cm × 4.6 cm with a poorly defined margin and an irregular contour in the tail of the pancreas. The lesion was hypo-enhanced in the pancreatic parenchyma phase, with progressive delayed enhancement; this possibly indicated a pancreatic tumor . Additionally, a cystic-solid mass measuring 15.1 cm × 12.0 cm in the right ovary and a cystic mass measuring 5.7 cm × 4.3 cm in the left ovary were detected in the pelvic cavity. Both masses were thin-walled and had multiple enhancing septa. There was no evidence of liver or peritoneal metastases .
+The initial diagnosis was uncertain, but the focus was on pancreatic or ovarian cancer. Therefore, she underwent fine-needle biopsy of lesions after a consultation of doctors. Endoscopic ultrasound-guided fine needle (22 gauge) biopsies of the lesion in the pancreatic tail revealed that there was an infiltrative heterogenic glandular growth in the fibrous tissue. And the ultrasound-guided biopsy of the ovary indicated the mass was likely to be metastatic. Immunohistochemistry showed the following findings: CK20 (+), CK7 (+), CDX2 (-), ER (-), and PR (-). The multidisciplinary team considered this pancreatic tumor to be possibly resectable or borderline resectable with ovarian metastases.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_289_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_289_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e414526c4c080e798603b0c46a19354d9fb379b2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_289_en.txt
@@ -0,0 +1,11 @@
+A 58-year-old woman was referred to the Endocrinology Unit in 2019 due to incidental findings of hypercalcaemia. Her medical history included hypertension, stage 3a chronic kidney disease (CKD), and carpal tunnel syndrome treated surgically. She had no family history of endocrine diseases or nephrolithiasis.
+A laboratory test revealed hypercalcaemia, hypercalciuria, and unsuppressed PTH levels (27 pg/mL, reference range, 15-65 pg/mL) .
+Computed tomography (CT) scans of the chest, abdomen and pelvis were conducted and showed no signs of malignancy or granulomatous disease.
+Neck ultrasonography and technetium 99m sestamibi (MIBI) scintigraphy revealed a mass in the upper pole of the left thyroid gland lobe, which was confirmed to be the parathyroid gland after biopsy via immunohistochemical staining .
+There were no abnormalities in the densitometry results (T score of the lumbar spine 1.1; T score of the proximal femur -0.2; T score of the radius 0.5). However, an X-ray revealed advanced subperiosteal bone resorption in the fingers and bone loss in the thoracic spine and clavicles. There were no renal stones or fractures.
+The patient underwent effective parathyroidectomy, after which the calcium level was normalized (2.45 mmol/L, reference range, 2.2-2.55 mmol/L). Histopathology confirmed parathyroid adenoma.
+Ten months after the operation, postoperative assessment revealed a normal calcium concentration (2.48 mmol/L), but vitamin D deficiency (16.4 ng/mL, reference range, 30-50 ng/mL); thus, supplementation with cholecalciferol was administered (4000 IU/daily) . The patient did not attend her follow-up appointments for two years. In 2022, a laboratory test showed hypercalcaemia and hypercalciuria recurrence, which was initially identified as recurrent primary hyperparathyroidism. However, blood tests revealed PTH suppression with elevated 1,25(OH)2D3 concentrations .
+The patient was screened for granulomatous disease and hypercalcaemia of malignancy again, and the results were negative.
+Vitamin D metabolites were measured using LC–MS/MS, which revealed high 25(OH)D3 (72.62 ng/mL) and low 24,25(OH)2D3 (0.09 ng/mL) concentrations and an elevated 25(OH)D3/24,25(OH)2D3 ratio 806,9 (reference range, 7.0-23.6), suggesting a defect in vitamin D catabolism.
+The genetic testing of the CYP24A1 gene was conducted using the NGS technique, and two pathogenic variants were identified NM_000782.5:c; 1186C>T(p.Arg396Trp, rs114368325) and NM_000782.5:c; 428_430del (p.Glu143del, rs777676129). Both variants are classified as pathogenic/likely pathogenic, and associated with hypercalcemia in the available databases, including ClinVar NIH (ClinVar archives, National Institutes of Health). Due to the unavailability of family members, it was impossible to assess whether the variants were located in the same of different alleles of CYP24A1, what would be a direct proof of their dominant or recessive involvement in development of the observed symptoms.
+The recommendation was to discontinue vitamin D supplementation, maintain adequate hydration and avoid excessive sunlight exposure. Follow-up evaluation showed normalization of calcium and PTH concentrations .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2925_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2925_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8628e04e0efb2730cfa5ded809f3be8d49d78aad
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2925_en.txt
@@ -0,0 +1,16 @@
+A 15 year old girl presented to the ER with coma following several tonic–clonic convulsions.
+The patient was previously healthy with no personal or familial medical history. During her visit to a dentist for endodontic treatment, the dentist injected 1.5 ml of 2 % lidocaine (the total dose was 30 mg) and epinephrine 1:100,000 for local anesthesia. The solution was injected on the left side by an expert hand without prior aspiration.
+The injection lasted about 2 min. By the end of the injection, the girl collapsed and several intermittent tonic–clonic convulsions ensued. These lasted about 30 min and were followed by deep coma.
+Glasgow coma scale (GCS) was three, brainstem reflexes were intact, and no fever was noticed. Vital signs were within normal limits.
+Her left cheek and gingiva were edematous and a giant gingival hematoma was noticed.
+Optic disc examination showed no edema.
+Electrocardiogram (ECG) was normal except for sinus tachycardia (120 beat per minute).
+Electroencephalography (EEG) showed diffuse slow activity, predominately theta rhythms, with no signs of continuous status epilepticus.
+Brain computed tomography (CT) revealed reduced white–gray matter differentiation with effacement of cerebral sulci which was compatible with cerebral edema.
+Brain magnetic resonance imaging with venogram and angiogram MRI + MRV + MRA showed cerebral edema, bilateral and almost symmetric hyperintense T2 lesions with restricted diffusion in both frontal and occipital lobes , and no underlying cerebral venous thrombosis CVT.
+Lumbar puncture was performed and revealed the following results: 10 lymphocytes, elevated protein (50 mg/dl), no RBCs, and negative gram stain. Whereas blood glucose was 50 mg/dl, CSF glucose was 70.
+Ordinary labs including Calcium, Albumin, MG, Na, K, creatinine, urea, LFTs, CBC, Plt, PT, PTT, and INR were all normal and troponin was negative.
+The patient was admitted to the ICU and intubated.
+Phenytoin at dose 15 mg/kg was loaded with close cardiac monitoring, and a maintenance dose of 100 mg twice daily was initiated in the second day.
+A bolus (1 g/kg) of Mannitol was given intravenously, followed by a maintenance dose of 0.5 g/kg/8 h. GCS, consequently, improved to nine in 2 days.
+The patient recovered completely and was discharged after a week of admission.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2942_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2942_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f50ece422b4819705103530e41fdd3fd0f08a974
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2942_en.txt
@@ -0,0 +1 @@
+An 18 year old female patient presented with acute symptoms of abdominal and flank pain, nausea, dark red urine, fevers and chills. One month prior to presentation, she had experienced a few days of rhinorrhea and headaches, suggestive of a viral upper respiratory tract infection. Upon presentation, she was found to be pregnant by serum hCG and ultrasound, with an estimated gestational age of 6 weeks. Laboratory evaluation showed hemoglobin 11.2 g/dL, haptoglobin <20 mg/dL, total bilirubin 6.8 mg/dL, direct bilirubin 0.7 mg/dL, lactic acid dehydrogenase (LDH) 735 U/L, and absolute reticulocyte count 49.3 K/μL. Urine analysis demonstrated 3+ blood and the microscopic examination was negative for red blood cells. A direct antiglobulin test was positive for anti-C3d and negative for IgG. The cold agglutinin titer was negative (<2). Donath Landsteiner antibody testing was performed using a blood sample that was immediately immersed into an insulated container filled with water at 37°C, and directly delivered to the testing laboratory. A Donath Landsteiner antibody test was positive , confirming the diagnosis of PCH. Over the next 48 hours, the patient’s hemoglobin declined to 7.3 g/dL . She was managed supportively with a prenatal vitamin supplement and encouraged to keep warm. Her hemoglobin and LDH normalized by day 42 . A Donath Landsteiner test on day 77 was negative. Her hemoglobin declined during the third trimester of pregnancy, to 11.0 g/dL on the day of delivery, without any laboratory evidence of recurrent hemolysis. She delivered a healthy female child by Cesarian section at 39 weeks of gestation. The neonate did not have anemia or hemolysis after birth.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2956_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2956_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3297cff5552d352c18f24769967bc90ad49570ba
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2956_en.txt
@@ -0,0 +1,4 @@
+A 50-year-old post-menopausal woman was diagnosed with a stage IIB (T2N1M0) right breast cancer and subsequently years later developed an unusual recurrence that was diagnosed following rupture of one of her breast prostheses. Following initial diagnosis, she underwent a right modified radical mastectomy and review of surgical pathology revealed a grade 4 (of 4) invasive lobular carcinoma, nuclear grade 2 (of 3), forming a 2.2 × 2 × 1.8 cm mass. No definite vascular invasion was noted apart from the central tumor mass, although lobular carcinoma in-situ with extension into adjacent ducts was seen. Lactiferous ducts beneath the nipple showed pagetoid spread of carcinoma cells. One of 14 right axillary lymph nodes was positive for metastatic involvement with focal extranodal extension of disease. Tumor cells were ER/PR positive. Following surgery, she received six months of chemotherapy with cyclophosphamide, methotrexate and 5-fluorouracil (CMF). A subsequent prophylactic left simple mastectomy with bilateral breast reconstruction was performed 4 months following completion of chemotherapy. Approximately 4 months after surgery, tamoxifen therapy was started and administered for 5 years. Of note, this patient underwent a total abdominal hysterectomy and bilateral salpingo-oophorectomy a year after breast reconstructive surgery.
+The patient had regular follow up without evidence of disease recurrence. Approximately 12 years after her breast reconstructive surgery, she developed a deflated right breast implant. She was scheduled for bilateral implant exchange surgery. During preoperative evaluation, she was found to have evidence of mitral valve regurgitation due to a flail mitral valve posterior leaflet, and subsequently underwent mitral valve repair. The cardiothoracic surgeon informed the patient that her sternum was found to be “somewhat mushy” during her sternotomy.
+About 5 months after open heart surgery, the patient had developed a neck lump and back pain. Imaging studies with CT revealed postoperative mastectomies with implants. However, the right breast implant was ruptured with extensive soft tissue mass and nodularity involving the anterior chest wall, predominantly anterior to both sides of the sternum but slightly more marked on the right with subcutaneous nodularity throughout the right mastectomy site . This was noted to be inseparable from the adjacent pectoralis muscles along with right subpectoral adenopathy and right neck base adenopathy consistent with tumor recurrence. The anterior chest wall mass extended posteriorly through the chest wall into the hemithorax and was also associated with internal mammary adenopathy. Partial lytic lesions were seen in the mid sternum. In addition, there was bulky anterior mediastinal adenopathy and tumor extending inferiorly along the anterior pericardium and anterior to the right atrium and right ventricle as well as to the root of the aorta . Nodularity was noted in the right upper lung pleura and left lung base pleura. There were bulky soft tissue masses in both costophrenic angles. Tumor nodularity was noted anterior to the liver representing peritoneal implants. Skin thickening was noted over both anterior chest walls but greater on the right. Bony metastases were noted in the T5 and L1 vertebral bodies, the right temporal bone of the skull, and the right anterior iliac bone.
+The patient underwent a T10 vertebroplasty and then subsequent palliative radiotherapy to T8 through L1 vertebral bodies. During palliative radiotherapy, she developed right hip pain and was found to have a destructive metastasis in the right femoral head and neck requiring surgery with a right hip replacement followed by palliative radiotherapy to bilateral hips and the right femur. She went on to receive palliative chemotherapy but ultimately expired from disease progression approximately 11 months following diagnosis of metastatic disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2964_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2964_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2469d21623f014f42175c15d405acba51d821b49
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2964_en.txt
@@ -0,0 +1,5 @@
+In January 2004 previously healthy 38-year-old man was admitted to hospital with fever (40°C) and arthralgia of upper and lower extremities. He was not addicted to drugs or alcohol. He smoked about 20 cigarettes per day. Physical examination revealed mild tachycardia with normal cardiac sounds and normal blood pressure. Oral cavity examination showed poor dentition. He presented generalized arthralgia and edema and redness of involved joints. Also there was a 3 day history of papulomacular haemorrhagic rash on his lower extremities. The patient had no symptoms of respiratory tract infection and X-ray examination showed no evidence of pneumonia. Laboratory evaluation revealed elevated white blood cell count (17,8 × 103/μl) with 34% of band neutrophils and 51% of granulocytes, decreased platelet count (29 × 103/μl), slightly elevated liver enzymes (AST 52 U/L, ALT 41 U/L, LDH 589 U/L, alkaline phosphate 150 U/L), hyperbilirubinemia (2,69 mg%), elevetad creatinine concentration (1,51 mg%), mild proteinuria, leucocyturia and erythrocyturia. The initial diagnosis was septicemia. Three blood samples were drawn during two first days of hospitalization for microbiological evaluation and empirical therapy with ceftazidime and teicoplanin was started.
+Nontoxigenic C. diphtheriae biotype gravis was isolated from all blood cultures. On the third day of treatment the antibiotics were changed to amikacin and ciprofloxacin according to antibiogram. Despite resolution of most symptoms and negative blood and throat swab cultures after eight days of treatment the patient was still febrile. For that reason ciprofloxacin was changed to clindamycin.
+Transthoracic and transoesopharyngeal echocardiography performed on the 13th day of treatment showed two vegetations attached to the mitral and aortal valves. The patient underwent surgery for replacement of both valves. The cultures from vegetations were negative. After the operation the patient recovered. Although the cultures were negative we have supposed that the vegetations were caused by C. diphtheriae because the patient had no cardiac troubles before bacteremia.
+Nontoxigenic C. diphtheriae biotype gravis isolated from blood cultures was identified and biotyped with use of morphological and biochemical methods as described elsewhere. Toxin production was examined in vitro by the conventional and modified Elek test . Polymerase chain reaction (PCR) was used for the detection of diphtheria toxin gene [,] and the PCR result was negative.
+The susceptibility of isolates to 13 antibiotics was determined by the disk diffusion method accordingly to the National Committee for Clinical Laboratory Standards guidelines on Mueller-Hinton II blood agar (supplemented with 5% sheep blood). However NCCLS does not define breakpoints for Corynebacterium sp. For that reason interpretation was done comparatively as for Streptococcus spp. and Staphylococcus spp., because some breakpoints are different for that genera. The antimicrobial disks contained penicillin, cefaclor, cefuroxime axetil, cefazolin, ceftazidime, ceftriaxone, cefepime, amikacin, meropenem, azithromycin, trimethoprim-sulfamethoxazole, vancomycin and teicoplanin. Determination of MIC (results are shown in brackets) for ampicillin (0.5 mg/L), gentamicin (0.38 mg/L), ciprofloxacin (0.125 mg/L), clindamycin (0.25 mg/L), erythromycin (0.016 mg/L), chloramphenicol (2 mg/L) and tetracycline (0.5 mg/L) was done using E-test strips. Clindamycin and erythromycin MIC breakpoints for Streptococcus spp. are lower than for Staphylococcus spp. but both interpretations showed susceptibility of examined C. diphtheriae strain. Ampicillin MIC breakpoints pointed to investigated strain as ampicillin resistant. The strain was also resistant to penicillin and ceftazidime and intermediate to cefuroxime axetil and ceftriaxone.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2991_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2991_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f7ab04bd2fd9c485eb51badd878aa61b469e2486
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2991_en.txt
@@ -0,0 +1,15 @@
+A previously healthy 43-year-old woman complained of progressive visual field restriction, with a bitemporal hemianopsia and headache.
+On admittance, the patient presented also extraocular movements within normal limits and double vision in the right gaze. The bitemporal hemianopsia was confirmed by visual field analysis.
+Magnetic resonance imaging and magnetic resonance angiography revealed two spherical formations in the right and left carotid siphon.
+The patient underwent to a cerebral angiography [Figures and ]. There were two aneurysms. A right supraclinoid one measuring 3 cm in maximum diameter and a left one, also supraclinoid and measuring a maximum diameter of 10 mm.
+We decided to clip the right carotid aneurysm microsurgically. A right pterional route was performed and the right carotid aneurysm was approached during temporary endovascular occlusion of the right internal carotid artery (ICA). This allowed careful dissection of the aneurysm sac from the surrounding structures.
+Preoperatively, a balloon occlusion test of right ICA was performed for 20 minutes; the test confirmed the counter lateral compensate by the anterior communicating artery.
+During the procedure, however, the aneurysm ruptured at the neck and, as surgical clipping could not be achieved, the neck of the aneurysm was sutured and then reinforced with a Yasargil clip. The patient was then transferred to the Intensive Care Unit for postoperative monitoring.
+Angiographic control demonstrated the complete exclusion of the right ICA giant aneurysm, but a right ICA occlusion was discovered . Right intracerebral vascularization was compensated by the left circulation. The left carotid aneurysm remained unchanged . At discharge, the patient presented a right third cranial nerve palsy and hypoesthesia in the right V1and V2nervous branches that recovered within 1 month. After 3 months, the patient returned to our institution to undergo treatment for the left ICA aneurysm for which an endovascular approach was selected.
+The wide neck of the left ICA aneurysm suggested the possibility of a stent-assisted coiling, instead of a simple coiling. A right EC-IC bypass was proposed mainly due to the possible risk of a left ICA occlusion during the endovascular procedure. EC-IC bypass has been proposed by Donaghy and Yasargil to bypass an occlusive process in the arteries supplying the brain that is not accessible surgically in another way.
+It was our opinion that a stent-assisted coiling procedure of the left ICA aneurysm could increase the risk of thrombotic complications. Therefore, a right ICA-MCA bypass was planned and a saphenous vein graft was chosen because radial artery was not available as a suitable vessel (Allen test negative).The bypass was performed under electroencephalographic confirmed burst suppression. A frontal branch of the MCA-M2 was chosen as a recipient vessel without perforators. The right ICA was isolated and sectioned 1 cm above the common carotid artery bifurcation and, after removal of the thrombus, a proximal end-to-end anastomosis of the saphenous vein graft to the right ICA and a distal end-to-side anastomosis of distal end of the graft to the MCA-M2 branch was performed. An interrupted 8-0 Prolene suture was utilized both at the proximal and distal end of the graft. The patency of the bypass was assessed intraoperatively by an intraoperative indocyanine green angiography and Doppler ultrasound.
+The patient did well postoperatively and magnetic resonance angiography demonstrated the patency of the bypass despite a kinking at the level of the proximal anastomosis .
+Two months later, following an intracranial angiography, endovascular treatment for exclusion of the left carotid aneurysm was performed. Before undergoing the procedure, the patient was pharmacologically treated for 7 days with antiplatelet drugs (ASA 300 mg + ticlopidine 300 mg per QD). During the procedure, an intracranial carotid stent was placed to cover the aneurysm neck (Neuroform, Boston Scientific). A microcatheter was then passed through the stent and GDCs (Guglielmi Detachable Coils) were used to fill the aneurysm sac. The procedure was well-tolerated with no further neurological deficits or complications .
+Three months later, the patient underwent an angiographic study confirming a complete aneurysm occlusion, and demonstrating an area of segmental narrowing at the level of the previously revealed kinking of the proximal portion of the graft.The narrowing was graded 75% (NASCET method) . The endovascular team then proceeded with an angioplasty and stenting of the graft . The procedure was well-tolerated and followed by a regular clinical course and immediate mobilization.
+Antiplatelet agents (ASA 300 mg + ticlopidine 300 mg per QD) were continued after the procedure.
+One year after the first surgical procedure, the patient presented visual field loss improvement and no other neurological deficits. A follow-up angiogram performed 36 months later showed a widely patent graft and robust flow to the MCA territory . The patient remained asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3054_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3054_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bf636d4752094517e0c91bc0abcaea8c285247e2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3054_en.txt
@@ -0,0 +1,5 @@
+A 60-year-old white female was referred to the nephrology clinic for further evaluation for unexplained rise in the creatinine (Cr) level to 1.4 mg/dL during her routine hematology visit from the baseline of 0.9 mg/dL. She was diagnosed with Polyneuropathy, Organomegaly, Endocrinopathy, Monoclonal plasma cell disorder, Skin changes (POEMS) syndrome approximately 1 year prior due to the presence of sciatica, hypothyroidism, monoclonal gammopathy of undetermined significance (MGUS), and onychomycosis, with regular hematology visits afterwards. Her serum protein electrophoresis around 2 years prior showed m-spike of 1.0 g/dL with immunofixation electrophoresis demonstrated the presence of monoclonal IgG having kappa light chain restriction (kappa free light chain: 2.12 mg/dL, lambda free light chain: 2.01 mg/dL, kappa/lambda free light chain ratio: 1.05). Complementary bone marrow biopsy indicated mildly increased plasma cell (5%-7%) with kappa light chain predominance, in favor of MGUS.
+
+She was diagnosed with HTN approximately 3 years before her referral. Despite having few episodes of high blood pressure, her HTN status was well controlled. Patient has been receiving allopurinol, aspirin, losartan, hydrochlorothiazide, levothyroxine, metoprolol, and prednisone (20 mg daily). The latter was prescribed by the patient’s hematologist due to suspected vasculitis approximately 1 year after the nephrology visit, and the patient continues to take it. She did not report long-standing use of nonsteroidal anti-inflammatory drugs; however, she mentioned intermittent consumption (approximately 500 mg weekly) over the past couple of years, with normal Cr levels. She had no family or personal history of kidney diseases. The patient denied any active smoking. However, she reported long-standing exposure to passive cigarette smoking because of living with a heavy smoking family member and working as a bartender for more than 30 years. At her first nephrology visit, her blood pressure, pulse rate, and body mass index were 97/64 mm Hg, 59 beats/minute, and 19.32 kg/m2, respectively, and there was no rash on physical examination. She was not diabetic (hemoglobin A1c [HbA1c]: 5.4%). At the time of the nephrology consultation request, her Cr level was 1.4 mg/dL (blood pressure: 101/65 mm Hg), a value that had also been observed 2 months earlier. Therefore, the patient was diagnosed with chronic kidney disease stage 3B at the nephrology visit (estimated glomerular filtration rate [eGFR]: 43 mL/min/1.73 m2), with the increase in serum Cr to 1.8 mg/dL 1 week after her first nephrology visit. One month later, complementary tests showed a similar Cr value (1.8 mg/dL), and urinalysis results were in favor of nephritic range proteinuria, hematuria, and pyuria with moderate bacteriuria and negative nitrite without any urinary symptoms. Autoimmune and infectious markers (antinuclear Ab, anti-ds DNA Ab, anti-smith Ab, anti-SSA and SSB Abs, anti-SCL70 Ab, anti-Jo1 Ab, anti-centromere Ab, cytoplasmic antineutrophil cytoplasmic Ab [C-ANCA], perinuclear ANCA [P-ANCA], hepatitis B virus [HBV]) were negative. Kidney ultrasound was unremarkable.
+
+The patient underwent kidney biopsy, and the results of hematoxylin and eosin, periodic acid-Schiff, Jones silver, and Masson trichrome staining revealed diffuse and focal nodular mesangial expansion without hypercellularity and moderate arteriosclerosis. Out of 49 glomeruli, 18 (37%) showed signs of diffuse glomerulosclerosis and 3 (10%) showed segmental sclerosis. DNAJB9 immunohistochemical staining and immunofluorescent studies (IgA, IgG, IgM, C1q, kappa, and lambda light chains) as well as Congo red staining were negative. On electron microscopy, mesangial matrix expansion was confirmed with the additional finding of scattered embedded distinct curved fibrils ranging from 7 to 12 nm in diameter. The patient was finally diagnosed with ING in the context of HTN and passive smoking. During follow-up and after kidney biopsy, the patient’s blood pressure became uncontrolled, reaching a peak of 183/93 mm Hg. Several first-line antihypertensive regimens failed to control her blood pressure, and she was subsequently prescribed carvedilol, clonidine, and hydralazine. A duplex kidney ultrasound revealed left renal artery stenosis, and she was referred for appropriate management. Regarding her hematological condition, her most recent serum protein electrophoresis showed an M-spike of 0.8 g/dL, with immunofixation electrophoresis confirming the presence of monoclonal IgG with kappa light chain restriction (kappa free light chain: 4.51 mg/dL, lambda free light chain: 2.86 mg/dL, kappa/lambda free light chain ratio: 1.58). The patient remains under regular follow-up with a stable condition. At her most recent nephrology visit, 12 months later, the patient reported no symptoms, and her blood pressure reduced to 144/78 mm Hg. Table 1 shows the most recent patient’s laboratory data approximately 12 months after her first nephrology visit.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3065_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3065_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5cc5d57590221e2b4ed64b6d4f3e6b8510fa21e6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3065_en.txt
@@ -0,0 +1,18 @@
+A 92-year-old female was referred to the Department of Urology, Kanazawa Medical University Hospital due to left lumber back pain. She had a history of asthma and chronic heart failure. She had no fever on arrival at the hospital. Physical examination revealed left costal-vertebral angle (CVA) knocking pain.
+
+
+Investigations
+
+Abdominal CT showed a left hydroureteronephrosis and obstruction of the left distal ureter with herniation into the sciatic foramen.
+
+She underwent retrograde ureterography (RP), which showed definite tortuosity of the left ureter in the sciatic foramen.
+
+
+Treatment
+
+A guidewire was inserted into the left ureter and was linearized. A retro-grade placement of the 6Fr ureteral stent.
+
+
+Outcome and follow-up
+
+No recurrence of the ureterosciatic hernia was observed after the ureteral stent was removed at 12 month follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3073_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3073_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9ea8b64d48b68a7ce6613ce568761935c2ad6cca
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3073_en.txt
@@ -0,0 +1,13 @@
+7-month-old male infant admitted to a tertiary hospital for treatment and evaluation of a severe case of persistent vomiting, refusal of food and neurological findings including axial hypotonia with poor head support, poor suck-swallow coordination, lack of social smile and contact, and abnormal oral-motor movements. The osteotendinous reflexes are normal. There is no perinatal, personal or family history of interest. They report normal neurological development to date and deny known consanguinity.
+
+A battery of complementary tests (blood analysis, metabolic and autoimmune study, imaging tests, electroencephalogram, auditory evoked potentials of the brain stem, fundus of the eye...) was performed during admission with anodyne results, among which only the isolation of respiratory syncytial virus in a nasopharyngeal aspirate and the findings of the brain magnetic resonance, in which a bilateral and symmetric diffusion restriction in the anterior aspect of the bulbo-protuberant union compatible with the diagnostic suspicion of a subacute rhombencephalitis is described, are highlighted. Therefore, treatment with two doses of intravenous immunoglobulins (2 g/kg in total) was initiated, and the patient was discharged after 10 days of admission as a result of a progressive improvement in the neurological clinical and a recovery of tolerance by oral route.
+
+He is subsequently monitored in outpatient neuropediatric consultations. The parents report clinical normality and a slight improvement in the examination is evident: he has better contact and visual tracking, achieves stable sitting for a few seconds without support and the masticatory movements appear only occasionally and in the supine position. The osteotendinous reflexes are still present.
+
+However, at 10 months of age, he was readmitted to the hospital for a case of food rejection after the administration of a vaccine. A case of neurological regression, consisting of irritability, inexpressive face and absence of social smile, progressive evident axial hypotonia, proximal weakness and osteotendinous reflexes, which become lively and with equine feet, is very striking in the exploration. It is decided, therefore, to extend the metabolic studies and request new neuroimaging.
+
+On this occasion, the brain resonance shows more conclusive findings: a generalized bilateral and symmetrical affectation of the signal intensity of the deep and subcortical white matter with affectation of the U-fibers and of the globus pallidus, which corresponds to a neurometabolic picture compatible with leukodystrophy. It also presents an altered spectroscopic study, with a slight increase in choline, and the N-acetyl aspartate is normal. With this result, the genetic study is expanded with a clinical exome directed to leukodystrophies of early onset, in which a pathogenic mutation in homozygosity is identified that affects the EIF2B5 gene and that is associated with the diagnosis of leukoencephalopathy with evanescent white matter, of autosomal recessive inheritance.
+
+In addition, a family genetic study is requested, and both parents and his two brothers are healthy heterozygous carriers.
+
+He required a new admission at 15 months of age due to a first convulsive episode, and treatment with levetiracetam was initiated. During his stay, neurological regression persisted and he showed a poor response to stimuli, as well as the impossibility of feeding orally, which led to the placement of a nasogastric tube. He could be discharged to his home thanks to the follow-up by the paediatric home hospitalisation unit, which established palliative care due to the advanced stage of the disease. The patient died at 15 months of age as a result of the evolution of his disease. He died at home, asleep, calm and surrounded by his family.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3074_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3074_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..82d071d019b176af20f1a73d7df70f6cfae188e5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3074_en.txt
@@ -0,0 +1,5 @@
+The patient is a 58-year-old man with a history of well-managed glaucoma and psoriasis. The patient was notified of the writing of this deidentified case report and provided written consent. Institutional approval was not required to publish case details. His glaucoma was maintained with a single topical agent taken twice daily. The patient initially presented for examination with mild pain and conjunctival hyperemia, without visual changes. He also denied photophobia.
+
+On exam, the patient’s visual acuity was 20/40 OD and 20/25 OS. In the left eye, the patient had a salmon-colored lesion on the superior conjunctiva. The cornea below the lesion had an area of thinning consistent with peripheral ulcerative keratitis. The epithelium measured 40 microns superiorly. On fluorescein staining, there was a partial defect in the central part of the circumferential ulcer. There was mild conjunctival hyperemia without episcleritis, corneal infiltrate, scleritis, or anterior chamber inflammation. There were no ocular surface changes such as tear film abnormalities, blepharitis, or dry eye. Fundus examnation revealed superior arcade cream colored faint lesions. The rest of the physical exam including tonometry was within normal limits.
+
+The patient underwent excisional biopsy of the left conjunctival lesion with placement of an amniotic membrane graft and was prescribed tobramycin–dexamethasone QID for a week after surgery. Flow cytometry demonstrated an aberrant population of CD5 negative, CD10 negative small B lymphocytes compatible with a B-cell non-Hodgkin’s lymphoma. The pathologic surgical specimen confirmed the diagnosis of extranodal marginal zone lymphoma (EMZL). The patient was referred to oncology and underwent a systemic workup including PET/MRI imaging to search for orbital involvement and underlying primary disease elsewhere. All tests were negative for tumor elsewhere. The patient had undergone screening colonoscopy 1-month prior to presentation, which was normal. No other local therapies were administered for the PUK. The patient is following up closely with oncology and is being treated with local radiation therapy of the conjunctiva. He is receiving radiation of the conjunctival sac and lacrimal gland. On follow-up, 3 months after the initial work-up, excision of lesion, and radiation treatment, the area of superior thinning has improved. His visual acuity OS was 20/30, and he refracted to −5.00, −1.50 with an axis of 090, and is doing very well.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3079_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3079_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d38fcfad0fa401012d2b1cb622f4d697133cd500
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3079_en.txt
@@ -0,0 +1,9 @@
+We report the case of a 67-year-old man who presented to the services of Manatí Medical Center with a chief complaint of fatigue upon exertion, dyspnea, and lower-extremity edema that had been progressively worsening for 2 weeks. His medical history was significant for a 30-year history of hidradenitis suppurativa (HS) Hurley stage III, hypertension, major depressive disorder, and a positive Mantoux test, treated with isoniazid 12 years ago. On physical exam, he was hypotensive, tachycardic, and tachypneic. On auscultation, a mild holosystolic murmur with S3 gallop was heard at the apex. Crackles and rales were appreciated in all lung fields, as well as bilateral lower-extremity edema. Additionally, there was mild ascites without abdominal tenderness or guarding. The patient was not confused at any point during history taking or physical exam.
+
+Troponin levels remained constant at less than 0.015 ng/mL, CK-MB less than 1.00 mg/mL, and total creatinine kinase at 15 IU/L, all within normal limits. However, Pro-B natriuretic peptide was elevated at 77 660 pg/mL (normal levels are 5–125 pg/mL). The electrocardiogram showed sinus rhythm with no indication of acute ischemic changes or arrythmia. A chest X-ray showed marked Kerley B lines, enlarged cardiac silhouette, and bilateral pleural effusion, suggesting exacerbated congestive heart failure. He was admitted to the hospital the same day for clinical stabilization and further treatment.
+
+During the hospital stay, various studies were performed to find the etiology of his CHF. The patient’s echocardiogram showed an ejection fraction (EF) of 20–25%, significantly different from a previous study done 2 months ago, which reported an EF of 50%, which also mentioned findings of global hypokinesis of the left ventricle with enlarged atria, left worse than right, and present mitral regurgitation. There were no changes indicating possible myocarditis or pericarditis. Findings of this study suggested new-onset decompensated congestive heart failure (CHF). Other diagnostic tools looking for ischemic and infectious etiology yielded negative results.
+
+A chest CT scan without contrast showed bilateral pleural effusions with bibasilar compressive atelectasis and no evidence of pulmonary or infectious processes. There was also no evidence of an intra-abdominal emergent process on abdominal imaging. The patient did not have significant leukocytosis, with negative blood cultures and pleural fluid culture, suggesting there was no systemic infection or sepsis that may have caused the heart failure. The patient had no coronary disease or cardiovascular risk factors that could explain his symptoms’ severity and rapid progression. However, his clinical history revealed that he was re-initiated on adalimumab 2 months before this presentation. Therefore, adalimumab was discontinued as a precaution of potential cause, with an adverse drug reaction probability of 5.
+
+Further investigation with his dermatologist revealed he first started adalimumab treatment 3 years ago with the standard HS regimen, beginning with subcutaneous 160 mg on the first day, and 80 mg on day 15. On day 29 and weekly thereafter, the dose was maintained at 40 mg. After 2 years of utilizing the medication with no complications, it was discontinued due to his lesions’ progression. However, even with alternate standard treatments and procedures, his condition had not stabilized. After various hospital admissions, adalimumab was re-initiated with the standard-dose regimen, as previously described. Once adalimumab was discontinued during this hospital stay, his health continued to decline, with worsening of symptoms. Unfortunately, the patient’s condition continued to worsen, increasing his hospital visits for symptom management. On the 8th day of hospitalization, he died due to de-compensated heart failure and septicemia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3088_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3088_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8e1015077b548674edeb64bf01a02c51baa37769
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3088_en.txt
@@ -0,0 +1,5 @@
+A 38-year-old female patient with a 12-year history of Relapsing-Remitting Multiple Sclerosis (RRMS) was evaluated. There was no personal or familial history of other autoimmune disorders. MS was diagnosed in March 2011 based on the interpretation of brain and spinal cord MRI results. The patient originally rejected pharmacological treatment. However, after a disease flare-up in May 2014, she got intravenous corticosteroid treatment. Subsequently, treatment with interferon beta-1a was initiated. Due to ongoing disease activity and progression, interferon therapy was escalated to Fingolimod after two years. Fingolimod therapy was initiated in 2016 and was well-tolerated. The patient has remained relapse-free and clinically stable with an Expanded Disability Status Scale (EDSS) score of 2. In 2019 NTZ was introduced in anticipation of a planned pregnancy, which, however, did not occur. She remained on treatment until February 2023, when she discontinued medication in terms of the emergence of painful cutaneous lesions. Over a 3-year period, the patient received injections at a frequency of every 55 days. No adverse reactions were reported during or following infusions. The patient denied using any new medications or herbal agents. Throughout this period, the patient remained clinically and radiologically stable with no evidence of disease exacerbation.
+
+The initial presentation occurred in November 2022 with the development of erythematous plaques on both upper extremities. This onset occurred subsequent to the administration of the 15th dose of Natalizumab. The excruciating lesions that are accompanied by myalgia, fever, and periodic exacerbation. Insect injuries and pathergy were excluded due to the patient’s history, the characteristics of the lesions, and their duration. The patient’s condition showed a gradual deterioration. Laboratory evaluation revealed elevated levels of Erythrocyte Sedimentation Rate (ESR) and C-reactive protein (CRP), indicative of an inflammatory process. A diagnosis of cellulitis was established at an external medical center, and the patient received intravenous antibiotic therapy without achieving clinical improvement.
+
+The patient presented to our clinic only after painful skin lesions had progressed to necrotic ulcers. As an initial step in the evaluation, brain and cervical spine MRI examinations were performed to exclude a new disease relapse. She referred to a dermatologist for consultation and further investigation. Additional test for anti-nuclear antibody (ANA), anti-phospholipid antibody, cytoplasmic ant neutrophil antibodies (c-ANCA), perinuclear autoantibodies(p-ANCA), Anti-cardiolipin antibodies(ACA), lupus anticoagulant antibody, C3, C4 and CH50 were within normal limit and viral hepatitis serology was negative. Skin biopsies were obtained. Negative results were obtained when microorganisms, such as bacteria, fungi, and acid-fast bacilli, were stained. A diagnosis of PG was made on the basis of the clinical presentation and histopathological findings. Topical Pipecuroniums and Mupirocin were also prescribed, in addition to oral Prednisolone 50 mg daily with a subsequent three-month cessation. Although oral prednisolone therapy resulted in a significant diminution of pain, complete ulcer healing was not achieved. Consequently, the dermatologist recommended intra lesion corticosteroid injections to optimize treatment outcomes.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3090_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3090_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9609f309623c65bf4270eed57650dadb45e28abd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3090_en.txt
@@ -0,0 +1 @@
+A 53-year-old man, who had been receiving pembrolizumab at a dosage of 2 mg/kg every 3 weeks for invasive bladder cancer, developed itchy, erythematous papules on his legs, without a febrile condition, following his 11th infusion. Histological examination of the bladder cancer revealed urothelial carcinoma with a G3 malignancy grade and detected a Kirsten rat sarcoma viral oncogene homolog (KRAS) mutation. The skin lesions progressively spread to his entire trunk and extremities. Some of these lesions evolved into purpuric papules and, within a month of their onset, were accompanied by pustules and crusted ulcers. A 4-mm trepan punch biopsy taken from an erythematous papule on his leg revealed acanthosis, parakeratosis, several apoptosis keratinocytes, and spongiosis. Additionally, perivascular and band-like lymphocytic infiltration, predominantly with vacuolar alteration of the basal layer, was evident. Immunohistochemistry showed infiltration of both CD4+ and CD8+ T cells in the epidermis and papillary dermis, with a predominance of CD8+ cells. Granzyme B-positive inflammatory cells were also slightly present. A blood test indicated an elevated C-reactive protein level at 2.54 mg/dL. Based on the clinical and histopathological findings, particularly the characteristic necrosis, he was diagnosed with PLEVA. Despite the discontinuation of pembrolizumab and the initiation of topical corticosteroids, the purpuric papules increased. Approximately 2 weeks after starting oral prednisolone (10 mg/day), the skin rash and itching gradually improved. Due to concerns about a repause of cutaneous manifestations, pembrolizumab treatment was discontinued.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3093_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3093_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..83f9b4541b8de5ae653ea80ccc8a6fa1da699860
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3093_en.txt
@@ -0,0 +1,11 @@
+A 35-year-old male patient was brought to the emergency department after sustaining a high velocity motor vehicle accident. He was the driver of the car and was not wearing a seat belt. He presented with polytraumatism, severe head injury, right upper limb and left lower limb trauma. His Glasgow Coma Scale (GCS) score was 11/15 and he was agitated and uncooperative. He was intubated and sedated and transferred to the intensive care unit. His vital signs were stable and his laboratory tests were normal. His initial clinical examination revealed a dislocated right wrist and an open dislocation of the metatarsophalangeal (MTP) joint of the left hallux. There was no neurovascular compromise of the right upper limb or the left lower limb. The rest of the physical examination was unremarkable.
+
+The initial radiological examination showed a pure medial and volar radiocarpal dislocation of the right wrist, with no associated fractures of the distal radius, ulna, or carpal bones (Moneim type II and Dumontier Type I). The radiological findings also showed a short ulnar head with radial-sided deformity, radioulnar convergence, erosive scalloping of distal radius, subchondral sclerosis of ulnar head, medial rotation of the scaphoid with the scaphoid tubercle located medially, extensively arched carpus, scapholunate diastasis, DRUJ diastasis, an increased scapholunate and scaphocapitate angles, a dorsal intercalated segment instability (DISI), and a trapezoid that articulated medially with the left aspect of scaphoid tubercle rather than its distal aspect. The elbow and forearm radiographs were normal. The contralateral wrist radiographs were normal.
+
+The initial management consisted of closed reduction and radio-metacarpal external fixation of the right wrist. The reduction was achieved by applying traction and pressure on the carpus in a dorsal and lateral direction, while maintaining the wrist in flexion and ulnar deviation. The stability of the reduction was assessed by passive and active movements of the wrist and the fingers. The external fixator was locked in a neutral position of the wrist. The reduction and fixation were confirmed by postoperative radiographs. The patient was also treated for the left hallux open dislocation, which required surgical exploration, debridement, and serum rinsing, followed by reduction. The patient received prophylactic antibiotics and tetanus immunization.
+
+The patient was kept under medically induced general anesthesia in the intensive care unit for 10 days, due to his severe head injury. He underwent a computed tomography (CT) scan of the brain, which revealed a non-operative extra dural hematoma and meningeal hemorrhage. He was gradually weaned off sedation and extubated, and his neurological status improved. He was then transferred to the orthopedic ward, where he received physiotherapy and occupational therapy. After the patient's awakening, he reported no previous injury or trauma of the right wrist, and no previous episodes of wrist instability or dislocation. He also reported suffering from mild mechanical wrist pain after major efforts, with a slight limitation of the supination movement. He denied any history of congenital anomalies, rheumatoid arthritis, or gout. He had no family history of wrist disorders.
+
+The follow-up radiological examination showed a satisfactory reduction and alignment of the radiocarpal joint, but a persistent ulnar impingement syndrome, an extensively arched carpus and a medially rotated scaphoid. The patient was informed about the nature and the severity of his injury and the possible treatment options. He consented to undergo a subsequent surgery to address the ulnar impingement syndrome, the arched carpus and the scaphoid rotation. The patient was scheduled for a definitive surgical treatment of his right wrist, which was performed 4 weeks after the initial injury. The surgery consisted of three steps: Sauvé-Kapandgi procedure, ulnolunate and ulnotriquetral ligamentoplasty using palmaris longus tendon, and scapholunate fusion. The surgery was performed under general anesthesia and tourniquet control, using a dorsal approach. The external fixator was removed, and the radiocarpal joint was exposed. The joint was found to be unstable and incongruent. The scapholunate ligament was found to be elongated but not ruptured with no macroscopic evidence of injury. The Sauvé-Kapandgi procedure was performed by resecting the distal 1 cm of the ulna, creating a pseudarthrosis between the ulnar stump and the ulnar head, and stabilizing the DRUJ with two 2.4 mm cortical screws. The ulnolunate and ulnotriquetral ligamentoplasty was performed by harvesting the palmaris longus tendon, passing it through drill holes in the ulnar stump, the lunate, and the triquetrum, and suturing it in a tensioned fashion using two suture anchors. The scapholunate fusion was performed by debriding the scapholunate joint, inserting a cancellous bone graft harvested from the distal radius, and fixing the scaphoid and the lunate with two headless compression screws. The wound was closed in layers and a long arm splint was applied. The surgery was uneventful and the intraoperative radiographs confirmed the adequacy of the procedures.
+
+The patient was followed up regularly in the outpatient clinic. The long arm splint was replaced by a short arm splint after 8 weeks, The patient was allowed to start active and passive range of motion exercises of the wrist and the forearm and the patient was encouraged to resume his daily activities. The radiographs showed proper bone healing and no signs of infection, nonunion, or hardware failure. The patient reported significant improvement in his pain and function of the right wrist. He was able to perform most of his personal and professional tasks without difficulty. He was satisfied with the cosmetic appearance of his wrist and had no complaints of ulnar impingement or instability. The patient was evaluated at 6 months and 12 months after the surgery, with a Patient-Rated Wrist Evaluation (PRWE) score of 15, a Disabilities of the Arm, Shoulder and Hand (DASH) score of 18, and a Visual Analog Scale (VAS) of 2 for pain. The radiographs showed no changes in the bone alignment or the hardware position.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3104_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3104_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2a5a3a7b155176fd5f8f5f2f1412af5a8c24a4c7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3104_en.txt
@@ -0,0 +1,5 @@
+The patient is a 24-year-old male with no relevant history, except for an appendectomy performed 12 days prior to admission. The patient reported that he had a two-day course of evolution until surgical treatment. He had nausea, vomiting and intense pain in the right iliac fossa, without fever. The examinations of that occasion revealed a mild leukocytosis of 13,200 mm3 and platelets of 64,000 mm3 as the only alterations. An appendectomy was performed, finding gangrenous appendicitis, without intra-abdominal collections. After the surgery, good evolution was observed, so he was discharged on the second day of hospital stay, prescribing cefuroxima (1 g) from admission until five days after discharge.
+
+On his second admission, the patient presented with a fever of three previous days, not quantified, without predominance of time, self-limited. Subsequently, ictric skin and sclera dye was added, in addition to coluria. He did not manifest any pain, fever or others. In his initial laboratories, leukocytes of 8600/µl, platelets of 32,000/l, total bilirubin of 4.7 mg/dL, direct bilirubin of 3.9 mg/dL, TGP of 129 U/I, TGO of 63 U/I, alkaline phosphatase of 288 U/l and lipase of 744 U/l were observed.
+
+Empirical treatment was initiated with piperacillin/tazobactam and with noreprinephrine, due to low blood pressure. An ultrasound was performed, which showed a tubular portal vein of 10 mm in diameter, with hypoechoic content and flow present. A blood culture was performed, with no bacterial development. Subsequently, an intravenous contrast medium tomography was performed, which revealed the presence of a thrombus in the portal vein and splenomesaraic trunk. After six days of established management, leukocytes of 7500/µl, platelets of 128,000/l, total bilirubin of 1.0 mg/dL, direct bilirubin of 0.6 mg/dL, ALT of 34 U/I, AST of 37 U/I and alkaline phosphatase of 189 U/l were observed. During the hospital stay, clinical improvement was observed, with normal blood pressure after the cessation of norepinephrine. The antibiotic was maintained for a week and he was discharged with rivaroxabán, 20 mg daily for three months, on the recommendation of the haematology department. The three-month review did not show any clinical alteration, in addition to normal or negative immunological profile and determination of protein C, S and antithrombin III.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3136_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3136_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a38af1c48f7bd0018bf83906600637d09a82bf29
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3136_en.txt
@@ -0,0 +1,7 @@
+A 69-year-old male patient presented to our cardiology clinic complaining of intermittent shortness of breath upon moderate exertion in the absence of chest pain, paroxysmal nocturnal dyspnea, orthopnea, dizziness, palpitations, or lower limb edema for a couple of months. The patient’s past medical history was significant because of a history of pericarditis associated with pericardial effusion 6 years prior to his presentation at our clinic, which was resolved with appropriate pharmacological treatment consisting of NSAIDs and colchicine and of which he had not complained since. Also, he had an anterior wall myocardial infarction dating to several years ago, which required immediate intervention and stenting to his left anterior descending artery. Additionally, the patient is a heavy smoker and is diabetic, and hypertensive, both conditions are under pharmacological intervention and well-controlled.
+
+At first visit, the patient’s results were as follows: blood pressure 131/67 mmHg, heart rate 85 bpm, respiratory rate 18bpm, oxygen saturation rate 95%, and oral temperature 36.5 C. A cardiopulmonary examination showed normal S1 and S2 with no murmurs and clear lung fields to auscultation bilaterally. Laboratory tests included negative outcomes for tuberculosis, ANA, and rheumatoid factor double-stranded DNA thus making any rheumatological disease less likely. ECG showed a sinus rhythm with q waves in the anteroseptal leads. Subsequently a transthoracic echocardiogram (TTE) was performed and revealed an ejection fraction of 60%, no wall motion abnormality and mild left ventricular hypertrophy. Additional findings noted were grade 1 diastolic dysfunction, moderate aortic stenosis, mild aortic regurgitation and a moderate pericardial effusion moderately circumferential with an anterior pocket of 1 cm and a posterior pocket of 1.8–2.4 cm with no evidence of cardiac tamponade physiology. At that point, the patient was prescribed colchicine for 3 months and NSAIDS for 14 days with a follow-up visit. Then the patient improved, and his pericardial effusion improved.
+
+Three months following his initial presentation, the patient started complaining again of occasional symptoms of chest pain not related to physical activity or stress. However, the patient reported that his shortness of breath had diminished with time. Based on this clinical picture, the possibility of coronary artery syndrome was suspected and needed to be ruled out. The patient underwent a pharmacological myocardial perfusion stress and rest scan. The test showed no significant evidence of ischemia and a subtle decrease uptake in the distal anteroseptal wall, which represents apical thinning rather than a true perfusion defect. The ECG portion of the study was normal. The patient was treated with another course of colchicine and steroids.
+
+Six months later, the patient presented with a third relapse of shortness of breath. Upon inquiring further, the patient revealed that he had, unfortunately, discontinued the colchicine prior to completing the intended period of six months. TTE showed relapse of pericardial effusion and an echo-dense lesion in the pericardium of the anterior wall, which was more prominent than had been seen on the previous echo. This led to performing a CMR, which revealed an echo-dense lesion in the pericardium of the anterior wall between the right atrium and the right ventricle. It was accompanied by moderate pericardial effusion consisting of multiple layered fibrous bands that were more pronounced at the right ventricle, with a maximum thickness of 26mm and the appearances of fibrotic pericarditis (non-constrictive pericarditis) with delayed enhancement. Accordingly, the diagnosis of a fibrous pericardial mass was established. The patient was treated with a prolonged course of colchicine.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3138_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3138_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2deeefe7679b0890c834ae500146db1ec8e1f55b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3138_en.txt
@@ -0,0 +1 @@
+The proband was a 6-year-old Caucasian female referred to our center for neurodevelopmental disorder, history of hypotonia, and minor face anomalies. The family history was negative for intellectual disability or genetic conditions. She was born to non-consanguineous parents at 39 weeks of gestation after a normally conducted pregnancy until the seventh month when there was an onset preeclampsia, and a caesarian section was performed. She was deemed adequate for her gestational age: birth weight was 3460 g (75th percentile), length 50 cm (50–75th percentile) and head circumference 35 cm (75–90th percentile). The Apgar score at 1 and 5 min was 8/9. Clinical evaluation at 6 months revealed hypotonia and, successively, delay in the acquisition of the stages of psychomotor development. Auditory, visual, somatosensory, and motor evoked potentials were normal. A brain MRI, performed at 9 months, showed minimal gliotic changes in bilateral occipital periventricular white matter. Control MRI, performed a year later, showed improvement of the alteration of the posterior periventricular signal in relation to myelination phenomena, low-signal stria in the supratrigonal area from a likely vascular element, and modest ectasia of the regional perivascular spaces. The childhood neurological and neuropsychiatric visits ended with psychomotor delay and general developmental disorder characterized by the absence of language, a tendency to isolation, with little interest and inconsistent visual engagement. Autistic traits characterized by poor participation, repetitive behaviors, unusual interest in objects, symptoms that resemble attention deficit hyperactivity disorder and mild macrocrania, motor stereotypies, and broad-based walking were also found. Cardiac evaluation performed at 2 and 6 years revealed patent foramen ovale and abdominal ultrasound was normal. Neuropsychiatric control, performed at 5 years, established a definitive diagnosis of childhood autism and developmental delay. Peripheral blood karyotype analysis was 46, XX (female, normal). To exclude the presence of small cytogenetic anomaly, we performed high resolution array-CGH, which was revealed to be very small at 2p16.3 microdeletion (87 kb) with maternal transmission, involving part of the first intron, part of the second intron, and the second exon of the NRXN1 gene, without a clear pathogenetic role considering size, transmission with a large presence in other family healthy controls (mother, 2 of 3 brothers of the mother and 2 of 5 maternal cousins of proband), and incomplete penetrance of the NRXN1 deletion syndrome. No mutations were found sequencing the NRXN1 and ZEB2 genes. To rule out Angelman syndrome, methylation and MLPA tests of chromosome 15q11–13 were also performed and were normal. Whole exome sequencing of the patient and her parents was performed on genomic DNA obtained from peripheral blood leucocytes, identifying the de novo c.9244C > T; p.Pro3082Ser missense variant. According to the Combined Annotation Dependent Depletion score (CADD score 22) and according to the American College of Medical Genetics score (PS2, PM2, PP3) [5] this variant can be considered as likely pathogenic. CADD has become one of the most widely used tools to assess human genetic variation and values > 20 indicate that a variant is more likely to have deleterious effects. The final diagnosis for the patient was Kleefstra syndrome 2. The last examination at 6 years and 9 months still revealed the absence of both language and independent walking. Irritability, hyperactivity, self- and hetero-harm were observed. The child showed macrocephalic facies, broad and rounded forehead, hypertelorism, nose with a saddle bridge and bulbous tip, slight telelia, ligamentous hyperlaxity, and a café au lait spot on the left thigh,
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3144_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3144_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5a93e1465bb8c08210a93dcac7b33499608d6367
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3144_en.txt
@@ -0,0 +1,32 @@
+A 32-year-old Iranian female presented to Rajaei Hospital Cardiac Center in Tehran, Iran with a chief complaint of progressive shortness of breath (dyspnea), which persisted even at rest. The patient was referred for an outpatient hematology consultation to assess for inherited coagulopathies and to further evaluate the etiology of the thromboembolic events. Initial clinical and paraclinical evaluations, including echocardiography and computed tomography (CT) angiography, were performed owing to the high clinical suspicion of pulmonary embolism; the diagnosis of pulmonary thromboembolism (PTE) was confirmed. Anticoagulation therapy with heparin was promptly initiated, and the patient was transitioned to oral rivaroxaban after stabilization. She was discharged in stable condition, with close follow-up recommendations.
+
+Subsequently, 2 weeks later, the patient returned with worsening dyspnea accompanied by systemic symptoms, including fever, chills, night sweats, and anorexia. Abdominal ultrasonography and contrast-enhanced abdominopelvic CT scan revealed a renal mass involving the inferior vena cava (IVC) with a tumor thrombus extending into the right atrium. Given these findings, the patient was referred to the emergency general surgery department at our referral hospital for further management and surgical evaluation.
+
+The patient had no significant past medical or family history and denied smoking, alcohol use, or illicit drug use. On presentation, her vital signs included a body temperature of 37 °C, blood pressure of 100/60 mmHg, respiratory rate of 20 breaths per minute, and a pulse rate of 110 beats per minute. Physical examination revealed a painless, palpable abdominal mass located in the right flank region without tenderness, guarding, or percussion abnormalities. No signs of hepatosplenomegaly or lymphadenopathy were detected, and other systemic examinations were unremarkable.
+
+Diagnostic assessment and therapeutic interventions
+Laboratory assessments, including complete blood count (CBC), blood biochemistry, urinalysis (UA), and arterial blood gas (ABG) analysis, yielded normal results.
+
+The initial spiral CT scan of the lungs, mediastinum, abdomen, and pelvis with and without contrast revealed an enlarged heterogeneously enhancing solid mass located at the mid to lower pole of the left kidney, measuring 70 mm × 75 mm × 105 mm with tumor thrombosis extending into the left renal vein and IVC superiorly over a craniocaudal length of ~23 cm, terminating below the right atrium. In addition, mild hypodense fluid was noted in the pelvic cavity. Pulmonary findings revealed filling defects in the right main pulmonary artery and its segmental branches, consistent with pulmonary thromboembolism and a 7 mm ground-glass nodule detected in the left lower lobe (LLL) superior segment. No signs of appendicitis, cholecystitis, pancreatitis, diverticulitis, hydronephrosis, urinary stones, gastrointestinal obstruction, or free air were observed, and major vascular structures remained open without gross pathology in other abdominal or pelvic regions.
+
+Echocardiography showed normal systolic function with an ejection fraction (EF) of 55%. There was mild to moderate tricuspid regurgitation (TR), mitral regurgitation (MR), and pulmonary insufficiency (PI), with a mean pulmonary artery pressure (PAP) of 27 mmHg and a peak instantaneous pressure gradient (PIPG) of 17 mmHg. A large, rope-like, hyperechoic mass with tissue texture was identified in the inferior vena cava (IVC), measuring 14 cm × 2.7 cm. The mass protruded from the IVC into the right atrium, highly suggestive of massive vein thrombosis.
+
+With a possible diagnosis of renal tumor with extensive tumor thrombus into the inferior vena cava and right atrium, an open, left radical nephrectomy was performed by the urologist team, and then the cardiac surgery team performed IVC thrombectomy. During surgery, there was a huge intracardiac tumor (tumoral and fibrous in gross vision in the right atrium) that was resected, and then the IVC was evacuated from the tumor (extracardiac tumor) with cardiopulmonary bypass and abdominal exploration. The left kidney specimen, following radical nephrectomy, was preserved in formalin and submitted for pathological examination.
+
+Macroscopic examination of the left radical nephrectomy specimen revealed a 7 cm × 6.5 cm × 5 cm mass in the lower pole of the kidney with extension to the renal sinus. On microscopic examination, sheet-like diffuse infiltration of small and round neoplastic cells with monomorphic nuclei, fine speckled chromatin pattern, and inconspicuous nucleoli was seen. The arrangement of the tumor cells in occasional pseudorosette-like structures was also identified.
+
+Results of immunohistochemical staining (IHC) were as follows: positive staining for NKX2.2, CD99, synaptophysin (Syn), and chromogranin; negative staining for CK7, CK20, CK, LCA, PAX8, AMACR, P63, CКA1/A3, and TLE 1; and non-diagnostic staining for Ki67. Finally, the peripheral primitive neuroectodermal tumor (PNET/Ewing sarcoma) was diagnosed with 20% tumor necrosis.
+
+In the fluorescence in situ hybridization (FISH) study, translocation was identified at (11;22), indicating the presence of an EWSR1 gene rearrangement. This finding confirmed the final diagnosis of primitive neuroectodermal tumor (PNET).
+
+Differential diagnosis
+On the basis of the clinical and paraclinical findings, the physicians considered a differential diagnosis that included a kidney tumor with thromboembolism in the superior vena cava (SVC), extending into the right atrium.
+
+Outcome and follow-up
+The patient’s postoperative course was largely uneventful, aside from some minor incisional pain, which was well managed with analgesics. She was discharged 1 week after the operation in stable condition with appropriate follow-up care. She initiated systemic chemotherapy as part of her comprehensive treatment plan 2 months postoperatively. Given the prothrombotic risk associated with both malignancy and chemotherapy, she has remained on anticoagulant therapy since her initial admission. This regimen was carefully maintained throughout her chemotherapy to minimize the risk of thrombotic complications, ensuring optimal management of her condition.
+
+Adjuvant therapy
+Following surgery, the patient was initiated on interval-compressed therapy with alternating cycles of vincristine/doxorubicin/cyclophosphamide (VDC) and ifosfamide/etoposide (IE), which was administered every 14 days with hematopoietic growth factor support. Our radiation oncology team indicated that there was no need for radiotherapy. The treatment demonstrated a favorable response, and the final management plan included an autologous stem cell transplant to consolidate the response. However, after 12 weeks of therapy, some adjustments were necessary owing to significant toxicity and the onset of cytopenia. To mitigate these side effects, doxorubicin was replaced with dactinomycin, and the duration of each cycle was extended from 2 to 3 weeks to accommodate the patient’s tolerance and recovery better.
+
+Spiral CT scan
+At the end of the eighth cycle of chemotherapy, 4 months later, we evaluated the patient using spiral CT. Multislice CT spiral imaging before and after oral and intravenous contrast revealed normal findings in the lungs, pleura, mediastinum, heart, chest wall, liver, pancreas, spleen, right kidney, adrenal glands, aorta, IVC, retroperitoneum, bowel loops, stomach, bladder, and pelvic organs. The left kidney was absent owing to prior nephrectomy, and no lymphadenopathy, ascites, or abnormalities in the bones were detected. A chemotherapy port was noted on the left upper chest wall. All findings were stable compared with the previous multislice CT spiral.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3151_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3151_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..48a2548c38a1f4464c811ee9c479367cbd2e62b5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3151_en.txt
@@ -0,0 +1,23 @@
+History of Presentation
+We report a case of a 73-year-old woman who was referred to us from an outside hospital because of progressive dizziness and exertional dyspnea. An echocardiogram revealed a large floating structure (27 × 17 mm) attached to the anterior mitral leaflet along with hypertrophy and massive calcification of the left ventricle. Notably, significant involvement of the midventricular septum was observed, leading to subvalvular left ventricular outflow tract (LVOT) obstruction. On explicit inquiry, the patient reported experiencing breathing difficulties during exertion in her youth. According to the patient, an ultrasound examination at that time revealed that her heart was enlarged.
+
+Medical History
+The patient was known for coronary artery disease and had a history of ovarian carcinoma. She had undergone an adnexectomy, pelvic lymphadenectomy, and adjuvant chemotherapy with carboplatin and paclitaxel.
+
+Differential Diagnosis
+Massive myocardial calcification is a very rare condition that manifests because of a range of different etiologies. In terms of cause, they are classified into metastatic and dystrophic. Metastatic calcification occurs as a result of elevated serum calcium levels and most commonly affects patients with chronic renal failure undergoing hemodialysis. Additionally, hyperparathyroidism, calcium and vitamin D deficiency, and oxalosis can also contribute to the development of myocardial calcifications. Dystrophic calcification arises from calcium deposits forming in necrotic tissue, which can be caused by a range of myocardial injuries such as myocarditis, myocardial infarctions, tuberculosis, sarcoidosis, hemorrhage, endomyocardial fibrosis (EMF), and idiopathic mitral annular calcification (MAC).
+
+Investigations
+In regards of the floating mitral valve structure morphologically, there was suspicion of a fibroelastoma or a vegetation, although clinically and microbiologically no evidence of an endocarditis was found. Because of the high risk of embolization in either case and because of the presence of hypertrophy-related LVOT obstruction as well as significant aortic valve stenosis, we decided to proceed with surgery for the patient.
+Preoperatively, coronary angiography revealed no significant coronary stenoses in terms of the known coronary artery disease. However, during the examination, significant myocardial calcification observed echocardiographically was confirmed. Additionally, computed tomography (CT) of the heart was performed, revealing excessive calcifications of the left ventricular myocardium, with emphasis on the septum and apex. Furthermore, there were significant calcifications of the mitral valve annulus suggestive of caseous calcification of the mitral annulus.
+
+Management
+During the intraoperative procedure, removal of the floating structure, decalcification of the anterior mitral leaflet, subvalvular myectomy with excision of a hypertrophic myocardial portion next to the calcification, and biological aortic valve replacement (BAVR) due to an aortic valve stenosis were performed. Histologic examination of the intraoperatively removed floating mitral valve structure revealed fibrin components, enclosed basophil granular structures, nucleated cells, and neutrophilic granulocytes, consistent with endocarditis.
+
+Regarding the myocardial calcification of the midventricular septum, histologic examination of the hypertrophed myocardium revealed endocardium and myocardium with significant scarring (which could be well visualized with Elastika-van-Gieson staining), intramural blood vessels without abnormalities, no inflammation, and cardiomyocytes with slight variation in nuclear size, indicating evidence of EMF and interstitial fibrosis.
+Postoperatively, the patient was readmitted to our cardiology clinic. We continued the antibiotic endocarditis therapy in accordance with guidelines alongside postoperative care and discharged the patient in good clinical condition thereafter.
+
+Outcome and Follow-Up
+Four years later, the patient was admitted to our hospital by her cardiologist. She presented again with increasing exertional dyspnea. On the transthoracic echocardiogram, we now observed an increasing left ventricular hypertrophy with a preserved left ventricular systolic function and a diastolic dysfunction. However, there was no gradient increase in the LVOT under Valsalva maneuver. In addition, we noticed signs of pulmonary hypertension with a systolic pulmonary artery pressure of 99 mm Hg. Furthermore, during a magnetic resonance imaging (MRI) examination, right ventricular dilatation and impaired right ventricular function with a right ventricular ejection fraction of 29% were confirmed as a consequence of pulmonary hypertension. A follow-up CT of the heart revealed a significant increase in myocardial calcification.
+
+The patient also underwent cardiac catheterization. Coronary angiography ruled out progression of her known coronary artery disease, and right-sided cardiac pressures and resistances were determined during a right heart catheterization. During this procedure, the diagnosis of combined precapillary and postcapillary pulmonary hypertension was established, with a mean pulmonary artery pressure of 58 mm Hg, pulmonary capillary wedge pressure of 26 mm Hg, and pulmonary vascular resistance of 8.4 WU. In the clinical context, we interpreted the combined precapillary and postcapillary pulmonary hypertension to be caused by the chronic severe diastolic dysfunction because of massive myocardial calcification of unclear etiology.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3186_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3186_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..11afb8bd1e51a0a0d51d6ea2781ff5aec8a16ac4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3186_en.txt
@@ -0,0 +1,7 @@
+M.C.L.M., 16 years old, reported a history of productive cough for 7 days, with fever and progressive respiratory discomfort for 4 days. She had a history of asthma without follow-up, with the last crisis 1 year ago. She denied other comorbidities, allergies, surgeries or previous hospitalizations. Her parents were healthy, and there were no sick contacts.
+
+She sought emergency care at the beginning of the condition and was prescribed azithromycin. On the seventh day of symptoms, she went to emergency care again due to a significant worsening of dyspnea and a drop in saturation. Measures were taken for bronchospasm, and she was connected to non-invasive ventilation, without response, and required ventilatory support. A sepsis protocol was opened, and the patient received ceftriaxone (2g intravenous - IV - every 12 hours) and oseltamivir (75mg orally - VO - every 12 hours). A panel of respiratory viruses, polymerase chain reaction (PCR) for 2019 coronavirus disease (COVID-19), cultures and laboratory and imaging tests were collected. The patient was transferred on the same day to a paediatric intensive care unit.
+
+The next day, she tested positive for Influenza B and negative for the other agents. She tolerated weaning from the ventilator and was extubated in 2 days. She required noradrenaline for 1 day due to hypotension and haemodynamic instability. On the third day of ceftriaxone, she had a fever, and oxacillin (2g EV every 4 hours) was associated to extend antibiotic coverage. On the eighth day of admission, despite progressing with improvement of the general state, she had a fever for 11 days, when she started laminar desquamation in hand, feet and inguinal region and raspberry tongue. She had bilateral conjunctivitis since admission, in addition to cervical lymph node on the left (5cm), closing criteria for DK. She received acetylsalicylic acid (AAS) 200mg once a day and gamma globulin 80g EV single dose, according to the protocol. Initial and control echocardiogram (ECO) was performed, without alteration of coronary arteries (initial ECO: right coronary artery: 2.9mm and z-score -0.57; left coronary artery: 3.3mm and z-score -0.49; descending anterior artery: 3.2mm and z-score +1.0).
+
+As she had tachypnea with worsening of the chest radiograph image, in addition to the need for supplemental oxygen, an angiotomy was performed, showing pulmonary thromboembolism, small bilateral pleural effusion and pulmonary infiltrate compatible with the current pulmonary disease, and enoxaparin 40 mg subcutaneously was prescribed every 12 hours. Investigation for systemic lupus erythematosus and serologies (cytomegalovirus, toxoplasmosis and Epstein-Barr) were negative. On the 18th febrile day, prednisolone (60 mg, oral, once daily) was introduced due to the persistence of fever, which ceased 24 hours after the introduction of corticoid. Due to pulmonary thromboembolism, coagulopathies were investigated, with the presence of heterozygous mutation of factor V Leiden. She was discharged with the use of acetylsalicylic acid (AAS, 200 mg, oral, once daily) and warfarin (10 mg, oral, once daily) with ambulatory follow-up. During the follow-up, she collected serology for COVID-19, after more than 1 month from the onset of symptoms, presenting negative immunoglobulin G (IgG) and M (IgM).
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3192_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3192_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..60488d55213743b1a2d153e384dbc3a7db5aa76d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3192_en.txt
@@ -0,0 +1,3 @@
+A 51-year-old woman complained of visual fatigue for 1 week. The patient had unremarkable medical and family histories with no reported history of trauma. Both eyes exhibited myopia. The best corrected visual acuity (BCVA) was 1.0 (decimal) in both eyes. The intraocular pressure was measured as 16 mmHg in the right eye and 17 mmHg in the left eye. The slit lamp examination revealed unremarkable anterior segments of both eyes accompanied by normal bilateral pupillary reactions.
+
+The multimodal imaging was performed on both eyes. The right eye exhibits a blurred optic disc margin on the color fundus photograph (CFP). Small patchy hemorrhage was observed in the optic disc of the right eye (Clarus 500, Carl Zeiss Meditec, Inc). Fundus autofluorescence (FAF) revealed a totally hypofluorescent on binocular optic disc (Panoramic ophthalmoscope, Daytona P200T). SD-OCT and OCTA with Min-IP were performed (Cirrus HD-OCT 5000, Germany). Min-IP is a special imaging process on Cirrus HD-OCT 5000. PHOMS exhibited an ovoid shape on B-scan SD-OCT image and manifested as a peripapillary hyperreflective bright regions on en-face Min-IP image corresponding to the B-scan SD-OCT image. The active blood flow signal of PHOMS was detected on SD-OCT/OCT images. The vertical cup-to-disc ratio (C/D) was measured by the analysis of the optic nerve head (ONH) and retinal nerve fiber layer (RNFL). The vertical cup-to-disc ratio is defined as the ratio between the vertical diameter of the optic cup and that of the optic disc within the optic nerve head. Both eyes have a C/D ratio of 0.06. However, there was no evidence of visual field abnormalities. The results should be consistent with the diagnosis of spontaneous hemorrhage in the right optic disc, binocular PHOMS, visual fatigue and ametropia.39411573
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3193_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3193_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f59eb28c012f7feb5bafd48616b51bd54beb2ed8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3193_en.txt
@@ -0,0 +1,7 @@
+A 60-year-old Caucasian woman was referred to our department due to suspected cutaneous squamous cell carcinoma on the left thigh. She reported an 8-week history of a non-traumatic ulcer that initially resembled a bruise, but gradually developed into a painful, non-healing ulcer. The patient had a poor performance status and a past medical history of smoking, peripheral vascular disease (PVD), and rectal squamous cell carcinoma that had been treated with chemoradiotherapy 5 years earlier. There was no other known history of immunocompromise.
+
+On examination, the patient was febrile (37.9°C) and tachycardic (109 bpm). A necrotic ulcer with a purple undermined border was present on the left inner thigh that was surrounded by warm and tender induration. No crepitus or discharge was present.
+
+Blood tests revealed raised inflammatory markers (white cell count [WCC] of 23.8 × 109/L and C-reactive protein of 282 mg/L). Autoimmune screen was unremarkable. Microscopy, culture, and sensitivity from a wound swab only identified contaminants. Ultrasonography was performed which excluded the presence of an underlying fluid collection. Given the lack of remarkable imaging and the slow advance of the condition, the possibility of necrotising fasciitis was excluded. The patient was therefore treated with co-amoxiclav and metronidazole for presumed pyoderma gangrenosum with superimposed cellulitis.
+
+Three days later, the patient was found to have spreading induration and increasing pain despite improving inflammatory markers (WBC of 10.9 × 109/L and C-reactive protein of 134 mg/L) and was admitted to hospital with presumed worsening cellulitis. She was escalated to intravenous antibiotics. A skin biopsy was performed that revealed ulceration to the subcutis, neovascularisation with proliferation of vascular channels and spindle cells. There was no evidence of neutrophilia, atypia or mitotic activity to suggest pyoderma gangrenosum or malignancy. Immunohistochemistry studies found positivity to the vascular marker CD31 and were negative to HHV-8. A diagnosis of RAE was thus made based on the clinical and histological findings, and the patient was urgently referred to the vascular team for consideration of surgical correction of PVD. Unfortunately, following their assessment, and due to her poor performance status, the patient was not found to be fit to undergo surgical treatment. Instead, antibiotics were continued with improving inflammatory markers and lessening pain. Wound dressings and topical timolol were also initiated. Unexpectedly, and despite ongoing antibiotic therapy, the patient’s condition deteriorated suddenly, leading to her demise within 3 weeks of her initial presentation to our department due to irretrievable PVD.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3194_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3194_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d11f5495e6cfcbaeb7de6b370dc1c39b7786630f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3194_en.txt
@@ -0,0 +1 @@
+The patient, an Ivorian of 37 years of age, was admitted to the emergency department with a rapidly progressive tetraparesis that was detected on his awakening on March 30, 2024. The day before, the patient reported diffuse myalgia. The patient has a history of hyperthyroidism diagnosed in November 2023, for which treatment with neomercazole was initiated. The patient's history reveals a episode of tetraparesis without ascending character in November 2023 that lasted approximately 30 minutes, and was followed by a progressive spontaneous regression of the motor deficit in an apyretic context. On March 29, 2024, the patient presented a motor deficit of the four limbs detected on his awakening and of progressive aggravation. The patient indicated a therapeutic interruption of one week before the onset of symptoms. This motor deficit was preceded the day before by diffuse myalgia. The examination on his admission to hospital noted a flaccid tetraparesis with a motor strength of 3/5 affecting mainly the lower limbs. The biological balance found a hypokalaemia of 2.6 mEq/l. The natremia and chloremia as well as the renal functions were normal. The ultrasensitive TSH was low (less than 0.005 µl/ml) with an elevation of T3 and T4 respectively to 24.42 µl/ml and 79.68 µl/ml. We retained the diagnosis of a hypokalemic thyrotoxic periodic paralysis. The management consisted of an infusion of 3 g of potassium chloride. The clinical evolution after 24 hours was marked by an improvement of the motor strength. The biological balance found a normal potassium level of 3.9 mEq/l. The patient was discharged 48 hours later, in the context of satisfactory clinical follow-up with endocrinology.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_319_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_319_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9fd8c30429154d7fccca3fc737934ca32107635c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_319_en.txt
@@ -0,0 +1,3 @@
+On 30 Jun 2016, a 16-year-old male patient without any known medical background presented with a 1 month history of fatigue and fever without sweating. He had no familial history of malignancies and no social and environmental history or exposure to toxins and animals. Initial laboratory evaluation of peripheral blood (PB) revealed white blood cells (WBC) of 52.2 × 109/l (88% were blasts). He was treated with Predlon 60 mg/day per 10 days. Afterwards, physical examination and ultrasound at our hospital showed no splenomegaly, however, several lymphadenopathies (sternocleidomastoidal (1 cm) and right of subaxilla (1 cm)), normal heart rate (90/min) and his blood pressure was 12/6. His PB showed: WBC 3.5 × 109/l (neutrophils 33%, lymphocytes 64%), Hb = 7.5 g/dl, and platelets = 49.4 × 109/l. Serum biochemistry analyses were: Calcium (Ca+ 2) 9.9 mmol/l (normal value 8.5–10.3); LDH 229 U/l (normal level < 460); β2-microglbulin 3.32 mg/l (normal value 0.61–3.7); alanine aminotransferase level was 24 U/l (normal up to 40 U/l); aspartate aminotransferase level 17 U/l (normal up to 40 U/l); creatinine was 0.57 μmol/l (normal 45–120); Urea 38 mmol/l (normal 10–50); Sodium (Na+) 137 mmol/l (normal 135–148), Potasium (K+) 4.7 mmol/l (3.5–5.2), total protein 6.2 g/dl (normal 6.6–8.7), albumin 4.2 g/dl (normal 3.8–5.4). Bone marrow (BM) aspiration revealed hypercellularity with 90% of lymphoblasts. In cerebrospinal fluid aspiration no cells were found.
+He was diagnosed as having pre-B-ALL according to the World Health Organization (WHO) classification. Thus, the patient was treated further according to GRALL 2003 chemotherapy protocol. Two days after initiating GRALL 2003 chemotherapy, the patient developed neutropenia, was given Neupogen and restarted chemotherapy protocol. The patient suffered from neutropenia and fever many times during chemotherapy. All chromosomal aberrations were vanishing during the chemotherapeutic treatment. After 17 months of treatment the patient relapsed. BM aspiration revealed 10% of lymphoblasts and PB showed: WBC 1.7 × 109/l (neutrophils 60.5%, lymphocytes 32.2%, and immature cells 7.3%); Hb = 13.6 g/dl; and platelets = 216 × 109/l. The patient received cytosar 3.5 g (twice per day for 4 days) and doxorubcin 50 mg/m2 for 3 days and a wide spectrum of antibodies.
+Approximately 2 months after relapse patient died due to respiratory and heart arrest, as well as neutropenia. No autopsy was performed. Patient’s father agreed with scientific evaluation of his case and the study was approved by the ethical committee of the Atomic Energy Commission, Damascus, Syria.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3202_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3202_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e9eaf7310e9ba1b50dc33a14e27984835e68bf26
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3202_en.txt
@@ -0,0 +1,9 @@
+An 85-year-old male presented, lethargic and confused, from a skilled nursing facility in which he was “found down”, covered in non-bloody diarrhea. On arrival to the hospital, the patient was unable to recall events but as reported by the nursing staff at the nursing facility, he had been complaining of abdominal bloating. Th patient’s medical history was significant for congestive heart failure, atrial fibrillation, hypertension, diabetes, and chronic kidney disease. There was no history of liver disease or alcohol or drug use.
+
+On physical examination, he was found to be awake and oriented to self and place. A notable examination finding was a soft, non-tender, mildly distended abdomen, asterixis and 2+ lower extremity pitting edema. The patient was admitted with the preliminary diagnoses of a congestive heart failure exacerbation, metabolic encephalopathy, and an acute kidney injury. Due to concern for sepsis, he was empirically started on vancomycin and cefepime.
+
+Initial laboratory tests revealed a brain natriuretic peptide (BNP) level of 3915 pg/mL, white blood cell count of 11 500/mm3, hemoglobin of 11.5 g/dL, platelet count of 90×103/mm3, serum bicarbonate of 25 mEq/L, blood urea nitrogen (BUN) of 89 mg/dL, creatinine of 3.51 mg/dL, total bilirubin of 2.3 mg/dL, direct bilirubin of 1.4 mg/dL, aspartate aminotransferase of 22 U/L, alanine aminotransferase of 9 U/L, and an international normalized ratio of 1.27. His initial cultures, urinalysis, and stool studies were negative for infection. A transthoracic echo-cardiogram was performed and was notable for an ejection fraction of 35–40% with global hypokinesis, a dilated inferior vena cava, and an elevated pulmonary artery (PA) pressure of 67 mmHg. A follow-up abdominal computed tomography (CT) scan showed a small right pleural effusion and a moderate amount of free intraperitoneal fluid.
+
+Given these imaging findings, in conjunction with his symptoms of confusion, asterixis, and abdominal distension, a diagnostic paracentesis was performed. The aspirated fluid was dark yellow and opaque with a serum ascites albumin gradient (SAAG) calculated to be 1.9 g/dL, total fluid protein of 3.3 g/dL, polymorphonuclear (PMNs) of 1115 cells/mm3, 49% PMN leukocytes, 2% lymphocytes, and 40% mononuclear leukocytes. With a SAAG of 1.9 g/dL and a total fluid protein count of 3.3 g/dL, we concluded that the peritoneal fluid represented cardiac as-cites as there was no evidence of cirrhosis. Blood cultures taken were negative, which may reflect initiation of sepsis protocol on patient’s admission reducing the yield of the culture. Diagnosis was made on the basis of previously reported cell counts of the fluid. Bacterial peritonitis was presumed due to a very high neutrophil count. The patient was subsequently treated with ceftriaxone 2 mg daily for 5 days and albumin (on day 1 and 3) with improvement in his encephalopathy.
+
+Unfortunately, the patient exhibited a rapid acute and then chronic decline in his renal function. The patient and family declined hemodialysis resulting in further failure of his congestive heart failure treatment. Shortly afterwards, he became oliguric and expired from renal failure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3211_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3211_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..df0ffe157a04db57a8c1b516dc0fbca484a2fca5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3211_en.txt
@@ -0,0 +1 @@
+A 39-year-old man, a drug addict in treatment with methadone, suffered an accident with a fracture dislocation of Monteggia, open grade II of Gustilo and multifragmentary of the right cubitus. There was no nerve deficit. A closed reduction of the radial head and provisional fixation with two percutaneous Kirschner needles, wound closure, immobilization with a brachial plaster splint and antibiotic prophylaxis with cephalosporin were performed urgently. Six days later, the definitive stabilization of the fracture was performed by a reconstruction plate of titanium in the cubitus and fixation of the coronoid process with a screw. The patient did not return to the evaluation after eight months postoperatively. Two years postoperatively, the patient returned to the consultation for having elbow pain and large defects of skin coverage with exposure of the osteosynthesis material. Some of the screws of the cubitus plate had been removed by the patient himself. He was advised to remove the plate, due to the risk of infection, but the patient refused and did not return for revision. Four years later, the patient was admitted to the emergency department for having suffered a new accident, he had a fracture intertrocantérea of the right hip. In addition, he presented a complete exposure of 20 cm long of the forearm plate, without signs of infection after six years of evolution since the surgery. In the same intervention, an internal fixation of the fracture of the hip and extraction of the cubitus plate were performed. Under the forearm, skin growth was observed below the plate. Radiologically, there was consolidation with malalignment of the proximal cubitus and proximal radiocubital synostosis. Clinically, the patient had a great limitation of pronosupination, 100o elbow flexion and a deficit of 50o extension. The patient evolved favorably, without presenting infection and with complete reepithelisation of the forearm.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3212_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3212_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5e7d8289a37ac131c518979052d8a0686659bd1c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3212_en.txt
@@ -0,0 +1 @@
+The case of a 59-year-old non-smoker who consulted for a month-long cough and mucous expectoration is described. On physical examination, he was in good general condition and a dull sound was heard in the lower right lung field with decreased wheezy murmurs in that area. A chest X-ray showed a round opacity (3-4 cm) in the lower right lung field. A chest CT scan showed a heterogeneous mass of 65 mm x 56 mm with lobar margins in the lower right lung field with heterogeneous enhancement with intravenous contrast that compromised the bronchus of the same lobe. A video bronchoscopy was performed, where a white, irregular, endobronchial formation was observed in the lower right lung field that occluded the same, after the exit of the apical segment. Remains of white membranes similar to those frequently observed in patients with complicated hydatid cyst were aspirated. Also, the adherence of these formations to the bronchus wall was observed, for which several biopsies were taken. The cytology of the endobronchial wash and brush was positive for neoplastic cells, and remains of hydatid membranes were also observed. The histopathology showed a high-grade sarcoma, without the immunohistochemical type of the same being able to be typified; in the biopsies, fragments of hydatid membranes were also visualized, with which the final diagnosis of pulmonary sarcoma associated with hydatid disease was reached. In the abdominal tomography, no images compatible with hepatic hydatid disease were found. The ELISA serological test was positive for Echinococcus. The patient underwent surgery, where the impossibility of resection of the tumor was observed in surgery. He was subsequently referred to oncology, where it was decided to perform radiotherapy and chemotherapy, but he died before initiating the same due to a cardiovascular complication.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3221_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3221_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e1744c1ec6abd9a103f5b82c21222b21ac08d648
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3221_en.txt
@@ -0,0 +1,13 @@
+27-year-old female, native and resident of Mexico City, single, merchant, no family history of importance to her condition; no allergies, chronic diseases, recent immunizations, transfusion history, or previous hospitalizations. In terms of surgical history, she had bilateral intraocular lens placement for strabismus at age 7.
+
+His condition began in August 2021 with odynophagia, rhinorrhea, dry cough, without predominance of time, without fever or other added symptoms. 48 hours after the beginning of the condition, he went to a doctor, who prescribed him treatment with montelukast, salbutamol, ambroxol and ceftriaxone for a week, after which he presented improvement of the symptoms.
+
+Ten days after the end of treatment, the patient presented paresthesia in the right pelvic limb, without improvement with postural changes. One day later, lower paraparesis was added, which made it impossible to walk. Minutes after the previous event, she presented paresis of the right thoracic limb, incoordination of movements and loss of fluency of speech. She was treated empirically with multivitamins, without improvement.
+
+The next day, she presented with sudden, stabbing pain localized to the posterior cervical region, accompanied by nausea, staring, and loss of response to stimuli, with subsequent generalized onset convulsive seizures, tonic-clonic, without recovery between them, so she was transferred to a hospital unit, where she was received in status epilepticus, which required advanced airway management and sedation.
+
+Imaging studies performed at admission showed diffuse hemorrhages of various sizes with ill-defined borders in the white matter with diffuse demyelination and perilesional edema consistent with hemorrhagic disseminated encephalomyelitis.
+
+Treatment with methylprednisolone boluses, 1 g every 24 hours for 5 days, was given, which resulted in improvement of neurological symptoms. Subsequently, tracheostomy and withdrawal of sedation were performed, and maintenance antiepileptic drugs were continued, without new seizure events.
+
+The patient showed improvement in neurological status, and achieved automatic respiration and interaction with the external environment, but without recovery of language function and with very little recovery of motor function; the patient was left with a lower paraparesis sequelae with 2/5 on the Daniels scale and residual paresis of 3/5 in the right thoracic and 4/5 in the left thoracic limbs. Rehabilitation therapy and progression of mechanical ventilation were subsequently initiated.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3231_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3231_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..276e88994a0a52a0b2c74a87fa141ec5c31c3881
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3231_en.txt
@@ -0,0 +1 @@
+Female, 77 years old, ECOG Performance Status Scale-1 (restricted in physically strenuous activity but ambulatory and able to carry out work of a light or sedentary nature), with a history of basalioma, arterial hypertension, total hip prosthesis, colonic diverticulitis, referred to the Hematology consultation in September 2018 for mild neutropenia, with no other cytopenias. She reported anorexia, with no infectious or hemorrhagic clinical signs. Two months later, she presented pancytopenia: Leuc 2.3 x 109/L (N = 4.0 - 10.0 x 109/L), Neut 0.97 x 109/L (N = 2 - 7 x 109/L), Hb 9.3 g/dL (N = 12.0 - 16.0 g/dL), Plaq 121 x 109/L (N = 150 – 400 x 109/L); and blastemia of 6% (N < 0%). The bone marrow study revealed multi-lineage dysplasia ≥ 50%, with the presence of erythroid dysplasia, with the presence of karyorexis (nucleus fragmentation), internuclear bridges, and myeloid dysplasia with abnormal segmentation and maturational asynchrony; and 33% of blasts; karyotype 46,XX,i(7)(p10). The NPM1 and FLT3-ITD mutational study was negative. The diagnosis of AML-ARM was established with an intermediate prognosis (ELN 20179).
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3236_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3236_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d4c4d00cb87566d48f8fcaef127abcfecf84edb5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3236_en.txt
@@ -0,0 +1,25 @@
+A 45-year-old merchant from Cali who consulted a level IV center in May 2022 for a persistent cough of four months accompanied by fever and significant weight loss (8 kg). He did not have any relevant medical history, except for a non-complicated respiratory infection by SARS-CoV-2 two months earlier.
+
+On initial physical examination, he was pale and hypotensive with decreased breath sounds in both lung fields. On admission chest X-ray showed predominantly alveolar infiltrates in the basal field of the right lung. Severe pneumonia was diagnosed and treatment with antibiotics of piperacillin-tazobactam and vancomycin was initiated.
+
+A chest computed tomography scan showed idiopathic pneumonia; admission laboratory tests showed: procalcitonin elevated, 22.51 ng/ml (normal <0.5); no leukocytosis (4,610 cells/μl) with neutrophils (2,480 cells/μl), lymphocytes (1,520 cells/μl) and monocytes (560 cells/μl) normal. The respiratory panel (Filmarray™) was negative in the nasopharyngeal swab. In the complementary infectious studies of the bronchoalveolar lavage by fibrobroncoscopy, a viral load positive for cytomegalovirus (CMV) of 995,000 copies/ml was found; the result was negative for bacteria, tuberculosis, fungi and for Pneumocystis jirovecii.
+
+A transbronchial biopsy confirmed the presence of intra-nuclear basophilic inclusions indicative of active CMV infection with positive PCR for P. jiroveccii in the lung tissue.
+
+During the hospital stay, he had multiple episodes of diarrhea, and a colonoscopy was performed, which revealed ulcers in the colon. Colon biopsy and immunohistochemistry demonstrated chronic colitis and ulceration, reported as CMV negative. CMV viral load in blood was positive at 890 copies/ml. Ganciclovir was prescribed for active CMV infection and was administered for 21 days.
+
+HIV testing (4th generation ELISA and viral load) was negative, and other chronic infections such as HTLV, HCV, or HBV were ruled out.
+
+As a patient who was HIV negative and had an opportunistic infection, further studies were performed to exclude hematological malignancies or solid tumours as a cause of his immunosuppressed state and the development of the severe CMV infection. Bone marrow biopsy showed an 80% increase in the number of cells, with preservation of all three cell lines and no morphological alterations.
+
+Bone marrow flow cytometry revealed asynchrony in the expression of CD13 and CD10 antigens on granulocytes and neutrophils. Total B lymphocytes represented 0.35% of total leukocytes (extremely low), with a complete absence of mature B lymphocytes and very few plasma cells.
+
+In the head and neck PET-CT, no metabolic changes were found; in the thorax, there were bilateral infiltrates predominantly in the right lung, which were interpreted as secondary to pneumonia, while the mediastinal ganglion component showed no infectious changes. The liver and spleen showed no apparent alterations.
+
+In view of the patient's immunological compromise, the possibility of an innate immunity defect was considered. The evaluation of the humoral immune response showed agammaglobulinemia in the protein electrophoresis and a complete absence of serum immunoglobulins, given by: IgA < 0.13 g/L (0.7 - 4.9), IgG < 3 g/L (7 - 16) and IgM < 0.25 g/L (<0.25) ]. The total lymphocyte count was discretely increased, so CD3+, 3,424 cells/μl (849 - 1,963), with normal CD4+ T lymphocytes, 1,115 cells/μl (477 - 1,140) (31.9 % of the T lymphocytes), but the CD4/CD8 ratio was reversed (0.48). B lymphocytes and NK cells were not quantified at that time.
+
+In view of the finding of severe hypogammaglobulinemia in the range of agammaglobulinemia, in addition to the severe pneumonia and multisystem involvement by CMV, the patient was considered to have a primary immunodeficiency or congenital immunodeficiency of predominantly antibody deficiency type. The absence of serum immunoglobulins was confirmed with a second sample, but, given the urgency and severity of the clinical picture, no functional evaluation of the humoral immune reaction was performed and intravenous immunoglobulin was initiated every 28 days at a dose of 400 mg/kg.
+
+The patient has been on continuous immunoglobulin replacement therapy, but has had two respiratory infections that required antibiotic treatment.
+
+The patient was evaluated by the adult clinical immunology group, who considered advancing extension studies and ordered a diagnostic test.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3237_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3237_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..96e1b4bdce7b3eb77fbb8c7eb241ab6b1b9a55ec
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3237_en.txt
@@ -0,0 +1 @@
+This study presents a case of a 49-year-old woman with MOG-IgG-positive ON, who reported to the ophthalmic emergency room with decreased visual acuity, retrobulbar pain and red color desaturation in her left eye. Abnormalities in the ophthalmological examination were: decreased Snellen's distance best-corrected visual acuity (DBCVA) to 0.04 in her left eye, slightly elevated optic nerve disc in the left eye confirmed by increased peripapillary retinal nerve fiber layer (RNFL) thickness in SD-OCT, abnormalities in pattern visual evoked potentials in both eyes. The preliminary diagnosis was demyelinating optic neuritis left for observation. However, two weeks after the first symptoms, treatment with intravenous methylprednisolone was initiated due to a decrease in DBCVA to no light perception. Intravenous steroids were followed by oral prednisone and later also by mycophenolate mofetil. The patient experienced slow but gradual improvement. One year after the occurrence of the initial symptoms, DBCVA was 0.5 in the left eye, however partial atrophy of the optic nerve developed, confirmed by macular ganglion cell layer (GCL) thickness and RNFL atrophy in SD-OCT, while visual pathway function improved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3240_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3240_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cc1423715a8a02014b8fa28eeafb82f539572454
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3240_en.txt
@@ -0,0 +1,2 @@
+A 17-year-old patient presented to the emergency department in November 2019 following the sudden onset of low back pain when he stood up. His main medical history included bilateral hearing loss since 2017, chronic gastritis with Helicobacter pylori treated with antibiotics in February 2019, and recent episodes of “red urine”. There was no traumatic background and the pain was inflammatory, without irradiation to the lower limbs. On clinical examination, there was a significant bilateral paravertebral contracture, without pain triggered by palpation of the spinal nerves. The pain was relieved only by analgesics of level 3.
+The biochemical profile showed a CRP initially at 68 mg/L, increasing to 202 mg/L, with a hyperleucocytosis of neutrophils (14 G/L), as well as an increase in CPK to 66 336 IU/L (N < 192 IU/L). The infectious and autoimmune profiles, including the DOT myositis, were negative. In view of the inflammatory and hyperalgesic nature of the lower back pain, a spinal MRI was performed, showing a myofasciitis necrotizing affecting the erector spinae, iliocostalis lumborum, longissimus thoracis, transverse spinae and quadratus lumborum bilaterally extended in relation to L1 to S3. A biopsy of the paraspinal muscles showed complete myocyte necrosis, associated with a recent infarction, without further specificity. After rest, the patient described a clear improvement in his lower back pain, but the CPK remained elevated, between 1116 and 1752 IU/L, on the control biological tests the following months. The control MRI at 3 months found areas of sequellae necrosis at the level of the erector spinae muscles in particular. When reviewing the patient's history, there were difficulties in playing sports since childhood, in a context of significant muscular fatigue. There was no phenomenon of second breath. The etiological profile was then completed with a non-ischemic forearm stress test that did not find an elevation of lactate acidemia, at 0.70 mmol/L before a stress and a maximum of 1.18 mmol/L after a stress. In view of this result suggestive of GSD 5, a molecular study of the PYGM gene showed the presence of two variants in a heterozygous state: the c.1963G>A (p.Glu655Lys) class 5 variant that has already been described in the literature and whose various prediction tools are in favour of its pathogenicity, and the c.2178-1G>A class 4 variant that has never been described but that affects a consensus splicing site and is very likely pathogenic. These results were in favour of the diagnosis of GSD 5. After three years of follow-up, the patient did not present a new access of lower back pain but remained limited to practising a sport.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3247_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3247_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8cffac2eb3183dad0df2dc9c6a63dd7359750056
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3247_en.txt
@@ -0,0 +1,11 @@
+A 32-year-old 38 week-pregnant Caucasian female was admitted to the emergency department with right upper abdominal pain since 2 weeks prior, which suddenly worsened 2 h before admission. She had been diagnosed with Gestational Hypertension and treated with Methyldopa. Initial examination during admission revealed elevated blood pressure of 180/110 mmHg and proteinuria with urinary dipstick test (3+). Laboratory investigation revealed mild thrombocytopenia (125.000/uL), increased alanine-aminotransferase (ALT) level of 10.54 μkat/L (=632 U/L) and aspartate-aminotransferase (AST) level of 13.20 μkat/L (=792 U/L), increased lactate dehydrogenase (LDH) levels of 28.10 μkat/L (=1686 U/L), hypoalbuminemia (25.0 g/L), and high serum folate (>20.0 ng/mL). An ultrasound scan of the fetus revealed normal development, with weight estimation at the 5 SD growth curve. Cardiotocography (CTG) examination resulted in pathologic CTG. Diagnosis of preeclampsia with HELLP syndrome was made based on clinical and biochemical features.
+
+Due to the deteriorating condition of the patient and fetal distress, an emergency Caesarean section was performed. A female newborn was delivered with respiratory distress, weighing 2,466 g at 5 SD, APGAR Score of 0/2/5, positive Rhesus, umbilical artery pH value of 7.06 and BE −9.1. The patient was then admitted to intensive care. Within 4 h postpartum, a hypertensive crisis, rapidly progressive severe anemia with thrombocytopenia, as well as liver and renal impairment was recorded. Hemoglobin level went down to 5.7 g/dL, platelet count dropped to 57 × 109/L, haptoglobin level dropped to <7.4 mg/dL, serum creatinine went up to 259 μmol/L, urine excretion deteriorated to around 7 mL/h. With the presence of thrombocytopenia, anemia with fragmentation of red blood cell (RBC) in blood film and evidence of hemolysis, TMA was considered. A disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13) levels were sent for examination and daily plasma exchange therapy was initiated.
+
+The patient’s blood pressure was managed and maintained with intravenous antihypertensive agents and she was given prophylactic anticonvulsant therapy with Magnesium. Due to ongoing hemolytic anemia, she was given multiple transfusion of blood products: four (4) units of red blood cell for four (4) days, three (3) units of fibrinogen and three (3) units of human prothrombin complex. The patient also underwent plasmapheresis with 42 units of fresh frozen plasma (FFP) for three (3) days. Rhophylac (Anti-D IgG 1500 IE) was also given due to Rhesus incompatibility with her baby.
+
+Renal sonography revealed patent renal vasculature with no blockage. Initial chest X-ray revealed basal pleural effusion which then progressed significantly over the next four days. Thoracocentesis was performed due to progressive dyspnea, yielding 500 mL of serous fluid. Transthoracic echocardiography results revealed normal functions of the left and right ventricle with no valve abnormalities.
+
+Further diagnostics were made for differential diagnostic purposes. Complement tests revealed alternative pathway dysregulation with low plasma level of C3 at 47.1 mg/dL (90–180 mg/dL) and normal level of C4 at 12.5 mg/dL (10–40 mg/dL). Genotyping with Sanger sequencing of CFH and CFI genes showed no abnormality. Autoimmune diagnostic tests revealed negative Antinuclear Antibodies (ANA), c-ANCA, p-ANCA Serum. ADAMTS13 activity was within normal range (53%), which excluded TTP. Stool sample showed a negative test for E. coli and the patient had no previous history of diarrhea, excluding STEC-HUS. HELLP syndrome was doubted due to lack of significant postoperative liver function improvement.
+
+Based on our suspicion of p-AHUS, the patient then received prophylactic antibiotic therapy and vaccinated against meningococcus before a therapy of Eculizumab 900 mg was initiated. The patient’s clinical condition improved significantly after the first dose of Eculizumab, with stabilizing blood pressure and the resolution of dyspnea and hemolysis, as well as a gradual restoration of hematologic parameters, renal, and liver function. After being treated for 14 days in the Intensive Care Unit (ICU), the patient‘s condition stabilized and she was transferred to the nephrology department for further management.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3257_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3257_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cddeb5f066046eec97754dbda83a8f789d720d93
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3257_en.txt
@@ -0,0 +1,21 @@
+A 39 years old lady was admitted to a COVID-19 treatment center in July 2021 with a complaint of worsening shortness of breath, easy fatiguability, low-grade fever, chills, frontal headache, and productive cough of yellowish sputum of ten days duration. The patient tested reverse transcription-polymerase chain reaction (RT-PCR) positive for COVID-19 five days before her admission.
+
+She is a known cerebral palsy patient since birth and was on sodium valproate 200mg PO/day for a long time. Two weeks back she was told to have acute angle-closure glaucoma on her right eye and was put on timolol 0.5% eye drop BID, tropicamide 1% eye drop TID, acetazolamide 250 mg PO BID with prednisolone 20mg PO/day.
+
+The patient was referred from a local health center for better ICU care and follow-up after being started on Dexamethasone, Azithromycin, and Ceftriaxone-sulbactam. In the emergency room (ER), her vital signs were BP of 120/80 mmHg, PR of 92 beats/min, RR of 32 breaths/min, T of 36.2 °C, and SpO2 96% on 6L/min facemask oxygen. The only pertinent findings were coarse crepitations over the left lung.
+
+Random blood sugar determined at the ER was recorded high (>600 mg/dL) and urine analysis showed ketone +1 and glucosuria of +3. A chest x-ray from the referral center showed evidence of left-side pneumonia. Laboratory tests on her first day of admission (DOA) showed mild leukocytosis and lymphopenia (14.4 x 103 WBCs with 95% neutrophil and 0.9% lymphocyte), moderate hyponatremia (127 mmol/L) likely due to hyperglycemia, mild hypokalemia (3.2 mmol/L), pre-renal azotemia (serum creatinine of 2.95 mg/dL and BUN of 69 mg/dL) and c-reactive protein of 89.9 mg/L with negative serostatus for HIV. Abdominal ultrasound showed normal-sized kidneys. Arterial blood gas analysis was unfortunately not done because of cartridge stockout at the time.
+
+The patient was admitted to the ICU right away with a problem list of severe COVID-19 with superimposed bacterial pneumonia, prerenal acute kidney injury (AKI), stress-induced hyperglycemia r/o ketosis-prone type 2 diabetes mellitus (T2DM), known cerebral palsy, and right eye glaucoma, and was put on dexamethasone 6mg IV/day, ceftriaxone-sulbactam 1.5 mg IV BID, UFH 17,500 SC BID, vitamin C 200mg PO/day, and Zn 20 mg PO/day, and she was treated for diabetic ketoacidosis (DKA) as per the local protocol.
+
+On the second hospital day, the patient developed right eye swelling and with an added assessment of right orbital cellulitis, vancomycin (renal dose adjusted) was added.
+
+On day three of admission, the patient was started on NPH (Neutral Protamine Hagedorn) insulin 16/8 SC BID with correctional regular insulin since her glycemic control was poor despite being on a modified sliding scale. Her NPH insulin requirement would eventually be escalated to 28/14 until the patient achieved the target glycemic range on the seventh DOA.
+
+On the fourth DOA, rhino-orbital mucormycosis was considered and liposomal amphotericin B (5mg/kg/day IV) was started and ceftriaxone-sulbactam changed to meropenem 1g IV TID. On the same day, the ophthalmologist evaluated her and planned to continue amphotericin B and a nasal swab was sent for culture.
+
+On the fifth DOA, extensive surgical debridement of necrotic tissue over the rhino-orbital area was done. The next day, the HgA1c result arrived (13.8%) and newly diagnosed T2DM was added to the problem list. Dexamethasone was also held and overall, the patient was improving with resolved fever, decreasing leukocytosis, normalized renal function test, and coagulation profile (PTT of 50.8 and INR of 1.3), and decreasing oxygen support (2 L/min intranasal oxygen).
+
+However, on the eighth DOA, the patient developed a new high-grade fever, increased oxygen demand (20L/min facemask oxygen) and meropenem was escalated to 2g IV TID and septic work up sent. Culture from wound site in the face would eventually grow Methicillin-resistant Staphylococcus aureus (MRSA) sensitive to tigecycline and linezolid.
+
+Eventually, patient deteriorated developing lethargy and septic shock of chest focus (new bilateral consolidation on lung ultrasound) with the possibility of fungal invasion into the brain (Rhino-Orbital-Cerebral Mucormycosis). She was started on vasopressors and hydrocortisone; however, intubation was deferred due to likely poor outcome after thorough family counseling. Despite all the above management, the patient eventually died on the ninth day of ICU admission and 20th total duration of illness from symptom onset with the possible immediate cause of death, multi-organ dysfunction syndrome (MODS) secondary to refractory septic shock.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3261_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3261_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fc0f2b40b68c142354f61543ed42443807963eb9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3261_en.txt
@@ -0,0 +1,15 @@
+A 78-year-old man presented to our Ophthalmology Unit of “SS. Annunziata” Hospital, Taranto, complaining a progressive bilateral decreased vision, repeated episodes of sudden onset of pain with redness, and foreign body sensation. Concerning ophthalmic history, he underwent previously conventional phacoemulsification with IOL implantation in both eyes, and trabeculectomy in right eye (RE). He was under topic antiglaucoma therapy in both eyes. His visual acuity was 20/100 in RE and 20/400 in the left eye (LE). Slit lamp examination revealed corneal erosions and relevant stromal opacities with branching lines in the inferior portion of the cornea of both eyes. The lesions spared the peripheral cornea and did not involve the limbus. No other pathological findings were observed. Ophthalmological examination of the family members of our patient revealed similar clinical findings in the patient’s daughter and son, supporting the diagnosis of RCEs in LCD with an autosomal dominant inheritance.
+
+The Institutional Review Board (IRB) of the Ophthalmology Unit of “SS. Annunziata” Hospital, Taranto approved the study protocol. All clinical procedures were conducted according to the principles of the Declaration of Helsinki. The patient provided informed consent for all procedures and their possible complications were explained. The patient gave informed consent for the publication of any case details and accompanying images. The IRB of the Ophthalmology Unit of “SS. Annunziata” Hospital, Taranto gave the approval for the publication of this case report.
+
+Our first attempt was using autologous serum drops four times daily with no improvement at all.9 A treatment with amniotic membrane extract eye drops (AMEED) was started.10 Even in this case, the improvement in symptoms was temporary with no effect on the corneal opacities. The patient was subsequently placed under nerve growth factor (NGF) eye drops q.i.d.11 After a few days, there was an improvement in symptoms. After one month of treatment, the patient was uncomfortable, complaining again foreign body sensation. The slit lamp examination showed corneal epithelium irregularities, RCEs, and stromal opacities.
+
+The combined treatment with PRK and PTK was scheduled in both eyes, firstly in the LE and, after 2 weeks in the RE. A trans-epithelial topography-guided approach using the iRes® excimer laser platform (iVIS Technologies, Taranto, Italy) was performed under topical oxibuprocaine anesthesia.
+
+The customized treatment was based on refractive and morphological data including spherical error collected by the visual acuity examination; biometric data including anterior chamber depth, intraocular lens (IOL) power, and axial length; corneal morphological irregularity index (CMI) measured by tomographer (Precisio2®, iVIS Technologies, Taranto, Italy); target refractive zone and ablation zone defined by the projection of an ideal pupil, identified by dynamic pupillometry (pMetrics®, iVIS Technologies, Taranto, Italy), onto the ideal corneal surface. The Corneal Interactive Programmed Topographic Ablation software (CIPTA®, iVIS Technologies, Taranto, Italy) determined the volume of ablation as the intersection between the anterior shape detected by the tomographer and the ideal shape determined taking care of the total corneal astigmatism and of the high order of aberrations, by means of a ray tracing process.
+
+The customized ablation profile obtained with PRK, had a refractive zone of 5.00 mm in RE and 3.8 mm in LE, and a connecting zone of 8.80 mm in RE and 9.1 mm in LE. The cumulative ablation depth was 34 μm in the RE and 90 μm in the LE. After surface ablation, PTK was performed using masking agents (1% hydroxy-methylcellulose) to smooth the ablated surface. Subsequently, 0.02% Mitomycin C (MMC, 0.2 mg/mL, diluted in BSS®) was applied over the ablated surface for a duration of 20 seconds. At the end of the procedure, a soft therapeutic contact lens was placed.
+
+Postoperatively, topical dexamethasone and amikacin eye drops were administered four times daily for one week. The patient was then put on 0.1% fluorometholone eye drops and artificial tears eye drops for 12 weeks, which were gradually tapered afterward. The contact lens was removed after 1 week. At the 3-month follow-up, a slit lamp examination revealed a clear central cornea in both eyes.
+
+The final visual acuity improved to 20/25 in the RE and 20/50 in the LE at 3 months after treatment. The keratometric astigmatism improved from −1.71 D to −0.92 D in RE, and from −5.43 D to −1.12 D in LE. CMI decreased from 16.04 µm to 7.84 µm in RE and from 53.07 µm to 37.04 µm in LE, and minimum corneal thickness was reduced from 570 µm to 508 µm in RE, and from 576 µm to 452 µm in LE. The postoperative follow-up was uneventful. The ablation map and topographic changes of both eyes were reported.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3264_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3264_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..596a4058f90d82b815dbcacd380d4f7febd193e4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3264_en.txt
@@ -0,0 +1,13 @@
+24-month-old male patient with no significant perinatal history. During growth he achieved motor milestones up to crawling on his own, but at 8 months of age he began to develop floppy hypotonia of the lower limbs associated with marked weakness, with loss of the ability to crawl and subsequently required support to sit. Therefore, neurological evaluation was performed and multiplex ligation-dependent probe amplification (MLPA) was performed to detect the number of copies present or deletion of multiple genes for SMN1, SMN2 and NAIP in the samples. The result of the test showed homozygous deletion of the SMN1 gene and presence of only three copies of the SMN2 gene, as well as deletion of the NAIP gene. To evaluate the clinical response, three main outcomes were measured: motor function, respiratory function and swallowing function. For motor function, the CHOP INTEND scale and the extended Hammersmith scale (HFSME) were used. Also, measurement of respiratory function with pCO2 values, clinical symptoms and complex pulmonary function tests could not be performed due to the patient's age limitations. Swallowing function was evaluated by swallowing tests with water-soluble contrast.
+
+Therapy
+Initial treatment at the center was with nusinersen (Spinraza, Biogen, MA USA) at 18 months. Administration was intrathecal, 12 mg/5mL in four occasions, for drug impregnation every 14 days. The patient subsequently increased baseline scores in the CHOP INTEND scale by 30 points and in the HFMSE scale by 17 points.
+
+Following administration of intrathecal nusinersen, the patient did not experience any adverse effects related to the medication and two months after administration of this medication, the patient showed a significant increase in CHOP INTEND and HFMSE scores.
+
+In December 2020, when the patient was 23 months old, after evaluating the progress in motor function, the possibility of having an additional improvement with the application of onasemnogene abeparvovec-xioi was agreed with the parents. They were explained the absence of evidence and the possible adverse effects. After evaluating the risk and the benefit, it was decided to administer onasemnogene abeparvovec-xioi (Zolgensma, Novartis, Switzerland), 1.1 x 1014 of viral particles per kilogram of weight, 5.5 mL/kg in infusion for 60 minutes. The application of the therapy was performed in hospital and the patient presented as adverse effects fever, thrombocytopenia and elevation of AST and ALT twice in their normal value.
+
+Subsequently, monthly assessments of motor function were performed using the CHOP INTEND and HFMSE scales and the patient progressed very favourably to being able to walk with support.
+
+Follow-up and outcomes
+The patient is currently in the process of normalizing AST and ALT and intrathecal nusinersen is planned to be continued in the coming months; the patient continues to gain motor skills over time.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3294_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3294_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..924c54752662ea999c00868a57460e9ff4d5d8b8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3294_en.txt
@@ -0,0 +1,9 @@
+A 20-year-old man with psychomotor delay and a history of epilepsy was admitted to the emergency department of the State University Hospital in Haiti for abdominal distension, rigidity, generalized pain, absence of bowel movements and gas, and a history of vomiting. He had a history of falling on a sharp object that pierced his perineum 6 days prior, with the onset of symptoms 3 days later. Vital signs on admission were blood pressure 104/58 mmHg, heart rate 138 beats/min, respiratory rate 20 breaths/min, temperature 36.2 degrees Celsius, and oxygen saturation 98 % on room air. Initial physical examination revealed rebound tenderness, decreased bowel sounds, and diffuse pain. Rectal examination showed a clean anal margin, tonically competent anal sphincter, and a rectal ampulla filled with stool. He had a functional impairment of grade B according to the Fränkel classification, with a lesion level at L2/L3. The initial diagnosis on admission was peritonitis due to hollow organ perforation with a Fränkel grade B spinal cord injury. Initial treatment included ceftriaxone 2 g IV, metronidazole 500 mg IV, tramadol 100 mg, omeprazole 40 mg IV, dexamethasone 8 mg IV, tetanus serum 5000 U/ml, intra-rectal fleet enema, fluid resuscitation with Ringer lactate, and placement of a Foley catheter for diuresis monitoring. Laboratory tests showed a hemoglobin level of 16 g/dL, white blood cell count of 3250, urea level of 25 mg/dL, creatinine level of 6.9 mg/dL, and normal electrolyte levels. No imaging studies were available at the center. After anesthetic evaluation, the decision was made to proceed to the operating room, because he becomes hemodynamically unstable with a blood pressure of 90/50 mmHg, heart rate of 148, oxygen saturation of 94 %, and a urinary drainage bag containing 400 cc of highly colored urine was emptied.
+
+In the operating room, the abdomen was accessed through a supra umbilical-pubic incision that was later extended. After resecting various anatomical planes, the abdominal cavity was opened, revealing a highly dilated rectum with areas of extensive necrosis at the base.
+
+The colon was dissected, revealing dilation of the entire colonic frame using Mattox's maneuver to explore the retroperitoneal zones 1 and 2. Three staged biopsies were performed (diseased zone, transition zone, and healthy zone).
+
+A double-barreled sigmoid colostomy was created, followed by irrigation of collected materials. Approximately 300 cc of reactive fluid was aspirated. During the procedure, the patient experienced three cardiac arrests but was successfully resuscitated with the transfusion of two units of compatible blood. Due to the patient's inability to tolerate the rest of the procedure, closure was done using the Bogota technique to delay definitive closure.
+
+The surgery lasted about 2 h and 40 min, and the patient was transferred to the postoperative care unit with a diagnosis of Hirschsprung's disease complicated by severe acidosis and acute renal failure. The patient left the operating room in a relatively stable condition with the following vital signs: blood pressure 130/60 mmHg, heart rate 70 beats/min, and oxygen saturation 93 % on room air. However, approximately 15 min later in the postoperative period, the patient's condition deteriorated with blood pressure dropping to 63/39 mmHg, heart rate increasing to 154 beats/min, respiratory rate of 44 breaths/min, temperature of 39 degrees Celsius, and oxygen saturation of 70 % with supplemental oxygen. About 4 h later, the patient passed away.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3297_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3297_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c6666ce6944a08205d1b02b44b2e5ee6d8148b23
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3297_en.txt
@@ -0,0 +1,25 @@
+We admitted a child of 3 years and 11 months to the pediatric intensive care unit (PICU) of Montpellier University Hospital following a sudden collapse at home.
+
+The event occurred at about 1 pm, approximately 5 min after the child woke from a nap showing sudden eye rolling and loss of consciousness, but no abnormal movements. The father made the decision to transport her in his vehicle to the nearest medical center. Upon arrival 15 min later, the child was lifeless with cardiac asystole on electrocardiogram (ECG) and the medical team began cardiopulmonary resuscitation (CPR).
+
+At admission, the child was pale and cold and showed no hematoma, purpura, rash or wound. Abundant digestive hemorrhage of black blood was aspirated by a gastric tube. Expired CO2 was very low, 20 mmHg, indicating prolonged low blood flow. ECG monitoring showed persistent asystole. After discussion with the referral service, there was no indication for circulatory extracorporeal membrane oxygenation. Resuscitation was stopped and death declared after 80 min of CPR performed by health professionals.
+
+The parents were immediately interviewed and they asked for all exams, including an autopsy, to identify the cause of their child’s death. The forensic pathologist was contacted and, after being fully informed of all events prior to the child’s death, decided that an autopsy should be carried out, for both legal and medical purposes.
+
+This girl was the first child of non-consanguineous Caucasian parents, born full-term with low weight for gestational age (2330 g at 39 weeks of gestation). She was without significant health problems and her vaccinations were up to date on her health record. The child had had gastroenteritis 3 weeks earlier. Two days before the event, she had a fever associated with fatigue and abdominal pain in the right iliac fossa. For this reason, she was kept at home and was examined by the general practitioner, who found no worrisome signs. Treatment with trimebutine maleate and domperidone was prescribed. The previous night, the father noted a small amount of vomiting and more frequent liquid intake. In the morning, she woke at 7 am with an occipital headache relieved with paracetamol. When she woke from her nap, she spoke correctly and had perioral cyanosis without any other sign of respiratory distress.
+
+As for her family, her father had convulsions in childhood, from 6 months to 12 years, and was treated intermittently with diazepam. Her maternal great-grandmother died suddenly at the age of 25–35 years from a ruptured intracranial aneurysm.
+
+Immediately after death, transthoracic puncture in the cardiac area was performed to collect blood. The puncture, however, brought back 10 ml of yellow serous fluid, which prompted an echocardiography that revealed a large pericardial effusion. The analysis of the pericardial fluid was indicative of an exudate (albumin 46 g/L, protein 66.4 g/L, LDH 344 IU/L), with 440 cells/mm3 (73% granulocytes, 24% lymphocytes). Direct examination by Gram staining and bacterial culture was negative. The search for a panel of respiratory viruses by real-time polymerase chain reaction (PCR) was positive for respiratory syncytial virus (RSV).
+
+Bacterial cultures of urine, cerebrospinal fluid (CSF) and blood were negative, and stool culture found neither fungal nor specific pathogenic bacteria, including clostridium botulinum. Bordetella pertussis and parapertussis were not found in nasal swabs. No other bacterial or viral analysis was performed on nasal specimens. The search for viruses in CSF, stool, and blood was also negative. Laboratory tests found normal concentrations for hemoglobin, C-reactive protein, and procalcitonin, while leukocyte (19.4 109/L) and platelet (448 109/L) counts were slightly elevated. The serum levels of immunoglobulins were normal for the age. Chromatography found no abnormal peak suggestive of aminoacidopathy, and the acylcarnitine profile was normal. No psychotropic or narcotic drugs were detected in the blood. Serum paracetamol concentration was within the therapeutic range (11.6 mg/L) but domperidone was undetectable. The carboxyhemoglobin level measured in the blood sample at admission was 0%. Radiography of the entire skeleton found no significant abnormality, including no recent or old fracture.
+
+The autopsy was performed 48 h after death. External examination found normal development: weight 14.4 kg; height 100 cm. There was no morphological abnormality and no lesion suggestive of maltreatment or trauma. The internal examination found no malformation or visceral malposition. There was nonspecific polyvisceral congestion, as well as global cerebral edema without hemorrhage or mass effect, which could be attributed to the prolonged resuscitation. Several centimetric and infracentimetric flexible lymphadenopathies were observed at the cervical and mesenteric levels, which may be trivial at this age. The examination also confirmed a pericardial effusion of about 30 mL and bilateral pleural effusions of a few milliliters.
+
+Pulmonary, hepatic and cardiac tissue fragments collected during autopsy were negative for a panel of viruses tested by PCR. Bacterial culture found postmortem contaminants, i.e., some lactococcus lactis in the liver and lungs, with klebsiella oxytoca after enrichment in the lung tissue.
+
+Histopathological examination of the tissues was normal except in the lungs and heart. Diffuse edematous lesions associated with severe alveolar hemorrhages were observed, particularly in the left lung. Rare foci of inflammatory interstitial lesions and discrete bronchitis lesions of the pedicular bronchi were also present in both lungs. Mild to moderate inflammatory infiltrate consisting of T lymphocytes and macrophages (respectively, about 7 per field and 9 per field under × 40 magnification) was found in the myocardium and epicardium, consistent with the diagnosis of myoepicarditis. Edematous foci and some myocyte changes were visualized. Immunolabeling with anti-CD3, −CD45 and -CD68 antibodies highlighted the inflammatory infiltrates. Cardioneuropathy was also observed, with embracing and sometimes penetration of autonomic nerves and ganglion cells by inflammatory cells.
+
+A joint consultation, in the presence of a pediatrician and psychologist, was held with the parents 7 weeks after the death of their daughter. The parents were told that the most likely cause of death appeared to be a cardiac rhythm disorder occurring in the context of myocardial inflammation. Five months after this first consultation, a new meeting with the family was requested because we had just received the molecular analysis of unexplained sudden death genes on an index case. Among a panel of 31 genes, a heterozygous variation was identified in exon 6 of the myosin light chain 2 (MYL2) gene, responsible for the replacement of a glutamic acid by alanine at position 134 p and probably corresponding to a pathogenic variant (class 4 of pathogenicity). At this meeting, we thus proposed a family study to investigate the segregation of this variant with the phenotype and to determine its deleteriousness. Their 20-month-old son was examined by a pediatric cardiologist. Clinical examination was normal, with easily palpated axillary and femoral pulses, normal blood pressure and absence of cardiac murmur. ECG showed a regular sinus rhythm at 126 bpm and conduction and repolarization normal for age. Echocardiography found normal intracardiac architecture, good biventricular function, and the absence of any sign suggestive of cardiomyopathy, valvulopathy or pulmonary arterial hypertension. Molecular analysis of the MYL2 gene, however, revealed the same heterozygous variation as in his sister. The parents were also examined by an adult cardiologist. ECG and echocardiography were normal for both. The mutation in the MYL2 gene was observed in the father only.
+
+These elements prompted a new reading of the cardiac histology by two anatomopathologists in two different laboratories, both of whom reported no evidence of arrhythmogenic right ventricular dysplasia or hypertrophic cardiomyopathy (HCM).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3321_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3321_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8ac0e50b567af8e6d6ec6edff72482a5817c9349
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3321_en.txt
@@ -0,0 +1,15 @@
+70-year-old woman with a medical history of hypertension, diabetes, hyperlipidemia, ischemic heart disease, and degenerative joint disease who presented with progressive weakness of proximal muscles and myalgia over several months. The patient's current medication was tramadol/paracetamol 75 + 650 mg every eight hours, fluoxetine 20 mg/day, furosemide 40 mg/day, metformin 1,000 mg/day, linagliptin 2.5 mg/day, and simvastatin 20 mg/day (for the last seven years).
+
+She began to have problems climbing steps and getting out of a chair. Her weakness progressed gradually until she was unable to walk unaided, comb her hair or bathe without support. She reported anorexia and weight loss of 15% in the past 10 months. She denied fever or associated chills, rash, oral ulcers, dyspnoea, chest pain, dysphagia or visual disturbances. There was no family history of neuromuscular disease.
+
+The physical examination revealed significant proximal muscle weakness of the upper and lower extremities (shoulder abduction 3/5, elbow flexion 4/5, hip flexion 3/5, knee flexion 4/5 bilaterally, according to the Medical Research Council scale of muscle strength) and was unable to rise from a sitting position. Deep tendon reflexes, sensation and coordination were intact. Cardiac and pulmonary auscultation and abdominal examination revealed no abnormalities. Physical examination did not reveal cutaneous manifestations suggestive of dermatomyositis.
+
+Laboratory tests showed an elevation of creatine kinase (2,954 U/L, ref. 10-149), aldolase (45.6 U/L, ref. <7.6), aspartate transaminase (124 U/L, ref. 10-31) and alanine transaminase (95 U/L, ref. 10-31). Serologic tests for herpes simplex virus, Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, human immunodeficiency virus and hepatitis C were negative. Serology for hepatitis B virus revealed a past infection (hepatitis B virus DNA was negative). Thyroid function was normal.
+
+Nerve conduction studies and electromyography showed abnormal spontaneous muscle activity in proximal muscles of the upper and lower extremities, suggestive of irritable myopathy. A biopsy of the right deltoid muscle showed deep myopathic features with numerous necrotic fibers, some regenerating fibers, and perimysial infiltrate of inflammatory cells (predominantly composed of macrophages and T cells), combined with a diffuse overexpression of major histocompatibility complex class I. The test for antibodies to connective tissue diseases and myositis, including antinuclear antibodies, anti-dsDNA, anti-SSA, anti-SSB, anti-Sm, anti-RNP, anti-neutrophil cytoplasmic antibodies PR3, anti-neutrophil cytoplasmic antibodies MPO, and myositis panel for Mi2, Ku, SRP (signal recognition particle), PL7 (antithreonyl-tRNA synthetase), PL12 (antialanyl-tRNA synthetase), EJ (antiglycyl-tRNA synthetase), OJ (antiisoleucyl-tRNA synthetase), TIF1-γ (transcriptional intermediate factor 1 gamma), MDA5 (melanoma differentiation associated gene 5), SAE (small ubiquitin-like modifier activator enzyme), PM-Scl100, PM-Scl75, and Jo 1 (anti-histidyl-tRNA synthetase), was negative. Anti-3-hydroxy-3-methylglutaryl-coenzyme A (anti-HMG-CoA) reductase antibodies were positive (>200, ref. <20).
+
+Given the association between inflammatory myopathies and malignancy, cancer screening was reviewed. Colonoscopy, mammography, and past cervical cancer screening did not show significant abnormalities. Chest and abdominal computed tomography, thyroid ultrasound, and positron emission tomography were negative for malignancy.
+
+SINAM was diagnosed and the statin was discontinued. He started with 1 g methylprednisolone/day for three days, followed by 60 mg prednisolone/day (0.75 mg/kg/day). Due to the lack of improvement in his symptoms, he was started on intravenous immunoglobulin therapy for five consecutive days (0.4 g/kg/day).
+
+This combination of treatment allowed a significant improvement in muscle strength and myalgia, and a substantial reduction in the creatine kinase level, to 1,029 U/L. After 21 days of hospitalization, she was discharged with a decreasing dose of steroids and methotrexate was initiated. After three months of follow-up, the neurological examination was normal and the creatine kinase level returned to normal (15 U/L). At that time, the patient was medicated with methotrexate 10 mg/week and prednisolone 20 mg/day.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3348_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3348_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f32cc3e8b4457b039e1c260dbba54cf1214d7c5f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3348_en.txt
@@ -0,0 +1,5 @@
+The index case is that of an 18-year-old primigravida who was referred to the antenatal testing center for a growth scan at 35 weeks and 5 days gestation, due to lagging symphysio-fundal height measurement. She had no significant past medical history, and her antenatal course was uncomplicated. A detailed ultrasound scan was done and revealed a normal fetus with estimated fetal weight that was appropriate for gestational age, normal amniotic fluid index and a posterior placenta with a 3-vessel umbilical cord. There was a cystic structure with internal echoes, originating from the placenta at the point of the umbilical cord insertion, which was determined to be a 1.9 × 1.8 cm umbilical artery aneurysm on 3D and Doppler imaging. On subsequent imaging 3 days later at 36 weeks and 1 day, the aneurysm was noted to measure 3.06 × 1.79 cm, an increase in size from prior measurement. Umbilical artery Doppler studies were within normal limits. The middle cerebral artery peak systolic volume calculated was 1.04 MoM, which was at the higher end of the normal range. Fetal echocardiogram was done and revealed normal cardiac evaluation, with no abnormality detected in the ductus venosus velocimetry.
+
+Due to the increase in size of the aneurysm over a short interval, the patient was counseled regarding the risks of intra-uterine fetal demise and was transferred to the labor and delivery unit. Fetal monitoring via non-stress test revealed fetal tachycardia, with a baseline heart rate above 165 bpm and regular uterine contractions. Her calculated Bishop score was 2, she was remote from delivery with a category 2 tracing, and a potentially compromised fetus. The decision was then made to proceed with cesarean section delivery. A live female infant was delivered weighing 2,850 g; Apgar scores were 7 at 1 min and 9 at 5 min. The baby was admitted to the special care nursery for observation due to transient tachypnea. The newborn hemoglobin was 15.8 g/dL. Karyotyping subsequently revealed 46 XX.
+
+On pathological examination, the placenta was ovoid in shape with an eccentrically inserted 22 cm long 3-vessel edematous umbilical cord. There was a 2.5 × 2.4 × 1.2 cm dilated intact vessel containing a soft dark red blood clot, approximately 0.4 cm from the base of the umbilical cord. Surrounding the blood vessel was a 7.0 × 6.0 cm ovoid pale tan area. The umbilical artery aneurysm was confirmed at the point of insertion onto the placental disc. Microscopic and macroscopic chorionic pseudocysts were also noted.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3349_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3349_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c949d0a1c942ec8eed4ffb7acf49d0769d8d8661
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3349_en.txt
@@ -0,0 +1,9 @@
+57-year-old male patient, born in Chile, with a history of Beta-thalassemia in pharmacological treatment with oral folic acid and iron, with a history of BCG vaccination in childhood, eutrophic.
+
+During 2021, he presented a case of a year-long evolution of significant weight loss, loss of appetite and abdominal pain of a colic type. The initial laboratory study showed a normocytic, normochromic anaemia with a negative serological study of hepatitis B and C viruses and a non-reactive HIV. Complementary study: Computed tomography (CT) of the abdomen and pelvis: segmental thickening of the ascending and descending colon with adjacent inflammatory changes; upper gastrointestinal endoscopy: no significant alterations. Incomplete colonoscopy without ileocecal evaluation: two ulcerated lesions in the ascending and sigmoid colon, suggestive of neoplasia. Colon mucosa biopsies reported chronic active colitis with the presence of granulomas, and negative Ziehl Neelsen and Kinyoun stains. A PET/CT FDG scan was performed due to suspicion of neoplasia, which reported a distal ileal and inflammatory ascending and descending colon segments, and hypermetabolic ileocolic lymph nodes, suggestive of IBD. Subsequently, an MRI enterography was performed, which reported images compatible with ileocecal involvement in Crohn's disease. Based on these findings, a diagnosis of inflammatory phenotype of Crohn's disease with ileocolonic involvement was made, and corticosteroid therapy (prednisone 1 mg/kg with progressive tapering in 8 weeks) and azathioprine were initiated for 2 months.
+
+Patient develops clinical deterioration characterised by abdominal pain, dysenteric diarrhea and fever of 38 °C. Laboratory highlights haemoglobin of 8.9 g/dl, white blood cells of 2,490, C reactive protein of 30.18 mg/dl, VHS 15 and severe hypoalbuminaemia of 2.6 g/dl. He is hospitalised for severe crisis of Crohn's disease and eventual need of biological therapy.
+
+On admission, intravenous corticosteroid therapy was initiated and a pre-biological study was requested. Abdominal CT with inflammatory ileocolonic involvement, Quantiferon TB positive, with chest radiography and chest CT without alterations.
+
+A new ileocolonoscopy was performed which reported: "active Crohn's colitis with ulcerative involvement of the ileum, sigmoid and rectum". Staged biopsies reported necrotizing granulomas with positive Ziehl Neelsen staining in all samples. Corticosteroids were de-escalated and anti-tuberculosis therapy was initiated with a standard scheme with a good early clinical response.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3351_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3351_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58927762d558b604c19799c871a67e28da9f21c0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3351_en.txt
@@ -0,0 +1,11 @@
+19-year-old pregnant woman from the city of Jauja in Junín, with a history of previous pregnancy without complications and irregular attendance at her prenatal check-ups. No previous history of threatened abortion in her current pregnancy. With a family history of a mother with a diagnosis of pulmonary hydatid disease that was treated. She presented abdominal pain of the stabbing type for four months, with a sensation of a mass in the left hypochondrium that was occasionally associated with dyspnoea during inspiration and expiration.
+
+She was admitted to hospital for exacerbation of symptoms with vital signs: blood pressure of 120/70 mmHg, heart rate of 60 per min, respiratory rate of 16 per min, temperature of 36.5 °C. Physical examination showed a pregnant abdomen, uterine height of 27 cm, fetal heartbeat of 140 per min, estimated weight by ultrasound of 2532 g (8th percentile) with a gestational age of 37 weeks and 2 days, with a diagnosis of intrauterine growth restriction. Presence of a palpable tumour in the upper left half of the abdomen of approximately 10 cm × 10 cm with a hard, mobile and non-painful consistency to the touch.
+
+Laboratory study reported leukocytes: 17,400/uL, segmented: 15,400/uL, hemoglobin: 14 g/dL, platelets: 12,200/uL, C-reactive protein: 26.47 mg/dL, serum creatinine: 0.57 mg/dL, ALT: 14.79 U/L, AST: 5.19 U/L, total bilirubin: 0.27 mg/dL. Serologic study for HIV, syphilis and hepatitis B was performed and was non-reactive.
+
+The transabdominal ultrasound evaluation showed a large cystic image dependent on the spleen measuring 190 mm × 154 mm × 164 mm, with an approximate volume of 2500 cm3, with thin walls with a mass effect on adjacent structures, very reduced splenic parenchyma, without calcifications.
+
+The cesarean section allowed a product of 37 weeks according to Capurro, Apgar 9/9, with weight of 2225 g, head circumference of 32 cm, abdominal circumference of 27 cm, height of 43 cm. Then an exploratory laparotomy was performed where a surgical piece with characteristics of abdominal tumour depending on the spleen was obtained. The measures were 28 cm × 17.5 cm × 12 cm, with transverse section transparent serous liquid content, and with multiple cystic formations inside. In the histopathology of the spleen by staining with haematoxylin and eosin, numerous inflammatory cells and hydatid membranes with viable head were found.
+
+The patient recovered satisfactorily. A computed tomography of the thorax, abdomen and pelvis was performed, which did not find any hepatic, pulmonary or other organ involvement. She received prophylaxis with albendazole 400 mg orally every 12 h for 6 weeks, pneumococcal vaccination and seasonal influenza vaccination. She was discharged without observing a recurrence of hydatid foci during follow-up. The newborn gained adequate weight and height, did not receive specific treatment and received his vaccination according to his months of life.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3377_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3377_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f2ce63c3955af23dcae9670f61736827666bdc1f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3377_en.txt
@@ -0,0 +1,7 @@
+A 4-year-old Japanese girl with B-cell acute lymphoblastic leukemia (ALL) presented to the emergency room with febrile convulsion. The age of disease onset was 3 years and the patient received maintenance chemotherapy in our outpatient clinic. The patient had a high fever (40.1 C°), tachypnea (respiratory rate 38/min), and tachycardia (pulse rate 180/min). She was diagnosed with febrile neutropenia and systemic inflammatory response syndrome (SIRS) based on her neutrophil count, which was 322/μL, as well as remarkably elevated inflammatory responses (CRP: 2.2 mg/dl; procalicitonin: 67.8 ng/mL). Chest X-ray revealed mild perihilar infiltration with normal cardiothoracic ratio (51.6%), and chest computed tomographic scanning showed bilateral consolidation and pleural effusion. Within two hours after admission, the patient’s respiratory condition continued to deteriorate despite oxygen supplementation while lactate levels increased to 62.6 mg/dL. The patient was transferred to the intensive care unit for mechanical ventilation; however, her systolic blood pressure decreased gradually from 116 to 40 mmHg despite hydration and blood transfusion for volume expansion. Therefore, catecholamine administration, intravenous immunoglobulin, and continuous venovenous hemofiltration were initiated. As we suspected myocardial dysfunction, cardiac ultrasound was performed and showed depressed left ventricular function with an ejection fraction of 27%, as well as a left ventricular Tei index of 0.62 indicating global systolic and diastolic ventricular function, mitral regurgitation, and tricuspid regurgitation. An electrocardiogram showed ST-T wave change in V4-6. Furthermore, a marked increase in myocardial markers was noted, including Troponin-I 0.541 ng/mL (normal 0-0.04 ng/mL), myoglobin 91.2 ng/mL (normal 12.8-66.1 ng/mL), and CK-MB 10.6 ng/mL (0.9-5.9 ng/mL).
+
+Two days after admission to the hospital, her systolic blood pressure improved to 120 mmHg and inotropic support was gradually reduced and stopped by day 9. In addition to the administration of milrinone for 11 days, continuous hemofiltration was carried out for 6 days to treat the heart failure. Subsequently, left ventricular function gradually improved, and myocardial markers returned to normal levels 17 days after admission to the hospital. Finally, she was discharged from the intensive care unit on day 13.
+
+Three separate blood cultures were negative. Additionally, the patient tested negative for influenza virus, human-metapneumovirus, adenovirus, and Group A streptococcus using rapid antigen tests; however, RSV antigens were detected in a nasal swab at the time of hospital admission. Moreover, seroconversion of RSV antibody titers (< 4 and 16) was confirmed using a neutralizing antibody test (SRL Inc., Tokyo, Japan). In order to elucidate the pathophysiology of RSV infection, serially collected tracheal tube aspirates and serum samples were examined using real-time RT-PCR. Real-time RT-PCR analysis detected high amounts of RSV type B RNA in the tracheal aspirates on day 2 (1.6 × 109 copies/ml) and day 5 (1.4 × 108 copies/ml) after the onset of the disease. Interestingly, viral RNA was also detected in the serum sample obtained on day 1 of the illness (3.2 × 104 copies/ml), but it had decreased to undetectable levels in serum samples collected on days 5 and 8.
+
+In order to examine the pathophysiology of this severe cardiac complication caused by RSV infection, various cytokines and chemokines were measured in serially collected serum samples using the Cytometric Bead Array system. Serum samples were serially collected before the onset of the RSV infection and on days 1, 5, 7, and 14 after illness onset. IL-6, IL-10, IL-8, IFN-γ, MCP-1, and IP-10 were markedly elevated at the time of disease onset. The levels of these biomarkers returned to normal by 14 days after illness onset.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_343_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_343_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d7c141a33dcd90cac2f34e8af693fb42dd4f7463
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_343_en.txt
@@ -0,0 +1,7 @@
+A 26-year-old woman who presented with unexplained fever was admitted to our hospital for further examination.
+The patient showed a clear mind and no significant weight loss in the past three months.
+She had no smoking or drinking history and no family history of tumors. She had no cough or expectoration. Ethical approval for publishing this case was obtained from the First Medical College of Zhejiang Chinese Medical University Research Ethics Committee.
+She denied a family history of hereditary disease.
+Her physical examination showed nothing abnormal.
+Her thyroid function tests showed elevated levels of thyroid-stimulating hormone and antithyroglobulin antibody, with a decreased level of thyroglobulin. Her biochemical tests showed elevated levels of triglycerides and cholesterol. Routine blood tests showed neutrophilia and lymphocytosis. Humoral tumor screening presented an elevated level of CA50. Her blood coagulation function was normal.
+She underwent a positron emission tomography/magnetic resonance imaging (PET/MRI) examination in our hospital. The PET/MRI images showed a space-occupying lesion in the left thyroid with increased fluorodeoxyglucose (FDG) metabolism , and a Computer tomography (CT) scan revealed that the lesions in the left lobe of the thyroid showed low-density nodular changes involving the thyroid capsule . The PET/MRI images also showed multiple diffuse nodules (maximum 0.8 cm) in the lung with increased FDG metabolism and multiple nodules (maximum 2.0 cm) in the liver with increased FDG metabolism . Chest CT showed multiple metastases in both lungs, multiple low-density shadows in the liver, and small calcifications in the left breast . Abdominal ultrasound showed a fatty liver and multiple liver nodules . MRI showed multiple space-occupying lesions in the liver . Whole-body bone imaging and organ tomography showed a metabolically active left tibia and unevenly increased local bone density .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_363_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_363_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f989e01e88d94f4deba1170fe6745263c0f6e463
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_363_en.txt
@@ -0,0 +1,9 @@
+A 17-year-old female college student presented to her GP with a one-year history of weight loss and poor appetite. She had a past medical history of pulmonary atresia and ventricular septal defect, surgically corrected at the age of 4 with a 18 mm Contegra conduit and was transitioning from paediatric to adult congenital cardiac care. She was initially suspected to have an eating disorder due to low mood and decreasing weight (from 53 to 39 kg). She subsequently developed a lower limb vasculitic rash. At that time urinalysis demonstrated haemoproteinuria (urine PCR 116 mg/mmol) resulting in an urgent renal referral. Her serum creatinine was 128 μmol/l (estimated glomerular filtration rate (eGFR) 58 ml/min/1.73 m2), however Cystatin C (which estimates GFR independent of muscle mass low muscle mass) estimated her GFR at 16 ml/min/1.73 m2 and accordingly she was admitted to hospital urgently for further urgent investigations.
+On admission, she had a low body mass index (BMI 15) and was found to be pyrexial and have massive splenomegaly (19 cm). Initial immunological workup revealed a weakly positive ANCA PR3 (PR3 positive 2.3 (reference range 0–0.9)). She was commenced on a reducing regime of prednisolone on the second day of her admission empirically for presumed ANCA vasculitis, which resulted in a rapid resolution of the rash and improvement in her creatinine levels.
+Rheumatology review was requested in view of a history of intermittent joint pains and ocular dryness. Blood tests were requested, the results of which are illustrated in Table .
+A renal biopsy showed focal segmental proliferative and necrotising lesions with double contours and fibrocellular crescents. Tubulointerstitium was normal with no acute tubular necrosis or chronic changes. Immunofluorescence showed C3 (3 +), Lambda (2 +), IgM (1 +), C1q (+ / −). Immune complexes were seen in paramesangial, mesangial and subepithelial locations. These biopsy features were in keeping with an infection related membranoproliferative glomerulonephritis (Type 1) pattern.
+Given the clinical features, renal biopsy findings and immunological abnormalities a potential diagnosis of cryoglobulinaemic, rather than ANCA vasculitis, was made with further testing confirming a Type 3 cryoglobulin (polyclonal IgG). Serial blood cultures were negative and initial investigations for an infectious cause (e.g., Hepatitis B, C serology and HIV antibody screen) were also negative. Bone marrow biopsy showed reactive changes and excluded haematological malignancy.
+Additional investigations to identify an infective cause resulted in an echocardiogram showing vegetations on her conduit. A positron emission tomography (PET) scan was then requested as the changes seen on the conduit could have been due to conduit degeneration, which is common after 13 years. The PET scan showed uptake around the conduit valve in the pulmonary position supporting an infectious or inflammatory aetiology, with a CT pulmonary angiography (CTPA) demonstrating septic emboli in the anterior basal right lower lobe.
+Empirical antibiotics treatment for endocarditis (vancomycin, gentamycin, and rifampicin) were commenced. Inflammatory markers and renal function failed to improve following two weeks of intravenous antibiotics for bacterial endocarditis and accordingly the patient was referred for surgical revision of her conduit. This was performed at a tertiary paediatric cardiothoracic unit. Tissue samples cultured positive for Bartonella and aspergillus species. Antibiotic therapy was altered to doxycycline and anti-fungal therapy whilst oral steroids were continued. Following completion of antibiotic treatment and steroid taper, she achieved resolution of her cryoglobulinaemia and normalization of renal function, RhF and C4.
+The unifying, final diagnosis was, therefore, Type 3 Cryoglobulinaemia with crescentic glomerulonephritis secondary to Bartonella endocarditis + / − fungal infection of conduit. On reviewing the social history, the patient’s mother revealed that she had adopted several stray cats in the preceding year; this was identified as the cause of the Bartonella infection.
+The patient was subsequently reviewed in the Rheumatology outpatient clinic, approximately six months following her initial admission. She was found to be progressing well; her splenomegaly had resolved, appetite improved, she had regained weight and her antibiotics and steroids have been stopped. Her biochemical markers have also improved; with creatinine of 51 μmol/l (from 128, peak creatinine 192 μmol/l), CKD-EPI-eGFR > 90 ml/min/1.73m2 (from 16) and her most recent cryoglobulin remains negative. Her post-operative follow up in the adult congenital cardiac clinic has shown an excellent outcome. She has returned to college, however, has continued to house stray cats at home despite medical advice.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_38_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_38_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..30887d380d84ee55072058fb7d4ea6690b3761eb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_38_en.txt
@@ -0,0 +1,8 @@
+A 66-year-old male patient was referred to our department with a right intraventricular mass that had been diagnosed as anaplastic ependymoma on open biopsy at another hospital.
+He had been followed because of diabetes mellitus, hyperlipidemia, and carotid artery stenosis but had been otherwise well. Two months before admission to our department, he had undergone magnetic resonance imaging (MRI) of the head, which incidentally revealed a mass lesion in the right lateral ventricle, for which he had been referred to the neurosurgery department at another hospital. He underwent a biopsy and the tumor was diagnosed as an anaplastic ependymoma. Although he had been initially referred to a Radiation Oncology Department for adjuvant radiation therapy, the provider referred him to our Department of Neurosurgery because of concerns that the residual tumor was not suitable for radiotherapy without prior cytoreduction.
+Physical examination showed some short-term memory impairment, and ophthalmological examination revealed a visual field compromise (quadrantanopia) likely related to access corridor chosen for the biopsy. There was no focal motor weakness, major sensory deficit, dysmetria, or ataxia.
+Computed tomography (CT) showed two hyperdense foci in the inferior horn and the atrium of the right lateral ventricle with peri-lesional edema of the ipsilateral temporo-occipital parenchyma [Figure and ]. The intraventricular lesions showed heterogeneous enhancement on postcontrast T1-weighted imaging (T1WI), on which the lesions appeared to arise from the choroid plexus [Figure –]. The postcontrast T1WI also showed additional tumor dissemination in the left lateral ventricle and around the brain stem . Further whole-spine imaging showed leptomeningeal dissemination in the lumbar region (not shown).
+The patient was taken to surgery and underwent subtotal removal of the tumor in the right lateral ventricle via an inferior temporal gyrus approach [Figure and ]. The tumor was solid, densely adherent to the choroid plexus but floating in the ventricle .
+Histopathologically, the tumor showed diffuse, tightly packed monotonous neoplastic cells with large, round, or slightly irregular nuclei and a scant to moderate amount of eosinophilic cytoplasm . There were numerous mitotic figures and foci of focal necrosis. Perivascular pseudorosettes were not discernible. On immunohistochemical staining panels, the tumor cells were positive for leukocyte common antigen (LCA), CD20 , CD30, CD79a, bcl-2, bcl-6 , and MUM-1; and negative for cytokeratins, epithelial membrane antigen, S-100 protein, and glial fibrillary acidic protein.
+Ophthalmological examination showed no intraocular lesions. CT of the chest, abdomen, and pelvis was interpreted as normal and bone marrow biopsy showed no atypical lymphocytic infiltrate. The patient was thus diagnosed with primary diffuse large B-cell CNS lymphoma likely originating in the choroid plexus.
+The patient underwent chemotherapy with high-dose methotrexate (3500 mg/m2) every 14 days for three courses, followed by a course of chemotherapy with carboplatin (360 mg calculated by using the Calvert formula) and etoposide (80 mg/m2) 14 days after the third administration of high-dose methotrexate. After chemotherapy, cerebrospinal fluid (CSF) samples were obtained for cytology, which was negative for malignant cells. After the patient had undergone whole-brain irradiation (1.8 Gy × 22), postcontrast T1WI showed complete resolution of all previously visible CNS disease. Physical examination showed persistent quadrantanopia—unchanged from the patients status prior to subtotal removal of tumor—and amelioration of his short-term memory impairment. Because meningeal dissemination recurred during the follow-up period, the patient is currently again receiving chemotherapy with high-dose methotrexate in our department (8 months after surgery).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_39_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_39_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..64855a1292e850dc23e0316e420337252293fefd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_39_en.txt
@@ -0,0 +1,11 @@
+A 12 year old girl initially presented at 6 years of age with exercise intolerance. She was born to non-consanguineous healthy parents. She has two younger, healthy brothers although one has autistic spectrum disorder. She presented with shortness of breath with low-intensity aerobic exercise such as jogging or biking. She had no chest pain or palpitations. Cardiac examination at 7 years old noted a normal clinical examination however her electrocardiogram revealed biventricular hypertrophy. Subsequent echocardiogram and cardiac MRI identified thickening of the posterior left ventricle (LV) wall, apex and septum consistent with a non-compaction cardiomyopathy. Bilateral ventricular systolic and diastolic function was normal with a LV ejection fraction of 63%. Stress testing confirmed a normal baseline heart rate, blood pressure and a normal response to exercise. Pulmonary function tests were normal. Biochemical testing revealed normal serum creatine kinase (CK) with a slight elevation of serum troponin T. Genetic testing included normal SCN5A sequencing, chromosomal microarray and hypertrophic and dilated cardiomyopathy panel (GeneDx, Gaithersburg, MD).
+Over the next year, she reported exercise-induced myalgia. She had no muscle weakness, cramping or pigmenturia. She could perform short bursts of anaerobic activity without difficulty however, sustained activity would elicit muscle pain. Biochemical testing was abnormal on multiple occasions including: plasma lactate (2.3 – 4.6 mmol/L; normal 0.5 - 2.2 mmol/L) and plasma alanine (603 - 841 μmol /L; normal 152 - 547 μmol/L). Her acylcarnitine profile and carnitine levels (free and total) were normal as was urine organic acid analysis. Repeated serum CK, liver and renal function were normal. Neuromuscular assessment at 9 years of age showed her cranial nerves, muscle power, reflexes, sensory testing and coordination to be within normal limits. Gower manoeuvre was negative and gait was normal. Electrodiagnostic testing confirmed normal right median and sural nerve sensory responses and normal right median and tibial nerve motor responses. Concentric needle electromyography of her right quadriceps was normal.
+Muscle biopsy of the quadriceps performed at 9 years of age revealed a preponderance of type 1 fibers although no other microscopic, histochemical or ultrastructural abnormalities were apparent. Muscle respiratory chain enzyme testing and muscle mitochondrial DNA sequencing was normal. MRI of the brain at 10 years of age revealed abnormal T2 and T2FLAIR hyperintensity in the periventricular and trigonal white matter bilaterally. MR spectroscopy of the basal ganglia and subcortical white matter was normal. MRI of the proximal leg muscles was unremarkable. Treatment with ubiquinone, vitamin B50 complex, levocarnitine and ubiquinol were started at 10 years old without apparent clinical effect. Creatine monohydrate was added several months later after which she reported a sustained, subjective clinical improvement in her exercise tolerance.
+Neuromuscular evaluation at 12 years old was significant for bilateral extensor hallucis longus and extensor digitorum brevis weakness (4/5). Strength testing of all other muscles was within normal limits. Cranial nerve testing, deep tendon reflexes, sensory testing and coordination were within normal limits. Repeat neurophysiological testing revealed a reduction in her right common peroneal nerve motor response due to a slight CMAP amplitude reduction of 2.1 mV (normal >2.4 mV). Motor responses at the left peroneal, right tibial, right median and ulnar nerves were normal. Sensory responses at the right median, ulnar, superficial peroneal and sural nerves were normal. Concentric needle EMG of the right tibialis anterior and medial gastrocnemius was normal. Her most recent cardiac evaluation at 12 years old identified two new findings: electrocardiogram identified a new subclinical Wolf-Parkinson-White pre-excitation that was not noted on prior studies as well as evidence for LV diastolic dysfunction on echocardiogram.
+Her medical history was otherwise unremarkable. She was born at term with no complications. Early milestones were appropriate; she sat at 6 months old, pulled to stand by 12 months and walked independently by 18 months of age. Her growth parameters were stable; height (just <50th percentile) and weight (just < 25th percentile) following along her percentile curves from infancy. She has never had any seizures, headaches or endocrine dysfunction. She has no oculobulbar symptoms and no sensory or autonomic dysfunction. Her visual acuity and hearing were normal. She excelled academically, achieving high grades in a gifted program.
+We followed standard manufacturer protocols to perform target capture with the Agilent SureSelect All Exon 50 MB (V3) exome enrichment kit and sequencing of 100 bp paired end reads on Illumina Hiseq 2000, which generated over 12.4 Gb of data for the proband. We removed adaptor sequences and quality trimmed reads using the Fastx toolkit and then used a custom script to ensure that only read pairs with both mates present were subsequently used. Reads were aligned to hg19 with BWA 0.5.9 and indel realignment was done using the GATK . Duplicate reads were then marked using Picard and excluded from downstream analyses. We assessed coverage of consensus coding sequence (CCDS) bases using the GATK, which showed that all samples had >91% of CCDS bases covered by at least 10 reads, and >85% of CCDS bases covered by at least 20 reads. Single nucleotide variants (SNVs) and short insertions and deletions (indels) were called using samtools mpileup with the extended base alignment quality (BAQ) adjustment (-E), and were then quality filtered to require at least 20% of reads supporting the variant call. Variants were annotated using both Annovar and custom scripts to identify whether they affected protein coding sequence, and whether they had previously been seen in dbSNP132, the 1000 genomes dataset (Nov 2011), the NHLBI GO exomes, or in approximately 500 exomes previously sequenced at our center.
+Given the suspicion of a mitochondrial disorder based on the patient’s clinical phenotype, we first filtered the list of non-synonymous variants to retain only those present in genes in the MitoCarta Inventory of Mammalian Mitochondrial Genes and which were seen in 7 or fewer internal control exomes (of ~500) and at less than 1% frequency in the 1000 genomes and NHLBI GO exome databases. There were 13 genes with single heterozygous variants, and a single gene, GARS, with two rare heterozygous variants. The two GARS variants, NM_002047.2: c.1904C > T (p.Ser635Leu) and c.1787G > A (p.Arg596Gln) occur at highly conserved positions and are predicted to be deleterious by both SIFT (scores 0.01 and 0.00, respectively) and PolyPhen2 (scores 0.94 and 1.00, respectively). We then analyzed the remaining exome data and no convincing disease-causing variants were identified in any other genes relevant to previously reported neuromuscular disorders.
+We identified our patient to have a sequence variant in the MIB1 (mindbomb E3 ubiquitin protein ligase 1) gene which has been linked to non-compaction cardiomyopathy. Our patient’s MIB1 sequence variant has not been previously reported but did occur in a highly conserved region of this gene. We confirmed that the proband’s father carries the same MIB1 sequence variant although he shows no evidence of cardiomyopathy on clinical examination or echocardiogram.
+Sanger sequencing was used to validate the variants in GARS and to evaluate segregation in the family. Blood samples were obtained and DNA was extracted from the patient as well as her parents and two unaffected siblings. PCR amplification and sequencing was performed with primers 5′CAGATGATCCACCTACCTCAG3′ and 5′ATAACACAGGAAACTGGTTTGTC-3′ to test the c.1787G > A variant. PCR amplification was performed using 5′AGTGAAGATTTGGATTCCCG-3′ and 5′GGACTTGAGAATCTGGGCTC3′ primers and Sanger sequencing was done using 5′AAGAAGCAGTACACATTTCTAAG-3 and 5′GTAAGACAGTAGTTAGATAAC-3 primers, to test the c.1904C > T variant.
+Sanger sequencing confirmed the presence of these variants in the proband. The parents were each heterozygous for one of the mutations; c.1787G > A was inherited from her mother and c.1904C > T was inherited from her father . The c.1904C > T mutation has previously been reported to be disease-causing [,], the reported patient exhibited a clinical phenotype characterized by adolescent-onset foot deformity necessitating an orthopedic referral at the age 27 years old.
+Given the findings of recessive mutations in GARS and the knowledge that heterozygous mutations in this gene can cause disease, the family was evaluated in detail. The proband’s father reported no weakness or sensory deficits when examined at 55 years old. His clinical examination was entirely within normal limits. His electrodiagnostic testing, however, revealed evidence of a mild sensorimotor polyneuropathy with axonal features. Bilateral sural and superficial peroneal nerve sensory amplitudes were low. His common peroneal and tibial motor amplitudes were within normal limits. Concentric needle EMG of his right extensor digitorum brevis and abductor hallucis revealed fibrillation potentials and positive sharp waves in addition to chronic neurogenic changes. Needle EMG of his right tibialis anterior also revealed chronic neurogenic changes. The proband’s mother reported no functional difficulty. Her clinical examination, echocardiogram and nerve conduction studies at age 47 years old were within normal limits. Needle EMG was not performed. The proband’s two younger brothers had no significant findings on clinical examination or nerve conduction testing.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_404_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_404_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9c21a8a451aeab7cbe148702d22a2f55c9621e76
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_404_en.txt
@@ -0,0 +1,2 @@
+A 56-year-old male was diagnosed with multiple HCCs in Barcelona Clinic Liver Cancer (BCLC) stage B. The patient had chronic viral hepatitis B and received standard antiviral therapy. He had no medical history of glucose intolerance, autoimmune diseases, thyroid dysfunction, or other systemic diseases (e.g., Cushing’s syndrome), and no evidence of acute infection, trauma, or drug poisoning. He also had no family history of diabetes, autoimmune diseases, and hereditary diseases. Psychosocial assessment showed that the patient had no mental, physical, or emotional health issues. After unsuccessful treatment with trans-hepatic arterial chemotherapy and embolization (TACE), the patient voluntarily participated in the CISLD-1 trial, provided signed informed consent in July 2019, and started to receive Sintilimab at a dose of 200 mg every 3 weeks. Five months after receiving Sintilimab, tumor marker examination and imaging scans showed that the treatment was effective. The patient’s alpha-fetoprotein (AFP) level decreased to 40.4 μg/L from a baseline level of 9829.9 μg/L . Magnetic resonance imaging (MRI) showed that the tumor nodule in the liver had shrunk dramatically with a response evaluation of partial regression (PR) according to Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 . During these months, the patient felt mild fever regularly; however, there was no fatigue, nausea, erythema or any other side effect found.
+At 24 weeks, after 8 courses of Sintilimab, the patient presented with increased urination and drinking for 1 week, and blood tests showed that his fasting plasma glucose was as high as 22.2 mmol/L, with an HbA1c value of 7.8%. Considering the high risk of diabetic ketoacidosis, blood gas analysis was performed, which revealed that he had severe metabolic acidosis, with an arterial pH of 7.27, serum bicarbonate of 12.9 mmol/L, and lactate of 1.8 mmol/L. The blood ketone body determination was positive. Therefore, the patient was suspected to have new onset diabetes mellitus with ketoacidosis and was admitted to our hospital. Further blood assessment showed that the patient’s fasting insulin was as low as 1.5 mIU/L and fasting C-peptide was 1.12 ng/mL (0.78–5.19 ng/mL), which further decreased to 0.21 ng/mL 4 days later. The oral glucose tolerance test (OGTT) revealed that the fasting, 1-, 2-, and 3-h plasma glucose levels were 12.34, 18.32, 28.38, and 25.41 mmol/L, respectively, accompanied by a 2-h postprandial C-peptide level of 0.30 ng/mL and a serum insulin level of 10.4 mIU/L. In addition, the patient’s serum inflammatory cytokines, measured using an enzyme-linked immunosorbent assay (ELISA), demonstrated an interleukin-6 (IL-6) level of 786.32 pg/mL, which decreased to 338.70 pg/mL 2 months later . There was no infection, medication, thromboembolic event, or other factor (Autoimmune diseases, Cushing’s syndrome, or drug poisoning) that could cause hyperglycemia. Consequently, Sintilimab-induced new-onset autoimmune diabetes was diagnosed. However, the anti-glutamic acid decarboxylase 65 (GADA) antibody, anti-islet cell antibody (ICA), and anti-insulin (IAA) antibody tests were all negative. In addition, the type 1 diabetes-related alleles of human leukocyte antigen (HLA) class I and II, which were explored at the loci of HLA-A, B, C, DRB1, DQA1 and DQB1 by sequence-based typing primed PCR , revealed that the most relevant allele was HLA-A∗0201 . For other endocrine function assessments, thyroid hormones showed that the patient’s serum total triiodothyronine (TT3) and free triiodothyronine (FT3) were slightly decreased, but later become normal without oral thyroxine treatment . Moreover, the levels of anterior pituitary hormones and their regulated hormones were all normal . The patient received insulin therapy delivered by micropump, maintaining water and electrolyte acid-base balance and other supportive treatment to correct acidosis. Thereafter, he was treated with insulin therapy subcutaneously, which was adjusted daily to the dose of once-daily basal insulin glargine (long-acting insulin, 30 units) plus thrice-daily prandial insulin aspart (fast acting insulin, 14 units) during his hospital stay. The patient’s plasma glucose returned to normal levels gradually and he was discharged 10 days later . Subsequently, the patient’s plasma glucose was monitored in the outpatient setting and the insulin therapy was gradually adjusted to once-daily basal insulin glargine (28 units) plus thrice-daily prandial insulin aspart (15 units). Then, the patient received continued Sintilimab administration, which resulted in a further decreased in his AFP level . And the patient’s plasma glucose level was stable during follow-up visits.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_406_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_406_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..01020c48942d15e68f43d865a9b2a56aa1ad9249
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_406_en.txt
@@ -0,0 +1,8 @@
+A 62-year-old Caucasian woman with cardiovascular risk factors of smoking and dyslipidaemia was evaluated in the ED of her local hospital due to sudden onset anterior chest tightness with no radiation, relief positioning nor intensification through breathing movements. The patient described throat pain, as well as fever and cough for the preceding 2 weeks. Constant CP started 2 h before the ECG was obtained, and it showed ST-segment elevation in the inferior and lateral leads . This clinical condition was interpreted as a ST-segment elevation myocardial infarction. Acetylsalicylic acid and clopidogrel loading doses were immediately administered and thrombolytic treatment with tenecteplase (7000 U) was initiated [time estimated to percutaneous coronary intervention (PCI) was more than 120 min]. The patient was transferred to a PCI centre. During the helicopter transportation, the patient experienced two episodes of diplopia, lasting a few minutes. At arrival, ECG was repeated showing no ST-segment deviation and the coronary angiogram did not identify any atherosclerotic lesions. The patient noted complete relief from CP, although during evaluation presented with tachypnoea, basal crackles upon pulmonary auscultation, a 3/6 systolic murmur in the cardiac area, blood pressure of 130/70 mmHg, heart rate of 90 b.p.m. and body temperature of 37.8°C. Bed rest, furosemide, and supplemental oxygen were initiated. The echocardiogram showed moderate to severe left ventricular systolic dysfunction, due to areas of akinesia in the apex, distal and mid segments of the walls, sparing most of the basal segments and a mobile friable mass inside the left atrium, attached to the septum with dimensions of approximately 55 mm × 42 mm . Images acquired 48 h after admission revealed a left ventricle ejection fraction slightly improved (, S1–S3).
+The initial laboratory study showed leucocytosis (15.7 × 103cell/mm3) with neutrophilia and C-reactive protein (3.6 mg/dL), N-terminal prohormone of brain natriuretic peptide (1431 pg/mL), and troponin I (19.4 µg/L) slightly high. Other laboratory values were within normal range. On the second day, C-reactive protein increased to 14 mg/dL and the maximum troponin I levels were 20.2 µg/L.
+The head computed tomography did not present bleeding or recent ischaemic lesions but could identify morphologic sequelae of focal ischaemic lesions in the cerebellum and left occipital lobe.
+In order to clarify the characteristics of the mass and understand the cause of the cardiac dysfunction, the patient was transferred to a tertiary centre with CMR available and possibility of performing cardiac surgery.
+The CMR showed a mobile left atrium mass (, S4 and S5), adherent to the interatrial septum, isointense with respect to myocardium on T1 weighted images (WI), hyperintense with respect to myocardium on T2 WI, with slight enhancement during first pass perfusion, and heterogeneous enhancement in the late gadolinium enhancement (LGE) images, suggesting a possible myxoma . Regarding the myocardium evaluation, the left ventricle was non-dilated with mild systolic dysfunction and multiple subepicardial LGE foci in the inferolateral and mid-distal segments of the anterolateral wall, consistent with the diagnosis of myocarditis .
+The patient underwent surgery on the 6th day with total tumour excision and autologous pericardial patch repair of the atrial septal defect. The periprocedural transoesophageal echocardiogram showed the mobility of the mass in to the left ventricle during diastole (, S6–S8).
+During recovery, the patient presented with mild vertigo while walking and diplopia in extreme eye movements. After a neurologist assessment, a cerebral magnetic resonance imaging was requested where were identified multiple infracentimetric lesions throughout the cerebral parenchyma, infra and supratentorial, affecting the cerebellar peduncles and left caudate nucleus. These lesions were moderately hypointense on T1 WI and hyperintense on T2 WI, presenting enhancement after administration of gadolinium. These features were consistent with an embolization process caused by fragments of the myxoma. The histopathological results of the operative specimen confirmed the diagnosis of myxoma.
+The patient started in a rehabilitation program and at the 2 months’ follow-up visit complete recovery from neurological deficits was noted with the echocardiogram revealing normal left ventricle ejection fraction.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_420_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_420_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9919881e48253776de28cd15d5c6e5a4088a9565
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_420_en.txt
@@ -0,0 +1,2 @@
+A 63-year-old Japanese man who had cardiomyopathy of unknown etiology experienced ventricular tachycardia, and an implantable cardioverter defibrillator (ICD) was thus implanted. The ventricular lead was fixed on his RV high septum, because a low-voltage area extended across his mid- to low-ventricular septum. The pacing mode of the ICD was programmed to AAI mode. The width of his own QRS wave was 120ms. His echocardiogram showed a severely dilated and diffuse hypokinetic left ventricle. His septal wall was thin and high-echoic. Cardiac sarcoidosis was suspected, but the diagnostic criteria could not be fulfilled. Three years after ICD implantation, he developed dyspnea until he experienced New York Heart Association (NYHA) class III heart failure. A Wenckebach-type second-degree atrioventricular block was observed during atrium-only pacing at 60 beats per minute (Figure ), therefore, the pacing mode was programmed to DDDR mode. After changing the pacing mode, his symptoms apparently worsened, and he was admitted the following week. He experienced NYHA class IV heart failure, and his electrocardiogram showed dissociated biphasic QRS morphology (Figure ). The width of the first component of the QRS wave was 110ms, and that of the second component was 102ms. His echocardiogram showed severe interventricular dyssynchrony. LV ejection occurred 150ms later than did RV ejection.
+Endocardial substrate mapping by the CARTO™ XP system (Biosense Webster Inc., Diamond Bar, CA, USA) showed a low-voltage area extended across his basal to mid-ventricular septum. Activation mapping of his own QRS wave (Figure A) showed that ventricular conduction started at his mid-septum, and both LV and RV excitation ended simultaneously within 166ms. However, activation mapping during RV high-septal pacing (Figure C) showed that RV conduction started at the pacing site and ended at the RV basal inferior site within 83ms after the pacing stimulus. Subsequently after a 10ms interval, LV conduction started at his basal posterior septum and ended at the lateral wall within 226ms after the pacing stimulus. These data show that in RV high-septal pacing, the first component of the QRS wave supposedly reflects only RV excitation originating at the RV high septum, and the second component reflects only LV excitation originating at the LV posteroseptum. His electrocardiogram (ECG) also showed biphasic QRS morphology during LV lateral or RV apical pacing. This interventricular dyssynchrony was improved by biventricular pacing, therefore, his ICD was upgraded to cardiac resynchronization therapy with defibrillator (CRTD; Figure ). Two years after upgrading to CRTD, he showed good hemodynamic conditions and improved to NYHA class II.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_448_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_448_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5e02cebd27d62c3c3e253332af3e9176a753ce4a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_448_en.txt
@@ -0,0 +1 @@
+A 68-year-old Caucasian man with a history of squamous cell cancer of the lung in 2011 and a remote history of T4aN2cM0 squamous cell carcinoma of the right oropharynx was referred to our institution because of progressive dysphagia to solids with recurrent regurgitation and loss of 7lb within the previous 2 months. The patient attributed the symptoms to radiation therapy he had received following chemotherapy in late 2011. The patient had done well for more than 1 year and had been followed by primary care and oncology clinicians. Given the worry for malignancy as a cause of his dysphagia, he underwent follow-up positron emission tomography-computed tomography (PET-CT) imaging. This showed a hypermetabolic lesion (standardized uptake value 7.6) in the posterior mediastinum increased in the level of midesophagus, as shown in both the axial and sagittal positions . His physical examination did not reveal any oral thrush or palpable lymphadenopathy. He had no history of allergic disease or atopy. An esophagogastroduodenoscopy (EGD) was performed, which revealed esophageal rings and linear furrowing in the midesophagus without evidence of acid reflux disease. Biopsies from the distal, middle, and proximal esophagus were taken, which revealed significant eosinophilia of the midesophagus with up to 80 eosinophils per HPF and associated parakeratosis consistent with EoE . We elected to perform empiric dilation, and the patient was treated with omeprazole 20mg bid, which led to mild improvement in symptoms but also an episode of food bolus impaction 6 weeks after initiation of treatment. An emergency EGD revealed the same findings, with biopsies showing more than 30 eosinophils per HPF. Swallowed fluticasone 440μg bid was added to the patient’s treatment protocol, which led to a good response. Unfortunately, 8 weeks after treatment the patient died suddenly due to a cerebrovascular accident.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_450_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_450_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a3883e3aa0ae54d6e35b1c07dfd614354abcdf59
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_450_en.txt
@@ -0,0 +1,2 @@
+A 78-year-old Japanese man with ischemic heart disease, chronic heart failure, and type 2 diabetes was presented with a complaint of fever for 2 days. He had reportedly completed a 12-day course of intravenous ceftriaxone treatment for E. coli pyelonephritis without bacteremia, 8 days earlier. He had persistent fever despite having received empirical oral levofloxacin for the last 2 days and was admitted for further investigations and management. Physical examination revealed a body temperature of 38.9 °C, respiratory rate of 24 breaths per minute, heart rate of 116 beats per minute, and tenderness of the prostate gland. Laboratory findings showed a white blood cell count of 10,810/μL (neutrophils, 90.1%); C-reactive protein, 316 mg/L; hemoglobin A1c, 9.5%; urinary leukocytes, 0–1/HPF; and no evidence of urinary nitrites.
+A full-body enhanced computed tomography scan showed no evidence of infectious foci, including abscesses. However, blood culture results revealed the presence of E. coli bacteremia. Therefore, we initiated intravenous cefmetazole, considering suspected bacteremic prostatitis. However, transthoracic echocardiography was performed as part of the workup for recurrent fever, which revealed moderate mitral regurgitation and a high echoic structure (measuring 13 mm × 5 mm diameter) on the posterior mitral leaflet . Since the structure was not detected in the previous transthoracic echocardiography performed 3-months earlier, we also conducted transesophageal echocardiography. It revealed a high and low echoic heterogenous immobilized structure (measuring 10.2 mm × 11.7 mm in diameter) attached to the annulus of the mitral valve from P2 to P3 and showed hypermobile vegetation (measuring 18 mm × 4.2 mm in diameter) attached continuously to the immobilized structure . With bacteremia evidence and echocardiography findings, we diagnosed the patient with infective endocarditis associated with a suspicious calcified amorphous tumor. Antibiotic treatment was modified to ceftriaxone and gentamicin following the diagnosis because E. coli was not a multidrug-resistant strain. E. coli was detected on blood culture samples taken on day-1 and day-5 of hospitalization, confirming persistent bacteremia. On day-6 of hospitalization, the patient developed altered mental status. A head magnetic resonance imaging scan was performed, which revealed bilateral acute multiple cerebral infarctions . Since no acute hemorrhagic transformation after the stroke was identified by the follow-up computed tomography, we performed removal of the vegetation and mitral valvuloplasty on day-7 of hospitalization. Cardiopulmonary bypass was established with the initial intravenous administration of heparin (300 U/kg) and maintained the activated clotting time above 400 s. Intravenous heparin was switched to oral warfarin postoperatively. There was no intraoperative or postoperative cerebral hemorrhage. Histopathological examination of the specimen showed calcified deposits and inflammatory granulation tissue infiltrated by neutrophils . The patient experienced renal insufficiency 21 days after admission, and the treatment was changed from ceftriaxone with gentamicin to ceftriaxone with ciprofloxacin. Antibiotic treatment was administered for 6 weeks from the day of the first negative blood culture result (7 days after admission). The patient recovered fully from the infection and was transferred to a rehabilitation hospital 77 days after admission.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_459_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_459_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0905a48039cc4d17ba4246cdc28829027ed5a174
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_459_en.txt
@@ -0,0 +1,4 @@
+A 43-year-old Caucasian woman, a mother of three sons, at 30 days post-partum after a full-term pregnancy without any complications and concluded by a vaginal delivery, suffering from diabetes on oral antidiabetic medication, presented to the emergency department with left flank pain with hematuria of one week’s duration. A clinical examination revealed an alert patient, febrile at 38°C, with blood pressure of 158 over 67mmHg, heart rate of 90 beats per minute, respiratory rate of 20 breaths per minute, suffering from pain in the left flank (visual analog score (VAS) = 5), this pain was exacerbated by palpation, which found lumbar contact. Diagnostic studies in the emergency room revealed a urine analysis with 104 white blood cells (WBCs), gross hematuria, and a C-reactive protein level of 88. Her blood cell count revealed anemia at 9g of hemoglobin; blood electrolytes and renal function with serum creatinine levels were normal.
+An abdominal ultrasound scan showed discrete pyelocalyceal cavities dilation with a slightly enlarged left kidney and without visible urinary obstruction. A CT urography and angiography scan was performed and showed an ectatic left renal vein, seat of a large hypodense thrombus extending from the segmental renal veins to the inferior vena cava, with a large heterogeneous and hypodense region located in the medium and lower poles of the left kidney without urinary tract dilatation or tumoral lesions; this aspect concluded in a perfusion abnormality (renal venous infarction) (Figures and
+).
+Anticoagulation heparin therapy was started and our patient was admitted to a medical center for further investigations. Her proteinuria and blood cultures did not show any abnormalities, and her serum albumin levels were normal. The thrombophilia assessment, with protein C or S deficiency, mutation of coagulation factors II and V, lupus and antiphospholipid antibody syndrome (APS) tests, were negative. The outcome was favorable with disappearance of pain and, after five days of hospitalization, our patient was put on oral anticoagulant therapy (acenocoumarol 4mg/day) and discharged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_461_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_461_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2c9f5b118e89960de71d541077604d169f3488d2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_461_en.txt
@@ -0,0 +1,10 @@
+A 64-year-old Caucasian woman was referred to our office for the assessment of a gigantic left neck mass . The patient reported that she had started to feel a paratracheal node 34 years previously, and that it had grown progressively during the subsequent three decades. She had undergone an operation in the area 24 years previously, although the surgery had to be terminated due to massive bleeding from the mass. During surgery, the mass was diagnosed as most likely a glomus tumor. No further surgeries to remove the mass were attempted, and it had been allowed to grow steadily.
+In May 2013, the patient was referred elsewhere for further study of the mass. Magnetic resonance imaging (MRI) revealed a hypervascularized mass with a maximum diameter of 4 cm located at the bifurcation of the left carotid artery and causing the forward displacement of the external carotid artery and the backward displacement of the internal carotid artery. The patient refused surgery at that time and remained asymptomatic for almost 3 years. She then decided to consult a physician again due to the enlargement of the mass, which caused discomfort and mild compression symptoms when swallowing.
+In 2016, angio MRI showed a 9 cm paratracheal mass on the left cervical side that laterally displaced the sternocleidomastoid muscle and 2 cm of the trachea. The mass was pulsatile and slightly painful. No Horner syndrome or Hering–Breuer reflex was noted. A carotid occlusion test and a complete angiography were also performed, and these confirmed the permeability of the Willis polygon and the diagnosis of the mass.
+Due to the change in the behavior of the tumor, which had doubled in size within 3 years after remaining relatively stable for almost three decades, the size of the tumor, which had started causing compression symptoms, and the Shamblin grade II classification, the maxillofacial team at Ruber International Hospital decided to remove the tumor surgically after embolization.
+The surgery was performed in February 2016. The tumor was approached through a wide cervical exposure after identifying the primitive carotid artery .
+The tumor was gently dissected from the carotid bifurcation in a subadventitial plane , with great emphasis placed on maintaining hemostasis.
+The surgeons would like to note that a partially blunt Freer periostotome is the best tool to use in high-risk areas. The vagal nerve was readily identified and separated from the mass. The hypoglossal nerve and major neck vessels were also preserved . The mass was then removed from the bifurcation uneventfully. Two small nodes adhering tightly to the internal carotid adventitia and the posterior torn hole were left in place to avoid any potentially life-threatening complication.
+The postoperative phase was uneventful, and the patient was discharged 6 days after the surgery with moderate hoarseness, which was resolved within 1 month. The final biopsy confirmed the initial diagnosis of carotid body paraganglioma and showed a Ki-67 expression of 19%.
+Due to the aggressive growth behavior and high Ki-67 expression of the tumor, the patient was referred to the CyberKnife Unit of Ruber International Hospital for treatment of the remaining nodes. A thermoplastic mask was made to ensure that the patient remained immobilized during the treatment. A T2 MRI and computed tomography (CT) with intravenous contrast were performed to locate the above-mentioned remaining nodes of the paraganglioma. The treatment was performed separately in each affected area on two consecutive days. A coverage dose of 14 Gy and an isodose of 83% were administered using 5- and 7.5-mm collimators. The maximum dose used was 16.87 Gy. The medullary canal received a dose of less than 4 Gy, and the left VII and VIII nerves received a dose of less than 5 Gy . The treatment course was uneventful, and no complication occurred during or after treatment.
+After a 48-month follow-up period, no lesion recurrence or surgery-related complications have occurred. Some minor scar revision due to the tracheostomy was performed under local anesthesia. The patient is otherwise completely symptom free .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_505_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_505_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e53206b2b00a26b2c37949b8775ba98d7bc2877c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_505_en.txt
@@ -0,0 +1,3 @@
+We present the case of a 7 year old boy who presented with effort intolerance and no cyanosis. Clinical examination was unremarkable. Doppler echocardiography revealed left sided pulmonary veins opening into left innominate vein. Right pulmonary veins were seen draining normally into the left atrium. There was no ASD and right atrium and right ventricle were dilated. CTPA ( & ) aided in defining the anatomy. Left pulmonary veins were shown to be joining to form a common channel and draining into superior vena cava via left brachiocephalic vein suggestive of left supracardiac PAPVC thus confirming the preliminary diagnosis of isolated left sided PAPVC.
+Pt. was successfully surgically managed. Median sternotomy approach was chosen.
+Innominate vein and superior vena cava were found to be dilated. Also, the right atrium and the right ventricle were dilated . Vertical vein was seen opening into innominate vein. Left Pulmonary veins were seen opening into the vertical vein. Patient was operated without cardiopulmonary bypass (CPB) support. A 15 mm opening was made in the common chamber horizontally after applying a Cooley’s clamp. Another opening of similar dimension made over LA appendage. Vertical vein was anastomosed to left atrial appendage posteriorly with 6-0 prolene in side-to-side fashion. The vertical vein-innominate confluence was ligated at the end of the procedure. Chest was closed in standard fashion. Mechanical ventilation was required for 12 h. Patient recovered uneventfully and was discharged on Day 10.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_522_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_522_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6af0ac8f9cffbd59d1c17a9c3a91d848b4b8d842
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_522_en.txt
@@ -0,0 +1,6 @@
+The subject of this case study was a 54-year-old male with medium build (body mass index: 21 kg/m2) who had been infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in January 2020 and diagnosed with critical COVID-19. To the best of our knowledge, the patient had enjoyed good health without any previous lung or cardiovascular conditions, except for a history of smoking for over 20 years. Symptomatic medical treatment, including antiviral treatment (umifenovir), was administered from January 29 to February 20. However, during hospitalization, the patient developed atypical pneumonia followed by ALI and severe hypoxaemia on February 12. Extracorporeal membrane oxygenation (ECMO) was initiated on February 22. The patient developed acute kidney injury requiring haemodialysis on April 1. On April 3, the patient tested negative in the SARS-CoV-2 nucleic acid test and was diagnosed to be in the recovery stage of critical-type COVID-19. Following refractory hypoxaemia after 73 days, different slices of chest computed tomography (CT) scan revealed severe pulmonary fibrosis , which was confirmed by pathological examination after lung transplantation. The patient was treated with umifenovir, convalescent plasma, alpha-interferon, corticoids, and other supporting therapy. However, there was no clinical improvement after 73 days on ECMO or active medical treatment, the patient suffered progressive dyspnoea, and progressive respiratory failure continued. In order to increase the patient’s life expectancy, double-lung transplantation was performed.
+The patient underwent double-lung transplantation in late April 2020, following the ethical principles of international organ transplantation. The allocated lungs were harvested from the donor after brainstem death and donated through the China Organ Transplant Response System.
+Extracorporeal membrane oxygenation was discontinued 6 days after double-lung transplantation for the first time, but the patient suffered from hypoxaemia, respiratory acidosis, and circulation instability 7 days after double-lung transplantation. Hence, venous–venous ECMO was used again. In addition, biological tests showed D-dimer levels of 12.38 µg/mL, ultrasound indicated pulmonary hypertension and right heart failure, and minor levels of right pulmonary stenosis and embolism were found by CT angiography. Therefore, we administered intravenous heparin for anticoagulant therapy and inhaled nitric oxide to dilate the pulmonary arteries. The respiratory and circulation status improved during the following days. The patient was weaned from ECMO 12 days after double-lung transplantation, and tracheal intubation was removed 17 days after double-lung transplantation.
+However, more than 3 months after double-lung transplantation, the patient complained of progressive dyspnoea again. Branch PAS was confirmed by pulmonary artery CT angiography, which revealed stenosis in the right lower pulmonary branch, including a minor level of pulmonary embolism. Electrocardiography (ECG) results showed sinus rhythm at 79–116 b.p.m. with right bundle branch block. Echocardiography revealed right ventricular enlargement, moderate to severe tricuspid regurgitation, and an estimated right ventricular systolic pressure (RVSP) of 76 mmHg. Considering clinical presentation, ECG, echocardiography, and CT angiography findings, the patient was diagnosed with branch PAS. Later, Treprostinil injection was continuously administered for pulmonary vasodilation. However, biological tests showed that brain natriuretic peptide (BNP) and N-terminal pro-B-type natriuretic peptide (NT-proBNP) levels were not improved. The patient underwent further right cardiac catheterization examination and pulmonary angiography under general anaesthesia and mechanical ventilation. Pulmonary angiography revealed the main pulmonary artery was at a pressure of 60/20 mmHg, severe stenosis was present in the right branch pulmonary artery with a pressure of 17/9 mmHg , and mild stenosis was present in the left branch pulmonary artery with a pressure of 50/20 mmHg.
+The MPA1 catheter (Cordis, USA) was delivered to the distal end of the right pulmonary artery after right heart catheterization and exchanged for Amplatz Super Stiff Wire (BostonScientific Corporation, USA). A 14-Fr guiding sheath (Cook Medical, Bloomington, USA) was introduced into the right pulmonary artery so as to ensure the previously preloaded 25-mm long Pul-Stent™ (Med-Zenith Company, Beijing, China) could pass through the lesion smoothly. The stent was expanded step by step with a 12-mm Balloon-in-Balloon (Numed Company, USA) after accurate location was confirmed by angiography.
+After the endovascular procedure, pulmonary angiography revealed the main pulmonary artery was at a pressure of 54/17 mmHg, the right branch stenotic lesion diameter improved and its estimated pressure was 45/17 mmHg , and the pressure gradient decreased from 43 to 9 mmHg. The percutaneous interventional procedure went smoothly, and the vital signs of the patient remained stable during catheterization. After treatment, echocardiography estimated the RVSP decreased from 76 to 34 mmHg. The patient’s BNP and NT-proBNP levels decreased distinctly . Additionally, the mean level of the postoperative oxygenation index was also significantly improved compared with the preoperative oxygenation index .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_526_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_526_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d1eee364ac7653fb1d5a5333c51e68688a6b4e7c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_526_en.txt
@@ -0,0 +1,2 @@
+A 39-year-old female presented with a 10-month history of the right-sided neck pain and bilateral hand numbness/weakness, accompanied by leg heaviness. Her neck pain was exacerbated by movement but was also present at rest. She described an accident while on an all-terrain vehicle 2 years ago but did not recall sustaining any specific cervical injury. She exhibited 4/5 strength involving both hands and the right triceps, decreased sensation throughout the hands, with diminished light touch, pain, and temperature in the hands. Reflexes remained intact. The outside computed tomography obtained 2 months previously demonstrated osseous hypertrophy of the C1 lamina, while the cervical magnetic resonance (MR) showed a pseudoarticulation between the lamina of C1 and C2 .
+The patient underwent left-sided C1 hemilaminectomy and partial C2 laminectomy at which time the thickened pseudoarticulation at C1 was removed and was sent for pathology. Histologically, it proved to be “benign osteocartilaginous tissue with fibrosis.” The patient did well and regained full strength bilaterally on postoperative day 1. Two weeks later, initial neck pain and prior numbness resolved. Postoperative flexion and extension films showed no delayed instability. Six months later, with mild residual occipital pain, the MR image demonstrated complete resection of the lesion and no residual left-sided stenosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_541_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_541_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cf586104b0e8c85eea6e840e6be85a6d68e0733b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_541_en.txt
@@ -0,0 +1 @@
+A 35-year-old Han Chinese male football player presented with abnormal ECGs for 8 years without any evident subjective discomfort. The patient recently complained about slight exertional dyspnea with reduced sport/physical tolerance and was admitted to our hospital. This patient had been employed as a professional football player from the age of 10 years and had been a physical education teacher from the age of 26 years. He was a longtime local resident and never went to any affected areas (areas with high prevalence of infectious diseases). He reported being formerly healthy without any medical histories or current comorbidities, and he reported taking no medications. He has smoked 20 cigarettes per day for 7 years and consumed alcohol for 10 years at 100 to 250 g per day. His parents were healthy, and his family history was unremarkable. His physical examination revealed no abnormal findings. His body temperature was 36.5 °C, blood pressure was 121/73 mmHg, respiratory rate was 18 breaths/min, pulse was 69/min, heart rate was 70 beats/min, and reflexes were normal. He had no pathology reflex, and his body mass index was 22.81 kg/m2. Laboratory evaluation revealed slightly elevated cardiac troponin T level of 0.017 ng/ml, N-terminal probrain natriuretic peptide level of 291.80 pg/ml, and C-reactive protein level of 0.40 mg/L. The patient’s blood lipid levels, liver function, and renal function were within the normal range with glutamic oxaloacetic transaminase level of 23 U/L, glutamic-pyruvic transaminase level of 31 U/L, alkaline phosphatase level of 84 U/L, total protein level of 67.9 g/L, albumin level of 41 g/L, globulin level of 26.9 g/L, total cholesterol level of 4.01 mmol/L, triglyceride level of 1.42 mmol/L, high-density lipoprotein level of 1.08 mmol/L, low-density lipoprotein level of 2.14 mmol/L, uric acid level of 353 μmol/L, epidermal growth factor receptor level of 105.48 ml/min/1.73 m2; serum K+ level of 4.05 mmol/L, serum Ca2+ level of 2.16 mmol/L, serum Mg2+ level of 0.88 mmol/L, and serum Na+ level of 141 mmol/L. The results of routine blood test and urinalysis were negative, thyroid function was normal, and microorganisms were not detected. Chest radiography showed an apparently normal morphology of the heart and lungs . ECGs revealed progressively deepened and widened Q waves on the II, III, and avF leads and contiguous TWIs on the I and avL leads . Echocardiography revealed an increasingly thickened interventricular septum from 10 mm to 13 mm, an enlarged left atrium and ventricle, and a reduced left ventricular ejection fraction from 73% to 63% . Coronary angiography (CAG) was performed and showed no distinct stenosis. Emission computed tomography (ECT) revealed mild myocardial ischemia of the left ventricular inferior wall . All of these clinical tests supported the diagnosis of HCM, which became gradually evident with time. For further identification, we proposed other examination techniques for this patient, including cardiac magnetic resonance imaging (CMRI) to better evaluate the left ventricular wall thickness and to identify potential areas of myocardial fibrosis, Holter monitor recordings and an exercise test to evaluate possible “dynamic” changes of repolarization abnormalities, as well as genetic testing. However, the patient refused all of these suggestions and was discharged. In the subsequent follow-up visits at 1 month, 3 months, and 6 months after discharge, the patient showed poor compliance and was eventually lost to follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_552_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_552_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..678fb7a71ab372f2094bfad710aa637fb18cce0e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_552_en.txt
@@ -0,0 +1,14 @@
+A 26-year-old male patient experienced a car accident and was diagnosed with an open fracture (Gustilo-Anderson type IIIB) of the right distal humerus with massive bone defects and severe intra-articular involvement, without neurovascular injuries or other associated injuries. Within 24 h after the injury, he was treated by surgical debridement, negative pressure vacuum sealing drainage, and immobilization by casting in a local hospital. Due to severe contamination and a poor soft tissue condition, the wound was surgically debrided again and closed 15 days later. Two months after the initial operation, the wound had finally healed, and the soft tissue was in good condition, without infection or effusion. The CRP (C-reactive protein) and ESR (erythrocyte sedimentation rate) levels returned to normal, and the patient was transferred to our department for additional treatment.
+The patient’s height was 175 cm, and his weight was 130 kg. The preoperative anteroposterior (AP) and lateral X-rays (see Fig. ) and 3D-CT scans (see Fig. ) of the right elbow joint showed massive bone defects at the supracondylar level as well as a comminuted articular surface. According to the Association for Osteosynthesis/Association for the Study of Internal Fixation (AO/ASIF) criteria, the fracture was classified as a type 13-C3 fracture . The physical examination revealed pseudarthrosis at the fracture site, which made it much more difficult to reconstruct the distal humerus.
+After the induction of general anesthesia, the patient was placed in the supine position with elbow flexion and forearm crossing chest , and a longitudinal incision was made along the midline of the posterior aspect of the elbow and medially curved at the olecranon tip. The ulnar nerve was dissected carefully and protected by a rubber strip, and then, a V-shaped osteotomy was performed in the proximal olecranon. The proximal bone fragment and triceps muscle were flipped upward to expose the distal part of the humerus.
+Then, we removed all the fibrous scar tissue as well as the anterior and posterior capsules to release the elbow. The dead bones and redundant calli were debrided until fresh bone was evidently revealed, and then the bone callus was kept for grafting. The original articular cartilage was preserved to the greatest extent possible, but the trochlear groove was too severely comminuted to be reconstructed. Therefore, the fracture fragments and adhesive fibrous tissue were removed to facilitate reconstruction.
+The trochlear and capitellar articular surfaces of the distal humerus were aligned with the olecranon and radial head articular surfaces, respectively. Then, we measured the width of the trochlear groove defect, harvested a cylindrical autograft of an appropriate size and shape from the iliac crest, and inserted the graft into the defect to reconstruct the distal humerus. The cortical bone surface of the graft was directed towards the articular cavity but was located 2 mm proximal to the cartilage. We stabilized the distal fragments using K-wires (Kirschner wires) for temporary reduction. Then, the intercondylar fracture was converted to a supracondylar fracture of the distal humerus.
+Next, the humeral shaft and both columns were reduced. First, the medullary canal was opened by a 3.5 mm diameter drill to promote fracture healing. The supracondylar bone defects were measured to be approximately 3 cm at the medial column and 5 cm at the lateral column. We performed shortening by 2 cm at the supracondylar level. Then, 2 pieces of autografts harvested from the iliac crest were trimmed according to the size and shape of the bony defects to reconstruct the medial and lateral columns, respectively. The cortical bone was directed outward, and the cancellous side was directed inward. The total bone loss was estimated by measuring the humeral length. Then, K-wires were inserted for temporary fixation.
+Finally, to optimize the stability of the bony structure, the distal humerus was stabilized using anatomical locking compression plates via a parallel configuration (Zimmer Biomet, USA). Several K-wires were left for the fixation of the tiny fragments.
+After internal fixation, the elbow joint exhibited almost full range of motion during passive flexion and extension (see Fig. ). The remaining iliac crest autografts and bone callus were cut into several strip-shaped bone chips and implanted around the supracondylar level.
+Finally, the olecranon osteotomy site was reduced and fixed by tension band wires. We performed subcutaneous transposition of the ulnar nerve using soft tissue sling to prevent direct contact and irritation from the hardware. The muscles and deep fascia were sutured carefully to cover the bone grafts and internal fixation site. The donor site was closed by direct suturing.
+After the surgery, standard AP and lateral radiographs of the elbow joint were taken to evaluate the quality of reconstruction (see Fig. ).
+The drainage tube was removed 24 h after surgery. Active exercises of the hand and wrist, isometric contractions of the biceps and forearm muscles, and active elbow flexion and extension exercises were initiated on the second day after surgery.
+Routine follow-ups were carried out. The fracture healed at 3 months postoperatively, and the radiographs showed the presence of a continuous callus passing through the fracture line. Six months after the index surgery, the patient had a painless elbow joint and almost full recovery (125° elbow flexion and 0° extension, 90° forearm supination and 65° pronation). The Mayo elbow performance score (MEPS) was 100 (excellent).
+Three years after the index surgery, the patient came to our department for hardware removal due to psychological factors. He was pain free at the affected elbow joint. The flexion-extension range of motion was 130–0°, and the supination-pronation range of rotation was 90–80°. The MEPS was 100 points. The patients was very satisfied.
+Secondary displacement or the loss of reduction, implant loosening or internal fixation breakage, and obvious articular degeneration were not observed. No other postoperative complications, such as infection, nonunion, delayed union, ulnar nerve symptoms, or donor site pain, occurred after the initial internal fixation procedure. After hardware removal, the overall bony structure of the affected elbow joint remained intact with only a partial deformity at the lateral column, which had no significant influence on the overall functional outcome (see Fig. ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_578_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_578_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a2b061da7cc74e1456dbdfbdd1e4a0954c7357dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_578_en.txt
@@ -0,0 +1,7 @@
+A 5-year-old male neutered Persian cat was referred for investigation of a 4 week history of weight loss, inappetence and vomiting, following management of feline lower urinary tract disease, with repeated urethral catheterisations and assisted nutrition by an oesophagostomy tube. The nutritional support provided at that time was estimated at approximately 40% of its basal energy requirement (BER).
+On examination, its body condition score was estimated at 4/9 and the body weight was 2.95 kg. A subcutaneous abscess was noticed at the level of the oesophagostomy tube insertion site. Mild pyrexia (39.6°C) and a left systolic parasternal heart murmur grade II/VI were also identified. The remainder of the physical examination was unremarkable.
+A CT scan revealed a large left cervical abscess associated with the oesophagostomy tube, treated with surgical debridement followed by drainage and antibiotic therapy (amoxicillin-clavulanic acid). A naso-oesophageal tube was placed to allow continuation of assisted nutrition. Despite having received 100% of its BER for 10 days followed by 150% BER for 4 days using an energy-dense complete commercial diet (Royal Canin Convalescence Support), the cat continued to lose weight and remained anorexic. Energy requirement was calculated with the standard formula: BER (kcal) = 30 × body weight + 70.
+Haematology and biochemistry revealed mild non-regenerative anaemia (haematocrit 25%; reference interval [RI] 28–52%) and elevation of symmetric dimethylarginine (20 µg/dl; RI 0–14) with creatinine within the upper range of the reference interval (112 µmol/l; RI 0–140), suggestive of International Renal Interest Society stage 1 CKD. The fasting serum bile acids, folate and cobalamin and feline trypsin-like immunoreactivity were within normal limits. Urinalysis revealed a urine specific gravity of 1.041, inactive urine sediment, borderline proteinuria (urine protein to creatinine ratio 0.37; RI <0.2) and negative urine culture. Faecal parasitology and culture for Salmonella and Campylobacter species were negative. Ultrasonography showed bilateral renal changes consistent with CKD and prominence of the jejunal muscularis layer, compatible with chronic enteropathy or – less likely – intestinal lymphoma. Endoscopy revealed oedema of the gastric and duodenal mucosae. Histology revealed mild eosinophilic, lymphoplasmacytic gastritis and marked neutrophilic, plasmacytic, histiocytic enteritis, with villous blunting .
+Oral maropitant at 4 mg daily (Cerenia 16 mg tablets; Zoetis) along with mirtazapine (Mirtazapine 2 mg tablets; reconditioned tablets) at 2 mg every other day were provided as appetite stimulants during the hospitalisation. Immunosuppressive therapy was started 6 days after admission, with dexamethasone initially (0.5 mg/kg IV q24h for 7 days [Rapidexon 2 mg/ml injectable solution; Eurovet]), followed by prednisolone (1.8 mg/kg PO q24h [Prednicare 5 mg tablets; Animalcare]). Owing to a lack of improvement, another immunosuppressive drug was added 4 days after initiation of steroids: ciclosporin (Cyclavance 100 mg/ml oral solution; Virbac) at 5 mg/kg q12h on an empty stomach.
+Seventeen days after admission, the cat became acutely subdued. This progressed rapidly to loss of consciousness, opisthotonos and bilateral light-responsive mydriasis, consistent with an intracranial neurolocalisation. The plasma ammonia was markedly elevated (>286 µmol/l) and likely responsible for the neurological signs. At that stage, the cat’s owners elected euthanasia, and consented to blood collections for plasma amino acids, serum organic acids measurement and post-mortem examination. This revealed low plasma concentrations of the urea cycle amino acids arginine, citrulline and ornithine, which was suggestive of acquired urea cycle amino acid deficiencies resulting in hyperammonaemic encephalopathy . Measurement of serum organic acids did not provide additional relevant information.
+On necropsy, the following organs and tissues were examined histologically: heart, lung, liver, spleen, pancreas, intestine (duodenum, jejunum, ileum, colon), kidneys, urinary bladder, perioral skin and brain. Duodenal histopathological changes revealed minimal multifocal predominantly lymphocytic submucosal inflammatory reaction. Both kidneys presented with mild-to-moderate multifocal to global thickening of most glomerular membranes, which was suspicious of membranous glomerulonephritis . No relevant histological lesions were identified in any of the remaining organs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_582_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_582_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9d5cec217447e9e89a79c05bce791b88c29f52a9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_582_en.txt
@@ -0,0 +1,5 @@
+A 48-year-old male with an unremarkable medical history was referred to our department with perianal and pelvic pain, and constipation. Physical examination revealed a mass in the rectum. Endoscopic evaluation revealed a normal rectal mucosa. Magnetic resonance imaging (MRI) confirmed the presence of a cystic mass below S3, with a solid component in the median presacral position posterior to the mesorectum. The mass extended longitudinally by 6 cm, imprinting the right posterior wall of the lower rectum near the levator ani muscles. A diagnosis of a tailgut cyst of 36 × 23 × 33 mm was made, including both a solid component with T2 contrast enhancement and multiple small cyst-like components with a maximum diameter of 10–12 mm . Transperitoneal laparoscopic resection was proposed, as it was deemed safer to preserve the integrity of the cyst wall.
+Different approaches to rectal dissection have been described for benign and malignant disease [,]. In our technique, the patient was placed in the supine decubitus position. After laparoscopic entry with an open Veress-assisted technique , four trocars were placed. A circumferential incision of the peritoneal reflection was made posteriorly and laterally, saving the anterior plane. Rectal mobilization began from the posterior aspect, preserving the mesorectal fascia to visualize the cyst, which was isolated and excised to avoid injuries to the capsule. Peritoneal continuity was restored. Specimen extraction was performed via a suprapubic incision .
+The procedure may be complicated by injury to the nerves, supplying the rectum and pelvic plexus. Furthermore, bleeding from the presacral vein must be avoided because it is difficult to manage. We suggest mobilizing the posterior wall as the initial step, in order to avoid injuries at pelvic splanchnic nerves, also known as nervi erigentes, which can help to preserve sexual function in male patients.
+The estimated operative time was 120 min, estimated blood loss was insignificant, and no transfusion was performed. No postoperative complications occurred, and the patient was discharged on postoperative day two. No signs of recurrence were found at the six-month follow-up and no functional urinary or anorectal symptoms were reported. Preoperative management and postoperative follow-up at six months included MRI and endoscopy, which were negative for metastasis.
+Histopathological examination was performed on the excised specimen (5 × 4.3 × 2.5 cm), and macroscopically, the mass was partly multicystic and partly solid in appearance. The solid area corresponded to a neuroendocrine neoplasm with a nested trabecular pattern of growth comprising round cells with salt-and-pepper nuclear chromatin staining positive for chromogranin and synaptophysin, with a ki67 labelling index of 5–10% (compatible with a grade 2 NET). This neoplasm arose in a conglomerate tailgut cyst. The cystic spaces were lined with immature intestinal-type epithelium and urothelium .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_583_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_583_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9f7eee3b61c34ec0dfde157fecbd0c8924d43f5c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_583_en.txt
@@ -0,0 +1,5 @@
+A 20 years old woman was referred to Gazi University Department of Prosthodontics with a chief complaint of tooth discoloration, diastema, unsatisfactory esthetics and slight tooth sensitivity. The medical and dental history revealed that the patient’s family was not affected by AI. A renal ultrasound scan was normal, and it showed no evidence of nephrocalcinosis. Laboratory findings, including serum electrolytes, calcium, phosphate, urea, creatinine, alkaline phosphatase and parathormone levels were all normal. Clinical examination of the patient showed the insufficient enamel thickness, and the patient’s anterior and posterior teeth were discolored . The panoramic radiography also showed that the thin enamel layer could not be distinguished from the underlying dentin . There were no anterior open bite and missing teeth. However, short crowns, multiple diastema, occlusal wear with exposed dentin in the posterior areas, poor contact points and dental caries are the additional clinical findings . The roots showed normal length and form. The pulp chambers were regular in size. Her oral hygiene was acceptable with no signs of gingivitis .
+The maxillary and mandibular left third molar teeth were extracted to perform SEM and histologic analyzes. These teeth were totally covered by mucosa . Therefore, they were selected for SEM and histologic analyzes by the purpose of examining the tooth structure of the patient which had not been exposed to the oral environment. SEM and histologic analyzes were performed on the extracted mandibular and maxillary third molar teeth . One of the third molar teeth was fixed in 4% glutaraldehyde. The tooth was then cut longitudinally, and the sections were coated with gold (Sputter Coater SC7620, Polaron, VG Microtech, England). The analysis was done via SEM (JEOL, JSM-6060LV, Tokyo, Japan). SEM analysis showed that there was an insufficient enamel layer . Additionally, the other third molar tooth was demineralized with 10% formaldehyde for 3 weeks. The tooth was then cut longitudinally, and it was stained with hematoxylin-eosin stain. Histological findings revealed that dentin structure was intact and there was no irregularity in tubular structure. These findings confirmed that there was no defect related to dentin .
+Diagnostic casts were attached on a semi-adjustable articulator (Stratos 200; Ivoclar Vivadent Ag, Pforzeim, Germany) in centric occlusion. The occlusal vertical dimension was determined by the Niswonger method and verified with the closest speaking space method. The interocclusal distance at the physiologic rest position was 6 mm. In order to ensure proper vertical dimension and to create enough space for a restorative reconstruction, the bite was opened 5 mm in the anterior region. Furthermore, to predict the last appearance of the restoration, diagnostic wax-up was prepared at the determined vertical dimension , and expected treatment outcome was performed with the digital smile design software (Romexis 4.5, Planmeca USA, Inc).
+Under local anesthesia, all teeth were prepared with chamfer margins. The crown length of maxillary and mandibular posterior teeth was insufficient for crown retention. In addition, there was an asymmetry of the gingival contours in the anterior maxillary teeth . After periodontal evaluation, because of insufficient crown length, ostectomy procedure was performed for maxillary and mandibular posterior teeth. In addition, gingivectomy was applied for maxillary anterior teeth. All periodontal surgery procedures were performed by the periodontologist. The impressions for provisional casts were made with a condensation silicone impression material (Zetaflow; Zhermack, Italy). Then, an interocclusal record was prepared with a hard addition-type A-silicon material (Imprint™ Bite, 3M ESPE) at the increased vertical dimension (5 mm in anterior region) which was determined in diagnostic wax-up stage. The autopolymerizing acrylic resin (ALIKETM; GC America, Alsip, IL, USA) provisional crowns were fabricated at the determined vertical dimension extraorally by an indirect method, then they were cemented with temporary cement (Temp Bond NETM; Kerr) . These restorations were assessed in terms of esthetic and phonetics. 1, 2 and 3 month regular checkups were performed. The speech, swallowing, anterior and posterior speaking space, muscle sensitivity, mastication, TMJ discomfort, were assessed during this period. The patient was asymptomatic. The criteria of the success for increased vertical dimension were the absence of pain, no sensitivity in facial and masticatory muscles, phonetic and swallowing satisfaction. At the end of the 3 months follow up period, definitive impressions were made with a condensation silicone impression material (Zetaflow; Zhermack, Italy). Occlusal registration was obtained with a hard addition-type A-silicon material (Imprint™ Bite, 3M ESPE) with a slightly reduced vertical dimension from the provisional restoration. After that, the working casts were obtained and mounted on the semi-adjustable articulator (Stratos 200) using a face-bow transfer (Facebow UTS-3D, Ivoclar Vivadent) .
+The patient was rehabilitated with metal alloy (Mıcrolit Isı, Schütz Dental Group) - ceramic (Cerabien ZR Noritake) fixed partial dentures in the posterior regions. In order to achieve better esthetic appearance and to camouflage the AI affected tooth color, zirconia ceramic (Katana, Kuraray Noritake Dental Inc) based crowns were used in the anterior regions of low and upper jaws . With this prosthodontic rehabilitation, maximum interdigitation and a canine guidance could be achieved. Metal-ceramic fixed partial dentures were cemented with zinc polycarboxylate cement (Adhesor® Carbofine; Kerr) and zirconia ceramic crowns cemented with self-etch dual cured resin cement (Maxcem Elite, MXE; Kerr). Following cementation, a maxillary protective occlusal splint was manufactured to protect the restorations from chipping or fracture due to the bruxism. The patient was instructed about oral hygiene maintenance.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_597_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_597_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d5959ed72bd1f1d3e5a27d9937b5bac15c142644
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_597_en.txt
@@ -0,0 +1 @@
+We present the case of a 50-year-old woman of Italian ethnicity who presented with a slow-growing frontal mass, tender to pressure, with spontaneous pain. Her neurological examination was completely normal. There was no history of trauma or other systemic disease. A magnetic resonance imaging (MRI) scan showed a hypointense lesion on the T1-weighted image and a hyperintense lesion on the T2-weighted image. A computed tomography (CT) scan showed an osteolytic lesion with erosion of the tabula externa . A left frontal craniectomy via linear incision was performed with excision of the frontal lesion and a margin of surrounding uninvolved bone and a cranioplasty. There was no involvement of the underlying dura. This lesion was well delineated and brown in color with erosion of the outer tables of the skull. Her postoperative course was uneventful and a CT scan showed complete resection of the mass with a correct cranioplasty. A histological examination revealed a cavernous hemangioma of the diploe with large, thin-walled, dilated capillary spaces lined by flattened endothelial cells without evidence of malignancy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_602_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_602_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b41c482e4c2da58a6e22f7385fcea4ecf8871b22
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_602_en.txt
@@ -0,0 +1,10 @@
+In February 2009, a 67-year-old female patient sought medical advice one week after suffering from a tick bite at the dorsal scalp. She had acquired the tick in southern Germany in the vicinity of Freiburg (Baden-Wuerttemberg). Two days after removal of the tick she noticed redness followed by ulcer formation at the biting site along with swollen regional lymph nodes. She presented with high fever (40°C), malaise, headache and nuchal lymphadenopathy. At the site of the tick bite an eschar with edematous margins was present . The remaining physical examination was unremarkable. She denied animal contacts and had not been anywhere else than in the vicinity of Freiburg. Laboratory investigations revealed a white blood cell count of 8.3 × 109/L, C-reactive protein of 112 mg/L (normal < 5 mg/L), moderately elevated transaminases (ALT 133 U/L [normal < 35 U/L], AST 99 U/L [< 35 U/L], γ-GT 158 U/L [< 40 U/L]) and mildly elevated LDH (314 U/L [< 214 U/L]). Blood cultures were negative and cultures of dermal swabs obtained from the eschar revealed normal skin flora. Computed tomography revealed imbibition of the subcutaneous tissue underneath the eschar and non-necrotizing lymphadenitis of the draining lymph nodes without evidence of cervical or mediastinal abscess formation . Antibody testing for Francisella tularensis, Borrelia burgdorferi, Rickettsia prowazekii, Rickettsia typhi and Yersinia enterocolitica was negative. She was empirically treated with ampicillin/sulbactam and ciprofloxacin, three days after initiation of antibiotic treatment defervescence and clinical improvement could be noticed.
+In serial serum samples (day 7, 17 and 24) specific antibody testing for rickettsiae of the tick-borne spotted fever group revealed a seroconversion (indirect immunofluorescence assay : R. conorii IgG [Fuller Laboratories], <1:32, 1:512, 1:1024, respectively; R. helvetica IgG [in house], <1:32, 1:32, 1:128, respectively). Skin-biopsy of the eschar was not performed. The patient recovered without further complications, a change to specific anti-rickettsial antibiotic therapy, i.e. doxycylin was not necessary.
+Human rickettsioses occur worldwide and are considered to be emerging infections . One of the newly discovered rickettsial diseases is tick-borne lymphadenopathy (TIBOLA). The causative agent, Rickettsia slovaca, was discovered in 1968 in Slovakia, but was being considered as non-pathogenic until 1997 [,]. R. slovaca is transmitted almost exclusively by Dermacentor marginatus and rarely by Dermacentor reticulatus ticks .
+Here we report the case of a female Caucasian patient presenting with the characteristic clinical features of TIBOLA. In our patient the tick was not available for genus and species identification, however, the season late winter/early spring and the localisation of the tick bite on the scalp strongly suggest a bite due to D. marginatus which is prevalent in the vicinity of Freiburg. Noteworthy, TIBOLA is one of the rare tick-borne diseases that is more common in the cold season. As reported in several case series, females are at higher risk of TIBOLA, the mean age is 30-35 years with a substantial proportion of cases occurring in children. Apart from TIBOLA, two other acronyms were proposed for this clinical entity: Dermacentor-borne necrosis erythema and lymphadenopathy (DEBONEL) or scalp eschar and neck lymphadenopathy after tick bite (SENLAT) .
+R. slovaca has been described in Dermacentor ticks in many European countries including France, Greece, Hungary, Spain, Italy, Switzerland, Austria, Russia, Ukraine, Armenia, and others. In Germany, R. slovaca has been found in D. marginatus ticks in Baden-Wuerttemberg in the area of the Rhine valley and recently in the Main valley in the vicinity of Aschaffenburg, Bavaria .
+Within the last years, detection of R. slovaca from human cases has been increasingly reported from France, Hungary, Spain and Italy [,-]. It is remarkable that although R. slovaca was isolated in ticks in Germany already 30 years ago, no human case of TIBOLA in Germany has been described until recently. As a consequence of the case presented here and another case of 2009 from southern Rhineland-Palatinate , Germany must be added to the list of countries where autochthonous acquisition of TIBOLA has occurred. R. slovaca infections seem to be more widespread over Germany as has been found so far since our case was several hundred kilometers south of the case described in Rhineland-Palatinate. Including the recently described detection of Rickettsia aeschlimannii, up to now seven rickettsial species have been reported in Germany .
+Apart from R. slovaca, the rickettsial genotypes RpA4, DnS14 and DnS28 belonging to a new spotted fever group species recently named R. raoultii have been implicated in the etiology of TIBOLA . Due to only minor antigenetic differences among all spotted fever group rickettsiae, serology is not able to discriminate within members of this group and unambiguous (sub)species-specific diagnosis can only be made by PCR from skin biopsies or swab specimen of the eschar . As R. raoultii is prevalent in D. reticulatis ticks in southern Germany and skin biopsy/PCR was not performed, we cannot rule out TIBOLA due to R. raoultii. However, our patient suffered from high fever and pronounced malaise. This strongly favours an infection due to R. slovaca since R. raoultii is considered to be less pathogenic and to cause a milder form of TIBOLA [,].
+Noteworthy, apart from fever and malaise our patient presented with moderately elevated transaminases indicating hepatic involvement in the course of infection. Further evaluation included abdominal/hepatic ultrasonography which was unremarkable. Antibody testing for Coxiella burnetii was negative. Improvement of ALT/AST during antibiotic treatment argues against drug induced hepatitis due to ampicillin/sulbactam or ciprofloxacin.
+The differential diagnosis in patients with an eschar includes rickettsial infections, cutaneous anthrax, tularaemia, necrotic arachnidism (brown recluse spider bite), scrub typhus (Orientia tsutsugamushi), rat bite fever (Spirillum minus), staphylococcal or streptococcal ecthyma, and, as discussed recently, infection due to Bartonella henselae . However, in the context of a previous tick bite, infection due to Francisella tularensis, or possibly B. henselae, as well as staphylococcal or streptococcal superinfection occur as most likely diagnoses.
+As for other rickettsioses the treatment of choice is considered to be a 7 to 10 day course of doxycycline (100 mg twice daily for adults), with ciprofloxacin or azithromycin/clarithromycin as possible alternative agents. Severe complications as seen in other rickettsiosis (e.g. epidemic typhus, Rocky Mountain Spotted Fever, Mediterranean Spotted Fever) have not been described in TIBOLA so far.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_605_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_605_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5155a20d1d6a12910d5845555cc97c50d7409431
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_605_en.txt
@@ -0,0 +1,2 @@
+A 45-year-old woman presented with a 4-month history of a painful lump in the anterior aspect of her left elbow associated with altered sensation in the dorsoradial aspect of her left hand. There was no history of trauma or any exacerbating factors. On examination the altered sensation was in the superficial radial nerve distribution and she had a positive Tinel's sign over the site of the swelling which was located over the anterior aspect of the radiocapitellar joint. There was no weakness in the motor function of the muscles innervated by the PIN.
+An ultrasound scan showed an ill-defined cystic lesion measuring approximately 3 cm in length and up to 1.4 cm in depth within the soft tissues on the anterior aspect of the elbow joint, closely related to the anterior aspect of the radius. A magnetic resonance imaging (MRI) scan was carried out and this showed a bilobed cystic mass over the anterior margin of the radiocapitellar joint extending over the anterior surface of the neck of the radius. It was seen to be intimately related to the radial nerve as it passed over the arcade of Frohse and at the division of the PIN. The appearances were typical of a ganglion cyst . As the patient's symptoms remained severe, exploration of the area was carried out under an axillary block using an anterior approach. Dissection showed that the superficial branch of the radial nerve was stretched over the ganglion which was located on the anterior aspect of the elbow joint . The ganglion was resected in its entirety together with the stalk originating from the radiocapitellar joint . Histology of the sample confirmed a multiloculated fibrofatty ganglion cyst with no discernible epithelial lining. The patient was reviewed in the clinic a month later and her symptoms had resolved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_607_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_607_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0ce06dc5dba21c6acae8c8ee75a6d2c4bfe06e20
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_607_en.txt
@@ -0,0 +1 @@
+A 42-year-old Korean male presented with gradually progressive proptosis of right eye for 2 years. He also complained of right-sided frontal headache for 1 week. He had previously undergone endoscopic sinus surgery (ESS) for chronic rhinosinusitis with nasal polyp 15 and 9 years ago. There were no other rhinological or ophthalmological symptoms. He had suffered from adult onset diabetes mellitus for 5 years and was well controlled on oral hypoglycemic agents. The endoscopic examination showed an expansive, large middle turbinate with normal mucosa filled the majority of right nasal cavity and displaced the septum to the left. Ophthalmologic examination revealed exophthalmos and globe was displaced antero-laterally. Ocular motion and visual acuity were normal. A computed tomography (CT) scan of the orbit showed a well demarcated huge mass at right nasal cavity extending to ethmoid sinus and orbit. The mass caused a bony defect on the lamina papyracea and displaced medial rectus muscle and orbit laterally. Moreover, the right frontal and ethmoid sinus was totally opacified . Magnetic resonance (MR) images of the paranasal sinus revealed a cystic mass displaying intermediate signal intensity on T1-weighted images (T1WIs) and T2WIs without enhancement. In addition, right frontal and ethmoid sinusitis was also observed . From these findings, the lesion was suspected to be a CB mucocele with orbital invasion and frontal sinusitis. Resection of the lateral and inferior walls of the right middle turbinate was performed under general anesthesia combined with a right frontal sinusotomy. The middle turbinate consisted of thick, dark brown, and inspissated material surrounded by a partially bony shell with mucosa at both inner and outer side, confirming the diagnosis of a mucocele in CB. No organism was seen on gram, AFB, and fungus stain and culture yielded no growth in the pus from CB. After frontal sinusotomy, pulsating pus like discharge and inflammation-induced edematous sinus mucosa were noted. An oral antibiotic treatment with Amoxicillin and Clavulanate was started for concurrent paranasal sinus infection, and planned to complete for 2 weeks. The patient’s symptoms quickly diminished postoperatively and a follow-up CT scan 9 month after surgery demonstrated complete resolution of CB mucocele and frontal sinusitis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_60_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_60_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58892d2a5d80c9651594229a7a95880dc29c3742
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_60_en.txt
@@ -0,0 +1,5 @@
+A 62-year-old man presented to his local hospital after 1 month of mucous and bloody stool and 2 weeks of worsening abdominal pain. He had leukocytosis (1.4 × 104/μL), thrombocytopenia (6.4 × 104/μL), and elevated blood urea nitrogen (BUN; 71 mg/dL) and serum creatinine (2.56 mg/dL) levels. The patient was admitted with a suspicion of sepsis secondary to intraabdominal infection, and broad-spectrum antimicrobial therapy was initiated. However, his condition deteriorated, and after 7 days, he was transferred to the intensive care unit (ICU) at Chiba University Hospital.
+On admission to the ICU, the 165.3 cm tall patient weighing 99.3 kg was fully conscious (Glasgow Coma Scale E4V5M6), but he had a tendency to somnolence. His blood pressure was 154/103 mm Hg, heart rate 115/minutes, respiratory rate 30/minutes, body temperature 37.9 °C, and SpO2 96% on room air. The conjunctiva and skin were icteric. The chest was clear to auscultation. There was abdominal distention with mild hypogastric tenderness but no sign of peritoneal irritation. There was pitting edema in the upper and lower extremities. The white blood cell count was 1.2 × 104/μL, C-reactive protein level was 23.9 mg/dL, and procalcitonin level was 8.92 ng/mL, which were consistent with a diagnosis of bacterial infection. The platelet count had dropped to 3.8 × 104/μL, and the prothrombin time was 41% with a fibrin degradation product level of 53.1 μg/mL, indicative of coagulopathy. The lactate dehydrogenase level was 392 IU/L, aspartate transaminase and alanine transaminase levels were 50 and 17 IU/L, respectively, and also total and direct bilirubin levels were 6.2 and 4.6 mg/dL, respectively; however, other indicators of hemolysis, including anemia and schistocytosis, were absent. The BUN had increased to 92 mg/dL and the creatinine level was stable at 2.09 mg/dL. The CH50 level was 40.6 U/mL (normal range: 30–50 U/mL), the C3 level was 85 mg/dL (normal range: 65–135 mg/dL), and the C4 level was 23 mg/dL (normal range: 13–35 mg/dL).
+The patient's clinical course is summarized in the Fig. . Since a stool culture test on ICU admission identified Enterococcus species and Corynebacterium striatum, a diagnosis of severe sepsis derived from bacterial enteritis was established and wide-spectrum antimicrobial therapy was initiated. Continuous hemodiafiltration was initiated on ICU day 3 but oliguria progressed to anuria, thrombocytopenia persisted, and laboratory values did not improve. Blood, urine, and spinal fluid cultures taken on admission to the ICU were all negative, which eliminated the possibility of additional foci of infection. Two polyps (one each in the sigmoid colon and the rectum) were discovered on lower gastrointestinal endoscopy, which were diagnosed at histopathology as early-stage nonhemorrhagic adenocarcinoma. The polyps did not appear to be the cause of the bloody stool. Additional laboratory evaluations were negative for other hematological disorders or connective tissue diseases. On ICU day 9, schistocytosis (0.5%) was noted on the peripheral blood smear, and a diagnosis of TMA was established. The Hct level also had dropped to 23.5% on the same day and the declining trend continued, therefore red blood cell transfusion was performed days later when he complained dyspnea. Plasma exchange (PE) therapy was initiated on ICU day 11. The patient had only a slight remission of thrombocytopenia after a total of 8 PE sessions (2.1 × 104/μL before the 1st PE and 5.9 × 104/μL after the 8th PE), but there was no notable clinical improvement and the anuria persisted . The level of ADAMTS13 activity in a plasma sample collected from the patient prior to initiation of PE was 25.1%, and the sample was negative for ADAMTS13 inhibitor. These findings eliminated the possibility of TTP. Furthermore, the stool was negative for Shiga toxin-producing-strains of Escherichia coli, and the serum titer for anti-Shiga-toxin antibody was also negative, eliminating the possibility of HUS. Although we considered TMA secondary to colorectal cancer in the differential diagnosis, the endoscopic findings of intramucosal carcinoma and negativity for tumor markers eliminated this possibility. Careful consideration of other possible causes, previous history, and drug history failed to identify an extrinsic etiology of TMA in this patient, and we ultimately suspected aHUS as the cause. Accordingly, intravenous eculizumab treatment (900 mg, once a week) was initiated on ICU day 26. An increase in urine output was observed on the next day, and renal support was successfully discontinued on the same day. And also marked recovery of the platelet count was obtained in combination with the effectiveness of supportive therapy including PE. Biweekly eculizumab infusion was repeated 4 times and then discontinued.
+After approval by the institutional review boards of Chiba University, the University of Tokyo, and National Cerebral and Cardiovascular Center, an anticomplement factor H (CFH) antibody assay and an analysis of complement factor H-related (CFHR) genes were performed using a blood sample collected from the patient prior to initiation of PE. Also written informed consent was obtained from the patient before the assays. The anti-CFH antibody level was 6.16 AU/mL, which indicated negativity for anti-CFH antibody. We performed the multiplex ligation-dependent probe amplification (MLPA) analysis to screen the copy numbers of CFHR1/3 on chromosome 1q32 using a commercially available kit (MLPA kit P236-A2; MRC-Holland, The Netherlands),[ and found that CFHR1/3 did not show gene deletions. However, moderate hemolysis was induced in concomitant hemolytic assays using sheep red blood cells (RBCs), and analysis for mutations potentially associated with aHUS identified a nonsynonymous mutation (p.Ala311Val) in the gene encoding membrane cofactor protein (MCP). All screened genes are presented in the Table .
+The patient was discharged from the ICU on day 37 and was discharged to home on day 58. He was followed up regularly as an outpatient and was receiving 40 mg/day of prednisolone. At approximately 1 year after discharge, the patient remained in stable condition without relapse or resumption of eculizumab therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_614_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_614_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8a9da595f5167afd1fc5466430460e7810a3ab38
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_614_en.txt
@@ -0,0 +1,2 @@
+A 39-year-old, healthy, non-smoking female patient with no family history of cancer was referred on suspicion of rectal cancer. Digital rectal examination and subsequent rigid proctoscopy revealed a low rectal tumor and multiple polyps in the rectum. Subsequent colonoscopy showed extensive polyposis of the entire colon. The tumor biopsy confirmed the presence of a rectal adenocarcinoma, while dysplastic changes were found in the polyp biopsies. No distant metastases were detected on the thoracoabdominal computed tomography (CT) scan, and baseline carcinoembryonic antigen (CEA) was 8 μg/L. Pelvic magnetic resonance imaging (MRI) revealed a locally advanced rectal cancer with extra-mesorectal growth into the rectovaginal septum and the lower posterior vaginal wall as well as a suspected growth into the anterior aspect of the coccygeal bone with multiple suspected malignant lymph nodes within the mesorectum (T4N2). Upon evaluation by our multidisciplinary team (MDT), she was scheduled for neoadjuvant chemoradiotherapy (CRT) followed by surgery. Neoadjuvant treatment was given as CT planned radiotherapy (daily 2-Gy fractions, 5 days per week; the initial 23 fractions to the macroscopic tumor and areas at risk, and the two final fractions adapted to the macroscopic tumor) with concomitant capecitabine (825 mg/m2) on days of RT. The response evaluation showed excellent tumor volume response, but with similar organ involvement as at baseline, and she proceeded to surgery 8 weeks after CRT completion. Surgery involved total colectomy, APE with resection of the posterior vaginal wall and coccygeal bone with subsequent reconstruction of the perineum with right-sided VRAM flap, and a terminal ileostomy. After an uneventful recovery, she was discharged 15 days postoperatively. Histologic examination of the specimen showed a 35-mm large adenosquamous carcinoma removed with free resection margins and metastasis in one of four local lymph nodes (pT2N1). In addition, multiple dysplastic adenomas were present in the entire colon.
+At the routine follow-up 6 months postoperatively, clinical examination revealed a 2 × 2 cm tumor located in the muscle tissue of the VRAM flap, and an early local recurrence was suspected. Pelvic MRI showed a 10 × 16 mm rich vascularized and cell dense lesion corresponding to the clinically detected tumor . No other pathological findings were made on CT or MRI, and CEA was 1 μg/L. The lesion was surgically excised with a wide local resection of the tumor. Interestingly, histologic examination of the removed lesion described a mass composed of fatty tissue, fibrocytes, and fibroblasts arranged in broad, sweeping fascicles infiltrating the adjacent striated muscle tissue. No dysplasia was observed, but mitoses were present. Immunohistochemistry showed positive staining for β-catenin (ABCAM, Cambridge, USA), and the tumor was diagnosed as a fibromatosis . The medical geneticists suspected familial adenomatous polyposis (FAP), and testing of the APC gene, revealed a known disease-causing mutation c.3317dupG (p.Ala1107Serfs*12), confirming this diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_615_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_615_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e55127b018bbb5d047647031c775ffd6d53fca73
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_615_en.txt
@@ -0,0 +1,3 @@
+A 44-year-old Asian male visited the emergency room with chief complaints of intraoral pain and dysphagia that had started on the same day. The patient had paranoid-type schizophrenia that began 10 years ago; he had been hospitalized and was being treated at another clinic, and was transferred to the emergency room by the medical staff after swallowing a toothbrush.At the time of admission, the patient’s mental status, including orientation, was alert, and other vital signs were stable as well. Physical examinations showed uvular lacerations and a foreign body that appeared to be a toothbrush in the posterior oropharyngeal wall. A plain radiograph of the paranasal sinuses confirmed the presence of a foreign body located in the nasal cavity and oropharynx . CT scan of the neck revealed a foreign body spanning from the left nasopharynx to the right hypopharynx, as well as a broad area of subcutaneous emphysema in the anterior and lateral cervical regions . As additional damage could occur if the foreign body removal process was delayed, an emergency surgery was attempted.
+An intraoral approach employing nasotracheal tube insertion under general anesthesia was used. The exposed part of the toothbrush was cut with an electric surgical saw. Following the removal of the two separate parts, the uvular laceration was sutured and the surgery was completed .
+To evaluate hypopharyngeal and esophageal damage, an esophagogram was obtained using a water-soluble contrast dye on the first postoperative day, and a small perforation in the hypopharyngeal region was identified. Accordingly, the patient received conservative therapy, including intravenous broad-range antibiotic administration and was placed on oral dietary restrictions. No specific findings or complications were detected via the esophagogram on the 10th postoperative day, and the patient was subsequently discharged and is currently being followed up .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_623_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_623_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..32106cff8ba2e63121de47721cd3ae5a1979933b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_623_en.txt
@@ -0,0 +1,3 @@
+A 13-year-old child with learning disability was referred for ophthalmic assessment as she complained of bilateral blurring of vision. At presentation, her visual acuity was 1/60 in the right eye and 6/18 in the left eye. Relative afferent pupillary defect (RAPD) was present in the right eye. Both eyes anterior segment examination findings were normal. Grade 1 vitritis was noted in the right eye. Funduscopic examination of the right eye revealed a pale optic disc and pigmented scar over the macula with salt and pepper appearance. Intense retinitis with focal areas of haemorrhage was present nasally . There was mild pallor of the left optic disc with macula and peripheral granular retinitis .
+Systematically, she was diagnosed with combined T and B cell deficiencies by the immunologist at the age of 11. At that time, she presented with high fever, recurrent episodes of diarrhoea, oral thrush, and failure to thrive, with the weight of only 12kg. PIDD screening showed low T cell, very low B cell counts, and low immunoglobulin levels . Her systemic therapy consisted of 3 weekly intravenous immunoglobulin, sulfamethoxazole, and trimethoprim prophylaxis as well as empirical therapy for fungal infection which include syrup fluconazole 6mg/kg/day and syrup nystatin 1ml QID. She was also treated for CMV colitis as HPE of the colon showed CMV inclusion bodies. She completed 6 weeks of intravenous ganciclovir 3 months prior to presentation of her ophthalmic symptoms.
+We diagnosed the child of having bilateral eye CMV retinitis based on typical fundus features and history of treated CMV colitis. She was planned for right eye intravitreal ganciclovir injection in view of poor visual function with posterior pole involvement. However, she was deemed unfit to undergo general anaesthesia due to concomitant hospital acquired pneumonia. IV ganciclovir 75mg (6mg/kg) 12 hourly was started and good response was noted after 2 weeks of therapy . The treatment was continued for 8 weeks until the retinitis lesions had healed with scarring . However, the right visual acuity reduced to light perception and improved to 6/9 in the left eye.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_658_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_658_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..672a7b83bc9fd0c2656d107e84c0c051d684562c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_658_en.txt
@@ -0,0 +1,8 @@
+Timeline: The timeline of diagnosis and treatment after admission is shown in Table .
+An 81-year-old Japanese woman had been diagnosed with a branch-duct disease IPMN lesion in the pancreas by abdominal computed tomography (CT) in 2015. In March 2017, an abdominal CT examination had showed no significant change in IPMN, but in November 2017, blood examinations found elevated CA19-9 (87 U/mL).
+In March 2018, the patient was transferred to our hospital for further examination. CT and magnetic resonance imaging (MRI) found the known branch-duct disease IPMN lesion (12 mm) and confirmed localized pancreatitis in the tail of the pancreas and mild pancreatic duct dilatation (2.2 mm). In April 2018, endoscopic ultrasound (EUS) (UE260 Ultrasonic gastrovideoscope; Olympus, Tokyo, Japan) revealed a hypoechoic tumor (approximately 7 mm) and local atrophy in the tail of the pancreas. There were no changes in the lesions or other suspicious lesions on CT and MRI scans performed in May 2018.
+After admission, the patient’s temperature was 36.4 °C, heart rate was 72 beats per minute, respiratory rate was 16 breaths per minute, blood pressure was 112/60 mmHg, and oxygen saturation in room air was 98%. The physical examination did not reveal any abnormal findings.
+The patient was admitted to our hospital for EUS-guided fine needle aspiration (EUS-FNA) for the pancreatic tail tumor. Gastroscopy revealed a suspicious 10 mm lesion in the greater curvature of the gastric antrum, which was confirmed as early gastric cancer (Tub1, 10 mm, M, UL-) by magnifying endoscopy with narrow band imaging and EUS, and as group V adenocarcinoma by pathological biopsy [negative for Helicobacter pylori (HP) antibody]. Thus, it met the indications of endoscopic submucosal dissection (ESD). Colonoscopy revealed no positive findings. Although pancreatic EUS confirmed a 7 mm pancreatic tail tumor, FNA could not be performed despite contrast-enhanced EUS because of its small size and poor reproducibility. Endoscopic retrograde cholangiopancreatography was performed, and the pancreatic juice was collected four times for cytological examination.
+The patient was diagnosed with class III cellular atypia. CA19-9 levels continued to increase. Based on the American College of Gastroenterology clinical guidelines, we suggested surgical treatment, and her family supported the decision. The patient refused pancreatic surgery but agreed to gastric ESD. In February 2019, we attempted EUS-FNA again, as the lesion had enlarged (15 mm). We were able to successfully obtain a pathological diagnosis following puncture, from which the subsequent ex vivo examinations indicated adenocarcinoma class V.
+Blood test data on admission are shown in Table . The CA19-9 levels before and after treatment are shown in Figure .
+The imaging comparison, pathology, and immunostaining of pancreatic cancer and IPMN are shown in Figure . The endoscopic images, pathological examination, and immunostaining of early gastric cancer are shown in Figure .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_660_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_660_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..890446add5fc2803ece5b5c43acad8f2aaf71e59
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_660_en.txt
@@ -0,0 +1,3 @@
+Our patient was a 27-year-old Javanese man with borderline intellectual functioning and striking dysmorphisms. Both his parents were Javanese, normal, non-consanguineous, and in their sixth decade of life. He was the third child born after a normal third pregnancy and he had two sisters who were normal. His mother had a cesarean delivery with no history of trauma, infection, or drug use during the term. No family history of similar complaints or any other congenital abnormality was reported. Our patient was born at term after an uneventful pregnancy.
+He is a slow learner and attends a school for children with special needs in Cirebon, West Java, Indonesia. There he began to socialize, play with other classmates, and he likes to draw and enjoys music. The dysmorphisms found are very characteristic. On physical examination, his weight was 36 kg, height 158 cm, and occipital frontal circumference 54 cm. It was observed that he displayed hypertelorism, down-slanting palpebral fissure, strabismus, ocular proptosis, depressed nasal bridge, short philtrum, and low-set ears. In addition, acrocephaly, asymmetrical flat facies, nasal deformity, and prominent jaw were present . His oral deformities showed maxilla hypoplasia with high arch palate. His V-shaped maxillary arch was filled with double rows of teeth. In addition, there was a dental fusion between maxillary premolar and first molar. Panoramic radiographs were performed for confirmation . Other abnormalities found were mild scoliosis and mild pectus excavatum. Symmetrical cutaneous bilateral syndactyly involving his four fingers, his palms were spoon-shaped with an inwardly placed thumb, was present (type 2). Both feet showed type 2 symmetrical cutaneous syndactyly of the first to fifth toes. Radiographs of both hands and feet confirmed soft tissue syndactyly . He had corrective surgery twice on both hands to correct for joint contractures. There was no postoperative complication. Six months after the second surgery, he could start using his fingers. A clinical diagnosis of AS was previously made based on these clinical features, as earlier mentioned in our study describing clinical manifestations of this patient . Furthermore, Pictures of Standard Syndromes and Undiagnosed Malformations (POSSUM) software was used before molecular analysis and the result showed suspected AS with a cut-off point of 14. Ethical clearance for genetic testing was obtained according to the research ethic committee of Faculty of Medicine, Swadaya Gunung Jati University, Indonesia.
+Mutation analysis was conducted for our patient. DNA was isolated from peripheral blood using the salt saturation method, as previously described by Miller et al. . Molecular genetics analysis of FGFR2, targeting exon 7, was performed by direct sequencing at the Laboratory of Neurovascular Unit and Cognitive Impairments, University of Poitiers, France. The reference genomic DNA sequence used was NM_000141.4. Polymerase chain reaction (PCR) amplification of exon 7 from the FGFR2 gene was performed using the primers FGFR2-F 5-CCGGCAGTCTCCTTTGAAGT-3′ and FGFR2-R 5′-GATCTGTTAATTCCTTAGAACACTCTCT-3′, resulting in a 525 bp fragment. Approximately 50 ng of DNA solution (2.5 μl) was added to 22.5 μl of PCR mixture. This PCR mixture contained 0.25 μl of 25 mM deoxyribonucleotide triphosphates (dNTPs), 3 μl of 25 mM MgCl2, 0.25 μl of each 20 μM primer, 2.5 μl of 10× PCR buffer, 0.125 μl of 5 U/μl Diamond® high fidelity Taq DNA polymerase (Eurogentec), and 16.13 μl of H2O. PCR was initiated with denaturation at 95 °C for 3 minutes, followed by 35 PCR cycles (at 95 °C for 30 seconds, 60 °C for 30 seconds, and 72 °C for 30 seconds) and 7 minutes final elongation at 72 °C. The amplified products were detected by electrophoresis on a 1.5% agarose gel with 0.5 mg/ml ethidium bromide and visualized under ultraviolet (UV) light. Furthermore, 5 μl of the PCR product was cleaned up with 2 μl ExoSAP reagent (ThermoFisher) according to the manufacturer’s instructions, to remove excess primers and unincorporated nucleotides enzymatically. Finally, 2 μl of the PCR product was used for the sequence reaction (BigDye Terminator Cycle Sequencing Kit Version 3.3; Applied Biosystems), which was run on an ABI PRISM® 310 Genetic Analyzer (Applied Biosystems), following the manufacturer’s directions. Sequencing was performed bidirectionally using the forward and reverse PCR primers. The sequence result was compared with the published reference sequence using Chromas software version 2.6.4. In this patient, we detected a missense mutation, changing a TCG codon (coding for a serine) into a TGG (coding for a tryptophan): p.Ser252Trp (c.755C>G) .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_704_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_704_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6fb20c0934c78ac9e9dd4b96d4c739c52b672fa0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_704_en.txt
@@ -0,0 +1,2 @@
+A 2630 g female newborn was delivered at term by a cesarean section due to deceleration after an uncomplicated pregnancy to a 36-year-old mother. Since the age of three months she was hospitalized several times with intermittent wheezing, inspiratory stridor, epigastrical retractions, dyspnea and cough. Each time, she was diagnosed either with bronchiolitis or wheezy bronchitis and treated with bronchodilators, inhaled corticosteroids and antibiotics. However the symptoms recurred frequently, therefore further diagnostic approaches were initiated including chest-radiography, allergy tests (specific IgE) and otorhinolaryngeal examination, which revealed no abnormalities. At the age of two years the girl was admitted to our hospital because of an acute exacerbation of her pulmonary situation. She presented in reduced physical condition with respiratory distress at rest, wheezing and dry cough. Inhalation therapy with beta agonists showed no success, there were no signs of a severe viral or bacterial infection. Based on her medical history of several episodes with recurrent, therapy-refractory wheezing without signs of an infection and her acute condition of severe respiratory distress we decided to extend the diagnostic approach and underwent flexible bronchoscopy under general anesthesia. The larynx appeared with a mild malacia, the branching of the right upper lobe bronchus (RUL) was atypical in the anterior aspect of the carina followed by tracheal stenosis. The main bronchi could not be entered with a two millimeter bronchoscope . Therefore and to identify the exact anatomical situation a CT scan of the lung was performed with a three-dimensional reconstruction of the tracheo-bronchial system, which demonstrated a voluminous right upper lobe bronchus branching of the trachea at the level of the aortic arch, followed distally by a tracheal stenosis to the left . At a lower vertebral level than that of the normal carina (T5-6), the trachea was divided into two bronchi (bifurcatio tracheae), of which one proceeded to the left side of the lung (left main bronchus, LMB) and one adjacently with the pulmonary artery to the right (bridging bronchus, BB). This bridging bronchus upcoming from the left supplied the right lower and middle lobe. Whereas the right lower lobe was normally configured, the right middle lobe appeared hypoplastic. Parts of the ventral upper lobe were hyperinflated. Despite the small diameter of the left main bronchus, the left lung was normally ventilated. CT scan provided no indication of an associated vascular malformation e.g. a left sling pulmonary artery (SLPA). To exclude further anatomical variations of the cardiovascular, renal or gastrointestinal system echocardiography and abdominal ultrasound were performed and demonstrated no anomalies.
+Treatment with epinephrine inhalation and leucotriene receptor antagonist was initiated for several weeks and the patient was followed by our outpatient clinics every three months. Early intervention with physiotherapy, early use of mucolytic therapy and antibiotics were recommended during infections. During her three-years follow up period the girl has shown several croup-like attacks, but did well without further intervention or therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_722_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_722_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d948504da1e62168ae724b2bb7f5cb1a00c7a4a2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_722_en.txt
@@ -0,0 +1,5 @@
+A 59-year-old man with complaints of epigastric discomfort for 5 months underwent upper endoscopy in a local hospital in July 2018; the gastroscopy report described a “foreign body in the mucosa of the esophagus”. At that time, a nematode body was removed under endoscopy, and parasitic infection was considered. The removed worm body was discarded without further detection. The patient was then referred to our hospital after approximately two weeks in August 2018, and gastroscopy was recommended again.
+The endoscopy showed a white movable worm-like object adhering to the esophageal mucosa at approximately 35–38 cm from the incisors, which was more clearly depicted by narrow-band imaging . Observing the peristalsis of the worm, we were able to distinguish its head and tail, and the worm was carefully removed in one piece using biopsy forceps to grab the head and placed in formalin . Parasitologists at our hospital confirmed that the object was a mature female G. pulchrum individual, which may have been living in the body for at least 1 year.
+No other worms were found in the patient’s oral cavity, esophagus, stomach or duodenum. Physical examination and clinical examination revealed no abnormalities, and no parasite eggs were observed in multiple stool tests. This patient had no high-risk factors for esophageal cancer, such as smoking, flushing after drinking, or tumor history. He was a farmer in Hebei Province, China, and he had not traveled abroad. His living environment was relatively poor, and he also admitted to drinking unboiled water and eating uncooked vegetables that he grew with human feces fertilization. No animal was kept in his house. We suppose that the route of transmission was accidental ingestion of water or food contaminated by intermediate insect hosts.
+In addition to the worm, this patient also had a large area of early esophageal cancer around the esophagus, which was 19–25 cm away from the incisors . Magnifying gastroscopy and ultrasound endoscopy indicated that the lesion was limited to the M2 layer , and no lymph node metastasis was found on enhanced computed tomography (CT). The patient underwent endoscopic submucosal dissection . The pathological report revealed M2-infiltrated early esophageal squamous cell carcinoma of the esophagus, with focal infiltration of the muscularis mucosa but no complete infiltration. As no tumor tissue was present at the resection margin, curative resection was achieved. The squamous cell carcinoma lesion did not contain any parasites.
+Forty-eight hours after the operation, the patient began taking prednisone acetate 30 mg Qd to prevent stenosis and albendazole for 7 days as antiparasitic treatment. The patient developed esophageal stenosis after surgery, though it steadily improved after multiple dilations. There was no parasite recurrence after repeated gastroscopy, and the patient’s symptoms disappeared.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_738_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_738_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2d9adc69e317a3db73cb0b26affc33415366d455
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_738_en.txt
@@ -0,0 +1,8 @@
+A 71-year-old Japanese man with end-stage renal disease due to diabetic nephropathy was emergently admitted to our hospital because of uremia with fatigue, pulmonary edema, and hyperkalemia. Therefore, hemodialysis was initiated using a temporary blood access catheter on the same day. He gradually recovered his health, and we planned to create an AVF.
+He was right-handed. Preoperative ultrasonography of the left upper extremity showed good continuity and patency of the cutaneous vein from the wrist to the upper arm. However, the cephalic vein near the wrist was of a poor quality. Moreover, the internal diameter of the radial artery was approximately 2.0 mm in the FIS, and the second dorsal metacarpal vein (SDMV) was approximately 2.3 mm under avascularization. Therefore, we decided to create an RSDAVF in the FIS of the left dorsal hand. Thirteen days after his admission, the operation was successfully performed (A–D).
+The radial artery, SDMV, tendonof the extensor pollicis longus, and skin incision line were preoperatively indicated using markers (A). The procedure was performed under local anesthesia (1% lidocaine) following a single dose of prophylactic antibiotic (cefazolin 1 g, intravenous), routine disinfection and aseptic shield.
+First, a longitudinal 1.5-cm skin incision was made along the slight ulnar side of the artery over the FIS. Next, an approximately 3-cm segment of the vein was dissociated to reach and anastomose with the artery, and an approximately 2-cm segment of the artery was dissociated (B).
+After 2000 units of heparin were administered and allowed to circulate for 5 min, the distal part of the vein was ligated and transected proximal to the ligation (C). The vein with visible blood reflux was flushed using a 10-ml syringe connected to a 5-Fr × 45-cm catheter, and by injecting 20–50 ml heparinized saline into the vascular lumen, we confirmed a good thrill. An end-to-side AVF whose anastomotic diameter was approximately 8 mm was then created using continuous 7/0 polypropylene sutures (D), and a good thrill was confirmed.
+Finally, the wound was closed with 4/0 Nylon after we confirmed that no active bleeding was detected in the operative field.
+The puncture of the RSDAVF was initiated 13 days after the operation. The AVF had developed sufficiently (A), and the blood flow rate during hemodialysis (QB) exceeded 300 mL/min. In addition, not only the superficial veins of the dorsal hand and forearm but also the cephalic and basilic veins in the forearm and upper arm had developed. He was able to receive hemodialysis without problems. The venipuncture sites are shown in B–C, and a schematic illustration of the AVF in the patient’s left hand and forearm is shown in D.
+About six months later, he needed percutaneous transluminal angioplasty due to VA stenosis. It was successfully performed, and he has been on hemodialysis for seven months without additional VA interventions.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_747_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_747_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8aa632b8787ab07fcf97af0144814fdd8e3bdb15
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_747_en.txt
@@ -0,0 +1,4 @@
+A 55-year-old Caucasian male presented in February 2005 with new onset hematuria, easy bruising, and jaundice. He also reported fevers, nausea with vomiting and fatigue in the week prior to presentation without any associated abdominal pain or pruritus. At presentation, he was afebrile and there was no skin rash, hepatosplenomegaly, asterixis, or stigmata of chronic liver disease but he was deeply jaundiced with scleral icterus and multiple ecchymoses. Initial laboratory tests included a white blood cell count of 13.7 (4.0–10.0 K/UL) with a left shift, hemoglobin 15.5 (13.5–17.5 GM/DL), platelets 200 (140–450 K/UL), AST 1466 (20–57 IU/L), ALT 1459 (21–72 IU/L), total bilirubin 5.3 (0.0–1.5 mg/dl), direct bilirubin 4.9 (0.0–0.8 mg/dl), alkaline phosphatase 219 (30–136 IU/L), INR 13, and prothrombin time 145.8 (10.0–13.5 sec). Serum liver biochemistries were normal 4 months prior (AST 32 IU/L, ALT 40 IU/L, Total Bilirubin 0.5 mg/dl). An abdominopelvic CT scan without contrast was unremarkable.
+The patient had a history of mild depression, hypertension, and hyperlipidemia. He denied using intravenous drugs or recent travel or sick contacts. He had discontinued alcohol in 2002 but smoked a half-pack of cigarettes for the past 8 years. He was receiving warfarin for a prosthetic mitral valve since 2002 and had a previously stable and therapeutic INR. His other medications for the past 3 years included metoprolol XL, atorvastatin, and aspirin. Paroxetine had been started shortly after surgery and discontinued in May 2004 but restarted in October 2004 for recurrent depressive symptoms. Bupropion 150 mg bid was started for smoking cessation in July 2004 and was continued up until hospitalization (6 months of treatment). The patient reported never having received bupropion or other anti-depressants beyond the paroxetine previously. He also denied ingesting over the counter products such as acetaminophen or herbals. He had allergies to penicillin and sulfa drugs that caused hives.
+After receiving several units of fresh frozen plasma, he was temporarily placed on intravenous heparin. Diagnostic studies included a serum iron of 193 ug/dl, transferrin saturation of 55%, and ferritin of 974 mg/dl but subsequent hemochromatosis genotyping was negative. Serum ceruloplasmin was normal at 28 mg/dl. Serological studies for acute hepatitis A IgM, hepatitis B surface antigen and anti-HB core antibody, and hepatitis C RNA by PCR as well as CMV and EBV serologies were negative. However, an anti-nuclear antibody (ANA titer = 1:160; speckled pattern) and anti-smooth muscle antibody (ASMA titer = 1:40) were positive. A surface echocardiogram revealed an ejection fraction of 75–80%. Despite withdrawal of all outpatient medications, his serum aminotransferases and bilirubin continued to rise . A transjugular liver biopsy revealed severe interface hepatitis with intense peri-portal inflammatory infiltrate consisting of a mixture of lymphocytes, eosinophils, and a few scattered plasma cells . A reticulin stain showed hepatic collapse with crowding of the reticulin meshwork and loss of hepatocytes. A trichrome stain did not reveal established fibrosis. A pathological diagnosis of a severe hepatotoxic injury due to a drug with autoimmune-like features was made.
+Because of the persistent severe biochemical injury, the patient was started on prednisone 60 mg/day. Over the next 13 days, the serum ALT levels trended down . His total bilirubin peaked at 22.7 mg/dl and his ALT reached a second peak at 1357 IU/L before trending down over the next four weeks. The patient's INR remained difficult to manage even with lower doses of coumadin, ranging between 1.6 and 3.7. However, the INR values became more stable at approximately 20 days after institution of prednisone therapy. Upon referral to the University of Michigan, a repeat ANA was higher at 1:1280 and serum IgG, IgM, and IgA levels were 1510 mg/dl, 125 mg/dl, and 367 mg/dl, respectively. At this point, the patient felt much improved and his prednisone was tapered off over 6 weeks. The patient was discharged on prednisone, metoprolol and coumadin. Three weeks later his transaminases began to rise but his bilirubin remained unchanged. Repeat testing two weeks later showed marked elevation of his total bilirubin to 23.7 mg/dl and ALT to 961 IU/L and he was readmitted to the hospital for a possible repeat liver biopsy. A decision was made to forego the liver biopsy and restart the patient on prednisone 60 mg per day and he was discharged home. However, two days later his total bilirubin increased to 37.4 mg/dl and his ALT was 1158 IU/L. He was then admitted to the hospital for liver transplantation evaluation with new onset mental status changes. The patient was started on broad-spectrum antibiotics. The patient's condition quickly deteriorated with the onset of encephalopathy and coagulopathy. On hospital day 13, he developed respiratory failure and was transferred to the ICU but he died of multiorgan failure the next day. An autopsy revealed coronary artery disease but otherwise intact myocardium. His liver was shrunken and weighed 1320 grams and there was evidence of extensive necrosis, predominantly central zone, with cholestasis. He also had bilateral aspergillus pneumonia, which had previously not been recognized. There was no evidence of other solid organ infection. His death was attributed to sepsis resulting from acute liver failure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_748_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_748_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..daaa25ec0a1a76ce24724f369e9c97855d17fb96
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_748_en.txt
@@ -0,0 +1,6 @@
+A twenty-year-old female presented to the oral medicine clinic at the Faculty of Dentistry, Alexandria University. The patient complained of a reddish painful area on the tongue, that started one year ago and has been increasing in size over time . The patient reported completing an orthodontic treatment two years ago after which she has been using a Hawley retainer for orthodontic retention .
+No specific findings were found on medical history taking and extraoral examination. Intraoral examination revealed a reddish patch on the left dorsolateral surface of the tongue surrounded by whitish lines. The lesion measured 2 × 3 cm, had normal consistency, smooth surface texture, and normal surrounding tissues . Another lesion in the form of a white keratotic plaque on the right dorsolateral surface of the tongue was found upon clinical examination. It was of 1 cm in size with normal consistency and normal surrounding tissues .
+The initial differential diagnoses included erythroplakia (because of the fiery red color), lichenoid contact reaction (because of the Hawley retainer), and geographic tongue (because of the location and age). An incisional biopsy was taken and subjected to histopathological examination to aid in reaching a conclusive diagnosis.
+The soft tissue section showed keratinized stratified squamous epithelium of variable thickness. Atrophic areas were predominantly present, other areas showed hyperplasia or epithelial proliferation in the underlying lamina propria. Degeneration of the basal epithelial cells and the basement membrane was evident. There was a dense, band-like lymphocytic infiltrate in the lamina propria that obscured the epithelial-connective tissue junction. Additionally, numerous dysplastic criteria such as hyperchromatism, pleomorphism, prominent nucleoli and mitotic figures were evident .
+Histopathological results suggested the diagnosis of OLR. In an attempt to confirm this diagnosis, we performed a patch test by applying grinded acrylic resin, similar to that used in the construction of the Hawley retainer, on the forearm for 72 h and instructed the patient to report any kind of discomfort. After 72 h, there was desquamation, erythema and pigmentation of the skin suggesting a positive patch test, which confirmed our diagnosis .
+We instructed the patient to discontinue using the Hawley retainer, replaced it by a vacuum retainer, and prescribed topical corticosteroids to decrease patient’s discomfort. Three weeks later, partial resolution of the lesion was evident. We followed the patient for six months with no signs of lesions recurrence .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_765_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_765_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b076b4c58d963aec2444d61afa2bc2bb40cdd21b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_765_en.txt
@@ -0,0 +1,3 @@
+The patient is a 71-year-old man who presented with abdominal discomfort and vomiting after a meal. Upper gastrointestinal endoscopy revealed a tumor in the duodenal bulb, and he was referred to our hospital for further examination and treatment. Laboratory tests revealed anemia, elevation of CEA (87.0 ng/ml) and CA19-9 (136 ng/ml), and a normal total bilirubin value (0.7 mg/dl). He underwent upper gastrointestinal endoscopy again, which revealed an irregular tumor occupying the lumen of the duodenal bulb, and the 2nd portion could not be observed. The biopsy result was adenocarcinoma . CT scan revealed a 10-cm tumor with poor contrast effect in the pancreatic head region, and a 6-cm tumor thrombus was observed from the superior mesenteric vein to the junction of the portal and splenic vein . Invasion into the gastroduodenal artery was suspected, but no invasion into the celiac or superior mesenteric arteries was revealed. MRCP showed no significant dilation of the common bile duct or main pancreatic duct . In abdominal ultrasonography, the lesion invading the superior mesenteric vein was considered to be a tumor thrombus with an echogenic region in the vascular lumen . After admission, frequent blood transfusions were required due to bleeding from the tumor. There were no problems with cardiopulmonary function and no evidence of distant metastasis. He was diagnosed with primary pancreatic cancer or primary duodenal cancer with portal vein tumor thrombus. We planned to perform pancreatoduodenectomy combined with portal vein resection to cure and relieve the symptoms.
+At operation, a large tumor was found in the head of the pancreas and the descending duodenum . GDA was not involved. There were no obvious findings of peritoneal dissemination or liver metastasis, so we performed pancreaticoduodenectomy, with combined resection of the portal vein replaced by the right external iliac vein graft . The caudal limit of the tumor thrombus was just above the first branch of the SMV, and the SMV was cut at one orifice. The cranial side of the portal vein was cut in the hepatoduodenal ligament, and the splenic vein was ligated. The portal vein was reconstructed by the interposition of the right external iliac vein graft. The portal vein flow was gradually interrupted by thrombosis formation so that collateral vessels developed. SMV flow was completely blocked, and the flow seemed to run through collateral vessels. This made surgery difficult due to hemorrhage. On the other hand, temporary bypass was not necessary because collateral vessels were well developed. The operation time was 615 min, and blood loss was 2405 g. The resected specimen showed a large tumor occupying the head of the pancreas and invading the duodenal lumen . The tumor showed a gelatinous appearance on cross section and was mainly located in the pancreas head. The tumor size was 105 × 70 × 100 mm in three dimensions. Histopathological findings showed colloid carcinoma of the pancreas, as adenocarcinoma cells floating in the mucus lake were observed . No adenomatous lesions were observed in the adjacent duodenum mucosa. There was a tumor thrombus in the portal vein. Tumor thrombi were also observed in small vessels within and around the tumor bed . Because we did not observe any distinct evidence of direct cancer involvement into the portal vein , we considered that this tumor thrombus in the portal vein was formed by intravascular extension through venous vessels. According to the general rules of the AICC/UICC 8th edition TNM staging system, the tumor was described as pT3N0M0. The resection margin was positive for the tumor thrombus at the proximal stump of the portal vein. Immunohistochemistry studies showed that it was CK7+, CK20−, CA19-9+, CK19+, and CDX-2+, which were consistent with colloid carcinoma of the pancreas.
+The postoperative course was uneventful, and there were no complications, including pancreatic fistula. He was discharged from the hospital approximately 2 months after the operation after moving to the rehabilitation ward. He moved to the rehabilitation ward not only for medical reasons, but also for social reasons. After 6 weeks of surgery, S-1 was administered as adjuvant chemotherapy, which was discontinued and switched to gemcitabine monotherapy as he had severe diarrhea. Liver metastases appeared 12 months postoperatively, so gemcitabine was used in combination with nab-paclitaxel for 2 months. However, his physical status worsened, and chemotherapy was discontinued. He died at home 16 months after the operation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_76_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_76_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6b2cb5838f268b737b0212107000653e242eec45
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_76_en.txt
@@ -0,0 +1,3 @@
+The patient was a 67-year-old man. Esophagogastroduodenoscopy revealed Borrmann type 3 advanced gastric cancer at the pyloric region and abdominal ultrasonography revealed abdominal aortic aneurysm. The patient initially underwent distal gastrectomy and D2 dissection for Borrmann type 3 advanced gastric cancer. One month later, endovascular aortic repair was performed for the abdominal aortic aneurysm. The size of the gastric tumor was 40 × 27 mm, and the pathological report identified tubular adenocarcinoma: tub2 and T2N1M0 stage IIA. Six weeks after gastrectomy, postoperative adjuvant chemotherapy was started with oral TS-1 (120 mg/body; days 1–14 every 3 weeks). Six months later, abdominopelvic computed tomography (CT) showed multiple tumors in liver segments S1 and S7 and partial resection of the caudate lobe and posterior segment was performed. The pathological report showed metastatic adenocarcinoma from gastric cancer and HER-2 positive.
+Eight courses of S-1 (120 mg/body; days 1–14 every 3 weeks) and oxaliplatin (80 mg/m2 every 3 weeks) were added after liver resection, but 7 months later, the tumor recurred with multiple liver metastases. Nine courses of paclitaxel (80 mg/m2; days 1, 8, and 15) and ramucirumab (8 mg/kg; days 1 and 15) therapy, three courses of irinotecan (140 mg/m2 every 2 weeks), and four courses of docetaxel (50 mg/m2 every 3 weeks) were added sequentially. Liver metastases temporarily reduced in size, but the tumor enlarged again (a). Nivolumab (3 mg/kg every 2 weeks) was therefore started and the liver metastases displayed a reduction in size after 2 months (b). Administration of nivolumab was continued and the tumor shrank further (c), but the patient suffered from general malaise. The dose interval of nivolumab was gradually increased to every 4, 6, and 8 weeks while liver metastases were monitored by CT.
+After 28 months of nivolumab administration, the patient developed cough due to bronchitis and malaise had worsened, so nivolumab was discontinued (a). Two months after discontinuing nivolumab, bronchitis symptoms had improved, but malaise had worsened, blood pressure had decreased, and adrenocorticotropic hormone and cortisol levels had declined. Adrenal insufficiency was diagnosed and steroid therapy was started with hydrocortisone, leading to improvements in general malaise and gradual recovery of adrenocorticotropic hormone and cortisol levels. Moreover, the metastatic tumors shrank further after discontinuation of nivolumab (b). Nine months after discontinuation of nivolumab, CT showed that the liver metastases had almost disappeared (c). Hydrocortisone administration was tapered off and discontinued after 1.5 years of treatment. Currently, as of 3.5 years after discontinuation of nivolumab and 8 years after recurrence of liver metastases, no radiological evidence of recurrence has been identified .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_771_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_771_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2c2d7ffc1e7cc2a4a61257a76b34f7e4bd003a5e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_771_en.txt
@@ -0,0 +1,9 @@
+A 53-year old man presented to his local district general hospital with epigastric pain. Relevant past medical history includes type 2 diabetes mellitus, and a history of excessive alcohol consumption of 44 units/week.
+The patient underwent an abdominal dual-phase contrasted computed tomography (CT) scan. In addition to background liver steatosis and right liver atrophy, a central mass was identified at the bifurcation of the right anterior and posterior portal vein. The lesion was enhanced during the arterial phase, and mild contrast washout at the portal venous phase, suggestive of possible hepatocellular carcinoma (HCC) . The mass had increased in size as compared to previous imaging. Subsequent magnetic resonance imaging (MRI) liver confirmed the same mass in the right lobe with peripheral biliary ductal dilatation. This then raised the possibility of a clinical diagnosis of intrahepatic cholangiocarcinoma .
+Preoperative bilirubin was 15 μmol/L (normal range: 4–22 μmol/L), alkaline phosphatase was 110U/L (42–98U/L) and aspartate transaminase was 39 IU/L (6–34 IU/L). Alpha-Feto Protein (AFP) and carbohydrate antigen 19–9 (CA19-9) were 3.7kU/ml (<4kU/ml) and 7 (<33kU/L) respectively.
+This patient was then referred to our tertiary hepato-pancreato-biliary centre for further management. Having discussed this case in our multi-disciplinary meeting, fluorodeoxyglucose—positron emission tomography (FDG-PET) CT scan was performed and excluded extrahepatic metastasis. No FDG uptake was demonstrated within the lesion as compared to the background liver parenchyma.
+The patient was listed for surgical resection with curative intent. Right lobe hepatectomy and excision of the extrahepatic biliary tree with the reconstruction of a hepaticojejunostomy was performed. There were no postoperative complications. Patient made a good post-operative recovery and was subsequently discharged home. 68Ga-DOTA-conjugated peptide PET scan completed 4 weeks post-operation did not demonstrate any evidence of residual disease.
+A 20 mm diameter friable, greyish and pale tumor occupied the lumen of the right hepatic duct and infiltrated into the surrounding liver and hilar adipose tissue. The background liver appeared yellowish with vague accentuation of the lobular architecture.
+At light macroscopy , approximately half of the tumour mass formed an intraductal growth, with the rest of the tumour infiltrating into periductal fibrovascular tissue and local liver parenchyma. Both the intraductal and periductal infiltrative aspects were composed of large sheets of relatively monomorphic cells mixed with a rhabdoid or plasmacytoid appearance. Nuclei were generally round and regular and often showed a “salt-and-pepper” appearance with focally increased and dense chromatin. Immunohistochemistry in this cell population stained strongly and diffusely for synaptophysin (DAKO, M0776, 1:100) and chromogranin (DAKO, 1:100) . The proliferative rate estimated with immunohistochemical analysis for Ki67 (MIB-1, DAKO, M0701, 1:100) was up to 8 % and up to three mitotic figures were present in 50 HPF .
+A minor component of the cell population (estimated to be around 30 %) showed a signet ring appearance with clarification of the cytoplasm suggestive of intracellular mucin , which stained weakly with alcian-blue-dPAS and showed focal acinar formation with intraluminal mucin secretion . With the limitation of single epitope immunohistochemistry on serial sections this cell population appeared to retain the expression of chromogranin and synaptophysin. This also showed cytoplasmic or membranous expression of MUC-1, (Abcam, Ab696-250, 1:100) predominantly in the deeper aspect of the tumour, but did not stain for MUC-2 (Novocastra, NCL MUC2, 1:100), MUC5 (Novocastra, NCL MUC5, 1:100) or MUC-6 (Novocastra, NCL MUC6, 1:100). There was weak and diffuse nuclear staining for CDX2 (Leica Bond RTU, PA0535) throughout the tumour. Staining for CA19.9 (Leica RTU, PA 0424) highlighted the superficial component of the intraductal growing tumor, in keeping with residual biliary epithelium . The background biliary epithelium did not reveal dysplasia or metaplastic changes. Hep-Par1 staining of tumour was negative .
+The background liver showed steatohepatitis, mainly macrovesicular, affecting around 30 % of the hepatocytes associated with a mild bridging fibrosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_785_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_785_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0b721a043d50ba61c1c66a91a0fa47ec81197178
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_785_en.txt
@@ -0,0 +1,7 @@
+Left limb weakness for 1 d.
+A 38-year-old female presented to the Moyamoya Disease Research and Treatment Center of Henan Provincial People's Hospital with "left limb weakness" as the main symptom, in addition to difficulty in lifting the left arm and walking with dragging of the left leg. On further inquiry, her regular medication included the long-term consumption of aspirin (100 mg/d) for recurrent transient ischemic attack.
+Four months previously, she had been diagnosed with an acute cerebral infarction by a brain MRI in our hospital following the complaints of "weakness of lower limbs" . Additionally, she had also experienced abnormal uterine bleeding for a month, which was heavy at times.
+There was no significant past personal history or any diseases running in the family. She was not a smoker and did not drink alcohol.
+The patient was conscious but in poor spirits. The tongue appeared skewed to the left on extension. The left upper and lower limbs had muscle strengths of grade 3 and grade 4, respectively, with a positive Babinski sign on the left.
+The blood investigation showed a low hemoglobin level of 61.0 (normal reference value: 115-150 g/L), RBC count 3.1 × 1012/L (reference value 3.5-5.0), platelet count 350 × 109/L (reference value 100-300), and abnormal thromboelastogram (residual platelet function after taking ADP drugs = 14.2 mm, normal reference value: 31-47 mm). The coagulation was slightly low.
+Upon admission, the first brain magnetic resonance imaging (MRI) (diffusion weighted imaging sequence) revealed acute cerebral infarction in the bilateral fronto-parietal lobes and posterior horn of the left ventricle . Preoperatively, the digital subtraction angiography (DSA) demonstrated bilateral internal carotid artery occlusion , with cerebral perfusion perfusion-weighted imaging (PWI) suggesting severe cerebral ischemia in both hemispheres .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_795_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_795_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..95c31000d389142c715304c803ee4378e0f213c2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_795_en.txt
@@ -0,0 +1,2 @@
+A 57-year-old lady with a history of diabetes, thyroid disease, dyslipidemia, and an episode of atrial fibrillation, resolved with pharmacological cardioversion several years before, presented to the Emergency Department for worsening dyspnea (New York Heart Association Classification—NYHA: IV). Her medical therapy included levothyroxine once daily, dapagliflozin 10 mg once daily, metformin 1,000 mg twice daily, rosuvastatin 5 mg, and ezetimibe 10 mg every night. She had no prior heart failure admissions. Other symptoms included orthopnea and paroxysmal nocturnal dyspnea but no chest pain or syncopal episodes. Physical examination showed a pulse rate of 95 bpm, blood pressure of 140/70 mmHg, and 97% of peripheral oxygen saturation. Cardiac auscultation revealed a pansystolic murmur of 3/6 Levine grade over the apex as well as an ejection systolic murmur over the second intercostal space at the left sternal border. There were moderate bibasal lung crepitations and mild ankles edema. Intravenous furosemide was given with resolution of the lungs and ankles edema. Her electrocardiogram showed ectopic atrial rhythm, left anterior hemiblock as well as LV hypertrophy . Laboratory tests showed troponine T of 20 pg/ml (URL of 14 pg/ml), N-terminal pro B-type natriuretic peptide (NT-proBNP) of 582 pg/ml (URL <150 pg/ml).
+A trans-thoracic echocardiogram showed a significant septal, asymmetric LV hypertrophy (basal anteroseptal wall diastolic thickness of 19 mm). Left and right ventricular systolic functions were normal. There was a clear SAM of the AML and an LVOT gradient of 56 mmHg at rest rising to 136 mmHg during the Valsalva maneuver ( and ). In addition, there was evidence of moderate to severe MR with a significant anteriorly directed jet, not very typical of SAM-related MR. A large calcification at PML-base was noted. 2D-3D trans-esophageal echocardiogram (2D-3D TEE) revealed the true MR mechanism. There was an MR combined mechanism based on: (1) PML degenerative prolapse with P2-flail from ruptured chordae with an eccentric anteriorly directed regurgitant jet and (2) a second posteriorly directed jet, related to SAM of AML ( and –). The pre-operative end-systolic mitral annular diameter was 39 mm while the end-diastolic diameter was 34 mm. There were no signs of infective endocarditis. We added beta-blockers and intravenous diuretics to pre-existing therapy and her clinical condition improved together with a significant LVOT gradient reduction (from 56 to 30 at rest). She underwent coronary-computed tomography angiography that excluded the presence of significant coronary stenoses. She was discharged and, one month later, she underwent MV surgical repair (artificial ring annuloplasty plus artificial chordae implantation) together with septal myectomy. Septal myectomy was performed according to modified Morrow’s procedure. The ruptured chorda was resected during the operation. Regarding annuloplasty, a Carpentier-Edwards Physio II ring N. 32 (Edwards Lifesciences, Irvine, CA, USA) was used. Chordal reconstruction was performed using n. 2 ePTFE Goretex neo-chordae (W.L. Gore & Associates, Flagstaff, AZ, USA). Gore-Tex chords were anchored at the papillary muscle and individually sutured to the free posterior leaflet margin. This intervention shifted the coaptation line posteriorly and contributed to fully resolving AML-SAM. The final outcome was good.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_79_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_79_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0535a8066f666e23fcf86bd122136f795ca78902
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_79_en.txt
@@ -0,0 +1,4 @@
+A 53-year-old female was referred to our centre because of a two-month lasting exhaustion, abdominal distension, early satiety and fever of up to 39°C. Her medical history was not significant. She had been travelling for a longer periods of time in the countries of the Middle and Far East, especially to Indochina and India. Physical examination showed splenomegaly and hepatomegaly, palpable at 15 and 6 cm below the costal margin, respectively. Peripheral lymph nodes measured up to 1 cm in the largest diameter. Petechiae and suffusions were present on the skin of the thoracic region and flanks. Laboratory tests demonstrated: (1) white blood count 3.40 × 109/l (Neu 2,01 (59%) , Ly 0,99 (29%), Mono 0,17 (5%), Eos 0,03 (1%)), platelet count 64 × 109/l, red blood cells 3,66 × 109/l, haemoglobin level 115 g/l (2) liver function tests were raised: AST 2.21 IU/L, ALT 0.95 IU/L and γGT 1.30 IU/L with bilirubin within normal ranges-bilirubin 17 IU/L (3) LDH was raised to 15,68 IU/L; raised was also CRP to 35 (4) serology for HAV showed reactive IgG anti-HAV antibodies, whereas IgM anti-HAV, HbsAg, anti- HBc, anti-Hbs, anti-HCV and CMV were negative.
+The Giemsa-stained smears from bone marrow and peripheral blood showed presence of medium-sized atypical lymphoid cells. These cells slightly differed in size and shape, being round, oval or droplet-like with irregular cell borders. The cytoplasm was scant and basophilic, containing few small vacuoles. The nuclei were round or oval. Chromatin was immature, finely granular, with small inconspicuous nucleoli . On flow cytometric immunophenotyping (FCI) of bone marrow and peripheral blood, these cells had immunophenotypic profile consistent with gamma-delta T-cell lymphoma (CD3 dim +, CD7 dim+, CD2+, TCRγδ dim +, CD52 dim +, CD56+, CD5-, CD4- and CD8-) . Besides T-cell lymphoma, a small population of monoclonal B-cells with immunophenotype characteristic of HCL (CD103+, CD25+, CD22+, surface-kappa+) was also present in the bone marrow and peripheral blood. After careful re-examination of peripheral blood smears, only few hairy cells were found. These cells were medium-sized and oval in shape, their cytoplasm was abundant, pale basophilic, with circumferential “hairy” projections .
+Biopsy of a slightly enlarged left inguinal lymph node and bone marrow trephine biopsy were also performed. Histology of the lymph node showed partial, predominantly intrasinusoidal infiltration by medium-sized, atypical lymphoid cells that were immunohistochemically positive for CD3, CD56, and TIA, while other T- and B-cell markers were negative. Bone marrow biopsy revealed hypercellular bone marrow with reduced orthotopic haematopoiesis and intrasinusoidal infiltrates consisting of medium-sized lymphocytes with the same immunohistochemical profile as was observed on lymph node infiltrates. To continue, patchy interstitial infiltrates were also present, consisting of medium-sized lymphocytes with a round nuclear profile and fine chromatin, and they were widely separated from each other by abundant clear cytoplasm. These cells were positive for CD20, HCL, Cyclin D1 and TRAP . There was also a marked increase in reticulin fibres. According to the morphology, the immunophenotype and the infiltration pattern of lymphoid infiltrates, the diagnosis of coexistent HSTCL and HCL was established.
+The patient was treated with multivalent chemotherapy including rituximab. The effect of treatment was monitored by clinical and ultrasound examination, leukocyte and lymphocyte counts and FCI of peripheral blood. The patient received the first immunochemotherapy regimen with R-VACPE (rituximab-vincristine, doxorubicin, cyclophosphamide, prednisone, etoposide) and splenectomy . After that HCL regressed completely while HSCTL was refractory to the treatment. R-VACPE was therefore changed to R-DAHP (rituximab, dexamethasone, cytarabine, cisplatin) and then to R-EPOCH (rituximab- etoposide, vincristine, doxorubicin, cyclophosphamide, prednisone). However, all these treatment regiments turned out to be only partially effective. The disease progressed again in the liver, and the patient’s general condition worsened. Therefore, only palliative treatment with liver irradiation was continued. The patient died soon because of haematemesis and Mallory-Weiss syndrome, 7 months after the initial diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_814_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_814_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..10af0d6457c3e583ae7d49ca79c833a0fa0598db
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_814_en.txt
@@ -0,0 +1,7 @@
+A 47-year-old obese Caucasian woman with a history of thyroid cancer, hypothyroidism, depression, and tobacco abuse presented to the hospital with acute chest discomfort. She described a substernal, diffuse, nonradiating heavy sensation over her chest that was a 7 out of 10 in severity. She was diaphoretic and nauseous, and reported no prior similar episodes.
+Her social history was significant for a 20-pack-year smoking history and occasional alcohol use. She works as a real estate agent, does not exercise, and is relatively sedentary most of the day. Our patient denied any history of toxic exposure or recent travel. Her family history was significant for cardiovascular disease in her grandfather, who died in his 70s from a heart attack. Home medications included oral levothyroxine (137 mcg once daily) for hypothyroidism and oral bupropion (150 mg once daily) for depression. She denied any symptoms of claudication and her review of systems was noncontributory.
+Her vital signs revealed a blood pressure of 102/59 mm Hg, a heart rate of 49 beats/minute, temperature of 98.6 °F, and oxygen saturation of 97% on room air. Her body mass index (BMI) was 37 kg/m2. Our patient appeared to be in moderate distress. A neck examination showed no lymphadenopathy, jugular venous distension, or carotid bruits. On cardiac examination, she had a slow heart rate, regular rhythm, normal S1 and S2, and no murmurs, rubs, or gallops were appreciated. Her breath sounds were clear and symmetric bilaterally without any crackles, wheezes, or rhonchi. Her abdomen was soft, nondistended, and nontender with normal bowel sounds and no organomegaly. Extremities showed no lesions, rashes, or lower extremity edema. Radial pulses were 2+ bilaterally, femoral pulses 2+ bilaterally, posterior tibial pulses 1+ bilaterally, and dorsalis pedis pulses absent bilaterally. On neurological examination, our patient was awake, alert, and oriented to person, place, and time. Her cranial nerves 2–12 were grossly intact, motor strength was 5 out of 5 throughout, sensation was intact to soft touch and pinprick throughout, and her gait was not assessed.
+An electrocardiogram showed sinus bradycardia with ST-elevation in inferior leads II, III, and aVF, as well as reciprocal ST depression in leads I and aVL – suggestive of an acute inferior STEMI. Our patient was given intravenous heparin (5000 mg), oral aspirin (325 mg), and oral ticagrelor (180 mg), and immediately taken to the catheterization laboratory.
+Laboratory workup revealed a white blood cell count of 12,300/mm3, hemoglobin of 14.4 g/dL, and platelet count of 262,000/mm3. A chemistry panel showed a sodium of 139 mmol/L, potassium of 4.4 mmol/L, carbon dioxide of 15 mmol/L, blood urea nitrogen (BUN) of 13 mg/dL, creatinine of 0.8 mg/dL, international normalized ratio (INR) of 1.18, and troponin of < 0.012 ng/mL. Liver function tests were within normal limits.
+Left heart catheterization and coronary angiography were performed via the right femoral artery. There was difficulty obtaining the vascular sheaths by the right femoral artery, which was likely from preexisting peripheral vascular disease. Left ventriculography showed inferior hypokinesis with an ejection fraction of approximately 55%. Coronary arteriography revealed a 60% proximal diagonal branch lesion. The right coronary artery was subtotally occluded in its mid-portion . A 3.0 × 28 mm Promus Premier stent was deployed with significant improvement in blood flow . Our patient suddenly became uncomfortable and reported severe bilateral lower extremity pain. Her femoral pulses were diminished and could not be palpated in either leg – even with Doppler. Both lower extremities were pale and cool to touch. An aortography showed no dye flow below L1–L2. The vascular surgeon was called and our patient was immediately taken to the operating room.
+A distal aortogram revealed 95% stenosis with an apple core-like lesion in the mid-abdominal aorta . An Epic self-expanding stent was deployed, resulting in significant improvement of blood flow through the distal aortic segment . The iliac artery was small but patent. After stent placement, our patient’s pain resolved and distal pulses became palpable. The rest of the hospital course was unremarkable and our patient was discharged 48 hours after the procedure. Our patient remained asymptomatic on follow-up 6 months later. Computed tomography (CT) angiography with aortic runoff showed the stented segment of the abdominal aorta remained widely patent without evidence of significant stenosis or occlusion .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_819_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_819_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5647f6c83598cf398acdbead9469bb89b8c2b1d3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_819_en.txt
@@ -0,0 +1,2 @@
+We present here the case of a 75-year-old Caucasian woman, who 21 years ago underwent a right mastectomy and axillary dissection followed by radiotherapy and breast reconstruction with a prosthesis for invasive ductal carcinoma of her right breast, and now presented with a mass in her left breast. Mammography showed a dish-shaped skin nodule in the upper outer quadrant of her left breast . Echography confirmed the presence of a lesion measuring 14 × 8 mm. Based on imaging, the diagnosis was a probable angiosarcoma . She has a history of hypertension, a pacemaker for cardiac arrhythmia and was also treated with acenocoumarol for a pulmonary embolism two years ago. Magnetic resonance imaging (MRI) was not feasible due to the pacemaker. We proceeded to a quadrantectomy after modifying anticoagulation therapy. Her postoperative recovery was uneventful.
+At gross examination, the specimen measured 11 × 11 × 4 cm and harbored a 1 × 1 cm well delineated dermal nodule close to the upper surgical margin. The cut section showed a solid whitish tumor with foci of hemorrhage . Microscopic examination revealed a proliferation of bland spindle cells arranged in a storiform pattern extending into hypodermal fat . These cells diffusely and strongly expressed the CD34 antigen, and were negative for CD31 and S-100 protein . The diagnosis was DFSP; 1.8 cm in its greatest microscopic dimension located 0.1 cm from the upper surgical margin. To ensure the wide resection margins required for this type of neoplasm, a re-excision was performed, up to the pectoral muscle fascia and including some muscle fibers. Pathology examination showed no residual tumor. This re-excision allowed for additional safety margins of at least 5 cm. No additional treatment was done. Our patient is well with no evidence of recurrence one year after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_81_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_81_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5d823199731934ae9ca09b8c80979fcbeabf29e8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_81_en.txt
@@ -0,0 +1,4 @@
+A 44-year-old Chinese female with left invasive ductal breast cancer underwent a modified radical mastectomy in April 2005. The pathological stage of her cancer was T2N0M0 with intermediate grade and lymphovascular invasion. The primary tumor was ER, PR, and HER2 positive and phosphatase and tensin homologue (PTEN) negative as determined by immunohistochemistry (IHC). The expression of ER and PR was scored according to the Allred score. HER2 status was scored as positive if >30% of tumor cells showed strong (3+) membrane staining, and PTEN status was designated as positive if tumor cells showed positive staining by IHC. The patient was treated with CAF (cyclophosphamide, adriamycin, and fluorouracil) adjuvant chemotherapy for six cycles and tamoxifen for 2 years without radiotherapy or trastuzumab. Metastases to the supraclavicular and cervical lymph nodes and left chest wall relapse were found in December 2007. Thus, the disease-free survival was 32 months.
+From December 2007 to August 2012, the patient underwent multiple-line rescue treatments including several cytotoxic agents, HER2-targeted therapies, and endocrine therapies used for breast cancer . Pretreatment biopsy and pathology results were not available. The rescue treatment was started with chemotherapy, but this was switched to endocrine drugs due to the adverse effects of chemotherapy. The patient obtained clinical benefit from endocrine therapy. The recurrent tumor in the left supraclavicular lymph nodes was HR negative by IHC and HER2 positive by fluorescence in situ hybridization detection in two hospitals in May 2009. Then, chemotherapy and HER2-directed therapy as main choices were applied, and endocrine therapy was also used due to the intolerance or lack of response to chemotherapy. Among these regimens, two regimens provided clinical benefit, namely, anastrozole combined with goserelin for 11 months and exemestane plus lapatinib for 7 months during the earlier treatment. In contrast, a total of seven regimens containing trastuzumab and two regimens containing lapatinib all failed .
+After discussion of various therapeutic options including palliative care, in 2012, we decided to treat the patient with everolimus (5 mg/d orally) in combination with intramuscular fulvestrant (500 mg once/28 days). The response and side effects of the regimen are shown in . After 6 days, we increased the dose of everolimus to 10 mg/d for 34 days., Measurable lung lesions diminished modestly as observed by computed tomography (CT) examination . The changes in target lesions based on the maximum reduction of the sum of lesion diameters are shown in . Side effects included third-degree stomatitis and liver toxicity and second-degree hematologic toxicity. After discontinuation of everolimus for 10 days, the side effects were relieved and eventually disappeared. When the patient took 5 mg everolimus daily, the lung lesions increased slightly. We therefore increased the dose to 5 and 10 mg/d alternately, with an estimated daily dose of 7.5 mg, and the lesions diminished again. Subsequently, everolimus was reduced to 5 mg daily or treatment was discontinued due to fatigue and other adverse events. Treatment was resumed again at 5 and 10 mg/d alternatively and after approximately six months of treatment, the patient could tolerate the full dose (10 mg/d) of everolimus.
+At the first appearance of tumor progression detected by CT on June 7, 2013, the patient’s pleural effusion was extracted for pathologic examination and molecular profile testing (performed by Caris Life Sciences, Irving, TX, USA). The results confirmed that the tumor was a HR-negative, HER2-positive adenocarcinoma that contained a PIK3CA gene mutation and was positive for PTEN expression . The patient continued everolimus treatment until disease progression was confirmed on June 24, 2013. The response was stable disease as evaluated by Response evaluation criteria in solid tumors, and progression-free survival (PFS) was 10 months. Thereafter, the patient was treated with trastuzumab, emtansine, and sorafenib, individually, with no measurable responses. The patient died on October 27, 2013, with overall survival time of 102 months. Written informed consent was obtained from the patient for publication of this Case Report and any accompanying images. This case report was approved by the Ethics Committee of Affiliated Hospital of Academy of Military Medical Sciences.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_836_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_836_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..923d7dea937596c689eb54a75ab5d8a3fd79cd7d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_836_en.txt
@@ -0,0 +1,3 @@
+A 46-year-old Asian man without any significant past medical history presented to an out-patient clinic complaining of fever, epigastric pain, and back pain. He was diagnosed as having gastric ulcer by upper gastrointestinal endoscopy and prescribed a proton pomp inhibitor; however, his fever of approximately 38 °C and his back pain remained. Two weeks later, his back pain had worsened, and the laboratory data of the out-patient clinic showed an elevated C-reactive protein level (17.2 mg/dL); thus, he came to our hospital for further evaluation. His medication included only orally administered azelnidipine for hypertension. There was no significant family medical history. He denied smoking tobacco, alcohol consumption, and exposure to toxins. He worked at a ceremonial hall without any ill contacts. He had a fever of 37.9 °C, heart rate of 90 beats per minute (bpm), respiratory rate of 20 breaths/minute, blood pressure of 126/78 mmHg, and oxygen saturation of 97% on room air. A physical examination including a neurological examination showed a well man without any specific abnormal findings. Blood tests at the first encounter revealed a white blood cell count of 10,300/μL with 70% neutrophils, 14% lymphocytes, and 16% monocytes, and the platelet count was 275,000/μL. His lactate dehydrogenase level was 299 IU/L (normal range, 119–229 IU/L), his alkaline phosphatase level was 983 U/L (normal range, 103–335 U/L), and his gamma-glutamyl transpeptidase level was 256 IU/L (normal range, 0–73 IU/L). His C-reactive protein level was 23.47 mg/dL (normal range, 0–0.29 mg/dL). Other results are shown in Table . A contrasted computed tomography (CT) scan showed edema around his gallbladder without gallstones or bile duct dilation, along with left adrenal enlargement without contrast, suggesting necrosis and slight pleural effusion . His right adrenal gland was contrasted normally. Contrasted magnetic resonance imaging (MRI) of his adrenal glands was also performed, and the results showed necrosis of his left adrenal gland with a slight possibility of infarction and no specific evidence of hemorrhage. He was hospitalized for further investigation into the cause of the unilateral adrenal necrosis.
+Lupus anticoagulant and don't break the value complex antibody were measured, and both were negative, which suggested a low possibility of antiphospholipid syndrome. He did not meet the criteria for diagnosis of systemic lupus erythematosus. We considered the possibility of adrenal insufficiency or pheochromocytoma and measured several types of adrenal hormones, such as serum cortisol, adrenocorticotropic hormone, plasma renin activity, plasma aldosterone activity, and urinary metanephrine and normetanephrine, but none of them explained our patient’s condition. The culture results from blood drawn at the first encounter were all negative. We performed CT-guided needle biopsy of his left adrenal gland, which revealed necrosis and the formation of fibrotic granulomatous tissue . There was no epithelioid granuloma, malignant lymphoma cells, or hemosiderin deposition, suggesting a low possibility of the involvement of a hemorrhagic etiology. The bacterial culture of this biopsy tissue was also negative. After the biopsy was finished, he was discharged. However, 1 week later, severe thrombocytopenia (5000/μL) appeared, and he was rehospitalized. His creatinine level had increased to 1.03 mg/dL from the initial value of 0.85 mg/dL. Bone marrow aspiration first resulted in a dry tap, but subsequent results showed increased megakaryocytes and hypercellular marrow with fibrosis classified as MF-1 according to the European consensus on bone marrow fibrosis staging . A contrasted CT scan showed new left axillary lymphadenopathy with a size of 15 mm, right pleural effusion, and increased ascites . Because our patient’s condition was worsening, we needed to start immediate treatment for any possible underlying causes, including bacterial infection and autoimmune disease, before obtaining the exact diagnosis. The laboratory data from the second hospitalization are shown in Table . The clinical course of this case is shown in Fig. . The initial treatment included ampicillin/sulbactam and a methylprednisolone pulse followed by orally administered prednisolone and intravenous immunoglobulin therapy (400 mg/kg for 5 days), considering the underlying causes mentioned above, such as severe bacterial infection or autoimmune diseases including antiphospholipid syndrome and immune thrombocytopenia; however, all of these treatments seemed to be ineffective. We also used recombinant thrombomodulin (380 U/kg) for 7 days to cope with the possibility of a thrombotic event or disseminated intravascular coagulation. Because the blood and adrenal gland biopsy culture results were both negative, we stopped the antibiotic treatment. On hospital day 9, we performed a left axillary lymph node needle biopsy, which showed no evidence of malignant lymphoma. With the edema, severe thrombocytopenia, fever above 37.5 °C, reticulin myelofibrosis (MF), mild lymphadenopathy, and progressive renal insufficiency and with other diseases excluded, we diagnosed this patient as having TAFRO syndrome according to the diagnostic criteria . The administration of intravenously administered tocilizumab (8 mg/kg) was begun on the same day with tapering prednisolone dose; his C-reactive protein and alkaline phosphatase levels gradually improved, along with his renal function and fever . For the anasarca, furosemide and potassium canrenoate were used and were highly effective.
+Because the thrombocytopenia remained, we added eltrombopag, a thrombopoietin receptor agonist, on hospital day 14, followed by tocilizumab administered on hospital day 16. Then, his platelet count began to increase. Under the strong immunosuppressive treatment, he contracted methicillin-resistant Staphylococcus epidermidis bacteremia on hospital day 20 and cytomegalovirus viremia on hospital day 31, which were successfully treated with vancomycin and ganciclovir, respectively. Tocilizumab was administered a third time on hospital day 47, and our patient was discharged on hospital day 48. After discharge, he remained afebrile and with an alkaline phosphate level within normal limits, and tocilizumab administration was no longer necessary. Eltrombopag administration was stopped because his platelet count increased and remained stable within normal limits. Nine months after the first treatment, this patient continues to do well. He is only being treated with low-dose prednisolone at approximately 5 mg per day and is still tapering carefully because of the presence of unilateral adrenal necrosis, considering the possibility of adrenal insufficiency.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_839_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_839_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2ebad13fff751d2b7da25602f0617df2d788856d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_839_en.txt
@@ -0,0 +1,9 @@
+A 45 year-old male patient presented to the outpatient unit of Internal Medicine Department in September 2019 with complaints of fever, abdominal pain (right flank), and burning micturition for 3 days. He was otherwise well in the past and none of his family members had similar illness. On physical examination, he had normal temperature, blood pressure, pulse rate, and respiratory rate. On systemic examination, he had tenderness at his right renal angle. Respiratory, cardiovascular, and neurological examinations were unremarkable. There were no rash, lymphadenopathy or hepatosplenomegaly.
+On urine investigation, 1–2 pus cells were seen per high power field (hpf) but no red blood cells (RBC). Total white cell count (TC) including differential counts (DC), hemoglobin (Hb), platelet count, and erythrocyte sedimentation rate (ESR) were within normal limits. His blood creatinine level was 0.9 mg/dL, urea was 33 mg/dL, sodium 142 mmol/L and potassium 4.8 mmol/L. Urine and blood culture was ordered. Ultrasonography (US) of his abdomen-pelvis showed mild fatty changes in liver, right renal concretions, and prostatomegaly (approx. 26.59 g). The patient was sent home on oral cefixime 400 mg twice daily, oral diclofenac 75 mg thrice daily, and hyoscine tablet 20 mg thrice daily.
+On Day 4, the patient returned to the outpatient unit with persistent symptoms. He was then admitted to the medical ward with intravenous (IV) ceftriaxone 1 g twice daily, Injection tramadol for pain, and intravenous fluids. Urine and blood culture reports showed no growth of pathogens. Routine laboratory investigations were repeated. Urine showed plenty pus cells but no RBCs, sugar and albumin. Serum creatinine level increased to 1.5 mg/dL whereas blood urea (30 mg/dL), sodium (135 mmol/L), and potassium (3.8 mmol/L) levels decreased. Liver panel (transaminases, total and direct bilirubin, alkaline phosphate, serum lipase, serum amylase) was normal. .
+The patient continued to be symptomatic on Day 5 of illness despite IV medication. Routine urine and blood investigations came out unremarkable except for a sudden decrease in platelet count (190,00 on Day 4 to 115,000 on Day 5) and serum creatinine level (1.5 on Day 4 to 1.3 on Day 5). Follow-up US abdomen-pelvis showed globular right kidney with probe tenderness, suggestive of acute pyelonephritis. Antibiotics were then upgraded to IV meropenem and IV teicoplanin.
+A plain computer tomography scan of the patient’s kidneys-ureters-bladder (CT-KUB) showed right perirenal haziness and fatty strandings; thickened right lateral conal fascia with minimal surrounding haziness but no evidence of hydroureteronephrosis; tiny renal concretions, splenunculus, and plate atelectasis in the posterobasal segment of right lower lobe of right kidney; and mild degenerative changes in the visualized spine. These findings complemented the US diagnosis of acute pyelonephritis. .
+On Day 7 of illness, the patient was still complaining right flank pain along with fever. He suddenly became tachypneic with respiratory rate of 24/min. An urgent US chest was performed which showed minimal bilateral pleural effusion. Routine laboratory investigations came out unremarkable except for decreasing creatinine level (1.2 mg/dL). Then, a possibility of serositis was suspected.
+Kathmandu city was hit by dengue epidemic at the time of the patient’s hospital admission. Therefore, a possibility of tropical fever in this patient was thought of too. His blood samples were sent for the investigation for dengue virus, scrub typhus, leptospirosis, leishmaniasis (kala-azar), and malaria (optimal test). All tests came out negative except for scrub typhus –IgM antibodies positive on rapid diagnostic test. Immediately, doxycycline (100 mg IV twice daily) was added to the patient’s medication list (Day 7 of illness).
+The patient’s clinical features and lab results did not change remarkably for 36 h of initiating doxycycline. However, over the next 48 h (Day 10 onwards), the patient showed clinical improvement. His fever and abdominal pain decreased significantly. On Day 12 of illness (9th day of admission, 7th day of IV meropenem, 5th day of IV doxycycline), the patient had a feeling of well-being, so he was sent home with oral doxycycline for 10 additional days and oral levofloxacin for 7 days.
+When the patient visited hospital after 6 days of discharge (Day 17), he was found apparently asymptomatic; all blood and urine investigations came out normal; and his follow-up ultrasonography findings (chest-abdomen-pelvis) were non-significant.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_842_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_842_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e92f91ae4a5fe327deda940c345bb88d9bc83299
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_842_en.txt
@@ -0,0 +1,4 @@
+A 59-year-old postmenopausal female presented herself to our hospital with a mass on her right breast for 2 weeks. The patient had no history of hormonal treatment or family history of cancer. Clinical examination confirmed a nodule in the right breast, situated at 5 o’clock. Mammography revealed a spherical, well-defined nodule of 3.2*3*2.3 cm .
+Core needle biopsy (CNB) revealed multiple lesions lined with layered columnar cells and abundant mucous secretion, and the diagnosis of invasive breast cancer with abundant mucous secretion was made. Then, a right lumpectomy along with ipsilateral axillary lymph node dissection was performed. Under macroscopic observation, the tumor was a well-circumscribed mass 3*3*2 cm in size. The cross-section was grayish-white with a moderate myxoid appearance. Microscopically, the tumor consisted of mucus-filled cavities of varying sizes lined with columnar cells . Tall columnar cells were rich in mucous and had nuclei at the base of the cell. Cells in some areas appeared stratified, protruding into the lumen and even forming branched papillary structures. Nests or papillary cell masses floated in the intracavity mucous lake accompanied by necrosis and inflammatory cell infiltration . Microscopically, no distinct myoepithelial layer was observed, and subsequent immunohistochemical results also confirmed the absence of myoepithelium . The cells had mild atypia, and mitotic figures were rare. No common ductal carcinoma in situ (DCIS) existed, and ipsilateral axillary lymph nodes showed no metastasis. The Nottingham grade was 1 (tubule formation = 3, nuclear pleomorphism = 1, and mitotic count = 1), and the pathological stage was T2N0Mx.
+Based on these morphological features, a wide range of differential diagnoses included metastatic tumors from the ovaries or pancreas, mucinous carcinoma, mucoceloid lesions, encapsulated papillary carcinoma (EPC) and invasive papillary carcinoma. A broad immunohistochemical panel was performed to narrow the differential diagnosis. The neoplastic cells showed diffuse immunoreactivity for cytokeratin 7 (CK7) and a high Ki-67 index of up to 40% . There was no immunoreactivity for ER, PR, HER2, cytokeratin 20 (CK20), CA19-9, CDX-2, Villin, PAX8, GATA3, SOX10, GCDFP-15, mammaglobin, p63 or calponin. Positive immunoreactivity for CK7, negative immunoreactivity for CK20, CA19-9, CDX-2, and Villin, and metastasis from the ovary, pancreas or intestine were excluded. Positron emission tomography (PET)/computed tomography (CT) was performed on the patient, and no other lesions were found, confirming nonmetastatic lesions. A triple-negative immunophenotype and a relatively high Ki-67 index ruled out mucinous carcinoma and EPC, which typically express ER and PR. Mucoceloid lesions of the breast are benign lesions in which myoepithelium is present around the lumen. The absence of myoepithelium also ruled out this diagnosis . Invasive papillary carcinoma is composed of mildly dilated ducts and microcysts containing a papillary formation without intracellular and extracellular mucus. These cases are usually non-triple-negative phenotypes. Eventually, we favored the diagnosis of MCA based on the morphological and immunohistochemical findings.
+Furthermore, 425 genes were sequenced using formalin-fixed and paraffin-embedded (FFPE) tissues and next-generation sequencing (NGS) technology. Recurrent mutations in PIK3CA, KRAS, MAP2K4, RB1, KDR, PKHD1, TERT, and TP53 were identified and are summarized in Table . The tumor mutation burden (TMB) was 9.27, and microsatellite instability high (MSI-H) was not detected. P53, RB1 and PD-L1 protein were stained according to the sequencing results. Immunohistochemistry confirmed the overexpression of p53 protein and loss of RB1 protein expression. PD-L1 (sp142) was focally positive in immune cells, and the positive rate was approximately 7% . The patient received 6 cycles of adjuvant chemotherapy and was followed up for 108 months, with no signs of recurrence or metastasis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_865_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_865_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7e3e6a77b4e0ddf8029ae3a0fedf4bf36bc16b14
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_865_en.txt
@@ -0,0 +1,8 @@
+A 42-year-old Caucasian man was referred to our Nephrology Department. He presented with acute renal failure linked to severe dehydration secondary to diarrhea that had lasted a week. He was known to have end-stage renal disease secondary to nephrotoxicity from calcineurin inhibitors administered over 15 years as part of his heart transplant anti-graft rejection regimen, but had not started hemodialysis yet. His estimated glomerular filtration rate (GFR), using Modification of Diet in Renal Disease (MDRD) calculation, was 16.8 mL/minute/1.73 m2 before admission, and he had only mild proteinuria (0.56 g/24 hours) and no hematuria.
+On admission, his clinical and specifically his abdominal examinations were unremarkable except for the presence of non-hemorrhagic and non-mucoid diarrhea associated with fever. Community-acquired infectious gastroenteritis was suspected. Our patient's medical history revealed he had been diagnosed as having a transposition of the great arteries that led to an initially successful heart transplantation 15 years ago, before the occurrence of chronic cardiac transplant rejection. As a former smoker, he had also had an isolated ischemic stroke five years ago, but had no history of allergies or anaphylaxis. A recent echocardiograph showed congestive heart failure, with, a left ventricular ejection fraction of 30% and pulmonary hypertension. His immunosuppressive regimen included cyclosporin (45 mg twice a day) and prednisone (5 mg/day). He was given intravenous antibiotic therapy including ceftriaxone (1 g/day) and oral ciprofloxacin (500 mg/day).
+Because he presented with symptoms of heart failure following rehydration, as well as no improvement of his renal function, intermittent hemodialysis was started on day five after admission after the placement of a temporary jugular catheter. By day nine, because of persistent sepsis and diarrhea despite the antibiotic therapy, an abdominal computed tomography (CT) scan was performed and our patient was diagnosed as having stercoral peritonitis secondary to a colonic diverticular perforation. Bacteroides fragilis was identified in blood cultures. A Hartmann surgical procedure was performed and the antibiotic therapy was switched to piperacillin/tazobactam (4 g twice a day) .
+By day 24 after admission, our patient showed clinical improvement. He had no further fever or diarrhea, and his biological test results had normalized, so piperacillin/tazobactam was stopped. On day 27, his fever recurred. A second abdominal CT scan showed an abdominal peri-hepatic abscess, and antibiotic therapy was restarted (piperacillin/tazobactam (4 g twice a day), gentamycin (a single injection), and vancomycin (one injection at each hemodialysis session). By day 36, our patient became afebrile and a third CT scan showed regression of the peri-hepatic fluid collection. Antibiotic therapy was again stopped on day 41, after a second 15-day course.
+On the day the antibiotic therapy should have been stopped, our patient had necrotic purpura eruptions on the external sides of his feet, knees, and elbows . Concomitant with the purpuric eruptions, he also presented with arthralgia and macroscopic hematuria, but remained afebrile. Arthralgia was bilateral, and located in the joints near the purpuric eruptions. Hematuria was asymptomatic, and was associated to either other urinary signs, or intra-vesical clotting. This new flare was accompanied by systemic inflammatory response syndrome and elevated C-reactive protein level (124 mg/L; normal values < 3 mg/L), and a new empirical antibiotic therapy was initiated, including intravenous gentamycin, ceftriaxone, and valaciclovir. Vancomycin was continued. An echocardiograph showed no signs of endocarditis. Blood cultures, urine analysis, as well as polymerase chain reaction testing for herpes simplex virus 1 (HSV1), HSV2, and varicella zoster virus (VZV), and serology for HSV1, HSV2, VZV, Epstein-Barr virus (EBV), human herpesvirus 6 (HHV6), human herpesvirus 8 (HHV8), cytomegalovirus (CMV), hepatitis B virus (HBV), hepatitis C virus (HCV), human immunodeficiency virus (HIV), parvovirus B19, rickettsia, and Lyme disease, did not show any evidence of recent viral, bacterial, or fungal infections. Differential diagnostic investigations included tests for anti-nuclear antibodies, cryoglobulin, cryofibrinogen, complement dosage, protein electrophoresis, immunoglobulin dosage; results were positive for isolated anti-nuclear antibody (1/200, with no specificity), and increased circulating polyclonal IgA level (4.71 g/L; normal values: 0.88 to 4.1 g/L). Skin biopsies, performed four days after the eruptions, showed leucocytoclastic necrotic vasculitis of the dermal capillaries , with neutrophils and lymphocytes in and around the blood vessels and intra-vascular fibrin thrombi, all of which are characteristic features of vasculitis. Immunofluorescence examination showed IgM and C3 deposits in the dermal capillary walls.
+On day 53 after admission, that is, 12 days after the first eruption occurred and after antibiotic therapy was restarted, our patient presented with arthritis of the right knee and left elbow. Arthritis regressed spontaneously within 48 hours, and no articular puncture was performed.
+On day 58 after admission, he then presented with a second purpuric eruption of both legs, associated with arthralgia and macroscopic hematuria. All bacteriological and viral test results were negative and he was still receiving antibiotics at that time, so that antibacterial therapy was interrupted. A full-body CT scan showed no more abscess and no adenopathy, but ascitis, which on puncture produced a sterile fluid. A second skin biopsy was performed on the day the purpura appeared. It showed the same leucocytoclastic dermal vasculitis with eosinophils, but vascular IgA and C3 deposits were found with immunofluorescence imaging .
+After antibiotic therapy was stopped, our patient finally recovered entirely with disappearance of purpura, arthritis and hematuria, and has not relapsed after a follow-up period of eight months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_866_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_866_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c1a4c9a316666f788e2cfaea5a2be4bf6a00d9f0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_866_en.txt
@@ -0,0 +1,3 @@
+A low-birth-weight (2.25 kg), late preterm (35 weeks) male infant with normal Apgar score was born by a nonconsanguineous marriage to a third gravida (G3P2L2A1) 27-year-old woman. The pregnant woman had regular antenatal checkups, and the baby was born by normal vaginal delivery. Her first pregnancy was ectopic, for which a laparotomy was performed 4 years previously; her second pregnancy resulted in normal vaginal delivery. The baby was healthy and well, without any malformations, and is now about 2½ years old.
+The pregnant mother was on IM during the previous 4 years, including during the first and second index pregnancy. During the index pregnancy the antenatal scans were normal. There was no history of radiation exposure. On examination, the baby was diagnosed with malformed right external ears, preauricular tag on the left side, absence of right depressor angular oris muscle, and imperforate anus . Whole-body X-ray showed dextrocardia, hemivertebrae in the thoracic region and cervical spina bifida occulta . Abdominal and renal ultrasonography showed absent right kidney and ectopic left kidney in the pelvic region. Ultrasound of the head showed mild ventriculomegaly, and ECHO showed situs inversus with no other cardiac diseases. The infant was operated on for the imperforate anus, with an uneventful postoperative period. Hemogram, blood urea, blood sugar, serum calcium, and electrolytes were normal.
+There was no family history of any significant illness or any other disorder. The mother was diagnosed with CML during her first pregnancy when her routine hemogram was suggestive of myeloproliferative disorder. Bone marrow examination done at that time showed CML breakpoint cluster region Abelson leukemia virus (quantified using real-time PCR) at a level of 83.04s%. She was prescribed IM 400 mg/day that was started about 1 month after diagnosis. She had regular monitoring by hemogram and PCR every 6 months and had complete hematological and cytological remission throughout. The baby was discharged in good condition but was lost to follow-up after 2 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_874_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_874_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1bd1d7f8948aecfcee823bf2c383e06c6fbaab2c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_874_en.txt
@@ -0,0 +1,6 @@
+A 74-year-old Asian woman with no family history of significant medical problems presented with erythema on her face, back, and the back of her hands which had developed 3 weeks earlier . At the same time, she noticed a right breast mass and redness of the skin of the breast . Breast ultrasonography revealed a hyperechoic view of the entire skin of the right breast and a 36-mm irregular mass at the 9 o’clock position . A T2-weighted magnetic resonance imaging (MRI) examination showed a high-signal mass at the same area, and enlargement of the right axillary lymph nodes .
+A vacuum aspiration biopsy was performed. It showed that atypical cells with enlarged chromatin nuclei and eosinophilic endoplasmic reticulum form vesicular nests on hematoxylin–eosin stain. We made a diagnosis of invasive ductal carcinoma that was suspected to be inflammatory breast cancer . The tumor was positive for both estrogen (about 100%) and progesterone (over 90%) receptors, HER2 was negative, and the Ki-67 index was 40%. A computed tomography (CT) scan revealed no metastases, and the stage was IIIC (cT4dN3aM0) in TNM classification.
+The patient was also referred to a dermatologist. The shawl sign was seen on her upper back . Multiple hyperkeratotic and erythematous papules were observed over the metacarpophalangeal and interphalangeal joints of both hands (Gottron papule, Fig. c). The patient did not have muscle weakness. Blood tests showed that her creatine kinase, aspartate aminotransferase, and aldolase were normal, the anti-transcriptional intermediary factor 1-γ antibody (specific to amyopathic dermatomyositis) was positive, and the test for anti-aminoacyl tRNA synthetase antibody was negative.
+Based on these findings, she was diagnosed with amyopathic dermatomyositis, and prednisolone was started at 20 mg/day. She also received 4 cycles of epirubicin–cyclophosphamide therapy. The total dose of epirubicin was 425 mg and cyclophosphamide was 2970 mg. Subsequent ultrasonography and MRI revealed that the tumor had shrunk remarkably, the swollen right axillary lymph node had disappeared as had the rash on the right breast. Therefore, a total mastectomy and sentinel lymph node biopsy were performed. No tumor cells were found in the sentinel lymph nodes and axillary lymph node dissection was not performed.
+Breast pathology showed only non-invasive carcinoma in the duct. The sentinel lymph nodes in the permanent specimen showed fibrosis. Chemotherapeutic effect was Grade 2b in the General Rules for Clinical and Pathological Recording of Breast Cancer (18th edition) . Therefore, postoperative stage was ypTisN0M0.
+The dermatomyositis began to improve during chemotherapy. The prednisolone was reduced to 5 mg/day after surgery, without any worsening of her symptoms. No postoperative chemotherapy was performed, and she has been taking letrozole (an aromatase inhibitor) for a year and has not seen a recurrence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_884_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_884_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ad632347d283b707e59d68260be9cd675e8d4ec3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_884_en.txt
@@ -0,0 +1,2 @@
+An 83-year-old Taiwanese woman found a palpable mass in her right breast for 1 year. The lesion was approximately 1cm in greatest dimension last year and had got larger in the past 6 months. She had a history of type AB thymoma and was treated with complete tumor resection 10 years ago. The thymoma was 15cm in greatest dimension, encapsulated with focal pericardial adhesion and without pericapsular invasion . A mammography revealed a well-defined hypoechoic oval mass in 10 o'clock direction and 3.0cm away from her nipple, occupying the whole thickness of her breast, and measuring 4.0×3.2×2.6cm in size . A tumor excision was performed.
+The specimen consisted of a piece of breast tissue partially occupied by an oval encapsulated mass that measured 5.0×3.8×3.5cm in size, with focal artificial disruption. The cut surface of the tumor was tan red and the focal was light yellowish. The tumor consistency was soft and fragile. On microscopic examination, the well-encapsulated tumor was composed of neoplastic cells arranged in solid sheets, vague fascicles or ribbons and few rosettes without lumen, and admixed with variable amounts of lymphocytes . The neoplastic cells set in the lymphocyte-rich background were oval, polygonal or short fusiform, and had small round-to-oval nuclei with inconspicuous nucleoli . The spindle tumor cells were mainly seen in the lymphocyte-poor area. The two groups of neoplastic cells either separated with a discrete border or were intermixed together. Mild nuclear atypia was occasionally seen. Mitoses were scanty. Some aggregates of histiocytes and few dilating and mildly branching thin-walled vessels were also found. The neoplastic cells were diffusely positive for cytokeratin , partially positive for vimentin and smooth muscle actin, mostly positive for p63, and focally immunoreactive with epithelial membrane antigen. A few tumor cells were also positive for CD20 . Some spindle neoplastic cells were surrounded by collagen IV deposition. The tumor cells were negative for CD21 and CD34. The lymphocytes were positive for CD3, CD5, CD1a, and CD99 . Few scattered individual and small groups of interdigitating reticulum cells were seen by S-100 protein staining. From these features and past history, we diagnosed this tumor as a metastatic type AB thymoma to the breast.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_885_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_885_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fda1a55376dc81b0bc61c374a5a8eaaae914faf0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_885_en.txt
@@ -0,0 +1,4 @@
+A 44-year-old man was admitted presented to the emergency department with a complaint of right limb weakness and unclear speech for the past 10 h. Questioning medical history, he had also repeated fever and was diagnosed diabetes for one month before admission. At the time of physical examination on admission, the patient was delirious, with fever temperature of 38.8 ℃, muscle strength of the right limb was Grade IV, and other signs were stable. Brain magnetic resonance imaging (MRI) revealed left basal ganglia and right parietal lobe cerebral infarction, which is consistent with embolic stroke .
+Laboratory testing revealed that the blood white cell count was 14.31 × 10^9/L (normal range 3.5–9.5 × 10^9/L), absolute value of neutrophils was 11.16 × 10^9/L (normal range 1.8–6.3 × 10^9/L), percentage of neutrophils was 78.10%. Highly sensitive Troponin I increased to 0.08 ng/ml (normal range 0-0.0268ng/ml) and N-terminal pro-B natriuretic peptide increased to 207.9 ng/L (normal range 0-125ng/L). Chest Computed Tomography (CT) showed that the bilateral lung markings were heavier, the pleura was thickened, strip and nodular high-density shadows were visible, the heart was not enlarged, and calcified spots were visible in the aorta and coronary arteries. Transthoracic echocardiography (TTE) showed the aortic valve was bicuspid combined with calcification, moderate regurgitation and a possible paravalvular abscess (increased thickening to 5 mm in the right posterior sinus wall of the aorta) . A 16.4 mm*7.8 mm vegetation can be seen on the right posterior aortic valve. Based on the clinical, laboratory, and echocardiographic findings, the patient was diagnosed infective endocarditis (IE). According to the AHA/ACC guideline for the management of patients with valvular heart disease, delaying valve surgery for at least 4 weeks may be considered for patients with IE and major ischemic stroke if the patient is hemodynamically stable , the patient was prescribed antibiotics with vancomycin 0.5 g per every 6 h. The transesophageal echocardiography (TEE) was performed 10 days later revealed that the vegetation was smaller than before . He had no fever again and no complaints of discomfort and was hemodynamically stable, the blood cultures were negative twice.
+However, TEE one month later after cerebral infarction revealed a large periaortic abscess led to formation of an aortic sinus pseudoaneurysm and flows were in from pseudoaneurysm and out to left ventricular combined with moderate mitral valve regurgitation.
+Cardiopulmonary bypass and aortic valve replacement surgery via median sternotomy were performed. During the operation, it was confirmed that bicuspid deformity combined with vegetation, an aortic annular abscess eroding into the base of the anterior mitral leaflet making prolapse of mitral valve annulus . Aortic valve vegetations and perivalvular abscesses were completely removed. 5/0 Prolene suture was used to continuously suture bovine pericardium to reconstruct mitral aortic valve fiber connection and fix the anterior mitral valve annulus. The patient underwent mechanical prosthetic valve replacement and annulus reconstruction successfully. The tissue culture of the diseased aortic valve showed no bacterial growth and no pathogenic microorganism was identified. The patient’s condition was stable after operation. He was discharged two weeks later with antibiotics for six-weeks. During the one-month follow-up, the patient felt well, laboratory testing revealed that the blood white cell count and percentage were normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_894_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_894_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0f4eff945cfde3c99b3eb5963938c385fe79bc50
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_894_en.txt
@@ -0,0 +1,6 @@
+A 36-year-old woman was admitted with acute severe headache. She had also experienced an epileptic seizure and had a slightly lowered consciousness at admission. Nonenhanced computed tomography (CT) showed subtle signs of subarachnoid hemorrhage (SAH) with some frontobasal subarachnoid blood . CT angiography revealed a 4-mm aneurysm of the left anterior cerebral artery (ACA). At admission her blood pressure was 128/55 mm Hg. On the first day of admission her mean arterial pressure (MAP) varied between 81 and 99 mm Hg, with a mean of 88 mm Hg. She had no history of hypertension, was no taking any medication, and exhibited a good neurological condition (Hunt and Hess grade of 1).
+The aneurysm was coiled on the same day. The procedure took longer than usual (2 hours) because of the smallness of the aneurysm, which made it difficult to enter it safely with the microcatheter. During the procedure, both internal carotid arteries were catheterized to optimize depiction of the local vascular anatomy . However, a microcatheter was only advanced in the left ACA to reach the aneurysm. According to the local protocol, 5000 IE of heparin was given during the procedure; no other medication was given during the procedure. The aneurysm was successfully packed with two small coils (3 cm long; 2-mm UltraSoft, Boston Scientific, Natick, MA, USA) using a left approach. No complications were noted and the patient experienced no focal neurological symptoms.
+After the procedure the patient developed periods of bradycardia with sinus arrest in the intensive care unit (ICU) but without clinical symptoms. There were assumed to be secondary to the SAH, and were treated conservatively. Transcranial Doppler (TCD) performed during the following week showed mildly increased flow velocities in the middle cerebral artery (MCA) that were just within the normal range (111 and 82 cm/s in the left and right MCAs, respectively), suggesting mild vasospasm. Oral nimodipine at 30 mg taken 12 times daily and triple-H therapy were started according to the local protocol. On day 4 of the triple-H therapy the MAP reached 72-108 mm Hg (mean 93 mm Hg). Slight lung edema was treated with furosemide. TCD performed 5 days later showed normal MCA velocities, although the velocities in the MCA and ACA continued to be higher on the left than on the right, albeit still within the normal range. Triple-H therapy was subsequently stopped. During the hospital stay the clinical status of the patient improved and her headaches gradually diminished. The patient was discharged in good clinical condition after 12 days with a prescription for oral nimodipine (60 mg taken six times daily for 20 days). The MAP at discharge was 100 mm Hg.
+The evening after taking the last prescription of nimodipine, which was 21 days after coiling and 15 days after the cessation of triple-H therapy, the patient presented at the emergency room with progressive headache, right-sided homonymous hemianopsia, right-sided tactile extinction, and a slight paresis of the right arm. Her MAP during the first day of re-admission was 81-120 mm Hg (mean 108 mm Hg). The cerebrospinal fluid pressure measured via a lumbar puncture was elevated at 42 cmH20. Spinal fluid showed residual signs of the recent SAH but no signs of meningitis. Renal function was normal with serum creatinine, sodium, and potassium levels of 47 µmol/L, 140 mmol/L, and 4.4 mmol/L, respectively. Nonenhanced CT performed 21 days after the first onset of the SAH revealed subcortical hypodense areas in the left hemisphere occipitally and around the insula. Magnetic resonance imaging (MRI) showed vasogenic edema mostly subcortically in the entire left hemisphere, with a preference for the watershed areas . No susceptibility artifacts were seen within the parenchyma. Diffusion-weighted MRI images showed no signs of ischemia. After gadolinium administration there was patchy enhancement in the lesions . CT angiography did not show vasospasms or vascular occlusions.
+The combination of headache, confusion, visual disturbances, and vasogenic edema on MRI was suggestive of RPLS. Further clinical analysis revealed no signs of infection, and dural sinus thrombosis was ruled out with CT venography. Because late-onset secondary brain ischemia was initially suspected clinically, oral nimodipine was restarted at a daily dose of 180 mg. This improved the clinical status of the patient, with headache being the most prominent symptom; this was reduced by prescription of dexamethasone at 2 mg twice daily. Slow tapering of dexamethasone led to the return of slight headaches, but they could now be controlled with acetaminophen. Because the initial clinical suspicion of ischemia was ruled out by the imaging workup, a diagnosis of RPLS was eventually suggested on the fifth day of re-admission based on clinical signs and MRI findings. By the sixth day of re-admission the MAP had decreased to 82-100 mm Hg (mean 89 mm Hg), possibly due to the nimodipine treatment, and so no antihypertensive medication was administered in our patient. The patient was discharged and nimodipine was gradually reduced.
+At three months after SAH the patient had no neurological symptoms apart from slight balance problems. The MRI abnormalities had diminished but were not completely resolved. However, MRI performed 7 months after the first presentation showed further reduction of the lesions, with a single small area of signal enhancement remaining in the left frontal lobe .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_904_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_904_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..95556bec6cfe6a863435fc1c29541984b4e96bb7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_904_en.txt
@@ -0,0 +1,6 @@
+A 34-year-old Caucasian woman presented to the emergency department at our institution, with left-sided pleuritic chest pain and haemoptysis for 5 days on the background of being unwell for a month with flu-like symptoms that included fatigue, myalgia, and night sweats. She denied any recent foreign travel or any intravenous drug use in the past. On admission, her blood pressure was 173/100 mmHg (this subsequently reduced to 105/62 mmHg during admission), and her heart rate was 91 b.p.m. She was saturating 100% on room oxygen and was apyrexial at 36.2°C. On lung auscultation, there were mild inspiratory crepitations heard along the left base of the lung. On cardiac auscultation, a systolic murmur was heard over the aortic area that was louder on expiration. On further clinical examination, there were no enlarged neck or axillary lymph nodes. She tested negative for COVID-19 and her initial electrocardiogram showed normal sinus rhythm with good R-wave progression, narrow QRS, normal QRS axis, normal PR and QTc intervals, and no ischaemic changes. Her chest X-ray revealed patchy airspace opacification at the left base of the lung that was thought to be infective in nature.
+The patient had no known medical history but a family history of a sister who underwent EP ablation for atrioventricular nodal re-entrant tachycardia and suffered a deep vein thrombosis after pregnancy.
+Initial blood tests revealed raised inflammatory markers, with an initial C-reactive protein of 71 mg/L (normal <5 mg/L) and erythrocyte sedimentation rate of 43 mm/h (normal range 1–9 mm/h, when adjusted for patient demographics), with C4 complement of 0.44 g/L (normal range 0.10–0.40 g/L) and a positive D-dimer test (qualitatively reported, with normal range 0–500 µg/L). The patient’s white blood cell count was 9.6 × 109/L on admission and peaked at 11 × 109/L (normal range 3.8–11.0 × 109/L) 4 days later, before dropping back to normal levels, and the urine sample provided returned negative for bacterial growth while revealing normal white and red blood cell counts. Computed tomography pulmonary angiogram revealed probable sub-acute pulmonary emboli that had mostly resolved but with several peripheral pulmonary infarcts. There were no pathological mediastinal, hilar, or axillary lymph nodes identified, no malignancy of the chest and the upper abdominal viscera and no destructive bone lesion. Blood cultures returned no growth. Initial transthoracic echocardiography (TTE) revealed no obvious vegetations but showed a dilated coronary sinus with aliasing on colour Doppler imaging (; , and ) and turbulent flow in the region of the RCA (; , ). A further TTE was done the following day and revealed good left ventricular and right ventricular systolic function with non-dilated ventricles, no evidence of infective endocarditis, but confirmed a dilated coronary sinus with suspicion of flow towards the left atrium (; , ). Due to suspicion of an unroofed coronary sinus, a bubble transthoracic echocardiogram was performed with administration of agitated saline through a left antecubital fossa vein. However, this was not confirmed, and no significant right-to-left shunt was detected. Only a small number of bubbles were noted in the left atrium after a Valsalva manoeuvre, indicating a patent foramen ovale (; , ). A CTCA was performed, revealing an RCA-to-coronary sinus fistula .
+The patient was started on intravenous antibiotics upon admission with initial suspicion of infective endocarditis. However, this was discontinued after negative blood cultures and the absence of obvious vegetations identified on TTE. With the confirmation of multiple pulmonary emboli, the patient was then started on lifelong, therapeutic anticoagulation with apixaban and referred for thrombophilia screening, which was ultimately negative. A transabdominal and transvaginal ultrasound of her pelvis performed a few days after discharge excluded any obvious gynaecological malignancy.
+A stress cardiac magnetic resonance imaging scan with adenosine was performed in an outpatient setting after discharge. This did not reveal any stress-inducible myocardial ischemia. The left ventricle was mildly dilated (end-diastolic volume index 103 mL/m2—normal values 62–96 mL/m2) but with normal ejection fraction (left ventricular ejection fraction - LVEF 59%). The right ventricle was not dilated and had good systolic function. The pulmonary artery was not dilated.
+With no significant haemodynamic consequences or complications of the RCA-to-coronary sinus fistula, the patient was managed conservatively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_90_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_90_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a6d90828b6b28352c55e95cd623e5f5f26238e58
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_90_en.txt
@@ -0,0 +1,7 @@
+A 30 year old male presented at the Surgery OPD with chief complaint of discharging wound in the upper part of the abdomen for 1 month. The problem started 6 months back when he underwent an emergency exploratory laparotomy at another medical college for 3 days old abdominal pain. A small peptic perforation was detected and was repaired with an omental patch. On fourth post-operative day the patient developed burst abdomen. It was managed conservatively. Over a period of time the bowel got contained and the patient was put on oral nutrition. The patient was discharged was doing fine at home. However his abdominal wound was not healing. In the fourth month it was covered with the split thickness skin graft. The procedure and the post-operative period was uneventful till one month. However in the fifth month a serous discharge from the upper part of the grafted surface was noticed. It was coming from a small ulcer and was small in amount. Over a the period of time till he presented at our OPD it remained small in output. It was managed by applying gauge pieces over the wound which has to be changed once or sometimes two to three times a day.
+The examination of the abdomen revealed a 12 cm × 5 cm elliptical patch of skin graft over the middle of the abdomen. There was a small depressed ulcer of around 1 cm × 1 cm in its upper part covered with pale granulation showing serous ooze. Apart from this ulcer there were few other spots showing exuberant pale granulation . A scar was seen at previous drain site. Palpation of the abdomen showed deficient abdominal wall below the skin graft.
+The blood reports were all but normal. Haemoglobin was 11.4 gm/dl with total WBC count as 11.6 × 103/mm3. The total serum protein was 7.9 gm/dl with serum albumin as 3.5 gm/dl. A left subphrenic collection of size 8 cm × 7 cm was seen on the ultrasound. With a suspicion of some missed pathology at previous surgery site an upper GI endoscopy was performed. A small benign looking ulcer was seen at the pylorus of the stomach.
+With a strong suspicion of gastrocutaneous fistula, a CT fistulogram was performed. An enterocutaneous fistula between the pylorus of the stomach and the anterior abdominal wall was seen. A long side branch of the fistula tract was seen communicating to a moderate sized left subphrenic collection .
+With confirmed diagnosis of complex gastrocutaneous fistula a repeat surgery was planned. The abdomen was entered after incising the previous scar on left lateral side and extending the incision downwards and upwards. Dense interbowel adhesions were encountered. Meticulous adhesiolysis and dissection was performed. The abscess cavity was drained and the perforation on the pylorus of the stomach was identified. It was around 1 cm × 1 cm size. Repeat omental patch repair was performed. In view of difficult dissection, feeding jejunostomy and retrograde tube duodenostomy were also made.
+An uneventful recovery happened. He attended follow up clinic till 4 months following the discharge. There was an incisional hernia but otherwise he was doing fine. After this he was lost to follow up.
+Timeline
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_918_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_918_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ddfd99c10f7d7c43a02405095c98b492a7038424
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_918_en.txt
@@ -0,0 +1,4 @@
+We show the treatment timeline for the patient in . In June 2017 (Sichuan, China), a 66-year-old woman was admitted to our hospital with abdominal distension for more than 6 months. The patient had a total of four pregnancies, three abortions and one normal delivery. Ascites cytology result showed malignant cells (poorly differentiated, considered adenocarcinoma). An abdominal computed tomography (CT) scan revealed bilateral adnexal masses and multiple retroperitoneal lymph nodes. The cancer antigen 125 (CA 125) blood test was 698.20 U/ml. Based on the above clinical results, the patient was diagnosed with ovarian adenocarcinoma . The patient refused surgery for personal reasons and underwent 6 cycles of chemotherapy (paclitaxel 175 mg/m2 + carboplatin AUC=5, ivgtt, q21d). After completion of 6 cycles of chemotherapy, abdominal CT confirmed a complete response (CR). The physician again recommended surgical resection, which the patient declined. Considering the patient’s actual condition, the oncologist implemented the 7th cycle of chemotherapy (paclitaxel 175 mg/m2 + carboplatin AUC=5, ivgtt, q21d). Upon completion of the treatment, follow-up abdominal CT and tumor markers (CA125 and human epitope protein 4 (HE4)) did not show any signs of recurrence for more than 2 years.
+In February 2020, the patient presented for vaginal bleeding. A pelvic magnetic resonance imaging (MRI) revealed a cystic solid mass shadow in the pelvis (size 10.3×6.3×8.2 cm). CA125 was greater than 1000 U/ml and HE4 was 114.90 pmol/L. The oncologist considered the patient to be a platinum-sensitive recurrence. The patient still refused surgery and underwent a second course of 6 cycles of systemic chemotherapy (paclitaxel 175 mg/m2 + carboplatin AUC=5, ivgtt, q21d). CT confirms that localized lesions achieve PR and CA125 consistently decreases to the normal range (23.30 - >1000 U/ml). After the completion of chemotherapy, the oncologist advised the patient to perform surgical resection or maintenance therapy, but the patient refused all therapeutic recommendations.
+Afterward, the patient progressed again in less than a year, still presenting as a localized adnexal mass and same location as the first recurrence. MRI (May 2021) showed a cystic solid mass shadow in the pelvis (size 12.2×7.9×10.0 cm) and CA125 was 560.05 U/ml and HE4 was 186.10 pmol/L. The oncologist considered the patient a platinum-sensitive recurrence again. However, after 1 cycle of chemotherapy (paclitaxel 175 mg/m2 + carboplatin AUC=5, ivgtt, q21d), the patient’s CA125 remained elevated (855.34 U/ml). Positron emission tomography-computed tomography (PET-CT) demonstrated there is a huge mass in the pelvic cavity with increased glucose metabolism, compared with the pelvic MRI in May 2021, the volume of the pelvic lesion has slightly increased. Considered platinum-resistant, it was replaced with bevacizumab combined with gemcitabine (bevacizumab 7.5 mg/kg + gemcitabine 1.0 g/m2, d1, d8 ivgtt, q21d) in June 2021. As the tumor marker serum CA125 continued to rise, the oncologist implemented 3 cycles of targeted drug combination chemotherapy (bevacizumab 7.5mg/kg d1 + irinotecan 80mg/kg d1, d8, d15 q21d). The last systemic treatment was in September 2021. MRI in October 2021 suggested a significant reduction in the shadow of the cystic solid mass in the pelvis, and efficacy was evaluated as PR of the localized lesion.
+In February 2022, the patient experienced abdominal distension again along with a large amount of ascites. In July 2022, the patient was readmitted to our hospital with a worsening condition. Abdominal CT suggested a cystic solid mass in the pelvis (size 12.5×10.6 cm) and CA125 was 1175.16 U/ml and HE4 was 133.80 pmol/L. Tumor recurrence was considered. From July 2022 to November 2022, the patient received 7 cycles of systemic therapy with a targeted agent in combination with a chemotherapeutic agent. On the clinician’s recommendation, the patient received 1 cycle of bevacizumab in combination with irinotecan (bevacizumab 7.5 mg/kg + irinotecan 60 mg/kg, ivgtt, q21d), 1 cycle of bevacizumab in combination with albumin-paclitaxel (bevacizumab 7.5 mg/kg + albumin-paclitaxel q21d), and 5 cycles of bevacizumab in combination with eribulin (bevacizumab 7.5mg/kg + eribulin 2mg d1, d8, q21d). During the treatment, the pelvic mass of the patient was still increasing, and the general condition was getting worse. The patient refused to undergo palliative surgery to relieve symptoms and to be enrolled in clinical studies. Considering that the patient has experienced multiple relapses with the same pelvic lesion and the lesion is isolated, local radiotherapy combined with immunotherapy was chosen. Due to financial reasons, the patient refused immune-related genetic tests, including microsatellite instability (MSI) status, programmed cell death-ligand 1 (PD-L1), and tumor mutation burden (TMB). However, considering the MSI-H/dMMR incidence of up to 30% , our patient strongly expressed her willingness to do immunotherapy and chose the relatively affordable and cheap the PD-1 inhibitor tirilizumab produced in China. We informed our patient of the treatment purpose and risks, and signed an informed consent form. The patient then received triple therapy from November 30, 2022. The radiation oncologist implemented interstitial implantation radiotherapy at a prescribed dose of 10 Gy, combined with a subcutaneous injection of GM-CSF (200 µg) for one week. The tumor got an actual dose of 926.91 cGy. On December 2, 2022, the patient began immunotherapy with the PD-1 inhibitor tirilizumab (300 mg, ivgtt). shows the three-dimensional conformal dose assessment for interstitial implantation radiation therapy. After radiotherapy, the patient developed mild localized erythema. The patient now has no skin ulcers, no bilateral lower extremity edema or other complications, and only mild localized skin pigmentation. The patient’s efficacy evaluation showed a PR. After that, single-agent maintenance therapy with the PD-1 inhibitor tirilizumab was administered every three weeks. During immune maintenance therapy, the patient was temporarily free of treatment-related adverse events (TRAEs), like hemopoietic, thyroid, lung, and heart dysfunction. As of the follow-up in June 2023, abdominal CT suggested a smaller pelvic mass than before and CA125 was persistently decreasing (most recent CA125 was 18.30 U/ml) . The patient’s lesion achieved a PR and continues to benefit for more than six months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_919_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_919_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a785ac60a1d6c7f1058a4e604d993799f177981a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_919_en.txt
@@ -0,0 +1 @@
+A 63-year-old male married , smoker , non-drinker was admitted to the hospital for the evaluation of a fever and a small amount of melena and hematemesis. This was accompanied by generalized weakness, constant fatigue and shortness of breath. Note that the patient did not suffer from any dysphagia, dyspepsia, abdominal pain or any abnormal change of bowel habits. And the patient does not have any history of continuous use of NSAIDs, according to the patient, he used them when necessary. and he was found to have anaemia depending on a medical report done before hospital admission on the background of a medical history of the juxtarenal abdominal aortic aneurysm with synthetic grafting aortobifemoral bypass 1 year earlier, hypertension, type 2 diabetes mellitus, glaucoma, lens transplantation, and ischaemic heart disease with 6 times of catheterization with 4 stents. Note that the patient is committed to taking blood pressure, diabetes, lipid and anticoagulant medications. A medical workup, including an upper GI endoscopy and CT angiogram , was done. There were a few millimetres of opening in the second-third portion of the duodenum, through which pus discharge and blood were coming out, which was compatible with an aortoenteric fistula. It also showed caecal air bubbles. On admission, the patient was transferred to the Surgical ICU as a case of sepsis (his vital signs were a blood pressure of 90/50 mmHg, tachycardia of 135 bpm, and a temperature of 38°C, and his lab report was white blood cell 5.56 with neutrophil 96.8, haemoglobin% 11.41, ESr35 mm/h, and C-reactive protein 185.4 mg/dl), managed with IV antibiotics, and referred to the surgical ward after patient stabilization. After a few days, the patient underwent the first stage of the operation, in which an exclusion aortic limb graft with endarterectomy was performed, then an axillofemoral bypass was done, and then a femoro-femoral bypass was done using polytetrafluoroethylene. Following surgery, the patient was transferred to the ICU for close monitoring. During the second stage of the operation, we found intestinal adhesion, an aorto-duodenal fistula at the second-third part, an aortocecal fistula with severe inflammation and unhealthy tissue, an infected aortobifemoral graft with pus discharge, and large infrarenal AAA (aneurysm remnants after juxtarenal abdominal aorta repair). Then we did infrarenal aortic neck control. That is, the remainder of the juxtarenal abdominal aortic aneurysm has been removed, along with the old infected aortobifemoral graft, closure of the infrarenal abdominal aorta with double layers of prolein, fistula management, primary repair of the second-third part of the duodenum, and right hemicolectomy with primary anastomosis. The patient was kept in the SICU post-operation for further intensive care management and daily labs, and the patient started on total parental nutrition, stabilized, and was transferred to the surgical ward, where he started on an oral diet gradually and tolerated it. A follow-up CT scan was done, which had acceptable results: no leak and intact vascular supply to the lower limb and bowel. then the patient was discharged, in good general condition, afebrile, and with stable vital signs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_927_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_927_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..80382611827113a9f5e608e4c5e01af6cf577e5a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_927_en.txt
@@ -0,0 +1,4 @@
+We report here two cases of pulmonary hypertension after the second dose of the Pfizer mRNA COVID-19 vaccine (BNT162b2).
+Case #1 is a previously healthy 49-year-old male physician athlete, body mass index (BMI) 23, non-smoker with a history of mild exercise-induced asthma treated with albuterol. The patient completed the primary series of Pfizer mRNA COVID-19 vaccine (BNT162b2), Dose 1 in December 2020 and Dose 2 in January 2021. Approximately three weeks after the second dose, the patient suddenly developed severe fatigue, flu-like symptoms, tachycardia, palpitations, orthostasis, right-sided chest pressure and dyspnea on exertion. SARS-CoV-2 polymerase chain reaction (PCR) testing was negative at the time of the onset of these symptoms. Transthoracic echocardiogram revealed normal left ventricular function with an ejection fraction (EF) of 65%, normal right ventricular size and function and a maximal tricuspid regurgitation velocity (TRVmax) of 3.09 m/s. The estimated right ventricular systolic pressure (RVSP) of 42 mmHg was interpreted as mild/moderate pulmonary hypertension . Laboratory studies including measurement of brain natriuretic peptide (BNP) (22 pg/mL; reference range < 900 pg/mL) were unremarkable except for elevated low-density lipoprotein (LDL) cholesterol and a hematocrit of 50%. Pulmonary computer tomography (CT) angiogram with 3D reconstruction of the PA tree was normal without evidence of pulmonary clots . The patient subsequently developed 15 lbs of fluid gain and generalized swelling, neck pressure, headaches and a feeling of “being hung upside down” consistent with jugular vein distention (JVD) and cerebral venous congestion. The resting oxygen saturation (SpO2) was 92% and there was new onset systolic and diastolic arterial hypertension. Symptoms and chest pressure occurred at rest and were exacerbated by exertion. Exercise and functional limitations were consistent with New York Heart Association (NYHA) Class 3–4. Serial echocardiograms showed no worsening of RVSP and continued normal RV function . Symptoms and exercise tolerance improved to NYHA class 1–2 over one year. Fluid weight gain, swelling, tachycardia and arterial hypertension resolved and the resting SpO2 increased to 98–100%. Flu-like symptoms and fatigue diminished but did not disappear. RVSP remained elevated and essentially unchanged by follow up echocardiography . This case was reported to the Vaccine Adverse Event Reporting System (VAERS ID 1039123).
+Case #2 is a previously healthy and active 56-year-old male, BMI 25, non-smoker, with a history of spontaneous deep venous thrombosis (DVT) on two occasions which were resolved with courses of anticoagulation without symptoms of pulmonary emboli. Hematologic investigation identified no clotting abnormalities. In 2005, an incidental isolated left superior vena cava was suspected by an otherwise normal transthoracic echocardiogram and confirmed by cardiac magnetic resonance imaging (MRI). The patient completed the primary series of Pfizer mRNA COVID-19 vaccine (BNT162b2) Dose 1 and Dose 2 in April 2021. Twelve days after the second dose, the patient experienced sudden onset fatigue, flu-like symptoms and dyspnea on exertion. SARS-CoV-2 PCR testing was negative at the time of the onset of these symptoms. Exercise tolerance was consistent with NYHA Class 2. The patient sought medical attention two weeks later, but a stress echocardiogram and CT pulmonary angiography were not performed until almost 4 months after vaccination. The stress echocardiogram revealed normal left ventricular function, an ejection fraction (EF) of 60%, ventricular ectopy and mild right-sided chamber enlargement. No right-sided pressures were measured. A pulmonary CT angiogram with 3D reconstruction revealed mosaic attenuation of lung parenchyma with relative pruning of distal pulmonary vessels and mild enlargement of the PA without evidence of pulmonary emboli . A Ventilation Perfusion (V/Q) scan was interpreted as near normal and a very low probability for pulmonary emboli. Despite the negative studies, anti-coagulation with rivaroxaban was started out of an abundance of caution due to patient’s distant history of DVT. A complete echocardiogram performed 5 months after vaccination measured a TRVmax of 2.82 m/s and calculated an RVSP of 40 mm Hg , suggesting a diagnosis of pulmonary hypertension. Follow-up echocardiography three months later measured a TRVmax of 3.22 m/s and estimated an RVSP of 46 mmHg . Subsequent right heart catheterization confirmed the diagnosis with directly measured systolic and diastolic PA pressures (PAP) of 44/18 mm Hg (mean 28 mm Hg) and elevated pulmonary vascular resistance (PVR) calculated at 3.6 Woods units. An endothelin receptor antagonist was prescribed and then a phosphodiesterase inhibitor. Fifteen months after vaccination, the patient’s exercise tolerance remained unchanged and consistent with NYHA Class 2 and the RVSP remained elevated at 49 mm Hg, estimated by a TRVmax of 3.22 m/s . The patient’s course was complicated by transient episodes of new onset atrial fibrillation. BNP remained in normal range at 99 pg/mL. A subsequent Cardiac MRI revealed a mildly enlarged right ventricle with normal systolic function and normal main PA. A pulmonary hypertension screening panel by Invitae Genomics was negative for twelve genetic predisposition markers.
+The clinical findings of the two cases are summarized in .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_933_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_933_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..78b5aa5fc0d7134e25f211af3174619d7d5bf44b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_933_en.txt
@@ -0,0 +1,6 @@
+A 23-year-old female presented to the emergency department with a 1-day history of fits. It was described as a generalized tonic-clonic seizure with loss of consciousness for about 30 minutes. There was no aura or focal neurological deficit. She reported having headache, vertigo, disturbed sleep, and reduced appetite. The patient had a history of similar seizures that progressively worsened over the last 1 month. The patient was taking sodium valproate for the last 6 months but the seizures were uncontrolled despite of strict medication compliance. In addition, she also had generalized body weakness, intermittent twitching and tightness in the hands for the past 7 years. She did not have a history of seizures, head trauma, central nervous system infection, stroke, hypertension, diabetes, thyroid disease, or autoimmune disease. Family history was not significant for seizures disorder.
+Her vital signs were as follows: blood pressure was 120/70 mm Hg; pulse rate was 74 beats per minute, respiratory rate of 20 breaths per minute, and body temperature of 37.3°C. Neurological examination revealed clear consciousness with no cognitive impairment or cranial nerve dysfunction. Her systemic and general physical examinations were unremarkable except for a positive Chvostek sign.
+Initially workup was done for the metabolic causes of seizures and the laboratory evaluation revealed hypocalcemia as shown in
+Computed tomographic (CT) scan of the brain was ordered that diffuse brain parenchymal calcification involving globus pallidus, putamen, caudate, internal capsule, thalamus, dentate nucleus, and subcortical white matter in scattered areas of fronto parietal regions as shown in .
+Based on the patient laboratory investigation and radiological finding a differential diagnosis of fahr’s disease and fahr’s syndrome were made. Initially the patient received injection calcium gluconate 20 mL of calcium gluconate 10% diluted in 50 mL of dextrose infused over 10 minutes by intravenous route, injection midazolam and an injection diavalproex sodium 500 mg. Patient was admitted to the medical unit and further workup for hypocalcemia was initiated that revealed hypoparathyroidism as shown in the .
+Due to the absence of secondary causes that is, congenital defects, thyroid surgery, neck radiation in the patient history, negative anti-nuclear antibodies a diagnosis of Fahr’s syndrome secondary to primary hypoparathyroidism was made. The patient was placed on oral sodium valproate 500 mg twice daily, calcium citrate 600 mg twice daily, vitamin D3 50 000 once weekly for 6 weeks. At sixth week follow up, the patient remained symptomatic having 2 episodes of seizure in the last 15 days despite of strict compliance to anti-seizures and calcium supplements. Her calcium remained low (5.2 mg/dL). She was prescribed oral prednisolone 2 mg/kg for 4 weeks along with the anti-seizures and calcium and vitamin D supplement. After 1 month of starting the steroid therapy her calcium level raised to 7.2 mg/dL, she remained asymptomatic and her steroid therapy was tapered.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_942_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_942_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bf46a82dafbe57fab68a2ebae532b5a1e614cce9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_942_en.txt
@@ -0,0 +1 @@
+A 24-year-old female presented with a massive fungating mass over the left upper back and shoulder. The patient gave a history of swelling over the left upper back, which was insidious in onset and gradually progressed over the past 2 years. Incisional biopsy over the most prominent aspect of the swelling was performed elsewhere about 1 year ago, a provisional diagnosis of ES of the left scapula was made and the patient was started on chemotherapy and operated following 3months of chemotherapy. The wound following surgery did not heal and an ulcer developed over the operated site which rapidly increased in size. Neoadjuvant chemotherapy was started and the regimen was changed multiple times over the next 9months as the tumor did not respond and swelling continued to progress in size. In view of the size and nature of the lesion, wound, and associated complications, the patient was advised forequarter amputation of the left upper limb at multiple centers in her country, which she refused and was finally referred to our hospital for further management. On presentation, a huge fungating mass was noticed over the left upper back and shoulder region with active bleeding and foul-smelling discharge from the ulcer . The patient was febrile and unable to use the left upper limb due to the size of the lesion and excruciating pain. Magnetic resonance imaging of the shoulder and upper back showed a T1 isointense and T2 heterogeneous high-signal intensity lesion which measured 18 cm ×27cm × 26cmin size, with multiple fluid levels, degenerative cystic changes, hemorrhage, areas of necrosis, and infiltration of periscapular musculature . On computed tomography (CT) scan, tumor was ill defined with heterogeneous attenuation, multiple areas of cystic changes, and gross osteolysis of the scapula. However, the shoulder joint, chest wall, and the brachial plexus were not involved, axillary vascular bundle was displaced anteriorly without signs of infiltration. Whole body positron emission tomography-CT scan showed no signs of pulmonary or distant metastasis. Diagnosis of Ewing’s sarcoma was made by histopathological examination of needle biopsy sample from the swelling, which showed sheets of small, round, and uniform cells with scanty cytoplasm, separated by fibrous strands with few mitosis and minimal stroma . CD99 was positive on immunohistochemistry. In view of the clinical condition of the patientupfront surgery was performed, following antibiotics to control infection, blood transfusions to correct anemia, and selective arterial embolization of feeding vessels. The patient underwent enbloc excision of the tumor mass bytotal scapulectomy. The ulcer was covered with an adhesive sterile surgical drape; circumferential incision was made around the tumor mass including 3cm of pinchable uninvolved skin. Axillary vascular bundle and the brachial plexus were dissected and isolated from the tumor mass. Arthrotomy of the left shoulder was performed as a layer of the capsule of the joint was also removed. Periscapular musculature was also removed along with the tumor mass. Frozen section from the surrounding soft tissue and chest wall was negative for residual tumor cells. The humeral head was secured to the lateral end of the clavicle , and the defect over the back following resection was closed by negative pressure dressing and subsequentlycovered2days later with latissimus dorsi free pedicle flap. The humeral head was plain radiograph of the left shoulder region following resection. Diagnosis of ES was confirmed by histopathological examination of the resected specimen and all the resected surgical margins were free of tumor . 3 weeks after surgery, concomitant radiotherapy and adjuvant chemotherapy (6 cycles of vincristine, doxorubicin, and cyclophosphamide alternating with if osfamide and etoposide) were started. The patient also underwent autologous stem cell transplantation following adjuvant chemotherapy. There were no neurological or vascular deficits in the operated limb following the procedure and the patient on follow-up had good functional range of motion of the left shoulder and full range of motion of the left elbow, wrist, and fingers. On final follow-up of 3years, the patient showed no signs of local recurrence (LR) or metastasis and had returned to her prior vocational status .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_958_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_958_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..64a9e1366702e8dd7fbee9d75723843b930bc86b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_958_en.txt
@@ -0,0 +1,6 @@
+A 69-year-old man presented to the outpatient clinic of the Department of Breast Surgery at the Shiga General Hospital (Moriyama, Shiga, Japan) with a lump in his left breast in the 1990s. Physical examination revealed a mass measuring > 6 cm without skin invasion in the upper-lateral region as well as axillary lymph node swelling. The patient had a history of diabetes, hyper tension, cerebral infarction, and brain schwannoma controlled by oral glimepiride 0.5 mg, nifedipine 40 mg, and aspirin 100 mg. He had no remarkable family history.
+Ultrasonography showed a breast mass and right-sided axillary lymph node swelling. A core needle biopsy was performed, and the tumor was diagnosed as a high histological grade invasive ductal carcinoma. It was ER-positive, PgR-negative, HER2-negative and AR-positive (detected by anti-AR rabbit monoclonal antibody SP107; Roche tissue diagnostics, Ltd.); the Ki-67 labeling index was 10% . The tumor was radiologically classified as cT3N3M0, stage IIIC disease (Union for International Cancer Control-TNM classification, 8th edition) .
+Preoperative chemotherapy was not performed at the time; thus, a mastectomy and axillary dissection were performed. The final histological diagnosis was pt3n3a (36/39) M0, stage IIIC disease. Postoperative chemotherapy with epirubicin 40 mg/body with 5-fluorouracil (5-FU) 500 mg/body every 2 weeks plus oral cyclophosphamide 100 mg daily (CEF) was administered. After 2 cycles of the chemotherapy, computed tomography (CT) revealed pleural metastasis in his right lung. Anti-estrogen therapy with high-dose toremifene (TOR) 120 mg b.i.d and oral 5-FU, doxifluridine (5’DFUR) 1200 mg was administered as first-line therapy for metastatic breast cancer.
+Two years after the recurrence, the patient complained of frequent urination. Radiological and histological examinations revealed that he had cT3N0M0, stage III primary prostate cancer with a prostate-specific antigen (PSA) level of 40.5 ng/mL. He underwent radiation therapy at a dose of 66.0 Gy/33 fractions as local control to treat the prostate cancer. After radiotherapy, the prostate cancer therapy was temporarily suspended, and the watchful waiting approach was taken. Breast cancer therapy with high-dose TOR was continued since breast cancer control was good. Six months later, the PSA level increased from 3.7 ng/mL to 18.0 ng/mL. Oral estramustine phosphate sodium hydrate (Estracyt®) 626.8 mg was administered daily because this drug remains specifically in prostate cancer tissue and is not contraindicated in patients with breast cancer. The PSA level immediately decreased to within the normal range (3.7 ng/mL), and Estracyt® as well as TOR were continued for 3 years until the patient experienced a deep vein thrombosis in his right leg related to the endocrine therapy, while the antiplatelet therapy was ongoing.
+TOR was stopped but Estracyt® was continued for symptomatic disease control. A CT scan revealed liver metastasis from the breast cancer after the patient stopped the breast cancer therapy. Estracyt® was changed to the non-steroidal anti-androgen agent, Casodex® as the second-line endocrine therapy for the prostate cancer and a luteinizing hormone-releasing hormone (LHRH) agonist as third-line treatment; however, the patient died due to breast cancer progression 5 years after the diagnosis of prostate cancer .
+We retrospectively reviewed the medical records of 1431 patients with breast cancer who underwent breast cancer therapy at the Shiga General Hospital between 1998 and 2017. The retrospective review of the medical records was approved by the appropriate ethics review board, and the study complied with the tenets of the Declaration of Helsinki. Of all patients, 8 (0.6%) were men; they were diagnosed with primary breast cancer histologically. Table shows the clinicopathological characteristics of the patients with MBC.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_95_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_95_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0d4874b688dbc96737715a8fc3400731861b5448
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_95_en.txt
@@ -0,0 +1,8 @@
+A 34-year-old woman with an unremarkable past medical and family history presented at the emergency room with symptoms of nausea, abdominal discomfort, and pallor for 7 days. High blood pressure levels were recorded all days. She had previously received nonsteroidal anti-inflammatory drug treatment for toothache for 3 days. There was no recent history of diarrhea, dysentery-like illness, pregnancy, miscarriage, or use of contraceptives.
+Physical examination of the patient revealed pallor of the skin and mucous membranes. Her blood pressure was 155/100 mm Hg. Otherwise, physical examination was unremarkable.
+Laboratory tests were indicative of microangiopathic hemolytic anemia with hemoglobin levels of 9.4 g/dL (normal range, 12.2–16.1 g/dL). Peripheral blood smear revealed anisopoikilocytosis (red blood cells of varying shapes and sizes), including the presence of fragmented red blood cells (schistocytes and helmet cells). Coomb's test was negative, and haptoglobin was absent. The platelet count was 27,000/mm3. Renal damage was present, with serum creatinine levels of 5.8 mg/dL (normal range, 0.43−0.9 mg/dL), urea levels of 173 mg/dL, phosphorus levels of 6.4 mg/dL, and lactate dehydrogenase levels of 1,394 UI/L. There were no further pathological biochemical parameters. Urinalysis revealed 3+ albumin, and microscopy of the urine sediment yielded 5–7 red cells per X power field. Prothrombin time was 12 s, and activated partial thromboplastin time was 26.5 s. Antinuclear antibodies, antiphospholipid antibodies, rheumatoid factor, anti-neutrophil cytoplasmic antibody, and anti-native DNA antibodies were not detected. Blood and urine cultures were sterile. The patient's serum tested negative for hepatitis B virus, hepatitis C virus, and human immunodeficiency virus. A hyperechogenic cortex was displayed on the renal ultrasound scan. The exploration was otherwise normal. Renal biopsy was not performed.
+After ruling out secondary causes of thrombotic microangiopathy, a definitive diagnosis of aHUS was made. Plasma exchange was initiated with the patient receiving exchanges twice daily, for a total of 31 sessions. However, her renal function did not improve, and hemodialysis therapy was subsequently initiated.
+A further diagnostic workup was performed. ADAMTS13 activity in the plasma was 86.5% (normal range, 40–124%) and thus, it was found to be normal. The plasma concentrations of complement components were as follows: C3, 73.6 mg/dL (normal range, 77–210 mg/dL), C4, 28.4 g/L (normal range, 14–47 g/L), and CFH, 21.37 mg/dL (normal range, 12–56 mg/dL). CFI activity was 85% (normal range, 71–115%), MCP was 117% (normal range, 91–109%), and anti-CFH antibodies were absent. Mutation screening of CFH, CFI, CD46, C3, and CFB was conducted. This analysis revealed a heterozygous single-nucleotide mutation in the exon 13 of the CFH gene (c.1707>A; Cys569stop) that was predicted to truncate the protein product by introducing a stop codon (Cys569stop). This mutation was not defined in the Exome Sequencing Project. No mutations were found either for CFI or MCP genes. Moreover, the patient carries the CFH and MCP risk haplotypes for aHUS in heterozygous pattern.
+The patient was switched to automated peritoneal dialysis (APD) after almost 2 months of hemodialysis. Her APD schedule consisted of 5 overnight exchanges of 2 L and 1 icodextrin (extraneal) wet day. At this moment, the patient's residual renal function (RRF) was 3–4 mL/min, and her urine output was 700 mL per day (urea clearance of 1,400 mg/dL and creatinine clearance of 108 mg/dL). Blood pressure remained poorly controlled (>163/105 mm Hg) despite administration of maximal doses of 6 different antihypertensive drugs. Platelet count was 103,000/mm3, and hemoglobin level was 12.2 g/dL.
+Sixty-two months following diagnosis and treatment with dialysis, the patient remained on APD with sustained high blood pressure, anemia and thrombocytopenia. At this point, she was re-evaluated, as her clinical symptoms and hematological and biochemical profile remained poorly controlled. Treatment with complement-blocking therapy with eculizumab was initiated. At the time of initiation of eculizumab, the patient was asymptomatic and in good clinical status. Blood pressure values remained 160/105 mm Hg despite the use of full doses of 6 hypotensive drugs (verapamil, trandolapril, atenolol, doxazosin, aliskiren, and furosemide). Platelet count was 103,000/mm3. Diuresis was 700 mL with proteinuria of 0.3 g/L and creatinine of 7.53 mg/dL. RRF was 3.9 mL/min (urea clearance of 2.2 mL/min and creatinine clearance of 5.6 mL/min). The patient was on continuous cycling peritoneal dialysis with 10 L overnight exchanges and 2 L of icodextrin during the day. In order to prevent meningococcal infection, the patient received prophylactic antibiotic treatment with ciprofloxacin and vaccination against Neisseria meningitides before receiving the first dose of eculizumab on August 5, 2013. Follow-up was performed every 3 months . The patient's clinical condition improved within 6 months of starting eculizumab therapy: RRF increased to 11 mL/min and urine output increased to 2,000 mL per day. Levels of hemoglobin, platelets, and lactate dehydrogenase returned to normal ranges. The patient's blood pressure was better controlled with 4 drugs (furosemide, verapamil, trandolapril, and metoprolol), with levels below 120/70 mm Hg . Improvement was sustained through successive follow-up visits. Fifteen months after the initiation of eculizumab, kidney creatinine clearance rate was 30 mL/min, RRF was 20 mL/min, and urine output was 2,300 mL per day. At 16 months of follow-up, APD dose was reduced to 3 overnight exchanges of 2 L, 5 days per week, and extraneal exchange and wet day were no longer required. Currently, dialysis has been successfully discontinued.
+Treatment with eculizumab was well tolerated by the patient throughout the follow-up period. At present, and in anticipation of her progress in the next months, we are evaluating the options of either keeping the patient under supervision for advanced renal disease or including her in the renal transplant waiting list.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_970_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_970_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..697d4a1b51b4fca81ee58260f9953ac2712faa05
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_970_en.txt
@@ -0,0 +1,8 @@
+A 30-year-old female presented with “39 (6/7) wk of menopause and 6 h of irregular abdominal pain”.
+Her abdominal pain occurred at intervals of 15 to 30 min and lasted for 30 s. She was admitted to the obstetric department of our hospital as an emergency case.
+The patient denied a history of other diseases.
+The pregnant woman was previously healthy and denied a family history of hereditary diseases.
+Measurements of fundal height, abdominal circumference, fetal heart rate, and external pelvis were normal. The position of the fetus was Left Occiput Anterior (LOA). No dystocia of the head was noted. An internal examination revealed no abnormalities.
+The pregnant woman was admitted to the operating room as an emergency due to intrauterine distress before her laboratory results were available. Intraoperatively, laboratory tests showed that the white blood cell count was 11.3 × 109/L ↑, the prothrombin time (PT) was 33.7 s ↑, the international prothrombin standard was 2.79 ↑, partial thromboplastin time was 60.4 s ↑, partial thromboplastin ratio was 2.06 ↑, PT was 45.2 s ↑, prothrombin activity was 22% ↓ and antithrombin was 17% ↓, fibrinogen assay was 0.6 g/L ↓, fibrin (pro) degradation product was 116.4 μg/mL ↑, uric acid was 615 μmol/L ↑, creatinine was 172 μmol/L ↑, glutathione aminotransferase was 705 U/L ↑, glutathione aminotransferase was 323 U/L ↑, total bilirubin was 89.51 μmol/L ↑, direct bilirubin was 70.25 μmol/L ↑ and indirect bilirubin was 19.26 μmol/L ↑.
+Ultrasound examination showed ascites and bright liver. Obstetric three-dimensional color ultrasound showed the following: The fetal position was cephalic, the fetal heart rate was 171 bpm, fetal movements were palpable, the biparietal diameter was 9.1 cm, the head circumference was 32.0 cm, the abdominal circumference was 33.1 cm, femoral length was 6.8 cm, the placenta was in the fundus with a maturity of II, the amniotic index was 17.41 cm, umbilical artery S/D was 2.4, placental entrance and the inferior border was indistinct. The results of the non-stress test after admission showed a non-responsive type, a flat baseline, no fetal movements, and no fetal heart fluctuations.
+We analyzed genomic DNA obtained from the blood sample to check for mutations in the fibrinogen gene. Both the mother and the newborn had abnormal coagulation values, indicating that the disease was inherited in the family. Genotype analysis confirmed the diagnosis of hypofibrinogenemia by identifying a homozygous mutation in fibrinogen alpha chain gene (FGA) (p.R350H). In addition, genetic testing was performed on the patient’s parents and daughter, and the results confirmed that both the father and daughter were disease-causing gene carriers . We have studied the clinical symptoms, fibrinogen results, genetic analysis, treatment, and clinical outcomes of pregnant women with CD over the past 30 years . In addition, we reviewed the CD-related gene mutation sites mentioned above .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_982_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_982_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6a88fb0f68fb694dc25e32175e524a0629b4fa93
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_982_en.txt
@@ -0,0 +1,7 @@
+A 76-year-old male patient presented to the Department of Orthopedics of our hospital complaining of worsening progressive right hip pain, a limp when walking and weakness of the right hip. He was admitted to our hospital.
+The patient’s symptoms started four years ago with recurrent swelling of the right hip with mild pain, which had worsened in the last 48 h.
+The patient initially presented with neck pain and weakness in all four limbs 16 years ago and was diagnosed with cervical spondylosis, which was treated conservatively.
+The patient had an unremarkable personal and family history.
+The patient reported mild pain with flexion and extension of the cervical spine and activity limitation. Apparent swelling was observed in the left hip, and more than 110 mL of clear yellowish joint fluid was extracted. The active range of motion of the right hip was recorded as follows: flexion 90°, abduction 30°, internal rotation 20°, and external rotation 35°, with pain in all directions. The visual analog score was 6/10 points, and the Harris hip score (HHS) was 56 points. Neurologically, the sensation of pain and temperature in the upper and lower extremities was decreased, and proprioception and position sensation were normal. A pathologic reflex was not elicited. Both upper limbs and the right lower limb exhibited weakness with a muscle strength of 4/5, the muscle strength of the left lower limb was normal at 5/5, the right abductor had a muscle strength score of 5/5, and the modified Japanese Orthopedic Association score for CSM was 9/17 points. The bone mineral density (BMD) of the hip was 0.45 g/cm2, and the T score was -2.9. Laboratory results were nonspecific.
+Blood biochemistry and urine analyses were normal. Electrocardiogram, chest X-ray and arterial blood gases were also normal. The BMD of the hip was 0.45 g/cm2, and the T score was -2.9.
+Magnetic resonance imaging (MRI) of the cervical spine showed cervical syringomyelia at C4, cervical disc herniation and spinal canal stenosis from the C3 to the C7 levels . Cervical computed tomography (CT) revealed destruction of the vertebral body at C4 and C5–7 vertebral body assimilation . Three-dimensional CT reconstruction, CT scans, and X-rays of the right hip joint showed joint space loss, articular surface collapse, and destructive changes in the acetabulum and femoral head . T2W1 MRI of the right hip showed articular cartilage loss, degeneration of the joint, disordered soft tissue, and apparent joint fluid .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_996_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_996_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0fa982a583fdc42434ec9f4af198766e6b044bd1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_996_en.txt
@@ -0,0 +1,3 @@
+A 71-year-old woman presented with a 2-month history of dysphagia and chest pain after swallowing and came to our hospital with a complaint of worsening symptoms. An esophagogastroduodenoscopy revealed a type-3 tumor at the middle intrathoracic esophagus (a), and a barium esophagography revealed an irregular stricture of the middle intrathoracic esophagus, measuring about 5 cm in length (b). Endoscopic biopsy specimens taken from the tumor histologically showed poorly differentiated squamous carcinoma, and an enhanced computed tomography (CT) work-up revealed thickening of the esophageal wall and swelling of a mediastinal lymph node without any distant organ metastases (a, b). She was diagnosed with an advanced ESCC with cT3N1M0, and underwent radical subtotal esophagectomy with three-field lymph node dissection.
+The gross examination of the specimen showed that there was a type-3 tumor measuring 45 × 15 mm in consonance with an unstained area of iodine staining (a). Microscopic findings of the low-power field revealed invasion into the adventitia without exposure of the tumor (b), and those of high-power field also revealed poorly differentiated squamous cell carcinoma with multiple lymph node metastases; these findings led to a diagnosis of pT3N1M0 (c). However, she had been sequentially administered adjuvant doublet chemotherapy using cisplatin and 5-FU, grade 4 hematological toxicity, and hepatobiliary disorders aborted it during the first course. She was then followed for 6 years without recurrence; however, chest X-ray and CT examinations at the 7-year follow-up revealed a 1.5-cm-diameter solitary pulmonary tumor at right middle lobe with (a, b). In addition, positron emission tomography CT (PET-CT) also showed abnormal uptake of this pulmonary tumor (c). Although we could not preoperatively perform CT-guided percutaneous lung biopsy due to the deep location of the tumor, any regional lymph nodes or distant metastases were undetected; therefore, we performed thoracoscopic partial resection of the right middle lobe.
+Microscopic findings of low-power field revealed that there was a solid tumor with necrotizing compartments, and those of high-power field also revealed that tumor cells proliferate without having a basement membrane-like structure (a, b). From these findings, morphological features led to the diagnosis of poorly differentiated squamous cell carcinoma. An immunohistochemical examination was performed to identify the origin of the tumor primary lung cancer or pulmonary metastasis from ESCC. The tumor cells of primary ESCC were positive for CK14, CK18, CK19, and CK5/6 (a–d). On the other hand, the tumor cells of the lung tumor were negative for CK14, napsin A, and synaptophysin (a–f). From these immunohistochemical features, the pulmonary tumor was not derived from both alveolar epithelium and neuroendocrine cells; thus, we finally made the diagnosis of super-late pulmonary recurrence of ESCC. This patient was discharged from the hospital on postoperative day 10 without any complications, and no recurrence was noted for four years after pulmonary metastasectomy.
\ No newline at end of file