diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1001_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1001_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6fb7bfe4b711e49584c53cc04af317d0cc1d39b5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1001_en.txt
@@ -0,0 +1 @@
+A 38-year-old woman developed numbness in the right limb and weakness and limited movement in the left limb following a fall from hitting her head on a door beam. She was unconscious on the spot. After treatment, her whole body was numb and limb activity was limited. Half an hour later, she felt numb and weak in the right limb and weak in the left limb. She had no previous hypertension, diabetes, or coronary heart disease. 13 years ago, she developed numbness in her right hand after pregnancy and was diagnosed with congenital fusion of cervical C2-5, which was not treated at that time . Her symptoms had improved and had not interfered with her normal life. There was no diplopia, slurred speech, hiccups, nausea and vomiting, dysphagia, urinary incontinence, and no corresponding symptoms such as facial sensory abnormalities. Physical examination revealed a short neck, limited cervical mobility, and low occipital hairline. Below the C3 level of spinal cord, bounded by the anterior median line, there were different sensory and motor abnormalities from left to right. The patient had decreased pinprick and temperature sensation on the right side and normal pinprick sensation on the left side. Her sense of spatial position was normal. There was increased muscle tone in the right upper and lower limbs and decreased muscle tone in the left upper and lower limbs. The muscle strength of the left upper and lower limbs was 0 out of 5 and the strength of the right upper and lower limbs was 4 out of 5. After conservative treatment, her muscle strength gradually recovered. 10 days later, some of the muscle strength showed changes, and the muscle strength of the key muscle groups was as follows: shrugging shoulder muscle strength (left 2, right4), elbow flexion muscle strength (left 2, right 4), elbow extension muscle strength (left 2, right 4), wrist flexion muscle strength (left 1, right 4). finger flexion muscle strength (left 1, right 4), finger extension muscle strength (left 1, right 3), hip flexion (left 2, right 4), knee extension (left 2, right 4), dorsalis pedis (left 3, right 4), plantarflexion (left 3, right 4), and hyperreflexia of the biceps and triceps tendons bilaterally. Abdominal wall reflexes were present, knee and Achilles tendon reflexes were hyperactive, patellar clonus was positive on the right, patellar clonus was positive on the left, ankle clonus was positive on the right and ankle clonus was positive on the left. The dorsalis pedis artery was palpable bilaterally. The bilateral Hoffman's sign was positive. Babinski's sign was positive and Kernig's sign was positive. The findings of Magnetic resonance imaging (MRI) in the neck revealed that small C2-5 vertebral body with partial fusion of the vertebral body; increased anterior atlantoaxial space, posterior superior displacement of the cardinal vertebrae, the narrowing of the spinal canal at the corresponding level and marked compression and thinning of the spinal cord (C1-2 joint instability, discontinuity of the odontoid process, congenital fusion of cervical C2-5). posterior protrusion of the C7-T1 intervertebral disc, with compression of the corresponding dural sac. No significant abnormal signs were seen in the cervical medulla. We considered that the woman sustained BBS because she had previously suffered from KFS, which according to ASIA(American Spinal Injury Association) Impairment Scale was a grade B: incomplete injury. After admission, the woman was given methylcobalamin for neurotropism and tizanidine to reduce muscle tone and received acupuncture and hyperbaric oxygen therapy. After conservative treatment, her spinal cord oedema decreased and the numbness on the right side gradually subsided, but the results were still unsatisfactory so the doctor recommended surgery. She then underwent posterior decompression of the spinal canal, and lateral mass fixation between atlas and axis with screw-plate system . After surgery, her numbness subsided and she continued to receive adenosine cobalamin for neurotropic treatment. She came to our hospital for a check 5 months later after the operation. The numbness of the right limb significantly decreased and the dysfunction of the limbs was slightly better than before. She could sit independently and stand with assistance, but she was still unable to take care of himself. She then underwent regular rehabilitation treatment in our hospital. 18 months later, the numbness of her limbs had disappeared and she was able to take care of herself with assistance, and her condition improved from grade B to grade D according to the ASIA classification.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1026_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1026_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..17fd7709a88bbfd0678f1b4ca0f5a59ff01ba5ba
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1026_en.txt
@@ -0,0 +1,12 @@
+A 62-year-old Caucasian man presented with symptoms of cough, fever, myalgia and chills. Symptoms had begun 6 days prior to admission. He had tested positive for SARS-CoV-2 by Xpert Xpress SaRS-CoV-2 (Cepheid, Dx System Version 4.8) three days after symptom onset. His past medical history was unremarkable except for hyperlipidemia treated with atorvastatin 40 mg daily. No allergies were reported, the patient did not smoke, drink alcohol or use illicit substances. Kidney function was normal on admission.
+Computed tomography (CT) scan of the chest, abdomen and pelvis excluded pulmonary emboli and showed diffuse bilateral ground-glass infiltrates of the lungs with associated lymphadenopathy, moderate pleural effusions, normal-sized and -shaped kidneys with adequate perfusion and without cortical defects.
+Two days after admission the patient required intubation due to acute respiratory distress syndrome (ARDS). He was managed with prone positioning and was initiated on hydroxychloroquine after exclusion of glucose-6-phosphate dehydrogenase (G6PD) deficiency. Antibiotic therapy with amoxicillin-clavulanate was given empirically assuming bacterial superinfection of viral pneumonia. His clinical condition worsened with the development of atrial fibrillation, AKI, paralytic ileus, hemolytic anemia and a maculopapular rash on the trunk and lower extremities.
+The chronologic sequence of medications and clinical events are highlighted in Fig. . Laboratory results are shown in Table . Details of affected organ systems, diagnostics and therapies are listed in Table .
+A maculo-papular skin rash developed on day 7 after admission. Severe AKI with oliguria (AKIN 3), consecutive fluid overload and metabolic acidosis necessitated initiation of continuous veno-venous hemodiafiltration (CVVHDF) on day 9. Peak creatinine was 519 umol/L, urinalysis showed minimal proteinuria and microscopic hematuria. Proteinuria subsequently increased significantly and microscopic hematuria persisted, urine leucocytes were persistently within the normal range. .
+Several days after initiation of CVVHDF (on day 24) the patient developed severe microangiopathic hemolytic anemia, Coombs negative, which was transfusion dependent. Serologic screening was negative for HIV, hepatitis B and C virus infection; anti-nuclear antibodies, anti-DNA antibodies, anti-neutrophil cytoplasmic antibodies, anti-cardiolipin antibodies and complement levels were normal. Eosinophils were initially not significantly elevated. There was no evidence of urinary obstruction or rhabdomyolysis. Echocardiogram showed preserved cardiac function.
+Differential diagnosis of the AKI included acute tubular injury (ATI) due to hemodynamic instability; sepsis-associated AKI; ATI with pigmented tubular casts as a consequence of hemolysis; thrombotic microangiopathy - given the ongoing severe hemolysis with schistocytes on peripheral smear (despite lack of overt thrombocytopenia); collapsing glomerulopathy - given the large rise in proteinuria,; and acute interstitial nephritis associated with antibiotics - given concurrent skin rash, although peripheral eosinophilia and leucocyturia were not marked. In the absence of improvement of kidney function a transcutaneous renal biopsy was performed while the patient was proned in ICU, 32 days after admission.
+Light microscopy revealed 34 mostly normal glomeruli. Few glomeruli were mildly congested, without thrombi. There was diffuse interstitial edema and focal infiltrates with lymphocytes, histiocytes, rare plasma cells, neutrophils and eosinophils. Multiple non-caseating granulomas mostly consisting of lymphocytes and epithelioid histiocytes were present. There was very mild tubulitis with rare lymphocytes in the tubular epithelium. Many tubules had a dilated lumen, flattened epithelium and loss of brush border. Some had fine, isometric vacuolization of the cytoplasm. Rare lumina contained finely granular, mostly eosinophilic and very rare brownish casts only partially positive for hemoglobin in a few tubules. Some peritubular capillaries contained mononuclear cells, but no erythrocyte aggregation. There was mild arteriolar hyalinosis and arteriosclerosis, but no thrombi or vasculitis. Immunhistochemistry showed only trace IgM, Kappa and Lambda in the mesangium. IgG, IgA, C3 and C1q were negative in the glomeruli. Electron microscopy revealed myelin figures in the cytoplasm of a few parietal epithelia. No definite viral particles were detected.
+The biopsy was consistent with granulomatous tubulointerstitial nephritis, acute tubular injury and regeneration. There was no evidence of renal thrombotic microangiopathy, collapsing glomerulopathy or vasculitis.
+Mycobacterium tuberculosis infection as excluded and confirmed by negative cultures of urine and tracheal secretions. Serology for Sjogren’s Syndrome was negative. Sarcoidosis was considered clinically unlikely, despite thoracic lymphadenopathy which was interpreted as consistent with severe SARS Cov2 pneumonia. The ionized calcium levels were normal or low during the ICU stay. Angiotensin converting enzyme and Interleukin-2 levels were however not measured. The biopsy findings could not explain the proteinuria, which was interpreted as a consequence of kidney injury and profound inflammation associated with SARS Cov2 infection.
+Given that a medication reaction was a potential cause for kidney biopsy findings as well as for the rash and the hemolysis, a multidisciplinary decision was taken to stop ß-lactams, amiodarone and pantoprazole and to begin methylprednisolone 60 mg daily on day 37 . 47 days after admission urine output began to improve and CVVHDF was discontinued. The hemolysis resolved, the skin rash improved.
+On transfer to neurorehabilitation 48 days after admission, the patient was tetraparetic due to critical illness polyneuropathy but alert and able to follow simple commands, he had tracheostomy in place and was breathing spontaneously with little support. The course of rehabilitation showed progressive improvement of kidney function . The estimated GFR two months post-discharge was 43 ml/min/1,73 m2 suggesting a likely transition to chronic kidney disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1043_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1043_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2cfc6fc596c977d5a5b159b4b96e4e7b7eb547bf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1043_en.txt
@@ -0,0 +1,12 @@
+A 73-year-old Caucasian woman with a medical history significant only for hypertension, presented to our emergency department complaining of intermittent subjective fever, anorexia, weakness, and fatigue for 2 weeks. Her subjective fevers were occurring almost nightly, and she had associated night sweats. Her weight was stable. She had a persistent non-productive cough. There was no sore throat or rashes. Her review of systems was negative for any other current symptoms. Her only medication was enalapril. Her family history was non-contributory.
+She had been previously assessed by her family doctor for the same symptoms 2 weeks prior to this presentation. Routine investigations were unrevealing. At that time, she had left knee pain that developed after a hike the previous month. X-rays of her knee and femur were unremarkable. Her pain resolved within a week. No therapeutic interventions were undertaken at that time.
+She had no sick contacts, no sexual partners, and no insect or tick bites. She had no known exposure to tuberculosis. She travelled to the Channel Islands 3 months before presentation. She had no animal exposures. She denied any history of injection drug use.
+On initial examination, she appeared non-toxic. Her vital signs included a temperature of 38.6 °C, a heart rate of 96 beats/minute, blood pressure of 130/65 mmHg, and oxygen saturation of 99% on room air. There were no rashes and no lymphadenopathy was present. There were no signs of hyperthyroidism and the thyroid itself was normal in size without any nodules. Her jugular venous pulse was 2 cm above the sternal angle. She had normal heart sounds with no extra sounds or murmurs. There were no stigmata of endocarditis. Her lungs were clear with equal breath sounds bilaterally. An abdominal examination revealed a soft and non-tender abdomen. There was no hepatosplenomegaly, jaundice, or asterixis. Examination of her knees did not reveal any redness, warmth, effusions, or pain. A screening neurologic examination demonstrated grossly normal cranial nerves, full strength bilaterally, and normal reflexes, tone, and coordination. She was admitted for further investigation for her fever of unclear cause. Empiric piperacillin-tazobactam and intravenously administered saline were started on admission as acute bacterial infection was in the differential diagnosis.
+Table displays the results of her laboratory investigations. A peripheral smear was unremarkable. Serum free light chains were normal. No monoclone was found on serum protein electrophoresis. Urine analysis was bland. Five sets of blood cultures, a urine culture, and Lyme serology were negative. A chest X-ray was normal. Computed tomography (CT) scans of her head, neck, chest, abdomen, and pelvis were all unremarkable. A transthoracic echocardiogram revealed a normal heart with no vegetations.
+She had one further temperature of 39.4 °C while in hospital, without any clear infectious source. Once the blood cultures were known to be negative, piperacillin-tazobactam was stopped. There was an impression that her workup could be continued on an out-patient basis as immediately life-threatening causes of fever had been ruled out. She was discharged home after an 8-day admission in hospital with plan for out-patient follow up.
+She was seen 1 month after discharge. She had no improvement in her symptoms and noted a recurrence of her left leg pain. Her C-reactive protein (CRP) was 207 mg/L. On examination, she had a large, warm, left thigh mass. An urgent ultrasound revealed a 4.5 × 6.8 × 11.6 cm spindle-shaped, well-defined soft tissue mass with internal vascularity . Magnetic resonance imaging (MRI) found that the mass met the femur but was not invading . An initial biopsy revealed a poorly differentiated malignant neoplasm.
+She underwent a distal femur excision with distal Global Modular Replacement System (GMRS) reconstruction. Final pathology revealed a grade 3, pT2bN0M0 undifferentiated sarcoma with epithelioid morphology. She had no nodal involvement or distant metastases at this time. Her CRP fell to 28.42 mg/L within 8 days of surgical excision. She recovered well from her surgery with resolution of her constitutional symptoms. She subsequently was planned to receive radiation therapy.
+Prior to receiving radiation therapy, a follow-up CT scan was done a couple months after her surgery. This revealed the presence of a new 4 mm pulmonary nodule in the lower lobe of her left lung that was not felt to be a metastasis. There was no other evidence of distant metastases. Given these results, adjuvant radiation treatment was begun. She received 6600 cGy given in 33 fractions to her leg.
+Roughly 1 month following the end of her radiation therapy course, she re-presented to our emergency room with painless hematuria and a month-long history of non-productive cough associated with decreased energy. CT scans of her chest revealed 16 pulmonary masses, measuring up to 6.2 cm. A CT scan of her abdomen and pelvis revealed a solitary nonobstructive renal calculus, as well as a new 3.2 × 6.5 cm pelvic mass.
+She was subsequently referred to radiation and medical oncology where a shared decision was made to pursue palliative management.
+Figure provides a timeline of the above described case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1044_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1044_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4aaffd7af28bd20d27d7b934bd349b3568dc553b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1044_en.txt
@@ -0,0 +1,4 @@
+The patient was a 37-year-old male from a non-consanguineous Chinese family. Since the age of 35, he had experienced progressive weakness of his hands and a reduction of grip strength, especially in his right hand. Six months later, muscle atrophy and muscle fibrillation were noticed in his hands, and he was unable to hold things or to write. One year later, he experienced weakness in his lower extremities with no sensory disturbance. He currently experiences difficulty in climbing the stairs and standing up from a squatting position, is unable to lift his foot upward, and trips over easily. Physical examination revealed that the cranial nerves were normal, and that orolingual fasciculations and atrophy were absent. The neck flexion strength was 5 (MRC muscle scale, grades 0–5). The muscle strength of both sides of the body was as follows: triceps and biceps 3/3, forearm flexors 2/2, intrinsic hand muscles 1/1, iliopsoas muscles 4/4, quadriceps muscles 3/3, tibialis anterior and gastrocnemius muscles 2/2. Deep tendon reflexes were absent. There was no sensory abnormality or coordination difficulty of any of the limbs. Atrophy was seen in most of the muscles, especially the interosseous muscles of the hands, bilateral gastrocnemius and anterior tibial muscles . Muscle fibrillation was observed in the biceps and quadriceps muscles.
+The patient’s serum level of creatine kinase was 668 U/L (normal range, 50–310 U/L). Extractable nuclear antigens were negative, and serum sex hormone levels were normal. Peripheral neuropathy antibodies such as GM1-antibody and GQ1b-antibody were also negative, and there was no albuminocytological dissociation of his cerebrospinal fluid. The nerve conduction velocity revealed severe reduction in compound muscle action potential (CMAP) amplitudes and motor conduction velocities in bilateral median nerves, ulnar nerves, and radial nerves, while the sensory conduction was normal (Additional file A and B). Right ulnar nerve F-waves were absent. Chronic denervation/reinnervation (e.g., motor unit action potentials of increased amplitude and duration, with reduced inference patterns) was observed in three regions on the electromyogram (EMG), including the bilateral extremities and sternocleidomastoid muscles (Additional file C, D and E). And spontaneous activity (positive sharp waves) was recorded from these muscles. Echocardiography and electrocardiogram evaluations did not detect any cardiac abnormalities. Lower limb muscle MRI showed marked involvement of the gastrocnemius muscle at the calf level. There was a strongly increased signal intensity in turbo inversion recovery magnitude (TIRM) sequences, indicating muscular edema. A mild increase in the signal intensity of soleus and tibialis anterior muscles was observed in the T2 sequence, indicating fat replacement . At the proximal leg level, slight fatty degeneration was detected in the posterior compartment, such as the semimembranosus and semitendinosus muscles .
+After providing written consent, a skeletal muscle biopsy was taken from the patient’s gastrocnemius muscle, precooled with isopentane, and frozen in liquid nitrogen. Frozen sections of 8 μm were then prepared and examined by light microscopy. A marked variation in fiber size was observed, with many angular atrophic fibers. Some fibers also showed structural changes with abnormal material deposits after staining with hematoxylin–eosin . On Gomori trichrome-stained sections, these abnormal deposits appeared as purple inclusions. They varied in size, shape, and thickness, and were either single or multiple . In the NADH-tetrazolium reductase reaction, oxidative activity was reduced in fibrous areas occupied by the inclusions, showing core-like lesions . Neurogenic changes, such as the grouping of angular atrophic fibers, were also present. Immunohistochemical analysis showed prominent FLNC immunoreactive deposits accumulating at subsarcolemmal and sarcoplasmic levels . Electron microscopy of the available transverse sections showed an inordinate myofibrillar structure and dissolved myofilaments. Subsarcolemmal accumulations of lipofuscin were also present .
+Next-generation sequencing identified a heterozygous missense mutation (c.7123G > A, p.V2375I) in the Ig-like domain 21 of FLNC . Confirmation of the variant was undertaken by Sanger sequencing using an ABI 3730XL DNA Sequencer (Applied Biosystems, Thermo Fisher Scientific, USA). The mutation was absent in the DNA of 100 healthy unrelated controls, and the allele frequency in the Asian population is zero according to the Exome Aggregation Consortium . The p.V2375I missense mutation affects valine at position 2375, which is highly conserved from mice to humans . To exclude other hereditary diseases similar to LMN disease, we also tested for mutations in the genes disrupted in SMAs and the androgen receptor gene, but none were found. Since the patient had no immediate family members and loses contact with other family members, further co-segregation analyses among the family cannot be conducted.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_104_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_104_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4728f95d7aeffc4162e8f0c04a9835d494017b15
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_104_en.txt
@@ -0,0 +1,4 @@
+A 79-year-old woman presented with recurrent cough and hemoptysis. A computed tomography (CT) and laboratory studies indicated bronchiectasis in the lower lobe of the left lung associated with allergic bronchopulmonary mycosis. One month later, a sudden and massive hemoptysis prompted an emergency fiberoptic bronchoscopy (FOB), which exhibited substantial bleeding in the left lung and its aspiration into the right lung. A single-lumen endotracheal tube was immediately placed in the right main bronchus to isolate the right lung, followed by mechanical one lung ventilation (OLV). We had to choose a single-lumen tube in the endoscopy room unequipped for emergency airway management. An emergency computed-tomography angiography (CTA) revealed a bulged left bronchial artery, urging BAE. The common trunk of bronchial arteries arose from the thoracic aorta , complicating selective advancement of an embolization catheter. The BAE failed to achieve satisfactory hemostasis. During BAE, oxygenation worsened down to SpO2 40%. A shift to bilateral mechanical ventilation provided a slight amelioration in blood gas analysis at FiO2 0.35; pH 7.37, PaCO2, 35.5 mmHg, PaO2 104 mmHg, HCO3− 20.2 mmol/l, and BE − 4.5 mmol/l. However, we were afraid that severely decreased lung compliance produced by persistent blood afflux in both lungs would hamper sufficient and protective mechanical ventilation. We, thereby, decided to install VV-ECMO using a poly-2-methoxyethylacrylate (PMEA)-coated circuit (Capiox®, TERUMO, Japan) withholding the use of anticoagulants with the setting of pump speed 1500 rpm, pump flow 2 L/min, O2 flow, 2 L/min. The coagulation system examinations following the installation of ECMO were activated partial thromboplastin time (APTT) 40 s and serum fibrinogen 158 mg/dl.
+Following 2 days, no apparent active bleeding observed let us confine only to performing FOBs for bronchial cleaning, hoping for spontaneous hemostasis. The finding and lowering extracorporeal membrane oxygenation (ECMO) support (FiO2 1.0 to 0.5) suggested possible withdrawal from VV-ECMO despite chest X-rays manifesting atelectasis in the whole left lung . On day 3, however, an FOB found active rebleeding in the lateral and posterior basal bronchi, where thrombin solution was instilled. The single-lumen tube was replaced by a 35-Fr left-sided double-lumen endobronchial tube through which only the right lung was ventilated and the left lung was kept pressurized at a constant airway pressure 10 cmH2O with 100% O2, intending astriction. Notwithstanding the efforts, we thought such conservative means were only palliative and a radical surgical measure should be adopted. In the meantime, ECMO weaning trials were carried out in accordance with the Extracorporeal Life Support Organization guideline , indicating possible weaning. The ECMO was, however, kept operated at the minimal setting, pump speed 1250 rpm, pump flow 1.5 L/min, O2 flow 0.5 L/min, in preparation for surgery-associated worsening of gas exchange and unexpected hemorrhage. Preoperative total amounts of blood products transfused were fresh frozen plasma (FFP) 6 units, packed red cells (PRC) 6 units and platelets 10 units. The preoperative APTT was 42 s and serum fibrinogen 173 mg/dl.
+On day 4, resection of the left lower lung lobe was scheduled under inhalational anesthesia with sevoflurane while the patient was on ECMO. We were concerned about unstable depth of intravenous anesthesia produced by abrupt changes in hemodynamics and circulation volume. Depth of anesthesia was closely monitored with the bispectral index (BIS®, Medtronic, USA). The VV-ECMO remained well-controlled during the surgery without major cardiovascular or respiratory events. The surgery achieved considerable hemostasis, with the operation duration 3 h 51 min and intraoperative bleeding volume 863 ml. She was transfused with FFP 8 units, PRC 10 units, and platelets 20 units. Postoperative chest X-ray showed good aeration in the resting left upper lung . Bilateral mechanical ventilation presented a marked improvement in gas exchange. However, VV-ECMO still remained operated in the postoperative ICU at the minimal setting since unstable hemodynamics and slowly progressing anemia were sustained.
+On day 5, the patient developed a hematoma in the left thoracic wall. An exploratory thoracotomy was performed, achieving hemostasis. Intraoperative bleeding of 2500 ml was compensated by transfusions of FFP 18 units, PRC 12 units and platelets 20 units. Serum fibrinogen was below 100 mg/dl preoperatively but recovered to 132 mg/dl after surgery. For inspection of intravascular emboli formed possibly after prolonged anticoagulation-free ECMO, a postoperative CTA was performed and found, instead, extravasation of contrast medium from intercostal arteries. Transcatheter arterial embolization (TAE) provided a dramatic hemodynamic stability, enabling weaning from VV-ECMO on the same day. Eventually, VV-ECMO was kept operated without anticoagulation for as long as 5 days. On day 6, a CTA detected floating thrombi in the inferior vena cava and bilateral popliteal veins, which required a continuous heparin administration. She was extubated on day 8 and transferred to a general ward on day 9. She was discharge uneventfully from the hospital on day 53.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1066_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1066_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e8297418f86137401b42b40f992e7e9c95fb7cf4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1066_en.txt
@@ -0,0 +1,7 @@
+We report the case of a 37-year-old man with a 6-month history of headaches and blurred vision. Our patient had been followed by an otorhinolaryngologist for 2 years for cervical lymphadenopathy and a right submandibular swelling. The cervical lymphadenopathy biopsy was non-diagnostic twice, showing a non-specific inflammatory disease. He had no other medical background and no personal or familiar history of an autoimmune disease.
+On examination, he had significant swelling of the right hemi face and the neck with trismus and a decrease in the visual acuity of the right eye. The dilated fundus examination showed a right papillary paleness.
+Peripheral blood markers of inflammation were elevated. Screening for immunodeficiency and mycobacterial infections was negative.
+Cerebral MRI showed a pseudotumoral lesion developing in the right pterygoid-palatine fossa spreading to the orbital and the intracranial cavity through the superior orbital fissure. The intracranial portion forms a temporal extra-axial mass mimicking a meningioma that infiltrates the lateral wall of the cavernous sinus. The lesion was strongly enhanced after the injection of gadolinium . CT scans of the chest, abdomen, and pelvis were normal.
+The patient was operated through a pterional approach. Our first strategy was a gross total resection of the intracranial portion of the tumor. Regarding its very firm consistency, we opted for a large biopsy of the extra-axial lesion. The tumor was solid, well-delineated, and strongly adherent to the temporal lobe.
+Histological examination showed dense lymphoidplasmacytic infiltrate with storiform fibrosis [ and ]. Immunohistochemical staining revealed an increased number of IgG4-positive plasma cells . The inflammation is often focal, predominantly in a perivascular location.
+Our patient received high doses of corticosteroids (0.6 mg/kg/day) followed by progressive tapering. His neurological manifestations gradually improved and resolved after 2 months. A cerebral MRI was done 1 month after a well-conducted treatment and showed a reduction of the tumor’s size .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1099_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1099_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1a0d34935fdc89194fb2f98d40ae2e2f1c79fed0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1099_en.txt
@@ -0,0 +1,7 @@
+A 42-year-old female was seen in the emergency department with three days of severe abdominal pain and sepsis. Medical history included menometrorrhagia due to uterine fibroids and previous endometrial ablation in 2015. She used a contraceptive vaginal ring for three months prior and Provera for 2 days prior to presentation for persistent vaginal bleeding. Physical examination revealed the following vital signs: temperature 39.2°C; blood pressure 136/78 mmHg, pulse 132 beats/min, and respiratory rate 16 breaths/min. Oxygen saturation was 100% on room air. Physical exam revealed tenderness throughout the lower abdomen with voluntary guarding. Labarotory data revealed WBC of 12,000/µL, Hgb of 7.8 gm/dL and Hct of 25.7, sodium of 127 mmol/L, and chloride of 96 mmol/L. Lactate was normal at 1.5 mmol/L. Initial CT scan showed uterine masses, consistent with known fibroids, and minimal pelvic fluid .
+She was initially admitted to the medical service for sepsis. Given her lower abdominal pain, Gynecology was consulted for presumed pelvic inflammatory disease (PID). She was started on empiric antibiotics for PID (ceftriaxone IV 1 g every 24 hours, azithromycin IV 500 mg every 24 hours, and metronidazole IV 500 mg every 8 hours). Blood, urine, and stool cultures were sent upon admission, all of which were negative.
+Her pain continued to progress with rising leukocytosis to 20,000/µL. A repeat CT scan on hospital day four showed interval development of ascites . Surgical consultation was obtained, and she was found to have an acute abdomen. She was taken for a diagnostic laparoscopy, which revealed a dense fibrinous exudate and significant ascites in all four quadrants of the abdomen . Multiple peritoneal biopsies were taken, and peritoneal fluid was sent for gram stain, cultures, and cytology.
+Postoperatively, carcinoembryonic antigen (CEA) and CA-125 levels were obtained. CEA was within the normal range, and CA-125 was mildly elevated at 56.8 U/mL (normal 0–35.0 U/mL). Her WBC fluctuated between 15,000 and 25,000/µL. The peritoneal fluid gram stain did not reveal any bacteria. Cytology revealed rare mesothelial cells and abundant neutrophils but no malignant cells. Final pathology report stated the presence of benign fibromembranous tissue with severe acute inflammation and extensive necrosis, consistent with “severe necrotizing acute peritonitis.”
+Given the extensive inflammatory reaction, infectious disease was consulted. Group A Strep (GAS) peritonitis was suspected, and recommendations were made to continue ceftriaxone at 1 g IV every 24 hours in addition to one dose of clindamycin 600 mg IV. Azithromycin was added to ceftriaxone three days later (IV 500 mg every 24 hours). A streptolysin O antibody (ASO) titer was sent but came back normal at 61 I U/mL (normal range 0–330 IU/mL), arguing against GAS peritonitis. Ceftriaxone was stopped, and azithromycin was transitioned to oral 500 mg daily.
+She continued to have persistent abdominal pain and anorexia. A repeat CT scan obtained nine days after surgery showed peritoneal enhancement and several fluid collections. A diagnostic paracentesis was performed, and the peritoneal fluid was sent to an outside institution for 16S ribosome analysis, to isolate bacterial RNA.
+Her abdominal pain and leukocytosis slowly improved. She continued to have severe anorexia and food aversion, despite reassuring physical exam findings. On hospital day 23, she was discharged home on oral azithromycin. Several days after discharge, 16S ribosome testing revealed Mycoplasma hominis RNA within the peritoneal fluid. Her outpatient antibiotic was changed to oral doxycycline 100 mg twice daily for three months. She was closely followed as an outpatient and gradually demonstrated clinical improvement. She remains well ten months after hospitalization.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1139_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1139_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9f6e5750c5297158f379fc0f63944e01ae2337e3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1139_en.txt
@@ -0,0 +1,2 @@
+An 86-year-old male came to our attention seeking medical treatment for a growing lesion of the lower lip. The patient previously treated the lesion with topical antibiotics and steroids, with no improvement in the condition. The lesion was exophytic and with a warty appearance . Suspecting an SCC, the surgeon performed an excisional biopsy on the lesion. . A total body computerized tomography and an echography of neck and mandibular nodes were performed before surgery, showing no presence of suspect secondarisms.
+The histopathological examination confirmed the diagnosis of SCC, describing a histologically well-differentiated lesion. HPV typization of the lesion showed positivity for HPV 16 after a conventional polymerase chain reaction assay. The margins of the lesions were not microscopically clear. Considering the patient’s old age and the unwillingness to undergo another surgical procedure, the patient, one month after surgery, was sent to the Dermatological Unit of Magna Graecia University, Catanzaro, for examination . The patient was there treated with topical 5% imiquimod (Aldara, Meda Pharma S.p.A, Milan, Italy) application on the affected area once a day for two weeks, then once a week. The patient performed another total body computerized tomography one and a half years after surgery due to the follow-up of internal malignancy. No signs of SCC-related manifestations were assessed. Two years after the initial surgical procedure, the patient has not developed any sign of systemic or local relapse of the condition .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1141_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1141_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c17c4355b3c4cc97a007f70cf1b09102d5e810b9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1141_en.txt
@@ -0,0 +1,4 @@
+A 47-year-old Japanese woman, gravida 2, para 0, was referred to our institution for abnormal uterine bleeding. She had an extensive past medical history which included SLE, anti-phospholipid antibody syndrome (APS), idiopathic thrombocytopenic purpura (ITP), as well as previous dissecting right vertebral artery aneurysm and left cerebellar infarction. Her body mass index (BMI) was 18.1. Workup revealed severe anemia requiring an 8-unit red cell transfusion, and subsequent to gynecological examination, endometrial sampling cytology with conventional biopsy revealed Grade 1 endometrioid adenocarcinoma; serum tumor markers were obtained for evaluation and anticipated ongoing management of endometrial cancer; CA-125, CA19-9, and CEA levels were 176 U/mL, 27U/mL, and 1.8 ng/mL, respectively. Given her intravascular hypercoagulability due to ITP, we administered continuous heparin along with methylprednisolone (mPSL) pulse therapy to bring her hematology profile within an acceptable range of tolerability for surgery. The patient’s laboratory results and serologies are summarized in Table . Her medications included prednisolone 20 mg twice a day, candesartan 8 mg daily, amlodipine 5 mg daily, rabeprazole sodium 3 g daily, and 600 μg subcutaneous teriparatide daily.
+Magnetic resonance imaging (MRI) studies revealed cancer invasion into the uterine myometrium . On computed tomography (CT) imaging, abnormal masses involving a large segment of multiple encapsulated lymphadenopathies and measuring up to 6 cm were present both in pelvic and para-aortic lymph nodes , strongly suggesting retroperitoneal metastases from endometrial cancer. However, positron emission tomography-computed tomography (PET-CT) imaging showed only slightly abnormal FDG uptake in the lymph nodes (Standardized uptake value (SUV)-Max = 2.1) in comparison with high FDG uptake in the uterus (SUV-Max = 19.1). Eventually, total hysterectomy and bilateral salpingo-oophorectomy was performed for primary staging, avoiding lymph node dissection due to ongoing ITP-related thrombocytopenia.
+On the basis of preoperative findings, we initially diagnosed the patient as International Federation of Gynecology and Obstetrics stage IIIC2 uterine endometrial cancer, with 70 % myometrial invasion, lymphovascular invasion, and metastasis to the pelvic and para-aortic lymph nodes. The patient subsequently underwent adjuvant chemotherapy with paclitaxel (175 mg/m2) and carboplatin (area under the curve, 6). However, no change in size of lymphadenopathy was observed after 3 cycles of chemotherapy. As her overall condition improved, with platelets stabilizing at >80,000/μL, and the patient wishing to avoid radiation therapy due to the considerable complications, we then performed dissection of retroperitoneal (pelvic and para-aortic) lymph nodes. On gross exam, we found well-circumscribed lymph node masses growing along the lymph vessels , which were systematically dissected , and found to have no metastatic involvement or cured remnants of metastatic disease (0 out of 100 lymph nodes), although there was an option to perform intraoperative diagnosis using frozen sections if necessary. Final pathological diagnosis was consistent with LAM arising from the retroperitoneal lymph nodes.
+Microscopically, masses was composed of neoplastic smooth muscle leiomyoma-like tumor cells with clear to eosinophillic cytoplasm arranged in alveolar pattern without necrosis , and slit-like vascular channels lined by endothelial cells . Lymph node tumors were focally positive for smooth muscle actin (SMA), caldesmon, Melan A, HMB-45, and estrogen receptor (ER), characteristics suggestive of LAM . Interestingly, re-examination of uterine tissue from the primary operation revealed that regional LAM tissue was co-localized with endometrial cancer with similarly arranged alveolar structure . Unlike normal myometrium smooth muscle cells, immunostaining of smooth muscle cells for HMB-45 and Melan A was positive in the LAM lesions. Moreover, we found that LAM cells had locally invaded into the lymphatic vessels of the myometrium. Taken together, our findings presented herein suggest that LAM initially occurred in uterine smooth muscle, subsequently invading the retroperitoneal lymph nodes by ascending via a lymphogenous route. The patient is currently asymptomatic after the final diagnoses of LAM and endometrial cancer (stage IB), with no evidence of recurrence or metastasis to date. No recurrent enlargement of lymph nodes or pulmonary LAM has been observed on repeat CT imaging. However, she is currently maintained on low dose warfarin therapy for SLE-related intravascular hypercoagulability. Long-term follow-up by both internal medicine and gynecological healthcare providers will continue to be important to correctly diagnose LAM and/or cancer-related diseases.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1155_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1155_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..75d266d68b9ba5352b003508e91e9da91b34437d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1155_en.txt
@@ -0,0 +1,6 @@
+A 9-year-old boy was admitted to the paediatric department because of an ongoing headache that had been getting worse in the weeks preceding the hospitalisation.
+The headache was the main symptom, it was ongoing and had been getting worse in the past weeks. The headache started eight months prior to the visit with a frequency of one per month, then escalated to one per week and has been present every day in the last week. He described it as a dull non-spreading pain above the right eyebrow, with an intensity of 5/10. The episodes lasted five to 15 min and usually disappeared after a short rest. He had no need for analgesics. Several times, he was also woken up during the night by the headaches and vomiting. He denied any history of nausea, flashing of light or scotoma.
+The boy had no history of other illness except middle ear inflammation at the age of 9 months and took no medications. He had no known allergies.
+At the admission, the physical examination was within normal limits, as was the neurological examination. The dilated fundus examination showed bilateral papilledema, indicating raised intracranial pressure.
+Laboratory examinations were within the normal range. The haemostasis was normal, as was the blood count and the biochemistry test. The routine laboratory results were normal.
+The MRI substantiated the diagnosis by showing hypointensive modality in the right part of the mesencephalic tectum, which was highly suspectful for a tectal low-grade astrocytoma. It was completely obstructing aqueduct of Sylvius, causing extensive supratentorial hydrocephalus with some reliable findings, such as enlarged third ventricle that was bulging into the sella turcica. Additionally, the periventricular hyperintensive area, effacement of cortical sulci, dilatation of lateral ventricles and intracranial hypertension with important narrowing of transverse sinuses were observed . There were no signs of a hyperdynamic CSF circulation on the MRI at the level of the aqueduct, suggesting a complete flow blockade by the tumour.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1181_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1181_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..366b93d09ccff7dfa646ead9180cea6f2c745dff
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1181_en.txt
@@ -0,0 +1,7 @@
+A 37-year-old woman with a history of chronic back pain and sciatica presented to our teaching hospital at 36.5 weeks' gestation in early labor. At the time of presentation, she was noted to have acute onset of mild-range elevated blood pressures (140s-150s/90s) with a urine protein-to-creatinine ratio of 0.37, consistent with a diagnosis of preeclampsia. Six hours after admission, her blood pressures progressed to severe-range, with a maximum of 195/105. Per protocol, she was given IV labetalol and MgSO4 for preeclampsia with severe features. Shortly thereafter, the patient retrospectively reported that she began to have mid-back pain along with numbness, tingling, and weakness in her right lower extremity, but she did not report these symptoms initially to her healthcare team, as she was more concerned about her pelvic pain with contractions. Approximately 3 hours after the onset of her neurological symptoms, a labor epidural was administered to help control her contraction pain and blood pressures. The epidural catheter was placed uneventfully at L3-L4 with the tip threaded to the maximum height of T11. As the epidural was being placed, the patient then reported to the anesthesiologist that she had been feeling weak. The patient was noted to appear lethargic on exam, but she was able to sit up with minimal assistance for her labor epidural. Therefore, her weakness was attributed to labor. She progressed to complete cervical dilation and had a vaginal delivery with vacuum assistance due to a 5-minute prolonged deceleration on FHT.
+The patient continued to complain of leg weakness after delivery. At 14 hours postpartum, the nurse encouraged the patient to attempt ambulation. However, even with her best efforts, the patient was unable to move her body from a distinct line below her breasts down to her toes. She also noticed numbness, burning, and electrical sensations to light touch from that line down to her toes. At this time the resident team was notified, and a Foley catheter was inserted. There was low suspicion for magnesium toxicity as she had intact reflexes with no complaints of shortness of breath, and her magnesium level was 5.9. She still had mild-range elevated blood pressures at the time, and she remained on IV magnesium for 24 hours postpartum.
+A stat CT scan of the head without contrast resulted in normal findings with no evidence of stroke. MRI of the spine showed a fluid sac suggestive of epidural blood, measuring 3.5 cm in the craniocaudal plane and 0.4 cm in the anteroposterior plane. There was also a mild-to-moderate degree of spinal stenosis at T5-T6 due to extrinsic mass effect of the epidural hemorrhage but no direct spinal cord compression . The patient was immediately started on IV dexamethasone 4 mg q6h. Upon evaluation by neurosurgery, the patient was not considered to be a surgical candidate because the MRI showed no clear evidence of spinal cord hemorrhage or spinal cord compression.
+On the morning of postpartum day #1, the patient remained with paresthesia in her lower extremities and flaccid paralysis from the waist down, but she was able to wiggle her toes. Her blood pressures were predominately normal (120-140/80-90) with a few mild-range elevated blood pressures. Per protocol, she was kept on IV magnesium for seizure prophylaxis until she was 24 hours postpartum. Diffusion-weighted imaging of the spine later that day showed an epidural lesion with a hemosiderin ring that had decreased in size to 2-3 mm in maximal depth, suggestive of a resolving epidural hematoma when compared to the most recent MRI .
+On postpartum day #2, the patient was started on PO nifedipine XL 30 mg daily to consistently maintain her blood pressures within normal range. Her mobility improved with demonstrated flexion and extension at the hips bilaterally, in addition to return of normal sensation in her lower extremities.
+The patient's movements and sensation continued to improve day by day while she was kept on IV dexamethasone and PO nifedipine. By postpartum day #4, the patient was ambulating with a walker and had good bladder and bowel control. On postpartum day #6, the patient was ambulating without assistance and reported complete resolution of her pain in the back and lower extremities. She was discharged home in stable condition.
+A follow-up MRI 6 weeks later showed complete resolution of the spinal epidural hematoma . At the time, she was still ambulating independently and had full control of her bladder and bowel function.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1220_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1220_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6dc018a47fbcbbeb2fb5f3f3e3803383271c90aa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1220_en.txt
@@ -0,0 +1,4 @@
+A 12-year-old boy complained headache for 6 months. MRI revealed a D-shaped mass adjacent to the superior sagittal sinus and falx in the right parietal lobe. The mass was well-circumscribed and dura-based, with a size of 15 × 27 × 22 mm. No necrosis, cysts or hemorrhage was found. MRI also showed isointense with cortex on the T1-weighted imaging and hyperintense on the T2WI sequence, lightly hyperintense on the T2-Flair weighted imaging, but MRI enhanced homogeneously and intensely after intravenous administration of the contrast with gadolinium . The gray matter next to the central gyrus was buckled. Dural tail sign was observed, suggesting a meningioma “en plaque”, but peritumoral edema was indistinct. Computerized tomography perfusion imaging further showed prolonged time to peak and mean transit time, as well as increased relative cerebral blood volume and flow.
+Simpson grade II gross total resection was performed in a right decubitus position. Through a craniotomy of 5.5 × 6.5 cm, we found his dural arteries and veins enlarged abnormally, while the bone flap had no signs of invasion . The tumor was close to the centerline, its anterior edge adhered to the right vein of Trolard, and the right wall of the superior sagittal sinus and falx was invaded. The central sulcus in close to the tumor was located by the somatosensory evoked potential with cortical electrode on the cortex surface, and the epilepsy wave detected by the electroencephalogram was not found during the operation. The lobulated tumor with the size of 3 × 2.5 cm had a clear boundary with many nodules on the surface and adhered to the normal brain tissue, without full arachnoid membrane between the tumor and the brain. The strata externum of the sagittal sinus and falx was removed, and the inner of the sinus was kept intact. The bone flap was returned to the patient. No neurological adverse events occurred during the follow-up.
+KF-PRO serial scanner was used, and pathological assessment was performed using K-Viewer software. Pathologically, the tumor cells manifested nested, sheet-like or whorled aggregates of spindle to epithelioid cells prominently with indistinct cell borders. Mitotic count was less than 1 per 10 high-power fields. Focally, rhabdoid cells were identified, accounting for 10% of the tumor . Rhabdoid morphology was characterized by incomplete differentiation and intercellular adhesion, not accompanied by paranuclear inclusion body. Atypical features including brain invasion, hypercellularity, small cell formation, macronucleoli, sheeting architecture and spontaneous necrosis, were not identified in this tumor. Therefore, the patient was diagnosed as WHO grade I meningioma with focal rhabdoid features. The tumor cells showed diffuse and strong EMA and SSTR2 immunoreactivity. Immunohistochemistry for CD34, S100, STAT6, CK and SOX10 were negative in all tumor cells. Most tumor cells showed diffuse expression for SMARCB1/INI-1. The Ki-67 index was less than 1%.
+To determine molecular features and seek potential treatments, a next-generation sequencing-based gene panel (Simceredx, Nanjing, China) was used for genomic profiling in primary tumor tissue and matched blood. Except for a novel MAML2-YAP1 fusion break point (5’ MAML2 exon 1 fused to 3’ YAP1 exons 7–9) identified , no other mutations like single nucleotide polymorphism, InDel and copy number variations were detected.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1222_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1222_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..586d2bb385189bf1dd4aa67b28034f3cf32fb6bf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1222_en.txt
@@ -0,0 +1,5 @@
+A 52-year-old, right-handed, previously healthy woman presented to our hospital for unprovoked numbness and worsening impairment of sensibility at the level of her right thumb, index, middle finger, and radial half of her ring finger. She also complained of impairment in everyday activities due to worsening weakness of her opponens pollicis muscle. Only slight improvement in her symptoms was reported during the past 12 months despite splinting the hand using a wrist brace, undergoing physiotherapy, and taking high doses of non-steroidal anti-inflammatory drugs (NSAIDs) and Gabapentin. The patient reported a chronic history of repetitive movements of the fingers and wrists with chronic pressure points on the right wrist.
+On examination, the affected hand revealed no swelling or local heat. Atrophy of the thenar muscle and hypoesthesia in the distribution of the median nerve were noted. Both Phalen’s test and Tinel’s sign were positive on the right side with no restriction in the range of motion of wrist and fingers. Nerve electrodiagnostic testing suggested right median nerve compression at the level of the right carpal tunnel. An initial plain radiograph of the right wrist showed an oval radio-opacity on the volar side of the wrist joint facing the carpal bones .
+A confirmatory magnetic resonance imaging (MRI) of the right hand and wrist showed a solitary oval calcification (low-intensity lesion both in T1WI and T2WI) measuring 2 × 0.8 × 0.6 cm (cm), located in the carpal tunnel centrally between the flexor tendons of the wrist, at the lunatum-capitatum junction, without surrounding adherence (the boundary between the lesion and the surrounding tissues was clear) . The lesion is also surrounded by a reactive fluid collection . The MRI also showed subtle tenosynovitis of the flexor’s tendon sheaths, with mild compression of the median nerve . The patient’s full blood count, vitamin D, calcium, phosphate, electrolytes, uric acid, urea, creatinine, and alkaline phosphatase were within normal range. Other laboratory data including an endocrine and rheumatology panel were also normal. Subsequently, the patient was diagnosed with CTS secondary to a localized calcareous mass.
+Given that conservative treatment was ineffective, the patient’s condition was managed by open incisional carpal tunnel release. An incision of approximately 4 cm was performed on the volar side of the right wrist facing the third metacarpal bone . The palmar aponeurosis was then dissected, and the flexor retinaculum was located and transected. The white calcareous tumor was lying over the carpal bones of the osteofibrous canal, and it was only visualized after retracting the median nerve. A 2.1 by 1.0 cm mass was easily removed with no adhesion to surrounding tissues. Histological sections showed calcified deposits encased in a fibrocartilaginous tissue with inflammatory infiltrates composed of giant cell granulomas. These findings supported the diagnosis of tumoral calcinosis [, ].
+During her follow up, three months following the surgery, no clinical or radio-graphical signs of recurrence were noted and the patient reported complete resolution of her symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1223_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1223_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bbcafefcb5a5bc94ac0105a6ee29378ddefebed8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1223_en.txt
@@ -0,0 +1,4 @@
+A 43-year-old Caucasian woman presented to our clinic with a mild itching sensation in her arms and legs. She was referred by her physician for contact eczema. A physical examination revealed erythematous papular lesions over her metacarpophalangeal and proximal interphalangeal joints together with a periungual involvement with redness, hyperkeratosis, and capillary telangiectasia along the distal nailfolds on both her hands . No other skin findings such as heliotrope rash or erythema on the extensor surface of her extremity joints were present.
+She complained about pain and weakness in the muscles of her proximal extremities and neck flexor muscles with difficulty raising her arms and climbing stairs. At the same time she experienced swallowing difficulties and reported an uncharacteristic weight loss of 10 kg in the last 3 months. She had a 30 pack-year history of cigarette smoking with persistent nicotine use at the time of presentation in our clinic. A neurological examination showed symmetrical mild proximal muscle weakness. The rest of her physical examination including auscultation of her lungs, body temperature and lymph nodes status was normal.
+The laboratory findings revealed elevated serum levels of myoglobin 397 μg/l (normal range 25 to 58), creatine phosphokinase (CK) 881 IU/L (normal range 0 to 145 IU/L) and aldolase 11.8 U/l (normal range up to 7.6 U/l). Her liver enzymes were slightly elevated as were aspartate transaminase (AST) 69 U/l (normal range up to 31 U/l) and alanine transaminase (ALT) 50 U/l (normal range up to 34 U/l). Antinuclear antibody (ANA 1/160) was weakly positive while extractable nuclear antigens (ENAs) including anti-Jo-1 antibody were negative. Other laboratory parameters such as C-reactive protein (CRP) and lactate dehydrogenase (LDH) were normal. A histopathologic examination of the skin/muscle biopsy showed vacuolar degeneration of the basal membrane with perivascular inflammatory infiltration together with a lymphohistiocytic infiltration. In addition, an extensive mucin deposition in her dermis and linear atrophy of her muscle layer were detected. The morphologic features were compatible with dermatomyositis. An electromyogram and magnetic resonance imaging (MRI) of the muscles of her extremities showed a symmetric moderate myopathy mainly of proximal muscles which confirmed the diagnosis of dermatomyositis. A chest X-ray showed an unspecific pulmonary nodule in the upper field of her right lung. Computed tomography (CT) of her chest revealed a nodule of 20×22 mm in her right upper pulmonary field without mediastinal or axillar lymphadenopathy . A CT-guided biopsy of the lung nodule revealed a lung adenocarcinoma of moderate differentiation. After diagnosis of the lung tumor was made, she underwent a thorough screening including CT of her abdomen and MRI of her head/neck in order to exclude other tumors, lymph metastases or organ metastases. Furthermore we performed an endoscopy of her upper digestive tract and a gynecological control to exclude any other types of cancer. All of them were negative. Her pulmonary function tests and echocardiography were normal as well.
+She was given a presumed diagnosis of a lung adenocarcinoma with clinical manifestations of paraneoplastic dermatomyositis. No metastatic lesions were found, and there were no abdominal or cerebral abnormalities. A corticosteroid treatment with prednisolone 1 mg/kg/day was administered. In the absence of cardiologic or anesthesiologic contraindications she was assessed to be eligible for surgery. She underwent a right upper lobectomy. The histopathology showed a moderately differentiated adenocarcinoma that was pathologically staged as T1b N0 M0. In the postoperative period, she presented partial improvement of her skin lesions, muscle weakness and dysphagia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1240_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1240_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8dc5e5a118d541b0b3cafcd4895f74bf4bd13c8e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1240_en.txt
@@ -0,0 +1,8 @@
+A 14-year-old iTaukei (indigenous Fijian) girl presented to our hospital with a 1-month history of abdominal pain. Two days prior to her admission, her abdominal pain became worse, especially after movement, and was relieved by lying down. She also developed a high-grade fever and nausea and had one episode of vomiting. She gave no history of cough, diarrhea, vomiting, or dysuria. Her last menstrual period was on 28/9/2017. She denied any history of sexual intercourse.
+She was referred to a nearby hospital, where ultrasonography showed a cystic structure measuring 4.9 cm × 4.4 cm at the right adnexal region. Minimal free fluid was seen in the pouch of Douglas. No obvious appendix abnormality was seen, and other structures, including the uterus, were normal. She was then transferred to one of the main hospitals in Fiji for further investigation and management.
+The patient’s past medical history was unremarkable. She had no record of previous admission. She had not been receiving any regular medication and had no known allergies.
+The patient resides in a village that is approximately a 45-minute drive from the nearest town. She lives in a two-bedroom corrugated house with her parents and three younger siblings. Her usual diet consists of boiled root crops (such as cassava and taro), local vegetables, and fish. The water source is a spring that supplies the whole village. The family uses a water seal toilet. She gave no history of travel outside her village in 2017.
+On examination at the main hospital, the patient looked unwell. Her pulse was 116 beats per minute, blood pressure 114/60 mmHg, respiratory rate 21 breaths per minute, and temperature 38.8 °C. The results of her chest and cardiovascular examinations were normal. Abdominal examination revealed generalized tenderness on light palpation. However, there was no guarding or rebound tenderness, and no mass was palpable. The result of the per rectal examination was normal, as was the remaining examination.
+Blood tests revealed a hemoglobin of 9.8 g/dl (normal range [NR] 11.5–18.5 g/dl) and white blood cell count of 14,100 cells/mm3 (NR 4000–11,000 cells/mm3). Two blood cultures revealed no growth after 48 hours. The patient’s full blood count, liver and renal function, and serum electrolyte test results are shown in Table . The results of her chest and abdominal x-ray were normal.
+Exploratory laparotomy revealed serosal appendicitis with erythema and abundant fibrinous peritoneal fluid; hence, an appendicectomy was performed. It was noted that the right ovary was enlarged and had ruptured because of pus collection. The right ovary was incised, and pus was drained. This pus was cultured and yielded a pure growth of Salmonella Typhi , which was identified by using Microbact™ 12A/12B identification kits (Oxoid Microbiology Products, Altrincham, UK). This identification was later confirmed by Salmonella-specific antiserum testing (Difco™; Becton, Dickinson and Company, Franklin Lakes, NJ, USA). The antimicrobial sensitivity test was performed using a disk diffusion method on Mueller-Hinton agar. The organism was susceptible to all tested antibiotics (ampicillin, chloramphenicol, trimethoprim-sulfamethoxazole, gentamicin, cephalothin, ceftriaxone, ciprofloxacin, and nalidixic acid). Histopathology of the resected appendix revealed reactive lymphoid follicle in mucosa and acute inflammation on the serosal layer, compatible with periappendicitis.
+The patient was treated with intravenous ceftriaxone 1 g twice daily, cloxacillin 1 g four times daily, and metronidazole 500 mg three times daily for 5 days. She made an uneventful recovery and was discharged to home on the sixth postoperative day to complete a further 8 days of oral cotrimoxazole. Patient was reviewed 1 week after her discharge from the hospital. She did not have any complaint; her surgical wound was clean; and there were no remarkable physical findings. The result of her stool culture after completion of treatment was negative for Salmonella.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1245_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1245_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b772cc40547ee28542493de8d15e7e5625fea447
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1245_en.txt
@@ -0,0 +1,12 @@
+A 24-year-old gentleman with no past medical history had been experiencing debilitating chest pains for 2 years. He described these as varying in intensity, worsened by exercise, and relieved partially by analgesia. They were not associated with palpitations or syncope.
+Unfortunately, due to his symptoms he had to give up his studies and minimize his physical activity. He had trialled multiple analgesics (daily paracetamol and tramadol) with partial relief of symptoms.
+He underwent serial investigations at his local cardiology unit, including a cardiac CT which identified an absence of pericardium on the left side of the heart. He was referred to the Adult Congenital Heart Disease (ACHD) team at The Royal Brompton Hospital.
+When first reviewed in the ACHD clinic he was not cyanosed, in sinus rhythm with no evidence of cardiovascular decompensation. His apex beat however was grossly displaced to the left and more so on lying supine. His first heart sound was normal, second split, there was also a soft one-sixth systolic heart murmur. The rest of his examination was unremarkable.
+His electrocardiogram showed him to be in sinus rhythm at 78 b.p.m., with normal conduction times but a poor R wave progression and an intermittently changing axis.
+A chest radiography which showed situs solitus, levocardia, with a left aortic arch, no displacement of the heart to the left, and a protrusion at the level of the left atrial appendage at the left upper quadrant of the heart.
+His echocardiogram showed a structurally normal heart with maintained ventricular function. Stress echocardiography showed mild right ventricular dilatation at rest with increase in right ventricular volume directly after exercise. A cardiac CT revealed a partial absence of pericardium on the left side with a small layer of pericardium on the upper right heart border. The heart was grossly shifted leftwards and posteriorly, highly suggestive of enhanced heart mobility. Similarly, no pericardium could be seen on cardiac magnetic resonance imaging (CMR). There was lung tissue in between the base of the heart and diaphragm , the heart was displaced to the left of the chest and the RV appeared dilated .
+The patient’s symptoms were thought to be due to his absent pericardium and related to cardiac mobility. We were struck by the discrepancy of the erect Chest X-ray (CXR) and supine CMR with regards to cardiac position, mobility, and the severity of disabling symptoms. We thus discussed the patient at our ACHD Multidisciplinary Team meeting and offered him surgery, in an attempt to immobilize his heart, hoping to improve his symptoms and quality of life.
+The heart was exposed via a left postero-lateral thoracotomy. There was complete pericardial agenesis on the left side and on the diaphragmatic surface. Several 0.4 mm thickness Gore-tex® patches were sutured together to create a large sheet and this was sutured down with widely spaced interrupted 3-0 Prolene® sutures to the posterior mediastinum, starting at the level of the left pulmonary artery, posterior to the left atrial appendage and along the left hilum and inferior pulmonary ligament, to the diaphragm and down. This was then brought forward to the anterior chest wall and then fixed anteriorly along the anterior chest wall with the superior end free (see Figure ). A left pleural drain was inserted and a paravertebral catheter for analgesia, followed by routine multilayered chest closure.
+The post-operative course was uneventful apart from a small left apical pneumothorax with a small pleural effusion. Both resolved spontaneously within days.
+Echocardiography on Day 5 showed that the RV was of normal size with no evidence of pericardial effusion nor compression of cardiac chambers. The patient was discharged 8 days after his procedure on simple analgesia, mobilizing well with improved symptoms.
+Three months from surgery the patient had come off analgesia completely, with resolution of his debilitating chest pains. He was resuming his University studies and restoring normality in his life.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1278_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1278_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2f91fe8cb573801fb9b3f676302442773c31381d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1278_en.txt
@@ -0,0 +1,9 @@
+A 44-year-old Caucasian man presented to an outpatient clinic with a 2-month history of fatigue, night sweats, weight loss, loss of appetite, and mild abdominal discomfort. The patient did not have fever, chills, cough, nausea, vomiting, itching, urinary, or bowel symptoms. The patient had a past medical history significant for biopsy-proven sarcoidosis of the mediastinal lymph nodes, which was diagnosed 9 years prior. At that time, the patient had hilar lymphadenopathy seen on a routine chest radiography. The disease seemed inactive, as the patient never had symptoms related to sarcoidosis nor received treatment throughout the years. He also had a history of hypertension, hyperlipidemia, bipolar disorder, coronary artery disease with percutaneous coronary intervention performed a month prior to the current presentation, as well as a recently diagnosed type 2 diabetes mellitus. His regular home medications included amlodipine, metoprolol tartrate, lisinopril, lamotrigine, clopidogrel, metformin, rosuvastatin, and sildenafil. The patient denied any history of alcohol or tobacco use and stated that he used to work as a secretary.
+On physical examination, the vital signs were normal. Body mass index was 37.2 kg/m2, and weight was 263 pounds. The general, lung, heart, and abdominal examinations were unremarkable, and no palpable lymphadenopathy was identified. A battery of laboratory tests were performed and revealed the following: alanine aminotransferase and aspartate aminotransferase levels were within normal limits; however, the alkaline phosphatase (ALP) and γ-glutamyl transferase (GGT) levels were elevated (ALP = 258 U/L, reference = 38-126 U/L; GGT = 274 U/L, reference = 12-73 U/L). He was also found to have hyperbilirubinemia (total bilirubin was 1.7 mg/dL, reference = 0.0-1.3 mg/dL, and direct bilirubin was 0.7 mg/dL, reference = 0.0-0.3 mg/dL). The total protein, albumin, serum creatinine, and calcium levels were within normal limits. Further workup including ceruloplasmin, serum iron saturation, lactate dehydrogenase, serum angiotensin converting enzyme level, and erythrocyte sedimentation rate were normal. Alpha-1 antitrypsin antigen, a viral hepatitis panel, and anti-mitochondrial and anti-smooth muscle antibodies were negative. A slight elevation in β2-microglobulin levels were noted (3.2 mg/L, reference = 0.8-2.34 mg/L).
+Ultrasound examination of the abdomen was negative for common bile duct dilatation but showed a 3.5 × 4.1 cm abdominal mass at the head of pancreas. Computed tomography (CT) scan of the abdomen and pelvis with intravenous contrast demonstrated cirrhotic appearance of the liver with steatosis, with enhancing hepatic masses, splenomegaly, and multiple enlarged lymph nodes in the periaortic and portocaval areas. The largest lymph node was measured at 7.2 × 4.3 cm in diameter in the precaval area. There was, however, no visible pancreatic lesions, biliary duct dilatation, or gallbladder stones .
+Histopathological examination of a transjugular liver biopsy showed expanded portal areas containing occasional granulomas with the majority of the granulomas appear non-necrotizing, with a few demonstrating central necrosis. Mild macrovascular steatosis and chronic inflammation is noted . Auramine-rhodamine and GMS stains was negative for acid-fast bacilli and fungal organisms. Staining for iron and immunoglobulin G4 was negative.
+Evaluation for other etiologies of abdominal lymphadenopathy was performed to exclude malignancies and infectious granulomatous diseases. Infectious workup for granulomatous hepatitis was negative for Histoplasma, Bartonella, tuberculosis, and Coxiella burnetii (Q fever). An autoimmune workup including ANA, ANCA, immunoglobulin G4, complement C3, and complement C4 levels was performed and was unremarkable.
+A provisional diagnosis of hepatic sarcoidosis and nonalcoholic steatohepatitis was procured based on the biopsy results. Unfortunately, at that time the patient refused steroid treatment as well as immunosuppressive therapy; however, he agreed to ursodeoxycholic acid 1500 mg daily to help with itching.
+Two months later, the patient started to complain of excruciating pain in his lower back with radiation to his thighs and legs, in addition to diffuse joint pain. His loss of appetite and fatigue did not improve significantly, and he continued to lose weight. A whole body positron emission tomography-CT scan showed extensive hepatic uptake, hypermetabolic lymphadenopathy involving the chest, cervical, supraclavicular regions, upper abdominal, retroperitoneal, iliac chain, and inguinal lymph nodes, as well as numerous fluorodeoxyglucose-avid osseous lesions involving the thoracic and lumbar spine, left proximal humerus, left scapula, pelvis, and proximal right femur. There was a concern of metastatic bone disease given the widespread distribution of the lesions . Evaluation with spine, pelvis, and upper extremity, magnetic resonance imaging (MRI) showed multiple small marrow lesions involving the vertebral bodies in the thoracic and lumbar spine, with small spotty lesions noted in the sacrum, pelvis, hips, ribs, and humerus on the left. MRI of the brain showed no evidence of neurosarcoidosis. An ophthalmologist evaluated the patient, and ocular involvement was ruled out. The patient underwent a bone biopsy of the T12 vertebra, which revealed benign trabecular bone with replacement of the marrow space with numerous non-necrotizing granulomas and fibrosis consistent with diagnosis of vertebral sarcoidosis .
+Of note, while this extensive workup was taking place, the patient developed a sudden onset of left flank pain and hematuria. There was a small left ureteric stone on abdominal imaging identified. He underwent laser lithotripsy and left ureteral stent placement.
+The patient agreed to immunosuppression and was started on methotrexate 20 mg subcutaneously once weekly, folic acid 1 mg daily, and prednisone 5 mg daily as treatment for systemic sarcoidosis. However, 2 months later, he developed actinomycosis skin infection of the groin. Methotrexate was held, and he was treated with amoxicillin until the infection resolved. The patient was restarted on methotrexate. Two months after restarting methotrexate, the patient reported significant clinical improvement of his pain, loss of appetite, and has gained 40 pounds since the start of methotrexate. His liver enzymes improved significantly. A repeat positron emission tomography-CT scan demonstrated a decrease in the lymph nodes, bone, and hepatic lesions size.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1287_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1287_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0e3fb0e3232419dc43fd4626615a2387d5a30f8d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1287_en.txt
@@ -0,0 +1 @@
+A 4-year-old boy (height, 100 cm; weight, 16 kg) was hit in the chest by a car. He was conscious and complained of chest tightness. Upon arrival to the local hospital at 18 min after the injury, he was semiconscious and cyanotic. Breath sounds were not heard in the right hemithorax, and his vital signs were unstable: heart rate( HR) of 162 beats per minute (bpm), blood pressure (Bp) of 102/56 mmHg, respiratory rate (RR) of 32 times per minute, and oxygen saturation (SPO2) of 70%. For sedation, 30 mg of propofol was administered intravenously, and emergency endotracheal tube above the carina was performed. Chest computed tomography (CT) showed right pneumothorax with lung compression of 90%, and the left clavicle was fractured . A chest tube was positioned in the right thoracic cavity, and a breathing balloon was used for ventilation. His vital signs were as follows: HR of 155 bpm, Bp of 97/50 mmHg, RR of 22 times per minute, and SPO2 of 98%. Twenty-four minutes later, he was admitted to the Emergency Department of our hospital for further treatment. The results of blood gas analysis were as follows: pH, 7.12; carbon dioxide partial pressure (PaCO2), 76 mmHg; oxygen partial pressure (PaO2), 68 mmHg. Bronchoscopy indicated that the right middle lobe bronchus was ruptured. Transthoracic echocardiography ruled out associated blunt cardiac injury. Emergency exploratory thoracotomy and right middle or right middle and lower lobectomy were planned. The patient went into sudden cardiac arrest after being sent to the operating room (SPO2, 76%; end-tidal carbon dioxide partial pressure (PetCO2), 46 mmHg). Return of spontaneous circulation after twelve minutes of external chest compression. He did not regain consciousness. Mainstem intubation of the left bronchus was performed under direct fibreoptic guidance to ventilate the left lung. With pressure control ventilation, the fraction of inspiration O2 was 100%, peak pressure was 32 cmH2O, and tidal volume was 45 mL; HR was 145 bpm, Bp was 92/48 mmHg (0.05 µg/kg/min norepinephrine), RR was 20 times per minute, and SPO2 was 70%. Blood gas analysis results at this time were as follows: pH, 6.87; PaCO2, 114 mmHg; PaO2, 46 mmHg; plasma lactic acid (Lac), 6.7 mmol/L; K + , 3.2 mmol/L; haemoglobin 7.3 g/dl; and Ca + + 1.21 mmol/L. As sudden cardiac arrest occurred due to severe respiratory acidosis, we decided to initiate V-V ECMO. Our hospital has an adult ECMO centre, and it is 300 km away from our nearest paediatric ECMO centre, approximately a 3.5-h drive. To prevent death, we decided to use small adult ECMO tubes. ECMO was initiated percutaneously in the left femoral vein, and an incision was made in the right internal jugular vein (MAQUET 2050, Cardiopulmonary GmbH BE-PLS, Germany; left femoral vein: 15 Fr/5 mm single-stage drainage cannula, MAQUET, Germany; right internal jugular vein: 14 Fr/ZX 4.7 return cannula, Changzhou Kangxin Medical Equipment Co., Ltd., China). The blood flow was 1.7 L/min, sweep gas was 1.5 L/min, and FiO2 was 100%. Cardiac arrest occurred again after ECMO, and we immediately administered cardiopulmonary resuscitation. Blood gas analysis results at this time were as follows: pH, 6.84; PaCO2, 72 mmHg; PaO2, 61 mmHg; Lac, 9.7 mmol/L; K + , 9.8 mmol/L; haemoglobin 7.3 g/dl; and Ca + + 1.21 mmol/L. Insulin (2 U) were added to the glucose injection (10%, 100 ml), and sodium bicarbonate (5%, 32 ml) and calcium chloride injection (3%, 0.1 g) were administered immediately. Spontaneous sinus rhythm was restored after 18 min. An exploratory thoracotomy was performed successfully; the root of the right middle lobe bronchus was found to be ruptured , as was a branch of the right middle lobe artery. Right middle lobectomy and right middle bronchoplasty were performed. The patient was admitted to the intensive care unit (ICU) after the operation. Mechanical ventilation and ECMO were continued, and we adjusted the ventilator parameters as follows: FiO2 at 30%; positive end expiratory pressure (PEEP) at 10 cmH2O; respiratory rate at 12 times/minute, and tidal volume at 6 mL/kg. Oxygen saturation was between 98 and 100%. Along with mild hypothermia for brain protection (34-36 °C for 30 h), piperacillin sodium and tazobactam injection for the prevention of infection, methylprednisolone injection (16 mg q12 h) to reduce pulmonary exudation, and norepinephrine 0.15 µg/kg/min to maintain blood pressure were applied. On postoperative day 2, he became conscious and was responsive. Due to the traumatic wet lung on the left and secondary pulmonary infection, ECMO was withdrawn on the 6th day after the operation, with a total ECMO time of 137 h. Mechanical ventilation was withdrawn on postoperative day 11. On postoperative day 12, chest CT showed a mass of a high-density shadow in the upper lobe of the left lung with cavitation, which was considered a large traumatic pseudocyst . The patient left the ICU on postoperative day 16 and was discharged from the hospital on postoperative day 31 without neurological deficit. He is able to communicate and play normally. The timeline of the treatment process is shown in Fig. .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_128_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_128_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..127bbbd9d3bf608a943bfaa5de9889991dbb3ade
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_128_en.txt
@@ -0,0 +1 @@
+A 19-year-old female had a subcutaneous implant placed one year prior to a visit to her physician. During the implantation of the device, abnormal cutaneous bleeding was noted. After the physician was unable to locate the implant, an ultrasound was performed. The ultrasound was unable to locate the contraceptive device. A thoracic CT scan revealed that the implant had migrated into the lower left lobular segmental pulmonary artery. The patient reported no symptoms related to the migration of the implant. After a multidisciplinary consultation involving a cardiac surgeon, anaesthesiologists, a gynaecologist, a cardiologist, and an interventional radiologist, an endovascular approach was considered. The patient underwent a preoperative consultation with a gynaecologist, an anaesthesiologist, and an interventional radiologist to explain the removal procedure and the known risks of pulmonary arterial catheterization. The procedure planning included the de-sterilization of a Nexplanon® to assess its flexibility. The team decided to perform the removal under bi-planar fluoroscopic guidance, as routinely done in our department for foreign body retrieval. Both right and left anterior obliquities were chosen to ideally expose the contraceptive implant . The procedure was conducted under general anaesthesia. Following a right femoral venous puncture under ultrasound guidance, a long 8F NeuronMax® introducer (Penumbra, Inc., Alameda, CA, USA) was placed under fluoroscopic guidance into the right inferior vena cava. The left pulmonary artery was catheterized using a 5F 145° angled Pigtail catheter (Merit Medical, UT, USA). An angiogram confirmed the position of the contraceptive implant, without thrombosis. After guide exchange with a stiff guide wire (Terumo, Tokyo, Japan), the NeuronMax® catheter was subsequently advanced to the left pulmonary artery, just upstream of the foreign body. A 25-mm diameter loop snare (One Snare®, Merit Medical, UT, USA) was deployed. Once captured, the contraceptive implant was removed under fluoroscopic guidance without removing it into the NeuronMax® catheter. The procedure lasted 60 min. The fluoroscopic dose was 261 mGy, and fluoroscopy time was 10 min. The following day, a thoracic CT scan showed no procedure-related complications, and the patient was discharged. The patient did not receive any medical treatment before, during, or after the procedure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1303_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1303_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..54d8d6cb1c48b6ed90ce8a4b407cf0f0ff778dbc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1303_en.txt
@@ -0,0 +1,9 @@
+We report the case of a 36-year-old Sri Lankan Sinhalese man from Kandy, Sri Lanka, who presented to a tertiary care hospital with a 3-day history of an acute febrile illness. He had been in apparently good health and working as farmer involved in paddy cultivation. Three days prior to admission he developed high spiking fever with chills and rigors associated with severe arthralgia and myalgia. He could not mobilize due to severe muscle cramps in lower limbs. He developed shortness of breath at rest with a non-productive cough 1 day prior to admission and was anuric for 12 hours prior to hospital admission. His past medical history was unremarkable and there was no significant medical illness in his family. He was an occasional ethanol consumer and did not smoke tobacco.
+On admission to our emergency unit, we found an averagely built man with a body mass index of 24 who was in severe distress and pain. He was severely dehydrated. He had mild icterus with injected and suffused conjunctiva. He had a temperature of 39.5 ºC with warm peripheries. His pulse rate was 140/minute with a blood pressure of 80/40 mmHg and he had marked postural symptoms on attempting a standing blood pressure. He was dyspneic with a respiratory rate of 32 cycles per minute on air saturation of 90%; it improved with 10 L oxygen via a face mask. On examination of his lung fields he had bilateral coarse crepitations. He had 3 cm hepatomegaly which was tender without palpable spleen or flank dullness. Although he was agitated and in distress, he was oriented in time, place, and person with normal neurology.
+His laboratory results showed a leukocyte count of 24.6 × 109/l (90% neutrophils) with a platelet count of 86 × 109/l and hemoglobin of 14.5 g/dL. A peripheral smear showed neutrophil leukocytosis with toxic neutrophils, few myelocytes, and abnormal lymphocytes with thrombocytopenia. His aspartate aminotransferase (AST) level was 924 U/l (normal up to 31 U/l) and alanine aminotransferase (ALT) was 331 U/L (normal up to 31 U/L). His serum bilirubin level was 55 mmol/L (normal 1–21 mmol/L) with direct fraction of 55%. His alkaline phosphatase level was 459 U/L (normal 64–306 U/L). His serum creatinine was 217 micromoles/L on admission with a potassium of 2.9 mmol/L and sodium of 136 mmol/L. His blood urea nitrogen level was 40 mg/dl (normal 8–20 mg/dl). His coagulation profile was normal. His C-reactive protein (CRP) was 379 mg/dl on admission. Arterial blood gas revealed a partially compensated metabolic acidosis (pH 7.26) with an arterial bicarbonate of 14.5 mmol/L and carbon dioxide partial pressure of 20 mmHg. His creatinine kinase level was 440 mcg/l (10–120 mcg/l). His arterial lactate was 5 mmol/L. A chest X ray on admission showed bilateral air space opacifications. An electrocardiogram (ECG) showed T inversions in the anterior leads (V1–V6) with a troponin I of 0.16 ng/mL (0.04 ng/mL). Bedside two-dimensional echocardiography revealed global hypokinesia with a left ventricular ejection fraction of 40% which was suggestive of myocarditis.
+A working diagnosis of severe leptospirosis with multiorgan dysfunction was made based on the above findings in the background of significant mud exposure and epidemiology of the locality. He was immediately moved to a high dependency unit and oxygen was given via a face mask. He had 50 ml of concentrated urine after catheterization. After fluid resuscitation of 1.5 L of crystalloids, he was started on intravenously administered noradrenalin as his blood pressure remained low. Intravenously administered cefotaxime with orally administered doxycycline was prescribed after taking blood cultures. Acidosis was corrected with 8.4% sodium bicarbonate. An N-acetyl cysteine (NAC) infusion was started considering his elevated transaminases. Hypokalemia was corrected with intravenously administered potassium chloride. He was given 1 g of intravenously administered methylprednisolone.
+On day 2 of illness, our patient was clinically improved with less myalgia. Inotrope requirement was reduced from 0.8 mcg/kg per minute to 0.2 mcg/kg per minute. His oxygen requirement improved from 10 L/minute via face mask to 2 L/minute oxygen via nasal prongs. His urine output was 525 ml/last 24 hours.
+On day 3 of illness his blood pressure was normalized without inotropes and on day 4 of illness his saturation on air was 99%.
+Over the subsequent 5 days his clinical condition gradually improved with gradual normalization of biochemistry.
+Methylprednisolone 1 g continued for 3 days and intravenously administered cefotaxime and orally administered doxycycline for a total of 7 days. He was discharged after an uneventful recovery on day 7 of hospital admission.
+His dengue NS1 antigen test was negative on day 3 of fever. Throat and nasal swabs taken on admission were negative for influenza A (H1N1) viral RNA. A microscopic agglutination test (MAT) for IgM and IgG against Leptospira was done on day 7 and was negative. It was done in the Medical Research Institute of Sri Lanka, which is the reference center which tests for all the common serovars of leptospirosis in Sri Lanka. Blood taken on day 7 was positive for IgM against hantavirus on 1:100 dilutions. Unfortunately, our patient did not turn up for subsequent testing at 4 weeks to demonstrate the rising antibody titers in convalescence.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1310_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1310_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..314215a27e582ceffc243119e7b8b3ef8b757ba3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1310_en.txt
@@ -0,0 +1,6 @@
+A 73-year-old man visited our emergency room (ER) in October 2004 with right upper abdominal pain and fever for the previous two days. Vital signs on arrival at the ER were blood pressure (BP): 161/107 mmHg, pulse rate (PR): 90/minute, respiratory rate (RR): 20/minute, and body temperature (BT): 38.9ºC. His consciousness was unaffected but he had an acutely ill appearance. Tracing back his medical history, he had hepatitis B virus (HBV)-related liver cirrhosis (Child-Pugh Classification Grade A), and in August 1999, a small HCC (Segment 5 of the liver, diameter less than 2 cm) was diagnosed. He received transcatheter arterial chemoembolization (TACE) at a medical center and a second TACE again in May 2001 for recurrent HCC. He declined further TACE for residual recurrent lesions. Therefore oral chemotherapy with the regimen tegafur/uracil (100 mg/224 mg) had been prescribed to him from December 2001 to November 2003, and was ceased due to loss at follow-up.
+Physical examination in the ER found no yellowish skin, no icteric sclera but moderate right upper quadrant (RUQ) abdominal pain. Murphy's sign was positive. Bowel sounds were normal and his abdomen was soft, with no rebounding pain. There was no shifting dullness. Lab data included: white blood cell count (WBC): 14,520/mm3 (Neu/Lym: 83.5/6.4%), platelets: 169 k/mm3, total and direct (T/D) bilirubin: 1.4/0.6 mg/dL, serum glutamic-oxaloacetic transaminase/serum glutamic-pyruvic transaminase (sGOT/sGPT): 38/32 U/L, albumin (Alb): 3.9 gm/dL, C-reactive protein: 11.9 mg/dL, NH3: 98 mcg/dL, and α-FP level: 231.1 ng/mL. Abdominal echogram revealed a thickened gall bladder wall, gall stones and a suspected tumor mass in the distended gall bladder. An abdominal computed tomography (CT) scan showed liver cirrhosis, gall stones, diffusely thickened gall bladder wall with increased contrast enhancement compatible with acute cholecystitis, and a hypodense mass lesion without contrast enhancement in the gall bladder . There was no roentgenographic evidence of a suspected recurrent lesion in the liver parenchyma at that time.
+An open cholecystectomy via a right subcostal incision was performed on the next day. A distended gall bladder with multiple pigmented gall stones and a tumor mass, 6.0 × 4.0 × 2.0 cm in size, were found in the gall bladder lumen. When seen, the mass had already detached from the mucosa at the opening of the sac and no stalk could be identified . The mucosal surface of the gall bladder wall was smooth without evident tumorous or ulcerative lesions .
+Microscopic pathologic examination of the gall bladder revealed heavy neutrophil and lymphocyte infiltration as in ordinary acute and chronic inflammation. The mucosa was congested and showed no evidence of tumor invasion. The vessels in the gall bladder wall were free from tumor emboli .
+The sections of the tumor showed extensive infarction necrosis. The viable tumor cells were seen as uniform polygonal cells with eosinophilic granular cytoplasm arranged in tiled array or microtrabecular pattern mostly surrounding the blood vessels . Immunohistochemistry staining with α-FP antibody demonstrated varied positive staining intensity in the cytoplasm of the tumor cells . Other antibodies including CK7, chromogranin, and synaptophysin were all negative, excluding the possibility of carcinoid tumor or adenocarcinoma.
+The patient recovered from the surgery well without major or minor complications and was discharged one week after the surgery. He received regular follow-up in our gastrointestinal (GI) outpatient department and his α-FP levels went down to 3.1 ng/mL in March 2005, and to 3.08 ng/mL in August 2005, five and 10 months after cholecystectomy, respectively. He died in July 2006 in another hospital due to upper gastrointestinal bleeding from a hemorrhagic duodenal ulcer complicated by hepatorenal syndrome.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1328_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1328_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..711589d14f0964e20e103dc1a635f420d22b496d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1328_en.txt
@@ -0,0 +1,8 @@
+A 28-year-old man complained of an abdominal mass and continuously increasing pain over the previous 2 months. Physical examination revealed a midabdominal mass on abdominal palpation, atrophy and minimal induration in the right testis on scrotal palpation. The left testis was found to be normal. No abnormal finding was noted on digital rectal examination. Examination of the other systems, including the endocrine system, was normal.
+His white blood cell count and urine microscopy were normal. Aspartate aminotransferase (AST): 56 mg/dl (normally 1 to 40), alanine aminotransferase (ALT): 42 mg/dl (normally 1 to 38), alkaline phosphatase (ALP): 768 mg/dl (normally 80 to 306), gamma glutamyl transferase (GGT): 160 mg/dl (normally 6 to 50) and lactate dehydrogenase (LDH): 6302 mg/dl (normally 266 to 501) were found in the blood biochemistry. His erythrocyte sedimentation rate was high (110 mm/hour). Values for alpha-fetoprotein (AFP) (5.9 ng/ml (normally 0 to 10.0)) and beta human chorionic gonadotrophin hormone (β-hCG) (0.773 mIU/ml (normally <4)) were within normal limits. Chest X-ray was normal. Scrotal ultrasonogram revealed minimal hypoechogeneity and non-homogeneity in the right testis. Abdominal computed tomography (CT) revealed a very large retroperitoneal mass (13×8 cm), extending across the midline . Thorax CT was normal.
+Needle aspiration biopsy was performed for the retroperitoneal mass and malignant tumour infiltration was reported. After the immunohistochemical studies, cytokeratin (CK) (-), vimentin (-), leukocyte common antigen (LCA) (-), β-hCG (-) and placental alkaline phosphatase (PLAP) (+) immunoreactivity were noted, indicating a germ cell tumour.
+Scrotal ultrasonogram revealed hypoechogeneity and non-homogeneity in the right testicle. Evidence of a tumour was not found. The left testicle and epididymis were normal. After pre-operative evaluation, right inguinal orchiectomy was performed to determine the primary site of the tumour. Histological examination of the biopsy specimen revealed a large area of hyalinization, tubular hyalinization, interstitial fibrosis and focal Leydig cell hyperplasia. There were no pathological findings in the epididymis and spermatic cord. The final pathological diagnosis was 'burned-out' testicular tumour .
+Because of the large retroperitoneal lymph node metastasis, primary chemotherapeutic treatment was performed. Combination chemotherapy, consisting of bleomycin, etoposide and cisplatin, was given in three weekly cycles of four courses. After the four courses of chemotherapy treatment, the abdominal mass had regressed from 13×8 cm to 3×2 cm .
+After the chemotherapy, a control CT scan was obtained revealing regression in the para-aortic and para-caval lymph nodes (3×2 cm and multiple lymph nodes). After 6 months, tumour markers had increased (AFP: 3.59 ng/ml (normally 0 to 10.0) and β-hCG: 20.95 mIU/ml (normally <4)). Because only the β-hCG level had increased, the histology of the primary tumour seemed to indicate a seminoma. For this reason, retroperitoneal lymph node dissection was planned. Exploratory laparotomy revealed a retroperitoneal mass which extended both sides of the midline and involved the major vessels and extended to the eosophogastric junction, indicating an unresectable mass. A biopsy was performed from the unresectable mass and histological examination of the biopsy specimen showed only necrotic tissue and no tumour cells.
+Salvage chemotherapy consisting of paclitaxel, ifosfamide and cisplatin (TIP) was given in monthly cycles of four courses. After this chemotherapy, an abdominal CT scan revealed regression in the para-aortic and para-caval lymph nodes (milimetrical). AFP and β-hCG levels were normal (AFP: 1 ng/ml (normally 0 to 10.0) and β-HCG: 0.180 mIU/ml (normally <4)).
+The patient has been disease and recurrence free for 5 years since the primary surgical and medical treatment.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1331_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1331_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0a246e42c5033fee4f510f3a7ff68572d828a4fd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1331_en.txt
@@ -0,0 +1,5 @@
+A 55-year-old male patient was presented to a general hospital with fever, myalgia, and persistent cough. Polymerase chain reaction testing for COVID-19 was positive and he was admitted to the hospital due to severe respiratory symptoms. The patient is a known diabetic and hypertensive with a history of a nonfunctioning pituitary macroadenoma for which he underwent an endoscopic endonasal transsphenoidal resection 11 years ago in another hospital. Pituitary tumor recurrence was documented in the available two postoperative magnetic resonance imaging (MRI) studies . After surgery, the patient was kept on maintenance levothyroxine and hydrocortisone for panhypopituitarism.
+Six days after admission, the patient complained of severe headache and acute onset of ptosis and diminution of vision in the left eye. Ophthalmological evaluation revealed complete visual loss in the left eye, a visual acuity of 20/60 in the right eye, left oculomotor nerve palsy with ptosis, and dilated nonreactive pupil. Fundus examination revealed a pale left optic nerve head. Neurological examination was otherwise normal. Computed tomography revealed hyperdensity of the sellar and suprasellar areas. MRI was consistent with PA in a recurrent large pituitary adenoma [ and ].
+The patient was transferred to our center and underwent an urgent endoscopic endonasal transsphenoidal surgery through which a near total excision of the tumor was achieved [ and ].
+The procedure was performed under strict COVID-19 precautions including use of powered air purifying respirators and limited OR personnel. Intraoperative findings were similar to those usually seen in cases of PA and included dark blood mixed with purple-red adenoma tissues of variable consistencies . It was our observation that the nasal mucosa was pale and separated easily from the underlying bone. We have previously observed such features in two patients who previously tested positive for COVID-19. Histopathological examination demonstrated classic features of PA.
+Within the first 3 postoperative days, the patient had some improvement of vision of the left eye so that he was able to perceive hand movement. Ptosis also improved partially. However, his chest condition progressed and he had to be transferred to COVID-19 intensive care unit in the referring hospital where he was intubated and put on mechanical ventilation. One week later, the patient unfortunately passed away due to complications of severe COVID-19 pneumonia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1336_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1336_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6cc64c161bbd5310344b1d9602dbcef6796766d1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1336_en.txt
@@ -0,0 +1,3 @@
+The patient was a 67-year-old man, who had been admitted to the hospital due to melena and a hematocrit level of 20.1 %. Nasogastric intubation revealed a fresh blood clot in the stomach. Urinalysis, chest and abdominal films, and liver function tests were within normal limits, and serum creatinine was 1.2 mg/dl. Five units of packed blood cells were transfused promptly.
+Abdominal CT scan showed a well-defined, heterogeneous mass (3 × 4 m) which was located in the lower part of the stomach body . Gastric endoscopy showed the ulcerated tumor with bleeding along the lesser curvature of the proximal stomach and a submucosal nodule that measured about 3 cm in diameter in the lower part of the stomach body . No other metastatic lesions in other organs were found on abdominal ultrasonography or the CT scan. High-grade gastrointestinal bleeding persisted, necessitating the additional transfusion of ten units of packed red blood cells. Subsequently, the patient underwent a total gastrectomy. During the operation, there was no other evidence of metastatic disease in the intra-abdominal cavity. Macroscopic examination of the total gastrectomy specimen showed Borrman type-2 tumor measuring 5 × 6 cm and submucosal nodule measuring 3 × 4 cm in the stomach . On histopathological examination, the Borrman type-2 tumor gastric tumor showed transmural infiltration by a poorly differentiated diffuse adenocarcinoma . There was no vascular invasion and no lymph node metastasis. Further histopathological examination of the submucosal nodule revealed GIST of the low-risk category , which was composed of cytologically bland spindle cells and showed a low mitotic index (< 5/50HPF).
+The immunohistochemistry indicated strong staining for CD34 and C-kit, while expressions of SMA and S-100 were negative . These findings confirmed the simultaneous development of gastric cancer and GIST. The patient was subsequently discharged without any complications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_133_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_133_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..94e2e73397dd69e3546c018882d89c9da70b3c0e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_133_en.txt
@@ -0,0 +1,5 @@
+Preceding availability of COVID-19 vaccination, a 58-year-old Caucasian male presented to his primary care provider with one-week of cough, low-grade fever, and general malaise. He was diagnosed with follicular lymphoma 10 months prior and received 6 cycles of chemo-immunotherapy (bendamustine and rituximab), achieving clinical remission, and received an additional dose of maintenance rituximab one month prior. An oropharyngeal swab was positive for SARS-CoV-2, but he did not require hospitalization at that time.
+Twenty-seven days after the initial positive swab, he developed hypoxemia prompting hospital admission. Initial NP swab was negative and computed tomography (CT) imaging demonstrated recurrent ground glass opacities with bilateral interstitial pneumonia, compatible with COVID-19. Blood tests revealed lymphopenia (0.1 × 109/L, normal: 0.7–3.5 × 109/L) with increased C-reactive protein (57.0 mg/L, normal: 0.0–8.0 mg/L) and ferritin (2047 μg/L, normal: 30–500ug/L). He improved with dexamethasone 6 mg daily for 10 days. However due to relapsing hypoxemia and radiographic progression, a diagnosis of organizing pneumonia as sequelae of COVID-19 was considered. Bronchoscopy was declined, and oral prednisone 50 mg daily was initiated with a planned dose taper.
+On day 90, 73 days post admission, following ongoing reduction of prednisone (10 mg), the patient presented with new onset of pyrexia and recurrence of hypoxemia. RT-PCR testing was again positive by NP swab . The patient was re-initiated on dexamethasone with bronchoscopy performed. Bronchoalveolar lavage was both SARS-CoV-2 RT-PCR (Ct 18.7) and culture positive (1.17 × 104 pfu/mL, wild-type G clade) and negative for bacterial, mycobacterial, other viral and fungal growth. Transbronchial biopsies demonstrated active pneumonitis with occasional foci of organizing pneumonia, and patchy interstitial fibrosis. Symptoms were consistent with COVID-19 relapse and remdesivir was given (200 mg intravenous loading dose then 100 mg daily) for 5 days concurrently with dexamethasone . On day 107, there was clinical improvement with reduction in oxygen requirements to room air and RT-PCR Ct of 24.4 Subsequent investigations revealed hypogammaglobinemia (IgA 0.48 g/L, IgG 3.29 g/L, IgM 0.05 g/L (normal: 0.6–4.2 g/L, 6.8–18.0 g/L, 0.4–3.00 g/L, respectively), likely secondary to prior rituximab administration. He was initiated on monthly intravenous immunoglobulin. He clinically improved and was discharged home on day 107 with an oral dexamethasone (4 mg) taper. Viral culture load at time of discharge was not detectable.
+On day 118 the patient re-presented to hospital with respiratory failure. A repeat SARS-CoV-2 RT-PCR swab was positive with Ct of 23.7and a viral culture load of 1.25 × 101 pfu/mL, suggestive of ongoing viral persistence and a third COVID-19 relapse . SARS-CoV-2 testing failed to demonstrate remdesivir resistance (supplementary material). He was re-treated with another course of remdesivir for 5 days with modest clinical improvement. Repeat CT scans demonstrated persistent, migratory bilateral ground glass opacities . Subsequent medical therapy included bamlanivimab 700 mg (day 133; one dose), IVIG 75 mg (days 137, 165 and 193; one dose each) and a third course of remdesivir (day 146; ten-day course). The patient demonstrated a gradual clinical recovery with progressive reduction in oxygen therapy and eventual negative swab by RT-PCR on day 189. On days 174 and 202, the mRNA-1273 COVID-19 vaccine was administered. On day 202 after initial presentation, he was ultimately discharged home with repeat COVID-19 swabs (days 209 and 224) negative. He has continued to improve with gradually increasing exercise tolerance.
+Notably, whole genome sequencing of the patient’s viral samples over the duration of the time-period demonstrated an identical sequence belonging to SARS-CoV-2 clade D614G equivalent to the PANGO B.1 lineage viral strain with a specific sublineage of B.1.160. A review of the local epidemiology during this period noted B.1.160 as the 12th highest lineage, accounting for only 1.4% of the those sequenced from the general population. Based on the sequencing results, relapse of infection by an identical virus strain was demonstrated rather than re-infection with different strains. Finally, serology testing completed was negative to the nucleocapsid antibody, however positive for the spike antibody (value of 1515.3AU/mL; positive threshold of > 50AU/mL).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1358_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1358_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b567503c3f8245706b6c6d2123639ad42190256b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1358_en.txt
@@ -0,0 +1,8 @@
+A 55-year-old man was admitted to The Second Affiliated Hospital of Zhejiang University School of Medicine (Hangzhou, China) in October 2021 with rapidly worsening heart failure.
+The patient had been experiencing heart failure for 3 mo, but had begun to experience chest tightness, dyspnea, edema, and fatigue after activity.
+The patient had undergone a pulmonary resection 20 years prior to address carcinoma in situ; his current disease state was considered stable.
+The patient’s personal and family histories were unremarkable.
+The patient’s blood pressure was 87/49 mmHg, pulse rate was 101 beats per minute with a regular rhythm, and O2 saturation was 97% at room air. Physical examination revealed that he had clear lungs and normal heart sounds with no murmurs or gallops on auscultation. His lower extremities showed mild bilateral pitting edema. No enlargement of lymph nodes, liver, or spleen was found.
+Laboratory tests showed normal findings in a complete blood count and comprehensive metabolic panel. The levels of serum lactate dehydrogenase and β2-microglobulin were within normal limits. However, the levels of brain natriuretic peptide (385.7 pg/mL; normal: < 100) and troponin T (0.058 ng/mL; normal: < 0.014) were over the normal upper limits. Creatinine was within the normal range (at 51.9 μmol/L), while urine analysis was negative for protein. Quantitation of 24-h urinary lambda light chain showed a level of 365.2 mg. Quantitative serum immunoglobulin analyses demonstrated normal levels of IgG (at 10.5 g/L), IgA (at 2.01 g/L), and IgM (at 0.28 g/L). Serum immunofixation was used to evaluate an underlying gammopathy and showed lambda light chain proteinemia. The level of serum-free lambda light chain (FLC) was normal (at 15.56 mg/L), with the difference between the involved and uninvolved serum FLC levels being 6.75 mg/L. A bone marrow aspirate smear showed 5% infiltration of plasma cells, while flow cytometry analysis showed an abnormal population of plasma cells that accounted for 5.8% of normal cells, most of which were positive for surface CD38, CD56, CD138, and cytoplasmic λ light-chain. The fluorescence in situ hybridization test was negative, which included a 1q21 amplification, 13q14 deletion, p53 deletion, and translocation of t (4; 14), t (11; 14), t (14; 16).
+Positron emission tomography/computerized tomography (PET/CT) was performed and showed no abnormal metabolic lesions. An electrocardiogram showed low voltages in the limb leads. Echocardiogram revealed severe left ventricular hypertrophy, a reduced left ventricle ejection fraction of 38.1%, and an elevated left ventricular filling pressure E/A of more than 2.04. Cardiovascular magnetic resonance imaging (MRI) showed the morphologic phenotype of increased left ventricle wall thickness, while 99technetium pyrophosphate (99mTc-PYP) planar scintigraphy showed a heart-to-contralateral ratio of 1.31.
+Cardiac amyloidosis was considered as a possible etiology of the cardiomyopathy due to the left ventricle thickness on echocardiogram and the heart-to-contralateral ratio of 1.31 on 99mTc-PYP. An endomyocardial biopsy was performed with electron microscopy, revealing fibroid deposits in the myocardium and after Congo-red staining, fibrous tissue with apple green birefringence visualized by polarized light microscopy . Immunohistochemistry analysis showed dominant positivity for monoclonal lambda light chains.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_13_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_13_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..062dceb825691e797e12482a473ad89f5833c25e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_13_en.txt
@@ -0,0 +1,2 @@
+A 56-year-old male patient presented with a pancreatic cyst identified by abdominal ultrasonography on a comprehensive medical examination and was admitted to our hospital. He had a past medical history of type 2 diabetes, hyperlipidemia, and chronic hepatitis C for which he received interferon therapy for chronic hepatitis C more than 20 years previously. He had no family history of cancer. Laboratory tests revealed normal levels of carcinoembryonic antigen (CEA) and carbohydrate antigen 19–9, and alpha-fetoprotein (AFP) and protein induced by vitamin K absence or antagonist-II (PIVKA-II) were absent. Endoscopic ultrasound (EUS) showed a cystic mass measuring 13 mm in size in the pancreatic head and a low-density mass measuring 16 mm in size in the pancreatic tail , which was partially enhanced on the contrast-enhanced ultrasound image . Contrast-enhanced computed tomography (CT) revealed branch duct type intraductal papillary mucinous neoplasms in the pancreatic head and an early enhanced nodule measuring approximately 10 mm in size in the pancreatic tail . An enhancement of the nodule lasted until the late phase, although its density was gradually attenuated. Magnetic resonance imaging (MRI) did not detect the corresponding nodule in the pancreatic tail.
+Based on the above features, our initial differential was that of a neuroendocrine tumor or a solid pseudopapillary neoplasm (SPN). Endoscopic ultrasound-guided fine-needle aspiration (FNA) was performed to make a definitive diagnosis. FNA cytology showed that the tumor cells exhibited an acidophilic cytoplasm with small, round nuclei. Immunohistochemistry was performed to differentiate between a neuroendocrine tumor, SPN, and acinar cell carcinoma. The tumor cells were positive for cytokeratin, nuclear/membranous β-catenin, CD10, and CD56 and were negative for chromogranin A, synaptophysin, progesterone receptor, vimentin, and Bcl-10. Therefore, we suspected that the hypervascular tumor in the pancreatic tail was suspected to be SPN, but the results were not convincing. Laparoscopic spleen-preserving distal pancreatectomy was performed. Macroscopically, a well-circumscribed whitish-yellow solid mass, measuring 7 mm in the greatest dimension, was found in the pancreatic tail . Histologically, polygonal tumor cells with round nuclei and abundant eosinophilic cytoplasm formed thick trabeculae. The differentiation was moderate . Immunohistochemically, the tumor cells were positive for hepatocyte paraffin 1, AE1/AE3, and CD10 and negative for AFP, progesterone receptor, vimentin, chromogranin A, and synaptophysin . A canalicular pattern was confirmed on the polyclonal CEA staining . HC is characteristically hepatocyte paraffin 1 (HepPar1)-positive and has a canalicular pattern on polyclonal CEA staining. Finally, a diagnosis of moderately differentiated pancreatic HC was made. The patient’s postoperative course was uneventful, and he was discharged in good health 10 days after the operation. The patient did not receive adjuvant chemotherapy and remained recurrence-free at 6 months after the surgery. The serum levels of AFP (3 ng/mL) and PIVKA-II (28 mAU/mL) were normal at 1 month after the surgery. The latest serum levels of AFP (2 ng/mL) and PIVKA-II (25 mAU/mL) were normal at 6 months after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1423_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1423_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f7d59cfa48180d62b04cb5a1c2938e57591ab9f6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1423_en.txt
@@ -0,0 +1,2 @@
+The patient was a 59-year-old woman with complaints of intermittant abdominal pain, distention, and dyspepsia over 6 months. There were no specific diseases in her history except chronic atrial fibrillation. The laboratory results were in normal range except Gamma-glutamyl transpeptidase (358 IU/L) and alkaline phosphatase (288 IU/L) levels. Tumor and hepatitis markers were negative. Ultrasound examination had revealed a 49-mm mass, creating a dense acoustic shadow on the posterior area of the neck of the gallbladder. Magnetic resonance cholangiopancreatography (MRCP) had showed a hidropic gallbladder with an excessively dilated CBD, and a 110 mm × 41 mm stone emerging from CBD, showing finger-like projections into the biliary ducts. Intrahepatic biliary ducts were dilated, especially in the left lobe, having milimetric calculus inside; there was a 39 mm × 20 mm stone in the proximal segment of the left lobe, coalescing with the stone in CBD [Figures and ]. CBD was 5 cm in width, filled with a stone, emerging into the intrahepatic biliary ducts. Following a partial sphincterotomy, a stent of 12 cm length and 10 F diameter was inserted in CBD.
+In the operation, following cholecystectomy, an excessively dilated CBD was seen and after choledochotomy, a very large calculus that filled CBD completely was observed . Choledochotomy incision was carried forward and the calculus was extracted . After the extraction, it was observed to be a giant calculus, nearly 15 cm in length and 4.5 cm in width, that had taken the shape of CBD . After exploring CBD for any other masses, a T-tube choledochostomy with choledochoduodenostomy (CD) was performed . The bile duct was not biopsied to rule out a possible pre-existing choledochal cyst preoperatively. The patient was discharged without any complications on postoperative 8th day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1433_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1433_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6d021a60633ec4f1fe6217de2f8dd7dfefe22d5c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1433_en.txt
@@ -0,0 +1,6 @@
+A 55-year-old female was admitted to the hospital’s emergency department with the chief complaint of a painful mass located in the right thigh and perineal area and with progressed pain and paresthesia to the right thigh and right shin. The patient seemed ill but not toxic. No history of fever, abdominal pain, digestive dysfunctions, chest pain, cough, hemoptysis, urticarial were found. The vital signs were in a normal range, and there was no family history.
+Physical examination showed that the skin over the mass had no discoloration, and the size of the mass was around 5.7 cm long. The blood tests were normal, and the lab results showed no eosinophilia. The result of the ultrasonography examination was a cystic mass with suspicion toward femoral hernia. After a CT scan, the result of secondary workups was a multi-lobular cystic mass with no connection to the abdominal region , which suggested a hydatid cyst.
+The patient underwent surgery under spinal anesthesia in the next step, and the right thigh was opened up. A cystic mass with ecto- and endocyst with clinical similarity to a hydatid cyst was removed with wide margins and without penetration of the cyst wall. The removed specimen was sent for histological examination with the first impression of cystic hydatidosis.
+Received specimen in formalin consist of a creamy-whitish colored cyst M = 7 * 5 * 3 cm filled by multiple variable-sized creamy cysts . The cyst consists of three layers; the outermost fibrous pericyst layer, the middle laminated ectocyst layer, and the inner hyaline and acellular endocyst as the germinative layer, which encompasses daughter cysts and brood capsules with scolices. There may be granulomatous palisading reaction and pseudocyst formation as seen in cutaneous lesions .
+Following the surgical removal of the cyst, the patient underwent recovery. Besides, Post-surgical Abdominal and thoracic Ultrasonography screening were used to exclude recurrence. Albendazole 400 mg PO BID was prescribed for 3–6 months. An 18-months follow-up demonstrated no reoccurrence or any other site of cystic hydatidosis.
+After a year of routine follow-up, the patient did not demonstrate any signs of recurrence of the adverse effect of surgery, and she was entirely well.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1444_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1444_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..19135f31340c77a5414ea4a460451180b5a0bdb7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1444_en.txt
@@ -0,0 +1,2 @@
+A 47-year-old male who complained of upper abdominal pain and vomiting was referred to our hospital. He was a heavy drinker and had a past history of hospitalization for alcoholic chronic pancreatitis. Laboratory data revealed elevated levels of amylase (245 IU/L), CRP (14.99 mg/dl), and white blood cell count (14900/μL). Plain abdominal computed tomography (CT) showed a cystic lesion of 7 cm in size in the lumen near the second part of the duodenum. The cystic lesion showed high density inside. The pancreas was slightly enlarged, and the main pancreatic duct was dilated. Calcifications were seen in the uncus of the pancreas . Gastrointestinal endoscopy revealed that the lumen of the duodenum was deformed by a submucosal tumor-like mass and the endoscope could not pass through it . However, active bleeding was not seen in the lumen of the duodenum. A submucosal tumor or hematoma of the duodenum or a pancreatic pseudocyst associated with chronic pancreatitis was suspected. On the fourth day of hospitalization, his hemoglobin level had decreased from 14.0 to 11.1 g/dl. Contrast-enhanced CT demonstrated a high-density spot on the wall of the cystic lesion . A pancreatic pseudocyst complicated with intracystic hemorrhage was preliminary considered. Angiography was immediately performed, and a pseudoaneurysm was identified in the branch of the anterior superior pancreaticoduodenal artery (ASPDA) . The pseudoaneurysm was successfully treated with transcatheter arterial embolization (TAE). Anemia did not progress after that. Upper gastrointestinal series demonstrated a filling defect in the duodenum, while the inside of the cystic lesion was not contrasted . Magnetic resonance cholangiopancreatography (MRCP) was performed but did not show a communication between the cyst and the pancreatic and biliary ducts. Follow-up CT on the 27th day after TAE showed that the cyst had decreased in size to 2 cm and obstruction of the duodenum was gradually improved . Surgical treatment was considered for the pancreatic pseudocyst with intracystic hemorrhage. However, he refused an operation and was discharged on the 34th day after TAE.
+Two years later, abdominal pain and vomiting recurred. The cyst was enlarged again, and CT showed that it contained high-density fluid. Recurrence of a pancreatic pseudocyst with intracystic hemorrhage was suspected because of anemia progression. TAE was performed in the branches of the ASPDA and posterior superior pancreaticoduodenal artery (PSPDA). After TAE, the size of the cyst decreased and symptoms were relieved. However, the same symptoms recurred 2 months later. We obtained informed consent for surgical treatment, and we performed subtotal stomach-preserving pancreatoduodenectomy (SSPPD). Intraoperatively, severe inflammatory adhesion was noted around the pancreas head and the border between the pancreas and the cystic lesion was unclear. Macroscopically, a cystic mass of 5 cm in size was adjacent to the second part of the duodenum on the pancreas side and was close to the ampulla . A pinhole-sized communication was identified between the cyst and the duodenum lumen. Microscopically, the cyst was filled with mucus and the wall of the cyst was composed of gastric mucosa and shared a common proper muscle layer with the duodenum. Chronic ulcers and erosions were seen in the cyst . Ectopic gastric mucosa was observed in non-ulcerative region . Based on these findings, a diagnosis of duodenal duplication cyst was made. The patient’s postoperative course was uneventful, and he was discharged on the 30th day after the operation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1447_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1447_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b666a32aeffd64c9f1a5e296a6d2a42f8bd7022f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1447_en.txt
@@ -0,0 +1,9 @@
+A 77-year-old woman presented to the hospital with progressive swelling in the right hemiabdomen, a loss of appetite, and a weight loss of 8 kg in a period of 5 months. She was a former agricultural worker (including undocumented pesticide handling) and had no significant medical history, eight natural births, no alcohol or tobacco abuse, and no history of signs and symptoms of cholelithiasis. At the clinical examination, skin pallor and a firm, tender, slightly mobile lump in the right hypochondrium and the right iliac fossa, without signs of ascites, were detected.
+The abdominal ultrasound revealed a solid mass occupying the entire right hemi-abdomen, though it could not provide details about the origin or the relationships with neighboring structures, due to the large size and the inhomogeneous character of the tumor.
+MRI highlighted an abdominal tumor located in the right hypochondrium and right abdominal flank with liver invasion (segment V). At the lower pole, the tumor wall was discontinuous. Intraperitoneal tumor extension was detected over a length of approximately 25 mm, with the invasion of the small bowel and omentum at this level. The tumor had a mixed appearance: solid-wall, gadolinophilic, with a maximum thickness of 35 mm and an inhomogeneous central liquid portion. Multiple stones, some of them with a diameter of 18 mm, were visible in the lower part of the tumor, but most agglutinated in the upper part, with dimensions varying between 5 and 30 mm. There were no lymph nodes and no metastasis. The common bile duct appeared with a normal caliber, alithiasic, and pushed antero-superior by the tumor mass, with no sign of invasion. This imaging result is characteristic of primitive gallbladder cancer . A cT3N0M0 stage was established under the limitations of the imaging evaluation difficulties regarding the large volume of the tumor, which made it hard to evaluate its relationships with the neighboring structures. CEA and CA 19.9 levels were within normal ranges.
+After the median laparotomy, a giant tumor (25/17 cm) occupying the entire right abdominal flank from the subhepatic region to the right iliac fossa was identified, which included the gallbladder, segment V of the liver, mesocolon, omentum, and a jejunal loop invasion, with numerous inflammatory adhesions with the neighboring structures . A cholecystectomy was performed with liver wedge resection, enterectomy, the partial resection of the mesocolon and omentum, and loco-regional lymphadenectomy. The complete resection of the tumor was performed en bloc with the abovementioned structures.
+The postoperative evolution progressed without incident, with discharge on the 7th postoperative day.
+The microscopic description was suggestive of biliary-type intracholecystic papillary–tubular neoplasm, with high-grade dysplasia/carcinoma in situ and without neoplastic invasion in neighboring structures, pT2aN0Mo.
+The oncological (multidisciplinary) re-evaluation established an R0-type excision. Adjuvant treatment remained as a reserve (such as FOLFOX or FOLFIRI) in the case of loco-regional relapse or the appearance of metastases. Only clinical and paraclinical monitoring was decided.
+The patient is still alive two and a half years later, with no signs of local recurrence or metastases.
+The case depicted in exhibited a poorly differentiated adenocarcinoma with a poorly cohesive cell pattern (B), associated with a pancreatobiliary-type ICPN with high-grade dysplasia (C), being diffusely positive for specific lineage markers such as CK7 and MUC1 and expressing focal MUC5AC and MUC6.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1463_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1463_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..46f5acd058331ebb78ca96c3ff939fde19cd1d46
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1463_en.txt
@@ -0,0 +1,2 @@
+A 52-year-old female patient with OI had recently injured her left knee, rupturing her anterior cruciate ligament (ACL). She had pre-existing degenerative changes in her right knee with a deficient medical collateral ligament (MCL) of clinical grade 3, which had been symptomatic for 2 years prior to her fall . We opted to perform a right total knee replacement before addressing the left knee injury. This would provide her with an immediate stable right limb prior to addressing her left knee.
+A Nextgen Rotating Hinge Knee (ZimmerBiomet®) hinged prosthesis was used because of her incompetent MCL . The smallest components available were used because of her small anatomical bony dimensions. The OI population tend to experience growth retardation and standard implant sizes are generally over-sized for these patients. This necessitates pre-operative planning in the form of templating to ensure the specific implant sizes are available for the patient. In the absence of such implants, patient-specific implants and cutting guides should be considered for outlier cases . The initial postoperative course was uneventful. The patient mobilised slowly though. She had poor flexion at 6 weeks and a gentle manipulation was performed cognizant of the inherent dangers. She is currently at 2-year post-op with full extension and flexion to 110 degrees. The patient-reported outcome measures improved as follows: her visual analogue score (VAS) was 7/10, 3/10 and 2/10 before, 6 and 24 months after surgery respectively. The Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) knee score was 36.4, 59.4 and 86.4 before, 6 and 24 months after surgery respectively. She continued to wear a brace on left knee as she was reluctant to undergo an ACL reconstruction.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1476_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1476_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f176577108baecd492ba491f0c4602b51e421c3b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1476_en.txt
@@ -0,0 +1,8 @@
+A 79-year-old male complained of persistent diffuse abdominal pain for 4 d.
+Initially, the abdominal pain occurred abruptly after eating a big meal, 4 d prior to admission. The initial abdominal pain was mainly located in the right upper quarter abdominal area and then migrated to the whole abdomen. Additionally, the patient experienced nausea, vomiting, constipation, and fever. Recurrent abdominal pain was noted for the 4 d as well. Sonography-guided percutaneous catheter drainage of the left subphrenic abscess, as shown by contrast computed tomography (CT) of the abdomen, was performed. The bilirubin level was 76.0 mg/dL and volume of abscess drainage was around 600 mL. The abscess culture yielded Enterococcus faecalis and Enterobacter cloacae complex. The blood culture yielded no pathogen isolates. Biloma was confirmed. However, the patient still complained of epigastric pain after drainage.
+The patient had a medical history of hypertension and had taken an antihypertensive drug regularly.
+The patient’s personal and family histories were unremarkable.
+Initial vital signs were a temperature of 37.8 °C, heart rate of 126 beats/min, blood pressure of 163/93 mmHg, and respiratory rate of 32 breaths/min. There was no apparent loss of consciousness. Physical examination showed icteric sclera, abdominal fullness, diffuse tenderness, and muscle guarding. Follow-up vital signs before repeat abdominal CT for persistent abdominal pain were a temperature of 37.5 °C, heart rate of 116 beats/min, blood pressure of 162/84 mmHg, and respiratory rate of 20 breaths/min. Severe muscle guarding and diffuse tenderness were observed.
+Abnormal laboratory findings included hyperbilirubinemia (total bilirubin: 3.0 mg/dL; reference range: ≤ 1.2 mg/dL), mildly elevated alkaline phosphatase (138 U/L; reference range: 40-129 U/L), hyponatremia (sodium: 127 mmol/L; reference range: 136-145 mmol/L), impaired renal function (creatinine: 1.59 mg/dL; reference range: 0.70-1.20 mg/dL), white blood cell count of 3200/μL (reference range: 3400-9500/μL), and 8% band form of white blood cells (reference range: 0.0%-4.2%).
+Plain abdominal radiography showed ileus and contrast abdominal CT showed a dilated common bile duct (CBD) and left subphrenic abscess . Repeat contrast CT of the abdomen was performed for persistent abdominal pain after biloma drainage and showed bile leakage and gastric wall thickening . Esophagogastroduodenoscopy (EGD) showed an edematous, hyperemic gastric mucosa with poor distensibility . Endoscopic retrograde cholangiopancreatography after EGD showed a dilated CBD with one filling defect of about 10 mm in size .
+The gastric mucosal culture yielded Enterococcus faecalis and the biopsy showed that the gastric submucosa and mucosa were infiltrated by clusters of lymphocytes, neutrophils, and plasma cells . According to initial CT and endoscopic retrograde cholangiopancreatography, the etiology of the initial abdominal pain with fever was a CBD stone with cholangitis and spontaneous biloma. However, according to serial CT images and gastric mucosal culture, the persistent pain after biloma drainage was caused by PG. The etiology of PG was bile leakage after biloma drainage.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1493_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1493_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9f4ea8a3e7a515e2d3236568a906e376665677c7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1493_en.txt
@@ -0,0 +1,2 @@
+A 47-year-old man was found to have optic disc swelling by his optometrist. MRI revealed a 7.1 cm sellar mass (Additional file : Figure S1), shown to be an ACTH-positive pituitary adenoma on transsphenoidal biopsy. He had a history of obesity, hypertension, gout and renal calculi but no cyclical symptoms or blood pressure fluctuations. Body mass index was 52.1 kg/m2 but he had no supraclavicular fat pads, Cushingoid striae, facial plethora, ecchymoses or proximal weakness. He had a right-sided oculomotor nerve palsy and right-sided proptosis and conjunctival injection suggesting ophthalmic vein compression. He was eupituitary apart from fluctuating ACTH-dependent cortisol production ranging from normal to 35-fold ULN (Additional file : Figure S1). He was diagnosed with CCD due to a giant corticotrophinoma with intermittent biochemical hypercortisolism, although the precise temporal cyclicity could not be defined prior to transcranial partial tumour resection 1 week later. Histopathology confirmed a corticotrophinoma with no significant mitotic activity and a Ki67 count of < 1%. He was eucortisolaemic immediately pre- and postoperatively with ACTH lowering from 376 ng/L (ULN 60) to 169 ng/L (Additional file : Figure S1). Postoperative complications included acute kidney injury, transient hyperglycaemia, pneumonia, deep vein thrombosis and central hypothyroidism. He later noticed improved BP control, reduced appetite and improved satiety with early but transient weight loss. Serial MRI showed a stable 4.2 cm tumour remnant (Additional file : Figure S1). Despite having typical CS comorbidities and postoperative complications, he has had no cyclical symptoms to guide the timing of investigations and no further episodes of overt hypercortisolism have been detected during intermittent testing. His family history is negative for endocrine tumours.
+We performed WES of germline and tumour DNA and single nucleotide polymorphism (SNP) array of tumour DNA to identify sequencing variants and copy number variation in circadian/pituitary-associated genes. Tumour immunohistochemistry was performed to further evaluate the leading genetic variant of interest. Further details are provided in Additional file : Supplementary Methods.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1502_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1502_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..444a6e625aa74f687c8b3981bd910d83ccb3b01c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1502_en.txt
@@ -0,0 +1,6 @@
+A 26-year-old man complained of foamy urine for 3 years without hospital examination. Proteinuria was found in routine physical examinations 1 month prior, and he attended our clinic on the basis of these results. Laboratory data were as follows: urine analysis showed proteinuria (dipstick 2 +) and hematuria (3 +), 24-h uric protein quantification was 0.75 g/day (normal range, 0–0.15 g/day), and serum creatinine (Scr) was 151 μmol/L (normal range, 88–104 μmol/L). Based on abnormalities in the examination indicators, the patient was admitted to the nephrology department with an initial diagnosis of glomerulonephritis and renal insufficiency.
+Further detailed consultations and examinations were carried out. The patient felt no other discomfort. His routine physical examinations showed no obvious abnormalities. He had no edema or hypertension, and his urine output was normal. During neurological examination, the patient was found to have an imperceptible tremor in his hands. A review of medical history revealed that the patient had allergic purpura 22 years prior and pneumothorax 7 years prior. The patient denied having consumed alcohol or abused drugs and denied having a history of hepatitis or family history of chronic or genetic diseases. His parents had a nonconsanguineous marriage. Laboratory examinations indicated normal white blood cell counts and hemoglobin levels. Urinalysis showed 2 + proteinuria with microhematuria (approximately 100 erythrocytes per high-power field), and his 24-h uric protein quantity fluctuated from 0.75 to 1.1 g/day. Abnormal renal function with an Scr of 150–170 μmol/L was detected. Liver function was normal, and other laboratory examinations, including serum electrolytes, thyroid function, C-reactive protein, and serum complement (C3 and C4), were also within the normal range. Additionally, immunoglobulin levels (IgG and IgM) were normal, except for mild elevation of IgA (3.73 g/L, normal range: 0.97–3.2 g/L). Serological tests were negative for anti-nuclear, anti-neutrophil cytoplasmic, anti-glomerular basement membrane, anti-hepatitis B virus, and anti-hepatitis C virus antibodies. Routine physical examination results indicated normal electrocardiogram and color Doppler ultrasound with normal kidney size and shape. Color ultrasound of the liver, gallbladder, spleen, and pancreas indicated rough echo in the liver.
+Renal biopsy was performed to identify kidney disease. Analysis of renal biopsy specimens using light microscopy showed mesangial cells and matrix proliferation with glomeruli focal segmental hyperplasia and sclerosis (1/10 glomerulus; Fig. a). Epithelial cells were vacuolated and showed granular degeneration. Additionally, brush margins disappeared, the lumen dilated, and focal atrophy (atrophy area of approximately 15%) was observed in some renal tubules. Interstitial focal inflammatory cell infiltration was accompanied by fibrosis, and the walls of arterioles showed no obvious pathological changes . Immunofluorescence staining showed granular deposition of IgA+++ in the mesangium . No glomeruli were observed by electron microscopy. Silver staining showed shedding of tubule bristles and enhancement of interstitial edema . The pathologic diagnosis was focal hyperplastic IgA nephropathy accompanied by acute tubular interstitial injury (Lee grade III, Oxford grade M1E0S0T1).
+Diagnosis of IgA nephropathy is relatively simple based on hematuria, proteinuria, and renal biopsy results; however, renal pathology may not yield a clear diagnosis. In our study, the observed pathological changes associated with IgA nephropathy did not explain the renal dysfunction in our patient. Additionally, the degree of tubular injury was not consistent with glomerular lesions. Thus, reasons other than IgA nephropathy may contribute to tubular injury. More importantly, the young patient in our study showed rough echo of the liver in our ultrasound findings. Although we repeatedly questioned the patient about his medical history, no common causes of liver damage, such as hepatitis or a history of drugs and alcohol, were reported by the patient. Furthermore, magnetic resonance imaging of the liver revealed liver atrophy and splenomegaly. The unexplained symptoms were confusing; however, the chief physician of our institution observed the mild involuntary fingertip tremors of the patient, and WD was then considered as a potential diagnosis based on this nonspecific neurological abnormality combined with the observed liver damage.
+Renal biopsy was re-examined, and some subtle changes that had been overlooked on the first analysis were detected. For example, granular deposition in the cytoplasm of renal tubule epithelial cells was observed using light microscopy . Under electron microscopy, some renal tubular epithelial cells showed degeneration of mitochondria in the cytoplasm. The size of mitochondria varied, the inner and outer membranes were separated, and the cristae became shorter and disappeared . Moreover, lysosome size increased, and some round granules were deposited in the lysosome . Timm’s copper staining revealed some brown to black deposits in some renal tubular epithelial cells . Measurement of copper metabolism further confirmed the diagnosis of WD; lower levels of serum ceruloplasmin (0.02 g/L, normal range: 0.27–0.47 g/L) and increased urinary excretion of copper (260.4 μg/day, normal range: 10–60 g/day) were detected, although normal copper serum levels (12.52 μmol/L, normal range: 7.12–21.29 μmol/L) were also observed. The presence of K–F rings in the patient’s eyes, as observed by slit lamp examination, also supported the diagnosis of WD. To confirm this diagnosis, we also performed DNA sequence analysis and identified two mutations in the ATP7B gene; one was a known pathogenic mutation, whereas the other was a suspected pathogenic mutation .
+Finally, the patient was diagnosed with WD. The observed kidney damage was identified as WD-associated renal injury, including renal tubulointerstitial injury and focal proliferative IgA nephropathy. The patient agreed to targeted treatment, including penicillamine 250 mg twice daily and oral zinc sulfate daily. Additionally, he was prescribed losartan to control proteinuria while monitoring renal function and blood pressure. During the 3-year follow-up, the tremor in his hands disappeared, and his 24-h uric protein level fluctuated from 0.3 to 0.5 g/day. Renal dysfunction was reversed, and Scr was maintained at approximately 110–130 μmol/L. Moreover, 24-h uric cooper dropped from 260.4 to 69 μg. The patient retained normal liver function and maintained a good quality of daily life.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1523_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1523_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..317933a364d7b1e8a3c9c31de86e7033d52ef879
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1523_en.txt
@@ -0,0 +1,4 @@
+A 20-years-old, British, male sustained cervical spinal cord injury (ASIA impairment scale B) at C-5 level in 1970 while teaching gymnastics. He was a physical training instructor in army and he landed on the wrong side of a trampoline. This gentleman had been managing his bladder by penile sheath drainage until 2013 when he underwent surgery for upper gastrointestinal bleeding. Since then, he had been draining urine by urethral Foley catheter.
+Following a routine change of urethral catheter by a health professional, this patient started sweating profusely. The Foley catheter was draining urine; there was no bypassing, no bleeding per urethra, and no haematuria. Patient’s wife, who had been looking after her tetraplegic husband for more than forty years, told the health professionals that the catheter might have been placed incorrectly but her concerns were ignored by health professionals. Therefore, this patient came to spinal unit for advice. On clinical examination, this patient was sweating profusely over his head and face. Blood pressure was 140/70 mm Hg. The patient did not have symptoms of urine infection nor did he feel unwell. Ultrasound scan of urinary tract revealed no urinary calculi, no hydronephrosis. The balloon of Foley catheter was not seen in urinary bladder but this finding was not recognised by radiologist and spinal cord physician. Patient continued to sweat profusely; therefore, Computed Tomography (CT) of pelvis was performed, but there was a delay of ten days. Special attention was taken to include the entire urethra in addition to urinary bladder for scanning, as misplacement of urethral catheter was suspected by the spinal cord physician. CT revealed the balloon of Foley catheter in the over-stretched prostato-membranous urethra . The tip of Foley catheter was not located within the urinary bladder but was lying distal to bladder neck . Flexible cystoscopy was performed and Foley catheter was inserted into the bladder over a guide wire. The intensity of sweating decreased; noxious stimuli arising from traumatised urethra might take a long while to settle.
+24-hours ECG monitoring revealed bradycardia: slowest being 39 beats per minute , 214 episodes, and 36 beats at 00:09:04. There was a pause of 2.08 seconds at 22:14:51 . X-ray of pelvis revealed marked osteoarthritic changes in both hips; X-ray of lumbar spine revealed slight scoliosis concave to the right; anterior hyperostosis, most marked at L4/5; disc spacing was well maintained.
+Ultrasound scan revealed normal size right kidney measuring 12.5 cm with no hydronephrosis or calculi. The left kidney was atrophic measuring 8.4 cm, cortical depth of 14.1 mm. No calculus was seen. Blood tests: Urea: 5.9 mmol/L; Creatinine: 69 micromol/L; HbA1c: 36 mmol/mol; PSA: 0.15 ug/L. Urine culture yielded growth of >108/L of Staphylococcus aureus. Cytology of urine revealed abundant neutrophils and red cells. Groups of urothelial cells were seen with slightly enlarged nuclei. Some of the groups have a vaguely papillary appearance, which could be seen in low-grade urothelial neoplasms, infection, instrumentation or stones. A follow-up urine cytology revealed a few inflammatory cells and urothelial cells. No malignant cells were seen.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1574_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1574_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..113ce6b1bd1a240ea1069310afde1ac9887043c1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1574_en.txt
@@ -0,0 +1,4 @@
+A 37-year-old Caucasian female nonsmoker with no known past medical history presented to our emergency department with 4 months of dyspnea and back pain. At her initial presentation 4 months prior to an outside facility, she underwent a chest C-ray and chest computed tomography (CT) scan, which showed a right upper lobe consolidation. She had been treated for and discharged with a diagnosis of pneumonia. Two months after her initial presentation, she underwent an outpatient bronchoscopy with bronchoalveolar lavage (BAL) and transbronchial right upper lobe biopsy owing to persistent symptoms and a concern for malignancy. Fungal studies and acid-fast bacilli fluorochrome smears were negative, and biopsy results were negative for malignant cells; the pathology results were consistent with chronic inflammation. Upon arrival to our emergency room, she again reported similar symptoms. Physical examination was notable for neck pain on palpation and tachypnea. A chest CT with intravenous (IV) contrast was performed, revealing near-complete right upper lobe collapse, right upper lobe consolidation, enlarged subcarinal lymph node, and enlarged station 6 lymph node . Magnetic resonance imaging (MRI) of the spine was performed, demonstrating a C7 50% compression fracture and lytic lesions throughout the spinal vertebrae, concerning for metastatic disease. A CT of the abdomen and pelvis was also performed, revealing a single 15-mm hypodense nodule on the liver .
+The patient subsequently underwent a transthoracic right upper lobe biopsy, which showed dense fibrous pleural bits, samples of alveolar parenchyma showing interstitial fibrosis, and a patchy dense lymphocytic infiltrate; no malignant cells were seen on histopathological examination. Next, the patient underwent bronchoscopy and endobronchial ultrasound with transbronchial lymph node sampling, as well as brushing and BAL of the right upper lobe. Most studies were unremarkable except the BAL cytology exhibit, which was positive for poorly differentiated neoplastic cells, raising the possibility of a poorly differentiated carcinoma; however, the material on the cell block was insufficient to run immunostains. As the concern for metastatic disease remained high on our differential diagnosis, we pursued a liver biopsy to better characterize the malignancy. The patient underwent a fluoroscopy-guided liver biopsy of the aforementioned liver nodule, which demonstrated a malignant undifferentiated neoplasm with epithelioid morphology and weak neuroendocrine differentiation.
+The cells formed nests/cords in a background of hyalinized sclerotic stroma, frequently demonstrating eosinophilic cytoplasm and round-to-ovoid nuclei . These ancillary studies were insufficient to rule out epithelioid synovial sarcoma, breast malignancy, renal malignancy, thyroid malignancy, gynecologic primary tumors, and epithelioid osteosarcoma. The neoplastic cells were weakly reactive for synaptophysin, and CD99 staining showed a membranous pattern . In a subset, GATA-3 was positive and PAX-8 was weakly positive . However, the neoplastic cells were nonreactive to ER (breast marker) and SATB2 (lower gastrointestinal and osteosarcoma marker). Moreover, the tumor cells were negative for Oscar pankeratin, CK7, CK20, Moc-31, TTF-1, WT-1, HMB45, Melan-A, SOX-10, S100, Inhibin, SMA, MyoD1, CD117, CD45, CD30, and CD34. Thus, the liver tissue was sent for a second opinion for evaluation by a pathologist with expertise in gastrointestinal, liver, soft tissue, and cardiothoracic pathology in a state-of-the-art center at the national and international levels. They found that a specialized panel of immunohistochemical stains revealed that the tumor cells were reactive to MUC4 expression. BRG1 and INI1 immunostains revealed preserved nuclear staining; however, claudin-4, ERG, CD31, CAMTA1, P40, ETV-4, and NUT stains were negative. Subsequently, a diagnosis of sclerosing epithelioid fibrosarcoma was concluded.
+Based on our diagnostic workup, the patient was promptly started on doxorubicin therapy. The patient ultimately joined a genetic research protocol at a major cancer research center. Next-generation sequencing (Tempus genetic testing) was completed to evaluate for any variant known to increase her risk for cancer. There were no genes identified that would increase her risk for cancer. However, there was an identified variant of unknown significance of the WRN gene, an autosomal recessive gene associated with Werner syndrome (WS). She has not had any clear manifestations of WS other than malignancy and has yet to be assessed for osteoporosis. At 3-month follow-up, she is in the early stages of her treatment course and has tolerated her regimen without issues.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1583_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1583_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..92f7e2c200482db8b45d4ce91181bd46f6f8ebc3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1583_en.txt
@@ -0,0 +1,3 @@
+An 83-year-old man was brought to our emergency room with 10-day history of fever, severe headache, and difficulty in moving. MRI revealed a brain abscess, which was treated by abscess drainage and systemic antibiotic treatment. Although the patient had no symptoms, a CT performed to determine the cause of the brain abscess revealed thickening of the wall of the esophagus , and the patient was referred to our department.
+Barium swallow revealed a tumor measuring 6 cm in length with an abnormal ulcer mound in the middle thoracic esophagus; endoscopy revealed a Type 2 tumor . Histopathological examination of biopsy specimens revealed the squamous cell carcinoma. Abdominal and chest CT revealed wall thickening in the middle thoracic esophagus without invasion of the adjacent mediastinal organs or mediastinal lymph node metastasis. In addition, CT revealed an azygos lobe in the right thoracic cavity . We planned the esophagectomy for the esophageal cancer after control of the brain abscess. Although intrathoracic adhesions were anticipated on account of a previous history of bacterial pyothorax 14 years ago, we decided to perform esophagectomy via a thoracoscopic approach without any preoperative treatment because of his advanced age. After consulting with the respiratory surgeons, we planned to resect the abnormal azygos vein during esophagectomy.
+The patient was placed in the prone position. Due to the adhesions in the thoracic cavity as expected, insertion of the trocars required some ingenuity. We performed dissection of adhesions using a 10-mm flexible scope and obtained an adequate field of view. Trocars were inserted as needed while performing dissection of adhesion, and we finally inserted the four trocars into the right thoracic cavity: three 12-mm trocars into the fifth intercostal space on the posterior axillary line, seventh intercostal space at the midpoint between the inferior scapular angle line and the posterior axillary line, and ninth intercostal space on the level of the inferior scapular angle, and a 5-mm trocar into the sixth intercostal space on the mid-axillary line. Although we usually insert a trocar into the third intercostal space on the mid-axillary line, we could not insert it due to adhesion of upper lobe of the of right lung. Therefore, we performed all surgical procedures via the four trocars. Then, we continued the dissection of remaining adhesion in the thoracic cavity. The middle and lower mediastinum was manipulated first because of the strong adhesions around the esophagus in the middle and lower mediastinum and the tumor's extensive contact with the left main bronchus on preoperative CT . Fortunately, the adhesions were detached without any damage, and the esophagus could be dissected from surrounding organs. Adhesions around the upper esophagus were not severe and fortunately found the azygos lobe easier than expected, and the azygos vein was supported by the mesentery draining into the superior vena cava . It might interfere with forceps operation and the surgical field or pose a risk of injury during esophagectomy, after dividing the mesentery, we clipped and cut the vessel with a vessel-sealing system, and both ends were ligated using the endloop™ . After that, we performed McKeown esophagectomy with dissection for three field lymph nodes including around bilateral recurrent laryngeal nerve, as previously described . The operation time for the thoracic part was 325 min, and the blood loss during the thoracic part of the surgery amounted to 29 ml. The postoperative course was uneventful and physical functions that were impaired by the brain abscess recovered well. The patient was discharged on the 21st postoperative day. Histopathological examination of the resected specimen confirmed the diagnosis of esophageal squamous cell carcinoma, and the lesion was classified as pT3, pN0, M0, pStageIIB (UICC 8th).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1588_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1588_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..788b0d7003d8d575388fbbe0a6e4224807377781
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1588_en.txt
@@ -0,0 +1,2 @@
+A 78-year-old male with chronic kidney disease, dementia and sequelae of cerebral hemorrhage presented to his family doctor complaining of back pain; however, there were no abnormal findings on physical examination. Three days later, the back pain worsened and an ambulance was called. When the ambulance crew (including an emergency doctor) arrived at his home, his systolic blood pressure was 50 mm Hg, and the doctor performed portable echocardiography on site. Cardiac tamponade was diagnosed, and pericardiocentesis was performed using a puncture needle via the subxiphoidal approach. After draining ~ 500 ml of bloody pericardial fluid, the patient’s blood pressure immediately increased to 124/98 mm Hg. The patient was transferred to our hospital by helicopter with the outer cannula of the puncture needle placed in the pericardial cavity, and his hemodynamic status was stable at the time of arrival. We immediately started intravenous administration of saline (200 mL/h) to prevent the decrease in blood pressure due to blood loss. Electrocardiogram revealed negative T waves with slight ST elevation in II, III, and aVF leads, and echocardiography revealed severe hypokinesis at the left ventricular inferior wall and a small pericardial effusion. Laboratory tests showed the abnormal values in white blood cell (12.5 × 109/L, reference range, 3.3 to 8.6 × 109/L), C-reactive protein levels (68.5 mg/L, reference range < 1.4 mg/L), creatinine (1.24 mg/dL, reference range, 0.46–0.79 mg/dL), and highly sensitive troponin I (6559 ng/L, reference range < 34.2 ng/L). Creatinine phosphokinase levels (101 IU/L, reference range, 41 to 153 IU/L), hemoglobin (12.3 g/L, reference range, 11.6 to 14.8 g/L), and platelets (254 × 109/L, reference range, 158 to 348 × 109/L) were within reference range. We quickly performed contrast-enhanced computed tomography of the chest. A small protrusion of contrast media was observed on the inferior wall of the left ventricle, suggesting cardiac rupture due to acute myocardial infarction (AMI) . The tip of the outer cannula was confirmed in the pericardial cavity and appeared to reach epicardial adipose tissue around the right ventricle . Emergency coronary angiography was then performed, which confirmed occlusion of the posterior descending branch of the left circumflex coronary artery . Stenotic or occluded lesions were not found in other coronary arteries, and the patient's coronary tree was left side dominant. In addition, extravasation of contrast medium due to Ellis type III coronary artery perforation was observed in the acute marginal branch of the right coronary artery . We considered that coronary artery perforation had occurred as a complication of the pericardial puncture, and we performed transcatheter coil embolization of the perforated branch. A hydrophilic microcatheter (internal diameter, 0.018-in.; MIZUKI standard, KANEKA, Japan) was advanced selectively immediately proximal to the site of leakage in the acute marginal branch. One 0.018-in. and 20-mm-long tapered microcoil (diameter, 2 mm; Hilal, Cook, USA) was quickly released using the microcatheter, and angiography confirmed immediate vessel sealing and hemostasis 170 min after the emergency pericardiocentesis . After the coil embolization, there was no new bloody pericardial effluent and the patient was hemodynamically stable. Therefore, we reduced the rate of intravenous saline administration to 1 mL/kg/h. The total amount of drained bloody pericardial fluid was 610 ml including the first 500 ml. Hemoglobin level decreased to 8.9 g/L, and we performed blood transfusion. The total amount of contrast medium used in contrast-enhanced computed tomography and coronary angiography was 165 ml. Creatinine increased to 1.89 mg/dL 48 h after the use of contrast medium, and the urine volume decreased. Therefore, intravenous administration of saline continued, and then the urine volume gradually increased. Consequently, Intravenous administration of saline had been performed for 7 days. Timeline of clinical presentation and treatment was presented in Table .
+Oozing-type cardiac rupture due to AMI was considered as a cause of the cardiac tamponade, but the time of onset of AMI could not be identified, and subsequent blood tests had shown no increase in cardiac enzyme levels. Considering the general condition of the patient, who had dementia and comorbid chronic kidney disease, and the requests of the patient and his family, the patient underwent conservative treatment without cardiac surgery for oozing-type cardiac rupture and any procedure for occlusion of the posterior descending branch of the left circumflex coronary artery. Although the patient made steady progress without a further increase in pericardial effusion after the procedure, the patient needed treatment for a concomitant aspiration pneumonia (from day 3 to day 24 of admission) and rehabilitation for muscle weakness due to protracted bed rest. Finally, the patient was discharged on the 50th day after admission. Creatinine level was 1.28 mg/dL at the time of discharge.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1599_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1599_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..19368baec18fa8d0593300e8b3d665c4483e1101
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1599_en.txt
@@ -0,0 +1,9 @@
+In October 2009, a four-year-old girl was referred to the Rare Disease Unit of Bambino Gesù Children Hospital, presenting with phthisis bulbi (atrophy of the ocular bulb) of the left eye. She was the second child of Caucasian, non-consanguineous parents. Since the age of two-year-old, she developed recurrent episodes of conjunctivitis with pseudomembranes on the eyelids. After the failure of medical treatments, topical antibiotics and steroids, the lesions were surgically excised, but after a few weeks, they recurred, and conjunctivitis persisted. The surgical procedure was repeated twice.
+After the third recurrence, she was referred to our unit with a suspected diagnosis of LC.
+At first examination, the left eye presented a red, woody-like pseudomembrane (9 mm thick) that involved the edge of the upper lid and the upper tarsal conjunctiva, causing ectropion of the lid . Slit lamp examination revealed a yellow-white membrane affecting the bulbar conjunctiva, fornix, and cornea, hampering the evaluation of both anterior and posterior segments. Brain MRI with Optic Nerves study, showed severe involvement of the left eye .
+The right eye examination showed a small area of corneal de-epithelialization with a paracentral stromal opacity, and a whitish-yellow soft pseudomembrane involving the upper tarsal conjunctiva. The bulbar conjunctiva was not involved, and the rest of the ocular examination was normal. .
+After approval of the local Ethical Committee, treatment was started with topical plasminogen drops prepared from fresh frozen plasma (Kedrion Industrie Farmaceutiche, Lucca, Italy) in sodium hyaluronate, according to the Watts formulation [, ]. An intensive treatment schedule was chosen, with two drops instilled every two hours in both eyes.
+A rapid and complete response was observed in the right eye after one week. . In the left eye, we observed a reduction of the pseudomembranes after one week of treatment . The therapy was further intensified three days before surgery to two drops every hour. After that the red woody-like membrane was surgically removed. The thickened subconjunctival tissue was debulked via a conjunctival approach but the ectropion and lid retraction was not corrected until the upper lid retractors were recessed. The debulked posterior surface of the tarsus was left bare to granulate and the debulked flaps of conjunctiva were approximated to the upper border of the tarsus. The eyelid margin was left intact. A prosthetic shell was inserted behind the eyelids to maintain the conjunctival sac. The plasminogen was restarted every two hours.
+The eye drop schedule was prolonged from every two hours to every four hours, and there was no evidence of membrane reformation at the twelve-month follow-up evaluation up to the present twelve-year follow-up and the eye prosthesis is well tolerated .
+After three years of follow-up a nodular asymptomatic gingival hypertrophy with ulceration around the eruption site of tooth 36, was found. Non-surgical management of the lesion and strict follow-up was performed. The first molar erupted completely, with no signs of bone and periodontal pathology.
+Genomic DNA was extracted from peripheral blood by using NucleoSpin tissue, according to the manufacturer's protocol (Macherey–Nagel, Germany). Whole exome sequencing (WES) was conducted on the proband and his parents by using kit Twist Custom Panel (clinical exome—Twist Bioscience) on platform NovaSeq6000 (Illumina). The bioinformatics analysis was performed trough BWA Aligner or DRAGEN Germline Pipeline systems and the sequences were aligned to reference human genome GRCh37. The DNA sequence analysis showed the variants c.112A > G (p.Lys38Glu) and c.217 T > C (p.Cys73Arg) in compound heterozygosity of PLG gene. The first variant was inherited by the father and the second by the mother.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1602_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1602_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d3a00cbee4fd3b748124e06e878dd17b66be49db
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1602_en.txt
@@ -0,0 +1,6 @@
+A 49-year-old male Chinese HCC patient with chronic hepatitis B virus (HBV) infection (having lasted more than 20 years) and cirrhosis. The laboratory results showed the following: alanine aminotransferase (ALT) 43.4 U/L, aspartate aminotransferase (AST) 35.7 U/L, alkaline phosphatase (ALP) 200.5 U/L, gamma-glutamyl transpeptidase (GGT) 188.1 U/L, bilirubin (TBil) 15.5 μmol/L, and a-fetoprotein (AFP) > 2000 μg/L. Liver function of the patient was Child-Pugh A grade and preoperative indocyanine green retention rate (ICG) was 10.5%.
+Computed tomography (CT) showed a large mass about 11.3 × 9.9 cm2 in size in the right hepatic lobe, and a tumor thrombus (TT) in the right hepatic vein (RHV) extending into the IVC .
+Using both his medical history and imaging findings, he was diagnosed with HCC associated with IVCTT. The clinical stage was BCLC stage C. The patient had no symptoms of right heart failure or pulmonary embolization at admission. Considering that the patient had normal hepatic function without distant metastasis, anterior approach right hepatectomy combined with IVC thrombectomy using trans-diaphragmatic intrapericardial IVC occlusion was planned for this patient .
+Surgery was performed via a subcostal inverse-L-shaped incision. At laparotomy, a tumor located in the right lobe of cirrhotic liver and no detectable ascites or peritoneal metastasis was observed. After the right hepatic artery and the right portal vein branch were ligated, hepatic parenchymal resection was performed using the clamp-crushing technique with inflow occlusion (Pringle’s maneuver) following the demarcation . Then the suprarenal IVC and portal vein were dissected and taped from the caudate lobe . The retrohepatic IVC below the confluence of the common channel of the left and middle hepatic veins was encircled by a vascular clamp. The diaphragm was transected via a vertical incision exposing the right atrial appendage. Then intraoperative ultrasonography was used to show that a TT in the RHV, involving the IVC, but it had not entered in the right atrium. The supradiaphragmatic IVC was encircled though trans-diaphragmatic intrapericardial IVC . The sequence of total hepatic vascular exclusion is shown in Fig. d and the IVTT was then removed en bloc successfully with Babcock forceps, the whole removal of IVCTT with IVC exclusion cost 20 min. The total operation required 481 min and the intraoperative hemorrhage was 900 ml.
+The macroscopic findings of tumor measured 10 × 11 × 13 cm3 and the TT measured 3.0 × 2.0 cm2 . Postoperative histological diagnosis showed moderately differentiated HCC (grade II-III Edmondson) had invaded the right hepatic vein with hepatic fibrosis and intravascular tumor thrombus. No positive resection margins or local lymph node metastasis were observed microscopically . The TNM stage was T3bN0M0.
+Postoperative recovery was uneventful. The patient was discharged with few adverse events after the operation. The patient was disease-free at 32 months after the initial treatment .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1636_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1636_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2ebd5c07a9fd048c7891a14cbdc28d7e2317e743
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1636_en.txt
@@ -0,0 +1,5 @@
+The patient, a 5-month-old boy, was delivered full-term and vaginally without complications. The neonatal course was uneventful. At discharge, he was exclusively breastfed and his weight and length were in the 50th percentile.
+A family history revealed consanguineous parents coming from Northern Africa; the mother had a history of two miscarriages before the birth of his older siblings. His elder brother had asthma and presented with abnormalities of the rib cage, while his sister underwent surgical treatment for transposition of the great vessels.
+At age 3 months, after a chickenpox infection, he experienced his first respiratory exacerbation followed by recurrent wheezing associated with airway infections, that required frequent admissions to the emergency room and treatment with inhaled beta2-adrenergic drugs, antibiotics and oral steroids. The child had received all of the mandatory and recommended vaccines for his age; he had no allergies and no history of apparent prior failure to thrive. At the age of 5 months, he was admitted to our Pediatric Unit for acute respiratory distress in a framework of suspected viral bronchiolitis. He presented with tachypnea (103/min), retractions, and hypoxemia (oxygen saturation on room air at 88 % at rest), requiring oxygen supplementation. Expiratory wheezing and crackling were the main respiratory auscultation findings. A clinical examination also revealed a significant reduction in growth velocity (both weight and length from the 50th to 10th percentile). Blood gas analysis revealed a respiratory acidosis (pH: 7,30; PaCO2: 48 mmHg; HCO3: 19 mmol/l). A chest radiograph revealed over-inflation of the lungs with some interstitial markings in the pulmonary hilum and right upper lobe. Nasal secretions were analyzed for respiratory syncytial virus, rhinovirus, influenza virus, parainfluenza virus and adenovirus; all resulted negative. After a first therapeutic trial with nebulized β2-adrenergic agonists without improvement of symptoms, he was treated with respiratory support in combination with appropriate fluid and nutrition management.
+Considering the persistent hypoxemia, despite supplemental oxygen support together with the associated pronounced respiratory distress and the clinical and radiological findings, the bronchiolitis diagnosis was determined to be misleading and an extensive diagnostic workup was performed. Complete blood count and measurement of serum immunoglobulin levels were normal; sweat test, serological tests for bacterial infections (Chlamydia and Mycoplasma pneumoniae, Bordetella pertussis), echocardiography and intraluminal impedance pH monitoring were negative. Assessment of the ciliary ultrastructure, beat frequency and pattern from a brush biopsy of the nasal epithelium excluded the diagnosis of primary ciliary dyskinesia. Subsequently, genetic testing for all exons encoding the ABCA3 surfactant gene (ATP-binding cassette 3) and the SFTPC gene (surfactant protein C) was carried out for suspected genetic surfactant disorders, with negative results. A diagnostic bronchoscopy excluded airway malacia and a bronchoalveolar lavage (BAL) revealed the high prevalence of neutrophils and the presence of slightly enlarged lymphocyte aggregates and macrophages with intracellular lipids. Microbiological examination of the BAL fluid showed an important colonization by Streptococcus pneumnoniae, Moraxella catarrhalis, Rhinovirus and Adenovirus. Meanwhile, high-resolution chest computed tomography (HRCT) showed air trapping in the left upper lobe and both lower lobes, and ground-glass opacities of the middle-upper lobes and of the lingula . This typical radiological pattern raised the possibility of neuroendocrine cell hyperplasia of infancy (NEHI). In order to complete the diagnostic workup, an open lung biopsy performed at 9 months of age showed the presence of areas characterized by macrophage alveolitis associated with neuroendocrine cell hyperplasia of the small airways. Immunohistochemistry demonstrated a significant number of bombesin-positive cells in the small airways walls . Finally, NEHI was diagnosed on the basis of radiological and histopathological findings typical of NEHI, while pulmonary interstitial glycogenosis was excluded with the biopsy findings. The infant was initially treated with oral prednisolone (1 mg/kg daily); afterwards, he required long-term oxygen and nutritional supplementation.
+At follow up visits he exhibited gradual clinical improvement. At 12 months of age, oxygen support was administered only at night. At the age of 18 months, his respiratory rate improved and his growth values were back within the normal range (50th percentile). At this time, the daily dose of steroids was stopped. Currently, at age 2 years, he only requires symptomatic treatment of any respiratory infection.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1664_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1664_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e2a4012019916dd716f9ff6f2ecc260a4c168d9f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1664_en.txt
@@ -0,0 +1,2 @@
+A 37-year-old white man, suffering from hepatitis B, presented to the emergency department with cough, low grade fever and night sweats. He was heterosexual with no history of intravenous drug use and worked as a bartender. Radiological examination of the abdomen and chest revealed no pathologies. Biochemical and hematological profiling showed: SGOT: 71 U/liter, SGPT: 61 U/liter, LDH: 931 U/liter, CRP: 28.33 mg/dl, leucocytosis (12,900/μL) associated with polymorphonucleosis (88.2%), Ht 35% and Hb 11.8 g/dl. The serologic examinations for HIV and hepatitis C were negative, as well as the Mantoux reaction.
+The next day, the patient presented with dyspnea and auscultation revealed diminished breath sounds with diminished vocal resonance in the right hemithorax. A chest X-ray revealed a pleural effusion in the right hemithorax. Computed tomography (CT) scanning of the chest and abdomen revealed a pleural effusion and a liver abscess . The abscess measured 14 × 9 × 7 cm, occupying a great percentage of the right lobe. An echogram of the liver showed septae within the abscess and for this reason echo- or CT-guided drainage was avoided. An operation was scheduled for the following day, but a rapid deterioration of the patient's clinical condition was observed that evening. The patient was febrile (oral temperature 39.2°C) with hypotension, tachypnea (32 breaths/minute) and tachycardia (110 beats/minute) and signs of an acute abdomen. Therefore, emergency surgery was deemed necessary. During exploratory laparotomy, a large volume of free fluid (~2200 ml) together with debris was found on entry into the peritoneal cavity. A rupture of the hepatic abscess at the position of segment VIII was found <Authors: and surgical drainage of the hepatic abscess (that contained many septae) was performed and two wide drains (32G) were placed in the remaining hepatic cavity. Finally, a thoracic drain tube (Büllau) was placed and gave only yellowish reactive fluid. The patient was hospitalized in the ICU for 14 days and for another 14 days in our department. The cultures of the pus were negative for any microorganisms. The diagnosis of an amebic abscess was made by the pathologists who identified E. histolytica in the debris . The patient was discharged receiving metronidazole (Flagyl, Rhone Poulenc Rorer) 500 mg three times a day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1665_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1665_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0977d5bfa9e89c5f6c9550a3a90ccdb960894391
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1665_en.txt
@@ -0,0 +1,4 @@
+A 15-year-old averagely built male, having no significant medical history, presented to the casualty with a history of closed trauma of the right knee following self-fall while playing. The mechanism of injury was hyperextension of the knee joint with a valgus stress. On physical examination, the patient had difficulty to move and was unable to stand on his right lower limb. There was visible swelling over his right knee and distal third of thigh with no skin defect. The attitude of the affected limb was that of abduction and external rotation with visible deformity around the right knee. There was a limb shortening of about 3 cm of the right lower limb as compared to the normal limb. The pulsations of the popliteal, tibialis posterior, and dorsalis pedis arteries were positionally palpable.
+An urgent color Doppler of the right lower limb was done which revealed positional variability in the pulsatality of the popliteal artery with compromised lumen and showing triphasic waveform in certain positions only. The anterior and posterior tibial arteries and dorsalis pedis artery also showed positional variability in the pulsatality with biphasic waveform in certain positions. Thus, the limb was maintained in the position where pulsations of the major arteries were felt . The capillary refill and toe movements were present. No motor or sensory defect was found. Plain AP and lateral X-ray of the right knee revealed a distal femur physeal fracture (Salter and Harris type I) with complete metaphyseal fragment displacement .
+The patient was operated within 12 h after the injury. Under spinal anesthesia, patient was positioned supine. Closed reduction was attempted using a proximal tibial Steinman pin for skeletal traction and manipulation of the right lower limb. After a gentle continuous traction, manipulation was done in the form of downward pressure on the distal epiphysis and an upward pressure on the proximal metaphyseal fragment of the femur. The reduction was not achieved and hence the fracture site was opened up using a Lateral approach. After the fracture site was visualized, the proximal fragment was held using bone holding forceps and the distal fragment fixed using a clamp , and traction and manipulation was done to achieve anatomic reduction of the fracture site. Reduction was confirmed under fluoroscopy and fixed using three 2.5 mm K-wires in a crossing manner , 2 from lateral to medial side and 1 from medial to lateral side. For additional stability, a long leg splint was given anteriorly in 20–30 degrees flexion of the knee.
+Post-operative radiographs revealed anatomic reduction of the physis of the distal femur with restoration of the normal axis of femur . Post-operative surgical outcome was satisfactory. Close monitoring of the patient was done for the first 24 h postoperatively and no signs of secondary vascular thrombosis were found. Patient was started with hamstring and quadriceps strengthening exercises postoperatively. The slab was kept for 6 weeks, following which the K wires were removed. A review X-ray done showed healing of the fracture , and partial weight bearing was initiated with the help of walker. On subsequent follow-up, after 4 and 8 months, correct limb axis alignment and no significant post-operative complications were found. After 6 months, the patient had become free of pain and had a complete range of movement in the right knee joint . There was no significant angular deformity or shortening in the right lower extremity.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1708_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1708_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a0744574650214df095da67a78b367613d39cf8b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1708_en.txt
@@ -0,0 +1,7 @@
+A 19-year-old man developed blurry vision with new headaches in November 2014. He had bilateral papilledema. A MRI brain showed a large right-sided lesion involving the parieto-temporal lobes, hyperintense on T1 and T2-weighted sequences, with significant surrounding vasogenic edema on T2-weighted fluid-attenuated inversion recovery (FLAIR), contrast enhancement post-gadolinium, and a right-to-left midline shift . The overall appearance of this lesion looked a bit unusual for a classical GBM. He had a subtotal resection on January 30th, 2015, and was diagnosed by a local pathologist with a “GBM”. He completed 6 weeks of radiation therapy (RT) and temozolomide (TMZ). Four months later, a follow-up MRI showed an increase in the size of the enhancing tumor and, despite the possibility of pseudoprogression, a second surgical resection was performed on June 2nd, 2015 and showed “GBM”. Maintenance TMZ was started and follow-up imaging showed stable disease .
+The patient was referred to the Neuro-Oncology clinic at MCC in June 2015. Histology review showed that he had a malignant PXA grade III–IV, rather than a GBM. It had multinucleated giant cells, prominent nucleoli, and eosinophilic granular bodies on 600 × HPF, and a high mitotic index with dysplastic neurons on 200 × HPF . Histological samples were GFAP positive, with necrosis, ATRX retained, had a proliferation rate of 2% by Ki-67, and was positive for BRAF V600E on IHC . Foundation one testing confirmed the BRAF V600E mutation, IDH1 wild-type, and no EGFRviii. Other testing showed that the tumor was negative for 1p/19q co-deletion and was O6-methylguanine-DNA methyltransferase (MGMT) promoter unmethylated.
+After an initial 17 months of stable disease, on his MRI, there was a small increase in the size of his tumor . Accordingly, combination therapy with BRAF kinase and MEK inhibitors, Dabrafenib 150 mg PO BID and Trametinib 2 mg PO OD, was started on November 2016. As soon as 2 months after starting treatment, there was radiographic evidence of disease regression, though it did not meet the criteria for a Partial Response because of its small size. The patient was continued on this treatment regimen for 10 months and further serial imaging showed stable disease.
+After 8 months of treatment, in July 2017, treatment was held to give the patient a “drug holiday,” but, 2 months later, his MRI showed disease progression. Dabrafenib and Trametinib were re-started, and he remained stable until January 2018 when he had disease progression with BRAF MEKi. Since resistance to BRAF inhibition can be overcome by autophagy inhibition [–], we added the autophagy inhibitor chloroquine (500 mg PO daily) to his BRAF MEKi therapy. Each tablet of chloroquine contains 500 mg of chloroquine phosphate USP and the equivalent to 300 mg chloroquine base, which is the standard, maximal safe dose that is FDA-approved for adults .
+Based on the Response Assessment in Neuro-Oncology (RANO) criteria, the lesion size was measured, the sum of the perpendicular diameters (SPD) calculated and plotted . The tumor decreased by more than 25% after BRAF MEKi was started but unfortunately increased after a drug holiday , and continued to grow despite re-starting therapy with BRAF MEKi , at which point the autophagy inhibitor chloroquine was added halting the rate of tumor progression and even causing a slight decrease in the lesion size .
+There are no reported potential interactions between chloroquine and Dabrafenib and/or Trametinib. Chloroquine’s adverse effects can be multisystemic affecting the eyes (e.g., retinopathy, visual disturbances), hearing, liver, gastrointestinal system (e.g., nausea, vomiting, diarrhea, abdominal cramps), muscles (e.g., myopathy), skin (e.g., erythema multiforme, Stevens–Johnson syndrome), cardiac (e.g., prolonged QT interval), hematologic system (e.g., pancytopenia), and nervous system (e.g., seizures, extrapyramidal signs) . Given these side effects, we had taken precautionary measures with close monitoring every 1–2 months since started triple therapy, checking complete blood cells counts, complete metabolic panels, electrocardiogram, and echocardiograms. Overall, our patient tolerated the triple therapy well for 17 months until recently, when he complained of mild nausea, diarrhea, and a skin rash. The decision was made to hold chloroquine, while continuing Dabrafenib and Trametinib, with plans to re-assess him in 2 months.
+In summary, radiographically, he has had Stable Disease with BRAF MEKi for 14 months, and later with the addition of chloroquine for a total of > 2.5 years of treatment (triple therapy for 17 months), without major side effects from the treatment, until recently for which he is receiving a drug holiday from chloroquine.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1716_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1716_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..761ea0ccd0dddd5fb3e55b54b819b9774fd43c77
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1716_en.txt
@@ -0,0 +1,2 @@
+In April 2023, a 39-year-old Chinese woman presented to our hospital complaining of a black shadow in front of her right eye for 5 days. This patient had been diagnosed with acute lymphoblastic leukaemia in 2017 and received an autologous HSCT in 2018. Unfortunately, she suffered a relapse of leukaemia and underwent an allogeneic HSCT in October 2022. The patient developed ocular symptoms at 6 months after receiving the transplant. After the consultation, the patient received a series of tests including visual acuity, slit lamp, noncontact tonometer, ocular ultrasound, macular optical coherence tomography, and Optos fundus photography. The patient’s best corrected visual acuity was 20/20 in both eyes using the Snellen visual acuity chart. The intraocular pressure was within the normal range. Slit lamp examination revealed that the anterior segmental structures of both eyes were normal. Ultrasound of the eye suggested flocculent vitreous clouding in the lower part of the right eye . Partial signal enhancement in the retina of the left eye was found, and part of the photoreceptor cell layer was missing on optical coherence tomography(OCT) . Fundus photography revealed a yellowish-white exudate with haemorrhage in the peripheral retina of the right eye and a faint haemorrhage in the lower retina of the left eye . Combining the medical history and relevant ophthalmic examination, we highly suspected that the patient had developed cytomegalovirus retinitis.
+Therefore, we performed anterior atrial puncture and extracted aqueous humour from the patient for viral testing on 23, April. We further refined FFA + ICGA on April 25. Surprisingly, utilizing broad-spectrum high-throughput sequencing, it was found that the aqueous humour of her right eye tested positive for three viral DNAs-CMV, EBV, and HSV . Internal markings and no template control were added to rule out a false detection of both herpes viruses during the high-throughput sequencing. The left eye was positive for CMV only. The FFA + ICGA findings indicated a small amount of retinal exudate in the patient’s right eye, and a large area of obscured fluorescence in the subnasal and inferior choroid . The patient was then treated with bilateral vitreous cavity ganciclovir injections. Viral DNA was retested one week later and no virus was detected in the aqueous humour of either eye by quantitative polymerase chain reaction(QPCR). The test was negative for viral DNA. OCT and fundus photography indicated no significant changes in the fundus. The patients underwent weekly serum cytomegalovirus and EBV testing after the second stem cell transplant. She was cytomegalovirus positive only between November 15, 2022 and January 14, 2023, with viral copy numbers ranging from 1.02 × 102 to 2.37 × 104 during this period. Each test was negative for EBV. The patient was treated with systemic antiviral therapy in the hematology department since February, 2023. As of May 22, 2023, her fundal lesions all remained stable.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1731_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1731_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c8fbf1209c6325e6313cc5f4513047b5e9c2894a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1731_en.txt
@@ -0,0 +1,3 @@
+A 50-year-old female with a history of well-controlled focal epilepsy presented to her neurologist with new symptoms of recurrent ‘sudden collapse’. At the age of 30, the patient had been diagnosed with non-lesional temporal lobe epilepsy characterized primarily by episodes of tonic–clonic seizures preceded by a sensation of déjà vu. She had been started on carbamazepine at that time with excellent seizure control. Her medical history was positive for hypertension and dyslipidaemia. She also maintained a family history of cardiac disease, unspecified. The patient had not suffered from any seizures or syncopal events until 5 months before her presentation. She complained of ‘unusual’ episodes, witnessed by her husband, of sudden drop attacks with brief loss of consciousness and postural tone associated with urinary incontinence. The syncopal episodes occurred without warning and without an associated trigger. She sustained no significant injuries from her syncopal events. Her clinical examination and biochemical profile on blood work were unremarkable. Magnetic resonance imaging of the head did not reveal evidence of acute changes to explain her presentation. Her carbamazepine dose was escalated in an attempt to control these episodes but failed to result in any improvement. Her antiepileptic medication was then changed from carbamazepine 200 mg p.o. t.i.d. to brivaracetam 75 mg p.o. b.i.d., again with no improvement. The patient underwent a continuous video-electroencephalographic study to characterize these events further.
+During observation in the epilepsy unit, the patient was observed to have an episode of sudden of loss of consciousness and urinary incontinence without any tonic–clonic activity or a prominent post-ictal state. Continuous electrocardiogram (ECG) monitoring revealed a concurrent episode of asystole lasting ∼20 s, followed by sinus bradycardia at a rate of 20–30 beats/min . There was no evidence of seizure activity on the electroencephalogram (EEG) preceding, during or following this event. The patient recovered and was subsequently admitted to the coronary care unit. On examination, her heart rate was 82 per minute, blood pressure was 128/74 mmHg, 86 kg, body mass index 32.1, and the systems examination was normal. She was recorded to have two episodes of symptomatic Mobitz type I atrioventricular (AV) block. Overall, her findings were consistent with isolated symptomatic bradyarrhythmia rather than ictal bradyarrhythmia or seizures. An echocardiogram was completed, which did not reveal any abnormalities. She underwent the successful implantation of a dual-chamber pacemaker. Her device was programmed to AAI-DDD with lower and upper rates of 50–130. Paced AV delay was set to 220 ms, and sensed AV delay 200 ms. Rate drop response was programmed ‘on’ to both low rate and rate drop. At 13-month follow-up, the patient was symptom free with no recurrence of her presenting events. Interrogation of her pacemaker revealed atrial pacing at 15.2% and ventricular pacing at 11%, suggesting a bradyarrhythmia of atrial aetiology.
+The patient was maintained on brivaracetam as her antiepileptic and was well tolerated. A decision was made not to switch back to her original anticonvulsant, carbamazepine, despite the non-ictal aetiology of her event. Carbamazepine exerts its therapeutic function through sodium channel blockade and can therefore theoretically affect depolarization currents within cardiomyocytes. Its use has been reported by the Food and Drug Administration (FDA) to be associated with AV block. As such, given the patients bradyarrhythmia, she was maintained on the alternative agent.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1734_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1734_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aa899a11a32d3098ea092cf41e67afd8ff8c2488
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1734_en.txt
@@ -0,0 +1,5 @@
+A 75-year-old man with a history of persisting abdominal pain and mild diarrhoea for three months was referred by a general practitioner to the hospital. During this period the patient observed a weight loss of 2 kg, but did not show any B symptoms. A colonoscopy was performed without pathological findings. A subsequent CT examination of the abdomen showed two separate fat-containing retroperitoneal masses one in the adrenal gland and the second lateral of the psoas muscle inferior to the right kidney, outside the peri-renal adipose tissue. The lesions were separate and had no connecting tissue in between them . To further confirm the obtained CT scan results an MR imaging was performed and showed again a fat-containing lesion in the adrenal gland and a 7 × 5 × 7 cm soft tissue-tumour inferior to the right kidney without invasion of the right kidney, urethra or renal vasculature. Both lesions appeared similar in the CT and MR imaging and were consistent with a well-differentiated liposarcoma . Aware of the fact that a liposarcoma of the adrenal gland is extremely rare, a primary benign and fat containing tumour derived from the adrenal gland itself, such as a lipoma or myelolipoma was considered. Regarding tumour markers, only increased levels of CA 19-9 were detected (81.86 U/ml reference < 37 U/ml, CEA 2.2 μg/l, reference < 5 μg/l). To exclude a neuroendocrinological pathology additional tests were performed but did not reveal any noticeable conspicuities.
+Consequently, we assumed a combination of a retroperitoneal liposarcoma and a primary benign, lipomatous tumour of the adrenal gland. Alternatively, the very rare case of the combination of a retroperitoneal liposarcoma and an adrenal liposarcoma was taken into consideration. Therefore, two therapeutic options were considered on these accounts. In the unlikely case of simultaneous liposarcomas an enbloc resection including both masses would be required after pre-treatment. But, in the probable situation of a benign lipomatous primary lesion of the adrenal gland in combination with a retroperitoneal liposarcoma an adrenalectomy with an additive biopsy of the infrarenal mass was decided as the strategy of choice in this individual case.
+Concerning this strategy a neoadjuvant radiotherapy followed by radical surgery, preventing the kidney, could have been performed as it has been approved as follows. To perform a neoadjuvant therapy a positive biopsy for sarcoma would be a compulsory prerequisite. Prognostic survival markers for retroperitoneal liposarcomas are the histologic subtype and margin of resection . Response rates to neoadjuvant chemotherapy alone are less than 10% . Preoperative radiation therapy or combined radio-chemotherapy with consecutive radical resection improves survival [,]. Concerning surgery complete resection of the lesion is to be achieved. Extended resection including contiguous organs without pre-treatment is associated with an increased risk without influence on disease specific survival and is therefore considered to be inappropriate .
+According to our described strategy, the patient received a laparotomy. As expected, the adrenal tumour appeared well-encapsulated in accordance with a benign lipomatous tumour. Following the above mentioned second option first an adrenalectomy was performed. The rapid section of the adrenal lesion revealed the result of a myelolipoma. Having in mind that both lesions presented morphologically identical in CT and MR imaging and the assessed intraoperatively analogousness of the masses, we resigned a biopsy of the infrarenal tumour and removed it in toto without the kidney. Once more the rapid section revealed a myelolipoma. The final histology described a 4 cm sized and in weight 46 g well-encapsulated myelolipoma of the adrenal gland. Further a 14 cm sized and in weight 250 g well-encapsulated retroperitoneal myelolipoma was determined, without capsule involvement. Both tumours were composed of predominantly mature adipose tissue with mature myeloid elements, allowing the diagnosis of an extra-adrenal and adrenal myelolipoma. Consequently no other treatment than surgery was indicated and has not been performed in this case.
+Postoperatively, the patient's recovery was uneventful and he was subsequently discharged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1735_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1735_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..924dfdd5255005e3b4100c25e703220f83d850ba
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1735_en.txt
@@ -0,0 +1,5 @@
+A 14-year-old female came to our facility with concerns about difficulty in walking owing to weakness in both lower limbs, an erythematous, pruritic rash that covered her face, neck, axilla, elbows, and knees, and photosensitivity that had been present for eight months. It was unknown if she had any allergies. Patient underwent surgery 1.5 years after being diagnosed with retinoblastoma two years prior. After the enucleation, the patient underwent 40 cycles of radiation therapy and 13 cycles of chemotherapy with the drugs cyclophosphamide, etoposide, carboplatin, vincristine, and dactinomycin. In addition to developing proximal muscular weakness in both the upper and lower body after undergoing chemotherapy for 10 months, the patient also got a rash over their face that progressed.
+The patient was brought with these issues to our facility. Indicators of the patient's weakness in the proximal muscles of the upper and lower limbs were difficulty in rising from a sitting position and lifting the arms over the head. Her lower limbs had grade II muscle power and her upper limbs grade III, according to the examination. The CMAS score for childhood myositis was 36. Her vital signs were normal, and she had no underlying systemic issues. On inspection of the joints, there were no indications of active synovitis. At presentation, her neck flexor strength was higher than grade IV. Findings of skin examination showed hallmark manifestations consistent with DM, well defined to ill defined hyperpigmented scaly lichenified plaques over the neck, face, axilla , elbows, knees, including the V neck sign/Shawl sign, heliotrope eruption over the face especially on the forehead and periorbital region , Gottron papules over the digits of upper limb on both sides , calcinosis cutis involving the extensor aspect of elbows .
+The initial blood tests, such as complete blood counts, liver and renal functions, were all normal. Both lactate dehydrogenase (578 U/L) and creatine phosphokinase (171.61 U/L) levels were high. Positive antinuclear antibodies were found. Features of Dermatomyositis with interface dermatitis and mucin deposition in the dermis was consistent in the skin punch biopsy. Electromyography was done which showed small polyphasic motor unit potentials with fibrillations, positive sharp waves suggestive of Dermatomyositis. A muscle biopsy revealed fibres of the muscle that were necrosed and fragemted [Fig. ].
+According to the online calculator of EULAR/ACR classification for Juvenile Idiopathic Inflammatory Myopathies(IIM), the criterion score was 15.7, which was suggestive of Definite IIM . According to the Bohan and Peter criteria , JDM was determined to be the cause of the symptoms, which included the characteristic heliotrope rash with Gottron papules, symmetrical proximal weakness, raised muscle enzyme levels, electromyographic alterations, and even JDM-related changes in the muscle biopsy.
+Prednisolone oral 2 mg/kg/day and methotrexate oral 15 mg/m2 once weekly were started on the patient. After beginning the therapy for a week, the youngster displayed a slight improvement in symptoms as shown by lessened joint discomfort, stiffness, and erythema. Exercises for muscle strengthening and physiotherapy were started. During the patient's future hospital visits, it was seen that the patient's muscle strength had significantly improved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1749_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1749_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e9ce4aed2c3f91839250fdaf6b211e3c38bcf285
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1749_en.txt
@@ -0,0 +1,2 @@
+We presented a 20-year-old male patient, who fell from a height of about 30 feet. He was initially managed at a nearby community hospital where he was diagnosed to have multiple rib fractures on both sides, with bilateral hemopneumothorax. The primary management of patient was performed with bilateral intercostal chest drains and positive pressure ventilation for lung contusion. The patient had no neurological deficit at initial presentation. He was then referred to our center after four weeks for further management.
+On examination, there was tenderness over the tenth thoracic vertebrae with mild knuckle deformity. There was no motor or sensory deficit at any level. Superficial and deep tendon reflexes were normal. Radiographs and computerized tomography showed a fracture dislocation with spondyloptosis of the ninth thoracic vertebra (T9) over the tenth thoracic vertebra (T10) with vertebral body fracture of the eight vertebral body ( - ). The pedicles of both T9 and T10 vertebrae were fractured bilaterally, thus separating the posterior elements from their respective vertebral bodies. There was complete spondyloptosis of T9 over T10 vertebral body and both T9 and T10 vertebral bodies could be seen in a single transverse section of computerized tomography . The patient was scheduled for surgery after improvement in general and lung condition. The spine was approached through standard posterior midline incision. There was no significant kyphosis seen and the posterior elements of the eighth and ninth thoracic vertebrae were lying almost in place with undisplaced fractures in the lamina of respective vertebra. The pedicle screws were inserted in the fifth, sixth and seventh thoracic vertebrae proximally and the tenth, eleventh and twelfth vertebrae distally ( - ). An in-situ posterior instrumentation with laminectomy of T8 and T9 vertebrae and posterolateral fusion from the fifth to twelfth thoracic vertebrae was performed. No attempt was made to reduce spondyloptosis of T9 over the T10 vertebrae. The patient tolerated the operation well and there was no postoperative neurological deterioration. He was mobilized with the help of customized dorsolumbar rigid orthosis on fifth postoperative day. He was followed up at monthly intervals and radiographs along with computerized tomography showed satisfactory in situ fusion between T9 and T10 vertebral bodies . The patient returned to his previous occupation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1765_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1765_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6685ede8eeea64a061263b7b70035d6112bd3212
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1765_en.txt
@@ -0,0 +1,3 @@
+An 11-year-old skeletally immature girl presented to us 2 years back with pain and swelling over the right forearm without any restriction of moments and other constitutional symptoms. The patient had a similar problem 4 years back , for which she underwent surgery elsewhere and she completely recovered. Available biopsy reports suggested a non-ossifying fibroma. On examination, the patient had a tender bony thickening of radius extending to about 2cm underneath the previous surgical scar which was a 5cm anterolateral longitudinal surgical scar in the region of the middle third and distal third junction of forearm. The patient had no neurovascular deficit.
+X-ray radiography showed a 1cm diameter multiloculated lesion involving the complete diameter of bone with sclerotic rim in the distal diaphysis of radius, with no periosteal reaction and cortical breach . Magnetic resonance (MR) imaging showed a well-defined expansile lytic, trabeculated lesion with multiple internal septations region ( and ). Since the previous biopsy report from a reputed institute suggested non-ossifying fibroma 4 years back, we did not go for further studies like bone scan. As the lesion was painful and the child had difficulty in carrying heavy objects, we decided to intervene. Based on the previous biopsy report and imaging features, we decided to perform direct intralesional excision (curettage) of the lesion. Radius was exposed through the previous surgical scar (Henry’s approach) without tourniquet control. During exposure, we found gross adhesions around radial artery due to the previous exposure. Radial artery was accidentally cut, repair was not attempted and hence ligated. Under image intensifier guidance, the lesion was identified and bone window was made. Tumor tissue was thoroughly curetted and the defect was filled with artificial bone substitute (STIMULAN calcium sulfate beads).
+Tumor tissue was sent for biopsy. Above elbow, POP slab was applied for 6 weeks. Histopathology showed tissue with spindle cells arranged in fascicles and bundles in a storiform pattern along with osteoclast such as giant cells and no evidence of cytological atypia/atypical mitosis/necrosis suggestive of non-ossifying fibroma . The patient was put on the above elbow POP slab for 2 weeks and converted to POP cast for the next 4 weeks. At 6 weeks, POP was removed and an active range of motion exercises of wrist started. The patient was advised not to involve in sports activities for nearly 6months until bony union was seen radiologically. The patient was serially followed up. Post-operative radiograph showed some residual tumor involving the dorsal cortex which was noted even at 1-year follow-up X-ray .The patient was followed up for 3 years. Tumor was completely regressed and was not seen on X-ray . She had a full range of movement with no functional deformity (-).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1802_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1802_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a11acec2f7ad106463b42c0d8cc3d2b963247052
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1802_en.txt
@@ -0,0 +1,3 @@
+The patient is a 2-year-old boy, the second child in the family. His elder brother and parents are healthy. Ophthalmological, neurological, and ultrasonographic examination of the patient showed complete aniridia, cataract, optic disc hypoplasia and partial atrophy of the optic nerves, foveal hypoplasia, nystagmus, hypotalamia (shallow anterior chamber), high hypermetropia, and strabismus; , as well as early organic CNS damage, hydrocephalus, brain vascular plexus cysts, developmental delay, myotonic syndrome, pes valgus, ataxia, and emotional lability. In addition, short stature, gallbladder dysfunction, reactive pancreatitis, iodine deficiency, anemia, celiac disease, atopic dermatitis, open oval window, and umbilical hernia were observed.
+Initial cytogenetic study revealed the normal karyotype 46,XY and pericentric inversion of chromosome 11, inv(11)(p13q14) . The best resolution of the karyotyping was about 10 Mb. Inversion was not identified in the healthy parents of the proband with normal karyotype (data not shown) thus it was assumed to occur de novo. Such an inversion could lead to the patient’s phenotype with aniridia in two ways: either through the so-called position effect earlier described for AN , or through the loss of genomic material at the rearrangement break points. In the latter case the refinement of the deletion boundaries is crucial due to the vicinity of the WT1 gene.
+To determine a possible chromosome disbalance in the 11p13 region, multiplex ligase-dependent probe amplification (MLPA) analysis was applied using the SALSA MLPA of P219-B2 PAX6 probes (MRC-Holland, Amsterdam, the Netherlands). The MLPA analysis showed a deletion stretched for at least 668 kb in 11p13 region (hg19::chr11:g.(30255690_31671656)_(32339851_32410037)del) and removed loci of the ELP4, PAX6, and RCN1 genes, and it did not affect the WT1 gene . This was confirmed by normal fluorescence in situ hybridization (FISH) pattern with a specific probe for the WT1 gene locus (FA0275, Abnova, Taiwan) and 11p region (CEN11p, FC0096, Abnova). . Further high-resolution chromosomal microarray analysis (CMA) with CytoScan HD array (2.67 M probes, ThermoFisher Scientific, MA USA) specified the deletion region to be 977.065 kb (arr [GRCh37] 11p13(31400114_32377179)×1) . The CMA revealed no meaningful disbalance of more than 10 kb in the 11q14 region at the other side of the inversion.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1807_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1807_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e8a16e2a443bad3241015393b701e041075adb0f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1807_en.txt
@@ -0,0 +1,4 @@
+A 28-year-old man with a history of chronic alcoholism visited the emergency department owing to weakness in the left extremities. He was under treatment with an antiepileptic drug for the past 6 months since a traumatic subdural hemorrhage occurred during a fall down the stairs. At that time, he underwent facial nerve decompression for left-sided facial palsy due to ear bleeding and a temporal bone fracture. He complained of a 5-day history of myalgia and upper respiratory infection symptoms, such as coughing and sore throat. Initially, his vital signs were stable except for a body temperature of 38.6 °C. He was responsive to the medical staff’s questions, but his answers lacked fluency. Findings of a physical examination performed on arrival to the emergency room were unremarkable, and mild neck stiffness was observed during a neurological examination.
+Baseline laboratory data of complete blood count showed leukocytosis (white blood cell [WBC] count, 15,090/µL; neutrophils, 87.5%; lymphocytes, 4.9%) with mild C-reactive protein elevation (2.08 mg/dL). Since the patient’s neck stiffness worsened and stupor was noted, a cerebrospinal fluid (CSF) analysis was performed. The CSF analysis showed pleocytosis (WBC count of 390/µL; polymorphonuclear leukocyte count, 60%), high protein level (161.3 mg/dL; reference range, 15–40 mg/dL), and low glucose level (30 mg/dL; reference range, 40–70 mg/dL) with a negative Gram stain. No focal lesions were observed on brain magnetic resonance imaging (Additional file : Fig. S1). Intravenous ceftriaxone (2 g every 12 h) and vancomycin (1 g every 12 h) as empirical antibiotic therapy were administered with intravenous dexamethasone, as the findings were suggestive of bacterial meningitis caused by Streptococcus pneumoniae or Neisseria meningitidis.
+On day 6 of hospitalization, blood culture revealed Gram-negative bacilli growth in the aerobic and anaerobic bottles. On day 11 of hospitalization, the organism was identified as C. fetus. However, these organisms were not identified in the CSF culture. The CSF specimen was collected 6 h after prompt empirical antibiotic treatment. Doripenem (500 mg every 8 h) was administered for 10 days until the meningitis symptoms completely resolved without neurological sequelae. The automated susceptibility test (VITEK2 system, bioMérieux, France) showed that the isolate was susceptible to erythromycin and ciprofloxacin. The patient regularly visited the outpatient clinic for 2 years, without recurrence of the meningitis. He stated that he had been raising a companion dog and denied contact with livestock animals such as cattle and sheep or ingestion of raw or undercooked meat.
+To confirm the species and identify the subspecies of the isolated C. fetus sample, a sequence analysis of the 16 s rRNA gene was conducted using the polymerase chain reaction primers 27F 5′-AGA GTT TGA TCM TGG CTC-3′ and 1492R 5′-TAC GGY TAC CTT GTT ACG ACT-3′. The sequencing primers 785F 5′ (GGA TTA GAT ACC CTG GTA) 3' and 907R 5′ (CCG TCA ATT CMT TTR AGT TT) 3′ were used. The C. fetus 16S rRNA sequence was compared to the published sequences from GenBank. Phylogenetic analysis (Jukes-Cantor/Neighbor Joining) revealed that the 16S rRNA sequence in this case showed high similarity (99.93%) with other Cfv 16S rRNA sequences . These sequences were also distinct from those of Cff and other Campylobacter spp. compared with previously reported 16S rRNA nucleotides of other Campylobacter species (C, coli, C. jejuni, Cff) .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_181_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_181_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8e93891d70c2ededd25e96234d472846829b2c30
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_181_en.txt
@@ -0,0 +1 @@
+Our patient was 35 year old male who presented to emergency department with history of fall by tripping on a stone (fall on outstretched hand). Post trauma patient had pain and difficulty moving both the shoulders. Patient was a known alcoholic, with previous history of one episode of shoulder dislocation on right side about 2 years prior to the present episode, which was adequately treated with closed reduction and immobilisation for 3 weeks. Patient does not give any history of convulsions (past or present) and no other neuro-muscular problems. On clinical examination, patient's both upper limbs were abducted and externally rotated. Bilaterally shoulder contour was lost with flattening. Other classical signs of shoulder dislocation viz, Bryants test, Callway sign, Hamilton's ruler test were positive. Radiographs of both shoulders were obtained and clinical diagnosis of SBAD was confirmed. Both shoulders were reduced in emergency operation theater under general anaesthesia by Kocher's method and were immobilized in sling. The left was immobilized with 90° elbow flexion and the right at 110° flexion for 3 weeks. Reduction was confirmed post operatively with X-rays. Intermitted assisted excercises where started from second week onwards and at the end of immobilization patient was advised vigorous supervised physiotherapy. By six week post injury patient had full range of adduction, flexion and internal rotation. Abduction up to 110° was possible. Patient was advised to be cautious while doing overhead activities especially which require abduction and external rotation of shoulder.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1823_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1823_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3fe760152e3d4db40011c4aabe6b341636fd2da2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1823_en.txt
@@ -0,0 +1,3 @@
+A 17-year-old female with a history of allergy and systemic reactions to peanuts unknowingly ate a plate of Spaghetti in a Chinese restaurant cooked with groundnut oil. She immediately developed an anaphylactic shock with dyspnea, agitation and cardiac arrest. Cardiopulmonary resuscitation (CPR) was begun upon arrival of the medical emergency team, 10 minutes after collapse-the first rhythm was asystole. Intravenous Epinephrine (total dose 10 mg) and fluid administration (total 2.5 L) were administered and although transient return to spontaneous circulation was achieved at 22 minutes, the patient rearrested with recurrent pulseless electrical activity and then asystole. Only mild laryngeal edema was noted on intubation. She was transferred to our tertiary care facility, under continuous CPR with the Lund University Cardiac Arrest System–Version 2 device (LUCAS 2; Jolife AB, Lund, Sweden). Immediate femoro-femoral, veno-arterial extra-corporeal life support (ECLS) was surgically implanted (RotaFlow, Maquet, Hirrlingen, Germany). No-flow was estimated to be 10 minutes and total low-flow from CPR initiation to full ECLS support 95 minutes. Soon after the establishment of the VA-ECLS, the patient regained an effective sinus rhythm. However, the transesophageal echocardiography performed during the implantation procedure showed a bilateral ventricular dysfunction with global hypokinesia (Additional file ). In order to maintain both a left ventricular drainage and a mean arterial pressure (MAP) above 65 mmHg, a hemodynamic support with dobutamine and norepinephrine was necessary during the first 12 hours. There was no sedative or analgesic administration at any point during pre- or in-hospital care.
+Clinically, the patient was deeply comatose-Glasgow Coma Scale 3–with bilaterally dilated pupils unresponsive to light. Complete clinical examination and brain death assessment were performed according to the guidelines of the Swiss Academy of Medical Sciences . The apnea test was carried out in accordance with previously published data on apnea test and brain death testing in patients under ECLS . The clinical diagnosis of brain death was established 16 h after hospital admission and the parents consented to organ donation. Thyroid hormones, low dose corticosteroids and desmopressin were administered for the organ preservation and diabetes insipidus.
+Cardiac assessment for heart donation was made by transthoracic echocardiography (TTE). Given the young age, coronary angiography was not performed. TTE displayed normal findings with no inotropic or vasoactive support and ECMO flow lowered to 1.5 L / min (Additional file ). Left ventricular function was assessed by measuring the left ventricular outflow tract velocity time-integral (16 cm), visual assessment of the left ventricular ejection fraction (60 %) and measurement of the systolic peak velocity of the mitral annulus (TDSa) (> 6 cm/s). Right ventricular function was assessed visually and by tricuspid annular plane systolic excursion (TAPSE) (18 mm). There were no segmental anomalies as well as normal valves. The heart was retrieved 50 h after hospital admission (total ECLS support of 50 h, ECLS support prior to organ assessment 16 h and time from assessment to transplant 34 h). Warm and cold ischemia times were 23 and 202 minutes respectively. The heart was transplanted in an 11-year-old female with anthracyclin-induced cardiomyopathy following treatment for high-grade osteosarcoma of the tibia. The immediate post-operative course was favourable allowing extubation on day 2, she required milrinone but no mechanical support for a total intensive care length of stay of 21 days. The patient was discharged 56 days post transplantation, she is symptom-free at 6-month follow-up with normal cardiac function.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1833_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1833_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ec077d6effa765e4ae126459a96ee45f74c582a5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1833_en.txt
@@ -0,0 +1,4 @@
+A 47-year-old Asian woman was admitted to our hospital with a 1-year history of worsening leg numbness and urinary dysfunction. She first noticed her bilateral 3rd and 4th toe numbness for 5 years. Her symptoms worsened, and her whole toes became numb a year ago. She had also been experiencing frequent urination for a year. She visited her previous physician and was referred to our hospital after magnetic resonance imaging was taken. On physical examination, her motor function was intact, but she had sensory disturbance around the anal region. Deep tendon reflexes were normal. Her finger–floor distance was 10 cm, and her straight leg raise test result was 80 degrees; this indicated that her hamstrings were not tight. Magnetic resonance imaging revealed a low-lying conus medullaris extending to the level of S2 and surrounded by fat tissue at that level . The spinal MRI did not point to any other abnormalities that could explain her symptoms. We diagnosed her condition as adult tethered cord syndrome, and spine-shortening vertebral osteotomy was planned. After the patient provided informed consent, she underwent shortening osteotomy.
+After induction of general anesthesia, the patient was positioned onto a Jackson Spinal Table (Mizuho Co. Ltd., Tokyo, Japan). Neurophysiological monitoring was performed using motor evoked potentials. A midline incision was made from the T11 to L4 spinous process level. The target level for the osteotomy was L2. The L2 segment was extensively exposed, in turn exposing the posterior element and transverse processes bilaterally. Bilateral pedicle screw implants were placed at L1 and L3 using an anterior–posterior image intensifier. In this procedure, it is essential to use monoaxial screws inserted exactly parallel to the rostral endplates of each vertebral body; this ensures appropriate alignment between the L1 caudal endplate and the L2 osteotomy surface. The osteotomy was started after insertion of the pedicle screws. First, the lower half of the L1 lamina and bilateral inferior articular processes of L1 as well as the bilateral L2 superior articular processes were resected. Second, the upper one-third of the lamina of L2 was resected, and the bilateral two-thirds of the pedicle of L2 was removed with a surgical air drill. Resection of the upper one-third of the lamina of L2 is very important to prevent postoperative neurological deterioration due to epidural hematoma formation. Although bone union can effectively occur without resection of the lamina, the dural space will be so tight that only a small hematoma will be symptomatic. After exposure of the lateral side of the L1–2 disc, discectomy was performed with a knife and curette. Following complete discectomy of L1–2, the upper vertebral body of L2 was removed with a surgical air drill. The surgical air drill was inserted from the pedicle parallel to the upper endplate of L2, and the posterior wall of the vertebral body was thus removed. After thinning of the lateral vertebral cortex, the lateral surface of the vertebral body was carefully exposed, and the lateral cortex was removed with a punch. After thinning of the anterior vertebral cortex, a Kerrison rongeur was used to remove the anterior cortex. Because the anterior longitudinal ligament protects the vessels and anterior organs, little bleeding occurred when the anterior body was removed. After complete removal of the vertebral body, a straight rod was connected to two screws and applied pressure between the screws. Two polyethylene tapes (Alfresa Pharma Corporation, Osaka, Japan) were applied to the L2 lamina and bilateral rods. A drawing of the surgery is shown in Fig. . The operation time was 5 h 13 min, and the estimated blood loss was 108 ml. In this case, there was less degeneration, and the epidural venous plexus was less developed, which may have been the reason for the small amount of blood loss.
+The tips and tricks of this procedure are as follows. (1) Carefully develop the sides of the vertebral body and intervertebral disc with hemostasis; (2) use the endplate of the vertebral body as a guide and insert an air tome parallel to the endplate to resect the vertebral body; (3) leave the lateral wall of the vertebral body like an eggshell and complete the resection by resecting the shell at the end.
+The postoperative course was uneventful. The postoperative radiograph showed 18-mm shortening from the L1 upper endplate to the L2 lower endplate . The patient’s leg numbness improved immediately after surgery, and her urinary disturbance improved 1 year after surgery, although magnetic resonance imaging did not show evidence of untethering. Computed tomography 1 year after the operation showed complete bone union ; therefore, we removed the instrumentation. She had developed no recurrence at 2 years after surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1834_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1834_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d5a654c9d787ad0a8f2745d27d2e56e9c79a643b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1834_en.txt
@@ -0,0 +1,5 @@
+A 67-year-old male presented with abdominal pain and blood-tinged stool of 1-month's duration. His past medical history revealed hypertension well controlled by medication for 8 years and that he had been a smoker for 20 pack years. His family history was noncontributory. Physical examination revealed a protuberant abdomen with a huge tender intra-abdominal mass. Laboratory findings including blood analysis, serum electrolytes, and hepatic and renal functions were within normal limits, as was the serum alkaline phosphatase.
+On colonoscopy, a solid mass measuring 5 cm was detected protruding from the colon wall . The mass was covered with blood clots and necrotic debris. Colonoscopic biopsy confirmed a sarcoma of an undetermined type. Computed tomography demonstrated a 15 × 9.7 cm heterogeneously enhancing mass, with mottled calcification and a cystic portion, occupying the left upper quadrant of the abdominal cavity . For curative resection of the tumor, en bloc mass excision with segmental colon resection and splenectomy was performed. During the operation, the surgeon described the tumor as being located in the mesentery and involving the stomach, greater omentum, pancreas, and transverse colon. The resected tumor measured 18.5 × 13 × 9.5 cm. It was located in the mesentery and perforated the abutting colon wall. The external surface of the mass was smooth. The cut surface consisted of a gray-white to tan-yellow solid area with a gritty sensation and a large multicystic area . The cystic portion contained clotted blood with thin septae and was focally necrotic.
+Sections taken from the cystic structure showed large blood-filled spaces separated by thin septae and smaller cystic spaces within the solid area. The septal walls consisted of numerous large, bizarre rounded to spindled cells with multilobed hyperchromatic nuclei, and coarse granular chromatin . Sections from the firm, calcified portion revealed a poorly differentiated sarcomatous tumor showing a solid growth pattern with large anaplastic cells and spindle cells . Giant cells with multiple bizarre nuclei or osteoclast-like giant cells were scattered throughout the tumor and were associated with the areas of hemorrhage. The osteoid was laid down in a fine ramifying lacework, and was partly calcified . Transition areas between neoplastic osteoid and cartilage were noted . More than 20 mitoses per ten high-power fields were observed, and these included highly atypical forms. Necrosis was evident.
+For immunohistochemical studies, paraffin-embedded tissue was stained using the avidin-biotin peroxidase complex method. The neoplastic cells were positive for vimentin, alpha smooth muscle actin, osteonectin, CD99, and S100 in the chondroblastic portion, but negative for cytokeratin, epithelial membrane antigen, desmin, myogenin, CD34, and c-kit. The final histologic diagnosis was a mesenteric extraskeletal osteosarcoma with telangiectatic features.
+After the uneventful surgery, the patient underwent the first cycle of chemotherapy consisting of intravenous ifosfamide (1800 mg/m2) and adriamycin (25 mg/m2). However, he developed a recurrent peritoneal mass measuring 11 × 9.5 cm and multiple lung and liver metastases 3 months postoperatively. He died 4 months later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_186_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_186_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..95527c82287f7f2973c3fcc612af730b5dfd50e1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_186_en.txt
@@ -0,0 +1,3 @@
+The patient was a 19-year-old Caucasian woman who presented to the clinic initially with nonspecific symptoms of fatigue, fever and abdominal pain. Past medical history was noncontributory; she was an otherwise healthy adult from the United States, and did not report ill contacts, intravenous drug use, or recent sexual contacts. She had a temperature of 102.3°F, WBC of 4,800, AST of 330 U/liter and ALT of 250 U/liter. She was thought at the time to have a viral prodrome and was treated symptomatically. The patient returned to the clinic 3 days later with resolution of her constitutional symptoms but with the development of inflammation and pain around her recent tongue piercing (1 to 2 weeks before this visit). The patient was treated for oral thrush, and cultures of the tongue were taken and grew normal oral flora and beta hemolytic streptococci group C. Several days later, the patient presented to the emergency room with worsening fever, abdominal pain, vomiting, diarrhea, myalgia, and arthralgia. At this time, she had an AST of 6000 U/liter and ALT of 4000 U/liter. The following day, her lab values increased to an AST of 9200 U/liter and an ALT of 4400 U/liter. Bilirubin and alkaline phosphatase were within normal limits. Other laboratory values were as follows: alcohol, non-detectable; CMV, infectious mononucleosis, leptospira, EBV, HBV, HCV, HEV, HIV all negative; urine drug screen negative; serum acetaminophen level of 3 μg/dl.
+CT scan showed a mottled liver and a 2 to 4 mm abscess of the anterior tongue. Shortly after admission to the ICU, she developed hypotension, coagulopathy with a PT of 83.2s and PTT of greater than 200s, hyperammonemia, and acute renal failure thought to be due to hepatorenal syndrome. The medical team was in the process of preparing her for transport to receive a liver transplant but the patient expired. Postmortem laboratory results revealed a tongue viral culture positive for HSV and a positive serum HSV PCR.
+Autopsy revealed a liver weighing 1620 g with diffuse geographic necrosis. Histological examination of the liver showed extensive hemorrhagic necrosis with HSV intranuclear inclusion , Cowdry type 1 and 2 , with immunoreactivity for HSV-1 . Other findings included bilateral pleural effusions (approximately 500 ml) and a pelvic wall hematoma (4.0 × 2.5 cm).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1875_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1875_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f4600ee4ca4131c1f3e7c1cb69ec5967d221adc4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1875_en.txt
@@ -0,0 +1,4 @@
+Over the course of two months, a 75-year-old Caucasian man weighing 45kg who had a history of multiple previous drug overdoses, depression, bulimia and stage 3 chronic kidney disease (creatinine between 160μmol/L and 140μmol/L, that is, estimated glomerular filtration rate, 39ml/min/1.73m2 to 46ml/min/1.73m2) presented on three occasions to St Vincent’s Hospital following aspirin overdoses. During his third admission, he overdosed with aspirin while on the ward recovering from the previous aspirin overdose. His alleged ingested dosages Table were classed as “potentially lethal” in two episodes (>500mg/kg in both) and “serious” in the other two (300mg/kg to 500mg/kg) . However, the peak plasma concentrations indicated a “moderate” severity of poisoning after the first and second overdose and “mild” severity after the other two . The patient was dehydrated upon each admission with mild hyperventilation (respiratory rate around 30 breaths/min), nausea and tinnitus. He had no other neurological symptoms or signs. He was normothermic upon all admissions. In the second and third overdoses, the patient presented with respiratory alkalosis . Raised anion gap levels (that is, anion gap >18mmol/L) were observed upon the first admission (anion gap, 21mmol/L) and the second admission (anion gap, 22mmol/L) and resolved within 24 hours of treatment both times.In each of the four episodes, the patient received intravenous fluids (0.9% saline and/or 4% dextrose diluted 1:5 in saline) with the aim of achieving clinical euvolemia. Potassium supplementation was needed in the first, second and third overdoses. Additionally, sodium bicarbonate was administered after the second, third and fourth overdoses. The bicarbonate therapy led to an increase in urinary pH to between 7.5 and 8 (measured using Siemens Multistix 10 SG (Siemens Healthcare Diagnostics, Tarrytown, NY, USA) (referred to as dipstick below)). Single-dose charcoal was given after the second overdose only. None of the admissions warranted airway support, and there was no incidence of bleeding.
+This patient had short high-dependency unit admissions (<48 hours) after the first, second and third overdoses. His fourth overdose was treated in a general ward. Refractory hypokalemia was encountered after the first and second overdoses, taking more than 20 hours to achieve normokalemia . Urinary pH between 7.5 and 8 was observed only when plasma potassium concentration was ≥3.7mmol/L . Subsequently, using urine samples from one healthy volunteer (author DG) across a manipulated pH range of 5.0 to 8.5, dipstick readings were compared to those determined using a pH meter (Mettler Toledo, Columbus, OH, USA). The dipstick readings were consistently lower, by 0.36±0.2 units (based on six readings), than the “gold standard” pH meter readings.
+The longest apparent half-life (t1/2) of elimination of salicylate (t1/2 = 30 hours) was seen after the first overdose, when urinary alkalization was not attempted . The most rapid elimination was observed during the second admission (t1/2 = 9.7 hours). On that occasion, compared to the other overdoses, a much greater volume of intravenous fluid was administered, along with bicarbonate therapy and a single dose of charcoal .
+The patient’s lengths of stay were 21 days (first overdose), 8 days (second overdose) and 6 days (third and fourth overdoses), respectively.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1925_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1925_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6b18bcf2af09ff3947a51a6c7a15fe195ee3f9bf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1925_en.txt
@@ -0,0 +1 @@
+A 43-year-old man presented with a 2-month history of side-locked attacks of excruciatingly severe stabbing and boring left-sided pain located in the orbit. The attacks were associated with nasal obstruction, conjunctival injection, and restlessness and migrainous features such as nausea and photophobia/phonophobia. No continuous background pain was identified. The duration of the attacks was about 30 min and the frequency 4 to 5 per 24 h, 3 to 4 days a week and they also occurred during the night. There was no history of headache. His medical and family history was otherwise unremarkable. He was not on any medications and used no drugs. Vital signs, physical examination, and neurological examination were normal. Laboratory testing was normal. He satisfied the revised International Classification of Headache Disorders criteria for CH. A diagnosis of CH was made and subcutaneous sumatriptan as well as oral sumatriptan were prescribed. A prophylactic treatment with steroids and verapamil was suggested but the patient preferred symptomatic medication instead of using a prophylactic drug for CH. He responded to the treatment with relief within 15 to 20 min. A follow-up was planned. As the headache attacks continued, the patient was hospitalized after about 1 month. At admission, the neurological examination was normal. He was on the following medication: subcutaneous/oral sumatriptan when required. A CT scan of the head displayed a supra- and intrasellar arachnoid cyst with mass effect . An enhanced magnetic resonance imaging (MRI) was ordered in order to further evaluate the lesion. It confirmed the diagnosis of a supra- and intrasellar arachnoid cyst with mass effect on adjacent structures . Operation (craniotomy with cyst fenestration) and histopathological examination verified the diagnosis of AC. The headache attacks resolved completely after the surgery. He remained headache free and had not experienced any headache attacks at follow-up after 4 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1942_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1942_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e259605c8264fd2382ae8696fa831d623f7e692d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1942_en.txt
@@ -0,0 +1,2 @@
+A 17-year-old male with no comorbidities presented to the emergency department (ED) with complaints of headache and recurrent vomiting for 2 weeks, vision loss in right eye for 1 week, and altered sensorium for 2 days. On examination, the patient was drowsy but arousable, right hemiparesis grade 4/5, right-sided secondary optic atrophy, and left-sided papilledema (pseudofoster Kennedy syndrome). Magnetic resonance imaging (MRI) of the brain showed, T1-weighted images heterogeneous predominantly solid (iso-intense) cystic with central hypo-intense core suggestive of necrosis . T2-weighted images showed, solid (iso-intense) cystic (hyper-intense) with hyper-intense central core suggestive of necrosis . On contrast administration, the lesion demonstrated heterogeneous enhancement with central necrosis with a positive DTS .
+Patient was taken up for emergency surgery, and left parasagittal parieto-occipital craniotomy fashioned and gross total tumor excision was done. On opening the dura, tumor was seen surfacing and invading the superior sagittal sinus as well as the falx, with infiltration into the adjacent brain parenchyma. Tumor was greyish soft to firm in consistency with central necrosis and highly vascular suggestive of a high-grade lesion. Per-operatively patient had a transient episode of hypotension, which was managed. Approximate blood loss was 2 liters. Postoperative computed tomography scans showed complete tumor removal . Postoperative recovery was uneventful and patient was discharged in a stable condition. Final biopsy revealed GBM with primitive neuro-ectodermal (PNET) like components.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1984_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1984_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2b7b6f24e2ef7dbe46bac6bd4be5b987747866af
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_1984_en.txt
@@ -0,0 +1,4 @@
+A 62-year-old Japanese woman was referred for bilateral dry eyes, with Schirmer’s test results of 0 mm for both eyes. Four years previously, she had been diagnosed with primary rheumatoid arthritis (RA) and secondary Sjogren’s syndrome. She was being treated with 6 mg of methotrexate. CT scans appeared normal when she was first diagnosed with RA. Just prior to her dry eye referral, her previous hospital found C-reactive protein (CRP) and lactate dehydrogenase (LDH) levels to be significantly increased (CRP of 11.83 and LDH of 952), leading to a suspicion of an underlying malignancy. A CT scan was done, and some lung opacities were found, but biopsies of bone marrow, pleural fluid and cerebrospinal fluid (CSF) all revealed no neoplastic activity.
+While being treated for dry eye at our hospital, emergent hyperemia presented in the right eye coupled with fever and photophobia, for which she was admitted to the hospital. In the inpatient ward, hemorrhagic hypopyon that showed niveau-like hypopyon with hemorrhage as reported in previous case was seen on slit lamp. A distinct herpetic corneal lesion were noted via fluorescein staining. Keratic precipitates were noted, but no synechiae. HSV was specifically identified in the right eye via Checkmated Herpes-eye®, (Wakamoto Co., Ltd., Tokyo Japan). Corneal smear was done to rule out bacteria as a potential cause. Right eye visual acuity was found to be 20/500, while left eye visual acuity remained 20/20. Right eye intraocular pressure (IOP) was 16 mmHg and left eye IOP was 18 mmHg. The anterior segment of the right eye presented with hyperemia, dendritic keratitis, and intracameral fibrin deposits . Posterior segment appeared normal. Anterior segment optical coherence tomography (AS-OCT) further illustrate the fibrin deposits and hemorrhagic hypopyon . Body temperature was elevated to 38.5 °C, with a white blood cell count (WBC) of 10.4 × 103/μL (with neutrophils being 64.3%, lymphocytes 16.5%, monocytes 16.8%, eosinophils 1.9%, and basophils 0.5%) Treatment with topical acyclovir ophthalmic ointment (5 times daily), topical levofloxacin (5 times daily) and oral valacyclovir (3 times daily). Two days later, the dendritic keratitis began to regress.
+By day 5 of treatment, the dendritic keratitis, fibrin, hypopyon had regressed, with only superficial, punctate keratitis and Descemet membrane folds remaining. WBC normalized, CRP dropped to 9.72 and body temperature dropped to 36 °C. The right eye’s visual acuity recovered to 20/200, which was comparable to baseline on account of a cataract. Three weeks after hospitalization, symptoms had completely regressed; slit-lamp findings revealed no findings indicative of herpetic keratouveitis or recurrent hypopyon.
+Nearly 3 months later, a fever and corneal opacities reoccurred. Again, a characteristic herpetic dendritic lesion, superficial punctate keratitis, and intracameral fibrin deposits were noted . WBC count remained normal, diminishing suspicion of RA flare-up. Due to the previously elevated LDH levels and previous rare viral presentation, malignancy was again suspected. A positon-emission tomography-computed tomography (PET-CT) showed significant diffuse lung opacities whereafter a lung biopsy was performed to confirm an intravascular B cell lymphoma . Rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP) regimen was begun immediately, and the corneal lesions and the lymphoma both went into complete remission. Over a year and a half later, there is still complete remission of the cancer and no corneal lesions or ocular symptoms .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2015_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2015_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..387b612cf1e271bcdd5f90c33b61ae1da7dd40f8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2015_en.txt
@@ -0,0 +1,2 @@
+A 71-year-old man with no history of episodes suggesting mental illness was brought to us after a suicide attempt. Forty days earlier, he had undergone cataract surgery, and during the operation, the artificial lens fell inside the lens, resulting in a decrease in visual function compared with before the illness. Thereafter, he tended to have insomnia due to stress caused by the difficulty he faced in returning to his work and hobbies. He gradually developed depression, along with anxiety related to physical ailments such as discomfort in his right eye, back pain, and complaints of right knee pain. The depressive mood continued to worsen, and the patient complained that "I'm finished" and "I want to die"; he then ingested an herbicide (glyphosate) and was rushed to the emergency room. After gastric lavage, there was no physical abnormality, but as the patient's suicidal thoughts continued, the need for psychiatric treatment was recognized, and he was admitted to the psychiatric department the next day.
+The patient had been experiencing insomnia, depressed mood, weight loss of 5 kg in 1 month due to loss of appetite, poor concentration, low energy, feelings of worthlessness, loss of interest, and hopelessness for more than 2 weeks, triggered by the loss of vision caused by the surgery, which had made it difficult for him to lead his daily life without getting help from his family. Therefore, we diagnosed the patient with major depressive disorder and started him on mirtazapine (15 mg/day). On the seventh day, mirtazapine was discontinued due to suspected mirtazapine-induced delirium. Although his anxiety and agitation improved slightly, the patient scored 23/30 points on the Hasegawa Dementia Scale-Revised (HDS-R), with some disorientation and short-term memory impairment. The patient did not remember his suicide attempt or cataract surgery and had both anterograde and retrograde amnesia; on that basis, we suspected some organic cause. EEG showed some slow waves at 6-7 Hz on the 12th day . MRI showed bilateral swelling of the medial temporal lobes and hippocampi and high signal on T2-weighted imaging; diffusion-weighted imaging showed high signal predominantly in the right insular cortex, and T2-weighted fluid-attenuated inversion recovery (T2-FLAIR) also showed high signal predominantly in the right insular cortex . In addition to the insular cortex, T2-FLAIR also showed a high signal in the hippocampus . On the 13th day, involuntary movements of the left face, tongue biting, and weakness of the right side of the body were observed with no impairment of consciousness; these movements were judged to be a simple partial seizure. On the same day, the patient was placed in the ICU for general management. There were no abnormal findings on a CT scan of the head. The patient was given 1000 mg of levetiracetam. On the following day, he was free of convulsions and hemiplegia and was able to communicate well; therefore, he returned to the psychiatric ward that day. On the 14th day, the patient returned to the psychiatric ward. An electroencephalogram (EEG) showed spikes in the right frontal lobe (F4), suggesting epilepsy originating in this region, and levetiracetam 1000 mg was continued. A lumbar puncture performed on the same day showed no increase in cerebrospinal fluid cell count, and cultures were negative, suggesting encephalopathy rather than infectious or autoimmune encephalitis. Gradually, in addition to the original disorientation, the patient became agitated, had difficulty maintaining attention, and was unable to receive rest instructions. For this reason, we considered him to be in a state of delirium and started physical restraint on the same day. At night, the patient became emotionally unstable, shouting, "I'm going to the office," yelling, and suddenly bursting into tears. In addition, from the 15th to the 16th day, 11 bouts of involuntary movements occurred on the left side of the face, lasting a few minutes each. The dose of levetiracetam was increased to 2000 mg/day on the 16th day, and simple partial epileptic seizures did not occur from then on. Risperidone (0.5 mg/day) was added before bedtime on the 17th day, and although there were some fluctuations in affect and disorientation after that, the patient was able to sleep at night and received rest instructions on the 19th day. Risperidone was discontinued. Gradually, the patient recovered from his cognitive impairments, including disorientation, and the HDS-R on the 26th day showed a score of 23/30, with improvement only in the recall item. An EEG on the 27th day showed no slow waves or spikes, and an MRI scan on the 28th day showed a slight improvement in the high signal and swelling of the hippocampus and insular cortex on T2-weighted, T2-FLAIR, and diffusion-weighted imaging; on this basis, the patient was discharged on the 33rd day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2019_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2019_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1f56b5734934eaa52a283c76121cfee6939714b8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2019_en.txt
@@ -0,0 +1,4 @@
+A 74-year-old previously healthy man was referred to our institution for repeated palpitations over 6 months. A Holter electrocardiogram (ECG) from the local hospital showed persistent AT. No oral anti-arrhythmia drugs were prescribed. The initial workup included baseline ECG, routine blood tests, chest X-ray, echocardiogram, and coronary angiography. There was frequent unifocal initiating AT with a P-wave morphology of positive amplitude in I, II, III, aVF, and V1 .
+The patient underwent an electrophysiological study and ablation. Endocardial mapping of the atrium was performed using a PentaRay catheter (Biosense Webster, Inc., CA, USA) and a smart-touch contact force (CF)-sensing catheter (Biosense Webster, Inc., CA, USA) with the CARTO mapping system (Carto, Biosense Webster). Spontaneous AT was identified and mapped throughout the procedure using activation mapping, voltage mapping, and ripple mapping. Intracardiac electrophysiology during AT [cycle length (CL) 184 ms] showed atrial signals with an eccentric pattern of atrial activation on the coronary sinus catheter . Further activation mapping showed the earliest activation zone of AT originated in the right atrial FO. Ripple mapping showed activation progressing from the FO to both the right atrium and left atrium . Voltage mapping revealed no low-voltage regions in either atrium .
+In the FO, further high-density mapping (HDM) using the PentaRay catheter and point-to-point mapping using the CF-sensing catheter (Biosense Webster, Inc., CA, USA) demonstrated significantly long-duration fractionated electrograms covering a considerable percentage of the CL of the tachycardia within a localized region . About 107 points at 12 cm2 were taken for the map. The colours of the wavefront on the activation maps can be tracked by following the regions where red meets purple . Concealed entrainment was fulfilled only at the FO, which implied the tachycardia mechanism is micro-reentrant in nature.
+A radiofrequency catheter ablation (RFCA) current was delivered at 30 W in power-controlled mode at 43°C and a normal saline velocity of 17 mL per minutes. The RFCA was delivered to the middle of the micro-reentrant circuit, terminating the AT immediately after 3 s (, Video S2). No AT was induced during programme stimulation and isoproterenol infusion (10 µg/min). The patient had no further episodes of AT over the ensuing 12 months until he was discharged to his home without antiarrhythmic drugs.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_201_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_201_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..22e62376f9ce268d39dcb9901f39f097c46e80b9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_201_en.txt
@@ -0,0 +1,4 @@
+A 64-year-old female patient presented with blurry, double, and starburst vision in her right eye, accompanied by a one-year history of decreasing visual acuity. Her ocular background involved chronic angle-closure glaucoma. Four years prior, she underwent trabeculectomy surgery along with cataract phacoemulsification and PCIOL implantation in both eyes. Additionally, she has a medical history of osteoarthritis and an inguinal hernia. Two months post-surgery, the anterior capsule of her left eye contracted rapidly, and Nd: YAG capsulotomy therapy was employed to restore visual acuity. Throughout the follow-up, intraocular pressure in both eyes ranged between 18 and 21 mmHg.
+Recently, her right eye’s best-corrected visual acuity (BCVA) had been gradually declining and was now 6/20. Clear corneas, typical anterior chambers devoid of cells or flare, and a properly positioned posterior chamber intraocular lens (PCIOL) were observed during slit lamp inspection. However, the pupil was only slightly dilated at 3.5 mm. Examination revealed collections of the OS in the right eye trapped between the retro-IOL surface and the hyper-distended posterior capsule in the posterior chamber . Utilizing the IOL master (Carl Zeiss Meditec AG, Germany) and ultrasound biomicroscopy (UBM, SW-3200 L, Tianjin), preoperative biometry measured an axial length of 20.66 mm, anterior chamber depth (ACD) of 2.90 mm, and the distance between the PCIOL surface and posterior capsule of 1.96 mm, respectively . No space was observed between the posterior iris surface and the lens-complex interface. According to UBM, a weak echo was reflected following the IOL and posterior capsule, with a dot/cluster echo towards the posterior capsule’s bottom. B-scan ultrasound (Esaote, Genova, Italy) did not reveal any noteworthy abnormalities. Simultaneously, measurements for the left eye indicated a 20/20 BCVA, a 20.31 mm axial length, and a 2.81 mm ACD. Examination of the posterior segments of both eyes revealed nearly normal macular anatomy, with a cup-to-disc ratio of 0.5 in both eyes. Itrace’s visual quality (VQ) analysis indicated that coma and trefoil in the internal eye were the primary causes of blur, double vision, starbursts, and decreased contrast sensitivity. The presence of a trapped OS and a hyper-distended posterior capsule could contribute to confusing low VQ across all indications. All evidence suggested late-onset CBS occurring in her right eye based on the trapped OS and the apparent absence of anterior and/or posterior inflammation. However, Nd: YAG laser capsulotomy therapy was constrained by the small pupil and hyper-distended posterior capsule.
+Once permission was granted, the patient underwent local anesthesia for pars plana anterior vitrectomy, pupil reformation, posterior capsulotomy, release of opaque material with an inflammatory cytokine test, and other necessary procedures. Iris hooks assisted in visualizing a roughly 3.5 mm-sized white anterior capsule, though shrinking during surgery, which showed signs of fibrosis around its entire perimeter. No retained cortex was observed, and the posterior capsule remained non-turbid. Using a 23-gauge trocar, a 3.5 mm pars plana port cannula was created from the limbus. Initially, attempts to remove OS from the posterior chamber using a 30-gauge needle were hindered by negative pressure, indicating a sealed area between the posterior capsule and the retro-IOL surface. Subsequently, the posterior capsule was penetrated, and the capsular bag contents were aspirated by a cutter through the super-temporal port, with irrigation closed infra-temporally. For the analysis of inflammatory cytokines, the aspirated fluid was promptly transferred and maintained at a temperature of 4 °C. The remaining anterior capsular, enlarged to a diameter of 6 mm, was released after careful peeling off of the fibrosis anterior capsular ring. The ring material was then fixed for pathology study. A 4 mm diameter posterior capsulotomy was performed in the center using a 23-gauge vitrectomy, followed by a local anterior vitrectomy. Pathological examination of the 3 × 2 mm area and 1 mm thick fibrosis anterior capsular material revealed innocent fibrotic cystic tissue with minor pigment accumulation. Cytokine analysis using a flow cytometer multiple array assay device identified changes in some cytokines, including up-regulation of BFGF, IL-8, and down-regulation of VCAM .
+The patient was monitored for 6 months, with a positive postoperative phase and an improvement in BCVA to 20/25. The anterior chamber’s depth increased slightly from 2.90 to 2.95 mm. This procedure also addressed other CBS issues, such as improved pupil function, release of the trapped OS, proper placement of the IOL in the bag, and the absence of aberrant IOL deposits . The absence of visual complaints confirmed the successful treatment of coma and trefoil in the internal eye through Itrace analysis. Due to a history of glaucoma, fundoscopy and optic coherence tomography revealed moderate optic atrophy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2023_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2023_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3e6b75c12100a1421da7968393abc95c888bf809
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2023_en.txt
@@ -0,0 +1,3 @@
+A 40-year-old woman was referred to the facial plastic surgery clinic with a seven-month history of asymptomatic left-sided facial lipoatrophy. She was otherwise healthy with no significant medical or surgical history and was not taking any medications. The lipoatrophy presented over the course of 2 weeks and remained stable for 6 months preceding presentation. There was no history of trauma, infection or previous surgery in the area. She did not receive treatment prior to presentation to clinic. The patient reported no previous lipoatrophy, HIV infection, or autoimmune disease. Her family history was unremarkable for these as well.
+The area of fat loss was asymptomatic but socially disfiguring . On examination, there was almost complete loss of the malar fat pad over the malar eminence as well as a concave deformity extending temporally towards the lateral canthus. She was clinically assessed to have moderate to severe concavity of one or more facial regions, observable prominence of bony landmarks, and possible visibility of underlying musculature. These features were consistent with grade 4 facial lipoatrophy according to the scale developed by the Facial Lipoatrophy Panel . Investigations, including a full autoimmune workup, were unremarkable. Lipoatrophy of this severity would be unlikely to resolve spontaneously. No other specialists were consulted in the investigation of this presentation.
+The patient provided consent to treatment and the publication of this case report. She received two treatments of autologous fat grafting both of which were done using a Coleman type approach . The area to be treated was marked with the patient standing. For the harvest of fat, 20 mL of 1% lidocaine with adrenaline was injected into the periumbilical area followed by initiation of sterile technique. Using a Coleman liposuction harvesting cannulae, a total of 15 mL of fat was harvested in an atraumatic fashion through a small periumbilical stab incision. The fat was not centrifuged, but was simply transferred directly into 1 mL leur lock syringes for injection, discarding any fluid that accompanied the fat. An infraorbital nerve block was performed with local anesthetic injection into the depressed area. The face was prepped and draped in a sterile fashion and a small stab incision was performed in the mid cheek subunit at the intersection of a vertical line drawn down from the lateral canthus and a horizontal line drawn from the ipsilateral alae. A total of 8 mL of fat was injected into the soft tissues of the cheek and various levels ranging from the supraperiosteum to the subcutaneous plane. Both umbilical and facial stab incisions were closed with a single fast absorbing gut suture. This procedure was repeated 1 year later as a second stage of treatment to improve the correction of the facial deformity. The patient reported no adverse effects from treatment and was satisfied with the results . She continues to be followed annually though future treatments are not anticipated.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2027_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2027_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a8b1efb559a7fdea86b564c0e52b029c0d3b2887
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2027_en.txt
@@ -0,0 +1,4 @@
+In February 2018, a 26-year-old female patient presented to our hospital with progressively worsening anal pain, constipation, and hematochezia for approximately two years. She had given birth right two and a half years previously. She had no prior medical history and family history of gastrointestinal malignancies. On admission, her vital signs were stable. Digital rectal examination revealed an ulcerated 5-cm indurated lesion located at the nine o’clock position and 2 cm from the anal verge, with bleeding upon palpation. The blood tests showed elevated carcinoembryonic antigen (CEA) (10.51 ng/ml; reference range, < 3.4 ng/ml) and carbohydrate antigen 19-9 (CA19-9) (40.49 U/ml; reference range, < 22 U/ml). The diagnosis of poorly differentiated adenocarcinoma was established by flexible sigmoidoscopy with biopsies and histological examination. Computed tomography (CT) of the chest and abdomen and magnetic resonance imaging (MRI) of the pelvic confirmed the tumor stage of cT3N1M0 . Radiologic examinations did not detect metastasis to the liver, bone, lung, or breast.
+Following consultancy with the multidisciplinary team, the patient underwent prophylactic transverse colostomy to avoid upcoming obstruction and then received 6 cycles of modified FOLFOX-6 neoadjuvant chemotherapy. The scheduled long-course radiotherapy (50Gy/25f) was ceased after the first time due to severe anal incontinence and myelosuppression. Laparoscopic abdominoperineal resection (R0) with a permanent colostomy was performed for her 6 weeks after the termination of neoadjuvant therapy . Guided by the fast-track surgery pathway, the patient’s recovery was uneventful, with discharge on postoperative day 5. The final diagnosis of rectal SRCC (ypT3N1bM0, Tumor Regression Grade 2) was determined via postoperative pathologic findings . Two out of eighteen mesorectal lymph nodes were identified with tumor involvement. Meanwhile, the proficient mismatch repair (MMR) was detected. The postoperative chemotherapy was consistent with the neoadjuvant regimen and initiated 4 weeks after surgery.
+After the second cycle of adjuvant modified FOLFOX-6, a painless, firm mass was palpable in the right breast and the area of vulva, respectively. The follow-up CT examination found the right breast mass . Ultrasound-guided core needle biopsies were performed for her. Hematoxylin & eosin and immunohistochemical (IHC) staining indicated the metastases to the breast (positive: CK20, CDX-2, E-cadherin; negative: CK7, PR, ER, Her-2, GATA3, GCDFP15) and vulva (positive: CDX-2, PCK, CEA, Alcian Blue) from rectal SRCC. In addition, genetic testing demonstrated RAS/BRAF wild-type and microsatellite instability-low (MSI-L).
+In December 2018, metastases to bilateral lung have been developed and the evaluation of efficacy was identified as progressive disease. Then the chemotherapy regimen was changed to irinotecan (290mg, day1, q3w) plus tegafur (50mg bid, day1-14, q3w). However, multiple metastases throughout the body (including the left breast) were found 3 months later. Tegafur (50mg, bid, day1-14, q3w) plus raltitrexed (4mg, day1, q3w)-based chemotherapy in combination with bevacizumab (400mg, day1, q3w) as the third-line treatment did not provide favorable efficacy. Unfortunately, the patient passed away 15 months after initial diagnosis due to rapidly progressive disease. The results of serum tumor markers (CEA and CA19-9) are listed in . Though limited sensitivity, the reduction of tumor markers at the early phase represented favorable response to neoadjuvant therapy, while the elevation of tumor markers at the late phase indicated rapidly progressive disease. The timeline with clinical data from the episode of care is shown in .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2029_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2029_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e02238ac590268164a3ad6935db8369b7c040543
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2029_en.txt
@@ -0,0 +1,7 @@
+A 52-year-old Caucasian woman with a past medical history of severe hypertension and non-insulin dependent diabetes mellitus presented with bilateral subacute visual loss which progressed over eight to 10 days to perceiving only light in the left eye and only hand movements in the right eye. The visual loss was preceded by dull ocular pain which persisted after the onset of visual loss. The patient experienced pain on eye movements but had no double vision. The patient did not have any temporal artery tenderness and temporal pulses were palpable bilaterally.
+On fundoscopic examination, both optic discs were swollen and no retinopathic changes of diabetes or hypertension were evident. There was no evidence of venous engorgement. There was reduced color vision in both eyes and a left relative afferent papillary defect was present. Visual field mapping showed a left central scotoma and a normal right sided visual field. The patient's blood pressure was 152/80 on admission and lower on subsequent readings during her hospital stay. The remaining neurological examination was unremarkable. There was nothing in her history or physical examination suggestive of connective tissue disease or sarcoidosis. Initial blood tests showed a normal full blood count, normal urea and electrolytes (U&Es), normal liver function tests, a normal C-reactive protein (CRP; < 1) and plasma viscosity and a raised glycated haemoglobin (HbA1c) of 7.3% (normal 4 to 6.1). Chest X-ray was normal. A lumbar puncture was performed which yielded cerebrospinal fluid (CSF) with normal white and red blood cells, a normal angiotension converting enzyme (ACE) level, no oligoclonal bands and a marginally elevated protein level of 467.7 mg/L (normal 150 to 450 mg/L). A magnetic resonance imaging (MRI) scan of her brain and spinal cord was normal.
+A provisional diagnosis of acute ischaemic optic neuropathy was made by the general medical team and the patient was started on aspirin with omeprazole cover. On review by the neurology team a day later the cause was thought to be inflammatory rather than ischemic. She received a three day course of intravenous methyl prednisolone. Vision improved to 6/6 in both eyes within two days with full restoration of color vision and visual field defects. Ten days later however, vision deteriorated again in the right eye to 6/36 with a temporal peripheral field loss. The relative afferent papillary defect had now switched to the right eye. The patient received 500 mg oral methyl prednisolone for five days. Her visual acuity and visual fields returned to normal within two days.
+A subsequent auto-immunity screen including aquaporin-4 antibodies was negative. Visual evoked potentials performed twelve days after the onset of the second episode of visual loss were delayed bilaterally (left > right) indicating bilateral optic nerve dysfunction. Her pattern electroretinograms, brainstem evoked potentials, median nerve and posterior tibial somatosensory evoked potentials were normal bilaterally.
+There was no evidence of Leber's hereditary optic neuropathy on genetic molecular analysis. The m.11778G > A, m.3460G > A, m.14484T > C mitochondrial mutations were tested for and not detected in our patient.
+A chest computed tomography (CT) was normal and did not show any hilar adenopathy or any other features of sarcoidosis.
+Serial MRIs over the next four months were normal without any inflammatory lesions and oligoclonal bands were negative which excluded multiple sclerosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2035_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2035_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fb7a6483973f7ac3121b55634f2e66933c2a8829
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2035_en.txt
@@ -0,0 +1,7 @@
+In July 2021, a 34-year-old woman came to the emergency department with a five-day history of fever and a dull ache in the chest radiating to the right arm.
+She visited her family doctor one week before because the ache in the chest was given a visual analogue scale score of 9-10 and gradually worsened. There was no redness or irregularity in the skin of the chest area. Blood tests were normal. She was given nonsteroidal anti-inflammatory drugs and opioids for pain relief, but the condition did not improve, therefore she came to our hospital for emergency treatment.
+There is no relevant history of past illness, intravenous drug abuse, inflammatory joint alterations, trauma, and spreading from a source of infection (dental, skin areas).
+The patient was a non-smoker. She claimed to have no allergies to food or medicines, no operations were performed. The patient denied any family history of arthritis.
+Body mass index - 22.4 kg/m2. The vital signs were as follows: Body temperature - 36.9℃; blood pressure - 98/60 mmHg; heart rate - 100 beats per minute; respiratory rate - 19 breaths per min During palpation, there were no swollen or painful lumps and lymph nodes in the typical axilla, neck, or groin areas; the chest was painless.
+Primary laboratory tests showed significantly increased inflammatory markers: C-reactive protein (CRP) 256.0 mg/L (Ref ≤ 5 mg/L), leukocytosis white blood cells (WBCs) - 14.20 × 109/L (Ref from 4.5 to 11.0 × 109/L); elevated procalcitonin 0.69 µg/L (Ref < 0.1 ng/mL) and liver enzymes: Aspartate aminotransferase - 239 U/ L (Ref ≤ 40), alanine aminotransferase - 334 U/L (Ref ≤ 40); normal troponin - 0 ng/L (Ref ≤ 16), and elevated D-dimers 1725 µg/L (Ref < 250 µg/L). No abnormality was found in urine analyses.
+The electrocardiogram showed only sinus tachycardia - 103 bpm. Pulmonary embolism, aortic aneurysm, pneumonia, pneumothorax, and even rib fracture were suspected. Thoracic CT angiography, non-contrast chest CT, and X-ray of the thoracic spine, ribs, and sternum were performed, as well as diagnostic ultrasound with PD (by an abdominal sonographer) of the soft tissues at the sternum, but no pathology was detected.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2043_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2043_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eee2945b30caa6d883b1427443c0494e9a557cb4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2043_en.txt
@@ -0,0 +1,7 @@
+A 16-year-old Persian man visited a referral hospital after his mother was diagnosed as having aggressive MTC. The 38-year-old woman, who had had a mass in the thyroid gland and cervical lymphadenopathy for six years, underwent thyroidectomy a year earlier after being diagnosed as having the disease. Her family members were then asked to visit a physician for further evaluation as the disease usually runs in the family.
+Our patient had no history of the main symptoms of the disease, namely lymphadenopathy (LAP), weight loss, fever, café au lait spots, ocular problems, gastrointestinal problems (failure to thrive (FTT), abdominal pain, dysphagia, projectile vomiting, diarrhea, constipation, flatulence), thyroid nodule, hoarseness, dyspnea and cough.
+On physical examination, his face was symmetric and there was no sign of high arched palate, mandibular prognathism, and flat nasal bridge. He, however, had bumpy lips and several neuromas on his upper and lower eyelids, lips and tongue, all characteristic of MEN2B. His thyroid gland and abdomen were normal, and there were no other remarkable finding in the physical examination. He had a normal height with no signs of marfanoid habitus. He had increased calcitonin and carcinoembryonic antigen (CEA) levels but tests for RET proto-oncogene on exon 10, 11 and 16 were negative.
+The results of an ophthalmology examination showed several mucosal neuromas on inner eyelids and conjunctivae, prominent perilimbal conjunctival blood vessels and enlarged corneal nerves. His intra-ocular pressure (IOP) was normal. His upper gastrointestinal and small bowel series were also normal.
+Pheochromocytoma was ruled out based on the laboratory test results. Our patient thereafter underwent a thyroidectomy. The results of pathological tests revealed a small (0.5cm) medullary thyroid carcinoma in right lobe, with surgical margins free of tumor.
+Post-operative evaluation, including cervical ultrasound as well as cervical, thoracic and abdominal computed tomography, were normal. Our patient's calcitonin and CEA levels were then assessed periodically.
+It should be noted that all the family members had signed an informed consent, providing the authors with an authorization to publish their information.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2054_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2054_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ee1850e940b062ce9cdd1ed0d16239870a088361
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2054_en.txt
@@ -0,0 +1,7 @@
+A 44-year-old male presented with chronic osteomyelitis of the right tibia. The patient presented to the orthopaedic clinic due to right leg pain and swelling, the inability to bear weight, and multiple attacks of subjective fever. The right leg pain suddenly progressed over the prior 3 mo, without a history of recent trauma. The pain increased at night and later became constant even during rest. The pain was located mainly on the proximal right tibia with radiation to the right knee and middle third of the right leg. The patient also experienced multiple attacks of fever and night sweats.
+The patient had an open fracture 22 years ago with an infection and was diagnosed with chronic osteomyelitis with a discharging sinus. The sinus had closed, but the pain continued. He was treated with evacuation of the abscess and courses of antibiotics.
+The patient had a history of hypertension.
+No personal or family history relevant to the presentation. No history of allergy to medications was reported.
+On inspection, there was swelling of the right leg and skin redness on the anterior aspect of the proximal third of the right leg. We observed a skin scar with thin scar tissue over the tibia directly. There was no underlying soft tissue on the anterior aspect of the proximal right tibia with massive swelling and tenderness around this area. The patient had an intact neurovascular examination.
+Laboratory findings included slightly increased leukocytes (12.3 × 109/L; normal range: 4.5-11.0 × 109/L), haematocrit (40.2%; normal range: 41%-50%), platelets (522,000 mcL; normal range: 150,000 to 450,000 mcL), elevated erythrocyte sedimentation rate (95 mm/h, normal range: < 20 mm/h), and high C-reactive protein (133 mg/L; normal range: 0-10 mg/L). The patient had a discharging sinus on the anterior proximal third of the right leg in the centre of the previous scar. Culture from the sinus grew Staphylococcus aureus.
+Anteroposterior and lateral X-ray views showed multiple opacities, and magnetic resonance imaging showed a collection with high signal intensity in the proximal right tibia. The radiological studies revealed an intramedullary collection of the proximal right tibia with the impression of subacute osteomyelitis with multiple Brodie’s abscesses of the proximal right tibia .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2064_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2064_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..560ec20918285d3bbe5adcbefbc7e8f2afaf013c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2064_en.txt
@@ -0,0 +1,6 @@
+A 44-year-old Chinese man, weight 55 kg and height 165 cm, presented to the neurosurgery department of our institution with an 11-month history of paroxysmal headache and weakness of the right limb without any other pertinent positive symptom. The patient had been diagnosed with NF1 for more than 30 years. His past surgical history included having undergone left parietal tumor resection in May 2016, the postoperative pathology of which indicated glial sarcoma (World Health Organization grade IV). In July 2017, the patient presented with paroxysmal headache with weakness of the right limb. Computed tomography (CT) of the head revealed recurrence of left parietal glioma, acute cerebral infarction in the left frontal lobe and around ventricle. As a result, the patient received conservative treatment in the neurology department.
+The only pertinent positive physical examination finding was multiple cutaneous neurofibromas and numerous café-au-lait spots of different sizes dispersed over the trunk and limbs . The results of the patient’s cardiovascular, respiratory, and abdominal examinations were all unremarkable. His baseline blood pressure was in the range of 120–140 mmHg for systolic blood pressure and 65–85 mmHg for diastolic blood pressure. He denied any current medication, tobacco, or alcohol use, and a family history of NF was also excluded.
+The results of the patient’s preoperative laboratory examination were unremarkable, including blood and urine analysis. His electrocardiographic examination showed normal sinus rhythm. His chest x-ray revealed multiple nodules in the two lung fields, the largest being located in the upper right quadrant of the lung field and having a diameter of about 29 mm. Magnetic resonance imaging of the head revealed the recurrence of glioma. The patient was scheduled for resection of the recurrent gliomas.
+During the preoperative examination, it was thought that general anesthesia application would be more appropriate for the patient. The patient was monitored with electrocardiography, heart rate (HR), invasive blood pressure, and pulse oximetry in the operating room. He was anesthetized with midazolam 3 mg, etomidate 14 mg, cisatracurium 20 mg, fentanyl 0.15 mg, and propofol 60 mg in sequence. When assisted respiration was started, the monitor showed a persistent increase in blood pressure. Within 40 seconds, it rose to about 310/140 mmHg, and the HR increased to about 140 beats per minute (bpm). We quickly eliminated the following possibilities: taking the wrong medicine, blood pressure monitoring equipment malfunction, or problem with venous access. To prevent the cardiovascular complications, we took measures to control the patient’s blood pressure and HR with phentolamine 2 mg, esmolol 30 mg, and remifentanil 80 μg when the blood pressure was about 310/140 mmHg and HR was about 140 bpm. The blood pressure values were stable during intubation, but the HR continued to be higher than 110 bpm.
+The patient’s blood pressure was stable during the operation. However, there was a fluctuation of blood pressure during extubation with an increase to as high as 210/140 mmHg, which was aborted with phentolamine 1 mg. Nevertheless, the patient’s HR continued to be higher than 120 bpm, and he was not sensitive to β-adrenergic blockade.
+During postoperative follow-up, no headache, nausea, or blood pressure change (especially hypotension) was observed, and the patient’s tachycardia disappeared 3 days after the operation. To investigate the causes of severe hypertension during anesthesia induction, we initiated a biochemical workup of his adrenal hormone 3 days after the operation, which revealed elevated 24-hour blood laboratory test results: epinephrine 3.57 nmol/L (normal range, 0.01-0.34 nmol/L), metanephrine 8.99 nmol/L (0.01–0.42), normetanephrine 2.25 nmol/L (0.01–0.71), and vanillylmandelate 160.41 nmol/L (0.01–62). Subsequently, CT of the abdomen with contrast enhancement demonstrated a 7.7-cm × 6.7-cm heterogeneous mass in the left adrenal gland.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2085_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2085_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5bfcc0d660ab5dad149b05e5b6a2cd112945df72
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2085_en.txt
@@ -0,0 +1,3 @@
+Our case was a 65-year-old elderly woman with an ongoing scene of jaundice and abdominal pain which was settled with medical therapy. The transabdominal ultrasound was indicative of the presence of stone inside the dilated common bile duct (CBD) and she was alluded to an elective outpatient ERCP owing to choledocholithiasis. The assessment was average; in addition, aspartate aminotransferase, alanine aminotransferase, and bilirubin were seen to be inside the ordinary range. Nonetheless, alkaline phosphatase was elevated (659 IU/dl). Her vital sign was stable, oxygen therapy with nasal cannula was established and oxygen saturation was 98%.The patient underwent general anesthesia with midazolam, fentanyl, and ketamin at the proneposition.
+The side view endoscope was inserted slowly and easily into the duodenum, and a papilla with a normal appearance was seen next to a small diverticulum anfistolotomy was performed using a kindle knife following technically unsuccessful cannulation of CBD with a standard sphincterotome. Meanwhile, pulse oximetry dropped to 80% and the procedure was interrupted. The patient was released from pronepositin and auxiliary oxygen was applied with bag mask ventilation; nonetheless,the pulse oxymetry did not exceed 82% and there was no obvious reduction in lung sounds at that moment. Also, the patient developed abdominal distension. Therefore, duodenum perforation was suspected and abdominal radiography was performed which disclosed a large area of mottled air in the retroperitoneal area (around the kidney) . The physicians made the patient NPO and Iv administration of metronidazole and ceftriaxone was started. Subsequently, facial, cervical, and thoracic subcutaneous emphysema occurred. Oxygen therapy continued with the reservoir bag mask, pulseoxymetry dropped to 75% and bilateral lung sounds decreased. Abdominal computed tomography indicated the evidence of duodenal rupture, including retroperitoneal air, intra-abdominal free fluid, bilateral pneumothorax, Pneumomediastinum and subcutaneous emphysema (-).
+Bilateral chest tube was inserted instantly and the patient created indications of peritonitis. Laprotomy and repair of a lease (2 cm) situated in the posterolateral mass of the second segment of duodenum (Stapfer type 1 perforation) was performed. At long last, the patient was moved to the ICU, and after 4 days she was moved from the emergency unit to the ordinary ward. She bit by bit improved and was released from the clinic 8 days after the procedure.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2092_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2092_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c85c0d8219416d5900850b2f68aa37c769784415
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2092_en.txt
@@ -0,0 +1,4 @@
+We present a 62-year-old ethnic Indonesian woman previously diagnosed as having thoracic spinal cord entrapment with paraplegic condition for 6 months and chronic renal failure on hemodialysis for 2 years. She felt pain in her back and had difficulty in getting up from the floor. She could not move her legs, their power was 0/5, and there was no movement of her toes. She had no improvement in the neurologic deficit for 6 months. No sign of spinal shock was found in a physical examination during a neurological examination at her first visit. All modalities of sensation below her belly button were lost including proprioception. Urinary retention had to be catheterized, but she had no urine production for 2 years (please see information on kidney failure below). Defecation had to be helped by digital exploration. Her muscles were hypertonic with exaggerated jerk reflex and clonus. There was no history of significant injury to her back.
+A chest and thoracic X-ray was taken and the result was normal . T1-weighted magnetic resonance imaging showed a regular hypointense lesion in intradural location behind the bodies of Th8 and Th9 vertebrae predominantly on the left side. The lesion compressed the cord to the left. On T2-weighted magnetic resonance imaging the lesion was isointense relative to normal cord .
+The special note that we took here was that our patient had not urinated for the last 2 years before the paraplegic condition due to thoracic spinal cord entrapment. She had had diabetes mellitus for more than 10 years that already affected her kidneys. Two years before the incident, she had already been diagnosed as having ESRD. There is no history of diabetes mellitus, renal dysfunction, or paraplegic condition in her family. Her creatinine (Cr) level at that time was 11 mg/dl. She had to undergo hemodialysis three times a week.
+We performed our protocol of human umbilical cord MSCs (hUC-MSCs) implantation and injection to treat this patient. The protocol consists of six cycles of hUC-MSCs intrathecal implantation and intravenous injection with time interval of 3 months. One cycle consists of implantation of 16 million hUC-MSCs performed three times and intravenous injection of 16 million hUC-MSCs performed three times. After the second cycle of hUC-MSC protocol, improvement was seen in both legs, and she could do extensions of both of her knees. Her sensory level was increased from 0 to 2, but the clonus was still there. Surprisingly, we also found that she had urinated for the first time in the last 2 years after the first cycle of hUC-MSC protocol, and her Cr level decreased significantly from 11 mg/dl to 2 mg/dl after the second cycle of hUC-MSC protocol. Fortunately, no signs of allergy were found in this patient; as we know, allergic effect is one of the most terrifying effects of intravenous injection of MSC.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2095_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2095_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..318d9916d77582828aff9ddbc4a526c4e85bce6d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2095_en.txt
@@ -0,0 +1,5 @@
+The patient was a 74-year-old male who underwent heart transplantation in 2016 and presented to our facility as a direct transfer for headaches, acute renal injury, and tremors. Four months prior to admission, he had a routine echocardiogram and coronary angiogram for post-transplant surveillance, with no focal abnormalities reported. For transplant immunosuppression, he was taking tacrolimus 1 mg twice daily and mycophenolate mofetil 500 mg twice daily. The patient was not taking any antibiotic or antifungal medications.
+He was diagnosed with COVID via rapid testing 7 days prior to admission and was prescribed Paxlovid nirmatrelvir 300–ritonavir 100 mg twice daily by an outside, non-transplant provider for a 5-day course. During that time, the patient noticed worsening headaches, vertigo-like symptoms, and a metallic taste in his mouth. The headaches did not relieve with acetaminophen therapy. During that time while he was taking Paxlovid, he continued to take his home dose of tacrolimus (1 mg twice daily). There was no collected serum creatinine, tacrolimus trough level, or random tacrolimus level at the time he was prescribed with Paxlovid. His last creatinine was one month prior to Paxlovid and was 1.2 mg/dL (normal ≤ 1.2 mg/dL) with a blood urea nitrogen of 19 mg/dL (normal ≤20 mg/dL). His last trough was 5.1 ng/mL (goal 4–6 ng/mL) four months prior to admission. The patient initially went to his local facility with these symptoms. Given his history of heart transplant and established relationship with our transplant program, he was transferred here for further management .
+On examination, the patient was alert and oriented. He endorsed headaches but did not have limb weakness, numbness, tingling, or dysphagia. He did endorse mild tremors (hand tremors noted bilaterally) but denied chest pain, trouble breathing, or fluid retention. On admission, his vitals were recorded. He was afebrile with a temperature of 36.3°C, and the blood pressure was elevated with a reading of 149/86 mm Hg. He maintained a normal oxygen saturation of 96% on ambient air. The cardiovascular examination revealed a regular rate and rhythm without any concerning murmurs, rubs, or gallops. At that point, the differential for his constellation of symptoms included dehydration, atypical migraine, and accelerated hypertension with symptoms.
+Serum chemistry, complete blood count, and a tacrolimus morning trough level were obtained. His serum chemistry noted a mildly elevated creatinine level of 1.31 mg/dL with a blood urea nitrogen of 31 mg/dL. Complete blood count was unremarkable. His serum tacrolimus level was recorded as >60 ng/mL (an exact measurement could not be obtained as the value exceeded this laboratory limit). A non-contrasted computerized tomography scan was obtained of the head, which revealed no acute intracranial abnormalities.
+The tacrolimus was held during his hospitalization. He was started on intravenous hydration with lactated ringers at 100 mL/h for 10 h initially on Day 0 of the hospital stay. He received intravenous 0.9% normal saline at 100 mL/h for 10 h daily for three additional doses. No additional therapies were used to address the supra-therapeutic tacrolimus level. There were no specific therapies required for management of patient’s COVID-19. His oxygen saturation was normal, and he was not in respiratory distress. The patient’s headache improved. Standard strength acetaminophen was used on a parenteral basis to treat the headache. Daily labs showed a decline in his trough levels. The hand tremor persisted but was mild in severity. Both the serum creatinine and blood urea nitrogen levels also normalized. The patient still had an elevated level of tacrolimus, 15 ng/dL, on the day of discharge, but he was asymptomatic and instructed to resume the tacrolimus at his home dosing. He was scheduled to return to the clinic in 1 week and repeat a trough level. The patient did return to clinic 1 week after discharge, and his trough level, obtained 10 days post-discharge, was 4.7. He did not report any further adverse events and that the headaches and tremors had resolved.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2114_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2114_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..36d67d160010577dc624013723a1e3cac797221b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2114_en.txt
@@ -0,0 +1,5 @@
+Our patient was a 39-year-old Chinese woman who had delivered a second live full-term infant through an uncomplicated cesarean section in 2011 after a miscarriage in 2010 and a first cesarean section in 2005. In December 2014, she noticed a purple, nontender swelling appearing as an anterior abdominal wall mass around her cesarean scar. The mass was the size of a green bean and was not accompanied by any abdominal pain or abnormal vaginal bleeding. There were no notable findings in her past medical history, family history, or psychosocial history. The abdominal wall mass had progressively enlarged, which led to her presentation to a local institution. She had undergone tumor resection of the abdominal wall in June 2015, which might be interpreted as the abdominal wall endometriosis malignancy.
+The patient had visited a regional tertiary hospital for a consultation regarding the pathologic diagnosis of a CC before presenting to our hospital for further diagnosis and treatment. Her physical examination showed no abnormalities except for the scar from the local excision on the abdominal wall. Our pathologists reviewed the first excised specimen from the previous hospital and confirmed the characteristic of CC coexisting with minor ETT. Her Ki-67 proliferative index was approximately 50%. Laboratory analysis revealed normal serum levels of β-human chorionic gonadotropin (β-hCG; < 1.2 IU/L) and tumor markers, including carbohydrate antigen 125 (CA 125), carcinoembryonic antigen (CEA), CA 19-9, CA 15-3, and α-fetoprotein; all of these biomarkers had consistently negative values. Positron emission tomography was performed to further determine whether other metastatic lesions existed; however, no residual tumor and suspicious malignant lesions were observed. For further evaluation, endometrial curettage was performed, the results of which revealed normal menstrual phase endometrium. Subsequently, the patient received two courses of chemotherapy with a regimen of etoposide and cisplatin (EP) over a 2-month period. During chemotherapy, her serum β-hCG levels remained negative (< 1.2 IU/L).
+Subsequently, she underwent regular follow-up in the outpatient department, and a recurrent nodule was found on the same abdominal wall scar site in January 2017, approximately 17 months after the last chemotherapy. The patient was registered for admission again. Her serum β-hCG had increased to 6.17 IU/L, and two oval hypoechoic masses were visualized by ultrasonography in the subcutaneous soft tissue of the lower abdomen wall scar. Chest computed tomography (CT) and head magnetic resonance imaging (MRI) showed no abnormality. Then she underwent a second notable mass excision by ultrasound interventional localization. In this case, the nodule was in the fat layer next to the superficial fascia. Her serum β-hCG level was decreased to 3.4 IU/L on the second postoperative day. The result of pathological examination was initially in line with CC metastasis to the abdominal wall, and the patient’s Ki-67 index was 20%. However, the patient’s pathological sections were sent to the Fudan University Obstetrics and Gynecology Hospital, another tertiary hospital in China, for further consultation, and the finding was ETT. Finally, the patient was encouraged to maintain close follow-up, and her serum β-hCG level had gradually decreased.
+In the follow-up visits, the patient’s serum β-hCG level was elevated to the highest level of 10.68 IU/L again 4 months later , but she was still without any abdominal pain or abnormal vaginal bleeding. Furthermore, a pelvic CT scan showed several nodules on the abdominal wall midline fascia; the largest nodule was approximately 21 × 15 mm in size. The nodules had clear boundaries but were less uniform in internal echoes . Throughout the disease process, test results for tumor markers such as CA 125, CA 19-9, CEA, and HE4 were negative, and the results of routine blood sampling tests (blood cell count, liver and kidney function, coagulation function) were normal. We suggested a third resection of the mass to the patient, but she opted for a hysterectomy due to fear of malignancy and further relapse. She finally underwent exploratory laparotomy with removal of the abdominal wall lesion, subtotal hysterectomy, bilateral salpingectomy, and left ovarian cyst resection as well as right inguinal lymph node biopsy in July 2017. Intraoperative exploration revealed that the abdominal wall lesion was located on the anterior wall fascia.
+Histopathological observations suggested that hyperplasia of fatty fibrous tissue was visible with cancer infiltration and necrosis around the cancer tissue, which was consistent with trophoblastic tumor, constituted primarily by major epidermoid trophoblastic tumors (approximately 90%) and the remainder by CC components (approximately 10%) on the abdominal wall lesion . Immunohistochemistry showed β-hCG (focal positive), inhibin-α (epithelial trophoblast negative, CC positive), and p63 (epidermoid trophoblast positive, CC positive) . There was no tumor involvement in other tissues, including uterine, left ovarian cyst, and the right inguinal lymph nodes, which indicated an isolated and extrauterine mixed trophoblastic tumor. On the basis of all these findings, the diagnosis was ETT accompanying CC. The patient’s postoperative recovery was uneventful. Two weeks after hysterectomy, her serum β-hCG level had returned to normal (low 1.2 IU/L). Two years later, there was no evidence of recurrence according to serum β-hCG and imaging studies.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2171_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2171_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9c098ba229d9c81f4eaec347a829253cccb438b8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2171_en.txt
@@ -0,0 +1,7 @@
+A 70-year-old right-handed man, who showed the first signs of PD at 60 years of age, was admitted to our hospital for behavioral alterations. He presented with a six-month history of a delusional belief that his wife was having an affair with someone. At the same time, he began to show an obvious increase in libido presenting as frequent masturbation.
+The patient noticed he had a right-hand tremor ten years ago and then developed akinesia and rigidity. He was diagnosed with PD by a neurologist approximately one year later. Following treatment with levodopa-benserazide (200-50 mg/d), he initially showed significant improvement. His symptoms then progressed to difficulty turning during a walk, constipation, olfactory dysfunction, and vivid anxiety-provoking dreams. Seven years ago, the patient engaged in binge eating with a significant increase in food consumption, eating 3-4 times at night, and the symptoms lasted approximately one year. Six years ago, pramipexole (0.75 mg/d) and selegiline (1 mg/d) were prescribed. His pramipexole dosage was titrated up to 1.5 mg/d. In the past year, his memory has declined, especially his recent memory. About six months ago, he began to accuse his wife of having an affair with someone, although he could not provide any evidence of infidelity. The delusional belief was confirmed by his wife and two children. At the same time, he began to show an obvious increase in libido presenting as frequent masturbation. Three months before his current admission to the hospital, he developed visual hallucinations of seeing ghosts in the window. This visual hallucination was so vivid that he often asked family members to exorcise the ghosts.
+The patient was otherwise healthy. He denied a history of hypertension, diabetes mellitus, prior cerebrovascular disease, or other neurological complications. He had no past psychiatric history.
+The patient had a college diploma and was retired from the Municipal People's Procuratorate. He denied a past history of drug or alcohol abuse, smoking, and sexual promiscuity. One of his five siblings had PD, but there was no family history of psychiatric illness. The patient is married and has two children who are living independently.
+The patient’s general examination was unremarkable. The neurologic examination revealed a masked-like facial expression. The motor examination revealed moderate bradykinesia and rigidity of all four limbs. Mild resting tremor was present in the patient’s right upper extremity, and he exhibited difficulty in the initiation of walking and turning. A reduced arm swing was observed when walking, and his performance on the pull-back test was negative. No other positive neurological signs were found. The patient’s scores on the rating scales were as follows: 29 on Part III of the Unified PD Rating Scale, stage II on the Hoehn and Yahr scale, 9/30 on the Mini-Mental State Examination, 13/30 on the Montreal Cognitive Assessment Scale, 11 on the Hamilton Depression Rating Scale, and 11 on the Hamilton Anxiety Rating Scale.
+The following laboratory tests were within normal limits: blood cell count, liver and renal function, thyroid function, electrolytes, vitamin B12, folate, syphilis, and tumor markers.
+Magnetic resonance imaging (MRI) showed mild bilateral frontotemporal atrophy . The T1, T2 and FLAIR sequence showed temporal atrophy, with broadening of the posterior horn of the lateral ventricle ; and the magnetic resonance sagittal view showed mild frontal lobe atrophy .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2188_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2188_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..eb5228e270097414b081f44a4b62ec213d7d7421
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2188_en.txt
@@ -0,0 +1 @@
+A 37-year-old man presented with a 2-year history of painless swelling of the right arm with a gradual increase in size. A physical examination was normal except for a well circumscribed non-tender mass in the upper two-thirds of the right arm and multiple lymph nodes in the right axilla. Imaging revealed a 53 × 40 mm diameter soft tissue mass that was hyperintense on T2-weighted MRI in the posterior compartment of the right arm, with no bone or vascular invasion . Surgical biopsy of the mass and axillary lymph node excision were performed; the laboratory received two fragments with soft consistency, measuring 2 × 1 × 0.3 cm and 2.5 × 1 × 0.5 cm. Histopathological examination showed a desembryoplastic multitissular tumor, containing a sarcomatous component constituted by spindle cells and organized in bundles with rhabdomyoblastic differentiation. There was also an immature and malignant neuroglial component, and this tumor additionally showed epithelial structures with squamous or glandular differentiation; some cells were compatible with embryonal carcinoma. These various tissular structures were very confluent, without transition. Atypical immature cartilage and bone components were observed associated with necrosis. The axillary lymph node excised was metastatic. There was no need for immunohistochemical staining to confirm the diagnosis of malignant mixed GCT (teratocarcinoma variety) . Testicular palpation and ultrasonography results were normal. A computed tomography (CT) scan of the chest, abdomen and pelvis showed no abnormalities. Serum α-fetoprotein (AFP), β-human chorionic gonadotropin (β-HCG), and serum lactate dehydrogenase (LDH) levels were all within normal ranges. The patient received four courses of chemotherapy (bleomycin 30 units intravenous injection, days 1, 8, and 15; etoposide 100 mg/m2 intravenously, days 1 through 5; cisplatin 20 mg/m2 intravenously, days 1 through 5). A clinical evaluation of response at the end of chemotherapy showed a stable disease. Then, 1 month later, a wide excision with axillary dissection was performed; the excised tumor was partially well circumscribed and measured 57 × 42 × 38 mm and had a uniform, yellowish, solid, and partially nodular appearance on the cut surface. Final pathology revealed the same histological aspect as observed in the biopsy but did not revealed tumoral necrotic patterns. All surgical margins were free, and one of six lymph nodes identified was involved without extracapsular spread . Two further cycles of chemotherapy using the same protocol were added. At 18 months of close follow-up, no locoregional recurrence or distant metastases have been detected.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2198_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2198_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4c2b08111cbdd4639f22af5ff3d0d31430f527f2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2198_en.txt
@@ -0,0 +1,4 @@
+The patient was a 48-year-old woman who had occasionally felt pain and swelling in her left forearm since childhood, but she had not visited a clinic because the pain resolved naturally. She had no medication history or surgical history, and no relevant family history. She had felt increasing pain and numbness in her left finger for about 1 month, and she was referred to our hospital after the pain increased further.
+Her forearm were broadly distended and the circumference of the left wrist was 1.2 cm longer than that of the right wrist. Grip strength was reduced by 11.4 kg on the left. Pain in the dorsiflexion of the wrist joint was noted, and the patient complained of numbness in the fingers. Electromyography showed a decreased amplitude of motor nerve conduction of the median nerve compared to the healthy side, but there was no delay in latency. Sensory nerve conduction velocity was undetectable on the affected side in the median nerve. The visual analogue scale for pain was 30/100.
+Imaging findings showed no abnormalities on plain X-rays. MRI revealed hyperintensity on T2-weighted imaging and suggested that the vein had expanded from the proximal forearm to the palm . The size of the lesion was 16 × 2.2 × 3.3 cm. The median nerve was compressed by the vascular malformation invading the carpal tunnel.
+Pregabalin was given for pain, but there was no improvement. Resection of the vascular malformation was considered to be invasive and to have a risk of incomplete resection. Therefore, carpal tunnel release was performed as an alternative treatment. A skin incision was made from the distal forearm to the palm, and the flexor retinaculum was opened. The veins were present on the ulnar side of the median nerve and were not touched during the procedure to avoid damage. Postoperatively, pain gradually diminished. One year after the operation, numbness of the finger disappeared and the patient was able to return to work. She has had no recurrence of symptoms due to the vascular malformation to date.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2202_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2202_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8d173078a792c0dfc20c8f3673617ccb60b7b23b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2202_en.txt
@@ -0,0 +1,14 @@
+A healthy 79-year-old Caucasian woman was referred to our hospital with a diagnosis of stage III immunoglobulin A-lambda MM with numerous osteolytic areas (bilateral iliac wings, T3 to T4) and cardiologic symptoms of pulmonary embolism. Computed tomography (CT) of her chest documented the presence of a right atrial mass (42mm × 53mm), confirmed by subsequent magnetic resonance imaging (MRI) and fluorine-18-fluorodeoxyglucose positron emission tomography (F18-FDG PET). A transesophageal echocardiogram revealed a large pericardial effusion with evidence of cardiac tamponade and a large right atrial mass encasing her interatrial septum and extending into her left atrium. Histologic specimens of a bone marrow biopsy demonstrated the presence of tiny aggregates of atypical plasma cells with asynchronous morphology, positive for cluster of differentiation 138.
+Our patient was treated with four cycles of bortezomib, four cycles of melphalan and prednisone and another four cycles of bortezomib, achieving a lessening of the symptoms and a stability of the cardiac disease. Pharmacological toxicity was not significant.
+Nine months later, our patient developed a painful bone relapse. The pain was severe, constant and localized primarily in her sacrum and the right iliac wing. The pain increased to some extent with movement. Our patient received local radiotherapy on both sites (2000cGy/5 fractions), achieving a reduction in symptoms and an improvement of her performance status.
+One year after the initial diagnosis, our patient presented to our emergency department because of the new appearance of signs and symptoms of congestive heart failure: dyspnea, hypotension, cyanosis and facial edema.
+CT of her chest revealed an increase in the size of the mass (78mm × 84mm), which appeared to infiltrate her right pulmonary vein and superior vena cava for approximately 21mm, causing neoplastic thrombosis of her right subclavian vein . These findings were confirmed by echocardiography and F18-FDG PET .
+Restaging examinations documented stable bone disease.
+Our patient was evaluated by a surgeon for possible surgery on her right atrium, but she was considered inoperable due to the extent of the disease. The diagnosis of atrial localization of malignant plasmacytoma was confirmed via examination of a biopsy specimen. In order to obtain rapid control of the intracardiac disease, radiation to the cardiac mass was started.
+External-beam radiation, totaling 3000cGy in 10 daily fractions of 300cGy, each with 6mV photons, was delivered using the intensity modulated radiation therapy (IMRT) technique.
+Our patient was immobilized in the supine position with a wing board and target localization was accomplished using CT simulation. The volumes of interest were identified on each axial CT slice. The gross tumor volume was defined as the gross extent of the tumor shown by imaging (CT, MRI and PET); the clinical target volume was defined as the gross tumor volume plus a margin for potential microscopic spread (5mm); and, in order to account for organ motion and patient setup errors, the planning target volume was defined by adding a 1 cm margin to the clinical target volume. Treatment planning was performed using an inverse planning algorithm in a tomotherapy planning system and our patient was treated with an IMRT delivered with tomotherapy.
+The treatment was generally well tolerated; our patient showed no symptoms suggestive of radiation-induced toxicity. Her symptoms immediately improved with a decrease in generalized edema and improved performance status. A transesophageal echocardiogram performed three weeks from the end of the radiotherapy confirmed a significant decrease in tumor size in her right atrium.
+Due to our patient’s age and good condition, the medical staff chose a ‘wait and see’ approach. Three months later, repeat chest and abdominal CT scans showed complete remission of the cardiac disease, but progressive bone disease.
+The worsening of the general conditions of our patient, due to other causes, meant that she was subjected to supportive care for two months. After the improvement of her health status, our patient started maintenance chemotherapy with lenalidomide and she is currently tolerating it well.
+In a new CT scan of her chest done eighteen months after the end of the radiotherapy , complete remission of the cardiac disease was confirmed.
+Currently, our patient is generally in good condition and shows no significant cardiac symptoms. Recently performed chest and abdominal CT documented stability of the disease in known locations, but highlighted the emergence of an axillary mass, for which we are programming a new radiation treatment in view of her good response to previous radiotherapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2213_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2213_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..59b07ced241e6aa7895feae4e2b73d50fbf03405
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2213_en.txt
@@ -0,0 +1 @@
+A 15-month-old girl presenting a congenital hydrocephalus, diagnosed at uterine life. At the age of 3 months, a right VAS was made due to the progressive character of her congenital hydrocephalus. Immediate and short time follow-up was simple. One year later, the infant goes to the emergency department for a progressive respiratory distress with polypnea and diminution of oxygen saturation. She was afebrile with pulmonary auscultation evidencing hypophony of the right hemithorax and abdomen not distended and depressible without pain. The blood analysis did not show significant alterations. A thoracoabdominal X-ray shows complete opacity of the right hemithorax, without evidence of intestinal obstruction or intraperitoneal air and with a well-positioned catheter tip but in contact of diaphragm on sleep position and in pelvic cavity on up position . This was confirmed by ultrasound exploration without CSF ascites. A thoracoabdominal scan revealed the right pleural hydrothorax and the position of the catheter tip in the peritoneal cavity . The patient has been transferred to the pediatric intensive care unit and right pleural effusion drainage has been performed, obtaining a clear crystal appearance and transudative fluid. Proteinorachia and glycorachia were normal in CSF microbiological studies and culture excluded infection. Noninvasive ventilatory support is initiated with oxygen therapy. We had progressive clinical improvement after cessation of drainage debit and the radiographic disappearance of the effusion after 48 h. A cardiac cause was eliminated by a strictly normal cardiac examination and echocardiography not compatible with heart failure, as well as a nephrological origin by the biological analyzes. However, clamping of the chest tube was marked by recurrent pleural effusion 24h after with polypnea. A ventriculoatrial shunt was performed with simple operative follow-ups. Clinically, the patient became normal and resolution of the pleural effusion was obtained on the thoracoabdominal control X-ray .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2218_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2218_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a68c370e45d3874bbc9e30bd936649f88c459b1a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2218_en.txt
@@ -0,0 +1,3 @@
+A previously healthy 62-year-old woman (BMI = 28.1) experienced progressive low back pain with bilateral hip pain soreness for the past 1 year. The patient's symptoms did not improve significantly after conservative treatment. She complained of back and pelvic pain, which had persisted for the past year. The pain in the lower back was aggravated when standing for a long time and when tired, and the pain was relieved when resting. Japanese orthopaedic association (JOA) score was 19 points, and the low back pain visual analogue scale (VAS) score was 5 points. The neurological examination was normal. Lumbar X-ray positive lateral position, lateral and overextension, overcurved slices showed lumbar 4 (L4) vertebral body instability and slipped forward I degree . Magnetic resonance imaging (MRI) revealed lumbar degeneration and L4 vertebral body slip forward (I degree), corresponding to segmental spinal stenosis, spinal cord and nerve root compression . Lumbar computed tomography (CT) showed: lumbar vertebrae 4 degenerative spondylolisthesis, no fractures in the lumbar isthmus . According to the patient's symptoms, signs and imaging findings, the patient was diagnosed with lumbar degenerative spondylolisthesis (I degree). After completing the preoperative routine examination to eliminate contraindications, the patient underwent elective OLIF surgery under general anesthesia.
+Under general anesthesia, the patient underwent routine catheterization, and was placed in the right lateral position. Then the skin was shaved and prepared with povidone iodine and draped in a sterile manner. With the L4/L5 intervertebral space as the center, a vertical incision (approximately 4 cm) was made at the level of the left anterior axillary line. The skin and subcutaneous tissue were cut, and the muscle tissue was bluntly separated layer by layer. The peritoneal fat was pushed forward to protect the viscera and other tissues until it touched the psoas muscle. The psoas muscle was pushed backward and the guide needle was placed on the leading edge of the psoas muscle. The expansion cannula was placed step by step, and a fixation screw was placed in the L4/L5 intervertebral space. When placing the self-retaining retractor onto the L4/L5 intervertebral disc, a thread pin, which fixates the retractor through a small hole, went deep into the anterior space of the spinal column. After confirming that the CAGE position was good during the operation, the expansion sleeve was removed, and a large amount of saline was used to rinse the incision. Then double-click electrocoagulation was used to stop the bleeding. It was found that there was a clear liquid flowing out of the peritoneum at the level of the L4/5 segment, and hematuria was found in the catheter . These phenomena indicated that the left ureter may have been damaged. A urinary surgeon was consulted urgently during the operation, and left ureteral injury was definitively diagnosed. Then the patient underwent left ureteral injury exploration and ureteral stent (double pigtail stent, Cook, USI-626-B) placement into the ureter . The original incision was expanded along about 6 cm, and the shape of the left ureter was explored. There was a ureteral leak at the level of the L4/L5 segment. Both ends of the ureteral injury were freed, and the F4.5 short-term ureteral stent (double pigtail stent, cook, USI-626-B) was implanted from the ureteral leak. A 5–0 absorbable thread was used to suture the ureteral end without tension of the ureter. Then, the abdominal incision was closed, and the patient was changed to the prone position. Under the guidance of the C-arm, percutaneous pedicle screws were placed into the L4 and L5 bilateral pedicles. The intraoperative plain film showed the height recovery of the intervertebral disc and the left ureter stent was in a good position . The left ureteral stent was removed 2 months after surgery, and the lumbar spine X-ray showed good spine stability 1 year after surgery .
+The patient was indwelled with a catheter for 2 weeks, and regular oral administration of levofloxacin to prevent urinary tract infection. After 2 months, the ureteral stent was removed by using cystoscope. One year after surgery, the symptoms of lumbar back were significantly improved (JOA score of 25 point, low back pain VAS score of 1 point), and there were no urinary system symptoms 3 years after surgery. However, the patient still needs to regularly check the left ureter and the left kidney by ultrasound annually.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2231_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2231_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..42ad867c3ab50cd0893d4c22752255d38541aec0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2231_en.txt
@@ -0,0 +1,6 @@
+A 48-year-old Bangladeshi gentleman was brought to the emergency room because of breathlessness and disorientation. He had been suffering from fever, cough and sputum production over the preceding 5 days. He had been receiving amoxicillin (orally 500 mg three times a day) and paracetamol (500 mg four times a day) without much benefit. He did not have significant medical history of note, except diabetes mellitus and was on vildagliptin–metformin combination (vildagliptin 50 mg and metformin 500 mg orally once daily).
+He was febrile (temperature 38.9 °C), had altered conscious level (Glasgow Coma Scale E3V4M4, 11/15), low oxygen saturation (87% in room air), tachycardia (pulse 110/min), tachypnea (respiratory rate 38/min), normal blood pressure (115/75 mmHg), bi-basal crepitations and signs of meningeal irritation without any rash. Ocular fundi looked normal.
+Random blood glucose was 8.9 mmol/L. Electrocardiography revealed sinus tachycardia, chest X-ray showed pulmonary oedema, computed tomography of head was normal. Arterial blood gas analysis showed type I respiratory failure. He was shifted to intensive care unit.
+He had neutrophil leukocytosis (total white cell count 22,300/mm3, neutrophil 83%), high erythrocyte sedimentation rate (56 mm in 1st hour) and C-reactive protein (64 mg/L). Cerebrospinal fluid (CSF) was cloudy with high opening pressure, high protein (140.6 mg/dL, reference range 15–45 mg/dL) and low glucose (3.1 mmol/L, reference range 3.3–4.5 mmol/L) content, had high white cell counts with predominant neutrophils (1290 cells/mm3, polymorphs 90%). No micro-organism was identified in Gram-stain or acid fast bacilli (AFB) staining of CSF or cultures. Bacterial antigen test of CSF (done by Latex test to detect Streptococcus group B, H. influenza type B, S. pneumoniae, N. meningitides ABCY W135 and E. coli K1 antigens, Wellcogen™ Bacterial Antigen Kit, Remel Europe Ltd., UK) was positive for pneumococcus. Blood culture did not reveal any organism. Sputum microscopy revealed Gram positive cocci in long chains but culture did not reveal any organism. Urine routine examination showed red cells (5–8/high power field) and protein (+).
+Treatment consisted of ceftriaxone (2 g intravenously every 12 h), moxifloxacin (400 mg intravenously once daily), paracetamol, frusemide and insulin along with other supportive measures including oxygen. He became afebrile on fourth day and was transferred to general medical ward.
+His assessment in ward showed a new regurgitant murmur in mitral area that radiated to left axilla. Transthoracic echocardiography revealed moderate mitral regurgitation but there was no vegetation. Trans-oesophageal echocardiography could not be done. Repeat chest X-ray revealed right middle lobe consolidation . Depending upon clinical manifestation, imaging, echocardiography, sputum, CSF and urine examination findings, he was diagnosed as having Austrian syndrome. He completed 4 weeks of intravenous antibiotic treatment, follow-up echocardiography after 6 weeks revealed trivial mitral regurgitation (Additional file ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2263_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2263_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b077101e9ab543285fa194501f88770154695025
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2263_en.txt
@@ -0,0 +1,12 @@
+A previously healthy 14-day-old male presented with an uncontrollable bleeding following a circumcision. The circumcision, which is a norm in the patient's family, was performed at local settings by his primary healthcare physician without adequate preparation in terms of laboratory tests, and was complicated by profuse bleeding despite sutures placement. There was no fever, vomiting, diarrhea, shortness of breath or jaundice upon presentation to the emergency room (ER).
+This neonate is a product of a normal vaginal delivery of a 29-year-old mother that had undergone all required pregnancy tests which came back normal. Apgar Scores were 8 and 9 at 1 minute and 5 minutes, respectively. Physical examination after the delivery did not show any findings of clinical importance. His first 2 weeks were uneventful. Weight at birth was 3.1 kg.
+The patient's blood group is AB+ with an unknown maternal blood group, which makes it relatively more difficult to find matching blood and plasma.
+Regarding the family history, the patient is a member of a family of five, with two older brothers who are completely healthy with no history of bleeding tendencies, as are the parents, who are first degree cousins. The patient is not taking any medications, and there is no family history of bleeding episodes. No psychosocial history of clinical importance was reported. The patient doesn't have any known food or drug allergy.
+Regarding vital signs at the presentation, the patient's heart rate was 166 beats/minute, respiratory rate was 62 breaths/minute, blood pressure was 82/51 mmHg and the rectal temperature was 37.3 °C.
+Initial workup included a Complete Blood Count (CBC) that showed a hemoglobin of 15.5 g/dl, Hematocrit (HCT) of 46%, White Blood Cells count (WBC) of 10.15*109/L, platelets (PLT) count of 409000, Prothrombin time (PT) of 57 seconds, Partial Thromboplastin time (PTT) of 120 seconds, and International normalized Ratio (INR) of 4.69.
+Initial management with vitamin K and Fresh Frozen Plasma was made. The patient was stabilized and monitored for the next three days. His first admission lasted six days.
+An inpatient follow up with coagulation profile was done on the admission to the pediatric ward and showed elevated PT, PTT, and INR with normal platelets count despite the initial management (A). A presumptive diagnosis of coagulation disorder was made. A mixing study was sent and the results showed a correction in the coagulation profile, which confirmed a factor deficiency. Factors assay showed normal results for all factors except factor V which was only 11% active. Factor V's normal activity range is between 50% and 200%.B shows the activity level of factor V during the first admission.
+The patient was discharged with the diagnosis of factor V deficiency, and the family were advised to follow up at the hematology clinic. Genetic testing was ordered for the patient, and the parents.
+Two weeks later, the patient was brought to the emergency room by his mother complaining of seizures that she described as alternating eye movements and bilateral arm jerking. The patient's initial workup showed elevated PT, PTT (A) and low factor V activity (B). Urgent head CT scan was done and showed intracranial hemorrhage .
+The patient was started on Phenytoin, Mannitol, and the neurosurgery team was consulted, who decided that craniotomy and evacuation are required to stabilize the patient's condition. Fresh Frozen Plasma and vitamin K were given prior to and after the surgery.
+After 9 days of admission, no complaints or complications were noted, and the patient is now discharged and is being followed in the outpatient hematology clinic.weeks later, genetic testing results showed a homozygous pathogenic frameshift mutation in the F5 gene -p.(P927Lfs*7) gene-causing premature termination after 7 codons. Both parents were heterozygous for this mutation.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2265_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2265_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3220d84db99a54c68c0d1b4ea5c0607bfd53cef3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2265_en.txt
@@ -0,0 +1,5 @@
+A 70-year-old male with a history of hypertension, diabetes mellitus, and atrial fibrillation presented to the emergency department with chest pain lasting for 1 hour. The patient did not have any previous neurologic deficits or surgical, family, or genetic history, although he was a heavy smoker (75 pack-years). His initial blood pressure was 109/62 mmHg with a heart rate of 103 beats per minute. There were no remarkable findings upon physical exam. The electrocardiogram (ECG) showed ST segment elevation in leads II, III, and aVF and reciprocal changes in leads I and aVL, suggestive of ST elevation myocardial infarction. Initial troponin I level (0.021 ng/mL [0–5 ng/mL]) was unremarkable. The patient was started on intravenous unfractionated heparin (UFH).
+The patient was immediately moved to the catheterization lab for emergent percutaneous coronary intervention (PCI) of ST elevation myocardial infarction. Vital signs were normal during the femoral artery puncture and insertion of a 6 French (Fr) sheath into the right femoral artery (FA). We punctured at the femoral head level without any mispuncutures during the process. After puncture and before coronary angiography (CAG), however, the patient went into ventricular fibrillation and the blood pressure became unmeasurable. Cardiopulmonary resuscitation (CPR) was immediately initiated with defibrillation every 2 min, although normal rhythm of vital signs were not recovered. As CPR was performed for a total of 30 min, we concurrently inserted a venoarterial ECMO. A 16.5 Fr (external diameter: 5.5 mm) arterial and 21 Fr (external diameter: 7 mm) venous cannula was inserted through the right FA and femoral vein (FV), respectively. CAG revealed an extensive thrombotic occlusion of the mid right coronary artery (RCA) with thrombolysis in myocardial infarction (TIMI) 0 flow distally. A drug eluting stent (Biomime™ 4.0 × 19 mm) was inserted to the lesion and the RCA restored a TIMI 2 flow (pain-to-balloon time: 120 min).
+After the PCI, the patient was moved to the intensive care unit for ECMO care. Initial echocardiography showed a left ventricular ejection fraction (LVEF) of 15% and an extensive regional wall motion abnormality of the RCA territory. However, there was blood pressure drop with concurrent massive nasal and gastrointestinal bleeding. Hemoglobin level became 5.9 g/dL, which was approximately 8 g/dL decrease compared with initial levels. Blood pressure was recovered to normal after massive transfusion; however, we lowered the target activated partial thromboplastin time to approximately 40 s to prevent additional bleeding. There were no cannulation site complications such as hematoma or signs of infection during ECMO care, although diffuse swelling developed in the right lower extremity (LE) the next few days. Pneumatic compression devices were applied to both LEs to prevent DVT. ECMO therapy was maintained for 4 days, while vital signs slowly recovered. As the LVEF was restored to 46% on the 4th day, the ECMO was weaned and removed. The ECMO cannulas were removed by manual compression. Despite the risk of stent thrombosis, dual-antiplatelet therapy was stopped after ECMO removal (day 4) in concern of additional bleeding.
+On the 7th day of admission, the patient recovered orientation. However, leg edema did not improve despite ECMO removal. He also started complaining impaired function, pain, and hypesthesia of the LE. Compartment syndrome was initially suspected. We clinically ruled out compartment syndrome , since the patient was negative for Homan’s sign and had good distal pulsation with warm circulation. The patient had burning sensation and Grade 3 weakness in hip and knee flexion motions with no deep tendon reflex. Neurologic findings were not dermatome specific. LE Doppler sonography and computed tomography (CT) showed DVT extending from the right external iliac vein to the calf vein without any evidence of puncture site hematoma or intramural bleeding . The patient was started on rivaroxaban (15 mg twice daily) for DVT (day 8). The swelling of the right LE gradually improved over the next 30 days, although his pain and weakness were not alleviated. As the patient was suspected to have post-thrombotic syndrome (PTS), which is pain and abnormal sensation after the onset of DVT, further studies such as the nerve conduction study (NCS) or electromyography were not considered until later on. The patient was discharged to a rehabilitation hospital on the 35th day.
+During outpatient department follow up, the patient consistently had pain, abnormal sensation, and weakness in the right LE, which resulted in insomnia and depression. Although he was given thioctic acid (600 mg qd) and pregabalin (150 mg bid) during outpatient department follow up, his pain remained. Femoral and pulmonary arterial CT angiography was performed 100 days post-ECMO insertion showed no thrombus in the right LE or pulmonary arteries. However, the NCS revealed no sensory nerve action potential in the right peroneal nerve and tibial nerve, suggestive of impaired sensation. Additionally, the compound muscle action potential was not observed in the right femoral , peroneal and tibial nerve, indicating motor nerve palsy. These results collectively suggested FN. The patient is continuing rehabilitation exercises and slowly recovering from the weakness, although the tingling sensation remains to a lesser degree. The patient shares his regrets on his previous smoking habits which caused his myocardial infarction and eventually FN. An informed consent for publishing data was obtained from the patient. A timeline of events is summarized in Table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2268_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2268_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..470f16dc322fea291eb4bb1465a0345f7f8934fc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2268_en.txt
@@ -0,0 +1,3 @@
+A previously healthy 15-year-old Caucasian girl with Italian-German parents presented with new onset of fatigue, diffuse arthralgia, butterfly rash, tenosynovitis of the wrist, lymphopenia and thrombocytopenia. In the absence of other explanations and the presence of antinuclear antibodies (ANA, 1:7680, granular pattern), anti-double stranded deoxyribonucleic acid (dsDNA) antibodies (69 U/mL) and hypocomplementemia the diagnosis of SLE was made. All symptoms resolved with 130 mg prednisolone followed by dose-tapering and azathioprine at a dose of 100 mg/d.
+At the age of 20 acute appendicitis (treated by open surgery) was followed by persistent high fever and rashes, fatigue, diffuse arthralgia, leucopenia and hypocomplementemia. A lupus flare-up was suspected. ANAs and anti-dsDNA were 1:7680 and 2713 U/mL, respectively. The prednisolone maintenance dose of 5 mg/d was increased to 1 mg/kg body weight along with 100 mg azathioprine. However, because of 2.5 g proteinuria over 24 hours and dysmorphic erythrocyturia (serum creatinine 1.1 mg/dL), a renal biopsy was performed and displayed diffuse proliferative lupus nephritis (class IV). Our patient received six 500 mg pulses of cyclophosphamide according to the Euro-Lupus protocol and was subsequently treated with 2 g/d mycophenolate mofetil as a maintenance therapy. Complete remission of proteinuria was reached 18 months after initiation of this regimen so the low dose prednisolone was stopped.
+Three years later after stepwise reduction of the mycophenolate mofetil down to 1 g/d our patient developed pain in her right hip, lymphopenia, hypocomplementemia, erythrocyturia and massive proteinuria of 10 g/d. A flare-up of SLE and lupus nephritis was suspected. She was put on prednisolone 1 mg/kg body weight and the dose of mycophenolate mofetil was increased to 2 g/d, and later to 3 g/d. She was also put on chloroquine but stopped it shortly after because of new-onset of alopecia. Partial improvement of her proteinuria was reached one year later (200 mg/d). Since then her SLE-related symptoms and laboratory parameters have remained stable suggesting sustained remission. Only her hip pain persisted and had not at all responded to the high doses of prednisolone. Magnetic resonance imaging (MRI) of her right hip suggested the diagnosis of villonodular synovitis and subsequent arthroscopy of her right hip and subtotal synovectomy confirmed the diagnosis of PVNS. Her hip pain resolved but reoccurred two years later when another MRI indicated remittent PVNS without evidence of osteoarthritis, arthritis, or osteonecrosis . Plain X-rays were normal. Our patient underwent rigorous synovectomy by open surgery, which subsequently controlled all PVNS-related symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2281_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2281_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e7cdfd3bd3248f77533721414c7ac1cf80723bb2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2281_en.txt
@@ -0,0 +1,2 @@
+The diagnosis of hepatitis B virus (HBV)-associated hepatocellular carcinoma was confirmed by pathology on a 36-year old male patient on September 19, 2011. Despite treatment with entecavir, radiofrequency ablation (September 29, 2011 and May 10, 2012), and transarterial chemoembolization (July 30, 2012) for recurrent local tumors, the tumors recurred in both lobes and lung metastases were detected by computed tomography on September 12, 2012.
+Therefore, the patient was treated with an initial dose (109 plaque forming unit [pfu]) of JX594 (Pexa-vec®) via intravenous injection on December 19, 2012 (ClinicalTrials.gov Identifier: NCT01387555). No apparent adverse effects were observed following intravenous injection other than a single fever episode. However, on December 25, 2012 pustular lesions were detected on the proximal interphalangeal joint of the right middle finger and on both sides of the tongue dorsum . Physical examination did not reveal any additional skin or mucosal lesions. The patient’s contact history was unremarkable. The patient’s white blood cell count on the day the pustular lesions were identified were 7100 per cubic millimeter (61.1 % neutrophils, 21.7 % lymphocytes) and a hemoglobin concentration of 14.0 g/dl. Serology was negative for measles virus, varicella zoster, EB-VCA, rubella, and CMV. Pus aspirated from the pustules on December 28 was JX594 positive. The discharge was diluted and filtered using 0.45-μm-pre-size filter, and cocultured with MRC-5 (lung fibroblast cell line). The cells were then maintained in the minimal essential medium (Gibco, life technologies, USA), supplemented with 2 % fetal bovine serum and 1 % penicillin-streptomycin-gentamycin at 37 °C with 5 % CO2. The cytopathic effect, such as discohesive arrangement, cell rounding and shrinkage, and necrosis with vesicles and cell debris, was apparent . Biopsy samples analyzed by PCR identified the presence of the JX-594-specific hGM-CSF transgene (Primer pair 1) and the disrupted viral thymidine kinase (TK) gene (Primer pair 2, accession no. AF163844). The sequences amplified were 99 % similar to the hGM-CSF (accession no. M10663) and beta-galactosidase (accession no. U54829) sequences available on the NCBI database. Following aspiration of the lesion a scab formed that resolved within 14 days without necessitating additional treatment. The patient received intra-tumor injection on December 26, 2012 but there was no further skin or mucosal lesions detected on follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2293_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2293_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..51098ae5038dd0d7916cacfeb8522c2af00e03a6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2293_en.txt
@@ -0,0 +1,4 @@
+This study was approved by our institutional review board (MOD18120143-003, approved 3/9/2020), and written consent was obtained.
+A 60-year-old male with history of nonischemic cardiomyopathy and left ventricular ejection fraction of 20% was admitted to the hospital with recurrent ventricular tachycardia. He had undergone three unsuccessful ablation procedures and had also failed multiple outpatient anti-arrhythmic pharmacotherapies. While inpatient, he was maintained on a continuous intravenous infusion of lidocaine. Initially, he was listed as Status 3E, and remained inpatient awaiting a heart offer for over four months. Eventually, he was upgraded to Status 2E due to increased burden of ventricular tachycardia. On post-upgrade day 16, he received a donor offer.
+The donor was a 40-year-old male who underwent brain death pronouncement after sustaining blunt head trauma. On echocardiography, the heart had good biventricular function. Due to the donor’s age, left coronary catheterization was performed, which revealed an anomalous origin of the left coronary artery (LCA). The LCA and right coronary artery arose from a single ostium within the right sinus of Valsalva . Chest computed tomography demonstrated a retro-aortic course of the LCA . A discussion was held among the heart failure cardiology and cardiac surgery team. Because the LCA did not appear to have an inter-arterial or other malignant course, nor did it appear to have flow limitation or restriction on angiography, the decision was made to pursue transplantation. A heart team was sent to the donor facility, and the heart was accepted and later transplanted (Additional file : Video). Transplantation was performed using our usual implantation technique without modification, beginning with the left atrial cuff anastomosis followed by the aortic anastomosis. The single coronary ostium was widely patent upon inspection, and did not require unroofing.
+The patient did well post-transplant. His hospital course was prolonged primarily due to pretransplant physical deconditioning, having been hospitalized for four months prior to transplant. On posttransplant day 36, he was discharged to a rehabilitation facility, and was discharged home 24 days later.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_22_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_22_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..961cc67a7bd8435ee3f756c7f603aa585e9c408b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_22_en.txt
@@ -0,0 +1,4 @@
+A 40 -year-old male patient, nondiabetic, nonsmoker and normotensive was presented with the history of persistent pain along the dorsal surface of right foot, which was aggravated with the activities. Conservative management was tried for 8 months without much relief. Diagnosis of ATTS was made on clinical examination. Nerve Conduction velocity (NCV) showed decreased conduction in deep peroneal nerve and stress test was positive. Patient was planned for operation. Under spinal anesthesia, the body part was prepared and tourniquet inflated. Intraoperatively, thrombosed dorsalis pedis artery was found along with two adjacent collateral vessels (, , and ). Retinaculum was released and nerve was mobilized. No adherence with the surrounding structures was found. Tight compartment got released. Upon deflating the tourniquet blood flow in the collaterals was checked, which was adequate. Dorsal pulsation was felt too. No excision was done. Wound was closed and the patient was followed up in outpatient department. Over 9 months of follow up, no recurrence of any symptoms was noted.
+Tarsal tunnel corresponds to the carpel tunnel in the limb counterpart. Tight compartments exert pressure over the nerves resulting in the compressive neuropathies. Tarsal tunnel syndrome as the name suggests relates to the tightening of the inferior extensor retinaculum of the foot. It causes compression over the deep peroneal nerve resulting in the spectrum of symptoms. Numerous factors have been described to cause this compression. Intrinsic factors mentioned in the literature are due to osteophytes, ganglionic cysts or lipomas. These factors cause compensatory forefoot valgus leading to subtalar supination and midtarsal inversion leading to the pressure over the nerve.
+Distally the nerve is vulnerable to injury due to lack of protective sheath. Extrinsic factors like tight shoe laces or the external trauma can cause injury to the nerve. Edema or fibrosis causes pressure over the nerve and neural ischemia. The relation of nerve with the tendons and the vascular structures is depicted in . The little space in the tunnel formed by the inferior extensor retinaculum and the close proximity of the structures make the nerve vulnerable to compressive neuropathy. In an already small space, any addition to the structure can cause pressure over the nearby structures. The final brunt is to be burnt by the nerve, as happened in our case.
+The patient had trivial trauma at the ankle, which can cause thrombosis at the dorsalis pedis artery. Over time, the collaterals had developed to compensate for the dysfunctional arterial segment and to bypass it. Addition of new vessels in the already tight tunnel had resulted in the pressure over the nearby structures, including the nerve. The mixed sensorimotor nature of the deep peroneal nerve leads to both sensory and motor symptoms as in our case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2310_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2310_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..81789f15a946644875c893ee74f81292bc08b79c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2310_en.txt
@@ -0,0 +1,4 @@
+A 50-year-old Chinese woman accidentally injured her left thumb at 5 pm, while cutting a fish for dinner. She washed the wound with cold, running water for 1 minute and applied a bandage. However, on the night of the incident, her left thumb became red and swollen, which gradually spread to the left dorsal hand and extended to the forearm within 12 hours after the injury, warranting a visit to the emergency department of local hospital the next morning. The doctor recommended hospitalization for surgery. She refused and came to our hospital for treatment a day after the injury.
+During admission, there was significant swelling on the dorsum of the left hand and left forearm, high tension, and severe infection. She had a history of dilated cardiomyopathy, chronic heart failure, atrial fibrillation, and type 2 diabetes. Physical examination on admission showed a temperature of 36.8 °C, pulse rate of 80 beats per minute, respiratory rate of 20 breaths per minute, and blood pressure of 87/54 mmHg. A linear wound was also observed at approximately 0.5 cm in length at the left thumb interphalangeal joint on the radial side. The skin and soft tissues of the left hand and the left forearm were red and swollen, especially the left dorsal hand extending to the left dorsal forearm. A purple ecchymosis was noted on the skin of the left dorsal hand, accompanied by scattered tiny tension blisters, high skin tension, significant tenderness, slightly above normal skin temperature, and a weak pulse in the ulnar and radial arteries . Emergency laboratory and clinical examinations performed revealed white blood cell count (WBC) of 21.41 × 109/L, N of 92.0%, platelet count (PCT) of 6.72 ng/mL, GLU of 16.4 mmol/L, HbA1c of 8.0%, and BNP > 5002 pg/mL. A standard 12-lead electrocardiogram (ECG) showed atrial fibrillation, while a plain computerized tomography (CT) scan of the left forearm and left hand revealed moderate to severe swollen skin and soft tissue.
+Initial diagnosis was skin and soft tissue infection in the left upper limb, dilated cardiomyopathy, congestive heart failure (CHF) (grade III cardiac function), atrial fibrillation, postoperative state of cardiac pacemaker implantation, and type 2 diabetes mellitus (DM). Combining the patient’s history of injury, the possibility of infection by aquatic-related bacteria such as Vibrio, Aeromonas, Mycobacterium marinum was considered .
+Emergency open decompression was performed on the left upper limb. A longitudinal incision was made to the deep fascial layer, along the most significantly swollen site, to achieve complete tension reduction and drainage . Intraoperatively, a large amount of clear yellow discharge was found in the deep fascia of the dorsal area of the left wrist and hand. We sent the discharge for bacterial culture. The wound was thoroughly flushed with a large amount of hydrogen peroxide, normal saline, and iodophor and then packed and bandaged with iodoform gauze. Postoperatively, we administered antibiotics such as cefoperazone–sulbactam sodium 3 g intravenously twice a day, combined with moxifloxacin 0.4 g once a day. During postoperative change of dressing, we found that the wound infection continued to spread, partly to the second phalanxes, accompanied by skin blackening and tissue necrosis . On the second day after admission, surgical debridement was performed on the left upper limb. Further open decompression and drainage was conducted. During the operation, the viability of fat and tendon tissues was found to be poor and the subcutaneous venous network was scattered and embolized ; therefore, another discharge sample was sent for bacterial culture. The wound was flushed with a large amount of hydrogen peroxide, normal saline, and iodine and then packed and bandaged with iodoform gauze. On the fourth day after admission, the results of bacterial culture were reported as A. veronii and A. ichthiosmia. The drug sensitivity test results showed that the two bacteria were sensitive to cephalosporins, aminoglycosides, and quinolones but resistant to penicillin and carbapenems. Based on the drug sensitivity test results of the bacterial culture, we administered cefoperazone–sulbactam sodium 3 g intravenously twice daily (BID), combined with levofloxacin 0.5 g four times daily (QD). Subsequently, multiple operations to control the wound infection, and further skin grafting to close the wound, were performed. Finally, the patient recovered and was discharged 1 month after the injury. After 3 months of rehabilitation, the left hand recovered well in appearance and function . The patient was very satisfied with our treatment and expressed great gratitude.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2333_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2333_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c3e1f94d4f290cddf4b7e155f29d560ea9b18e72
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2333_en.txt
@@ -0,0 +1,3 @@
+A 65-year-old-man was admitted in the emergency department for seizures. His medical history included diabetes mellitus, arterial hypertension, and smoking. Four months before admission, a chest X-Ray performed because of a persistent cough revealed a lung mass. The lung biopsy yielded a squamous non-small-cell lung cancer with 80% expression of PD-L1. Extended evaluation including a brain CT , thoracic CT, abdominal MRI and whole-body PET-scan showed a unique hepatic metastasis. Following consultation with the institutional multidisciplinary team in charge of lung cancer, the patient was treated with intravenous pembrolizumab (anti-PD-1 antibody), started 3 months before admission, as a single-drug regimen, 200 mg every three weeks, with no tolerability or adherence issues.
+On admission, the patient was afebrile, and clinical examination was normal. Routine biochemical and hematology tests were normal, with blood leukocytes count of 7.8 G/l, and serum C reactive protein at 1.1 mg/l. The electroencephalogram performed 12 h after seizures was normal. Brain CT scan found a focal hypodense lesion in the right frontal lobe, further characterized by brain MRI as an intracranial round-shaped lesion with a maximal diameter of 18 mm, low signal intensity on T1-weighted and intermediate signal intensity on T2-weighted images, associated with perilesional edema and wall enhancement on T1-weighted gadolinium-enhanced images , suggestive of brain abscess, while brain metastasis could not be ruled out. The patient was transferred to the neurosurgical department for a total removal of the lesion (excision with craniotomy), both for diagnostic and therapeutic purposes. Per-operative macroscopic findings were also suggestive of brain abscess, and empirical antimicrobial therapy was started after surgery with a combination of intravenous ceftriaxone and metronidazole. Microscopic examination revealed numerous filamentous-branching Gram-positive rods. Cultures yielded Nocardia farcinica, identified by MALDI-TOF mass spectrometry. Antibiotic treatment was modified to meropenem 1 g every 8 h associated with cotrimoxazole 1600 mg/400 mg every 8 h and folinic acid. Body-CT did not show any other localization of nocardiosis, while the mass tumor had decreased by 80% after the sixth cycle of pembrolizumab. Drug susceptibility testing found a meropenem MIC of 32 mg/L, while linezolid MIC was 4 mg/L, and cotrimoxazole MIC was 0.5 mg/L. Meropenem was replaced by linezolid 600 mg every 12 h, in combination with cotrimoxazole. Following the diagnosis, additional risk factors for cerebral nocardiosis were ruled out.
+After 2 months, the patient was asymptomatic, except for asthenia. Antibiotics were well tolerated. He did not receive additional dose of pembrolizumab. At 10 weeks of treatment, he developed thrombocytopenia due to linezolid. He died 3 months after the diagnosis of cerebral nocardiosis, because of a major upper-gastrointestinal bleeding probably related to a peptic ulcer disease and thrombocytopenia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2337_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2337_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5f3a6a1438e1b7508264c3ec1db5032a2db68444
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2337_en.txt
@@ -0,0 +1,2 @@
+A19-year-old male with sudden chest discomfort was admitted to the hospital. He had no past medical history. He did not have bloody stools or symptoms of upper respiratory infection before the onset of chest discomfort. He complained of general fatigue and shortness of breath upon exertion. Physiological examination findings were not noteworthy; no skin lesions were noted, blood pressure was 104/54 mmHg, heart rate was 67 beats per minute, and oxygen saturation was 99% on room air. Careful follow-up was performed without inotropic therapy. The initial electrocardiogram (ECG) showed sinus rhythm with a right bundle branch block, ST segment elevation in II, III, aVF, V4, V5, and V6, and abnormal Q waves in the same leads . Peripheral blood tests revealed remarkably elevated troponin T and creatinine kinase levels . Echocardiography demonstrated moderate left ventricular hypertrophy accompanied by oedema and left ventricular ejection fraction (LVEF) of 42% with patchy areas of reduced wall motion. Coronary angiography did not reveal significant stenosis (see , ). Patchy areas of reduced wall motion were demonstrated by LV angiography (see , and ). Endomyocardial biopsy from the right ventricular septum showed no pathological findings that were consistent with myocarditis . Subsequent tests reported high levels of soluble interleukin-2 receptor and lysozyme . Cardiac magnetic resonance (CMR) with contrast revealed myocardial late gadolinium enhancement (LGE) predominantly on the epicardial side of the posterolateral wall . Fluorine-18-fluorodeoxyglucose (18F-FDG) positron emission tomography (PET) revealed fluorodeoxyglucose accumulation in the same regions as LGE detected with CMR and in the transverse colon and sigmoid colon ( and ), but there was no abnormal accumulation in the respiratory tracts. Faecal occult blood was positive, so colonoscopy was performed. Inflammatory changes were observed in the transverse colon . Epithelioid granulomas were found in a biopsy specimen from the transverse colon .
+Based on these findings, we made a clinical diagnosis of active CS. We administered oral prednisolone (30 mg/day). The dose of prednisolone was decreased by 5 mg each month. At 6-month follow-up, LVEF (57%), and follow-up colonoscopy revealed significant resolution of inflammation. When PET was performed 1 year later, there was still strong accumulation of FDG in the heart ( and ). After the examination, the patient experienced sudden runs of sustained ventricular tachycardia with loss of consciousness at rest. He was admitted to our hospital again. We performed implantable cardioverter-defibrillator placement. At 4 months after the addition of methotrexate (8 mg/week), there was markedly less cardiac accumulation of FDG ( and ). Eight months have passed since the addition of methotrexate, there is no episode of heart failure admission nor shock therapy.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2340_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2340_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e85e9ca1c8c3bb9c08baee142bd7c1458e8af349
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2340_en.txt
@@ -0,0 +1,3 @@
+A 40-year-old man presented with painful inflammation of the right toenail for 3 years. He had undergone several nail extractions and long-term antibiotic treatment. However, the pincer nail continued to recur after several surgeries. The patient had no relevant family history of genetic disorders and the absence of skin diseases such as nail moss on the right foot. Physical examination revealed a pincer-like deformity of the right great toenail with peri-nail redness and swelling without pus exudation. The rest of the toes did not show pincer deformity. Measurement using a method proposed by Yabe in 2013 to assess the severity of the PN revealed a curvature index of 64.5%. It belonged to type 1 according to the Baran classification . At the same time, the patient was evaluated with a VAS score of 6.
+The patient underwent the procedure under combined spinal and epidural anesthesia with tourniquet control. First, the ingrown nail plate was turned up and removed with mosquito forceps. When removing the nail, we need to protect the nail root, which has the nail matrix. Proliferation, keratinization, and forward migration of the nail cells determine the growth of the toenail. We then trimmed the edges of the nail bed and separated the nail bed from the lateral nail fold by cutting through the border of both sides of the embedded segment. We suggest the incision be at least 3-mm-long from the nail root. Too long an incision will affect the nutrient supply to the nail bed, while too short an incision will not adequately correct the ingrown nail. Subsequently, the nail bed was dissected from the phalanx with a scalpel at the edge of the incised nail bed along the nail grooves bilaterally. We made the separation to preserve the nail midline at least 5 mm wide to minimize the disruption of blood circulation to the nail bed. Be careful to maintain the integrity of the nail bed. We turned over the nail bed to expose the sub-bed tissue. After that, the DLAD from Lando, Shenzhen was soaked in saline for 5 min, and the surface silicone layer was removed. The remaining multinull matrix complex composed of depsipeptide-activated collagen and chondroitin sulfate was filled with the subnail bed tissue. There needs to be sufficient filling below the nail bed in both inset nail grooves to bring the nail bed closer to the physiological curvature. It is also vital to ensure that the proper width of the nail groove is retained to allow for nail plate growth. Finally, the nail bed was re-covered back onto the toe bone and checked again to see whether the nail bed was level. The shape of the nail bed determines the shape of the new toenail, and if the nail bed is still ingrown, the pincer nail may recur. Next, the nail bed was resutured with its original corresponding lateral nail crease using 4-0 absorbable sutures to form a new nail groove (avoiding dislodgement of the filled multivessel matrix complex). Finally, we covered the surface with oiled gauze and bandaged the surgical incision. The whole operation process is shown in . After the procedure was completed, antibiotics and anti-inflammatory pain management were given to the patient. The schematic diagram of this procedure is shown in .
+The dressing was replaced every 1–2 days postoperatively, and the patient was told to wear loose shoes postoperatively. The follow-up 1 month after surgery showed complete healing of the surgical wound and well growth of the nail with the DLAD . About 3 mm of nail plate growth could be observed at this time. Then, at the 3-month postoperative follow-up, about 15 mm of nail plate growth was seen. The growth rate of the bilateral area of the nail was lower than that of the middle part of the nail, and the nail plate was abnormally thickened . Probably because of the damage to the nail grooves on both sides of the affected toe after repeated nail extractions. Nine months after the operation, we saw that the nail plate growth improved obviously, the curvature index reached 87.5%, and the VAS score reduced to 1 . So far, the nail plate is fully grown and looks good; the patient has not felt pain and is back to work, feeling satisfied with this operation .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2345_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2345_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ccb656e4b3d5f7f53f896b7bbe98e2046ae5f9fe
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2345_en.txt
@@ -0,0 +1,7 @@
+A 75 year old Jamaican Female of African descent was admitted for shortness of breath. She had been complaining of fatigue and shortness of breath for six months since arriving in the U.S. from Jamaica. She reported mild symptoms in Jamaica, but felt they had worsened during her time in the States. She had been admitted multiple times to at least four different hospitals since her symptoms began. She had been treated for both congestive heart failure (CHF) and asthma exacerbations, despite carrying no significant history of either condition. At the time of the admission described herein, she had been discharged from another hospital two days prior on a tapered prednisone regimen prescribed for an "asthma exacerbation".
+A review of systems at the time of admission revealed symptoms consistent with New York Heart Association Class IV CHF, including orthopnea, paroxysmal nocturnal dyspnea, lower extremity edema, and a virtually non-existent exercise tolerance.
+On examination the patient was in acute distress, sitting bolt upright in bed and tripodding. She was obese. Jugular venous distension was difficult to discern due to her body habitus. She did not have a palpable point of maximal impulse. Her heart sounds were distant but regular with a II/VI systolic ejection murmur heard loudest over the right upper sternal border which did not radiate. Her breath sounds were absent at the bases and diminished 2/3 of the way up the posterior lung fields. She had 2+ pitting edema to the hips. There was no hepatomegaly or macroglossia.
+Her electrocardiogram (ECG) at the time of admission showed diffuse low voltage and Q waves in leads III and aVf . A trans-thoracic echocardiogram (TTE) was performed soon after admission . It showed moderately reduced left ventricular function with an ejection fraction (EF) of 33%, a small left ventricular cavity (20.4 cm2 in diastole, 16.3 cm2 in systole), markedly increased wall thickness (septal diameter in diastole = 1.86 cm), and severe concentric hypertrophy. Additionally, there was moderate mitral regurgitation. A speckled pattern in the myocardium was noted.
+Both serum and urine protein electrophoresis demonstrated a normal protein distribution without a monoclonal spike. She had modestly impaired renal function (estimated GFR 51 mL/min by Cockocroft-Gault, 52 mL/min by Modification of Diet in Renal Disease Criteria) with no proteinuria.
+She was diuresed using furosemide, and treated with monopril, metoprolol (later changed to carvedilol for better blood pressure control), and digoxin. There was little subjective or objective improvement in her condition with this treatment. The digoxin was stopped on the 5th hospital day, as the suspicion for Amyloidosis at that point in time was high.
+She underwent a fat pad aspiration biopsy, which was negative for amyloid by Congo Red Staining. At that time, it was felt that her refractory condition, in combination with the ECG and TTE data was sufficiently suggestive of amyloid disease that she should undergo endomyocardial biopsy as a means of definitive diagnosis. The biopsy revealed AL Amyloidosis with kappa and lambda light chain deposits. Stains for iron and amyloid AA were negative.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2355_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2355_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..75db997e96e79f9b88fcd14950ab4a8c8ec718e7
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2355_en.txt
@@ -0,0 +1,4 @@
+A 4-month-old boy, weighing 6.3 kg, presented to the local hospital 18 days before the consultation with no apparent cause of dyspnea, cough, and sputum. Imaging revealed an anterior mediastinal occupancy, possible abnormal enlargement of the thymus, and bilateral pneumonia. No improvement was seen after antibiotic treatment was given. To clarify the etiology, an ultrasound-guided fine needle biopsy was performed, which showed normal thymic tissue with no evidence of malignancy. The patient was seen at our hospital for a significant worsening of symptoms, and the parents denied any other previous symptoms or comorbidities of the patient. On admission, body temperature was 37.1°C, blood pressure was 93/51 mmHg, pulse rate was 147 beats/min, and respiratory rate was 35 breaths/min. He had cyanotic lips, diminished breath sounds in both lungs, positive three concave sign, no fever, and ptosis. The peripheral blood leukocyte count was 10.38 × 109/L, with 12.8% neutrophils and 81% lymphocytes. Blood gas analysis data were pH 7.403, pCO2 40.7 mmHg, pO2 51.8 mmHg, ctHb 13.9 g/dl, sO2 85.4%, BE 0.7 mmol/L, cHCO3- 24.7 mmol/L. The ultrasound showed a significantly enlarged thymus with a soft texture and fair echogenicity. Chest radiographs showed large soft tissue shadows in the bilateral thoracic cavity .
+After admission, he received non-invasive ventilation, which relieved his breathing difficulties to some extent. Enhanced computed tomography scan of the chest revealed that the thymus was significantly enlarged, it had smooth margins, regular morphology, and mild uniform enhancement, both lungs were compressed, solid, and non-distended, and the distal segments of the left and right main bronchi and their branches were thinned, and the superior vena cava, right subclavian vein, and left cephalic brachial vein were thickened, which was considered as thymic hyperplasia . Further, the tumor markers alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), neuron-specific enolase (NSE), and human chorionic gonadotropin (HCG) in peripheral blood were checked within normal limits. Combining the patient's clinical features, imaging, and biopsy findings, TTH was considered. On the third day of admission, the patient's dyspnea further worsened and he underwent tracheal intubation. To relieve the compression of the lungs and heart and great vessels, exploratory thoracoscopic surgery was performed on the third day of admission.
+The patient entered the operating room with a tracheal tube, awake and sedated, with pulse oximetry of 85%, a blood pressure of 55/40 mmHg, a heart rate of 101 beats/min, and an airway pressure of 26 cm H2O. After induction of anesthesia, the tracheal tube was removed and an Arndt5F bronchial blocker was placed in the right bronchus, followed by the insertion of a normal tracheal tube. To prevent airway collapse, muscle relaxants were not administered during anesthesia. Due to the patient's low blood pressure and slow heart rate, intraoperative blood pressure was maintained at 55–80/35–52 mmHg after pumping a small dose of dobutamine, and the heart rate fluctuated from 98 to 142 beats/min. Intraoperative blood oxygen fluctuated from 70%–100%.
+The patient was placed in the left lateral recumbent position and a 5 mm Trocar was placed in the 8th intercostal space/midaxillary line, 5th intercostal space/anterior axillary line, and 6th intercostal space/posterior axillary line, respectively. Artificial pneumothorax was established at 6–8 mmHg pressure. We observed giant thymus-like tissue occupying the bilateral thoracic cavity, up to the roof of the pleura and down to the diaphragm. It had an intact envelope, a yellowish-white solid lobulated shape, and a soft texture, and these were consistent with the normal thymus appearance . It compressed but did not invade the surrounding structures and measured approximately 12 × 10 × 5 cm , with the phrenic nerve traveling at its margin. We used an electric scalpel to first free dissect and removed the mass occupying the right side of the thorax in its entirety, followed by freeing and removing most of the mass occupying the left side of the thorax, preserving part of the thymus in the left lobe and the volume of the preserved thymus is about 1/3 of the normal unilateral thymus in the age cohorts . And we carefully protected the phrenic nerves bilaterally during the operation. Finally, we enlarged one of the trocar holes to 2 cm and removed the tissue using a retrieval bag, and the weight of the resected mass was approximately 308 g . We placed one silicone drainage tube, with intraoperative bleeding of approximately 2 ml and an operative time of 90 min. The patient had his drainage tube removed 5 days after surgery and was discharged 7 days after surgery. Postoperative pathological histology showed enlarged lobular structures, clear corticomedullary demarcation, and visible thymic vesicles. Combined with the immunohistochemical staining results, it was considered consistent with true thymic hyperplasia . At the 2-month postoperative follow-up, the patient had no new symptoms or related complications. The routine blood test showed WBC 12.46*1012/L, LYMPH# 8.92*109/L, LYMPH% 71.6%. No recurrence was detected on chest x-ray and both lungs were well dilated .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2357_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2357_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..bfc1495c703d31c9385a3757e39067cecad747b9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2357_en.txt
@@ -0,0 +1,9 @@
+A 61-year-old Caucasian man underwent a chest CT due to unclear right-sided thoracic pain. In addition our patient complained of abdominal cramps. Examination suggested a retroperitoneal mass seen on the most caudal CT slices. He was referred to our hospital for abdominal ultrasound, showing a 11 cm large retroperitoneal tumor located right and ventral to the abdominal aorta . The craniocaudal dimension extended from the head of pancreas to the aortic bifurcation. The tumor consisted of two different components: the cranial component was well delineated and heterogeneous with hyperechoic and anechoic compartments. The caudal tumor component was poorly delineated, homogeneous and hypo-echoic. The tumor led to a ventral displacement of the duodenum and a compression of the inferior vena cava. Due to an obstruction of the right ureter, there was a right-sided hydronephrosis.
+A subsequent abdominal CT confirmed these findings . As seen by ultrasound, the tumor consisted of two different parts: (1) a well-perfused heterogeneous part with cystic lesions and (2) a less-perfused, homogeneous part. The two parts were well delineated from each other. The tumor partially encased the inferior vena cava, the right common iliac artery and right ureter. In addition the pancreas and the duodenum could not be delineated from the tumor. Due to the obstruction of the right ureter, the right kidney showed delayed enhancement.
+Laboratory analyses found elevated levels of normetanephrin (4411 nmol; normal 570 to 1930 nmol) in a 24-hour urine test, clinically proving a neuroendocrine tumor of the pheochromocytoma/paraganglioma family. Unaware of this differential diagnosis, an endosonographic-guided transduodenal fine needle aspiration was performed confirming the diagnosis. Fortunately no hypertensive crisis occurred.
+In addition, intra-hepatic metastases were seen on the initial CT scan and a subsequent octreoscan also revealed the presence of intra-osseous metastases. On contrast-enhanced CT the liver metastases had a slight early arterial enhancement with a reduced wash-out during the venous phase. On ultrasound the liver metastases were not well delineated, but appeared slightly hypo-echogenic compared with the surrounding liver tissue. Contrast-enhanced ultrasound was not performed. The CT findings, in particular, would be consistent with metastases from a neuroendocrine tumor.
+The presence of metastatic disease precluded a curative resection. However, local resection of the tumor was undertaken for symptomatic relief.
+Macroscopically the partially resected tumor reflected the radiological results. The cranial component was well defined and encapsulated and displayed red, brown and black hemorrhagic and cystic areas consistent with the appearance of paragangliomas. Meanwhile the caudal part, corresponding to the neuroblastoma, was macroscopically less well demarcated with a white-gray-tan and solid cut surface.
+Microscopically, the encapsulated paraganglioma showed the typical Zellballen growth pattern, an elevated mitotic activity (Ki-67) of up to 50%, necrosis and vascular invasion. The small blue round cells of the neuroblastoma component displayed a highly proliferative (around 90%) and broadly infiltrative growth pattern and lymphovascular invasion was seen . Immunohistochemically, both components were positive for synaptophysin and somatostatin receptor 2 with the latter one being consistent with the positive octreotid scan. In contrast to the neuroblastoma, the paraganglioma expressed the typical markers chromogranin A and vimentin.
+There was no evidence for an amplification of the prognostic oncogene N-myc. Tumor metastasis of the neuroblastoma component was histologically confirmed by lymph node and skin biopsies.
+Subsequently, our patient was treated with palliative chemotherapy and radiotherapy beginning with three cycles of carboplatin aqueous solution and etoposide phosphate. On tumor progression palliative radiotherapy with 10 × 3 Gray at multiple locations followed. Subsequently chemotherapy with CHOP (cyclophoshamide, hydroxydaunorubicin, oncovin, prednisone) was started and finally (after two months) changed to a weekly dose of docetaxel with prednisone. Ten months after the initial diagnosis our patient died of cancer-related pulmonary embolism and pneumonia.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2379_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2379_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..11c1fc37faf2d3e8c0be38d77d7003a84c1a4209
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2379_en.txt
@@ -0,0 +1,6 @@
+A 57-year-old woman presented with a 6 month history of increasing pain in the right side of her groin radiating down to the medial thigh, to the anterior aspect of the knee and to the medial side of the lower leg and foot. The pain worsened when climbing stairs and walking and could not be relieved by non-steroidal medications. She became unable to climb stairs and walk long distances for the preceding 2 months, due to paresthesias and hypoesthesia of the medial side of the right lower leg and foot.
+Physical examination revealed tenderness over the anterior hip, no palpable mass and there was no muscle atrophy. Neurological examination revealed an altered sensation to light touch in the medical side of the right lower leg and foot. Internal rotation, external rotation and extension of the right hip were painful and were markedly limited. Vascular examination of her lower limb was intact. The result of the straight-leg-raising test was negative.
+Laboratory investigation included blood sugar, serum electrolytes, erythrocyte sedimentation rate, C-reactive protein, corpuscular blood count with differential count, rheumatoid factor and antinuclear antibodies. The results were all normal. Radiographs of the hip and lumbar spine were also normal. Computer tomography (CT) scan and magnetic resonance imaging (MRI) of the right hip region revealed a cystic lesion of 2.6 × 1.4 cm in diameter, both in high-T2- and low-T1-weighted signal intensity, arising from the antero-medial aspect of the acetabulum, displacing the femoral nerve as well as the femoral vein and the artery . A colour duplex Doppler ultrasonography excluded the possibility of aneurismal lesion. Electromyography (EMG) revealed evidence of muscle denervation.
+At the time of surgery, a cyst measuring 3.3 × 2.4 × 1.8 cm was identified which was adherent to the anterior surface of the hip joint capsule. No communication was found between the joint space and the cyst. The joint capsule appeared intact. The cyst was removed totally and the base of the cyst was cauterized. The cyst was opened in the operating room and was found to contain thick, lucent gelatinous material .
+Histological evaluation identified fragments of benign cyst wall composed of variably dense fibroconnective tissue with no lining cells, consistent with a ganglion cyst .
+Postoperatively, the patient was pain-free and showed almost normal strength and sensation in the right leg. On clinical and ultrasonographic examination, no recurrence has been observed up until the time of writing this report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2398_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2398_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2b3d027248b316c33ef30afec2dca3391f3b9b22
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2398_en.txt
@@ -0,0 +1 @@
+A 72-year-old man was addressed to the nephrology department for acute kidney injury with increased creatininemia at 2.2 mg/dL (N: 0.72–1.17) corresponding to an estimated glomerular filtration rate (eGFR) of 30 mL/min/1.73 m2 according to the CKD-EPI formula. He was asymptomatic. He had no personal or family history of kidney disease. He did not travel, had no allergies, and had no known contact with ill patients. He was not taking any nonsteroidal anti-inflammatory drugs. His medical history comprised of pleural tuberculosis treated 20 years before, well controlled hypertension under treatment with calcium antagonists and glaucoma treated by monthly intravitreal injections of bevacizumab in the past 6 months. Physical examination and blood pressure were normal. There was no swelling. Laboratory investigations did not show any sign of TMA, with normal haemoglobin and platelet count. Immunological testing was positive only for antiphospholipid antibodies. Infectious serology was negative. The urinalysis showed no haematuria but increase of albuminuria from 2.9 to 226 mg/g of creatinine (N: <30). Urine cultures were negative. Kidney ultrasound was normal. A renal biopsy performed two weeks after showed ten glomeruli. Two of them were obsolescent glomeruli with complete glomerulosclerosis. The other glomeruli demonstrated thickening of capillary wall . There were segmental glomerular capillary microaneurysms, filled with pale material, and segmental hyaline thickening of the glomerular basement membrane . Silver staining showed some double contours . Mild focal interstitial fibrosis and tubular atrophy with a mononuclear cells infiltrate were seen. Immunofluorescence for IgA, IgG, IgM, C1q, kappa, and lambda was negative. However, C3 immunofluorescence showed a sparse endothelial positivity in arterioles (not shown). On electron microscopy, the endothelial cells showed irregularities, and focal loss of fenestrations. Subendothelial space expansion by electron-lucent material was visible . This was consistent with signs of endothelial injury. Intravitreal injections of anti-VEGF were suspended. Four months after withdrawal, serum creatinine was of 1.20 mg/dL, and albuminuria normalized, supporting our hypothesis of intravitreal anti-VEGF induced renal microangiopathy. One year after bevacizumab was stopped, serum creatinine was of 0.95 mg/dL, and urinary albumin-creatinine ratio was of 3.3 mg/g. The patient did not present any thromboembolic event.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_23_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_23_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..45e51dbc9d671cb21d67d094165d9a2cf4506a6a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_23_en.txt
@@ -0,0 +1,25 @@
+This is a case of a 50 years old female patient who is known to be hypertensive, dyslipidemic, obese (BMI: 31.88-Height: 168 cm Weight: 90 kg), and operated of sleeve gastrectomy in 2012.
+On the morning of 13/02/2013, the patient noted a near syncope episode. She was transferred to the emergency department for a fever of 39.2°C, a microcytic anemia (Hb: 7 g/dl) with elevated inflammatory markers CRP 239 mg/l and ESR 90 mm and admitted for care and investigation.
+Her physical exam showed lower limbs weakness at 4/5 proximally and distally (possible movement against gravity with moderate resistance). She was put on IV meropenem after blood and urine cultures were taken. The gram color was negative so were the cultures after 48 hours.
+On the following morning she started complaining of paraparesia. Her physical examination showed a motor deficit of the lower limbs at 1/5 (visible contraction without any movement) with total anesthesia in all modalities (proprioceptive and thermo-algic). A D6 level was also noted.
+An abdomino-pelvic computer tomography (CT) scan showed a complete thrombosis in the lower part of the mesenteric and the splenic veins extending to the portal bifurcation and the intrahepatic portal branches. It associated an important infiltration of the peritoneal and peri-pancreatic fat, and a mean abundance of free peri-hepatic, splenic and peri-pelvic ascites. There was a collection of 42 × 15 mm near the splenic hilum, containing a trace of contrast and a small two-fluid level. This collection seemed to communicate with the digestive tract at the gastro-esophago-jejunal anastomosis in its proximal part, suggestive of infected fistula .
+IV heparin was added to her medications.
+An urgent brain and cervico-dorso-lombar MRI (magnetic resonance imaging) were performed and showed:Small brain abscesses formation Figure . An extensive transverse infectious myelitis Figure .
+In front of these findings a lumbar puncture was performed revealing 430 WBC (92% neutrophils, 7% lymphocytes, and 1% mesothelial cells) 10 RBC with hypoglycorachia and hyperproteinorachia in favor of an inflammatory liquid with polymorphic predominance of polynucleated elements. The objective of this technique was to try to isolate a bacterium. The CSF culture returned sterile and PCR BK was negative.
+An electromyogram was normal.
+After this result vancomycin was added to the treatment regimen.
+Clinical presentation, physical examination, and history are important diagnostic tools in assessing an acute myelopathy as the pattern of functional loss can help to determine the location of the lesion. When an acute myelopathy is suspected, a thorough neurological evaluation will help determine the region of the spinal cord affected and then the next diagnostic step is to evaluate for a compressive or structural etiology (Timothy W. ).
+Magnetic resonance imaging (MRI) of the complete spinal axis is mandatory in any patient with myelopathic features to exclude structural lesions, particularly those amenable to emergent neurosurgical intervention .
+Once neuroimaging has excluded a compressive etiology, a lumbar puncture (LP) is indicated to determine if there are signs of inflammation within the cerebrospinal fluid (CSF). If the CSF is non-inflammatory, then vascular, toxic/metabolic, neurodegenerative, or neoplastic myelopathies become much more likely and the subsequent work-up should focus on these etiologies. If the CSF shows signs of inflammation (pleocytosis, elevated protein concentration, oligoclonal bands, or elevated IgG index), then the subsequent work-up should focus on demyelinating, infectious, or other inflammatory causes of an acute myelitis, as the differential diagnosis is broad .
+However, for elucidating the etiology of infectious myelitis, CSF studies are essential. CSF studies include cell count with differential protein and glucose concentrations. In addition, measurements of intrathecal immunoglobulin production with oligoclonal bands (OCBs) and an immunoglobulin G index or synthesis rate are very helpful when trying to determine the presence and etiology of myelitis.
+An elevated protein concentration is the most common CSF abnormality in patients with spinal cord disease and is present in approximately 50% of patients with transverse myelitis . A low CSF glucose concentration is defined as less than 60% of serum glucose and generally suggests fungal, bacterial, or mycobacterial infection, especially when associated with an elevated CSF white blood cell count. An isolated low CSF glucose concentration can occur in neurosarcoidosis, leptomeningeal carcinomatosis, subarachnoid hemorrhage, and even systemic lupus erythematosus (SLE) with CNS involvement . The white blood cell differential can be very helpful as well. The presence of eosinophils can suggest parasitic or fungal infection, the presence of foreign material (such as surgical hardware following a spinal operation) or possibly neuromyelitis optica (NMO) (Timothy W. ).
+The most frequent pathogens involved in transverse myelitis include Treponema palidum, Mycobacerium tuberculosis, Borrelia burgdorferi, Campylobacter jejuni, Acinetobacter baumanii, Coxiella burnetii, Bartonella henselae, Chlamydia psittaci, Leprospira, Chlamydia pneunoniae, Legionella pneumonia, Orientia tsutsugamushi (scrub typhus), Salmonella paratyphi B, Brucellosis melitensis, Group A and B streptococci .
+Intramedullary abscess may also complicate congenital dermal sinuses or bacterial endocarditis. So a cardiac echography should be performed to exclude endocarditis.
+In our case, a PPD, HIV serology, wright and widal all returned negative. A cardiac echography was performed and ruled out any sign for endocarditis.
+Successful treatment of infections of the nervous system depends on rapid and accurate diagnosis. The time course of symptom progression may suggest specific pathogens. In general, symptoms of less than 2 day’s duration bespeak bacterial processes. The clinical syndrome and associated extra neural infection sites favor certain organisms .
+Empiric corticosteroids may be of benefit in bacterial and in tuberculous meningitis . For bacterial meningitis, the typical dosing is a four-day regimen of dexamethasone (0.6 mg/kg daily) started before or with the first dose of antibiotics .
+Our patient had developed an abdominal abscess with fistula. The bacteria implicated in her myelitis are probably an enterobacteriaceae or an enterococcus. The CSF culture was negative probably because we already initiated the meropenem before the lumbar puncture was performed.
+A follow-up brain and cervico-dorsal MRI after 2 months of IV treatment (IV meropenem and vancomycine) showed: Figure .Net decrease of small contrast enhancing lesions scattered with persistence of nodular contrast right frontobasal, left upper front, in the region of the left and right thalamic lenticular ventricular junction, compared with small abscess formations in the process healing. We found a great reduction in the T2 signal abnormalities of the spinal, cervical, and thoracolumbar intramedullary spine signal. Virtual disappearance of intramedullary signal abnormality in the cervical spinal and back to a normal size.
+1 year after the myelitis and physical rehabilitation, her physical exam shows motility at 3/5 (active movement against gravity) over both her lower limbs. The sensitivity over her lower limbs is recovering but poorly over the feet. Her sphincteral dysfunction is still persistent.
+The differential diagnosis with the infectious myelitis is one caused by autoimmune disease. A thorough workup was conducted eliminating all autoimmune diseases. The antinuclear antibodies, antibodies to extractable nuclear antigen, rheumatoid factor, antiphospholipid antibodies, and anti-neutrophil cytoplasmic antibodies (ANCA) are all negative .
+CSF and blood angiotensin-converting enzyme levels are normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2409_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2409_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7ae537e12d7567852b4a9690b3ac2a1ae9a20817
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2409_en.txt
@@ -0,0 +1,4 @@
+A 55-year-old man, with body mass index (BMI) of 18.36 kg/m2, was admitted into our hospital for left hip pain for 6 months. The symptom started with moderate pain after walking. Over the last few days, the pain got worsen with no remission after rest. The patient denied any history of trauma, glucocorticoid hormone consumption or radiotherapy. Examinations before admission revealed old fracture on the left femoral neck and an increase in blood uric acid. After admission, the function evaluations of his bilateral hip joint were summarized as follows: Visual Analogue Scale (VAS) score was 4, Harris score was 23 in the left hip joint, while VAS score was 0, Harris score was 90 in the right hip joint. The imaging examinations of the pelvis, including radiographs , CT and MRI scan , confirmed the existence of bilateral femoral neck fractures, with fracture nonunion and femoral neck shortening in his left femoral neck and double fracture lines in his right femoral neck. The Dual energy X-ray absorptiometry (DXA) examination of the lumbar spine showed reduced bone mineral density (BMD) and severe osteoporosis (L1–L4: BMD0.514 g/cm2, T score = − 4.6). In addition, tumor markers, tuberculosis antibodies, alkaline phosphatase and parathyroid hormone levels were found to be normal.
+We recommended a left cementless THA, and a cannulated screws fixation on the right side. And the uric acid lowering treatment was performed on the patient. However, the patient only agreed to the left THA, while on the right side, conservative treatment was selected for patient because of financial reasons. The left THA through the lateral approach was performed for the patient under general anesthesia . During the surgery, we found sclerosis, fatty degeneration and necrosis of the fracture end of the left femoral neck . We used impactive bone grafting to strengthen the acetabular on the fracture region .
+After the operation, the patient was treated with 20 U Elcatonin injection (Sidinuo®, Shangdong Luye Pharmaceutical Co.LTD, Yantai, China) once a week, and 1 tablet of Calcium Carbonate D3 Granules (Langdi®, Beijing Kangyuan Pharmaceutical CO.LTD, Beijing, China) containing calcium carbonate (500 mg) and vitamin D (200 IU), twice a day. Meanwhile, He was required to exercise his quadriceps and calf muscle on bed, move with the help of wheelchairs, and avoid walking on crutches. The postoperative histological examination, as showed in Fig. , revealed that the left fracture gap was filled with fibrous tissues, with few new bone tissues and a large amount of necrotic bone tissue observed. Meanwhile, the plain radiograph of the pelvis one day after surgery revealed that the total hip replacement arthroplasty was very successful . Generally, the patient recovered well during the hospitalization and was successively discharged home.
+Four months after discharge, the radiograph image showed no signs of implant loosening or infection in his left hip . It was worth noting that CT images revealed fracture union of the right femoral neck, as shown in Fig. b and Fig. c. In addition, function evaluations of his bilateral hips at four months after surgery was satisfactory and summarized as follows: VAS score was 0, Harris score was 98 in the left hip joint and VAS score was 0, Harris score was 95 in the right hip joint.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2414_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2414_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..668c281634d54d8c35c980cab0b0f83368fcdb50
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2414_en.txt
@@ -0,0 +1,5 @@
+A 28-year-old male with normal BMI presented to a surgical department clinic with complaint of a pain and swelling in the right inguinal region for the past two weeks initially it was small and gradually increase in size and associated with pain. This swelling was present for the last 8 years causing no symptoms, so the patient did not seek any medical advice for it. There was no history of abdominal pain and vomiting. The patient is an engineer by profession, suffering from Hepatitis C, for which he took treatment.
+On examination, there was an indirect right inguinal hernia incomplete, and reducible type with positive cough impulse.
+Patient was diagnosed clinically as indirect inguinal hernia. Hematological workup was within normal limits.
+A Preoperative diagnosis of right inguinal hernia was made and was planned for hernia mesh repair, during surgery under spinal anesthesia, the hernia sac was found to contain an appendix. The appendix was slightly congested, not inflamed but there were dense adhesions within the sac and so adhesiolysis and appendectomy along with excision of the sac and Lichtenstein mesh hernioplasty was done. The postoperative period was uneventful. The patient postoperatively received fluid therapy, Oral fluids were administrated after 6 h along with soft diet and was discharged on postoperative day 2.
+The patient was discharged on second post-operative day with complications on oral anti-biotics and followed up after one week of surgery (, , ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_241_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_241_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d3d89c71cf747d008d1567f660856e90d67d3de9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_241_en.txt
@@ -0,0 +1,8 @@
+A 44-year-old female factory worker presented to our clinic complaining of a 1 year history of repeated, temporal and parietal headache characterized by bursting sensations. She had previously presented to a local hospital 6 months prior, in April 2016. The patient’s initial brain magnetic resonance imaging (MRI) and magnetic resonance angiography (MRA) were normal. CSF studies revealed 68 white cells per microliter and a pressure of 310 mmH2O. Viral encephalitis was suspected and she received acyclovir intravenously (500 mg Q8H for 7 days), but symptoms showed no signs of relief.
+The patient visited the local hospital again 3 months later, in July 2016, complaining of an aggravated headache and paroxysmal numbness of her left face and arm. She was diagnosed with an ischemic stroke of the right thalamus and administered oral aspirin 100 mg and atorvastatin calcium 20 mg daily . Her numbness improved while the headache showed no improvement.
+She visited the local hospital for the third time 5 days prior to presenting to our hospital due to the severity of her headache on October 26, 2016. Lumbar puncture was remarkable for a CSF pressure greater than 400 mmH2O, white cell count of 40 per microliter, and a protein level of 1171 mg/L. Cerebral magnetic resonance venography (MRV) revealed underdevelopment of her right lateral sinus and sinus thrombosis was considered as a possible etiology. She was treated with low molecular heparin and her headache was slightly relieved. She was then admitted to our hospital for further treatment.
+The patient had no significant past medical history, denied a history of blood transfusions and consumption of raw food. Her physical examination was unremarkable, and no abnormal neurologic signs apart from horizontal nystagmus was noted.
+Laboratory tests revealed the proportion of eosinophils to be slightly elevated (3.35%) while other indices were within normal limits. HIV, syphilis, and Herpes simplex virus-1 and 2 antibodies were absent. In addition, the T-Cell spot test, purified protein derivative test for Mycobacillus Tuberclosis and Latex agglutination test for the cryptococcal capsular antigen were all negative. She underwent three lumbar punctures after admission to our clinic and results revealed a high intracranial pressure and an increased white cell count .
+No abnormalities were found on cerebral MRA, while MRV imaging suggested underdevelopment of the right lateral sinus. Digital subtraction angiography (DSA) revealed the arterial system to be normal and confirmed dysplasia of the right lateral sinus . Cerebral MRI with contrast revealed several small, hyperintense lesions involving the right cerebellar hemisphere and bilateral occipital lobe, with gadolinium ring enhancement . NGS of CSF sample was further carried out and suggested several possible pathogens including parasites and virus . Serum was subsequently evaluated for presence of cysticercal antibodies and CSF also confirmed positivity, but negative for Echinococcus granulosus. Review of the patient’s previous imaging records revealed several additional anomalies: her pulmonary CT revealed multiple densities in chest wall soft tissue , and her chest radiographs take 6 months prior to admission to our hospital revealed multiple calcifications on the left side of the neck and right chest wall . A diagnosis of cerebral cysticercosis was therefore finally established. Oral praziquantel (2.5 mg/Kg/d × 7 days for one procedure) was administered thrice. Her headache was recovered markedly. Three months after she was discharged, her secondary cranial MR scan revealed persistence of the aforementioned ring-enhancing lesions . She underwent a repeat lumber puncture that revealed a CSF pressure of 220 mmH2O and 10 white blood cells per microliter. Meanwhile, CSF cysticercal antibodies remained positive. Repeat CSF NGS revealed that the T. solium index dropped considerably compared to initial NGS readings. On follow-up 6 months later, she reported no persisting symptoms.
+CSF was collected via standard procedures. DNA was extracted from 300 μL CSF samples using the TIANamp Micro DNA Kit (DP316, Tiangen Biotech, Beijing, China) and sonicated to a size of 200–300 bps fragments (Bioruptor Pico protocols). DNA libraries were then constructed via end-repaired adaptation added overnight and application of polymerase chain reaction (PCR) amplification to extracted DNA. An Agilent 2100 Bio-analyzer (Agilent Technologies, Santa Clara, CA) in combination with quantitative PCR was utilized to quantify DNA libraries. Sequencing was performed using the BGISEQ-100 platform (BGI-Tianjin, Tianjin, China) .
+Most high-quality sequencing data were generated and computational subtraction of human host sequences was performed using a Burrows- Wheeler Alignment tool . Remaining sequencing data were aligned with Microbial Genome Databases, which is composed of 2700 whole genome sequences of viral taxa, 1494 bacterial genomes or scaffolds, 73 fungi and 47 parasites associated with human infectivity. The total number of reads from different samples was standardized as 20 M for comparison. After alignment, previously obtained files were filtered and duplicates removed. ThMmapped data were further processed and with the depth and coverage of each species calculated using Soap Coverage . A control sample from a non-infected patient was obtained and subjected to the aforementioned procedures. The DNA of CSF samples before and after drug treatment was extracted to construct a complementary DNA (cDNA) library for sequencing. The number of reads from the cDNA library of the patient’s CSF was 37,781,754 (before drug treatment) and 19,043,412 (after drug treatment) respectively. Those of the control sample were 25,962,600. As a result of pathogen detection, T.solium was identified as the most predominant parasite with 3.495% coverage of the T.solium genome in the first detection; however this reduced to 0.078% in the second detection after specific drug therapy. No reads of T.solium were detected from control samples. Reads of viruses were also detected in the CSF samples, later identified as human herpesvirus 4 (HHV-4). After drug therapy, the number of HHV-4 reads decreased approximately 20-fold. The results of CSF NGS prior to and after praziquantel therapy are shown in Table .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2444_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2444_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..fbc127e2ca2b621507c529d2180ef699ca4d32a0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2444_en.txt
@@ -0,0 +1,8 @@
+On 24 January 2020, a 48-year-old male patient with a history of asthma was transferred to our department due to acute myocarditis of unknown origin. The patient described a sudden onset of high-grade fever without prodromal symptoms beginning on 12 January. Within a few days, he developed dyspnoea and haemoptysis requiring hospital admission.
+Laboratory testing showed high levels of the inflammatory markers creatine phosphokinase (CPK) and lactate dehydrogenase (LDH; see ). Ferritin was only marginally elevated. His differential blood count showed prominent eosinophilia (19%) and lymphopenia (18%). Testing for autoantibodies only yielded antinuclear antibodies (ANAs) at a very low titre without any detectable specificity against a broad panel of nuclear antigens. However, myositis-associated antibodies, antineutrophilic cytoplasmic antibodies (ANCAs), as well as antiphospholipid antibodies were negative. The measurement of vital signs revealed tachycardia (100 b.p.m.) with hypotonic blood pressure (90/65 mmHg) and fever (39°C). On physical examination, lower leg oedema was present. The auscultation of heart and lungs was unremarkable.
+Thoracic computed tomography (CT) showed bilateral, patchy peripheral ground-glass opacities with a crazy-paving pattern, focal consolidations, and mild pleural effusions . Due to highly elevated cardiac markers [N-terminal probrain natriuretic peptide (NT-proBNP) and troponin T], echocardiography and cardiac magnetic resonance imaging (MRI) were performed. Both showed highly reduced ventricular function [left ventricular ejection fraction (LVEF) 22%, right ventricular ejection fraction (RVEF) 28%]. Furthermore, late gadolinium enhancement (LGE) of the entire left ventricular myocardium with intracardial thrombi was detected on MRI . T1 and T2 times were markedly prolonged, reflecting acute oedema following myocardial inflammation. In light of a multifaceted differential diagnosis, pulmonary and myocardial biopsies were performed. Histopathological analysis of the pulmonary biopsy showed interstitial alveolitis with capillaritis, necrosis, and mild eosinophilia. The cardiac specimen revealed active lymphocytic myocarditis . PCR analysis for usual cardiotropic viruses was negative. A few days after admission, the patient developed an acute renal injury with microhaematuria.
+Based on these findings and the clinical presentation at that point, the diagnosis of an ANCA-negative small-vessel vasculitis was established. Given the known asthma, eosinophilia, renal injury with microhaematuria, and cardiopulmonary inflammation, the patient fulfilled the criteria for eosinophilic granulomatosis with polyangiitis (EGPA) despite the lack of ANCAs.
+In accordance with current guidelines, pulse therapy with cyclophosphamide and high-dose steroids was initiated, and the patient recovered adequately after several weeks of treatment. On discharge, the patient was afebrile without dyspnoea, but a wearable defibrilator was prescribed. .
+After discharge of the patient from our hospital, the COVID-19 pandemic had evolved to affect Europe as well. Individual cases were reported at the end of January and early February in France, Italy, and Austria. Owing to the initial broad spectrum of differential diagnoses, we revisited the complete medical history and contacted the patient, who reported a prior vacation in Tyrol, Austria, from which the patient and his family had returned 1 day before the sudden onset of his symptoms. It is of interest that Austria is considered the origin of the COVID-19 outbreak in Europe. The distance from Tyrol to our department in Germany is ∼500 km. One week later, the patient arrived at the hospital because of a progressive fever and weakness. Moreover, the patient reported that his 8-year-old daughter developed flu-like symptoms with a high-grade fever (40.7°C/105°F) ∼1 week after his first symptoms.
+Subsequently, PCR testing for SARS-CoV-2 RNA was initiated on the histological specimens of the heart using quantitative reverse transcription–PCR (RT–qPCR) kits targeting the E gene and RdRp gene (TIB MOLBIOL, Roche Diagnostics, Germany), and the N2 assay (N gene). Unexpectedly, those tests were positive for SARS-CoV-2 RNA. Therefore, we revised the diagnosis from small-vessel vasculitis to COVID-19-associated myocarditis and immediately stopped immunosuppressive treatment with cyclophosphamide. The steroid dose was also tapered. The course of resolving the intracardial thrombus was accomplished with a therapy that included coumarin-type drugs. The normalization of elevated laboratory inflammation markers, improvement of cardiac function on echocardiography, and the absence of cardiac inflammation on cardiac MRI confirmed the patient’s recovery.
+The pulmonary specimen showed mild eosinophilia with parenchymal necrosis and alveolitis. Staining for CD31, factor VIII, and CD68 were positive, while all other staining experiments were negative. In the cardiac specimen, markedly elevated counts of lymphocytes (positive for LFA-1, CD45R0, and CD3) and elevated counts of macrophages (positive for MAC-1) could be detected along with the expression of adhesion molecules (ICAM-1). In contrast, perforin-expressing cytotoxic cells were not present. While PCR did not detect typical cardiotropic viruses, additional testing for SARS-CoV-2 RNA revealed a positive signal in the myocardium.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2453_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2453_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..742286e9f8b5052cdfee9911d397cebe8915c2d9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2453_en.txt
@@ -0,0 +1,4 @@
+A 44 year old afro-Trinidadian female presented with a two week history of abdominal distension, weight loss, decreased appetite and low grade fever. She had a normal white cell count, a haemoglobin of 9.02 g/dL and a CA125 level of 909 U/ml. Ultrasound scan showed moderate ascites with a septated cystic left adnexal mass . CT scan showed smooth peritoneal thickening . There was no lymphadenopathy or peritoneal or hepatic deposits. Chest CT showed no lung parenchyma lesions. An ascitic tap was negative for malignant cells and a mantoux test was negative. Primary ovarian malignancy was suspected and the patient was referred to the gyne-oncology clinic. One week later her symptoms improved and the CA125 level fell to 303 U/ml. Due to this unexpected result, alternate diagnoses were considered. The patient declined to have a diagnostic laparotomy at this time as her symptoms had resolved. She agreed however to be monitored in the clinic but was counselled on the need for definitive diagnosis due to the possibility of ovarian carcinoma.
+A few months later she developed dyspnoea due to a large right pleural effusion. A chest tube was inserted and the pleural fluid was negative for malignant cells and acid-fast bacilli (AFB). Repeat CT showed multiple subcentimeter nodules as well as a ‘tree in bud’ appearance throughout the lung parenchyma . The ascitic volume decreased but became denser. Bowel loops appeared matted with mesenteric stranding . In view of the radiological findings tuberculosis was strongly suspected in spite of the negative skin and bacteriologic tests.
+The patient then agreed to diagnostic laparotomy (laparoscopy services were not available).
+At laparotomy the peritoneal cavity was difficult to enter with thick adhesions and miliary seedlings . Frozen section facilities were not available however biopsies were taken for tissue diagnosis, leaving the uterus and ovaries intact. Histology revealed caseating granulomas with epithelioid and Langhan’s type giant cells. The Ziehl–Neelsen stain for AFB was negative. PCR testing was unavailable however the patient’s symptoms resolved and the CA125 levels normalized after 2 months of antituberculosis therapy. She is to continue her treatment for a total of 6 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2454_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2454_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1657e59ef57cacd12a12629da978be972e998620
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2454_en.txt
@@ -0,0 +1 @@
+A 12-year-old female has presented to the clinic with the history of early-onset scoliosis and progressive deformity for 6 months. She underwent deformity correction surgery with spinal loop rectangle and sublaminar wires 4 years ago. On examination, patient was decompensating in coronal and sagittal plane. Neurological examination was within normal limits. Standing anteroposterior and lateral radiograph revealed failed implant with progression of deformity. Cobb’s angle was 64° at presentation. The patient underwent implant removal and revision deformity correction surgery with pedicle screw-rod system simultaneously. The patient-specific 3D-printed pedicle screw templates were used for safe pedicle screw placement. These templates are manufactured by 3D printing technology using CAD files but in a sequential manner . In the first step, images were acquired using multidetector computed tomography(CT) scan and a 3D image of patient’s vertebral column was created. Computer software was used to convert digital imaging and communications in medicine (DICOM) images to 3D model of spine. This software was Mimics Innovation Suite®, Materialise, Belgium (Mimics Medical and 3-Matic Medical 11). DICOM data of the patient’s CT scan were imported into Mimics Medical 19. On initial examination of 3D model, it was asserted necessary to separate the vertebral column from the residual implant. This was done initially by segmenting the bone and implant using different respective threshold values. Next, further segmentation was done manually to eliminate the artifacts caused by stainless steel spinal rectangle loop and sublaminar wires. The implant and vertebral column were then imported into 3-Matic Medical 11 software and were used as base data to manufacture pediclelocating guides for each vertebra, using various CAD tools available in the software. Biomedical engineer and surgeon together differentiated metal artifacts and bone defects so as to make templates with maximum bone contact surface possible. The final 3D-printed model of spine and the design of templates are illustrated. These templates were manufactured using polyurethane material. Hence, they could be sterilized and used intraoperatively for creating the tract for appropriate placement of pedicle screws as bony landmarks for putting pedicle screws by free-hand technique were obscured. Placement of pedicle screws was assessed postoperatively on CT scan. illustrates the pre-operative and post-operative radiographs of a patient.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2462_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2462_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2f9e8d5c00b89d9888601e22aeeeec08665f656e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2462_en.txt
@@ -0,0 +1,7 @@
+A 23-year-old American female patient with 2-week history of blistering and drainage from suture sites from recent cosmetic surgery (abdominoplasty, liposuction of abdominal flanks and back, with immediate fat transfer to the gluteal region in the Dominican Republic on 5 March 2020), presented to the emergency department (ED) with severe abdominal pain between low pelvic sutures and umbilicus, preventing her from being able to stand up straight, pruritis and boils on her back from the area of liposuction preventing her from being able to stand up straight. The patient denied fever and chills. Her blood pressure and pulse were 122/78 mmHg and 101 beats per minute, respectively. General appearance showed an overweight female with three linear open wounds along with incision sites: two on the right and one on the left with residual scars, with clear yellow drainage, erythematous and tender area, and areas of burn and dried scabs on back. The patient had no significant past medical history.
+Abdominal examination showed a morbidly obese patient with a non-distended, soft, tender abdomen to palpation around the wound, multiple open draining sinuses along the transverse incisional scar, and the base of openings with healthy granulation tissue. There was no erythema, with no warmth to touch. Respiratory, cardiac, musculoskeletal, and neurological examinations were normal. The patient reported that she was being kept in a “recovery clinic” in the Dominican Republic after the cosmetic operation, and because she complained of severe discomfort from her back drain, the doctor removed the posterior drain. She eventually left the clinic and the Dominican Republic against medical advice and flew back to the USA (11 March 2020).
+After arriving from the Dominican Republic, she treated her back pain with a heating pad, causing a partial-thickness burn. She was then treated at Nassau University Medical Center (NUMC) Burn Clinic for her partial-thickness burns. The patient reported that she had multiple draining sinuses along her transverse abdominal incision, as well as her umbilicus. She had been packing the sinuses by herself at home with gauze, wounds continued to drain, and she completed a course of cefalexin and doxycycline after admission to urgent care. The patient was also seen at Good Samaritan Hospital, which recommended trimethoprim–sulfametoxazole, which the patient did not take. She was treated with oxycodone–acetaminophen 10 mg, acetaminophen 1 g, and clindamycin 900 mg at the emergency department.
+Computed tomography (CT) of abdomen and pelvis was performed and showed a minor fat-containing umbilical hernia, status post-Roux-en-Y gastric bypass, no evidence of afferent limb dilation, no evidence of obstruction, unremarkable appendix and terminal ileum, and reactive bilateral inguinal lymphadenopathy, with the largest node measuring up to approximately 1.5 cm on the left. The CT also showed infiltration of the lower abdominal soft tissues containing an 11.9 × 1.4 × 4.4 cm3 fluid collection compatible with abscess. Several foci of air were noted within the right side of this fluid collection, tracking to a soft tissue defect in the right pyramid line lower abdomen. There was a thickening of the skin and subcutaneous fat-containing globules in the gluteal soft tissues. The urinary bladder was collapsed. The uterus and adnexa were not enlarged.
+A management plan was put in place for the patient after the CT, which included intravenous hydration, clindamycin 600 mg, pain control with oxycodone, follow-up blood cultures, interventional radiology (IR) for image-guided drainage, plastic surgery, and wound consult, and skincare referral. IR procedure was done. A fluid culture was sent to the laboratory, and the sample was also to be tested for acid-fast bacillus (AFB). Blood culture was done and showed no growth after 5 days, the abdominal fluid culture showed no growth after 48 hours, and abdominal fluid AFB showed no growth after 24 hours. After 8 days, the culture showed acid-fast bacilli in the liquid culture medium, and the DNA probe result was negative for M. tuberculosis.
+The management plan at this stage included no clinical indication for the patient to receive antibiotics at this time; the patient was to be discharged with pain medication, proper irrigation and debridement, daily packing, sterile dressing change, and a plastic surgery appointment was scheduled within the following 2 weeks. Laboratory investigations were ordered and noted as white blood cell (WBC) count: 4.28 × 109/L.
+Under real-time ultrasound guidance by IR procedure, access to the fluid collection was obtained with a 19G single-wall needle. Approximately 7 cm3 of cloudy fluid was aspirated and sent for appropriate analysis. After 25 days, the bacterial culture showed M. abscessus complex on 21 June. The patient was prescribed doxycycline for 10 days and azithromycin 500 mg. On 29 June, the left side of the wound almost completely healed, with few open draining tracts on the right side and some minor erythema. The patient was advised to continue on the recommended antibiotics, continue local wound care, and come to the ED for worsening pain, erythema, and drainage from wounds.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2483_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2483_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a3479dae7063cae4dd8fd34adbd64bbae753dabe
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2483_en.txt
@@ -0,0 +1 @@
+A 50-year-old female presented with three years of metatarsophalangeal (MTP) joint pain. She has no family history of RA. She visited our hospital with a chief complaint of foot pain and swelling 3 years ago. Morton's disease was initially suspected. She stopped visiting our hospital because pain did not get better. 3 years after, she was referred from clinic to our hospital because of the foot deformity, subcutaneous hemorrhage, and bone erosion image on the X-ray. On physical examination, she had pain and swelling on MTP joint of forth toe . The MTP joint had 0° of extension and 30° of flexion. Pain on motion was observed at that time. Laboratory tests revealed low levels of inflammatory markers and positive serological markers for RA: C-reactive protein (CRP) was negative, rheumatoid factor (RF) was 29.3 IU/mL, and anti-cyclic citrullinated peptide (ACPA) was 496.6 IU/mL. She scored 6 points according to the 2010 American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) classification criteria and was classified with RA. X-ray showed bone erosion of metatarsal (a and b). MRI showed synovial proliferation and fluid around 3rd and 4th metatarsals (c). Because of difficulties in diagnosis, disease-modifying anti-rheumatic drugs were not administered prior to surgery, only non-steroidal anti-inflammatory drugs were administered, but there was no improvement in pain. She had pain due to lateral dislocation of proximal phalanx of foot and was performed synovectomy for diagnosis and treatment. Enlarged MTP joint capsule was observed (a). Incision through the joint capsule revealed synovial proliferation (b). After synovectomy, we found destruction of articular cartilage and subchondral bone (c). Joint instability due to periarticular tissue destruction was observed, so MTP joint was fixed by using Kirschner-wire (d). On pathological examination, there was infiltration by inflammatory cells including plasma cells with blood vessel proliferation (a and c) and formation of lymphoid follicle (b). CD138 immuno-staining was positive (d). CD138 is a member of the syndecan family of type I transmembrane proteoglycans. CD138 is highly expressed on plasma cells which is characteristic for RA . Pathological findings were consistent with chronic synovitis consistent with rheumatoid arthritis. Surgical wound had healed in two weeks. K-wire was removed one month after surgery, and she could walk with a little pain. The MTP joint had 20° of extension and 40° of flexion postoperatively. Postoperative figure is shown . After that, she was administered methotrexate at 4 mg per week. The pain has been getting better after administering methotrexate. 8 mg per week of methotrexate is still being administered to inhibit the progression of RA.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2508_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2508_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2373f74b1b75e97b763511566c9b344e23eed8de
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2508_en.txt
@@ -0,0 +1,3 @@
+A 50-year-old woman with a 45 pack-year smoking history was referred to our hospital for further investigation of an abnormal left hilar shadow . The patient’s medical history included hypertension, and the patient had previously undergone an appendectomy at the age of 35 years and an abdominal myomectomy at the age of 49 years. The levels of tumor markers were as follows: carcinoembryonic antigen, 2.8 ng/mL; cytokeratin 19 fragment, 1.4 ng/mL; neuron-specific enolase, 21.0 ng/mL; and pro-gastrin-releasing peptide, 84.4 pg/mL.
+Chest contrast-enhanced computed tomography (CT) revealed a 28-mm solid pulmonary nodule in the left lower lobe (S6) and an enlarged left hilar lymph node adjacent to the left main pulmonary artery . 18F-fluorodeoxyglucose (FDG) positron-emission tomography/CT showed increased FDG uptake in the S6 nodule and the hilar lymph node, in which the maximum standard uptake values were 5.3 and 5.0, respectively . CT-guided biopsy of the S6 nodule led to the pathological diagnosis of high-grade neuroendocrine carcinoma. Brain contrast-enhanced magnetic resonance imaging showed no signs of brain metastasis. Thus, the preoperative clinical stage was defined as cT1bN1M0. The patient underwent left lower lobectomy with ND2a-2 lymph node dissection via thoracotomy.
+Pathological investigation revealed a 22 × 18 × 12-mm nodule . Within the tumor, there was a dense sheet-like growth of small tumor cells with scant cytoplasm and finely granular nuclear chromatin . Moreover, there was a sheet-like growth of bizarre, highly pleomorphic mono- or occasionally multinucleated giant cells, accounting for approximately 40% of the tumor . Both the small and giant cell components were thyroid transcription factor 1 (TTF-1)-positive and p40-negative, exhibiting neuroendocrine differentiation, as indicated by positivity for synaptophysin and CD56 and negativity for chromogranin A . While the small cell component was E-cadherin-positive and vimentin-negative, the giant cell component was E-cadherin-negative and vimentin-positive, indicating epithelial-to-mesenchymal transition (EMT) . Only the small cell component was found within the mediastinal and hilar lymph nodes. The final pathological diagnosis was combined SCLC and GC, pT1bN2M0, pStage IIIA. The patient received adjuvant chemotherapy with 4 cycles of cisplatin and irinotecan. No sign of recurrence has been noted for 1 year after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2536_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2536_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7fc17d423fae46fa441a05d8e8c17a32bdc5862b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2536_en.txt
@@ -0,0 +1,7 @@
+A 62-year-old Caucasian man with diabetes presented with low back pain that he had been experiencing for four months.
+An MRI of his pelvis, including his right sacroiliac joint and pelvic floor muscles, revealed osteomyelitis of the pubic symphysis and extensive pelvic osteomyelitis.
+Pus obtained from his right sacroiliac joint, as well as several pieces of his sacrum, grew P. aeruginosa.
+As is usually done in severe infection with Pseudomonas, our patient was given double antibiotic therapy for almost two months. His treatment consisted of two types of antibiotics to which the pathogen was susceptible (seven weeks of intravenous ciprofloxacin and piperacillin and/or tazobactam).
+At present, available data are limited to extensive, life-threatening infections such as in the case of our patient. The literature, however, consists of cases supporting the long-term administration of ciprofloxacin monotherapy in bone infections caused by Pseudomonas after an initial period of combination therapy . Because of the high probability of infection recurrence, our patient continued with high-dose oral ciprofloxacin (1 gram twice a day) for 20 months. Repeat MRIs confirmed a marked improvement of his inflammation, which subsequently led us to stop his antibiotic therapy.
+The quantitative stool cultures of our patient were studied after 20 months of treatment with oral ciprofloxacin. After incubation at 37°C under aerobic and anaerobic conditions for two to five days, qualitative and quantitative analyses of the cultures were performed. The cultures yielded 3 × 106 CFU/mL of Escherichia coli, 107 CFU/mL of Enterococcus faecium, 2 × 104 CFU/mL Staphylococcus epidermidis, 6 × 104 CFU/mL of Corynebacterium group A, 2 × 103 CFU/mL of Bacillus stearothermophilus, 1010 CFU/mL of Bacteroides uniformis, 2 × 109 CFU/mL of Prevotella oralis, 5 × 108 CFU/mL of Prevotella loescheii and 3 × 104 CFU/mL of Candida albicans.
+Susceptibilities of aerobes and anaerobes to antibiotics were performed for five randomly selected colonies of all bacterial isolates using the disk diffusion method recommended by the Clinical and Laboratory Standards Institute (CLSI) . As expected, E. coli was resistant to ciprofloxacin and the rest of the fluoroquinolones tested. The population of E. faecium, meanwhile, was resistant to the fluoroquinolones but sensitive to vancomycin. Repeat stool cultures were taken one month after the discontinuation of our patient's antibiotics treatment, and the same method was performed. There was a marked increase in the Enterobacteriaceae population with E. coli at up to 5 × 108 CFU/mL. The Gram-negative flora was enriched with Klebsiella pneumoniae (5 × 106 CFU/mL) and Enterobacter cloacae (6 × 107 CFU/mL). The susceptibility of E. coli to fluoroquinolones was restored, while K. pneumoniae and E. cloacae were also found to be fully susceptible to fluoroquinolones. A small population of enterococci (E. faecalis 1.5 × 106 CFU/mL and E. avium 2 × 106 CFU/mL) was reported as being intermediately sensitive to the fluoroquinolones but fully sensitive to vancomycin. The yeast population decreased from 3 × 104 CFU/mL to 8 × 103 CFU/mL, while the anaerobic population remained basically unchanged.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_257_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_257_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..95678feff54ca1c957053bca1f3c993fc274f3fb
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_257_en.txt
@@ -0,0 +1,6 @@
+A patient is a 39-year-old man with left limb pain and limited movement caused by a traffic accident for 35 days. Due to the severe abdominal injury caused by a traffic accident, the initial treatment focused on the abdominal trauma. Only tibial tubercle traction was given to the fracture of the lower extremity. The diagnosis of the injured extremity was that: complete transcervical fracture of the left femoral neck (AO/OTA31B2.3, Pauwels III), obsolete segmental fracture of the left femoral shaft (AO/OTA32C2) .
+Due to difficult reduction on complete fracture, open reduction and internal fixation were carried out under general anesthesia in July 2020. The patient was placed in the supine position on the OSI full fluoroscopic traction operation bed. The left tibial tubercle bone traction was connected with the lower limb traction system. The calf was rotated internally to keep the patella perpendicular to the ground, and the femoral shaft and femoral neck fractures were initially reduced by traction. The surface projection of the proximal and distal approach was determined in front of the thigh, the junction area of the isthmus and the non-isthmus of the proximal femoral shaft was taken as the boundary, the line between the anterior superior iliac spine and the lateral edge of the patella was taken as the incision surface projection in the proximal area, and the line between the anterior superior iliac spine and the medial edge of the patella was taken as the incision surface projection in the distal area , . The location of the fracture site was determined by intraoperative C-arm fluoroscopy and marked horizontally on the body surface.
+First of all, the femoral shaft fracture was reduced and fixed. The first step, according to the position of the surface projection of the proximal femoral shaft fracture line (anterolateral approach), a 6 cm longitudinal skin incision (-a) was performed, then open the subcutaneous and deep fascia to expose the rectus femoris, pull the rectus femoris to the medial side and split the vastus intermedius, directly expose the proximal fracture site, which was reduced by Weber forceps under direct vision. Through the anteromedial approach (-b), the medial muscle space of the rectus femoris exposes and splits the vastus intermedius to the distal fracture site and achieves fracture reduction in a similar way as the proximal fracture site. The third step, after the femoral neck fracture was temporarily fixed with two percutaneous Kirschner wires, the Trigen Tan Fan (Simth&Nephew Ltd., Watford, UK) was placed, and the distal locking screws were firstly inserted after the position of the nail. The fracture reduction was confirmed by C-arm fluoroscopy. The next step is to augment the fixation of the non-isthmus region of the distal femoral shaft with two Poller screws to reduce the medullary cavity and decrease the nailing swing.
+After the femoral shaft fracture was fixed, the femoral neck fracture was reduced and fixed. Through the anterior approach of the proximal femur (-c), the fracture site of the femoral neck was exposed, and two cephaloscrews were placed after confirming that the reduction was satisfactory. To counteract the high vertical shear force and compressive stress, the medial anatomical buttress plate (MABP) (ZhengTian Medical Instrument Co. Ltd., Tianjin, China) was used to fix the femoral neck fracture , .
+After all, fractures were fixed, C-arm fluoroscopy confirmed again that the reduction of fractures and the position of internal fixation was satisfactory. Then the incision was closed layer by layer after flushing the incision and placing the drainage tube.
+Due to reliable augmentation fixation for every fracture site, the patient immediately began the functional exercise postoperatively. Then, the patient was reviewed regularly in the outpatient clinic and instructed to increase the practical training intensity gradually. The patients were followed up at 3, 7, and 17 months after the operation; the radiographic follow-up results are shown in , , respectively; the function and quality of life evaluation results are shown in . Three months after the operation, the fracture healed, and he began the entire weight-bearing exercise. Finally, the patient had a good prognosis without complications.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_25_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_25_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f27653fde72750da01fa82c08bd5aad30e53352a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_25_en.txt
@@ -0,0 +1,8 @@
+A 59-year-old man experienced ptosis, diplopia, fibromyalgia, muscle fatigue, and fluctuating limb weakness for 1 year. Worsening weakness in bilateral lower limbs caused walking disability. The patient then came to our outpatient hospital in hopes of regaining muscle power and better walking ability.
+The patient’s symptoms had started 1 year ago with recurrent episodes of weakness in four limbs. His eyelid dropped soon after he woke up and double vision appeared spontaneously. He also required a ventilator to maintain his daily sleeping.
+The patient was initially diagnosed with MG on August 5, 2018, accompanied by severe ptosis, diplopia, and fibromyalgia. He visited a neurologist in a local medical center, who prescribed acetylcholinesterase inhibitor, pyridostigmine (oral: 60 mg/tab, 2 tabs three times daily), for 1 year. Later, the patient was treated with immunosuppressive drugs; namely, rituximab (intravenously: 375 mg/m2, once weekly for 4 wk), and received six courses of IVIG to improve his conditions. However, the severe ptosis, diplopia, and fibromyalgia persisted without any sign of recovery. The patient reported no improvements in the weaknesses of his bilateral lower limbs, which caused walking disability and muscle fatigue, which severely affected his daily life.
+The patient had no significant personal or family history.
+During his visit, the MG activities of daily living scale (MG-ADL scale) total score was 20/24 , while that for the quantitative MG scale (QMG scale) was 32/39 . The patient’s vital signs were within the normal ranges. Repetitive stimulation test at 3 Hz revealed decremental responses (11.8%) in both orbicularis oculi muscles but not in the right abductor pollicis brevis muscle, which suggested the need to consider post-synaptic neuromuscular junctional disorder.
+Laboratory evaluation revealed positivity for acetylcholine receptor antibody (5.97 nmol/L). The blood biochemistry examinations revealed mildly decreased complement C3 (74.8 mg/dL) levels compared to normal values (79–152 mg/dL). The urine analysis showed normal values.
+No abnormalities were noted on electrocardiograms and chest X-rays. Regional cerebral perfusion (rCBF) scans by brain single-photon emission computed tomography (SPECT) were performed 30 min after the intravenous injection of 30.8 mCi Tc-99m ECD. Easy Z-score Imaging System was used for statistical analysis. The first brain SPECT showed decreased rCBF in the frontal regions and anterior cingulate gyri . Magnetic resonance imaging of the chest showed no evidence of a thymic mass.
+The results of the antinuclear autoantibodies (ANA) test were negative. The levels of RA factor (serum) were within normal limits (< 20 IU/mL). The levels in anti-cyclic citrullinated peptide (anti-CCP) screening were also normal (0.6 U/mL). The patient was negative for HLA-B27. Finally, the result of the myositis 16-specific Ag panel was unremarkable.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2607_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2607_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..58664b704ef5e4e778812e1552463be4a6b99da2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2607_en.txt
@@ -0,0 +1,3 @@
+A 71-year-old Chinese man presented with urinary hesitancy, dribbling urination, and prolonged urination and was diagnosed as benign prostatic hyperplasia at out-patient one year ago. The serum creatinine was 101 μmol/L (normal range 53~140 μmol/L) at that moment. He was prescribed with epristeride and tamsulosin. Nine months ago, the patient stopped the oral medication because of loss of appetite. The symptoms of urinary hesitancy, dribbling and prolonged urination worsened gradually and therefore he was admitted to our hospital for surgery. On admission, the renal function test revealed a serum creatinine level of 291.0 μmol/L. The post-void residual was normal. The ultrasonic examination revealed that both kidneys were normal in structure and size (left 11.6 cm × 6.3 cm,right 10.7 cm × 4.4 cm). Obstructive nephropathy was thus excluded and the surgery was canceled for renal dysfunction. The patient was transferred to renal division of internal medicine department where additional tests were performed in order to establish the etiology of his documented renal failure. The results of routine peripheral blood test were as follows: hemoglobin 89 g/L (normal range 130~175 g/L), white blood cells 5.21 × 109/L (normal range 3.5~9.55.21 × 109/L), and platelets 204 × 109/L (normal range 100~300 × 109/L). Urinalysis was positive for 1+ protein. Red blood cells and white blood cells were negative in urine sediment microscopic examination. The 24 h urinary protein determination was 0.67 g. Fecal occult blood testing was positive. In addition, the serum creatinine level increased to 415 μmol/L. The immunology tests revealed the following: anti-nuclear antibody + 1:100, rheumatoid factor 149 IU/ml (normal range < 20 IU/ml), IgG 23 g/L (normal range 8~15.5 g/L), serum IgG4 13.9 g/L (normal range 0.035~1.5 g/L), IgE 288.7 IU/ml (normal range 0.1~150 IU/ml), C3 0.4310 g/L (normal range 0.785~1.520 g/L), C4 0.0362 g/L (normal range 0.145~0.360 g/L). The direct Coomb’s test was negative. The anti-neutrophil cytoplasmic antibodies and anti-glomerular basement membrane antibody were both negative. The abdominal ultrasonography revealed multiple solid nodules in the liver. Magnetic resonance imaging (MRI) confirmed multiple liver parenchymal round shaped long T1 and long T2 signal nodules, with a diameter of between 0.6 and 16 cm. The nodules revealed mild enhancement during arterial enhancement phase with some of them showed a decline of enhancement during portal enhancement period. Since the patient has gastrointestinal symptoms in combination with positive fecal occult blood test and moderate anemia, a gastrointestinal endoscopy was performed and It showed a circular cauliflower shaped, ulcerative mass at the middle section of the transverse colon. Biopsies of the mass revealed adenocarcinoma .
+For evaluation of renal dysfunction, a renal biopsy was performed. The pathological findings in light microscopy demonstrated glomerular sclerosis in two of twelve glomeruli whereas the other glomeruli demonstrated only mild lesions. The periodic acid-silver metheramine and Masson’s trichrome stainings showed 75% interstitial fibrosis and tubular atrophy in the tubulointerstitial area. In the fibrotic interstitial compartment, collagen fibers exhibited a storiform pattern, with massive lymphocyte and plasma cells infiltration. Immunohistochemical staining showed more than 30 IgG4-positive plasma cells per high-power field . Immunofluorescence testing was negative for IgG, IgA, IgM, C3, C4, C1q, κ chain, and λ chains in glomeruli. A diagnosis of IgG4-related tubulointerstitial nephritis (IgG4-TIN) was thus made.
+As previously established, both IgG4-related disease and metastasis of gastrointestinal tumor could cause hepatic occupying lesions. In that sense, liver nodules in the current case could be secondary to either IgG4-related tubulointerstitial nephritis or remote metastasis from colon adenocarcinoma. Prednisone of 1 mg/kg daily was initiated with the objective to treat IgG4-TIN. On the one hand, the treatment might improve renal function, the improvement of renal function would then create better conditions for chemotherapy or surgery of adenocarcinoma treatment. On the other hand, the imaging response of hepatic nodules to glucocorticoid administration might suggest whether the nodules were malignancy or IgG4-related pseudo-tumor. One and a half month later, the serum creatinine had decreased from 415 to 246 μmol/L, and the serum IgG4 level dropped from 13.9 g/L to 5.3 g/L. However, the repeat MRI revealed no diminution of hepatic nodules. A liver biopsy was performed and atypical glands were founded in the specimen . Based on the findings of immunohistochemistry of the specimen and clinical data, a diagnosis of adenocarcinoma with hepatic metastasis was made. Chemotherapy was recommended by the Oncology team although impaired renal function was a contraindication. Prednisone was continued to improve kidney function in order to propitiate conditions for chemotherapy administration. Prednisone was gradually tapered and 14 weeks later, the serum creatinine level was 207 μmol/L and the serum IgG4 level was 1.41 g/L . Unfortunately, five months later, the patient’s general condition deteriorated quickly. The patient suffered from anorexia and poor mental state. During the last follow-up, occurring half-year later, the patient experienced shortness of breath but refused to be admitted and died two days later. The last serum creatinine level tested was 176 μmol/L.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_263_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_263_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1f4731d22720885f662900ede38345193d205b96
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_263_en.txt
@@ -0,0 +1,6 @@
+A 64-year-old woman was admitted to the hematology department of our hospital in August 2019 with pancytopenia complicated by headache.
+The patient had recurrent pancytopenia for half a year. The symptom of headache had lasted for 4 d.
+The patient presented with a 3-mo history of lumbar pain and was finally diagnosed with solitary bone plasmacytoma a year ago. She had received only radiotherapy, at a dose of 45 Gy, 22 times. She was first admitted to the hospital in February 2019 due to persistent pancytopenia. The initial complete blood count (CBC) showed a hemoglobin (HB) level of 96 g/L, white blood cell count (WBC) of 2.5 × 109/L, and platelet (PLT) count of 38 × 109/L. Immunofixation electrophoresis showed that the M component was an IgG-kappa light chain. On bone marrow (BM) aspiration, 0.13% of monoclonal plasma cells were observed by flow cytometry (FCM). Biopsy revealed hypoplastic marrow without megakaryocytes. No bone lesion other than primary local lumbar injury was observed in a series of X-ray scans. The patient was diagnosed with SBP with minimal marrow involvement, according to the diagnostic criteria for plasma cell dyscrasia, with concomitant myelosuppression. She underwent treatment with thalidomide, granulocyte colony stimulating factor (G-CSF), and thrombopoietin (TPO), blood transfusion, and other supportive treatments. Peripheral blood was significantly improved after 3 mo of treatment and almost restored to normal.
+On admission, the patient was lucid and slurred in speech. The skin mucous membrane of the whole body had scattered haemorrhage spots. Limb activity was normal, and nervous system examination showed no abnormality.
+The CBC revealed pancytopenia (HB 70 g/L, WBC 3.0 × 109/L, and PLT 38 × 109/L). A peripheral blood smear showed 16% of abnormal promyelocytes with dendritic protrusions . Thrombin function test showed that prothrombin and partial thromboplastin times were prolonged, fibrinogen was decreased, and the D-dimers were elevated to 4.5 μg/mL. BM examination was conducted, followed by cytogenetic and molecular analyses using BM specimens. The BM aspirate showed 90% of abnormal promyelocytes with densely packed large granules , which on flow cytometric immunophenotyping expressed CD13, CD33, CD117, CD56, CD81, and myeloperoxidase; partially expressed CD38 and CD34; and slightly expressed CD15, CD11b, and CD16 HLA-DR . Chromosome analysis using a BM sample revealed a karyotype of 46,XX,t(15;17)(q22;q21) in 20 metaphase cells examined . Reverse transcription-PCR (RT-PCR) analyses confirmed the presence of S-form PML/RARα gene rearrangement. The FLT3-ITD gene mutation was detected by Sanger sequencing . Plasma cells were not detected. A monoclonal peak was continuously observed on serum IFE, showing IgG and kappa-type monoclonal gammopathy.
+The patient was married and had two daughters and one son. No additional family history was obtained.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2669_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2669_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f24565349a48c29b812bba9dc3cbcf8a4599d484
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2669_en.txt
@@ -0,0 +1,6 @@
+A 28-year-old Caucasian woman consulted her gynecologist with pain in the right fossa at a gestational age of 15 weeks. Her medical history was straightforward. She smoked 10 cigarettes per day for more than 10 years. Sonographic examination suggested an appendicular plastron and was interpreted as an ovarian mass. Subsequently, a laparoscopy was performed in a district hospital. Due to the pregnancy and the adhesions the view was incomplete (the uterus and ovaries could not clearly be identified) but peritoneal spread of malignant plaques was evident. Microscopic examination of the peritoneal lesions showed a solid, fat-infiltrating mass, composed of cancerous cells with storiform growth pattern. Cancer cells have a spindle form containing a moderate quantity of eosinofilic cytoplasm and a polymorph vesicular nucleus, sometimes containing a prominent nucleolus. More than 10 mitotic figures per 10 high-power fields were present, including abnormal mitotic figures. This morphology corresponds to a high grade sarcoma. Immunohistochemistry was performed and the tumor cells revealed the following immunophenotype: desmin (-), alpha SMA (+++), CK7 (+), CK20 (-), CD117/C-Kit (-), S100 (-), CD34 (-), C125 (-), EMA (-), CD10 (diffuse +++), calretinine (-), CK 5.6 (-), MDM 2 (-), ER (-), PR (-). The positive staining for CD10 and alpha-smooth muscle actin (alpha-SMA) in the absence of desmin expression may be indicative for a sarcoma of endometrial stromal origin.
+Chromosome preparations from the tumor specimen were obtained using standard primary culture procedures. For diagnostic purposes the karyotype was determined:
+66-71<3N>,XXX,+X,-1,der(2)t(1;2)(p35;q37)),-7,+11,-13,-14,der(14;15)(q10;q10),-15,-16,+17,der(18)t(7;18)(q11;q23),+20,+21,+21 [cp17]. Hence, the tumor karyotype was not specific for any known translocation-related or other sarcomas.
+In order to exclude the possibility of KIT-immunonegative gastrointestinal stromal tumor, mutational analyses were performed using a combination of polymerase chain reaction (PCR) amplification, denaturing high-performance liquid chromatography (D-HPLC) pre-screening, and bi-directional sequencing, as described previously . Tumor specimen showed wild-type genotype for exons 9, 11, 13, 17 of the KIT or exons 12, 14 and 18 of PDGFRA genes. Thus, the mutational analysis was not indicative for any particular sarcoma. Therefore, the final diagnosis was most suggestive for high-grade ESS.
+Subsequently, she was transferred to our hospital. Magnetic resonance imaging showed diffuse peritoneal and omental tumoral implants, spreading along the visceral surfaces of the small bowel and large bowel, without a definable primary mass . Also a moderate amount of ascites was present. There were no signs of hepatic and lymph node metastasis. Computer tomography of the lungs excluded metastasis.
+We discussed the diagnosis of a high-grade ESS with transperitoneal spread, but without distant metastasis, with the patient and her husband. Psychological support was provided. We explained that the situation was life threatening for both the mother and fetus. Given the young age of the patient and expected limited response to chemotherapy, we opted for a maximal surgical effort during cytoreductive surgery. If this had been a case of a significant cytoreduction, we would have considered anthracyclin based chemotherapy, even in the presence of an ongoing pregnancy. We agreed that if the maternal situation seemed prospectless, termination of pregnancy should be performed. In which case, hysterotomy would appear to be a better solution when compared to induction and labor. At midline laparotomy, the tumor was diffusely spread throughout the pelvis and upper abdomen. The disease at the level of the peritoneum was infiltrating the sub-peritoneal fat and this infiltration was responsible for the pain at the right fossa. The uterine serosa was diffusely involved . The small and large bowel and the omentum contained diffuse and multiple tumoral plaques. Given the diffuse and sometimes deep infiltration of both the peritoneum and intestines, she was considered inoperable. A hysterotomy was performed, leaving the uterus in situ. The placenta was macroscopically and microscopically normal. Three days later, intestinal obstruction was diagnosed. We agreed that chemotherapy was not likely to be a clinical benefit for a high-grade sarcoma causing intestinal obstruction whereas the potential for sepsis was considerable. Symptomatic treatment was initiated. She died at home six weeks after diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2684_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2684_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4daa8ba9e0d7305533548dd294e41ee4d1b1ef89
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2684_en.txt
@@ -0,0 +1,4 @@
+Our patient is a 40-year-old P1332 who presented for prenatal care with dating ultrasound confirming viable intrauterine pregnancy at 6.5 weeks. Her medical history was notable for type 2 diabetes, chronic hypertension, severe preeclampsia, and intrauterine fetal demise in a previous pregnancy. She received routine prenatal care and was started on medication for her co-morbidities. First trimester cfDNA resulted “low risk” for fetal trisomies though was “no call,” or unable to ascertain the risk for monosomy X or sex chromosome aneuploidy. Targeted anatomy ultrasound at 22 weeks revealed a singleton fetus with normal anatomy, a normal fetal echocardiogram, and a normal appearing anterior placenta. Additional images showed a 12 cm by 7 cm area of multi-cystic placental tissue in the uterine fundus concerning for possible molar tissue versus placental mesenchymal dysplasia.
+Repeat cfDNA testing, using single nucleotide polymorphism-based next-generation sequencing, reported results consistent with a possible triploid, vanishing twin, or unrecognized multiple gestation. The report also noted suspected complete uniparental disomy, which is most consistent with a molar pregnancy. She received genetic counseling and declined amniocentesis for diagnostic testing.
+She was asymptomatic and had normal vital signs. Labs were notable for a significantly elevated hCG over 250,000, subclinical hyperthyroidism, and normal hepatic function. Chest x-ray was negative for metastatic disease. She was counseled by a multidisciplinary team including Maternal Fetal Medicine (MFM) and Gynecologic Oncology regarding expectant management versus uterine evacuation. Despite the serious health risks posed by continuation of her pregnancy, pregnancy termination was not available in her state as her gestational age at the time of diagnosis was greater than the gestational age ban limit of 20 weeks post conception. Counseling did include the ability to explore termination care in other states with later gestational age limits, though given the legal restrictions in place she could not be directly referred or transferred if she desired termination care . Her options were further limited by the additional barriers of out-of-pocket costs for the procedure, travel, lodging, and childcare. She elected to proceed with expectant management and was co-managed by MFM and Gynecologic Oncology. Delivery was scheduled for no later than 32 weeks after consensus conference, but she ultimately developed severe preeclampsia at 31 weeks necessitating delivery. Following counseling, the patient desired to proceed with cesarean hysterectomy given she did not desire future fertility and she was counseled about a decreased risk of post-molar conversion to GTN following hysterectomy compared to uterine evacuation. Her case was uncomplicated with total EBL 1300 cc. Other than blood pressure elevations in the setting of severe preeclampsia, her post-operative course was uncomplicated and she discharged home on post-operative day four. APGARs were 1, 6, and 8, and the neonatal course was complicated by prematurity and respiratory distress requiring a 19-day NICU stay.
+Histology revealed an intact unremarkable placental disc loosely adherent to the posterior uterine wall, together with a tan-pink, spongy cystic mass densely adherent to the right uterine wall measuring 13.5 cm by 7.7 cm by 2.6 cm (A). Sections of tissue demonstrate a tan friable cut surface with focal myometrial invasion (B). Hematoxylin and eosin slides show a complete hydatidiform mole displaying intrauterine implantation with focal extension of a molar villous into the superficial myometrium, which is diagnostic of invasive hydatidiform mole (A and 2B). There was complete absence of immunohistochemical staining for p57 in the molar villi and hyperplastic trophoblast, which confirmed the diagnosis of complete hydatidiform mole (C). Additionally, there is a distinct interface identified without invasion into the normal placental disc (D). Based on her WHO score and FIGO stage 1 disease she was low risk for recurrence or progression and was followed with serial hCGs. Her hCG nadir was 8.0 before rising two months after delivery, consistent with post-molar GTN. She has since finished 4 cycles of single agent Actinomycin D, receiving 3 cycles of chemotherapy past a negative hCG. She is now 8 months from treatment with no evidence of disease by exam and serially negative hCG testing.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2688_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2688_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..4486286e30270a2b6560f5e70785d58b6cc6630d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2688_en.txt
@@ -0,0 +1,3 @@
+A 22-year-old man presented to the emergency department at the general hospital no 58 (IMSS León Guanajuato México) after being stabbed once with an ice pick in the chest during a bar fight. On arrival, the patient was unstable with a blood pressure of 90/50 mmHg, no paradoxical pulse was noticed, heart rate was 110 beats/min, and respiratory rate was 28 breaths/min. The physical examination was notable for one penetrating stab wound, the object was not in situ, the entry site was a tiny hole in the fifth intercostal space to the left of the sternum, and there was a left pleural effusion syndrome and a holo-systolic murmur at the heart apex. The X-ray confirmed the haemothorax, and 3D transthoracic echocardiography showed an LV ejection fraction of 60%, a VSD located at the apex with a diameter measured around 6 × 8 mm, and no signs of tamponade or free wall of the right ventricle rupture (, , and ). A left chest tube was placed draining 700 mL of blood, and no transfusion was required. The patient was transferred to UMAE T1 Bajío Hospital (third-level centre) for treatment of the VSD. There was a discussion with the heart team and the patient. Because there was only one central defect with good rims and the patient rejected surgery, it was decided to perform percutaneous closure.
+The procedure was performed under general anaesthesia and transthoracic echocardiography guidance. Right femoral arterial access and right internal jugular venous access were obtained. We considered no need to perform coronary angiography. Right and left heart haemodynamics demonstrated mild pulmonary hypertension and a QP:QS >1.5. A left ventricular angiogram shows an apical 10 mm VSD (, ). From the right femoral sheath, a 5F JR3.5 catheter was advanced into the left ventricle (LV). A 0.035″×260 cm glidewire was used to cross the VSD to the left pulmonary artery. A 20 mm Ensnare was used to snare and externalize the wire through the jugular sheath . We used the arteriovenous loop to introduce the 8 Fr TorqVue delivery sheath and placed it into the LV. The VSD was sealed by deploying an Amplatzer 14 mm muscular VSD occlude (St Jude Medical, St. Paul, MN) (, ).
+Transthoracic echocardiography performed on the third day after the procedure showed the excellent location of the device with a trace of flow through the mesh in colour Doppler imaging. The patient was discharged on the fifth postoperative day. After 6 months, the echo Doppler shows no residual shunt, normal pulmonary artery pressure, and normal biventricular function ( and , ). The patient remains asymptomatic.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2700_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2700_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..293b3765bb6ed1b1372e1a7867830f3908fc47dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2700_en.txt
@@ -0,0 +1,10 @@
+A 19-year-old Iranian male of Caucasian ethnicity sought treatment at a tertiary centre specializing in cardiovascular diseases. The patient’s chief complaint was dyspnoea on exertion, which he had been experiencing for the past 2 months. His condition corresponded to New York Heart Association functional Class II (NYHA Class II).
+The patient denied any additional symptoms. His medical history revealed a diagnosis of hypothyroidism, and he reported no known genetic or congenital disorders in his parents. During the initial physical examination, the patient exhibited short stature (height: 135 cm and weight: 53 kg), but his blood pressure, heart rate, oxygen saturation, and body temperature were within the normal range.
+Upon auscultation, a characteristic murmur consistent with aortic stenosis was detected. The murmur was described as high-pitched, crescendo–decrescendo in nature, and exhibited a mid-systolic ejection pattern. It was graded as III/VI and best heard at the heart base. Additionally, a Grade IV/VI holosystolic (pansystolic) murmur was noted, audible at the apex with the diaphragm of the stethoscope, particularly when the patient assumed the left lateral decubitus position. This finding was suggestive of mitral regurgitation (MR). Symmetrical pulses were observed in both the upper and lower limbs, and a palpable spleen was detected ∼4 cm below the costal margin. No other significant abnormalities were identified during the examination. The patient was on a regular daily dosage of levothyroxine (0.1 mg).
+At the time of presentation, the electrocardiogram (ECG) exhibited changes indicative of left ventricular hypertrophy (LVH) .
+The patient underwent trans-thoracic echocardiography (TTE) initially, and subsequently, trans-oesophageal echocardiography (TEE) was performed due to abnormal findings observed in the TTE ( and ). Trans-thoracic echocardiography and the complementary TEE examinations revealed a LV ejection fraction of ∼65% and moderate LVH. Furthermore, the AV was observed to be thickened with severe calcification of the AV cusps, resulting in severe AV stenosis. The maximum velocity (Vmax) across the AV was measured at 5.6 m/s, and the AV area was determined to be 0.84 cm2.
+The severe calcification observed in the proximal region of the under-developed ascending aorta and aortic arch led to the presence of severe supra-valvular aortic stenosis. Additionally, the calcification extended to the aortomitral continuity and anterior MV leaflet, resulting in moderate mitral stenosis and severe degenerative MR. The echocardiographic findings indicated a mean gradient across the MV of 10 mmHg, a vena contracta of 7.4 mm, a regurgitant volume of 84 mL/beat, and an effective regurgitant orifice area (EROA) of 0.43 cm2. It is noteworthy that the patient’s heart rate during the echocardiographic examination for the assessment of the MV gradient was recorded as 82 b.p.m. The initial laboratory investigations revealed normal results, except for thrombocytopaenia, with a platelet count of 62 000 × 103/µL (150 000–450 000 × 103/µL). Thyroid function tests were within normal limits. Microscopic examination of the peripheral blood smear showed thrombocytopaenia, along with a few foci of platelet aggregation. The red blood cell count and white blood cell count appeared normal, both in terms of count and morphology.
+Abdominal ultrasound revealed an abnormal finding of splenomegaly, with a span measuring 180 mm. Further imaging with multi-detector computed tomography (CT) of the aorta, cervical, and cerebral arteries confirmed the previously visualized findings from the echocardiography examination (see , ). It was observed that the aortic arch and descending aorta also exhibited hypoplasia, similar to the under-developed ascending aorta with an average diameter of 15 mm. The assessment of the patient’s cardiovascular system included the examination of the aortic arch branches, abdominal aorta, and its branches, as well as the cervical and cerebral arteries. These blood vessels were found to be patent and exhibited a normal anatomical structure. Additionally, the coronary CT angiography (CTA) scan indicated a normal course and no significant luminal stenosis in the coronary arteries. However, it was noted that there was calcification present in the left circumflex artery.
+Considering the extensive cardiovascular involvement in the patient and the scarcity of similar cases documented in the literature, a heart team was convened. After careful deliberation, it was decided that surgical intervention was necessary due to the worsening dyspnoea experienced by the patient. Prior to the open-heart surgery, a bone marrow aspiration and biopsy were performed. The results of the bone marrow biopsy and aspiration revealed the presence of clusters of eosinophilic histiocytes exhibiting a fibrillar or striated appearance and characterized by thin nuclei. These findings were consistent with Gaucher cells, indicative of GD .
+The patient underwent surgery, which the Bentall procedure was performed by the surgeon using a mechanical composite St-Jude #21 valve. Additionally, MV replacement was carried out using a mechanical St-Jude #27 valve. Septal myectomy was also performed, due to the high LV outflow tract pressure gradient (LVOT PG) and high LV end-diastolic pressure. Following the operation, a post-operative echocardiography examination revealed preserved LV systolic function, as well as well-functioning prosthetic valves in both the AV and MV. The echocardiogram also indicated good leaflet motion and acceptable gradients across the prosthetic valves.
+Upon discharge, the patient has prescribed warfarin, aspirin 80 mg daily, and bisoprolol 1.25 mg daily as part of their post-operative management. However, 1 month after the surgery, the patient contracted a COVID-19 infection. Fortunately, they recovered after receiving a course of intravenous glucocorticoid therapy. During the follow-up visits at 1, 3, and 6 months, the patient’s symptoms improved, and they were in good overall condition. It is important to note that the patient underwent enzyme replacement therapy with imiglucerase (Cerezyme) at a monthly dosage of 1200 units. As a result of this treatment, the patient’s platelet count remained within the range of 100 000–130 000 × 103/µL. Therefore, splenectomy was not deemed necessary in this case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2711_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2711_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a37e625da9079eb1a271cb9d8704e3b2689e8b7a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2711_en.txt
@@ -0,0 +1,5 @@
+A 51-year-old unemployed, married Japanese woman was admitted to our hospital to determine the aetiology of pericardial effusion. At 8 years of age, she had complained of pain in the extremities induced by fever and exercise. At 15 years of age, she had been diagnosed with FD on the basis of reduced α-galactosidase A activity (15.4 nmol/mg protein/h; reference range, 31–47 nmol/mg protein/h) and the presence of inclusion bodies in the peroneal nerve. Subsequently, a 3 bp deletion (GAG) at position c.1072 of the α-galactosidase A gene was identified as the mutation site. Her father died of anaphylactic shock due to injection when he was aged 28 years, and her mother’s α-galactosidase A activity was 37.3 nmol/mg protein/h at diagnosis. No relatives had the same diagnosis or any medical history that could be suspected as FD (, pedigree chart). She was not followed up between the ages of 15 and 42 years. At 42 years of age, she complained of palpitations and chest discomfort. Transthoracic echocardiogram revealed cardiac involvement with hypertrophic cardiomyopathy. At 44 years of age, she was started on 0.2 mg/kg agalsidase alfa therapy administered every 2 weeks without additional drugs. However, LV concentric hypertrophy progressed and plasma brain natriuretic peptide (BNP) levels continued to increase over a period of 7 years.
+At 51 years of age, she experienced shortness of breath at rest and during sleep, accompanied by a weight gain of 3 kg in 2 months. She received 20 mg/day of furosemide orally once-a-day for a month at an outpatient clinic. However, we discontinued its administration before the admission day because it did not affect the severity of pericardial effusion despite the 3-kg reduction in body weight as shown below. She had been receiving ERT regularly until the time of admission. Her blood pressure, heart rate, and respiratory rate were 128/70 mmHg, 60 beats/min, and 14 breaths/min, respectively. Her heart sounds were normal and systolic murmurs were audible at the 5th left sternal border. Chest X-ray revealed an increased cardiothoracic ratio compared with that 1 year prior . Twelve-lead electrocardiogram showed T-wave inversions in leads I, II, aVL, aVF, and V3–6 and a high voltage in the precordial leads . Protein (1+) was detected in urine, and blood test results showed increased levels of cardiac troponin-T (0.24 ng/mL; cut-off, 0.1 ng/mL) and BNP (66.1 pg/mL; cut-off, 18.4 pg/mL). Her C-reactive protein (CRP) level was 0.06 mg/dL (cut-off, 0.14 mg/dL).
+Transthoracic echocardiography revealed 65% LV ejection fraction without abnormal regional wall motion. Additionally, previously unrecognized pericardial effusion was noted . Cardiac cine magnetic resonance imaging revealed diffuse LV hypertrophy with circumferential pericardial effusion and increased signal intensity on non-enhanced T2-weighted imaging and late gadolinium enhancement . These findings suggested potential myocardial damage with oedema/inflammation and fibrosis in the anterior and lateral walls. A cardiac catheterization study revealed the presence of a 27 mmHg pressure gradient at the mid-LV cavity; however, other intracardiac pressures, i.e. pulmonary artery wedge pressure, pulmonary artery pressure, right ventricular pressure, and right atrial pressure and cardiac output values were within normal ranges. Endomyocardial biopsy specimens demonstrated vacuolated myocytes mixed with normal myocytes , cytoplasmic granular inclusions , laminated inclusion bodies , infiltration of macrophages , T lymphocytes , and interstitial fibrosis .
+summarizes the changes in the plasma levels of lyso-Gb3, tumour necrosis factor (TNF)-α, interleukin (IL)-6, IL-18, and high-sensitivity (hs)-CRP proportional to the changes in LV mass over the 7-year period of agalsidase alfa therapy. The lyso-Gb3 level, which initially decreased from 19 to 13 nmol/L [reference range, 0.37 ± 0.11 nmol/L (mean ± standard deviation, SD)] over the first 2 years, increased thereafter in proportion with increasing LV mass [reference range, 93 ± 16 g/m2 (mean ± SD)] . The levels of TNF-α (reference range, 0.75–1.66 pg/mL), IL-6 (cut-off, 4 pg/mL), and hs-CRP (cut-off, 1500 ng/mL) remained within the normal range . The IL-18 levels [reference range, 126 ± 44.5 pg/mL (mean ± SD)] increased despite ERT . Echocardiography-guided pericardiocentesis was performed to drain 700 mL of pericardial fluid to relieve her symptoms and obtain the sample. Pericardial fluid analysis conducted at 7 years and 3 months since ERT revealed the presence of exudate. Cytological examination was negative for malignant cells, and bacterial cultures were negative for infection. However, lyso-Gb3 (14 nmol/L), IL-18 (135 pg/mL), TNF-α (1.19 pg/mL), and hs-CRP (343 ng/mL) were detected in the pericardial fluid. The level of IL-6 was higher (885 pg/mL) in the pericardial fluid than in plasma (2.3 pg/mL; ).
+She started receiving 1.25 mg of bisoprolol once-a-day from the day of discharge. The pericardial fluid persists to date, as observed at every 6-month examination; however, anti-inflammatory drugs were not administered because the patient was asymptomatic and her hs-CRP level was within the normal range. The pericardial effusion disappeared spontaneously 1.5 years after pericardiocentesis. She continues to receive ERT to date.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2733_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2733_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..155c0582cd503db5e83a79589b28f97eb7046414
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2733_en.txt
@@ -0,0 +1,11 @@
+A 40-year-old European woman presented with a 1-year history of a palpable anterior neck mass. Physical examination revealed a 1 × 1 cm indurated mass in the right thyroid lobe without palpable lymphadenopathy. Fine-needle aspiration confirmed a papillary thyroid carcinoma. She underwent a total thyroidectomy with cervico-central and cervico-lateral lymphadenectomy. Intraoperative histopathological examination revealed a bilateral papillary carcinoma pT1 pN1b. Laryngeal nerves and thoracic duct were identified and not harmed, and administration of cream via gastric tube showed no leakage. Two suction drains were left behind.
+On the second postoperative day, the patient complained of dyspnoea and chest discomfort. In absence of neck swelling or suggestive fluid in her drains, a computed tomography of the chest for suspected pulmonary embolism was performed. Massive bilateral pleural effusions were detected; bilateral thoracic drainages were inserted and about 2 L of milky white fluid with a triglyceride level of 17 mmol/L were evacuated. Total parenteral nutrition with total enteral rest and octreotide were initiated. The output of both pleural drains was over 2 L a day. The patient was re-operated on post-operative day (pod) 4 due to the persisting thoracic discharge of over 2 L a day. Again, no chyle leak or injury to the thoracic duct was found. The thoracic duct was ligated. This resulted in a dramatic decrease in the drain output. The thoracic drains were removed on pod 9 and a regular diet was started again. The patient was discharged on pod 11.
+The thoracic duct arises from the cisterna chyli at the level of the second lumbar vertebra. It enters at the base of the neck and curves to the left to cross the scalene anterior muscle and the thyrocervical trunk. From here it enters the internal jugular, left subclavian, left external jugular or right jugular vein with a high variability . Injury to the duct usually occurs with thorough dissection of lymphatic tissue in this region. It is commonly recognized by milky effusion in the drain.
+Chylothorax in absence of direct injury to the thoracic duct and therefore without chylous effusion however is rare. Bilateral chylothorax is even more uncommon. The pathophysiology is not completely understood; two pathologic mechanisms are discussed in the literature. First, direct leakage of the thoracic duct with subsequent drainage into the mediastinum leads to an inflammatory reaction that causes effusion to both thoracic cavities. Even though in this case no obvious injury to the thoracic duct was found intraoperatively, there has been reports of a few cases in which the suction drains in the thyroid cavity drained chyle. This has been thought to be an indirect sign of injury to the cervical lymphatic vessels.
+The second pathologic mechanism is thought to be the inadvertent ligation of the thoracic duct which leads to a rise of the intraductal pressure intrathoracically. This rising pressure and in combination with the negative intrapleural pressure generated during inspiration is thought to be severe enough to result in the rupture of the thoracic duct. In our case study, we were not able to identify any injury to the large lymphatic vessels. In both initial and in the revision procedure, cream was administered and the thoracic duct was inspected. Furthermore, the thoracic duct was only ligated in the revision operation. Therefore, exact pathophysiology of chylothorax in our case study remains unknown.
+Management of chylothorax is mostly conservative and is focused on decreasing the amount of chyle production and preventing concurrent nutritional, immunologic and cardiopulmonary complications.
+The first measure is to drain the bilateral effusions by inserting chest tubes to relieve respiratory and circulatory distress. Diet comprising of middle chain fatty acids or even total parenteral nutrition without oral intake is recommended.
+Administration of octreotide to reduce thoracic duct flow remains controversial .
+Operative treatment is recommended for chyle leaks of more than 1 L per day persisting for more than 5 days or chylothorax remaining longer than 4 weeks, or in a case which results in severe metabolic complications.
+However, some surgeons prefer early operative intervention to reduce hospital stay and morbidity secondary to long time nutritional restriction and drainage tubes . Due to the paucity of cases, definitive treatment guidelines are still lacking.
+Another aspect is the delay in treatment. This is particularly significant in oncologic patients where lymphadenectomies are being performed. In our patient, a computed chest tomography was performed due to a high clinical suspicion of a pulmonary embolic event. Due to iodide exposition, radioiodine therapy followed with a delay of 4 weeks.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2735_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2735_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c5a8f818052a5332f9e8bd66ced77a7c9c5e5de4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2735_en.txt
@@ -0,0 +1,9 @@
+A 41-year-old man (height 171.5 cm, body weight 67 kg) was transferred to the regional medical center due to right hemiplegia and aphagia. Cerebral magnetic resonance imaging revealed cerebral infarction caused by occlusion of the left middle cerebral artery, while cerebral magnetic resonance angiography showed the development of a network of abnormal collateral vessels. Hence, the patient was diagnosed with MMD.
+Before cerebral revascularization surgery, severe MR (III/IV) due to the prolapse of the P2 leaflet in the mitral valve was indicated by transthoracic echocardiography. Cardiac catheterization indicated elevated pulmonary arterial pressure (PAP) (systolic/diastolic/mean: 86/33/60 mmHg) and pulmonary capillary wedge pressure (32 mmHg) at the systemic arterial pressure of 120/83/102 mmHg. Hence, the patient was admitted to our university center for the surgical treatment of MR.
+Preoperative single-photon emission computed tomography revealed reduced cerebral blood flow in the left cerebral hemisphere (especially in the external left frontal cortex; Fig. ). Neurosurgeons at our center judged that the patient did not have an indication for cerebral revascularization surgery, which is used to prevent ischemic complications during the perioperative period of mitral valve plasty. This was because his left frontal lobe showed extensive cerebral infarction and no cerebral infarction symptoms were observed in the right cerebral hemisphere. Therefore, mitral valve plasty without cerebral revascularization was chosen.
+In the operation room, the patient’s monitoring of electrocardiogram, oxygen saturation, systemic arterial pressure via right radial artery catheter, bispectral index, and regional cerebral oxygen saturation (rSO2) at the right and left forehead (INVOS™ 5100C, Somanetics, USA) was initiated before the administration of general anesthesia. The rSO2 values for the left and right forehead were 72 and 81 %, respectively.
+General anesthesia was induced by intravenous administration of 3 mg of midazolam, 0.4 mg of fentanyl, and 50 mg of rocuronium. After tracheal intubation, a transesophageal echocardiography (TEE) probe was inserted. Then, a central venous catheter and right heart catheter were inserted via the right internal jugular vein, and central venous pressure, PAP, cardiac output, and mixed venous oxygen saturation were measured. The nasopharyngeal temperature and urinary bladder temperature were also measured.
+Before CPB, general anesthesia was maintained by inhalation of sevoflurane (1–1.5 % of end-tidal concentration). The patient’s PaCO2 was maintained between 38 and 42 mmHg. Intra-aortic balloon pumping (IABP) was placed at the start of surgery and the augmented pressure was maintained. The mean arterial pressure was constantly above 70 mmHg. Before CPB, rSO2 values were almost above 80 % on both sides .
+During CPB, administration of sevoflurane via the oxygenator was also continued because of its cerebrovascular dilatation activity and potential preconditioning effect against focal cerebral ischemia. PaCO2 was maintained between 45 and 50 mmHg, and alpha-stat management of pH was performed. Hypothermia was induced; the temperature at the bottom of the nasopharyngeal temprature was 28 °C. We used pulsatile perfusion assist to maintain cerebral circulation during CPB with IABP. A decrease in rSO2 was observed 162 min after the initiation of CPB. Our perfusionist increased the CPB pump flow from 2.2 L/min/m2 to 2.8 L/min/m2 in order to increase cerebral blood flow. Moreover, the concentration of sevoflurane was increased to 2 %. Yet, rSO2 desaturation (15 % reduction from baseline) was not improved. We decided to increase the depth-of-anesthesia with another dose of midazolam. After administration of 3 mg of midazolam, the rSO2 values increased from 67 to 73 % on the right side and from 71 to 74 % on the left side. During CPB, the lowest values (and variation) of rSO2 in the left and right forehead were 71 % (−2 %) and 67 % (−17 %), respectively. Mitral valve plasty was performed as planned.
+At the weaning from the CPB, the disappearance of MR was confirmed by TEE; the weaning was not difficult. Pulmonary hypertension also improved (PAP was 26/12 mmHg, while systemic arterial pressure was 105/56 mmHg). After CPB, inhalation of sevoflurane (1–1.5 % of end-tidal concentration) was also continued. The rSO2 values were almost above 75 % on both sides and not below the awake rSO2 values . CPB and aortic cross-clamping lasted 352 min and 289 min, respectively. On the completion of the surgery, the IABP was discontinued and sevoflurane administration was stopped. The patient was transferred to the intensive care unit with ventilator support under propofol sedation.
+On the 1st postoperative day (POD), the patient was weaned from the ventilator, and the patient did not complain about any new neurological deficits. We monitored the rSO2 of his forehead until the 2nd POD and no significant decrease (−20 %) of the rSO2 values was confirmed. The postoperative course was uneventful. On the 15th POD, single-photon emission computed tomography revealed that the low cerebral blood flow lesions had not changed , and the patient was discharged from our hospital on the 16th POD.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2748_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2748_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..18ec834159c58d363b748f791f91bf213272f25d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2748_en.txt
@@ -0,0 +1,4 @@
+A 42-year-old white man without pre-existing comorbidities was transferred to our unit on 8 September 2014. He was involved in a car crash on 30 August 2014 with traumatic hemorrhagic shock and an ISS of 28. Shock resuscitation according to Advanced Trauma Life Support (ATLS) guidelines and massive transfusion policy were immediately started . Upon hemodynamic stabilization, a total body computed tomography (CT) scan confirmed unstable pelvic fractures and right flank mesenteric bleeding, without clear evidence of intestinal perforation. Damage control surgery of his pelvic fractures was performed by positioning external fixators [, ]. Transfer to our unit was then planned for definitive osteosynthesis.
+On arrival he had fever and profuse diarrhea, leukocytosis, normal procalcitonin (PCT), elevated C-reactive protein (CRP), lactate 0.9 mmol/L, an Acute Physiology and Chronic Health Evaluation (APACHE) II score of 11, and a Sequential Organ Failure Assessment (SOFA) score of 3; his Predisposition, Infection, Response, and Organ Dysfunction (PIRO) score was 5 . He wore a tracheostomy and was mechanically ventilated on analgosedation; he was left on parenteral nutrition and a minimal enteral feeding was started.
+Chest X-rays detected a right basal infiltrate. Orthopedic surgery was postponed. After thorough microbiological sampling, immune chromatography for Clostridium difficile was negative, rectal swabs grew MDR Acinetobacter baumannii, whereas blood cultures yielded coagulase-negative staphylococci. His antibiotic therapy was modified as described here and in Table . As external fixators poured purulent secretions, on day 15 he underwent definitive pelvic osteosynthesis in spite of persistent fever and diarrhea . Septic shock ensued 24 hours after surgery, with oliguria, leukocytosis, PCT 4.39 ng/ml, CRP 46.6 mg/L, and lactate 1.17 mmol/L; his SOFA score rose to 6. After adequate fluid resuscitation, norepinephrine was added for persistent hypotension, based on data of hemodynamic monitoring (cardiac output and stroke volume variation using PiCCO Plus monitoring system) and trends of central venous saturation of oxygen (ScVO2). Low doses of steroids were prescribed for the first 3 days. Microbiological sampling included blood cultures, quantitative culture of tracheal secretions, and culture of urine . Blood cultures were negative; urine and tracheal aspirate samples were positive for CRKP and MDR A. baumannii.
+He had a short-lasting improvement, with fever, abdominal pain, and vomiting relapsing after a few days; a repeated CT scan of his abdomen revealed suprapubic and left ischiatic abscesses at surgical sites, as well as dilated bowel due to paralytic ileus. Surgical debridement was performed, followed by vacuum-assisted closure (VAC) therapy . Intraoperative microbiological sampling revealed multiple CRKP isolates, with a worsened resistance profile, including colimycin (colistin) resistance. He improved and a control radiographic (RX) scan of his thorax was negative; bronchoalveolar lavage (BAL) sampling, however, confirmed persistence at low bacterial load of CRKP. After 21 days, colimycin was withdrawn. However, 4 days later, he had fever and severe leukocytosis; he relapsed with acute renal failure: creatinine 2.53 mg/dL and acute kidney injury (AKI) stage 2 according to the Kidney Disease: Improving Global Outcomes classification (KDIGO) . His PCT levels rose above 100 ng/ml, his lactate was 3.3 mmol/L, and his SOFA score was 10. After further blood sampling for blood cultures and multiplex polymerase chain reaction (PCR; Magicplex™ Sepsis Test, Seegene), colimycin and anidulafungin were restarted with the addition of rifampicin . Multiplex PCR revealed A. baumannii and Candida albicans. To support septic shock recovery, two extracorporeal hemoperfusion devices were used: the Polymyxin B-Immobilized Cartridge (Toraymyxin® PMX 20-R, Toray Medical, Tokyo, Japan), allowing endotoxin removal and coupled plasma filtration adsorption (CPFA; CPFA® LYNDA®, Bellco, Mirandola, Italy), a hydrophobic resin with high affinity for many inflammatory mediators. Within 3 days, two Polymyxin B and three CPFA treatments were overall delivered. Clinical improvement ensued; his PCT fell to 19.25 ng/ml and serum creatinine to 1.82 mg/dL. Microbiological samples yielded: MDR A. baumannii and CRKP from tracheal aspirate, C. albicans and MDR A. baumannii from blood cultures, and A. baumannii and panresistant CRKP from wound swabs. In spite of septic shock reversal, he remained febrile with diarrhea and worsening anemia in the next 2 weeks. Control blood cultures (three lots) were persistently positive for C. Albicans, A. baumannii and CRKP. Ophthalmoscopy revealed retinal involvement, so that sequential therapy with liposomal amphotericin B was started. In the following weeks frequent vomiting ensued, impeding any enteral nutrition; his abdominal pain increased, paralleled by a palpable mass in his right flank. Colonoscopy revealed patchy serpiginous ulcers; a repeated CT of his abdomen revealed a periappendicular mass. Based on such data, after repeated multidisciplinary consults, an exploratory laparotomy was at last performed and an inflammatory pseudotumor of his right colon was diagnosed and resected with ileostomy. Soon after surgery, his blood cultures turned negative. Colimycin was interrupted. Once more, septic shock relapsed 4 days later. Leukocytosis, hypotension, PCT >100 ng/mL, renal failure, and lactate 4.0 mmol/L led to a SOFA score of 11; creatinine zenith was 4.73 mg/dL. Combination antibiotic therapy was modified (see Table ) and a single Polymyxin B extracorporeal hemoperfusion cycle was repeated. Blood cultures were persistently positive for CRKP. After interdisciplinary consultation, removal of pelvic synthesis media was anticipated. Shortly after surgery, he improved; 3 weeks later, microbiological and biochemical evidence of infection resolved, as well as gastric atonia. Combination therapy was continued for 56 days . He was transferred to the orthopedic ward after 146 days of ICU stay and later to rehabilitation. At present, he is doing well at home able to walk.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2753_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2753_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b530758a8ecb20543a93f1105263cdf8fe0036bc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2753_en.txt
@@ -0,0 +1,4 @@
+Written patient consent was obtained and our institutional ethical committee approved publication of this case report.
+A 55-year-old female (157 cm tall and weighing 58 kg) was admitted to our hospital for annuloaortic ectasia (AAE) and moderate aortic valve regurgitation (AR). The preoperative transthoracic echocardiography (TTE) examination confirmed AAE and moderate AR and detected abnormal blood flow just superior to the pulmonary valve. A coronary angiography demonstrated two fistulas from the right coronary cusp and left coronary artery with contrast draining to the pulmonary artery. Thus, the patient was diagnosed with AAE, AR, and coronary artery to pulmonary artery fistula and scheduled for repairing the dilated aortic root while preserving the native aortic valve and closure of the fistula.
+Anesthesia was induced with midazolam, 10 mg; fentanyl, 0.2 mg; and vecuronium, 8 mg and maintained with propofol, remifentanil, and vecuronium. After induction of anesthesia, a pulmonary artery catheter was placed through the right internal jugular vein and we performed blood sampling from the pulmonary artery, the right atrium, and the radial artery. We detected the oxygen step-up in the pulmonary artery and calculated that pulmonary flow/systemic flow (Qp/Qs) and left-to-right shunt ratio was 1.9 and 46%, respectively (oxygen saturation in the radial artery, the right atrium, and the pulmonary artery is 99.6, 73.3, and 85.5, respectively). Furthermore, we confirmed shunt flow of the coronary artery to pulmonary artery fistula draining to just superior to the pulmonary valve by TEE. Since the calculated values of Qp/Qs and left-to-right shunt ratio were unexpectedly high, we explored the presence of another shunt which had not been detected by preoperative TTE or plain computed tomography. Then, we found abnormal blood flow contrast draining from the descending aorta to the pulmonary trunk with upper esophageal aortic arch short-axis view . We suspected the presence of PDA and reported it to surgeons, and then, closure of PDA was added to the schedule.
+After establishment of cardiopulmonary bypass (CPB), the fistula from the right coronary cusp was found easily on the heart and it drained to the pulmonary artery. We tried to snare the fistula and confirmed no ECG changes, and then, we ligated this fistula. Then, the aorta was cross-clamped and the heart was arrested. The surgical findings after incision of the pulmonary main truncus included two orifices at just superior to the pulmonary valve and at the roof of the pulmonary trunk. The former orifice was drained from the fistula from the right and left coronary artery. After cardiac arrest, significant blood flow was noted through the latter orifice, so we considered that the latter orifice was drained from PDA. These orifices were closed, and then, repairing the dilated aortic root while preserving the native aortic valve was performed. Weaning from CPB was uneventful. We confirmed no residual shunt by TEE and calculated Qp/Qs as 1.0.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2754_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2754_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..765de526923f24dbe541ecd79049329fc0826ae0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2754_en.txt
@@ -0,0 +1,5 @@
+A 75-year-old woman was admitted in ICU after a cardiac arrest with return of spontaneous circulation, caused by tension pneumothorax. Now-flow and low-flow were 1 minute and 17 minutes, respectively. She was admitted 1 hour after the event, without sedation. Lungs were mechanically ventilated, the pleural drain was in place, pulse oximetry was 100% /FiO2 0.5, arterial pressure and heart rate were 160/70 mmHg and 110bpm, respectively, with norepinephrine at an infusion rate of 1mg/h, and temperature and glycaemia were 36.5°C and 8 mmol/L, respectively. There was no any sign of pneumothorax. Fever was actively treated without inducing hypothermia.
+She was unconscious (Glasgow Coma Scale: 3/15), with a conserved bilateral photomotor reflexes. She had intermittent bilateral ocular revulsion and bilateral shoulders tremor. Propofol was initiated by a bolus followed by a continuous infusion and the movements of the eyes and shoulders ceased immediately. One hour later a 13 channels EEG ( in supplementary figures) diagnosed a NCSE as a pattern of generalized periodic spike-waves evolving in generalized rhythmic spike-waves at 1 Hz with high amplitude (> 200 µV), without response to stimulation. Midazolam was initiated by a bolus followed by a continuous infusion which permitted to achieve a burst suppression pattern ( in supplementary figures). A 4-channel sensor connected to BIS VISTA® monitor was placed, in order to monitor the two processed parameters and showed an isoelectric signal ( in supplementary figures).
+On day 2 Clobazam and levetiracetam were added to ensure a bridging between IV and oral antiepileptic drugs. Conventional EEG recording showed a pattern of burst suppression and raw EEG from BIS monitor showed an isoelectric signal.
+On day 3, the 4-channel sensor was replaced by a 2-channel sensor which was connected to patient's bedside monitoring. Propofol and midazolam were both decreased progressively. Few hours later (, , and ), while there were no any abnormal movements, raw EEG of BIS monitor connected to a Philips BIS module [panel A] and secondarily to a BIS VISTA module [panel B] showed a pattern of high voltage with irregular morphology, alternating with isoelectric signal, evoking spikes (white arrows), spike-waves (red arrows), and polyspikes (white star). BIS and SR values did not show significant variations.
+Although it was not planned at that moment to request a conventional EEG recording, given the high suspicion of NCSE recurrence, the neurophysiology team was urgently contacted and the NCSE recurrence was confirmed and treated. The conventional EEG showed continuous generalized rhythmic spikes and spike-waves, sharply countered, of medium amplitude at 1-1.5 Hz ( in supplementary figures). Unfortunately the patient died on the fifth day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2757_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2757_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9a10fc2f68e804e2fee3af76ba858edccbeceaa9
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2757_en.txt
@@ -0,0 +1,3 @@
+A 4-month-old infant with a history of fever, vomiting, poor appetite and constipation for approximately 48 h, along with a previously reducible umbilical hernia, born at 34 weeks via cesarean section due to premature rupture of membranes in a twin pregnancy, was transferred to the emergency department of our institution.
+On admission, hematochemical examination showed a white blood cell count of 19.7 × 103/ul, 55.9% neutrophils, a C-reactive protein of 13.77 mg/dl, and a procalcitonin level of 5.34 ng/ml. At physical examination, the patient presented abdominal distention, and an erythematic area around the umbilicus with a palpable reducible soft tissue mass within the umbilical defect. A complete abdominal ultrasound performed in the emergency department revealed diffuse and marked distention of the intestinal loops, the absence of intestinal effusion or invagination, and the presence of a reducible herniated loop at the umbilical site with no vascular abnormalities on doppler .
+Within 2 days of admission, the patient became distressed and developed severe intestinal bloating, vomiting, irreducibility of the umbilical hernia, and skin discoloration and erythema at the umbilical site. A direct abdominal x-ray showed signs of hydro-gas stasis and multiple hydro-aerial levels that were relevant to the ileum when there was no free abdominal air . The patient underwent an urgent surgical procedure for hernia reduction, involving the isolation and release of the hernia sac from the ileal loop, which was firmly adhered to a fibrin plate. Upon opening the herniary sac, the presence of a gangrenous and perforated appendix within it was discovered. An appendectomy was therefore performed on double tobacco-pouch technique (, ), and the abdominal wall defect was sutured . The cecal appendix and the herniary sac were sent for histological examination, which revealed a picture of acute appendicitis with acute necrotizing-exudative serositis, approximately 5 cm in size, with perforation of the appendiceal wall. The postoperative course was uneventful, and the patient was discharged on the seventh postoperative day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2785_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2785_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6e70401c8515411207dc6f5f52d9def1d8063100
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2785_en.txt
@@ -0,0 +1,4 @@
+An 8-year-old boy presented with pain in his left hip joint that had persisted for several months. His height was 112.5 cm (−2.93 standard deviation), and his weight was 21.5 kg, from which body mass index was calculated to 67.1 percentile for age and sex. His growth had started to slow at 4 years of age . He presented with hirsutism, dry skin, and bradycardia. Hip joint radiography revealed Trethowan’s sign bilaterally in the frontal view and a posterior tilting angle of 34° on the left side and 25° on the right side in the Lauenstein view . Magnetic resonance imaging (MRI) of the hip joint showed separation of the proximal metaphysis of the femur. Based on these findings, the patient was diagnosed with chronic bilateral SCFE (mild on the right side, moderate on the left side).
+Blood tests revealed hepatic dysfunction and hypercholesterolemia, with a very low free thyroxine level of 0.10 ng/dl and a very high thyroid-stimulating hormone (TSH) level of 1789 μIU/ml. The anti-thyroid peroxidase antibody level was >600 IU/ml, and the anti-thyroglobulin antibody level was 1720 IU/ml. At the age of 8 years 7 months, the bone age (assessed by the Tanner–Whitehouse 2 radius, ulna, short bones method) was 3 years 4 months. Ultrasonography showed marked atrophy of the thyroid, and color-flow Doppler sonography revealed decreased thyroid blood flow. Cardiac ultrasonography disclosed slight retention of pericardial fluid. MRI scans of the head showed that the anterior lobe of the pituitary gland was enlarged to a height of 17 mm. Although the pituitary gland displaced the optic chiasm superiorly, there were no visual acuity or field abnormalities. Hyperplasia of the anterior lobe of the pituitary gland caused by the overproduction of TSH was suspected. Therefore, atrophic thyroiditis was diagnosed.
+For SCFE treatment, the patient was admitted and kept at rest, with the lower limbs in traction. Oral levothyroxine therapy was initiated with a low dose, followed by gradual dose increases. About 2 months later, the free thyroxine levels had increased to the normal range. In addition, the hirsutism, dry skin, and bradycardia had diminished, and his growth velocity had improved. MRI scans of the head showed reduction of the swollen pituitary gland. An arginine stimulation test (0.5 g/kg infused intravenously over 30 min) showed a normal growth hormone response (peak 7.26 ng/ml). Also, a human corticotropin-releasing hormone stimulation test (1.5 μg/kg infused intravenously) showed a normal adrenocorticotropic hormone response (peak 48.4 pg/ml) and cortisol response (peak 14.4 μg/dl). After 2 months of thyroxine treatment, the patient’s thyroid levels had stabilized, at which time surgery was performed for bilateral SCFE.
+The CARE guidelines were followed in this case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_280_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_280_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..ebe182b9cbfbd222221f07a181067b016a3f7efa
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_280_en.txt
@@ -0,0 +1,6 @@
+A 35-year-old man of South Asian origin with a strong family history of ischaemic heart disease and history of smoking (15 pack-years) presented in another city with anterior wall myocardial infarction and was thrombolyzed with streptokinase. He did not have any other relevant personal medical history. Patient had low socioeconomic status and avoided leaving his work and travelling to another city for treatment. Four weeks later he presented to our hospital with persistent angina. On examination, patient was clinically stable and had a blood pressure of 155/90 mmHg with a heart rate of 97 beats per minute. His general physical and systemic examinations were unremarkable. Electrocardiogram showed Q waves in Leads V1–V6. Transthoracic echo revealed a left ventricular ejection fraction (LVEF) of 35% with hypokinetic anteroseptal and anterior, basal-to-apical segments but preserved wall thickness and normally functioning valves. His troponins were normal. Low-density lipoprotein was 165 mg/dL and HbA1c was 5.5%.
+Coronary angiography showed multivessel coronary artery disease with critical disease in circumflex (LCx) and dominant right coronary artery (RCA). There was subtotal occlusion in mid LAD followed by diffuse disease in distal course needing endarterectomy/patch-plasty. Heart Team meeting decided for CABG with saphenous venous graft (SVG) to obtuse marginal (OM), SVG to RCA, and LIMA to LAD with hybrid DCB to distal LAD as an experimental treatment after patients consent. Endarterectomy/patch-plasty was planned as a bail out strategy. Hospital ethical board approval was obtained for this experimental treatment.
+CABG was carried out through mid-line sternotomy as conventional on pump CABG with cardioplegia in our hybrid operation theatre with fluoroscopic facility. Cardioplegia dosage was repeated after every 60 min. Pedicled LIMA was harvested using electrocautery with the help of LIMA retractor. Meanwhile long saphenous veins were harvested from right and left legs. Cardiopulmonary bypass was established using aortic and two-stage venous cannula. Reverse SVG was anastomosed to distal RCA and OM using 7/0 Prolene suture with good distal run off. At the planned site for LIMA implantation, a 6 mm arteriotomy was made in the LAD and a reverse SVG was anastomosed to it temporarily with 7/0 Prolene suture using 6 stitches, while the proximal end of SVG was secured to 6 Fr radial sheath. This sheath remained in the SVG and was not advanced into the native LAD. This sheath SVG combination was then used for contrast injections and for taking wire and balloons into distal LAD . In order to prevent the contrast from crystallizing out in the coronaries, as the heart was not beating, the contrast was flushed continuously using saline and cardioplegia. These were directly given into the SVG sheath combination via the cardioplegia pump. Gentle contrast injections were taken through the SVG sheath and then segment of LAD, distal to arteriotomy site, to be treated with angioplasty was marked by placing two metal clips on top of the heart surface. Road map was taken and BMW (Abbott vascular) 0.014 workhorse coronary wire was introduced into LAD through SVG sheath and parked in distal LAD. Mid-to-distal LAD disease was predilated between the 2 metal clips with 1.5 and 2 mm semi-compliant, Sprinter (Medtronic) balloons . Repeat contrast injection showed well-expanded LAD with no residual stenosis or significant dissection. Final treatment was done with 2 mm polymer-free paclitaxel DCB, Sequent Please Neo (B. Braun), extending 5 mm on both sides of predilated LAD segment . Excellent angiographic result was obtained with no residual stenosis . SVG radial sheath combination was then removed and LIMA was implanted on the proposed insertion site using 8/0 Prolene suture.
+Anticoagulation during procedure was done with unfractionated heparin at a dose of 300 units/kg and then activated clotting time (ACT) maintained as per CABG protocol throughout the procedure. Patient was given 75 mg of Aspirin via N/G on induction of general anaesthesia.
+After completing CABG, a final coronary angiogram was done through right femoral access. LIMA injection was done to confirm patency of LAD distal to LIMA insertion, that showed excellent results and CABG completed . After CABG protamine was administered as 1.5 mg/kg aiming to achieve an ACT of 150–160 before shifting the patient to intensive care unit. In the ITC, patient was loaded with 75 mg of Aspirin and 300 mg Clopidogrel after 04 h of surgery after ensuring that chest tube drainage was less than 0.5 mL/kg/h for consecutive 3 h. Unfractionated Heparin was started as 1000 units/h after 04 h to maintain an ACT between 150 and 200 for 12 h followed by injection Clexane 0.5 mg/kg/day for 5 days. Twenty-four hours after CABG, patient was started on maintenance dose of 75 mg Clopidogrel, 75 mg Aspirin, and 40 mg Rosuvastatin daily.
+Patient had an uneventful post-procedure recovery and remained asymptomatic during OPD visits. At 6-month follow-up, patient was asymptomatic with stable cardiovascular status. Transthoracic Echo revealed an LVEF of 45% with slightly hypokinetic anteroseptal and anterior, basal segments but preserved wall thickness and normally functioning valves. CT coronary angiography at 6 months revealed a patent LIMA to LAD with no significant stenosis in mid-to-distal LAD .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2829_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2829_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8420764baae8eb853360fc5e839efde9b6e6e371
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2829_en.txt
@@ -0,0 +1 @@
+A 48-year-old fit and healthy gentleman fell from a mountain bike following a sudden deceleration impact against a tree. He confirmed landing on the left wrist first and sustained injury to both the thumbs at the same time. He attended the emergency department immediately but the injuries were missed due to significant swelling and pain which made clinical examination difficult. As the radiographs revealed no bony injury he was referred to the hand clinic. He presented with pain and swelling of both the thumbs with painful grip on the right and inability to extend the thumb on the left side. Clinically, there was tenderness along the ulnar aspect of the MCPJ of the right thumb and positive stress test for UCL injury. This was confirmed by stress radiographs of the MCPJ joint of the thumb. The ultra sound scan confirmed complete rupture of UCL at insertion with Stener’s lesion. On the left side, he was unable to extend the interphalangeal joint of the thumb actively. The ultrasound scan confirmed rupture of EPL with the distal stump of the tendon located just distal to the extensor retinaculum. He underwent sequential exploration of both the thumbs in one anaesthetic. On the right side, complete rupture of UCL at the insertion with adductor pollicisaponeurosis interposed (Stener’s lesion) and rupture of dorso-ulnar capsule of MPJ was noted. The capsule was repaired with absorbable sutures and the ruptured UCL was repaired with absorbable anchor suture . On the left side, the distal stump of the EPL tendon was located just distal to the extensor retinaculum The proximal stump of EPL could not be located as it had probably retracted deep in the forearm. Hence, EIP tendon was transferred to EPL . Right thumb was immobilised for six weeks and mobilised thereafter. The left thumb was mobilised after two weeks in a custom made thermoplastic dynamic splint. He was followed up at six weeks, three months, five months and one year after surgery. At the end of five months, he regained full range of movements of both the thumbs and satisfactory grip strength as measured with Jamar Dynamometer.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_282_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_282_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b1b9da98986af3f8b1deccf2e5762ad9681cec28
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_282_en.txt
@@ -0,0 +1,5 @@
+A 37-year-old female patient was admitted to local hospital on January 28, 2023, due to chest tightness and dyspnea for 4 h. The patient reported no previous history of HIV/AIDS, organ transplantation, corticosteroid use, or immunosuppressive medications. Before admission, the woman had a car accident and drowned in a private fishpond. After being rescued, she developed chest tightness and breathing difficulties which were assumed to be due to water aspiration. The lung computed tomography (CT) scan showed bilateral pulmonary edema with multiple high-density nodular shadows. The head CT showed no apparent abnormalities . She was then started on corticosteroids, diuretics, and antibiotics for 12 days which was discontinued when her respiratory symptoms were improved. However, she developed a new headache and subsequently, rapid cognitive decline, aphasia, lethargy, and impaired consciousness. Physical examination revealed significant muscle weakness in the left limb (grade 2), compared to her right limb (grade 4). The second head CT showed multiple annular high-density shadows with slightly low-density shadows around it. A head magnetic resonance imaging (MRI) showed multiple ring reinforcement nodules with cerebral edema, which raised the concern for multiple intracranial metastatic lesions. Thus, a positron emission tomography–computed tomography (PET/CT) was performed and revealed multiple hypermetabolic nodules within the cranium and lungs, suggesting a high probability of infection. The metagenomic next-generation sequencing (mNGS) and culture of cerebrospinal fluid (CSF) detected no specific pathogen.
+After a course of antibiotics treatment, her headache aggravated, fever and vomiting occurred, and muscle strength further decreased (left limb: grade 1, right limb: grade 3). Additionally, decreased vision of the left eye and mild conjunctival congestion appeared. She was then transferred to the Department of Neurosurgery of our hospital.
+The puncture drainage of intracranial lesions was performed and the pus was tested by mNGS. A total of 600ul brain abscess drainage fluid samples were collected and mixed by glass beads. DNA was extracted by column extraction method. The libraries were constructed using end repair, and specific tag sequences were introduced at the end of each library. The size of library inserts to be sequenced was determined using an Agilent 2100 Bioanalyzer (G2939BA, Agilent, USA). DNA nanospheres were prepared using a one-step DNB preparation kit (1,000,025,076, Huada Gene Technology Co. Ltd, Shenzhen, China). Sequencing was performed on the MGISEQ-200 sequencing platform. Then the reads containing sequencing adapter, low quality, short (length < 35 bp) and low complexity were removed, and aligned to the human reference genome (hg38) using STAR software (v2.7.1a) to remove the host reads. The remaining non-host reads were searched and classified against four self-built pathogenic microorganism genome databases, including bacteria, fungi, parasites and viruses. Finally, S. apiospermum was detected with a coverage of 99.45%. At our hospital, the patient was conscious, but with difficulty speaking, grade 2 muscle strength of the left limb, grade 4 for the right limb, and positive Babinski’s sign on the left side. The neck rigidity was present and the Kernig sign was positive. Antifungal therapy started (voriconazole 200 mg bid, ivgtt). Dehydration (mannitol) to reduce intracranial pressure and low-dose glucocorticoids (methylprednisolone 40 mg qd, ivgtt) were also used. Two days later, the patient developed severe conjunctival congestion of the left eye with no light perception, and in less than one day, the left eye rapidly progressed to yellow-green vitreous opacity, with an unclear pupil .
+Ophthalmic physical examination revealed no light perception in the left eye, hyperemia and Tyndall’s. The cornea was clear, however, a thick exudative membrane in the pupil was present, and the fundus was unclear. Eye ultrasound showed vitreous opacity in the left eye. The patient was treated with fluconazole and voriconazole eye drops combined with antibiotics. The infection was resolved, but her visual acuity was not improved. One week after the antifungal treatment, a head MRI showed that the brain lesions became smaller in size, however severe edema around the lesions was still present. The lung CT showed the lung lesions were significantly improved compared to the previous CT. The headache and dizziness were alleviated, and there was no significant change in muscle strength. Two weeks later, an orbital MRI showed an abnormal signal of the left eyeball with enhancement. The patient’s muscle strength was significantly improved as the muscle strength of the left limb was grade 4-, and the right limb was grade 5. Two weeks later, the head MRI and lung CT showed that the abscess lesions became smaller. The pupil of the left eye was clear, but the eyeball atrophy and vision did not improve . After discharge, the patient was prescribed to continue voriconazole (200 mg bid po) and rehabilitation therapy.
+The patient has been followed up for over 7 months, and the brain and lung lesions were smaller than before, but have not completely disappeared . Figure summarizes the timeline of the case.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2897_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2897_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..553826bdeba44e3d539ba9e98023961d83ce6752
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2897_en.txt
@@ -0,0 +1,5 @@
+A 68-year-old woman, who had a history of hypertension, hyperlipidemia, and diabetes mellitus, underwent laparoscopic low anterior resection (LLAR) for treatment of her rectal cancer in December 2011. Histological examination revealed a well differentiated tubular adenocarcinoma, pT3N0M0 stage II A according to the Union for International Cancer Control (UICC) TNM classification system . The surgical margin was negative, and there was no vascular or lymphatic invasion. No adjuvant therapy was given, and there was no evidence of recurrence for 3 years.
+Three years after the LLAR, the follow-up computed tomography (CT) scan revealed liver metastasis in Couinaud segment V . A diagnosis of liver metastasis of rectal cancer was made, and she therefore underwent a laparoscopic anterior segment liver resection in February 2015. Histological examination revealed a moderately differentiated tubular adenocarcinoma without vascular or bile duct invasion, and with a preserved surgical margin .
+Two years after undergoing hepatectomy, the follow-up CT scan revealed dilation of the left intrahepatic bile duct and a high-density mass in the common trunk of segment II and segment III (B23). Magnetic resonance cholangiopancreatography (MRCP) and endoscopic retrograde cholangiopancreatography (ERCP) also revealed a mass in B23 . The biopsy findings from ERCP confirmed adenocarcinoma. Therefore, she underwent left and caudal lobectomy with extrahepatic bile duct resection in April 2017. Histological examination revealed a moderately differentiated tubular adenocarcinoma in segments II and III that invaded into the left hepatic duct and the liver parenchyma, forming a 20 mm nodule. There was no vascular invasion, and the surgical margin was preserved . The postoperative diagnosis was intrahepatic cholangiocarcinoma, pT2N0M0 stage II according to the American Joint Committee on Cancer (AJCC) 8th edition.
+In October 2017, a follow-up CT scan revealed a 15 mm mass with enhancement in the early phase in the common bile duct, and lymphadenopathy at 8a. MRCP also revealed a 15 × 6 mm low intensity mass at the end of the common bile duct, and a slightly high diffusion-weighted imaging (DWI) but no corresponding low signal on the apparent diffusion coefficient (ADC) map . A diagnosis of lower bile duct cancer was made. Consequently, she received pylorus-preserving pancreatoduodenectomy in November 2017. Histological examination revealed a well to moderately differentiated tubular adenocarcinoma with preserved surgical margin. Although there was no vascular invasion, lymph node (LN) 8a metastasis (2/2) was observed .
+Upon comparison, the histology of the current surgical specimen was found to be similar to those from the earlier surgeries. Immunological findings also revealed similar cytokeratin (CK) expression patterns of the specimens, which were negative for CK7 and positive for CK20 , indicating that the tumor originated from the colon or rectum. Based on these findings, a definitive diagnosis of rectal cancer with metastases to the liver, intrahepatic bile duct, and lower bile duct was made. The patient was followed up as an outpatient for 2 years, and no apparent recurrence or metastasis was observed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2907_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2907_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..793fb741b84bfb00414149890d77ee455c4a3d7a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2907_en.txt
@@ -0,0 +1,4 @@
+A 12-year-old Amara male patient presented to University of Gondar comprehensive specialized hospital, Northwestern Ethiopia, with a complaint of right lateral neck swelling of 6 months duration. The swellings were painless and reported to have increased in size. He had visited a nearby health center on multiple occasions for this complaint and took unspecified antibiotics, but no improvement. There was no history of fever, cough, weight loss, night sweating, loss of appetite, pressure effects, or bowel, bladder, joints or nervous system involvement. He had no family history (first-degree relatives) of diabetes, hypertension, or any other remarkable noncommunicable disease, including cancer. His past medical history is not significant. He had no history of admission to hospital. He had no history of any form of surgical procedures. He was a grade four student in a public school at the time of presentation. On physical examination, there were six discrete firm, nontender, freely mobile right lateral cervical lymphadenopathies, the largest measuring 3 × 2 cm2 . On the basis of the above findings, a provisional clinical impression of lateral cervical lymphadenopathy, due to either lymphoma or tuberculosis, was entertained.
+Liver was not palpable below costal margin. There was no splenomegaly. Other clinical findings were within normal limits. Laboratory investigations done on the same day of his presentation, including complete blood count (CBC), erythrocyte sedimentation rate (ESR), and chest X-ray, were noncontributory. On CBC, total white blood cell (WBC) count was 5800 µL with 50% granulocytes, 45% lymphocytes, 1% eosinophils, and 4% monocytes. Platelet count was 300,000 µL. Hemoglobin was 14.5 g/dL with mean corpuscular volume (MCV) of 88 fL. ESR was 14 mm/hour. Renal function test revealed blood urea nitrogen (BUN) of 12 mg/dL, and serum creatinine level was 0.68 mg/dL. On liver function test, total bilirubin was 0.6 mg/dL, serum albumin was 4.2 g/dL, and serum aspartate transaminase (AST/SGOT) and serum alanine transaminase (ALT/SGPT) were 30 and 32 IU/L, respectively. Urinalysis was also done and it was normal. Sputum was negative for acid-fast bacilli. Serum was negative for HIV antibody. Chest X-ray and ultrasound of abdomen did not reveal any abnormality.
+Due to limited number of pathologists and long waiting list of patients, he underwent fine needle aspiration cytology (FNAC). After 2 weeks of his initial presentation, FNAC from cervical lymph node was done and smears were stained with Wright’s stain following the standard procedures. Microscopic examination showed intracellular and extracellular Leishmania donovani (LD) bodies on polymorphous background . Serum tested for anti-rK39 antibodies was strongly positive. Bone marrow aspirations done on two occasions were negative for LD bodies. On the basis of above findings, the case was diagnosed as lymphatic leishmaniasis and the patient was put on sodium stibogluconate (20 mg/kg body weight/day), and paromomycin (15 mg/kg body weight/day) injections, which were given intramuscularly for 17 days and defined as the preferred first-line regimens for primary VL in Ethiopia.
+Having completed his medication at the University of Gondar comprehensive specialized hospital, he had a smooth course and was discharged with an appointment scheduled for follow-up after 3 months. When he came for the follow-up after 3 months, he had right lateral neck small mobile lymph nodes and was discharged with advice to return to the University of Gondar comprehensive specialized hospital if there was any new-onset increment of his right lateral neck small mobile lymph nodes.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2920_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2920_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c7ed7a76a29e78aca609bb99da6b6f65b5b25189
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2920_en.txt
@@ -0,0 +1,7 @@
+This 54-year-old Malay woman, an insurance agent, was seen at a primary care clinic in February 2021 when she was 52 years old for a routine follow-up of hypercholesterolaemia. She had been on treatment for hypercholesterolaemia since the age of 25. Initially, atorvastatin 40 mg nocte was commenced, and the dose was gradually increased to 80 mg nocte at the time of presentation. There was no history of chronic kidney disease, diabetes, or hypothyroidism to suggest a secondary cause for hypercholesterolaemia. She was a non-smoker and did not drink alcohol. She had no history of hypertension or cerebrovascular disease. The Edinburgh Claudication Questionnaire was negative for peripheral vascular disease (PVD). However, the WHO Rose Angina Questionnaire was positive. She had retrosternal chest pain during exertion, relieved within 5 min of taking glyceryl trinitrate 0.5 mg. It occurred once or twice a month. There was no radiation, shortness of breath, or any other associated symptoms. Her resting electrocardiogram was normal.
+This patient was diagnosed with PCAD in 1998 at 29 years of age when she presented to a cardiology clinic complaining of exertional angina and reduced effort tolerance. She subsequently underwent percutaneous coronary intervention (PCI) of the left anterior descending artery. After the intervention, she received follow-up care at a primary care clinic. Unfortunately, she developed another episode of chest pain in 2015 at the age of 46. An angiogram revealed an 80% blocked left circumflex artery and obtuse marginal arteries. She was initially treated with medical therapy due to financial constraints but eventually underwent another PCI in 2018 at the age of 49 years. She then continued her follow-up concurrently in the cardiology and primary care clinics.
+This patient had a strong family history of hypercholesterolaemia and PCAD. Both of her parents were treated for hypercholesterolaemia. Her father passed away at 63 due to a major adverse cardiovascular event (MACE). Her mother had coronary artery bypass grafting at 72 years old. Among her eight siblings, seven were treated for hypercholesterolaemia and had either MACE or sudden cardiac death between the ages of 43 and 56 at the time of diagnosis. She has three children who are being investigated for high cholesterol. None of her family members have had genetic testing for suspected FH. Her family pedigree chart is shown in .
+On examination, she was obese, with a body mass index of 38.4 kg/m2. Her blood pressure was 104/74 mmHg. Other vital signs were normal. Bilateral grade 2 corneal arcus were observed , but the patient only noticed them at 52 years old. There was no tendon xanthoma.
+The SBC, DLCN score, and FAMCAT relative risk score for this patient were deduced based on the clinical history and laboratory investigations that were extracted from her electronic medical record. The highest LDL-c level was 8.0 mmol/L, and the highest total cholesterol (TC) level was 10.7 mmol/L, recorded in October 2020. Therefore, this patient fulfilled the SBC (possible FH), DLCN (score of 8 – probable FH), and FAMCAT (relative risk score of 9.51) criteria. She was then offered and counselled for genetic testing, the gold standard for diagnosing FH. Targeted next-generation sequencing of the three FH candidate genes (LDLR, APOB, and PCSK9) was conducted. Subsequently, she was confirmed to carry a heterozygous pathogenic variant in the LDLR gene (rs769446356) located in intron 2 (noncoding area), in keeping with the American College of Medical Genetics and Genomics (ACMG) recommendation. This patient was then counselled by the primary care physician regarding the genetic diagnosis, the need to intensify her lipid-lowering medication (LLM), and to screen her first-degree relatives. The importance of adherence to lifestyle modification and pharmacotherapy was also emphasized.
+This patient received long-term follow-up care from a multidisciplinary team of primary care physician, cardiologist, and lipid specialist. Despite being on atorvastatin 80 mg nocte, her LDL-c level was still high at 8.0 mmol/L, and her TC level was also high at 10.7 mmol/L. The cardiology team changed the LLM regime to a combination therapy of rosuvastatin 20 mg nocte and ezetimibe 10 mg daily. The lower rosuvastatin dose of 20 mg was chosen instead of 40 mg to minimize the potential side effects of high-intensity statin in this patient. She responded well to the combination treatment, where her LDL-c level decreased to 5.0 mmol/L, and her TC level decreased to 7.6 mmol/L. However, she still failed to achieve the ≥50% reduction in LDL-c or the target LDL-c of <1.8 mmol/L as recommended by the international guidelines. Her LLM will be further intensified by the lipid specialist in the subsequent follow-ups to achieve the recommended LDL-c target of <1.8 mmol/L by maximizing rosuvastatin from 20 to 40 mg nocte before adding an injectable LLM, such as the PCSK9 inhibitors. The possibility that lipoprotein apheresis may be needed in the future was also discussed with the patient if there is an inadequate response to the maximum tolerated dose of LLM. The cost of treatment with PCSK9 inhibitors and lipoprotein apheresis was also discussed, as these treatments are not currently reimbursed by the government health financing system in Malaysia.
+The primary care physician conducted a cascade screening of her first-degree relatives. All three of her children were found to have elevated LDL-c levels and were clinically diagnosed with FH. They were started on statin monotherapy by the primary care physician and were referred to the lipid specialist for further management and intensification of LLM. The cardiology team was informed of the FH diagnosis in these children. summarizes the important key features of this case, and summarizes the clinical histories of her three children.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2922_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2922_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a37edefa0ae1e377769f43a45517a978970e95f4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2922_en.txt
@@ -0,0 +1,6 @@
+We present a case of a 33 year old Bulgarian male who attended a Neurological Clinic at University Hospital Alexandrovska. He attended the clinic because of progressive attention and memory impairments as well as apathy, anxiety and irritability reported by family members. Eighteen months earlier his brother noticed that he was confused, forgetful and unable to manage his professional activities as a construction worker. He became apathetic, irritable and more verbally aggressive. Our patient has a low level of education with poor written language and simple arithmetic abilities; however he was a good worker who was able to carry out everyday activities.
+Neuropsychological assessments were performed using a general cognitive functioning scale (Mini Mental State Examination, MMSE), and tests of attention, memory, language and executive functions (see Table ). Our patient was not fully orientated (he did not know the year, season, month, day and date), however, he was relatively orientated to place. Assessment of memory revealed a severe verbal learning impairment with an extremely low ability to retain new information. He also demonstrated difficulty with remembering autobiographical and personal information. His verbal communication was relatively spare; however he did have a mild anomia and poor categorical fluency. A severe dysexecutive syndrome was also documented (with notably poor coding test and letter fluency). Bearing in mind the patient’s premorbid cognitive functioning, neuropsychological assessment revealed mild to moderate dementia (MMSE = 16/30).
+The patient had no history of skin lesions or symptoms of Argyll-Robertson; his pupillary reflexes were preserved, and the pupils constricted in response to light and accommodation. Pyramidal and extrapyramidal signs, dysarthria, and impairment in coordination were documented.
+Laboratory workups, including a complete and differential blood count, serum electrolytes and glucose, liver and renal function tests, thyroid function tests, serum B12 and folate levels, were normal. In addition, cerebrospinal fluid (CSF) analysis showed pleocytosis, elevated protein levels, and positive oligoclonal bands. Cerebrospinal fluid was clear with 1 × 106/l erythrocytes, 39 × 106/l leucocytes (82% lymphocytes, 16% monocytes) and a protein level of 0.88g/l. The diagnosis of active neurosyphilis was based on positive results of the Venereal Disease Research Laboratory test/Treponema pallidum hemagglutination assay (VDRL/TPHA) reactions in blood and CSF samples (serum-VDRL 1:128, serum-TPHA 1:2560, CSF-VDRL 1:64, CSF-TPHA 1:640). The serum and CSF test for HIV was negative. Magnetic resonance imaging (MRI) of the brain demonstrated moderate cortical and marked hippocampal atrophy .
+No adverse reactions were observed upon receiving a course of intravenous Penicillin G 5x5000000 IU /daily for 20 days.
+At the 6 month follow up examination, clinical signs and neuropsychological findings showed slight improvement in general cognitive functioning. Six months after treatment the patient’s MMSE score was 19/30 (see Table ). Improvement was also noted on the activities of daily living and behavioural disturbances assessments. The patient’s CSF protein level was 0.55 g/L, with 1 × 106/l leucocytes. The VDRL test of CSF indicated positive results.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2972_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2972_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..387c759645508ba016b34457f7117202fdcd77cc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_2972_en.txt
@@ -0,0 +1 @@
+A 10-year-old Saudi Middle Eastern girl presented to King Abdulaziz University Faculty of Dentistry, Jeddah, Saudi Arabia, complaining of “malpositioned frontal teeth.” The patient’s medical history was insignificant. She had no known allergies or any possible syndrome. Her dental history was significant for multiple restorations. Her family history was insignificant. Her parents reported that their 10-year-old daughter did not pronounce the letters D, T, and Th correctly until the age of 7, and she had not received any previous medical intervention. Extraoral examination showed incompetent lips. Intraoral examination was within normal limits but revealed two lingual frenula with no limitation of tongue function . The patient faced no challenges. No further management regarding the lingual frenula was required. Her family members were also examined for double lingual frenula as part of the comprehensive assessment process. The patient’s father had a double lingual frenula, and two of her three siblings had no lingual frenulum. None of the family members had any syndromes. A written informed consent was obtained from the patient’s legal guardian for publication of this case report and any accompanying images.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_299_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_299_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f2a2077dd7a02afaf81eb103719d7dce7702a160
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_299_en.txt
@@ -0,0 +1,2 @@
+A 45-year-old Hispanic man with a 2-year history of progressive proptosis of the left eye attended to our center complaining of diplopia and hemicranial migraine. He was previously diagnosed with hyperthyroidism receiving thyrostatic treatment with thiamazole for 6 months without clinical improvement. His past medical history was not relevant, and he denied previous ocular trauma. At his arrival, physical examination revealed ptosis, palpebral edema, and exophthalmos of the left eye, as well as the abolishment of the ipsilateral photomotor and consensual responses, but conserving the corneal reflex. Furthermore, the patient presented an evident limitation for the abduction and supraduction of the affected eye, whereas fundoscopy showed mild optic atrophy. The exploration of the right eye did not reveal any abnormality, whereas the neurological examination showed normal cognitive function with no focal neurologic deficits. A T2-weighted magnetic resonance imaging (MRI) of the head showed a hyperintense mass arising at the superotemporal wall of the left orbit that was displacing the eyeball, invading the frontal bone, and causing inflammation of the adjacent dura mater .
+Due to the extension of the tumor, we decided on its surgical resection using a pterional approach. The skin incision and dissection of the temporalis muscle fascia were performed as described before [, ], in order to expose the temporal fossa and the orbital roof . To get access to the orbit, we performed the osteoplastic removal of the superolateral orbital wall (formed by the greater sphenoidal wing) using a surgical drill, with no need for opening the dura mater . This technical modification allowed us to completely resect a well-defined mass of hematic brown color, invading the frontal bone to the level of the frontozygomatic joint and the orbital floor, with minimal risk of lesioning intradural and orbital structures . The histopathological analysis of the resected tumor indicated the presence of abundant fibrous tissue, cholesterol crystals, coagulated hematic content, and a mixed inflammatory infiltrate with a predominance of lymphocytes and foamy histiocytes , compatible with the diagnosis of cholesteatoma. The patient recovered the functionality of the left eye with no deficits in the visual acuity nor diplopy , although he remained with a low degree of ptosis. Finally, a second MRI was performed, which showed no residual tumor 1-year after the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3012_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3012_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f41c57a8ce773e3e448aa5a5facfeeccb3a39c0c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3012_en.txt
@@ -0,0 +1,3 @@
+25-year-old nulliparous woman with no routine gynecological check-ups. She presented with a one-month history of a clinical picture characterized by acne-like lesions on the face, neck, chest, facial oedema and blurred vision. She initially went to another facility where hypertensive readings, hypokalaemia and an ultrasound scan showed multiple lesions in the liver consistent with neoproliferative disease. She subsequently developed delirium, incoherent speech and suicidal ideation, and was brought to our hospital by relatives. On admission, she was hypertensive (160/112 mmHg), disoriented, aggressive and delirious. She had acne-like lesions on the face and chest, marked hirsutism on the face, chest and back, a full moon face, dorsal hump, supraclavicular pads and generalised muscle weakness. Her laboratory test on admission showed hyperglycaemia, hypokalaemia, hyper-transaminasaemia and metabolic alkalosis. An ultrasound scan and a magnetic resonance scan of the brain showed no significant findings. With suspicion of encephalitis, a lumbar puncture was performed with the only relevant finding being hyperproteinaemia. She was admitted for study and treatment, and was interpreted as having a severe Cushing's syndrome with significant general impairment and rapid onset. Confirmatory biochemical tests were performed: Nugent test with cortisol 8 am > 60 ug/dL (positive > 1.8 ug/dL), inhibition test with dexamethasone 8 mg at 23 h: cortisol > 60 ug/dL, night salivary cortisol of 1610.2 ug/dL (VN < 7). ACTH dependence was found with frankly elevated values. The severity and rapidity of the onset of the clinical picture led to studies to detect a primary tumour responsible for ectopic ACTH secretion. An ultrasound scan was performed that showed bilateral, smaller than 3 mm, nodular opacities in the thorax, hyperplastic adrenal glands, lesions in the liver and vertebral bodies of the sacral region, L3 and dorsal, suggestive of secondary disease. When the patient was re-examined, she commented that she had presented postcoital bleeding weeks before the onset of the clinical picture. An ultrasound scan of the uterus was performed that showed an enlarged uterine cervix, after which a speculum was used to examine the cervix and a pathological characteristic was observed and a biopsy was taken. An ultrasound-guided biopsy of liver lesions was also performed. Other studies performed: fundus of eye that showed a serous central macular oedema in the left eye.
+
+During his admission, he developed severe hypokalaemia that persisted despite replacement. He received spironolactone and ketoconazole at increasing doses up to 1200 mg/day. Mifepristone was added, but had to be discontinued after 7 days due to severe hypokalaemia. Histopathological examination showed liver parenchyma and exocervical mucosa infiltrated by neoplastic proliferation composed of small cells with scant cytoplasm, fine and granular chromatin nuclei, with positivity for cytokeratin, chromogranin, synaptophysin, CD56, p16, with a proliferation index Ki 67 greater than 75%. With these findings, the diagnosis of neuroendocrine carcinoma of small cells was reached. He initiated chemotherapy with cisplatin and etoposide, developed a septic shock secondary to febrile neutropenia and died after 6 days.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3020_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3020_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..710bcbab77bcb38153d9eb578f501596f36f75bd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3020_en.txt
@@ -0,0 +1 @@
+72-year-old woman with a histological diagnosis of high-grade urothelial carcinoma of the bladder with secondary involvement of lymph nodes and bone. Her personal history included hypertension, smoking, stage I lung adenocarcinoma and intraductal mucinous neoplasia of the pancreas in control. The first treatment proposed for her bladder cancer was a total cystectomy and hysterectomy with a surgical margin free of neoplastic involvement. The pathological anatomy showed a high-grade urothelial carcinoma with infiltration of the bladder ceiling, posterior wall and lateral wall, and extravesical involvement of the uterine body and both ovaries. She then received chemotherapy with carboplatin AUC 6 + gemcitabine for 6 cycles with a partial response. One year after the surgery, she had a breakthrough haematohaematuria, tenesmus and rectal pain. A neoplastic-looking stricture was observed during a colonoscopy that occluded the lumen 10 cm from the anal margin, preventing the passage of the endoscope. The mucosa appeared normal in the colonoscopy area. While awaiting the results of the biopsy, an abdominal and pelvic MRI with contrast was requested, which reported a 5 cm long solid rectal lesion that occluded the lumen and traversed the peritoneum, 6 cm from the anal margin. It was accompanied by 3 regional lymph nodes with characteristics suggestive of malignancy. A lesion was biopsied during the video-colonoscopy and the pathological anatomy reported a poorly differentiated neoplastic metastasis. The immunohistochemical positivity with GATA 3 and CK20 and negativity with TTF1, CDX2, P63 and PAX8, together with the oncological history, resulted in the diagnosis of a probable metastasis of urothelial origin. Due to these findings, it was recommended to initiate treatment with pembrolizumab and evaluation for eventual rectal radiotherapy.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3022_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3022_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..aaa9a2da8bc11bfd8cbaf0f2c6c39f0845bca85c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3022_en.txt
@@ -0,0 +1,5 @@
+The boy is a 10-year-old indigenous boy of the Kichwa people, born and living in the community of Kuchapamba (0°03’20.1” N, 76°58’29.5” W) in the parish of Santa Cecilia, in the canton of Lago Agrio, in the province of Sucumbíos, in the north of the Ecuadorian Amazon. The boy was referred from the Marco Vinicio Iza General Hospital, located in Nueva Loja (35.4 km from Kuchapamba), for respiratory symptoms such as cough and rusty expectoration and sometimes frank haemoptysis, which had been present for four years. His father reported that he occasionally had a fever and had been hospitalized three times; the presumptive diagnoses were pulmonary tuberculosis and pneumonia. The paternal grandfather died of pulmonary tuberculosis. However, all the patient’s sputum examinations were negative for Mycobacterium tuberculosis. During the last hospitalization, a chest tube was placed to drain the pleural effusion. Given the recurrence and persistence of the aforementioned symptoms, and in the absence of an etiological diagnosis, the patient was referred to the Baca Ortiz Paediatric Hospital in Quito (located in the Andean region, 293 km from Nueva Loja), to investigate the cause of the pulmonary symptoms. The father stated that the family diet included the consumption of freshwater crabs collected from the nearby creeks. They also eat fish, molluscs and meat from wild animals such as wild boars and guanta (Cuniculus spp.), among others.
+
+The patient presented to the hospital admission examination with a temperature of 36°C, blood pressure of 115/76 mmHg, heart rate of 60 beats per minute, respiratory rate of 24 breaths per minute, weight of 26.8 kg, height of 126 cm, body mass index of 16.9 kg/m2, conscious, oriented in space, time and person, Glasgow Coma Scale of 15/15, no neurological focal signs, no palpable adenopathies, symmetric chest with preserved expansion capacity and decreased murmurs in the left lung base, no over-additive noises or respiratory distress, other physical findings were normal, and the patient expectorated copious rust-coloured sputum with streaks of blood, especially in the morning. This sputum was collected for microscopic examination for the presence of eggs of Paragonimus spp., M. tuberculosis bacilli and yeast. The haematological profile showed 6.1 x 103 leukocytes/μl (reference range: 4.4 - 11.0 x 103 cells/μl); 5.0 x 103 neutrophils/μl (2.5 - 7.5); 3.1 x 103 lymphocytes/μl (3.0 - 9.5); and 2.24 x 103 eosinophils/μl (1.0 - 1.5); haemoglobin of 9.7 g/dl (9.5 - 13.0); haematocrit of 29.6% (30 - 44%); and 306,000 platelets/μl (150,000 - 450,000). In addition, the results included: glucose of 102 mg/dl (100 - 180); urea of 6.8 mg/dl (5 - 18); creatinine of 0.17 mg/dl (0.3 - 0.7); glutamic oxaloacetic transaminase of 25.6 U/L (0 - 37); glutamic pyruvic transaminase of 28.6 U/L (> 60); gamma glutamyl transferase of 22 U/L (11 - 50); total bilirubin of 0.10 mg/dl (1.0); direct bilirubin of 0.04 mg/dl (0.3); alkaline phosphatase of 179 U/L (up to 350); lactate dehydrogenase of 203 U/L (170 - 580); total protein of 4.5 g/dl (4.4 - 5.4); albumin of 6.88 g/dl (6.2 - 8.0); and C-reactive protein of 1.33 mg/L (up to 10). The stool examination did not reveal parasitic cysts or eggs.
+
+In the microscopic study of fresh sputum (without staining), abundant eggs, operculated and ovoid, indicative of Paragonimus spp. were observed. With the staining of Ziehl-Neelsen and acid-fast staining, no bacilli or fungal spores were observed. In the axial computed tomography of the thorax, simple and with contrast, a round lesion of 22 x 20 x 33 mm and a volume of approximately 8 ml with a hydroaereous level and gas foci in the anterior part, as well as consolidated areas around this lesion, were observed. In the left basal field, a patterned glass-milled image was visualized. After the parasitological diagnosis of pulmonary paragonimiasis was made, the sending of praziquantel or triclabendazole to the Ministry of Public Health of Ecuador was requested, and they responded that they did not have either of the two drugs. Triclabendazole was obtained in 250 mg tablets of Egaten® (Novartis) through the non-governmental organization “Centro de Epidemiología Comunitaria y Medicina Tropical”, in Esmeraldas, and a single daily dose of 10 mg/kg was administered orally for two days. After five days of hospitalization, the pulmonary symptoms disappeared. The patient did not present adverse or secondary effects, so he was discharged.In the last control, carried out one year after finishing the treatment, the father reported that the patient had presented sporadic cough without rusty expectoration. The patient underwent a physical examination whose findings were normal, and the microscopy of sputum for eggs of Paragonimus spp. and bacilli of M. tuberculosis was negative.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_304_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_304_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c32df5bb86b170c4f1c0719a3effa24577f4e35d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_304_en.txt
@@ -0,0 +1,3 @@
+A 2-year-old male presented with fevers, leukocytosis (studies were only positive for leukocytosis with WBC of 179,000/cu.mm), and mild lower extremity weakness. The thoracic CT scan showed a needle-shaped foreign body in the spinal canal at the level of T10 level .
+CT myelography documented the presence of a linear radiopaque foreign body (likely a pin/ needle) in the spinal canal at the T10 level traversing from the right pedicle to the left neural foramen; it appeared to be traversing the anterolateral aspect of the cord with no clear contrast separating it from the cord.
+The patient underwent a T10 laminectomy for removal of the foreign body that proved to be a medical syringe needle tip . As the needle traversed the spinal canal, intraoperative monitoring including motor evoked potentials was utilized. There were no significant intraoperative changes. Indeed, postoperatively, the patient’s mild lower extremity weakness resolved progressively after 2-week follow-up and his gait improved after 6 weeks from OR date.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3053_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3053_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..71792e9649c4ca6671c32ead3c67ca387c8228dd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3053_en.txt
@@ -0,0 +1,5 @@
+A 40-year-old Japanese woman developed numbness in both legs, back pain, and gait disturbances after experiencing these symptoms for a month and visited her previous hospital. She had a prior diagnosis of NF1. Magnetic resonance imaging (MRI) revealed a spinal tumor located in the left thoracic spinal cord at the Th9-10 level, prompting her to undergo a laminectomy at Th8-9, intradural tumor resection, and partial resection of the epidural tumor. Pathological evaluation showed no malignant findings, and the tumor was diagnosed as a neurofibroma. On the 37th day after surgery, the patient was referred to our hospital for rehabilitation therapy.
+
+She had multiple raised skin lesions all over her body, including her face. Neurological examination revealed muscle weakness at the Medical Research Council (MRC) grade 4 level in the bilateral iliopsoas, left quadriceps, bilateral hamstrings, and left anterior tibialis. There was increased tendon reflex activity in both lower limbs, a positive right Babinski sign, positive right foot clonus, and paresthesia in both lower limbs. No cranial nerve deficits, upper limb paralysis, or ataxia were noted. Although the patient experienced some difficulty with urination, they were able to defecate independently. She used a walker for mobility due to lower limb weakness. We initiated rehabilitation therapy with the short-term goals of promoting independence in basic activities of daily living (ADLs), improving muscle strength and range of motion, and long-term goals of returning to daily life, providing psychological support and encouraging social participation, and enhancing the quality of life. Specifically, we planned to implement muscle strengthening exercises, range of motion exercises and stretching, balance training and exercises for fall prevention, gait training, and instruction in ADLs (bathing, dressing, eating, etc.). These rehabilitative efforts led to some improvement in the patient's walking function. She was able to walk independently for short distances and train with a walking stick for longer distances. However, over a period of 15 days, starting on the 46th day after surgery, she tried various laxatives but was unable to have a bowel movement. On the 67th day after surgery, walking deteriorated, and the patient was no longer able to walk using a walker. Thoracic spine MRI revealed a 63 x 55 mm sized, lobulated mass extending from the Th9 vertebral body, arch, and epidural space to the left posterior mediastinum through the left foramina of Th9/10. This mass demonstrated hypointensity on T1-weighted images and hyperintensity on T2-weighted images with internal heterogeneity. On the 75th day after surgery, she was transferred back to her previous hospital.
+
+On the 80th day after her initial surgery, she underwent a second surgery for spinal tumor removal. The tumor, which had progressed from the epidural space into the Th9 vertebral body, was resected. Pathologists deemed no malignant findings, and the tumor was diagnosed as a neurofibroma. A postoperative MRI performed at the previous hospital confirmed that spinal cord compression had been alleviated. As a result of postoperative rehabilitation at her previous hospital, she regained walking with a walker. On the 113th day after the initial surgery, the patient was transferred back to our hospital for rehabilitation. Neurological examination revealed spasticity in both lower limbs with the following MRC grades (right/left): iliopsoas 3/2; gluteus maximus 2/2; quadriceps 4/4; tibialis anterior 3/2; gastrocnemius 3/2; left-dominant hypoesthesia in both lower limbs; and hyperreflexia in both lower limbs. In terms of ADLs, the patient was independent in getting in and out of bed and transferring with the use of handrails. While they could use a walker, they exhibited instability, requiring supervision. However, after transferring to our hospital, the patient's back pain, lower limb numbness, and paralysis in both legs worsened progressively. She and her family sought a second opinion and visited another advanced medical center on the 125th day after the initial surgery, where she was diagnosed with MPNSTs. The thoracic spine MRI on the 126th day showed significant tumor enlargement (diameter 98 mm). By the 127th day after the initial surgery, both legs had reached MRC grade 1. On the 128th day, she returned to her previous hospital; however, surgery was deemed impossible, and the focus shifted to palliative care, leading to her death several days after readmission.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3058_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3058_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d66870426794b9128ddcca6451b8cd134beea129
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3058_en.txt
@@ -0,0 +1 @@
+A 52-year-old female with a history of repeat PKPs was referred to the glaucoma clinic due to uncontrolled IOP. The patient underwent PKP five times in the right eye from 1989 to 2019. She constantly experiences corneal rejection symptoms after several years of keratoplasty. The contralateral eye was diagnosed with myopic macular degeneration, and with appropriate treatment and uncomplicated cataract surgery, a best-corrected visual acuity (BCVA) of 1.00 logMAR was achieved. Therefore, treating the right eye was the immediate concern. There was no documented history of IOP elevation in the patient’s medical history prior to the fourth PKP. During that period, the IOP was adequately managed with topical antiglaucoma monotherapy, ranging from 12–14 mmHg. One week after the fifth PKP, the patient complained of pain, redness, and halos around lights. She was referred to the glaucoma service for further evaluation and management. The IOP was 42 mmHg by applanation tonometry, and the BCVA was 0.25 logMAR with a clear graft and no signs of rejection. The patient was treated with maximum topical antiglaucoma medications; however, the IOP was still 36 mmHg. We suggested tube implantation due to the uncontrolled IOP and history of repeat PKPs with a current viable graft. However, the patient was unable to attend our care due to socioeconomic factors and continued care in a tertiary clinic with no resources for glaucoma tube implantation. The patient underwent trabeculectomy with mitomycin C (MMC), and the IOP was well controlled after 22 months without antiglaucoma medications. In April 2022, she came to our clinic with complaints of irritation, redness, and decreased vision in the right eye. On examination, we found an incarcerated bleb with a positive Seidel test, 5 mmHg IOP, and BCVA hand movement. We treated this as a blebitis with broad-spectrum topical and oral antibiotics. After the infection subsided, we performed a bleb revision with scleral patch graft. One month after surgery, the IOP was 22 mmHg on maximum topical antiglaucoma medications, wound closure was good, and the corneal graft was clear. We decided to insert an Ahmed Glaucoma Valve (New World Medical, Inc., Rancho Cucamonga, California, USA) to lower the IOP. The tube was inserted in the posterior chamber to protect the corneal endothelium. Six months after surgery, the IOP was well controlled (11 mmHg) without antiglaucoma medications, BCVA was 0.2, and the graft remained clear.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3102_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3102_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dedf1ede39e78f80c08f9e63f11949f90d5f0752
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3102_en.txt
@@ -0,0 +1,15 @@
+A previously healthy 9-year-old boy from Trujillo, Peru, fully vaccinated according to the vaccination schedule for his age, presented to the emergency department with respiratory problems and suspected COVID-19.
+
+The mother and child were tested for the presence of antibodies to SARS-CoV-2. The results showed that both were positive for IgG antibodies to SARS-CoV-2. In the child, the reverse transcriptase polymerase chain reaction (RT-PCR) molecular test for SARS-CoV-2 was negative. According to the mother, the child had a fever, abdominal pain, diarrhea and vomiting for 3 days. The patient was admitted to the surgical center for acute examination of the abdomen without major findings.
+
+Twenty-four hours after surgery, the child was tachypneic with respiratory rate of 40 breaths per minute, subcostal retractions, low oxygen saturation (SatO2) of 80% in room air and 85% on high flow oxygen support, heart rate of 138 beats per minute and blood pressure of 790/550 mmHg. Due to his clinical deterioration, he was admitted to the paediatric intensive care unit (ICU), where he was urgently intubated for mechanical ventilation and presented low SatO2 at 85% and peripheral signs of hypoperfusion. Initial analysis of the venous blood gases showed pH of 7.29, carbon dioxide partial pressure (pCO2) of 39.8 mmHg, oxygen partial pressure (pO2) of 37.3 mmHg, bicarbonate levels of 17.8 mmol/L, base excess of -7.8 and inspired oxygen fraction of 100%, consistent with protective mechanical ventilation measures. Serial chest radiographs were performed, which showed bilateral parenchymal involvement, along with a thoracic tomography result consistent with a consolidated parenchymal inflammatory process and bilateral pleural effusion.
+
+No improvement in oxygenation was observed with the initiation of mechanical ventilation with sedoanalgesia and optimal relaxation; therefore, it was decided to place him in the prone position for 48 hours, increasing the SatO2 to 92%. The child presented circulatory collapse and received several vasoactive agents (epinephrine, norepinephrine and dobutamine), achieving mean arterial pressure within the 50th percentile for his age. The vasoactive inotropic score (EVI) was 50, and the echocardiogram showed left ventricular dysfunction and vasoplegia, which reversed after 5 days with normal values of arterial pressure for his age and remained so until hospital discharge.
+
+The respiratory pathogenic nucleic acid amplification panel was negative. Blood, urine and peritoneal fluid samples were negative. Blood tests showed a hemoglobin level of 9.9 g/dL, a leukocyte count of 10,680/mm3 and lymphopenia (640/mm3). The blood tests showed elevated levels of inflammatory markers, with a C-reactive protein level of 243 mg/L, a fibrinogen level of 410 mg/dL, a ferritin level of 1,260 ng/mL and hypalbuminemia (2 g/dL). In addition, the patient had a high level of D-dimer of 9.4 mg/L with signs of coagulopathy, a prothrombin time of 49 seconds and an international normalized ratio of 1.51. There were also elevated levels of pro-BNP (282 pg/mL), troponin (0.24 pg/mL) and a high level of lactate dehydrogenase (LDH). The fever persisted while the patient was on mechanical ventilation, and clinical, gas and radiological improvements were observed after 15 days. The patient was weaned off the mechanical ventilator to spontaneous ventilation with the support of a 30 L high flow cannula, and the inspired oxygen fraction was 60%. After 3 weeks, the child had neurological deterioration, with a Glasgow coma scale of 11/15 (M4/O4/V3), pupils of 3 mm in diameter, bilateral plantar fasciitis, delusions and suicidal ideation, psychomotor agitation and the incidence of two convulsive events of approximately 2 minutes in duration each, with no recovery of consciousness between the events, for which the patient received intravenous (IV) midazolam 0.1 mg/kg and then phenytoin bolus 20 mg/kg/dose with a maintenance dose of 8 mg/kg/dose. This prescription was maintained after hospital discharge. Psychomotor agitation was controlled with antipsychotics; haloperidol was administered orally at 5 mg every 8 hours. No immunosuppressive treatment was used.
+
+Brain MRI showed bilateral occipital involvement in hyperintense T2 and FLAIR images, which affected subcortical white matter symmetrically, especially at the posterior level, and did not stand out with contrast or show significant changes in diffusion. These findings were consistent with vasogenic edema and indicative of posterior reversible encephalopathy syndrome (PRES). Electroencephalographic findings showed a generalized slowing of theta/delta frequency activity.
+
+To treat the multisystem inflammatory syndrome, he received immunoglobulin at 2g/kg in a single dose and methylprednisolone at 2mg/kg/dose for maintenance. Subsequently, we focused on the therapeutic management of PRES by the IV administration of antiepileptic drugs to maintain blood pressure levels at normal tension, preserving an adequate homeostasis of the internal environment with special emphasis on the treatment of volume overload and the prevention of electrolyte disorders.
+
+During follow-up at 4 weeks after discharge, at the time of neuropsychological evaluation, abilities such as attention, concentration, memory, language, visuoconstructive abilities, calculation and orientation were assessed, and motor deficits of 4/5 in the legs were preserved. MRI abnormalities of the brain were reversed 21 days after discharge.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_310_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_310_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..5bda743ee00fce9a5d062e57e3b3224359f50ba4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_310_en.txt
@@ -0,0 +1,7 @@
+A 64-year-old man visited the local medical center on March 4th with a complaint of general weakness, myalgia, and abdominal pain, which had begun a week prior to the visit.
+The patient underwent computed tomography (CT) at the local medical center where he was diagnosed with thrombosis of the SMV, and was subsequently transferred to our hospital. The abdominal CT scan revealed a large thrombus running straight from the SMV gastrocolic trunk to the distal site, totally obstructing a segmental portion of the SMV. Additionally, the surrounding fat stranding and bowel wall edema of the ascending colon were confirmed.
+The patient had a fever of 37.9 °C at the time of the visit, and complained that he felt hot. He also complained of a headache, but there was no cough, sputum, diarrhea, or vomiting.
+Over the previous 5-years, the patient had been prescribed 1000 mg metformin once daily (Q.D.), 1 mg glimepiride Q.D., 2.5 mg linagliptin Q.D., 50 mg losartan Q.D., and 10 mg rosuvastatin Q.D. for hypertension and diabetes.
+The patient continued to complain of a dull pressing pain in the right upper quadrant, with mild tenderness in the area during the physical examination. The bowel sound was hypo-active, and there were no other specific findings in other physical examinations.
+Blood tests revealed that the white blood cell count was 16160 /mL, the level of ESR was 86 mm/hr, and the level of HS-CRP was 16 mg/dL. Although SMV thrombosis was diagnosed, the patient only complained of mild tenderness, and no rebound tenderness. However, there were complaints of fever and muscle pain throughout the body. Since the patient’s symptoms were considered atypical for SMV thrombosis, a sample was collected through a nasopharyngeal swab and an Influenza A/B rapid antigen test was performed. The influenza test was performed using "The BD Veritor™ Plus System for Rapid Detection of Flu A+B" kit, sensitivity 81.3% (71.1%, 88.5%, 95% confidence interval), specificity 98.2% (95.7%, 99.3%, 95% confidence interval). In addition, after collecting samples through nasopharyngeal swab, coronavirus disease-2019 (COVID-19) test by RT-PCR was performed by taking account of recent pandemic situation.
+The abdominal CT scan revealed a large thrombus running straight from the SMV gastrocolic trunk to the distal site, totally obstructing a segmental portion of the SMV. Additionally, the surrounding fat stranding and bowel wall edema of the ascending colon were confirmed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3114_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3114_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..859e357b26e432df93987618ee6453ea6f22ff53
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3114_en.txt
@@ -0,0 +1,6 @@
+61-year-old man was referred to the cardiologist at a highly specialized Danish university hospital, Rigshospitalet, for an evaluation of severe congestive heart failure (CHF) in 2017. He had a history of CHF, dilated cardiomyopati since many years and left ventricular ejection fraction at 20%. About half a year ago, he had an ablation due to tendency to ventricular tachycardia. He was assessed to NYHA class III and had multiple heart failure-related hospitalizations in the past few years. He presented a clinical challenge, as it was difficult to control his fluid balance. He was deemed a candidate for a CardioMEMS device, which was implanted in the fall 2018 without complications. His pulmonary artery pressure was found too high, and subsequently tried lowered by many different kinds of diuretics. However, trying to drain his fluid overload by diuretics turned out to have severe adverse effects:
+
+○ Kidney parameters increased rapidly
+○ Hypokalemia
+○ Ventricular tachycardia
+In a little more than 3 months’ time, the patient went from a state of CHF with diuresis to a state with chronic kidney disease and anuria. He started on a hemodialysis regime with in-hospital dialysis three times weekly through a central venous catheter. After 8 dialysis sessions, he was in start 2019 referred to Department of Nephrology at a bigger university hospital outside Copenhagen, North Zealand University Hospital, Hillerød. This rare combination of having an implanted CardioMEMS device and ongoing hemodialysis gave the possibility to invasively monitor pulmonary pressure in course of the dialysis sessions, and compare the results to clinical assessment and bioimpedance analysis. The sessions were conducted. Bioimpedance2. Bioimpedance (BIA) was measured by a multifrequency portable whole-body bioimpedance spectroscopy device (Fresenius Medical care). By intradialytic hypotension is understood a decrease in systemic blood pressure along with clinical symptoms as assessed by the responsible dialysis nurse. Pre-dialytic blood samples was planned once weekly. Endpoint was set to be either 10 dialysis, patient death or withdrawal for other reasons.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3124_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3124_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..00a3914de7a6b3940f402ffe2678fda8760e1709
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3124_en.txt
@@ -0,0 +1,19 @@
+We report the case of a 52-year-old patient from Bangladesh, diabetic and hypertensive, referred for exertional angina Canadian Cardiovascular Society III. A stress myocardial scintigraphy was performed and revealed deep hypoperfusion in the antero-apical, septo-apical, and lateral walls with electric positivity on the stress test; resting left ventricle ejection fraction was 61%. His clinical examination revealed a blood pressure of 127/85 mmHg, a heart rate of 92 b.p.m., and a normal oxygen saturation. No murmurs were detected, and there were no signs of heart failure. His electrocardiogram showed a sinus rhythm without significant repolarization abnormalities.
+
+We performed a diagnostic coronary angiogram in this context. Left injection revealed a stenosis on a third significant diagonal branch and a circumflex of very poor calibre. However, we were struck by the appearance of the LAD, which seemed to stop at its mid-segment without wrapping around the apex and did not present a stump that could suggest a chronic occlusion.
+
+The injection of the right coronary sinus revealed a dominant RCA free of stenosis. At the end of the injection in right anterior oblique and left anterior oblique views, we noticed a vessel opening into the ostium of the RCA and following the classic path of an LAD. A non-selective injection into this artery with a diagnostic JR 4 catheter (Judkins Right) identified an ostial-proximal stenosis of this artery but did not allow complete opacification of the distality of the vessel. Percutaneous coronary intervention of the third diagonal was performed during this procedure.
+
+The coronary CT scan performed for a better characterization of this AAOCA identified an artery whose course is compatible with a mid and distal LAD. This artery connects in the right coronary ostium and joins the interventricular groove to wrap around the apex of the heart.
+
+
+Intervention
+Given the evidence of ischaemia on stress myocardial scintigraphy in the apical territory, we decided to perform angioplasty on this AAOCA. We used a 6F IM guiding catheter (Internal Mammary) through a right radial access to engage the ostium of the RCA. We first positioned a workhorse wire (RUNTHROUGH® NS Extra Floppy) in the right posterolateral artery to stabilize the guiding catheter, and then navigated within the AAOCA using a polymerjacket wire with a hydrophilic coating (ASAHI SION® black).
+
+Since the proximal injection did not allow the visualization of the distal part of the AAOCA, we performed a distal injection through a microcatheter, which revealed a severe stenosis in the mid LAD.
+
+We treated the distal lesion with a drug-eluting stent (DES) 2.25 × 15 mm and the mid lesion with a drug-eluting balloon (DEB) 2.0 × 15 mm. The ostial-proximal segment was treated with a DES 2.5 × 15 mm.
+
+
+Outcome
+The final angiographic result was satisfactory. At the end of the procedure, a contralateral injection was performed, confirming the discontinuity of the AAOCA with the native LAD. The post-procedural course was uneventful, and the patient was discharged the following day.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3158_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3158_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..9399859c1faab6ac4c30d9cb96359b7c549451ed
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3158_en.txt
@@ -0,0 +1,5 @@
+A 27-year-old young adult Ethiopian female patient who is known to have chronic rheumatic valvular heart disease for the past 8 years started to experience repetitive uncontrollable movements of her extremities and trunk since 3 years ago and which were occurring once to three times per month. The abnormal body movements usually lasted up to a week duration and got worse while she tried to sit or walk and improved with rest. She was consistently taking intramuscular injection of benzathine penicillin G 1.2 million units every month for the past 8 years. She did not have previous history of behavioral and emotional lability. She does not remember childhood history of rheumatic fever or movement disorder. She did not use oral or injectable hormonal agents. There was no family history of rheumatic fever, social stress, psychiatric disease, or tic disorders. Upon physical examination, temperature was 36.7°C, heartbeat was 90 beats per minute, and blood pressure was 100/70 mmHg. There was holosystolic murmur at the apical area radiating to the left axilla. Choreiform movements were apparent on all limbs and trunk.
+
+Laboratory investigations revealed moderate leukopenia (but with a normal repeat complete blood count after 3 days), normal liver enzymes, normal renal function tests, erythrocyte sedimentation rate of 37 mm/hour, negative qualitative C-reactive protein, weakly positive anti-streptolysin O antibody, negative qualitative antinuclear antibody, negative urine human chorionic gonadotrophin and normal level of thyroid stimulating hormone. Magnetic resonance imaging of the brain showed left parietal periventricular tiny white matter non-specific lesion. Rheumatic heart involvement was confirmed by echocardiography which showed thickening of mitral valve leaflets with severe mitral regurgitation.
+
+The present case was diagnosed as recurrent Sydenham chorea based on clinical evidence and she was prescribed valproic acid 500 mg PO/day for 2 weeks and benzathine penicillin G injection was made every 3 weeks. She was re-evaluated after 2 weeks and she had significant improvement with good control of motor activity and reduced involuntary movements of her extremities and trunk. She was then followed every 3 weeks for the subsequent 3 months and she did not have any abnormal body movement. She was finally referred to an advanced cardiac center for possible mitral valve replacement.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3179_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3179_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..265a4a96789026a10b296c8a45dbca414d581473
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3179_en.txt
@@ -0,0 +1,7 @@
+An 18-year-old patient came to our clinical center for correction of local chest deformity. This patient’s chest deformity is congenital. The patient did not receive any treatment. When examining the chest, there is a complete absence of the pectoralis major muscle on the right, local retraction at the level of the 3rd and 4th intercostal spaces, incomplete development of the right nipple, and thinning of the subcutaneous fat layer of the skin.
+
+The patient is asthenic, height - 184 cm, weight - 59 kg. BMI - 17.4. After hospitalization, the patient underwent a computed tomography scan of the chest, which revealed local depression of the chest at the level of the third and fourth ribs and deformation of the cartilaginous parts of the ribs. After preoperative preparation, the patient underwent thoracoplasty with the installation of a wire-frame structure.
+
+The operation took place under intubation anesthesia. After processing the surgical field, an arcuate incision was made along the anterior wall of the chest from the level of the second rib on the right to the fifth intercostal space on the right. The skin is dissected, subcutaneous fat, periosteum and soft tissues are mobilized to the outer boundaries of the deformity. A defect in the third and fourth ribs on the right is visually noted. After skeletonizing the II to V rib on both sides to the outer boundaries of the deformation, the ends of the III and IV ribs were skinned. An autograft was taken from the cartilaginous part of the 5th rib. Then a frame structure is formed using Kirschner wires.
+
+Additional costotomies of the third and fourth ribs on the right were also performed. The wound is washed and sutured tightly in layers, leaving a drainage tube. The operation time was 80 minute, intraoperative blood loss was 2000 mL. The next day after the operation, the patient was activated and rehabilitation measures were started (breathing exercises, inhalations). The drainage tube was removed on the second day after surgery. The patient was discharged 4 days after surgery. The sutures were removed 14 days after the operation. A follow-up examination of the patient was carried out 6 months after the operation. Clinical and tomographic results are satisfactory. Removal of metal structures is planned no earlier than 2 years after the operation. The purpose of our operational manual is to restore the frame structure of the cage. The second stage of surgical treatment is the replacement of the pectoralis major muscle defect with a silicone prosthesis. However, this operation is performed by aesthetic surgeons.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3196_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3196_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f7537737099a538202ebdf08f11468da6afaea0f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3196_en.txt
@@ -0,0 +1,5 @@
+After experiencing constipation and abdominal distension for three days, a 55-year-old man was brought to the emergency department for treatment. The patient had a fever following an upper respiratory illness 9 days before admission. He had neither a history of anticholinergic prescription use nor recent abdominal surgery. His vital signs upon arrival were as follows: His temperature was 37.8°C, his pulse rate was 92 beats per minute, his respiratory rate was 20 breaths per minute, and his blood pressure was recorded at 151/99 mmHg upon arrival. He had a swollen, non-tender, tympanitic belly and no audible bowel sounds during auscultation. Hepatosplenomegaly or peritoneal irritation signs were absent in the patient. Urinary retention was not noticed. Abdominal ultrasound revealed diffuse abdominal gas distention and a dilated small intestine. On auscultation, active peristalsis was absent.
+
+Three days after abdominal distension, the patient developed ascending weakness in both upper and lower extremities. A neurological evaluation revealed sensory deficiencies (reduced sensation to touch and reduced sensitivity to pain, while vibration and joint position sense was intact) and decreased muscle strength (3/5 both upper and lower extremities based on the MRC scale). The patients’ s deep tendon reflexes were absent in both upper and lower extremities. Plantar reflexes were muted bilaterally. His initial bowel distension was not considered a neurological manifestation; however, the development of symmetrical quadriparesis caught the neurologist’s attention.
+
+Routine biochemical studies, including serum potassium level (4 mEq/L) and other blood tests, showed no abnormal findings. Magnetic resonance imaging of the brain, cervical, and thoracic spinal cord did not reveal any underlying brain or spinal pathology. Abdominal CT with contrast showed markedly delayed bowel without mechanical obstruction, which suggested paralytic ileus, and no contrast passed through the duodenum during a 6-hour small bowel series examination. Over the next few days of total parenteral feeding and prokinetic use (metoclopramide 10 mg IV TID), the patient showed persistent severe ileus. A nerve conduction study (done 4 days of symptom onset) demonstrated demyelinating sensorimotor polyneuropathy. Cerebrospinal fluid analysis showed a normal white blood cell count (2 WBC/μL), high protein (819.9 mg/L; reference: 150–450 mg/L), and a glucose level of 55 mg/dl. This showed albumin-cytological dissociation. Based on the clinical presentation, neurophysiologic findings, and CSF findings, we diagnosed him with Guillain-Barre syndrome. Immediate treatment with intravenous immunoglobulin (IVIG) 0.4 g/kg daily for 5 days was initiated. Five days after the onset of motor weakness, the patient’s condition rapidly progressed to involve bilateral facial paralysis (facial diplegia) and dysphagia. In the next few days, the patient developed respiratory failure requiring mechanical ventilation due to diaphragmatic weakness. The patient was transferred to the intensive care unit. After 2 months of intubation in the intensive care unit, the patient passed away due to septicemia. In this case, the patient presented with paralytic ileus as a type of dysautonomia; however, it was not recognized as GBS dysautonomia. The later emergence of motor weakness and sensory disturbances prompted the consideration of GBS.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3215_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3215_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..14e2162d273ffed9a99798078ed820f479009fef
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3215_en.txt
@@ -0,0 +1,5 @@
+A 13-year-old girl with intellectual disability experienced epilepsy and fatigue for two years, with a recent event of edema, breathlessness, and nocturnal dyspnea that prompted admission to the Cardiology Department of Beijing Children’s Hospital. She had a fever and convulsions 2 years before admission and was treated with oral digoxin, prednisone acetate, and captopril at another hospital. Her prenatal and perinatal history was unremarkable. Her family had no similar health issues.
+
+Two weeks before admission, the girl developed a cough, worsening dyspnea, breathlessness, and orthopnea. Antibiotics failed to improve her condition. Physical examination exhibited systolic murmur, jugular vein distention, and enlarged liver and spleen. Blood biochemistry showed elevated blood urea nitrogen (BUN) (12.95 mmol·L− 1), creatinine (1.1 mg·dl− 1), uric acid (734.1 µmol·L− 1), aspartate aminotransferase (63.8 U·L− 1), and alanine aminotransferase (97.6 U·L− 1) and low estimated creatinine clearance rate (53.98 ml/min/1.73 m2; bedside Schwart estimation). Troponin-I (0.132 ng·mL− 1) and N-terminal pro-brain natriuretic peptide (NT-proBNP) (15,906 pg·mL− 1) levels were significantly increased. Blood pressure was 100–122/65–84 mmHg. The urine routine showed no abnormalities, including white cells, red cells, or proteinuria. The 24-hour urine volume was 820–1100 ml. Tests for urine organic acids and plasma amino acids were negative. Echocardiography showed a low ejection fraction (34%) and fractional shortening (16%). Echocardiography indicated heart enlargement and ventricular hypertrophy, suggesting cardiomyopathy. Edema, dyspnea, elevated NT-proBNP levels, and reduced ejection fraction were all indicative of heart failure. In addition, echocardiography revealed left cardiac dysfunction, general heart enlargement, ventricular hypertrophy, massive pericardial effusion, moderate regurgitation in multiple valves, and a severely reduced ejection fraction of 35%, further supporting the diagnosis of heart failure. Electrocardiography indicated paroxysmal ventricular tachycardia and ST-T wave alterations. Routine urine tests and a kidney ultrasound were conducted, revealing no evidence of proteinuria, hematuria, or morphological changes typical of NPHP, such as corticomedullary cysts or significant structural abnormalities. No kidney biopsy was performed, limiting a conclusive diagnosis of a kidney pathology based on histological assessment. Although the blood tests indicated elevated BUN and creatinine, these findings were considered to be acute kidney injury due to severe cardiac failure, which might lead to impaired kidney perfusion rather than primary kidney disease. After informed consent, genetic testing was conducted on the patient and her relatives. After filtering the non-candidate variants of the proband from the databases, a homozygous splicing mutation, XPNPEP3 c.970–2 A > G, was detected in intron 6, and no other related significant mutations were identified, establishing a diagnosis of NPHPL1. Using Sanger sequencing, this mutation was confirmed in the proband’s asymptomatic brother (heterozygous) and parents (recessive carriers). ESEfinder v.3.0 (http://rulai.cshl.edu/tools/ESE) predicted that c.970–2 A > G may reduce the binding of the splicing factors SRSF2 and SRSF5 to their target sequence, suggesting that the mutation may lead to abnormal splicing of XPNPEP3. Similar results were predicted by Human Splicing Finder (HSF) and the NetGene2 servers. Moreover, the experimental results of the minigene approach confirmed the deleterious effect of c.970–2 A > G. Agarose gel electrophoresis analysis of the PCR fragments revealed that the wild-type transcript had a longer band of 412 bp. In contrast, the mutant exhibited only one band of 326 bp, with the 86 bp band being absent. Sanger sequencing confirmed that the mutant plasmid transcribed a mature mRNA product with exon 7 being skipped entirely (86 bp del, c.970_1055del, NM_022098) in the mature mRNA, suggesting that c.970–2 A > G leads to the abnormal splicing of XPNPEP3 in the absence of nonsense-mediated mRNA decay.
+
+Upon admission, the patient received digoxin, milrinone, furosemide, hydrochlorothiazide, and spironolactone to enhance heart function and metoprolol to manage arrhythmias. Despite these interventions, she developed worsening edema, kidney failure, hypotension, and sustained ventricular tachycardia within 5 days. Her parents opted to transfer her to another facility for continued care. Tragically, the child passed away approximately 1 week after discharge. It is believed that the cause of death may originate from arrhythmias, as the child had ventricular tachycardia, which could lead to malignant arrhythmias and result in sudden cardiac death. Furthermore, the exacerbation of heart failure, likely due to complications from end-organ damage, may also have contributed to the outcome.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_325_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_325_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..779be324eb0274ebf4b7dcbf5a0096ea2e6bc063
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_325_en.txt
@@ -0,0 +1,6 @@
+A 12-year-old entire male Basset Hound presented with a 1 week history of tenesmus, bloody penile discharge and anorexia, and polyuria and polydipsia of 2 days’ duration. General examination revealed mild dehydration and a high rectal temperature (39.5 °C). Digital rectal examination and caudal abdominal palpation revealed an enlarged, symmetrical and painful mass that extended from the cranial hypogastrium to the pelvic cavity, just cranial to the prostate. The prostate was smooth, non-painful and of a normal size. Scrotal palpation revealed diffusely swollen scrotal tissue and vaginal tunics, and small, solid, non-painful testes. There was a mucopurulent discharge from the external orifice of the urethra.
+Haematology revealed mild non-regenerative anaemia, leucocytosis and neutrophilia with left shift. A serum biochemistry panel yielded results consistent with dehydration: slight increases in alanine aminotransferase (112 U/L; reference range: 20–98 U/L), alkaline phosphatase (125 U/L; reference range: 17–111 U/L) and hyperglobulinaemia (78 g/L; reference range: 24–40 g/L) were noted. Subsequent endocrine evaluation revealed a low serum testosterone concentration (0.9 ng/ml; reference range: 1.5–8.5 ng/ml; radioimmunoassay) and high concentrations of oestradiol (32 pg/ml; reference range: < 15 pg/ml; radioimmunoassay) and progesterone (3.1 ng/ml; reference range for neutered females: < 1.0 ng/ml; radioimmunoassay).
+Abdominal ultrasonography revealed a hypoechoic hollow lesion that was 10 cm in length and up to 4 cm wide, which was adjacent to the prostate and extended cranially, beyond the level of the apex of the urinary bladder . The prostate was normoechoic and had a diameter of 2.5 cm. The urinary bladder was moderately full and had a wall of normal thickness, without irregularities. Cystocentesis of the urinary bladder was performed, and the fluid obtained was submitted for biochemical and cytological evaluation, as well as culture and sensitivity testing. The urine was clear, and had a pH of 7.0 and a specific gravity of 1.020. The urine cytology was normal and the bacterial culture was negative. Cystocentesis of the cystic structure revealed that it was filled with a dark mucopurulent liquid . Cytological examination of this revealed abundant mature and degenerate neutrophils, a small number of large polygonal epithelial cells and a low N:C ratio . Clusters of rods and cocci were also found. Subsequent culture of the fluid showed the presence of Escherichia coli.
+Exploratory laparotomy revealed the presence of a single, large paraprostatic cyst that was located dorsal to the neck of the urinary bladder, arose from the prostate, extended cranially into the abdominal cavity, and had two horn-like blind-ended tubes that were suspended from the genital fold . The ducti deferentia lay lateral to the cyst. The cyst was ligated and fully resected, and the abdominal cavity was closed in routine fashion. The testes were removed via a scrotal approach and then scrotal ablation was performed. Both testes were firm and small (2 cm in diameter and 3.5 cm in length). A 10 day course of oral amoxicillin/clavulanic acid (Nisamox, Norbrook; Newry, United Kingdom; 12.5 mg/kg twice daily) was then administered and post-operative analgesia was provided using meloxicam (Metacam, Boehringer Ingelheim; Germany; 0.1 mg/kg once daily for 7 days).
+The tenesmus and penile discharge resolved immediately following the surgery and examinations conducted 10, 30, and 60 days later were unremarkable. Ultrasonography performed 60 days after surgery revealed normal hypogastric and pelvic anatomy.
+Histopathology of the paraprostatic cyst showed that it was a tubular structure, lined by simple columnar epithelium that contained glands, and therefore resembled endometrium. It also had a smooth muscle layer, but no evidence of neoplasia. Mild lymphocytic, neutrophilic, plasmacytic and eosinophilic inflammatory cell infiltration was also present. A histological diagnosis of true uterus masculinus was made . Histopathological examination of sections prepared from the testes revealed the presence of neoplastic changes in the seminiferous tubules. The mass was composed of neoplastic intratubular Sertoli cells and a significant scirrhous reaction. The cells showed mild anisocytosis and anisokaryosis, were fusiform in shape and contained a moderate amount of eosinophilic cytoplasm, with variably distinct cellular borders. Their nuclei were oval and euchromatic, and contained stippled chromatin and a single basophilic nucleolus. Three mitotic figures were present. Therefore, a histological diagnosis of bilateral Sertoli tumour was made.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3268_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3268_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c75b442d980fa1ffd528bdfd5fe2370dad364d7f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3268_en.txt
@@ -0,0 +1,4 @@
+We present the case of a 10-year-old girl whose left arm was injured by a fall from a height of approximately 1.5 m. The patient was transported to a nearby hospital on the same day and referred for treatment on the second day after the injury. X-rays revealed a modified Gartland type 2B supracondylar humerus fracture, a Bado type I Monteggia fracture–dislocation, and a Salter–Harris type II distal radius physeal fracture with volar displacement in the ipsilateral upper extremity. No neurovascular symptoms or open wounds were noted. Surgical treatment was performed on the third day after the injury. Surgery was performed with the patient in the supine position. Reduction and fixation of the distal radius physeal fracture were performed to restore radial length prior to reduction of the humeroradial joint. The distal radius physeal fracture was reduced and fixed using steel wire-connected pins (JuNction, Arata, Japan) through closed reduction and percutaneous pinning. Next, manual reduction of the humeroradial joint was performed; however, it was difficult to achieve the reduction position. It was considered that the inability to achieve reduction was the interposition of soft tissue within the humeroradial joint. The supracondylar humerus fracture showed no progression of dislocation during the reduction maneuver; therefore, open reduction of the humeroradial joint was performed. The tourniquet was inflated to 200 mmHg and used for 60 min. An open reduction of the radial head was performed through a posterior approach. With the posterior approach, triceps splitting is performed proximal to the olecranon, and as per the Boyd approach, the humeroradial joint was exposed by detaching the anconeus muscle from the radial side of the ulna distal to the olecranon. The annular ligament was incarcerated within the humeroradial joint, preventing reduction. A partial longitudinal incision was made through the annular ligament, allowing for easy reduction of the radial head. The absence of instability in the forearm during pronation and supination was confirmed following the reduction of the humeroradial joint. Reduction of the humeroradial joint resulted in an appropriate reduction position for the ulnar diaphyseal fracture. The ulnar diaphysis fracture was fixed with a titanium elastic nail (TEN) to prevent displacement. Steel wire-connected pins were used to fix a supracondylar humerus fracture. The postoperative X-rays showed a good reduction position. Postoperatively, a long arm splint was applied to the forearm in a supinated position, and no postoperative drainage was performed. At 5 weeks postoperatively, as callus formation was favorable, the steel wire-connected pins for the supracondylar humerus and distal radius physeal fractures, along with the splint fixation, was removed, and range of motion training for the elbow and wrist joints was initiated. At approximately 3 months postoperatively, bone union was confirmed on X-rays. Approximately 6 months postoperatively, the ulnar TEN was removed. Intraoperatively, Fluoroscopic imaging under general anesthesia was used to evaluate the instability of the humeroradial joint. No instability was noted in the humeroradial joint during forearm pronation.
+
+Approximately 1 year after surgery, the elbow joint range of motion was 10° extension, 150° flexion, 90° pronation, and 90° supination, with no range of motion limitation. X-rays showed that bone union had been achieved at each fracture site with good alignment. The patient was unaware of any symptoms in her daily life, and her Mayo Elbow Performance score was 100.
+
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3337_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3337_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..759a2c2c481cd58f14ec04d6fe1ae2e6d3a2f59e
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3337_en.txt
@@ -0,0 +1,5 @@
+The patient was a 78-year-old male smoker (half-pack per day for 50 years) who presented with progressive cough, dyspnea, and hemoptysis. Computed tomography (CT) and whole-body positron emission tomography (PET) imaging revealed 4.6 × 4.8 cm right lower lobe (RLL) and 4.8 × 2.7 cm left lower lobe (LLL) spiculated masses with increased avidity. Axillary and mediastinal lymph nodes, including subcarinal nodes, were normal in size and avidity. CT-guided percutaneous core needle biopsy of the RLL mass was performed. Histopathological examination revealed an invasive adenocarcinoma composed of acini lined with tall columnar epithelium with focal cribiforming and luminal necrosis. These cells were strongly reactive with CK-20 and CDX-2, moderately reactive with CK-7, and nonreactive with thyroid transcription factor (TTF)-1/napsin-A, which was concerning for gastrointestinal metastasis. Further evaluation with esophagogastroduodenoscopy, colonoscopy, and whole-body PET was unrevealing for gastrointestinal primary. Special AT-rich sequence-binding protein 2 (SATB2) staining of the RLL mass was also nonreactive.
+
+Endobronchial ultrasound (EBUS) was subsequently performed to complete mediastinal staging, which demonstrated a concerning level 7 subcarinal lymph node that had previously been undetected on CT/PET imaging. Transbronchial needle aspiration was performed on the LLL mass and the level 7 lymph node. Histopathological examination of both specimens revealed neoplastic cells with abundant cytoplasm and large hyperchromatic nuclei with prominent nucleoli. In contrast to the RLL, these cells were immunoreactive to TTF-1/napsin-A, and nonreactive to p40 and p63 antibodies, indicating a primary conventional lung adenocarcinoma. Next-generation sequencing (NGS) also revealed discordant profiles. The RLL mass had an intermediate tumor mutational burden (19 mutations/Mb), programmed death ligand-1 (PD-L1) tumor proportion score of 0%, KRAS wild type, and mutations in CDKN2A, NOTCH1, and TP53. NGS of the LLL adenocarcinoma demonstrated EGFR amplification, an intermediate tumor mutational burden (11 mutations/Mb), loss of CDKN2A/B, and mutations in RBM10 and TP53.
+
+After completion of mediastinal staging, the patient was diagnosed with pulmonary enteric adenocarcinoma of the right lobe (T2bN0M0) and conventional adenocarcinoma of the left lobe (T2bN2M0). He received palliative intent chemoimmunotherapy with carboplatin, pemetrexed, and pembrolizumab leading to complete response of the RLL PEAC and a partial response of the LLL adenocarcinoma at 6 months post-diagnosis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3350_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3350_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..cc12e30f495a51e01c4ad2f23da7ac081f161278
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3350_en.txt
@@ -0,0 +1,11 @@
+A 51-year-old male, a bricklayer by profession, presented to our clinic with complaints of left testicular pain, swelling, and an ulcer with purulent secretion over the last two weeks. The patient had a remote medical history, including chest pain and hemoptysis 11 years prior, at which time a CT scan revealed excavated lesions in the right lung apex, suspicious of tuberculosis (TB). He had not received any anti-TB therapy at that time.
+
+On physical examination, the left scrotum was significantly enlarged, with a palpable mass occupying the entire scrotal sac. The mass altered the intrascrotal structure, and there was an ulceration over the scrotal skin, secreting purulent material. The right testis appeared normal on examination. The patient denied fever, systemic symptoms, or trauma.
+
+The patient was referred for further imaging, including ultrasound (US), to assess the scrotal mass and guide further management. US of the left testis showed a dysmorphic testicle with irregular, blurred contours. The testis was reduced in size, and its structure was non-homogeneous, with areas of hypoechogenicity suggesting fluid or abscess formation. These findings raised concern for a testicular abscess. Additionally, there was evidence of a non-homogeneous mass extending from the testis to the scrotal skin, indicating possible extension of the infectious process. Color Doppler US revealed reduced vascularity within the testicular parenchyma, further suggesting an abscess or significant inflammatory process rather than a malignancy. The ipsilateral epididymis was not clearly identifiable, which is consistent with an advanced inflammatory process affecting the testis. The right testis appeared normal, with no abnormal findings on ultrasound.
+
+Given the clinical presentation and imaging findings, the differential diagnosis included a testicular abscess, a rare manifestation of testicular tuberculosis. The possibility of a testicular tumor could not be excluded based on imaging alone, and further diagnostic evaluation was necessary.
+
+The patient underwent left epididymo-orchidectomy to excise the testis and address the infectious process. Intraoperative findings revealed extensive involvement of the testis by a necrotic and abscessed lesion. Laboratory tests, including blood cultures and tissue cultures, confirmed the diagnosis of active tuberculosis. The patient was started on a standard anti-TB regimen consisting of rifampicin, isoniazid, pyrazinamide, and ethambutol. This regimen was continued for a total of six months, with the first two months consisting of all four drugs and the remaining four months with rifampicin and isoniazid. Testicular tumor markers, including alpha-fetoprotein (AFP) and human chorionic gonadotropin (hCG), were negative, ruling out testicular malignancy.
+
+At the 6-month follow-up, the patient reported complete resolution of testicular pain and swelling, with no recurrence of scrotal ulceration.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3353_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3353_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3373d72c445c685ad7ee041a839944ad29f6249d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3353_en.txt
@@ -0,0 +1,61 @@
+Patient details and presentation
+A male Japanese patient in their 30s developed epilepsy in 2017, initially attributed to behavioral anomalies during sleep. Focal epilepsy was diagnosed and controlled with levetiracetam 1500 mg and clonazepam 1 mg until 2019. However, in 2021, the patient began experiencing focal impaired awareness seizures. Owing to the occurrence of seizures approximately once per month, the patient was referred to the epilepsy department of our hospital. These seizures involved loss of consciousness following “déjà vu” sensations. At the time of referral, the patient was on four antiepileptic drugs: levetiracetam, 1500 mg; lacosamide, 300 mg; perampanel, 2 mg; and clonazepam, 1 mg. Despite using multiple antiepileptic drugs with different mechanisms of action, seizure suppression remained suboptimal, leading to the decision to implement a surgical approach.
+
+
+Summary of progress
+
+Preoperative course	
+2017: onset of seizure symptoms with behavioral abnormalities during sleep
+
+2018: start of LEV
+
+2019: seizures suppressed by adding CZP
+
+2021: the patient was referred to our hospital because his seizures were not controlled despite the addition of CZP, LCM, and PER
+
+Test results	
+Electroencephalography: spiny waves were observed in the bilateral antero-medial temporal regions
+
+It was difficult to identify the starting point from EEG findings during seizure
+
+Head MRI: no obvious abnormal findings. No hippocampal sclerosis or atrophy
+
+FDG-PET: hypoglycemia in the left anterolateral temporal region
+
+Surgery	
+Intracranial electrode implantation: subdural electrodes were implanted in the lateral and medial left temporal lobe, and in the frontal lobe. Intracranial electrodes were placed in the lateral and medial left temporal lobe, and frontal lobe.
+
+Intracranial EEG during seizure showed repeated spikes in the temporal pole followed by propagation to the lateral temporal lobe
+
+Focal resection: resection of the left lateral temporal lobe, including the temporal pole, was performed. Intraoperative hippocampal wave recordings showed a low frequency of spikes, so the hippocampus was preserved
+
+Post-surgery	Four months postoperatively, FAS recurred. One year after surgery, FIAS disappeared
+
+
+Glu-CEST MRI
+Pre-surgery MRI was performed using a UHF (7 Tesla) MRI system (MR950; GE Healthcare, Chicago, IL, USA) with a 32-channel head coil (Nova Medical, Houston, TX, USA) at the Center for Integrated Brain Function Research, Niigata University Brain Research Institute. T1-weighted three-dimensional magnetization-prepared rapid acquisition gradient echo scans were acquired with the following parameters: field of view = 220 × 220 mm2, matrix = 220 × 220, repetition time/echo time = 4.1/1.4 ms, flip angle = 4°, and slice thickness = 1 mm.
+
+On the basis of the three-dimensional T1 data, the CEST image slice was determined. CEST images were corrected for the B0 field distribution using water saturation acquisition [14]. To correct for B1 inhomogeneity, we followed the method of Cember et al. which leverages classification based on T1 values and a measured effective B1 irradiation pulse intensity distribution map to enhance CEST imaging [15]. A single-slice CEST image sequence based on fast spin echo was then acquired with the following parameters: field of view = 220 × 220 mm2, matrix = 128 × 128, repetition time/echo time = 10,000/5.8 ms, flip angle = 70°, and slice thickness = 4 mm. CEST imaging was conducted using a pulsed CEST preparation of eight sinc pulses of 100 ms each with a 10 ms interpulse delay (total saturation time of 800 ms) and a root mean square (RMS) amplitude of 3.0 μT. A total of 31 frequencies were acquired, each spaced by 100 Hz, ranging from −1500 to +1500 Hz.
+
+B0 and B1 corrected CEST images were used to calculate the Glu-CEST MRI using the following equation:, where S (−3.0 ppm) denotes the signal intensity after the saturation pulse with an offset of −3.0 ppm from the water peak, and S (+3.0 ppm) represents the signal intensity after the saturation pulse with an offset of +3.0 ppm from the water peak. Glutamate exhibits a CEST effect at approximately +3.0 ppm downfield from the bulk water resonance.
+
+
+Observations
+The patient exhibited no obvious paralysis, sensory disturbances, or other abnormal neurological findings. In addition, there was no history of cerebrovascular or cardiovascular disease that could have contributed to loss of consciousness.
+
+Interictal EEG revealed sharp waves localized at F7 and F8, although seizure recordings failed to demonstrate a distinct onset pattern. MRI revealed no evident abnormalities, while magnetoencephalography identified a cluster of dipoles within the left insular cortex. Fluorodeoxyglucose-positron emission tomography (FDG-PET) indicated reduced glucose metabolism in the left temporal pole. Neuropsychological testing showed normal intellectual and memory functions.
+
+All tests were performed without administering sedatives or other medications. FDG-PET was performed after the patient fasted for at least 6 hours. These tests were performed 1 year before surgery.
+
+On the basis of the findings, epileptogenic regions were suspected within the left frontal and temporal lobes. However, the precise focus could not be determined, making it difficult to differentiate between medial and lateral lobe epilepsy. Consequently, intracranial subdural electrodes were implanted in the lateral and basal regions of the left frontal lobe, the lateral aspect of the left temporal lobe, and the medial temporal lobe. Interictal intracranial EEG revealed discrete spikes from the basal left temporal lobe, anterior to the left parahippocampal gyrus, and from the lateral aspect of the left temporal lobe. During three recorded intracranial EEG seizures, a pronounced spike was identified in electrodes located between the distal portion of the left temporal lobe and the parahippocampal gyrus, followed by propagation to the lateral temporal cortex (Fig. 1A). Subsequently, anterior temporal lobectomy was performed, encompassing the distal tip of the left temporal lobe, the basal region, and the middle and inferior temporal gyri (Fig. 1D and E). Intraoperative EEG recordings from the surface of the amygdala and hippocampus revealed no discernible spikes from the amygdala, with sporadic low-frequency spikes detected in the posterior aspect of the hippocampus. Therefore, the language-dominant hippocampus and amygdala were preserved to prevent postoperative verbal memory loss.
+
+
+Postoperative MRI indicated no obvious neurological deficits. Focal aware seizures (FAS) recurred 4 months postoperatively; however, no focal impaired awareness seizures were observed 1 year postoperatively. During evaluation 1 year after surgery, the patient was classified as Engel Class Ib. There were no postoperative neurological abnormalities, and psychological tests showed no deterioration.
+
+Glu-CEST MRI was performed the day before intracranial EEG electrode placement. It delineated an elevation in glutamate concentration extending from the left temporal pole to the medial temporal lobe. Subsequently, a 1 × 8 strip electrode was positioned in the corresponding area, revealing a prominent spike in EEG activity at seizure onset from the electrode proximate to the region with heightened Glu concentration. The region exhibiting increased Glu concentration, as identified by Glu-CEST MRI, was encompassed within the resection area (Fig. 1D and E). Histopathological examination of the resected tissue revealed focal cortical dysplasia type IIa (FCD type IIa).
+
+FCD type IIa causes drug-resistant epilepsy and is characterized by histopathologic findings of dysmorphic neurons and absence of balloon cells. Complete resection of the focal area is expected to suppress seizures; however, MRI often shows no abnormalities. The resected area was associated with abnormal EEG activity during seizures and an elevated Glu concentration as detected by Glu-CEST MRI.
+
+In addition, Glu-CEST MRI revealed an increased Glu concentration within the hippocampal head, albeit at a lower magnitude than that in the left temporal pole (Fig. 1C and F). The highest Glu concentrations were observed in the tip of the temporal lobe, followed by the head of the hippocampus.
+
+The Glu-CEST results suggested that the residual seizures were caused by the preserved hippocampal head and may be useful for considering additional surgical treatment in the future.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3357_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3357_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e2604a261486cafc433b9cf921bbce960db94574
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3357_en.txt
@@ -0,0 +1,10 @@
+A 62-year-old female was referred to our hospital as a case of upper airway obstruction secondary to possible advanced thyroid cancer + Grade 5 dysphagia after five days of stay. She presented with anterior neck swelling of 12 years’ duration, which increased in size rapidly over five days with associated fever, shortness of breath, a hoarse voice, difficulty swallowing both solids and a fluid diet, and vomiting of ingested matter. She had long-standing intolerance of heat and irritability, and was easily fatigued, and had experienced unquantified weight loss despite having a good appetite along with anterior neck swelling. Otherwise, she had no history of cough, orthopnea, body swelling, previous neck surgery or trauma, treatment for tuberculosis, or chronic medical illnesses like diabetes, asthma, hypertension, cardiac or renal disease. For the above complaint, she was treated at the referring hospital with oxygen supplementation, ceftriaxone, and dexamethasone for a week but did not show improvement.
+
+Upon presentation, the patient was acutely sick looking, in severe respiratory distress and had a stridor with oxygen saturation (SPO2) of 77% on a 15-liter per minute face mask. She had a respiratory rate of 40–44 breaths per minute, pulse rate of 118 beats per minute, blood pressure of 145/90 mm Hg, and temperature of 37.8 0C. Examination of the neck revealed a large mass more on the right side of the anterior neck, which was shiny without ulceration or discharge. The mass was non-tender and warm to the touch, with a firm-to-hard consistency. It measured 15×13 centimeters, extending from the sternum to the submental area, but had no retrosternal extension on either palpation or percussion. Upon oropharyngeal assessment, the patient had a Mallampati score of III.9 Otherwise, there were no oropharyngeal lesions or cervical lymphadenopathy, and no pertinent findings on other systems.
+
+Laryngoscopic glottis visualization showed complete obstruction of the glottis, class 4 according to the Cormack–Lehane scale, but no visible mucosal infiltration, thickening, or bleeding.9 With the above history and following physical examination, mixed type 1 and 2 respiratory failure, secondary to upper airway obstruction, anterior neck mass compression, and hospital-acquired pneumonia was considered. With this, a difficult airway was anticipated and prepared for double setup airway management but there was no place for a surgical airway. Adequate preparation was made to increase the success rate of endotracheal intubation with a bronchoscope. A rigid bronchoscope with a size of 7 mm was used to visualize the airway and possible intubation; however, we could not advance the scope beyond the glottis area due to the compression effect of the mass causing resistance. No visible infiltrative mass was noted to the level of the airway evaluated. The patient was then intubated with a 6 mm endotracheal tube secured at a depth of 18 cm and put on a mechanical ventilator: AC/VCV mode, FiO2 of 100%, positive end-expiratory pressure of 5 cm of H2O, SPO2 ranging from 96–98%, tidal volume of 360 mL, and rate of 14.
+
+
+Once the patient was stabilized, she was investigated with a complete blood count showing leucocytosis of 25.47×103, with left-shift and moderate anemia. Her thyroid function test result was within the normal range. Fluid analysis from the aspirate of swelling was chocolate-colored thick pus with a cell count of 108,000/mm3, a neutrophil of 85%, and a low glucose level. Gram stain from aspirate revealed gram-positive cocci in pairs; however, culture and sensitivity tests were not done due to their unavailability in our setup. Cytology results from the aspirate demonstrated intense suppurative inflammation along with necrotic material, which raised suspicion of malignancy. Neck ultrasound showed a homogenously hypoechoic avascular midline ovoid mass more on the right, with posterior acoustic enhancement measuring 13×10.7 cm, and a significant mass effect on the cervical esophagus and trachea. Head and neck computed tomography (CT) performed two days prior to her presentation revealed a well-defined lesion, with water attenuation at the right neck region extending from the clavicle inferiorly to the hyoid bone level, cranially measuring 11×10.5x10.8 cm (craniocaudal, transverse, anterior–posterior). The lesion had enhancing soft tissue foci, likely thyroid tissue. The lesion displaced right-side vascular structures postero-laterally and midline structures (larynx, trachea, and esophagus) on the left lateral side, suggesting a large cystic mass originating from thyroid tissue.
+
+Subsequently, after stabilization and initial investigation, incision and drainage (I & D) of the thyroid abscess was done, draining a total of 900 mL thin pus with the initial aspirate. Antibiotics were initiated and wound care was done on a daily basis. The patient was extubated after four days of intubation with improvement. Subsequently, the patient had persistent discharge from the wound and neck swelling increased. A right-side thyroid lobectomy with cystic mass excision was then performed, and a 6×6 cm smooth cystic mass on the right thyroid lobe on an elective base was found interoperatively. The patient was discharged in a better condition after 10 days of stay in the hospital. The biopsy result turned out to be follicular nodular disease.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3376_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3376_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c990a8c0e61ca55702bf82df01e30ee5750344b5
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3376_en.txt
@@ -0,0 +1,5 @@
+A 27-year-old woman with no relevant medical history presented to the emergency department with 15 days of lower limb oedema and a history of oliguria. She reported a weight gain of approximately 5 kg in the past 15 days. On physical examination, she presented hypertensive crisis with bilateral oedema, jugular engorgement, basal crepitations in both pulmonary bases, and stage II oedema with pitting in all four limbs. The admission test showed metabolic acidosis with elevated anion gap, leukocytosis, neutrophilia, normocytic/normchromic anaemia without transfusion criteria, severe hyperkalaemia, KDIGO 3 acute renal injury, and hyperkalaemia electrocardiographic changes. Given the initial approach of hypertensive emergency with a compromised kidney versus a nephritic syndrome, medical management was initiated and, due to refractoriness, haemodialysis was decided in the nephrology department. Further studies with renal ultrasound showed chronic parenchymal process with signs of exacerbation. The patient also had an increase in calcium and phosphorus profile with increased PTH, autoimmune profile with only one positive P-ANCA result (1/160), and negative infectious profile. Clinical evolution showed persistent signs of overload and progressive deterioration of renal function, and glomerulonephritis was considered rapidly progressive. Treatment started with intravenous corticosteroid pulses for 3 days, plasmapheresis (7 sessions) and continuation of renal replacement therapy. Renal biopsy showed glomerulonephritis with increasing and extracapillary proliferation mediated by P-ANCA, and immune complex mediated glomerulonephritis with membranoproliferative pattern superimposed, which is consistent with full-house disease. Due to satisfactory clinical evolution after the first dose of cyclophosphamide, she was discharged for continuation of immunosuppressive treatment and renal replacement therapy with haemodialysis.
+
+Five days after leaving the hospital, the patient was readmitted with a cough with purulent expectoration associated with fever, asthenia and adynamia. The physical examination showed crepitations in both pulmonary bases and stage I edema in the lower limbs. The patient suffered progressive deterioration of the respiratory pattern, had anemia requiring transfusion, findings in the imaging examinations with areas of glass-like opacity and multilobular infiltrates. Antibiotic coverage (cefepime) was initiated and a bronchial brush was performed that detected macroscopic alveolar hemorrhage. The patient presented progressive deterioration of the ventilatory pattern, with the need for orotracheal intubation and transfer to the intensive care unit. After presenting a poor clinical evolution, the patient died.
+
+Microbiological screening studies (blood culture, urine culture, bronchoalveolar lavage culture) were negative. The family did not authorize an autopsy.
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3380_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3380_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d93a6b39fae97c6218953307a34bb63448f8c2f0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_3380_en.txt
@@ -0,0 +1,5 @@
+A 60-year-old male patient complained of a painless mass under the nipple for more than four months. No pain, itching or nipple discharge were noted. The patient had no history of cancer and no specific family history but felt that the tumor was growing. Further immunohistochemistry investigations were recommended because a diagnosis of an invasive breast carcinoma does not exclude breast polymorphic invasive lobular carcinoma or cancer with syngenetic differentiation. The results of these investigations showed that ER, PR, HER2, E-cadherin, P120, CK5/6, and P40 were all negative, although a high expression of Ki-67 was noted. The results obtained from the local hospital that initially treated the patient showed that these immunohistochemistry results were not specific to the liquid obtained from the biopsy, with histological analysis revealing an aggressive cancer morphology. Following intradepartmental consultation, the patient was diagnosed with a highly aggressive breast cancer consistent with a triple-negative breast lesion. The patient decided to receive a new adjuvant treatment, although his relatives complained and asked for further treatment options as there were no other obvious symptoms due to the patient’s preexisting health conditions. This led to the patient seeking treatment at our hospital. An ultrasound examination carried out on admission showed that the larger gland was located below the nipple and measured 4.4 cm x 4.4 cm x 1.4 cm. Striped blood flow signals were observed in the region, with low echoes seen in the shallow fat layer measuring 1.1 cm x 0.5 cm. The integrated ultrasound diagnosis based on the mammography reports and data systems (BI-RADS) was a type 4C right breast parenchymal occupying lesion.
+
+Only a small number of tumor tissue biopsy samples were obtained for histology. Light microscopy showed a greater number of tumor cells and reduced stroma. The tumor cells were linear or trabecular, with some areas being monoline. The local lesions harbored a mixture of cells, with the tumor cells being large and containing fine chromatin and multiple mitotic images. The tumor cells exhibited deep staining and were disproportionate in size. Necrosis and bleeding were not observed. The results of the immunohistochemistry investigations were as follows: AE1/AE3 (-), EMA (+), S-100 (-), CD68 (-), CD3 (weak+), CD20 (-), Pax5 (-), CD30 (+), Bcl-2 (-), CD2l (-), CD23 (-), Bcl-6 (-), MUM1 (+), CD2 (-), CD4 (+), CD8 (-), CD5 (-), CD7 (-), TIA-1 (-), GrB (+), ALK (+), CD56 (-), EBER (-), and Ki-67 (70%+). Based on the above results the pathologic diagnosis was non-Hodgkin’s anaplastic large cell lymphoma in the right breast, ALK-positive.
+
+Interphase fluorescence in situ hybridization (FISH) analyses were then performed using the two-color fusion probes IRF4 and DUPS22, obtained from Ambipycin Pharmaceuticals Co., Ltd., Guangzhou, China. Where possible, at least 100 nuclei were evaluated for each probe. The FISH analyses were evaluated and recorded using ISIS Digital Image Analysis version 5.0 (MetaSystems, Altusheim, Australia). To analyze the whole genome for imbalance, DNA was extracted from the FFPE material using the QIAmp DNA FFPE tissue kit (Qiagen, Lab Division, America) and processed using the Oncoscan™ FFPE express 3.0 kit (Affymetrix, Santa Clara, CA, USA). Processing involved analysis of copy number aberrations (CNA) and constructing copy TuScan algorithms using Nexus Express for Oncoscan 3 software (Beijing Yuxin Biotechnology Co., China). The human reference genome GRCh37/hg19 was used for gains and deletions smaller than 100 Kb or containing less than 20 probes, and CNN-LOH for those smaller than 5000 Kb or containing deletion regions not considered in the analyses. Molecular cytogenetic analysis using interphase fluorescence in situ hybridization (FISH) analysis showed that the vast majority of cells in the tissue sections had chromosomal breakpoints that affected the fusion of the IRF4 motif and DUPS22, and chromosomal breakpoints that affected the DUPS22 motif. We also detected an additional signal for the nonrecombinant allele, suggesting a gain in the DUPS22 locus. In addition, we observed a gain in the IRF4 locus without breaks. Based on these results and with reference to the current classification of lymphoma of the World Health Organization (WHO), we changed the diagnosis to “non-Hodgkin’s mesenchymal metaplastic large cell lymphoma, ALK-positive”. This malignancy was not associated with an IRF4/DUPS22 rearrangement. Chromosomal imbalance mapping using the Oncoscan™ Chromosomal Imbalance Mapping platform revealed mutations in the following genes: BCOR_p.Q600X, DNMT3A_p.F609fs, NOTCH1_p.P2320fs, and IDH2_p.R140Q. Finally, we attempted to sequence the whole exome of the tumor, although unfortunately, this failed due to technical reasons.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_33_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_33_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..730fb63b0fadc9decfed58cd418a7cef69b156b8
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_33_en.txt
@@ -0,0 +1,6 @@
+On October 9, 2022, a 32-year-old male farmer sought treatment in the outpatient department with complaints of “abdominal pain and fever.” The patient had developed a persistent, intensifying burning sensation in the upper abdomen three days earlier, which was progressively worse, accompanied by nausea, vomiting, fever, fatigue, cough, sputum production, dizziness, headache, and shortness of breath. His temperature had risen to 38.5 °C without any apparent cause.
+The patient had a medical history of binge eating and alcohol abuse, diabetes mellitus, and chronic pancreatitis for many years. Most notably, in 2020, the patient developed septic shock as a result of a B. pseudomallei infection. Then, in 2021, he suffered a recurrence of septic shock, this time due to severe pneumonia and suppurative knee arthritis. Following treatment, he was discharged once his condition improved.
+The patient's temperature was 38.3 °C, pulse 132 beats/min, respiratory rate 20 breaths/min, blood pressure 110/92 mmHg, and weight 40kg. His symptoms acutely appeared, with notable abdominal distension and abdominal tenderness (3+), along with rebound tenderness (3+), especially severe in the upper left abdomen. Laboratory examination showed hemodiastase 972U/L, urinary amylase 1420 U/L, blood glucose 13.36 mol/L, CRP 178.1 mg/L, and procalcitonin 5.44 mg/L.
+Ultrasound imaging highlighted the pancreatic head as having diffuse, calcified, and echogenic characteristics (A). Further CT examination showed a clearer picture, showing swelling of the pancreas with flocculent exudate in the surrounding area, suggesting the exacerbation of chronic pancreatitis (B). Additionally, the scan revealed bilateral infectious lesions in the lungs and pleural effusions on both sides (C).
+By the third day of the patient's hospitalization, B. pseudomallei was detected in blood, sputum, and pancreatic drainage samples (A). Identification of the pathogen was perfomed by MALDI-TOF MS (RUO database) and confirmed through whole genome sequencing. The genome assemblies of B. pseudomallei strain (T165) in this study are available in the figshare (DOI:10.6084/m9.figshare.23902500). After 1 day of cultured on blood agar plates at 37 °C, the colonies were small in size, with a smooth, milk-like and slightly viscous texture. After an additional two days for cultivation, these colonies gradually became pale white, round and opaque (B). Broth microdilution method was employed for antimicrobial susceptibility testing. The isolate was susceptible to amoxicillin-clavulanate, ceftazidime, imipenem, doxycycline and co-trimoxazole, except for intermediate sensitivity to chloramphenicol.
+Acute attack of chronic pancreatitis and pulmonary infection was diagnosed on the first day of admission, and the patient was initially treated with intravenous ampicillin-sulbactam (2 g/dose, twice daily) combined with metronidazole (0.5 g/dose, twice daily) to control infection, along with protamine insulin to manage blood glucose levels. Despite these interventions, the patient's condition took a turn for the worse, with continuous thrombocytopenia, chills, intensified fever, and his shortness of breath progressed, ultimately resulting in shock. In response to the patient's deteriorating state, on the second day of admission, he was transferred to the intensive care unit (ICU) for further treatment, where pancreatic intubation was performed for pus-drainage, and a ventilator was placed for assisted breathing. Continuous renal replacement therapy was initiated at the bedside, which aids in clearing inflammatory mediators from the bloodstream. Additionally, the patient received other symptomatic treatments to address his symptoms and stabilize his condition. For infection control, the patient was started on intravenous meropenem (2 g/dose, every 8 hours) for a two-week period. Following the antimicrobial susceptibility results, ceftazidime (1 g/dose, every 6 hours) was subsequently used for an additional three weeks as part of a de-escalation strategy leading up to discharge. The patient also received platelet transfusions. After 38 days in the hospital, the patient felt well with no discomfort. He was discharged in stable condition, with all symptoms resolved and a complete absence of flocculent exudate around the pancreas, as confirmed by CT (D), and the inflammatory foci in the lungs had marked absorption (E). Post-discharge, the patient continued to take oral co-trimoxazole tablets (0.96g/dose, twice daily) for six months to maintain infection control, and insulin to control blood sugar. Six months after discharge, the patient was regularly followed up with, and he had made a full recovery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_345_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_345_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c567f001344c3932eeb42145777e55da12d24fda
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_345_en.txt
@@ -0,0 +1,8 @@
+A 78-year-old female with hypertension, hyperlipidaemia, coronary artery disease, and atrial fibrillation, presented with shortness of breath over the last several months. She is unaware of any significant diseases in her family, and she had no major surgeries except for vaginal hysterectomy, which was uneventful.
+Physical examination on admission indicated signs of mild heart failure with a continuous holosystolic murmur at the cardiac apex and rales at the base of the lung. Chest X-ray shows mild pulmonary oedema and a significant dilated left heart silhouette . Transoesophageal echocardiography (TOE) indicated a left ventricle (LV) ejection fraction of 50%, severely dilated left atrium (LA) and right atrium (RA), severe mitral regurgitation with malcoaptation, and centrally directed flow jets, and mild to moderate tricuspid regurgitation (Video 1). The proximal isovelocity surface area derived effective regurgitant orifice area measured 0.43 cm2 with LV end-systolic diameter of 42 mm.
+A cardiac heart team discussed all treatment options, including valve replacement surgery, percutaneous valve repair (PMVR) using a clip, and transcatheter mitral valve replacement (TMVR) study trial. The patient underwent an abdominal and chest computed tomography (CT) angiogram to assess the feasibility of TMVR, which indicated large MV dimensions excluding her from the procedure. No other major abnormal findings were reported on CT except for cholelithiasis and suspected renal cysts.
+Considering the patient’s high mortality risk for surgery (3.96% by the Society of Thoracic Surgeons score), unfavourable anatomy for TMVR, and patient preference, we decided to proceed with a PMVR using an edge-to-edge technique.
+Under ultrasound guidance, we introduced a 6 Fr sheath into the right femoral vein using a micropuncture catheter and confirmed its location by angiography.
+While ascending, the wire took an abnormal path on the left side of the chest and beyond the cardiac silhouette and then downwards towards the RA . A multipurpose catheter showed RA trace and a flow-jet directed to the left side supporting the location right-sided chambers (Video 2). Transoesophageal echocardiography confirmed that the trajectory was from the superior vena cava (SVC) to the RA without passing through the IVC-RA junction . Given this, we decided to stop the procedure as it cannot safely be performed.
+Retrospective analysis of the CT revealed an interruption of the IVC at the level of the hepatic segment. The IVC was drained directly into dilated azygos veins along with the hemiazygos and the accessory veins and entered the RA via the SVC. The massive enlargement of the LA led to significant compression of the azygos vein before draining to the SVC ( and corresponding , Video 3, ).
+The patient was referred to surgery, where the mitral and the tricuspid valves were repaired successfully and discharged home in good health. Two months following the surgery, the patient reported a significant improvement in daily life activity and denied exertional dyspnoea. She engaged in cardiac rehabilitation and felt much better than before the surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_359_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_359_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..d913213fc8ed2baa806c78e5efa58e0c963faea1
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_359_en.txt
@@ -0,0 +1,4 @@
+A 39-year-old female presented painful ulceration on the oral mucosa for the past two months and visited the Hospital of Stomatology, Sun Yat-sen University in November 2021. She had received treatment for this condition with a systemic administration of corticosteroids for more than one month in other hospital without efficacy. She denied any history of other systemic medications, dental restorations, radiotherapy, smoking and tobacco use. She had no family history of relevant conditions and malignancies. Physical examination revealed extensive ulcerated lesions on the tongue dorsum, bilateral tongue and buccal mucosa as well as the lower lip, and Nikolsky’s sign was negative . A biopsy from the left tongue showed dyskeratosis of spinous cells, liquefaction and degeneration of basal cells, indistinct basement membrane, and a large number of lymphocytic infiltrates in all epidermal layers instead of band-like infiltrates, which are consistent with pathological changes of OLL . Oral thalidomide and topical tacrolimus mouthwashes were scheduled to control the OLL, while the oral lesions remained unhealed. We recommended the patient for further systemic examination.
+In January 2022, the patient found a goiter in the right neck, accompanied with extensive unhealed ulcerated lesions on the oral mucosa. The patient visited Xiangya Hospital, Central South University for further examination. Contrast-enhanced computed tomography (CECT) confirmed the thyroid mass and revealed a mediastinal mass unexpectedly . Laboratory examination showed procalcitonin (PCT), C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), interleukin-1β (IL-1β) and cancer antigen 125 (CA125) were obviously elevated (PCT: 0.104 ng/mL, normal: < 0.06 ng/mL; CRP: 14.70 mg/L, normal: 0–8.00 mg/L; ESR: 46.00 mm/h, normal: 0–26.00 mm/h; IL-1β: 7.11 pg/mL, normal: < 5 pg/mL; CA125: 76.6 U/mL, normal: 0–35 U/mL). The neck and mediastinal masses were surgically removed and the histopathologic examination showed PTC in the right lobe of the thyroid and CD (unicentric, hyaline vascular type) in the anterior mediastinal mass . Further immunohistochemical staining confirmed the diagnosis of CD . After thyroid cancer surgery, oral levothyroxine was scheduled for the inhibition and replacement therapy, and topical tacrolimus mouthwashes were applied to subdue pain and inflammation for oral lesions.
+In March 2022, two months after complete excision of the neoplasms, the patient revisited to the Hospital of Stomatology, Sun Yat-sen University. The mucosal involvement showed significant alleviation, but there remained unhealed ulceration on the bilateral tongue . Based on the manifestations and findings across the timeline, a definitive diagnosis of OLL associated with CD and PTC was made. We subsequently gave the patient intralesional injection of corticosteroids and systematic thalidomide, and applied triamcinolone acetonide ointment and tacrolimus mouthwashes topically. After one month, the tongue mucosal lesions gradually healed . Positron emission tomography/computed tomography confirmed that there was no recurrence/metastasis of CD and PTC. The management of the patient was summarized in Fig. .
+We followed the guidelines of the Helsinki Declaration in this investigation. The procedure has been explained to the patient, who signed an informed consent allowing treatment procedures and publication of her data.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_366_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_366_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..6fd3816e790a1642515d2e3bd59213aa59445547
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_366_en.txt
@@ -0,0 +1,6 @@
+A 45-year-old male patient presented to the OPD with complaints of pain in the left hip and difficulty in walking for 4 years. The patient had a history of fever and swelling over the left hip in childhood with no treatment taken for the same. The patient had no history of tuberculosis, weight loss, anorexia, morning stiffness, other joints involvement, or any history of drug abuse. The patient was not a known case of asthma, diabetes, and hypertension. The patient had no history of chronic alcohol consumption or tobacco smoking. Local examination revealed tenderness in the Scarpa’s triangle and over the greater trochanter. The movements at the hip were restricted in all planes with the presence of 1 cm of true shortening of the limb as compared to the opposite side with adduction deformity.
+The patient was investigated radiographically with X-ray of the pelvis with both hips which was suggestive of osteoarthritis of the left hip with narrow femoral canal (Grade I Dorr), collapse of femoral head, narrow and broad neck of femur, and arthritic changes in acetabulum.
+The patient was initially managed with traction to cause relaxation of the contracted soft tissues. The patient was also started with physiotherapy to increase the strength in the affected muscles around the hip. As the patient’s X-ray showed hip with narrow femoral canal (champagne flute canal) , templating for the hip was done and surgery was planned as total hip arthroplasty using a Wagner cone stem for the femoral component. After obtaining fitness for surgery with ESR and CRP in normal range, the patient was operated in lateral position through posterior approach. The soft-tissue dissection and the dislocation of femoral head posed difficulty due to presence of soft-tissue contracture and fibrous tissue surrounding the hip joint. After acetabulum preparation, femoral canal preparation was done using small rasps and broaches and completed with no complications.
+Uncemented total hip arthroplasty was done using Zimmer implant of acetabulum (Mallory head acetabulum shell 46 mm) with two self-tapping bone screws of size 6.5 mm, femoral component (uncemented Wagner cone prosthesis, 135°, size 16 with ceramic femoral head size of 28), and polyethylene liner of size 22. After implant placement, the movements at the hip joint in all planes were assessed and limb length compared for no discrepancy. Wound was closed in layers and the patient was given abduction bar to prevent dislocation postoperatively.
+Post-operative X-ray showed well-fixed femoral and acetabular components with proper inclination.
+The patient was gradually initiated with hip range of motion exercises and weight-bearing with walker started after pain relief. At present 1.5 years follow-up, the patient is comfortable with no pain and difficulty in walking. The patient has good hip range of motion. The functional outcome is good as per Harris hip score. X-ray shows bony ingrowth at the tip of femoral stem and acetabulum without loosening of implants . Shorter follow-up period is the limitation of this case report.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_375_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_375_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a086edcc68e5faab726238822d5cfa894fda99bc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_375_en.txt
@@ -0,0 +1,2 @@
+A 74-year-old male, history of a left A2 aneurysm, presented after a motor vehicle accident at low speeds. At the scene, the patient exhibited confusion. He sustained abrasions above his left eye, around his nose, and above his lip. Upon further investigation, patient had also had a syncopal episode on the prior day, where he fell and hit his head as well. Besides the confusion, he exhibited no focal neurological deficits. A computed tomography (CT) head demonstrated a 4 cm × 6 cm hyperdensity and edema with mass effect on left frontal area . The concerns included possible traumatic brain contusion, aneurysmal hemorrhage (given history of left A2 aneurysm), or hemorrhage from an underlying tumor given profound edema. The patient was started on fosphenytoin. A CT angiography of the head demonstrated a pericallosal cerebral aneurysm . A magnetic resonance imaging of the brain demonstrated a bifrontal, enhancing brain lesion with surrounding edema, concerning for a high-grade glioma . Subsequently, he was started on intravenous decadron.
+The patient was discussed at the brain tumor board, where the plan was to address the aneurysm followed by resection of the mass versus close monitoring with subsequent imaging. The high risk of rehemorrhage, given the possibility of an aneurysmal hemorrhage, motivated prompt treatment of the aneurysm. The patient was taken to the angiography suite. An anterosuperiorly projecting azygous A2 aneurysm, measuring 4.5 mm × 5.5 mm with a neck width at 3.5 mm and a small daughter sac, was completely obliterated with primary coiling . Visualization of the external carotid arteries and internal carotid arteries bilaterally did not show any tumor blush. The following day, he underwent a left craniotomy along a forehead skin crease for mass excision. Final pathology revealed glioblastoma. The patient recovered well from both procedures, with a baseline neurological exam. The patient subsequently underwent hypofractionated radiation and temodar. The Medical College of Wisconsin does not require Institutional Review Board approval or patient consent for this case study.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_378_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_378_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c7584fd5066c68e362a54e1eb5c5cd6f9f0cbcef
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_378_en.txt
@@ -0,0 +1,7 @@
+A 72-year-old woman suffered from repeated fever, nausea and vomiting for 3 years following pancreatoduodenectomy, which had been aggravated for 2 d prior to her presentation at the hospital.
+The patient presented with a complaint of repeated fever, sometimes accompanied by nausea and vomiting following pancreatoduodenectomy for 3 years. No associated abdominal pain, diarrhea, or melena was observed. Similar symptoms appeared repeatedly, once every 1-2 mo, with fever symptoms that gradually resolved 3-5 d after antibiotic treatment. Two days later, she became febrile again. The use of oral moxifloxacin tablets could not control the infection, and her body temperature reached 39.8 °C.
+The patient underwent pancreatoduodenectomy with child reconstruction for adenocarcinoma of duodenal papilla 3 years prior. Histological analysis revealed a moderately differentiated adenocarcinoma at stage T2N0M0, Ia. The patient recovered well and was followed-up regularly. No evidence of local recurrence or distant metastasis was noted within 3 years after surgery. Multiple cysts of the liver were detected over more than 40 years but were asymptomatic. She also had hypertension, which was controlled with medication for more than 20 years.
+The patient’s temperature was 39.8 °C, heart rate was 92 bpm, and blood pressure was 145/92 mmHg. Physical examination revealed yellowish skin and icteric sclera. The abdomen was soft with no abdominal pain or rebound pain.
+Laboratory findings revealed a white cell count of 8900/µL (reference value, 4000 to 10000/µL), neutrophil ratio of 90%, serum C-reactive protein concentration of 126 mg/dL (reference value, < 8 mg/dL), serum gamma glutamic transpeptidase concentration (GGT) of 158 IU/L (reference value, 8 to 50 IU/L), serum alkaline phosphatase concentration (ALP) of 576 IU/L (reference value, 40 to 150 IU/L), serum total bilirubin (TBIL) level of 95 µmol/L (reference value, 3 to 22 µmol/L), serum direct bilirubin (DBIL) level of 76.5 µmol/L (reference value, 0 to 7 µmol/L), serum aspartate aminotransferase concentration (AST) of 55 IU/L (reference value, 15 to 40 IU/L), and serum alanine aminotransferase concentration (ALT) of 115 IU/L (reference value, 7 to 40 IU/L). In the past 3 years, blood culture was positive for Klebsiella pneumoniae and Escherichia coli 7 times and 4 times, respectively.
+Preoperative computed tomography (CT) showed several asymptomatic hepatic cysts . Abdominal CT performed 2 mo postoperatively did not reveal signs of hepatic cyst infection, such as an enhanced thickened wall, edema of the perilesional hepatic parenchyma or a significant increase in cyst diameter . Abdominal CT performed 5 mo postoperatively and Magnetic Resonance Imaging (MRI) performed 9 mo postoperatively both showed that the cyst on the lateral side of the right liver had significantly decreased in size, and the wall of the cyst was slightly thickened. The interior cyst appeared slightly enlarged, but it had a thin smooth wall and homogenous contents, and no edema was observed in the surrounding liver tissue. Three years postoperatively, a CT plain scan showed that the cyst on the lateral side of the right liver had disappeared and that the cyst on the inner side of the right lobe had obviously increased in size. Mild dilatation of the intrahepatic bile duct was also noted .
+Enhanced CT revealed that the cyst on the inner side of the right lobe had obviously increased in size, had a thick wall and was surrounded by edema, with less pleural and peritoneal effusion . The cyst showed obvious infection. The blood culture was positive for Klebsiella pneumoniae at this time.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_387_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_387_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..08d2db3f18f5ab240bb3dc6dcab564c97d10a9e0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_387_en.txt
@@ -0,0 +1,3 @@
+A 33-year-old woman, a nurse, was referred to our hospital due to headache for 10 days. She had a brain CT scan at a local hospital on June 5, 2018, which revealed a hypodensity lesion in the right frontal lobe . Brain MRI was also performed on the same day. An irregular lesion, hypointense on T1-weighted imaging (T1WI) and hyperintense on T2-weighted imaging (T2WI), was observed. Enhanced scans showed irregular enhancement with perifocal edema . Besides, tunnel-shaped focus was observed, involving the bilateral brain . The patient was suspected to have demyelinating pseudotumor and was treated with 10 mg dexamethasone for 5 days. After the treatment, her headache relieved.
+When she was admitted to our hospital on June 12, 2018, the general physical examination and neurological examination revealed no abnormality. Routine haematological and biochemical investigations were normal. The brain MRI performed in our hospital on June 15 revealed similar findings to that performed on June 6. Lumbar puncture revealed normal cranial pressure. CSF analysis disclosed 166 cells/μL and protein concentration of 0.742 g/L. The levels of glucose and chloride were normal. Bacterial and fungal cultures were negative. A postcontrast MRI was ordered. The tunnel-shaped lesion involving the contralateral hemisphere caused our attention, which was clearly seen in the body of corpus callosum. Based on her CSF and imaging findings, parasitic infection was suspected. ELISA showed positive anti-sparganum antibody in both blood and CSF.
+The patient was thus diagnosed as cerebral sparganosis. However, it remained unclear how she got infected by this rare parasite. She denied having drunk contaminated water, eaten raw or undercooked frog, snake, chicken, or pork meat, or used the flesh of them as a poultice to open wounds. The patient refused to have the surgery. She received praziquantel 25 mg/kg/dose 3 times daily for 2 days. Lumbar puncture and brain MRI were performed again to evaluate the treatment effects 1 week later. CSF analysis showed 120 cells/μL and protein concentration of 0.264 g/L, which was better than before. MRI showed that the lesion size was markedly reduced. The two-day course of praziquantel treatment was repeated, and she was then discharged with no signs or symptoms. A follow-up brain MRI on July 25 showed that the punctate enhancement was further reduced and the tunnel sign almost disappeared, indicating significant therapeutic effect of the treatment . No headache relapse or other neurological deficits were observed during six-month follow-up.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_391_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_391_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..08688aba12a1dce788044eaacac979f901056f0f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_391_en.txt
@@ -0,0 +1,7 @@
+A 35 years old man was hospitalised for multiple, painful and debilitating ulcers over both lower limb and scrotum. It initially started as a small wound over his right shin which gradually grew in size. Subsequently multiple similar lesions appeared extensively on both lower limb and scrotum over a period of 5 months. He was treated with multiple courses of antibiotics to no avail.
+Additionally, he had 6 months history of polyarthralgia involving the inter-phalangeal joints of both hands, knees and elbows. He reported early morning stiffness of both hands with discolouration and numbness of his fingers upon exposure to cold temperatures. He also complained of bilateral lower limb numbness. He had significant impairment to his activities of daily living as a consequence of these symptoms. Besides that, he also complained of dysphagia, unintentional weight loss of 10 kg and fatigue.
+There was no fever, recurrent oral ulcers, photosensitivity rash and history of gritty or red eyes. He denied chronic cough or night sweats. He had no abdominal pain or alteration in bowel habits. Review of other systems were unremarkable. Family and past medical history were insignificant. He denied alcohol intake, smoking, or use of recreational drugs. He was not a vegetarian and consumed meat regularly. There was no known food intolerance, medication allergies and surgical history.
+On examination, the patient was afebrile and normotensive with a pulse rate of 110 bpm. There was clear evidence of alopecia, generalised hyper-pigmented fragile skin, depapillation of tongue and bilateral parotid swelling. Raynaud’s phenomenon was noted over both hands. Multiple tiny lymph nodes were palpable over bilateral cervical and supraclavicular areas which were soft and mobile. There were multiple ulcers on his scrotum and both legs of varying ages indicating chronicity with the largest measuring 10 × 5 cm. The ulcers were irregular in shape, had erythematous-purplish borders with a yellowish necrotic base. However, the legs were warm and well perfused, with distinctly palpable peripheral pulses. There was no nodular lesions or thrombophlebitis over the lower extremities. Neurological examination of his lower limbs revealed symmetrical paraesthesia distally with loss of vibratory sensation and diminished proprioception. Respiratory, cardiovascular and abdominal examinations were normal .
+Laboratory investigations revealed haemoglobin of 8 g/dl, mean corpuscular volume (MCV) of 84 fL, white blood cells of 6.27 × 10^3/μL with a lymphocyte count of 1.02 × 10^3 /μL. A peripheral blood film showed normochromic, normocytic anaemia with no evidence of haemolysis or abnormal blast cells. Anaemic work up showed low serum iron of 3.7 μmol/L, total iron binding capacity value of 25.3 μmol/L, low transferrin saturation of 14.6%, serum ferritin of 100 ng/ml, low cobalamin level of 176 pg/mL and normal folate level of 16.3 pg/mL. Serum cortisol level was low at 124.6 nmol/L whilst sodium and potassium levels were also low at 130 mmol/L and 3.0 mmol/L respectively. Liver function test showed low albumin level at 27 g/L with slightly raised AST at 63 U/L. Renal profile and coagulation screening were normal. Antinuclear antibody (ANA) was positive at a titre of 1:5120 which has a speckled pattern. Other autoimmune screening showed positive anti-SSA/Ro 60, anti-SSA/Ro 52, antiSmD1, and anti U1-snRNP. C-ANCA, p-ANCA, double stranded DNA, anti-SSB/La and rheumatoid factor were not detected. Complement 3 and 4 were below the reference range. Both inflammatory markers were elevated with CRP of 219 mg/L and ESR of 154 mm/hr. Serum protein electrophoresis displayed no paraprotein band or immunoparesis. Quantitative serum immunoglobulin test were normal. The serological tests for various infectious agents (HBsAg, anti HCV ab, anti HIV 1 + 2 ab and treponemal tests) were negative. Intrinsic factor antibodies and anti-tissue transglutaminase IgA were below detection limits.
+Cultures and sensitivities from the leg ulcers were positive for Proteus mirabilis. He was treated with a two-week course of intravenous amoxicillin/clavulanic acid. Histopathological examination of the leg ulcers demonstrated dense inflammatory cells infiltrate with neutrophil predominance. There was no evidence of necrotising vasculitis, vascular thrombosis, squamous dysplasia or invasive malignancy. No atypical mycobacteria or yeast were detected. An oesophagogastroduodenoscopy and colonoscopy was done which revealed atrophic gastritis, duodenitis and normal colonic mucosa. Campylobacter-like organism (CLO) test was negative. Histologically, the biopsies of small bowel showed well-formed and irregularly spaced glands secondary to expansion of lamina propria by lymphoplasmacytic inflammatory cell infiltrates. Colonic biopsies were insignificant. Periodic acid-Schiff (PAS) staining was negative. The findings were inconsistent with inflammatory bowel disease, Whipple’s disease, coeliac disease or pernicious anaemia.
+Based on clinical features, laboratory investigations, endoscopic and histological findings, he was diagnosed as SLE with pyoderma gangrenosum and cobalamin deficiency. He was treated with prednisolone, hydroxychloroquine, methotrexate, parenteral cyanocobalamin and iron supplements. Noticeable clinical improvement was observed after commencement of recommended treatment. Upon clinic review 1 month later, he reported weight gain, increased level of well-being, great improvement of skin lesions along with significant control of symptoms.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_393_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_393_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..950da0c59c9361d399c3775f181e70c4e20d1164
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_393_en.txt
@@ -0,0 +1,3 @@
+A 68-year-old woman presented with right-sided abdominal pain. Contrast-enhanced CT revealed an 86 mm tumor in the right retroperitoneal space that extended into the IVC; superiorly, it reached the right atrium, and inferiorly, it extended to the confluence of the iliac veins . On chest and abdominal CT, no findings suggestive of metastasis were observed. Percutaneous needle biopsy confirmed a diagnosis of leiomyosarcoma. Echocardiography revealed tumors in the IVC and atrium; however, adhesions could not be definitively assessed. We conducted cine MRI to assess tumor invasion into the IVC wall. The cine MRI comprised two different types of steady-state free precession images, and the parameter details are presented in Table . Cine MRI demonstrated that the uppermost part of the tumor was located within the right atrium; this part of the tumor exhibited mobility and was not adherent to the right atrial wall. Furthermore, we observed blood flow between the tumor and the intraluminal wall of the upper segment of the IVC, and no adhesions were detected . Based on these findings, tumor resection was considered feasible.
+The surgery was performed via an abdominal approach. The tumor was contiguous with the IVC inferior to the renal vein. Following a diaphragmatic incision, palpation of the IVC near the right atrium revealed the mobility of the intravascular tumor. This affirmed our pre-surgical predictions. The tumor's adherence to the right kidney necessitated en bloc resection. Clamping sites were obtained as shown in Figure , with the upper IVC clamp achieved by manually pressing down the tumor. After clamping, blood pressure remained stable at around 110/90 mmHg. The IVC inferior to the renal vein was strongly adherent to the tumor, so it was resected together, while the tumor superior to the renal vein was withdrawn. The artificial vascular replacement was performed from the inferior border of the left renal vein to the bifurcation. The operative time was 628 min, and the blood loss was 2750 mL.
+The final histopathological diagnosis revealed pleomorphic leiomyosarcoma with a Ki-67 index of 60% and negative margins. Some areas exhibited identifiable smooth muscle characteristics, while other regions were notably pleomorphic, suggesting highly undifferentiated zones. CT on postoperative Day 49 showed tumor recurrence in the right retroperitoneum. The subsequent CT on postoperative Day 65 showed metastases in the lung, liver, and right ischium. The patient died on postoperative Day 106.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_396_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_396_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..99626634fac18b9e323ad8edf2e167a8ab2b4045
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_396_en.txt
@@ -0,0 +1,3 @@
+A 56-year-old male with no previous history of depression and sleep disorder experienced nightmare and abnormal dreams after consumption of 750 mg extended release metformin. He described his dream as bizarre which awakened him at night with negative feelings. The nightmare only lasted for a night, but the dreams every night thereafter seemed abnormal. He reported that the dreams did not affect his quality of sleep except for the first night. He had been diagnosed with type 2 diabetes mellitus (T2DM) 5 years ago and managed to control his blood glucose level by dietary modification. He concurrently took atorvastatin and candesartan for his hypertension and dyslipidemia. The Pittsburgh Sleep Quality Index (PSQI) and Hamilton Psychiatric Rating Scale for Depression (HAM-D17) showed very good sleep quality and negative results for depressive symptoms. He stated that he was happy with his life and working environment. Physical examination showed that the patient was overweight but other examinations were otherwise unremarkable. Liver enzymes, blood creatinine and urea were within normal limits. His A1C hemoglobin level was 7.6%.
+In attempt to evaluate the causality of the nightmare and abnormal dreams, the patient agreed to temporarily discontinue and rechallenge atorvastatin, candesartan, and metformin, respectively. Every single drug was consumed for four consecutive days and then was changed to another drug. On the night when metformin was reintroduced, the abnormal dreams ensued. Although it did not affect his overall sleep quality and daily life, his abnormally vivid dreams continued for 4 following nights as the metformin was rechallenged.
+After the extensive potential benefits of metformin were explained, the patient agreed to continue taking metformin 750 mg per day for the first week and metformin was uptitrated to 1500 mg per day in a 3-month follow-up plan. Three months after the initial visit, he reported that he still experienced abnormal dreams every night with no interference of daily activities. He noticed that the symptoms temporarily worsen when the dose was increased and felt better if he consumed metformin in the morning. He also occasionally experienced a mild metallic taste and bloating. His A1C hemoglobin level on the follow-up visit was 6.5%. The patient still reported the same abnormal dreams every night even after 6 months of using metformin. Both his global PSQI score and HAM-D17 were 0, and A1C hemoglobin level was 6.7% on the last visit.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_417_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_417_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..12d24f3bfa01a5985df7b146007360cbcf13eb11
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_417_en.txt
@@ -0,0 +1,9 @@
+A 42 year old female with cutaneous lupus for 16 years was evaluated for new onset hypertension and ankle oedema of 2 months duration. She was found to have a nephrotic range proteinuria (3.7 g per day) with microscopic haematuria and underwent renal biopsy for suspected lupus nephritis. She did not have coagulopathy, local skin sepsis or uncontrolled hypertension at the time of the biopsy. The procedure was performed under ultrasound guidance, adhering to aseptic precautions by an experienced specialty trainee in nephrology. Two cores were obtained with two passes using a Histo Automated Spring-loaded renal biopsy gun with a 16G needle. No complications were observed during the immediate post-procedure period. Patient did not develop undue pain, haematuria or overt bleeding from the biopsy site. She was discharged from hospital the next day.
+She was on prednisolone 60 mg daily and had steroid induced diabetes mellitus. Her glycemic control was poor (HbA1c 9.0%, fasting plasma glucose 188 mg/dL) while being on treatment with metformin 750 mg thrice daily and gliclazide 40 mg twice daily.
+Eight weeks later she was re-admitted with pain in the left flank, intermittent fever and malaise for 1 week. She did not have urinary symptoms, haematuria, nausea or vomiting.
+Her past medical, surgical, gynaecological and family history was otherwise unremarkable. She was a housewife, leading an active lifestyle, well supported by family members and was well compliant with treatment.
+On admission, she was ill, febrile (37.5 °C), had tachycardia (112 beats per minute) with normal blood pressure (120/70 mmHg), respiratory rate (18 per minute) and oxygen saturation (99% on ambient air). She was pale and had bilateral symmetrical pitting ankle oedema, malar rash, and erythematous desquamating rash over sun exposed areas. Abdominal examination revealed an exquisitely tender subcutaneous induration in the left flank without overlying erythema, warmth or rash. Cardiovascular, respiratory and neurological examinations were unremarkable.
+Investigations revealed a neutrophil leukocytosis (total white cell count 22 300 / mm3, neutrophils 88% with left shift and toxic granules), elevated C-reactive protein (120 mg/L, reference < 6 mg/L) and erythrocyte sedimentation rate (88 mm 1st hour). She also had normochromic normocytic anaemia (haemoglobin 8.9 g/dL), normal renal functions (Creatinine 57 micmol/L) and normal liver biochemistry except for hypoalbuminaemia (26 g/L). Renal biopsy was reported as having insufficient tissue as it contained only tubules, without any glomeruli.
+Urinalysis showed proteinuria and microscopic haematuria without pyuria. Urine and blood cultures grew no organisms. Ultrasound scan of the abdomen showed a subcutaneous hypoechoeic area over the left flank suggestive of a fluid collection. A contrast enhanced CT scan of the abdomen was done which showed a retroperitoneal collection of pus that extended in to the subcutaneous tissues through the muscles of the posterior abdominal wall . No communication was reported between the abscess and the renal tissue.
+She underwent incision and drainage of the abscess, which drained 400 mL of blood stained pus. Collection was found to be extending from the retroperitoneal region to the subcutaneous tissue plane, two regions communicating through a channel that penetrated the posterior abdominal wall musculature. The abscess had no communication with renal tissues or the collecting system. Pus culture isolated an extended spectrum beta lactamase producing Escherichia coli. She was treated with intravenous meropenem 1 g 8 hourly along with regular debridement of the surgical site.
+Her symptoms gradually resolved with treatment and inflammatory markers returned to normal. Follow up imaging with ultrasonography did not reveal any residual collection. Two weeks later, she was discharged from in patient care with a plan for repeat biopsy from the right kidney.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_431_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_431_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..13d508f2379ad623d9cba53d4c50fc85ce33c5a0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_431_en.txt
@@ -0,0 +1 @@
+A 53-year-old Japanese man affected by NF-1 presented with a three-week history of jaundice, upper abdominal discomfort, dysphagia and loss of appetite . His mother had a history of neurofibromatosis. Upon physical examination, a smooth mass, with its largest dimension measuring 20 cm, was palpated in his right upper abdomen. On admission, laboratory findings revealed leukocytosis, with a white blood cell count of 12,200/mm3; aspartate aminotransferase, 75 U/L; alanine aminotransferase, 75 U/L; alkaline phosphates 1913 U/L; γ-glutamyl transferase, 960 U/L; total protein, 7.4 g/dL; and total bilirubin, 4.4 mg/dL. His C-reactive protein level was 9.3 mg/mL (normal range, 0.5 mg/mL to 0.8 mg/mL). His serum level of carcinoembryonic antigen (CEA) was extremely high at 3050 ng/mL (cutoff, 2.5 ng/mL), and his α-fetoprotein (AFP) level was 812 ng/mL (cutoff, 10 ng/mL). The carbohydrate antigen (CA) 72-4 was also high at 180 U/mL (cutoff, 8.0 U/mL); CA 19-9 was normal at 16 U/mL (cutoff, 37 U/mL). An upper GI barium study showed a 5.0 cm filling defect on his cardia that extended to his lower esophagus. An abdominal computerized tomography (CT) scan showed multiple liver lesions and ascites, but no lymph node enlargement was identified . Gastroendoscopic examination revealed a tumor with a 6 cm diameter on the esophagogastric junction, which was spreading to his esophagus . Multiple biopsies showed moderately differentiated tubular adenocarcinoma of the stomach at stage IV . An immunohistochemical study showed that CEA-positive and AFP-negative cells were present in the tumor . Our patient was administered palliative chemotherapy and treated with TS-1 (tegafur, gimeracil, oteracil potassium). Our patient died due to liver failure a month after initial admission. A pathological review of necropsy specimens of his liver lesions showed moderately differentiated tubular adenocarcinoma . An immunohistochemical study showed that CEA-positive and AFP-negative cells were present in the metastatic liver tumor resembling the gastric lesion .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_43_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_43_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f1c337505b96d3a3e297fa5b6dc1967cf4d4b456
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_43_en.txt
@@ -0,0 +1,4 @@
+A previously healthy 38-year-old Caucasian man and competitive amateur cyclist sustained a displaced fracture of his left femoral neck following a fall from his racing bicycle whilst at rest. Having slowed gradually to a halt, our patient attempted to unclip his feet from the pedals. He was unable to unclip his feet and when the bicycle slipped on some ice, he was unable to remove his feet to steady himself. As a result he sustained a direct trauma to his left hip, resulting in a displaced intra-capsular fracture of the right femoral neck .
+Once other injuries had been excluded and adequate imaging had been obtained, our patient was admitted to our orthopedic ward and a closed reduction and internal fixation was performed later the same day. Reduction was obtained using the Leadbetter maneuver , and fixation performed with three 6.5 mm cannulated screws . The surgical treatment was completed within 12 hours of the injury. Subsequent to the fixation our patient progressed well with no immediate complications and was discharged two days following the injury. Toe touch weight bearing was commenced for a period of six weeks and, following satisfactory radiographs, partial weight bearing was allowed for a further six weeks.
+Although our patient had no risk factors for osteoporosis, given the relatively low energy of the injury, a bone density scan was performed along with other metabolic bone disease screening tests. These were all within normal limits.
+At a subsequent review four months after the injury, our patient had no pain in the hip, a good range of movement and is walking unaided. Radiographic appearances are satisfactory and show no evidence of avascular necrosis. Regular clinical and radiographic review is planned until two years after the injury.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_475_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_475_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..07e63a0421ea74279159673f2b163d6fc40b87f4
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_475_en.txt
@@ -0,0 +1,2 @@
+A 54-year-old Caucasian woman, without any relevant medical history and no gynecological aftercare, was admitted to our hospital emergency room with dyspnea that had progressed over 10 days and was worsening. Upon admission, we noted blood oxygen saturation of 89%, tachycardia (125 beats per minute) and hyperthermia (38.9°C). Her blood pressure was 120/80 mmHg. Electrocardiography showed sinus tachycardia and echocardiography revealed severe pericardial effusion with a swinging heart. An emergency subxiphoid incision with pericardial drainage was performed through a pericardial window, which permitted draining of 700 mL of bloody fluid and a pericardial biopsy. Cytological examination of the fluid revealed atypical cells, and the biopsy specimen showed tumor emboli suggestive of adenocarcinoma. Immunostaining indicated elevated levels of tumor marker, cytokeratin 7 (CK7). Her blood concentrations of carbohydrate antigen (CA) 125 and CA 15.3 were 4667 IU/L and 451 IU/L, respectively, suggesting ovarian malignancy.
+When stabilized, our patient was transferred to our department for further investigations. A gynecological examination only found a large uterus. A physical examination of her cervix was normal. An ultrasound examination showed uterine myomatosis, but no endometrial abnormality. Her ovaries were not seen. Magnetic resonance imaging (MRI) showed a 35 mm cervical lesion indicative of an endocervical tumor . A thoracic tomodensitometry and liver ultrasound were normal. Exploratory laparoscopy found normal ovaries, with no ascites, but diffuse peritoneal lesions suggestive of carcinosis. A bilateral adnexectomy and multiple peritoneal biopsies were performed. Endocervical curettage revealed necrotic tumor tissue. Cervical biopsies were performed. Histological examination showed a poorly differentiated micropapillary adenocarcinoma of her cervix with peritoneal and ovarian involvement . Immunostaining showed that the tumor cells were strongly positive for CA 125, Kit-ligand-1, Ki67, and CK7. Three weeks after this surgical procedure, intravenous chemotherapy with carboplatin and paclitaxel was initiated. Our patient's progression was unfavorable; three days after the first course of chemotherapy she was admitted to our intensive care unit and given thrombolytic therapy for severe pulmonary embolism with no sign of pericardial effusion recurrence. She died due to heart failure after three days in a context of severe pulmonary arterial hypertension.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_518_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_518_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..0ff55f7ad448716910f421c62f16d7e0eef263cc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_518_en.txt
@@ -0,0 +1 @@
+This is a case of a 14-year-old male who sustained a twisting injury to his right leg during early phase of COVID-19 pandemic. He sustained a three-part lateral triplane fracture of the ankle with a concomitant ipsilateral displaced spiral fracture of the shaft at middle-lower third junction of his right tibia . The mechanism of injury was a twisting injury with external rotation of the foot while running indoors. The ankle injury was initially missed in the emergency. The orthopedic team examined the patient the following morning and ordered a CT scan of the ankle on clinical and radiographic suspicion. CT ankle reported the triplane injury pattern . The coronal, sagittal cuts revealed 2 mm gap and axial cut revealed 3 mm gap at the articular surface without any step. Conservative plan of management was decided as the displacement of shaft fracture was <50%, varus/valgus angulation <5o, recurvatum <5 degrees and shortening <1 cm and triplane ankle fracture was without any intra-articular step. The patient underwent close reduction under fluoroscopy and above-knee casting and was discharged on day-2. Regular follow-ups were done at weekly intervals for initial 3 weeks post-discharge to check for any fracture displacement and then at 6, 10, 14, 18, and 22 weeks, 6 months, 9 months, and 1 year. Above-knee plaster cast was converted to a patellar tendon bearing (PTB) cast at the 10th week for another 4 weeks and weight-bearing was started on PTB cast. The shaft fracture showed abundant callus at 14 weeks and follow-up X-rays (, , , ). The triplane fracture was uniting well with no disruption of the tibial plafond and an initially open anterolateral physis of the distal tibial gradually closed in the follow-up X-rays. The patient achieved a good functional recovery in 22 weeks and there was no limb length discrepancy at the end of 1 year. Evaluation was done based on modified Weber scale using the pre-operative and post-operative scores for pain, walking, activity, and ankle, subtalar function and awarded clinical demerit points with scores 15/24 at 10 weeks, 10/24 at 14 weeks, 6/24 at 18 weeks, 4/24 at 22 weeks, 2/24 at 6 months, and 0/24 at 9 months.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_51_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_51_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..dff302ad82c6af906ee936e91fb6dc861fbcf990
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_51_en.txt
@@ -0,0 +1,4 @@
+A 67-year-old Caucasian woman with an unremarkable medical and breast history was referred to our breast unit with a screen-detected right breast mass. Mammography had revealed a fairly well-circumscribed 2 cm lesion located deep and in close proximity to the nipple and was graded as M3 on the Breast Imaging Reporting and Data System scale. Her physical examination and ultrasound showed no abnormalities. A subsequent diagnostic biopsy revealed an infiltrating ductal carcinoma with an adenoid cystic component. The patient was treated with simple mastectomy and sentinel node biopsy. The histologic examination revealed a lesion of 1.7 cm maximum diameter with mixed infiltrating NOS ductal carcinoma and ACC characteristics. The four sentinel nodes were all free of cancer. She had a good post-operative course and remained well with no evidence of recurrence 24 months later.
+The tumor was whitish tan and was ill defined in appearance and firm in consistency. No nipple or skin involvement was present. Both the nuclear grade of the lesion and the Bloom-Richardson grade were two based on the overall appearance of the tumor. The lymph nodes were negative. The tumor was staged as T1N0M0 and was estrogen receptor (ER)- and progesterone receptor (PR)-negative. The proliferative activity was low as measured by the Ki-67 labeling method (12%). Immunohistochemically, overexpression of the proto-oncogene HER2/neu was found in 15% of the carcinomatous cells. In fluorescence in situ hybridization analysis, which was performed at a later stage, no protein amplification was ascertained.
+Two histological patterns were blending into each other without a clear-cut boundary between them . The dominant pattern, comprising more than 70%, was an ordinary, moderately differentiated ductal carcinoma NOS. It consisted of tubule islands and cribiform structures with epithelial cells exhibiting a high nuclear-to-cytoplasmic ratio, dark nuclear chromatin, and inconspicuous nucleoli. The mitotic index was low (< 2/10 hematopoietic tissue).
+The rest of the histological pattern was limited and mainly consisted of well-defined nests and pseudo-glandular structures occasionally filled with homogeneous basophilic (periodic acid-Schiff stain-positive) material. Interestingly, the neoplasmic nests contained predominantly basaloid cells with sparse cytoplasm coexisting with epithelial cells with more abundant eosinophilic cytoplasm .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_535_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_535_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..01dd161bfe80c49674d08e95172576b23aaae67c
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_535_en.txt
@@ -0,0 +1,5 @@
+A 56-year-old woman with staghorn calculi with 43 mm as long diameter in the abdominal X-ray was referred to our hospital. She had the comorbidities of hypertension, diabetes mellitus, obesity (Body Mass Index was 33), and without coagulopathy.
+The surgical procedure was as following. The patient was set in the Galdakao-modified-Valdivia-position under general anesthesia. We planned to puncture into the dorsal-middle calix along the anterior line to avoid the renal cyst . 0.035-inch guidewire was successfully inserted into the urinary collecting system at the first puncture of the 18 gauge needle guided by ultrasound and fluoroscopy. The 24Fr Amplatz sheath was inserted through the tract which was enlarged by metallic telescopic serial dilator. The stone was crushed by Holmium laser (Lumenis VersaPulse PowerSuite 30W: 0.5–0.6 J/ 5–15 Hz) and removed by forceps visualized by the rigid and flexible nephroscope. There was no bleeding which prevent the endoscopic view during the surgery. The 20Fr nephrostomy tube with the 5Fr ureteral catheter to prevent slip-out was indwelled at the end. The operation time was 97 min. The dust and multiple fragments smaller than 3 mm diameter were seen in abdominal X-ray on the next day of PNL , and hemoglobin drop was not seen (11.9 g/dl).
+Suddenly, massive bleeding was seen around the nephrostomy tube on the 2nd day after PNL. CECT was examined after 37 min from onset of the bleeding. The extravasation of contrast agents was seen in the abdominal wall . It could not be controlled by finger pressure and suturing around the nephrostomy. Then, the patient had got into the hemorrhagic shock status (the blood pressure was 76/44 mmHg and hemoglobin dropped to 9.1 g/dl).
+Emergently, TAE was performed by the interventional radiologist after 123 min from onset of the bleeding. The 4Fr sheath was inserted into the right femoral artery by the Seldinger technique under local anesthesia. The injuries of the distal branches of the 9th and 10th intercostal arteries were identified and embolized by gelatin sponges cut into 1 mm size through the micro-catheter involving the communicating branch of the circumflex iliac artery . The blood pressure had been recovered to 97/65 mmHg as soon as closing TAE. A lot of infusion (normal saline, 3000 ml, and albuminous preparations, 5% 500 ml) were intravenously dripped to stabilize hemodynamics. On the next day of TAE, the hemoglobin dropped down to 7.2 g/dl and the transfusion of red blood cells (560 ml) was needed.
+On the 7th day after PNL, the patient got a high fever. Pseudomonas aeruginosa was detected in her blood and urine sample. Ceftriaxion and ceftazidime were intravenously administered for 7 days. The 2nd PNL by flexible nephroscope and basket retrieval device was performed on the 19th day (operation time was 51 min), and she could discharge without residual fragments on the 30th day from the first PNL .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_542_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_542_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7413d4610532d99c49fc7ed2a62244af35e41082
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_542_en.txt
@@ -0,0 +1,3 @@
+A 21-year-old man visited a hospital with scrotal swelling after a baseball struck his left testis. Plain computed tomography revealed no abnormalities. He was treated conservatively with analgesia until he visited the hospital again 5 days later, reporting no improvement. MRI indicated a tear of the left tunica albuginea, and he was referred to our hospital. His scrotum was swollen, and he was in pain at the time of admission. Ultrasonography showed echo-free space in the left scrotum, including a swollen testis with heterogeneous echogenicity. Doppler ultrasonography revealed no blood flow in the left testis. Blood flow was maintained in the right scrotum, and both epididymides were normal . MRI indicated swelling of the left testis with surrounding high-intensity areas and partial disruption of the tunica albuginea . The preoperative levels of LH, FSH, and testosterone were 6.7 mIU/mL, 13.8 mIU/mL, and 1065.9 ng/dL, respectively. Thus, we suspected testicular rupture with damage to the tunica albuginea. Emergency surgery was performed on the day of admission.
+A dark-red serum drained after incising the tunica vaginalis. The tunica albuginea was extensively torn and the testicular contents were exposed . Primary closure of the tunica albuginea with absorbable sutures was initially attempted but not possible to complete since tight closure could cause secondary damage. A vascular pedicle flap was prepared by shaping the tunica vaginalis to replace the damaged tunica albuginea . The dartos fascia and scrotal skin were sutured with absorbable sutures.
+The patient was discharged 2 days postoperatively. Ultrasonography identified no abnormalities in the size and blood flow of the ruptured testis at 2 weeks and again at 3 months’ follow-up . The LH, FSH, and testosterone levels were 6.7 mIU/mL, 13.8 mIU/mL, and 1065.9 ng/dL, respectively, at 3 months postoperatively. No abnormalities were observed either morphologically or functionally. Thus, the tunica vaginalis flap was considered to successfully preserve the injured testis.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_546_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_546_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..342b24629989640542d2bfead15e762b86a5ea54
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_546_en.txt
@@ -0,0 +1,5 @@
+This case was a 44-year-old male patient. During his routine physical examination, an approximately 6.0 × 5.5 cm inhomogeneous echo mass was found incidentally in the right lobe of the liver by abdominal ultrasound. The patient denied any accompanying symptoms such as anorexia, abdominal distension or pain, fever, or weight loss. He had a 5-year history of hypertension and took felodipine tablets to control blood pressure. The patient had a 20-year drinking history, equivalent to about 40 g ethanol/day. He had no history of intravenous drug use, exposure to herbal medicines or health care products, or surgical and familial genetic disease. Routine blood analysis was conducted and the values for various tests—liver and kidney function, coagulation function, and tumor markers (alpha-fetoprotein, carcinoembryonic antigen, and carbohydrate antigen 19-9)—were within the normal range. Serological tests for hepatitis B and hepatitis C were negative. Autoantibodies related to autoimmune liver disease, thyroid function, and ceruloplasmin were within the normal range. Physical examination showed no positive disease indicators.
+The patient then underwent an imaging examination. A second ultrasound revealed multiple small irregularly shaped hypoechoic masses with slightly hyperechoic septae in segment 6 of the liver (S6), and a total size of approximately 6.0 × 5.5 cm. Contrast-enhanced ultrasound (CEUS) showed a cystic-solid lesion with honeycomb-like enhancement in the arterial phase, in which multiple disordered unreinforced tubular columnar areas were seen. No obvious papillary structure was found. The enhanced region was slowly cleared in the portal and delayed phases. Abdominal contrast-enhanced computed tomography (CT) scans showed a honeycomb-like cystic-solid lesion with a tubulocystic manifestation lacking well-defined borders in S6 and no dilation of the major intrahepatic bile duct in the background liver. The cystic components were low-density and showed no enhancement in the arterial phase. The solid components, which were septa or the cystic wall, were more enhanced than the normal hepatic parenchyma in the arterial and portal phases and were consistent with normal hepatic parenchyma in the equilibrium phase. Abdominal magnetic resonance imaging (MRI) showed an irregular-shaped multicystic mass with a mixed signal shadow in S6. The lesion was revealed as an irregular tubular low-density area on T1-weighted images and a high-intensity area on T2-weighted images, which were interspersed with strips of slightly higher signal shadows. The signal of the solid component of the intermediate inclusion was not high on diffusion-weighted imaging (DWI), while the apparent diffusion coefficient (ADC) signal was high, indicating that the dispersion was not limited. The solid components of the lesion were enhanced in the late arterial phase by injecting the contrast medium, gadoxetic acid disodium. In the hepatobiliary phase, the whole lesion was low signal. The mass had no obvious invasion into adjacent structures and was thought to be benign. Magnetic resonance cholangiopancreatography (MRCP) showed intrahepatic hybrid-density cystic-solid masses that did not communicate with the bile duct. Intrahepatic and extrahepatic bile ducts were not dilated. No definite abnormal signal shadow was found in the bile duct cavity and gallbladder. Imaging examination did not reveal any bile duct stones . To exclude liver metastatic carcinoma caused by gastrointestinal malignancies, gastroscopy and colonoscopy were performed and no obvious abnormalities were detected. Duodenal papilla was normal, and no colloidal mucus was present. Based on these results, the lesion was suspected to be MCBH but other diseases such as HMH, VMC, Caroli's disease, biliary cystadenoma, and CHFC could not yet be excluded.
+Since MCBH is a localized cystic-solid lesion, it can be difficult to diagnose by needle biopsy due to limited sampling of the lesion and heterogeneous distribution of the tumor components. After communicating with the patient and his relatives, surgical resection was performed. This was an open operation. The lesion could not be observed in the liver surface. The intraoperative ultrasonic testing was performed and the lesion was located in the right posterior segment VI of liver. Anatomical resection of segment VI was performed and the resection margin was more than 1 cm to the lesion. No enlarged lymph nodes were found during the operation. The residual liver had no tumors and showed healthy texture by intraoperative ultrasound. The operation was successful, lasting about 2 h, and the intraoperative bleeding was 100 ml.
+The surgical specimen revealed an approximately 6.0 × 5.5 cm nodular mass. A cystic-solid lesion with a honeycomb appearance and gray-white, medium texture, was seen in a section of the resected specimen. The lesion was composed of diffuse, cystically dilated ductal structures that were approximately 0.1–1.5 cm in diameter and surrounded by fibrous tissue. The lesion was filled with clear, colorless liquid surrounded by normal liver tissue.
+Low-power microscopy displayed a relative clearance boundary in the lesion area that consisted of ductal structures, periductal glands, fibrous connective tissues, and blood vessels. Ductal structures were cystically dilated and irregularly angulated. Bile-stained materials were observed in some ducts and the peripheral bile ducts were not dilated. High-power microscopy showed that the ductal epithelium was composed of a monolayered columnar and cuboidal epithelium that was morphologically identical to biliary epithelium. Fibrous connective tissue around the ducts contained only mild lymphocytic infiltration. Normal hepatocytes were observed between the cystic ducts. There were no smooth muscle elements or ovarian-like stroma, and there were no atypical cells or papillary growth of the epithelial cells. Synchronous biliary hamartomas, nodules, steatosis, or significant fibrosis were not observed in the non-lesion liver tissue. Immunohistochemistry showed CK7 and CK19 positivity in the dilated duct epithelium and CD34 positivity in the vessels. Ki-67 antigen staining revealed the proliferative activity of individual cells .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_561_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_561_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..7bc9127f0bd2e02618dd78a42f2183e649059966
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_561_en.txt
@@ -0,0 +1 @@
+A 53-year-old male underwent a right L4-L5 microdiscectomy and foraminotomy and was discharged home the same day. With no improvement 6 months after surgery, we offered a trial of SCS, and he experienced significant relief from the back and leg pain. Ten days later, we placed an epidural paddle electrode through a T10–T11 laminotomy . The lead was secured to the ligamentum flavum with 4-0 NUROLON sutures. When he returned 15 days later, he no longer experienced pain relief and reported consistent stimulation in upper extremities. A thoracic X-ray revealed that the epidural paddle electrode had migrated to the cervical C6-C7 epidural space . Upon return to the operating room, we were able to retract the paddle electrode to the level of T5 where we encountered resistance; therefore, we performed a laminotomy at this level to remove the paddle electrode. When placing a new epidural paddle electrode, we encountered significant adhesions in the epidural space requiring additional laminotomies at T8–T9 and T9–T10 to adequately dissect the adhesions and place the epidural paddle electrode . We then affixed the leads to the T11 lamina using a 16 mm craniomaxillofacial low-profile plate. The patient was discharged home the following day without further sequelae.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_57_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_57_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2ff8e69795297ab5f91d29d4260ae31277dc1fd0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_57_en.txt
@@ -0,0 +1,4 @@
+A 73-year-old female complained of back pain and weakness in lower limbs for 2 weeks. 3 months ago, after a minor trauma, she got back pain without weakness in lower limbs. Radiography including lateral radiographs and MRI performed at a local hospital. Initially, she was diagnosed with a L1 compression fracture and accepted conservative treatment. After an asymptomatic period, she complained progressive pain at the fracture position with weakness of both lower limbs and was referred to our hospital with suspicion of Kümmell’s disease. The back pain evaluated by visual analog scale (VAS) scale was 9. According to American Spinal Injury Association (ASIA) grading criteria, the neurological function was rated as ASIA C. Sagittal MR images showed a fluid-containing IVC with high-signal intensity on T2-weighted images and STIR MR sequences at L1 and sagittal reconstruction CT scan showed a linear radiolucent IVC, accompanying spinal cord compression. The biochemical workup revealed no abnormal indications of infection (including C-reactive protein (CRP) levels, erythrocyte sedimentation rate (ESR) and T-SPOT). Furthermore, the patient denied the history of cancer or tuberculosis and she also denied hypothermia, night sweats and weakness.
+Before surgery, we obtained the informed consent of the patient and her family to perform the operation. The patients were placed in a prone position under general anesthesia with somatosensory-evoked potentials and motor-evoked potentials for spinal cord monitoring. After the lesion was positioned with the C-arm, a standard posterior midline approach with subperiosteal stripping was used to expose the spinous processes, lamina, and facet joints. Considering the presence of osteoporosis in elder female patient, we performed a long segment pedicle screw fixation (Cox Spinal Screw-Rod System, Fule Science & Technology, Beijing, China) from T10-L3 to avoid implant failure . Then, a complete laminectomy-facetectomy was performed to decompress and fully visualize the dural sac. A temporary stabilizing rod was fixed on one side of the pedicle screws. On the contralateral side, the facet joints of the diseased vertebra were removed to reveal the pedicle. Then, the pedicle and vertebral body, including the superior and inferior disk, were piecemeal removed by rongeurs, osteotomes, or curettes. To our surprise, caseous necrosis and inflammatory granulation could be seen in the surgically resected lesions. The specimens were sent for pathologic examination. After osteotomy and debridement in anterior column at L1, we used a ‘off-the-shelf’ (OTS) three-dimensional (3D) printed artificial vertebral body instead of various materials, such as bone grafts, mesh cages, or expandable titanium cages, to reconstruct sagittal alignment . Based on preoperative 3D reconstruction of CT and MRI images, the artificial prosthesis was designed in conformity with the expected defects that may occur after the affected vertebral body resection.
+Pathological examinations reported caseous necrosis tissue, epithelioid granuloma existed with the hyperplasia tissue and the acid-fast bacillus was also found .
+After surgery, the patient was treated with quadruple anti-tuberculous chemotherapy and hepatoprotective drug for 12 months and required to wear a brace for at least 3 months. Two weeks after surgery, the patient could walk and discharge from the hospital. Three months after surgery, the VAS scores decreased from preoperative 9 to 1 and the neurological function recovered to ASIA E. No internal fixation failure and recurrence of tuberculosis occur at last follow-up .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_581_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_581_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..3845da266496511a115aa3693c9cd10408a3a94b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_581_en.txt
@@ -0,0 +1,6 @@
+A 57-year-old male patient visited the Department of Oral Medicine, Kyungpook National University Dental Hospital with the chief complaint of painful ulcer on the tip of the tongue. The ulcer had developed 3–4 weeks ago without any apparent initiating event such as trauma. He described a pricking sensation and an increased soreness at the tongue tip area upon touching. The patient’s medical history revealed a diagnosis of TB over 40 years ago. He reported that complete recovery was gained at that time.
+Intraoral examination revealed a round ulcer measuring approximately 0.7 cm in diameter on the tip of the tongue. The ulcer was characterized by a granulomatous center and a whitish, well-defined border with slight elevation . The base of lesion was firm in consistency on digital palpation. Extraorally, there was no evidence of lymph node involvement. A panoramic radiograph showed no evidence of bone involvement. The laboratory examinations showed that complete blood count (CBC) was within normal limits. Serologic tests for human immunodeficiency virus and hepatitis C also revealed negative findings. Based on the clinical examination, differential diagnosis included major aphthous ulcer, traumatic ulcer, granulomatous diseases, and infections.
+Topical mouthwash with a mixture of amoxicillin 1.0 g and prednisolone 30 mg in 500 mL distilled water was used for 7 weeks with careful instruction to avoid possible stimuli, and triamcinolone acetonide 5 mg was also injected into lesion twice for 2 months. Despite subtle improvement after these conservative managements, the ulcer had not completely disappeared. Biopsy was eventually performed to rule out malignancy.
+An incisional biopsy of the ulcer was carried out under local anesthesia (2% lidocaine with epinephrine 1:100,000). Histological examination revealed the presence of numerous epithelioid cells and multiple Langhans giant cells and Ziehl–Neelsen staining demonstrated acid-fast bacilli (AFB) . Based on histological findings, the oral ulcer was finally diagnosed as lingual TB.
+The patient was immediately referred to a pneumologist for further examination and management. AFB stains of lesion were positive for M. tuberculosis. AFB cultures were positive for M. tuberculosis complex. Polymerase chain reaction (PCR) was conducted on his sputum, and analysis confirmed the presence of M. tuberculosis.. Additional blood biochemistry revealed the increased values of erythrocyte sedimentation rate (ESR) (103 mm/h) and c-reactive protein (CRP) (2.54 mg/dL). An IFN-γ release assay (IGRA) using the QuantiFERON-TB Gold in-tube method was positive. Chest computed tomography (CT) showed destructive findings with consolidation and fibrothorax in right lung and formation of cavitary lesion with clustered centrilobular micronodules in left lung apex .
+After about 2 months of drug therapy, the oral ulcer of patient almost disappeared , and after another 2 months, AFB culture showed no growth of M. tuberculosis in 4 weeks. The patient was followed up for 9 months without any complications .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_587_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_587_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..1563ba6fa8524b261426fc880064a750522f83cf
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_587_en.txt
@@ -0,0 +1 @@
+A 50-year-old woman with no coronary artery disease risk factors had suffered from transient chest pain, dyspnoea, and paroxysmal neck swelling irrespective of emotional stress for ∼15 years . Since the attacks often developed after meals, especially at full stomach, she took care not to eat too much. At the age of 44, she was admitted to the emergency department for the first time due to acute pulmonary oedema following the aforementioned attacks. Urgent cardiac catheterization showed no significant coronary stenosis and typical apical LV ballooning , and finally she was diagnosed as having TTS. Later, at the age of 45 and 49, she developed the same clinical disorder. Interestingly, the LV wall motion abnormality was localized to the basal region at the second admission and diffusely at the last time (no images available). Moreover, during the second admission, acetylcholine (ACh) provocation testing for coronary spasm was performed with negative results. Although local LV asynergy disappeared spontaneously in each hospitalization, she had frequently suffered from the same attacks after meals and was referred to our hospital for further investigation. She did not have any oral medication during the TTS episodes. On admission, she had no subjective symptoms or objective signs in electrocardiogram (ECG) or echocardiographic examinations. However, abdominal ultrasonography for screening purposes detected a right adrenal mass of 35 mm × 35 mm in size and scintigraphy imaging showed high uptake of M-iodobenzylguanidine in the tumour . Furthermore, urinary catecholamine levels (especially normetanephrine) were markedly elevated . Since pheochromocytoma was highly suspected from these data, we paid attention not to perform any contrast studies that could cause adrenal crisis. This tumour was urgently removed surgically and histological diagnosis of norepinephrine-secreting pheochromocytoma was made . Ten days after the operation, when urinary catecholamine levels were normalized , we performed cardiac catheterization and ACh provocation testing. As shown in , intracoronary administration of ACh (20, 50, and 100 μg) into the left coronary artery (LCA) and that of ACh (25 and 50 μg) into the right coronary artery induced epicardial coronary spasm accompanied by chest pain and ischaemic ECG changes. Chest pain, ischaemic ECG changes, and myocardial lactate production were already noted at the timing of administration of 20 μg of ACh into the LCA before the occurrence of epicardial coronary spasm at 100 μg, indicating that microvascular spasm (MVS) preceded epicardial coronary spasm. Thus, we diagnosed that she had both epicardial coronary spasm and MVS, and initiated drug therapy with a calcium antagonist (benidipine 8 mg/day). After discharge from our hospital, she experienced no episode of postprandial attacks and her urinary catecholamine levels remained low, indicating that she was free of catecholamine surges from pheochromocytoma . She again underwent a scheduled follow-up ACh provocation testing at 18 months after the operation. Calcium antagonist was discontinued 72 h before the provocation testing. Interestingly, epicardial coronary spasm was no longer induced, whereas MVS persisted .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_59_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_59_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c8efcc5b55632324a08cb7be9458517b3c923cad
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_59_en.txt
@@ -0,0 +1,3 @@
+A 55-year-old male presented to the Respiratory Department in our hospital because of mild morning hemoptysis for about five weeks, having undergone futile antibiotic therapy administered at his local hospital for two weeks before admission to our institution. Symptoms of hemoptysis were alleviated with venous hemostatic drugs in our Respiratory Department. He did not complain of fever or night sweats but presented occasional palpitations. Additionally, he has suffered from hypertension for 10 years and diabetes II for two years, respectively. A physical examination was undertaken at the time of admission, which revealed a blood pressure of 163/95 mmHg, a heart rate of 100 beats per minute, and his auscultation bilateral respiratory murmur are normal. No abnormal heart sound was detected. Laboratory investigations implied WBC, neutrophils count, and procalcitonin concentration were normal. Remarkably, D-dimer (18.46 mg/L) and fibrinogen degradation products (28.7 mg/L) were both elevated despite normal function of blood coagulation. An electrocardiogram presented sinus tachycardia (103 bpm) and pseudo left-axis deviation of -82° . Chest CT exhibited multiple parenchymal nodules in lungs surrounded by ground-glass opacity , and a mass (58 mm × 41 mm) located at the right atrium with a clear boundary . Echocardiography indicated that the mass arose from the free wall of the right atrium , with uneven echoes and an anechoic area inside it , suggestive of intra-neoplastic necrosis. Left ventricle systolic function was normal (66% of ejection fraction value).
+Use of a fiberoptic bronchoscope indicated normal bronchial mucosa after removing the blood adhering to the bronchial mucosa, and the bronchoalveolar lavage fluid presented a normal cytology with no evidence of infection, consistent with laboratory tests. 18F-FDG PET/CT was conducted and exhibited an increase in FDG uptake within the atrial lesion, lung nodules, and pericardial nodule. Thus, a putative diagnosis was established that multiple hematogenous metastases in lung and pericardial metastases were secondary to the primary right atrial neoplasm. Thus, a pathological diagnosis is urgent.
+A percutaneous biopsy from the left lung was performed and indicated mild chronic inflammation of the lung, accompanied by proliferation of fibroblastic tissues and alveolar epithelium cells, and by a few hemosiderin in the alveoli. Urgent wedge resections for biopsy were conducted from the right lung. The gross pathology examination showed many bleeding protuberances on the lung surface , with diameters of about 5 mm to 10 mm. The final pathologic diagnosis was angiosarcoma with H–E staining and immunohistochemistry based on paraffin section (CD31+ , CD34+ , ERG + , CK−, EMA−, CgA−, CAMTA-1−, TFE-3−). Thus, we confirmed the diagnosis that metastatic intrapulmonary hemorrhagic foci were secondary to a right atrial angiosarcoma. The patient died of cardiorespiratory failure at one month postoperatively before chemotherapy and radiotherapy. To support an increase in the accuracy and transparency, we reported this case according to the 2013 CARE Checklist of BMC Surgery .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_600_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_600_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e5f8437b249f7c6b0ce8ea3f6685c169b517a7f6
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_600_en.txt
@@ -0,0 +1,7 @@
+A previously healthy 13-year-old Caucasian boy presented with testicular trauma to a community hospital and was transferred to the University of Kansas Hospital (KUHA) pediatric intensive care unit (PICU) for management of hypotension and swollen painful testicles. Five days prior he had been kicked in the groin during a football game and presented to his primary care physician with scrotal pain and swelling of his scrotum. Initial treatment consisted of rest and watchful waiting.
+Two days post-trauma he developed fever and nausea while at home and was taken to the emergency department of an outside facility. On examination the patient's scrotum was extremely swollen and tender, and his testes were firm to the touch. Urinalysis showed an elevated white blood cell count (WBC) and red blood cell count, and was positive for ketones, hemoglobin, leuko-esterase, and bacteria; however, gram stain and urine culture revealed no organisms. Blood culture also showed no growth of organisms. Ultrasound at this time showed findings suggestive of bilateral epididymitis with no evidence of testicular torsion or mass. The patient was discharged in stable condition on hydrocodone for pain and doxycycline for epididymitis with instructions to follow up with urology if symptoms worsened.
+Four days post-trauma, the patient presented to the urologist complaining of blood in his urine, lightheadedness, nausea, vomiting, and shortness of breath secondary to severe scrotal pain. On physical examination his scrotum was enlarged, warm, tender, and firm. He was admitted with a WBC of 38,600/mm3 with a left shift, and normal blood chemistry. The patient also had a temperature of 38.8°C, C-reactive protein (CRP) of 20 mg/dl, and an erythrocyte sedimentation rate of 80 mm/hour. Urinalysis was unchanged from the previous results. Ultrasound showed findings of bilateral epididymitis and echogenic material surrounding both testes, which was slightly more prominent in volume compared with the study done 2 days prior. Abdominal and pelvic computed tomography scan found shotty inguinal and periaortic nodes, as well as, mesenteric adenopathy. No discrete abscess or diffuse abnormal inflammation was seen. Doxycycline was discontinued and IV ceftriaxone was started empirically, although no microbiological organism was cultured from the patient's blood or urine. He was later switched to vancomycin and meropenem for broader antimicrobial coverage.
+On the fifth day post-trauma the patient remained febrile with progressing scrotal swelling and pain. The patient subsequently developed hypotension with a blood pressure drop as low as 87/22 mmHg, at which time; he was started on a dopamine drip at 13 mcg/kg/minute. An electrocardiogram performed at the time showed normal sinus rhythm. Once stabilized, he was transferred to KUHA's PICU for further management. Upon arrival his temperature was 39°C and heart rate was 108 beats per minute. The patient's blood pressure dropped again to 84/20 mmHg but was stabilized with dopamine and fluids. The patient's scrotum was swollen, erythematous, and his left testicle was more tender than his right. He had a WBC of 34,600/mm3, and CRP of 33 mg/dl. Doppler ultrasound scan of the scrotum showed focal heterogeneity with decreased vascularity in the left upper testicle consistent with a small laceration, subscapular hematoma and intraparenchymal hematoma.
+Blood and urine cultures at presentation to the PICU were negative for organisms. Ceftriaxone was restarted as his antibiotic regimen. The patient's WBC and CRP gradually declined while his scrotal sonograms showed little change during hospitalization. The patient's clinical condition gradually improved with continued antimicrobial therapy, scrotal elevation, ice and rest. The urological consult did not find evidence of abscesses or torsion and therefore did not recommend surgical intervention.
+By day 10, the patient's scrotal exam had dramatically improved, his WBC had normalized, CRP was 4.38 mg/dl and he had been afebrile for 4 days. His blood and urine cultures at initial presentation to the community hospital and at our facility were all negative. He was discharged on Levaquin 750 mg for 11 days to complete 21 days of therapy.
+At the 6-week follow up appointment the patient had significant improvement in scrotal appearance and swelling with some continued mild edema of the scrotal subcutaneous tissue and firm testes. His WBC was 9600/mm3 with a normal differential and on ultrasound there was interval decrease in bilateral testicular size with persistent diffuse moderate heterogeneity. These findings were consistent with resolving swelling and edema from post-traumatic orchitis and/or intraparenchymal hematoma and/or injury. Three months after the initial testicular trauma, the patient's testes were smaller and softer on examination and findings on ultrasound were consistent with post-inflammatory scarring.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_601_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_601_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..c217f7b5d72972cf92850b7c0f4f57c64e1439c3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_601_en.txt
@@ -0,0 +1,5 @@
+A 73-year-old (S.M. 24–08-39) woman presented at the gynecological first aid of the Grande Ospedale Metropolitano di Reggio Calabria (Italy) on the 22nd May 2012 referred with acute abdominopelvic pain. Her weight and height were, respectively, of 55 Kg and 155 cm. A detailed history with particular emphasis on gynecological data was taken. The woman was virgo, had a laparotomic appendectomy in childhood, had no pregnancy, and had been in menopause since the age of 50 years, receiving medication for hypertension. No other clinically relevant datum resulted from her medical and family history.
+There was no history of weight loss or loss of appetite. Bowel and bladder habits were normal. The physical examination (including rectal examination) showed a palpable abdominopelvic mass with abdominal tenderness. The woman reported an increasing abdominal girth during the last 2 months. During the clinical examination, the patient had also nausea and vomiting. At admission, she was tachycardic (95 bpm) and tachypneic (16 breaths per minute). Initial transabdominal ultrasound examination was performed in an emergency. A pelvic mass consisting of a uniloculated cyst of about 24 cm of maximum size with multiple small mobile hyperechoic internal lesions was observed . A solid and inhomogeneous structure of about 2 cm located in the inferior cystic wall was also observed . No fluid or ascites was detected. An expert operator continued the ultrasound examination showing extreme mobility of the endocyst formations to the movements impressed by the probe and a “honeycomb” aspect was observed with the use of tridimensional ultrasound (3D-USG) . No (typical/atypical) vascularization of the pelvic mass was detected at color Doppler velocimetry. Due to acute abdominal pain non-responsive to aggressive treatment with pain drugs, including a high dose of non-steroidal anti-inflammatory drugs (NSAD) (Toradol, ketorolac tromethamine, 2 vials of 10 mg/ml ev) plus (Contramal, tramadol hydrochloride, 1 vial of 100 mg/2 ml), it was decided for emergency surgery. The patient underwent a preoperative blood sample (for complete blood count, coagulation, and ovarian cancer markers) and electrocardiograms were transported to the operating room. Serum tumor markers, in particular, cancer antigen 125 (Ca 125), cancer antigen 19.9 (Ca 19.9), carcinoembryonic antigen (CEA), alphafetoprotein (AFP), human chorionic gonadotrophin (hCG), and lactate dehydrogenase (LDH) resulted in all normal ranges.
+In consideration of the large mass and the little size of the abdomen, a longitudinal midline umbilicus-pubic skin incision was initially performed. Upon exploration of the abdomen, the pelvic mass was found to involve the entire left ovary, was mobile, and in partial torsion on its vascular peduncle. A left ovariectomy was initially performed without intra-abdominal spillage. The macroscopic aspect of the left ovary after surgical excision is shown in Fig. . The tumor was opened and inspected . It had the macroscopic aspect of the MCTO and appeared to contain citrine liquid and numerous, small and identical neoformations. A calcific parietal implant with hair with a near area of about one centimeter of papillary tissue was also detected at the inspection of the internal capsule . A biopsy was performed on this papillary structure for intra-operative histological examination. An intra-cystic area of squamous cell carcinoma was detected at the frozen section. Thus, a complete surgical staging for ovarian cancer, including total hysterectomy, bilateral adnexectomy, infracolic omentectomy, pelvic and para-aortic node dissection, and peritoneal washing, was performed. No local and/or distant suspected lesion was detected at the direct exploration of the pelvis, and the low and high abdomen. The patient was discharged from the hospital on the fifth day. No short- and long-term intraoperative or postoperative complications were found.
+The definitive histological examination confirmed the presence of an MCTO measuring 21 × 19 × 17 cm with multiple neoformations of adipose tissue of about 6 mm each. A unique calcific parietal implant with hair was also observed. A papillary area of about one centimeter was described at the macroscopic examination. A total intra-cystic squamous cell carcinoma of moderate differentiation (grading 2) was also confirmed at microscopy. No local and/or distant metastasis was detected in all samples (uterus, surface of the left ovary, right ovary, left and right tubes, omentum, 8 right iliac nodes, 7 left iliac nodes, and 6 aortic nodes) sent for definitive microscopic examination. No cancer cells were also detected at the cytologic examination of the intracystic fluid and of the peritoneal washing. Thus, a Ia stage ovarian cancer according to the International Federation of Gynecology and Obstetrics was diagnosed.
+After 30 days from hospital discharge, a computer tomography (CT) of the abdomen was performed confirming no disease. In consideration of the definitive histological report, the multidisciplinary group suggested only clinical follow-up. Follow-up visits were performed every 6 months for the first 3 years and subsequently yearly. The patient died of myocardial infarction on May 10, 2021.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_611_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_611_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2c714e94dabea6b63ab78708f4d037490d5b81e0
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_611_en.txt
@@ -0,0 +1,5 @@
+A 59-year-old Pakistani woman with a past medical history of hypertension and a significant family history of cancer in first-degree relatives (breast, ovarian, and pancreatic cancer) was referred to the cardiothoracic surgery clinic. This was due to an incidental finding of a nodular density on her chest X-ray as part of a preoperative workup for a total left knee replacement due to osteoarthritis. However, there were no previous chest images for comparison. Aside from a minor complaint of blood-tinged sputum in the morning, there were no complaints or symptoms. She was vitally stable and saturating well on room air. Her general physical, cardiovascular, respiratory, abdominal, and central nervous system examinations were unremarkable.
+Radiological imaging (CXR) showed a nodular density in the right lower zone of the right lung measuring approximately 2.5 cm × 2 cm. A subsequently conducted high definition [18F]fluorodeoxyglucose (FDG) positron emission tomography/computed tomography (PET/CT) scan revealed a lobulated soft-tissue lesion measuring 23 mm × 23 mm (with internal cavitation) along the medial aspect of the anterior segment of the lower lobe of the right lung . The lesion had a maximum standardized uptake value (SUVmax) of 2.7. No evidence of hypermetabolic nodal, pulmonary, hepatic, splenic, adrenal, or bony metastasis was observed.
+A CT-guided core biopsy of the lesion was performed. Histopathological evaluation revealed a core of a spindle cell lesion with smaller cores of native unremarkable lung parenchyma. Significant cytological atypia or increased mitotic activity was not seen. Immunohistochemical staining revealed the cells to be S100 focal positive, SOX-10 negative, ASMA negative, Melan A negative, HMB-45 negative, STAT6 negative, and CD34 patchy positive. A diagnosis of a benign spindle cell lesion, likely of neural origin, was made. An elective surgical resection was planned for a month later.
+After standard preoperative optimization and preparation, a posterolateral thoracotomy with right lower lobectomy was performed under general anesthesia. The pleural cavity was entered through the fifth intercostal space. Enlarged station 9R and 10R lymph nodes and a mass in the lower lobe of the right lung were visualized, while no masses were observed in the middle or upper lobes. There were no pleural nodules or pleural effusion. The inferior pulmonary ligament was divided, and the inferior pulmonary vein was identified and divided between ties. The oblique fissure was incomplete, and was used to separate the upper, middle, and lower lobes of the lung through cautery. The pulmonary artery was identified at the confluence of the oblique and horizontal fissures, and the superior segmental and basilar branches were visualized. The superior segmental branch and the pulmonary artery distal to the take-off of the middle lobe branch were both divided between ties. The bronchus intermedius was dissected and the middle lobe bronchus was identified. The bronchus distal to the middle lobe take-off was dissected, and a TA-30 stapler was used to divide the superior segmental bronchus and the bronchus distal to the middle lobe take-off. The mass was then resected, and hemostasis was secured. The surgical wound was closed in layers after the placement of an extrapleural catheter and chest tubes, and the patient was shifted to the in-patient facility. The patient remained vitally and hemodynamically stable and was discharged 3 days after the operation. The patient was confirmed to be in her usual state of health upon 6-month and 1-year follow-up, with no late complications or recurrences.
+Histopathological examination of the resected lobe showed lung parenchyma infiltrated by an encapsulated neoplastic lesion composed of well-differentiated Schwann cells. The neoplastic cells showed a biphasic pattern with compact areas of spindle cells having moderate eosinophilic cytoplasm and normal chromatic elongated nuclei. Areas of occasional palisading (Verocay bodies) were also seen . These morphological findings, combined with immunohistochemical staining results concurrent with those mentioned earlier, were consistent with the diagnosis of an intrapulmonary schwannoma.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_627_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_627_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..882a3dd2fe50a3e097510b6cbfd096ee6d950501
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_627_en.txt
@@ -0,0 +1,2 @@
+A 45-year-old Khas male from Kathmandu, Nepal, office-worker by profession, presented to us with complaints of generalized aches and pains all over the body for one week and chest pain for two days. The chest pain was localized to the right lower region, gradual in onset and sharp stabbing in character which was aggravated on deep inspiration. He also complained of dry cough associated with shortness of breath for two days which was increased on exertion. He had no history of fever, rhinorrhea or sore throat or similar history in his family members or colleagues. He had a history of type 2 diabetes mellitus and hypertension for five years. He had no prior history of surgery or trauma. He had been diagnosed as a case of bilateral serous otitis media 20 days prior to this presentation for which bilateral grommet insertion was done at another hospital. However, he had no history of recurrent sinusitis, nasal deformity, hemoptysis, mononeuritis, frothy or bloody urine, skin rash, red eyes, joint pain, Raynaud’s phenomenon, alopecia, photosensitivity, oral or genital ulcers. His current medications included metformin-glimepiride (1gm/2 mg) twice daily, amlodipine-losartan (5/50) once daily and atorvastatin 10 mg once daily. He was a social drinker and non-smoker. He had no significant illness in the family. Physical examination showed tachycardia at 120 bpm, Blood pressure 130/90 mm Hg and respiratory rate 20 per minute with oxygen saturation 90% on room air. Head, ears, eyes, nose and throat (HEENT) examination was unremarkable. Chest examination revealed decreased breath sounds in right infra-scapular and infra-axillary regions. Cardiovascular examination revealed a pericardial friction rub with normal heart sounds. The abdominal, musculoskeletal, nervous system and skin examinations were unremarkable.
+His initial laboratory investigations showed mild anemia with neutrophilic leukocytosis . His nasal swabs for COVID-19 and influenza were negative. Chest radiography showed elevated right hemidiaphragm with blunting of bilateral costophrenic angles . Transthoracic echocardiography demonstrated minimal pericardial effusion with normal left ventricle and right ventricle systolic function. The patient was admitted with the working diagnosis of right sided pleuritis with pericarditis. The patient was managed with supportive measures along with empirical antibiotics in the line of pleuro-pericarditis. Further investigations were done including ultrasound of the chest which showed significantly reduced diaphragmatic excursion on the right side. Computed tomography (CT) chest showed a well-defined nodule in left upper lobe with bilateral pleural and pericardial effusion . Pulmonary function test (PFT) was done which showed significantly improved forced vital capacity in sitting position in comparison to supine position . Because of multisystem involvement in the form of bilateral otitis media, phrenic nerve palsy, pleuropericarditis, pulmonary nodule, neutrophilic leukocytosis, raised inflammatory markers, a strong suspicion for GPA was made. Anti proteinase-3(PR-3) was sent which came back strongly positive . A final diagnosis of GPA was made and the patient was started on intravenous methylprednisolone pulse of one gram daily for three days. He was also given the first dose of intravenous rituximab at 375 mg/m2 which was planned for a total of 4 weeks with prednisolone 60 mg. With the above treatment, his symptoms and laboratory markers started improving. He was discharged after seven days with the final diagnosis of GPA. Till the writing of this report, he had already completed 4 doses of rituximab and he had no further episodes of cough, chest pain, shortness of breath and body ache. His laboratory parameters including C-reactive protein (CRP) had normalized. However, his repeat chest X-ray showed persistent elevation of the right hemidiaphragm.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_638_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_638_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a92b718cd06a594bed8a11a8ecb475518f99cbad
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_638_en.txt
@@ -0,0 +1,3 @@
+The patient was a 51-year-old, female sex, blood group O, with advanced decompensated primary biliary cirrhosis presenting with refractory ascites, sarcopenia, portal hypertension and significant jaundice. The United Kingdom Model for End-Stage Liver Disease (UKELD) score was 61 [, , ] and she was listed for LT. This patient received a DCD liver from a 74-year-old, male sex, donor. Further donor details are presented in . Recipient laboratorial data on the index admission for transplantation were summarised in .
+The graft had normal hepatic artery anatomy, but an extensive atheromatous plaque up to the GDA. During implantation, the graft GDA was divided obliquely along the main hepatic artery stem and an endarterectomy was done. A plaque free portion of the hepatic artery above the GDA was obtained for direct anastomosis to the native CHA at the GDA junction; thereafter, a short, straight and non-redundant arterial reconstruction was performed. The anastomosis width was just over 6 mm, there were good pulse waves and the resistance index was confirmed by doppler ultrasound intra-operatively.
+Surgical times are presented in . In terms of postoperative complications, this patient developed renal dysfunction and fluid overload in the immediate post-operative period, requiring temporary renal support. Additionally, further respiratory infection required the intensive care unit (ICU) up to post-operative day (POD) 9. Patient also developed delayed graft function with prolonged cholestasis. The bilirubin level was 266 mmol/L on POD 29 and it improved gradually down to 69 mmol/L by POD 49 when the patient was discharged. It was within the normal range (18 mmol/L) after 3 months of the transplant. During hospitalisation 4500 units of low molecular heparin and 75 mg of aspirin were given daily from POD 1 onward, as per unit protocol. The haemoglobin level was maintained around 80 g/L and platelets on an average of 80,000 counts until POD 5. Immunosuppression was standard, and the biochemistry was within the normal range at 4 months follow up. An ultrasound scan at 4 months post-transplant showed patent graft vessels and a non-dilated biliary system without evidence of HAT or hepatic artery stenosis (, ).
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_694_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_694_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..b080635b730f78d86234a9052b15742c16d9491a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_694_en.txt
@@ -0,0 +1,4 @@
+A 15-year-old girl presented to our clinic with long-term nasal obstruction, which was bilaterally and more severe on the left side. The initial examination revealed that the patient had no history of epistaxis, trauma, headache, previous rhinoplasty, or constitutional symptoms. Moreover, the case lacked a history of any drug abuse, cocaine, and long-term nasal sprays. She also lacked any drug allergies and was healthy in other aspects, and the results of routine laboratory tests were normal. In the anterior rhinoscopy, a mass on the mucosal surface was observed, which almost completely filled the right nasal cavity. On the left side, there was a very severe nasal septal deviation that almost reached the lateral wall of the left nasal cavity. The endoscopic exam of the case showed a huge middle turbinate on the right nasal cavity that compressed the mid-portion of the nasal septum and made it deviate to the left side. Due to severe nasal septal deviation, the endoscope did not pass through the left side. No perforation was observed through the endoscopy. Since the endoscopic exam was not satisfactory, we requested a computed tomography (CT) scan of the paranasal sinuses without contrast to evaluate the whole system. Computed tomography imaging was consistent with giant CB on the right nasal cavity that passed through the nasal septum and extended somehow through the nasal septum. The septum seemed to be perforated, and there was a severe nasal septum deviation to the left side. This imaging also showed bilateral pneumatized superior concha and hypertrophic inferior conchae on the left side; nevertheless, no sinusitis was observed .
+According to , giant concha bullosa on the right nasal cavity passed through the nasal septum and extended through the nasal septum, and the septum perforation can be noticed.
+The patient was scheduled for surgery. Functional endoscopic sinus operation was performed under general anesthesia. After local anesthesia, 2 ml of 2% lidocaine and epinephrine 1: 100,000 was injected along the anterior parts of the middle turbinate. Separated the outer and inner slices of the large middle concha, and then, resect the inner slice to assess the nasal septum. The middle turbinate had pneumatized in preference to the anterior ethmoid cells. As expected, there was a circular perforation with preserved mucosa on its margins. As the pressure was reduced, we managed to perform an endoscopy on the left side .
+Histopathological examination of the excised lesion revealed fibroconnective tissue and inflammatory cell infiltration with no evidence of granulomatous reaction or malignancy. Purified protein derivative skin test was considered negative and perinuclear anti-neutrophil cytoplasmic antibodies (p-ANCA) and classic-ANCA and angiotensin-converting enzyme levels were within normal range. Chest X-ray examination was normal. The microbial smear and culture of the specimen were negative. After the operation, the patient's symptoms alleviated rapidly.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_726_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_726_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f21670422bb7ebb47745ff7d908df74814165ca2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_726_en.txt
@@ -0,0 +1,4 @@
+A 12-year-old Caucasian girl came to the emergency department of our hospital. She reported abdominal pain of 48-hour clinical course located in the left iliac fossa as well as feeling nauseous. The patient reported similar clinical symptoms, which were self-limiting, the month prior. She did not present with any medical or surgical history of note, and her gynecological history revealed that she had not undergone menarche and had not yet commenced sexual relations.
+Her physical examination revealed normal vital signs and no fever. We observed normal development of secondary sexual characteristics in Tanner stage 3–4. She presented with abdominal pain on deep palpation in the left iliac fossa, was free of signs of peritoneal irritation, and had no organ masses or organomegaly. Additional tests revealed mild leukocytosis (11.1 × 103/μl) with left shift (81.2% neutrophils) and negative C-reactive protein (CRP; < 0.5 mg/L). The results of basic analysis of normal urine and pregnancy tests were negative. We performed abdominal and transrectal ultrasound and visualized the patient’s uterus and ovaries of normal size, form, and echogenicity. Adjacent to the left ovary, an elongated formation of approximately 52 × 27 mm was seen, with anechoic content and negative color Doppler map, which suggested hydrosalpinx. No free fluid in the pouch of Douglas was observed .
+Given the above findings, hospital admission and observation were decided. Oral analgesia with 650 mg of paracetamol every 8 hours was prescribed. After 48 hours, the patient’s symptom of abdominal pain receded. No leukocytosis with a negative CRP was observed. Given the stability of the clinical symptoms, and having ruled out the complication of hydrosalpinx, hospital admission and monthly monitoring in gynecology consultation were decided.
+After 3 weeks, the patient was readmitted because of abdominal pain, nausea, and vomiting of several hours’ clinical course. She had presented menarche the week prior to readmission. Upon physical examination, she presented with intense pain in the left iliac fossa with signs of peritoneal irritation. Ultrasound revealed the same left para-adnexal formation and existence of a moderate amount of free fluid in the pouch of Douglas. Her blood workup had worsened, with leukocytosis (13.5 × 103/μl), left shift (83.9% neutrophils), and elevated CRP (24 mg/L). Given these findings and suspected complications, exploratory laparoscopy was indicated. During the intervention, we observed that the left fallopian tube was increased in size, with torsion on its own axis, signs suggesting ischemia and impossible detorsion. We proceeded to perform left salpingectomy . On a macroscopic level, subsequent pathologic study of the surgical specimen revealed a violet-colored tube measuring 53 × 35 × 20 mm. Microscopically, the existence of tissue with hemorrhagic infarction free of evidence of malignancy was revealed.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_750_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_750_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..95b26aa3d4b2f4bbbecec251d719bb85ad9c9fdd
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_750_en.txt
@@ -0,0 +1,8 @@
+The patient was a 65-year-old woman (height: 1.65 m; weight: 50 kg; body mass index: 18.4 kg/m2), who presented with a 2-year history of intermittent diarrhea.
+A 2-year history of intermittent diarrhea.
+The patient had a history of hypertension (diagnosed 2 years prior) and no history of surgery.
+Family history: The patient had a free family history.
+Obstetric history: The patient had an uneventful obstetric history (gravidity: 1, parity: 1).
+Findings from the physical examination upon admission were unremarkable.
+Routine blood examination, serum biochemistry tests, and measurement of tumor markers and coagulation function yielded results within normal range. The level of carcinoembryonic antigen (commonly referred to as CEA) was normal (at 0.96 ng/mL) as was that of the carbohydrate antigen 19-9 (commonly referred to as CA 19-9; at 7.99 U/mL).
+A 2.5 cm ulcerative mass was found in the ascending colon near the ileocecal region by colonoscopy, and adenocarcinoma was confirmed by biopsy. Chest-abdomen-pelvis contrast-enhanced computed tomography (CT) revealed a thickened wall of the ascending colon, without obvious enlarged lymph nodes around the mass. No distant metastases were found.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_755_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_755_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..77d89ffc6e328fc90a3647aee59d15b75ca84d5a
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_755_en.txt
@@ -0,0 +1,6 @@
+A 60-year-old Japanese woman presented with numbness in both lower extremities. This symptom appeared four months prior to admission, and she experienced giddiness two months before. However, she had ignored these symptoms. Her medical history revealed that she had undergone an oophorectomy, and she had a uterine sarcoma at the age of 36 and mastitis at the age of 45. Her consciousness was clear but she had anaemic conjunctivae. Physical examination revealed that she was a well-nourished female with normal vital signs. She had no chest pain. Her liver and spleen were not palpable. Although she experienced numbness in both her lower limbs, the neurological findings were normal, and neither extremity was cold.
+The patient had a white-blood-cell count of 2.74 × 103/μl with 37% neutrophils, 62% lymphocytes and 1% monocytes. Her haemoglobin level was 7.8 g/dl and her platelet count was 1787 × 103/μl. Examination of bone-marrow aspirate revealed normal cellular marrow, megakaryocytic hyperplasia and erythroid dysplasia. Her karyogram was normal.
+Abdominal ultrasonography revealed in the aorta a moveable mass with a diameter of 1.5 cm. The interior of the mass had no blood supply. A computed tomographic scan of her abdomen revealed a circular thrombus in the descending aorta at the level of the diaphragm . Arteriosclerosis was not recognized at that point.
+We diagnosed this case of thrombocytosis and anemia as myelodysplastic syndrome and/or myeloproliferative disorder-unclassifiable (MDS/MPD-U), and the aortic thrombus was thought to be associated with myeloproliferative thrombocytosis.
+For myeloproliferative thrombocytosis, she was treated with 500 mg of hydroxyurea from the seventh day of her hospital stay. However, she was administered 1000 mg of hydroxyurea on the 16th day because her platelet count increased to 2074 × 103/μl. In addition, she was administered 50 mg of ranimustine on the 18th day. The platelet count decreased to 274 × 103 /μl on the 39th day, but it increased slowly thereafter. After administration of 1000 mg of hydroxyurea, her platelet count stabilized at approximately 1000 × 103/μl. She was administered transfusions for anemia.
+Ticlopidine was administered to prevent the development of a thrombosis on the seventh hospital day, which was the same day treatment for myeloproliferative thrombocytosis was initiated. Aspirin (100 mg) was administered when an aortic thrombus was identified by computed tomographic scan on the 10th day of her hospital stay. The numbness in both of her lower extremities disappeared within two days. Also, the aortic thrombus was not observed in the computed tomographic scan on the 17th day of her hospital stay. She was administered aspirin after seven days . She has been without symptoms for more than one year.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_781_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_781_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..e1f04cc3f72657252dbd4085e3e11735ed508f27
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_781_en.txt
@@ -0,0 +1,3 @@
+A 58-year-old male presented with diarrhea. His medical history included type 2 diabetes, hypertension, and a lumbar hernia. He had a history of smoking and occasional alcohol consumption. Physical examination results were unremarkable. Initial laboratory tests revealed a serum hemoglobin level of 12.7 g/dL, a serum carcinoembryonic antigen level of 1.5 ng/dL (reference range: 0–2.5 ng/mL), and a carbohydrate antigen 19–9 level of 13.0 ng/dL (reference range: 0–37 U/mL). Lower gastrointestinal endoscopy revealed a half-circumferential rectal tumor. A biopsy confirmed a well-differentiated adenocarcinoma. Contrast-enhanced computed tomography (CT) revealed focal wall thickening of the rectum (T3) with several enlarged perienteric lymph nodes (N2) and extramural vascular invasion, without evidence of metastasis (M0). The patient received two courses of neoadjuvant chemotherapy of mFOLFOX6 regimen, followed by laparoscopic Hartmann's operation. Arterial flow at the edge of the sigmoid colostomy was preserved during surgery. The perienteric peritoneal metastasis was completely resected. Postoperative histopathological findings revealed a residual adenocarcinoma with a TNM score of ypT3N2aM1c. The patient was discharged from the hospital on postoperative day 13.
+On postoperative day 28, the patient reported an abnormal orifice in the stoma and painful defecation. Physical examination revealed a colostomy fistula at the 6 o'clock position of the stoma orifice . No intra-abdominal abscess or inflammation was observed , and adjuvant chemotherapy with mFOLFOX6 was administered. However, the colostomy fistula gradually enlarged and painful defecation persisted. Consequently, laparoscopic colostomy reconstruction was performed.
+During surgery, no necrosis or abscesses were observed in the abdominal cavity. The edge of the stoma was resected, and colostomy reconstruction was performed without complications. Macroscopic examination of the resected intestinal tract revealed thickening of the surrounding intestinal wall, without the evidence of a diverticulum . Histopathological analysis of the resected colon with the fistula showed a fibrosis replacement where originally muscularis propria exists, with adjacent ganglion cells . The patient did not experience any adverse events or gastrointestinal symptoms following surgery.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_789_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_789_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..99426668ec0938a22dc61dbcc0853aa09b4154e2
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_789_en.txt
@@ -0,0 +1,7 @@
+A 65-year-old male presented to the clinic with bilateral knee pain. On clinical examination, he had tenderness restricted to the medial joint line, and a correctible varus deformity. Plain radiographs of bilateral knee joint confirmed the pain to be due to bilateral, severe, and medial compartment osteoarthritis of the knee joint . The patient was on the treatment for hypertension for the past decade.
+He underwent bilateral UKR in single sitting. The intraoperative, perioperative, and immediate post-operative period was uneventful. The post-operative radiographs were acceptable, and the patient was discharged in a stable condition .
+By 21st post-operative day, he improved to a normal gait with near-complete pain relief. On 8-month post-operative follow-up, he presented with pain in the right knee which was exaggerated on weight bearing, difficulty in bending the knee, and an alteration in the gait was observed . On clinical examination, suprapatellar effusion was found due to a tense suprapatellar pouch and a positive patellar tap test.
+Consequently, the collection in the suprapatellar pouch of the affected knee joint was aspirated under all aseptic precautions. 120 cc of bloody aspirate was obtained, suggestive of hemarthrosis. Post-aspiration, the pain subsided, and the patient regained normal gait with no further complaints.
+Six months after this (1.5 years postoperatively), the patient presented with the same complaints in the same knee. Repeat aspiration of the suprapatellar pouch was done, and around 110 cc with bloody aspirate was noted. This time, the condition recurred after a mere 3 days, raising the suspicion of a pseudoaneurysm formation in the mind of the chief surgeon, due to the nature and the frequency of complaints. The patient was advised dynamic magnetic resonance angiography of his right lower limb. The diagnosis was confirmed to be a pseudoaneurysm of the right lateral genicular artery of the knee joint.
+The patient was referred to an interventional radiologist and he was advised angiography-guided embolization of the lateral genicular artery using polyvinyl alcohol particles .
+Post-embolization, the recurrence of hemarthrosis stopped, and the patient was mobilized immediately. Over a year since then, the patient has had no recurrence and has achieved complete clinical and functional normalcy in terms of gait, range of motion, and return to activities of daily life.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_82_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_82_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a74a5d781fc8757ae835678d94d118d201ec43fc
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_82_en.txt
@@ -0,0 +1 @@
+A 4-year-old girl was brought by her mother from Saravan city to the emergency department of gynecology in Ali-Ibn-Abitaleb Hospital of Zahedan University of Medical Sciences in May 2012, with the complaints of a foreign body in her vagina and lower abdominal pain for eight hours. The clinicians did a pelvic X-Ray in Saravan city hospital that showed a big metal nail in the child`s vagina . In physical examination of the girl in frog-leg position and by tension of her vulvae labials major, a black point in depth of her vagina through the orifice of hymen was observed, it was the tail of a nail, the hymen was intact and her mother entreated that we discharge the nail without trauma to child hymen. Fortunately the cooperation of child was very good and we could discharge the nail by doing the TR (rectal exam with finger) and pushing the nail to midline of vaginal canal and extraction of nail out of vagina by use of a magnetic mag . In this case, it could not be established whether the nail had been inserted by the child herself or by another child or an adult.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_848_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_848_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..486570f87a1742d4c399071036a45369d4d72df3
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_848_en.txt
@@ -0,0 +1,10 @@
+An 81-year-old man presented with epigastric pain lasting for a month.
+His pain increased after eating. He had undergone esophagogastroduodenoscopy (EGD) at the previous hospital, which showed findings suggesting GLP. He was therefore admitted to our hospital for further examinations.
+The patient had a history of postoperative benign prostatic hyperplasia and eradication of Helicobacter pylori.
+He had no specific personal and family history.
+His vital signs were normal, and the abdomen examination revealed mild epigastric tenderness and no guarding or rebound tenderness. He had no swollen Virchow's lymph nodes or parotid or lacrimal glands.
+A blood examination showed that inflammatory markers, serum pancreatic enzymes, and total and direct bilirubin levels were normal . The levels of serum carbohydrate antigen 19-9 (CA19-9) and IgG4 were elevated (2556 U/mL and 280.5 mg/dL, respectively).
+Endoscopy: EGD showed giant gastric folds and reddish mucosa; however, no epithelial changes were observed. The gastric lumen was not distensible by air inflation, making duodenoscopy impossible to perform . We suspected GLP, so seven specimens were obtained by a gastric mucosal biopsy, none of which showed malignancy .
+Computed tomography and fluorodeoxyglucose-positron emission tomography/computed tomography: Contrast-enhanced computed tomography (CT) showed thickening of the wall of the gastric body . Incidentally, CT showed diffuse enlargement of the pancreas and peripancreatic rim, suggesting the coexistence of AIP . No evidence of bile duct obstruction or dilation was observed. After fluorodeoxyglucose-positron emission tomography/CT (FDG-PET/CT), the accumulation of FDG was found in both the gastric wall [maximum standardized uptake value (SUVmax: 19.2) and pancreas (SUVmax: 4.9)] . No other organ involvement complicating AIP and no obvious metastasis of GLP nor swollen nodules in which FDG had accumulated were observed.
+EUS and EUS-FNB findings: An EUS-FNB was performed for the histopathological diagnosis. With a linear array echoendoscope and a universal ultrasonography processor (EG-580UT and SU-1; Fujifilm, Tokyo, Japan), the thickened third layer of the gastric wall (representing the submucosa) and the fourth layer (representing the muscularis propria) were observed , which was consistent with the findings of GLP. The thickness of the gastric wall as measured by EUS was up to 18.5 mm. The thickened fourth layer of the gastric wall was punctured a total of three times using a 19-gauge needle (SharkCore; Medtronics, Minneapolis, MN, United States) . EUS also revealed hyperechoic spots in the diffuse hypoechoic pancreatic parenchymal and duct-penetrating sign . These findings were consistent with AIP, and no obvious pancreatic tumor was observed. Puncturing the pancreas to obtain pancreatic tissue seemed undesirable because a transgastric puncture might cause seeding of cancer, and transduodenal puncture was impossible due to difficulty reaching the duodenum with the scope. No adverse event related to an EUS-FNB occurred.
+Histopathology: The histopathological findings of the gastric wall showed poorly differentiated adenocarcinoma within the muscularis propria and the deeper site of the mucosa . No cancer cells were found in the shallow site of the mucosa. In the muscularis mucosae, fibroblasts had proliferated and were considered to be the cause of gastric wall thickening.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_869_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_869_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..82b0e93ef2defdfddde3a163607ef33fcf418f2f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_869_en.txt
@@ -0,0 +1,11 @@
+The patient was a 3 years old girl who for 2 months had symptoms and signs of disease with fever and reduced general condition. The last week she had nose bleedings, petechiae, and pain from the throat and abdomen. The initial blood tests showed hemoglobin 4.3 g/dL (normal 11–14 g/dL), leukocytes 72 × 109/L (normal 4 × 109/L–15 × 109/L), and thrombocytes 19 × 109/L (normal 150 × 109/L–450 × 109/L). The blood and bone marrow smears revealed that the patient had acute lymphoblastic leukemia. Immunophenotyping of peripheral blood showed 80% pre-B-lymphoblasts, in the bone marrow 88%. The patient was treated according to the NOPHO ALL 2008 protocol, high-risk group . She started with induction treatment, but the bone marrow on day 15 showed 90% lymphoblasts. The treatment was therefore changed to block treatment according to the protocol, and on day 34 minimal residual disease (MRD) was less than 0.01%. Also repeated later measurements have shown MRD of less than 0.01%.
+The G-banding analysis at diagnosis of bone marrow and blood metaphase cells revealed a normal karyotype, 46,XX, in all 25 examined metaphases . Interphase FISH analyses with the Cytocell (Cytocell, Banbury, Oxfordshire, UK) multiprobe ALL panel did not detect aberrations of MYC, CDKN2A, TCF3, MLL, and IGH, no ETV6-RUNX1 or BCR-ABL1 fusions, nor was hyperdiploidy seen in 200 examined nuclei (data not shown). FISH with the PDGFRB breakapart probe (Cytocell) showed loss of the distal part of the probe in 176 out of 201 examined interphase nuclei from white blood cells and 42 out of 100 examined interphase nuclei from bone marrow cells, suggesting a genetic breakpoint in the PDGFRB locus in 5q32 .
+aCGH was performed with genomic DNA extracted from the patientʼs peripheral blood cells using the Maxwell 16 Instrument System and the Maxwell 16 Cell DNA Purification Kit (Promega, Madison, USA). Promegaʼs human genomic female DNA (Promega, Madison, USA) was used as reference DNA. For aCGH, the CytoSure array products were used (Oxford Gene Technology, Begbroke, Oxfordshire, UK) following the company’s protocols. The CytoSure Genomic DNA Labelling Kit was used for labelling of one μg of patient’s and reference DNA, the CytoSure Cancer +SNP array was used for hybridization, and the CytoSure Interpret analysis software was used to analyse the results.
+aCGH revealed submicroscopic deletions in chromosome bands 5q32q35.3, 7q34 (within TCRB), 9p13 (PAX5), 10q26.13 (DMBT1), 14q11.2 (TRAC), and 14q32.33 (within the IGH locus) . The deletion on 5q was 30 Mb long, started between exons 8 and 9 of PDGFRB (5q32), and finished in the CANX locus (5q35.3). The result was in agreement with the FISH data obtained with the PDGFRB breakapart probe . Because both FISH and aCGH findings indicated a possible PDGFRB-fusion gene, one µg of the total RNA, extracted from the patient´s bone marrow at the time of diagnosis using miRNeasy Mini Kit (Qiagen Nordic, Oslo, Norway), was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital for high-throughput paired-end RNA-sequencing. For library preparation from total RNA the Illumina TruSeq RNA Access Library Prep kit was used according to Illuminaʼs protocol (Illumina, San Diego, CA, USA; ). Sequencing was performed on NextSeq 550 System (Illumina) and 16 million reads were generated.
+Because the raw fastq RNA sequencing data were in the text-based format, we used the “grep” command-line utility to search for sequences which contained part of the ninth exon of PDGFRB . Using the search term “TCCCTGTCCGAGTGCTGG”, which corresponds to 1713–1730 nt in the PDGFRB reference sequence with accession number NM_002609.3, only one 76 bp long sequence was extracted . BLAT of this sequence on the human genome browser-hg19 assembly showed that the sequence between nucleotides 26–76 mapped on chromosome 5 at position 149510177–149510227 and was part of exon 9 of PDGFRB. The sequence between nucleotides 1–27 (GCCAGTTGGAAGTTCCAGCCACAGAAG) mapped on chromosome 7 at three different positions: (a) chr7:74172307–74172333 (exon 32 of general transcription factor Iii, GTF2I, reference sequence: NM_032999.3), (b) chr7: 74603796–74603822 (exon 22 of general transcription factor IIi pseudogene 1, GTF2IP1, reference sequence: NR_002206.3), and (c) chr7:72618618–72618644 (exon 22 of general transcription factor IIi pseudogene 4, GTF2IP4, reference sequence: NR_003580.2). These data were verified when we used the BLAST algorithm to compare the sequence with the reference sequences NM_002609.3 (PDGFRB), NM_032999.3 (GTF2I), NR_002206.3 (GTF2IP1), and NR_003580.2 (GTF2IP4).
+In order to confirm the existence of the GTF2I–PDGFRB fusion gene, reverse transcription (RT) and genomic PCR analyses were performed as previously described . The primers used for PCR amplifications and Sanger sequencing analyses are shown in Table . RT-PCR with the primers GTF2I-3306F1/PDGFRB-1732R1 amplified an 84 bp long cDNA fragment. Sanger sequencing of the PCR products verified the fusion which was found upon searching the RNA sequencing data using the “grep” command . Thus, the leukemic cells carried either the fusion transcript GTF2IP1-PDGFRB, or GTF2I–PDGFRB, or GTF2IP4-PDGFRB. Genomic PCR with the primers GTF2I-3317F1 and PDGFRB-1737R1 amplified a single 1200 bp fragment which by Sanger sequencing was shown to be a hybrid genomic DNA fragment in which intron 8 of PDGFRB is fused with either intron 22 of GTF2IP1, intron 32 of GTF2I, or intron 22 of GTF2IP4 . Additional interphase FISH experiments were performed to detect the GTF2I–PDGFRB fusion gene . BACs RP11-21I20 and RP11-137E8 were retrieved from the Human “32K” BAC Re-Array library (BACPAC Resources, ). RP11-21I20, the probe for the PDGFRB gene, mapped to band 5q32 (Position: chr5: 149,320,375–149,496,703; UCSC Genome Browser on Human February 2009 GRCh37/hg19 Assembly) and was labeled red . RP11-137E8, the probe for the GTF2I gene, mapped to band 7q11.23 (Position: chr7: 73,944,720–74,129,587) and was labeled green . Detailed information about the FISH procedure was given previously . Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK). FISH analysis showed a fusion signal in 44 out of 100 examined interphase nuclei from bone marrow cells suggesting a GTF2I–PDGFRB fusion gene . Thus, FISH with specific probes for PDGFRB and GTF2I was crucial to show that a novel GTF2I–PDGFRB fusion gene had been formed .
+Using the FusionCatcher software with the fastq files of the RNA sequencing data, an out-of-frame IKZF1–TYW1 fusion transcript was found .
+RT-PCR with the primers IKZF1-469F1/TYW1-1282R1 amplified a 319 bp long cDNA fragment which by Sanger sequencing was shown to contain IKZF1–TYW1 . The fusion point thus detected was identical to that found by analysis of the RNA sequencing data using the FusionCatcher software . In the IKZF1–TYW1 transcript, exon 4 of IKZF1 (nt 642 in sequence with accession number NM_006060 version 6) was fused out-of-frame to exon 8 of TYW1 (nt 1131 in NM_018264 version 4) .
+The IKZF1–TYW1 fusion gene would encode a putative truncated 159 aa IKZF1 protein containing the first 140 aa of IKZF1 (NP_006051) and 19 aa from the fused TYW1. This protein would not contain the functional domains of the normal IKZF1 protein. Alterations of IKZF1 (often deletions) are strongly associated with BCR-ABL1-positive as well as Ph-like ALL [, ].
+Additional interphase FISH experiments were performed to detect the IKZF1–TYW1 fusion gene using a home-made dual color dual fusion probe. The probes were made from commercial BACs which were purchased from BACPAC Resources Center . The probe for the IKZF1 gene was constructed from a pool of the clones RP11-813K3 (Accesion number AC020743; Position: chr7: 50157413–50339940) and RP11-95E2 (Accesion number AC018705; chr7: 50475184–50648153) and was labeled red . The probe for the TYW1 gene was constructed from a pool of the clones RP11-458F8 (Accesion number AC073335; Position: chr7: 66297269–66454983) and RP11-166O4 (Accesion number AC006480; Position: Chr7: 66699524–66859231) and was labeled green .
+FISH analysis showed double fusion signals in 91 out of 100 examined interphase nuclei from white blood cells suggesting an IKZF1–TYW1 fusion gene .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_871_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_871_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..2317e7e8338162bdee62022b03096225f5aaad5d
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_871_en.txt
@@ -0,0 +1,3 @@
+An 85-year-old man visited our hospital with dysuria including urinary hesitancy, difficulty and pain during urination, and hematuria. He had no family history of cancer, including prostate cancer, and had undergone a prostate biopsy 13 years earlier owing to an elevated PSA level of 7.18 ng/mL. Pathological evaluation revealed an adenocarcinoma with a Gleason score of 4 + 5 and a clinical stage of T3aN0M0. At that time, he elected to undergo 3D conformal radiation therapy up to a dose of 70 Gy combined with ADT for a total of 2.5 years. Thereafter, his serum PSA level dropped to 0.20–0.25 ng/mL for approximately 7 years.
+At the present visit, digital rectal examination revealed a swollen and enlarged prostate with a smooth surface; the PSA level was 0.41 ng/mL. Whole body computed tomography revealed no enlarged lymph nodes or visceral metastases; prostate magnetic resonance imaging showed an unclear boundary between the prostatic urethra and the transition zone border, and decreasing signal intensity from the middle to the apex . Magnetic resonance imaging findings did not clearly indicate malignant disease. Urethrocystoscopy, performed to assess the prostatic urethra for hyperplasia or stenosis, revealed bulging irregular mucosa in the prostatic urethra ; urine cytology and culture were negative. The location of the lesion almost corresponded to that of the diagnostic positive biopsy.
+TURP was subsequently performed for diagnosis as the PSA level was not elevated, and the differential diagnoses included radiation-induced inflammatory responses or hyperplasia rather than malignancy on magnetic resonance imaging findings. Histopathological examination revealed SCC based on proliferation of atypical squamous epithelial cells with keratinization . Microscopic sections of the prostate revealed p40-positive cells on immunohistochemical staining, indicative of SCC ; however, the PSA recurrence was negative . The AJCC-UICC stage of the SCC was stage II (T2cN0M0) and serum SCC level after TURP was 0.6 ng/mL (normal range: <1.5 ng/mL). PSA and SCC values were not increased at 0.16 and 0.7 ng/mL, respectively. Radiographic progression was also not seen for 3 months. He subsequently underwent total pelvic exenteration for severe prostatic pain and recurrent urinary retention owing to secondary cancer of the prostate. The pathological findings revealed that the SCC had invaded the subserosal layer of the rectum.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_920_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_920_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..284704d999f36f498d526ec3f1abb30af208844f
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_920_en.txt
@@ -0,0 +1,4 @@
+A 75-year-old non-Hispanic White male with past medical history significant for hypertension and dyslipidemia presented with 1-month history of flu-like illness characterized by fever reaching 38.5 °C, nonproductive cough, weight loss, and occasional night sweats. The patient denied any skin rashes, change in bowel movements, urinary symptoms, or joint pain. The patient is a nonsmoker with no history of alcohol intake and additionally reports no family history of malignancies. Physical examination on presentation was pertinent for diffuse wheezing and rhonchi in addition to abdominal distention and bilateral axillary lymphadenopathy; the patient had no apparent skin changes. The patient had no financial difficulties and was addressed with his preferred native language of Arabic. Upon admission, his complete blood count (CBC) showed elevated white blood cell (WBC) count (18,400/μL) and low hemoglobin (Hb) (6.4 g/dL), for which he received 2 units of packed red blood cells (pRBCs). Notably, he was found to have an elevated creatinine level (5.9 reaching 6.5 mg/dL) and low albumin (2.8 g/dL). Hemolytic work-up was negative .
+A computed tomography (CT) scan showed features of pneumonia, bilateral abnormal axillary lymph nodes (LN), splenomegaly (22 cm), and scattered abnormal LN across the abdomen and pelvis. Ultrasound (US)-guided axillary LN core biopsy revealed cells positive for CD5, CD20, CD 23, and cyclin D1 but negative for CD3 and CD10, with Ki-67 of 15% suggestive of MCL. Positron emission tomography (PET) scan showed fluorodeoxyglucose (FDG) avid supra- and infradiaphragmatic lymphadenopathy as well as splenic and lung involvement as well non-FDG-avid outer parenchymal right kidney mass . Bone marrow biopsy was performed, showing disease involvement. Molecular studies for t(11;14) were negative, and cytogenetic studies showed normal karyotype. His MCL international prognostic index (MIPI) was high (6.8).
+Work-up for elevated creatinine was pursued. US of the kidney showed increase in cortical echogenicity with normal thickness, denoting renal parenchymal disease. Serum protein electrophoresis and immunofixation showed protein bands of restricted mobility in the gamma region, corresponding to a monoclonal IgG-lambda as part of an oligoclonal pattern of IgG kappa and lambda. Urine analysis was positive for proteins, Hb, and numerous RBCs. Due to the unclear etiology of renal disease, CT-guided kidney biopsy was done, revealing mesangial hypercellularity, tubular atrophy, interstitial fibrosis, focal chronic inflammation with few plasma cells, and atypical lymphoid infiltrate positive for CD20 and cyclin D1. Immunofluorescence study showed diffuse mesangial positivity for IgA . Such findings were consistent with acute tubular injury and acute interstitial nephritis due to renal involvement by a known MCL.
+The patient received six cycles of alternating vincristine, rituximab, cyclophosphamide, doxorubicin, and prednisone (VR-CAP) and rituximab, dexamethasone, high-dose cytarabine, and oxaliplatin (R-DHAOx). His treatment was complicated by recurrent admissions for pneumonia and febrile neutropenia. Disease evaluation after four cycles of treatment by PET scan showed resolution of supra- and infradiaphragmatic disease with a Deauville score of 1 . End-of-treatment evaluation showed no FDG-avid disease, with complete resolution of the kidney mass with uptake in the upper poles of the kidney. Follow-up studies showed improvement in kidney function as evidenced by a creatinine level now ranging between 3.1 and 3.6 mg/dL. He was started on rituximab maintenance. After 3 months of follow-up, PET scan showed increased uptake in the kidneys without another lymphadenopathy. He was started on ibrutinib, a Bruton tyrosine kinase inhibitor, in addition to continuation of rituximab. PET scan after 3 months of ibrutinib with rituximab showed complete remission with a Deauville score of 3. A timeline of the patient’s disease course is presented in Fig .
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_924_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_924_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..8ee3ec2e77d2254220001924ca3de876d1660353
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_924_en.txt
@@ -0,0 +1,7 @@
+A 66-year-old male presented with pain and edema of the right leg for 2 d.
+Pain and edema of the right leg for 2 d prior to hospital admission, no fever, chest pain, or dyspnea.
+Multiple soft tissue injuries caused by falls 12 d before admission.
+The patient had no remarkable personal or family history.
+Swelling of the right lower extremity with palpable pitting edema, normal skin temperature, and a good arterial pulse within this extremity.
+At the time of admission, the patient had a D-dimer level of 2789 ng/mL (NG, 0-500 ng/mL).
+At the time of admission, color Doppler ultrasonography revealed right iliac-femoral vein thrombosis with decreased distal blood flow velocity. In order to accurately assess the anatomy of the retroperitoneal venous system in this patient, contrast-enhanced computed tomography was conducted after the thrombolysis procedure, which revealed that the right common iliac vein was located behind the left common iliac artery and was clearly compressed and stenotic. Many collateral vessels had formed in the pelvic cavity, and the left iliac vein was significantly wider than that on the right side. Abnormal left-sided IVC drainage was the result of the union of the two common iliac veins at the level of the 4th lumbar vertebra. It ascended vertically to the left side of the abdominal aorta where it connected with the left and right renal vein at the levels of the 2nd and 3rd lumbar vertebrae, respectively. The right renal vein additionally crossed posteriorly to the abdominal aorta. The left-sided IVC continued to ascend and intersected with the hemiazygos vein at the level of the 2nd lumbar vertebra, after which it crossed posteriorly to the left diaphragm crura and entered the thorax. It then ascended through the posterior mediastinum to the left of the four inferior thoracic vertebrae, crossing posteriorly to the thoracic aorta and the azygos vein at the level of 8th thoracic vertebra, arching over the root of the right lung and joining the right superior vena cava at the level of the 5th thoracic vertebra. There was no retrohepatic IVC or right IVC in this patient, and the hepatic vein drained directly into the right atrium . No other anatomic anomalies were detected in this patient, and echocardiographic findings were normal.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_954_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_954_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..f288418e6ac51db60e8836881a8ca86a177f6a45
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_954_en.txt
@@ -0,0 +1,6 @@
+Our in-patient rheumatology service evaluated a 17-year-old Hispanic woman for pain in the neck, low back, bilateral hip, and knee as well as for headaches and morning stiffness lasting two months. At her initial hospitalization two weeks into the disease course, and at six weeks prior to rheumatology evaluation, the hospital service noted that she had decreased range of motion in her neck secondary to pain. Plain radiographic films of the cervical spine revealed no abnormalities, and she was discharged with a course of naproxen. Non-steroidal anti-inflammatory drugs (NSAIDs) offered only minimal relief of symptoms, which prompted an out-patient orthopedics community evaluation and resulted in diagnosis of 'gluteal strain' and bursitis. She was placed on propoxyphene/acetaminophen and cyclobenzaprine, but they did not improve her symptoms.
+Due to the unremitting nature of our patient's symptoms two months into her illness, her pediatrician obtained laboratory studies and a bone scan which revealed abnormal uptake in the right seventh rib (possibly due to prior fracture), increased uptake in the left distal femur and anterior superior left tibial spine, and focal uptake at the facets of several thoracic vertebrae. Her erythrocyte sedimentation rate (ESR) was 49 mm/hour and high-sensitivity C reactive protein was 44.7 mg/L. Concerned about infection or malignancy, our patient's physician readmitted her to our institution. She did not have, then or previously, a history of fever, lymphadenopathy, bleeding or easy bruisability, weight loss, gastrointestinal symptoms, cardiac murmur, or rashes. Stool guaiac results were negative, and an abdominal ultrasound showed no abnormalities. A complete blood count was without cytopenias except for mild normocytic anemia.
+A rheumatological evaluation revealed an obese (body mass index (BMI) 42, greater than 97%) adolescent with findings of point tenderness in her bilateral inferior patella, lower sacrum, and anterior hips. She had a reduced range of motion with muscle spasms in her neck, but no psoriatic lesions or nail pitting. Her spinal symptoms were most severe in the morning and improved with movement and NSAID use. Her family history was positive for idiopathic iritis (father) and inflammatory bowel disease with spondyloarthritis (paternal aunt). A rheumatoid factor was non-reactive, and anti-nuclear antibody was not detected. Creatine kinase and aldolase levels were within normal limits. A HLA-B27 marker was present in our patient. Imaging studies were consistent with an inflammatory process: a hip ultrasound revealed bilateral hip effusions, and a lower extremity MRI revealed T2 abnormal signals in patellar tendon insertions and subcutaneous tissue anterior to the inferior aspect of the left patellar tendon. Prior to her rheumatology evaluation, our patient was given celecoxib (as prescribed by her family physician), which provided significant pain relief in her back and reduction of morning stiffness. Our pediatric rheumatologist diagnosed our patient with undifferentiated spondyloarthritis using the European Spondyloarthropathy Study Group (ESSG) classification criteria (inflammatory spinal pain, hip synovitis, positive family history of HLA-B27-associated diseases, and enthesopathy/enthesitis). The family and our pediatric rheumatologists opted to keep our patient on celecoxib and have close out-patient follow-up because her musculoskeletal pain decreased and her inflammatory markers improved, Although her hip, back, and knee pain improved, our patient continued to have persistent neck pain with symptoms of occipital neuralgia after three months of scheduled NSAID therapy. New plain radiographic imaging of the cervical spine revealed a reversal of the normal lordotic curvature, and a 10 mm distance between the odontoid and anterior arches of C1 had markedly increased since prior films . A computed tomography (CT) scan of the cervical spine showed evidence of bony erosion at the tip of the odontoid as well as mild rightward rotatory subluxation of C1, with moderate cervical stenosis at C1 and minimal flattening of the spinal cord . This was confirmed on MRI , which also demonstrated inflammation around the apical and transverse ligaments and adjacent pannus formation. There was no signal abnormality within the cord itself.
+At this point, doctors were concerned about our patient's joint instability and referred her to the neurosurgery department. She had no recent history of travel, fever, pharyngitis, torticolis, or trauma. Results of a general examination showed our patient was obese but otherwise normal. She was awake and alert, with full strength throughout. Her left upper extremity was hyper-reflexive compared to her right upper extremity, and her right lower extremity was hyper-reflexive compared to her left lower extremity. Proprioception was intact. She had up-going toes bilaterally but no clonus or Hoffman sign. She had a steady gait with no sway on Romberg testing. Because clinical and radiographic evaluations showed evidence of atlantoaxial instability in the setting of undifferentiated spondyloarthritis, our neurosurgeons recommended a C1-2 fusion to our patient and her family. The doctors postulated that inflammation-mediated ligamentous laxity was causing joint instability but that ongoing infection did not cause the cervical spine disease (Grisel's syndrome). Her anti-inflammatory medication was stopped about one week prior to surgery.
+After our patient was fiber-optically intubated with in-line stabilization, we placed needle electrodes for intra-operative neurophysiological monitoring. Then, we measured and recorded baseline somatosensory-evoked potentials, motor-evoked potentials, and free-run electromyography (EMG) readings from the upper and lower extremities. Our patient was then positioned prone using the Mayfield three-point fixation system and a Jackson table; there was no change in her electrophysiology monitoring after positioning. Using fluoroscopy, we checked alignment of the cervical spine, finding a decrease in the atlantodental interval from pre-operative studies. Then, we made a midline incision over the spinous processes and dissected, in standard sub-periosteal fashion, the paraspinous muscle from the spinous processes and laminae. Subsequently, we isolated and bilaterally divided the C2 nerve roots and clearly identified bilaterally the C1 lateral masses, C2 pars, and C1-2 facet complexes. Under fluoroscopic guidance, we placed C1 lateral mass screws: a 4.0 × 34 mm screw on the right and 4.0 × 32 mm screw on the left (Vertex; Medtronic Sofamor Danek, Memphis, TN USA). Then, we placed bilateral, crossing, 3.5 × 24 mm translaminar C2 screws. We performed a C1 laminectomy to ensure that the cervical cord was well decompressed; decorticated the bone; and placed the C1 laminectomy autograft over the denuded surfaces using bone morphogenetic protein (Infuse; Medtronic Sofamor Danek, Memphis, TN USA) and bone matrix (Mastergraft; Medtronic Sofamor Danek) to supplement the graft. We then placed the rods, performed the final tightening, and closed the wound in a layered fashion. Intra-operative-evoked potentials revealed no changes during the case. There was no spontaneous EMG activity. In the immediate post-operative period after waking from general anesthesia, our patient was at her baseline examination levels.
+At two weeks after surgery, our patient was restarted on celecoxib. Poor wound healing and drainage required antibiotic coverage and delayed initiation of immunomodulation. At four weeks after surgery, our patient received a methylprednisolone infusion (1 g) and was started on adalimumab (40 mg subcutaneously every other week (actual text of hospital formulary)) eight weeks after her operation. She has had relief from neck pain and remains neurologically intact except for soft signs of myelopathy, which were found pre-operatively. There was no evidence of abnormal motion between the C1 and C2 vertebrae or evidence of instrumentation failure on dynamic cervical spine X-rays . While maintained on adalimumab, our patient has had intermittent complaints of hip and knee pain exacerbated by weather changes. Inflammatory markers have remained within normal limits since our patient started adalimumab (even during mild clinical flares). She has not developed psoriasis and there has been no evidence of sacroiliitis or irritable bowel disease (IBD) on MRI scans during a two-year follow up period.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_961_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_961_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..26d88eb0c3749eb384c1b8db9526d747dae02f5b
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_961_en.txt
@@ -0,0 +1,7 @@
+A 2-year history of primary infertility after marriage.
+The patient was a 28-year-old female with a 2-year history of primary infertility after marriage. Her menstrual history was as follows: menarche at age 14, a cycle of 7/-30 days, normal volume and color of menstrual blood, and no dysmenorrhea. The male partner was 26 years old. Results of the routine semen analysis were normal (sperm concentration 34.7 × 106; percentage of progressive motility 64.6%; sperm DNA fragmentation index: 14.38%) according to World Health Organization 5th Edition criteria.
+In 2019, the patient underwent hysteroscopy and hysteroscopic endometrial polypectomy at another hospital due to abnormal echoes in the uterine cavity, and pathological examination of the uterine specimen indicated the presence of endometrial polyps.
+The patient had no pertinent personal or family history. Both partners had no bad living habits or hobbies, and were not engaged in work related to reproductive toxicity.
+The patient had a negative vulva, a normal uterus, and a negative bilateral adnexal area. Her body mass index was 21.23 kg/m2.
+The concentration of anti-Mullerian hormone (AMH) was 2.634 ng/mL (1 ng/mL = 7.14 pmol/L). There were no obvious abnormalities in basic hormone levels or thyroid function. The patient’s karyotype was 46, XX, and the male partner’s karyotype was 46, XY.
+Hysterosalpingography revealed that the uterine cavity was normal, bilateral fallopian tubes were developed, and the spread of the pelvic contrast agent was diffuse and limited.
\ No newline at end of file
diff --git a/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_979_en.txt b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_979_en.txt
new file mode 100644
index 0000000000000000000000000000000000000000..a594f562486eb5ad742da97e4ec22edfe131a7fe
--- /dev/null
+++ b/data/test_raw_data/en_test/multiclinsum_test_en/fulltext/multiclinsum_test_979_en.txt
@@ -0,0 +1,5 @@
+A 48-year-old Japanese woman fell down stairs that had a height of approximately 4 m. Her family called 119 (a direct-dial emergency number that connects the caller to the fire and emergency medical services) and the fire station simultaneously dispatched a “doctor-helicopter” from our hospital. She had past medical history including cholecystectomy and schizophrenia, and no remarkable family history. Her respiratory rate was 30 breaths/minute and blood oxygen saturation (SpO2) was 90% with oxygen at 10 L/minute. Her breath sound in her right chest was diminished. Her pulse rate was 130 beats/minute and her blood pressure was 88/55 mmHg. Her extremities were cold with sweat present, suggesting she was in a shock status. A focused assessment sonography for trauma (FAST) revealed hemoperitoneum in the pelvic space and a hemothorax in the right side of her chest. Her consciousness levels were 12 points (E3, V4, M5) according to the Glasgow Coma Scale at first contact and no coarse paralysis of limbs was observed. She was brought to our hospital by a doctor-helicopter, undergoing initial fluid resuscitation and respiratory assist with a bag valve mask (BVM).
+Her hemodynamics deteriorated remarkably with a pulse rate of 120 beats per minute and 50 mmHg systolic blood pressure on arrival. SpO2 was below 90% under respiratory assist with BVM. She was given 6 units of type O Rh plus red blood cells (RBC). A 7-French aortic occlusion catheter (Rescue Balloon®, Tokai Medical Products, Aichi, Japan) was inserted from her right femoral artery and was inflated with 20 ml distilled water to maintain her systolic blood pressure above 90 mmHg. A chest X-ray showed pneumothorax and pulmonary contusion in her right lung . A pelvis X-ray revealed an unstable fracture . The FAST showed a moderate hemothorax in the right side of her chest and a small amount of hemoperitoneum in Morison’s pouch and Douglas pouch. A 28-French chest drain was inserted, and preperitoneal pelvic packing (PPP) was performed to control bleeding from the unstable pelvic fracture, followed by application of a pelvic binder. A whole-body contrast-enhanced computed tomography (CT) scan was performed. The chest CT scan revealed massive lung contusion with major active extravasation of contrast media in the lower lobe of her right lung and moderate lung contusion in the lower lobe of her left lung . The abdominal CT revealed liver injuries with extravasation of contrast media, as well as massive hematoma in an erector spinae muscle with extravasation of contrast media and fractures of transverse process of lumbar vertebra . The pelvic CT confirmed multiple pelvic fractures involving moderate hematoma with extravasation of contrast media in retroperitoneal pelvic space .
+The laboratory data on initial arrival are shown in Table . The Injury Severity Score (ISS) in this case was 48 and the probability of survival was calculated as 29.1%. We first decided to perform damage control thoracotomy since the right severe pulmonary contusion was thought to be a main bleeding source based on CT. Hemorrhage influx into the lumen of our patient’s trachea from the right pulmonary contusion was observed in a tracheal tube when she returned to the operation room (OR) in our emergency department (ED) from the CT room. A double lumen tracheal tube was replaced with a single lumen tracheal tube to prevent blood influx into healthy lung areas before emergency thoracotomy in a supine position. The amount of bleeding in the right thoracic cavity was approximately 1500 ml. The main sources of bleeding in her chest were the lung contusion area of the lower lobe of her right lung and multiple rib fractures. Intrathoracic packing with surgical gauze was performed as a temporary hemostasis to control bleeding from the sites of fractures of ribs. Since the right lung contusion had extended to near the hilum of lung , the hilum of lung was clamped for temporary hemostasis of the lung. At that time, her body temperature was 35.2 °C, base excess and pH of arterial blood gas analysis (BGA) were 10.5 mmol/L and 7.099, respectively, and a persistent oozing of blood from a non-surgical site was recognized. Therefore, we decided to perform wide wedge resection of the lung using a surgical stapling device as a DCS instead of an anatomical lobectomy. We converted the hilum clamp to a limited clamp to the injured lobe with two Satinsky blood vessel clamps. The vessel clamps were left in the right thoracic cavity, clamping proximal to suture lines. Then, therapeutic intrathoracic packing for hemorrhage from multiple rib fractures was performed. Surgical packing gauzes were mainly put in the dorsal and lower side in right thoracic cavity in order to maintain respiratory function of the upper and middle lobes of her right lung, and the vessel clamps were stabilized with additional surgical towels. After the placement of a chest drain, a temporary vacuum packing chest closure was performed and DCS was finished (total surgical time was 55 minutes).
+After the DCS for the chest, TAE was performed for severe liver injuries including medial segment and right lobe with gelatin sponge. Furthermore, her left subcostal artery, left first and fourth lumbar arteries, right first to fourth lumbar arteries, right superior gluteal artery, bilateral iliolumbar arteries, right obturator artery, and left lateral sacral artery were embolized in the same fashion (total procedure time was 118 minutes). Meanwhile, her respiratory status worsened including decreased partial pressure of oxygen in arterial blood (PaO2)/fraction of inspired oxygen (FiO2) (P/F) ratio and elevation of partial pressure of carbon dioxide (pCO2) on arterial blood gas. In the intensive care unit (ICU), her respiratory functions deteriorated with a P/F ratio below 50: pCO2 on BGA over 70 mmHg, pH of 7.099, and base deficit of − 12 mmol/L. Since a ventilator was no longer sufficient to maintain her respiratory condition, VV-ECMO was initiated as a lung assist: FiO2 1.0, oxygen flow 2.0 L/minute, and veno-venous (VV) blood flow 4.5〜5.0 L/minute . A bronchial block balloon was inserted into her right lower bronchus to reduce pressure to the suture lines of the lung. Blood and clots in the other side of the trachea and bronchus were toileted with a bronchoscope. Her hemodynamics and respiratory function improved gradually with these treatments. A blood transfusion continued to maintain the following: hemoglobin (Hb) > 9.0 g/dl, fibrinogen > 150 mg/dl, and platelet > 10 × 104/μl. The total blood transfusion for 24 hours included 82 units of RBC, 136 units of fresh frozen plasma (FFP), and 70 units of platelet concentrate (PC).
+The planned reoperation for her chest and pelvis under VV-ECMO was performed on day 2 . When Satinsky blood vessel clamps were cautiously removed, there was a slight oozing of blood from the suture line at the resection site of the lower lobe of her right lung. The vessel forceps were reclamped and the stump was interruptedly sutured with two pairs of Teflon pledgets for hemostasis. We closed her chest with two chest drains placed following additional suture for hemorrhage from the multiple rib fractures area . Since slight bleeding continued from the right side of her pelvic retroperitoneal space after removal of PPP gauze, repacking and external fixation for pelvic fracture were also performed. On day 3, RBC and PC were appropriately transfused as our patient’s Hb and platelets were decreased due to VV-ECMO. Her respiratory function was completely dependent on VV-ECMO. Fluid infusion was restricted and a diuretic was administered to make her run on the dry side and her bloody and mucinous phlegm was deliberately removed by a bronchoscope. On day 5, the PPP gauze was removed and the wound was definitively closed. Her respiratory condition improved gradually, and P/F ratio became over 250, and her pCO2 level was within the normal limit when FiO2 and blood flow of VV-ECMO were decreased. The VV-ECMO circuit was withdrawn and the bronchial block balloon was removed on day 7. Our patient’s clinical course with intervention and examination and the change in lactate levels and P/F ratio until day 8 are shown in Fig. . On day 15, her respiratory condition was improved to the desired extent with no need for a ventilator . Pneumonia and right intrathoracic infection subsequently occurred and were treated by antibiotics. She needed another 45 days of rehabilitation to be able to walk independently, and was transferred to the psychiatric ward of our hospital on day 75.
\ No newline at end of file