[ { "id": "multiclinsum_test_1245_en.txt", "fulltext": "A 24-year-old gentleman with no past medical history had been experiencing debilitating chest pains for 2 years. He described these as varying in intensity, worsened by exercise, and relieved partially by analgesia. They were not associated with palpitations or syncope.\nUnfortunately, due to his symptoms he had to give up his studies and minimize his physical activity. He had trialled multiple analgesics (daily paracetamol and tramadol) with partial relief of symptoms.\nHe underwent serial investigations at his local cardiology unit, including a cardiac CT which identified an absence of pericardium on the left side of the heart. He was referred to the Adult Congenital Heart Disease (ACHD) team at The Royal Brompton Hospital.\nWhen first reviewed in the ACHD clinic he was not cyanosed, in sinus rhythm with no evidence of cardiovascular decompensation. His apex beat however was grossly displaced to the left and more so on lying supine. His first heart sound was normal, second split, there was also a soft one-sixth systolic heart murmur. The rest of his examination was unremarkable.\nHis electrocardiogram showed him to be in sinus rhythm at 78 b.p.m., with normal conduction times but a poor R wave progression and an intermittently changing axis.\nA chest radiography which showed situs solitus, levocardia, with a left aortic arch, no displacement of the heart to the left, and a protrusion at the level of the left atrial appendage at the left upper quadrant of the heart.\nHis echocardiogram showed a structurally normal heart with maintained ventricular function. Stress echocardiography showed mild right ventricular dilatation at rest with increase in right ventricular volume directly after exercise. A cardiac CT revealed a partial absence of pericardium on the left side with a small layer of pericardium on the upper right heart border. The heart was grossly shifted leftwards and posteriorly, highly suggestive of enhanced heart mobility. Similarly, no pericardium could be seen on cardiac magnetic resonance imaging (CMR). There was lung tissue in between the base of the heart and diaphragm , the heart was displaced to the left of the chest and the RV appeared dilated .\nThe patient\u2019s symptoms were thought to be due to his absent pericardium and related to cardiac mobility. We were struck by the discrepancy of the erect Chest X-ray (CXR) and supine CMR with regards to cardiac position, mobility, and the severity of disabling symptoms. We thus discussed the patient at our ACHD Multidisciplinary Team meeting and offered him surgery, in an attempt to immobilize his heart, hoping to improve his symptoms and quality of life.\nThe heart was exposed via a left postero-lateral thoracotomy. There was complete pericardial agenesis on the left side and on the diaphragmatic surface. Several 0.4 mm thickness Gore-tex\u00ae patches were sutured together to create a large sheet and this was sutured down with widely spaced interrupted 3-0 Prolene\u00ae sutures to the posterior mediastinum, starting at the level of the left pulmonary artery, posterior to the left atrial appendage and along the left hilum and inferior pulmonary ligament, to the diaphragm and down. This was then brought forward to the anterior chest wall and then fixed anteriorly along the anterior chest wall with the superior end free (see Figure ). A left pleural drain was inserted and a paravertebral catheter for analgesia, followed by routine multilayered chest closure.\nThe post-operative course was uneventful apart from a small left apical pneumothorax with a small pleural effusion. Both resolved spontaneously within days.\nEchocardiography on Day 5 showed that the RV was of normal size with no evidence of pericardial effusion nor compression of cardiac chambers. The patient was discharged 8 days after his procedure on simple analgesia, mobilizing well with improved symptoms.\nThree months from surgery the patient had come off analgesia completely, with resolution of his debilitating chest pains. He was resuming his University studies and restoring normality in his life.", "summary": "A 24-year-old otherwise fit and well patient, with debilitating exertional chest pain was found to have complete pericardial agenesis on the left side and on the diaphragmatic surface. There was gross cardiac mobility demonstrated on cardiac magnetic resonance imaging. His pericardium was reconstructed surgically using Gore-tex\u00ae patches. There were no complications, and the patient was discharged 8\u2009days later. Three months later at follow-up, the patient required no analgesia and has had complete resolution of his chest pains.", "subclaim_evaluations": [ { "subclaim": "The patient is a 24-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had debilitating exertional chest pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had complete pericardial agenesis on the left side.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had complete pericardial agenesis on the diaphragmatic surface.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac magnetic resonance imaging showed gross cardiac mobility.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent surgical pericardial reconstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "Gore-tex\u00ae patches were used for pericardial reconstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged 8 days after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no complications after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 3-month follow-up, the patient required no analgesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 3-month follow-up, the patient had complete resolution of chest pain.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1052_en.txt", "fulltext": "A 57-year-old Greek man was referred to our facility with pain, hemorrhage and a gangrenous smell due to a so-called wound on his penis. A physical examination revealed the complete absence of his penis and a large chasm in the lower abdominal wall, which made it possible to see parts of the lower pelvis, such as the spermatic cords, the destroyed basis of the corpora cavernosa and the residual stump of the urethra. The scrotum and the testicles were stiff and were possibly invaded by the cancer. In the chasm margins, we could detect hemorrhagic and necrotic areas . The inguinal lymph nodes were palpable, hard and mobile. Our patient was in a good general condition and his body temperature was normal. From his medical history, he had discovered a lesion in his inner prepuce 18 months before. He had requested medical advice at a private health center concerning that lesion. According to his recollection, a biopsy had been taken and he was diagnosed as having penile cancer (this biopsy could not be found, as he did not ask for a copy of it at the time and the private health center failed to track our patient's data as he was never hospitalized there). The physicians at the time suggested he should undergo a partial penectomy, but he refused and stopped seeking medical treatment.\nThe lesion slowly progressed, eventually involving the whole penis. He could not specify the exact time his penis sloughed off completely. He was not circumcised. Standard laboratory test results showed that his values were within normal limits except for a small rise in white blood cell count (14,750 cells/\u03bcL) and microcellular anemia (hemoglobin = 9.8 g/dL, hematocrit = 31.2%). A chest X-ray did not show any remarkable findings. An abdominal computed tomography (CT) scan showed lymph nodes of a pathological size and number, bilateral in the iliac vessels and inguinal areas as well as an erosion of the pubic bone . We proceeded with a chest CT scan, which did not show any distant metastases or lymph nodes. On the first day of his hospitalization, we obtained biopsies from the chasm margins and identified a poorly differentiated SCC. The clinical staging was T4N3M0 and our patient was treated with chemotherapy and regional radiotherapy. We also performed a bilateral cutaneous ureterostomy, with a Gibson incision in order to protect the corroded tissues from further urine impregnation . From a combination of regional radiotherapy and bilateral cutaneous ureterostomy, total dryness of the wound was achieved. During his extended hospitalization, he presented with deep vein thrombosis in the right shin vein and seizures that were attributed to small ischemic brain strokes after a brain CT scan. Debulking and flap coverage of the wound was not considered possible, firstly because of deep vein thrombosis, epileptic seizures and his poor general condition increased the risk from operation and secondly the size of the chasm combined with very poor vascularization of the region (a topical angiography was performed). Gradually, our patient developed depression, denial of feeding and loss of weight. He died 18 months after his first admission and six months after his last follow-up admission to our clinic.", "summary": "Our case report does not concern a new manifestation of penile cancer, but an interesting presentation with clinical significance that emphasizes the need to diagnose and treat penile cancer early. It is an unusual case of a neglected penile cancer in a 57-year-old Greek man that led to auto-amputation of the penis and a large chasm in the lower abdominal wall. The clinical staging was T4N3M0 and our patient was treated with a bilateral cutaneous ureterostomy, chemotherapy and radiotherapy. Our patient died 18 months after his first admission in our clinic.", "subclaim_evaluations": [ { "subclaim": "The case report is not about a new manifestation of penile cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case report describes an interesting presentation with clinical significance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case emphasizes the need to diagnose and treat penile cancer early.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case involves a 57-year-old Greek man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The man had a neglected penile cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The neglected penile cancer led to auto-amputation of the penis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The neglected penile cancer led to a large chasm in the lower abdominal wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical staging was T4N3M0.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with a bilateral cutaneous ureterostomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died 18 months after his first admission to the clinic.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2359_en.txt", "fulltext": "A 68-year-old Caucasian male presented for surgical evaluation with a right mid-infraclavicular chest mass from referral of his primary care physician . Three years prior, the patient presented with a mass at the same location, subsequently diagnosed as a lipoma and locally excised with no surgical complications. At the time of the previous surgery, it was incidentally discovered and diagnosed that the patient also had diffuse B cell lymphoma, complete remission status post chemotherapy. Family, psychosocial, drug, and other surgical history were noncontributory. Over the past three years, the mass increased in size, but did not have any discoloration, discharge, or pain; however, due to the patient\u2019s past medical history and immunocompromised state, the patient expressed concern and presented for elective excision of the mass.\nOn physical exam, a mass was palpated at the midclavicular line of the right upper chest, within the right first intercostal space. The mass was directly under the scar from previous excision, with no skin discoloration, telangiectasia, or visible raised nodules. The patient denied any pain, tenderness, or discharge associated with the new mass. Radiological testing was performed to determine the exact location and depth of invasion. CT chest with and without contrast revealed an ill-defined, cutaneous mass, while MRI chest was nondiagnostic.\nSurgical excision was performed under local anesthesia, with a wide, elliptical incision to the level of the underlying bony structures to ensure clean margins. Excised specimen measured 5.5 cm \u00d7 3.5 cm \u00d7 2 cm with surrounding 4 cm \u00d7 1.6 cm \u00d7 0.4 cm of skin attached. The resulting wound was closed using interrupted 4\u20130 plain gut sutures for the full thickness, with 3\u20130 Vicryl subdermal and 4\u20130 Monocryl subcuticular reinforcing sutures.\nThe specimen was sent to pathology for cryosectioning; however, due to increase in cellularity at the posterior margin, permanent fixation was performed. Within the submitted specimen, a subcutaneous firm nodule measuring 1.6 cm \u00d7 1 cm \u00d7 0.7 cm was located in the superior aspect with a 0.1 cm surrounding margin. Microscopic examination with hemolysin and eosin staining showed whorled myoid with spindled nuclei in storiform array throughout the dermis and extending into the subcutaneous fat with widening fibrous septa (, ). The specimen was also composed of uniform, small elongated cells and scant cytoplasm with frequent mitotic figures and giant cells. The sample stained positively for CD34 and ultimately diagnosed as DFSP .\nAs a result of the close margin excision, the patient was referred for radiation therapy with imatinib for recurrence prevention. Upon the last two follow-ups status post imatinib treatment, there have been no signs of recurrence.", "summary": "Here we present an atypical presentation of DFSP in a patient with a recurrent mass that was initially diagnosed as a lipoma, with supporting literature and clinical considerations for post-surgical management DISCUSSION: In its earlier stages, DFSP can mimic other benign or malignant dermatological pathologies, which can complicate diagnosis purely via history and physical exam. Atypical features such as prior surgical management, morphology, and location can complicate the clinical diagnosis of DFSP. Immunohistochemistry is often required for definitive diagnosis as DFSP is CD34+ and is histologically described as spindle-cells in whorled or storiform pattern, with uniform, small elongated cells.", "subclaim_evaluations": [ { "subclaim": "DFSP can present atypically.", "support_label": "supported", "is_refined": false }, { "subclaim": "A patient had a recurrent mass initially diagnosed as a lipoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP can mimic benign dermatological pathologies.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP can mimic malignant dermatological pathologies.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP diagnosis can be complicated by prior surgical management.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP diagnosis can be complicated by morphology.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP diagnosis can be complicated by location.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemistry is often required for definitive DFSP diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP is CD34+.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP is histologically described as spindle-cells in whorled or storiform pattern.", "support_label": "supported", "is_refined": false }, { "subclaim": "DFSP histology shows uniform, small elongated cells.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1941_en.txt", "fulltext": "We obtained a verbal informed consent from the patient and a written informed consent from a family member of the patient for publication of this case.\nAn 83-year-old man was transported to our emergency department, with a tentative diagnosis of heat stroke. He had previously been fit and healthy, except for undergoing colorectomy for colorectal cancer 8 years ago. He also received a central venous port system, a BardPort Titanium implantable port with its and 8.0 Fr Groshong\u00ae silicone catheter (Bard Access Systems, Inc., Salt Lake, USA) which was inserted through the right internal jugular vein, for chemotherapy.\nHe was transferred to the intensive care unit, where surface cooling and intravenous hydration were performed to treat heat stroke. He made a rapid recovery, and he had become able to eat on the same day.\nNext morning, he suddenly developed ventricular fibrillation. Cardiopulmonary resuscitation was performed immediately, his trachea was intubated, and he was sedated with continuous infusion of propofol. He had not complained any chest pain before the occurrence of ventricular fibrillation, and the electrocardiography indicated neither arrythmias nor ST changes, before and after the occurrence of ventricular fibrillation. Analysis of arterial blood taken after resuscitation indicated no abnormalities in the blood gases and the blood electrolyte; troponin was not measured. A chest radiograph, which was taken after resuscitation , indicated a previously placed central venous catheter access port, without any obvious abnormalities.\nEmergency coronary angiography, performed shortly after ventricular fibrillation, identified a 90% stenosis of the left anterior descending coronary artery. The cardiologists considered that this was not the direct cause of ventricular fibrillation, as the extent to which the blood flow in the coronary artery would not bring about ventricular fibrillation. The angiography instead identified a more likely cause: a foreign body in the coronary sinus.\nClose re-examination of the chest radiograph taken after resuscitation showed a long catheter-like foreign body (approximately 20 cm) in the heart . Chest computed tomography also confirmed the presence of the foreign body . We diagnosed that a long catheter-like foreign body, likely to be a fragmented central venous catheter, was in the coronary sinus.\nIn the angiography suite, physicians attempted to remove the foreign body. However, the attempts were abandoned, as the pull of the catheter resulted in repeated ventricular fibrillation. The patient was successfully resuscitated. Surgical removal was planned the next day.\nOn the next day, the patient was transferred to an operating room, and routine monitors, such as a pulse oximeter, a blood pressure cuff, and electrocardiogram, were attached. We prepared an electric defibrillator, and cardiac surgeons were present in the room. The breathing system of an anesthesia machine was connected to the tracheal tube, and general anesthesia was induced with sevoflurane 1.5% and fentanyl 0.1 mg; neuromuscular blockade was achieved with rocuronium 50 mg. Anesthesia was maintained with sevoflurane and oxygen in air.\nThe patient underwent sternotomy, and transesophageal echocardiography identified the fractured catheter in the coronary sinus . The right atrium was opened under cardiopulmonary bypass. Surgeons could remove the fractured catheter (approximately 20 cm in length) , but with great difficulty, by gently pulling the edge of the catheter with rotating movement. After the operation, the electrocardiogram indicated no arrhythmia or cardiac ischemia.\nOn the next day of the operation, his family requested strongly to treat the coronary stenosis, and thus, cardiac physicians placed a stent in the left anterior descending artery without complications. He was discharged from the hospital on postoperative day 14, to a rehabilitation facility, and he went home at a later day.", "summary": "An 83-year-old man with heat stroke was transferred to our emergency department, where he was treated and became able to eat on the same day. He had been fit and healthy, except for colorectomy and chemotherapy using a central venous access port placed in the right upper jugular vein 8\u00a0years ago. The next day, he suddenly had ventricular fibrillation. Cardiopulmonary resuscitation was successful. Emergency coronary angiography showed a catheter-like foreign body in the coronary sinus. Physicians failed to remove the foreign body using catheter therapy, and ventricular fibrillation occurred repeatedly. After induction of general anesthesia, the fractured catheter was removed surgically. Postoperative course was uneventful.", "subclaim_evaluations": [ { "subclaim": "The patient was an 83-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had heat stroke.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was transferred to the emergency department.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was treated and became able to eat on the same day.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a colorectomy 8 years ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had chemotherapy using a central venous access port.", "support_label": "supported", "is_refined": false }, { "subclaim": "The port was placed in the right upper jugular vein.", "support_label": "supported", "is_refined": false }, { "subclaim": "The next day, he had ventricular fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiopulmonary resuscitation was successful.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency coronary angiography showed a catheter-like foreign body in the coronary sinus.", "support_label": "supported", "is_refined": false }, { "subclaim": "Physicians failed to remove the foreign body using catheter therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ventricular fibrillation occurred repeatedly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fractured catheter was removed surgically after induction of general anesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative course was uneventful.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1110_en.txt", "fulltext": "A 52-year-old female with complaints of the right knee pain and swelling was referred to us in the outpatient clinic with a diagnosis of Baker\u2019s cyst. The pain increased on squatting and climbing stairs and was associated with swelling in the posteromedial aspect of the knee joint for the past 11 months. There was no history of the previous trauma, no intermittent locking of the knee joint, and unremarkable medical history. On examination, there was a solitary, firm, cystic, fluctuant, immobile, and slightly tender swelling on the posteromedial aspect of the right knee joint of size around 4 3 cm with no local signs of inflammation. There was joint line tenderness on the medial aspect with positive McMurray\u2019s test for a medial meniscus tear and no ligamentous instability. Knee range of motion was 0\u2013120 with terminal flexion painful. The plain radiograph showed evidence of early osteoarthritis of the medial compartment along with patellofemoral arthritis. MRI knee demonstrated a large well-defined cystic lesion medial to semimembranosus and semitendinosus at the posteromedial aspect of the right knee joint of size around 3.9 3.0 2.5 cm with few thin internal septations. The lesion was hyperintense on T2-weighted and fat suppression images while it was hypointense on T1 weighted image ( and ) also noted was a horizontal tear in the posterior horn and body of the medial meniscus and oblique tear in the posterior horn of the medial meniscus. The patient was posted for surgery and underwent arthroscopic partial medial meniscectomy and open excision of the cyst in its entirety along with its stalk through a medial incision under spinal anesthesia . The base of the cyst was traced and sutured with the synovial lining, thereby repairing the defect. The excised sample was sent for histopathological evaluation and found to be a cystic structure lined by flattened epithelium with walls made of fibrocollagenous tissue infiltrated sparsely with lymphonuclear infiltrate and foamy histiocytes which were consistent with a meniscal cyst. Post-operative period was uneventful and at 2-year follow-up, there was no recurrence, pain, instability, or locking of knee joint. The patient had 0\u2013120 active, painless range of motion at the knee joint. The patient was able to return to her daily activities without any limitations.", "summary": "We report a case of a large symptomatic medial parameniscal cyst in 52-year-old female which was clinically misdiagnosed as Baker's cyst. The patient had swelling over the posteromedial aspect of the right knee with difficulty and pain on squatting. Magnetic resonance imaging (MRI) reported horizontal tear in the posterior horn of medial meniscus and parameniscal cyst adjacent to medial meniscus with features of early osteoarthritis of the knee. She was successfully treated with open excision and repair of the defect of the cyst along with arthroscopic partial medial meniscectomy.", "subclaim_evaluations": [ { "subclaim": "The patient was a 52-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a large symptomatic medial parameniscal cyst.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cyst was initially misdiagnosed as a Baker's cyst.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had swelling over the posteromedial aspect of the right knee.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had difficulty and pain on squatting.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed a horizontal tear in the posterior horn of the medial meniscus.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed a parameniscal cyst adjacent to the medial meniscus.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed features of early osteoarthritis of the knee.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with open excision and repair of the cyst.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with arthroscopic partial medial meniscectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was successful.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2892_en.txt", "fulltext": "A 39-year-old woman was admitted complaining of sudden-onset headache, nausea, and vomiting for 1 day. She had a history of hypertension for 10 years and denied any history of diabetes, hyperlipidemia, autoimmune diseases, or other remarkable illnesses. She was alert and could correctly obey commands. Physical examination was unremarkable except for neck stiffness. Her blood glucose, electrolytes, blood cell counts, coagulation test, and antinuclear antibody series were within normal limits during laboratory investigations.\nHead computed tomography (CT) showed a subarachnoid hemorrhage (SAH) concentrated in the perimesencephalic cistern . CT angiography (CTA) showed that the bilateral ICAs were absent in the skull base . The bilateral MCAs and anterior arteries were normal. An aneurysm was identified in the PCA region .\nHead digital subtraction angiography (DSA) showed that the bilateral internal maxillary arteries and ascending pharyngeal arteries were confluent with the cavernous portion of the ICAs at the skull base. And the bilateral ICAs above the cavernous portion of the ICAs, the MCAs, and the anterior cerebral arteries were normal . The right vertebral artery (VA) was fine, while the left VA was well developed . Moyamoya-pattern collateral vessels could be seen in the bilateral PCAs region, the distal part of the PCA was composed of abnormally fine vessels, and an aneurysm was clearly identified in the left moyamoya-pattern collateral vessels .\nShe was diagnosed as bilateral carotid RM, moyamoya-like vessels in the PCA region, intracranial pseudoaneurysm, and SAH. Management of the aneurysm was difficult, and wait and see management was adopted. The patient experienced an uneventful recovery and was discharged 1 week later. Follow-up CT performed 44 days later showed complete resolution of the SAH . Head DSA revealed that the pseudoaneurysm disappeared spontaneously while the moyamoya-pattern collateral vessels were unchanged, the distal part of the PCAs became finer and smaller, and the transdural compensation of the posterior meningeal artery was visible . The patient was in good condition during follow-up, she returned to her normal activities.", "summary": "A 39-year-old woman was admitted complaining of sudden-onset headache, nausea, and vomiting. Further investigation revealed subarachnoid hemorrhage (SAH), carotid RM, a moyamoya collateral pattern in the PCA region, and a pseudoaneurysm in the moyamoya-like vessels. The patient was treated conservatively, recovered well and was discharged 1\u2009week later. Follow-up angiography showed that the aneurysm had disappeared.", "subclaim_evaluations": [ { "subclaim": "The patient is a 39-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted with sudden-onset headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "She reported nausea.", "support_label": "supported", "is_refined": false }, { "subclaim": "She reported vomiting.", "support_label": "supported", "is_refined": false }, { "subclaim": "Subarachnoid hemorrhage was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A carotid RM was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "A moyamoya collateral pattern was observed in the PCA region.", "support_label": "supported", "is_refined": false }, { "subclaim": "A pseudoaneurysm was identified in the moyamoya-like vessels.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated conservatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "She recovered well.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was discharged 1 week after admission.", "support_label": "supported", "is_refined": false }, { "subclaim": "Follow-up angiography showed the aneurysm had disappeared.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_38_en.txt", "fulltext": "A 66-year-old male patient was referred to our department with a right intraventricular mass that had been diagnosed as anaplastic ependymoma on open biopsy at another hospital.\nHe had been followed because of diabetes mellitus, hyperlipidemia, and carotid artery stenosis but had been otherwise well. Two months before admission to our department, he had undergone magnetic resonance imaging (MRI) of the head, which incidentally revealed a mass lesion in the right lateral ventricle, for which he had been referred to the neurosurgery department at another hospital. He underwent a biopsy and the tumor was diagnosed as an anaplastic ependymoma. Although he had been initially referred to a Radiation Oncology Department for adjuvant radiation therapy, the provider referred him to our Department of Neurosurgery because of concerns that the residual tumor was not suitable for radiotherapy without prior cytoreduction.\nPhysical examination showed some short-term memory impairment, and ophthalmological examination revealed a visual field compromise (quadrantanopia) likely related to access corridor chosen for the biopsy. There was no focal motor weakness, major sensory deficit, dysmetria, or ataxia.\nComputed tomography (CT) showed two hyperdense foci in the inferior horn and the atrium of the right lateral ventricle with peri-lesional edema of the ipsilateral temporo-occipital parenchyma [Figure and ]. The intraventricular lesions showed heterogeneous enhancement on postcontrast T1-weighted imaging (T1WI), on which the lesions appeared to arise from the choroid plexus [Figure \u2013]. The postcontrast T1WI also showed additional tumor dissemination in the left lateral ventricle and around the brain stem . Further whole-spine imaging showed leptomeningeal dissemination in the lumbar region (not shown).\nThe patient was taken to surgery and underwent subtotal removal of the tumor in the right lateral ventricle via an inferior temporal gyrus approach [Figure and ]. The tumor was solid, densely adherent to the choroid plexus but floating in the ventricle .\nHistopathologically, the tumor showed diffuse, tightly packed monotonous neoplastic cells with large, round, or slightly irregular nuclei and a scant to moderate amount of eosinophilic cytoplasm . There were numerous mitotic figures and foci of focal necrosis. Perivascular pseudorosettes were not discernible. On immunohistochemical staining panels, the tumor cells were positive for leukocyte common antigen (LCA), CD20 , CD30, CD79a, bcl-2, bcl-6 , and MUM-1; and negative for cytokeratins, epithelial membrane antigen, S-100 protein, and glial fibrillary acidic protein.\nOphthalmological examination showed no intraocular lesions. CT of the chest, abdomen, and pelvis was interpreted as normal and bone marrow biopsy showed no atypical lymphocytic infiltrate. The patient was thus diagnosed with primary diffuse large B-cell CNS lymphoma likely originating in the choroid plexus.\nThe patient underwent chemotherapy with high-dose methotrexate (3500 mg/m2) every 14 days for three courses, followed by a course of chemotherapy with carboplatin (360 mg calculated by using the Calvert formula) and etoposide (80 mg/m2) 14 days after the third administration of high-dose methotrexate. After chemotherapy, cerebrospinal fluid (CSF) samples were obtained for cytology, which was negative for malignant cells. After the patient had undergone whole-brain irradiation (1.8 Gy \u00d7 22), postcontrast T1WI showed complete resolution of all previously visible CNS disease. Physical examination showed persistent quadrantanopia\u2014unchanged from the patients status prior to subtotal removal of tumor\u2014and amelioration of his short-term memory impairment. Because meningeal dissemination recurred during the follow-up period, the patient is currently again receiving chemotherapy with high-dose methotrexate in our department (8 months after surgery).", "summary": "A 66-year-old male patient was referred to our department with a right intraventricular mass that had been diagnosed by biopsy at another hospital as anaplastic ependymoma. The patient underwent subtotal removal of the tumor via a transcortical inferior temporal gyrus approach. The mass was attached to the choroid plexus in the right atrium. Histopathological examination showed diffuse large B-cell lymphoma. Ophthalmological examination, blood tests, computed tomography of the whole body, and bone marrow biopsy did not show any other lesion, leading to the diagnosis of primary choroid plexus lymphoma. The patient underwent chemotherapy with three courses of high-dose methotrexate and one course of carboplatin and etoposide followed by whole-brain irradiation (1.8 Gy \u00d7 22).", "subclaim_evaluations": [ { "subclaim": "The patient is a 66-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was referred with a right intraventricular mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was diagnosed by biopsy as anaplastic ependymoma at another hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent subtotal removal of the tumor via a transcortical inferior temporal gyrus approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was attached to the choroid plexus in the right atrium.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination showed diffuse large B-cell lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ophthalmological examination did not show any other lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood tests did not show any other lesion.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Computed tomography of the whole body did not show any other lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bone marrow biopsy did not show any other lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was primary choroid plexus lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received three courses of high-dose methotrexate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received one course of carboplatin and etoposide.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent whole-brain irradiation at 1.8 Gy \u00d7 22.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_51_en.txt", "fulltext": "A 67-year-old Caucasian woman with an unremarkable medical and breast history was referred to our breast unit with a screen-detected right breast mass. Mammography had revealed a fairly well-circumscribed 2 cm lesion located deep and in close proximity to the nipple and was graded as M3 on the Breast Imaging Reporting and Data System scale. Her physical examination and ultrasound showed no abnormalities. A subsequent diagnostic biopsy revealed an infiltrating ductal carcinoma with an adenoid cystic component. The patient was treated with simple mastectomy and sentinel node biopsy. The histologic examination revealed a lesion of 1.7 cm maximum diameter with mixed infiltrating NOS ductal carcinoma and ACC characteristics. The four sentinel nodes were all free of cancer. She had a good post-operative course and remained well with no evidence of recurrence 24 months later.\nThe tumor was whitish tan and was ill defined in appearance and firm in consistency. No nipple or skin involvement was present. Both the nuclear grade of the lesion and the Bloom-Richardson grade were two based on the overall appearance of the tumor. The lymph nodes were negative. The tumor was staged as T1N0M0 and was estrogen receptor (ER)- and progesterone receptor (PR)-negative. The proliferative activity was low as measured by the Ki-67 labeling method (12%). Immunohistochemically, overexpression of the proto-oncogene HER2/neu was found in 15% of the carcinomatous cells. In fluorescence in situ hybridization analysis, which was performed at a later stage, no protein amplification was ascertained.\nTwo histological patterns were blending into each other without a clear-cut boundary between them . The dominant pattern, comprising more than 70%, was an ordinary, moderately differentiated ductal carcinoma NOS. It consisted of tubule islands and cribiform structures with epithelial cells exhibiting a high nuclear-to-cytoplasmic ratio, dark nuclear chromatin, and inconspicuous nucleoli. The mitotic index was low (< 2/10 hematopoietic tissue).\nThe rest of the histological pattern was limited and mainly consisted of well-defined nests and pseudo-glandular structures occasionally filled with homogeneous basophilic (periodic acid-Schiff stain-positive) material. Interestingly, the neoplasmic nests contained predominantly basaloid cells with sparse cytoplasm coexisting with epithelial cells with more abundant eosinophilic cytoplasm .", "summary": "We describe a case of mixed adenoid cystic cancer of the breast with infiltrating ductal carcinoma in a 67-year-old Caucasian woman who underwent mastectomy with sentinel node biopsy.", "subclaim_evaluations": [ { "subclaim": "The patient was a 67-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had mixed adenoid cystic cancer of the breast.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had infiltrating ductal carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent mastectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent sentinel node biopsy.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1695_en.txt", "fulltext": "A 53-year-old Japanese woman with a 30-year clinical history of anorexia nervosa (155 cm, 32 kg, body mass index: 13.3 kg/m2) was found unconscious at home. On admission to the Emergency Department, she was in a coma with a consciousness level of 6 on the Glasgow Coma Scale (E3V1M2). Her other vital signs initially recorded in the Emergency Department were as follows: body temperature, 35.1\u00b0C; heart rate, 83 beats/min; blood pressure, 84/62 mmHg; respiratory rate, 12 breaths/min; and percutaneous oxygen saturation, 98% (on oxygen 10 L/min via a non-rebreather mask). A laboratory examination showed remarkable hypoglycemia with a blood sugar concentration of 8 mg/dL, anemia with a hemoglobin concentration of 8.2 g/dL, hypopotassemia with a potassium concentration of 3.4 mmol/L, thrombocytopenia with a platelet count of 128,000/\u03bcL, and coagulopathy with an international normalized ratio of the prothrombin time of 1.49 and activated partial thromboplastin time of 36.2 s. After the intravenous administration of 20 g of glucose and 20 mg of thiamine, her blood sugar concentration increased to 230 mg/dL, and her consciousness level returned to 14 on the Glasgow Coma Scale (E3V5M6). Transthoracic echocardiography showed akinesis of the heart apex and a reduced left ventricular ejection fraction of 20%, consistent with takotsubo cardiomyopathy. She was obviously emaciated and malnourished but did not have a short neck or neck deformities. A computed tomography scan showed no vascular anomaly around the neck or thorax. A diagnosis of hypoglycemia-induced takotsubo cardiomyopathy [, ] with anorexia nervosa was made. She was admitted to the intensive care unit to receive close monitoring, correction of blood sugar and electrolytes, and continuous intravenous heparin administration (5000 U/day) for the prevention of thrombus in the akinetic ventricular apex.\nOn hospital day 2, this patient suddenly developed refractory ventricular fibrillation and suffered from cardiopulmonary arrest. A rigorous resuscitation attempt using chest compressions, electrical defibrillation, endotracheal intubation, and intravenous adrenaline administration was immediately initiated by intensive care unit physicians and nurses. Spontaneous circulation was restored in approximately 15 min. A CVC was required for continuous intravenous infusion of inotropic agents and vasopressin. The right neck was then sterilized with 1% chlorhexidine digluconate, and her head was tilted to the left by approximately 30\u00b0. On a pre-procedural ultrasound (US) examination, no vascular-like structures were visible behind the posterior wall of the right IJV. The right IJV was punctured by an experienced cardiologist under US guidance with the short-axis out-of-plane technique using an 18-gauge introducer needle contained in an Arrow triple lumen central venous catheter kit (Teleflex Medical Japan, Tokyo, Japan). Although the angle and depth of the needle appeared to be appropriate if the patient had not been emaciated, the right IJV was completely collapsed at the time of the US-guided puncture, and blood was not aspirated. Non-pulsatile dark-colored blood was smoothly aspirated during gentle withdrawal of the needle, and then a guide wire, dilator, and CVC were inserted without resistance. Immediately after the CVC placement, she developed enlarging swelling around the neck. Contrast-enhanced computed tomography showed massive contrast media extravasation around the neck and mediastinum , whereas the tip of the CVC was correctly placed in the right IJV. The patient was considered at a high risk for open repair. Therefore, transarterial embolization was planned. After 6-Fr short sheath introduction (Radifocus Introducer II; Terumo, Tokyo, Japan) from her right brachial artery, a pigtail catheter (4-Fr; Cook Medical, Bloomington, IN, USA) was advanced into the brachiocephalic trunk with the support of a 0.035\u2033 hydrophilic guidewire (Radifocus guidewire M; Terumo, Tokyo, Japan). Brachiocephalic artery angiography showed a characteristic \u201cblush\u201d appearance of the ruptured right thyrocervical trunk . After selective arterial embolization using a microcatheter (Masters Parkway Soft; Asahi Intecc, Aichi, Japan) and 33% N-butyl-2-cyanoacrylate, the extravasation completely disappeared and hemostasis was achieved. A schema of the operative course at the catheterization laboratory is shown in Figure S in the supplementary information file. After receiving 22 units of packed red blood cells, 20 units of fresh frozen plasma, and 20 units of platelet concentrate, the patient was returned to the intensive care unit where correction of body fluid imbalance, hypothermia, acidemia, and coagulopathy was continued. Secondary infection and multiorgan dysfunction developed approximately 2 weeks later, and the patient died from sepsis on hospital day 16. An autopsy was not performed because her family refused.\nThe search strategy was determined a priori by the survey team, which comprised anesthesiologists (YO and KS), an interventional radiologist (EU), emergency physicians (NN, IY, and JK), and a librarian (MJ, listed in the Acknowledgments). On June 2022, all reported cases of thyrocervical trunk injury associated with IJV puncture were searched for in the MEDLINE database from inception using the following keywords: \u201cthyrocervical trunk\u201d AND \u201cinternal jugular vein puncture\u201d; \u201cthyrocervical trunk\u201d AND \u201ccentral venous catheter\u201d; \u201cthyroid artery\u201d AND \u201cinternal jugular vein puncture\u201d; and \u201cthyroid artery\u201d AND \u201ccentral venous catheter\u201d. PubMed\u00ae was used to search the MEDLINE database. Cross-referencing was also performed using the reference list of articles included in this review. The following types of articles were excluded from the analysis: (1) they were not case reports or case letters, (2) they were not in English, and (3) they did not describe thyrocervical trunk injury associated with IJV puncture. This search produced 25 articles of which 10 relevant reports and cases were included in this review [\u2013] . We reviewed the variables of age, sex, underlying medical conditions of the patients, number of punctures, use of real-time US guidance, characteristics of the operator, treatment, and outcome.\nThe clinical characteristics of thyrocervical trunk injury after IJV puncture described in this review, including our patient, are shown in Table . Seven articles described pseudoaneurysm of the thyrocervical trunk or its branches [\u2013], three reported massive bleeding arising from the thyrocervical trunk or its branches [, ], and one reported CVC misplacement in the right inferior thyroid artery . The cases in the literature review consisted of four men and seven women, aged 33 to 71 years. More than 80% (9/11) of thyrocervical trunk injuries were associated with a landmark puncture without using real-time US guidance. More than half (6/11) of the thyrocervical trunk injuries were associated with multiple (\u2265 2) attempts. Aneurysm or active bleeding arising from a thyrocervical trunk injury was successfully managed by surgical repair (4/11) or endovascular treatment (5/11). Endovascular embolization using 33% N-butyl-2-cyanoacrylate for the treatment of vascular complications associated with CVC placement has not been reported previously.", "summary": "A 53-year-old Japanese woman with anorexia nervosa developed refractory ventricular fibrillation. After returning spontaneous circulation, a CVC was successfully placed at the initial attempt in the right internal jugular vein using real-time ultrasound guidance. Immediately after CVC placement, she developed enlarging swelling around the neck. Contrast-enhanced computed tomography showed massive contrast media extravasation around the neck and mediastinum. Brachiocephalic artery angiography showed a \"blush\" appearance of the ruptured right thyrocervical trunk. After selective arterial embolization with 33% N-butyl-2-cyanoacrylate, the extravasation completely disappeared and hemostasis was achieved.", "subclaim_evaluations": [ { "subclaim": "The patient is a 53-year-old Japanese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had anorexia nervosa.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed refractory ventricular fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "A central venous catheter was placed in the right internal jugular vein.", "support_label": "supported", "is_refined": false }, { "subclaim": "The central venous catheter was placed using real-time ultrasound guidance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The central venous catheter was placed at the initial attempt.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed enlarging swelling around the neck immediately after CVC placement.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast-enhanced computed tomography showed massive contrast media extravasation around the neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast-enhanced computed tomography showed contrast media extravasation in the mediastinum.", "support_label": "supported", "is_refined": false }, { "subclaim": "Brachiocephalic artery angiography showed a 'blush' appearance of the ruptured right thyrocervical trunk.", "support_label": "supported", "is_refined": false }, { "subclaim": "Selective arterial embolization was performed with 33% N-butyl-2-cyanoacrylate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The extravasation completely disappeared after embolization.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hemostasis was achieved after embolization.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1012_en.txt", "fulltext": "The present case reports a 37-year-old man suffering from metastatic osteosarcoma originating in the distal part of the left femur. In March 2018, the patient entered the hospital with pain in the left leg as the major symptom. An MRI scan showed a large tumor with extramedullary parts and an intraosseous diameter of 13 cm. The histological examination of the biopsy showed a mostly epithelioid, in part osteoblastic, high-grade osteosarcoma. In the CT scans of the thorax and abdomen, there was no metastasis detectable. Before surgery, the patient was treated with a neoadjuvant regimen analog to the EURAMOS-1 trial with two cycles of doxorubicin and cisplatin and four cycles of high-dose MTX. In the intermediate staging performed by a further CT scan before surgical resection of the tumor, there was still no sign of distant metastasis. In the restaging-MRI of the left thigh the tumor showed a decrease in size. Limb saving surgical resection of the entire tumor (R0) was performed in August 2018. The tumor showed regression with 30% vital tumor cells (grade IV Salzer-Kutschnik).\nSurgery was followed by an adjuvant chemotherapy analog to the EURAMOS-1-protocol containing two cycles of doxorubicin and cisplatin, two further cycles of Doxorubicin and eight cycles of high-dose MTX. The start of adjuvant chemotherapy was delayed for two weeks because of a wound infection.\nThe final staging after the last chemotherapy cycle showed two new pulmonary metastases in the CT scan of the lung. Hence, curatively intended surgical resection was performed in April 2019.\nIn September 2019, the patient had a seizure and in an MRI of the brain multiple cerebral metastases became visible. A neurosurgical resection of a symptomatic metastasis was performed, followed by a total brain irradiation with a boost on parafalcial and occipital metastases.\nIn a systemic restaging performed by a total body FDG-PET-CT scan and an MRI of the brain, the patient then showed a rapid systemic disease-progression with metastases affecting the lung, the mediastinum, the left adrenal gland, the brain, soft tissue, bones, and the skin. (, , )\nIn a molecular testing of the most recent tissue sample of the resected brain metastases, the tumor showed a high expression of PD-L1 (TPS 90% CPS 92%) but microsatellite stability (MSS). The patient was still in a good performance state (ECOG 1). A salvage chemotherapy containing the in osteosarcoma therapy established drugs ifosfamide and etoposide was not performed because of an acute kidney failure in the patient\u2019s history and a high amount of cumulative neurotoxicity after the total brain irradiation. Benefit-risk ratio was not considered being favorable for this option. Referring to the case of a patient with advanced osteosarcoma reported by Nuytemans et al. , who reached a stabilization of disease-progression undergoing immunotherapy with nivolumab and ipilimumab, an individual therapy attempt with the same treatment combination was conducted, as there was no further established therapy and no ongoing study available.\nStarting in December 2019, we exposed the patient to the immunotherapy combination of Nivolumab 3 mg/kg and Ipilimumab 1 mg/kg every 3 weeks for four times analog to the established treatment protocol for kidney cancer. In the following restaging performed by a PET-CT scan and an MRI of the brain 3 months after starting the therapy, the patient showed a clear response to the therapy with a profound remission of all tumor lesions (, , ). In some of the lesions, a minimally elevated uptake of FDG remained residually, whereas the lesions were not metrically measurable any more in the corresponding CT scan. In brain MRIs, minimal residual structures were interpreted as gliosis after total brain irradiation and immunotherapy. A definite distinction between inflammation or scar and minimal tumor residuals was not possible in PET-CT scans and MRIs.\nIn February 2020, the patient suffered from herpes zoster as a complication, which was treated with brivudine for 7 days.\nThe patient developed a mild facial palsy of the right side in March 2020, which can be considered as a side effect of the immunotherapy. In an examination of the cerebrospinal fluid, a slightly increased cell count of 9/nl could be detected but no signs of VZV encephalitis or meningeosis carcinomatosa, respectively.\nIn March 2020, the patient developed an immunotherapy-related pneumonitis with clinically mild symptoms but clear correlations in CT scans of the lung and noticeably reduced diffusion capacity in a subsequent lung-function examination. Therefore, immunotherapy had to be discontinued, and nivolumab maintenance could not be started according to protocol.\nFor treatment of pneumonitis, the patient received prednisolone with an initial dose of 50 mg per day (0.5 mg/kg). Because of decreasing signs of pneumonitis in control CT scans and an improving diffusion capacity in lung function, prednisolone could be quickly tapered to 7.5 mg, and re-exposure to nivolumab was feasible in June 2020. In the actual PET-CT scan and MRI of the brain, the patient still showed a profound remission of all tumor lesions, and there was no detectable sign of a relapse (, ). Currently, prednisolone is completely tapered, and the patient undergoes nivolumab maintenance (240mg) every 2 weeks. The performance state has further improved, and the patient is starting reintegration into work.\noutlines the patient\u2019s history.", "summary": "This report presents the case of a 37-year-old patient with metastatic advanced osteosarcoma, who had no more established options for tumor treatment left. PD-L1 expression in the most recent tumor sample was high (tumor proportion score (TPS) 90%, combined positive score (CPS) 92%) but no MSI could be detected. In an individual therapy attempt, an ongoing and profound remission of all tumor manifestations due to four cycles of immunotherapy with ipilimumab and nivolumab was reached. Despite discontinuation of immunotherapy for 3 months due to therapy-related pneumonitis, remission of all tumor manifestations was ongoing, and no detectable relapse in restaging before onset of Nivolumab-maintenance could be observed.", "subclaim_evaluations": [ { "subclaim": "The patient is a 37-year-old individual.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has metastatic advanced osteosarcoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no more established options for tumor treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "PD-L1 expression in the most recent tumor sample was high.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor proportion score (TPS) was 90%.", "support_label": "supported", "is_refined": false }, { "subclaim": "The combined positive score (CPS) was 92%.", "support_label": "supported", "is_refined": false }, { "subclaim": "No microsatellite instability (MSI) could be detected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received four cycles of immunotherapy with ipilimumab and nivolumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "A profound remission of all tumor manifestations was achieved.", "support_label": "supported", "is_refined": false }, { "subclaim": "The remission was ongoing despite discontinuation of immunotherapy for 3 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The discontinuation was due to therapy-related pneumonitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "No detectable relapse was observed in restaging before the onset of Nivolumab-maintenance.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3098_en.txt", "fulltext": "9-year-old female patient was admitted to the emergency department (ED) with respiratory distress. She had a history of six months of less severe dyspnea and symmetrical polyarthritis of large and small joints (proximal interphalangeal, 2nd and 3rd metatarsophalangeal joints, wrists, elbows, ankles, and knees), with functional limitations and intermittent fever (38-39\u00b0C), associated with malar rash aggravated by sun exposure, alopecia, petechiae on trunk and neck, generalized lymphadenopathy, and unmeasured weight loss. Therefore, she was started on 6.5 mg/kg/day hydroxychloroquine and 100 mg/kg/day cefepime (maintained for 10 days). Pulse therapy with methylprednisolone was not initiated at this time due to the possibility of infection.\n\nLaboratory tests, imaging studies, and a myelogram were then performed. A chest ultrasound was performed in the emergency room, revealing a left pleural effusion of 0.7 cm. This was complemented by a chest radiograph that showed a lingual atelectasis. The myelogram results revealed a hypocellular marrow with <1% blasts, mild granulocytopenia, and erythropoenia. The patient met the 2012 Systemic Lupus International Collaborating Clinics (SLICC) criteria for SLE (presence of acute cutaneous lupus, alopecia, arthritis, serositis, hemolytic anemia, thrombocytopenia, antinuclear antibodies (ANA), anti-DNA, and antiphospholipid antibodies). Thus, prednisone 1 mg/kg and azathioprine 2 mg/kg were added to the prescription after these results.\n\nThree days after admission, the patient developed a significant worsening of the general condition, worsening of dyspnoea, muffled heart sounds, jugular vein distension, haemodynamic instability and intense pallor. An echocardiogram was performed, which showed a large pericardial effusion with diastolic collapse of the right atrium. The patient received a transfusion and underwent a pericardiocentesis followed by pleuropericardial seal drainage. Due to the obstruction of the drain, a new approach was adopted the next day, without major complications. A new echocardiogram was performed two days later, showing moderate left ventricular systolic dysfunction, an ejection fraction of 60% and moderate tricuspid regurgitation. The therapies with furosemide 2 mg/day and spironolactone 2 mg/day were then initiated. Intravenous immunoglobulin (1 g/kg/day) was administered in two subsequent days due to persistent autoimmune bicytopenia. The echocardiogram two weeks later showed no pathological signs.\n\nAntigenemia for CMV was requested after a positive serological result with titers of 15/200,000 cells. Therapy with ganciclovir 5 mg/kg/day was initiated. After ten days of treatment, the antigenemia persisted (28/200,000 cells), and the dose of ganciclovir was, therefore, doubled. After eight days, another antigenemia presented titers of 1/200,000 cells. The patient maintained treatment with ganciclovir 10 mg/kg/day for two more weeks, with good clinical and laboratory improvement and was discharged with oral valganciclovir 20 mg/kg/day.\n", "summary": "A nine-year-old female patient was admitted to the emergency department with severe dyspnoea, hypofonetic murmurs, jugular vein distension, haemodynamic instability and intense pallor. She had been undergoing outpatient treatment for mild dyspnoea, polyarthritis, fever and various skin manifestations for six months. An echocardiogram revealed pericardial effusion. The patient underwent pericardiocentesis followed by pleuropericardial seal drainage without complications. Investigation continued with the completion of clinical and laboratory criteria for SLE and the presence of CMV antigenemia of 15/200,000 cells. Medication was initiated to control SLE and CMV, with good clinical and laboratory response.\n", "subclaim_evaluations": [ { "subclaim": "The patient is a nine-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted to the emergency department.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had severe dyspnoea.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had hypofonetic murmurs.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had jugular vein distension.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had haemodynamic instability.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had intense pallor.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had been undergoing outpatient treatment for six months.", "support_label": "supported", "is_refined": false }, { "subclaim": "An echocardiogram revealed pericardial effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent pericardiocentesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent pleuropericardial seal drainage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was without complications.", "support_label": "supported", "is_refined": false }, { "subclaim": "Investigation continued with the completion of clinical and laboratory criteria for SLE.", "support_label": "supported", "is_refined": false }, { "subclaim": "CMV antigenemia was 15/200,000 cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "Medication was initiated to control SLE.", "support_label": "supported", "is_refined": false }, { "subclaim": "Medication was initiated to control CMV.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a good clinical response.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a good laboratory response.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_68_en.txt", "fulltext": "In May 2017, a 51-year old female presented to our hospital with over 1 week of fatigue. She has medical history of donating both bone marrow and PBSCs 8 yrs ago for her brother with severe aplastic anemia (SAA). G-CSF was used to mobilize hematopoietic stem cells for PBSC collection. Complete blood count (CBC) showed lymphocytosis (Lymphocyte 10*10^9/L), moderate anemia (Hb 61 g/L) and thrombocytopenia (PLT 20*10^9/L). Peripheral blood smear demonstrated 30% of blast cells. Bone marrow biopsy showed lymphoblastic leukemia involving a markedly hypercellular marrow . Flow cytometry showed the blasts expressed CD10, CD19, CD22, CD38, HLA-DR, but not CD13, CD33, CD117, or cytoplasmic MPO. Chromosomal analysis showed a normal female karyotype. The diagnosis of B-ALL was made. VDP regimen (Vindesine, Daunorubicin, Prednisone) was started after her diagnosis and bone marrow aspirate 14 days later revealed complete remission (CR). Then 2 cycles of VDLP regimen (Vindesine, Daunorubicin, Prednisone, Pegaspargase) and 2 cycles of MA (Mitoxantrone, Cytosine arabinoside) + Pegaspargase (PEG-Asp) regimen were administered. During this period, the patient remained in remission and cerebrospinal fluid (CSF) remained clear after intermittent four time lumbar punctures. Minimal residue disease (MRD) monitoring by flow cytometry after each cycle did not detect blast cells with abnormal phenotype. Considering she has no other HLA-identical siblings or unrelated donors from China Bone Marrow Bank at that time and her brother, who was perfectly stable, a special type of auto-HSCT using her brother\u2019s PBSCs was performed in December 2017. Before the transplantation, whole exome sequencing (WES) was done for both the donor and recipient to rule out occult genetic abnormalities in the stem cells. Results showed that only the patient, not her brother, has genetic mutations including SF3B1 and BRAF mutation associated with hematological malignancies in her hematopoietic cells, not oral mucosal cells [\u2013]. Myeloablative conditioning regimen (Melphalan 140 mg/m2 d-3/d-2/d-1, Cytarabine 1 g/m2 d-3/d-2, Cyclophosphamide 60 mg/Kg d-3/d-2) was used. A total of 2.34*10^6/kg CD34+ cells, 13.0*10^8/kg MNCs from peripheral blood were collected and transfused into the patient. Neutrophil engraftment occurred at day + 11 and platelet engraftment occurred at day + 14. VP regimen (Vindesine, Prednisone) and MTX + 6-MP regimen were used for maintenance therapy. Bone marrow aspirate and flow cytometry showed that the patient remained in complete remission 3 months after transplantation. In May 2018, the patient\u2019s CBC showed leukocytosis and bone marrow aspirate indicated disease relapsed with 53.33% blast cells. Flow cytometry showed the blasts expressed CD10, CD19, HLA-DR and partially expressed CD11b. Genetic testing using polymerase chain reaction (PCR) technique found that SF3B1 and BRAF exome mutation was negative. Re-induction chemotherapy with VDP regimen was administered, the patient achieved CR. However, after another 2 cycles of high-dose MTX+ PEG-Asp regimen, disease relapsed. In November 2018, CD19 CAR-T therapy followed by HLA-identical unrelated hematopoietic stem cell transplantation was applied and the patient remains in remission for 7 months till now.", "summary": "This case report describes a 51-year old female diagnosed with acute lymphoblastic leukemia who donated both bone marrow and peripheral blood stem cells 8 yrs ago for her brother with severe aplastic anemia. Whole exome sequencing revealed leukemic genetic lesions (SF3B1 and BRAF mutation) only appeared in the donor sister, not the recipient, and an unusual type of hematopoietic stem cell transplantation with the recipient's peripheral blood stem cells was done. The patient remained in remission for 3 months before disease relapsed. CD19 CAR-T therapy followed by HLA-identical unrelated hematopoietic stem cell transplantation was applied and the patient remains in remission for 7 months till now.", "subclaim_evaluations": [ { "subclaim": "The patient is a 51-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with acute lymphoblastic leukemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She donated bone marrow 8 years ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "She donated peripheral blood stem cells 8 years ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "The recipient was her brother.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The recipient had severe aplastic anemia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Whole exome sequencing was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Leukemic genetic lesions were found in the donor sister.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The SF3B1 mutation was found in the donor sister.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The BRAF mutation was found in the donor sister.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The recipient did not have the SF3B1 mutation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The recipient did not have the BRAF mutation.", "support_label": "supported", "is_refined": false }, { "subclaim": "An unusual type of hematopoietic stem cell transplantation was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The recipient received peripheral blood stem cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient remained in remission for 3 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The disease relapsed after 3 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "CD19 CAR-T therapy was applied.", "support_label": "supported", "is_refined": false }, { "subclaim": "HLA-identical unrelated hematopoietic stem cell transplantation was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient remained in remission for 7 months after the transplant.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_513_en.txt", "fulltext": "We present the case of 32-year-old female patient who presented to the urologist with fever lasting for the previous two months, usually 37\u00b0C to 38\u00b0C, with occasional temperature leaps to 40\u00b0. Laboratory blood tests showed leukocytosis with cell counts up to 19,000. The patient did not complain of lumbar pain. Urinalysis showed leukocyturia, erythrocyturia, and slight positivity for protein. The patient was treated with a combination of amoxicillin, clavulonic acid, and cefuroxime. Abdominal ultrasound and multiphase CT depicted a large, expansive, heterogenous mass in the lower pole of the left kidney measuring 92 \u00d7 59 \u00d7 76 mm. CT scans showed a renal neoplastic mass with increased peripheral inhibition and poor central inhibition, possibly due to central necrosis. The tumor was unsharply demarcated from the surrounding parenchyma and pelvic system . Regional lymphadenopathy was present, but there were no signs of propagation in the main renal vein or perinephric fat tissue, and there were no signs of liver or bone metastasis. Chest CT showed no signs of lungs metastasis or mediastinal lymphadenopathy. In order to determine the final histopathological diagnosis, histopathological and immunohistochemical analyses were performed, complemented by reverse transcryptase-polymerase change reaction (RT-PCR). Gross examination of the slitted specimen showed a sharply circumscribed tumor measuring 9 \u00d7 6 \u00d7 6 cm and replacing a large part of the kidney. The renal tumor displayed infiltrated parenchyma but no expansion into the pelvic system and ureter or signs of spreading into the main renal vein. Gross appearance of the tumor was white-yellow with large necrotic areas. The microscopic analysis of perinephric fat tissue, regional lymph nodes, and the left adrenal gland revealed no signs of metastasis. Microscopic analysis showed that the tumor was composed of solid nests and stripes of tumor cells with small oval and round nuclei, and some of the nuclei contained small nucleoli . The tumor cell cytoplasm was scanty and pink with coarser appearance of chromatin. Mitotic figures were also found. Immunohistochemical analysis included MIC2 gene product/CD 99 , neuron-specific enolase (NSE) , CD3, CD 20, chromogranin, synaptophysin, vimentin, and neurofilament. Immunohistochemical staining revealed positive expression of CD99 and NSE in all tumor cells. The tumor cells did not stain with CD3, CD 20, chromogranin, synaptophysin, vimentin, or neurofilament. RT-PCR analysis for EWS-FLI1 fusion proteins was positive for type II 191 pb and negative for type I 125 pb. Diagnosis of rPNET set on the basis of characteristic morphological characteristics and results of immunohistochemical analysis was confirmed by RT-PCR. After nephrectomy, the patient received 14 cycles of a VAC/IE regiment adjuvant chemotherapy comprised of vincristine, doxorubicin, cyclophosphamide, ifosfamide, and etoposide. Our patient was disease-free for nine years and eight months. Blood and urine laboratory test values were in the normal range.\nThe study was approved by the institutional ethical committee and conducted according to the principles of the declaration of Helsinki of the world medical association. The authors declare that they have no conflicts of interest. The authors did not receive any grants for writing this article.", "summary": "We present the case of a 32-year-old female patient with primary renal PNET/EWS diagnosed nine years and eight months earlier. The patient presented with acute flank pain in the left lumbar region, hematuria, and episodes of high body temperature of 40\u00b0C. Abdominal ultrasound (US) and subsequently performed computed tomography (CT) revealed a large renal mass of heterogenous structure. The kidney tumor had central necrotic hypodense areas and strongly peripherally enhanced solid parts on postcontrast CT images. Immunohistochemistry revealed positivity for CD99 and neuron-specific enolase (NSE). Tumor cells were negative for CD3, CD 20, chromogranin, synaptophysin, vimentin, and neurofilament. Reverse transcription polymerase change reaction (RT-PCR) revealed EWS/FL1 translocation type 2. The patient underwent nephrectomy and polychemotherapy. The follow-up nine years and eight months after the diagnosis showed no evidence of tumor.", "subclaim_evaluations": [ { "subclaim": "The patient is a 32-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had primary renal PNET/EWS.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made nine years and eight months before the current report.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient presented with acute flank pain in the left lumbar region.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had hematuria.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had episodes of high body temperature of 40\u00b0C.", "support_label": "supported", "is_refined": false }, { "subclaim": "Abdominal ultrasound was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "CT revealed a large renal mass of heterogeneous structure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The kidney tumor had central necrotic hypodense areas on postcontrast CT.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had strongly peripherally enhanced solid parts on postcontrast CT.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemistry showed positivity for CD99.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemistry showed positivity for neuron-specific enolase.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor cells were negative for CD3.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor cells were negative for CD20.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor cells were negative for chromogranin.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor cells were negative for synaptophysin.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor cells were negative for vimentin.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor cells were negative for neurofilament.", "support_label": "supported", "is_refined": false }, { "subclaim": "RT-PCR revealed EWS/FL1 translocation type 2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent nephrectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received polychemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The follow-up nine years and eight months after diagnosis showed no evidence of tumor.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_209_en.txt", "fulltext": "The Columbia University Medical Center IRB (AAAR0802) exempted this retrospective case report from review.\nA 36-day-old female was fussy for a day and then developed respiratory distress. She was born at term, and a New York State newborn screen was negative. In the Pediatric ER, she was tachycardic (260 beats/minute) and hypothermic (32.4 degrees C) with prolonged capillary refill and faint distal pulses. She was placed on continuous positive airway pressure via nasal prongs. Adenosine was given twice via an intraosseous line for supraventricular tachycardia with conversion to sinus rhythm. She was then intubated for worsening respiratory distress and placed on an FiO2 of 1.0. An echocardiogram was notable for decreased biventricular systolic function and left to right shunting through a patent foramen ovale. A dobutamine infusion was started. Arterial cannulation was unsuccessful; transcutaneous pulse SO2 was consistently 100% during rewarming. Results from the first blood gas (all blood gas results were reported uncorrected for temperature) drawn from a catheter placed in the IVC (by Seldinger technique; sutured in place after advancing to its full length overlying the L3 vertebral body; ) were pH 7.01, PCO2 33 mm Hg, PO2 101 mm Hg, SO2 94%, and lactate 18 mmol/L. Early during rewarming, the IVC SO2 remained above 90% and was as high as 99% ; declines in IVC SO2 and lactate during the first 3 hours of rewarming correlated (Spearman r: 0.94; p = 0.002). An arterial catheter was then placed, and the FiO2 weaned. B-type natriuretic peptide was increased (4578.5 pg/mL). Capillary refill and distal pulses improved, and dobutamine was discontinued at 8 hours; a repeat echocardiogram the next day showed improved (though still diminished) biventricular systolic function with continued left to right shunting through a patent foramen ovale. Hypothermia and hyperlactatemia resolved over 10 and 12 hours, and IVC SO2 was 80% on hospital day 2. The patient was diagnosed with supraventricular tachycardia secondary to Wolff-Parkinson-White syndrome. Prior to discharge a week later, serum acylcarnitine profile, lactate, pyruvate, thyroid stimulating hormone, and thyroxine were all normal.\nIVC PO2 values were corrected retrospectively for the patient's temperature .", "summary": "A 36-day-old female was fussy for a day and then developed respiratory distress. In the Pediatric ER, she was tachycardic (260 beats/minute) and hypothermic (32.4 degrees C) with prolonged capillary refill and faint distal pulses. Adenosine was given twice via an intraosseous line for supraventricular tachycardia, with conversion to sinus rhythm. Blood drawn from an IVC catheter was significant for uncorrected (for temperature) oxygen saturation of 94% and lactate 18\u2009mmol/L; corrected and uncorrected IVC oxygen saturation early during rewarming were >90%. During rewarming, declines in uncorrected IVC oxygen saturation and lactate correlated. Hypothermia and hyperlactatemia resolved after 10 and 12 hours.", "subclaim_evaluations": [ { "subclaim": "The patient is a 36-day-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was fussy for a day before developing respiratory distress.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was tachycardic at 260 beats/minute in the Pediatric ER.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was hypothermic at 32.4 degrees Celsius.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had prolonged capillary refill.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had faint distal pulses.", "support_label": "supported", "is_refined": false }, { "subclaim": "Adenosine was given twice via an intraosseous line.", "support_label": "supported", "is_refined": false }, { "subclaim": "The adenosine was given for supraventricular tachycardia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The adenosine caused conversion to sinus rhythm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood was drawn from an IVC catheter.", "support_label": "supported", "is_refined": false }, { "subclaim": "The uncorrected oxygen saturation was 94%.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lactate level was 18 mmol/L.", "support_label": "supported", "is_refined": false }, { "subclaim": "The corrected and uncorrected IVC oxygen saturation were >90% early during rewarming.", "support_label": "supported", "is_refined": false }, { "subclaim": "During rewarming, declines in uncorrected IVC oxygen saturation and lactate correlated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hypothermia resolved after 10 hours.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hyperlactatemia resolved after 12 hours.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2822_en.txt", "fulltext": "An 84-year-old Chinese woman was admitted with gradual abdominal distension.\nThe patient\u2019s symptoms started 1 year ago. And she had poor appetite and a weight loss of 5 kg within the past 2 wk. She denied any symptoms associated with abdominal pain, fever and chills, nausea and vomiting, etc.\nThere was no prior history of trauma, hepatitis, allergy, or alcohol or tobacco usage.\nNo special.\nPhysical examination showed that she was in medium nutritional status with an icteric appearance. Vital signs were within normal ranges. The abdomen was asymmetrically enlarged, more in the right upper quadrant, without tenderness. Bowel movements occurred about 3-4 times per minute.\nLaboratory examination showed significantly increased serum levels of PIVKA-II (> 30000 mAU/mL; reference: < 32 mAU/mL), CA12-5 (428 U/mL; reference: < 35 U/mL), and CA19-9 (51.67 U/mL; reference: < 39 U/mL). Serum aspartate aminotransferase (AST) (97.03 IU/L; reference: < 40 IU/L), alanine aminotransferase (ALT) (64.73 IU/L; reference: < 40 IU/L), total bilirubin (TBIL) (61.19 \u00b5mol/L; reference: < 21 \u00b5mol/L), and direct bilirubin (DBIL) (36.42 \u00b5mol/L; reference: < 3.4 \u00b5mol/L) levels were moderately increased. Serum prothrombin time (PT) (33.3 s; reference: 11.0-15.0 s) and activated partial thromboplastin time (aPTT) (54.0 s; reference: 28.0-43.5 s) levels were also elevated slightly. However, serum albumin (ALB) (23.88 g/L; reference: > 35 g/L), prealbumin (PLAB) (17.3 mg/L; reference: 180-390 mg/L), and choline esterase (CHE) levels (1750 IU/L; reference: 3000-13000 IU/L) were significantly low.\nFollowing an initial abdominal ultrasound examination, an enhanced computed tomography (CT) scan was performed, which revealed multiple round cysts in the liver with clear boundaries. The largest cyst was located in the right lobe of the liver, with mild dilatation of the intrahepatic bile duct, and a size of approximately 20.1 cm \u00d7 12.2 cm \u00d7 19.6 cm. There was no contrast enhancement in either the arterial or venous phase .", "summary": "An 84-year-old Chinese woman was admitted with gradual abdominal distension. Her symptoms started 1 year ago, and she had poor appetite and a weight loss of 5 kg within the past 2 wk. She denied any symptoms associated with abdominal pain, fever and chills, nausea and vomiting, etc. The abdomen was enlarged, more in the right upper quadrant, without tenderness. Laboratory examination showed significantly increased serum levels of PIVKA-II, CA12-5, and CA19-9. A computed tomography scan revealed multiple round cysts in the liver with clear boundaries. The largest cyst was 20.1 cm \u00d7 12.2 cm \u00d7 19.6 cm in size, located in the right lobe of the liver with mild dilatation of the intrahepatic bile duct, but there was no contrast enhancement. Percutaneous drainage on the largest hepatic cyst and polycinnamol sclerosing agent injection into the cyst cavity were performed. After treatment, the patient's symptoms relieved and the elevated serum tumor makers reduced to the normal levels dramatically.", "subclaim_evaluations": [ { "subclaim": "The patient is an 84-year-old Chinese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted with gradual abdominal distension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her symptoms started 1 year before admission.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a weight loss of 5 kg within the past 2 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The abdomen was enlarged, more in the right upper quadrant.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum levels of PIVKA-II, CA12-5, and CA19-9 were significantly increased.", "support_label": "supported", "is_refined": false }, { "subclaim": "A computed tomography scan revealed multiple round cysts in the liver with clear boundaries.", "support_label": "supported", "is_refined": false }, { "subclaim": "The largest cyst was 20.1 cm \u00d7 12.2 cm \u00d7 19.6 cm in size.", "support_label": "supported", "is_refined": false }, { "subclaim": "The largest cyst was located in the right lobe of the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was mild dilatation of the intrahepatic bile duct.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no contrast enhancement in the cyst.", "support_label": "supported", "is_refined": false }, { "subclaim": "Percutaneous drainage was performed on the largest hepatic cyst.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A polycinnamol sclerosing agent was injected into the cyst cavity.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient's symptoms improved after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Elevated serum tumor markers reduced to normal levels after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_899_en.txt", "fulltext": "A 65-year-old male patient was referred to our hospital due to interventricular septal perforation following myocardial infarction. The patient was presented to the previous hospital with chest pain. Despite undergoing percutaneous coronary intervention (PCI) and attempted thrombus aspiration, reperfusion could not be achieved (See Fig. ). The patient\u2019s condition became unstable, and transthoracic echocardiography (TTE) revealed interventricular septal rupture and left-to-right ventricle shunt. Consequently, the patient was transferred to our hospital. Upon arrival, the electrocardiogram (ECG) showed QS wave on V1-V3 and persistent ST elevation, along with acute kidney injury (AKI) characterized by serum creatinine levels 4\u20135 times higher than baseline. TTE showed an ejection fraction (EF) of 50%, a mosaic flow near the apical septum, leading to the diagnosis of ventricular septal perforation (VSP), with an akinesia of the anterior left ventricular wall. The patient opted for emergency surgery. The initial procedure involved general anesthesia and cardiopulmonary bypass (CPB) with drainage from the right atrium and a venting tube in the left ventricle (LV). Cardiac arrest was induced through mild hypothermia using antegrade and retrograde cold blood cardioplegia.\nBriefly, a median sternotomy was performed, the pericardium was opened, and the heart was exposed and examined. The right chamber appeared enlarged, and the apex displayed pallor with a wide infarct area. An incision was made in the infarcted region of the LV myocardium, parallel to the interventricular septum, extending approximately 7 cm toward the apex, the VSP then been located . The double patch technique, as previously described by Takahashi et al. , was employed using bovine pericardial patches. The bovine patch was cut with a diameter 2 cm larger than the VSP for the right ventricle (RV) patch (R-patch), while the left ventricle (LV) patch (L-patch) was sized adequately to exclude the VSP, the infarcted area of the LV, and the LV incision. After confirming hemostasis, the heart was closed, and the patient was transferred to the intensive care unit (ICU) (See Fig. ).\nThe patient remained in the ICU for 9 days. Dialysis was required initially due to worsening kidney injury from the preoperative AKI, but the patient\u2019s condition stabilized, and continuous dialysis was no longer necessary. TTE performed 2 weeks after surgery indicated a shunt, but no signs of heart failure were observed. Thus, the patient received medication and was discharged 23 days after the surgery.\nAs an outpatient, the patient returned to the hospital after 22 days with chest discomfort. Mild pleural effusion was confirmed, and transesophageal echocardiography (TEE) revealed a left-to-right shunt through the previous patch. Following approximately 6 days of medication administration in the hospital, the patient\u2019s condition stabilized, and discharge was granted. However, the patient returned again after 2 weeks of being discharged, presenting with general malaise and decreased kidney function. TTE showed blood flow from the left to right ventricle, with EF of 55% and Qp/Qs = 1.7. Cardiac computed tomography (CT) and magnetic resonance imaging (MRI) confirmed the presence of a midventricular perforation measuring approximately 12 mm in diameter, leading to the decision to proceed with VSP repair surgery (See Fig. ).\nThe second surgery was performed on the 15th day after initiating medication in the hospital. A median incision was made, carefully exposing the heart, and establishing a CPB machine. The second surgery employed a double patch technique. Briefly, trans epicardial echocardiogram was performed to locate the VSP. The RV was accessed near the right ventricular outflow tract (RVOT) through a 4 cm incision toward the apex, positioned 1 cm laterally to the left anterior descending artery (LAD). As the distal LAD had already been damaged from the previous myocardial infarction, the RV was cautiously dissected to avoid injury to the first diagonal branch of LAD. The ruptured wall was confirmed, and RVOT was observed, with trabeculae being cut to enhance visibility . A bovine pericardium patch, measuring 3 cm in diameter and circular in shape, was prepared. The thread was passed from the LV lumen to the LV free wall and from the interventricular septal wall to the RV lumen using 3 \u2212 0 MH sutures. The patch was then pulled into the LV chamber by pulling the thread, and a single ligation was used for suturing, as shown in Fig. Another patch was prepared in a similar manner, with the thread applied from the opposite side and sutured with continuous sutures, securing it to the front side of the interventricular septum. A thread was passed from the LV free wall, near the previous suture, to the RV free wall, closing the RV with teflon felt and tying it with a mattress suture. An additional continuous suture was applied externally between the LV teflon felt and RV teflon felt to ensure closure. A pacing lead was placed in the right atrium and right ventricle, and an intra-aortic balloon pump (IABP) was inserted through the right common femoral artery. After confirming hemostasis, the chest was closed.\nThe patient remained in the ICU for 5 days, with a maximum creatinine level of 1.55, and experienced no postoperative complications. The IABP was removed 3 days after surgery, and the pacing lead was removed 4 days later. The patient was discharged 4 days after the removal of the pacing lead, displaying stability and no signs of heart failure.", "summary": "A 65-year-old male were re-administered to our hospital due to recurrent VSP. He was during follow up after undergone emergency VSP closure surgery 2 months earlier, utilizing the bovine double patch technique via left ventriculostomy. The initial VSP was located in the apical part of the interventricular septum, while the recurrent VSP appeared in the upper middle portion of the interventricular septum (Fig.\u00a01). As the previous patch remained intact, the second surgery employed the bovine double patch technique via right ventriculostomy. The patient's condition remained stable without the development of heart failure symptoms.", "subclaim_evaluations": [ { "subclaim": "The patient is a 65-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was re-administered to the hospital due to recurrent VSP.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had undergone emergency VSP closure surgery 2 months earlier.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The initial VSP was located in the apical part of the interventricular septum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The recurrent VSP appeared in the upper middle portion of the interventricular septum.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The previous patch remained intact.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The second surgery employed the bovine double patch technique.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second surgery was performed via right ventriculostomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's condition remained stable.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient did not develop heart failure symptoms.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2091_en.txt", "fulltext": "A 15-year-old girl presented with a history of progressive limping for 8 years. Another symptom was diffuse bone pain for 3 years. Family and drug histories were unremarkable. On physical examination, a large, firm, and non-tender mass was palpable in the right thyroid lobe. Left hip range of motion was limited in all directions, both actively and passively, and tenderness was present on left femoral head palpation. The rest of the physical examination was normal.\nBiochemical tests were performed and initial laboratory test results were as follows: serum calcium: 10.8 mg/dL (range: 8.5 - 10.5 mg/dL); phosphorus: 2.4 mg/dL (range: 2.9 - 5.1 mg/dL); iPTH: 2876 pg/mL (range 15 - 65 pg/mL); 25-hydroxy vitamin D3: 13.76 ng/mL (range 15 - 65 ng/mL); thyroid-stimulating hormone (TSH): 3.11 \u00b5IU/mL (range 0.51 - 4.34 \u00b5IU/mL); and alkaline phosphatase (ALP): 7410 IU/L (range: 180 - 1200 IU/L). While PHPT could be associated with other endocrinopathies, the complementary evaluations, such as insulin-like growth factor-1 (IGF-1) and prolactin measurements were done .\nThe plain pelvic radiography demonstrated a left femoral neck fracture. Spine radiography displayed wedge fractures at thoracic and lumbar spine levels . Bone mineral density (BMD) showed low bone density (lumbar spine's Z-core: -3.7). According to the above-mentioned test results, including elevated PTH, borderline high serum calcium, decreased phosphorus, and elevated ALP, primary hyperparathyroidism was considered as the most probable diagnosis.\nDual-phase sestamibi scintigraphy was performed for the patient after intravenous (IV) injection of 540 MBq of 99mTc-MIBI. The early scan images (at 20 minutes) revealed high thyroid uptake in the right lobe with a suppressive effect on the left side. Increased radiotracer uptake was seen in the right lobe without proper washout on delayed images, which was higher and larger than is expected with PAs . A thyroid scan was also done two days later, after IV injection of 185 MBq of 99mTc from the anterior view to rule out a thyroid nodule. This scan revealed a focal decreased uptake in the upper pole of the right lobe, which was smaller compared with the finding of the parathyroid scan . The discrepancy between the two scans led to further investigation into the underlying pathology. Neck ultrasound revealed an enlarged right thyroid lobe compatible with intra-lobar necrosis and echogenic regions with the approximate size of 20 mm compatible with the parathyroid gland ( and ).\nThe patient was referred to an experienced surgeon for neck exploration and parathyroidectomy. She underwent open surgery. The parathyroid mass had infiltrated to the surrounding thyroid tissue; hence, right thyroidectomy, isthmectomy, and right inferior parathyroidectomy were performed. The remaining parathyroid glands were examined during the operation and were normal. She experienced hungry bone syndrome postoperatively, which was managed appropriately. Finally, serum calcium and iPTH levels decreased to a level of 8.7 mg/dL (8.5 - 10.5 mg/dL) and 24 pg/mL (15 - 65 pg/mL), respectively. The operative phosphorus level was 2.3 mg/dL.\nGross histopathologic examination revealed a well-defined cream-colored mass measuring 2.5 \u00d7 1.5 \u00d7 1.0 cm. IHC helped with the confirmation of diagnosis .\nHistologic examination showed uniform chief cells presenting as nodules and sheet growth with proliferated blood vessels that were separated by a broad fibrous capsule from the adjacent thyroid tissue. The tumor had invaded the capsule and blood vessels. IHC staining for CD34 confirmed vascular invasion. IHC was also diffusely positive for CK in the tumor and tumor cells attached to endothelial cells. Ki67 was also positive in 2% - 3% of tumor cells. However, other markers, such as CD45, thyroid transcription factor 1 (TTF-1), and Pax5 were negative (-).\nWhole exome sequencing (WES) study was done for the assessment of familial hyperparathyroidism and MEN1. The genetic study demonstrated no mutation in CDC73 and menin genes. However, there was an incidental mutation in the breast cancer 1 (BRCA1) gene.\nWe performed an extensive search using different databases, including Medline, PubMed, Scopus, ScienceDirect, and Google Scholar to find all published cases of PC in children and adolescents. We used the following combination of keywords: parathyroid carcinoma or parathyroid cancer or parathyroid neoplasm or parathyroid malignancy, and pediatrics or child or adolescent or boy or girl. We could find 16 papers reporting 17 cases of pediatric PC from 1972. summarizes the published papers.\nAccording to these reports, the male to female ratio was 0.6. The youngest and oldest patients were 8 and 16 years old, respectively. The most common initial presenting symptoms were related to hypercalcemia, including anorexia, vomiting, polyuria, polydipsia, fatigue, bone pain, and renal calculi. Sixty percent had a palpable neck mass. Nearly 50% had skeletal involvement, including fracture and deformity. Only three patients had experienced weight loss. Pancreatitis was a rare condition diagnosed in one case. Nearly 20% had metastasis, most common sites were lung and cervical lymph nodes, and all cases with pulmonary involvement had experienced relapse and hypercalcemia after the initial operation. The range of serum calcium and iPTH was 12 - 20.7 mg/dL and 300 - 8638 pg/mL, respectively. IHC had been reported in two cases, which were both positive for parafibromin . Three cases had deletion mutation of CDC73, and another case was negative with regard to menin gene mutation. Three patients had a positive family history of primary hyperparathyroidism. There was no predominant tumor location site at the neck.", "summary": "A 15-year-old girl presented with progressive limping and bone pain for 8 years. She was referred by an orthopedic surgeon because of elevated intact parathyroid hormone (iPTH) for further evaluation. Physical examination revealed a large, firm, and non-tender neck mass, left hip tenderness, and limited range of motion. The initial biochemistry tests showed a borderline high calcium level of 10.8 mg/dl, an elevated iPTH level of 2876 pg/mL, and a decreased phosphorus level of 2.4 mg/dL. The 99mTechnetium (Tc) sestamibi scan displayed early intense activity in the right thyroid lobe persisting in the three-hour repeat scan, compatible with a parathyroid lesion. The patient underwent right-sided neck exploration and parathyroidectomy. Intraoperative and pathology findings confirmed the diagnosis of PC. Immunohistochemistry (IHC) staining revealed creatine kinase (CK) and CD31 in endothelial cells of the tumor. Ki67 staining was also positive in 2% - 3% of tumor cells. The whole exome sequencing (WES) study was negative for cell division cycle 73 (CDC73) and multiple endocrine neoplasia 1 (MEN1) genes.", "subclaim_evaluations": [ { "subclaim": "The patient is a 15-year-old girl.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had progressive limping and bone pain for 8 years.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was referred by an orthopedic surgeon.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had elevated intact parathyroid hormone (iPTH).", "support_label": "supported", "is_refined": false }, { "subclaim": "Physical examination revealed a large, firm, and non-tender neck mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial calcium level was 10.8 mg/dl.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial iPTH level was 2876 pg/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial phosphorus level was 2.4 mg/dL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The 99mTechnetium sestamibi scan showed early intense activity in the right thyroid lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The activity persisted in the three-hour repeat scan.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The findings were compatible with a parathyroid lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent right-sided neck exploration and parathyroidectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraoperative findings confirmed the diagnosis of parathyroid carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemistry staining revealed creatine kinase (CK) in endothelial cells of the tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemistry staining revealed CD31 in endothelial cells of the tumor.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Ki67 staining was positive in 2% - 3% of tumor cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "Whole exome sequencing was negative for CDC73.", "support_label": "supported", "is_refined": false }, { "subclaim": "Whole exome sequencing was negative for MEN1.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3360_en.txt", "fulltext": "A 43-year-old female presented in outpatient clinic with a history of a left adnexal cyst associated with foul-smelling PV discharge for the past 3\u20134 months. The patient was also under medication, tab. Thyroxine sodium-50 \u03bcg per day for hypothyroidism since 2 years. Physical examination revealed no abnormalities on per-abdominal assessment. The lesion in the liver was accidental finding during the ultrasonography of the abdomen and pelvis. Ultrasonography (USG) and CT scans identified a 9 \u00d7 8.7 \u00d7 8.4 cm well defined hypodense lesion in the right lobe of the liver, with a differential diagnosis of focal nodular hyperplasia in CT scan. The patient got admitted and surgery (hemihepatectomy) was done.\n\nHistopathological findings\nIn pathology department, a hemihepatectomy specimen was received. Gross examination of the specimen revealed a well-defined nodular growth measuring 9 \u00d7 7 \u00d7 5 cm within the liver, with a cut surface displaying a grey-white to brownish appearance. No areas of necrosis were observed.\nMicroscopic examination of multiple sections from the tumor mass revealed a well-circumscribed lesion characterized by spindle-shaped tumor cells arranged in fascicles and concentric pattern around numerous thin-walled capillaries. The tumor cells were exhibiting elongated nuclei and moderate cytoplasm. No atypia, mitosis, or necrosis were observed. All submitted margins were free of tumor cells. Surrounding liver parenchyma did not reveal any significant morphological changes.\n\nImmunohistochemistry\nImmunohistochemical staining done were Smooth Muscle Actin (SMA), h-Caldesmon, Desmin, CD34, STAT6, DOG1, S100 and ALK. Our differentials include neural tumors like schwannoma, so S100 was negative, solitary fibrous tumors, CD 34 and STAT6 were negative and vascular tumor, CD 34 was negative. Positivity for SMA and h-caldesmon, confirmed the myopericytic nature of the tumor. CD34 highlighted blood vessel endothelial cells. DOG-1, ALK and Desmin were negative, which ruled out the close differentials like GIST, Inflammatory myofibroblastic tumor and leiomyoma and further supporting the diagnosis of myopericytoma.\n\nDiagnosis\nBased on the clinical, radiological, and histopathological findings, the diagnosis of myopericytoma of the liver was established.\n\nTherapeutic intervention\nBased on the radiological findings, hemihepatectomy was already done. No further intervention was needed after histopathological report.\n\nFollow-up and outcomes\nAs the lesion was benign and completely resected, the patient was completely recovered. There were no clinical signs and symptoms related to disease and ultrasonography of the abdomen and pelvis was normal on follow up at 6th months.", "summary": "We reported a case of myopericytoma in a 43-year-old female with a history of a left adnexal cyst and foul-smelling per vaginal discharge with no significant findings in per abdominal examination. Imaging studies initially suggested the possibility of hemangioma in ultrasonography and further CT scan was advised which gave the possibility of focal nodular hyperplasia.", "subclaim_evaluations": [ { "subclaim": "The patient is a 43-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of a left adnexal cyst.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had foul-smelling per vaginal discharge.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no significant findings in per abdominal examination.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasonography suggested the possibility of hemangioma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A CT scan was advised.", "support_label": "supported", "is_refined": false }, { "subclaim": "The CT scan gave the possibility of focal nodular hyperplasia.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2314_en.txt", "fulltext": "A five-day-old full-term female baby delivered by cesarean section cried immediately at birth. The mother had no comorbid conditions and described her pregnancy as normal. During the pregnancy, the mother had an X-ray of her leg, but she was unaware of her pregnancy at the time. There is no family history of congenital anomalies, and the baby is born to parents that are unrelated. The baby was born with a trunk-like appendage that was arising from the superomedial canthus of the left eye, 26 mm \u00d7 12 mm in size, with a small tract with Cerebrospinal fluid discharge. The left nasal cavity was hypoplastic with left anophthalmia. No cleft palate, cleft lip, or choanal atresia was noted. .\nA two-dimensional Echocardiography (2D echo) revealed complex cyanotic congenital heart disease, including double outlet Right Ventricle with a large ventricular septal defect of 8 mm, malposed great vessels, mild valvular right ventricular outflow tract obstruction (RVOTO) with a pressure gradient of 26 mmHg, small Patent ductus arteriosus (PDA) with a left to right shunt and confluent branched pulmonary arteries. Two ostium Secundum atrial septal defects (ASD) were noted of 4 mm and 25 mm with a normal biventricular structure and function. On Magnetic resonance imaging (MRI) of the brain, mild hydrocephalus, bilateral colpocephaly (larger than normal occipital horns due to undeveloped white matter in the posterior cerebrum) with bilateral periventricular white matter hypodensities and corpus callosum agenesis were noted. Computed tomography (CT) imaging with a 3D reconstruction of the face revealed minor bony defects of the left nasal bone, frontal process of the maxilla, and absent nasal turbinates.Bilateral maxillary and ethmoid sinuses were underdeveloped, to a greater degree on the child's left side. CT imaging of the thorax and abdomen revealed a hemivertebra involving the T10 vertebral body causing focal scoliosis with right-sided convexity.\nOur patient\u2019s parents deferred treatment and chose to wait till the child grows older.", "summary": "A full-term female baby delivered by cesarean section cried immediately at birth. The mother reported having a normal pregnancy but has a history of x-ray during her first trimester. The baby was born with a rare presentation of proboscis lateralis which was accompanied by multiple anomalies, including but not limited to bilateral colpocephaly,\u00a0corpus callosum agenesis,\u00a0complex cyanotic congenital heart disease, and\u00a0hemivertebra of the T10 body.", "subclaim_evaluations": [ { "subclaim": "The baby was delivered by cesarean section.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby cried immediately at birth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mother reported a normal pregnancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mother had a history of x-ray during her first trimester.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby was born with proboscis lateralis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby had bilateral colpocephaly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby had corpus callosum agenesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby had complex cyanotic congenital heart disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby had hemivertebra of the T10 body.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2160_en.txt", "fulltext": "A 71-year-old female patient with thalassemia minor and hypertension was diagnosed in 1999 with early-stage right breast cancer. She underwent breast-conserving surgery and axillary dissection; pathology showed a small tumor, less than 2 cm, node-negative invasive ductal carcinoma. Hormone receptors (HRs) were positive but HER2 was negative. After the surgery, she received chemotherapy [cyclophosphamide, methotrexate, and 5-fluorouracil (CMF)] followed by radiotherapy and adjuvant tamoxifen for 5 years. She did well and was very adherent to clinical and mammographic follow-up until 2015, when she had an intractable cough. Imaging studies showed a left hilar lesion and multiple osteolytic bone metastases, including the left scapula, left shoulder, left iliac bone, and the fourth and seventh dorsal vertebrae. Fine needle aspiration from the left hilum, through endobronchial ultrasound, confirmed breast cancer metastasis. Similarly to the original tumor, hormone receptors were positive (ER 90%, PR 30%) and HER2 was negative. Therefore, she was started on endocrine therapy with fulvestrant, which kept her progression free for 2 years. She was then switched to exemestane and everolimus; however, this regimen was discontinued owing to grade II pneumonitis and prenephrotic range proteinuria. At that time, the patient was enrolled in a double-blind randomized clinical trial testing CDK4/6 inhibitors along with aromatase inhibitors. A few months later, the patient was taken off the study owing to disease progression, and was found to be on the placebo arm. Following the US Food and Drug Administration (FDA) approval of CDK4/6 inhibitors, she was started on ribociclib and letrozole, which she tolerated relatively well. Nonetheless, because of persistent neutropenia, the dose of ribociclib was reduced to 400 mg daily; on days 1\u201321 of a 28-day cycle.\nAlmost 20 weeks after starting ribociclib and letrozole, she noticed small, rounded, well-demarcated hypopigmented lesions over both hands with expanding patches reaching up to the mid forearms . Three weeks later, new similar lesions started to appear over her face and feet. The patient had no personal or family history of autoimmune diseases. The patient was seen at the dermatology clinic and was offered treatment with topical immunomodulators (calcineurin inhibitors), which she refused, and was kept on topical steroids with little improvement.", "summary": "A 71-year-old female patient was diagnosed initially with early-stage right breast cancer (HR+/HER2-) and was treated with breast-conserving surgery followed by chemotherapy, radiotherapy, and hormonal therapy. A few years later, she developed metastatic disease to the hilar lymph nodes, and to multiple skeletal sites, including the left scapula, left shoulder, left iliac bone, and dorsal vertebrae, for which she was treated with ribociclib and letrozole. While on treatment, she developed hypopigmented lesions involving both hands, feet, and face, which were described as vitiligo-like lesions.", "subclaim_evaluations": [ { "subclaim": "The patient is a 71-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with early-stage right breast cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The breast cancer was HR+/HER2-.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with breast-conserving surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received hormonal therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "A few years later, she developed metastatic disease to the hilar lymph nodes.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had metastatic disease to multiple skeletal sites.", "support_label": "supported", "is_refined": false }, { "subclaim": "The skeletal metastases included the left scapula.", "support_label": "supported", "is_refined": false }, { "subclaim": "The skeletal metastases included the left shoulder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The skeletal metastases included the left iliac bone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The skeletal metastases included the dorsal vertebrae.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with ribociclib.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with letrozole.", "support_label": "supported", "is_refined": false }, { "subclaim": "While on treatment, she developed hypopigmented lesions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hypopigmented lesions involved both hands.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hypopigmented lesions involved both feet.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hypopigmented lesions involved the face.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesions were described as vitiligo-like.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1455_en.txt", "fulltext": "A 62-year-old woman came to our center with extremely severe hydronephrosis and multiple right renal calculi found by annual physical check. She reported no renal colic, nausea or fever and had no current use of any medications. Her temperature was 36.7 \u00b0C, pulse 89 bpm, respiratory rate 18 bpm, and non-invasive blood pressure 130/57 mmHg. Unenhanced CT scan demonstrated extremely severe hydronephrosis and multiple right renal calculi with the largest diameter of 2 cm . Urine routine was positive for nitrites and leukocyte esterase, and microscopical examination showed + + + for leucocyte.\nAfter thorough examination, we performed prone-position mini-percutaneous nephrolithotomy under spinal anaesthesia. A single tract was created under the guidance of ultrasound to directly reach the median calyceal group. After the insertion of a guidewire, the channel was dilated to 16Fr with a fascia dilator. During the operation, swollen mucosa could hardly be seen through turbid purulent urine. Multiple golden stones embedded in the renal pelvis were fragmented with holmium laser and flushed out, and a considerable number of the stones were removed. After 2 h\u2019 lithotripsy, the operation finished after successful indwelling of a 6Fr double-J stent and a 16 F nephrostomy tube.\nTwo hours postoperatively, the patient complained of chilly and shiver. Her blood pressure dropped to 85/60 mmHg, and blood tests showed C-reactive protein 31.4 mg/L, White blood cell 9.55 \u00d7 109/L, D-dimer 570.0 ng/ml. Symptoms were relieved after empirically intravenous infusion of 300 mg biapenem bid and micro-pump injection with dopamine.\nThree days later during the CT scan, the patient abruptly developed respiratory distress and loss of consciousness. Her blood pressure dropped to 76/45 mmHg, and oxygen saturation decreased to 85% under nasal catheter inhalation of oxygen. Clinical findings indicated the possibility of PE with shock. Supported by multi-channel intravenous rehydration, micro-pump injection with norepinephrine and mask oxygen inhalation, her blood pressure fluctuated between 108\u2013124 and 65\u201378 mmHg. However, the patient still complained of dyspnea and chest pain, and her blood oxygen saturation remained unstable at an average of 92% under mask oxygen inhalation. Emergency laboratory tests showed a D-dimer of more than 3300 ng/ml. Considering the rising level of D-dimer and the patient\u2019s clinical manifestation, we decided that PE might be the most likely diagnosis. Thus, we administrated anticoagulant therapy with 4000 U low molecular weight heparin (LMWH) at once and offered emergency CTPA, which revealed multiple embolisms in her left pulmonary artery and its branches . Meanwhile, doppler echocardiography showed that the patient\u2019s left ventricular ejection fraction (LVEF) was 52% with severe tricuspid regurgitation, and experienced sonographers estimated that pulmonary arterial systolic pressure was about 40 mmHg (mild pulmonary hypertension). Doppler ultrasonography of lower limbs revealed intermuscular venous thrombosis in her left leg.\nIt was a contradictory situation with both the urgent need for thrombolysis therapy and the high vulnerability of surgery field bleeding. In order to solve the life-threatening problem first, our multi-disciplinary team administrated 50 mg of Alteplase ivgtt which was completed within 2 h for thrombolysis, and then transferred the patient to intensive care unit (ICU) for further life-supporting therapy. In order to prevent venous thromboembolism (VTE), 0.4 ml LMWH was subcutaneously injected every 12 h in ICU. Routine re-examination of the lower limbs venous ultrasonography and echocardiography was ordered to monitor the patient\u2019s condition. Sonographers reported the remission trend of tricuspid regurgitation and pulmonary hypertension. Intermuscular venous thrombosis in her left leg could no longer be detected 6 days after the thrombolysis treatment.\nOn the 6th postoperative day, the patient suddenly developed unconsciousness and anhelation in ICU, and her blood oxygen saturation progressively dropped to 85%. Urgent intubation, mechanical ventilation and blood transfusion were applied to correct the patient\u2019s anemia. Gradually, her oxygen saturation rose to 98%, but crimson and opaque drainage fluid kept flowing through her nephrostomy tube without any sign to stop even after clamping the catheter for 30 min. Her hemoglobin (Hb) level was still decreasing progressively . All the above clues were indicative of post thrombolysis bleeding. Diffused contrast medium in the middle and lower part of the right kidney was seen during DSA . SRAE was then performed under general anesthesia. The patient reported no obvious discomfort and generally recovered after conventional symptomatic treatment and blood transfusion. Anticoagulant treatment method was gradually changed to oral application of Warfarin 3 mg qn, and the patient was approved to be discharged 26 days postoperatively. She returned to her daily activity and reported no obvious discomfort, and during re-examination, the echocardiography showed LVEF of 70% with no obvious abnormality.", "summary": "A 62-year-old woman was admitted to our hospital with extremely severe hydronephrosis and multiple right renal calculi. After thorough examination, she received prone-position mini-percutaneous nephrolithotomy under spinal anaesthesia. Three days postoperatively, the patient complained of chest pain and dyspnea. Computed tomography pulmonary angiogram (CTPA) showed multiple embolisms in the left pulmonary artery and its branches. Symptoms were relieved after anticoagulant and thrombolysis therapy. On the 6th postoperative day, the patient developed shortness of breath, computed tomography angiography (CTA) showed massive hemorrhage in the right kidney, diffused contrast medium in the middle and lower part of the right kidney was seen during digital substraction angiography (DSA). Superselective right renal artery embolization (SRAE) was then applied using coil to occlude the responsible artery. The patient generally recovered under conscientious care and was approved to be discharged 26 days postoperatively.", "subclaim_evaluations": [ { "subclaim": "The patient was a 62-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted with extremely severe hydronephrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had multiple right renal calculi.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received prone-position mini-percutaneous nephrolithotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was performed under spinal anaesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three days postoperatively, she complained of chest pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three days postoperatively, she had dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography pulmonary angiogram showed multiple embolisms in the left pulmonary artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography pulmonary angiogram showed embolisms in the branches of the left pulmonary artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms were relieved after anticoagulant therapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Symptoms were relieved after thrombolysis therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "On the 6th postoperative day, she developed shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography angiography showed massive hemorrhage in the right kidney.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Digital substraction angiography showed diffused contrast medium in the middle and lower part of the right kidney.", "support_label": "supported", "is_refined": false }, { "subclaim": "Superselective right renal artery embolization was applied.", "support_label": "supported", "is_refined": false }, { "subclaim": "The embolization used coil to occlude the responsible artery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was discharged 26 days postoperatively.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2105_en.txt", "fulltext": "A 62 year old Caucasian female was hospitalized for six days for treatment of a chronic obstructive pulmonary disease (COPD) exacerbation. Management included steroids and antibiotics. Home medications included clopidogrel for coronary artery disease. Her weight was 46.58 kilograms with a BMI of 17.7 and an estimated glomerular filtration rate (eGFR) of 60.65 ml/min. During the hospitalization she was treated for DVT prophylaxis with enoxaparin 40 mg by subcutaneous injection daily.Seven days after discharge, the patient returned to the emergency department complaining of diffuse abdominal pain, increasing abdominal girth, and anterior wall bruising. An abdominal CT scan confirmed a large RSH . Both general surgery and interventional radiology were consulted. She was managed conservatively. Her hematocrit dropped from 34.8 to 25.3%; however, she declined transfusion of blood products. During the course of her stay, the patient experienced acute hypoxic respiratory failure and did not wish to be intubated. Her medical status deteriorated and, with support from her family, the patient chose to be made comfortable with minimal supportive care. She expired due to sepsis and respiratory failure two days after re-admission.\nA 79 year old male Caucasian was admitted for worsening dyspnea and management of atrial fibrillation with rapid ventricular rate and COPD exacerbation. His clinical course was further complicated by resistant gram negative and gram positive pneumonia and hypoxic respiratory failure. His weight was 59 kilograms with a BMI of 18 and initially his eGFR was 41.98 ml/min. He received subcutaneous abdominal injections of both prophylactic enoxaparin 30 mg and insulin sliding scale therapy. On day 2, his eGFR was calculated at 53.94 and his enoxaparin dose was increased to 40 mg daily.On day 5, he was noted to have abdominal pain and a noncontrast CT scan confirmed a left RSH that expanded considerably over 12 hours on follow up CT. Interventional radiology was consulted but ultimately the patient was managed conservatively with fluid resuscitation and close observation. His hematocrit dropped from 46 to 25.8%. The patient was discharged after 15 days to a long term acute care facility for further management of his respiratory failure and healthcare associated pneumonia.\nAn obese 44 year old Caucasian female with multiple chronic medical problems was readmitted to our facility from a ventilator capable extended care facility for sepsis and acute on chronic hypoxic respiratory failure. Comorbidities included spina bifida and central obesity with a BMI of 27. She was admitted on warfarin therapy for a history of recent deep vein thrombosis; however, she was subtherapeutic, with an International Normalized Ratio (INR) of 1.59. She was, therefore, treated with full dose enoxaparin 80 mg by subcutaneous injection twice daily. Her eGFR was 148.65 ml/min. Coumadin was held as the patient was treated with anitfungal and antimicrobial therapy that could prolong her INR.On day 8, she complained of abdominal pain and a CT scan confirmed a large right RSH . Repeat CT scan one day later showed extension of the hematoma and concern for possible active arterial extravasation. Both general surgery and interventional radiology were consulted. The patient underwent a failed attempt at embolization due to access complications. Due to hemorrhagic shock she required transfusion with 10 units of RBCs and pressure support ventilation in the intensive care unit. Her hematocrit dropped from 34.9 to 20.6%. Anticoagulation was reversed with fresh frozen plasma, vitamin K, and one dose of recombinant factor VIIa. The patient subsequently underwent successful embolization with thrombin and coiling of the right inferior epigastric artery by vascular surgery two days after the initial hematoma. Serial CT scans confirmed no further bleeding. After two weeks, anticoagulation therapy was reinstituted without further evidence of bleeding. The patient was ultimately discharged to a long term acute care facility for continued management of her chronic respiratory failure.", "summary": "Case number one: A 62\u00a0year old chronically ill Caucasian female develops a rectus sheath hematoma seven days after hospital discharge. The previous hospitalization included low molecular weight heparin administration for deep vein thrombosis prophylaxis. The patient ultimately chooses comfort care and expires due to sepsis and respiratory failure. Case number two: A 79\u00a0year old Caucasian male develops a rectus sheath hematoma during hospital admission where LMWH is used for deep vein thrombosis prophylaxis. He is managed conservatively; however, his hematocrit drops from 46 to 25.8%. Case number three: A 44\u00a0year old chronically ill Caucasian female is treated with therapeutic low molecular weight heparin for recent deep vein thrombosis during a hospital admission. She develops a large rectus sheath hematoma requiring embolization as well as blood transfusion.", "subclaim_evaluations": [ { "subclaim": "A 62 year old chronically ill Caucasian female develops a rectus sheath hematoma seven days after hospital discharge.", "support_label": "supported", "is_refined": false }, { "subclaim": "The previous hospitalization included low molecular weight heparin administration for deep vein thrombosis prophylaxis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient chooses comfort care.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient expires due to sepsis and respiratory failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 79 year old Caucasian male develops a rectus sheath hematoma during hospital admission.", "support_label": "supported", "is_refined": false }, { "subclaim": "LMWH is used for deep vein thrombosis prophylaxis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is managed conservatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's hematocrit drops from 46 to 25.8%.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 44 year old chronically ill Caucasian female is treated with therapeutic low molecular weight heparin for recent deep vein thrombosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She develops a large rectus sheath hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hematoma requires embolization.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hematoma requires blood transfusion.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_817_en.txt", "fulltext": "The patient was a 72-year-old man with no pertinent medical history. An upper gastrointestinal imaging (UGI) performed for GC screening revealed an abnormality wherein there was a horizontal inversion of the upper gastrointestinal tract and deformation of the stomach body. Upper endoscopy showed an elevated lesion with an ill-defined border in the anterior wall of the lower-third of the stomach body , and histopathological examination revealed a moderately differentiated tubular adenocarcinoma. Contrast-enhanced multidetector computed tomography (MDCT) showed inverted thoracic and abdominal organs and illustrated the wall thickness of the stomach body, which had no obvious metastasis . Furthermore, the aortic arch to the thoracic aorta was in the normal anatomical position ; hence, the case was diagnosed as SIP. The 3D angiography revealed a complete right\u2013left reversal of the abdominal arteries . SI is known to be frequently associated with chronic sinusitis and bronchiectasis, and this clinical triad is called the Kartagener syndrome . However, chronic sinusitis and bronchiectasis were not seen in this patient.\nPreoperative staging of GC was clinical Stage IIB (cT3N0M0) according to the tumor/node/metastasis (TNM) classification of malignant tumors 8th edition.\nLDG with D2 lymph node dissection (LND) and modified delta-shaped Billroth-I reconstruction was performed. Although this case was SIP, the abdominal organs were completely inverted ; hence, this operation could be performed with the usual LDG symmetrically . Five trocars were placed in the left\u2013right reversal of the usual LDG in our hospital. The surgeon and the assistant performed this operation by reversing the standing position and the roles of the left and right hands from the usual LDG. The surgeon had to operate the energy device with the non-dominant hand. However, the surgeon used the energy device with the dominant hand for supra-pancreatic LND. The problem encountered with this method was that the forceps of the left hand crossed the energy device; however, the supra-pancreatic LND could be safely performed without the energy device interfering with the pancreas.\nIn this operation, there were two problems that could not be solved by performing the operation symmetrically. One of the problems was the method of retracting the lateral segment of the liver. We usually use the Nathanson liver retractor in laparoscopic gastrectomy (LG), which was also used in this case. However, the tip of the liver retractor was oriented toward the hepatic hilar side due to its asymmetrical hook shape. Therefore, the retraction of the lateral segment of the liver was somewhat insufficient, and special care was required not to damage the liver . The second problem was intracorporeal suturing. We usually perform intracorporeal suturing with the surgeon in the paraxial position; however, in this operation, the surgeon performed the suturing in the co-axial position between the patient\u2019s legs. By shifting to this standing position, the surgeon was able to suture with the dominant hand and the normal needle direction.\nOperation time, including intraoperative frozen section histological analysis for the proximal resection margin, was 323 min, and blood loss was 10 ml. After an uneventful postoperative course, the patient was discharged on postoperative day 10. Postoperative staging of GC was pathological Stage IIIB (pT4aN3aM0) according to the TNM classification of malignant tumors 8th edition. The patient received S \u2212 1 + docetaxel adjuvant chemotherapy for 1 year after surgery without any signs of recurrence.", "summary": "The patient was a 72-year-old man diagnosed with GC. Upper endoscopy revealed a type 3 tumor in the anterior wall of the stomach body. Multidetector computed tomography showed no obvious GC metastasis or inverted organs. The preoperative diagnosis was cStage IIB (i.e., cT3, cN0, and cM0) GC with SI. Although liver retracting and intracorporeal suturing required special attention, LDG with D2 LND and Billroth-I reconstruction were safely performed by reversing the usual procedure. The patient was discharged 10\u00a0days after the surgery.", "subclaim_evaluations": [ { "subclaim": "The patient was a 72-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with gastric cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "Upper endoscopy revealed a type 3 tumor.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumor was located in the anterior wall of the stomach body.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multidetector computed tomography showed no obvious gastric cancer metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The preoperative diagnosis was cStage IIB gastric cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The preoperative diagnosis included cT3, cN0, and cM0.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a small intestinal stenosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Laparoscopic distal gastrectomy with D2 lymph node dissection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Billroth-I reconstruction was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged 10 days after the surgery.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2782_en.txt", "fulltext": "Our patient is a 70-year-old male, right-hand dominant farmer who presented at the outpatient clinic after falling on the concrete and landing on his left hand. The patient complained of pain on the ulnar side of his hand and swelling was noted on examination. No apparent deformity of the little finger was noted, finger cascade was normal, and full range of motion was elicited but with pain on motion. Ulnar nerve function was intact. Radiographs of the left hand were performed and showed no fractures or dislocations .\nThe patient denied any interval injuries but had persistent pain on the ulnar side of his left hand, prompting him to come back to the clinic 9 weeks later.\nRepeat radiographs showed complete ulno-palmar dislocation of the 5th CMCJ. A CT scan with 3-D reconstruction was also done, confirming said injury, and no associated fractures were noted .\nManual closed reduction was done under fluoroscopic guidance, but the joint was noted to be unstable when traction was removed. The patient was then indicated for open reduction of the 5th CMCJ.\nThe dislocated joint was approached from the dorsoulnar side and scar tissue was carefully removed from the 5th CMCJ . All ligaments of the 5th CMCJ were torn including the pisometacarpal ligament. Using manual longitudinal traction and dorsally directed force to the 5th metacarpal base, the 5th CMCJ was repositioned to its anatomic location. A K-wire was inserted perpendicular to the long axis of the 5th through 4th metacarpals as a temporary fixation. Thereafter, intermetacarpal fixation was performed between the 4th and 5th metacarpals using Mini TightRope\u00ae (Arthrex, FL, USA) .\nUnder C-arm guidance, 1.2-mm holes were drilled with a trajectory about 1 cm distal from and parallel to the articular surfaces of the 5th metacarpal base to the 4th metacarpal base, approximating the original location of the intermetacarpal ligament. Together with one of the stainless-steel metal buttons, a loop of the Mini TightRope\u00ae construct is passed from the ulnar to the radial hole of the 4th metacarpal. Mini TightRope\u00ae construct was then pulled to tension until the button was flush on the radial cortex of the 4th metacarpal base. The two strands of Mini TightRope\u00ae FiberWire were then passed through the radial to ulnar holes of the 5th metacarpal, and second button was then loaded into the sutures and pushed until it was flush against the ulnar cortex of the 5th metacarpal. While maintaining tension, a provisional knot is created, and range of motion and finger cascade are then checked. Once deemed acceptable, sutures were then tied for up to 5 knots over the ulnar button. Remaining strands are then cut using a blade 11 scalpel. Capsule, fascia, and skin were then closed. Immediately after surgery, the patient was allowed to use his fingers freely with unrestricted range of motion.\nK-wires were removed at 2 weeks postoperatively. Follow-up radiograph at 1 year postoperatively showed maintained proper alignment of the 5th CMCJ and the little finger had no limitation of motion. There are no plans to remove the Mini TightRope\u00ae, unless the patient begins to complain of pain related to the aforementioned hardware.", "summary": "A 70-year-old, right-hand dominant, male farmer injured his left hand when he slipped and fell on a concrete surface, landing on the ulnar side of his left hand. He was immediately seen in the clinic, just with a swollen left hand but no obvious deformity and with apparently normal PA and oblique radiographs of the hand. Nine weeks later, he came back due to persistent ulnar-sided hand pain; repeat radiographs and a CT scan of the left hand showed ulno-palmar dislocation of the fifth CMCJ. He then underwent trial closed reduction of the 5th CMCJ dislocation but failed. Open reduction, temporary K-wire fixation, and fixation using Mini TightRope\u00ae through the 4th and 5th metacarpals were done. A full range of motion of the hand was allowed immediately post-operative. Reduction was maintained and no complications were noted on subsequent follow-up visits.", "subclaim_evaluations": [ { "subclaim": "The patient is a 70-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is right-hand dominant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is a farmer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The injury occurred when the patient slipped and fell on a concrete surface.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient landed on the ulnar side of his left hand.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was seen in the clinic immediately after the injury.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a swollen left hand.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no obvious deformity of the left hand.", "support_label": "supported", "is_refined": false }, { "subclaim": "PA and oblique radiographs of the hand were apparently normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nine weeks after the injury, the patient returned due to persistent ulnar-sided hand pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "Repeat radiographs and a CT scan showed ulno-palmar dislocation of the fifth CMCJ.", "support_label": "supported", "is_refined": false }, { "subclaim": "A trial of closed reduction of the 5th CMCJ dislocation was attempted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The closed reduction failed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Open reduction was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Temporary K-wire fixation was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fixation using Mini TightRope\u00ae through the 4th and 5th metacarpals was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A full range of motion of the hand was allowed immediately post-operative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reduction was maintained on subsequent follow-up visits.", "support_label": "supported", "is_refined": false }, { "subclaim": "No complications were noted on subsequent follow-up visits.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3135_en.txt", "fulltext": "A 47-year-old Chinese male farmer, with history of contact with soil during farm work 2 days before the onset of illness, was admitted to our hospital with a 2-week history of a high fever, productive cough with purulent sputum, shortness of breath on exertion, and nausea and vomiting. Chest computed tomography (CT) performed at a local hospital before admission to our hospital had shown irregular patchy opacities in the lower lobe of the left lung. He had been treated with levofloxacin for 4 days and then switched to moxifloxacin and meropenem for 10 days at the local hospital. However, as his fever, expectoration, and shortness of breath had not improved, he was transferred to our hospital for further investigation and treatment.\n\nThe patient had a 7-year history of dry mouth and dry eyes which had not previously been medically evaluated or treated, but had no history of other possible autoimmune disease such as recurrent oral ulcers, Raynaud\u2019s phenomenon, rash, or arthritis. He was a smoker with a 30 pack-year smoking history. He denied a history of pulmonary disease. He didn\u2019t undergo any previous chest X-ray examination and reported no symptoms and signs of previous interstitial lung disease such as gradually progressive dyspnea on exertion, dry cough, fatigue of unknown origin. He also denied a history of occupational dust exposure, keeping pets and drug abuse. He had no family history of pulmonary disease and cancer.\n\nOn admission, he had a temperature of 37.6 \u00b0C, pulse of 82 beats/min, respiratory rate of 16 breaths/min, and blood pressure of 123/71 mmHg. The skin on both his legs was dry and rough, but there was no rash or bruising. There were no rales in the lungs on auscultation, and no other obvious abnormalities were noted on physical examination.\n\nThe chest CT images on admission at our hospital showed that the patchy opacities in the left lower lobe had extended since the previous chest CT, and there were new small patches in the right middle lobe. Laboratory tests revealed an elevated white blood cell count and neutrophil percentage, elevated levels of procalcitonin and C-reactive protein, an increased erythrocyte sedimentation rate, mild hyponatremia, and elevated levels of liver enzymes. The serum human immunodeficiency virus antibody was negative. No infectious agents were detected in the patient\u2019s blood culture and sputum microbiological examination.\n\n\nMain Laboratory test\n\nTest\tDay 1 (admission)\tDay 8\tDischarge\tReference result/range\nHematology\t\t\t\t\nWhite blood cell count (\u00d7\u2009109 cells/L)\t20.59\t11.53\t5.78\t3.5\u20139.5\nNeutrophil percentage (%)\t87\t81.7\t57\t42.5\u201371.5\nProcalcitonin (ng/mL)\t0.117\t\t\t<\u20090.05\nC-reactive protein (mg/L)\t103\t43.1\t12\t0\u20138\nErythrocyte sedimentation (mm/hr)\t100\t\t\t0\u201315\nLiver enzymes\t\t\t\t\nAlanine transaminase (U/L)\t101\t\t\t0\u201340\nAspartate transaminase (U/L)\t60\t\t\t5\u201334\nAlkaline phosphatase (U/L)\t463\t\t\t40\u2013150\nGama-glutamyl transferase (U/L)\t209\t\t\t9\u201364\nSerum sodium (mmol/L)\t132\t\t\t136\u2013145\nInfections\t\t\t\t\nLegionella urine antigen\tPositive\t\t\tNegative\nStreptococcus pneumoniae Urine antigen\tNegative\t\t\tNegative\nBlood culture\tNo growth\t\t\tNo growth\nSputum microbiological examination\tNegative\t\t\tNegative\nSerum anti-Mycoplasma IgM\tNegative\t\t\tNegative\nSerum anti-Chlamydia IgM\tNegative\t\t\tNegative\nSerum anti-Legionella IgG\tNegative\t\t\tNegative\nSerum HIV antibody\tNegative\t\t\tNegative\nImmunological test\t\t\t\t\nTear secretion test (mm/5 min)\tLeft eye: 3; right eye: 9\t\t\t10\u201315\nAntinuclear antibodies\tPositive, titer 1:160\t\t\tNegative,\u2009<\u20091:80\nAnti-SSA/Ro60\t5.2 (positive)\t\t\t<\u20090.8 negative\nAnti-SSA/Ro52\t5.5 (positive)\t\t\t<\u20090.8 negative\nAnti-SSB/La\t0.8 (weak positive)\t\t\t<\u20090.8 negative\nAnti-histone\t0.9 (weak positive)\t\t\t<\u20090.8 negative\nRheumatoid factor (IU/mL)\t94.5\t\t\t0\u201330\n\n\nBecause the patient had symptoms and signs of extrapulmonary system involvement, including gastrointestinal symptoms, hyponatremia, and signs of liver damage, we could not rule out Legionella pneumonia and thus we performed a Legionella urine antigen test, which was positive. The patient was treated with moxifloxacin 0.4 g once a day and piperacillin sodium and tazobactam sodium 4.5 g three times a day for 8 days. His white blood cell count, neutrophil percentage and C-reactive protein level had decreased since admission. However, his symptoms of fever, expectoration, and shortness of breath persisted. Thus, the antibiotic treatment was switched to intravenous tigecycline 50 mg twice a day for 5 days after an initial dose of 100 mg. However, his symptoms still did not improve. To confirm the diagnosis, we performed an ultrasound-guided percutaneous needle lung biopsy and tested for markers of autoimmune disease.\n\nThe result of a tear secretion test was positive. Salivary gland emission computed tomography dynamic imaging showed impaired uptake in both submandibular glands and parotid glands. Immunological index testing gave positive results for antinuclear antibodies, anti-SSA/Ro60, anti-SSA/Ro52, anti-SSB/La and anti-histone antibody, and the serum rheumatoid factor level was increased. Test for autoimmune liver disease-related antibodies, antineutrophil cytoplasmic antibodies, were all negative, and the serum complement C3 and C4 levels were normal.\n\nLung histology showed formation of fibrin balls in the alveolar cavities accompanied by changes associated with OP (Fig. 2). No pathogens were detected in the lung tissue using metagenomic next generation sequencing (mNGS). Based on the results of the lung biopsy, antibiotics were stopped and intravenous methylprednisolone 40 mg daily was initiated. The patient\u2019s symptoms improved rapidly, and his body temperature returned to normal on the first day of corticosteroid therapy. He was discharged home 4 days later, and continued oral prednisone 10 mg daily for 20 days followed by 5 mg daily for 5 days. At the follow-up visit one month after discharge, his chest CT showed almost complete resolution of the pulmonary lesions.", "summary": "A 47-year-old man was admitted to the hospital because of fever, expectoration, and shortness of breath. Lung imaging showed irregular patchy consolidation. A diagnosis of Legionella pneumonia was initially considered on the basis of the patient\u2019s history of exposure to soil before disease onset, signs of extrapulmonary involvement, and a positive Legionella urine antigen test result. However, the patient\u2019s symptoms and lung imaging did not improve after treatment with levofloxacin, moxifloxacin, and tigecycline for Legionella infection. In addition, Sj\u00f6gren\u2019s syndrome was diagnosed on the basis of clinical manifestations and immunological indicators. Pathological changes associated with AFOP were confirmed from the results of ultrasound-guided percutaneous lung biopsy. The patient\u2019s clinical symptoms improved rapidly after a short course of low-dose corticosteroid therapy, and lung imaging showed significant improvement.", "subclaim_evaluations": [ { "subclaim": "The patient is a 47-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to the hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had expectoration.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lung imaging showed irregular patchy consolidation.", "support_label": "supported", "is_refined": false }, { "subclaim": "A diagnosis of Legionella pneumonia was initially considered.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of exposure to soil before disease onset.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had signs of extrapulmonary involvement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Legionella urine antigen test result was positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with levofloxacin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with moxifloxacin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with tigecycline.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient\u2019s symptoms did not improve after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Lung imaging did not improve after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Sj\u00f6gren\u2019s syndrome was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathological changes associated with AFOP were confirmed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The confirmation was based on ultrasound-guided percutaneous lung biopsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received a short course of low-dose corticosteroid therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient\u2019s clinical symptoms improved rapidly.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lung imaging showed significant improvement.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1945_en.txt", "fulltext": "A 45-year-old man previously injured by a chest shotgun was referred to our Institution for a retained bullet in the left ventricle. The patient\u2019s medical history included hypertension, diabetes, and thyroid dysfunction.\nOne month before the admission, the patient underwent an emergency cardiorrhaphy through a left thoracotomy. At that time, the patient was in a war zone, and the previous emergent operation was performed by a general surgeon with the aim to stop the bleeding. At the time of hospitalization, the patient was in stable clinical conditions with sporadic atypical chest pains and rate-dependant left bundle branch block (LBBB). At presentation, the physical examination did not showed pathological signs, except for a left thoracic wound. Blood tests, including markers of cardiac injury, were all within normal limits. Transthoracic echocardiography showed the bullet retained within the left ventricular chamber localized into the posterior wall underneath the posterior mitral leaflet without signs of valve dysfunction or systolic dysfunction . Chest X-ray and angio-computed tomography (CT) scan confirmed the presence of the missile in the left ventricle wedged within the tendineal chordae underneath the posterior mitral leaflet .\nPreoperative workup included a coronary angiogram showing unobstructed coronary arteries. After multidisciplinary discussion at the Heart Team, we decided to proceed with the surgical removal of the RCM. The operation was performed through median sternotomy with routine cardiopulmonary bypass. After aortic cross-clamping and cardioplegia delivery, the left atrium was opened, the posterior mitral leaflet was incised just above the RCM, and the bullet was removed . The edges were then sutured to re-establish continuity of P2 with a 4/0 braided suture. Posterior ring annuloplasty was then performed using a flexible Gore-tex band. The post-operative course was uneventful and the patient was discharged on the seventh post-operative day. Echocardiography performed at discharge did not revealed any residual mitral regurgitation.", "summary": "We describe the case of successful surgical treatment of a retained missile localized within the left ventricle in close proximity of the posterior mitral leaflet. The operation was performed through a transatrial approach, detaching the posterior mitral leaflet. The post-operative course was uneventful. The patient was discharged on the seventh post-operative day. At 30-day follow-up visit, the patient was in good conditions, with normal mitral valve function.", "subclaim_evaluations": [ { "subclaim": "The missile was retained within the left ventricle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The missile was in close proximity to the posterior mitral leaflet.", "support_label": "supported", "is_refined": false }, { "subclaim": "The operation was performed through a transatrial approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "The posterior mitral leaflet was detached during the operation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The post-operative course was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged on the seventh post-operative day.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 30-day follow-up, the patient was in good condition.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "At 30-day follow-up, mitral valve function was normal.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2873_en.txt", "fulltext": "A 48-year-old man returned to Weihai from Wuhan on January 10, 2020. He developed recurrent fever on January 20, 2020 with a maximum temperature of 38.2 \u00b0C with mild cough, without sputum, expectoration or chest tightness. Only oral antipyretics were taken. He went to the clinic on January 23, 2020 where real-time reverse-transcription polymerase chain reaction of pharyngeal swab specimens confirmed COVID-19. He was admitted to the hospital.\nThe patient had asthma for 10 years that was stable in normal circumstances, without affecting daily life and activity. He inhaled salmeterol/fluticasone powder (Xeretide, 50/500 \u03bcg) twice daily. Smoking or other medical history was denied.\nOn admission, temperature was 37.3 \u00b0C, respiratory rate was 23 breaths/min, and a few wheezing rales were heard in both lungs. Arterial blood gases at 21% fraction of inspiration O2 (FiO2) showed partial pressure of oxygen (PaO2) 97 mmHg, partial arterial pressure of carbon dioxide (PaCO2) 39.5 mmHg, pH 7.393, and oxygenation index (OI, PaO2/FiO2) was 465 mmHg [normal range (NR) 400-500 mmHg].\nLaboratory parameters were as follows: White blood cell count 4.66 \u00d7 109/L (NR, 3.3 \u00d7 109\u20139.5 \u00d7 109/L), neutrophil count 3.0 \u00d7 109/L (NR, 2 \u00d7 109\u20137.7 \u00d7 109/L), lymphocyte count 1.27 \u00d7 109/L (NR, 0.8 \u00d7 109\u20134 \u00d7 109/L), CD4 T lymphocyte count 542/\u03bcL (NR, 500\u20131440/\u03bcL), monocyte count 0.35\u00d7109/L (NR, 0.12 \u00d7 109\u20130.8 \u00d7 109/L), eosinophil count 0.03 \u00d7 109/L (NR, 0.05 \u00d7 109\u20130.5 \u00d7 109/L), platelet count 135 \u00d7 109/L (NR, 125 \u00d7 109\u2013350 \u00d7 109/L), lactate dehydrogenase (LDH) 166 U/L (NR, 100\u2013190 U/L), alanine transaminase (ALT) 15 U/L (NR, 0\u201350 U/L), aspartate transaminase (AST) 20 U/L (NR, 5\u201335U/L), albumin 39.8 g/L(NR, 38\u201355 g/L), C-reactive protein (CRP) 10.94 mg/L (NR, < 4 mg/L). Procalcitonin, myocardial enzymes, serum electrolytes and renal and liver function tests were normal. Detection of antigen and antibody of respiratory tract pathogenic spectrum (including influenza virus A/B) was negative. Chest X-ray showed increased lung markings in both lungs.", "summary": "We report a patient with confirmed COVID-19 combined with asthma. It took 41 d from disease onset to discharge to obtain two negative tests for this coronavirus.", "subclaim_evaluations": [ { "subclaim": "The patient had confirmed COVID-19.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had asthma.", "support_label": "supported", "is_refined": false }, { "subclaim": "It took 41 days from disease onset to discharge.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient obtained two negative tests for the coronavirus.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 1 }, { "id": "multiclinsum_test_795_en.txt", "fulltext": "A 57-year-old lady with a history of diabetes, thyroid disease, dyslipidemia, and an episode of atrial fibrillation, resolved with pharmacological cardioversion several years before, presented to the Emergency Department for worsening dyspnea (New York Heart Association Classification\u2014NYHA: IV). Her medical therapy included levothyroxine once daily, dapagliflozin 10 mg once daily, metformin 1,000 mg twice daily, rosuvastatin 5 mg, and ezetimibe 10 mg every night. She had no prior heart failure admissions. Other symptoms included orthopnea and paroxysmal nocturnal dyspnea but no chest pain or syncopal episodes. Physical examination showed a pulse rate of 95 bpm, blood pressure of 140/70 mmHg, and 97% of peripheral oxygen saturation. Cardiac auscultation revealed a pansystolic murmur of 3/6 Levine grade over the apex as well as an ejection systolic murmur over the second intercostal space at the left sternal border. There were moderate bibasal lung crepitations and mild ankles edema. Intravenous furosemide was given with resolution of the lungs and ankles edema. Her electrocardiogram showed ectopic atrial rhythm, left anterior hemiblock as well as LV hypertrophy . Laboratory tests showed troponine T of 20 pg/ml (URL of 14 pg/ml), N-terminal pro B-type natriuretic peptide (NT-proBNP) of 582 pg/ml (URL <150 pg/ml).\nA trans-thoracic echocardiogram showed a significant septal, asymmetric LV hypertrophy (basal anteroseptal wall diastolic thickness of 19 mm). Left and right ventricular systolic functions were normal. There was a clear SAM of the AML and an LVOT gradient of 56 mmHg at rest rising to 136 mmHg during the Valsalva maneuver ( and ). In addition, there was evidence of moderate to severe MR with a significant anteriorly directed jet, not very typical of SAM-related MR. A large calcification at PML-base was noted. 2D-3D trans-esophageal echocardiogram (2D-3D TEE) revealed the true MR mechanism. There was an MR combined mechanism based on: (1) PML degenerative prolapse with P2-flail from ruptured chordae with an eccentric anteriorly directed regurgitant jet and (2) a second posteriorly directed jet, related to SAM of AML ( and \u2013). The pre-operative end-systolic mitral annular diameter was 39 mm while the end-diastolic diameter was 34 mm. There were no signs of infective endocarditis. We added beta-blockers and intravenous diuretics to pre-existing therapy and her clinical condition improved together with a significant LVOT gradient reduction (from 56 to 30 at rest). She underwent coronary-computed tomography angiography that excluded the presence of significant coronary stenoses. She was discharged and, one month later, she underwent MV surgical repair (artificial ring annuloplasty plus artificial chordae implantation) together with septal myectomy. Septal myectomy was performed according to modified Morrow\u2019s procedure. The ruptured chorda was resected during the operation. Regarding annuloplasty, a Carpentier-Edwards Physio II ring N. 32 (Edwards Lifesciences, Irvine, CA, USA) was used. Chordal reconstruction was performed using n. 2 ePTFE Goretex neo-chordae (W.L. Gore & Associates, Flagstaff, AZ, USA). Gore-Tex chords were anchored at the papillary muscle and individually sutured to the free posterior leaflet margin. This intervention shifted the coaptation line posteriorly and contributed to fully resolving AML-SAM. The final outcome was good.", "summary": "A 57-year-old lady with a history of diabetes, dyslipidemia, and a previous single episode of atrial fibrillation (treated with pharmacological cardioversion), presented to the Emergency Department for worsening dyspnea (New York Heart Association Classification class IV). A trans-thoracic echocardiogram (TTE) showed a significant, septal, and asymmetric left ventricular hypertrophy (basal anteroseptal wall diastolic thickness of 19 mm) with normal left ventricle systolic function. A SAM of AML was evident together with a left ventricular outflow tract gradient of 56 mmHg at rest, rising to 136 mmHg during the Valsalva maneuver. In addition, there was evidence of moderate to severe mitral regurgitation (MR) with an anteriorly directed jet, not very typical of MR related to SAM. A 2D-3D trans-esophageal echocardiogram (2D-3D TEE) revealed a combined MR mechanism based on PML degenerative prolapse with P2-flail from ruptured chordae with related eccentric anteriorly directed regurgitant jet, together with a second regurgitant posteriorly directed jet, related to SAM of AML. The patient underwent MV repair together with septal myectomy, with a good final outcome.", "subclaim_evaluations": [ { "subclaim": "The patient is a 57-year-old lady.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has a history of diabetes.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has a history of dyslipidemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a previous single episode of atrial fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The atrial fibrillation was treated with pharmacological cardioversion.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented to the Emergency Department for worsening dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her dyspnea was classified as New York Heart Association Class IV.", "support_label": "supported", "is_refined": false }, { "subclaim": "A trans-thoracic echocardiogram showed significant, septal, and asymmetric left ventricular hypertrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The basal anteroseptal wall diastolic thickness was 19 mm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Left ventricular systolic function was normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "A SAM of AML was evident.", "support_label": "supported", "is_refined": false }, { "subclaim": "The left ventricular outflow tract gradient at rest was 56 mmHg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The left ventricular outflow tract gradient rose to 136 mmHg during the Valsalva maneuver.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was evidence of moderate to severe mitral regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mitral regurgitation jet was anteriorly directed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 2D-3D trans-esophageal echocardiogram revealed a combined MR mechanism.", "support_label": "supported", "is_refined": false }, { "subclaim": "The combined MR mechanism included PML degenerative prolapse with P2-flail from ruptured chordae.", "support_label": "supported", "is_refined": false }, { "subclaim": "The combined MR mechanism included a second regurgitant posteriorly directed jet related to SAM of AML.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent MV repair.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent septal myectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a good final outcome.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_604_en.txt", "fulltext": "This case report has been written in accordance with the SCARE 2018 criteria .\nA 64-year-old female presented to the Emergency Department of our hospital with acute onset of a right-sided groin bulge that occurred earlier that day after doing heavy lifting. She had no significant past medical or surgical history. Her baseline functional status was exceedingly well. Her laboratory studies showed no leukocytosis or any electrolyte abnormalities. Initial radiologic studies included a transabdominal and transvaginal pelvic ultrasound, which showed a 2.4 \u00d7 2.6 cm fluid collection with some septations and absent visualized adnexal structures. A subsequent CT demonstrated a well-circumscribed 2.7 \u00d7 3.2 \u00d7 2.6 cm fluid collection containing echogenic debris. It did not have significant rim enhancement yet was noted to be most consistent with an abscess, complex seroma, or necrotic lymph node; its depth was amenable to percutaneous drainage. On further review with the radiologist, it was noted to contain the appendix, the tip of which was dilated and radiographically concerning for a cystic process, with mucocele remaining within the differential diagnosis.\nThe patient was kept nil per os, intravenous fluid resuscitation was initiated, and antibiotic therapy was begun. She was brought to the operating room for emergent surgical intervention. The patient underwent laparoscopic appendectomy with open femoral hernia repair. Intraoperatively, the appendiceal tip was incarcerated within the hernia sac . Due to the preoperative radiographic appearance and the suspicion for mucocele, extreme caution was exercised to avoid rupture and not to provide excess tension in an attempt to reduce it laparoscopically. It was easily removed through the open inguinal incision after the appendix base was divided laparoscopically . The femoral hernia was repaired in standard McVay fashion. Final pathology showed inflamed non-perforated acute appendicitis without evidence for neoplasm. The patient recovered well without notable complications and was discharged on postoperative day number two without antibiotics.", "summary": "A 64-year-old female presented to the Emergency Department of our hospital with acute onset of a right-sided groin bulge that occurred earlier that day after doing heavy lifting. Her workup revealed acute appendicitis contained within an incarcerated right femoral hernia. The patient underwent laparoscopic appendectomy with open femoral hernia repair. Intraoperatively, the appendiceal tip was incarcerated within the hernia sac. It was removed through the open inguinal incision after the appendix base was divided laparoscopically. Final pathology showed inflamed acute appendicitis without evidence for neoplasm.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented to the Emergency Department with a right-sided groin bulge.", "support_label": "supported", "is_refined": false }, { "subclaim": "The bulge occurred after doing heavy lifting.", "support_label": "supported", "is_refined": false }, { "subclaim": "The workup revealed acute appendicitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The acute appendicitis was contained within an incarcerated right femoral hernia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent laparoscopic appendectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient also had open femoral hernia repair.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraoperatively, the appendiceal tip was incarcerated within the hernia sac.", "support_label": "supported", "is_refined": false }, { "subclaim": "The appendix base was divided laparoscopically.", "support_label": "supported", "is_refined": false }, { "subclaim": "The appendiceal tip was removed through the open inguinal incision.", "support_label": "supported", "is_refined": false }, { "subclaim": "Final pathology showed inflamed acute appendicitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no evidence for neoplasm.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1607_en.txt", "fulltext": "A previously healthy 54-year-old Caucasian man presented to the emergency department of our internal medicine ward with a medical history of aggravation of general health related to dizziness, weight gain, and two syncopal attacks. A physical examination was conducted which showed his blood pressure to be normotensive and his measured pulse rate and body temperature to be within normal limits. His initial laboratory results showed an increased hematocrit level of 69%, a hemoglobin level of 23g/dl, and a white blood cell count of 15.5\u00d71000/\u03bcL. Initially he seemed to be hemodynamically stable with no signs of dyspnea. He experienced a rapid decrease of total proteins (5.67g/dl decreasing to 2.02g/dl within 72 hours) and began to exhibit hemodynamic instability, at which point he was admitted to our intensive care unit (ICU) and treated with catecholamines. Due to an increasing pulmonary insufficiency an endotracheal intubation was performed immediately. A massive emission of fluids and proteins from the intravascular to the extracellular compartments caused a generalized compartment syndrome to develop. Over 24 hours after admission to the ICU our patient developed compartment syndromes in both his upper and lower limbs and the abdominal compartment. The abdominal compartment syndrome was diagnosed by measuring the intra-abdominal pressure through a urinary catheter. The highest measured intra-abdominal pressure (IAP) was 26mm/Hg and therefore a diagnosis of abdominal compartment syndrome Grade IV was made. His abdomen and all four limbs required decompression by a fasciotomy of both forearms, both thighs, both lower legs, and the abdomen. The surgeries were performed 24 hours after admission to the clinic. Vacuum-assisted dressings were placed first on his lower limbs. During a second revision operation vacuum-assisted dressings were placed on his upper limbs to assist with monitoring the edema and in preparation for the definite closure of the fasciotomy wounds. The dressing of his abdomen included putting the intestine into a sac and covering it with a transparency dressing. Continuous renal replacement therapy (CRRT) was required three days after admission due to acute renal failure. Continuous venovenous hemodiafiltration (CVVHD) was applied for a total of four days. The blood levels of creatinine and urea returned to normal after three days of CVVHD and he gained back full renal function. Before CVVHD the highest creatinine level amounted to 1.4mg/dl and after renal replacement therapy (before discharge from the hospital) it decreased to 0.6mg/dl. The urea levels also decreased from 80mg/dl to 17mg/dl. The hematological parameters returned to their normal limits by the fourth day of admission . The clinical diagnostics included cultures of the blood, urine, stool, sputum, and intra-operative tissue samples which were all analyzed for aerobic and anaerobic bacteria, as well as for fungus. The results of the samples were all negative. After ruling out the differential diagnoses the diagnosis of a SCLS was confirmed, with secondary abdominal compartment and compartment syndromes in all four limbs. The secondary closure of the abdomen had been performed 16 days after admission and 23 days after admission we were able to remove the vacuum-assisted pumps and proceed in closing all wounds . His upper limbs required skin grafting . His lower limbs showed weakness in the dorsal flexion of the feet and toes, therefore peroneal splints were adjusted to his feet. His upper limbs showed residual deficits of fine motor skills, especially the left upper limb. These deficits had been improved with hand therapy. Our patient was moved to the rheumatology ward after 23 days in our ICU. He was started on medical prophylactic treatment with theophylline and terbutaline in combination with steroid therapy (prednisolone). During remission induction therapy the dose of theophylline ranged between 1200 and 1600mg per day in order to achieve serum concentrations between 20 and 25mg/dl. Before discharging him the theophylline dose was reduced to 1000mg/day. In order to obtain the remission advised to achieve peak serum concentrations between 10 and 20mg/dl, terbutaline was first given at a total dose of 20mg per day in divided doses. Before he was discharged the dose was reduced to 10mg per day. We recommended that he should continue to take theophylline and terbutaline for the rest of his life. Methylprednisolone was applied intravenously while in remission induction therapy at a dose of 40mg per day. After remission was induced the prednisolone was gradually reduced to 15mg/day. We recommended maintaining the gradual reduction of that dose.\nAfter 60 days of treatment he was discharged from the clinic. He was able to return to his previous place of work and reached the same level of athletic activity as before the illness.", "summary": "A previously healthy 54-year-old Caucasian man presented to the emergency department of our internal medicine ward with a medical history of aggravation of general health related to dizziness, weight gain, and two syncopal attacks. Due to a massive emission of fluids and proteins from the intravascular to the extracellular compartments, he developed compartment syndromes in his upper and lower limbs and the abdominal compartment. The abdomen and all four limbs required decompression by a fasciotomy of both forearms, both thighs, both lower legs, and the abdomen within 24 hours after admission. After 60 days of treatment he was dismissed from the clinic. He was able to return to his previous occupation and reached the same level of athletic activity as before the illness.", "subclaim_evaluations": [ { "subclaim": "The patient is a 54-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had two syncopal attacks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed compartment syndromes in his upper and lower limbs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed an abdominal compartment syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The abdomen required decompression by fasciotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both forearms required decompression by fasciotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both thighs required decompression by fasciotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both lower legs required decompression by fasciotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fasciotomies were performed within 24 hours after admission.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was dismissed from the clinic after 60 days of treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was able to return to his previous occupation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reached the same level of athletic activity as before the illness.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1368_en.txt", "fulltext": "A 10-year-old Tunisian girl presented to our department with fever, vomiting, and asthenia. She had neither family history of hematological diseases nor other illness before the disease onset. During her admission, a physical examination showed a child of normal stature with pallor and fever (body temperature of 39 \u00b0C). She was tachycardic at 141 beats/minute and her blood pressure was at 107/51 mmHg. She had tachypnea at 52 breaths/minute with oxygen saturation in air at 95% and no heart murmur. An abdominal examination found an isolated splenomegaly. Biochemical analysis showed signs of hemolysis: total bilirubin, 51 microml/L with a direct fraction of 9 microml/L; haptoglobin < 58 mg/L; and D-lactate dehydrogenase, 2051 U/L. Her complete blood count showed severe anemia with hemoglobin (Hb), 2.6 g/dl; RBCs, 90 \u00d7 104/mm3; hematocrit (Ht), 6.6%; mean corpuscular volume (MCV), 91.3 fL; mean corpuscular hemoglobin (MCH), 31 pg; mean corpuscular hemoglobin concentration (MCHC), 33 g/dL; reticulocytosis, 239,400/mm3; white blood cells, 40,500/mm3; and platelets, 540,000/mm3. The blood smear did not reveal schistocytes. A DAT identified autoantibodies of the immunoglobulin M (IgM), immunoglobulin A (IgA), immunoglobulin G (IgG) isotypes, and C3d that reacted strongly (3+) at 37 \u00b0C with all tested cells. This confirmed the diagnosis of AIHA.\nBacteriological analysis performed to access the etiology of the fever showed urinary infection (the urine analysis showed leukocytes of 2000/mm3 and erythrocytes of 1000/mm3) with C-reactive protein at 206 mg/L. The urine culture was negative because the child had already received amoxicillin. Then, antibiotherapy was continued with intravenously administered cefotaxime and amikacin. For AIHA, she had intravenously administered immunoglobulin (IVIG) at a dose of 1 g/kg per day twice during 48 hours. She also received repetitive RBCs transfusion. After controlling the infectious process, she was given a high-dose pulse of methylprednisolone (30 mg/kg per day for 3 days) followed by orally administered prednisone at a dose of 2 mg/kg per day. Due to the persistence of altered neurological status and severe hemolysis, she was again given IVIG and high-dose pulse methylprednisolone but without any benefit. Therefore, it was urgent to use a second-line therapy. In view of severe life-threatening hemolysis and her age, rituximab was deemed a better option than plasmapheresis, splenectomy, and/or cytotoxic drugs. Rituximab was given at a dose of 375 mg/m2 per week for 4 weeks. Afterward, prednisone was continued. After the second dose of rituximab our patient no longer required blood transfusions and there was a slow rise in her Hb level until day 15 at which point it stabilized . At the last out-patient follow up (4 months after her hospitalization), her Hb and hemolytic markers were still within a normal range: Hb, 13 g/dl; RBCs, 4.31 \u00d7 106/mm3; Ht, 37.5%; and reticulocytosis of 69,000/mm3. Biological investigations (serological tests, antinuclear antibodies screening, and immunity exploration) done to search for an underlying condition such as infection, lupus, or immune deficiency disease were all negative.", "summary": "Here, we report the case of a 10-year-old Tunisian girl with refractory acute autoimmune hemolytic anemia caused by warm-reactive immunoglobulin A, immunoglobulin G, immunoglobulin M, and C3d autoantibodies. First-line treatments using corticosteroids and intravenously administered immunoglobulin were ineffective in controlling her severe disease. On the other hand, she was successfully treated with rituximab. In fact, her hemolytic anemia improved rapidly and no adverse effects were observed.", "subclaim_evaluations": [ { "subclaim": "The patient is a 10-year-old Tunisian girl.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has refractory acute autoimmune hemolytic anemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anemia was caused by warm-reactive immunoglobulin A autoantibodies.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anemia was caused by warm-reactive immunoglobulin G autoantibodies.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anemia was caused by warm-reactive immunoglobulin M autoantibodies.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anemia was caused by warm-reactive C3d autoantibodies.", "support_label": "supported", "is_refined": false }, { "subclaim": "First-line treatment included corticosteroids.", "support_label": "supported", "is_refined": false }, { "subclaim": "First-line treatment included intravenously administered immunoglobulin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The first-line treatments were ineffective in controlling her severe disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with rituximab.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her hemolytic anemia improved rapidly.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "No adverse effects were observed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_1993_en.txt", "fulltext": "A 14-year-old girl had pain in the left epigastrium for more than 10 d, with no tarry stool, hematemesis, or coma history. She normally liked squatting, and her activity tolerance was low. She was normally developed without positive signs.\nThe results of laboratory examinations were as follows: routine blood examination: red blood cell 4.64 \u00d7 109/L, white blood cell 4.83 \u00d7 109/L, blood platelet 218 \u00d7 109/L; blood biochemistry: alanine aminotransferase 36.9 \u03bc/L, aspartate aminotransferase 30.6 \u03bc/L, serum albumin 41.9 g/L, total bilirubin 21.7 \u03bcmol/L, direct bilirubin 8.0 \u03bcmol/L, PT 12.8 s, international normalized ratio 1.13. Blood ammonia 22.4 \u03bcmol/L, lactic acid 3.28 mmol/L. No abnormality was observed in arterial blood gas parameters at resting state.\nCT suggested congenital extrahepatic portacaval diversion (Type Ib Abernethy deformation). The superior mesenteric vein and splenic vein joined to form a short extra-hepatic portal vein that drained into a postcava with left hepatic vein, associated with double pulmonary congestion and pulmonary arterial hypertension. There were multiple space-occupying lesions in the liver, and the size of the relatively large tumor was approximately 50 mm. To exclude malignant tumor transformation, positron emission tomography-CT examination was performed . The results indicated nodules and mass imaging with multiple increased glycometabolism in the liver parenchyma and increased 11C-choline metabolism in some lesions. Multiple focal nodular hyperplasia combined with partial malignant transformation was highly possible. Echocardiography suggested the mean pressure of pulmonary artery at 36 mmHg and light pulmonary arterial hypertension. Pulmonary function examination indicated severe diffusion impairment.", "summary": "The patient was a 14-year-old girl, diagnosed preoperatively as type Ib Abernethy deformation, intrahepatic multiple space-occupying lesion, and hepatopulmonary syndrome. The patient recovered well after undergoing classic orthotopic liver transplantation. Liver function, pulmonary function, and portal vein computed tomography angiography imaging were reexamined 20 mo postoperatively, and no abnormality was observed.", "subclaim_evaluations": [ { "subclaim": "The patient was a 14-year-old girl.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed preoperatively as type Ib Abernethy deformation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had intrahepatic multiple space-occupying lesions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hepatopulmonary syndrome.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient underwent classic orthotopic liver transplantation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient recovered well after the liver transplantation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Liver function was reexamined 20 months postoperatively.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Pulmonary function was reexamined 20 months postoperatively.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Portal vein computed tomography angiography imaging was reexamined 20 months postoperatively.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "No abnormality was observed in the 20-month postoperative reexaminations.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2831_en.txt", "fulltext": "A 44-year-old woman had undergone first allogeneic cord blood transplantation (CBT, 2.35 \u00d7 106/kg nucleated cells, two locus mismatch) for acute myeloid leukemia after two courses of induction therapy that led to hematologic complete remission. The patient was pre-treated with cytarabine, cyclophosphamide, and total body irradiation conditioning. Graft-versus-host disease prophylaxis consisted of cyclosporine and methotrexate. Her medical, family, and social histories were unremarkable. The patient underwent a second CBT (2.0 \u00d7 107/kg nucleated cells) 32 days after the first due to graft failure.\nSeven days after the second CBT, she presented with high fever and shaking chills. Upon physical examination, painful induration with linear erythema along the superficial veins was observed in the peripherally inserted central catheter (PICC) site, which was inserted on the day after the second CBT. Two sets of blood samples were drawn for culture and meropenem treatment was started. The blood culture was positive on the third day of incubation (10 days after the second CBT). Gram staining of a positive blood culture revealed GPR , and vancomycin was added thereafter. Fever persisted and PICC was removed on day 11 after the second CBT (PICC was maintained for 10 days). The VITEK\u00ae 2 system (bioM\u00e9rieux, Durham, NC, USA) was not able to identify the organism. Blood cultures drawn on days 10, 11, 15, and 22 after CBT were also positive for GPR. On the 14th day after the second CBT, Ziehl\u2013Neelsen staining was performed and was found to be positive for acid-fast bacilli .\nThe nucleotide sequences were analyzed using the National Center for Biotechnology Information BLAST . The almost full-length (1442-bp) 16S rDNA gene sequence of the isolate shared 100% similarity to M. wolinskyi type strain ATCC 700010.\nIn addition to PICC removal, imipenem/cilastatin (IPM/CS), amikacin (AMK), levofloxacin (LVX), and azithromycin (AZM) were started empirically. Antibiotic susceptibilities were determined using the broth microdilution method (BrothMIC RGM\u00ae; Kyokuto, Tokyo, Japan) based on the Clinical and Laboratory Standards Institute M24 recommendations .\nAccording to the susceptibilities, IPM/CS and AZM were discontinued, and minocycline (MIN) was added. LVX was changed to moxifloxacin (MFX) based on previous case series . After 1 month of intravenous administration of AMK, the patient was discharged on an oral regimen of MFX and MIN. Although MXF had to be discontinued after 4 months due to nausea, MIN was continued for 6 months.\nAfter 3 weeks of combination antimicrobial therapy, blood cultures became negative. She showed successful engraftment by day 28. The patient responded well to therapy and no recurrence of infection was identified at 1-year follow-up.", "summary": "We present a case of CRBSI caused by Mycobacterium wolinskyi, a rare RGM, in a 44-year-old female patient who received an umbilical cord blood transplant.", "subclaim_evaluations": [ { "subclaim": "The case involves a 44-year-old female patient.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received an umbilical cord blood transplant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed a catheter-related bloodstream infection (CRBSI).", "support_label": "supported", "is_refined": false }, { "subclaim": "The infection was caused by Mycobacterium wolinskyi.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mycobacterium wolinskyi is a rare rapidly growing mycobacterium (RGM).", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_2546_en.txt", "fulltext": "A 73-year-old woman with pancreatic head adenocarcinoma underwent pancreatoduodenectomy (PD) at the Division of Hepato-Biliary-Pancreatic Surgery, Shizuoka Cancer Center Hospital, Shizuoka, Japan, in July 2005. The patient\u2019s height, body weight, and body mass index were 154 cm, 56 kg, and 23.6 kg/m2, respectively. The patient was discharged 40 days postoperatively; however, approximately 1 month after discharge, she visited the hospital\u2019s Division of Dentistry and Oral Surgery with a chief complaint of tongue pain with dysgeusia. The first examination revealed glossitis characterized by complete atrophy of the lingual papillae, which became erythematous; this is a symptom of glossitis . Furthermore, remarkable taste disorder (hypogeusia) and oral pain were reported. The angle of the mouth had stomatitis with erosive changes. The extremities showed acrodermatitis enteropathica-like eruption and abnormal keratinization . Blood test results showed hypoproteinemia and hypoalbuminemia (total protein (TP) 5.1 g/dL, albumin (ALB) 2.4 g/dL) . Examination of trace elements showed remarkably lower serum zinc and copper levels (30 \u03bcg/dL and 40 \u03bcg/dL, respectively) . We diagnosed malnutrition, dysgeusia, glossitis, angular cheilitis, and acrodermatitis enteropathica due to zinc deficiency. However, she had no obvious frequent diarrhea or steatorrhea.\nInitially, we orally administered 150 mg of Promac\u00ae granules 15% (polaprezinc, ZERIA Pharmaceutical Co., Ltd, Japan) per day (total zinc dose, 34 mg/day) to treat the zinc deficiency. However, due to the insufficient effectiveness of the replacement therapy, we additionally administered multi-trace elements (MTEs) for high-calorie infusions. Elemenmic\u00ae (Ajinomoto Co Inc, Japan) was administered intravenously, one ampule of which contained elemental iron (Fe) 35 \u03bcmol, manganese (Mn) 1 \u03bcmol, zinc (Zn) 60 \u03bcmol (= 4 mg), copper (Cu) 5 \u03bcmol, and iodine (I) 1 \u03bcmol; this was administered twice a week for 2 weeks as an outpatient treatment. However, the intravenous replacement therapy was similarly inadequate at this dosing interval and did not provide sufficient improvement in the serum copper and zinc values. The blood test results 4 months after PD were as follows: TP, 4.4 g/dL; ALB, 2.0 g/dL; Zn, 34 \u03bcg/dL; and Cu, 28 \u03bcg/dL; the patient required nutritional management during hospitalization with total parenteral nutrition (TPN) . An improvement was observed in the zinc level (99 \u03bcg/dL) and copper level (204 \u03bcg/dL) after 20 days of administering one ampule of Elemenmic\u00ae per day. Concurrently, her tongue pain and dysgeusia gradually improved. Because of a similar improvement in her nutritional status, she completed TPN (TP 5.1 g/dL, ALB 2.5 g/dL, Zn 99 \u03bcg/dL, Cu 204 \u03bcg/dL). A central venous catheter (CVC) inserted after admission was removed, and she was discharged 20 days after the second admission. On this occasion, intravenous zinc replacement therapy was discontinued.\nOne month after discharge, the serum zinc level decreased sharply, her oral pain increased again, and she had reduced food intake (Zn 35 \u03bcg/dL, Cu 44 \u03bcg/dL) . The patient was readmitted at the end of December 2005. To improve malnutrition, a CVC was re-inserted through the external jugular vein and injected with the MTE formulation and high-calorie infusions on consecutive days for 4 weeks (TP 5.9 g/dL, ALB 3.4 g/dL, Zn 75 \u03bcg/dL, Cu 47 \u03bcg/dL). In January 2006, since her oral pain and diet had improved, she was discharged from the hospital after receiving an implant of a central venous port, and she continued home self-injection of MTEs to maintain zinc levels. In February 2006, her taste function tended to improve, and in April 2006, the taste almost improved. When MTEs were self-injected daily, the serum zinc level gradually exceeded the normal range and reached 167 \u03bcg/dL in August 2006 ; therefore, the administration was switched to every other day. Subsequently, we had to confirm the blood test data repeatedly to monitor serum zinc levels to ensure that they were within the normal range . Despite continuing intravenous zinc replacement therapy, serum zinc levels decreased when additional oral zinc was discontinued in May 2007. After resuming the oral administration of Promac\u00ae due to the recurrence of dysgeusia, both the serum zinc level and dysgeusia improved. Since 2008, Pancreatin\u00ae (pancreatic enzyme, Mylan Co Inc, USA) 3 g/day had been administered alongside conventional zinc administration for this patient .\nAs of January 2012, she continued using MTEs intermittently while her serum zinc values were monitored; however, slight angular cheilitis was observed, and she exhibited no signs of glossitis and dysgeusia . Moreover, recurrence and metastasis of the primary tumor were not observed. She subsequently died of lung cancer in May 2020.", "summary": "A 73-year-old woman with glossitis, taste disorder, and acrodermatitis enteropathica-like eruption on her fingers presented to the Division of Dentistry and Oral Surgery 69\u00a0days after PD. Her serum zinc level markedly decreased to 30\u00a0\u03bcg/dL. Oral zinc administration was inadequate to treat hypozincemia after PD; therefore, multi-trace elements were injected intravenously during readmission. Her serum zinc levels recovered, and her lesions gradually improved. Furthermore, a central venous port was implanted to maintain normal serum zinc levels, and she continued self-injecting zinc at home.", "subclaim_evaluations": [ { "subclaim": "The patient is a 73-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had glossitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a taste disorder.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had an acrodermatitis enteropathica-like eruption on her fingers.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented to the Division of Dentistry and Oral Surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented 69 days after PD.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her serum zinc level was 30 \u03bcg/dL.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oral zinc administration was inadequate to treat hypozincemia after PD.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multi-trace elements were injected intravenously during readmission.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her serum zinc levels recovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her lesions gradually improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "A central venous port was implanted.", "support_label": "supported", "is_refined": false }, { "subclaim": "She continued self-injecting zinc at home.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_884_en.txt", "fulltext": "An 83-year-old Taiwanese woman found a palpable mass in her right breast for 1 year. The lesion was approximately 1cm in greatest dimension last year and had got larger in the past 6 months. She had a history of type AB thymoma and was treated with complete tumor resection 10 years ago. The thymoma was 15cm in greatest dimension, encapsulated with focal pericardial adhesion and without pericapsular invasion . A mammography revealed a well-defined hypoechoic oval mass in 10 o'clock direction and 3.0cm away from her nipple, occupying the whole thickness of her breast, and measuring 4.0\u00d73.2\u00d72.6cm in size . A tumor excision was performed.\nThe specimen consisted of a piece of breast tissue partially occupied by an oval encapsulated mass that measured 5.0\u00d73.8\u00d73.5cm in size, with focal artificial disruption. The cut surface of the tumor was tan red and the focal was light yellowish. The tumor consistency was soft and fragile. On microscopic examination, the well-encapsulated tumor was composed of neoplastic cells arranged in solid sheets, vague fascicles or ribbons and few rosettes without lumen, and admixed with variable amounts of lymphocytes . The neoplastic cells set in the lymphocyte-rich background were oval, polygonal or short fusiform, and had small round-to-oval nuclei with inconspicuous nucleoli . The spindle tumor cells were mainly seen in the lymphocyte-poor area. The two groups of neoplastic cells either separated with a discrete border or were intermixed together. Mild nuclear atypia was occasionally seen. Mitoses were scanty. Some aggregates of histiocytes and few dilating and mildly branching thin-walled vessels were also found. The neoplastic cells were diffusely positive for cytokeratin , partially positive for vimentin and smooth muscle actin, mostly positive for p63, and focally immunoreactive with epithelial membrane antigen. A few tumor cells were also positive for CD20 . Some spindle neoplastic cells were surrounded by collagen IV deposition. The tumor cells were negative for CD21 and CD34. The lymphocytes were positive for CD3, CD5, CD1a, and CD99 . Few scattered individual and small groups of interdigitating reticulum cells were seen by S-100 protein staining. From these features and past history, we diagnosed this tumor as a metastatic type AB thymoma to the breast.", "summary": "We describe an 83-year-old Taiwanese woman with a metastatic thymoma to the breast 10 years after complete resection of noninvasive and encapsulated primary tumor, and analyze the possible factors to explain the recurrence and metastasis of the stage I thymomas.", "subclaim_evaluations": [ { "subclaim": "The patient is an 83-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is of Taiwanese ethnicity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a primary thymoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The primary thymoma was noninvasive.", "support_label": "supported", "is_refined": false }, { "subclaim": "The primary thymoma was encapsulated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The primary thymoma was completely resected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The metastasis occurred 10 years after the primary tumor resection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thymoma metastasized to the breast.", "support_label": "supported", "is_refined": false }, { "subclaim": "The primary tumor was stage I.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The case analyzes possible factors for the recurrence and metastasis of stage I thymomas.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 2 }, { "id": "multiclinsum_test_2202_en.txt", "fulltext": "A healthy 79-year-old Caucasian woman was referred to our hospital with a diagnosis of stage III immunoglobulin A-lambda MM with numerous osteolytic areas (bilateral iliac wings, T3 to T4) and cardiologic symptoms of pulmonary embolism. Computed tomography (CT) of her chest documented the presence of a right atrial mass (42mm \u00d7 53mm), confirmed by subsequent magnetic resonance imaging (MRI) and fluorine-18-fluorodeoxyglucose positron emission tomography (F18-FDG PET). A transesophageal echocardiogram revealed a large pericardial effusion with evidence of cardiac tamponade and a large right atrial mass encasing her interatrial septum and extending into her left atrium. Histologic specimens of a bone marrow biopsy demonstrated the presence of tiny aggregates of atypical plasma cells with asynchronous morphology, positive for cluster of differentiation 138.\nOur patient was treated with four cycles of bortezomib, four cycles of melphalan and prednisone and another four cycles of bortezomib, achieving a lessening of the symptoms and a stability of the cardiac disease. Pharmacological toxicity was not significant.\nNine months later, our patient developed a painful bone relapse. The pain was severe, constant and localized primarily in her sacrum and the right iliac wing. The pain increased to some extent with movement. Our patient received local radiotherapy on both sites (2000cGy/5 fractions), achieving a reduction in symptoms and an improvement of her performance status.\nOne year after the initial diagnosis, our patient presented to our emergency department because of the new appearance of signs and symptoms of congestive heart failure: dyspnea, hypotension, cyanosis and facial edema.\nCT of her chest revealed an increase in the size of the mass (78mm \u00d7 84mm), which appeared to infiltrate her right pulmonary vein and superior vena cava for approximately 21mm, causing neoplastic thrombosis of her right subclavian vein . These findings were confirmed by echocardiography and F18-FDG PET .\nRestaging examinations documented stable bone disease.\nOur patient was evaluated by a surgeon for possible surgery on her right atrium, but she was considered inoperable due to the extent of the disease. The diagnosis of atrial localization of malignant plasmacytoma was confirmed via examination of a biopsy specimen. In order to obtain rapid control of the intracardiac disease, radiation to the cardiac mass was started.\nExternal-beam radiation, totaling 3000cGy in 10 daily fractions of 300cGy, each with 6mV photons, was delivered using the intensity modulated radiation therapy (IMRT) technique.\nOur patient was immobilized in the supine position with a wing board and target localization was accomplished using CT simulation. The volumes of interest were identified on each axial CT slice. The gross tumor volume was defined as the gross extent of the tumor shown by imaging (CT, MRI and PET); the clinical target volume was defined as the gross tumor volume plus a margin for potential microscopic spread (5mm); and, in order to account for organ motion and patient setup errors, the planning target volume was defined by adding a 1 cm margin to the clinical target volume. Treatment planning was performed using an inverse planning algorithm in a tomotherapy planning system and our patient was treated with an IMRT delivered with tomotherapy.\nThe treatment was generally well tolerated; our patient showed no symptoms suggestive of radiation-induced toxicity. Her symptoms immediately improved with a decrease in generalized edema and improved performance status. A transesophageal echocardiogram performed three weeks from the end of the radiotherapy confirmed a significant decrease in tumor size in her right atrium.\nDue to our patient\u2019s age and good condition, the medical staff chose a \u2018wait and see\u2019 approach. Three months later, repeat chest and abdominal CT scans showed complete remission of the cardiac disease, but progressive bone disease.\nThe worsening of the general conditions of our patient, due to other causes, meant that she was subjected to supportive care for two months. After the improvement of her health status, our patient started maintenance chemotherapy with lenalidomide and she is currently tolerating it well.\nIn a new CT scan of her chest done eighteen months after the end of the radiotherapy , complete remission of the cardiac disease was confirmed.\nCurrently, our patient is generally in good condition and shows no significant cardiac symptoms. Recently performed chest and abdominal CT documented stability of the disease in known locations, but highlighted the emergence of an axillary mass, for which we are programming a new radiation treatment in view of her good response to previous radiotherapy.", "summary": "A 79-year-old Caucasian woman was treated at our hospital for right atrial myeloma localization. Our patient showed the following signs and symptoms of congestive heart failure: dyspnea, hypotension, cyanosis and facial edema. Surgery was not considered feasible due to the extent of the disease. Our patient underwent external-beam radiation therapy using an intensity modulated technique, thus obtaining a persistent complete remission. Our patient has been in continuous complete local remission for 25 months since the end of radiotherapy.", "subclaim_evaluations": [ { "subclaim": "The patient is a 79-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had right atrial myeloma localization.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypotension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cyanosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had facial edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgery was not considered feasible.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent external-beam radiation therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The radiation therapy used an intensity modulated technique.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient achieved a persistent complete remission.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient has been in continuous complete local remission for 25 months.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_3049_en.txt", "fulltext": "A 59 year old Chinese woman underwent routine mammographic screening that revealed scattered areas of fibroglandular densities with microcalcifications developing in the lower inner quadrant of the left breast and prominent lymph nodes. Magnification mammographic views of the left breast demonstrated amorphous heterogeneous calcifications in a segmental distribution, spanning an area approximately 70 mm in maximal anterior\u2013posterior dimension. No associated mass was identified on mammography or ultrasound. A 14 gauge (G) ultrasound-guided, spring-loaded core biopsy of the left breast lesion revealed low-to-intermediate grade ductal carcinoma in situ (DCIS) (with associated microcalcifications).\n\nThe patient was gravida 3 para 3, postmenopausal approximately 1 year previously, with no family history of breast cancer and in good health. She had no history of malignancy and was a lifetime nonsmoker.\n\nUltrasound of the left axilla showed normal morphology level I lymph nodes and one to two abnormal level II lymph nodes with focally increased cortical thickness measuring up to 5 mm and an eccentrically displaced and partially flattened fatty hilum. This clinical scenario raised the question of why this patient had enlarged nodes in the apparent presence of only DCIS.\n\nIn addition, 10 months prior to presentation, she had acute upper respiratory tract symptoms consistent with a viral illness, with a negative nasopharyngeal swab reverse transcription polymerase chain reaction test for severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2). This patient had sought medical attention after she detected swelling in her left supraclavicular fossa 7 months earlier. In addition, 7 days prior to presenting with left supraclavicular fossa swelling, she had received the first dose of the Pfizer COVID-19 vaccine in the left deltoid muscle. Just prior to her vaccination, serologic testing for total antibodies to SARS-CoV-2 nucleocapsid and spike proteins were negative.\n\nPhysical examination at the time of her presentation revealed a cluster of three soft nontender lymph nodes in the left supraclavicular fossa, each approximately 1\u20131.5 cm in diameter. There was no detectable cervical or axillary lymphadenopathy. Breast exam was normal, with no palpable masses. A chest X-ray revealed no abnormalities. The enlarged lymph nodes were attributed to the COVID-19 vaccine. Over the next 4 weeks, the left supraclavicular lymph nodes decreased in size and became barely palpable.\n\nInitial ultrasound-guided 25G and 22G fine needle aspiration of the level II axillary lymph node yielded insufficient lymphoid sample and was unsatisfactory for evaluation.\n\nDynamic contrast enhanced magnetic resonance imaging (MRI) was performed to further assess the breasts and lymph nodes. There was corresponding focally increased non-mass enhancement at the site of the left breast biopsy proving DCIS but no MRI evidence of grossly invasive disease. In the left axilla, there was an enhancing mass measuring 1.3 cm in diameter, deep to the pectoralis major muscle. An ultrasound-guided core biopsy of this mass was performed. Pathology revealed lymphoid tissue with interfollicular areas containing small lymphocytes, plasma cells, and rare eosinophils. No aberrant expression of CD20, CD3, BCL2, BCL6, kappa, lambda, or AE1/AE3 was identified. These histologic findings and the immunophenotype were consistent with lymphoid hyperplasia.\n\nLymphadenopathy can be caused by various etiologies, including malignancies, infections, autoimmune disorders, or miscellaneous conditions such as certain medications, foreign bodies, or vaccinations. In this case, many etiologies could be eliminated from consideration on the basis of the patient\u2019s history, physical exam, and investigations. The patient had no known infections and no findings suggestive of an infection. She had no history of or symptoms suggestive of an autoimmune disorder. The patient was only taking hormone replacement therapy, steroid inhaler, and chronic antihypertensive medications in the 7-month period between vaccination and diagnosis of DCIS, none of which are associated with lymphadenopathy. There was no history of any implanted device or foreign body. After reviewing imaging and pathology, the clinical team concluded that the enlarged left axillary lymph nodes with reactive histology were not due to a malignancy or benign tumor. Thus the team determined by diagnosis of exclusion that the lymphadenopathy was most likely due to the prior ipsilateral upper extremity COVID-19 vaccine administration.\n\nBecause of the extent of the DCIS, the final recommendation was to do a total mastectomy of the left breast with sentinel node removal and immediate reconstruction with a deep inferior epigastric artery perforator (DIEP) flap.\n\nSurgical pathology revealed multifocal intermediate grade DCIS that was positive for estrogen receptor protein and progesterone receptor protein, with the largest area spanning 59 mm on histology. The left axilla sentinel lymph node was negative for malignancy. The patient had an uneventful recovery and received no additional treatment.", "summary": "A 59 year old Chinese woman underwent routine mammographic screening that revealed scattered areas of fibroglandular densities in the lower-inner quadrant of the left breast and abnormal lymph nodes. A core biopsy of the breast identified ductal carcinoma in situ. A biopsy of the lymph nodes was performed, and histological findings and immunophenotype were consistent with lymphoid hyperplasia. This patient had sought medical attention after she detected swelling in her left supraclavicular fossa 7 months earlier. She had received the first dose of the Pfizer coronavirus disease-2019 vaccine in the left deltoid muscle 7 days prior to presenting with left supraclavicular fossa swelling.", "subclaim_evaluations": [ { "subclaim": "The patient is a 59 year old Chinese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent routine mammographic screening.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mammography revealed scattered areas of fibroglandular densities in the lower-inner quadrant of the left breast.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mammography revealed abnormal lymph nodes.", "support_label": "supported", "is_refined": false }, { "subclaim": "A core biopsy of the breast identified ductal carcinoma in situ.", "support_label": "supported", "is_refined": false }, { "subclaim": "A biopsy of the lymph nodes was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histological findings of the lymph nodes were consistent with lymphoid hyperplasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had sought medical attention after she detected swelling in her left supraclavicular fossa 7 months earlier.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had received the first dose of the Pfizer coronavirus disease-2019 vaccine in the left deltoid muscle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vaccine was administered 7 days prior to presenting with left supraclavicular fossa swelling.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_965_en.txt", "fulltext": "A 52-year-old man arrived at the emergency department with a chief complaint of right-sided weakness since 3 h. He had a history of hypertension. Neurological examination revealed right-sided hemiparesis (manual muscle test grade of 3 in the right arm and 4 in the right leg; grade 0 meaning no strength, grade 5 full strength) and hypoesthesia. The National Institutes of Health Stroke Scale score was 4. His blood pressure was 166/109 mm Hg. To avoid delaying thrombolysis, we first chose non-contrast CT to exclude intracranial hemorrhage. Initial head CT revealed no intracranial hemorrhage and no early ischemic changes and an old lacunar cerebral infarction in the left putamen . The prothrombin time/international normalized ratio and the activated partial thromboplastin time were normal. Intravenous treatment with tenecteplase of 16 mg (0.25 mg/kg) was started 3.8 h after stroke onset. CTA of the head and neck was performed using 50 ml of intravenous iopamidol-370 and flow rate of 4.0 ml/s 0.5 h after IVT. The CTA showed bilateral mild to moderate atherosclerosis of the carotid and fenestration of the left proximal middle cerebral artery without any hemodynamically significant stenosis or occlusion of the carotid and major intracranial arteries . Then, he was transferred to the stroke unit for further evaluation.\nAt about 1.5 h after CTA, the right-sided hemiparesis deteriorated with a manual muscle test grade of 1 in the right arm and 2 in the right leg, accompanied by drowsiness, aphasia, and urinary incontinence. Immediate head CT showed hyperdense lesions with mild space-occupying effect in the left basal ganglia and both lateral ventricles, which.\nhad a mean Hounsfield unit (HU) of 55 (range from 24 HU to 79 HU) . He was transferred to our department for further treatment. The follow-up CT after 5 h showed that the hyperdensity in the left basal ganglia and lateral ventricles was reduced in size. A mild hyperdensity of the right posterior insular cortex was found . Two days later, CT showed that the hyperdense lesions in the lateral ventricles had almost completely disappeared and only a small amount remained in the basal ganglia and insular, without obvious surrounding edema and mass effect . The hyperdensity in the right posterior insular cortex remained, probably representing a mild HT . Only some scattered small petechiae could be seen in the left infarcted area on CT eight days after intravenous thrombolytic treatment . The patient was improving with physical, occupational and speech therapies during hospitalization and was eventually discharged to a rehabilitation center.", "summary": "A 52-year-old man presented with right-sided hemiparesis and hypoesthesia. Initial non-contrast head CT was negative for intracranial hemorrhage and acute ischemic changes. He received intravenous treatment with tenecteplase 3.8\u00a0h after the onset of stroke. CTA of the head and neck was performed at 4.3\u00a0h after stroke onset. It showed no stenosis or occlusion of the carotid and major intracranial arteries. At about 1.5\u00a0h after CTA, the right-sided hemiparesis deteriorated, accompanied by drowsiness, aphasia, and urinary incontinence. Immediate head CT showed hyperdense lesions with mild space-occupying effect in the left basal ganglia and both lateral ventricles. The hyperdense lesions were reduced in size on follow-up CT after 5\u00a0h. Two days later, CT showed that the hyperdense lesions in the lateral ventricles almost completely disappeared and only a small amount remained in the infarcted area.", "subclaim_evaluations": [ { "subclaim": "The patient is a 52-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with right-sided hemiparesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had right-sided hypoesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial non-contrast head CT was negative for intracranial hemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial non-contrast head CT was negative for acute ischemic changes.", "support_label": "supported", "is_refined": false }, { "subclaim": "He received intravenous tenecteplase.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tenecteplase was administered 3.8 hours after stroke onset.", "support_label": "supported", "is_refined": false }, { "subclaim": "CTA of the head and neck was performed 4.3 hours after stroke onset.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "CTA showed no stenosis of the carotid arteries.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "CTA showed no occlusion of the major intracranial arteries.", "support_label": "supported", "is_refined": false }, { "subclaim": "Right-sided hemiparesis deteriorated 1.5 hours after CTA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Drowsiness occurred 1.5 hours after CTA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Aphasia occurred 1.5 hours after CTA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Urinary incontinence occurred 1.5 hours after CTA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immediate head CT showed hyperdense lesions in the left basal ganglia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immediate head CT showed hyperdense lesions in both lateral ventricles.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hyperdense lesions had a mild space-occupying effect.", "support_label": "supported", "is_refined": false }, { "subclaim": "Follow-up CT after 5 hours showed reduced size of the hyperdense lesions.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two days later, CT showed the hyperdense lesions in the lateral ventricles almost completely disappeared.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two days later, CT showed a small amount of hyperdense lesion remained in the infarcted area.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2111_en.txt", "fulltext": "A 67-year-old man presented with a 2-wk history of progressively worsening polyarthralgia and nail dystrophy.\nThe patient was diagnosed with advanced gastric adenocarcinoma with distant lymph nodes (LNs) metastases was referred to our department in March 2020. Esophagogastroduodenoscopy revealed a 3-cm sized ulcerofungating mass in the pre-pyloric antrum. Histopathological examination of the endoscopic biopsy specimen revealed moderately differentiated adenocarcinoma, negative results for human epidermal growth factor receptor 2 (immunohistochemistry 1+), Epstein-Barr virus, and deficient DNA mismatch repair (dMMR) (retained nuclear expression of MSH2 and MSH6 and loss of MLH-1 and PMS-1). Abdominal computed tomography showed multiple enlarged LNs in the para-aortic and aortocaval areas. The patient was treated with capecitabine and oxaliplatin as the first-line palliative chemotherapy for 11 mo, followed by ramucirumab and paclitaxel as second-line palliative chemotherapy. After 2 mo of treatment with ramucirumab and paclitaxel, the tumor response indicated progressive disease. In June 2021, pembrolizumab (200 mg in a 3-wk cycle) was initiated as third-line palliative chemotherapy, given that the tumors showed dMMR.\nHe had a history of foot psoriasis, which was well controlled without treatment.\nHe had no personal and family history.\nThe patient was afebrile with stable vital signs. Physical examination revealed erythematous swelling in the distal interphalangeal joints, left shoulder, and both knees . He had plaque psoriasis with psoriatic nail dystrophy and dactylitis in the distal joints of the fingers and toes .\nBefore pembrolizumab administration, the neutrophil-to-lymphocyte ratio (NLR, absolute neutrophil count divided by absolute lymphocyte count) and prognostic nutritional index (PNI, 10 \u00d7 serum albumin value, g/dL + 0.005 \u00d7 total lymphocyte count/mm3) were 1.1 and 50.5, respectively. Two months after the initiation of pembrolizumab, laboratory testing revealed a normal white blood cell count of 7970/\u00b5L with 72.6% neutrophils and 17.9% lymphocytes, an elevated erythrocyte sedimentation rate (ESR) of 89.0 mm/h, and a serum high-sensitivity C-reactive protein (hs-CRP) level of 2.3 mg/L. Immunological serum tests were negative for rheumatoid factor (RF) and anticyclic citrullinated peptide antibody. Synovial fluid analysis of knee joint revealed a yellow appearance, decreased viscosity, and a cell count of 26,678 cells/mm3 with 81.2% neutrophils, indicating inflammatory arthritis. Gram staining was negative, no crystals were detected by microscopy, and cultures for common pathogens and mycobacteria were negative.\nMagnetic resonance imaging of the right knee and left shoulder showed joint effusion and synovial enhancement.", "summary": "The patient was a 67-year-old man with a history of well-controlled foot psoriasis who presented with polyarthralgia. He had received pembrolizumab for metastatic gastric adenocarcinoma 2 mo previously. Physical examination revealed erythematous swelling in the distal interphalangeal joints, left shoulder, and both knees. He had plaque psoriasis with psoriatic nail dystrophy and dactylitis in the distal joints of the fingers and toes. Inflammatory markers including C-reactive protein and erythrocyte sedimentation rate were elevated but rheumatoid factor and anticyclic citrullinated peptide antibody were negative. The patient was diagnosed with psoriatic arthritis (PsA) and started on methylprednisolone 1 mg/kg/day after pembrolizumab discontinuation. However, despite 1 wk of methylprednisolone treatment, PsA worsened; hence, leflunomide and methotrexate were started. After 4 wk of steroid treatment, PsA worsened and improved repeatedly with steroid tapering. Therefore, the therapy was intensified to include etanercept, a tumor necrosis factor inhibitor, which ultimately resulted in adequate PsA control.", "subclaim_evaluations": [ { "subclaim": "The patient was a 67-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a history of well-controlled foot psoriasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with polyarthralgia.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had received pembrolizumab for metastatic gastric adenocarcinoma 2 months previously.", "support_label": "supported", "is_refined": false }, { "subclaim": "Physical examination revealed erythematous swelling in the distal interphalangeal joints.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had plaque psoriasis with psoriatic nail dystrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had dactylitis in the distal joints of the fingers and toes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Inflammatory markers including C-reactive protein and erythrocyte sedimentation rate were elevated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Rheumatoid factor was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anticyclic citrullinated peptide antibody was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with psoriatic arthritis.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was started on methylprednisolone 1 mg/kg/day after pembrolizumab discontinuation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Despite 1 week of methylprednisolone treatment, psoriatic arthritis worsened.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Leflunomide and methotrexate were started.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After 4 weeks of steroid treatment, psoriatic arthritis worsened and improved repeatedly with steroid tapering.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The therapy was intensified to include etanercept, a tumor necrosis factor inhibitor.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Etanercept ultimately resulted in adequate psoriatic arthritis control.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1066_en.txt", "fulltext": "We report the case of a 37-year-old man with a 6-month history of headaches and blurred vision. Our patient had been followed by an otorhinolaryngologist for 2 years for cervical lymphadenopathy and a right submandibular swelling. The cervical lymphadenopathy biopsy was non-diagnostic twice, showing a non-specific inflammatory disease. He had no other medical background and no personal or familiar history of an autoimmune disease.\nOn examination, he had significant swelling of the right hemi face and the neck with trismus and a decrease in the visual acuity of the right eye. The dilated fundus examination showed a right papillary paleness.\nPeripheral blood markers of inflammation were elevated. Screening for immunodeficiency and mycobacterial infections was negative.\nCerebral MRI showed a pseudotumoral lesion developing in the right pterygoid-palatine fossa spreading to the orbital and the intracranial cavity through the superior orbital fissure. The intracranial portion forms a temporal extra-axial mass mimicking a meningioma that infiltrates the lateral wall of the cavernous sinus. The lesion was strongly enhanced after the injection of gadolinium . CT scans of the chest, abdomen, and pelvis were normal.\nThe patient was operated through a pterional approach. Our first strategy was a gross total resection of the intracranial portion of the tumor. Regarding its very firm consistency, we opted for a large biopsy of the extra-axial lesion. The tumor was solid, well-delineated, and strongly adherent to the temporal lobe.\nHistological examination showed dense lymphoidplasmacytic infiltrate with storiform fibrosis [ and ]. Immunohistochemical staining revealed an increased number of IgG4-positive plasma cells . The inflammation is often focal, predominantly in a perivascular location.\nOur patient received high doses of corticosteroids (0.6 mg/kg/day) followed by progressive tapering. His neurological manifestations gradually improved and resolved after 2 months. A cerebral MRI was done 1 month after a well-conducted treatment and showed a reduction of the tumor\u2019s size .", "summary": "We present our experience with a biopsy-proven case of IgG4-RD presenting with an intracranial extradural tumor-like mass infiltrating the temporal lobe. The patient was treated with high doses of corticosteroids followed by slow tapering. The neurological manifestations gradually improved and resolved after 2 months with a cerebral MRI showing a significant reduction in the tumoral size.", "subclaim_evaluations": [ { "subclaim": "The case was biopsy-proven IgG4-RD.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had an intracranial extradural tumor-like mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass infiltrated the temporal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with high-dose corticosteroids.", "support_label": "supported", "is_refined": false }, { "subclaim": "Corticosteroids were followed by slow tapering.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neurological manifestations gradually improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neurological manifestations resolved after 2 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "A cerebral MRI showed a significant reduction in the tumoral size.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_461_en.txt", "fulltext": "A 64-year-old Caucasian woman was referred to our office for the assessment of a gigantic left neck mass . The patient reported that she had started to feel a paratracheal node 34 years previously, and that it had grown progressively during the subsequent three decades. She had undergone an operation in the area 24 years previously, although the surgery had to be terminated due to massive bleeding from the mass. During surgery, the mass was diagnosed as most likely a glomus tumor. No further surgeries to remove the mass were attempted, and it had been allowed to grow steadily.\nIn May 2013, the patient was referred elsewhere for further study of the mass. Magnetic resonance imaging (MRI) revealed a hypervascularized mass with a maximum diameter of 4 cm located at the bifurcation of the left carotid artery and causing the forward displacement of the external carotid artery and the backward displacement of the internal carotid artery. The patient refused surgery at that time and remained asymptomatic for almost 3 years. She then decided to consult a physician again due to the enlargement of the mass, which caused discomfort and mild compression symptoms when swallowing.\nIn 2016, angio MRI showed a 9 cm paratracheal mass on the left cervical side that laterally displaced the sternocleidomastoid muscle and 2 cm of the trachea. The mass was pulsatile and slightly painful. No Horner syndrome or Hering\u2013Breuer reflex was noted. A carotid occlusion test and a complete angiography were also performed, and these confirmed the permeability of the Willis polygon and the diagnosis of the mass.\nDue to the change in the behavior of the tumor, which had doubled in size within 3 years after remaining relatively stable for almost three decades, the size of the tumor, which had started causing compression symptoms, and the Shamblin grade II classification, the maxillofacial team at Ruber International Hospital decided to remove the tumor surgically after embolization.\nThe surgery was performed in February 2016. The tumor was approached through a wide cervical exposure after identifying the primitive carotid artery .\nThe tumor was gently dissected from the carotid bifurcation in a subadventitial plane , with great emphasis placed on maintaining hemostasis.\nThe surgeons would like to note that a partially blunt Freer periostotome is the best tool to use in high-risk areas. The vagal nerve was readily identified and separated from the mass. The hypoglossal nerve and major neck vessels were also preserved . The mass was then removed from the bifurcation uneventfully. Two small nodes adhering tightly to the internal carotid adventitia and the posterior torn hole were left in place to avoid any potentially life-threatening complication.\nThe postoperative phase was uneventful, and the patient was discharged 6 days after the surgery with moderate hoarseness, which was resolved within 1 month. The final biopsy confirmed the initial diagnosis of carotid body paraganglioma and showed a Ki-67 expression of 19%.\nDue to the aggressive growth behavior and high Ki-67 expression of the tumor, the patient was referred to the CyberKnife Unit of Ruber International Hospital for treatment of the remaining nodes. A thermoplastic mask was made to ensure that the patient remained immobilized during the treatment. A T2 MRI and computed tomography (CT) with intravenous contrast were performed to locate the above-mentioned remaining nodes of the paraganglioma. The treatment was performed separately in each affected area on two consecutive days. A coverage dose of 14 Gy and an isodose of 83% were administered using 5- and 7.5-mm collimators. The maximum dose used was 16.87 Gy. The medullary canal received a dose of less than 4 Gy, and the left VII and VIII nerves received a dose of less than 5 Gy . The treatment course was uneventful, and no complication occurred during or after treatment.\nAfter a 48-month follow-up period, no lesion recurrence or surgery-related complications have occurred. Some minor scar revision due to the tracheostomy was performed under local anesthesia. The patient is otherwise completely symptom free .", "summary": "We present the case of a 64 year-old Caucasian woman with a gigantic glomic tumor mass in the neck. Twenty\u00a0years before the consultation, the patient had undergone an unsuccessful attempt to remove the mass. Over the last 3\u00a0years, the patient had felt enlargement of the mass at an increased rate, almost doubling the prior size. Angio magnetic resonance imaging showed a 9\u00a0cm paratracheal mass on the left cervical side that laterally displaced the sternocleidomastoid muscle and 2 c\u00a0m of the trachea. Due to the change in the tumor behavior, the maxillofacial team at Ruber International Hospital decided to remove the tumor surgically after embolization. During the surgery the tumor was gently dissected from the carotid an removed from the carotid bifurcation uneventfully. Two small nodes adhering tightly to the internal carotid adventitia and the posterior torn hole were left in place to avoid any potentially life-threatening complications. The final biopsy confirmed the initial diagnosis of carotid body paraganglioma and showed a Ki-67 expression of 19%. Due to the aggressive growth behavior and high Ki-67 expression of the tumor, the patient was referred to the CyberKnife Unit of Ruber International Hospital for treatment of the remaining nodes.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64 year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a gigantic glomic tumor mass in the neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "Twenty years before the consultation, the patient had an unsuccessful attempt to remove the mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "Over the last 3 years, the mass almost doubled in size.", "support_label": "supported", "is_refined": false }, { "subclaim": "Angio magnetic resonance imaging showed a 9 cm paratracheal mass on the left cervical side.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass laterally displaced the sternocleidomastoid muscle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass displaced 2 cm of the trachea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The maxillofacial team decided to remove the tumor surgically after embolization.", "support_label": "supported", "is_refined": false }, { "subclaim": "During surgery, the tumor was dissected from the carotid.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was removed from the carotid bifurcation uneventfully.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two small nodes adhering to the internal carotid adventitia were left in place.", "support_label": "supported", "is_refined": false }, { "subclaim": "The posterior torn hole was left in place.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final biopsy confirmed the diagnosis of carotid body paraganglioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor showed a Ki-67 expression of 19%.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was referred to the CyberKnife Unit for treatment of the remaining nodes.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1611_en.txt", "fulltext": "A 63-year-old female patient with a medical history of type 2 diabetes, hypertension, and hyperlipidemia visited our hospital complaining of chest, waist, and back pain radiating to both groin for 15 days. It aggravated on bending over, but there was on obvious cause. No nausea, vomiting, diarrhea, or discomfort, such as numbness or fatigue of the lower limbs, was reported. The initial treatment administered was for back pain. After admission, the patient developed a fever and abdominal pain. Peripheral leukocyte count was 12.92\u00d7109/L(normal range, 3.5\u20139.5\u00d7109/L) with 11.51\u00d7109/L neutrophils (normal range, 1.8\u20136.3\u00d7109/L) and an elevated C-reactive protein of 101.59 mg/L, and Erythrocyte sedimentation rate was 120mm/hour. The computed tomography angiography (CTA) examination revealed a thoracic aortic pseudoaneurysm. Abdominal CTA confirmed the formation of a pseudoaneurysm in the aorta, approximately in the T10-T11 vertebral body plane .\nBlood was drawn during fever, gram-negative bacilli were Gram-stained, and Salmonella paratyphi A was cultured. Susceptibility testing by the minimum inhibitory concentration (MIC) gradient method revealed that the isolate was susceptible to piperacillin/Tazobactam, Imipenem, ampicillin, and gentamicin based on the Antimicrobial Susceptibility Testing criteria (piperacillin/Tazobactam MIC\u22648ug/mL; Imipenem MIC\u22641ug/mL; Ampicillin MIC\u22642ug/mL). Furthermore, susceptibility testing by Kirby-Bauer drug-sensitivity test showed that the isolate was susceptible to Cefotaxime, Ceftriaxone, Ciprofloxacin, and Levofloxacin based on the Antimicrobial Susceptibility Testing criteria (Cefotaxime inhibition zone diameter = 28mm; Ceftriaxone inhibition zone diameter = 30mm; Ciprofloxacin inhibition zone diameter = 26mm; Levofloxacin inhibition zone diameter = 28mm).\nThe endovascular stent-graft treatment was performed immediately. After inducing local anesthesia, the left femoral artery was punctured using the Seldinger\u2019s method. 5F arterial sheath was implanted, and a pigtail catheter was inserted in descending aorta for aortography, which showed signs of a thoracic aortic pseudoaneurysm. An oval-shaped soft tissue-density mass measuring 2.5\u00d72.1 cm was detected in the descending thoracic aorta at the level of the T10-T11 vertebral body. The right femoral artery was then exposed, and Ultra Stiff Wire (ASAHI, Japan) was put in. After that Hercules\u2122 Sterile Thoracic Stent-Graft System (Microport, Shanghai) was put in along Wire and then released to cover pseudoaneurysm. The procedure lasted 45 min. Aortography was conducted again, which revealed that the pseudoaneurysm had almost disappeared without leakage.\nMoreover, piperacillin sulbactam sodium 5 g was administered once every 8 h intravenously for 14 days in combination with levofloxacin 0.4 g once a day intravenously for 7 days. Abdominal pain was relieved, and the body temperature returned to normal. The treatment was well tolerated by the patient, and she was discharged on postoperative Day 10.\nAt the 2-month follow-up, the patient was asymptomatic, and CTA confirmed the total exclusion of the pseudoaneurysm with no signs of endoleaks . After discussion with the institutional research office, formal ethical approval was deemed unnecessary if written informed consent was obtained from the patient. Verbal and written informed consent were obtained from the patient for publishing the report.", "summary": "A 63-year-old female patient had a thoracic aortic pseudoaneurysm caused by Salmonella paratyphi A infection. The patient associated with diabetes had a fever, abdominal pain, and low back pain, who was successfully treated using endovascular stents treatment and antibiotics.", "subclaim_evaluations": [ { "subclaim": "The patient is a 63-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a thoracic aortic pseudoaneurysm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pseudoaneurysm was caused by Salmonella paratyphi A infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has diabetes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had low back pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with endovascular stents.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with antibiotics.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was successful.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_3349_en.txt", "fulltext": "57-year-old male patient, born in Chile, with a history of Beta-thalassemia in pharmacological treatment with oral folic acid and iron, with a history of BCG vaccination in childhood, eutrophic.\n\nDuring 2021, he presented a case of a year-long evolution of significant weight loss, loss of appetite and abdominal pain of a colic type. The initial laboratory study showed a normocytic, normochromic anaemia with a negative serological study of hepatitis B and C viruses and a non-reactive HIV. Complementary study: Computed tomography (CT) of the abdomen and pelvis: segmental thickening of the ascending and descending colon with adjacent inflammatory changes; upper gastrointestinal endoscopy: no significant alterations. Incomplete colonoscopy without ileocecal evaluation: two ulcerated lesions in the ascending and sigmoid colon, suggestive of neoplasia. Colon mucosa biopsies reported chronic active colitis with the presence of granulomas, and negative Ziehl Neelsen and Kinyoun stains. A PET/CT FDG scan was performed due to suspicion of neoplasia, which reported a distal ileal and inflammatory ascending and descending colon segments, and hypermetabolic ileocolic lymph nodes, suggestive of IBD. Subsequently, an MRI enterography was performed, which reported images compatible with ileocecal involvement in Crohn's disease. Based on these findings, a diagnosis of inflammatory phenotype of Crohn's disease with ileocolonic involvement was made, and corticosteroid therapy (prednisone 1 mg/kg with progressive tapering in 8 weeks) and azathioprine were initiated for 2 months.\n\nPatient develops clinical deterioration characterised by abdominal pain, dysenteric diarrhea and fever of 38 \u00b0C. Laboratory highlights haemoglobin of 8.9 g/dl, white blood cells of 2,490, C reactive protein of 30.18 mg/dl, VHS 15 and severe hypoalbuminaemia of 2.6 g/dl. He is hospitalised for severe crisis of Crohn's disease and eventual need of biological therapy.\n\nOn admission, intravenous corticosteroid therapy was initiated and a pre-biological study was requested. Abdominal CT with inflammatory ileocolonic involvement, Quantiferon TB positive, with chest radiography and chest CT without alterations.\n\nA new ileocolonoscopy was performed which reported: \"active Crohn's colitis with ulcerative involvement of the ileum, sigmoid and rectum\". Staged biopsies reported necrotizing granulomas with positive Ziehl Neelsen staining in all samples. Corticosteroids were de-escalated and anti-tuberculosis therapy was initiated with a standard scheme with a good early clinical response.\n", "summary": "A 57-year-old patient with an initial diagnosis of Crohn's disease and who was receiving immunosuppressive treatment was presented. Due to a lack of response to therapy, a new endoscopic and anatomopathological study was performed, concluding with a diagnosis of intestinal tuberculosis, which was treated with a good response.\n", "subclaim_evaluations": [ { "subclaim": "The patient is 57 years old.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had an initial diagnosis of Crohn's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was receiving immunosuppressive treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient did not respond to therapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A new endoscopic study was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A new anatomopathological study was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was intestinal tuberculosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated for intestinal tuberculosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment for intestinal tuberculosis had a good response.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_2312_en.txt", "fulltext": "A 50-year-old female patient with the main complaint of \u201cirregular vaginal bleeding and fatigue for 6 months\u201d visited our hospital on 12 February 2019. A mass was presented in the endometrium of the patient detected by ultrasonic examination. On pelvic MRI, a mass in the uterus involved deep muscular layer was confirmed as a 5*6 cm mass that appeared to be pelvic lymph node metastasis . Blood test showed a serous hyponatremia with Na+ level of 123\u223c131 mmol/L.\nThe patient received diagnostic curettage, and the pathological result showed high-grade malignant endometrial carcinoma. Tumor markers including carbohydrate antigens 125 (CA125) and human epididymis protein 4 were detected in normal ranges, and no intraepithelial or malignant lesions were found in cervical exfoliative cytology examination.\nThe uterus with enlargement in smooth and hard nature was found in the posterior position according to the gynecological examination. Hard nodules with poor activity and no tenderness can be touched in the anterior uterine wall. Based on the pathological result, endometrial carcinoma invading the serosa was diagnosed in the patient. For the huge mass in the endometrium and the poor state of patient, she received two circles of neoadjuvant chemotherapy with taxol and carboplatin, while improving the persistent hyponatremia, then staging operation of endometrial cancer was conducted under general anesthesia on 21 May 2019.\nDuring the operation, it was found that the enlarged uterus was located in the middle of the pelvis, the size was about 60 days of pregnancy, and the surface was smooth. The appearance of the main ligament and bilateral fallopian tubes and ovaries was normal, and no tumor was found on the surface of the appendix, omenta, and peritonea. The lymph nodes in the pelvis and surrounding the abdominal aorta were enlarged. First, we get the cytology of peritoneal fluid which resulted negative. And then laparotomy radical hysterectomy with bilateral salpingo-oophorectomy, and pelvic and para-aortic lymphadenectomy was performed. Incision of the uterus showed that the solid tumor of the posterior wall of the uterus with diameter of 2 cm, slightly brittle texture and pale in color protruded from the muscle wall to the uterine cavity. No lesion was found in the vaginal fornix and cervix. The normal appearance of the bilateral attachments was found, and the lymph nodes in the pelvis and surrounding the abdominal aorta were evidently enlarged.\nPathological gross examination of the tumor showed that there was no obvious tumor in the serous surface membrane of the uterus. Incision of the uterus showed that the solid tumor of the posterior wall of the uterus with diameter of 2 cm, slightly brittle texture and pale in color protruded from the muscle wall to the uterine cavity. Microscopically, the endometrium was presented with mixed carcinoma. Histologically, two kinds of carcinoma were distributed separately. And the carcinoid was distributed in the muscles of myometrium with invasive pattern, accounting for about 70% of the tumor. Diffused infiltrating carcinoma of myometrium of the uterus is neuroendocrine tumor, with no obvious cellular atypia, abundant cytoplasm, rare mitograms of 0\u20131/10 HPF, Ki67 index of about 2%, consistent with carcinoid, multifocal vascular and lymphatic invasion, nerve invasion. Squamous cell carcinoma is arranged in the uterine body cavity, accounting for about 30% of the tumor . There is no glandular (or tubular) structure or keratinization of the tumor cell components. The tumor has penetrated the uterine serous membrane. Multi-lesions of lymphatic vessel space infiltration were found. Of the 23 harvested lymph nodes from the pelvic, 5 metastasized lymph nodes were identified in the abdominal aortic and left pelvic lymph nodes with mixed carcinoma. Negative reaction was displayed in the cervix, bilateral ovary, and oviduct. Immunohistochemically, in carcinoid carcinoma, the tumor cells were partly positive for synaptophysin (Syn), S-100, NSE, chromogranin A (CgA), CD56, cytokeratin (CK), H-CK, P63, and P40. The progesterone receptor and the estrogen receptor were negative. CA125, P16, Napsin A, WT-1, CD99, and vimentin were negative. The Ki67 proliferation index was 10%. Elastic fibers show vascular invasion. D2\u201340 showed lymph node metastasis. In squamous cell carcinoma, the tumor cells were partly positive for CK, CK7, CEA, P63, P40, PAx-8, and CEA. Additionally, results of villin, CDX-2, and CK20 were all negative. The histologic features of the tumor and its immunohistochemical profile support the diagnosis of carcinoid of the endometrium with squamous cell carcinoma .\nBased on the revision of FIGO 2009 staging for endometrial carcinoma, the patient was classified as stage IIIC2. Postoperatively, the patient was given adjuvant chemotherapy with cisplatin and etoposide under interval of 3 weeks and received \u201csandwich\u201d therapy of chemotherapy-radiotherapy-chemotherapy. In the first circle of chemotherapy, grade 1 nausea and vomiting and grade 3 myelosuppression were developed in the patient. The patient received radiotherapy followed by 3 circles of chemotherapy with no sign of further deterioration. A complete response was achieved in the patient on the basis of the RECIST1.1 criteria. She is currently under close follow-up with no recurrence for 4 years and 4 months after surgery.", "summary": "Here, we report an interesting case of mixed carcinoma of endometrium with both carcinoid and squamous cell carcinoma, which presented with persistent vaginal bleeding and hyponatremia.", "subclaim_evaluations": [ { "subclaim": "The case involved a mixed carcinoma of the endometrium.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor contained both carcinoid and squamous cell carcinoma components.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with persistent vaginal bleeding.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hyponatremia.", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_2743_en.txt", "fulltext": "A 54-year-old woman was admitted to the hospital because of blood in the sputum and hemoptysis.\nA 54-year-old woman was admitted to the hospital because she had seen blood in her sputum for more than 4 mo and had had hemoptysis for 1 wk. The hemoptysis occurred without a clear reason. The coughed-out blood was bright red in clots and was accompanied by a large quantity of white and nonviscous sputum. The patient did not sweat excessively either during the day or night, did not feel cold or have a fever, did not feel chest tightness or shortness of breath, and had no dizziness or headache.\nThe patient had undergone surgical removal of gallbladder polyps more than 20 years ago, and had received minimally invasive surgery for breast fibroma more than 2 years ago.\nThe patient had no history of smoking or consuming alcohol, and there was no family medical history.\nOn admission, the patient's temperature was 36.7\u00b0C, with a heart rate of 78 beats/min, blood pressure of 110/68 mmHg, and respiratory rate of 16 breaths/min. The patient exhibited clear consciousness and compliance throughout the examination. Her trachea was in a neutral position, there was no cyanosis in her mouth or lips, and no swollen lymph nodes were identified in the supraclavicular region of either side. The breathing sound of both lungs was clear; no obvious rale was heard. The heart rhythm was regular; no obvious pathological noise was heard. The patient\u2019s abdomen was flat and soft; no tenderness or rebound pain was identified. Edema in her lower extremities was not evident, and no clear pathological signs were found in the nervous system.\nHer hemoglobin level was relatively low at 98 g/L; the remaining routine blood examination results, C-reactive protein level, liver and kidney function indicators, and electrolyte levels were all within the normal range. A laboratory examination indicated that the levels of the tumor indices neuron specific enolase (NSE), carbohydrate antigen (CA)-724, CA-125, CA19-9, carcinoembryonic antigen, and alpha-fetoprotein were in the normal range.\nA computer tomography (CT) image of the patient that had been obtained in November 2017 showed atrophy in the middle lobe of her right lung as well as bronchiectasis in the left lung and the middle lobe of the right lung accompanied by infections. Numerous nodules with a diameter of 0.3 to 0.5 cm were identified in the middle lobe of the right lung . Another CT image obtained in March 2018 revealed that the bronchiectasis in the middle lobe of her right lung was accompanied by atelectasis, which was more observable than the atrophy in the same location in the previous CT image .", "summary": "A 54-year-old woman was admitted to the hospital because she had symptoms of bloody sputum for more than 4 mo and hemoptysis for 1 wk. Computed tomography images showed atrophy accompanied by infections in the middle lobe of her right lung. Moreover, numerous nodules were identified in the middle lobe of the right lung. The patient underwent thoracoscopic pneumonectomy of the middle lobe of the right lung, and the resected mass was pathologically confirmed to have bronchiectasis, multifocal NEC hyperplasia accompanied by tumorlet, and PSP.", "subclaim_evaluations": [ { "subclaim": "The patient is a 54-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had symptoms of bloody sputum for more than 4 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had hemoptysis for 1 week.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed atrophy in the middle lobe of the right lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed infections in the middle lobe of the right lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "Numerous nodules were identified in the middle lobe of the right lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent thoracoscopic pneumonectomy of the middle lobe of the right lung.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The resected mass was pathologically confirmed to have bronchiectasis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The resected mass was pathologically confirmed to have multifocal NEC hyperplasia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The resected mass was pathologically confirmed to have tumorlet.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The resected mass was pathologically confirmed to have PSP.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2730_en.txt", "fulltext": "A 63 year-old male patient diagnosed with PDAC was referred to the BC Cancer Agency\u2019s Hereditary Cancer Program for hereditary cancer syndrome assessment due to a strong family history of PDAC . As the starting point for the genetic study of a family, this patient is considered the proband. The family history was noteworthy for the occurrence of PDAC in the proband and his brother, as well as an aunt and uncle on the maternal side. Diagnoses occurred between the ages of 63 and 69. Ancestry was reported as English on both sides.\nThe proband presented with a three-month history of weight loss and epigastric discomfort. A computerized tomography (CT) scan showed a 2.9 cm lesion in the head of the pancreas. He was deemed to have locally advanced unresectable PDAC and began treatment with a combination of 5-fluorouracil, irinotecan, and oxaliplatin (FOLFIRINOX). His medical history included type 2 diabetes, hypertension, osteoarthritis, gout and hyperlipidemia. He reported being a non-smoker who consumes 6\u20138 alcoholic drinks per day.\nThe proband\u2019s brother presented with left upper quadrant pain and underwent an ultrasound as well as a CT scan which revealed the presence of a mass in the pancreatic head and uncinate process. He was deemed to have resectable PDAC and underwent a pancreaticoduodenectomy (Whipple) procedure. Pathology confirmed a 3.5 cm moderately differentiated PDAC. Margins were negative. He was treated with adjuvant gemcitabine for six months. He reported being a non-smoker, rarely consuming alcohol. He denied a significant prior medical history.\nDuring the initial genetic consultation, the proband denied any history of breast, ovarian, colon cancer or melanoma in the family. There was no reported history of pancreatitis, multiple moles, lip freckling or gastrointestinal polyps. In this pancreatic-cancer prone family, none of the diagnoses occurred under the age of 50. The family history of cancer did not meet the current provincial guidelines for hereditary cancer genetic testing . The patient was informed of the options of self-pay genetic testing through one of several genetic testing companies or banking DNA at the BC Cancer Agency should criteria change in the future. He elected to bank a DNA sample and consented to future research.\nThe proband\u2019s brother was referred to the Hereditary Cancer Program six months later at which time a research study had opened that offered index genetic testing to unselected, newly diagnosed cases of PDAC utilizing a commercial-grade genetic test provided by Color Genomics. The test is designed to assess clinically relevant pathogenic variants in 30 genes associated with hereditary cancer risk, including the hereditary breast and ovarian cancer and Lynch syndrome associated genes. Details of their assay are published . After reviewing the advantages and limitations of multi-gene panel testing as well as the implications of possible results, he consented to the research study and provided a saliva sample for genetic testing. Genetic test results revealed a pathogenic missense variant in CDKN2A, c.377 T > A (p.Val126Asp). The pathogenic variant is associated with FAMMM syndrome, characterized by an inherited susceptibility primarily to melanoma but also to PDAC. No variants were detected in the remaining genes on the panel.\nDue to an inherited predisposition to cancer being diagnosed in his brother, the proband was subsequently seen in follow-up, where he consented to genetic testing. His results were positive for the familial CDKN2A pathogenic variant.", "summary": "We present the case of two brothers of English ancestry diagnosed with PDAC within the same 12\u00a0month period, at the respective ages of 63 and 64\u00a0years of age. Neither brother reported a personal history of multiple moles or melanoma. Family history was positive for two second-degree relatives diagnosed with PDAC but was negative for other cancers or multiple moles in first- and second-degree relatives. Due to the absence of melanoma, this family did not meet provincial criteria for publicly funded genetic testing. Clinical genetic testing offered through a research grant identified a pathogenic variant in the CDKN2A gene c.377\u00a0T\u2009>\u2009A (p.Val126Asp). This variant is a North American founder mutation believed to pre-date colonization.", "subclaim_evaluations": [ { "subclaim": "Two brothers of English ancestry were diagnosed with PDAC within the same 12-month period.", "support_label": "supported", "is_refined": false }, { "subclaim": "The first brother was diagnosed at age 63.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second brother was diagnosed at age 64.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neither brother reported a personal history of multiple moles.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neither brother reported a personal history of melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Family history was positive for two second-degree relatives diagnosed with PDAC.", "support_label": "supported", "is_refined": false }, { "subclaim": "Family history was negative for other cancers in first- and second-degree relatives.", "support_label": "supported", "is_refined": false }, { "subclaim": "Family history was negative for multiple moles in first- and second-degree relatives.", "support_label": "supported", "is_refined": false }, { "subclaim": "The family did not meet provincial criteria for publicly funded genetic testing due to the absence of melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical genetic testing offered through a research grant identified a pathogenic variant in the CDKN2A gene.", "support_label": "supported", "is_refined": false }, { "subclaim": "The variant identified was c.377 T\u2009>\u2009A (p.Val126Asp).", "support_label": "supported", "is_refined": false }, { "subclaim": "The CDKN2A variant is a North American founder mutation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The CDKN2A variant is believed to pre-date colonization.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1331_en.txt", "fulltext": "A 55-year-old male patient was presented to a general hospital with fever, myalgia, and persistent cough. Polymerase chain reaction testing for COVID-19 was positive and he was admitted to the hospital due to severe respiratory symptoms. The patient is a known diabetic and hypertensive with a history of a nonfunctioning pituitary macroadenoma for which he underwent an endoscopic endonasal transsphenoidal resection 11 years ago in another hospital. Pituitary tumor recurrence was documented in the available two postoperative magnetic resonance imaging (MRI) studies . After surgery, the patient was kept on maintenance levothyroxine and hydrocortisone for panhypopituitarism.\nSix days after admission, the patient complained of severe headache and acute onset of ptosis and diminution of vision in the left eye. Ophthalmological evaluation revealed complete visual loss in the left eye, a visual acuity of 20/60 in the right eye, left oculomotor nerve palsy with ptosis, and dilated nonreactive pupil. Fundus examination revealed a pale left optic nerve head. Neurological examination was otherwise normal. Computed tomography revealed hyperdensity of the sellar and suprasellar areas. MRI was consistent with PA in a recurrent large pituitary adenoma [ and ].\nThe patient was transferred to our center and underwent an urgent endoscopic endonasal transsphenoidal surgery through which a near total excision of the tumor was achieved [ and ].\nThe procedure was performed under strict COVID-19 precautions including use of powered air purifying respirators and limited OR personnel. Intraoperative findings were similar to those usually seen in cases of PA and included dark blood mixed with purple-red adenoma tissues of variable consistencies . It was our observation that the nasal mucosa was pale and separated easily from the underlying bone. We have previously observed such features in two patients who previously tested positive for COVID-19. Histopathological examination demonstrated classic features of PA.\nWithin the first 3 postoperative days, the patient had some improvement of vision of the left eye so that he was able to perceive hand movement. Ptosis also improved partially. However, his chest condition progressed and he had to be transferred to COVID-19 intensive care unit in the referring hospital where he was intubated and put on mechanical ventilation. One week later, the patient unfortunately passed away due to complications of severe COVID-19 pneumonia.", "summary": "A 55-year-old male patient with confirmed COVID-19 infection presented by progressive decrease in visual acuity and oculomotor nerve palsy. His medical history is notable for diabetes mellitus, hypertension, and pituitary macroadenoma resection 11 years ago. He was on hormonal replacement therapy for panhypopituitarism that complicated the surgery. Previous magnetic resonance (MR) imaging studies were consistent with enlarging residual pituitary adenoma. During the current hospitalization, computed tomography revealed hyperdensity of the sellar and suprasellar areas. MR imaging revealed PA in a recurrent large adenoma. Endoscopic endonasal transsphenoidal resection was uneventfully undertaken with near total excision of the adenoma and partial improvement of visual loss and oculomotor palsy. Histopathological examination demonstrated classic features of PA. However, his chest condition progressed and he had to be transferred to COVID-19 intensive care unit in the referring hospital where he was intubated and put on mechanical ventilation. One week later, the patient unfortunately passed away due to complications of severe COVID-19 pneumonia.", "subclaim_evaluations": [ { "subclaim": "The patient is a 55-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had confirmed COVID-19 infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had progressive decrease in visual acuity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had oculomotor nerve palsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of pituitary macroadenoma resection 11 years ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was on hormonal replacement therapy for panhypopituitarism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Previous MR imaging showed enlarging residual pituitary adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed hyperdensity of the sellar and suprasellar areas.", "support_label": "supported", "is_refined": false }, { "subclaim": "MR imaging revealed pituitary adenoma in a recurrent large adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endoscopic endonasal transsphenoidal resection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The resection achieved near total excision of the adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had partial improvement of visual loss.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had partial improvement of oculomotor palsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination showed classic features of pituitary adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was transferred to the COVID-19 intensive care unit.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was intubated and put on mechanical ventilation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient passed away one week later.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's death was due to complications of severe COVID-19 pneumonia.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1121_en.txt", "fulltext": "A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic. Her obstetric history mentioned a miscarriage and a pregnancy complicated by intrauterine growth restriction, without signs of preeclampsia. At 37 weeks' gestation, cesarean section was performed because of fetal distress. A boy was delivered, weighing 2015 g, with Apgar scores of 9 and 10 at one and five minutes, respectively. Histology of the placenta revealed 10% infarctions and a thrombus in the umbilical cord. Blood analysis after three months showed no hemostatic abnormalities associated with an increased risk of thrombosis.\nUltrasound examination of the index pregnancy at 112 weeks' gestation showed a dichorionic diamniotic twin pregnancy with measurements consistent with gestational age. The Crown Rump Lengths were 39 mm, consistent with 106 weeks, and 45 mm, consistent with 112 weeks. Nuchal translucency thickness measurements were not performed. No abnormalities of the placenta were documented.\nHer blood pressure was 125/70 mmHg. The pregnancy was complicated by episodes of vaginal bleeding at 16 weeks' gestation. Ultrasound showed one fetus with normal growth and one with early growth restriction and measurements consistent with 13 weeks. An echogenic area was interpreted as blood clots. At 20 weeks' gestation, fetal death of the abnormal fetus was noticed. One week later, the patient was asymptomatic but her blood pressure increased (154/98) which prompted the suspicion of a partial molar pregnancy. An enlarged placenta of 10 cm \u00d7 12 cm with some cysts was prominent on the anterior wall. Blood flow had ceased in this placenta. Urinary protein excretion was 2.5 g/L. Maternal serum beta-human-chorionic-gonadotropin (\u03b2-hCG) was markedly raised: 423,000 IU/L. Other laboratory investigations were normal.\nThe patient was sent to a University Hospital because of early preeclampsia and suspicion of a triploid twin. We decided to perform a chorionic villous biopsy because the placenta of the dead fetus was on the anterior wall. We did not perform a chorionic villous biopsy of the placenta of the healthy twin because no abnormalities were noticed by ultrasound and the placenta was located on the posterior wall.\nChorionic villus biopsy confirmed triploidy, 69, XXY. Without pharmacological interventions, the blood pressure stabilized, proteinuria decreased, and \u03b2-hCG decreased to 222,835 IU/L. At 22 weeks, the patient was discharged. She was reviewed twice a week. Urinary protein excretion was positive until 23 weeks, and blood pressure slowly decreased and normalized at 30 weeks. The \u03b2-hCG further decreased to 27,600 IU/L at 33 weeks. Episodes of some vaginal bleeding and cramps occurred up to 28 weeks' gestation. The placenta of the triploid twin was still enlarged until 23 weeks: 8 cm \u00d7 12 cm .\nAt 35 weeks, the patient developed preeclampsia again and was hospitalized. Her blood pressure increased to 170/105 mmHg and proteinuria to 0.8 g/L. Methyldopa 3 \u00d7 250 mg was initiated to control the blood pressure with good result . Blood analysis showed no signs of hemolysis, elevated liver enzymes, low platelets (HELLP) syndrome. At 38 weeks, a cesarean section was performed for fetal distress. A healthy girl weighing 2,710 g was born with Apgar scores of 9 and 10 at one and five minutes, respectively. The placenta of the triploid fetus was necrotic and as a result of autolysis, no further histologic information on fetus and placenta were available. \u03b2-hCG follow-up showed no signs of persistent gestational trophoblastic disease (pGTD). Four days after delivery, the level had already decreased to 440 IU/L.", "summary": "A 33-year-old Caucasian woman presented with a dichorionic diamniotic twin pregnancy. One fetus showed early growth restriction resulting in fetal death at 20 weeks. The placenta was enlarged with some cysts. Chorionic villus biopsy confirmed triploidy. At 21 weeks, the patient developed preeclampsia with a blood pressure of 154/98 mmHg and proteinuria (24 hour protein excretion of 2.5 g/L), for which she was hospitalized. Without pharmacological interventions, the blood pressure normalized and proteinuria disappeared. At 35 weeks, she again developed preeclampsia. A cesarean section was performed at 38 weeks and a healthy child was born.", "subclaim_evaluations": [ { "subclaim": "The patient is a 33-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a dichorionic diamniotic twin pregnancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "One fetus showed early growth restriction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fetus with growth restriction died at 20 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The placenta was enlarged.", "support_label": "supported", "is_refined": false }, { "subclaim": "The placenta had some cysts.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chorionic villus biopsy confirmed triploidy.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 21 weeks, the patient developed preeclampsia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient's blood pressure was 154/98 mmHg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had proteinuria of 2.5 g/L.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was hospitalized.", "support_label": "supported", "is_refined": false }, { "subclaim": "Without pharmacological interventions, the blood pressure normalized.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Without pharmacological interventions, the proteinuria disappeared.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "At 35 weeks, the patient again developed preeclampsia.", "support_label": "supported", "is_refined": false }, { "subclaim": "A cesarean section was performed at 38 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "A healthy child was born.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2998_en.txt", "fulltext": "The patient was a 67-year-old Middle-Eastern man who came to the emergency ward with progressive bilateral lower extremity muscle weakness and myalgia. The patient had no drug history and no significant past medical history or history of contact with toxins. Fifteen days prior to the onset of muscle weakness, the patient had presented with fever, rhinorrhea, and mild shortness of breath, and with a positive nasal swab PCR test, had a diagnosis of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pneumonia, for which he was treated as an outpatient, with desirable recovery after 15 days. However, following the resolution of COVID-19 symptoms, the patient started to develop myalgia and bilateral lower extremity proximal weakness. Due to augmentation of his lower extremity weakness and development of upper extremity proximal weakness, he was admitted to the hospital for further evaluation. In the physical examination, proximal muscle weakness was noted in the upper and lower extremities (power grade 4/5 and 3/5, respectively), with normal tone and deep tendon reflexes. The patient had no skin lesions or rashes. The patient also reported no muscle tenderness in our examination. The rest of the examination was normal.\nThe initial laboratory tests detected elevated muscle enzymes including creatine phosphokinase (CPK): 12,000 (normal: 38\u2013174 U/L); lactate dehydrogenase (LDH): 757 (normal: 130\u2013240 U/L)]; and aldolase: 11 (normal: 8.5 U/L). Procalcitonin was in the normal range. Also, 25-hydroxy vitamin D test levels were normal, at 40 ng/mL. Other laboratory data included a white blood count (WBC) of 8.83 \u00d7 103 \u00b5l), hemoglobin of 14.2 g/dL, erythrocyte sedimentation rate (ESR) of 9 mm/hour (normal: < 20 mm/hour), C-reactive protein of < 2 mg/L (normal: \u2264 6 mg/L), creatinine of 1 mg/dL, blood urea of 32 mg/dL, sodium (Na) 140 mEq/L, potassium (K) 4.4 mEq/L, aspartate aminotransferase (AST) of 25 IU/L (normal: 15\u201340 IU/L), alanine transaminase (ALT) 26 IU/L (normal: \u2264 41 IU/L), and alkaline phosphatase 121 IU/L (normal 120\u2013450 IU/L). Bilateral thigh magnetic resonance imaging (MRI) axial and coronal view (T1 and T2; Short Tau Inversion Recovery) showed diffuse edema within all muscle compartments of the thigh with notable intra- and perimuscular edema, suggestive of myositis. .\nElectromyography (EMG) and nerve conduction velocity (NCV) findings were suggestive of irritable myopathy in several proximal muscles, including rectus femoris, iliopsoas, and deltoid. Additionally, in a left deltoid muscle biopsy, muscle necrosis was reported in the absence of inflammation, in favor of necrotizing autoimmune myositis . In cryopreserved biopsy from deltoid muscle, variation in fiber size was evident, with presence of some pale necrotic fibers with evidence of myophagocytosis associated with some regenerating fibers. Inflammation was absent. On trichrome stain, no apparent fibrosis was seen. Based on the overall histomorphology and clinical and laboratory findings, the diagnosis of immune-mediated necrotizing myopathy was established. .\nAmong all myositis-related autoantibodies such as anti-3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), anti-signal recognition particle (SRP), anti-Jo-1, and anti-NXP2, only anti-NXP2 autoantibodies were positive, which prompted us to search for underlying malignant processes. The patient underwent a malignancy workup by abdomen and pelvis ultrasound, chest CT scan, endoscopy and colonoscopy, prostate-specific antigen (PSA), and ear, nose, and throat (ENT) examination, which were all unremarkable. Based on the positive results of NXP2 and to rule out malignancy, a fluorodeoxyglucose (FDG)-positron emission tomography (PET) scan was performed, which demonstrated a 35 \u00d7 28 mm left thyroidal lobe nodule . A thyroid biopsy confirmed its unmalignant nature and thyroid-stimulating hormone (TSH) levels were also normal. Cardiac echocardiography, electrocardiography, and lung spirometry were also normal. Chest high-resolution computed tomography (HRCT) also showed bilateral multifocal patchy ground-glass opacities with dominant peripheral distribution, which were attributable to previous COVID-19 pneumonia. .\nSince myositis could emerge in the context of some connective tissue disorders, testing for some other laboratory markers, including antinuclear antibodies (ANA), anti-smooth muscle antibodies (ASMA), perinuclear antineutrophil cytoplasmic antibodies (p-ANCA), cytoplasmic antineutrophil cytoplasmic autoantibody (C-ANCA), anticyclic citrullinated peptide (anti-CCP), rheumatoid factor (RF), anti-double-stranded DNA (anti-ds DNA), complement component 3 (C3), complement component 4 (C4), and anti-Ro were done, which were all in the normal range. Thus, a diagnosis of necrotizing autoimmune myositis, possibly complicating COVID-19, was made after ruling out other causes for NAM by appropriate tests.\nFor treatment, prednisolone 1 mg/kg orally was administered. CPK levels started to fall after the initiation of steroids and were 107 IU/mL at the time of discharge. Resolution of ground-glass opacity of the lungs was observed after three months from his discharge. The prednisolone dose was decreased gradually to 10 mg, 1 year after diagnosis, and azathioprine was continued with an initial dose of 150 mg/day, which was decreased to 100 mg/day. The patient\u2019s muscle force was resolved to normal after 1 year of follow-up. After confirming no inflammation, we reduced the prednisolone dose to an eventual 5 mg daily, along with 50 mg/day azathioprine. The patient is still relatively well after 15 months follow-up with improved laboratory examinations and muscle power in all extremities. The latest laboratory data were as follows: CPK: 115 U/L; LDH: 478 U/L; WBC: 9.02 \u00d7 103/\u00b5l); hemoglobin: 13.9 g/dL; AST: 25 IU/L; ALT: 23 IU/L; alkaline phosphatase (ALK): 134 IU/L; K: 4.1 mEq/L; ESR: 5 mm/hr; CRP < 2; vitamin D: 30 ng/mL; creatinine: 1.19 mg/dL; blood urea: 42 mg/dL; and Na: 139 mEq/L.", "summary": "Herein, we report a rare case of necrotizing autoimmune myositis in a 67-year-old middle eastern male following coronavirus disease 2019 infection, who presented with muscle weakness. The patient had positive anti-NXP2. The diagnosis of necrotizing autoimmune myositis was made according to muscle weakness, increased liver enzymes, electromyography and nerve conduction velocity results, and muscle biopsy. The patient underwent a full malignancy evaluation, which was unremarkable, and was discharged in relatively well condition with a daily dose of 1\u00a0mg/kg prednisolone and azathioprine 150\u00a0mg (2\u00a0mg/kg).", "subclaim_evaluations": [ { "subclaim": "The patient is a 67-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is of Middle Eastern descent.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a prior coronavirus disease 2019 infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with muscle weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had positive anti-NXP2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was necrotizing autoimmune myositis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on muscle weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on increased liver enzymes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The diagnosis was based on electromyography and nerve conduction velocity results.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on muscle biopsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "A full malignancy evaluation was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The malignancy evaluation was unremarkable.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged in relatively well condition.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was prescribed prednisolone at 1 mg/kg daily.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was prescribed azathioprine at 150 mg daily.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2452_en.txt", "fulltext": "A 2-year-old, 4.5-kg neutered male domestic shorthair cat was presented for acute-onset dyspnea. The past medical history was unremarkable. The cat lived indoors and was current on vaccinations and parasite prevention. On presentation, lung sounds were harsh, with no crackles. The cat exhibited inspiratory effort, with a respiratory rate of 44 bpm. The remaining physical findings were within normality. Thoracic radiographs identified moderate pleural effusion and lung edema. Echocardiography revealed asymmetric left ventricular myocardial thickening [interventricular septum end-diastolic thickness 5.7 mm (5 \u00b1 0.7 mm) , left ventricular posterior wall end-diastolic thickness 7.5 mm (4.6 \u00b1 0.5 mm) ] and severe left atrial dilation [left atrium-to-aortic root ratio 2.2 (1.29 \u00b1 0.23) ]. The cat was hospitalized and treated with oxygen, furosemide (Dimazon 50 mg/ml, MSD Animal Health S.r.l., Segrate, Italy; dose: 1 mg/kg IV q6h), pimobendan (Vetmedin chew 1.25 mg, Boehringer Ingelheim Animal Health Italia S.p.A., Noventana, Italy; dose: 0.2 mg/kg PO q12h), and clopidogrel (Clopidogrel ACT 75 mg, BB FARMA Srl, Samarate, Italy; dose: 18.75 mag/cat PO q24h). During hospitalization, blood was collected to assess the cat\u2019s systemic condition (i.e., complete blood count, biochemistry, test for feline leukemia and feline immunodeficiency virus), leading to unremarkable results. The cat was discharged after 4 days with oral furosemide (Dimazon 10 mg, MSD Animal Health S.r.l., Segrate, Italy; dose: 1 mg/kg PO q12h) and an unchanged dose of pimobendan and clopidogrel. One week after discharge, the cat was represented with a recurrence of lung edema, despite the regular administration of drugs by the owners. Therefore, the dose of furosemide was increased (2 mg/kg PO q12h), and spironolactone was added (Prilactone next 10 mg, CEVA salute animale S.p.A., Agrate Brianza, Italy; dose: 2 mg/kg PO q24h). Despite increasing diuretic therapy and adherence to the therapeutic protocol by the owners, the cat presented an additional relapse of lung edema the following week. Suspecting an ongoing diuretic resistance, the dose of furosemide was further increased, and its route of administration was switched from oral to parental. As the owners were not able to administrate the drug intramuscularly, the subcutaneous administration of furosemide was considered. In light of such a change, owners were carefully instructed about the technique of subcutaneous administration. Only when it was conclusively certified that owners were able to administrate SF (Dimazon 50 mg/ml, MSD Animal Health S.r.l., Segrate, Italy) properly, this therapeutic protocol was started at the dose of 2 mg/kg SC q8h. Other cardiac therapies were continued at the previously reported doses. Thanks to the introduction of SF, the cat no longer presented a recurrence of lung edema. However, although the cat had never presented skin problems before and owners administrated properly SF, multiple well-defined circulars, crusted ulcerative cutaneous lesions (0.5\u20131 cm) associated with alopecia developed at the sites of furosemide injections (i.e., dorsal area of thoracic region) 2 weeks later . At that time, spot-on treatment with fluralaner and moxidectine (Intervet International B. V., Boxmeer, Holland) was prescribed, albeit without clinical improvement. Accordingly, a dermatological consultation was subsequently obtained. On physical inspection, neither signs of self-trauma due to pruritic allergy nor signs of trauma due to improper administration of SF were identified. Trichoscopic evaluation at the level of the aforesaid areas showed neither alteration of the hair shaft nor the presence of spores. Scraping and culture for dermatophytes tested negative. Cytological examination of impression smears and fine-needle aspiration obtained from crusted areas showed an inflammatory pattern characterized by neutrophils, eosinophils, and rare macrophages, without evidence of microorganisms. Owners declined skin biopsies. Given the above and considering that several differential diagnoses for inflammatory ulcerated lesions were unlikely in the light of anamnestic and clinical findings (e.g., thermal/electrical/chemical burns, skin trauma/infection/neoplasia/autoimmune disorder), it was hypothesized that the dermal lesions were primarily associated with the administration of SF. This hypothesis was further supported by the use of the Naranjo Algorithm Adverse Drug Reaction Probability Scale, which led to a score of 6/13 (i.e., \u201cprobable\u201d reaction to the drug) . Nevertheless, considering the severity of the cardiac condition and the previous relapses of lung edema, we preferred not to return to oral furosemide. Rather, we decided to interrupt the ongoing injectable formulation and substitute it with an alternative brand (Lasix fiale 20 mg/2 ml, Sanofi S.r.l., Milano, Italy), maintaining the same dose. Moreover, the cutaneous lesions were treated locally with a lenitive local product for 1 week (Douxo S3 CALM pads, CEVA salute animale S.p.A., Agrate Brianza, Italy). The dermal ulcerations disappeared within 1 month . Subsequently, the cat experienced neither further skin problems nor recurrence of lung edema, and he is still alive at the time of manuscript writing (13 months after the initial presentation).", "summary": "A 2-year-old domestic shorthair cat was presented for CHF associated with lung edema and pleural effusion. Echocardiography revealed asymmetric left ventricular myocardial thickening and severe left atrial dilation. The cat was hospitalized and initially treated with oxygen, intravenous furosemide, and clopidogrel. After discharge, the route of administration of furosemide was switched from intravenous to oral. Within the following 2 weeks, the cat experienced two relapses of lung edema despite the progressive increase of the furosemide dose, the addition of spironolactone and adherence to the therapeutic protocol by the owners. The dose of furosemide was further increased and its route of administration at home was switched from oral to parental. As the owner was not able to administrate intramuscular injections, SF was prescribed. This allowed the prevention of further episodes of lung edema. However, although the cat had never presented skin problems before, multiple well-defined circular, crusted ulcerative cutaneous lesions associated with alopecia developed at the sites of furosemide injections 2 weeks later. After ruling out several differential diagnoses for these lesions, a rare side effect of furosemide, not yet described in cats but already known in canine and human medicine, was strongly suspected as the possible cause. Therefore, the ongoing injectable formulation of furosemide was interrupted and substituted with an alternative brand, maintaining the same dose and route of administration. Thanks to this change, the dermal ulcerations disappeared within 1 month. Subsequently, the cat experienced neither further skin problems nor a recurrence of lung edema.", "subclaim_evaluations": [ { "subclaim": "The cat was a 2-year-old domestic shorthair.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was presented for CHF.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat had lung edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat had pleural effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography revealed asymmetric left ventricular myocardial thickening.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography revealed severe left atrial dilation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was hospitalized.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was treated with oxygen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat received intravenous furosemide.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat received clopidogrel.", "support_label": "supported", "is_refined": false }, { "subclaim": "After discharge, furosemide was switched from intravenous to oral.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat experienced two relapses of lung edema within 2 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The furosemide dose was progressively increased.", "support_label": "supported", "is_refined": false }, { "subclaim": "Spironolactone was added.", "support_label": "supported", "is_refined": false }, { "subclaim": "The owners adhered to the therapeutic protocol.", "support_label": "supported", "is_refined": false }, { "subclaim": "The furosemide route of administration at home was switched from oral to parental.", "support_label": "supported", "is_refined": false }, { "subclaim": "The owner was not able to administer intramuscular injections.", "support_label": "supported", "is_refined": false }, { "subclaim": "SF was prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "This prevented further episodes of lung edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multiple well-defined circular, crusted ulcerative cutaneous lesions developed at the sites of furosemide injections.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesions were associated with alopecia.", "support_label": "supported", "is_refined": false }, { "subclaim": "A rare side effect of furosemide was strongly suspected as the possible cause.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ongoing injectable formulation of furosemide was interrupted.", "support_label": "supported", "is_refined": false }, { "subclaim": "An alternative brand of furosemide was substituted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The same dose and route of administration were maintained.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The dermal ulcerations disappeared within 1 month.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat experienced no further skin problems.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat experienced no recurrence of lung edema.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_844_en.txt", "fulltext": "A 28-year-old Asian female presented to accident and emergency department with 6 weeks history of intermittent left sided abdominal pain, which got worse over last 48 hours. Abdominal pain was associated with 2 episodes of watery diarrhea not mixed with blood and several episodes of vomiting. Drug history included nothing else apart from oral contraceptive pill. On examination she was comfortable and afebrile with pulse rate of 96 and blood pressure of 160/96. Abdomen was soft but tender in left iliac fossa and left lumber region with no guarding or rebound tenderness. Digital rectal examination was unremarkable. Full blood count showed white cell count to be elevated at 24.5 \u00d7 106/L. Urea, electrolyte, amylase and liver function tests were all within normal limits. Flexible sigmoidoscopic examination up to distal descending colon did not reveal any abnormality. Computer tomographic scan of the abdomen showed dilated large bowel up to splenic flexure along with dilated loops of small bowel. She was started on supportive treatment with IV Normal Saline, O2 inhalation, catheterization and antibiotics. However after treatment she failed to respond and progressively became more unwell. Gradually she developed hypotension and oliguria. Arterial blood gas analysis at 4 litre of oxygen showed compensated acidosis with following picture:\nPo2-10.7 kPa\nPCO2-4.04 kPa\nHydrogen ion - 43.4 nmol/litre\nHCO3-17.5 nmol/litre\nOn reassessment of abdomen it was more tender with both guarding and rebound tenderness. She underwent laparotomy which showed complete infarction of small bowel, Gall bladder and spleen. Large bowel was infracted up to splenic flexure. Liver also appeared ischaemic. No procedure could be carried out and abdomen was closed. She subsequently died after around six hours in the post operative period. An autopsy was requested in view of operative findings. Post mortem examination confirmed the presence of organized thrombus at the origin of celiac and superior mesenteric arteries. In the aorta there was eccentric intimal thickening with loss of smooth muscle and a proliferation of elastic tissue [Figure ]. The nature of the lesion was confirmed as intimal fibro muscular dysplasia and thrombosis causing stenosis and subsequent occlusion of the origin of superior mesenteric and celiac artery [Figure ]. Intimal fibro muscular dysplasia of aorta causing stenosis of the origin of superior mesenteric and celiac artery was rare in medical literature.", "summary": "A 28 year old Asian female presented with acute onset left sided abdominal pain and watery diarrhea. She had a laparotomy due to further deterioration. It showed infracted small intestine, gall bladder and parts of liver. Abdomen had to be closed without any therapeutic procedure. She died in early post operative period. Autopsy showed fibro muscular dysplasia of superior mesenteric artery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 28 year old Asian female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had acute onset left sided abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had watery diarrhea.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a laparotomy due to further deterioration.", "support_label": "supported", "is_refined": false }, { "subclaim": "The laparotomy showed infracted small intestine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The laparotomy showed an infarcted gall bladder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The laparotomy showed infarction of parts of the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "The abdomen was closed without any therapeutic procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "She died in the early post operative period.", "support_label": "supported", "is_refined": false }, { "subclaim": "Autopsy showed fibro muscular dysplasia of the superior mesenteric artery.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2955_en.txt", "fulltext": "We present a 30-month-old male child with a normal perinatal history who was referred to our center with a history of decreased sensation over the gluteal region along with persistent dribbling of urine for 6 months. Neurological examination was normal, except for decreased perianal sensations. He was able to walk but at a slower pace than before; however, the exact power could not be graded due to the age factor limiting communication. Magnetic resonance imaging (MRI) of the spine showed a well-defined intramedullary cystic lesion of size 12 \u00d7 8 \u00d7 8 mm in the conus medullaris at the T12-L1 level, which was hypointense on T1-weighted images and hyperintense on T2-weighted images with no perilesional edema, solid component, or contrast enhancement .\nThe patient underwent T12-L1 laminotomy under intraoperative monitoring. After a midline durotomy, the cyst was seen surfacing near the midline covered by a thin layer of gliotic tissue. The cyst was opened at its most superficial point and clear fluid akin to cerebrospinal fluid was drained. Repeated Valsalva maneuver confirmed that the central canal was separate from the cyst. There was no definite plane of dissection between the conus and the cyst. The cyst was marsupialized by suturing its wall to the arachnoid of the cord to prevent reclosure . This was followed by a watertight dural closure. The postoperative period was uneventful. On follow-up after 3 months, there was an increase in muscle strength with improved walking but dribbling continued to persist. Histopathological examination revealed arachnoid cells in the cyst wall along with glial tissue which was suggestive of an arachnoid cyst.", "summary": "We report a case of a 30-month-old child who presented with decreased gluteal sensation and urinary dribbling for 6 months. Apart from some slowness in walking, the power was normal in all four limbs. Imaging showed a non-enhancing, T2-weighted hyperintense 12 \u00d7 8 mm conus intramedullary cyst without any edema. A T12-L1 laminotomy followed by marsupialization of the cyst was done. Histopathology was suggestive of an arachnoid cyst. The postoperative course was uneventful with improvement in muscle strength and achievement of regular milestones. We also present the pertinent review of the literature to date.", "subclaim_evaluations": [ { "subclaim": "The patient is a 30-month-old child.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had decreased gluteal sensation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had urinary dribbling for 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging showed a non-enhancing, T2-weighted hyperintense 12 \u00d7 8 mm conus intramedullary cyst.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cyst showed no edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "A T12-L1 laminotomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Marsupialization of the cyst was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathology was suggestive of an arachnoid cyst.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative course was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was improvement in muscle strength.", "support_label": "supported", "is_refined": false }, { "subclaim": "Regular milestones were achieved.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1738_en.txt", "fulltext": "A 40 year old Malay male was seen at the emergency department with 1 week history of left hypochondriac pain with concurrent abdominal distention. He also complained of loss of appetite and feeling lethargic for 1 month duration. He had no fever, nausea, vomiting, changes in bowel habits or any history of bleeding diathesis. There was no history of trauma. Neither there were any significant past medical history nor family history of malignancy. He was an active smoker for 20 years but denied any alcohol consumption or substance abuse.\nOn clinical examination, he was afebrile, with an elevated heart rate of 110 beats per minute and a blood pressure measurement of 121/79 mmHg. Patient appeared pale. Abdominal examination revealed enlarged, non-tender liver and spleen. There was no ascites or peripheral lymphadenopathy. Cardiovascular and respiratory examinations were otherwise unremarkable.\nHaematological investigation revealed a low haemoglobin level at 6.4 g/dl. The patient had a white cell count (WCC) of 33.3 \u00d7 10^3 /uL and a platelet count of 568 \u00d7 10^3/uL. Differential WCC showed a predominant neutrophil count of 79.9%, lymphocyte count 8.9%, monocytes 9.6%, eosinophils 0.8%, basophils 0.8%, absolute neutrophil count of 25.63 \u00d7 10^3 /uL and absolute lymphocyte count of 2.95 \u00d7 10^3 /uL. There was an increase in lactate dehydrogenase levels (LDH) from 534 to 666 u/L. Peripheral blood film revealed leucocytosis with neutrophilia with no evidence of blast cells or atypical lymphocytes. Patient was reluctant to undergo a bone marrow aspiration and trephine biopsy. Abdominal ultrasonography demonstrated a large splenic collection. A contrast enhanced computerized tomography of the abdomen further revealed a large heterogenous splenic collection measuring 18 cm \u00d7 15 cm \u00d7 16.9 cm which was suggestive of a splenic haematoma [Fig. , and ]. There were no intra abdominal or pelvic lymph nodes enlargement. Based on computed tomography findings, a preliminary diagnosis of spontaneous splenic rupture was made. A surgical consult was obtained and an explorative laparotomy was performed on the patient. Intra operative findings showed a ruptured spleen with extensive adhesions to the omentum. No intra peritoneal lymph nodes enlargement were found. Splenectomy was then performed and subsequently, the patient was transferred to intensive care unit for close observation.\nFrom a histological perspective, the gross appearance of the obtained specimen revealed an enlarged spleen with irregular outer surfaces. A cut section of the spleen showed a firm, cream coloured layer occupying almost entire spleen with large area of necrosis with splenic infarcts. There as minimal amount of normal looking parenchyma tissues at the peripheral aspect of the specimen. Further histological examination revealed a diffuse infiltration of malignant lymphoid cells, which exhibited irregular nuclear membrane with vesicular nuclear chromatin and prominent nucleoli. The adjacent splenic parenchyma showed a congested and expanded red pulp with infiltration by atypical lymphoid cells [Fig. ].\nThe histological report confirmed the presence of diffuse large B-cell non-Hodgkin\u2019s lymphoma (NHL) via immunohistochemical testing. Immunohistochemical staining showed the cells to be positive to CD20 (diffuse), BCL-2, BCL-6 (> 30%), and MUM-1 (> 30%) and negative to CD3, CD10, Cyclin-D1, Tdt, CD30 and ALK. Ki67 proliferative index was > 80%. In accordance with the WHO classification of Lymphoid Neoplasm [, ], these findings were consistent with the diagnosis of a diffuse large B-cell non-Hodgkin\u2019s lymphoma, non-germinal center B-cell (non-GCB) type. Further molecular studies to assess MYC / BCL-2 / BCL-6 translocation or rearrangement was not done as the fluorescence in situ hybridization (FISH) analysis was not available in our local laboratory settings. Thirteen days later, the patient was discharged with prophylactic meningococcal, pneumococcal and influenza vaccinations. He was referred to the haemato-oncologist outpatient clinic at a tertiary care centre for post - operative chemotherapy. Unfortunately, the patient did not turn up for subsequent follow ups, rendering it difficult to further document any information with regards to treatment response in this report.", "summary": "A 40-year-old man presented with 1\u00a0week history of left hypochondriac pain associated with abdominal distention. There was no history of preceding trauma or fever. Clinical examination revealed signs of tachycardia, pallor and splenomegaly. He had no evidence of peripheral stigmata of chronic liver disease. In addition, haematological investigation showed anemia with leucocytosis and raised levels of lactate dehydrogenase enzyme. However, peripheral blood film revealed no evidence of any blast or atypical cells. In view of these findings, imaging via ultrasound and computed tomography of the abdomen was performed. The results of these imaging tests showed splenic collections that was suggestive of splenic rupture and hematoma. Patient underwent emergency splenectomy and the histopathological report confirmed the diagnosis as DLBCL.", "subclaim_evaluations": [ { "subclaim": "The patient is a 40-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a 1-week history of left hypochondriac pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had abdominal distention.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no history of preceding trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed tachycardia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed pallor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed splenomegaly.", "support_label": "supported", "is_refined": false }, { "subclaim": "Haematological investigation showed anemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Haematological investigation showed leucocytosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Haematological investigation showed raised lactate dehydrogenase levels.", "support_label": "supported", "is_refined": false }, { "subclaim": "Peripheral blood film showed no evidence of blasts.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound and computed tomography of the abdomen were performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging showed splenic collections.", "support_label": "supported", "is_refined": false }, { "subclaim": "The imaging findings were suggestive of splenic rupture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The imaging findings were suggestive of splenic hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent emergency splenectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological report confirmed the diagnosis as DLBCL.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2265_en.txt", "fulltext": "A 70-year-old male with a history of hypertension, diabetes mellitus, and atrial fibrillation presented to the emergency department with chest pain lasting for 1 hour. The patient did not have any previous neurologic deficits or surgical, family, or genetic history, although he was a heavy smoker (75 pack-years). His initial blood pressure was 109/62 mmHg with a heart rate of 103 beats per minute. There were no remarkable findings upon physical exam. The electrocardiogram (ECG) showed ST segment elevation in leads II, III, and aVF and reciprocal changes in leads I and aVL, suggestive of ST elevation myocardial infarction. Initial troponin I level (0.021 ng/mL [0\u20135 ng/mL]) was unremarkable. The patient was started on intravenous unfractionated heparin (UFH).\nThe patient was immediately moved to the catheterization lab for emergent percutaneous coronary intervention (PCI) of ST elevation myocardial infarction. Vital signs were normal during the femoral artery puncture and insertion of a 6 French (Fr) sheath into the right femoral artery (FA). We punctured at the femoral head level without any mispuncutures during the process. After puncture and before coronary angiography (CAG), however, the patient went into ventricular fibrillation and the blood pressure became unmeasurable. Cardiopulmonary resuscitation (CPR) was immediately initiated with defibrillation every 2 min, although normal rhythm of vital signs were not recovered. As CPR was performed for a total of 30 min, we concurrently inserted a venoarterial ECMO. A 16.5 Fr (external diameter: 5.5 mm) arterial and 21 Fr (external diameter: 7 mm) venous cannula was inserted through the right FA and femoral vein (FV), respectively. CAG revealed an extensive thrombotic occlusion of the mid right coronary artery (RCA) with thrombolysis in myocardial infarction (TIMI) 0 flow distally. A drug eluting stent (Biomime\u2122 4.0 \u00d7 19 mm) was inserted to the lesion and the RCA restored a TIMI 2 flow (pain-to-balloon time: 120 min).\nAfter the PCI, the patient was moved to the intensive care unit for ECMO care. Initial echocardiography showed a left ventricular ejection fraction (LVEF) of 15% and an extensive regional wall motion abnormality of the RCA territory. However, there was blood pressure drop with concurrent massive nasal and gastrointestinal bleeding. Hemoglobin level became 5.9 g/dL, which was approximately 8 g/dL decrease compared with initial levels. Blood pressure was recovered to normal after massive transfusion; however, we lowered the target activated partial thromboplastin time to approximately 40 s to prevent additional bleeding. There were no cannulation site complications such as hematoma or signs of infection during ECMO care, although diffuse swelling developed in the right lower extremity (LE) the next few days. Pneumatic compression devices were applied to both LEs to prevent DVT. ECMO therapy was maintained for 4 days, while vital signs slowly recovered. As the LVEF was restored to 46% on the 4th day, the ECMO was weaned and removed. The ECMO cannulas were removed by manual compression. Despite the risk of stent thrombosis, dual-antiplatelet therapy was stopped after ECMO removal (day 4) in concern of additional bleeding.\nOn the 7th day of admission, the patient recovered orientation. However, leg edema did not improve despite ECMO removal. He also started complaining impaired function, pain, and hypesthesia of the LE. Compartment syndrome was initially suspected. We clinically ruled out compartment syndrome , since the patient was negative for Homan\u2019s sign and had good distal pulsation with warm circulation. The patient had burning sensation and Grade 3 weakness in hip and knee flexion motions with no deep tendon reflex. Neurologic findings were not dermatome specific. LE Doppler sonography and computed tomography (CT) showed DVT extending from the right external iliac vein to the calf vein without any evidence of puncture site hematoma or intramural bleeding . The patient was started on rivaroxaban (15 mg twice daily) for DVT (day 8). The swelling of the right LE gradually improved over the next 30 days, although his pain and weakness were not alleviated. As the patient was suspected to have post-thrombotic syndrome (PTS), which is pain and abnormal sensation after the onset of DVT, further studies such as the nerve conduction study (NCS) or electromyography were not considered until later on. The patient was discharged to a rehabilitation hospital on the 35th day.\nDuring outpatient department follow up, the patient consistently had pain, abnormal sensation, and weakness in the right LE, which resulted in insomnia and depression. Although he was given thioctic acid (600 mg qd) and pregabalin (150 mg bid) during outpatient department follow up, his pain remained. Femoral and pulmonary arterial CT angiography was performed 100 days post-ECMO insertion showed no thrombus in the right LE or pulmonary arteries. However, the NCS revealed no sensory nerve action potential in the right peroneal nerve and tibial nerve, suggestive of impaired sensation. Additionally, the compound muscle action potential was not observed in the right femoral , peroneal and tibial nerve, indicating motor nerve palsy. These results collectively suggested FN. The patient is continuing rehabilitation exercises and slowly recovering from the weakness, although the tingling sensation remains to a lesser degree. The patient shares his regrets on his previous smoking habits which caused his myocardial infarction and eventually FN. An informed consent for publishing data was obtained from the patient. A timeline of events is summarized in Table .", "summary": "A 70-year old male presented to the emergency department for chest pain. The patient had cardiac arrest before percutaneous coronary intervention (PCI) and was inserted with ECMO. Although he was successfully weaned from ECMO 4 days after PCI, he consistently complained swelling, abnormal sensation, and weakness in his right lower extremity, where the cannulas were inserted. Imaging studies showed deep vein thrombosis (DVT) in his right leg, which was further treated with anticoagulants. Symptoms, however, remained after the regression of DVT. Nerve conduction study revealed femoral neuropathy, which may have been caused by ECMO cannula compression and tissue swelling.", "subclaim_evaluations": [ { "subclaim": "The patient is a 70-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented to the emergency department for chest pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cardiac arrest before percutaneous coronary intervention.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was inserted with ECMO.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was successfully weaned from ECMO 4 days after PCI.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of swelling in his right lower extremity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of abnormal sensation in his right lower extremity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of weakness in his right lower extremity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cannulas were inserted in the right lower extremity.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging studies showed deep vein thrombosis in the right leg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The DVT was treated with anticoagulants.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms remained after the regression of DVT.", "support_label": "supported", "is_refined": false }, { "subclaim": "A nerve conduction study revealed femoral neuropathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Femoral neuropathy may have been caused by ECMO cannula compression.", "support_label": "supported", "is_refined": false }, { "subclaim": "Femoral neuropathy may have been caused by tissue swelling.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_716_en.txt", "fulltext": "A 49-y-old man admitted to an emergency department in 21 December 2005, with the complaint of drowsiness and quadriparesia. On admission, the patient was afebrile and had a blood pressure of 200/110 mmHg, pulse rate of 95/min and, a body mass index of 32 kg/m2. On physical examination, he had facial plethora, central obesity, pitting edema of limbs, without evidence of purple striae or hyperpigmentation. On neurologic examination, cranial nerves function was intact, proximal and distal force were 3/5, and tendon reflexes were diminished. Other examination was unremarkable. His problem was started a year ago with weight gain (4 kg), fatigue, proximal muscle weakness, easy bruising and hypertension. He didn\u2019t complaint paroxysmal hypertension, headache, palpitation, or sweating. He had been smoker of 20 pack/y for almost 30 years, with no previous medical or surgical history, and no family history for endocrine disease. Initial work up on admission revealed marked hypokalemia (2.1 mEq/L), metabolic alkalosis (pH: 7.58, HCO3:57.2 mEq/L) and blood glucose of 330 mg/dL. Electrocardiogram showed long QT interval (0.52 s), inverted T wave, and prominent U wave in precordial leads. The patient admitted in coronary care unit. According to high suspicious of CS, 24-h urine for urinary free cortisol (UFC) was collected. Laboratory data revealed UFC greater than 1000 \u03bcg/24 h (reference value: 50\u2013149 \u03bcg/24 h), serum ACTH 257 pg/mL at 8 AM (reference value: 9\u201346 pg/mL), and morning serum cortisol 57 \u03bcg/dL (reference value:5.5\u201326.1 \u03bcg/dL) . Following 8 mg oral administration of dexamethasone at 11 PM, no suppression was found at morning serum cortisol level (67 \u03bcg/dL). Considering ACTH-dependent CS, dynamic pituitary magnetic resonance imaging (MRI) was done that did not show pituitary adenoma; spiral chest and abdominopelvic computed topographies (CT) were unremarkable, except of the significant enlargement of bilateral adrenal glands. Treatment with ketoconazole, 200 mg every 12 h, was initiated to control hypercortisolism. According to persistent hypokalemia despite excess potassium supplement (> 120 mEq/day) 2 days after starting ketoconazole, the patient was scheduled for bilateral trans-abdominal open adrenalectomy on 28 December 2005. The weights and sizes of excised right and left adrenal glands were 18 g, 6\u00d7 3\u00d7 0.8 cm and 20 g, 6\u00d7 3.5\u00d7 1 cm, respectively. Microscopic examination revealed diffuse adrenocortical hyperplasia. Three days after surgery, 24-h UFC, morning serum cortisol and ACTH levels decreased to 27 \u03bcg/24-h, 2.2 \u03bcg/dL, 44 pg/mL, respectively, furthermore blood pressure and serum potassium and glucose levels were normalized. The patient was discharged on daily dose of 5 mg prednisolone and 0.1 mg fludrocortisone. All signs and symptoms of CS were resolved gradually during 4 months, and 24-h UFC was consistently less than 4 \u03bcg/24-h. He remained asymptomatic and during annual laboratory follow-ups results of serum ACTH and UFC were unremarkable, i.e. ACTH < 50 pg/mL, UFC < 4 \u03bcg/24-h. In November 2016, serum ACTH began to rise, and in November 2017 reached to 341 pg/mL . Reassessment for ectopic ACTH producing NET was performed using spiral neck, chest, and abdominopelvic CT-scans. A 2 cm mass in the middle lobe of the right lung was found and dynamic contrast enhanced pituitary MRI and Technetium-99 m-octerotide scan were normal . A CT-guided biopsy from the lung mass showed a tumor composed of solid nests of small monotonous cells with no atypia or mitotic activity, suggesting an ACTH-producing carcinoid tumor. Histologic examination of the resected right middle lobe revealed carcinoid tumor without involvement of hilar, subcarinal and intralobar lymph nodes. Immunohistochemical (IHC) staining showed diffuse positivity for chromogranin, synaptofysine, and ACTH ; the proliferation marker of Ki-67 was positive in 1% of the neoplastic cells, with the final diagnosis of ACTH-producing carcinoid tumor. Postoperative course was uneventful, and serum ACTH level decreased to less than 100 pg/mL. Approximately 7 months later, serum ACTH level had an upward trend to 171 pg/mL . Spiral chest CT scan revealed at least 2 nodules measuring up to 5 mm in the lower lobe of the right lung. There were also suspicious lytic bone lesions in thoraco-abdominal CT. Subsequently, whole body bone scan with TC99 was performed suggesting multiple metastatic bone lesions at clavicles, ribs, iliac, temporal and parietal bones . CT-guided left iliac wing biopsy revealed thick sclerotic osteoid tissue, without neoplastic involvement, IHC staining for cytokeratin and chromogranin were negative, although serum chromogranin level was reported 2062 ng/mL (reference value: < 100 ng/mL). Hence, according to the high level of the chromogranin, as well as the presence of nodular lesions in the lung, the patient was managed as a metastatic NET, treatment with bisphosphonate and somatostatin receptor analogous was started.", "summary": "Here, we describe a 49-year-old-man with cushingoid feature, drowsiness and quadriparesis came to emergency department at December 2005. Laboratory tests revealed hyperglycemia, metabolic alkalosis, severe hypokalemia, and chemical evidence of an ACTH-dependent hypercortisolism as morning serum cortisol of 57\u2009\u03bcg /dL without suppression after 8\u2009mg dexamethasone suppression test, serum ACTH level of 256\u2009pg/mL, and urine free cortisol of >\u20091000\u2009\u03bcg /24\u2009h. Imaging showed only bilateral adrenal hyperplasia, without evidence of pituitary adenoma or ectopic ACTH producing tumors. Importantly, other diagnostic tests for differentiating Cushing disease (CD) from ectopic ACTH producing tumor, such as inferior petrosal sinus sampling (IPSS), corticotropin releasing hormone (CRH) stimulation test, octreotide scan or fluorodeoxyglucose (FDG)-positron emission tomography (PET) scan were not available in our country at that time. Therefore, bilateral adrenalectomy was performed that led to clinical and biochemical remission of hypercortisolism and decreased ACTH level to <\u200950\u2009pg/mL, findings suggestive of a primary focus of NET in adrenal glands. After 11\u2009years uncomplicated follow up, the ACTH level elevated up to 341\u2009pg/mL and re-evaluation showed a 2\u2009cm nodule in the middle lobe of the right lung. Surgical excision of the pulmonary nodule yielded a carcinoid tumor with positive immunostaining for ACTH; leading to decrease in serum ACTH level to 98\u2009pg/mL. Subsequently after 7\u2009months, serum ACHT levels rose again. More investigation showed multiple lung nodules with metastatic bone lesions accompanied by high serum chromogranin level (2062\u2009ng/mL), and the patient managed as a metastatic NET, with bisphosphonate and somatostatin receptor analogues.", "subclaim_evaluations": [ { "subclaim": "The patient is a 49-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cushingoid features.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had drowsiness.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had quadriparesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient came to the emergency department in December 2005.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed hyperglycemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed metabolic alkalosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed severe hypokalemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Morning serum cortisol was 57 \u03bcg/dL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The 8 mg dexamethasone suppression test did not suppress cortisol.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum ACTH level was 256 pg/mL.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Urine free cortisol was >1000 \u03bcg/24 h.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging showed bilateral adrenal hyperplasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no evidence of a pituitary adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no evidence of an ectopic ACTH-producing tumor.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Inferior petrosal sinus sampling was not available in the country at that time.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A corticotropin-releasing hormone stimulation test was not available in the country at that time.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "An octreotide scan was not available in the country at that time.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A fluorodeoxyglucose PET scan was not available in the country at that time.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Bilateral adrenalectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilateral adrenalectomy led to clinical remission of hypercortisolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilateral adrenalectomy led to biochemical remission of hypercortisolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum ACTH decreased to <50 pg/mL after bilateral adrenalectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings were suggestive of a primary focus of neuroendocrine tumor in the adrenal glands.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After 11 years of follow-up, ACTH levels increased to 341 pg/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 2 cm nodule was found in the middle lobe of the right lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgical excision of the pulmonary nodule was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary nodule was a carcinoid tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was positive for ACTH immunostaining.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum ACTH decreased to 98 pg/mL after excision.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 7 months, serum ACTH levels rose again.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multiple lung nodules were found.", "support_label": "supported", "is_refined": false }, { "subclaim": "Metastatic bone lesions were found.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum chromogranin level was 2062 ng/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was managed as having metastatic neuroendocrine tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bisphosphonate was used in the management.", "support_label": "supported", "is_refined": false }, { "subclaim": "Somatostatin receptor analogues were used in the management.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2035_en.txt", "fulltext": "In July 2021, a 34-year-old woman came to the emergency department with a five-day history of fever and a dull ache in the chest radiating to the right arm.\nShe visited her family doctor one week before because the ache in the chest was given a visual analogue scale score of 9-10 and gradually worsened. There was no redness or irregularity in the skin of the chest area. Blood tests were normal. She was given nonsteroidal anti-inflammatory drugs and opioids for pain relief, but the condition did not improve, therefore she came to our hospital for emergency treatment.\nThere is no relevant history of past illness, intravenous drug abuse, inflammatory joint alterations, trauma, and spreading from a source of infection (dental, skin areas).\nThe patient was a non-smoker. She claimed to have no allergies to food or medicines, no operations were performed. The patient denied any family history of arthritis.\nBody mass index - 22.4 kg/m2. The vital signs were as follows: Body temperature - 36.9\u2103; blood pressure - 98/60 mmHg; heart rate - 100 beats per minute; respiratory rate - 19 breaths per min During palpation, there were no swollen or painful lumps and lymph nodes in the typical axilla, neck, or groin areas; the chest was painless.\nPrimary laboratory tests showed significantly increased inflammatory markers: C-reactive protein (CRP) 256.0 mg/L (Ref \u2264 5 mg/L), leukocytosis white blood cells (WBCs) - 14.20 \u00d7 109/L (Ref from 4.5 to 11.0 \u00d7 109/L); elevated procalcitonin 0.69 \u00b5g/L (Ref < 0.1 ng/mL) and liver enzymes: Aspartate aminotransferase - 239 U/ L (Ref \u2264 40), alanine aminotransferase - 334 U/L (Ref \u2264 40); normal troponin - 0 ng/L (Ref \u2264 16), and elevated D-dimers 1725 \u00b5g/L (Ref < 250 \u00b5g/L). No abnormality was found in urine analyses.\nThe electrocardiogram showed only sinus tachycardia - 103 bpm. Pulmonary embolism, aortic aneurysm, pneumonia, pneumothorax, and even rib fracture were suspected. Thoracic CT angiography, non-contrast chest CT, and X-ray of the thoracic spine, ribs, and sternum were performed, as well as diagnostic ultrasound with PD (by an abdominal sonographer) of the soft tissues at the sternum, but no pathology was detected.", "summary": "A 34-year-old immunocompetent woman presented with a fever and a dull ache in the chest radiating to the right arm. Traumatic injury and the most common respiratory and cardiac disorders were ruled out. Blood cultures came back positive for Staphylococcus aureus, and sepsis was confirmed. A small lump was noted on the chest during the first week of hospitalization. Superb microvascular imaging was performed and septic arthritis of the manubriosternal joint was detected. MRI confirmed the diagnosis and showed septic arthritis of the manubriosternal joint with several localized abscesses behind the sternum. The patient was treated for three weeks with intravenous antibiotics and the outcome was favorable: Inflammatory markers became normal, and the lump disappeared. Three months later, the patient was examined for a new episode of mild pain in the sternum and was diagnosed with persistent perichondritis by ultrasound in comparison with MRI.", "subclaim_evaluations": [ { "subclaim": "The patient is a 34-year-old immunocompetent woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with a fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a dull ache in the chest radiating to the right arm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Traumatic injury was ruled out.", "support_label": "supported", "is_refined": false }, { "subclaim": "The most common respiratory disorders were ruled out.", "support_label": "supported", "is_refined": false }, { "subclaim": "The most common cardiac disorders were ruled out.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood cultures were positive for Staphylococcus aureus.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Sepsis was confirmed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A small lump was noted on the chest during the first week of hospitalization.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Superb microvascular imaging was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Septic arthritis of the manubriosternal joint was detected.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "MRI confirmed the diagnosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "MRI showed septic arthritis of the manubriosternal joint.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "MRI showed several localized abscesses behind the sternum.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was treated for three weeks with intravenous antibiotics.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Inflammatory markers became normal.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The lump disappeared.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Three months later, the patient was examined for a new episode of mild pain in the sternum.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Persistent perichondritis was diagnosed by ultrasound.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 4 }, { "id": "multiclinsum_test_1914_en.txt", "fulltext": "A 43-year-old woman was referred to our institution with a neck mass in the left submandibular region. She was studied in an outside hospital, where a neck ultrasound showed a multinodular goiter and a CBT on the left carotid bifurcation. A neck Computed tomography angiography (CTA) demonstrated a carotid body tumor (3.8 cm \u00d7 2.5 cm \u00d7 3.3 cm) classified as Shamblin II and an intrathoracic multinodular thyroid gland with a right lobe extension of 11.9 cm \u00d7 9.7 cm and the left lobe of 25.2 cm \u00d7 21.3 cm with caudal retrosternal growth and evidence of slightly trachea deviation .\nThyroid function test (TFT) were normal, serum antithyroglobulin antibodies and thyroperoxidase antibody (TPO) were undetectable. Thyroid gammagram was performed reporting a multinodular goiter. Fine needle aspiration was performed demonstrating nonmalignant cells. A total thyroidectomy was performed with a transverse lower neck incision (Kocher incision), posteriorly, CBT was resected by an extension of the previous Kocher incision to the anterior border of the sternocleidomastoid muscle using the retrocarotid reported previously in our group as an effective technique, also two surrounding lymph nodes were resected to rule out malignancy . The pathology report demonstrated a paraganglioma with negative lymph nodes invasion and a multinodular goiter .\nThe patient recovered satisfactorily after the surgery and she was discharged in postoperative day number three, she currently continues her follow-up as our patient. Twelve months after the surgery, she does not present any complaints. She is currently on levothyroxine and calcium carbonate.", "summary": "We herein present the case of a 43-year old woman with the aforementioned association. As a part of the diagnostic evaluation, an ultrasound was performed, revealing both conditions simultaneously. The surgery took place with the aim of resecting both lesions during the same intervention. The patient was discharged without complications.", "subclaim_evaluations": [ { "subclaim": "The patient is a 43-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "An ultrasound was performed as part of the diagnostic evaluation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ultrasound revealed both conditions simultaneously.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery aimed to resect both lesions during the same intervention.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged without complications.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_83_en.txt", "fulltext": "A 38-year-old male with no past medical history asked a bystander to call emergency medical services (EMS) after he had fallen 12 feet off a fire escape and landed on his right ankle. An Advanced Life Support ambulance was dispatched and, upon arrival, paramedics found the patient on the ground and unable to ambulate. He complained of 8/10 pain to his right ankle. Airway, breathing, and circulation to all four extremities were intact, and initial vital signs were heart rate (HR) of 100 beats per minute, blood pressure (BP) of 142/76 millimeters of mercury (mm Hg), respiratory rate (RR) of 20 breaths per minute, and oxygen saturation (SpO2) of 98%. Physical exam was notable for a right ankle deformity.\nParamedics on scene immobilized the patient\u2019s leg in a splint, after which they contacted their online medical control (OLMC) center to discuss options for analgesia. The OLMC physician authorized the delivery of a dose of nebulized ketamine via BAN at 0.75 milligrams per kilogram (mg/kg) mixed with three milliliters (mL) of normal saline. During administration, the patient reported dizziness, which was rated one on a scale from zero to four using the Side Effects Rating Scale of Dissociative Anesthetics. This is a scoring system used to grade severity of medication side effects where zero represents \u201cno change\u201d in symptoms and four represents \u201cvery bothersome\u201d symptoms. He did not become agitated, dissociated, or sedated.\nThirty minutes after the start of nebulization, pain was measured at 3/10. Repeat vitals at this time were HR 103 beats per minute, BP 128/79 mm Hg, RR 18 breaths per minute, and SpO2 97%. In the ED, at one hour after administration of nebulized ketamine, the patient reported a return of his pain, and was given a dose of four mg IV morphine. Radiograph revealed a right tibial pilon fracture. He was placed in a posterior short leg splint and admitted to the orthopedic service; he was operated on the next day for open reduction and internal fixation of the right ankle joint. He was subsequently discharged post-procedure with orthopedic follow-up.", "summary": "We present a case of a patient with right ankle fracture after a 12-foot fall who subsequently received 0.75 milligrams per kilogram of nebulized ketamine via BAN in the prehospital setting. The patient reported improvement of pain from 8/10 to 3/10 on the pain scale without need for additional pain medication during prehospital transport. This report supports the use of nebulized ketamine via BAN in the prehospital setting for acute traumatic limb injuries.", "subclaim_evaluations": [ { "subclaim": "The patient had a right ankle fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fracture occurred after a 12-foot fall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received 0.75 milligrams per kilogram of nebulized ketamine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nebulized ketamine was administered via BAN.", "support_label": "supported", "is_refined": false }, { "subclaim": "The administration occurred in the prehospital setting.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported improvement of pain from 8/10 to 3/10.", "support_label": "supported", "is_refined": false }, { "subclaim": "The improvement occurred without additional pain medication.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The improvement occurred during prehospital transport.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "This report supports the use of nebulized ketamine via BAN.", "support_label": "supported", "is_refined": false }, { "subclaim": "The use is for acute traumatic limb injuries.", "support_label": "supported", "is_refined": false }, { "subclaim": "The use is in the prehospital setting.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1203_en.txt", "fulltext": "A 37-year-old woman was presented to the emergency room with abrupt severe right upper abdominal pain. The pain was squeezing and started suddenly after breakfast. The pain was not accompanied by vomiting or fever. The patient had previously been treated at the Department of Medicine in Samsung Medical Center with a diagnosis of EGPA. After successful suppression of blood hypereosinophilia with combination of prednisolone and azathioprine in recent months, she had been in the process of tapering prednisolone down to 15 mg per day. However, after dose reduction, her eosinophil counts slowly increased to 1989 cells/\u00b5L and levels of aspartate aminotransferase and alanine aminotransferase were elevated from normal to more than 300 U/L with mild abdominal pain. Consequently, her dose of prednisolone was raised back to 60 mg per day. While waiting for admission for further evaluation, abdominal pain brought her to emergency room.\nFive years ago, her first visit was prompted by symptoms of sinusitis, rash and eosinophilia. Three months later, numbness and cutting pain in both upper and lower extremities with fever, myalgia, and asthma developed. A nerve conduction study suggested multifocal sensorimotor neuropathy. Biopsy of the sural nerve revealed ischemic change resulting from vasculitis with prominent eosinophilic infiltration. Although perinuclear anti-neutrophil cytoplasmic antibodies were not detected, the patient was diagnosed as EGPA. After repeated intravenous cyclophosphamide pulse therapy with a high dose of systemic steroids, most symptoms were resolved. Sinusitis, presented as an initial symptom, improved after treatment at an early stage and otolaryngologic complication did not appear afterwards.\nHowever, whenever the tapering a dose of steroids was attempted, she developed new symptoms such as myalgia and arthralgia. She even experienced dry gangrene in the fingertips of both hands because of arterial thrombosis when her eosinophil count increased up to 6000 cells/\u00b5L . Duplex scan for arteries and veins indicated the total occlusion of the right distal ulnar artery and left medial forearm ulnar artery. The study also revealed a total occlusion of both mid-anterior tibial arteries, whereas toes of both feet were intact as other vessels of lower extremities were not involved. Hypercoagulability was thought to be caused either directly or indirectly by hypereosinophilia. We recommended mepolizumab, a monoclonal antibody to interleukin-5 used to interrupt eosinophil production, to reduce eosinophil count. But the patient refused it because of cost. We added aspirin and calcium channel blockers after cardiologic consultation. After the affected fingers were dried up, necrotized fingertips were amputated by orthopedic surgeon.\nInitial vital signs in the ER showed a blood pressure of 85/45 mmHg, a heart rate of 98 beats per minute with a temperature of 36.1\u2019C, and a respiratory rate of 16 breaths per minute. Physical examination revealed mild tenderness in the right upper abdomen without rebound tenderness. The complete blood count revealed leukocytosis of 17,660 white blood cells/\u00b5L. Absolute eosinophil count was 1120 cells/\u00b5L. The erythrocyte sedimentation rate was 29 mm/hr, CRP was 3.7 mg/dL and total immunoglobulin E was 107 kU/L.\nAn abdomen-pelvis CT demonstrated subcapsular hematoma in the right hepatic lobe . Hemoperitoneum probably caused by multifocal hepatic capsular arterial bleeding was also detected. There was no evidence of bowel perforation. In a previous CT scan taken 1 year before, there had been no evidence of any aneurysm changes in the hepatic vessels. A celiac angiogram demonstrated multiple, various sized hepatic aneurysms in both lobes . The small aneurysms resembled the appearance of a string of beads, characteristically observed in polyarteritis nodosa (PAN). Huge aneurysms larger than 1 cm in size were noticed in S7 and S8. Emergency embolization was performed. The huge aneurysm and the aneurysms with bead-like appearance in S7 and S8 were successfully occluded. Although several small aneurysms in S5, S6 and the left lobe still remained, no further embolization was performed to conserve hepatic function.\nMeticulous review of the abdomen-pelvis CT did not reveal evidence of aneurysms in other abdominal organs. After emergency intervention, vital signs became stable and numbness of both hands and feet improved. Based on her clinical course, we strongly recommended to add mepolizumab to control hypereosinophilia and reduce the dose of steroid. After administration of mepolizumab in addition to the previous steroid and cyclophosphamide therapy, eosinophil count became stable and was reduced to a near zero percentage of total white blood cell count.", "summary": "A known EGPA patient visited to the emergency room (ER) with abrupt squeezing abdominal pain. She had suffered from gangrene in the fingertips of both hands for 1 year because of arterial thrombosis associated with hypereosinophilia. However, her absolute eosinophil count in the ER was 1120 cells/\u00b5L. An abdomen-pelvis CT demonstrated subcapsular hematoma in the right hepatic lobe. A celiac angiogram demonstrated multiple sized aneurysms in both hepatic lobes and some aneurysms in S7 and S8 were huge, more than 1\u00a0cm in size. The shape of the small aneurysms resembled a string of beads, as in polyarteritis nodosa. Given the clinical situation, emergency embolization was performed. Before this patient visited to the ER, she had been treated with a high dose of systemic corticosteroid, azathioprine, and cyclophosphamide. After addition of mepolizumab, the eosinophil count remained stable state with a near zero percentage of total white blood cell count.", "subclaim_evaluations": [ { "subclaim": "The patient is a known EGPA patient.", "support_label": "supported", "is_refined": false }, { "subclaim": "She visited the emergency room with abrupt squeezing abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had gangrene in the fingertips of both hands for 1 year.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The gangrene was due to arterial thrombosis associated with hypereosinophilia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her absolute eosinophil count in the ER was 1120 cells/\u00b5L.", "support_label": "supported", "is_refined": false }, { "subclaim": "An abdomen-pelvis CT showed subcapsular hematoma in the right hepatic lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "A celiac angiogram showed multiple aneurysms in both hepatic lobes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Some aneurysms in S7 and S8 were more than 1 cm in size.", "support_label": "supported", "is_refined": false }, { "subclaim": "The shape of the small aneurysms resembled a string of beads.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency embolization was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Before the ER visit, she was treated with a high dose of systemic corticosteroid.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was also treated with azathioprine.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was also treated with cyclophosphamide.", "support_label": "supported", "is_refined": false }, { "subclaim": "After adding mepolizumab, the eosinophil count remained stable.", "support_label": "supported", "is_refined": false }, { "subclaim": "The eosinophil count was near zero percentage of total white blood cell count.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1984_en.txt", "fulltext": "A 62-year-old Japanese woman was referred for bilateral dry eyes, with Schirmer\u2019s test results of 0 mm for both eyes. Four years previously, she had been diagnosed with primary rheumatoid arthritis (RA) and secondary Sjogren\u2019s syndrome. She was being treated with 6 mg of methotrexate. CT scans appeared normal when she was first diagnosed with RA. Just prior to her dry eye referral, her previous hospital found C-reactive protein (CRP) and lactate dehydrogenase (LDH) levels to be significantly increased (CRP of 11.83 and LDH of 952), leading to a suspicion of an underlying malignancy. A CT scan was done, and some lung opacities were found, but biopsies of bone marrow, pleural fluid and cerebrospinal fluid (CSF) all revealed no neoplastic activity.\nWhile being treated for dry eye at our hospital, emergent hyperemia presented in the right eye coupled with fever and photophobia, for which she was admitted to the hospital. In the inpatient ward, hemorrhagic hypopyon that showed niveau-like hypopyon with hemorrhage as reported in previous case was seen on slit lamp. A distinct herpetic corneal lesion were noted via fluorescein staining. Keratic precipitates were noted, but no synechiae. HSV was specifically identified in the right eye via Checkmated Herpes-eye\u00ae, (Wakamoto Co., Ltd., Tokyo Japan). Corneal smear was done to rule out bacteria as a potential cause. Right eye visual acuity was found to be 20/500, while left eye visual acuity remained 20/20. Right eye intraocular pressure (IOP) was 16 mmHg and left eye IOP was 18 mmHg. The anterior segment of the right eye presented with hyperemia, dendritic keratitis, and intracameral fibrin deposits . Posterior segment appeared normal. Anterior segment optical coherence tomography (AS-OCT) further illustrate the fibrin deposits and hemorrhagic hypopyon . Body temperature was elevated to 38.5 \u00b0C, with a white blood cell count (WBC) of 10.4 \u00d7 103/\u03bcL (with neutrophils being 64.3%, lymphocytes 16.5%, monocytes 16.8%, eosinophils 1.9%, and basophils 0.5%) Treatment with topical acyclovir ophthalmic ointment (5 times daily), topical levofloxacin (5 times daily) and oral valacyclovir (3 times daily). Two days later, the dendritic keratitis began to regress.\nBy day 5 of treatment, the dendritic keratitis, fibrin, hypopyon had regressed, with only superficial, punctate keratitis and Descemet membrane folds remaining. WBC normalized, CRP dropped to 9.72 and body temperature dropped to 36 \u00b0C. The right eye\u2019s visual acuity recovered to 20/200, which was comparable to baseline on account of a cataract. Three weeks after hospitalization, symptoms had completely regressed; slit-lamp findings revealed no findings indicative of herpetic keratouveitis or recurrent hypopyon.\nNearly 3 months later, a fever and corneal opacities reoccurred. Again, a characteristic herpetic dendritic lesion, superficial punctate keratitis, and intracameral fibrin deposits were noted . WBC count remained normal, diminishing suspicion of RA flare-up. Due to the previously elevated LDH levels and previous rare viral presentation, malignancy was again suspected. A positon-emission tomography-computed tomography (PET-CT) showed significant diffuse lung opacities whereafter a lung biopsy was performed to confirm an intravascular B cell lymphoma . Rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP) regimen was begun immediately, and the corneal lesions and the lymphoma both went into complete remission. Over a year and a half later, there is still complete remission of the cancer and no corneal lesions or ocular symptoms .", "summary": "We present a case wherein a 62-year-old Japanese rheumatoid arthritis woman, with HSV uveitis, presented with hemorrhagic hypopyon in the anterior chamber and a fever with photophobia. Patient was treated with antiviral drugs which improved the hyphema and corneal lesions, but lesions recurred 3\u00a0months later. This rare presentation of HSV induced uveitis, and its subsequent recurrence, aroused suspicion of an additional hypopyon-inducing pathology. On account of previous history of lung opacities and elevated LDH, intravascular lymphoma was eventually diagnosed via lung biopsy. She was treated for the lymphoma which also completely resolved all ocular symptoms without any recurrence as of 1.5\u00a0years later.", "subclaim_evaluations": [ { "subclaim": "The patient is a 62-year-old Japanese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has rheumatoid arthritis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had HSV uveitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with hemorrhagic hypopyon in the anterior chamber.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had photophobia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with antiviral drugs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hyphema improved after treatment with antiviral drugs.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The corneal lesions improved after treatment with antiviral drugs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesions recurred 3 months later.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of lung opacities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had elevated LDH.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intravascular lymphoma was diagnosed via lung biopsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated for intravascular lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "All ocular symptoms resolved after treatment for lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no recurrence of ocular symptoms as of 1.5 years later.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2666_en.txt", "fulltext": "A 35-year-old male presented to their GP for treatment of hot flushes on finasteride (5-alpha reductase inhibitor) for hair loss, which he had recently stopped. The finasteride was stopped because of these side effects and a subsequent baseline prostate-specific antigen (PSA) showed a raised reading of 12.5ng/mL, which prompted referral to a urologist.\nNegative urine culture excluded urinary tract infection, and repeat PSA 6 weeks later demonstrated a rise to 14.6ng/mL. Digital rectal exam revealed a small, benign-feeling prostate which was non-tender. There was no family history of prostate cancer, and the patient did not have any physical or sexual activity prior to the PSA tests.\nMultiparametric MRI found a PIRADS 4 lesion in the anterior zone of the prostate (see ). PSMA PET identified focal and markedly increased tracer uptake in the anterior zone of the prostate concordant with the MRI lesion (see ). The SUVmax on the PSMA PET scan was 23.5, consistent with a site of active tumor. There was no evidence of lymphadenopathy or metastatic disease. Targeted trans-perineal prostate biopsies found Gleason 4+5=9 (Grade Group 5) acinar adenocarcinoma in 8 of 8 biopsy cores involving 80% of the total material sampled. No cribriform architecture was identified but there were features suspicious of extra prostatic extension on the biopsy. Sperm banking was completed and a robotic-assisted radical prostatectomy was performed with a novel RoboSling vascularized continence sling, an aggressive bilateral nerve spare and a bilateral pelvic lymph node dissection, without complication. Pathology demonstrated Gleason 4+5=9 adenocarcinoma with focal cribriform architecture, 0.6mm of extracapsular extension at the apex anteriorly, and clear margins, stage pT3a N0 M0 (see ).\nAt 12-month follow-up, the patient had an undetectable PSA, complete continence with 0 daily pad use, and reported erections rigid enough for penetration with acupuncture and daily Tadalafil (phosphodiesterase-5 inhibitor) for penile rehabilitation. The patient\u2019s father has since been diagnosed with Gleason 6 prostate cancer at the age of 67, screening having been prompted by the patient\u2019s diagnosis. On further history from relatives, his maternal grandmother had a history of breast cancer at age 89. Genetic testing, including BRCA1, BRCA2, PALB2 and TP53, was performed in the context of the high grade disease at a young age and did not identify a heritable cause. Please see for a treatment timeline schematic.", "summary": "A 35-year-old male, intermittently taking finasteride for hair loss, was found to have an elevated prostate-specific antigen (PSA) of 12.5ng/mL leading to an incidental diagnosis of high grade prostate cancer. Targeted trans-perineal prostate biopsy found Gleason 4+5=9 acinar adenocarcinoma, without cribriform architecture but with features suspicious for extracapsular extension. Robotic radical prostatectomy with bilateral pelvic lymph node dissection was performed and found Gleason 4+5=9 adenocarcinoma with focal cribriform architecture, extra prostatic extension and clear margins, stage pT3a N0 M0. PSA was undetectable at 12 months, continence was immediate, and the patient reported strong erections soon after surgery. Family history of prostate cancer and genetic testing were both negative.", "subclaim_evaluations": [ { "subclaim": "The patient is a 35-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was intermittently taking finasteride for hair loss.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had an elevated prostate-specific antigen (PSA) of 12.5ng/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The elevated PSA led to an incidental diagnosis of high grade prostate cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted trans-perineal prostate biopsy found Gleason 4+5=9 acinar adenocarcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy showed no cribriform architecture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy showed features suspicious for extracapsular extension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Robotic radical prostatectomy with bilateral pelvic lymph node dissection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The prostatectomy found Gleason 4+5=9 adenocarcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The prostatectomy showed focal cribriform architecture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The prostatectomy showed extra prostatic extension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The prostatectomy showed clear margins.", "support_label": "supported", "is_refined": false }, { "subclaim": "The stage was pT3a N0 M0.", "support_label": "supported", "is_refined": false }, { "subclaim": "PSA was undetectable at 12 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient achieved immediate continence.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported strong erections soon after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Family history of prostate cancer was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Genetic testing was negative.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2033_en.txt", "fulltext": "A 66-year-old female had complained of intermittent discomfort and pain in the right gluteal area. She had also noticed an alteration in bowel habit with recent constipation. The symptoms persisted, and she was treated with analgesia and laxatives.\nHowever, there was no specific diagnosis until she fell onto her back and fractured L2, L3 and L4 vertebrae which necessitated further imaging work-up with CT scan of the thoracolumbar spine. Of note, the fractures were stable and non-displaced. Hence, no need for surgical intervention. The CT scan performed to assess the spine revealed an incidental finding of a large mass extending from the right gluteal region into the pelvis. A CT scan of the pelvis was also performed, and this showed a large fatty intramuscular lesion extending into the pelvis through the greater sciatic notch . The differential diagnosis was listed as a possible lipoma or low-grade liposarcoma. As part of the diagnostic work-up for this right intramuscular gluteal mass with intrapelvic extension, the patient underwent MRI of the abdomen and pelvis. There was no suspicious soft tissue abnormality detected on the MRI of the abdomen but the MRI of the pelvis showed a large homogenous fat lesion noted in the right pelvic side wall between the gluteus maximus and gluteus medius muscles which extended into the pelvis via the greater sciatic foramen . There was no enhancing component. No heterogeneity or thickened or irregular septations were detected. The margins were distinct. The mass measures approximately 18.9\u202fcm\u202f\u00d7\u202f13\u202fcm\u202f\u00d7\u202f22.8\u202fcm. The intrapelvic component of the mass measures approximately 10.5\u202fcm\u202f\u00d7\u202f6.2\u202fcm\u202f\u00d7\u202f12.1\u202fcm. There was a leftward displacement of the rectum noticed as a result of the mass effect from the central pelvic mass .\nPhysical examination revealed an area of firm induration/possible mass in the lower aspect of the right gluteal compartment. This was not tender and there was no associated redness or discoloration of overlying skin. Digital rectal examination showed normal anal sphincter tone and no mass was palpated within the anorectum.\nThe patient proceeded to have a CT guided core needle biopsy of the mass. This showed scant fragments of fibroadipose and fibroconnective tissue without features of malignancy. There was focal myxoid change. However, the cytologic atypia that would warrant a diagnosis of atypical lipomatous tumor/well differentiated liposarcoma was absent. Furthermore, FISH for MDM2 amplification was attempted, but could not be performed due to sample inadequacy. The case was presented for discussion at the multidisciplinary tumor conference and the consensus recommendation was to proceed with surgical resection of the tumor. Following this, the patient underwent wide excision of the mass through a transgluteal approach and final pathology showed well-differentiated liposarcoma .\nRegarding follow up, the patient has been undergoing surveillance for 3 years. She was seen every 3 months for the first year after resection. Computerized tomographic scans of the chest, abdomen and pelvis were done every 6 months for the first year of surveillance. The patient was seen twice a year for the following 2 years. Computerized tomographic scans of the chest, abdomen and pelvis were done annually for years 2 and 3 of surveillance. The patient has remained disease-free; that is no evidence of local or distant recurrence of the liposarcoma or the sciatic hernia.", "summary": "A 66-year-old female presented with persistent pain in the right gluteal region. Physical examination coupled with CT/MRI scans identified a firm mass extending into the right pelvic side via the sciatic foramen. It measured approximately 18.9\u202fcm\u202f\u00d7\u202f13\u202fcm\u202f\u00d7\u202f22.8\u202fcm. The tumor was resected via transgluteal approach. Immunohistochemical and microscopic features were consistent with well-differentiated liposarcoma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 66-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with persistent pain in the right gluteal region.", "support_label": "supported", "is_refined": false }, { "subclaim": "A firm mass was identified extending into the right pelvic side via the sciatic foramen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass measured approximately 18.9\u202fcm\u202f\u00d7\u202f13\u202fcm\u202f\u00d7\u202f22.8\u202fcm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was resected via transgluteal approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical and microscopic features were consistent with well-differentiated liposarcoma.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_69_en.txt", "fulltext": "A 17-year-old neutered male European Shorthair cat was presented owing to an\ninability to jump, weakness and respiratory stridor. All these signs had started a\nfew months previously. The cat was kept strictly indoors, had no history of trauma\nand the owner did not report any other clinical signs or pre-existing disease. The\nphysical examination revealed a plantigrade stance, pelvic limb muscle atrophy that\nwas more severe on the right, broad facial features and inspiratory stridor.\nNeurological examination showed the cat had a reluctance to move, lameness of the\nhindlimbs and paraparesis with plantigradism. Postural reactions and flexor reflexes\nwere reduced in both pelvic limbs. Neurological signs were more severe on the right\npelvic limb. A lesion affecting the sciatic nerves, more severe on the right side,\nwas suspected because the cat was not ataxic, and the other nerves originating from\nL4\u2013S3 spinal cord (femoral nerve, pelvic nerve, pudendal nerve, etc) were apparently\nnot affected. A lesion affecting the nerve roots of the sciatic nerve at the level\nof the cauda equina could not be excluded, but was considered less likely because of\nthe marked asymmetry of the clinical signs and the absence of evidence of\ninvolvement of the pelvic and pudendal nerve and coccigeal nerves. Degenerative\n(lumbosacral stenosis, disc herniation), neoplastic (lymphoma, paraneoplastic\npolyneuropathy) or metabolic (lumbosacral stenosis associated with acromegaly,\ndiabetic polyneuropathy) conditions were included as differential diagnoses.\nRoutine laboratory examination, including a complete blood count, serum biochemistry\nand complete urinalysis, was unremarkable. Serum glucose concentration was\n5.4 mmol/l (reference interval [RI] 4.1\u20136.4 mmol/l) and serum fructosamine\nconcentration was 211 \u00b5mol/l (RI 220\u2013350 \u00b5mol/l). Serum total thyroxine\nconcentration was also normal (32 nmol/l; RI 10\u201360 nmol/l). Serum IGF-1\nconcentration, measured with a validated commercially available chemiluminescence\nassay (Immulite; IDEXX Laboratories), was higher than the assay detection limit (1000 ng/ml). Basal GH\nconcentration was not measured. Abdominal ultrasound evaluation revealed visceral\norgans of normal size (liver, spleen, pancreas, kidneys and adrenal glands). An\nechocardiography was performed, which showed no evidence of cardiac hypertrophy.\nA CT scan of the lumbosacral spine and the head was performed with a single slice\nhelical scanner (Siemens Somatom Emotion). The cat was placed in sternal recumbency\nunder general anaesthesia and a scan of the lumbosacral spine was obtained with a\n2 mm slice thickness. Subsequently, the head was scanned with 1 mm slice thickness,\npre- and post-contrast (Iomeprol with an iodine concentration of 300 mg/ml, dosage\nof 600 mg iodine/kg EV [Iomeron 300; Bracco]). In the precontrast CT examination,\nthe right cranial articular process of S1 was hypertrophic, with severe impingement\non the right L7\u2013S1 foramen . The left L7\u2013S1 foramen was also mildly stenotic due to mild bony\nhypertrophy of the left caudal articular process of L7 . Ventral spondylosis between L6 and\nL7 without involvement of the L6\u2013L7 foramina was also detected. Post-contrast CT\nexamination showed an enlarged pituitary gland (4 mm in height, 4.5 mm in width,\n4 mm in length) with a mild suprasellar extension . Hypertrophic ethmoidal turbinates\nand left fluid-filled tympanic bulla indicating otitis media were other\nfindings.\nIn order to better characterise the peripheral neuropathy, electrodiagnostic tests\nwere performed. Electromyography showed mild spontaneous pathological activity of\nthe appendicular muscles innervated by the right sciatic nerve. Motor nerve\nconduction studies (MNCS) and sensory nerve conduction studies (SNCS) of both\nsciatic tibial nerves and of the right ulnar nerve were within normal limits.\nMinimum F waves latencies and F ratio were severely increased in the right tibial\nnerve. Onset latency of cord dorsum potential obtained by stimulating the tibial\nnerve was increased in both pelvic limbs, and more severely in the right one.\nElectrodiagnostic findings were indicative of a lesion of the proximal portion of\nboth sciatic nerves or their roots, which was more severe on the right side .\nThe final diagnosis was acromegaly and entrapment neuropathy of the sciatic nerve as\na consequence of lumbosacral/foraminal stenosis due to bone hypertrophy. Medical\ntreatment for acromegaly using cabergoline was suggested, but the owner declined it.\nSurgical treatment of the foraminal stenosis was discussed, but a medical approach\nwas preferred owing to the age of the cat. As a result, treatment was aimed to\ncontrol and prevent neuropathic pain (gabapentin 10 mg/kg q12h) and re-checks were\narranged every 3 months to evaluate neurological condition and glycaemic control.\nThe clinical condition slightly improved in the first weeks of treatment. Sixteen\nmonths after the first presentation, the cat was still euglycaemic and neurological\nsigns were stable. Serum IGF-1 concentration was re-evaluated at the time and was\nstill over the detection limit of the assay.", "summary": "A 17-year-old neutered male European Shorthair cat was presented owing to an inability to jump and respiratory stridor. The owner did not report any other clinical signs. On physical examination, the main findings were plantigrade stance, broad facial features and inspiratory stridor. Neurological examination revealed posterior paraparesis, hypotonia and right hindlimb muscle atrophy. Laboratory findings were unremarkable and glycaemia was normal. Serum insulin-like growth factor 1 concentration was elevated (>1000\u2009ng/ml). A total body CT scan showed an enlarged pituitary gland, thickening of the nasal turbinates and an L7-S1 right foraminal stenosis. Electrodiagnostic testing confirmed the presence of a neuropathy affecting both sciatic nerves. The cat was treated with gabapentin only and was still alive and euglycaemic 16 months after the diagnosis.", "subclaim_evaluations": [ { "subclaim": "The cat was a 17-year-old neutered male European Shorthair.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was presented owing to an inability to jump.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat had respiratory stridor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The owner did not report any other clinical signs.", "support_label": "supported", "is_refined": false }, { "subclaim": "On physical examination, the cat had a plantigrade stance.", "support_label": "supported", "is_refined": false }, { "subclaim": "On physical examination, the cat had broad facial features.", "support_label": "supported", "is_refined": false }, { "subclaim": "On physical examination, the cat had inspiratory stridor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neurological examination revealed posterior paraparesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neurological examination revealed hypotonia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Neurological examination revealed right hindlimb muscle atrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory findings were unremarkable.", "support_label": "supported", "is_refined": false }, { "subclaim": "Glycaemia was normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum insulin-like growth factor 1 concentration was elevated.", "support_label": "supported", "is_refined": false }, { "subclaim": "A total body CT scan showed an enlarged pituitary gland.", "support_label": "supported", "is_refined": false }, { "subclaim": "A total body CT scan showed thickening of the nasal turbinates.", "support_label": "supported", "is_refined": false }, { "subclaim": "A total body CT scan showed an L7-S1 right foraminal stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Electrodiagnostic testing confirmed the presence of a neuropathy affecting both sciatic nerves.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was treated with gabapentin only.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was still alive 16 months after the diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cat was euglycaemic 16 months after the diagnosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1405_en.txt", "fulltext": "A 73-year-old Japanese woman with a history of hyperlipidemia, diabetes mellitus, and malignant lymphoma of mucosa-associated lymphoid tissue (MALT) presented to our hospital complaining of headache and nausea for 10 days. MALT lymphoma had been treated with chemotherapy 10 years ago and was in complete remission. The patient had no antithrombotic medications. The patient was fully alert and had no neurological deficits on initial physical examination. Brain computed tomography (CT) and magnetic resonance imaging (MRI) demonstrated subacute subcortical hematoma mainly in the left superior to middle frontal gyrus (43 \u00d7 18 \u00d7 44 mm) with gadolinium enhancement in the perihematoma area and in the genu of the corpus callosum . Cerebral angiography detected neither vascular abnormalities nor feeder-like arteries of tumors in the left ICA, although it revealed an aneurysm in the contralateral ICA. A string of beads appearance was also detected in the bilateral extracranial ICA . Abdominal three-dimensional CT angiography performed for examination of hematuria 10 years previously also revealed a string of beads sign in the right renal artery. These studies indicate that FMD existed in the background. The abnormal vessels explaining the bleeding source were not disclosed on angiography; thus, we could not diagnose the apparent cause of hemorrhage. Craniotomy biopsy and removal of the hematoma were performed for diagnosis and decompressive treatment 10 days after admission. With a left frontal craniotomy, a xanthochromic capsule was observed on the surface of the hematoma. Although no specific findings were observed in the intraoperative frozen section diagnosis, the final permanent pathology specimen revealed FMD predominantly involving small- to mediumsized arteries distributed in the hemorrhagic necrotic brain tissue and overlying meninx. Many of the affected segments had stenoses with obliterations due to fibroplasia spreading into the intima and recanalization was observed in some of the obliterated vessels . In addition, aneurysmal dilatations were formed in the segments with severe medial lesions [ and ]. Immunostaining revealed that the most of the endothelium of thin-walled blood vessels and capillaries due to aneurysm had only CD31 without CD34 [ and ]. The patient was discharged 27 days after surgery. She was followed up in the outpatient clinic, and we recommend intervention for an aneurysm of the right ICA.", "summary": "A 73-year-old woman suffered from intracerebral hemorrhage (ICH) associated with FMD without abnormal angiography cerebral vessels. She presented with headache and nausea. Subsequent head-computed tomography-revealed ICH in the left frontal lobe, and contrast-enhanced magnetic resonance imaging revealed a gadolinium-enhancing lesion in the perihematoma area and in the genu of the corpus callosum. Although cerebral angiography revealed a string of beads appearance in the bilateral extracranial internal carotid arteries, no abnormality explaining the hemorrhage was identified. The hematoma was removed and the pathological diagnosis was FMD. In the pathological specimen, various patterns of vulnerable vessels, such as aneurysmal dilatation and obstruction, were observed, which could easily collapse and result in hemorrhage. In the case of ICH of unknown origin, microscopic vessel disruption due to FMD should also be considered.", "subclaim_evaluations": [ { "subclaim": "The patient was a 73-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She suffered from intracerebral hemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hemorrhage was associated with fibromuscular dysplasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cerebral angiography was not abnormal.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She presented with headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with nausea.", "support_label": "supported", "is_refined": false }, { "subclaim": "Head-computed tomography revealed intracerebral hemorrhage in the left frontal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast-enhanced magnetic resonance imaging revealed a gadolinium-enhancing lesion in the perihematoma area.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast-enhanced magnetic resonance imaging revealed a gadolinium-enhancing lesion in the genu of the corpus callosum.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cerebral angiography revealed a string of beads appearance in the bilateral extracranial internal carotid arteries.", "support_label": "supported", "is_refined": false }, { "subclaim": "No abnormality explaining the hemorrhage was identified.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hematoma was removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pathological diagnosis was fibromuscular dysplasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pathological specimen showed various patterns of vulnerable vessels.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vulnerable vessels included aneurysmal dilatation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vulnerable vessels included obstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vulnerable vessels could easily collapse and result in hemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "In the case of intracerebral hemorrhage of unknown origin, microscopic vessel disruption due to fibromuscular dysplasia should also be considered.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1204_en.txt", "fulltext": "A 66 year old woman with floor of mouth squamous cell carcinoma (SCC) presented to our institution after her second relapse. Originally diagnosed in 2006, she had undergone a composite resection with a flap reconstruction and bilateral neck dissections followed by post-surgical adjuvant radiotherapy for stage IVa (T4aN0M0) disease. Immunohistochemistry (IHC) staining for p16 was negative. In May of 2009, a resectable locoregional recurrence was detected and consequently treated with a composite resection utilizing a pectoralis flap reconstruction. In November of 2013, she presented with a second non-resectable locoregional relapse. She received carboplatin and paclitaxel for 4 cycles with a partial response (PR) after 2 cycles. The patient subsequently developed regional progression and was treated with weekly methotrexate and cetuximab and she achieved stable disease (SD) for 6 months. Later, she progressed locally and was enrolled into a trial utilizing single agent pembrolizumab. She had SD for 6 cycles , and then suffered from local progression with a significant increase in the size of her neck mass, with painful ulceration and bleeding. Pembrolizumab was therefore discontinued. At this time restaging studies revealed no evidence of distant metastasis. She required multiple transfusions secondary to tumor hemorrhage and as a result was treated palliatively with radiation therapy to a total dose of 30 Gy directed at the mass. The patient experienced an excellent clinical response. Bleeding had resolved and her pain had greatly improved. A significant radiographic response was also noted on computed tomography (CT) scan, with tumor dimensions decreasing by 60 %, from 7.1 \u00d7 7.2 cm pre-radiation, to 5.9 \u00d7 3.4 cm, 6 weeks post-radiation.", "summary": "We report a case of locally relapsed non-resectable oral cavity squamous cell carcinoma, with excellent local control after pembrolizumab (MK3475) followed by radiotherapy.", "subclaim_evaluations": [ { "subclaim": "The patient had locally relapsed non-resectable oral cavity squamous cell carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received pembrolizumab (MK3475).", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had excellent local control after treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2229_en.txt", "fulltext": "A 44 year old Caucasian male was referred by his primary care physician for a recurrent asymptomatic left sided massive pleural effusion. The pleural effusion was first discovered on a chest X-ray obtained to follow-up his left 8th, 9th and 10th rib fractures from an accidental fall. The effusion was recurrent over one and a half month even after drainage with thoracentesis and chest tube placement . The initial chest X-ray immediately after his fall that revealed the acute fractures did not show any pleural effusion or blunting of costophrenic angles . The patient had no significant past medical history, denied recent travel, but admitted to smoking tobacco and consuming alcohol. The patient worked, as a maintenance man, but at the time of presentation was unemployed.\nAt presentation the patient had normal vital signs with an oxygen saturation of 93% on room air. Physical examination revealed an average built man in no apparent distress, non-labored breathing, central trachea, absent breath sounds with a stony dull percussion note on the left hemi thorax. Abdomen was soft and non tender with a palpable liver 10 cm below the costal margin. Laboratory investigation revealed mild anemia, hypoalbuminemia (3.1 gm/dL), normal BUN, creatinine, electrolytes and urine analysis. Arterial blood gas (ABG) analysis showed pH 7.48, PaCO2 34 mm Hg, PaO2 63 mm Hg, HCO3 25 mEq/L, oxygen saturation 93% on room air. Pleural fluid study showed lactate dehydrogenase (LDH) 112 U/L, pH 7.80, WBC 76, Polymorphs 40%, Eosinophil 1%, glucose 139 mg/dL, albumin 0.90 gm/dL, RBC 1300/mm3, amylase 169 U/L, pleural fluid \u2013 serum LDH ratio was 0.48. Pleural fluid gram stain, cultures (aerobic, anaerobic, AFB, fungal) and cytology were all negative. Computerized tomography of chest showed the massive left-sided unilateral pleural effusion with complete collapse of the left upper and lower lobes, but no pulmonary embolism or malignancy. . Echocardiogram was normal. Ultrasound of abdomen was remarkable for fatty liver, but no ascites. Magnetic resonance cholangio-pancreatography (MRCP) showed normal pancreas and biliary system without ascites. Tuberculin skin test, ANA, ANCA, AMA, ceruloplasmin, TSH, HIV, RPR, and Hepatitis virus serology were normal. Due to frequent massive re-accumulation a diagnostic and therapeutic video assisted thoracoscopy (VATS) procedure was performed, which revealed a 2 cm diaphragmatic hernia with inflamed, friable, incarcerated omentum and small amount of bowel. This inflamed omentum was determined to be the etiology for the recurrent pleural effusion. About 3.5 liters of pleural fluid was removed by VATS. Histopathology was consistent with moderately inflamed omentum. Hernia was repaired and talc-pleurodesis was performed. There was no re-accumulation on follow-up over 2 years .", "summary": "A 44 year old male presented with recurrent pleural effusions over six weeks. His pleural effusion was first diagnosed incidentally on a chest X-ray after a fall. Extensive diagnostic studies were unyielding for the etiology of the effusion. A diagnostic and therapeutic video assisted thoracoscopy revealed a diaphragmatic hernia with inflamed, incarcerated omentum. After hernia repair there was no recurrence.", "subclaim_evaluations": [ { "subclaim": "The patient is a 44 year old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had recurrent pleural effusions over six weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pleural effusion was first diagnosed incidentally on a chest X-ray.", "support_label": "supported", "is_refined": false }, { "subclaim": "The chest X-ray was performed after a fall.", "support_label": "supported", "is_refined": false }, { "subclaim": "Extensive diagnostic studies were unyielding for the etiology of the effusion.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A diagnostic and therapeutic video assisted thoracoscopy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thoracoscopy revealed a diaphragmatic hernia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hernia involved inflamed, incarcerated omentum.", "support_label": "supported", "is_refined": false }, { "subclaim": "After hernia repair, there was no recurrence.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3091_en.txt", "fulltext": "A 67-year-old lady was admitted with confusion, right sided weakness and right arm shaking.\n\nComorbidities included a duodenal ulcer, diabetes mellitus and hypertension, but importantly no prior personal or family history of neurological disorders or cerebrovascular events. Medications included Metformin, Ramipril and Lansoprazole.\n\nShe was also suffering from a non-healing ulcer on her left 5th toe. Bone fragments grew Enterococcus and Proteus. Skin swabs grew Staphylococcus Aureus. Osteomyelitis of the 4th and 5th metatarsals was suspected. As co-existing cellulitis not responded to co-amoxiclav, the patient was switched to Linezolid 600 mg twice daily was commenced for four weeks. Full Blood Count after 3 weeks of treatment with Linezolid showed Hb 104 g/L, WCC 6.1 \u00d710 9/L, platelets 119 \u00d710 9/L and MCV 85 fL. Her platelet count was last checked three years prior and was within normal range at 245 \u00d710 9/L. She finished her full five-week course of linezolid to which her osteomyelitis responded well.\n\nTwo days after the last dose of Linezolid she noticed right arm shaking and weakness.\n\nAdmission blood pressure was 189/63. Her Glasgow Coma Scale (GCS) was 14/15 (E3, V5, M6). She had mild global weakness and was unable to finger count. However, she had power of 4/4 in all limbs, normal tone and plantar responses were flexor. There was evidence of right sided neglect.\n\nCT head was unremarkable. Her haemoglobin (Hb) was 69 g/L, but white cell count (WCC) and platelets were within normal limits. On admission, aspirin was given while a MRI Head was requested to investigate the considered differentials, including progressive multifocal leukoencephalopathy, Posterior Reversible Encephalopathy Syndrome, and encephalitis.\n\nShe developed a progressive decline in consciousness in the next 24 h. MRI Head revealed bilateral alteration of signal seen within the deep white matter of the posterior frontal and parietal lobes. These areas showed some mild diffusion restriction. The altered signal extended into the midbrain on the left side and there was also some involvement of the cortex in the right parietal lobe. Normal flow was seen in the basilar artery. Differential diagnoses of bilateral ischaemia, and progressive multifocal leukoencephalopathy were suggested. Posterior reversible encephalopathy syndrome was less likely due to the restricted diffusion. In the following 36 h, Hb had improved to 88 g/L, WCC remained at 5.0\u2009\u00d7\u200910 9/L but Platelets had dropped to 1\u2009\u00d7\u200910 9/L. Twelve hours later, her Hb was 78 g/L and platelets remained at 2\u2009\u00d7\u200910 9/L. The blood film showed a few left shifted neutrophils but with a lack of red cell fragments. During this period, the CRP rose from 22 mg/L to 132 mg/L. Reticulocyte count was 146. Bilirubin was normal. Direct antiglobulin test was negative. Lactate dehydrogenase sample unfortunately haemolysed. A Heparin-induced Thrombocytopenia Antibody assay was not done as the patient was not on anticoagulants on admission and had not been prior to admission.\n\nBone marrow biopsy or a therapeutic intravenous infusion of immunoglobulin was not indicated so instead she was transferred to a tertiary centre for urgent plasma exchange due to the strong suspicion of TTP. This suspicion was suggested by neurological symptoms, anaemia, unexplained thrombocytopenia. Her PLASMIC score was 6 (high-risk; however, please note that the INR component missing).\n\nCerebrospinal fluid analysis showed negative viral polymerase chain reaction testing, white cell count 12, red cell count 14, no organisms seen on microscopy, protein 0.53, and cytology acellular.\n\nElectroencephalogram suggested an encephalopathic pattern with anterior sub-cortical slowing present. ADAMTS13 was normal and vWF cleaving protease was 106. Reticulocyte count was 3.98% and Fibrinogen 2.12 g/L. CT Thorax, Abdomen and Pelvis showed no abnormality.\n\nA diagnosis of Linezolid induced Leukoencephalopathy was made.\n\nShe was discharged 8 weeks following presentation; making a complete recovery by 4 months.\n\nMRI Head repeated at 9 months showed gradually reducing signal intensity in abnormal areas described earlier consistent with leukoencephalopathy. In addition her platelet count improved to 219 \u00d7 10 9/L upon discharge.", "summary": "A 67-year-old lady was admitted with, right sided weakness and right arm shaking. She had recently completed a course of Linezolid for a diabetic foot infection and osteomyelitis. Prior to this she had prodromal symptoms including lethargy and loss of appetite. Clinical features prompting presentation included global weakness, verbal dysfluency and visual disturbance. MRI brain showed bilateral alteration of signal in the deep white matter of the posterior frontal and parietal lobes, sparing the superficial cortical areas. These areas showed diffusion restriction, suggestive of, but not limited to, ischaemic stroke. During admission she had a decline in consciousness and was hypertensive. An acute drop in haemoglobin and platelets occurred prompting consideration of Thrombotic Microangiopathy and other drug related/malignant/infective aetiologies. A diagnosis of Linezolid induced Acute Toxic Leukoencephalopathy and thrombocytopenia was made based on clinico-radiographic features and exclusion of other causes.", "subclaim_evaluations": [ { "subclaim": "The patient is a 67-year-old lady.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had right-sided weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had right arm shaking.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had recently completed a course of Linezolid.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Linezolid was for a diabetic foot infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Linezolid was for osteomyelitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had prodromal symptoms including lethargy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had prodromal symptoms including loss of appetite.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Clinical features included global weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical features included verbal dysfluency.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Clinical features included visual disturbance.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "MRI brain showed bilateral alteration of signal in the deep white matter.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI showed involvement of the posterior frontal lobes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI showed involvement of the parietal lobes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI showed sparing of the superficial cortical areas.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The MRI showed diffusion restriction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diffusion restriction was suggestive of ischaemic stroke.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diffusion restriction was not limited to ischaemic stroke.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a decline in consciousness.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was hypertensive.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was an acute drop in haemoglobin.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was an acute drop in platelets.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thrombotic Microangiopathy was considered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Drug-related causes were considered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Malignant causes were considered.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Infective causes were considered.", "support_label": "supported", "is_refined": false }, { "subclaim": "A diagnosis of Linezolid-induced Acute Toxic Leukoencephalopathy was made.", "support_label": "supported", "is_refined": false }, { "subclaim": "A diagnosis of thrombocytopenia was made.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on clinico-radiographic features.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on exclusion of other causes.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_946_en.txt", "fulltext": "A 38-year-old female underwent a medical check-up at our institution. The patient\u2019s medical profile had no history of weight loss, anorexia, or weakness. She had had a splenectomy 20 years prior for traumatic splenic rupture. Laboratory tests, including complete blood count, liver function test, and alpha-fetoprotein levels, were within the normal range. An abdominal CT scan without contrast enhancement revealed the absence of a normal spleen, with a homogeneous mass situated at the site (A and B). The mass exhibited heterogenous enhancement in the arterial phase (C), but homogeneous enhancement in the venous phase (D). The mass was suspected to have originated from the pancreas tail (A and C). There was no fat stranding surrounding the mass . Coronal CT image revealed that this mass compressed the left renal (A). The mass was fed by several branches of the splenic artery (B). An abdominal MRI was performed. This confirmed that the mass was located in the normal site of spleen and compressed the left kidney (A) and that the mass was round, with well-defined borders and without fat stranding. The mass presented as hyperintense compared to liver parenchyma on T2-weighted image (B). T1-weighted images showed that the mass was hypointense compared with liver parenchyma and did not lose signal on T1 out-of-phase images . Part of the mass was suspected to be connected to the pancreas tail (A and C). T1-weighted image in the arterial phase revealed that the mass enhanced markedly and inhomogeneously (A). The normal left adrenal gland was observed clearly (B). The mass exhibited homogeneous enhancement in the venous phase (C). It was clear that the mass showed restricted diffusion, since it was hyperintense on diffusion-weighted image (DWI) and had hypointense apparent diffusion coefficient (ADC) values on an ADC map compared to liver parenchyma . The preoperative diagnosis was a tumor of the pancreas tail. The patient underwent an operation to remove the mass by a general surgeon with 10-year experience. Histopathology showed white and red pulps, as well as connective tissue that presented within the mass as trabeculae that carry the arteries and veins (A). The white pulps included periarterial lymphatic sheath, lymphatic follicles, and the marginal zone (B). It was surrounded by a capsule composed of dense fibrous tissue (C). The lymphatic follicles contained benign lymphocytes (D). Histopathology of the mass revealed the appearance of a spleen parenchyma. The final diagnosis was an enlargement of AS after splenectomy. This patient was discharged from the hospital 4 days after surgery without further complications or treatment. The patient was lost to follow-up later. This case was reported in line with the SCARE 2020 criteria .", "summary": "Herein, we report the case of a 38-year-old female with an enlargement of AS after splenectomy that was misdiagnosed as a primary tumor of the pancreas and managed by a nonessential surgery.", "subclaim_evaluations": [ { "subclaim": "The patient was a 38-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had an enlargement of the accessory spleen (AS).", "support_label": "supported", "is_refined": false }, { "subclaim": "The enlargement occurred after a splenectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The enlargement was misdiagnosed as a primary tumor of the pancreas.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a nonessential surgery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_2883_en.txt", "fulltext": "An 83-year-old woman with permanent AF, undergoing treatment with direct oral anticoagulant therapy (rivaroxaban 15\u2005mg once daily), was referred to our hospital due to fatigue and worsening dyspnoea. Upon admission, the patient was afebrile (36\u00b0C), and exhibited a blood pressure of 125/78\u2005mmHg, a pulse rate of 96\u2005beats\u2005per\u2005minute, and an oxygen saturation of 92% on room air. Cardiac auscultation revealed a 2\u20133/6 systolic murmur at the lower sternal border and at the apex of the heart, radiating to the left axilla. Laboratory tests revealed severe microcytic anaemia, with a haemoglobin level of 4.9\u2005g/dL (normal range: 13.8\u201318.0\u2005g/dL). No signs of haemolytic anaemia were identified. The patient presented a CHA2DS2-VASc risk score of 4 and a HAS-BLED score of 4. Previous medical history was characterized by degenerative mitral valve disease complicated by severe mitral regurgitation. In 2016, patient underwent mitral valve repair with ring annuloplasty, tricuspid annuloplasty, and surgical LAA ligation. Her past medical history was also remarkable for arterial hypertension, dyslipidaemia, chronic anaemia, and previous erosive gastritis. Endoscopic examinations revealed gastric polyps, colonic diverticulosis, and enlarged haemorrhoids, with no evidence of recent or ongoing haemorrhage. The search for Helicobacter pylori yielded negative results. Transthoracic echocardiography showed normal left and right ventricular systolic function, residual mild to moderate mitral regurgitation, and severe tricuspid regurgitation. Transoesophageal echocardiography (TEE) ruled out intracardiac thrombi but revealed incomplete surgical LAA occlusion with a narrow neck of 5\u2005mm in conventional 2D images and 13 \u00d7 6\u2005mm using multiplanar reconstruction of acquired 3D datasets (, , , , and ).\nThe patient was transfused with six units packed red blood cells, with clinical improvement. Rivaroxaban was discontinued. Based on both the high bleeding risk and the results of the echocardiography study, the Heart Team members indicated percutaneous transcatheter LAAC to best manage the patient. Pre-procedural imaging with cardiac computed tomography (CCT) scanning was performed, showing a bilobed LAA with dehiscence of the ostium and a neck of 13 \u00d7 8\u2005mm (, , ). The LAA presented an elliptic landing zone with a major axis of 22\u2005mm and a depth of 17\u2005mm .\nThe procedure of LAAC was carried out with the patient under general anaesthesia. Adequate anticoagulation with heparin was maintained throughout the procedure (activated clotting time [ACT] 250\u2013300\u2005s). The intra-procedural combined angiographic and echocardiographic evaluation demonstrated a maximum LAA diameter ranging from 20\u201322\u2005mm ( and ): thus, an Amplatzer Amulet 28\u2005mm was considered to be the best choice. The device was delivered with good LAA sealing by the body of the prosthesis (see , and ), without peri-device leak. A slight protrusion of the external disc in the left atrium was observed without impeding of the mitral valve leaflets excursion (, , ). No pericardial effusion was detected, and the patient was discharged on single antiplatelet therapy (clopidogrel), remaining clinically stable on post-operative Day 2. One month post-procedure, the patient was asymptomatic with a haemoglobin level of 11.2\u2005g/dL, and no complications were recorded. Transoesophageal echocardiography examination confirmed the device\u2019s position without signs of thrombosis. After three months, the stability of the haemoglobin level and the absence of device thrombosis allowed the discontinuation of antithrombotic therapy . One year after hospital discharge, the patient did not experience adverse clinical events. Transthoracic echocardiography confirmed the stable position of the device.", "summary": "A 83-year-old woman, with permanent AF and a history of previous surgical LAA ligation, was referred to our hospital for fatigue and worsening dyspnoea. Laboratory tests showed severe microcytic anaemia, with a haemoglobin level of 4.9\u2005g/dL (normal reference: 13.8-18.0\u2005g/dL). Oesophagogastroduodenoscopy and colonoscopy excluded signs of either recent or ongoing haemorrhage. After achieving clinical improvement by haemotransfusions, we performed a transoesophageal echocardiography that showed an ISLL with a narrow neck of 5\u2005mm. Since the patient had high thrombo-embolic and haemorrhagic risk (CHA2DS2-VASc risk score of 4 and a HAS-BLED score of 4), we decided to discontinue anticoagulant therapy and perform elective percutaneous transcatheter LAA occlusion (LAAO) with an Amplatzer Amulet device. Patient was discharged in good clinical status. After three months, the stability of haemoglobin level and the absence of device thrombosis allowed the discontinuation of antithrombotic therapy.", "subclaim_evaluations": [ { "subclaim": "The patient is an 83-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has permanent atrial fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of previous surgical left atrial appendage ligation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was referred for fatigue and worsening dyspnoea.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed a haemoglobin level of 4.9 g/dL.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oesophagogastroduodenoscopy excluded signs of recent or ongoing haemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Colonoscopy excluded signs of recent or ongoing haemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transoesophageal echocardiography showed an intracardiac shunt with a narrow neck of 5 mm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a CHA2DS2-VASc risk score of 4.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a HAS-BLED score of 4.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anticoagulant therapy was discontinued.", "support_label": "supported", "is_refined": false }, { "subclaim": "Elective percutaneous transcatheter left atrial appendage occlusion was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "An Amplatzer Amulet device was used for the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged in good clinical status.", "support_label": "supported", "is_refined": false }, { "subclaim": "After three months, the haemoglobin level was stable.", "support_label": "supported", "is_refined": false }, { "subclaim": "After three months, there was no device thrombosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Antithrombotic therapy was discontinued after three months.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3130_en.txt", "fulltext": "A 63-old man presented to our Ophthalmology Unit of \u201cSS. Annunziata\u201d Hospital, Taranto, complaining of low visual acuity in both eyes and ocular discomfort for about two years.\n\nHis ophthalmic history was unremarkable. His uncorrected distance visual acuity (UDVA) measured with Snellen charts was 20/100 in the right eye (RE) and 20/200 in the left eye (LE), while his best corrected visual acuity (BCVA) was 20/50 in the RE and 20/100 in the LE. A history of amblyopia in his left eye was reported.\n\nSlit-lamp examination revealed a horizontal gray-whitish band across the central cornea in both eyes, sparing the peripheral cornea and the limbus. No other pathological findings were observed.\n\nHe was diagnosed with CBK secondary to occupational exposure to mercury vapors, since he was a worker of steel industry.\n\nFundus examination was not possible. The anterior segment OCT (AS-OCT) showed a thickness corneal opacity of 150 um in both eyes.\n\nThis study adhered to the Declaration of Helsinki and was approved by the Ethics Committee of the Ophthalmology Unit of \u201cSS. Annunziata\u201d Hospital Review Board. The patient provided informed consent for all procedures and their possible complications were explained. The patient gave informed consent for the publication of any case details and accompanying images. The IRB of the Ophthalmology Unit of \u201cSS. Annunziata\u201d Hospital, Taranto gave the approval for the publication of this case report.\n\nThe tomographic maps (Precisio2\u00ae, iVIS Technologies, Taranto, Italy) showed in both eyes an irregular corneal morphology due to the presence of the opacity.\n\nOur first attempt was performing EDTA chelation procedure which removed the superficial calcium plaques. Two months after the procedure, the UDVA had improved to 20/80 in RE and to 20/100 in the LE, but the cornea was not completely clear, with residual stromal haze. The EDTA chelation procedure had no effect on the deeper calcium deposits and the tomographic maps showed irregular corneal surface. For this reason, a combined treatment with PRK and PTK was scheduled in both eyes in order to recover visual acuity and minimize surgical invasiveness.The customized treatment was determined by taking into account the following parameters: spherical error, some biometric data including anterior chamber depth, axial length; corneal morphological irregularity index (CMI) measured by tomographer (Precisio2\u00ae, iVIS Technologies, Taranto, Italy); pupillometry (pMetrics\u00ae, iVIS Technologies, Taranto, Italy).\n\nCMI, measured in \u03bcm, is a parameter which indicates the aberrations above the second order of the anterior and posterior corneal surface. It is strongly correlated to the quality of vision of the patient: the more the CMI, the worse the quality of vision.\n\nThe customized ablation is achieved using a ray tracing-based software. Ray tracing is based on the Snell law of refraction and allows the evaluation of the pathway of light rays after their passage through the eye from the anterior corneal surface to the retina. In this way, it is possible to know the exact refractive contribution of each surface and fully customize excimer laser ablation. This is achieved by not performing a full regularization of the anterior corneal surface; instead, a small amount of aberration on the anterior corneal surface is left to compensate for the posterior surface aberrations which are of opposite sign. In fact, the posterior corneal shape introduces posterior corneal morphological irregularities, which partially compensate for the anterior ones.\n\nIn this way, the ray tracing algorithm optimizes the quality of vision and at the same time minimizes the consumption of stromal tissue.\n\nWe decided to perform the surgery first on the right eye and then after 20 days on the left eye. The surgery was performed using topical anesthesia (oxybuprocaine eye drops, Benoxinato Cloridrato, Alfa Intes S.r.l). We decided to use a no-touch approach in order to have less postoperative pain and faster re-epithelialization. The surgery was executed with the iRes\u2122 excimer laser, working with flying-spot of 650\u00b5m at 1000Hz (iVis Technologies S.r.l).\n\nThe customized ablation profile obtained had a refractive zone of 5.60 mm in RE and 5.50 mm in LE, and a connecting zone of 8.90 mm in RE and 9.60 mm in LE. The cumulative ablation stromal depth was 34 \u03bcm in both eyes.\n\nFollowing surface ablation, PTK with a frequency of 10% was carried out with masking agents (1% hydroxymethylcellulose) to smooth the ablated surface, with a depth of 80 \u03bcm.\n\nTo avoid any kind of corneal haze, 0.02% Mitomycin C (MMC, 0.2 mg/mL, diluted in BSS\u00ae) was applied over the ablated area for 20 seconds. At the end of the procedure, a soft therapeutic contact lens was placed. The therapeutical postoperative regimen consisted in topical dexamethasone and amikacin eye drops given four times a day for a week. The patient was then put on 0.1% fluorometholone eye drops and artificial tears eye drops for 12 weeks, which were tapered gradually. The patient was examined the day following surgery, and additional follow-up visits were carried out at one week, two weeks, one, three, and six months, respectively.\n\nAt the 1-week follow-up visit the contact lens was removed, with a complete epithelial healing. On slit lamp examination the clarity of the ablated area was notably improved.\n\nAS-OCT scans and topography were performed at 1 week, 1, 3 and 6 months after treatment.\n\nAt the 1-month follow-up the final uncorrected visual acuity (UCVA) improved from 20/200 to 20/20 in right eye and to 20/63 in the left eye.\n\nCMI decreased from 15 \u03bcm to 3 \u03bcm in RE and from 21 \u03bcm to 11 \u03bcm in LE, and minimum corneal thickness was reduced from 567 \u03bcm to 533 \u03bcm in RE, and from 574 \u03bcm to 540 \u03bcm in LE.\n\nThe improved visual acuity was maintained at 3-month follow-up and 6-month follow-up, with the patient fully satisfied. The corneal clarity remained during the 6 months follow-up.\n\nThe postoperative follow-up was uneventful. The ablation map and topographic changes of both eyes were reported.", "summary": "A 63-year-old man presented to our clinic with decreased visual acuity and ocular discomfort in both eyes. Clinical examination revealed a horizontal gray-whitish band across the central cornea in both eyes, supporting the diagnosis of CBK. Initially, an EDTA chelating procedure was attempted, but it had no effect on the deeper calcium deposits and on the irregular corneal morphology. In both eyes, a topography-guided trans-epithelial PRK with PTK was performed. Following PRK surface ablation, PTK was used to smooth the ablated area using 1% hydroxymethylcellulose as masking agent. The procedure was completed applying 0.02% Mitomycin C. At the 1-month follow-up, both eyes corneal opacities were resolved, and the LE visual acuity had improved to 20/63 and the RE to 20/20, which was maintained at the 3-, 6-, and 12-months follow-up. Furthermore, there was an improvement in spherical equivalent and corneal morphological irregularity index.", "subclaim_evaluations": [ { "subclaim": "The patient is a 63-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with decreased visual acuity.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had ocular discomfort in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed a horizontal gray-whitish band across the central cornea in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was corneal band keratopathy (CBK).", "support_label": "supported", "is_refined": false }, { "subclaim": "An EDTA chelating procedure was attempted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The EDTA chelating procedure had no effect on the deeper calcium deposits.", "support_label": "supported", "is_refined": false }, { "subclaim": "A topography-guided trans-epithelial PRK with PTK was performed in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Following PRK surface ablation, PTK was used to smooth the ablated area.", "support_label": "supported", "is_refined": false }, { "subclaim": "1% hydroxymethylcellulose was used as a masking agent during PTK.", "support_label": "supported", "is_refined": false }, { "subclaim": "0.02% Mitomycin C was applied at the end of the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "At the 1-month follow-up, corneal opacities were resolved in both eyes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Left eye visual acuity improved to 20/63 at 1 month.", "support_label": "supported", "is_refined": false }, { "subclaim": "Right eye visual acuity improved to 20/20 at 1 month.", "support_label": "supported", "is_refined": false }, { "subclaim": "Visual acuity was maintained at 3 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "Visual acuity was maintained at 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "Visual acuity was maintained at 12 months.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "There was an improvement in spherical equivalent.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "There was an improvement in corneal morphological irregularity index.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_263_en.txt", "fulltext": "A 64-year-old woman was admitted to the hematology department of our hospital in August 2019 with pancytopenia complicated by headache.\nThe patient had recurrent pancytopenia for half a year. The symptom of headache had lasted for 4 d.\nThe patient presented with a 3-mo history of lumbar pain and was finally diagnosed with solitary bone plasmacytoma a year ago. She had received only radiotherapy, at a dose of 45 Gy, 22 times. She was first admitted to the hospital in February 2019 due to persistent pancytopenia. The initial complete blood count (CBC) showed a hemoglobin (HB) level of 96 g/L, white blood cell count (WBC) of 2.5 \u00d7 109/L, and platelet (PLT) count of 38 \u00d7 109/L. Immunofixation electrophoresis showed that the M component was an IgG-kappa light chain. On bone marrow (BM) aspiration, 0.13% of monoclonal plasma cells were observed by flow cytometry (FCM). Biopsy revealed hypoplastic marrow without megakaryocytes. No bone lesion other than primary local lumbar injury was observed in a series of X-ray scans. The patient was diagnosed with SBP with minimal marrow involvement, according to the diagnostic criteria for plasma cell dyscrasia, with concomitant myelosuppression. She underwent treatment with thalidomide, granulocyte colony stimulating factor (G-CSF), and thrombopoietin (TPO), blood transfusion, and other supportive treatments. Peripheral blood was significantly improved after 3 mo of treatment and almost restored to normal.\nOn admission, the patient was lucid and slurred in speech. The skin mucous membrane of the whole body had scattered haemorrhage spots. Limb activity was normal, and nervous system examination showed no abnormality.\nThe CBC revealed pancytopenia (HB 70 g/L, WBC 3.0 \u00d7 109/L, and PLT 38 \u00d7 109/L). A peripheral blood smear showed 16% of abnormal promyelocytes with dendritic protrusions . Thrombin function test showed that prothrombin and partial thromboplastin times were prolonged, fibrinogen was decreased, and the D-dimers were elevated to 4.5 \u03bcg/mL. BM examination was conducted, followed by cytogenetic and molecular analyses using BM specimens. The BM aspirate showed 90% of abnormal promyelocytes with densely packed large granules , which on flow cytometric immunophenotyping expressed CD13, CD33, CD117, CD56, CD81, and myeloperoxidase; partially expressed CD38 and CD34; and slightly expressed CD15, CD11b, and CD16 HLA-DR . Chromosome analysis using a BM sample revealed a karyotype of 46,XX,t(15;17)(q22;q21) in 20 metaphase cells examined . Reverse transcription-PCR (RT-PCR) analyses confirmed the presence of S-form PML/RAR\u03b1 gene rearrangement. The FLT3-ITD gene mutation was detected by Sanger sequencing . Plasma cells were not detected. A monoclonal peak was continuously observed on serum IFE, showing IgG and kappa-type monoclonal gammopathy.\nThe patient was married and had two daughters and one son. No additional family history was obtained.", "summary": "We describe a 64-year-old woman who presented with lumbar pain and was initially diagnosed with SBP. However, after one year of radiotherapy treatment, this patient experienced a long-standing bone-marrow-suppressive period and finally developed APL harboring the FLT3-ITD mutation, as confirmed by analyses of clinical features, bone marrow morphology, flow cytometry, cytogenetic examination, and molecular biology. On admission, the patient had disseminated intravascular coagulation and intracranial hemorrhage, and the peripheral blood and bone marrow smear displayed abundant abnormal promyelocytes. Unfortunately, she died when the definite diagnosis was made.", "subclaim_evaluations": [ { "subclaim": "The patient was a 64-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with lumbar pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was initially diagnosed with SBP.", "support_label": "supported", "is_refined": false }, { "subclaim": "After one year of radiotherapy treatment, she experienced a long-standing bone-marrow-suppressive period.", "support_label": "supported", "is_refined": false }, { "subclaim": "She developed APL harboring the FLT3-ITD mutation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of APL was confirmed by analyses of clinical features.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of APL was confirmed by bone marrow morphology.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of APL was confirmed by flow cytometry.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of APL was confirmed by cytogenetic examination.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of APL was confirmed by molecular biology.", "support_label": "supported", "is_refined": false }, { "subclaim": "On admission, the patient had disseminated intravascular coagulation.", "support_label": "supported", "is_refined": false }, { "subclaim": "On admission, the patient had intracranial hemorrhage.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The peripheral blood smear displayed abundant abnormal promyelocytes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The bone marrow smear displayed abundant abnormal promyelocytes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died when the definite diagnosis was made.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2563_en.txt", "fulltext": "A 54-year-old woman presented at our hospital with left flank discomfort and palpebral edema of 1-week duration. She underwent abdominal postcontrast computed tomography (CT) in a local hospital, which showed a low-density renal pelvic mass and hydronephrosis of the left kidney and indicated renal pelvic cancer (Figure ). Her past medical history included sicca complex for 5 years previously. In her laboratory examination, a routine urine test revealed a red blood cell count of 118.4/\u03bcl (normal reference range, 0 to 25/\u03bcl), a white blood cell count of 127.3/\u03bcl (normal reference range, 0 to 25/\u03bcl) and an epithelial cell count of 13.4/\u03bcl (normal reference range, 2 to 10/\u03bcl). No remarkable findings in the complete blood count or urine cytology were observed. A retrograde pyelogram showed a dilated left renal pelvis and stricture of the upper ureter, which had a regular surface and a filling defect (Figure ). On postcontrast magnetic resonance imaging (MRI) scans, the wall of the ureteropelvic junction was irregularly thickened and showed isointensity on T1-weighted images and hypointensity on T2-weighted images. On both T1- and T2-weighted images, the thickened wall of ureteropelvic junction showed homogeneous enhancement. Furthermore, multiple enlarged retroperitoneal lymph nodes were visualized by MRI (Figure ). Positron emission tomography/CT findings indicated that the renal pelvic mass was a malignant tumor, because the glucose metabolism was very high (Figure ). PET/CT also revealed multiple enlarged hypermetabolic lymph nodes in the supraclavicular, retroperitoneal, peritoneal and pelvic regions. All of these findings together led us to consider a possible diagnosis of a renal pelvic malignant tumor with multiple lymph nodes metastasis.\nA few days later the patient underwent a left-sided nephroureteral cystectomy and retroperitoneal lymph node dissection, in which part of the bladder was removed. The surgery was performed to establish a definitive diagnosis and for treatment if the mass was malignant.\nGross examination of the kidney showed a 5 \u00d7 2.5\u2013cm, pale, whitish-tan, ill-defined mass located in the renal pelvis near the renal hilum. Histologic examination of the mass showed lymphatic tissue hyperplasia and diffuse infiltration of plasma cells. The plasma cells were IgG- and IgG4-positive. The IgG4/IgG ratio was approximately 40% (Figure ). Two retroperitoneal lymph nodes were dissected, which represented as reactive hyperplasia. The pathological findings did not reveal malignancy.\nAfter the diagnosis of IgG4-RD was made, a further laboratory examination was performed. The patient\u2019s serum IgG4 level was 18.6 g/L (normal reference range, 0.03 to 2 g/L), and her high-sensitivity C-reactive protein test result was 26.3 mg/L (normal reference range, 0 to 3 mg/L). The patient underwent steroid therapy in a local hospital for 1 year. At the fourth month of her steroid therapy, her high-sensitivity C-reactive protein level had descended to 8.76 mg/L (normal reference range, 0 to 8 mg/L). Her enlarged lymph nodes in the supraclavicular, retroperitoneal, peritoneal and pelvic regions diminished with the steroid therapy.", "summary": "A 54-year-old woman visited our hospital with left flank discomfort and palpebral edema. Computed tomography, magnetic resonance imaging, retrograde pyelography and positron emission tomography/computed tomography indicated renal pelvic cancer. However, after a left-sided nephroureteral cystectomy was performed, the mass was pathologically confirmed as an IgG4-related lesion. Her elevated serum IgG4 level and a past history of sicca complex supported the diagnosis of IgG4-RD.", "subclaim_evaluations": [ { "subclaim": "The patient is a 54-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had left flank discomfort.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had palpebral edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance imaging was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Retrograde pyelography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Positron emission tomography/computed tomography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The imaging studies indicated renal pelvic cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "A left-sided nephroureteral cystectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was pathologically confirmed as an IgG4-related lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her serum IgG4 level was elevated.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a past history of sicca complex.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was IgG4-related disease.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2562_en.txt", "fulltext": "A 19-year-old Japanese woman presented with a left temporal headache. Magnetic resonance imaging (MRI) of the brain revealed a well-defined, heterogeneously enhanced tumor in the left temporal lobe, approximately 10 mm in size, showing high-intensity on T2-weighted images . The patient underwent a left frontal-temporal craniotomy and total resection. These tumor cells had less than 1 mitosis per 10 high-power fields. The primary histopathological diagnosis at that time was low-grade glioma. The patient was discharged after treatment and followed up without any additional treatment. No clear local recurrence was detected during 3 years of follow-up and the patient subsequently elected to stop further medical examinations.\nHowever, 12 years after the initial treatment, the patient returned with a left temporal headache, diplopia and tinnitus. MRI showed a local recurrence of the tumor around the surgical cavity with prominent perifocal edema and a second resection was performed. Intraoperatively, the tumor was prominently hypervascular, with many feeding arteries from the dura, and a part of the tumor was weakly positive for 5-aminolevuinic acid-based photodynamic diagnosis (PDD). Hematoxylin and eosin (H&E) staining showed an astrocytic tumor lesion with necrosis, microvascular proliferation, invasion and multiple mitoses (5 mitotic counts per 10 high-power fields). No EGBs were observed. . Immunohistochemical (IHC) stains were positive for oligo2, and tumor cells were retained for INI1 and ATRX staining. Approximately 21% of these cells were positive for Ki-67 but negative for IDH1-R132H. Furthermore, the specimen from the initial surgery was revisited and the diagnosis was changed to PXA of WHO grade II based on histology showing spindle shaped cells, pleomorphic nucleated cells and EGBs . Reticulin fibers were not stained and CD34 staining was negative in both tumor resections . As recurrence happened after the PXA resection, APXA was expected due to poorer histological findings; however, the tumor had no characteristic feature of PXA such as EGB, leading to a diagnosis as GBM by histological classification because of nuclear atypia, mitotic activity, a diffuse growth pattern, microvascular proliferation and necrosis . The patient received chemotherapy (temozolomide) and conformal radiation therapy accordingly and outpatient follow-ups have detected no obvious symptoms for over 1 year after surgery.\nAdditionally, specimens of each resection were sent to the National Cancer Center Research Institute and MLPA (Multiplex Ligation-dependent Probe Amplification) was performed for 1p, 19q, CDKN2A, IDH1 R132H (c.395G > A), R132C (c.394C > T), IDH2 R172K (c.515G > A), R172M (c.515G > T) and Pyrosequence for IHD1 R132, IDH2 R172, BRAF V600E, H3F3A K27, H3F3A G34, HIST1H3B, TERT C228T, FGFR1 N546, and FGFR1 K656. The analysis detected a BRAF V600E mutation in both the initial and recurrent tumors, with mutant allele findings at 16 and 49%, respectively. Both 1p/19q and CDKN2A were intact in the initial specimen, but a 19q deletion and CDKN2A homozygous deletion were detected in the recurrent specimen. IDH1/IDH2, H3F3A, HIST1H3B, TERT, and FGFR1 were intact in both specimens. From this analysis the tumor was assumed to have been derived from pleomorphic xanthoastrocytoma.", "summary": "Here we describe an unusual case of PXA in a 19-year-old woman, first admitted with headache and a mass in the left temporal lobe in 2005 that was removed. Twelve years later, she returned with left temporal headache, diplopia and tinnitus. A local tumor recurrence was found, and a second resection was performed. The specimen showed highly malignant findings, such as necrosis, microvascular proliferation, and multiple mitoses. The integrated diagnosis was made as high grade glioma, probably derived from PXA. Immunohistochemical (IHC) stains were positive for oligo2, and approximately 21% positive for Ki-67, while negative for CD34, IDH1 R132H. INI1 and ATRX were retained. As the histological classification was glioblastoma, the patient received GBM-appropriate chemotherapy and radiation therapy and outpatient follow-ups have demonstrated no obvious symptoms for 1\u2009year after surgery. Additional molecular analyses found BRAF V600E mutations in both resections, supporting the idea that the recurrent tumor had derived from PXA.", "subclaim_evaluations": [ { "subclaim": "The patient is a 19-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was first admitted in 2005.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had a mass in the left temporal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was diagnosed as PXA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Twelve years later, she returned with left temporal headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had diplopia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had tinnitus.", "support_label": "supported", "is_refined": false }, { "subclaim": "A local tumor recurrence was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "A second resection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The specimen showed necrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The specimen showed microvascular proliferation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The specimen showed multiple mitoses.", "support_label": "supported", "is_refined": false }, { "subclaim": "The integrated diagnosis was high grade glioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was probably derived from PXA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical stains were positive for oligo2.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical stains were approximately 21% positive for Ki-67.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical stains were negative for CD34.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical stains were negative for IDH1 R132H.", "support_label": "supported", "is_refined": false }, { "subclaim": "INI1 was retained.", "support_label": "supported", "is_refined": false }, { "subclaim": "ATRX was retained.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histological classification was glioblastoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received GBM-appropriate chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received radiation therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Outpatient follow-ups showed no obvious symptoms for 1 year after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "BRAF V600E mutations were found in both resections.", "support_label": "supported", "is_refined": false }, { "subclaim": "The BRAF V600E mutations support the idea that the recurrent tumor derived from PXA.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_444_en.txt", "fulltext": "Fifteen years ago, this now 40-year-old female had undergone a L5S1 discectomy . Ten months before this admission, due to complaints of low back pain and left leg numbness, she had undergone a lumbar; MR; it documented significant cauda equina compression at the L4-L5 level due to a large central disc herniation and marked stenosis/OYL (i.e., isointense on T2-weighted sequences) [ and ]. She now acutely presented to an emergency room with the sudden onset (i.e., over several hours) of 4/5 weakness in both lower extremities, bilateral leg numbness, and urinary retention.\nThe new magnetic resonance imaging (MRI) and CT both demonstrated worsening of her L4-L5 cauda equina compression due the large central disc herniation and severe stenosis/OYL; the CT further confirmed ossification of the OYL [-].\nNotably, the patient should have undergone emergent surgery following the completion of the MR/CT studies. However, surgery was delayed for 9 h by which time she was fully paraplegic (0/5 motor function, L4-S1 loss of sensation, and urinary retention (JOA 2/29).\nFollowing a L4-L5 laminectomy for stenosis, OYL, and a partial central discectomy (i.e., not completely removed because of its central location), the patient never fully recovered; she had just 1/5 motor function bilaterally (i.e., residual loss perineal sensation and urinary incontinence \u2013 final JOA score 9/29) 1 month later. Of interest, the postoperative MR and CT studies, despite showing mild residual ventral disc, confirmed adequate cauda equina decompression [-].", "summary": "A 40-year-old female developed an acute cauda equina syndrome (CES) attributed to an acute lumbar disc herniation and to marked canal stenosis due to OYL. As the patient underwent a 9 h delayed removal of the ossified ligament and discectomy, she sustained only minimal recovery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 40-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed an acute cauda equina syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The acute cauda equina syndrome was attributed to an acute lumbar disc herniation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The acute cauda equina syndrome was attributed to marked canal stenosis due to ossification of the yellow ligament.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent removal of the ossified ligament.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent discectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery was delayed by 9 hours.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient sustained only minimal recovery.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_556_en.txt", "fulltext": "A 27-year-old male presented to the emergency department (ED) with a right-sided nasal mass and associated progressively worsening lower right eyelid swelling over the course of several months. Medical history was insignificant. His social history was significant for a two pack-year smoking history with additional cocaine and marijuana use. Before his initial presentation, the patient had visited the ED multiple times for symptoms of intermittent epistaxis, sinus congestion, midface pressure, throbbing headaches, and ocular discharge. He had been treated with antibiotics and steroids without improvement. Due to periorbital inflammation, concern for increased intraocular pressure and decreased visual acuity at this ED encounter, the patient underwent a lateral canthotomy and cantholysis by ophthalmology, after which the patients\u2019 eye symptoms improved quickly.\nContrast-enhanced computed tomography (CT) at that time showed a 4.0 \u00d7 2.2 cm mass in the right nasal cavity, deviation of the nasal septum to the left, erosion of most of the ethmoidal air cells, and possible extension through the cribriform plate. There was near total opacification of the right frontal sinus, maxillary sinus, and ethmoid air cells with right preseptal soft-tissue edema . Given the patient\u2019s gender, age, and imaging evidence at the time, there was a high suspicion for juvenile nasopharyngeal angiofibroma (JNA). The patient was admitted and elective interventional radiology (IR) embolization was scheduled. During his admission, the patient became febrile. Subsequently, embolization of the mass/maxillary artery was cancelled to avoid seeding of intravascular coils with bacteria, as the patient\u2019s fever was felt to be secondary to bacteremia. Furthermore, the patient exhibited a declining serum sodium concentration from 133 mMol/L to 118 mMol/L, and syndrome of inappropriate antidiuretic hormone secretion (SIADH) was suspected. He received salt tablets and several doses of demeclocycline with subsequent improvement.\nFor the treatment of the presumed JNA, otolaryngology performed a right medial maxillectomy, right nasal endoscopy with debridement, total ethmoidectomy, and removal of the intranasal mass. The patient recovered appropriately and was discharged on postoperative day 2. Unexpectedly, the pathology from the right maxilla revealed a high grade malignant neoplasm, most consistent immunophenotypically and histologically with high grade \u201cmixed\u201d ONB and carcinoma . The tumor was comprised nests of poorly differentiated cells with hyperchromatic nuclei, coarse chromatin, and minimal cytoplasm that was continuous with areas of typical neuroblastoma including neuropil formation. Foci of both squamous differentiation and nonenteric glandular differentiation were also noted. Lymphovascular and bone invasion were present. Immunohistochemical staining of the tumor showed positivity for the following markers, which differed slightly depending on the area of tumor that was stained: synaptophysin, CD56, chromogranin (rare/focal), S100 peripherally, Pan CK, CAM 5.2, CK7, p16, p63, CK 5/6, and p40 [, ]. After recognizing the nasal cavity mass as a malignancy, the tumor was staged as T4aN0Mx.\nDuring postoperative follow-up, the patient reported improved right periorbital swelling and erythema, decreased serosanguinous drainage from right nares. No purulent nasal drainage was noted and he remained afebrile. Based on the results of pending magnetic resonance imaging (MRI) and positron emission tomography scans, the patient is expected to undergo further resection of residual tumor versus chemotherapy and radiation.", "summary": "An otherwise healthy 27-year-old male presented with sinus complaints, headache, and unilateral eye discharge. Imaging and endoscopy revealed a mass presumed to represent a juvenile nasopharyngeal angiofibroma. Unexpectedly, the final pathology report revealed high grade mixed ONB and carcinoma. This tumor is the sixth and youngest documented patient with mixed ONB and carcinoma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 27-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is otherwise healthy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with sinus complaints.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had unilateral eye discharge.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging and endoscopy revealed a mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was presumed to represent a juvenile nasopharyngeal angiofibroma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final pathology report revealed high grade mixed ONB and carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "This tumor is the sixth documented case of mixed ONB and carcinoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "This patient is the youngest documented case of mixed ONB and carcinoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_3353_en.txt", "fulltext": "Patient details and presentation\nA male Japanese patient in their 30s developed epilepsy in 2017, initially attributed to behavioral anomalies during sleep. Focal epilepsy was diagnosed and controlled with levetiracetam 1500 mg and clonazepam 1 mg until 2019. However, in 2021, the patient began experiencing focal impaired awareness seizures. Owing to the occurrence of seizures approximately once per month, the patient was referred to the epilepsy department of our hospital. These seizures involved loss of consciousness following \u201cd\u00e9j\u00e0 vu\u201d sensations. At the time of referral, the patient was on four antiepileptic drugs: levetiracetam, 1500 mg; lacosamide, 300 mg; perampanel, 2 mg; and clonazepam, 1 mg. Despite using multiple antiepileptic drugs with different mechanisms of action, seizure suppression remained suboptimal, leading to the decision to implement a surgical approach.\n\n\nSummary of progress\n\nPreoperative course\t\n2017: onset of seizure symptoms with behavioral abnormalities during sleep\n\n2018: start of LEV\n\n2019: seizures suppressed by adding CZP\n\n2021: the patient was referred to our hospital because his seizures were not controlled despite the addition of CZP, LCM, and PER\n\nTest results\t\nElectroencephalography: spiny waves were observed in the bilateral antero-medial temporal regions\n\nIt was difficult to identify the starting point from EEG findings during seizure\n\nHead MRI: no obvious abnormal findings. No hippocampal sclerosis or atrophy\n\nFDG-PET: hypoglycemia in the left anterolateral temporal region\n\nSurgery\t\nIntracranial electrode implantation: subdural electrodes were implanted in the lateral and medial left temporal lobe, and in the frontal lobe. Intracranial electrodes were placed in the lateral and medial left temporal lobe, and frontal lobe.\n\nIntracranial EEG during seizure showed repeated spikes in the temporal pole followed by propagation to the lateral temporal lobe\n\nFocal resection: resection of the left lateral temporal lobe, including the temporal pole, was performed. Intraoperative hippocampal wave recordings showed a low frequency of spikes, so the hippocampus was preserved\n\nPost-surgery\tFour months postoperatively, FAS recurred. One year after surgery, FIAS disappeared\n\n\nGlu-CEST MRI\nPre-surgery MRI was performed using a UHF (7 Tesla) MRI system (MR950; GE Healthcare, Chicago, IL, USA) with a 32-channel head coil (Nova Medical, Houston, TX, USA) at the Center for Integrated Brain Function Research, Niigata University Brain Research Institute. T1-weighted three-dimensional magnetization-prepared rapid acquisition gradient echo scans were acquired with the following parameters: field of view\u2009=\u2009220\u2009\u00d7\u2009220 mm2, matrix\u2009=\u2009220\u2009\u00d7\u2009220, repetition time/echo time\u2009=\u20094.1/1.4 ms, flip angle\u2009=\u20094\u00b0, and slice thickness\u2009=\u20091 mm.\n\nOn the basis of the three-dimensional T1 data, the CEST image slice was determined. CEST images were corrected for the B0 field distribution using water saturation acquisition [14]. To correct for B1 inhomogeneity, we followed the method of Cember et al. which leverages classification based on T1 values and a measured effective B1 irradiation pulse intensity distribution map to enhance CEST imaging [15]. A single-slice CEST image sequence based on fast spin echo was then acquired with the following parameters: field of view\u2009=\u2009220\u2009\u00d7\u2009220 mm2, matrix\u2009=\u2009128\u2009\u00d7\u2009128, repetition time/echo time\u2009=\u200910,000/5.8 ms, flip angle\u2009=\u200970\u00b0, and slice thickness\u2009=\u20094 mm. CEST imaging was conducted using a pulsed CEST preparation of eight sinc pulses of 100 ms each with a 10 ms interpulse delay (total saturation time of 800 ms) and a root mean square (RMS) amplitude of 3.0 \u03bcT. A total of 31 frequencies were acquired, each spaced by 100 Hz, ranging from \u22121500 to\u2009+1500 Hz.\n\nB0 and B1 corrected CEST images were used to calculate the Glu-CEST MRI using the following equation:, where S (\u22123.0 ppm) denotes the signal intensity after the saturation pulse with an offset of \u22123.0 ppm from the water peak, and S (+3.0 ppm) represents the signal intensity after the saturation pulse with an offset of\u2009+3.0 ppm from the water peak. Glutamate exhibits a CEST effect at approximately\u2009+3.0 ppm downfield from the bulk water resonance.\n\n\nObservations\nThe patient exhibited no obvious paralysis, sensory disturbances, or other abnormal neurological findings. In addition, there was no history of cerebrovascular or cardiovascular disease that could have contributed to loss of consciousness.\n\nInterictal EEG revealed sharp waves localized at F7 and F8, although seizure recordings failed to demonstrate a distinct onset pattern. MRI revealed no evident abnormalities, while magnetoencephalography identified a cluster of dipoles within the left insular cortex. Fluorodeoxyglucose-positron emission tomography (FDG-PET) indicated reduced glucose metabolism in the left temporal pole. Neuropsychological testing showed normal intellectual and memory functions.\n\nAll tests were performed without administering sedatives or other medications. FDG-PET was performed after the patient fasted for at least 6 hours. These tests were performed 1 year before surgery.\n\nOn the basis of the findings, epileptogenic regions were suspected within the left frontal and temporal lobes. However, the precise focus could not be determined, making it difficult to differentiate between medial and lateral lobe epilepsy. Consequently, intracranial subdural electrodes were implanted in the lateral and basal regions of the left frontal lobe, the lateral aspect of the left temporal lobe, and the medial temporal lobe. Interictal intracranial EEG revealed discrete spikes from the basal left temporal lobe, anterior to the left parahippocampal gyrus, and from the lateral aspect of the left temporal lobe. During three recorded intracranial EEG seizures, a pronounced spike was identified in electrodes located between the distal portion of the left temporal lobe and the parahippocampal gyrus, followed by propagation to the lateral temporal cortex (Fig. 1A). Subsequently, anterior temporal lobectomy was performed, encompassing the distal tip of the left temporal lobe, the basal region, and the middle and inferior temporal gyri (Fig. 1D and E). Intraoperative EEG recordings from the surface of the amygdala and hippocampus revealed no discernible spikes from the amygdala, with sporadic low-frequency spikes detected in the posterior aspect of the hippocampus. Therefore, the language-dominant hippocampus and amygdala were preserved to prevent postoperative verbal memory loss.\n\n\nPostoperative MRI indicated no obvious neurological deficits. Focal aware seizures (FAS) recurred 4 months postoperatively; however, no focal impaired awareness seizures were observed 1 year postoperatively. During evaluation 1 year after surgery, the patient was classified as Engel Class Ib. There were no postoperative neurological abnormalities, and psychological tests showed no deterioration.\n\nGlu-CEST MRI was performed the day before intracranial EEG electrode placement. It delineated an elevation in glutamate concentration extending from the left temporal pole to the medial temporal lobe. Subsequently, a 1\u2009\u00d7\u20098 strip electrode was positioned in the corresponding area, revealing a prominent spike in EEG activity at seizure onset from the electrode proximate to the region with heightened Glu concentration. The region exhibiting increased Glu concentration, as identified by Glu-CEST MRI, was encompassed within the resection area (Fig. 1D and E). Histopathological examination of the resected tissue revealed focal cortical dysplasia type IIa (FCD type IIa).\n\nFCD type IIa causes drug-resistant epilepsy and is characterized by histopathologic findings of dysmorphic neurons and absence of balloon cells. Complete resection of the focal area is expected to suppress seizures; however, MRI often shows no abnormalities. The resected area was associated with abnormal EEG activity during seizures and an elevated Glu concentration as detected by Glu-CEST MRI.\n\nIn addition, Glu-CEST MRI revealed an increased Glu concentration within the hippocampal head, albeit at a lower magnitude than that in the left temporal pole (Fig. 1C and F). The highest Glu concentrations were observed in the tip of the temporal lobe, followed by the head of the hippocampus.\n\nThe Glu-CEST results suggested that the residual seizures were caused by the preserved hippocampal head and may be useful for considering additional surgical treatment in the future.", "summary": "A male Japanese patient in his 30s with drug-resistant focal epilepsy underwent preoperative assessment at our institute. Preoperative magnetic resonance imaging was performed using an ultra-high-field magnetic resonance imaging system. The results of intracranial electroencephalography and chemical exchange saturation transfer imaging were compared. Head magnetic resonance imaging revealed no abnormalities. However, fluorodeoxyglucose-positron emission tomography revealed reduced glucose metabolism in the distal left temporal lobe. Preoperative fluorodeoxyglucose-positron emission tomography and intracranial electroencephalography indicated abnormal interictal waves and identified the seizure onset site. Ablation was performed from the distal to the basal region of the temporal lobe. Pathological examination revealed focal cortical dysplasia type IIa. Chemical exchange saturation transfer imaging delineated an elevated glutamate concentration extending from the distal tip of the left temporal lobe to the medial temporal lobe. These regions included the areas of seizure onset identified by intracranial electroencephalography and matched the extent of the resection surgery. Four months postoperatively, focal aware seizures recurred; however, no focal impaired awareness seizures were observed at 1 year postoperatively. Elevated glutamate levels were detected in the hippocampus head, suspected to be associated with residual focal aware seizures.", "subclaim_evaluations": [ { "subclaim": "The patient is a male Japanese individual in his 30s.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has drug-resistant focal epilepsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent preoperative assessment at the institute.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative magnetic resonance imaging was performed using an ultra-high-field magnetic resonance imaging system.", "support_label": "supported", "is_refined": false }, { "subclaim": "Head magnetic resonance imaging revealed no abnormalities.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fluorodeoxyglucose-positron emission tomography revealed reduced glucose metabolism in the distal left temporal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative fluorodeoxyglucose-positron emission tomography indicated abnormal interictal waves.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Ablation was performed from the distal to the basal region of the temporal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathological examination revealed focal cortical dysplasia type IIa.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chemical exchange saturation transfer imaging delineated an elevated glutamate concentration extending from the distal tip of the left temporal lobe to the medial temporal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "These regions included the areas of seizure onset identified by intracranial electroencephalography.", "support_label": "supported", "is_refined": false }, { "subclaim": "These regions matched the extent of the resection surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Four months postoperatively, focal aware seizures recurred.", "support_label": "supported", "is_refined": false }, { "subclaim": "No focal impaired awareness seizures were observed at 1 year postoperatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "Elevated glutamate levels were detected in the hippocampus head.", "support_label": "supported", "is_refined": false }, { "subclaim": "Elevated glutamate levels were suspected to be associated with residual focal aware seizures.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2694_en.txt", "fulltext": "A 74-year-old woman, who presented with complaints of repeated upper abdominal pain for 3 days, was admitted to our hospital. She had no relevant past medical history. Abdominal ultrasonography and computed tomography (CT) scan at another hospital revealed a tumor in the pancreatic uncinate process; thus, she was referred to our hospital for a comprehensive examination.\nThe results of the laboratory tests were found to be almost normal (the italicized text indicates the test results with abnormal values): white blood cell 9130/\u03bcl, total bilirubin 1.0 mg/dl, aspartate aminotransferase 16 U/l, alanine aminotransferase 9 U/l, hemoglobin A1c 6.0%, amylase 76 U/l, C-reactive protein < 0.02 mg/dl, Ca 10.3 mg/dl, soluble interleukin-2 receptor 271.0 U/ml, IgG4 31.5 mg/dl, and antinuclear antibody 160 index. The levels of tumor markers were also normal: carcinoembryonic antigen 3.0 ng/mL, carbohydrate antigen 19-9 11.0 U/ml, DUPAN-2 < 25 U/ml, span-1 8.9 U/ml, and elastase-1 85 ng/dl.\nAn abdominal contrast-enhanced dynamic CT scan showed a 60-mm-diameter tumor in the pancreatic uncinate process, accompanied by multiple cysts , and the tumor size tended to increase over time. The gastroduodenal artery was noted to be passing through within the tumor. The pancreatic duct was not enlarged and separated from the tumor. The tumor had a poor contrast effect in the arterial phase and a small contrast effect in the equilibrium phase.\nThe gadolinium-ethoxybenzyl-diethylenetriamine pentaacetic acid-enhanced magnetic resonance imaging (MRI) showed a lobulated tumor with mixed high and low signals on T2-weighted imaging . Out-of-phase T1-weighted imaging showed a low-intensity area, which was a fat component. This finding suggested that the tumor was unlikely to be a malignant tumor. However, diffusion-weighted images revealed a high signal lobulated tumor and suggested potential for malignancy . Magnetic resonance cholangiopancreatography revealed a soft tissue tumor close to the pancreatic uncinate process, and it was not continuous with the main pancreatic duct.\nAn upper gastrointestinal examination revealed that the gastric angle was pushed to the dorsal side of the stomach by the tumor. Endoscopic ultrasonography (EUS) showed a collective cystic lesion on the ventral side of the pancreatic uncinate process . The main pancreatic duct was negative for intraductal papillary mucinous neoplasm. In addition, given that the tumor was accompanied by a cystic lesion, a fine-needle aspiration was not performed.\nIn the positron emission tomography CT scan, there was no significant fluoro-deoxy-glucose accumulation in the soft tissues of the pancreatic uncinate process.\nThe tumor in the pancreatic uncinate process was thought to be the possible cause of the upper abdominal pain. Based on the abovementioned findings, we considered that the tumor was a benign vascular malformation, but because the tumor size tended to increase over time, there was a possibility of it being a malignant tumor; thus, we planned on performing a pancreatoduodenectomy (PD).\nAfter a detailed examination, we performed an elective open laparotomy. During the operation, intraoperative findings revealed that the tumor appeared to be benign and was separate from the pancreatic duct or bile duct. We therefore performed a partial pancreatectomy instead of PD. Since the right gastroduodenal artery and small vein penetrated the tumor, they were ligated and detached. The tumor was excised with a small part of the pancreatic uncinate process, and the mesentery of the transverse colon was also removed. The operation time was 200 min with 75 ml blood loss. The patient\u2019s postoperative course was uneventful, and she was discharged on postoperative day 12.\nMacroscopically, the tumor was a 58 \u00d7 46 \u00d7 30-mm specimen with a spongioid appearance of the cut surface . Histologically, hematoxylin and eosin staining showed a mixed shape of small veins, small arteries, and capillaries . The pancreatic tissue was recognized within the tumor, suggesting that the tumor originated from the pancreas. There was no lesion with suspected malignancy. We performed immunostaining for CD31, CD34, Factor VIII, and D2-40, which revealed the following in general: CD31 was positive for vascular endothelium and histiocyte; CD34 and Factor VIII were positive for vascular endothelium; and D2-40 was positive for lymphatic endothelium. In the Elastica van Gieson staining, most vessels of the tumor had no muscular layer. These vessels were capillary blood vessels (CD31, CD34, and Factor VIII were positive, and D2-40 was negative) and lymphatic vessels (CD31 and D2-40 were positive; CD34 and Factor VIII were negative). Based on both histological appearance and immunostaining findings, we diagnosed the tumor as a capillary lymphatic malformation (CLM) according to the International Society for the Study of Vascular Anomalies (ISSVA) classification.", "summary": "A 74-year-old woman, who presented with complaints of repeated upper abdominal pain, was admitted to our institution. Contrast-enhanced dynamic computed tomography (CT) scan revealed that the tumor in the pancreatic uncinate process had a poor contrast effect in the arterial phase and a small contrast effect in the equilibrium phase, which are suggestive of a benign disease-like vascular malformation. However, we suspected that it could possibly be a malignant tumor because the tumor size tended to increase over time; thus, we decided to perform a surgery. We resected the tumor through a partial resection of the pancreas. Macroscopically, the cut surface of the tumor had a spongioid appearance. Histopathological examination findings showed a mixed shape of small capillaries and lymphatic ducts. The patient was diagnosed with CLM according to the International Society for the Study of Vascular Anomalies (ISSVA) classification, based on the histological appearance and immunostaining findings. The postoperative course of the patient was uneventful.", "subclaim_evaluations": [ { "subclaim": "The patient is a 74-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with repeated upper abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "A contrast-enhanced dynamic CT scan was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was located in the pancreatic uncinate process.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had a poor contrast effect in the arterial phase.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had a small contrast effect in the equilibrium phase.", "support_label": "supported", "is_refined": false }, { "subclaim": "The imaging findings were suggestive of a benign disease-like vascular malformation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor size tended to increase over time.", "support_label": "supported", "is_refined": false }, { "subclaim": "A partial resection of the pancreas was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cut surface of the tumor had a spongioid appearance.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination showed a mixed shape of small capillaries and lymphatic ducts.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with CLM.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on the ISSVA classification.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative course was uneventful.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1718_en.txt", "fulltext": "A 12-day-old female neonate with a cleft lip and alveolus was referred from the Department of Plastic Surgery for the feeding management and presurgical molding of the cleft lip and alveolus. The patient's parents reported difficulty in feeding and escapement of fluid through the nose. Detailed paternal and maternal family history was traced till the second generation but no significant finding was observed. There was no history of maternal infection or trauma during the conception period till birth.\nExtraoral examinations revealed a bilateral cleft of the upper lip with a complete cleft of the right alveolus ( to ). Radiographic examination was done using radiovisography, and a significant cleft was observed on the right paramedian area . Diagnosis of Veau's classification type III cleft of lip and alveolus was arrived. After discussion with the plastic surgeon, PNAM was planned using the Grayson method with a palatal plate accompanied by an approximation of extraoral soft tissue with taping and nasal stent. The surgical phase was planned at 4 months.", "summary": "A 12-day-old neonate born with a bilateral cleft of lip and alveolus was referred from the Department of Plastic Surgery. PNAM was planned in consultation with the plastic surgeon. A customized nasoalveolar molding plate was fabricated, and tissue molding was carried out. Following nasoalveolar molding, primary surgical repair was done.", "subclaim_evaluations": [ { "subclaim": "The patient is a 12-day-old neonate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The neonate was born with a bilateral cleft of lip.", "support_label": "supported", "is_refined": false }, { "subclaim": "The neonate was born with a bilateral cleft of the alveolus.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The neonate was referred from the Department of Plastic Surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "PNAM was planned.", "support_label": "supported", "is_refined": false }, { "subclaim": "PNAM was planned in consultation with the plastic surgeon.", "support_label": "supported", "is_refined": false }, { "subclaim": "A customized nasoalveolar molding plate was fabricated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tissue molding was carried out.", "support_label": "supported", "is_refined": false }, { "subclaim": "Following nasoalveolar molding, primary surgical repair was done.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_3294_en.txt", "fulltext": "A 20-year-old man with psychomotor delay and a history of epilepsy was admitted to the emergency department of the State University Hospital in Haiti for abdominal distension, rigidity, generalized pain, absence of bowel movements and gas, and a history of vomiting. He had a history of falling on a sharp object that pierced his perineum 6 days prior, with the onset of symptoms 3 days later. Vital signs on admission were blood pressure 104/58 mmHg, heart rate 138 beats/min, respiratory rate 20 breaths/min, temperature 36.2 degrees Celsius, and oxygen saturation 98 % on room air. Initial physical examination revealed rebound tenderness, decreased bowel sounds, and diffuse pain. Rectal examination showed a clean anal margin, tonically competent anal sphincter, and a rectal ampulla filled with stool. He had a functional impairment of grade B according to the Fr\u00e4nkel classification, with a lesion level at L2/L3. The initial diagnosis on admission was peritonitis due to hollow organ perforation with a Fr\u00e4nkel grade B spinal cord injury. Initial treatment included ceftriaxone 2 g IV, metronidazole 500 mg IV, tramadol 100 mg, omeprazole 40 mg IV, dexamethasone 8 mg IV, tetanus serum 5000 U/ml, intra-rectal fleet enema, fluid resuscitation with Ringer lactate, and placement of a Foley catheter for diuresis monitoring. Laboratory tests showed a hemoglobin level of 16 g/dL, white blood cell count of 3250, urea level of 25 mg/dL, creatinine level of 6.9 mg/dL, and normal electrolyte levels. No imaging studies were available at the center. After anesthetic evaluation, the decision was made to proceed to the operating room, because he becomes hemodynamically unstable with a blood pressure of 90/50 mmHg, heart rate of 148, oxygen saturation of 94 %, and a urinary drainage bag containing 400 cc of highly colored urine was emptied.\n\nIn the operating room, the abdomen was accessed through a supra umbilical-pubic incision that was later extended. After resecting various anatomical planes, the abdominal cavity was opened, revealing a highly dilated rectum with areas of extensive necrosis at the base.\n\nThe colon was dissected, revealing dilation of the entire colonic frame using Mattox's maneuver to explore the retroperitoneal zones 1 and 2. Three staged biopsies were performed (diseased zone, transition zone, and healthy zone).\n\nA double-barreled sigmoid colostomy was created, followed by irrigation of collected materials. Approximately 300 cc of reactive fluid was aspirated. During the procedure, the patient experienced three cardiac arrests but was successfully resuscitated with the transfusion of two units of compatible blood. Due to the patient's inability to tolerate the rest of the procedure, closure was done using the Bogota technique to delay definitive closure.\n\nThe surgery lasted about 2 h and 40 min, and the patient was transferred to the postoperative care unit with a diagnosis of Hirschsprung's disease complicated by severe acidosis and acute renal failure. The patient left the operating room in a relatively stable condition with the following vital signs: blood pressure 130/60 mmHg, heart rate 70 beats/min, and oxygen saturation 93 % on room air. However, approximately 15 min later in the postoperative period, the patient's condition deteriorated with blood pressure dropping to 63/39 mmHg, heart rate increasing to 154 beats/min, respiratory rate of 44 breaths/min, temperature of 39 degrees Celsius, and oxygen saturation of 70 % with supplemental oxygen. About 4 h later, the patient passed away.", "summary": "He is a 20-year-old male patient with past medical history of epilepsy, psychomotor delay and recently a perineal perforating injury, admitted in the emergency room with initial diagnosis of peritonitis by perforated viscus with Frankel grad B spinal cord injury. Among his initial signs and symptoms were abdominal distension, rebound tenderness, decreased bowel sounds and diffuse pain. Laboratory tests revealed increased Hb, decreased white cells count and increased creatinine level. Initial management included: fluid resuscitation, analgesics, antibiotics and laxatives. After becoming hemodynamically unstable, the patient was introduced to the operating room where a highly dilated rectum with areas of necrosis at the base was discovered after access to the abdominal cavity. While doing the intervention, the patient experienced 3 cardiac arrests following by successful ressucitation and blood transfusion; leading to the decision to delay the definitive closure using the Bottega technique. The surgical course was unfavorable as the patient died around 4 hour post-surgery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 20-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a past medical history of epilepsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has psychomotor delay.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a perineal perforating injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial diagnosis was peritonitis by perforated viscus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a Frankel grade B spinal cord injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abdominal distension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had rebound tenderness.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had decreased bowel sounds.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had diffuse pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed increased Hb.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Laboratory tests showed decreased white cell count.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed increased creatinine level.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial management included fluid resuscitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial management included analgesics.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial management included antibiotics.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial management included laxatives.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient became hemodynamically unstable.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was taken to the operating room.", "support_label": "supported", "is_refined": false }, { "subclaim": "A highly dilated rectum was discovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Areas of necrosis at the base of the rectum were found.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient experienced 3 cardiac arrests during the intervention.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was successfully resuscitated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received blood transfusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The decision was made to delay definitive closure using the Bottega technique.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The surgical course was unfavorable.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died around 4 hours post-surgery.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1165_en.txt", "fulltext": "In November 2017, an asymptomatic 14-year-old boy referred to the authors\u2019 hospital for management of right lateral chest wall mass discovered incidently one month earlier. There was no history of trauma. Clinical examination was unremarkable. Plain chest radiography showed a smooth-walled 6.0 \u00d7 3.5 cm homogenous right lateral chest wall mass (A). Computed tomographic (CT) scan revealed right lateral extrapleural soft-tissue mass 6.5 \u00d7 4.0 \u00d7 5.6 cm in size abutting 5th and 6th ribs and filling the 5th intercostal space (B). There were neither cavitation nor calcification within the mass, and the adjacent ribs were not eroded.\nMagnetic resonance imaging (MRI) revealed right extrapulmonary and extrapleural chest wall soft tissue mass. Tl-weighted MRI demonstrated a solid mass with a low signal intensity (C), while T2-weighted MRI demonstrated a homogeneous mass with high signal intensity similar to that of fat tissue (D). Early phases after administration of contrast, showed characteristic heterogeneous enhancement of the tumor that became more uniform during the delayed phase (E and F).\nThe angiogram showed a sizeable vascular mass supplied by a branch of the internal mammary artery. That branch was subsequently embolized with Gelfoam pledgets with no further filling on the post-embolization arteriogram.\nThe patient underwent an exploratory video-assisted thoracoscopy (VAT) through the right 8th intercostal space anterior axillary line (A and B). Posterolateral thoracotomy revealed well-demarcated mass abutting the 5th and 6th ribs filling the right 5th intercostal space. En bloc resection of the mass involved ribs and the intercostal muscles were performed (C). Chest wall defect was reconstructed using polytetrafluoroethylene (PTFE) patch (GORE-TEX\u00ae, DUALMESH\u00ae, W. L. Gore & Associates) (D).\nThe surgical specimen measured approximately 6 \u00d7 4 \u00d7 3.5 cm, which included a hemorrhagic, highly vascular, mass that extended from the intercostal muscles to the extra-pleural space (E). Cut section revealed whitish homogenous material. Microscopically, there were homogeneous thick and thin-walled blood vessels with proliferating vascular spaces of capillaries of the cavernous type with intervening fibrous stroma (F). There was no evidence of recurrence at 3 and six months of follow-up.", "summary": "A 14-year-old boy who presented with asymptomatic right lateral chest wall mass with no history of trauma. Different radiological modalities were employed for diagnosis including computed tomography (CT) showed a soft tissue mass 6.5\u00d74\u00d75.6cm in size abutting 5th and 6th ribs. Magnetic resonance imaging (MRI) revealed iso-intense signal in T1 and hyperintense signal in T2, that is higher than that of adjacent muscles in the inferolateral right chest wall which was compatible with intercostal hemangioma. The patient underwent surgery for excision of the mass. Through right posterolateral thoracotomy, there was a well-demarcated mass abutting 5th, and 6th ribs filling the right 5th interspaces. Histopathological examination confirmed the diagnosis of intercostal hemangioma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 14-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had an asymptomatic right lateral chest wall mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no history of trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed a soft tissue mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass measured 6.5\u00d74\u00d75.6 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass abutted the 5th and 6th ribs.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance imaging showed iso-intense signal in T1.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance imaging showed hyperintense signal in T2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The T2 signal was higher than that of adjacent muscles.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI findings were compatible with intercostal hemangioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent surgery for excision of the mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery was performed through a right posterolateral thoracotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was well-demarcated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass abutted the 5th and 6th ribs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass filled the right 5th interspace.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination confirmed the diagnosis of intercostal hemangioma.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3024_en.txt", "fulltext": "We present the case of a 51-year-old woman with a history of fibromyalgia and anorexia-bulimia of more than 30 years of evolution, without toxic habits. She comes to the emergency room presenting a picture of expectoration of a yellowish appearance, with scarse cough and without fever, of five months of evolution.\n\nThe blood test did not detect significant alterations. However, the chest X-ray showed extensive consolidation predominantly affecting the middle lobe and the upper left lobe, so the patient was admitted for study.\n\nMicrobiological and serological determinations were negative (human immunodeficiency virus and SARS-CoV-2), except for the isolation of Serratia marcescens in moderate growth in the sputum.\n\nA chest computed tomography (CT) scan was performed, which reported confluent opacities including areas of ground glass opacities and consolidation, bilateral and diffuse distribution, and greater extent in the upper left lobe, the lingula, the middle lobe and the lower left lobe. Empirical antibiotic treatment (ceftriaxone 2 g/24 h and azithromycin 500 mg/24 h) and corticosteroid (methylprednisolone 40 mg/12 h) were initiated for seven days.\n\nA flexible fibrobronchoscopy was performed in which no alterations were observed in the tracheobronchial tree. A bronchoalveolar lavage was performed in the middle lobe from which a turbid and yellowish liquid was obtained. Shortly after its obtaining, the liquid obtained was separated into two phases, leaving a supernatant of a foamy, yellowish appearance in the upper part, which was sent to the services of Pathological Anatomy and Microbiology. During the bronchoscopy, biopsy with clamp was performed in the mucosa of the bronchus of the lower left lobe.\n\nThe cytology of the bronchoalveolar lavage was negative for malignancy with a differential count of 90% macrophages, 7% lymphocytes and 3% polymorphonuclear cells. As for the microbiological study, no bacterial or fungal growth was observed, no acid-fast bacilli were observed, the mycobacterial culture was negative after 42 days of incubation, and no Legionella spp. was isolated.\n\nBiopsies reported lung parenchyma with preserved architecture, no specific lesions or evidence of deposits, with occasional macrophages with microvacuolated cytoplasm.\n\nPulmonary function tests were performed with no significant abnormalities.\n\nDue to the absence of clinical changes, and the patient remaining in good general condition at all times, it was decided to proceed with hospital discharge, pending a pulmonary cryobiopsy. This biopsy was performed two months later in the lower left lobe. According to the anatomopathological report, the samples obtained showed areas of occupation of the air spaces by abundant macrophages with intracytoplasmic vacuoles of varying sizes, characteristic of exogenous lipoid pneumonia. Also, large extracellular vacuoles were recognized, surrounded by macrophages with occasional multinucleated elements.\n\nThe presence of macrophages with intracytoplasmic vacuoles is characteristic of exogenous lipoid pneumonia. In light of these findings, the final diagnosis was exogenous lipoid pneumonia in probable relation to the patient's purgative behavior, who is currently in the process of recovery and changing habits, without cough or expectoration.\n", "summary": "We present the diagnostic process of a 51-year-old patient with a clinical history of a cough with yellowish expectoration, without symptoms of infection or fever, of long evolution. In the computed axial tomography, bilateral pulmonary infiltrates of an alveolar type were observed. A bronchoalveolar lavage was performed in which a yellowish material of unknown origin was obtained, which did not allow any clear conclusion to be reached. The pulmonary cryobiopsy was the key test that led to the diagnosis of exogenous lipoid pneumonia, in probable relation to the anorexia with purging habit that the patient suffered chronically.\n", "subclaim_evaluations": [ { "subclaim": "The patient is a 51-year-old individual.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a clinical history of a cough with yellowish expectoration.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cough has a long evolution.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient does not have symptoms of infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient does not have fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed axial tomography showed bilateral pulmonary infiltrates.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infiltrates were of an alveolar type.", "support_label": "supported", "is_refined": false }, { "subclaim": "A bronchoalveolar lavage was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A yellowish material was obtained from the bronchoalveolar lavage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The material's origin was unknown.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The bronchoalveolar lavage did not allow clear conclusions.", "support_label": "supported", "is_refined": false }, { "subclaim": "A pulmonary cryobiopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cryobiopsy led to the diagnosis of exogenous lipoid pneumonia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The exogenous lipoid pneumonia is in probable relation to an anorexia with purging habit.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anorexia with purging habit is chronic.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3102_en.txt", "fulltext": "A previously healthy 9-year-old boy from Trujillo, Peru, fully vaccinated according to the vaccination schedule for his age, presented to the emergency department with respiratory problems and suspected COVID-19.\n\nThe mother and child were tested for the presence of antibodies to SARS-CoV-2. The results showed that both were positive for IgG antibodies to SARS-CoV-2. In the child, the reverse transcriptase polymerase chain reaction (RT-PCR) molecular test for SARS-CoV-2 was negative. According to the mother, the child had a fever, abdominal pain, diarrhea and vomiting for 3 days. The patient was admitted to the surgical center for acute examination of the abdomen without major findings.\n\nTwenty-four hours after surgery, the child was tachypneic with respiratory rate of 40 breaths per minute, subcostal retractions, low oxygen saturation (SatO2) of 80% in room air and 85% on high flow oxygen support, heart rate of 138 beats per minute and blood pressure of 790/550 mmHg. Due to his clinical deterioration, he was admitted to the paediatric intensive care unit (ICU), where he was urgently intubated for mechanical ventilation and presented low SatO2 at 85% and peripheral signs of hypoperfusion. Initial analysis of the venous blood gases showed pH of 7.29, carbon dioxide partial pressure (pCO2) of 39.8 mmHg, oxygen partial pressure (pO2) of 37.3 mmHg, bicarbonate levels of 17.8 mmol/L, base excess of -7.8 and inspired oxygen fraction of 100%, consistent with protective mechanical ventilation measures. Serial chest radiographs were performed, which showed bilateral parenchymal involvement, along with a thoracic tomography result consistent with a consolidated parenchymal inflammatory process and bilateral pleural effusion.\n\nNo improvement in oxygenation was observed with the initiation of mechanical ventilation with sedoanalgesia and optimal relaxation; therefore, it was decided to place him in the prone position for 48 hours, increasing the SatO2 to 92%. The child presented circulatory collapse and received several vasoactive agents (epinephrine, norepinephrine and dobutamine), achieving mean arterial pressure within the 50th percentile for his age. The vasoactive inotropic score (EVI) was 50, and the echocardiogram showed left ventricular dysfunction and vasoplegia, which reversed after 5 days with normal values of arterial pressure for his age and remained so until hospital discharge.\n\nThe respiratory pathogenic nucleic acid amplification panel was negative. Blood, urine and peritoneal fluid samples were negative. Blood tests showed a hemoglobin level of 9.9 g/dL, a leukocyte count of 10,680/mm3 and lymphopenia (640/mm3). The blood tests showed elevated levels of inflammatory markers, with a C-reactive protein level of 243 mg/L, a fibrinogen level of 410 mg/dL, a ferritin level of 1,260 ng/mL and hypalbuminemia (2 g/dL). In addition, the patient had a high level of D-dimer of 9.4 mg/L with signs of coagulopathy, a prothrombin time of 49 seconds and an international normalized ratio of 1.51. There were also elevated levels of pro-BNP (282 pg/mL), troponin (0.24 pg/mL) and a high level of lactate dehydrogenase (LDH). The fever persisted while the patient was on mechanical ventilation, and clinical, gas and radiological improvements were observed after 15 days. The patient was weaned off the mechanical ventilator to spontaneous ventilation with the support of a 30 L high flow cannula, and the inspired oxygen fraction was 60%. After 3 weeks, the child had neurological deterioration, with a Glasgow coma scale of 11/15 (M4/O4/V3), pupils of 3 mm in diameter, bilateral plantar fasciitis, delusions and suicidal ideation, psychomotor agitation and the incidence of two convulsive events of approximately 2 minutes in duration each, with no recovery of consciousness between the events, for which the patient received intravenous (IV) midazolam 0.1 mg/kg and then phenytoin bolus 20 mg/kg/dose with a maintenance dose of 8 mg/kg/dose. This prescription was maintained after hospital discharge. Psychomotor agitation was controlled with antipsychotics; haloperidol was administered orally at 5 mg every 8 hours. No immunosuppressive treatment was used.\n\nBrain MRI showed bilateral occipital involvement in hyperintense T2 and FLAIR images, which affected subcortical white matter symmetrically, especially at the posterior level, and did not stand out with contrast or show significant changes in diffusion. These findings were consistent with vasogenic edema and indicative of posterior reversible encephalopathy syndrome (PRES). Electroencephalographic findings showed a generalized slowing of theta/delta frequency activity.\n\nTo treat the multisystem inflammatory syndrome, he received immunoglobulin at 2g/kg in a single dose and methylprednisolone at 2mg/kg/dose for maintenance. Subsequently, we focused on the therapeutic management of PRES by the IV administration of antiepileptic drugs to maintain blood pressure levels at normal tension, preserving an adequate homeostasis of the internal environment with special emphasis on the treatment of volume overload and the prevention of electrolyte disorders.\n\nDuring follow-up at 4 weeks after discharge, at the time of neuropsychological evaluation, abilities such as attention, concentration, memory, language, visuoconstructive abilities, calculation and orientation were assessed, and motor deficits of 4/5 in the legs were preserved. MRI abnormalities of the brain were reversed 21 days after discharge.\n", "summary": "We describe a case of posterior reversible encephalopathy syndrome secondary to SARS-CoV-2 infection in a 9-year-old boy who developed acute hypoxemic respiratory failure and required mechanical ventilatory support. The child developed multisystem inflammatory syndrome and was monitored in the paediatric intensive care unit, receiving mechanical ventilatory support and vasoactive agents for haemodynamic support. In addition, he developed pulmonary and extrapulmonary clinical manifestations along with neuropsychiatric manifestations that required careful follow-up, which was verified by brain magnetic resonance for timely intervention.\n", "subclaim_evaluations": [ { "subclaim": "The patient was a 9-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a SARS-CoV-2 infection.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient developed posterior reversible encephalopathy syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The posterior reversible encephalopathy syndrome was secondary to SARS-CoV-2 infection.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient developed acute hypoxemic respiratory failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient required mechanical ventilatory support.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed multisystem inflammatory syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was monitored in the paediatric intensive care unit.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received vasoactive agents for haemodynamic support.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed pulmonary clinical manifestations.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed extrapulmonary clinical manifestations.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had neuropsychiatric manifestations.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient required careful follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "Brain magnetic resonance was used for timely intervention.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_476_en.txt", "fulltext": "An 8-year-old girl presented with a 4 months history of right parietal bone swelling with an offensive odor. There was no discharge and no history of vomiting or trauma. She has taken no medications lately and had no allergic reactions. In the clinic, she had a mild headache with no fever, no symptoms of increased intracranial pressure, and no neurological abnormalities. A head computed tomography (CT) scan showed a parietal bone lesion. After that, an MRI scan of the brain showed a 2.5 \u00d7 1.5 cm bone lesion extended as swelling and suggested the diagnosis of EG . Histopathology was performed and revealed proliferation of monotonous population of discohesive cells composed of oval nuclei with open chromatin and coffee bean grooves with abundant pale cytoplasm. Immunohistochemistry for these cells was positive for CD1a and S100 . Initial treatment with augmentin was performed to relieve the infection and the odor. After that, a CT scan showed that the swelling is disappeared, but there was a lytic bone lesion . On examination, there was a feeling of soft tissue. Thereupon, a surgical procedure was done by excision of the lesion with a 3 mm safety margin, and a titanium mesh was inserted . During the surgery, the patient was given cefazolin. Laboratory values before and after the surgery were within the normal range. The patient was discharged home with augmentin and analgesia. In the clinic, the follow-up of the patient was performed with no post-operative complications.", "summary": "An 8-year-old girl presented with a 4\u00a0months history of a right parietal bone swelling of the skull with an offensive odor. There was no discharge and no history of vomiting or trauma. An MRI scan of the brain showed swelling with a bone lesion of the right parietal bone. Infection was the source of the swelling and the bad odor. Treatment was done by surgical excision of the lesion.", "subclaim_evaluations": [ { "subclaim": "The patient is an 8-year-old girl.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a 4-month history of a right parietal bone swelling.", "support_label": "supported", "is_refined": false }, { "subclaim": "The swelling had an offensive odor.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no discharge.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no history of vomiting.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no history of trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "An MRI scan of the brain showed swelling.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI showed a bone lesion of the right parietal bone.", "support_label": "supported", "is_refined": false }, { "subclaim": "Infection was the source of the swelling.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Infection was the source of the bad odor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Treatment was done by surgical excision of the lesion.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_2656_en.txt", "fulltext": "On January 31, 2021, a 75-year-old male presented at the Gastroenterology Department of our hospital complaining of intermittent melena with epigastric discomfort for 1 mo.\nThe patient reported that melena occurred several times a day and was accompanied by epigastric discomfort and fatigue, without dizziness or severe abdominal pain.\nThe patient detected a plantar nodule on the right side in November 2016. It gradually grew and developed an ulceration. Biopsy results showed melanoma. He underwent an extended resection of the melanoma on the right plantar. Postoperative pathological diagnosis was acral malignant melanoma. He received interferon \u03b12b (1800 WU three times per week) and continued maintenance therapy of a decreased dose of interferon \u03b12b. He had no history of other chronic diseases.\nThe patient had no history of smoking or drinking. He denied a history of allergies, and his family history was unremarkable.\nAt admission, the patient\u2019s temperature was 36.5 \u00b0C, heart rate was 70 beats per min, respiratory rate was 20 breaths per min, and blood pressure was 140/70 mmHg. Abdominal examination found soft tenderness in the left quadrant, without rebound tenderness. Lung and heart examinations were normal.\nRoutine blood tests revealed a normal white blood cell count (7.5 \u00d7 109 cells/L), moderate anemia (hemoglobin of 75.0 g/L; normal range: 130.0-175.0 g/L), hypoproteinemia (31.0 g/L; normal range: 35.0-52.0 g/L), and elevated levels of creatinine (136 \u00b5mol/L; normal range: 59-104 \u00b5mol/L). Transaminase, amylopsin and lipase levels were normal, and coagulation function was normal.\nAn abdominal computed tomography (CT) scan (January 30, 2021) showed an irregular shape of the jejunum in the left upper quadrant and shadows of fat, which indicated intestinal intussusception . Multiple gallstones were also found. Upper gastrointestinal endoscopy (February 2, 2021) showed multiple linear ulcers in the antrum, superficial gastritis, and small polyps. Magnetic resonance enterography (February 3, 2021) showed partial thickening of the jejunal wall in the left upper quadrant and formation of a soft tissue mass (32 mm \u00d7 24 mm), indicating a neoplastic lesion . The mass showed increased signal intensity in diffusion weighted imaging with intussusception of the distal jejunum and mesentery (jejunojejunal intussusception), and intestinal lumen expansion with air and fluid accumulation . Chest CT (February 7, 2021) showed a nodule in the superior lobe of the left lung (7 mm) and tiny nodules in the right lung (2-4 mm).\nThe patient underwent partial small bowel resection. Pathological findings revealed a 4.0 cm \u00d7 3.0 cm \u00d7 2.5 cm protrusion tumor. Histopathology showed diffuse growth of tumor tissue, with the majority located in the submucosa and nearly invading the mucosa . Tumor cells presented with patchy distribution, large nuclei, prominent nucleoli , and red cytoplasm . Some tumor cells showed pigment granules in the cytoplasm . Epithelioid tumor cells contained mitotic figures . Immunohistochemical staining showed HMB45 (+), Melan-A (+), S-100 (+), SOX10 (+), Braf (-), PCK (-), LCA (-), Ki-67 (about 50%) . Lymph node metastasis was detected in one of the five lymph nodes biopsied. Combined with the patient\u2019s history of past illness, the pathologic diagnosis was small intestine metastatic melanoma.", "summary": "A 75-year-old man with a history of acral malignant melanoma was admitted to the Gastroenterology Department of our hospital, complaining of intermittent melena for 1 mo. Magnetic resonance enterography showed partial thickening of the jejunal wall and formation of a soft tissue mass, indicating a neoplastic lesion with jejunojejunal intussusception. The patient underwent partial small bowel resection. Pathological findings and immunohistochemical staining indicated small intestine metastatic melanoma. The patient refused further anti-tumor treatment after the surgery. Ten months after the first surgery, the patient presented with melena again. Computed tomography enterography showed the anastomotic stoma was normal without thickening of the intestinal wall, and routine conservative treatment was given. Three months later, the patient developed melena again. The patient underwent a second surgery, and multiple metastatic melanoma lesions were found. The patient refused adjuvant anti-tumor treatment and was alive at the latest follow-up.", "subclaim_evaluations": [ { "subclaim": "The patient is a 75-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of acral malignant melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to the Gastroenterology Department.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported intermittent melena for 1 month.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance enterography showed partial thickening of the jejunal wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance enterography showed formation of a soft tissue mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings indicated a neoplastic lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings indicated jejunojejunal intussusception.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent partial small bowel resection.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathological findings indicated small intestine metastatic melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical staining indicated small intestine metastatic melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient refused further anti-tumor treatment after the surgery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Ten months after the first surgery, the patient presented with melena again.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Computed tomography enterography showed the anastomotic stoma was normal.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Computed tomography enterography showed no thickening of the intestinal wall.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Routine conservative treatment was given.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Three months later, the patient developed melena again.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient underwent a second surgery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Multiple metastatic melanoma lesions were found.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient refused adjuvant anti-tumor treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was alive at the latest follow-up.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2233_en.txt", "fulltext": "A 75-year-old Japanese man was admitted to our hospital with a gradually growing cutaneous polypoid mass that had appeared on the skin of the left scrotum approximately one year before. The tumor measured 13mm in diameter with relatively well-defined whitish-yellow outlines . Histological examination of an excisional biopsy revealed epidermal papillary proliferation with parakeratosis, hyperkeratosis, and neutrophil infiltration . Although mitotic figures were noted in the basal layer , cellular atypia was not prominent. Besides abundant plasma cells in the upper dermis, numerous foamy macrophages infiltrated the dermal papillae, forming a characteristic clear zone beneath the basement membrane . Histopathologically, the tumor was diagnosed as a benign cutaneous verruciform xanthoma with negative lateral and deep surgical margins.\nTo determine which cells release chemoattractants for macrophages, formalin-fixed and paraffin-embedded sections were stained for cytokeratin (AE1/AE3, M3515; Dako, Carpinteria, CA, USA; 1:200), CD68 (M0876; Dako; 1:100) and MCP-1 (DA103; BD Biosciences, San Diego, CA, USA; 1:40, 1:200, 1:800). After microwave heat-induced epitope retrieval, endogenous peroxidase activity was blocked with hydrogen peroxide (H2O2) in methanol. Indirect immunohistochemistry with the use of horseradish peroxidase conjugated anti-mouse rabbit antibody revealed that cytokeratin AE1/AE3 was strongly positive in differentiating epidermal keratinocytes, and weakly positive in keratinocytes in the basal and parabasal layers . However, strong CD68 staining was observed almost exclusively in foamy cells infiltrating beneath the basal cells . The parts densely stained for MCP-1 were observed in the differentiating cytokeratin AE1/AE3-positive keratinocytes. Clusters of the infiltrating macrophages also stained positive for MCP-1 .", "summary": "A 75-year-old Japanese man with a well-defined nodule on the left scrotum was admitted to the hospital. An excision biopsy revealed epidermal papillary proliferation with parakeratosis, hyperkeratosis, and infiltration of foam cell macrophages, whereby a pathological diagnosis of benign cutaneous verruciform xanthoma was made. Immunohistochemically, monocyte chemoattractant protein-1 was observed predominantly on cytokeratin AE1/AE3-positive differentiating keratinocytes in the prickle cell layer. However, while infiltrating macrophages were densely stained for monocyte chemoattractant protein-1, keratinocytes in the basal and parabasal layers were almost negative.", "subclaim_evaluations": [ { "subclaim": "The patient is a 75-year-old Japanese man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a well-defined nodule on the left scrotum.", "support_label": "supported", "is_refined": false }, { "subclaim": "An excision biopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy showed epidermal papillary proliferation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy showed parakeratosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy showed hyperkeratosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy showed infiltration of foam cell macrophages.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pathological diagnosis was benign cutaneous verruciform xanthoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical staining for monocyte chemoattractant protein-1 was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Monocyte chemoattractant protein-1 was observed on cytokeratin AE1/AE3-positive differentiating keratinocytes in the prickle cell layer.", "support_label": "supported", "is_refined": false }, { "subclaim": "Infiltrating macrophages were densely stained for monocyte chemoattractant protein-1.", "support_label": "supported", "is_refined": false }, { "subclaim": "Keratinocytes in the basal and parabasal layers were almost negative for monocyte chemoattractant protein-1.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_964_en.txt", "fulltext": "In June 2020, a 21-year-old male was admitted to our department after 2 weeks onset of headache, mild paraparesis (right side worse than left side), tactile, and thermic hypoesthesia with a D2 level. A contrast-enhanced MRI scan of the brain and spine showed an intramedullary lesion extending from D1 to D5. The cranial portion of the tumor presented an apparently exophytic extramedullary component which extended on the right posterolateral side up to C7 . A diffuse craniospinal leptomeningeal thickening was also present . A total-body CT scan ruled out lesions outside the CNS and cerebrospinal fluid (CSF) analysis excluded infection. Corticosteroid therapy was administered with no clinical improvement. After a week, the neurological status deteriorated rapidly with paraparesis worsening and onset of hydrocephalus with headache, emesis, and lethargy. The patient, therefore, underwent external ventricular drain positioning, once again, cultural and cytologic CSF analysis was not diagnostic. A C7-D4 laminectomy was subsequently performed. Intraoperatively, the spinal cord appeared swollen and distorted, with difficult to identify the apparent exophitic nodule. The tumor was then approached with intraoperative ultrasound and functional mapping with direct electrical stimulation with a monopolar probe.[,] The procedure was interrupted due to sudden deterioration of the motor evoked potentials; then, to decompress the spinal cord, a duraplasty was completed using a dural patch and a pedicled multifidus muscle flap was performed to decrease the risk of CSF leakage.[,]\nPostoperatively, the patient showed an immediate mild worsening of the lower limbs deficit. After a few days, severe further neurological deterioration occurred with progressive motor deficit to the upper limbs and ultimately respiratory failure. Mechanical ventilation was necessary and the patient was, therefore, transferred to the Intensive Care Unit. During the following weeks, he developed tetraplegia and underwent surgery for ventriculoperitoneal shunt positioning. By the time, the histological diagnosis was available; the clinical status would not allow radiotherapy (RT) or chemotherapy (ChT). The patient deceased approximately 90 days after hospitalization due to respiratory complications.", "summary": "A 21-year-old male presented with mild paraparesis and hypoesthesia with a D2 level. MRI scan of the brain and spine showed a dorsal intramedullary lesion; a diffuse craniospinal leptomeningeal thickening was also present. After a week, the neurological status deteriorated rapidly with paraparesis worsening and onset of acute hydrocephalus. The patient underwent external ventricular drain positioning; a C7-D4 laminectomy was subsequently performed with partial tumor resection. Histological examination revealed a DLGNT with aggressive aspects (Ki67 30%). Postoperatively, the patient showed an immediate mild worsening of the lower limbs deficit. After a few days, severe further neurological deterioration occurred with progressive motor deficit to the upper limbs and ultimately respiratory failure. Mechanical ventilation was necessary and the patient was transferred to the ICU; during the following weeks, he developed tetraplegia and underwent ventriculoperitoneal shunt positioning. By the time, the histological diagnosis was available, the clinical status would not allow radiotherapy or chemotherapy. The patient deceased approximately 90 days after hospitalization due to respiratory complications.", "subclaim_evaluations": [ { "subclaim": "The patient is a 21-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had mild paraparesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypoesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The neurological deficit was at the D2 level.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed a dorsal intramedullary lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed diffuse craniospinal leptomeningeal thickening.", "support_label": "supported", "is_refined": false }, { "subclaim": "The neurological status deteriorated rapidly after one week.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed acute hydrocephalus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent external ventricular drain positioning.", "support_label": "supported", "is_refined": false }, { "subclaim": "A C7-D4 laminectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Partial tumor resection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histological examination revealed a DLGNT.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The DLGNT had aggressive aspects.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The Ki67 index was 30%.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Postoperatively, the patient had an immediate mild worsening of the lower limbs deficit.", "support_label": "supported", "is_refined": false }, { "subclaim": "Severe further neurological deterioration occurred after a few days.", "support_label": "supported", "is_refined": false }, { "subclaim": "The motor deficit progressed to the upper limbs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed respiratory failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mechanical ventilation was necessary.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was transferred to the ICU.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed tetraplegia.", "support_label": "supported", "is_refined": false }, { "subclaim": "A ventriculoperitoneal shunt was positioned.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histological diagnosis was available.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical status did not allow radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical status did not allow chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died approximately 90 days after hospitalization.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cause of death was respiratory complications.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2798_en.txt", "fulltext": "A 28-year-old healthy man sustained injury to the left lower leg due to a traffic accident. He was admitted to the local hospital and received a DR/CT examination . The patient suffered a left ankle fracture, clavicle fracture and dislocation. He underwent debridement followed by Vacuum Sealing Drainage (VSD) cover and fibula plate fixation surgery. He was moved to the ICU postoperatively. One week later, he underwent open reduction and internal fixation of clavicle fracture surgery. Postoperative healing of the left shoulder wound was satisfactory, but the left lower leg showed poor wound healing and a large-area skin defect, and the long bone remained exposed. The patient returned to our hospital for further treatment.\nThe patient presented with stable vital signs and absence of any cardiopulmonary abnormalities; the wound covering the VSD had good negative pressure. There was a weak dorsalis pedis artery, toes showed restricted movement, the shoulder wound healed completely, dorsalis pedis pulse improved, the posterior tibial artery pulse remained unchanged, and the lateral margins of the left foot felt numb. General physical examination results were without exception.\nThe blood test results of the patient showed white blood cell count of 12.36 * 109/ L, neutrophil percentage of 80.3 %, C-reactive protein of 53.66 mg/L, and calcitonin of 0.115 (0\u20130.05 ng/mL).\nSevere open wound to the left calf, Large skin defect on left calf, Extensive bone exposure in the left calf, Left medial malleolar defect Positive after admission to cephalosporins anti-infection treatment, 7 Ye Zao nucleoside detumescence, low molecular heparin calcium sodium anticoagulation. Four days after admission and debridement surgery, the patient had a large left leg skin defect, the tibia was exposed (area: 23 cm * 10 cm), the ankle area had defects, and the medial malleolus osseous was absent . Ankle joint debridement take part of the training for the inflammatory tissue\u2005+\u2005drug susceptibility, after thorough debridement, will narrow rear to lift ahead of soft tissue wound, finally use the VSD cover the wound. After 4 days of germiculture, results revealed the presence of enterococcus, and the patient received levofloxacin to fight infection. After 7 days, the VSD was dismantled, the wound and exposed bone area had become smaller, and the surrounding granulation tissue was fresh. The medication of the patient was changed . After 14 days, the patient underwent a second surgery, where intraoperative debridement was carried out on the wound again; ipsilateral thigh skin transplantation was undertaken and covered with VSD. The skin graft grew well, leaving the long bone exposed . After 4 weeks, the skin graft area was observed to be healing well. The exposed bone was ground intraoperatively and subjected to micropower drilling such that each hole was spaced 5 to 10 mm apart . Gentamicin bone cement (DuPuy Synthes, USA) was mixed with powder bone cement (40 g); polymethyl methacrylate reagent (DuPuy Synthes, USA) was added and fully mixed. The cement dough was placed to cover the bone shape and fixed with sutures . The bone cement was removed, and the tissue showed no signs of necrosis . Using an external fixator with the fibula plate, the fibula segment and trim were removed. The fibula ankle bone graft showed fusion and wound healing. The patient was followed up 1 month after discharge, and the affected area showed no infection, indicating recovery .", "summary": "A 28-year-old healthy man was injured in a car accident and presented to the local hospital with a large skin defect and exposed left lower leg long bone. After transfer to our hospital, the patient underwent repeated debridement and skin graft, a cortex borehole combined with bone cement cover, and ankle fusion. The patient achieved full recovery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 28-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was injured in a car accident.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a large skin defect on the left lower leg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had exposed left lower leg long bone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent repeated debridement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent skin grafting.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a cortex borehole procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a bone cement cover applied.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had ankle fusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient achieved full recovery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 2 }, { "id": "multiclinsum_test_1678_en.txt", "fulltext": "A previously healthy 48-year-old woman, with no significant past medical history and no family history of colorectal diseases, presented to the emergency room with abdominal distension, colicky pain, and a history of repeated episodes of lower gastrointestinal hemorrhage for as long as couple of months. She also complained of 8 kg weight loss in the last 2 months. She denied taking any prescription or over-the-counter medications. Clinical examination revealed a malnourished woman in severe distress due to diffuse abdominal tenderness. Signs of colonic obstruction were apparent. Digital rectal examination was indicative for rectal bleeding. Her vital signs were temperature 38\u00b0C, pulse 118/min, blood pressure 105/60 mmHg, and respiratory rate 20/min. Blood counts showed Hb 7.4 g/dl and a white blood count of 16.000. Serum electrolytes, liver function tests, and urinalysis were unremarkable. A plain abdominal X-ray and abdominal CT scan confirmed the signs of large bowel obstruction, along with a polypoid mass fully occluding the lumen of the terminal sigmoid colon. The patient was taken to the operating room where a standard left hemicolectomy was performed because of the malignant appearance of the mass and the extensive lymph node involvement that was found intraoperatively .\nHistological examination revealed a branching polypoid lesion characterized by mucosa projections with a central muscular core . Additionally, misplaced mucosa was encountered within the submucosa forming cystic structures, while partly preserved continuity with the polypoid part of the lesion could be demonstrated . The colonic epithelium both of the exophytic and the endophytic component showed extensive adenomatous transformation with high-grade dysplasia . A lesion-restricted transmural Crohn-like inflammation with prominent lymphoid aggregates was also present. The final diagnosis was consistent with a solitary hamartomatous polyp of Peutz-Jeghers type characterized by an inverted component, analogous to colitis cystica profunda, and by extensive high-grade dysplastic changes. The patient had an uneventful postoperative recovery and complete resolution of her symptoms. Follow-up colonoscopy 3 months after surgery showed no abnormal findings. The patient remains free of symptoms.", "summary": "Herein, we describe a unique case of colitis cystica profunda in the setting of Peutz-Jeghers-type polyp of the sigmoid colon, associated with high-grade dysplasia of the overlying epithelium in a 48-year-old female patient, who presented to the emergency room with signs of intestinal obstruction. To the best of our insight, this is the first manifestation ever reported in the literature regarding the coexistence of solitary Peutz-Jeghers-type polyp, colitis cystica profunda, and high-grade dysplasia of the epithelium of the colon.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a Peutz-Jeghers-type polyp of the sigmoid colon.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had colitis cystica profunda.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had high-grade dysplasia of the overlying epithelium.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with signs of intestinal obstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case involves the coexistence of a solitary Peutz-Jeghers-type polyp, colitis cystica profunda, and high-grade dysplasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "This is the first reported case in the literature of this specific combination of findings.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2076_en.txt", "fulltext": "A 51-year-old Caucasian left-handed housewife lady (weight 61 kg, height 159 cm) was admitted to our institution because of severe sudden onset headache followed by transient loss of consciousness and vomiting. On examination she was fully conscious and oriented and complained of severe headache. Nuchal rigidity was evident. No focal neurological deficit was found. Temperature was 38\u00b0C and other vital signs were stable. Past medical history was negative and she did not consume any medication.\nCT scan of the head revealed acute subarachnoid hemorrhage prominently occupying the right sylvian fissure. CT angiography was performed . The cerebral vasculature was found to harbor three saccular aneurysms at: (1) right MCA trifurcation, (2) left ICA bifurcation, and (3) distal basilar artery. The right MCA aneurysm was presumed to be the ruptured aneurysm due to location of subarachnoid clot and irregular shape of the aneurysm.\nA right pterional craniotomy was performed with the patient in the supine position and head rotated 30 degrees to left. After elevation of the craniotomy flap, the sphenoid ridge was drilled flush with the orbital roof to facilitate exposure of the basilar tip aneurysm. After duratomy, gentle frontal lobe retraction allowed CSF drainage from the optic and carotid cisterns. Right optic nerve and right ICA were identified and the Sylvian fissure was opened from medial to lateral, following the bifurcation of right ICA to MCA trifurcation. A saccular aneurysm was found in the MCA trifurcation projecting inferolaterally. After dissection of the neck it was clipped. Next, opening the membrane of Liliequist, let to the distal basilar aneurysm from the corridor between the right optic nerve and right ICA. The aneurysm was located between the right PCA and right SCA with a wide neck, and its dome projected laterally to right. Successful clipping was achieved. The left ICA bifurcation aneurysm was identified after following the right A1, anterior communicating and left A1 arteries with minimal brain retraction, and gaining benefit from favorable neuroanesthesia. The aneurysm projected superiorly and was also clipped .\nThe patient experienced an uneventful post-operative period and was discharge within 5 days of surgery. A follow-up CT angiography confirmed successful obliteration of all lesions and preservation of normal cerebral vasculature .", "summary": "A 51 year-old Caucasian right handed housewife lady (weight 61 kg, height 159 cm) presented with a headache of acute onset which proved to be caused by acute subarachnoid hemorrhage. Cerebral computed tomographic angiography revealed multiple aneurysms. The patient underwent a right pterional craniotomy to obliterate right middle cerebral, distal basilar and left carotid bifurcation aneurysms. The post-operative course was uneventful.", "subclaim_evaluations": [ { "subclaim": "The patient is a 51 year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is right-handed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient is a housewife.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's weight is 61 kg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's height is 159 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a headache of acute onset.", "support_label": "supported", "is_refined": false }, { "subclaim": "The headache was caused by acute subarachnoid hemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cerebral computed tomographic angiography revealed multiple aneurysms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a right pterional craniotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right pterional craniotomy was performed to obliterate right middle cerebral aneurysms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right pterional craniotomy was performed to obliterate distal basilar aneurysms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right pterional craniotomy was performed to obliterate left carotid bifurcation aneurysms.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The post-operative course was uneventful.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1775_en.txt", "fulltext": "A 5-year-old girl initially presented to our department due to worsening pain in the left proximal thigh. Osteosarcoma was suspected radiographically . Open biopsy revealed a high-grade conventional osteosarcoma. The tumor was initially staged as IIB (T2b N0 M0), and neoadjuvant chemotherapy was commenced in accordance with the NECO-95J protocol . After three cycles of neoadjuvant chemotherapy, the pain was alleviated, the extra-osseous mass was dramatically reduced, and limb-salvage surgery was planned. As the tumor had already invaded the epiphyseal plate and epiphysis of the left distal femur at initial presentation, osteo-articular resection was thought necessary so as to obtain a negative surgical margin. At 6 years and 2 months old, distal femoral resection and temporary spacer insertion was performed . Both medial and lateral meniscuses were preserved. The spacer was hand-made, using an intramedullary nail of 7 mm in diameter and molded polymethylmethacrylate (PMMA). Because there were no commercially available molds fitting the distal femur of such a young child, we made the spacer by hand, imitating the original distal femur of the patient that had been just removed. After surgery, the left leg was externally fixed in a cast for 4 weeks. Partial weight bearing on the affected leg, supported by a hinged knee brace, was thereafter commenced ; however, the spacer was dislocated at 7 months post-operatively, preventing the patient from bearing weight and leading to bone atrophy in the left leg .\nAt 7 years and 8 months old, secondary surgery was performed with the aim of enabling weight bearing on the affected leg. In order to stabilize the spacer against the tibia, a custom-made ceramic spacer (Kyocera Corp., Japan) with a smooth straight stem of 8 mm in diameter had been ordered 3 months prior to the surgery . Intra-operatively, after the removal of the initial spacer, a 1-cm length of the distal edge of the residual femur was removed, but the periosteum and reactive membrane around the molded PMMA was preserved. The junction between the residual femur and the ceramic spacer was fixed with PMMA, and then covered with the preserved periosteum and membrane . After surgery, the left leg was placed in a cast for 4 weeks, after which the patient re-started partial weight bearing using a hinged knee brace as with the first spacer. The bone atrophy in the left leg was gradually resolved. At 18 months after the second surgery, the cortexes of the femur and tibia had thickened sufficiently for expandable mega-prosthesis; however, loosening of the stem and varus deformity was observed . A third surgical intervention was, therefore, planned.\nAt 9 years and 7 months old, the second spacer was removed, and the knee joint was reconstructed using a custom-made growing femoral prosthesis (Stryker Corp., Germany) with a curved porous stem of 8.5 mm in diameter fixed to the residual femur with two screws . Intra-operatively, the PMMA around the junction was already loosened, and the stem was easily removed. The residual femur was carefully reamed, and the stem was inserted. Cancellous bone chips from the proximal tibial epiphysis were grafted around the bone-prosthesis junction and then wrapped with the preserved periosteum and pseudo-periosteum membrane. The proximal surface of the tibia was also replaced, but the growth plate was preserved. Immediately after surgery, range of motion (ROM) exercise was started. Six weeks after surgery, partial weight bearing was permitted. Ten months after the third surgery, the patient was able to walk unsupported, and a radiograph showed further thickening of the cortex of the residual femur . At 10 years and 7 months old, the growing femoral prosthesis was extended by 1.1 cm. At the latest follow-up, at 11 years and 1 month old, the patient was 143 cm in height with a limb length discrepancy (LLD) of 5 cm and was able to walk unsupported using a 2.5 cm shoe lift (Video ). The Musculoskeletal Tumor Society (MSTS) score was 24 out of 30 points . The muscle strength of quadriceps recovered to manual muscle test (MMT) level 3, and active straight leg raising became possible without extension lag. The ROM of the left knee was 0\u201390\u00b0. The patient was receiving a second extension of growing femoral prosthesis.", "summary": "A 5-year-old girl with high-grade conventional osteosarcoma in the left distal femur underwent a series of surgeries. After three cycles of neoadjuvant chemotherapy, limb-salvage surgery was planned because femoral rotationplasty had been refused. At 6\u2009years and 2\u2009months old, distal femoral resection and temporary spacer insertion using a 7-mm-diameter intramedullary nail and molded polymethylmethacrylate was performed. At 7\u2009years and 8\u2009months old, secondary surgery was performed because the first spacer had been dislocated and the residual femur became atrophic. The distal end of the residual femur was removed by 1\u2009cm, but the periosteum and induced membrane around polymethylmethacrylate was preserved. In order to stabilize the spacer against the tibia, a custom-made ceramic spacer with a smooth straight 8-mm-diameter stem was utilized. The bone-spacer junction was fixed with polymethylmethacrylate and then covered with the preserved periosteum and induced membrane. After surgery, the bone atrophy improved. At 9\u2009years and 7\u2009months old, the second spacer was removed because it had loosened, and the knee joint was reconstructed using a custom-made growing femoral prosthesis with a curved porous 8.5-mm-diameter stem. Cancellous bone tips from the proximal tibia were grafted around the bone-prosthesis junction underneath the induced membrane. At 10\u2009years and 5\u2009months old, the patient was able to walk unsupported and a radiograph showed further thickening of the cortex of the residual femur without any stress shielding. Although having 5\u2009cm of limb length discrepancy, the patient and her mother were satisfied with the function. The MSTS score was 24 out of 30 points. Repeated limb length extensions are planned.", "subclaim_evaluations": [ { "subclaim": "The patient is a 5-year-old girl.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has high-grade conventional osteosarcoma in the left distal femur.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent three cycles of neoadjuvant chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Limb-salvage surgery was planned.", "support_label": "supported", "is_refined": false }, { "subclaim": "Femoral rotationplasty had been refused.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "At 6 years and 2 months old, distal femoral resection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 7-mm-diameter intramedullary nail was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "Molded polymethylmethacrylate was used as a temporary spacer.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 7 years and 8 months old, secondary surgery was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The first spacer had been dislocated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The residual femur became atrophic.", "support_label": "supported", "is_refined": false }, { "subclaim": "The distal end of the residual femur was removed by 1 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The periosteum and induced membrane around polymethylmethacrylate was preserved.", "support_label": "supported", "is_refined": false }, { "subclaim": "A custom-made ceramic spacer with an 8-mm-diameter stem was utilized.", "support_label": "supported", "is_refined": false }, { "subclaim": "The bone-spacer junction was fixed with polymethylmethacrylate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The bone atrophy improved after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 9 years and 7 months old, the second spacer was removed because it had loosened.", "support_label": "supported", "is_refined": false }, { "subclaim": "The knee joint was reconstructed using a custom-made growing femoral prosthesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The prosthesis had a curved porous 8.5-mm-diameter stem.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cancellous bone tips from the proximal tibia were grafted around the bone-prosthesis junction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The graft was placed underneath the induced membrane.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 10 years and 5 months old, the patient was able to walk unsupported.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A radiograph showed further thickening of the cortex of the residual femur.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no stress shielding observed.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a 5-cm limb length discrepancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient and her mother were satisfied with the function.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The MSTS score was 24 out of 30 points.", "support_label": "supported", "is_refined": false }, { "subclaim": "Repeated limb length extensions are planned.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1175_en.txt", "fulltext": "A 38-year-old male complained of palpitation and exertional dyspnea on his first visit to a local hospital in February. He never had a fever, arthralgias, weight loss or fatigue, nor did he have a personal or relevant family history of cardiovascular disease or neoplasms. A grade II/6 pansystolic heart murmur was heard during physical examination. Transthoracic echocardiography (TTE) revealed a large mass in the left ventricle, attached to the anterolateral papillary muscle and chordae tendineae. The local doctor made a preliminary diagnosis of suspected intracardiac fibroelastoma or myxoma, and suggested surgical resection for this intracardiac neoplasm through conventional median sternotomy. However, the patient was deterred by the invasiveness of sternotomy, and refused to have surgery in his local hospital. In May, as he learned about our experience in minimally invasive cardiac surgery, he came to our center.\nWe reexamined the patient. The TTE confirmed a mobile round cystic mass inside the left ventricle. The mass had a hyperechogenic wall and hypoechogenic content and was attached to the anterior mitral leaflet . In systole, the mass prolapsed into the left ventricular outflow tract (LVOT) with accelerated peak velocity (2.5 m/s), which led to mitral regurgitation . The LVOT appeared normal without subvalvular ridge or asymmetric septal hypertrophy. Complementary thoracic and abdominal computed tomographic (CT) scans did not show any evidence of the existence or potential spread of noncardiac neoplasms. All laboratory examinations including tumor markers were unremarkable.\nNon-invasively distinguishing aggressive from non-aggressive intracardiac tumors is an important clinical challenge. Preoperative biopsy for histopathological diagnosis is inapplicable to intracardiac tumors. In this case, fortunately, the TTE provided significant information on morphology, localization, biological characteristics, as well as tumor vascularity-perfusion. The mass had a smooth surface, clear border, and low echodensity. No imaging evidence showed any features of malignancy like vascularity-perfusion, invasion or filtration into the cardiac structure, permeation to the great vessels, or pericardial effusion. So, there was a fairly high probability that this mass would be benign. We made a diagnosis of a primary intracardiac cystic tumor according to the obtained information, and decided to resect the tumor.\nGenerally, a benign intracardiac tumor in this location and size can be accessed via trans-aortic or mitral orifice approach through mini-thoracotomy. Since we have enough experience of totally endoscopic mitral surgery, we decided to perform the operation in a totally thoracoscopic approach, and manage the possible deformation and dysfunction of the cardiac structure if necessary.\nTumor resection was planned and performed through a totally endoscopic, video-assisted approach with thoracoscopy and femoral cannulation (Supplemental Video). The cardiopulmonary bypass and the surgical approach were established as the conventional endoscopic mitral surgery . A 35-mm working port was made in the fourth interspace, lateral to the midclavicular line. After deflation of the right lung, two additional ports were then placed: a camera port through the anterior axillary line in the fourth interspace, and an 8-mm port in the lateral fifth interspace for a transthoracic Chitwood clamp (Scanlan International, Minneapolis, Minn). We used the Chitwood clamp to occlude the ascending aorta and administrated the antegrade cardioplegia. A left atriotomy was performed, and the atrial retractor was applied. The mitral orifice and the mass were then clearly visualized . The mass was oval and reddish, partly attached to the chordate structure of anterior papillary muscle and A1 area of anterior mitral leaflet via two pedicles . We completely excised the mass through the roots of the pedicles, and then carefully cauterized the margin of excision. The size and structure of the mitral leaflets and subvalvular apparatus appeared to be normal. No surgical injuries were found during further exploration . The saline test showed no mitral regurgitation.\nThe excised mass was 25 mm*20 mm*20 mm in size . Pathologic diagnosis confirmed a simple blood cyst, consistent with blood-filled space lined with a single layer of endothelium. The patients had an uneventful recovery. He was able to walk on the first postoperative day and was discharged three days after the operation. The patient was symptom-free and working full time during follow-up.", "summary": "An apparently healthy 38-year-old male presented to his local hospital with six months history of palpitation and exertional dyspnea. Transthoracic echocardiography showed a mobile round cystic mass inside the left ventricle, attached to the anterolateral papillary muscle and chordae tendineae of the mitral valve. The local doctor diagnosed an intracardiac tumor and suggested a surgical resection through median sternotomy. However, the patient refused to have a sternotomy. He was then referred to us seeking minimally invasive surgery. We assessed the location, appearance and relationship to nearby structures of the tumor with echocardiography, and made a diagnosis of a suspected primary cystic intracardiac tumor. Since we had enough experience of totally endoscopic mitral surgery, our surgical plan was to resect the tumor in the aid of thoracoscopy, and manage the possible deformation and dysfunction of the cardiac structure if necessary. Using femoro-femoral cannulation and cardiopulmonary bypass, we successfully resected the tumor through a thoracoscopic approach in a closed chest, and well preserved the subvalvular structure and valvular function. Postoperative recovery was quick and uneventful. Pathologic diagnosis confirmed a simple blood cyst.", "subclaim_evaluations": [ { "subclaim": "The patient is a 38-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had six months of palpitation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "He had exertional dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiography showed a mobile round cystic mass inside the left ventricle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was attached to the anterolateral papillary muscle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was attached to the chordae tendineae of the mitral valve.", "support_label": "supported", "is_refined": false }, { "subclaim": "The local doctor diagnosed an intracardiac tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The local doctor suggested surgical resection through median sternotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient refused sternotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was referred for minimally invasive surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was diagnosed as a suspected primary cystic intracardiac tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgical plan was to resect the tumor using thoracoscopy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery used femoro-femoral cannulation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The surgery used cardiopulmonary bypass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was resected through a thoracoscopic approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "The subvalvular structure was preserved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Valvular function was preserved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative recovery was quick.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative recovery was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathologic diagnosis confirmed a simple blood cyst.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1672_en.txt", "fulltext": "Patient is a 90-year-old Caucasian female with a past medical history of gastroesophageal reflux disease symptomatically managed with pantoprazole 40 mg daily, hypothyroidism, depression, anxiety, and peripheral neuropath; who presented to the emergency department (ED) with nausea, vomiting and abdominal pain. She also had a fever of 101.5 F and was complaining of chills. She initially went to a local ED where laboratory evaluation revealed a urinary tract infection. She was found to have elevated serum amylase (890 U/L) and lipase (3500 U/L) levels as well. Her white blood cell count was 11,000/mcL. Total bilirubin, alanine aminotransferase and aspartate aminotransferase levels were normal. Her blood cultures grew Gram-negative rods and Gram-positive cocci for which she was started on vancomycin [1250 mg every 12 h] and Zosyn\u00ae [3.375 gm every 6 h].\nA computed tomography (CT) scan of the abdomen and pelvis without intravenous contrast was performed which showed a very large hiatal hernia compressing and deforming the heart amongst other structures. The majority of the stomach along with the body and tail of the pancreas were herniated into the mediastinum. There was a large amount of free fluid in the mediastinum. There was dependent cholelithiasis and a distended gallbladder with signs of acute cholecystitis. A right upper quadrant ultrasound (RUQ US) showed intra and extra-hepatic biliary ductal dilation with possible echogenic material within the common bile duct. There was gallbladder wall thickening and peri-cholecystic fluid, these findings were thought to represent either acute cholecystitis or secondary to pancreatitis. The patient underwent an echocardiogram which showed left ventricular ejection fraction of 74%. There were no regional wall motion abnormalities.\nBased on the findings of RUQ US, an endoscopic retrograde cholangiopancreatogram (ERCP) was performed which showed a normal esophagus, large hiatal hernia with most of the stomach above the diaphragm and a duodenal diverticulum. The major papilla was located entirely within the diverticulum. The entire main bile duct was dilated. Choledocholithiasis was found.\nA repeat CT scan of the chest, abdomen and pelvis with intravenous contrast was performed. The body and tail of the pancreas was found to be herniating into the mediastinum .\nThe patient was continued on vancomycin and Zosyn\u00ae. The bacteria were found to be ampicillin-sensitive Enterococcus durans and a pan-sensitive E. coli. She was switched to ampicillin [2 g every 6 h] for the next 2 days and finally to oral amoxicillin PO [500 mg every 8 h]. Given the findings of large hiatal hernia, General Surgery was consulted. Given the chronicity of the patient\u2019s symptoms, her age and relatively good symptom control with proton pump inhibitors, a conservative approach to therapy was recommended with no surgical consideration for hiatal hernia repair. An elective cholecystectomy was offered to the patient and she elected to discuss this at a clinic visit in the upcoming weeks. On the day of discharge, the patient was tolerating a diet, had no pain or nausea, and was feeling well.", "summary": "We report an unusual case of pancreatic herniation into the mediastinum in a 90-year-old Caucasian female. This patient initially presented with nausea and vomiting associated with abdominal pain. Serum lipase and amylase both were elevated. Computed tomography scan of the chest, abdomen and pelvis revealed a large hiatal hernia with pancreas herniation into the mediastinum, with superimposed acute pancreatitis likely due to gallstone. Because of its unusual location, the patient also developed acute mediastinitis. The patient was management conservatively and did well. On the day of discharge; she was tolerating a diet, had no pain or nausea and was back to her baseline health.", "subclaim_evaluations": [ { "subclaim": "The patient is a 90-year-old Caucasian female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had pancreatic herniation into the mediastinum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with nausea and vomiting.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum lipase was elevated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum amylase was elevated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography scan showed a large hiatal hernia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography scan showed pancreas herniation into the mediastinum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The acute pancreatitis was likely due to gallstone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed acute mediastinitis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was managed conservatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "On the day of discharge, the patient was tolerating a diet.", "support_label": "supported", "is_refined": false }, { "subclaim": "On the day of discharge, the patient had no pain or nausea.", "support_label": "supported", "is_refined": false }, { "subclaim": "On the day of discharge, the patient was back to her baseline health.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3256_en.txt", "fulltext": "The parents of a previously healthy 2-year-old child came to our hospital with complaints of malaise, lethargy, vomiting, loose stools, yellowing of the sclera and skin, dark urine and white stools, which have been observed in the child for 4 days. Possible contact with infectious patients, use of drugs and other potentially toxic substances was not detected. The objective status of the child during hospitalization was characterized by elevated body temperature (37.7\u00b0C), marked lethargy, icteric coloration of the skin and mucous membranes, hepatomegaly. Heart rate (HR) \u2013 123/min., respiratory rate \u2013 24/min., SpO2-98%. The examination revealed an increase in total bilirubin to 129.6 \u03bcmol/l, direct fraction to 116.24 \u03bcmol/l, increased levels of transaminases: ALT - 4.5 mmol/l/h, AST - 3.3 mmol/l/h. Taking into account the clinical data, viral hepatitis was suspected, an appropriate examination and symptomatic therapy were prescribed.\n\nSpecific studies revealed positive titers of IgM HAV and IgM EBV (VCA), negative results of examination for markers of HBV (HBsAg), HCV (IgM+G), cytomegalovirus (IgM) and leptospirosis (PCR). An ultrasound examination revealed an increase in the size and increased echogenicity of the liver. Taking into account the detected markers, the disease was considered to be viral hepatitis A with EBV co-infection.\n\nDuring the first three days of inpatient treatment, the child\u2019s condition remained stable, vital functions were within normal limits. In laboratory tests, there was a tendency to decrease the elevated levels of bilirubin and transaminases. On the fourth day of stay, a disturbance of consciousness appeared in the form of stupor (on the Glasgow coma scale (GCS) - (E3V4M5)=12b). The appearance of neurological symptoms was associated with deterioration of coagulation hemostasis indicators (Prothrombin index (PI), Activated partial thromboplastin time (APTT)), a decrease in the concentration of protein in blood serum. The worsening of the condition was considered as ALF. The treatment included antibacterial therapy (cefotaxime 50 mg/kg/day), corticosteroids (dexamethasone 0.6 mg/kg/day), parenteral nutrition, replacement therapy (fresh-frozen plasma), albumin 20%, glutargin 80 mg/day, thioctic acid 10 units/kg/day, canavit up to 5 mg/day, respiratory support (ventilation). Over the next two days, the child\u2019s condition worsened due to ALF. Disturbances of consciousness progressed to severe coma (according to the FOUR (E0M0B0R1) scale = 1 point, without drug sedation), peripheral edema developed, hemorrhagic contents appeared through the nasogastric tube, intestinal peristalsis was suppressed, oligo-anuria developed, laboratory tests showed progression anemia, an increase in the level of indirect bilirubin, indicators of coagulation hemostasis worsened (Table 1). On the 6th day of hospital stay, the child had a cardiac arrest (asystole), which did not recover after resuscitation measures.\n\n", "summary": "A 2-year-old child was hospitalized on the 4th day of the disease with manifestations of jaundice and general intoxication. The examination revealed markers of active hepatitis A virus infection and Epstein-Barr virus infection. From the seventh day of the disease, the child's condition began to progressively deteriorate due to manifestations of ALF. Despite the use of immunomodulatory and replacement therapy, the disease ended fatally on the 9th day. Pathohistological examination revealed manifestations of viral necrotic hepatitis on the background of autoimmune sclerosing cholangitis.\n\nOn the 4th day of inpatient treatment, a liver biopsy was performed. The pathohistological study revealed changes in the liver, which were characterized by the following changes: the beam structure is absent, the parenchyma with disturbed architecture due to widespread massive necrosis. When carrying out a histochemical reaction with Azan, soft-fibrous fibrosis in the parenchyma is noted. In immunohistochemical reactions with cytokeratin, the expression of biliary epithelium in the parenchyma in the form of false bile ducts is noted. Immunohistochemical reaction with CD45 and CD68 \u2013 diffuse expression of lymphocytic and macrophage cells in the parenchyma.\n\nThe results of histological examination were considered as manifestations of viral necrotic hepatitis against the background of autoimmune sclerosing cholangitis.", "subclaim_evaluations": [ { "subclaim": "The child was hospitalized on the 4th day of the disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The child had manifestations of jaundice.", "support_label": "supported", "is_refined": false }, { "subclaim": "The child had manifestations of general intoxication.", "support_label": "supported", "is_refined": false }, { "subclaim": "Markers of active hepatitis A virus infection were present.", "support_label": "supported", "is_refined": false }, { "subclaim": "Markers of Epstein-Barr virus infection were present.", "support_label": "supported", "is_refined": false }, { "subclaim": "The child's condition began to progressively deteriorate on the 7th day.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The deterioration was due to manifestations of acute liver failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The disease ended fatally on the 9th day.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A liver biopsy was performed on the 4th day of inpatient treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The beam structure of the liver was absent.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The liver parenchyma had disturbed architecture due to widespread massive necrosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Soft-fibrous fibrosis in the parenchyma was noted with Azan histochemical reaction.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Immunohistochemical reaction with cytokeratin showed expression of biliary epithelium in the form of false bile ducts.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Immunohistochemical reaction with CD45 showed diffuse expression of lymphocytic cells in the parenchyma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Immunohistochemical reaction with CD68 showed diffuse expression of macrophage cells in the parenchyma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The histological findings were considered as viral necrotic hepatitis against the background of autoimmune sclerosing cholangitis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_341_en.txt", "fulltext": "An 8-year-old female presented to the pediatric haematology-oncology department at the Sun Yat-sen Memorial Hospital for scheduled chemotherapy treatment. The child was diagnosed with acute lymphoblastic leukaemia (Pre-B-ALL, BCR/ABL p190 positive) 2 months ago and the risk stratification was set as high risk.\nThe patient commenced the first round of CAM (cyclophosphamide + cytarabine + 6-mercaptopurine) regimen of induction chemotherapy along with oral dasatinib treatment. The child experienced neutropenia and developed a fever (38.5 \u00b0C) with occasional cough and pharyngeal discomfort. Chemotherapy was stopped and meropenem was used. Fever repeated with elevated fever peaks. C-reactive protein (CRP) increased to 23.3 mg/dL, while blood and sputum cultures were negative. Computed tomography (CT) scan showed multiple small patchy hyperdense shadows in both lungs with poorly defined borders, mainly in the lower lobes of both lungs . According to the examination results and the agranulocytosis state, teicoplanin combined with trimethoprim-sulfamethoxazole(TMP-SMX) and caspofungin were prescribed. Methylprednisolone (1 mg/kg qd) was also utilised. The patient's temperature did not decrease, and dyspnea gradually developed. The NGS test result indicated a Pneumocystis jirovecii infection, and ticoranine was discontinued.\nThe child's dyspnea significantly worsened, and the PaO2 was 59 mmHg (with an oxygen supplementation via mask at 8L/min). She was transferred to the pediatric intensive care unit (PICU) and intubated. Chest X-ray showed large dense shadows in the middle and lower lungs . The Procalcitonin(PCT) was mildly elevated(0.65 ng/ml). The 1,3-beta-D-glucan test (G test) result was positive (634 pg/mL) while the galactomannan test (GM test) result (0.33 \u03bcg/L) was negative. EBV, CMV nucleic acid test, as well as blood and sputum cultures were negative. Considering the severity of pneumonia and neutrophil deficiency after chemotherapy, linezolid was commenced for anti-infection treatment, and granulocyte colony-stimulating factor (G-CSF) (5 ug/kg.d) was administered to promote proliferation and differentiation of the bone marrow granulocyte lineage. Subsequently, the neutrophil count and C-reactive protein (CRP) began to rise rapidly .The sputum mNGS test result also showed a Pneumocystis jirovecii infection 2 days later, and the anti-infective regimen remained unchanged.\nThe patient's temperature decreased, but a gradually increasing ventilator parameter was required to maintain the oxygen saturation. The oxygenation index (OI) was between 14-and 16, implying the existence of moderate acute respiratory distress syndrome, according to the Pediatric Acute Lung Injury Consensus (PALICC). Inflammatory factor levels were significantly increased: sIL-2R (soluble IL-2 receptor, soluble IL-2 receptor) 5049 U/mL, IL-6 1141 pg/mL, IL-10 70.9 pg/mL, and IL-8 1242 pg/mL . The chest X-ray showed multiple speckled, corn-like dense shadows in both lungs with indistinct borders and lattice-like changes , T-SPOT and serological tests of common respiratory pathogens (Mycoplasma pneumonia, adenovirus, respiratory syncytial virus, parainfluenza virus, influenza virus A, influenza virus B, Legionella type 1\u20137, coxsackievirus A, coxsackievirus B, echovirus IgM) were negative. Meropenem and linezolid were replaced with amikacin and tigecycline. The peak and the frequency of fever decreased, but the ventilator parameters were still high, with OI values between 10 and 13.\nOn the 16th day, the CT scan showed that the patchy hyper-dense shadows were alleviated, but interstitial thickening with grid-like changes and ground-glass opacities appeared in both lungs, suggestive of bilateral interstitial pneumonia . The fibrosis markers significantly increased: collagen type IV (CIV) 140.12 ng/mL, pre-collagen peptide III (PCIII) 151.18 ng/mL, and hyaluronic acid (HA) 1056.81 ng/mL. High-dose methylprednisolone (10 mg/kg.d \u00d7 5 d) pulse therapy was given, along with the anti-fibrotic treatment of pirfenidone and acetylcysteine. But the lung function did not improve, and the X-ray showed corn-like high-density shadows in both lungs with unclear borders and grid-like changes . The child's parents opted for withdrawal of medical care, and the girl died after being discharged from the hospital.", "summary": "An 8-year-old girl presented with acute lymphoblastic leukaemia was admitted for scheduled chemotherapy treatment. During chemotherapy, she experienced pancytopenia and Pneumocystis jirovecii pneumonia, which was diagnosed based on the abnormal shadows observed on chest computed tomography, the elevation of serum \u03b2-D-glucan, and the positive mNGS results of Pneumocystis jirovecii in both sputum and blood. After treatment with Granulocyte Colony-Stimulating Factor, sulfamethoxazole, and caspofungin, aggravation of lung lesions was discovered and severe interstitial lung disease developed in a short period along with a rapidly increasing leukocyte count. Intravenous methylprednisolone pulse therapy was given, but lung function did not improve, and she finally died after the withdrawal of medical care.", "subclaim_evaluations": [ { "subclaim": "An 8-year-old girl presented with acute lymphoblastic leukaemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted for scheduled chemotherapy treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "During chemotherapy, she experienced pancytopenia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She was diagnosed with Pneumocystis jirovecii pneumonia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on abnormal shadows observed on chest computed tomography.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on the elevation of serum \u03b2-D-glucan.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on positive mNGS results of Pneumocystis jirovecii in sputum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on positive mNGS results of Pneumocystis jirovecii in blood.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She received treatment with Granulocyte Colony-Stimulating Factor.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received treatment with sulfamethoxazole.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received treatment with caspofungin.", "support_label": "supported", "is_refined": false }, { "subclaim": "Aggravation of lung lesions was discovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Severe interstitial lung disease developed in a short period.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a rapidly increasing leukocyte count.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Intravenous methylprednisolone pulse therapy was given.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lung function did not improve.", "support_label": "supported", "is_refined": false }, { "subclaim": "Medical care was withdrawn.", "support_label": "supported", "is_refined": false }, { "subclaim": "She finally died.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_402_en.txt", "fulltext": "A 71-year-old woman with a pancreatic tumor involving the head and uncinate process was referred to our hospital with symptoms of back pain, weight loss, and diabetes. According to imaging, the tumor was approximately 30 mm in diameter. The patient was diagnosed with pancreatic duct adenocarcinoma based on findings from an endoscopic ultrasound-guided fine-needle biopsy specimen. The tumor was in contact with the right side of the SMV at the level where it received the first jejunal vein tributary. The tumor attachment to the SMV had a longitudinal extent of about 20 mm but involved less than half of the vein\u2019s circumference, so the tumor was considered resectable. However, extension of tumor along the retropancreatic nerve plexus (RNP) approached the superior mesenteric artery (SMA; Fig. ), so based upon the results of the PREP-02/JSAP-05 trial , 2 cycles of gemcitabine and S-1 were administered before surgery.\nAlthough no radiologically evident changes of tumor status were recognized after chemotherapy, we planned to carry out pancreatoduodenectomy with SMV resection and reconstruction. The first jejunal vein tributary would be resected, provided that a vein-clamping test produced no jejunal congestion. Then the segment of the SMV caudal to its confluence with the inferior mesenteric vein (IMV) would be resected in continuity with the pancreatic tumor. Reconstruction of the SMV by simple end-to-end suturing without a venous graft would be difficult, considering that both the splenic vein and the IMV were to be preserved.\nOne notable finding from computed tomography (CT) before surgery was dilation of the right ovarian vein to a diameter of about 10 mm, similar to the SMV diameter where resection was planned . Although the patient had no active symptoms of PCS such as chronic pelvic pain, feelings of heaviness, or urinary urgency at the time of surgery, she had experienced severe dysmenorrhea prior to menopause and still had occasional feelings of pelvic heaviness, suggesting that she was at future risk for PCS. We reasoned that use of the dilated right ovarian vein as a graft might prevent or lessen such occurrences while also offering dimensions favorable for grafting.\nNo cancer dissemination was grossly evident at laparotomy; subsequent cytologic examination of abdominal lavage fluid detected no malignant cells. Dissection began with liberal application of the Kocher maneuver to the duodenum and firm retraction of the pancreatic head to the left. The peritoneum at the base of the transverse mesocolon was divided to approach the SMA and SMV, as in the mesenteric approach . When no evident jejunal congestion resulted from clamping the first jejunal vein tributary near the confluence of the tributary and the SMV, the tributary was ligated and divided. We performed the retropancreatic nerve plexus (RNP) hanging maneuver as we previously reported , making sure that the cut end of the RNP was free of cancer invasion. In brief, the RNP hanging maneuver was carried out as follows. The middle colic artery arising from the SMA and the middle colic vein both were ligated and divided, after which the SMA trunk was followed cranially to its origin. The tape for RNP hanging was placed around the RNP, which was divided together with ligation and division of the inferior pancreatoduodenal artery in the plane determined by the hanging tape prior to any division of the pancreatic parenchyma and gastric antrum. A 3-cm minimum length of the dilated right ovarian vein was removed for use as a venous graft. The tumor was removed together with the portion of the SMV that it had invaded. The SMV was reconstructed with no venous bypass, using the right ovarian vein graft. Obvious valves were not recognized within the patient\u2019s graft after harvesting, so we carried out reconstruction in a standard manner: distal end to distal end and proximal end to proximal end. The duration of reconstruction was 38 min , while total duration of the operation was 607 min. Intraoperative blood loss was 390 mL. The pathologic diagnosis was invasive ductal carcinoma; the stage according to the classification of pancreatic carcinoma was pT3pN1b (4/40) M0, pStage IIB, with invasion of the SMV (pPV1). R0 resection status was achieved.\nThe postoperative course was uneventful, and the patient was discharged 25 days after surgery. She has finished adjuvant chemotherapy and was free from disease recurrence at 8 months after surgery. PCS symptoms have not occurred. Patency of the venous graft for SMV reconstruction was confirmed by contrast CT carried out with administration of a direct oral anticoagulant 8 months after surgery .", "summary": "A 71-year-old woman with cancer involving the pancreatic head, uncinate process, and SMV underwent pancreatoduodenectomy with SMV resection. Reconstruction used a portion of the right ovarian vein that was markedly dilated and had placed her at risk for pelvic congestion syndrome (PCS). Graft patency was confirmed 8\u00a0months after surgery. She now finished receiving adjuvant chemotherapy and has no symptoms of PCS.", "subclaim_evaluations": [ { "subclaim": "The patient is a 71-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has cancer involving the pancreatic head.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has cancer involving the uncinate process.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has cancer involving the superior mesenteric vein (SMV).", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent pancreatoduodenectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent SMV resection.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reconstruction used a portion of the right ovarian vein.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right ovarian vein was markedly dilated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The dilated right ovarian vein placed her at risk for pelvic congestion syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "Graft patency was confirmed 8 months after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has finished receiving adjuvant chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has no symptoms of pelvic congestion syndrome.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_2802_en.txt", "fulltext": "A 69-year-old Japanese man who sustained an injury in a car collision received first aid at a nearby hospital and underwent craniotomy surgery for traumatic acute subdural hematoma, traumatic subarachnoid hemorrhage, and traumatic localized brain contusion. Conservative treatment was given for left-sided condylar process fracture, axis fracture, right clavicle fracture, and right fracture of the distal radius. After his consciousness disorder improved, 4 months after injury, it became clear that the patient was unable to close his mouth. His TMJ may have been dislocated during intubation. The mouth presented in an open state, with lip closure incapacity . Stenosis of the jaw dentition was demonstrated with labioclination of the front tooth, open bite, and xerostomia. The patient had a tracheostomy and could not evaluate the verbal response, Glasgow Coma Scale (GCS) 11. Traumatic brain injury left paralysis of his right upper extremity. The patient was at high risk of aspiration pneumonia due to diminished swallowing function, so the previous doctor had performed an additional gastrostomy, which recovered his ability to eat.\nPanoramic radiography examination revealed a left condylar process fracture and dislocation of the bilateral mandibular condyles. On computed tomography examination, the left condylar process fracture on the medial side and both mandibular condyles greatly exceeded the articular tubercle .\nWe attempted a manual reduction owing to the existing diagnosis of old left condylar fracture and bilateral anterior dislocation of the TMJ, but reduction was impossible. Therefore, we planned to perform right condylar resection using an intraoral approach. In addition, we evaluated the planned procedure using a three-dimensional model and confirmed that it would not disturb the jaw reposition, because the left condylar process fractures to medial. We confirmed that it was difficult to reduce and fix the old fracture and that it did not interfere with the reproduction of the original occlusion on the three-dimensional model, so we decided to treat it conservatively.\nWe performed right condylectomy with the patient under general anesthesia. Manual reduction was performed again in a state of muscle relaxation, but reduction was not possible. After an incision was made in the buccal mucosa according to the sagittal split ramus osteotomy, the inside and outside of the mandibular ramus was revealed, and the coronoid process and the neck of the mandible were confirmed . The coronoid process obstructed the visual field, so it was cut and resected with a reciprocating saw . Using a saw and osteotome, the base of the condylar was cut and separated from the surrounding soft tissue to remove the condylar head . We confirmed that the mandibular body had moved backward and that the molars could achieve the occlusion, and the wound was closed. Intermaxillary traction was started during the postoperative period using an intermaxillary fixation screw inserted in the alveolar region to improve occlusal deviation. Twenty-one days after the operation, a normal occlusion was obtained, and intermaxillary fixation screw was removed. During the 12-month postoperative follow-up period, no TMJ dislocation recurred, and the occlusion remained stable . After the operation, he was able to open and close the mouth by himself, and the lips could be closed, so that hypersalivation did not occur. His left condylar process was displaced inward owing to a fracture, but the opening and closing movements were possible because the hinge movement centered on the left condylar process.", "summary": "A 69-year-old Japanese man who sustained an injury in a car collision was unable to close his mouth. Owing to the diagnosis of long-standing temporomandibular joint dislocation, intraoral condylectomy was performed. In the case of temporomandibular joint dislocation, it is convenient to reach the condyle from the oral cavity because sufficient opening is maintained. The condyle can be clearly visualized using an approach similar to sagittal split ramus osteotomy, and the operation using surgical instruments can be facilitated by resecting the coronoid process. By separating the surrounding soft tissue and pulling the cut condyle with sufficient visual field, the condyle can be resected while addressing the hemostasis. During the 12-month postoperative follow-up period, no temporomandibular joint dislocation recurred and the occlusion remained stable.", "subclaim_evaluations": [ { "subclaim": "The patient was a 69-year-old Japanese man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient sustained an injury in a car collision.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was unable to close his mouth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was long-standing temporomandibular joint dislocation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraoral condylectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "In the case of temporomandibular joint dislocation, it is convenient to reach the condyle from the oral cavity.", "support_label": "supported", "is_refined": false }, { "subclaim": "Sufficient opening is maintained in temporomandibular joint dislocation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The condyle can be clearly visualized using an approach similar to sagittal split ramus osteotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The operation can be facilitated by resecting the coronoid process.", "support_label": "supported", "is_refined": false }, { "subclaim": "The condyle can be resected while addressing the hemostasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "During the 12-month postoperative follow-up period, no temporomandibular joint dislocation recurred.", "support_label": "supported", "is_refined": false }, { "subclaim": "The occlusion remained stable during the 12-month postoperative follow-up period.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1952_en.txt", "fulltext": "A 55-year-old Greek woman was referred to our clinic for the management of a cystic lesion located in the tail of the pancreas. The lesion was discovered incidentally during her staging workup with abdominal ultrasound for invasive ductal adenocarcinoma of the left breast 16 months ago. Just after a modified radical left mastectomy had been performed, we further investigated the pancreatic lesion with a magnetic resonance imaging (MRI) scan, which revealed a space-occupying cystic lesion of maximum diameter of 5 cm located in the tail of the pancreas with calcifications of the wall and a central cystic component . Besides the chemo-, radio-, and hormonal therapy she received for her breast cancer, her past medical history also included hypothyroidism under hormone-replacement therapy.\nThe findings in the physical examination were unremarkable. Blood investigation and tumor markers (CEA, CA 15-3, CA 19-9, and CA 125) were within normal limits. The possibility of a mucinous cystic neoplasm of the pancreas was considered, and a laparoscopic distal pancreatectomy and a splenectomy were chosen.\nThe first distal pancreatectomy in pigs was described by Soper et al. in 1994; 2 years later, Gagner reported his first five cases of spleen-preserving laparoscopic distal pancreatectomy for insulinoma.\nIn our case, the patient was placed in a modified lithotomy position, with the surgeon standing between the legs of the patient. We used a five-port technique, placing a 12 mm trocar left paramedian at about the level of the umbilicus, a 10 mm-trocar in the left upper quadrant of the abdomen on the anterior axillary line, a 10 mm-trocar in the subxiphoid region, a 5 mm-trocar in the left hypochondrium on the midclavicular line, and a 5 mm-trocar in the right hypochondrium in the midclavicular line as well . Pneumoperitoneum was established with the open Hasson technique through the 12 mm paramedian port. Exploratory laparoscopy did not reveal macroscopically evident intra-abdominal metastases. We used a 30-degree laparoscope and an ultrasonic dissector (UltraCision; Ethicon, Endosurgery). After entering the lesser sac, we identified the splenic artery at the upper border of the pancreas after its origin from the celiac axis, and we ligated, by using a disposable clip applicator (U.S. Surgical Corp., Norwalk, CT) . The mobilization of the pancreas started at the reflexion of the superior leaf of the transverse mesocolon on the pancreas. The plane at the inferior border of the body of the pancreas was opened with blunt dissection, gradually exposing the posterior surface of the pancreas. The splenic vein was gently dissected by using a right-angle dissector and was ligated with clips. After sufficiently mobilizing the pancreas, this was transected by using an endoGIA (45 \u00d7 2.5 mm) . Subsequent mobilization of the spleen from its attachments to the diaphragm, colon, and left kidney was performed. The specimen was retrieved through a vertical extension of the paramedian port site in a retrieval endobag (Autosuture, Norwalk, CT). A drain was placed in the splenic fossa. Estimated intraoperative blood loss was 320 ml, and no blood transfusion was required. The pathology report revealed a pancreatic tumor 5 cm in diameter. The lesion was multiloculated, contained a yellowish fluid and a thick, stiffened wall, consisting of dense fibrotic tissue with hyaline degeneration, calcifications, regions of ossific metaplasia, and microscopic foci of neoplasmatic tissue, compatible with cystic-solid pseudopapillary neoplasm of the pancreas. Seven reactive regional lymph nodes were harvested, and resection margins were free.\nThe postoperative course was complicated by a pancreatic fistula (50 ml/d) grade B and a reactive left pleural effusion. On the fifth postoperative day, a CT scan of the abdomen was performed, and a subdiaphragmatic collection was drained under CT guidance. The patient's clinical condition was improved, and the patient was finally discharged on postoperative day 13. The patient's follow-up (with abdominal CT and biochemical tests yearly) in a time period of 36 months revealed no disease recurrence or development of diabetes.", "summary": "We report the case of a 55-year-old Greek woman with a solid pseudopapillary tumor of the tail of the pancreas. She underwent a laparoscopic distal pancreatectomy and splenectomy. The histopathologic examination finally revealed a cystic-solid pseudopapillary neoplasm of the pancreas. Solid pseudopapillary tumors of the pancreas are rare and affect predominantly young women. These tumors are of unclear pathogenesis and low malignancy, and surgical resection offers an excellent chance for long-term survival.", "subclaim_evaluations": [ { "subclaim": "The patient is a 55-year-old Greek woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a solid pseudopapillary tumor of the tail of the pancreas.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a laparoscopic distal pancreatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a splenectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathologic examination revealed a cystic-solid pseudopapillary neoplasm of the pancreas.", "support_label": "supported", "is_refined": false }, { "subclaim": "Solid pseudopapillary tumors of the pancreas are rare.", "support_label": "supported", "is_refined": false }, { "subclaim": "Solid pseudopapillary tumors of the pancreas affect predominantly young women.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The pathogenesis of solid pseudopapillary tumors of the pancreas is unclear.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Solid pseudopapillary tumors of the pancreas are of low malignancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgical resection offers an excellent chance for long-term survival in patients with solid pseudopapillary tumors of the pancreas.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_984_en.txt", "fulltext": "A 46 year-old man with HIV/AIDS (CD4 T-cell 115 \u00d7 106/l) presented with two weeks of left 5th digit pain and swelling. He denied any history of recent trauma to the hand, fever, weight loss, or other systemic symptoms, but did note an occasional dry cough. He had traveled repeatedly between his native country Ivory Coast, West Africa and the United States. He was not taking antiretroviral medications at the time of presentation. On physical exam his fifth digit was swollen and erythematous at the proximal intraphalangeal joint [figure ]. His laboratory values on admission were as follows: white blood cell count 5000 cells/mm3, hemoglobin 11.6 grams/dl, hematocrit 33.9%, platelets 280,000 platelets/mm3, eosinophils 9.0%, and erythrocyte sedimentation rate (ESR) of 60 mm/hour. Left hand radiography was significant for soft tissue swelling over the left finger with joint space narrowing and cortical lucencies with cystic degenerative changes in the proximal phalanx [figure ]. Admission chest radiography demonstrated right hilar lymph node enlargement with multiple scattered nodules and a resolving right lower lobe infiltrate. Computed tomography scan of the chest revealed multiple pulmonary nodules [figure ], necrotic lymph nodes, and splenomegaly. The patient underwent incision, drainage, and biopsy of the affected finger. Operative findings were significant for purulent, mottled, soft, yellow bone.\nRare acid-fast bacilli were demonstrated on biopsy of the both phalanx and synovial fluid samples [figure ]. We used the Gen-PROBE\u00ae Amplified Mycobacterium tuberculosis Direct Test which employs a transcription-mediated amplification and hybridization protection assay to qualitatively detect Mycobacterium tuberculosis complex ribosomal RNA (rRNA). Several weeks later cultures of all surgical material grew Mycobacterium tuberculosis [figure ]. Multiple Ziehl-Neelsen stains of induced sputum samples were negative for acid-fast bacilli, but all specimens sent for sputum culture grew Mycobacterium tuberculosis. Antituberculous treatment was initiated with rifampin, isoniazid, pyrizinamide, and ethambutol prior to culture results. After 12 weeks of treatment, marked improvement in the finger lesion was noted [figure ].", "summary": "We describe a case of tuberculosis (TB) dactylitis in a patient with AIDS who originated from the Ivory Coast. The diagnosis was established by direct visualization of acid-fast bacilli on joint fluid and bone biopsy of the proximal phalanx. Imaging of the chest revealed multiple bilateral nodules. Confirmation of the diagnosis was made by isolation of Mycobacterium tuberculosis from sputum and bone cultures.", "subclaim_evaluations": [ { "subclaim": "The patient had tuberculosis dactylitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had AIDS.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient originated from the Ivory Coast.", "support_label": "supported", "is_refined": false }, { "subclaim": "Acid-fast bacilli were visualized in the joint fluid.", "support_label": "supported", "is_refined": false }, { "subclaim": "A bone biopsy of the proximal phalanx was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest imaging showed multiple bilateral nodules.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mycobacterium tuberculosis was isolated from sputum.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mycobacterium tuberculosis was isolated from bone cultures.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_673_en.txt", "fulltext": "A 45-year-old obese male with Stanford A DeBakey type-II aortic dissection, atrioventricular re-entrant tachycardia, and atrial regurgitation was complaining of chest discomfort accompanied by palpitations, nausea, and cold sweats. Patient had a history of controlled hypertension with nebivolol 2 \u00d7 5\u2005mg, as well as pericardial effusion and right bundle branch block 8\u201310 years prior. Previously, the patient was treated with anticoagulants and anti-arrhythmic medications. The patient was an ex-smoker for 16 years before quitting 6 years ago without any history of cardiac disease in the family. His vital signs on arrival were stable with normal jugular venous pressure, widened pulse pressure 99/59\u2005mmHg similar in both arms, and soft diastolic aortic heart murmur. Laboratory findings were elevated for white blood cells, erythrocyte sedimentation rate, D-dimer, and cardiac marker. Plain chest X-ray showed aorta elongation with cardiomegaly and basal infiltrate on the right lung and middle segment of the left lung. Transthoracic echocardiography (TTE) evaluation revealed aortic root and ascending aorta aneurysm with mild atrial regurgitation secondary to dilated aortic root. Based on the assessments, the patient gave consent for Bentall procedure to replace the dissected aorta.\nAscending and hemiarch replacement Bentall procedure was conducted successfully despite severe adhesion between epicardium and pericardium layer along with resolved complication of sinus bradycardia. The tear started at the level of aortic valve commissure extending to the ascending aorta and middle arch without sign of rupture. Circulatory arrest time was 30\u2005min. Post-intervention, patient was prescribed antibiotics and antifibrinolytic drugs. Anticoagulant medication warfarin for prosthetic valve maintenance was postponed due to concerns of high bleeding risk from aortic dissection and Bentall procedure.\n7 days post-operation, the patient unintentionally strained himself while defecating causing sudden shortness of breath, right chest pain, Visual Analogue Scale (VAS) 5\u20137, and cold sweats with persistent hypotension (81/51\u2005mmHg) and tachypnea (24 breaths/min), despite fluid support and vasoconstrictors. His electrocardiogram reading was normal. Laboratory tests showed insignificant erythrocyte reduction within predicted value (from 13.1 to 11.1\u2005g/dL in 2 days), raised troponin-T marker (341\u2005pg/mL), hypercoagulable state, and acute kidney injury (estimated glomerular filtration rate 65.9\u2005mL/min/1.73\u2005m2). Transthoracic echocardiography examination showed middle right ventricle free wall hypokinesis with apical sparing. Additionally, chest X-ray evaluation revealed right lung oligaemia and abrupt tapering of the pulmonary artery . All these findings were suggestive of PE for which the patient was prescribed anticoagulant heparin.\nHowever, pulmonary computed tomography (CT) angiography showed an enlarged heart with fluid collection in the right anterolateral-superior pericardial space of density 50\u201360 Hounsfield unit (HU) pushing the heart laterally while compressing posterior part of superior vena cava, as well as bilateral pulmonary vein and left atrium stenosis due to extraluminal cause indicating cardiac tamponade. Location of the compression at the level of vena cava and pulmonary vein supposedly gave rise to the findings that mimic that of PE. Anticoagulant therapy was immediately ceased, and the patient was scheduled for a surgical pericardiotomy.\nTransoesophageal echocardiography (TEE) evaluations were taken for comparison . Right upper pulmonary vein and pulmonary artery were narrowed due to an external compression compared with after release ( and ). The velocity\u2013time integral (VTI) was also shown to be improved after the clot evacuation.\nDuring the operation, active bleeding was found at the distal anastomosis of the ascending aorta with 600\u2005mL of blood clots pressing against the right ventricle, right atrium, superior vena cava, and main pulmonary artery . After the procedure, his haemodynamics returned to normal and was eventually discharged the following week after close monitoring. At 2 month follow-up, the patient was asymptomatic with improving exercise tolerance. Echocardiography revealed no sign of periaortic leakage from the repaired aorta.", "summary": "A 45-year-old male with aortic dissection DeBakey type-II, 7 day post-Bentall procedure, presented with sudden shortness of breath and persistent shock despite therapy. Initial assessment directed towards pulmonary embolism was supported by hallmark imaging signs from X-ray and transthoracic echocardiography evaluation. However, computed tomography scan results were suggestive of cardiac tamponade mainly accumulating at the right side of the heart, compressing the pulmonary artery and vena cava confirmed by transoesophageal echocardiography, thus mimicking the findings of pulmonary embolism. After clot evacuation procedure, the patient improved clinically and was discharged the following week.", "subclaim_evaluations": [ { "subclaim": "The patient is a 45-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had aortic dissection DeBakey type-II.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a Bentall procedure 7 days prior.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with sudden shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had persistent shock despite therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial assessment was directed toward pulmonary embolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging signs from X-ray and transthoracic echocardiography supported the initial assessment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography scan results were suggestive of cardiac tamponade.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tamponade mainly accumulated at the right side of the heart.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tamponade compressed the pulmonary artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tamponade compressed the vena cava.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transoesophageal echocardiography confirmed the findings.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings mimicked those of pulmonary embolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "A clot evacuation procedure was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient improved clinically after the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged the following week.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1632_en.txt", "fulltext": "A 61-year-old male patient who was operated due to laryngeal carcinoma six months ago. First, MDCT and then, whole body PET-CT scan (643 MBq F-18-FDG i.v.) was performed for the patient due to the lesion monitored on the right apical in PA radiography of the patient, who was followed up stably. The patient\u2019s routine blood test results were within the normal ranges. A lesion of 15x10 mm with radially spiculated extensions, in irregular appearance and containing a few microcalcifications was monitored in the apical region of the right lung in thoracic CT (, ). No lymphadenopathy was detected in the mediastinum. It was observed during the PET-CT that the lesion had a moderate F-18FDG uptake (2.40 SUVmax) . Apart from that, no significant pathologic finding was detected in the chest. In addition, no focus was detected during the PET-CT scan outside the thorax. The patient was first considered to have metastasis in the light of the existing findings. A wedge resection was performed for the patient\u2019s lesion . Microscopic examination of the surgical material showed a group of fungal hyphae, and the patient was diagnosed aspergilloma. The patient was not given any antifungal treatment because the entire region was cleaned within the surgical borders and there was not any other focus.", "summary": "However, in this case report, we presented a case with operated laryngeal carcinoma whom we first had considered to have metastasis and who had received a diagnosis of aspergilloma in CT and Positron emission tomography (PET).", "subclaim_evaluations": [ { "subclaim": "The case report presented a patient with operated laryngeal carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was initially considered to have metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received a diagnosis of aspergilloma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of aspergilloma was made using CT.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of aspergilloma was made using Positron emission tomography (PET).", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 4 }, { "id": "multiclinsum_test_3352_en.txt", "fulltext": "This is a healthy 22-year-old gentleman who presented with chronic hematospermia for 5 years. This has been a consistent problem, present with every ejaculation. It has severely and negatively affected his sexual life. He has no chronic medical issues apart from major depressive disorder for which he takes Trazodone and Escitalopram. He has had no previous surgeries. Interestingly, he has a congenitally absent left kidney. He denies previous sexually transmitted illnesses (STIs). The patient has denied urinary symptoms or urethral discharge at any point, and he has adequate erections for sexual intercourse without any concern for erectile dysfunction. General physical examination and genital/prostate examination are within the normal limits without any notable findings.\n\nIn attempts to address his hematospermia, the patient has received multiple courses of antibiotics (Doxycycline, Trimethoprim/Sulfamethoxazole, and Fluoroquinolones) without benefit over the past several years. A trial of Finasteride was offered but the patient declined this due to concern of possible sexual side effects at his young age.\n\nOther aspects of his work-up after presentation including labs and imaging. Serum creatinine was normal. Urinalysis, urine culture, Chlamydia/gonorrhea, and other STI tests came back negative. An ultrasound of the scrotum was performed which was unremarkable. Given the plethora of negative tests and persistent symptoms, it was agreed upon to perform a cystoscopy which was also unremarkable. At this point, Magnetic Resonance Imaging (MRI) of the pelvis was ordered and showed no evidence of tumors, cysts, or vascular abnormalities; and revealed distension of the left SV with blood. The right SV was normal.\n\n\nThe options of treatment were discussed with the patient and given the chronicity of the condition and its negative effect on his sexual life. Several treatment options were discussed with the patient. TRUS-guided SV puncture with drug instillation, TRUS-guided cyst aspiration and transurethral resection with deroofing were discussed as less morbid interventions but associated with higher failure rate. He opted for surgical removal of the left SV, despite potential for higher morbidity and potential impotence or ejaculatory dysfunction, due to his many year struggle with the condition. This was performed as a robotic-assisted laparoscopic left seminal vesiculectomy.\n\nTechnique of the primary procedure\nThe patient underwent standard induction, position preparation and draping. He was placed in the 30-degree Trendelenburg position. An Xi DaVinci robot was utilized with port placement identical to that of a robotic prostatectomy. After access was obtained and we had visualization, the small bowel was mobilized cranially. The sigmoid colon was then mobilized, exposing the cul-de-sac. The left SV was exposed and mobilized using blunt dissection and bipolar cautery to avoid neurovascular injury. The SV was traced back and dissected to the base of seminal vesicle duct. The duct of the SV was then ligated using 2-0 Monocryl suture. Transection was completed sharply, and the SV was then sent for pathologic examination. Additional examination and hemostasis using bipolar cautery and hemostatic agents. The peritoneum was then closed over the operative field once packed with SURGIFLO \u00ae Hemostatic Matrix mixed with thrombin.\n\nOutcome and follow up\nThe patient was discharged home in good condition the next morning. He presented with abdominal pain 2 days after the procedure with abdominal pain and no fever or urinary symptoms. Unfortunately, CT scan of the abdomen & pelvis revealed pelvic hematoma. On the 3rd day post-operatively, he was brought back to the operative room and underwent robotic-assisted laparoscopic exploration.\n\nTechnique for robotic exploration\nFollowing induction, positioning and draping, the port sites of the prior operation were opened and canula inserted. Intermediate Trendelenburg (15\u201320-degree) was used. Insufflation then proceeded normally. The hematoma was evacuated with the Stryker\u00ae large 10 mm suction device. The peritoneum in the Cul-de-Sac was reopened and additional hematoma was evacuated upon which, a small bleeding vessel was identified in the surgical field. This was controlled safely with bipolar cautery and a drain was placed in immediate vicinity. The field was then repacked with SURGIFLO\u00ae Hemostatic Matrix mixed with thrombin to limit any further bleeding. The peritoneum was again reconstituted, and the operation was concluded uneventfully following port closure.\n\nFollowing the procedure, the patient was feeling well and was discharged home the next day in good condition. At 6 months follow-up, the patient has no pain or urinary symptoms. He still maintains normal erections with maintenance of baseline ejaculatory volume and force without hematospermia. The patient was satisfied with the results of the procedure. Pathological examination revealed left SV with congestion and focal mild chronic inflammation but was negative for malignancy.", "summary": "We present an unusual case of chronic hematospermia for 5 years in a 22-year-old patient, which failed conservative medical management. MRI was conducted which revealed left seminal vesicle (SV) distended with blood and a normal right SV. He was treated with robotic unilateral seminal vesiculectomy (RUSV). At 6 months follow-up, ejaculation was normal and hematospermia resolved.", "subclaim_evaluations": [ { "subclaim": "The patient is a 22-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had chronic hematospermia for 5 years.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient failed conservative medical management.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI was conducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The left seminal vesicle was distended with blood.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right seminal vesicle was normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with robotic unilateral seminal vesiculectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 6 months follow-up, hematospermia resolved.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 6 months follow-up, ejaculation was normal.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1265_en.txt", "fulltext": "We report on an 81-year-old woman with no relevant comorbidities and a smoking history of 5 pack years. In 2006 she was diagnosed with a pT2a, pN0 (0/5), cM0, UICC stage IB squamous cell carcinoma of the left upper lung lobe, for which she underwent a double-sleeve lobectomy with lymphadenectomy. During 5 years of follow-up, no relapse occurred. In April 2019, the patient presented with a post-stenotic pneumonia. Computed tomography of the chest showed a mass in the left lung. Radiological staging with whole-body 18F-FDG-PET/CT and brain MRI showed metastatic disease with a strongly metabolically active primary tumor (SUVmax 16.7), pleural carcinomatosis on the left side (SUVmax 9.4), periclavicular lymph node metastases on the left side (SUVmax 9.9), and bone metastases in the 12th thoracic and 4th lumbar vertebra (SUVmax 5.0 and 4.6, respectively) . Histology of bronchoscopic biopsy specimens revealed squamous cell carcinoma, which could be interpreted as recurrence or as a second lung cancer, taking into consideration the 13-year-long disease-free interval. The immunohistochemistry for programmed cell death ligand 1 (PD-L1) revealed an expression in 20% of tumor cells and in < 10% of immune cells. In order to complete our internal lung cancer diagnostic algorithm (Treichler G, manuscript in preparation), we performed next-generation sequencing using the FDA-approved FoundationOne\u00aeCDx assay. We found a structural aberration on the long arm of chromosome 3 (3q) with amplifications of the genes , SOX2, and FGF12; mutations of TP53, ATRX1, RB1, and, subclonally, PIK3CA; a stable microsatellite state (MSS), and a low tumor mutational burden (5 Muts/Mb).\nBased on the recommendation by our multidisciplinary tumor board, a therapy regimen consisting of pembrolizumab, carboplatin and paclitaxel in analogy to the KEYNOTE-407 study was suggested. The patient declined systemic treatment. She was thus referred for radiotherapy in order to achieve local control, due to the central localization of the tumor with associated risk of post-stenotic pneumonia and bleeding. The patient underwent conventionally fractionated radiotherapy of the principal pulmonary tumor bulk with palliative intention with 3 Gy in 12 fractions, resulting in a total dose of 36 Gy, using Volumetric Modulated Arc Therapy (VMAT, RapidArc\u2122). Radiotherapy was well tolerated, with esophagitis grade 2 according to the Common Terminology Criteria for Adverse Events (CTCAE) version 5.0. Four weeks after the last day of radiotherapy, restaging was performed with 18F-FDG-PET/CT. A partial remission of the tumor bulk, the nodal metastases and, surprisingly, also of the vertebral lesions was shown . Of note, the supraclavicular lymph nodes and the two bone metastases in the spinal column had not been included in the irradiation field with scatter doses of 0.201 Gy, 0.093 Gy, and 0.021 Gy on the lymph nodes, vertebra Th12, and L4, respectively . Furthermore, no antiresorptive medication had been administered. Due to the remission and the lack of tumor-related symptoms, systemic treatment\u2014although no longer refused by the patient\u2014was withheld. The patient underwent radiological follow-up, during which further decrease in tumor size and complete metabolic remission of the bone, pleural and lymph node metastases was seen . Currently, 25 months after radiotherapy, the patient is still free of symptoms and has an Eastern Cooperative Oncology Group (ECOG) Performance Status of 0.", "summary": "Here, we report on the case of an 81-year-old woman with recurrent metastatic squamous cell carcinoma of the lung with mediastinal tumor bulk, lymph node and bone metastases. The patient refused to undergo systemic treatment, and palliative stereotactic radiotherapy of the mediastinal tumor was performed. At restaging with FDG-PET/CT, the patient presented with a decrease in size and FDG-avidity both of the irradiated site and of the lymph node and bone metastases (which did not receive radiotherapy). At 25\u00a0months after radiotherapy, the patient is still in remission at all sites.", "subclaim_evaluations": [ { "subclaim": "The patient is an 81-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has recurrent metastatic squamous cell carcinoma of the lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor has mediastinal bulk.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has lymph node metastases.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has bone metastases.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient refused systemic treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Palliative stereotactic radiotherapy of the mediastinal tumor was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "At restaging with FDG-PET/CT, the irradiated site decreased in size.", "support_label": "supported", "is_refined": false }, { "subclaim": "At restaging with FDG-PET/CT, the irradiated site showed decreased FDG-avidity.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lymph node metastases showed decreased FDG-avidity.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bone metastases showed decreased FDG-avidity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is still in remission at all sites.", "support_label": "supported", "is_refined": false }, { "subclaim": "The remission has lasted 25 months after radiotherapy.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_64_en.txt", "fulltext": "A 68-year-old man was admitted to our department with chief complaint of a scrotal mass, which had enlarged gradually over a 6 month duration. Physical examination revealed a round, nontender mass, approximate to the size of a tennis ball, occupying the whole left scrotum . Scrotal USG showed a heterogenous lesion in the left hemiscrotum arising from layer of tunica albuginea. The level of serum tumor markers, including alpha-fetoprotein, human chorionic gonadotropin and lactic acid dehydrogenase, were within the normal range. CT scans of the chest, abdomen did not reveal any lymphadenopathy or mass lesion. There was no evidence of lymph node enlargement or ascites. The patient underwent a high inguinal orchidectomy which was further send for HPE examination (, , ).", "summary": "A 68 years male presented with a gradually enlarging scrotal mass over a period of 6month duration. On examination a mass was felt (5\u202fcm\u202f\u00d7\u202f4\u202fcm) occupying left side of scrotum and abutting the lower pole of left testis. Left inguinal orchidectomy along with excision of mass was done. HPE revealed a spindle cell pattern with low cellularity and Immunohistochemical analysis revealed the tumor reactive for CD 117 and CD 34 which is suggestive of GIST.", "subclaim_evaluations": [ { "subclaim": "The patient is a 68-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a gradually enlarging scrotal mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass had been present for 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "On examination, a 5 cm \u00d7 4 cm mass was felt.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The mass occupied the left side of the scrotum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass abutted the lower pole of the left testis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A left inguinal orchidectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was excised.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination revealed a spindle cell pattern.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor showed low cellularity.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Immunohistochemical analysis showed the tumor was reactive for CD117.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Immunohistochemical analysis showed the tumor was reactive for CD34.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The findings are suggestive of gastrointestinal stromal tumor (GIST).", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2479_en.txt", "fulltext": "The 70-year-old female was electively admitted to our institution for an open pancreaticoduodenectomy for the treatment pancreatic adenocarcinoma. The patient had the chief complaint of painless jaundice.\nThe jaundice had arisen insidiously over a 6-mo period. It was associated with weight loss and poor appetite. Extensive investigations had been performed, including computed tomography of the chest, abdomen and pelvis, magnetic resonance cholangiopancreatography, endoscopic ultrasound, endoscopic retrograde cholangiopancreatography, and positive emission topography scan. She had also had a diagnostic laparoscopy.\nThe patient\u2019s only past medical history included an open appendectomy for appendicitis.\nAs per unit and hospital protocol, immediately post-operation, the patient was admitted to the intensive care unit (ICU) with nasojejunal (NJ) feeding tube. EN commenced 6 h post-operation at 30 mL/h. She required no vasopressor support and on day 1 had the feed rate increased. She was transferred to the surgical ward and the only concern in the immediate post-operative period was high nasogastric (NG) output. This initially improved, and slowly oral intake was introduced. She was prescribed an osmotic laxative at this time.\nOn day 5, the patient developed nausea and vomiting, with increasing pain in her central abdomen. Clinically, she had a mild tachycardia and central abdominal tenderness. The initial differential diagnosis of the presentation was postoperative anastomotic leak, particularly supported by the sudden deterioration in clinical picture and timing of the deterioration. Other differentials included postoperative collection and small bowel obstruction, potentially caused by internal hernia. To investigate, a computed tomography was organized; the finding was a large volume of fluid in distal thoracic esophagus and stomach. The tip of the NJ feeding tube was located appropriately within the efferent small bowel loop. There were also features of proximal to mid small bowel obstruction with faecalisation . The transition point was not clearly defined . Adhesions were postulated as a possible cause.", "summary": "The 70-year-old female presented to our institution for a pancreaticoduodenectomy (Whipple's procedure) for pancreatic adenocarcinoma. On day 5 post-operative, having failed to progress and developing symptoms of small bowel obstruction, she underwent a computed tomography scan, which showed features of mechanical small bowel obstruction. Following this, she underwent an emergency laparotomy and small bowel decompression. The recovery was long and protracted but, ultimately, she was discharged home. A literature search of reports from 1966-2020 was conducted in the MEDLINE database. We identified eight articles describing a total of 14 cases of small bowel obstruction secondary to enteral feed bezoar. Of those 14 cases, all but 4 occurred after upper gastrointestinal surgery; all but 1 case required further surgical intervention for deteriorating clinical picture. The postulated causes for this include pH changes, a reduction in pancreatic enzymes and gastric motility, and the use of opioid medication.", "subclaim_evaluations": [ { "subclaim": "The patient was a 70-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent a pancreaticoduodenectomy (Whipple's procedure).", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was for pancreatic adenocarcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "On day 5 post-operative, she developed symptoms of small bowel obstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "A computed tomography scan showed features of mechanical small bowel obstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent an emergency laparotomy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She underwent small bowel decompression.", "support_label": "supported", "is_refined": false }, { "subclaim": "A literature search was conducted in the MEDLINE database.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The search covered reports from 1966 to 2020.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Eight articles were identified.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The articles described a total of 14 cases of small bowel obstruction secondary to enteral feed bezoar.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "All but 4 of the 14 cases occurred after upper gastrointestinal surgery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "All but 1 case required further surgical intervention.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The surgical intervention was due to a deteriorating clinical picture.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postulated causes include pH changes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Postulated causes include a reduction in pancreatic enzymes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Postulated causes include a reduction in gastric motility.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Postulated causes include the use of opioid medication.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 4 }, { "id": "multiclinsum_test_1868_en.txt", "fulltext": "A 79-year-old Black female patient was referred for percutaneous LAAO. Past medical history was significant for mitral regurgitation, tricuspid regurgitation, and persistent atrial fibrillation complicated by recurrent significant gastrointestinal haemorrhage on anticoagulation secondary to diverticulosis. Five months prior to referral, she underwent surgical mitral and tricuspid valve repair, as well as LAA ligation with 35\u2005mm AtriClip due to elevated stroke risk (CHA2DS2-VASc score 5) with intolerance to oral anticoagulation. Initial pre-procedural clinical examination revealed a haemodynamically stable, well-appearing female with regular heart rate and irregular rhythm. Pre-operative laboratory assessment revealed normal kidney function (serum creatinine 0.81\u2005mg/dL) and mild anaemia (haemoglobin 10.8\u2005g/dL, reference 12.0\u201315.0\u2005g/dL). Intra-operative transoesophageal echocardiogram (TEE) demonstrated closure of the LAA. However, 40-day post-operative TEE and cardiac computed tomography (CT) imaging demonstrated a significant persistent communication between the left atrium and LAA with no evidence of LAA thrombus ( and ). After comprehensive review of the TEE and CT scan images, we felt that a LAAO device could be used to achieve adequate occlusion of the residual LAA pouch. For LAAO device implantation, trans-septal atrial imaging was performed using fluoroscopic and TEE guidance, with a mid-septal puncture chosen using intracardiac ultrasound guidance. Intra-procedural TEE was used for sizing of the LAA, and based on these measurements, a 27\u2005mm LAAO device (WATCHMAN\u2122) was selected and deployed, with all the P.A.S.S. (Position, Anchor, Size, and Seal) criteria satisfied . Only 1.4\u2005mm PDL was present. She continued on apixaban 5\u2005mg twice daily and aspirin 81\u2005mg daily post-operatively. Follow-up TEE at 6 weeks demonstrated a trivial PDL measuring 1.9\u2005mm along posterior aspect, with no thrombus seen. At that point, the decision was made to continue aspirin 81\u2005mg daily and clopidogrel 75\u2005mg daily, with discontinuation of apixaban. The patient has not experienced any further episodes of major bleeding, and we are tentatively planning to stop clopidogrel at 6 months post-operatively, with continuation of aspirin 81\u2005mg daily indefinitely thereafter.", "summary": "We present a case of a 79-year-old female patient who underwent LAAO device deployment within a surgically occluded LAA with PDL. She underwent 27\u2005mm LAAO device (WATCHMANTM) deployment and all the P.A.S.S. (Position, Anchor, Size, and Seal) criteria were satisfied. Only 1.4\u2005mm PDL was present. She was continued on apixaban and aspirin post-operatively. Post-operative transoesophageal echocardiogram at 6 weeks demonstrated trivial PDL measuring 1.49\u2005mm. Patient was continued on aspirin and clopidogrel, with discontinuation of apixaban.", "subclaim_evaluations": [ { "subclaim": "The patient was a 79-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent LAAO device deployment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The LAA was surgically occluded.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The LAAO device was a 27\u2005mm WATCHMANTM.", "support_label": "supported", "is_refined": false }, { "subclaim": "The P.A.S.S. criteria were satisfied.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 1.4\u2005mm PDL was present.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was continued on apixaban post-operatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was continued on aspirin post-operatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "A post-operative transoesophageal echocardiogram was performed at 6 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The 6-week transoesophageal echocardiogram showed trivial PDL measuring 1.49\u2005mm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was continued on aspirin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was continued on clopidogrel.", "support_label": "supported", "is_refined": false }, { "subclaim": "Apixaban was discontinued.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2852_en.txt", "fulltext": "In October 2006, a 46-year-old man received brain MRI, advised by a family doctor to investigate the persistency of memory loss and headaches unresponsive to pain killers medications. MRI evidenced a previously unknown infra- and supra-sellar mass of 3.5 \u00d7 2.6 cm, with high pressure on the third ventricle and on the interpenducular cistern; with MRI contrast, peripheral highlighting and an 8 mm enhanced solid nodule were found; the imaging was consistent with a diagnosis of cystic craniopharyngioma .\nSubsequently, the patient underwent fronto-temporal trans-cranial excision of the lesion and histological examination confirmed the diagnosis of PCP. In January 2007, the patient was referred by a multidisciplinary committee for discussion of adjuvant radiotherapy (RT), which was confirmed and then administered (total of 50 Gy in 25 fractions). Follow-up visits with clinical and radiological evaluations were periodically performed until 2013, every 3 months when the patient decided to discontinue medical examinations.\nIn November 2019, for the onset of vertigo and episodes of lipothymia, the patient accessed the emergency department where he performed computed tomography (CT), which showed an iso-dense infra and supra-sellar solid mass of 19 \u00d7 23 mm.\nAdditionally, a brain MRI was also performed, which confirmed the presence of a 25 \u00d7 38 \u00d7 23 mm lesion that extended to the chiasmatic and inter-peduncular cisterns and the flooring of the third ventricle; mass effect had displaced the pituitary gland to the right and had caused compression of the pons .\nThus, a second surgery was indicated for avoiding medical complications. Preliminary endocrinological and ophthalmological evaluations were performed and showed no critical signs. Therefore, in January 2020, the patient underwent total resection of the neoformation via endonasal endoscopic approach and the histological examination confirmed the recurrence of craniopharyngioma. The postoperative course was complicated by polyuria, mental confusion, dysphasia, ptosis, mydriasis, and ophthalmoplegia, and partially improved by palliative treatment with prednisolone and mannitol. Late surgery-related complications were anosmia and psychomotor impairment. At this stage, considering the young age of the patient and the clinical aggressiveness of the tumor, not controlled by curative treatments with surgery and RT, molecular analysis on the surgical sample was carried out: real-time polymerase chain reaction (PCR) for BRAF gene mutation and then next-generation sequencing analysis for a panel of >300 genes was carried out and the canonical mutation V600E in the exon 15 of BRAF gene was identified as the only relevant mutation (c.t1799a, p. V600E). As previously anticipated, the BRAF mutation had been recognized as a characteristic mutation of PCP, being identified in most, but not all, PCP and never in adamantinomatous craniopharyngioma (ACP). Post-operative brain MRI performed in February 2020 revealed residual tissue with dimensions of 19 \u00d7 22 \u00d7 19 mm, and after contrast, an inhomogeneous increase in this lesion occurred . The timeline of the clinical course is highlighted in .\nDue to the lack of standardized therapeutic approaches, an off-label therapy has been requested, considering BRAF mutation status. In literature, there have been several reports of remarkable responses to BRAF and/or MEK inhibitors (vemurafenib, dabrafenib, and combination therapy) in craniopharyngiomas in various stages, since the discovery that PCPs often harbor BRAF gene mutation .\nThe patient started combination treatment with double inhibition of BRAF and MEK with Dabrafenib 300 mg/day and Trametinib 2 mg/day .\nThe patient was consequently evaluated monthly clinically and with a biochemical profile. The treatment was initially well tolerated with no relevant adverse reactions.\nAt 4 months, laboratory results showed a pathological increase intriglyceride and Cholesterol levels, graded 3 on the CTCAE scale, rarely described during treatment with BRAF/MEK inhibitors. Anti-BRAF and anti-MEK were then suspended temporary and the patient was referred to an endocrinologist: a new medical treatment was established with Fenofibrate and Omega 3 with following the reduction in laboratory levels: oncological treatment was then resumed with dose reduction in accordance to European Medical Agency (EMA) recommendation (Dabrafenib 200 mg/day, Trametinib 1.5 mg/day) when levels reached grade 1, according to CTCAE scale. This was the only adverse event reported by the patient and it did not influence his quality of life. At the time of writing, treatment is ongoing (the total time of treatment until now is 14 months).\nFirst radiological evaluation with MRI after 4 months of treatment showed not only a significant volume reduction of the tumor (14 \u00d7 9 \u00d7 5 mm vs. 19 \u00d7 22 \u00d7 19 mm) but also a reduction of the mass effect on the surrounding tissue, for example, realignment of chiasmatic structure . The last radiological evaluation, performed in August 2021 with MRI after 1 year of treatment, showed overall stability of tumor burden compared to November 2020 .", "summary": "A 49-year-old man with recurrent craniopharyngioma, harboring BRAF V600E mutation, has been treated with targeted therapy based on a combination of a BRAF-inhibitor, dabrafenib (150 mg, orally two times daily), and a MEK-inhibitor, trametinib (2 mg, orally two times daily). Before starting treatment, the patient was symptomatic: he lamented confusion, dysphasia, and intense fatigue, that did not allow him to work normally. After just one cycle of treatment, the patient showed an important clinical improvement, reporting a progressive regression of the basal symptoms, hinting at a rapid and dramatic response, which was confirmed at the first radiological assessment. Thus, treatment was continued and at the time of writing, the treatment is still ongoing (total duration of treatment: 14 months) and it is well tolerated, with very good quality of life: the patient has no limitations in daily activities and he has even been able to restart to work.", "subclaim_evaluations": [ { "subclaim": "The patient is a 49-year-old man.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient has recurrent craniopharyngioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor harbors a BRAF V600E mutation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received targeted therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The therapy included dabrafenib.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dabrafenib was given at 150 mg, orally two times daily.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The therapy included trametinib.", "support_label": "supported", "is_refined": false }, { "subclaim": "Trametinib was given at 2 mg, orally two times daily.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Before treatment, the patient had confusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Before treatment, the patient had dysphasia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Before treatment, the patient had intense fatigue.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After one cycle of treatment, the patient showed clinical improvement.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient reported regression of basal symptoms.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The response was confirmed at the first radiological assessment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment duration was 14 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was well tolerated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has no limitations in daily activities.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was able to restart work.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1623_en.txt", "fulltext": "A 46-year-old man had been diagnosed with a clear cell carcinoma with rhabdoid differentiation (World Health Organization grade 4) of the left kidney in May 2018 through a renal biopsy. The tumor was locally invasive, associated with metastases to retroperitoneal lymph nodes, the liver and the lungs. Because of the widely metastatic disease, nephrectomy was not performed. At initial diagnosis, the thyroid function tests showed a discrete elevation of his thyroid-stimulating hormone (TSH) at 4.5 mU/L (reference range 0.27-4.2 mU/L), with normal levels of fT4 (16 pmol/L, reference range 12.0\u201322.0 pmol/L) and fT3 (4 pmol/L, reference range 3.1\u20136.8 pmol/L) . He was subsequently started on systemic therapy with the tyrosine kinase inhibitor sunitinib in May 2018, pending approval for immunotherapy with nivolumab and ipilimumab. Therapy with nivolumab was initiated in June, and ipilimumab was added in August. The therapy with sunitinib was definitely stopped in October after completion of the mutational analysis of the primary tumor (next-generation 400 gene sequencing panel), which showed mutations in the TERT promoter and the MET gene (exon 15: p.V1088A), and amplification of SETD2 (SET domain containing 2, histone-lysine N-methyltransferase) and MET. Moreover, the tumor showed significant expression of programmed death ligand 1 (80%).\nShortly after the introduction of ipilimumab, he developed transient thyrotoxicosis secondary to immune checkpoint inhibitor-associated thyroiditis, with subsequent hypothyroidism (October 2018: TSH 26.3 mU/L, fT4 9 pmol/L, fT3 2.0 pmol/L). At this stage, levothyroxine substitution was introduced (100 \u00b5g/day, corresponding to about 1.3 \u00b5g/kg/day). However, the TSH levels further increased to 72.7 mU/L after 4 weeks of therapy. The situation remained unchanged in the following months; in January 2019, the TSH was 81.5 mU/L, the fT4 was decreased at 9 pmol/L, and the fT3 was particularly low at 1.5 pmol/L. On February 18, 2019, the levothyroxine dosage was increased to 300 \u00b5g/day (corresponding to 4.3 \u00b5g/kg/day). Despite that, the fT4 and fT3 levels remained at similar levels after 2 weeks with 10.4 and 1.1 pmol/L.\nThe patient was hospitalized in March 2019 with a diffuse atopic eczema and was found to be severely anemic. He was hypotensive and tachycardic, and the dermatologic exam revealed dry skin and eczema eruptions with erythematous and squamous papules and plaques.\nAt that time, endocrinology was consulted for the first time. The patient reported profound weakness, a weight loss of 14 kg during the last 8 months, constipation, and a generalized pruritic rash. He plausibly reported regular and appropriate intake of the levothyroxine. Of note, the patient did not present any symptoms of malabsorption. At that time, the patient intermittently took proton pump inhibitors but took no other medication known to interfere with thyroid hormone absorption or metabolism.\nAlthough he then took the levothyroxine under supervision during a week, the thyroid function tests did not improve: fT4 was 8.2 pmol/L, fT3 1.1 pmol/L, total T4 46 nmol/L (reference range 66\u2013181 nmol/L), and total T3 0.5 nmol/L (reference range 1.3\u20133.1 nmol/L). Suspecting that the patient might have consumptive hypothyroidism, rT3 was ordered and immunohistochemistry of the tumor for D3 expression was planned. The rT3 level drawn 9 days prior to his passing but only available about a month later was found to be elevated at 0.79 nmol/L (reference range 0.14\u20130.54 nmol/L). Of note, the estimated increase of his tumor burden based on cross-sectional imaging studies was about 57% between June 2018 and March 2019 (557.01 cm3 to 878.73 cm3 based on RECIST (Response Evaluation Criteria in Solid Tumors) criteria).\nThe patient and his family opted for palliative care and he left the hospital; he passed away shortly thereafter at home.", "summary": "A 46-year-old male patient with previously normal thyroid function was diagnosed with a renal carcinoma with rhabdoid differentiation. He was treated with sunitinib, followed by the immune checkpoint inhibitors ipilimumab and nivolumab, and he developed primary hypothyroidism secondary to thyroiditis. Substitution with unusually high doses of levothyroxine as high as 4.3 \u00b5g/kg/day did not normalize his thyroid function. Poor compliance was refuted because there was no improvement after observed administration. He had no malabsorption. Although tyrosine kinase inhibitors can increase the expression of D3, this effect tends to be modest. Therefore, the suspicion of tumor-related consumptive hypothyroidism was raised and supported by low free T3 and elevated rT3 levels. The therapy could not be further modified because the patient opted for palliative care and passed away 12 days later. Immunohistochemistry of the tumor from a sample obtained prior to systemic therapy documented abundant expression of D3, corroborating the diagnosis of consumptive hypothyroidism.", "subclaim_evaluations": [ { "subclaim": "The patient is a 46-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had previously normal thyroid function.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with renal carcinoma with rhabdoid differentiation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with sunitinib.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with ipilimumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with nivolumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed primary hypothyroidism.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hypothyroidism was secondary to thyroiditis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Substitution with levothyroxine as high as 4.3 \u00b5g/kg/day did not normalize thyroid function.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no malabsorption.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had low free T3 levels.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had elevated rT3 levels.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor expressed D3.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The diagnosis of consumptive hypothyroidism was made.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient opted for palliative care.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient passed away 12 days after the diagnosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2384_en.txt", "fulltext": "A 53-year-old man with a history of hepatitis B virus infection was admitted to our hospital owing to sudden vision loss in his left eye. On ocular examination, the best-corrected visual acuity was 20/30 in the right eye and hand motion at 60 cm in the left eye. Fundoscopic examination demonstrated near-total rhegmatogenous retinal detachment with breaks at the 4 and 7 o\u2019clock positions in the left eye. The patient underwent placement of an encircling scleral silicone sponge (#506G; MIRA Inc.) and pars plana vitrectomy with silicone oil tamponade An incidental lens contact with posterior capsular damage was noted intraoperatively. Cataract gradually matured and obscured the fundal view; thus, phacoemulsification was performed two weeks later. During the operation, a fragmatome was used through the sclerotomy to remove the dropped lens with suction pressure of 400 mm Hg, flow limit 20 ml/min and an ultrasonic power output of 70% with pulse rate 5 pulse/second. The followability of the lens was poor in silicone oil and lens material was also difficult to be grasped and pulled out. Lens materials were usually pushed into the peripheral vitreous cavity by the fragmatome tip. Because the room lighting and illumination of the microscope were turned off and both the surgeon and the assistant concentrated on the fundal view under the microscope, so change of the eyelid or sclera were ignored. After the dropped nuclear materials were removed and illumination of the microscope and room lighting were turned on, a whitish wound with scorch and tissue defect on the nasal aspect of the left upper eyelid were noted . Examination of the superonasal sclerotomy site, which was created for the passage of fragmatome, also revealed a focal avascular area that resemble the scleral tissue following electro-cauterization. . An area of focal greyish necrosis was noted surrounding the whitish avascular area. Afterwards, the sclerotomy was closed with 7\u20130 vicryl sutures, and there was no postoperative leakage. We prescribed tobramycin and dexamethasone ointment (Tobradex\u00ae, Alcon, Rijksweg, Belgium) twice a day for the suspected thermal wounds on the eyelid and sclera. Because of the posterior capsular tear, the Sensar\u00ae 3-piece Intraocular Lens (AR40E, Johnson & Johnson, CA, US) was inserted and placed into the ciliary sulcus. The retina was attached under silicone oil tamponade. After following-up for one month, both eyelid and scleral wounds healed gradually with scar formation . The patient was then lost to follow-up.", "summary": "We present the case of a 53-year-old male patient with a thermal burn wound on the upper eyelid and sclera following phacoemulsification for a dropped lens in a silicone oil-filled vitreous. We further designed an experiment to verify our hypothesis that thermal injury could be induced by the high temperature of the metal tip during phacoemulsification in silicone oil. In our experiment, during 420\u00a0s of continuous ultrasonic wave, the temperature of the fragmatome tip in the balanced salt solution (BSS) increased from 22.0 to 24.0 \u00baC, while the temperature of the fragmatome tip in the silicone oil group increased from 22.0 to 43.0 \u00baC.", "subclaim_evaluations": [ { "subclaim": "The patient was a 53-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a thermal burn wound on the upper eyelid.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a thermal burn wound on the sclera.", "support_label": "supported", "is_refined": false }, { "subclaim": "The injury occurred following phacoemulsification.", "support_label": "supported", "is_refined": false }, { "subclaim": "The injury occurred due to a dropped lens.", "support_label": "supported", "is_refined": false }, { "subclaim": "The eye was filled with silicone oil.", "support_label": "supported", "is_refined": false }, { "subclaim": "An experiment was designed to verify the hypothesis that thermal injury could be induced by the high temperature of the metal tip during phacoemulsification in silicone oil.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "During 420 seconds of continuous ultrasonic wave, the temperature of the fragmatome tip in the balanced salt solution increased from 22.0 to 24.0 degrees Celsius.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "During 420 seconds of continuous ultrasonic wave, the temperature of the fragmatome tip in the silicone oil group increased from 22.0 to 43.0 degrees Celsius.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2631_en.txt", "fulltext": "Herein, we describe the case of a 73 year-old man in good health, who developed widely disseminated sebaceous carcinoma including metastases to brain, visceral organs, lymph nodes, and bone.\nHe initially presented in late October 2016 for removal of a rapidly growing nodule in the anterior abdominal wall. Two days later he developed confusion, urinary incontinence and progressive aphasia. Emergent magnetic resonance imaging (MRI) of the brain showed 4 enhancing gray-white matter junctional lesions, the two largest measured 3.8 \u00d7 3.3 cm in the right frontal lobe and 2.3 \u00d7 2.5 cm in the left frontal lobe. Two smaller enhancing lesions in the right parietal lobe measured 8 mm and 4 mm in diameter. In November 2016, he underwent craniotomy and resection of bilateral frontal lobe tumors, and he made a full neurologic recovery and went on to receive post-operative gamma knife radiosurgery to the resection cavities and the small parietal brain lesions .\nHis case was reviewed in melanoma tumor boards at the Masonic Cancer Clinic, University of Minnesota. Sections of tumor revealed sheets of epithelial cells with moderate eosinophilic cytoplasm and areas of tumor infiltrating lymphocytes . Cells exhibited nuclear pleomorphism and increased mitotic activity , desmoplastic stromal reaction and necrosis . Immunohistochemical staining was positive for cytokeratin AE1/AE3 and cytokeratin 7, and negative for S100, HMB45, Melan-A, CD45, calretinin, ERG, p40, TTF1, CDX2, and GATA3. The immunoprofile ruled out melanoma, mesothelioma, lymphoma, sarcoma with epithelioid features, and most visceral carcinomas. Microscopic examination revealed intracytoplasmic lipid vesicles , confirmed by diffuse membranous reactivity for adipophilin [, ] . The findings supported a histopathologic diagnosis of sebaceous carcinoma. Importantly, additional tumor testing confirmed high expression of PD-L1 in 100% of tumor cells . Commercial genomic testing using next-generation sequencing (Foundation Medicine, Massachusetts, USA) confirmed the tumor was microsatellite stable and carried a mutational burden of 17 mutations/Mb. Table also shows various somatic mutations in genes for regulatory transcription factors, DNA repair proteins, growth factor receptors, and targetable MAPK signaling proteins. Several of the affected genes have also been described in cases of sebaceous carcinoma reported in the COSMIC database .\nInitial staging positron emission tomography-computed tomography (PET/CT) revealed evidence of widely disseminated disease involving lung and liver, muscle, bone, and multi-compartment bulky lymphadenopathy in chest and abdomen . Standard chemotherapy approaches using platinum-based chemotherapy were reviewed. However, the patient and family strongly favored a less toxic therapy, considering advanced age and quality of life concerns. Given the strong rationale for use of checkpoint inhibitors in several other tumor types, moderately high tumor mutational burden (17 muts/Mb), and strong PD-L1 expression the patient opted for anti-PD1 immunotherapy. He initiated off-label treatment with pembrolizumab (2 mg/kg, every 3 weeks) in December 2016.\nFollow up PET/ CT scan 3 months after the initiation of anti-PD1 therapy revealed remarkable improvement in lymph nodes, lung, and soft tissue, however, there were multiple new and enlarging hepatic and osseous metastases initially worrisome for progression. After multidisciplinary review, the findings were felt consistent with pseudo-progression and immunotherapy was continued. Restaging PET/ CT obtained after 6 months of treatment showed further significant improvements in all previously noted lesions , with residual FDG activity seen in small mediastinal and abdominal lymph nodes. To further characterize the patient\u2019s innate and adaptive immune status at the time of his near complete response, a flow cytometry study of peripheral blood was performed. Lymphocyte subset analysis showed evidence of circulating CD45RA-CD27+ central memory (CM) and effector memory (EM) T cells, and a population of mature CD16 + CD57+ NK cells .\nHe continued on pembrolizumab, however, after 10 months of therapy he developed severe fatigue and orthostatic hypotension requiring hospitalization. Laboratory testing showed him to have secondary adrenal insufficiency with low (< 0.7 mcg/dL) serum cortisol and low (< 11 pg/mL) ACTH levels. He began 1 mg/kg prednisone with a prolonged steroid taper, and during high dose steroid therapy pembrolizumab dosing was interrupted. In December 2017, with 12 months of follow-up, restaging PET/CT was obtained and showed new FDG avid mediastinal and abdominal lymph nodes and a new hepatic and small bowel lesion . Biopsy of the liver lesion in January 2018 confirmed recurrent metastatic sebaceous carcinoma, and repeat immunohistochemical staining showed tumor cells continued to express high levels of PD-L1 (not shown). After discussion, the patient elected to restart immunotherapy, and he was continued on maintenance adrenal replacement therapy with hydrocortisone (10 mg/5 mg). Recent restaging studies demonstrate growth of the mediastinal metastases and a reduction in the size of the hepatic and small bowel metastases, suggestive of pseudoprogression and a durable ongoing response to pembrolizumab (Additional file ).", "summary": "A 73\u00a0year-old man presented with confusion and was found to have widely disseminated sebaceous carcinoma with metastases to brain, lungs, liver, bowel, lymph nodes, and bone. Following initial treatment of the brain metastases with surgery he received post-operative radiosurgery. He then began systemic immunotherapy with pembrolizumab. After 6\u00a0months, he developed a near complete response to therapy by irRECIST and RECIST v.1.1. The response was associated with circulating CD8+ T cells with central memory (CM) and effector memory (EM) phenotype and mature CD16\u2009+\u2009CD57+ NK cells. During treatment the patient developed adrenal insufficiency requiring high-dose systemic corticosteroids and later adrenal replacement therapy. After 12-months of follow-up he showed imaging evidence of progression in liver, mediastinum, and abdominal lymph nodes. Given persistent, strong PD-L1 expression he resumed pembrolizumab therapy and showed radiographic evidence of an ongoing response to therapy.", "subclaim_evaluations": [ { "subclaim": "The patient is a 73-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with confusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had widely disseminated sebaceous carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cancer had metastases to the brain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cancer had metastases to the lungs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cancer had metastases to the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cancer had metastases to the bowel.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cancer had metastases to the lymph nodes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cancer had metastases to the bone.", "support_label": "supported", "is_refined": false }, { "subclaim": "He received surgery for brain metastases.", "support_label": "supported", "is_refined": false }, { "subclaim": "He received post-operative radiosurgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "He began systemic immunotherapy with pembrolizumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 6 months, he had a near complete response by irRECIST.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After 6 months, he had a near complete response by RECIST v.1.1.", "support_label": "supported", "is_refined": false }, { "subclaim": "The response was associated with circulating CD8+ T cells with central memory phenotype.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The response was associated with circulating CD8+ T cells with effector memory phenotype.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The response was associated with mature CD16+ CD57+ NK cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "He developed adrenal insufficiency.", "support_label": "supported", "is_refined": false }, { "subclaim": "He required high-dose systemic corticosteroids.", "support_label": "supported", "is_refined": false }, { "subclaim": "He later received adrenal replacement therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 12 months, imaging showed progression in the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 12 months, imaging showed progression in the mediastinum.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 12 months, imaging showed progression in abdominal lymph nodes.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had persistent, strong PD-L1 expression.", "support_label": "supported", "is_refined": false }, { "subclaim": "He resumed pembrolizumab therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "He showed radiographic evidence of an ongoing response to therapy.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2586_en.txt", "fulltext": "A 48-year-old Japanese male was treated for uveitis of unknown aetiology in the left eye at a general ophthalmology clinic. Prednisolone (PSL) 40 mg/day was started due to the development of macula oedema (ME) in his left eye. Although ME improved temporarily, tapering of PSL to 20 mg/day resulted in relapse of ME. He then complained of blurred vision in the left eye due to recurrence of intraocular inflammation and was referred by the local ophthalmologist to Department of Ophthalmology, Tokyo Medical University Hospital. He has no medical history. At presentation at our facility, best-corrected visual acuity (BCVA) was 20/12.5 in the right and 24/20 in the left eye, and intraocular pressure was normal. Slit-lamp examination revealed 1 + cells in anterior chamber in left eye; fundus photographs showed diffuse vitreous haze and mild exudates in peripheral retina in left eye; fluorescent angiography depicted significant retinal vasculitis characteristic of Bechet\u2019s disease at the posterior pole and periphery retina in left eye; and OCT confirmed ME in left eye . Peripheral blood test showed elevated white blood cell count, elevated percent neutrophils, elevated LDH, positive for HLA-A26, negative for HLA- B51, negative tuberculin skin test (TST) and negative T-SPOT.TB test . He was diagnosed with incomplete type of Bechet disease based on the ophthalmological findings, recurrent oral ulcer, erythema nodosum-like rash in his legs, and HLA-A26 positivity. After a screening test, ADA was started as steroid-sparing therapy. Following the initiation of ADA, ME improved gradually and tapering of PSL to 2 mg/day was achieved, resulting in favourable outcome.\nHowever, 8 months after starting ADA, the patient developed general malaise. Peripheral blood examination was positive for T-SPOT.TB at this time, and chest X-ray and computed tomography (CT) showed granular shadows in bilateral lungs . He was diagnosed with miliary TB by a respiratory physician. ADA and PSL were discontinued immediately, and 4-drug regimen for miliary TB consisting of isoniazid (300 mg/day), rifampicin (450 mg/day), ethambutol (750 mg/day) and pyrazinamide (dose titrated from 0.8 g/day to 1.5 g/day) was started. The TB treatment was completed 6 months later based on clinical improvement , although T-SPOT.TB was still positive. During the period when ADA was discontinued, the patient received adjunctive therapy with betamethasone eye drops and sub-Tenon's injection of triamcinolone acetonide to manage the condition. However, the efficacy of these treatments approach was limited to control ME , resulting in decreased BCVA in the left eye (10/20) and gradual elevation of intraocular pressure due to topical administration of steroid. Therefore, a decision was made to restart TNF inhibitor. Although miliary TB treatment had been completed, the patient still tested positive for T-SPOT.TB, necessitating initiation of infliximab (IFX) in combination with isoniazid (300 mg/day) to address the condition. Following the initiation of IFX, subsequent fluorescein angiography demonstrated more severe vascular leakage compared to the initial examination. However, improvements of ME, vitreous opacity and BCVA in the left eye (24/20) were observed. Furthermore, there was no TB relapse during the course of treatment after starting IFX for 3 years.", "summary": "A 48-year-old Japanese male was treated for uveitis of unknown aetiology in the left eye at a general ophthalmology clinic. He was referred to Department of Ophthalmology, Tokyo Medical University Hospital because of macula oedema (ME) not responding to prednisolone (PSL) 20\u00a0mg. BD was diagnosed based on fluorescein angiographic findings of diffuse retinal vasculitis characteristic of BD, recurrent oral aphthous ulcer, erythema nodosum-like rash in his legs, and HLA-A26 positivity. After a screening test, adalimumab (ADA) was started as steroid-sparing therapy. Eight months after starting ADA, the patient was diagnosed with miliary TB. ADA and PSL were discontinued immediately due to TB. Anti-TB treatment was completed after 6\u00a0months based on clinical improvement, although T-SPOT.TB was still positive. Infliximab with isoniazid was started due to relapse of ME, worsened vitreous haze, and worsened visual acuity in his left eye. Subsequently, his ocular symptoms subsided and there was no relapse of TB.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old Japanese male.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was treated for uveitis of unknown aetiology in the left eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was referred to Tokyo Medical University Hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had macula oedema not responding to prednisolone 20 mg.", "support_label": "supported", "is_refined": false }, { "subclaim": "Beh\u00e7et's disease was diagnosed based on clinical findings.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis included diffuse retinal vasculitis characteristic of Beh\u00e7et's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had recurrent oral aphthous ulcers.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had erythema nodosum-like rash in his legs.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was HLA-A26 positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "Adalimumab was started as steroid-sparing therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Eight months after starting adalimumab, the patient was diagnosed with miliary TB.", "support_label": "supported", "is_refined": false }, { "subclaim": "Adalimumab and prednisolone were discontinued due to TB.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anti-TB treatment was completed after 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "T-SPOT.TB was still positive after completing anti-TB treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Infliximab with isoniazid was started due to relapse of macula oedema.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had worsened vitreous haze.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had worsened visual acuity in his left eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ocular symptoms subsided after starting infliximab.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no relapse of TB.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_747_en.txt", "fulltext": "A 55-year-old Caucasian male presented in February 2005 with new onset hematuria, easy bruising, and jaundice. He also reported fevers, nausea with vomiting and fatigue in the week prior to presentation without any associated abdominal pain or pruritus. At presentation, he was afebrile and there was no skin rash, hepatosplenomegaly, asterixis, or stigmata of chronic liver disease but he was deeply jaundiced with scleral icterus and multiple ecchymoses. Initial laboratory tests included a white blood cell count of 13.7 (4.0\u201310.0 K/UL) with a left shift, hemoglobin 15.5 (13.5\u201317.5 GM/DL), platelets 200 (140\u2013450 K/UL), AST 1466 (20\u201357 IU/L), ALT 1459 (21\u201372 IU/L), total bilirubin 5.3 (0.0\u20131.5 mg/dl), direct bilirubin 4.9 (0.0\u20130.8 mg/dl), alkaline phosphatase 219 (30\u2013136 IU/L), INR 13, and prothrombin time 145.8 (10.0\u201313.5 sec). Serum liver biochemistries were normal 4 months prior (AST 32 IU/L, ALT 40 IU/L, Total Bilirubin 0.5 mg/dl). An abdominopelvic CT scan without contrast was unremarkable.\nThe patient had a history of mild depression, hypertension, and hyperlipidemia. He denied using intravenous drugs or recent travel or sick contacts. He had discontinued alcohol in 2002 but smoked a half-pack of cigarettes for the past 8 years. He was receiving warfarin for a prosthetic mitral valve since 2002 and had a previously stable and therapeutic INR. His other medications for the past 3 years included metoprolol XL, atorvastatin, and aspirin. Paroxetine had been started shortly after surgery and discontinued in May 2004 but restarted in October 2004 for recurrent depressive symptoms. Bupropion 150 mg bid was started for smoking cessation in July 2004 and was continued up until hospitalization (6 months of treatment). The patient reported never having received bupropion or other anti-depressants beyond the paroxetine previously. He also denied ingesting over the counter products such as acetaminophen or herbals. He had allergies to penicillin and sulfa drugs that caused hives.\nAfter receiving several units of fresh frozen plasma, he was temporarily placed on intravenous heparin. Diagnostic studies included a serum iron of 193 ug/dl, transferrin saturation of 55%, and ferritin of 974 mg/dl but subsequent hemochromatosis genotyping was negative. Serum ceruloplasmin was normal at 28 mg/dl. Serological studies for acute hepatitis A IgM, hepatitis B surface antigen and anti-HB core antibody, and hepatitis C RNA by PCR as well as CMV and EBV serologies were negative. However, an anti-nuclear antibody (ANA titer = 1:160; speckled pattern) and anti-smooth muscle antibody (ASMA titer = 1:40) were positive. A surface echocardiogram revealed an ejection fraction of 75\u201380%. Despite withdrawal of all outpatient medications, his serum aminotransferases and bilirubin continued to rise . A transjugular liver biopsy revealed severe interface hepatitis with intense peri-portal inflammatory infiltrate consisting of a mixture of lymphocytes, eosinophils, and a few scattered plasma cells . A reticulin stain showed hepatic collapse with crowding of the reticulin meshwork and loss of hepatocytes. A trichrome stain did not reveal established fibrosis. A pathological diagnosis of a severe hepatotoxic injury due to a drug with autoimmune-like features was made.\nBecause of the persistent severe biochemical injury, the patient was started on prednisone 60 mg/day. Over the next 13 days, the serum ALT levels trended down . His total bilirubin peaked at 22.7 mg/dl and his ALT reached a second peak at 1357 IU/L before trending down over the next four weeks. The patient's INR remained difficult to manage even with lower doses of coumadin, ranging between 1.6 and 3.7. However, the INR values became more stable at approximately 20 days after institution of prednisone therapy. Upon referral to the University of Michigan, a repeat ANA was higher at 1:1280 and serum IgG, IgM, and IgA levels were 1510 mg/dl, 125 mg/dl, and 367 mg/dl, respectively. At this point, the patient felt much improved and his prednisone was tapered off over 6 weeks. The patient was discharged on prednisone, metoprolol and coumadin. Three weeks later his transaminases began to rise but his bilirubin remained unchanged. Repeat testing two weeks later showed marked elevation of his total bilirubin to 23.7 mg/dl and ALT to 961 IU/L and he was readmitted to the hospital for a possible repeat liver biopsy. A decision was made to forego the liver biopsy and restart the patient on prednisone 60 mg per day and he was discharged home. However, two days later his total bilirubin increased to 37.4 mg/dl and his ALT was 1158 IU/L. He was then admitted to the hospital for liver transplantation evaluation with new onset mental status changes. The patient was started on broad-spectrum antibiotics. The patient's condition quickly deteriorated with the onset of encephalopathy and coagulopathy. On hospital day 13, he developed respiratory failure and was transferred to the ICU but he died of multiorgan failure the next day. An autopsy revealed coronary artery disease but otherwise intact myocardium. His liver was shrunken and weighed 1320 grams and there was evidence of extensive necrosis, predominantly central zone, with cholestasis. He also had bilateral aspergillus pneumonia, which had previously not been recognized. There was no evidence of other solid organ infection. His death was attributed to sepsis resulting from acute liver failure.", "summary": "We present the case of a 55-year old man who presented with jaundice and severe hepatic injury approximately 6 months after starting bupropion for smoking cessation. Laboratory evaluation demonstrated a mixed picture of hepatocellular injury and cholestasis. Liver biopsy demonstrated findings consistent with severe hepatotoxic injury due to drug induced liver injury. Laboratory testing was also notable for positive autoimmune markers. The patient initially had clinical improvement with steroid therapy but eventually died of infectious complications.", "subclaim_evaluations": [ { "subclaim": "The patient was a 55-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed jaundice.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had severe hepatic injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hepatic injury occurred approximately 6 months after starting bupropion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bupropion was prescribed for smoking cessation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory evaluation showed a mixed picture of hepatocellular injury and cholestasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Liver biopsy showed findings consistent with severe hepatotoxic injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The injury was due to drug-induced liver injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory testing was notable for positive autoimmune markers.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient initially had clinical improvement with steroid therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient eventually died of infectious complications.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_2264_en.txt", "fulltext": "A 25-years-old severe morbidly obese male (Body Mass Index [BMI] 54 kg/m2, Body Surface Area [BSA] 3.27m2) with no other known past medical history, presented to the emergency department with worsening respiratory distress. Patient\u2019s family denied vaping, electronic cigarette or illicit drug use. On initial evaluation, he was found to have an arterial partial pressure of oxygen (PaO2) of 28 mmHg and an arterial partial pressure of carbon dioxide (PaCO2) of 79 mmHg, non-responding to supplemental oxygen and non-invasive positive pressure ventilation. He was endotracheally intubated, placed on lung protective mechanical ventilation with a fraction of inspired oxygen [FiO2] of 100%, and admitted to the intensive care unit (ICU). Initial respiratory viral panel, blood and respiratory cultures were negative. Chest radiograph demonstrated bilateral pulmonary infiltrates.\nInitial attempts to evaluate heart function with transthoracic echocardiography were unsuccessful given the patient\u2019s body habitus. Over the following five days, efforts to decrease the fraction inspired on oxygen (FiO2) were unsuccessful (nadir of 80%), and his PaO2/FiO2 ratio ranged around 110-164 mmHg. Pulmonary compliance was still preserved at this point. Next day, the patient developed frank anuria and acute kidney failure, requiring initiation of continuous veno-venous hemodialysis (CVVHD). Transesophageal Echocardiogram (TEE) revealed a mildly dilated left ventricle with moderately reduced function (ejection fraction 30\u201335%), no signs of wall motion abnormalities, and a moderate-to-severe dilated right ventricle with elevated systolic pressures (50\u201360 mmHg) .\nThe patient hypoxemia worsened (PaO2/FiO2 ratio of 75 mmHg) with associated ventilator desynchrony and worsening pulmonary compliance (plateau pressures 39cmH2O) for which neuromuscular blockade was started. A pulmonary artery catheterization demonstrated elevated pulmonary artery pressures (systolic 58 mmHg, diastolic 32 mmHg, mean 41 mmHg) and a central venous pressure of 14 mmHg. Inotropic support (milrinone) and inhaled epoprostenol were started, all aimed to decrease the pulmonary artery pressures and enhance right ventricular function. In spite of these changes, the patient still remained severely hypoxemic (PaO2 64 mmHg) as well as hypercarbic and acidotic (79 mmHg, pH 7.22, respectively) with normal lactate levels (1.7 mmol/L, normal value < 2 mmol/L), as well as normotensive with no vasopressor requirement.\nGiven that conservative therapy for acute respiratory distress syndrome (ARDS) failed, the decision was to institute extracorporeal membrane oxygenation (ECMO). Since no obvious signs of low cardiac output were present, the decision was made to institute veno-venous (VV) ECMO, via a 25-French multi-orifice left femoral vein drainage cannula with its tip at the left iliac vein, and a 21-French right internal jugular vein return cannula with its tip at the right atrium, reaching flows of 5\u20136 l/minute . The patient was initially placed on sweep flow rate of 10 l/minute and FiO2 100% (PaO2 344 mmHg). The prior hemodialysis catheter was left for administration of medications and blood products, and the CVVHD was run through the VV-ECMO circuit. The patient was continued on lung protective ventilation with tidal volumes at 6 ml/kg (ideal body weight), PEEP 10cmH20 and FiO2 100% and the inhaled epoprostenol therapy was discontinued.\nThree days later, the patient severe hypoxemia persists notwithstanding VV-ECMO at maximum settings (nadir PaO2 52 mmHg, arterial O2 saturation 81%). Oxygenator issues were ruled out by excluding any obvious thrombus in circuit and by confirming post-oxygenator high oxygenation levels (post-ECMO PaO2 332 mmHg). Nitric oxygen (NO) therapy was initiated to assist with right ventricular and pulmonary artery pressure off-loading. A supplementary 21-French drainage cannula was placed in the right femoral vein and its tip at the junction of the inferior vena cava and the right atrium , achieving flows of 7\u20138 L/min (veno-veno-venous [VV-V] ECMO). The patient oxygenation status intermittently improved (PaO2 310 mmHg), although a significantly elevated lactate dehydrogenase (LDH) was noticed (> 12,500 unit/L; normal range 313\u2013618 units/L). Liver function panel was normal.\nOn next day, hypoxemia persists (PaO2 66 mmHg), with associated systemic hypotension (mean arterial pressure [MAP] of 52 mmHg) and signs of worsening tissue oxygenation (serum lactic acid 5.5 mmol/L). The team decided to switch to VV and VA ECMO with parallel circuits, in order to provide further cardiovascular support, relieve the patient\u2019s refractory hypoxemia and provide adequate flows for his BSA.\nThe original VV-ECMO circuit consisting of a left femoral vein drainage cannula and right internal jugular vein return cannula was continued, and VA-ECMO was instituted through the existing venous cannula in the right femoral vein (which became the drainage cannula) and an additional 17-French right femoral artery return cannula with its tip at the distal aorta before its bifurcation . Distal right lower limb infusion cannula was placed to the right superficial femoral artery. No significant drop in the venous pressures in the original VV-ECMO or in the CVVHD lines was noticed when the four cannulations were instituted. The total flow of both circuits was 10\u201311 L/min: 5-6 L/min for the VV-ECMO and 5 L/min for the VA-ECMO.\nThe patient\u2019s hemodynamics and oxygenation subsequently improved over the course of the next days (average MAP 68 mmHg, average PaO2 170 mmHg). A significant decrease in the LDH levels was noticed. No clinical or laboratory signs of upper body hypoxia (Harlequin Syndrome) was noticed. Adequate weaning of flow sweeps and FiO2 in both circuits was achieved. VV-ECMO was removed by hospital day #29. TEE demonstrated an improved left ventricular function (ejection fraction 45%) with persistent right ventricular dilation, for which the VA-ECMO was continued to provide further relief of the right ventricle and successfully removed 5 days later. The patient continued further ventilator weaning and planned for long-term acute care recovery.", "summary": "We present the case of a 25-year-old morbidly obese male patient admitted for severe acute respiratory distress syndrome (ARDS) and refractory hypoxemia, requiring institution of double cannulation for veno-venous ECMO. Since his hypoxemia persisted, likely due to insufficient flows given his large body surface area, an additional drainage venous cannula was implemented to provide higher flows, temporarily addressing his oxygenation status. Unfortunately, the patient developed concomitant cardiogenic shock refractory to inotropic support and extracorporeal fluid removal, further worsening his oxygenation status, thus the decision was to institute four-cannulation/parallel-circuits veno-venous and veno-arterial ECMO, successfully controlling both refractory hypoxemia and cardiogenic shock.", "subclaim_evaluations": [ { "subclaim": "The patient is a 25-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is morbidly obese.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted for severe acute respiratory distress syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had refractory hypoxemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient required double cannulation for veno-venous ECMO.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's hypoxemia persisted.", "support_label": "supported", "is_refined": false }, { "subclaim": "An additional drainage venous cannula was implemented.", "support_label": "supported", "is_refined": false }, { "subclaim": "The additional cannula provided higher flows.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed cardiogenic shock.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The cardiogenic shock was refractory to inotropic support.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The cardiogenic shock was refractory to extracorporeal fluid removal.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The decision was made to institute four-cannulation/parallel-circuits veno-venous and veno-arterial ECMO.", "support_label": "supported", "is_refined": false }, { "subclaim": "The four-cannulation ECMO successfully controlled refractory hypoxemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The four-cannulation ECMO successfully controlled cardiogenic shock.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_1435_en.txt", "fulltext": "A 36-year-old female with a history of untreated hypertension presented to the emergency department with severe headache and a decreased level of consciousness. Computed tomography (CT) of the head demonstrated a large cerebellar parenchymal hemorrhage [Figure , ], but CT angiogram was negative for a vascular malformation, aneurysm, or venous sinus thrombosis. A right frontal EVD was inserted, and the patient underwent suboccipital decompression and clot evacuation, with clinical improvement. Subsequent vascular imaging, including magnetic resonance (MR) and digital subtraction angiography was negative for pathology [Figure \u2013]. A thorough hematological workup was also negative. As such, this was considered a hypertensive hemorrhage.\nFive weeks following admission, the development of communicating hydrocephalus required the insertion of a VP shunt [Figure , ]. Following burr hole placement, the dura was coagulated and monopolar cautery along a forceps was used to puncture the dura and cauterize the pia. After a single pass, good CSF egress was observed, and the ventricular catheter was gently advanced to approximately 10 cm. The surgery was well tolerated and the hydrocephalus and level of consciousness improved.\nOn day 15 following VP shunt insertion, the patient developed a dilated and fixed right pupil. An emergent CT scan demonstrated acute intraparenchymal hemorrhage into the right parietal lobe along the ventriculostomy tract with extensive intraventricular hemorrhage, acute hydrocephalus, and midline shift [Figure , ]. An EVD was inserted through the previous right frontal burr hole, and a CT angiogram followed by a four-vessel angiogram revealed a pseudoaneurysm of a right distal middle cerebral artery (MCA) branch immediately adjacent to the entry point of the ventricular catheter in the right parietal region [Figure \u2013]. A right parietal mini-craniotomy was performed for coagulation of the right distal MCA pseudoaneurysm and removal of the VP shunt. Repeat VP shunt placement was performed 2 months following pseudoaneurysm resection. The patient was discharged to a rehabilitation facility and continued to make cognitive and functional improvement. She has since been discharged home with in-home nursing and physiotherapy assistance.", "summary": "We present the case of a fusiform pseudoaneurysm in a 36-year-old female, which arose from a branch of the middle cerebral artery following VP shunt insertion. Parenchymal and intraventricular hemorrhage at the catheter insertion site developed 15 days postoperatively. The VP shunt was removed, and the aneurysmal segment was coagulated and occluded. Use of a limited dural opening during ventricular catheter placement may have been a factor in pseudoaneurysm formation.", "subclaim_evaluations": [ { "subclaim": "The patient is a 36-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a fusiform pseudoaneurysm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The pseudoaneurysm arose from a branch of the middle cerebral artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pseudoaneurysm developed following VP shunt insertion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Parenchymal hemorrhage occurred at the catheter insertion site.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraventricular hemorrhage occurred at the catheter insertion site.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hemorrhage occurred 15 days postoperatively.", "support_label": "supported", "is_refined": false }, { "subclaim": "The VP shunt was removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The aneurysmal segment was coagulated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The aneurysmal segment was occluded.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Use of a limited dural opening during ventricular catheter placement may have been a factor in pseudoaneurysm formation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 4 }, { "id": "multiclinsum_test_1095_en.txt", "fulltext": "A 56-year-old Caucasian male with a past medical history of hypertension, acute coronary syndrome and atrial fibrillation presented to the emergency department (ED) with acute epigastric pain. His complaints had started 2 weeks earlier and had worsened 1 day prior to ED presentation. The pain was associated with nausea and increased on inspiration. Defecation and micturition were normal. In addition to fenprocoumon and sotalol, he was on antihypertensives, a statin and a proton-pump inhibitor. There was no history of trauma. Physical examination showed a pale, sweating and obese man in pain. His blood pressure was 113/73 mmHg, with a heart rate of 72 beats/min, oxygen saturation of 95% on room air and a respiratory rate of 13 breaths/min. The abdomen was not distended, and there were normal bowel sounds. He had epigastric tenderness without muscular defence or hepato-splenomegaly. His initial haemoglobin was 8.5 mmol/l. White blood cell count was 8.5 \u00d7 109/l with a c-reactive protein of 26 mg/l. The international normalised ratio (INR) was 2.4. Abdominal ultrasound showed an inhomogeneous aspect of the spleen without free fluid. Contrast-enhanced computed tomography (CT) imaging of the abdomen revealed splenic haemorrhage with subcapsular hematoma .\nAn acute operation was deemed unnecessary because his vital signs remained stable. Oral anticoagulation was reversed with 10 mg vitamin K. The patient was admitted to the hospital for observation and was discharged in good condition after 3 days.", "summary": "A 56-year-old male on oral anticoagulation presented to the emergency department with epigastric pain, nausea, and left upper quadrant tenderness. There was no history of trauma. Contrast-enhanced CT imaging revealed a large subcapsular haematoma of the spleen. Oral anticoagulation was antagonised with vitamin K and the patient was discharged in good condition after 3 days of clinical observation.", "subclaim_evaluations": [ { "subclaim": "The patient is a 56-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was on oral anticoagulation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with epigastric pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported nausea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had left upper quadrant tenderness.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no history of trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast-enhanced CT imaging was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The CT showed a large subcapsular haematoma of the spleen.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oral anticoagulation was antagonised with vitamin K.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged after 3 days of clinical observation.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3384_en.txt", "fulltext": "Presentation, history, and physical examination on hospital admission\nIn March 2014, a 33-year-old Javanese woman presented with dyspnea and palpitations at rest and during the night. The patient denied any recent weight gain, peripheral edema, headache, chest pain, fever, or any other constitutional symptoms. She had suffered from hypertension since the age of 20 years, which had been treated intermittently.\n\nOn physical examination, she had dyspnea at rest, was alert, but anxious, and her blood pressure was 170/115 mmHg, with a heart rate of 112 beats per minute, and labored respiration at 32 breaths per minute. During her latest hospitalization, peaks of systolic blood pressure were noted of up to 210 mmHg, with elevated jugular venous pressure. Cardiac examination showed both LV and RV enlargement. Cardiac auscultation detected a fixed split S2 with a loud component and a grade 3/6 ejection systolic murmur which was audible at the upper left sternal border and a diastolic gallop that could be heard at the cardiac apex. The patient had bilateral fine crepitation in the lower zones of the lungs. Abdominal examination showed no organomegaly, no palpable mass, and no abdominal bruits. Neurological examination of the lower limbs showed muscular weakness in both legs with a reduced motor power of 3\u20134/5. The lower limbs showed symmetric palpable pulses, no pedal edema, and no muscular atrophy.\n\nPast medical history and previous investigations\nIn 2002, she had been diagnosed by echocardiography as having an ostium secundum ASD. Hypokalemia was first documented at a regional hospital in 2007 when she suffered from pre-eclampsia during pregnancy. She had been treated with potassium supplements and several antihypertension medications. However, neither satisfactory blood pressure control nor normal serum potassium levels were achieved during follow-up, and the patient began to complain of increasing weakness. The patient reported that among members of her family, only her mother had suffered from hypertension.\n\nIn 2008, the patient had initially sought a specialist endocrine consultation at our hospital when her hypokalemia resulted in disabling generalized muscle weakness and intense muscle cramps. On her admission in 2008, the following studies were performed, which confirmed a diagnosis of primary aldosteronism. The supine morning plasma aldosterone concentration (PAC) and plasma renin activity (PRA) were 56 ng/mL (N\u226415 ng/mL) and 0.13 ng/mL/hour (N=0.5\u20133.3 ng/mL/hour), respectively. The PAC to PRA ratio was calculated as 430.7 ng/dL per ng/mL/hour (N\u226430 ng/dL per ng/mL/hour). Ultrasound of the abdomen showed a mass (3.4\u00d72.3\u00d72.1 cm) in the right suprarenal area that was confirmed with computed tomography (CT) to be an adrenal tumor. The patient had been referred for adrenalectomy, but she initially declined surgery and preferred to remain on medication. She was discharged home with a blood pressure of 145/90 mmHg and a serum potassium level of 3.2 mmol/L with the medications that included spironolactone, captopril, amlodipine, bisoprolol, and potassium chloride tablets. The patient became lost to follow-up for six years, until March 2014. During the period between 2008 to 2014, she was admitted twice to two separate hospitals for episodes of heart failure.\n\nInvestigations on current hospital admission\nOn admission of the patient to our hospital in March 2014, preliminary laboratory investigations showed severe hypokalemia (2.2 mmol/L) which was refractory (range, 1.9\u20132.6 mmol/L) even with repeated potassium supplementation. Urinary potassium excretion was 43 mmol/24 h indicating a renal loss of potassium. The serum magnesium level was normal, while the sodium concentrations were in the high normal limit (143 mmol/L). Serum creatine phosphokinase (CPK) was elevated at 1,257 IU/L, and creatine kinase isoenzyme myocardial band (CKMB) was 221 IU/L. Arterial blood gas analysis showed metabolic alkalosis and ventilation-perfusion mismatch secondary to pulmonary edema. Renal function tests showed normal serum urea and creatinine. Urinalysis showed no proteinuria or myoglobinuria.\n\nChest X-ray showed cardiomegaly, with a cardiothoracic ratio of 74.3%, and right atrial (RA) and RV enlargement with pulmonary edema. The electrocardiogram (ECG) showed sinus tachycardia with a ventricular rate of 112 beats per minute, left axis deviation, LV hypertrophy with strain, and alteration in ventricular repolarization consistent with hypokalemia with nonspecific ST-T segment depression, and flattened T wave with a prominent U wave. Serum potassium level was 2.1 mmol/L.\n\nBased on initial findings, a diagnosis of acutely decompensated heart failure (ADHF) with hypokalemic myopathy was made, and the patient was immediately treated with oxygen therapy, intravenous isosorbide dinitrate, furosemide, and potassium replacement. Then, a conventional heart failure regimen was begun that included a non-selective \u03b2-receptor antagonist and \u03b11-receptor antagonist (carvedilol), an angiotensin converting enzyme (ACE) inhibitor (ramipril), a dihydropyridine calcium antagonist (amlodipine), and an aldosterone receptor antagonist (spironolactone). A serum potassium level was maintained of at least >3 mmol/L with parenteral potassium infusion and tablets.\n\nTransthoracic echocardiography was performed and showed concentric hypertrophy of the LV, with an interventricular septal (IVS) thickness of 14 mm (N=6\u20139 mm); LV posterior wall thickness in end diastole of 17 mm (N=6\u201311 mm); LV mass of 473.6 g (N=66\u2013150 g); LV mass index of 284.4 g/m2 (N=43\u201395 g/m2)); and RV wall thickness of 8 mm in diastole (N\u22645 mm). There was four-chamber cardiac dilatation, global ventricular hypokinetic and LV systolic dysfunction, with an ejection fraction of 17% (Teichholz method). A large interatrial septum gap was present with a defect size of 2.4\u00d72.7 cm, with a left-to-right shunt confirming the diagnosis of ostium secundum ASD. The RA and the RV were dilated, and the right ventricular systolic pressure (RVSP) of 60 mmHg indicated moderately severe pulmonary arterial hypertension (PAH).\n\nAn abdominal CT scan was performed and compared with the previous scans, and showed an enlarged adrenal mass, from 3.4 cm in diameter in 2008 to approximately 4 cm in diameter in 2014. The tumor was minimally enhanced after contrast injection with low attenuation (+5 Hounsfield units). The absolute washout was calculated as 68%, and the mass was considered as a lipid-poor adenoma.\n\nThe investigations of endocrine function showed that her PAC failed to be suppressed after 120 minutes of captopril 50 mg, and the PAC-to-PRA ratio was still elevated further, which confirmed the diagnosis of primary aldosteronism. Other adrenal hormone levels were within normal limits. The diagnoses made at this time were of a right adrenal adenoma and biochemical diagnosis of primary aldosteronism, with acute heart failure, decreased LV systolic dysfunction, hypertensive heart disease, severe hypokalemia, rhabdomyolysis, left-to-right cardiac shunt due to a secundum ASD with moderate pulmonary hypertension (WHO functional class II). On this hospital admission, adrenalectomy was performed as the patient was willing to undergo surgery, and the blood pressure was adequately controlled before surgery.\n\nSurgical management on current hospital admission\nAfter sufficient pre-operative preparation, the patient underwent open adrenalectomy and exploration of the right adrenal mass via a posterior approach. The resected adrenal gland was a single, well defined and encapsulated yellowish nodule which weighed 27.9 g and measured 4.1\u00d72.6\u00d71.5 cm. Histopathology examination confirmed a diagnosis of a benign adrenocortical adenoma.\n\nPatient follow-up and outpatient management\nThe patient made an uncomplicated recovery post-operatively. Immediately after the removal of the tumor, the PAC was found to be reduced to 8 ng/mL, and the PAC-to-PRA ratio dropped to nearly normal levels. Her serum potassium concentration was normalized without any supplementation. Approximately three days after surgery, the patient remained clinically stable and had adequate blood pressure control with ramipril 5 mg qd. Her postoperative biochemistry showed a serum potassium of 4.1 mmol/L and normal CPK and CKMB. The patient was discharged home and showed stable biochemical findings on follow-up outpatient visits.\n\nRepeated echocardiography in September 2015 demonstrated improvement in the LV and RV size. Her LVEF had improved from 17% at presentation to 56% at 18 months after adrenalectomy. Right cardiac catheterization showed a mean right atrial pressure (RAP) of 10 mm Hg, a pulmonary artery pressure (PAP) of 54/29 mmHg (mean 42 mmHg), pulmonary vascular resistance (PVR) of 597 dyn s/cm5, and a mean pulmonary capillary wedge pressure of 11 mmHg. The pulmonary artery blood flow (Qp) relative to systemic blood flow (Qs) was 3.8 (Qp/Qs >1.5). Given the significant ASD, particularly with a high PAP and PVR, she was referred for an open surgical closure of her ASD. However, she refused to undergo cardiac surgery because of financial constraints. At her last visit to the clinic in December 2015, the patient was still on ramipril 5 mg qd and remained symptom-free with a blood pressure of 130/80 mmHg and normal potassium level. Currently, her degree of heart failure is stable. At the time of writing this case report, surgical closure of the ASD remains to be undertaken.", "summary": "A 33-year-old woman with resistant hypertension and refractory hypokalemia presented with signs and symptoms of heart failure. She had previously been diagnosed having a right adrenal tumor and ostium secundum type ASD. Transthoracic echocardiography confirmed the location of the ASD, with a left-to-right cardiac shunt, moderate to severe tricuspid insufficiency, moderate pulmonary hypertension (60 mm Hg), four chamber dilatation and biventricular hypertrophy. The left ventricular ejection fraction was 17%. Endocrine function tests showed a raised plasma aldosterone concentration (PAC) to plasma renin activity (PRA) ratio, which supported a diagnosis of primary aldosteronism. A captopril suppression test failed to suppress the patient\u2019s PAC, which confirmed the diagnosis. The patient underwent a right adrenalectomy with subsequent normalization of hypokalemia, PAC, and PAC to PRA ratio and her hypertension was managed successfully with monotherapy. Surgical pathology examination of the tumor revealed an adrenocortical adenoma. At follow-up at 18 months, the patient had a normal potassium level, and her cardiac function and ventricular geometries were improved.", "subclaim_evaluations": [ { "subclaim": "The patient is a 33-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has resistant hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has refractory hypokalemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with signs and symptoms of heart failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had previously been diagnosed with a right adrenal tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had previously been diagnosed with an ostium secundum type ASD.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiography confirmed the location of the ASD.", "support_label": "supported", "is_refined": false }, { "subclaim": "The echocardiogram showed a left-to-right cardiac shunt.", "support_label": "supported", "is_refined": false }, { "subclaim": "The echocardiogram showed moderate to severe tricuspid insufficiency.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The echocardiogram showed moderate pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The echocardiogram showed four chamber dilatation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The echocardiogram showed biventricular hypertrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The left ventricular ejection fraction was 17%.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endocrine function tests showed a raised plasma aldosterone concentration to plasma renin activity ratio.", "support_label": "supported", "is_refined": false }, { "subclaim": "The raised PAC to PRA ratio supported a diagnosis of primary aldosteronism.", "support_label": "supported", "is_refined": false }, { "subclaim": "A captopril suppression test failed to suppress the patient\u2019s PAC.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a right adrenalectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "After the adrenalectomy, hypokalemia normalized.", "support_label": "supported", "is_refined": false }, { "subclaim": "After the adrenalectomy, PAC normalized.", "support_label": "supported", "is_refined": false }, { "subclaim": "After the adrenalectomy, the PAC to PRA ratio normalized.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hypertension was managed successfully with monotherapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Surgical pathology examination of the tumor revealed an adrenocortical adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 18 months follow-up, the patient had a normal potassium level.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 18 months follow-up, cardiac function improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 18 months follow-up, ventricular geometries improved.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1220_en.txt", "fulltext": "A 12-year-old boy complained headache for 6 months. MRI revealed a D-shaped mass adjacent to the superior sagittal sinus and falx in the right parietal lobe. The mass was well-circumscribed and dura-based, with a size of 15 \u00d7 27 \u00d7 22 mm. No necrosis, cysts or hemorrhage was found. MRI also showed isointense with cortex on the T1-weighted imaging and hyperintense on the T2WI sequence, lightly hyperintense on the T2-Flair weighted imaging, but MRI enhanced homogeneously and intensely after intravenous administration of the contrast with gadolinium . The gray matter next to the central gyrus was buckled. Dural tail sign was observed, suggesting a meningioma \u201cen plaque\u201d, but peritumoral edema was indistinct. Computerized tomography perfusion imaging further showed prolonged time to peak and mean transit time, as well as increased relative cerebral blood volume and flow.\nSimpson grade II gross total resection was performed in a right decubitus position. Through a craniotomy of 5.5 \u00d7 6.5 cm, we found his dural arteries and veins enlarged abnormally, while the bone flap had no signs of invasion . The tumor was close to the centerline, its anterior edge adhered to the right vein of Trolard, and the right wall of the superior sagittal sinus and falx was invaded. The central sulcus in close to the tumor was located by the somatosensory evoked potential with cortical electrode on the cortex surface, and the epilepsy wave detected by the electroencephalogram was not found during the operation. The lobulated tumor with the size of 3 \u00d7 2.5 cm had a clear boundary with many nodules on the surface and adhered to the normal brain tissue, without full arachnoid membrane between the tumor and the brain. The strata externum of the sagittal sinus and falx was removed, and the inner of the sinus was kept intact. The bone flap was returned to the patient. No neurological adverse events occurred during the follow-up.\nKF-PRO serial scanner was used, and pathological assessment was performed using K-Viewer software. Pathologically, the tumor cells manifested nested, sheet-like or whorled aggregates of spindle to epithelioid cells prominently with indistinct cell borders. Mitotic count was less than 1 per 10 high-power fields. Focally, rhabdoid cells were identified, accounting for 10% of the tumor . Rhabdoid morphology was characterized by incomplete differentiation and intercellular adhesion, not accompanied by paranuclear inclusion body. Atypical features including brain invasion, hypercellularity, small cell formation, macronucleoli, sheeting architecture and spontaneous necrosis, were not identified in this tumor. Therefore, the patient was diagnosed as WHO grade I meningioma with focal rhabdoid features. The tumor cells showed diffuse and strong EMA and SSTR2 immunoreactivity. Immunohistochemistry for CD34, S100, STAT6, CK and SOX10 were negative in all tumor cells. Most tumor cells showed diffuse expression for SMARCB1/INI-1. The Ki-67 index was less than 1%.\nTo determine molecular features and seek potential treatments, a next-generation sequencing-based gene panel (Simceredx, Nanjing, China) was used for genomic profiling in primary tumor tissue and matched blood. Except for a novel MAML2-YAP1 fusion break point (5\u2019 MAML2 exon 1 fused to 3\u2019 YAP1 exons 7\u20139) identified , no other mutations like single nucleotide polymorphism, InDel and copy number variations were detected.", "summary": "We presented a case of 12-year-old boy with meningioma adjacent to the superior sagittal sinus and falx. Simpson grade II gross total resection was performed after diagnosis. Pathologically, he was diagnosed as WHO grade I meningothelial meningioma with rhabdoid features. A next-generation sequencing-based gene panel was performed to determine the molecular features for potential treatment, and a novel MAML2-YAP1 fusion break point was identified.", "subclaim_evaluations": [ { "subclaim": "The patient is a 12-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a meningioma adjacent to the superior sagittal sinus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The meningioma was adjacent to the falx.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent Simpson grade II gross total resection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The resection was performed after diagnosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumor was diagnosed as WHO grade I meningothelial meningioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had rhabdoid features.", "support_label": "supported", "is_refined": false }, { "subclaim": "A next-generation sequencing-based gene panel was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The gene panel was used to determine molecular features for potential treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "A novel MAML2-YAP1 fusion break point was identified.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2783_en.txt", "fulltext": "In a 78-year-old female patient with long history of persistent AF and symptomatic AF recurrences despite multiple previous ablation procedures and persistently isolated pulmonary veins, we performed isolation of the LAA by applying an anterior and a mitral isthmus line. Following a waiting period of 6 weeks post-LAAI and oral anticoagulation with a direct novel oral anticoagulant (Apixaban), we readmitted the patient in order to implant an endocardial LAA occluder device (Watchman; Boston Scientific, Marlborough, MA, USA). A preprocedural transoesophageal echocardiography (TOE) was performed and excluded a left atrial (LA) thrombus. The novel oral anticoagulant was stopped the day of the procedure. Under deep sedation using midazolam, sufentanil, and continuous infusion of propofol, a single transseptal puncture was performed using a regular 8, 5 Fr SL1 transseptal sheath (St. Jude Medical, Inc., St. Paul, MN, USA) after a multi-electrode diagnostic catheter was inserted into the coronary sinus. Intravenous Heparin was administered with a target-activated clotting time (ACT) of 300 s. Angiography of the LAA was performed revealing a \u2018chicken-wing\u2019 morphology . The maximal diameter at the landing zone as measured in fluoroscopy and TOE was 30 mm. Accordingly, a 33 mm Watchman device was selected to occlude the LAA. The transseptal sheath was changed over a regular guidewire for the 15 Fr non-steerable Watchman sheath (Boston Scientific, Marlborough, MA, USA), which was gently advanced over the wire into the distal LAA until the according marker was in the predefined landing zone. Suddenly the patient became hypotensive and TOE showed a massive pericardial effusion . Immediate pericardiocentesis was performed, and a 7 Fr pigtail catheter introduced into the pericardial space. The 15 Fr Watchman sheath was immediately withdrawn into the inferior vena cava to avoid potential thrombus formation along the sheath. The ACT was measured with 357 s. A total of 5000 I.E. of protamine was immediately applied resulting in an ACT of 157 s. Aspirated epicardial blood was autotransfused via a right femoral vein access, but despite continuous aspiration the effusion remained unchanged indicating a massive perforation of the distal LAA.\nIn the meantime, the patient was intubated. Suspecting distal LAA perforation as the source of the massive bleeding proximal occlusion of the LAA was desired. Therefore a new transseptal puncture using a 8.5 Fr SL1 sheath (St. Jude Medical, Inc., St. Paul, MN, USA) was performed, and a guidewire was advanced into the LAA. The guidewire went via the distal LAA into the pericardial space proving the distal LAA perforation. Now, the SL1 transseptal sheath was changed over the wire for 12F steerable FlexCath Advance sheath (Medtronic, Inc., Minneapolis, MN, USA) which was advanced to the base of the LAA followed by introduction of a 28 mm cryoballoon (ArcticFront Advance, Medtronic, Inc., Minneapolis, MN, USA). The cryoballoon was gently moved over a guidewire to the base of the LAA and manually inflated using the cryoballoon manual retraction kit (Medtronic, Inc., Minneapolis, MN, USA) . Contrast medium was applied over the Flexcath sheath and demonstrated complete sealing of the LAA . Later the epicardial blood could be completely aspirated resulting in haemodynamic stability of the patient.\nSince emergency open heart surgery in this older patient would have been associated with high peri- and post-operative risk, we decided to attempt epicardial LAA closure applying the Lariat epicardial LAA suture device (Sentreheart, Redwood City, CA, USA). Another anterior epicardial puncture was performed, and the epicardial magnet was introduced via the epicardial Lariat-sheath while the endocardial magnet was advanced over a second transseptal sheath and across the temporarily deflated cryoballon into the LAA. Both magnets connected and the Lariat device was brought into the pericardium and gently advanced over the LAA and over the cryoballoon to the LAA base . After echocardiographic and fluoroscopic verification of the position of the Lariat snare, the snare was closed and the cryoballoon deflated and pulled back into the LA which resulted in complete closure of the LAA . The Lariat suture was tightened one and a second time after a waiting period of 5 min. A final TOE evaluation as well as another contrast injection via the transseptal sheath demonstrated complete LAA occlusion, no further pericardial effusion occurred. All sheaths except a pericardial 7 Fr pigtail catheter were removed and the patient was transferred to ICU for further monitoring. The patient was extubated 2 h after the LAA closure and after exclusion of further epicardial effusion during the next 24 h the pigtail catheter was removed. She was discharged 10 days after the procedure. Three months from discharge the patient had one episode of persistent AF requiring electrical cardioversion, and she had no further pericardial effusion.", "summary": "An endocardial LAA occlusion was attempted but resulted in perforation of the distal LAA and severe pericardial tamponade. To prevent open heart surgery, a cryoballoon was advanced to the base of the LAA and inflation resulted in complete occlusion and stopped further pericardial bleeding. An epicardial LAA suture device was then successfully implanted and completely sealed the LAA. No further pericardial bleeding occurred, and the patient fully recovered.", "subclaim_evaluations": [ { "subclaim": "An endocardial LAA occlusion was attempted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The attempt resulted in perforation of the distal LAA.", "support_label": "supported", "is_refined": false }, { "subclaim": "The perforation caused severe pericardial tamponade.", "support_label": "supported", "is_refined": false }, { "subclaim": "A cryoballoon was advanced to the base of the LAA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cryoballoon inflation resulted in complete occlusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cryoballoon inflation stopped further pericardial bleeding.", "support_label": "supported", "is_refined": false }, { "subclaim": "An epicardial LAA suture device was successfully implanted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The suture device completely sealed the LAA.", "support_label": "supported", "is_refined": false }, { "subclaim": "No further pericardial bleeding occurred.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient fully recovered.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1249_en.txt", "fulltext": "A 15-year-old male presented to the emergency department with a 4-hour history of substernal chest pain and reported an episode of syncope lasting a few minutes. He also reported homicidal ideation and audiovisual hallucinations. The patient reported using \u201cSpice\u201d, a synthetic cannabinoid, repeatedly over the last few hours in order to maintain his euphoric mood. He used a vaporizer for consuming \u201cSpice\u201d. The patient was agitated and experienced audiovisual hallucinations instructing him to harm himself and others. He had no prior psychiatric or medical history. He denied drug allergies. Surgical and family history was unremarkable. Social history revealed that the patient was an emancipated minor, smoking a pack of cigarettes per day, drinking 3-5 beers per month, and a regular user of marijuana and synthetic cannabinoids. He also reported smoking crack cocaine once at age of 13. Physical examination revealed normal cranial nerve examination, tachycardia, hyperventilation, and an erythematous lesion resembling a canker sore in the lateral tongue with surrounding erythema. Blood pressure was 137/83 mmHg, temperature was 37.3 \u00baC, pulse rate was 75 beats per minute, and respiratory rate was 12 breaths per minute. Laboratory testing revealed no electrolyte abnormalities. Electrocardiography (ECG) showed ST segment elevation in leads V1, V2, V3, and V4, non-specific ST, T-wave changes, and T-wave inversion. Erythrocyte sedimentation rate (ESR) was mildly elevated. Cardiac enzymes were 3.2 ng/ml. Echocardiography revealed hypokinetic systolic dysfunction of the left side of the heart. Liver function tests were within normal limits. Aspirin was immediately administered to the patient and he was admitted to the cardiac catheterization lab, where no blockages in the coronary vasculature were seen. He was given a diagnosis of Takotsubo cardiomyopathy, after that catecholamine levels were seen to be elevated and urine drug screen was negative.", "summary": "A case report of an emancipated 15-year-old male experiencing Takotsubo cardiomyopathy after using the synthetic cannabinoid \"Spice\" is presented here.", "subclaim_evaluations": [ { "subclaim": "The patient is an emancipated 15-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient experienced Takotsubo cardiomyopathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient used the synthetic cannabinoid 'Spice'.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case is presented as a case report.", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_2840_en.txt", "fulltext": "We present a 43-year-old nonsmoking and nondrinking white male with oral cancer on the left side of the tongue. A biopsy sample taken from the tumor revealed a G2 keratinizing squamous cell carcinoma. On a CT scan performed two months before the operation, the radiologist described a primary tumor measuring 15 \u00d7 10 mm with peripheral contrast enhancement and two suspected, probably metastatic lymph nodes on the left side of the neck in groups III and IV, size 17 \u00d7 14 mm and 26 \u00d7 16 mm, respectively. Distant metastases were ruled out on chest X-ray and abdominal ultrasound. Moreover, anamnesis proved previous lower extremity deep vein thrombosis, but Doppler ultrasound ruled out active disease.\nThe surgical procedure included excision of the left half of the tongue, the floor of the mouth and the sidewall of the throat and bilateral cervical lymph node dissection in groups I-V on the left side and I-III on the right side. The second part of the operation involved reconstruction by using an anterolateral thigh flap. After three days, reoperation was performed due to hemorrhage from the wound after lymphadenectomy. The final histopathology report revealed G2 keratinizing squamous cell carcinoma, stage IVa (pT3 pN2b, AJCC 8th edition). Additional risk factors included perineural invasion of small nerves, an unfavorable pattern of invasion with small islands (the worst pattern of invasion, 4), a closest margin below 1 mm, and five metastatic lymph nodes (of 49 lymph nodes dissected) without extracapsular extension at levels II, IV, V on the left side. The novel prognostic histopathological grading system in oral squamous cell carcinoma based on tumor budding revealed G-2 . There were 102 budding foci detected per 10 high-power fields. Two to four cell-sized nests or single-cell invasion was observed. A multidisciplinary case conference qualified the patient for postoperative radiochemotherapy, but he refused systemic treatment. Given the patient\u2019s decision, radiotherapy alone was recommended. Five-point head, neck and shoulder masks were employed for patient immobilization, and a CT scan (3 mm slice thickness) without intravenous contrast with the patient in the supine position was performed in the planning radiotherapy process. The dose prescription involved the bilateral lymph nodes I-V to a total dose of 50 Gy in 25 fractions, the left side neck in groups II-V to a total dose of 60 Gy in 30 fractions and the tumor bed with bilateral submandibular lymph nodes to a total dose of 66 Gy in 33 fractions . The VMAT (volumetric modulated arc therapy) technique was applied. In the first stage of treatment, three full arcs were used, followed by three arcs lateralized to the left side of the neck in the second stage. In the third stage, two frontal arcs were applied. Radiotherapy was performed by linear accelerators (Clinac 23EX; Varian Medical Systems, Palo Alto, CA, USA) with an energy of 6 MV and maximal dose rate of 600 MU/min. Two weeks after the beginning of radiotherapy, ultrasound of the neck was performed due to a suspected lump in group III on the right side. It revealed a 16 \u00d7 9 mm lymph node. Fine-needle aspiration biopsy was performed in the next stage, confirming metastasis of the squamous cell carcinoma. The multidisciplinary case conference urged the application of a single-fraction stereotactic radiosurgery (SRS) boost of 18 Gy to the metastatic lymph node. After 29 days of conventional treatment, a new 5-point mask, a new CT scan without contrast and an MR scan with gadolinium intravenous contrast (both with 1 mm slice thickness) in the supine position were performed in the planned stereotactic boost process. The GTVboost volume was 0.7 cm3. A 3 mm margin was added to the GTVboost to create a PTVboost volume of 3.1cm3. A new treatment plan consisting of four arcs was prepared. Four 6 MV FFF (flattening filter-free) photon beams with a maximal dose rate of 1400 MU/min were utilized. The dose that fully covers target volume was selected as the prescribed isodose level, so that the minimum dose in the target volume was 100% of the prescribed dose and the maximum dose was 108.4%. The angle range of arcs was adapted to the boost localization and was limited to the right and front sides of the patient. The boost was delivered two days after the last fraction of conventional radiotherapy with the same linear accelerator. Overall treatment time totaled 50 days. Figures and show the dose distribution of the SRS boost and the sum of conventional RTH with SRS boost, respectively. Dose analysis of the conventional and stereotactic radiotherapy is presented consecutively in Tables and . During radiotherapy, oral mucositis and moist desquamation (grade 3, CTCAE v5.0) were observed in the irradiated area, which subsided within three months of follow up. Additionally, Staphylococcus aureus and Klebsiella oxytoca were identified from the throat culture in six week of conventional treatment, subsequently treated using antibiotic therapy consistent with the antibiogram (clindamycin, amoxicillin/clavulanate potassium). Blood tests showed grade 1 anemia and leukopenia after 24 and 33 fraction respectively, and normalized seven months after treatment. Three, ten and thirteen months after the end of radiotherapy, CT scans and laryngological examinations did not prove locoregional recurrence. Chest X-ray and abdominal ultrasound did not detect any metastatic changes one year after treatment. Xerostomia G2 was the only symptom of late toxicity fifteen months after radiotherapy.\nAt 17 months of follow-up, the patient reported coughing, suffocation and bloody sputum.\nA CT scan revealed infiltration (64 \u00d7 65 \u00d7 100 mm) in the 3rd segment of the right lung, encompassing the hilum and central part of the mediastinum. Pathological examination after endoscopic ultrasound-guided fine needle aspiration (EUS-FNA) proved squamous cell carcinoma with moderate PD-L1 membrane expression (< 50%). Acknowledgment of the tumor in the chest as lung cancer or metastatic disease due to oral cancer was difficult; nevertheless, a further aggressive course might suggest a new primary cancer. The patient was qualified for palliative radiotherapy to a total dose of 30 Gy in 10 fractions (VMAT technique, single arc, gantry angle 30.0\u2013210.0 deg) for the tumor in the chest (systemic treatment was contraindicated in terms of performance status\u2014ECOG 2). Three months later, multiple metastases in the mediastinum, right lung, spleen and bones were detected by PET/CT. The most painful osteolitic lesion in the left ischium and femoral head was irradiated in one fraction to 8 Gy (two-dimensional radiotherapy technique, two coaxial opposite beams from AP and PA directions were used). The patient died the next month.", "summary": "Here, we present a case study of a patient with oral cancer who underwent surgery. During adjuvant radiotherapy, a metastatic cervical lymph node was diagnosed based on fine-needle aspiration biopsy. To increase the total dose to the metastatic tumor, a stereotactic radiosurgery boost of 1\u2009\u00d7\u200918\u00a0Gy was performed two days after the last fraction of conventional radiotherapy. The early and late tolerance of this treatment were positive. During the 18-month follow-up, locoregional recurrence was not detected. The patient died due to secondary malignancy.", "subclaim_evaluations": [ { "subclaim": "The patient had oral cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "During adjuvant radiotherapy, a metastatic cervical lymph node was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of the metastatic cervical lymph node was based on fine-needle aspiration biopsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "A stereotactic radiosurgery boost of 1\u2009\u00d7\u200918 Gy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The stereotactic radiosurgery boost was performed two days after the last fraction of conventional radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The early tolerance of the treatment was positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "The late tolerance of the treatment was positive.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "During the 18-month follow-up, locoregional recurrence was not detected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died due to secondary malignancy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_3122_en.txt", "fulltext": "A 41-year-old male was referred to our tertiary cardiovascular center for advanced evaluation of HF.\nHe had a history of progressive dyspnea, orthopnea, bilateral leg swelling, and palpitations for 6 months.\nA coronary angiography procedure had been performed 12 months earlier via the left transfemoral access. The initial vital signs recorded included a heart rate of 130 beats per minute, blood pressure of 135/78 mm Hg, respiratory rate of 36 breaths per minute, and oxygen saturation of 88% at room air. Bilateral, severe, pretibial pitting edema and inspiratory rales auscultable at the base of the lungs were the main findings of his physical examination.\nAdditionally, a palpable, continuous thrill at the right lower quadrant of the abdomen was confirmed by auscultation as a grade-5, systolodiastolic murmur over the left iliac artery. An electrocardiogram revealed nothing unusual other than sinus tachycardia. A chest X-ray revealed cardiomegaly, pulmonary arterial (PA) enlargement, and pulmonary congestion consistent with high-output HF. Echocardiography also revealed enlargement in the PAs, right atrium, right ventricle (RV); a D-shaped septum at diastole; severe tricuspid regurgitation; and moderate mitral regurgitation with a normal left ventricle ejection fraction. The estimated PA systolic pressure from the tricuspid regurgitant jet was 55 mm Hg. In addition, a continuous shunt flow from the left common iliac artery (LCIA) to the left common iliac vein (LCIV) was detected on a Doppler examination. Computed tomography (CT) angiography disclosed an enlarged inferior vena cava (IVC), and an AVF between the LCIA and the LCIV. Right and left heart catheterization and coronary angiography was performed in order to both exclude coronary artery disease and to perform further evaluation of the PH. Systolic, diastolic, mean, and wedge PA pressure was measured as 63, 33, 46, and 14 mm Hg, respectively. The Qp/Qs ratio of 2.5 was consistent with hemodynamically significant systemic to pulmonary shunting via a large AVF. The pulmonary vascular resistance (PVR) and systemic vascular resistance (SVR) were 2.7 and 15 Wood U, respectively. The diagnosis was high-output HF with PH due to a peripheral AVF, and it was decided that the shunt would be closed percutaneously.\nUsing the left femoral arterial access, a 6-F right Judkins catheter was engaged at the site of the AVF, and a 0.035-mm hydrophilic guidewire was crossed over the defect and advanced to the IVC. A snare was advanced from the right femoral vein to the IVC, and following the capture and retrieval of the guidewire, a veno-arterial (VA) loop was created between the right femoral vein and the left femoral artery systems. The delivery sheath of the occluder was pushed forward through this VA loop to the LCIA. Initial attempts to use a 16-mm Amplatzer patent ductus arteriosus (PDA) occluder device (St. Jude Medical, Inc., St. Paul, MN, USA) to close the AVF failed to close the shunt. The use of an Amplatzer atrial septal defect (ASD) occluder (St. Jude Medical, Inc., St. Paul, MN, USA) also failed as a result of malorientation of the device within the LCIA. Finally, shunt closure was achieved with the original 16-mm Amplatzer PDA occluder device in another effort. The signs and symptoms of AVF and high-output HF were markedly relieved immediately after device implantation. A 90th-day control CT and conventional angiography confirmed the stability of device without any significant leakage or luminal narrowing in the LCIA. The invasively evaluated mean PA pressure was determined to be 30 mm Hg, the PVR was 3.1 Wood U, and the Qp/Qs ratio was almost 1.0. Due to the borderline PVR measures, pulmonary arterial hypertension-targeted treatment with bosentan 62.5 mg twice daily followed by 125 mg twice daily was initiated to be accompanied by periodic follow-up. His initial clinical, echocardiographic, hemodynamic, and neurohormonal measurements showed marked and progressive improvement after the procedure.", "summary": "Presently described is the case of a 41-year-old male patient with signs of high-output right heart failure (HF) due to a possibly iatrogenic arteriovenous fistula (AVF) between the left common iliac artery and the left common iliac vein. Invasively evaluated hemodynamic measurements were consistent with severe shunting, which resulted in precapillary pulmonary hypertension (PH). The AVF was successfully closed with a non-dedicated, 16-mm Amplatzer patent ductus arteriosus occluder (St. Jude Medical, Inc., St. Paul, MN, USA). Although his signs and symptoms were documented to be dramatically improved after closure, because mild PH persisted, adjuvant pulmonary arterial hypertension-targeted treatment with bosentan was initiated to prevent late pulmonary vascular disease.", "subclaim_evaluations": [ { "subclaim": "The patient is a 41-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had signs of high-output right heart failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cause of the heart failure was a possibly iatrogenic arteriovenous fistula.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fistula was between the left common iliac artery and the left common iliac vein.", "support_label": "supported", "is_refined": false }, { "subclaim": "Invasive hemodynamic measurements showed severe shunting.", "support_label": "supported", "is_refined": false }, { "subclaim": "The shunting resulted in precapillary pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The AVF was closed with a 16-mm Amplatzer patent ductus arteriosus occluder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The occluder was provided by St. Jude Medical, Inc.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's signs and symptoms were dramatically improved after closure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mild pulmonary hypertension persisted after closure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bosentan was initiated as adjuvant pulmonary arterial hypertension-targeted treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was started to prevent late pulmonary vascular disease.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2176_en.txt", "fulltext": "A 27-week four days old preterm male infant was born from a dichorionic diamniotic twin pregnancy with low birth weight(1135 gr). His prenatal examinations were completed regularly without reported complications. In the 27th week of pregnancy, the mother experienced premature membrane rupture, contractions, and bleeding. She was treated with antenatal steroids and cesarean delivery was planned due to an arrested birth. During birth, the neonate was hypotonic and apneic, requiring intubation one minute after birth due to respiratory failure with an uncuffed endotracheal tube. His APGAR scores were 4,6 and 7 in the 1st, 5th, and 10th seconds, respectively. He was transferred to the newborn intensive care unit(NICU) for further management. After a diagnosis of respiratory distress syndrome was made, treatment with endotracheal poractant alfa 200 mg/kg, parenteral ampicillin-gentamicin, and caffeine citrate was initiated. His ventilation settings were arranged to assist control and volume guaranteed mode with maximum inspiring pressure of 20 cm/H\u00b2O. His cranial ultrasound showed no abnormalities.\nOn hospital day 3, he was extubated to nasal intermittent positive pressure ventilation but required reintubation for recurrent respiratory failure. His antibiotics were escalated to vancomycin-meropenem due to clinical deterioration.\nDuring hospital day 5, the baby had worsening acute hypoxic respiratory failure. A chest x-ray revealed mediastinal pneumothorax , with a follow-up x-ray one hour later showing accelerated pneumothorax on the left side and mediastinal shift to the right. To treat the pneumothorax, a thorax tube was placed through the left 5th intercostal space. Repeat x-rays showed an expanded lung on the left side and air bronchograms on the right. Ten hours later, he had persistent acidosis and hypoxia, with another x-ray displaying a repeat pneumothorax on the left side. The thorax tube was set to continuous suction, resulting in a reduction of pneumothorax on subsequent imaging.\nOn the 6th day of hospitalization, an echocardiogram revealed a 3 mm patent ductus arteriosus(PDA) with mostly left to right two-way shunts and pulmonary hypertension. His oxygen saturation levels were approximately 80%, and his arm-leg saturation differences were higher than 15 mm Hg, suggesting differential cyanosis. These findings were suspicious for persistent fetal circulation; therefore, pediatric cardiology advised against the closure of PDA. A new chest x-ray showed a collapsed left lung, and a second chest tube was placed in the left hemithorax.\nThe decision to perform a surgical intervention was made given no resolution of the pneumothorax after the second chest tube and the patient\u2019s continued clinical deterioration. A left posterolateral thoracotomy was performed. During the exploration, a 1 cm perforated area between the left bronchus and carina was found by following the air leak through the visceral pleura. The perforated area was repaired by using a pleural patch, and suturing with 6.0 prolene was performed. At the end of the procedure, there was no visible bleeding or air leak. The anesthesiologist applied high-pressure air via the endotracheal tube to check for any air leaks. A chest tube was inserted, and the thoracotomy incision was closed by layers. Post-procedure chest x-ray showed an expanded left lung. Three days later, the neonate experienced another episode of hypoxia, which was found to be secondary to a repeat left-sided pneumothorax. Consequently, a second thoracotomy was performed using the same technique as the prior surgery, with an air leak emanating from the same area. The perforated area was repaired using a pleural patch and the left 5th intercostal muscle long peduncle . Fibrin glue and spongestan were used as anchorage on top of the patch . After the repair, no leak was found with the use of maximal airway pressure. A PDA ligation operation was also performed simultaneously during the procedure . There was no air leakage in the repeat x-ray. Both the first and second thorax tubes were removed on postoperative days 0 and 5, respectively. There were no signs of air buildup or pneumothorax on the following days. On the 161st day of admission, the patient was discharged home with a home-type ventilator and 30% oxygen support.", "summary": "In this case, we present a preterm newborn who developed pneumomediastinum and pneumothorax. The pneumothorax persisted, despite placement of a thorax tube, requiring a thoracotomy to detect and treat the bronchial rupture.", "subclaim_evaluations": [ { "subclaim": "The patient was a preterm newborn.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed pneumomediastinum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed pneumothorax.", "support_label": "supported", "is_refined": false }, { "subclaim": "A thorax tube was placed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pneumothorax persisted despite placement of a thorax tube.", "support_label": "supported", "is_refined": false }, { "subclaim": "A thoracotomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A bronchial rupture was detected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The bronchial rupture was treated.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_14_en.txt", "fulltext": "The proband, female of 1 year and 3 months old, was referred to the Research Centre for Medical Genetics because of severe failure to thrive. She was born from a first pregnancy. Parents were nonconsanguineous and had normal growth. The threat of miscarriage took place at 27 weeks. Delivery was emergent at 38 weeks and 5 days by cesarean section. The condition at birth was severe. Respiratory failure was increasing. The child was on a ventilator for five days. In total, respiratory support was required for five months. The patient was diagnosed with pulmonary hypertension.\nBody weight at birth was 1490 g (Z-score \u22124.50), 40 cm in length (Z-score \u22124.54). Head circumference was 32.5 cm (Z-score \u22122.59). Chest circumference was 24 cm. She had hydrocephalic head, short palpebral fissures, ocular and nipple hypertelorism, depressed nasal bridge, epicanthus, microstomy, high-arched palate, hypoplastic low-set ears, short neck, low hair line, and arachnodactyly. The baby had a pronounced progeroid appearance. The subcutaneous fat layer was not pronounced. An external examination of the genitals revealed hypoplasia of the labia majora, and the clitoris was hypertrophied. The liver protruded 3 cm below the edge of the right costal arch and 1 cm below the edge of the left costal arch. Motor activity was reduced.\nUpon screening at 9 months, the patient\u2019s condition was severe, but her consciousness was clear, and her posture as active. The baby was responsive to communication. She had a body weight of 3.3 kg (Z-score \u22126.54), a height of 54 cm (Z-score \u22126.61), and a body mass index of 11.32 (Z-score \u22124.67). Her head circumference was 43.5 cm (Z-score \u22120.76), and her chest circumference was 30 cm. The patient\u2019s physical development was extremely low, disharmonic. Pseudohydrocephalus, high forehead, triangular face, exophthalmos, narrow nasal dorsum, smooth philtrum, microgenia, microtia, and arachnodactyly were observed in the child during the examination. The skin was clean and dry. The girl had cyanosis of the face and upper half of the trunk when crying. The subcutaneous fat was underdeveloped. The patient\u2019s chest was barrel-shaped. Hepatomegaly was observed. The child could not support her head but tried to turn her body from prone to supine. She had a pronounced interest in toys. Her speech consisted of babbling, with chains of syllables. X-ray showed delay in bone age \u2013 less than three months vs the patient\u2019s actual age of 9 months. The bone structure was sparse. Valgus deformity of the knee joints was observed. Data on the condition of the patella were not provided because these bones are transparent on X-ray scans in young children, and ultrasonography was not performed. EEG recordings contained no epileptiform or focal pathological activity. Echocardiography showed no signs of heart defects. Patent foramen ovale and diagonal trabecula in the left ventricular cavity were observed.\nAnother examination was performed at 1 year and 3 months was performed. The girl had a height of 58 cm (Z-score \u22127.06), a weight of 4 kg (Z-score \u22126.44) and a head circumference of 45 cm (Z-score \u22120.5). Hydrocephalic head, high forehead, triangular face, exophthalmos, narrow nasal dorsum, microgenia, microtia, severe hypotrophy, and areas of alopecia on the head were observed. Subcutaneous fat was not developed. The baby did not sit independently and could not steadily support herself on her feet, but she was able to stand with support. She played with toys, held objects in her hands, collected pyramids, and transferred small objects.\nThe last time the patient was examined when she was 1 year 11 months old. Short stature (63 cm, Z-score \u22127.04) and growth retardation (5 kg, Z-score \u22126.16) were noted. Clinical examination revealed dysmorphic facial features, microtia. Absent patella was noted by palpation. .\nInitially, chromosomal abnormality was suspected in the child. Cytogenetic testing was performed. Karyotype 46, XX was detected. Hutchinson-Gilford progeria was assumed. A corresponding study of the LMNA gene was performed. No pathogenic changes were observed. Clinical exome sequencing was ordered, identifying two variants in the CDC6 gene. Parental examination revealed that they were heterozygous carriers of relevant changes in the nucleotide sequence.\nNeither variant had been registered in either the GnomAD database (v.2.1.1), the clinical databases (Clinvar, HGMD Professional (v.2021.1)), or the database of variants obtained by exome sequencing (WES, CES) in the Research Center for Medical Genetics \u2013 RuExac (1337 samples). The exon 3 nucleotide sequence variant of the CDC6 gene (chr17:38447363C>T) results in a premature translation termination site (p.(Gln78Ter), NM_001254.3). According to the pathogenicity criteria, ACMG is classified as pathogenic (PVS1, PS3, PM2). The criterium PS3 was used due to the previously functional study that demonstrated pathogenicity of LoF variants in the CDC6 gene. A variant in exon 3 of the CDC6 gene (chr17:38447361A>G), resulting in a missense replacement of (p.(Lys77Arg), NM_001254.3), is classified as a variant with uncertain clinical significance (ACMG: PM2, PM3).", "summary": "The patient, a female, had extremely low physical development, neonatal progeroid appearance, lipodystrophy, thin skin, partial alopecia, cyanosis of the face, triangular face, microgenia, arachnodactyly, delayed bone age, hepatomegaly, hypoplasia of the labia majora, and hypertrophy of the clitoris in addition to known clinical signs. Differential diagnosis was performed with chromosomal abnormalities and Hutchinson-Gilford progeria. According to the results of sequencing of the clinical exome, the patient had two previously undescribed variants in the CDC6 gene, c.230A>G (p.(Lys77Arg)) and c.232C>T (p.(Gln78Ter)), NM_001254.3, in a compound heterozygous state.", "subclaim_evaluations": [ { "subclaim": "The patient is female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had extremely low physical development.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a neonatal progeroid appearance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had lipodystrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had thin skin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had partial alopecia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cyanosis of the face.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a triangular face.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had microgenia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had arachnodactyly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had delayed bone age.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hepatomegaly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypoplasia of the labia majora.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypertrophy of the clitoris.", "support_label": "supported", "is_refined": false }, { "subclaim": "Differential diagnosis included chromosomal abnormalities.", "support_label": "supported", "is_refined": false }, { "subclaim": "Differential diagnosis included Hutchinson-Gilford progeria.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had two previously undescribed variants in the CDC6 gene.", "support_label": "supported", "is_refined": false }, { "subclaim": "The variants were c.230A>G (p.(Lys77Arg)) and c.232C>T (p.(Gln78Ter)).", "support_label": "supported", "is_refined": false }, { "subclaim": "The variants were in the CDC6 gene, NM_001254.3.", "support_label": "supported", "is_refined": false }, { "subclaim": "The variants were in a compound heterozygous state.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_110_en.txt", "fulltext": "A 14-year-old Han Chinese woman with a history of neurogenic bladder for more than 10 years was admitted to our Department because of coma for 12 h. The patient complained for diplopia without fever or diarrhea 4 days before her coma with no incentive. She had no limb weakness and was treated with Vitamin B1and mecobalamine. Her previous medical history included neurogenic bladder caused by spina bifida occulta for 12 years and hydronephrosis diagnosed 1 year before. Sometimes she had urine retention, but she received no treatment for the neurogenic bladder except for urethral catheterization occasionally. She had no seizures and no fever. On admission, physical examination revealed that she was unconscious. The pupils did not react to light and presented different sizes in each eye (left pupil diameter, 2.5 mm; right pupil diameter, 4 mm). On stimulation, she could move her 4 limbs spontaneously. There were exaggerated deep tendon reflexes over both legs and the right Barbinski sign was positive. However, her vital signs were stable: Blood Pressure (BP) was 120/81 mmHg; pulse rate, 76 beats/min; body temperature, 36.5 \u00b0C; breath, 12 times/min. Non-contrast brain computed tomography (CT) after the onset of her coma revealed diffuse brain stem hypodensity. Brain MRI acquired 4 h after the coma onset in the county hospital showed high signal at the dorsal part of the pontine base and the mid brain on fluid-attenuated inversion-recovery (FLAIR) imaging and T2-weighted imaging. However, diffusion-weighted images presented normal signal . The non- contrast abdominal CT preformed on the next day of admission showed chronic obstructive uropathy with a distended bladder, severe hydronephrosis and dual renal atrophy.\nBlood analysis immediately after admission revealed renal failure [Urea nitrogen: 23.87 mmol/L, Creatinine: 566.8 \u03bcmol/L], and anemia [RBC: 2.5 \u00d7 1012/L, HGB: 79 g/L]. Arterial blood gas analysis revealed metabolic acidosis [pH 7.09 (7.35\u20137.45)]. Liver function was normal.\nThe patient was diagnosed with UE due to chronic renal failure and metabolic acidosis. She was immediately treated with 200 ml of bicarbonate at 5% conducted by quick intravenous injection, followed by 100 ml intravenous injection of bicarbonate at 5% once a day and 1.0 g of bicarbonate administered orally three times per day for 3 days. Simultaneously, she underwent urethral catheterization to relieve the urine retention. She was revived without diplopia 3 days after admission and the reviewed blood analysis after urethral catheterization showed that her renal function was returning to a normal level (Urea nitrogen: 13.10 mmol/L, Creatinine: 294 \u03bcmol/L); hence, dialysis was not necessary. She was treated with hypodermically administered erythropoietin 3000u twice a day, and ferrous sulfate 0.3 g orally thrice a day for the anemia. She was discharged 14 days after the admission without diplopia and any mental disturbance. She was still with the ureteral catheter because of the hydronephrosis. Two weeks after the discharge, the catheter was removed when abdomen ultrasonic showed decreased hydronephrosis. Follow-up MRI performed 2 months after the discharge revealed complete resolution of the brainstem UE . Reviewed blood analysis after 2 months of discharge showed that her renal failure still persisted (Urea nitrogen: 13.10 mmol/L, Creatinine: 190.3 \u03bcmol/L). However, she had no neurological disturbance or urinary retention. She underwent the comprehensive bladder-retraining program to avoid urinary retention and her renal function was regularly assessed once a month.", "summary": "A 14-year-old Han Chinese woman with a history of chronic renal failure caused by neurogenic bladder. On admission, she was unconscious and her pupils presented different sizes, while her vital signs were normal. MRI showed high signal in the dorsal pontine base and in the mid brain on fluid-attenuated inversion-recovery (FLAIR) imaging and on T2-weighted imaging while the signal was normal on diffusion-weighted images (DWI). Blood analysis revealed renal failure and acidosis. After urinary retention treatment and acidosis correction, the patient soon recovered. Follow-up MRI 2\u00a0months after the discharge revealed complete resolution of UE in the brainstem.", "subclaim_evaluations": [ { "subclaim": "The patient is a 14-year-old Han Chinese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has a history of chronic renal failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her chronic renal failure is caused by neurogenic bladder.", "support_label": "supported", "is_refined": false }, { "subclaim": "On admission, she was unconscious.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her pupils presented different sizes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her vital signs were normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed high signal in the dorsal pontine base on FLAIR imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed high signal in the mid brain on FLAIR imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed high signal in the dorsal pontine base on T2-weighted imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed high signal in the mid brain on T2-weighted imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "The signal was normal on diffusion-weighted images.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood analysis revealed renal failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood analysis revealed acidosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "After urinary retention treatment, the patient soon recovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "After acidosis correction, the patient soon recovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Follow-up MRI 2 months after discharge revealed complete resolution of UE in the brainstem.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1227_en.txt", "fulltext": "A 6 years old boy with dyspnea, orthopnea, generalized pitting edema and fever, was admitted to the pediatric intensive care unit, Shanghai Children\u2019s Hospital. Three years before this episode, he presented to our hospital with acute onset of edema, hypoalbuminemia, heavy proteinuria and hyperlipidemia. The diagnosis of IgA nephropathy (Grade II) was made by percutaneous renal biopsy and in accordance with Lee\u2019s classification . Initially he responded well to steroid therapy, but became steroid resistant after 2 years treatment. Immunosuppressive agents administered during this time period, included cyclophosphamide, mycophenolate mofetil and tacrolimus. He had no history of trauma, tuberculosis or radiation therapy.\nPhysical examination revealed tachypnea, orthopnea, anasarca and ascites. The heart sounds were muffled and hepatomegaly was also noted. Blood pressure ranged from 90/60 mmHg (systolic/diastolic blood pressure) to 130/70 mmHg. Blood cell count showed that white blood cells (WBC) was 14.49 \u00d7 109/L, neutrophils 79%, hemoglobin 11.5 g/dl, C-reactive protein 130 mg/L. Biochemistry analysis revealed total protein of 36 g/L, albumin 10 g/L, alanine aminotransferase (ALT) 10 U/L, aspartate aminotransferase (AST) 29 U/L, triglycerides 2.05 mmol/L, cholesterol 10.13 mmol/L. Serum electrolytes (Na+, K+, Ca2+ and Cl\u2212) were normal. Heavy proteinuria and hematuria were found on urinalysis (urinary protein: creatinine ratio 30.38). Serum creatinine was normal and estimated glomerular filtration rate (eGFR, calculated with Schwartz formula) was 147 ml/min/1.73m2. Blood and urine cultures were sterile. T-spot for tuberculosis was negative. There was no ultrasound evidence of thrombosis in the superior vena cava or subclavian vein. Ultrasound also demonstrated that both kidneys were enlarged with a loss of cortico-medullary differentiation. Thoracic computed tomography (CT) found no evidence of congenital malformation or malignancies. Echocardiography revealed pericardial fluid of 4.6 cm at maximal thickness, suggesting a large volume hydropericardial effusion. The massive pericardial and pleural effusions were additionally confirmed by thoracic CT . Notably, milky fluid was obtained from the pericardial space by pericardiocentesis . Chyle test was positive. Cell counts and biochemistry in the pericardial effusion revealed WBC 405 \u00d7 106/L, lymphocytes count 92%, red blood cells 63 \u00d7 106/L, AST 8 U/L, lactate dehydrogenase (LDH) 58 U/L, Glucose 7.22 mmol/L, total protein 7 g/L, albumin 4 g/L, adenylate deaminase (ADH) 2.6 U/L, triglycerides 2.55 mmol/L, cholesterol 0.79 mmol/L. These findings confirmed the diagnosis of chylopericardial effusion.\nContinuous renal replacement (CRRT) therapy was performed to alleviate the fluid overload. Meanwhile, pericardial drainage was performed and the diet was modified to low fat but rich in middle chain triglycerides and high protein. No side effects were encountered with this diet modification. The symptoms of cardiac tamponade subsided promptly, while the edema receded gradually over the subsequent 2 weeks. The indwelling pericardial catheter was removed when no fluid was drained after 3 weeks treatment and as shown in Fig. , the chylopericardial effusion was removed successfully. Pericardial effusion has not recurred at 1 year of follow up, on follow up echocardiography.", "summary": "A 6\u00a0years old boy with IgA nephropathy presented with dyspnea, orthopnea, pretibial pitting edema, ascites and fever. Muffled heart sounds and hepatomegaly were also noted. Echocardiography and thoracic CT revealed that there was a large volume of hydropericardium. Moreover, the pericardial milky fluid by pericardiocentesis was analyzed and chylopericardium effusion was eventually confirmed. Pericardial drainage was continued and his diet was modified to low fat, rich MCT and high protein. Complete remission was achieved after 3\u00a0weeks of this combined treatment.", "subclaim_evaluations": [ { "subclaim": "The patient is a 6-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has IgA nephropathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with orthopnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had pretibial pitting edema.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had ascites.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "Muffled heart sounds were noted.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hepatomegaly was noted.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography revealed hydropericardium.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracic CT revealed hydropericardium.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pericardiocentesis was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pericardial fluid was milky.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chylopericardium effusion was confirmed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pericardial drainage was continued.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's diet was modified to low fat.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's diet was modified to include rich MCT.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's diet was modified to include high protein.", "support_label": "supported", "is_refined": false }, { "subclaim": "Complete remission was achieved after 3 weeks of treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1797_en.txt", "fulltext": "A 48-year-old woman underwent a skin-sparing mastectomy for ductal carcinoma of the right breast.\nWe immediately reconstructed the breast using a deep inferior epigastric artery perforator (DIEP) free flap from the lower abdomen. The pedicle of the recipient was the thoracodorsal artery and its venae comitantes, which are commonly used in breast reconstruction. The surgery was successfully performed, and the patient was on the usual course without any postoperative complications . However, on postoperative day 7, she suffered a deep second- to third-degree contact burn over 30 percent of the reconstructed right breast due to incorrect application of a heating pad at the flap site .\nDuctal carcinoma of the right breast.\nThe burn wound was initially treated with a conventional dressing; however, the necrotic changes progressed with eschar formation . Therefore, we performed en bloc resection of the necrotic tissue at the 21st d postburn. During eschar resection, we confirmed flap survival by observing surviving glistening yellow adipose tissue in the subdermal layer .\nAs the Doppler sound of the flap pedicle was also traceable, we applied a V.A.C. dressing (KCI International, San Antonio, TX, USA) to promote healing of the burn wounds. We sealed it entirely over the exposed area of the patient\u2019s right breast under a pressure of -125 mmHg in continuous mode. However, after four days of V.A.C. application, the burn wound worsened, and the exposed adipose tissue changed to dry and brown-colored necrotic tissue . Upon further debridement, we observed an obstructed vascular pedicle with multiple thrombi in the transferred DIEP flap tissue . We also observed the presence of unviable adipose tissue. First, we performed daily dressing to demarcate the necrotic tissue.", "summary": "A 48-year-old woman who underwent immediate breast reconstruction with a deep inferior epigastric artery perforator free flap. While applying a heating pad directly to the flap site, she sustained a deep second to third-degree contact burn over 30% of the transferred flap on postoperative 7 d. As the necrotic changes had progressed, we applied an NPWT dressing over the burned area after en-bloc debridement of the transferred tissues on postoperative 21 d. After 4 d of NPWT application, the exposed fatty tissues of the flap changed to dry and brown-colored necrotic tissues. Upon further debridement, we noted that the wound gradually reached total necrosis with a collapsed vascular pedicle of deep inferior epigastric artery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent immediate breast reconstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reconstruction was performed with a deep inferior epigastric artery perforator free flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "She sustained a deep second to third-degree contact burn.", "support_label": "supported", "is_refined": false }, { "subclaim": "The burn occurred over 30% of the transferred flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "The burn occurred on postoperative day 7.", "support_label": "supported", "is_refined": false }, { "subclaim": "The burn was caused by applying a heating pad directly to the flap site.", "support_label": "supported", "is_refined": false }, { "subclaim": "Necrotic changes had progressed.", "support_label": "supported", "is_refined": false }, { "subclaim": "An NPWT dressing was applied after en-bloc debridement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The debridement was performed on postoperative day 21.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 4 days of NPWT application, the exposed fatty tissues changed to dry and brown-colored necrotic tissues.", "support_label": "supported", "is_refined": false }, { "subclaim": "Upon further debridement, the wound reached total necrosis.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The vascular pedicle of the deep inferior epigastric artery was noted to be collapsed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_3031_en.txt", "fulltext": "A 18-year-old previously healthy female (165 cm, 65 kg, body mass index (BMI) 23.9), without pre-existing comorbidities or a family history for cardiac pathologies, was admitted to the cardiac care unit (CCU) at nine o\u2019clock with cold-like symptoms and progressive dyspnea after five days of cold-like symptoms (fever, cough and expectoration). She had shortness of breath, palpitation (Heart rate: 156 beats per minute), and hypotension [Blood pressure (BP): 98/58 mmHg without vasoactive drugs usage]. Upon examination at an external hospital, a pulmonary computerized tomography (CT) revealed indications of cardiogenic pulmonary edema and moderate pulmonary inflammation. The patient presented upon admission in an alert and coherent state, but with a diminished overall condition, exhibiting sinus tachycardia at a rate of 150\u2013160 beats per minute and experiencing oxygenation impairment. Due to hypoxia, the patient necessitated supplemental oxygen administration through both nasal cannula (at a flow rate of 3 L per minute) and mask inhalation (at a flow rate of 6 L per minute) to maintain a transcutaneous pulse oxygen saturation (SPO2) level of approximately 93%. The arterial blood gas analysis revealed a pH value of 7.44, a partial pressure of oxygen of 93 mmHg, and a partial pressure of carbon dioxide of 32 mmHg following the administration of oxygen.\n\nThe patient reported no history of smoking or alcohol consumption. Additionally, there was no evidence of illicit drug use, immune-checkpoint inhibitor usage, or anti-tuberculosis medication intake. The patient received two doses of the Coronavirus Disease 2019 (COVID-19) vaccine on July 26th and August 17th, 2021, respectively. The patient contracted COVID-19 infection three months prior as a result of the implementation of a \u201cherd immunity\u201d policy.\n\nLaboratory results on admission showed an increased aspartic transaminase (AST) level of 56 IU/L, creatine kinase (CK) level of 373 IU/L, creatine kinase-MB (CK-MB) level of 36.5 IU/L, troponin I (TnI) level of 4.1 ng/mL (reference range: < 0.02 pg/mL), N-terminal pro brain natriuretic peptide (NT-proBNP) levels of 14,100 pg/mL, and serum creatinine levels of 119 umol/L. The lactate value was 1.7 mmol/L. The D-dimer was in the normal range (1.590mg/L). In addition, the inflammatory markers of white blood cell count, absolute neutrophil count, serum C-reactive protein (CRP), serum procalcitonin, amyloid A and interleukin 6 were 8.27\u00d710^9/L, 6.26\u00d710^9/L, 124.05 mg/L, 0.768ng/mL, 1114.5mg/L and 6235.0pg/mL, respectively. Thyroid function test suggested that hypersensitive thyrotropin (TSH) was decreasing (0.39 mIU/L), but triiodothyronine (T3) and tetraiodothyronine (T4) were normal.\n\nTwelve lead electrocardiogram (ECG) admitted to hospitalization (April 13th, 2023) demonstrated sinus tachycardia. ECG showed QS complex only in V1-V3 leads and 1\u20132 mm ST-segment depression in II, III, aVF, V4-V6 leads. Chest radiograph showed bilateral pulmonary scattered inflammatory changes and possible pulmonary oedema after IABP implantation. After a period of treatment, the ECG findings on April 18th revealed flat or inverted T waves in leads V1-V6. On April 19th, chest radiograph showed no signs of pulmonary congestion or inflammation.\n\nThe transthoracic echocardiography (TTE) revealed a severely impaired left ventricular ejection fraction (LVEF ~35.7%), a moderately reduced right ventricular function [tricuspid annular plane systolic excursion (TAPSE) =12 mm)], moderate to severe regurgitation of the mitral valve and tricuspid valve (the estimated pulmonary artery systolic blood pressure was 49 mmHg). The inferior vena cava was widened and its\u2019 respiratory collapse rate was less than 50%. The patient was admitted with a diagnosis of fulminant myocarditis: acute heart failure, cardiac function Grade III (New York Heart Association classification system); pulmonary infection; upper respiratory tract infection.\n\nDue to the patient\u2019s hemodynamic instability caused by acute heart failure, a continuous intravenous treatment regimen was administered. This included furosemide (4.1 ug/kg/min), dopamine (2.5 ug/kg/min), and metaraminol bitartrate injection (0.2 ug/kg/min) using microinjection pumps. Additionally, methylprednisolone sodium succinate (320 mg daily) was intravenously administered for five consecutive days to inhibit myocardial inflammation, while being protected by intravenous human immunoglobulin (PH4, 20 mg daily). Pulmonary infection was managed through transvenous administration of cefuroxime sodium every eight hours.\n\nDrug and Instrumental Treatment\nThree hours after admission, the patient exhibited a gradual progression into cardiogenic shock, specifically reaching the classic stage as defined by the cardiogenic shock staging of the American Society for Angiocardiography and Intervention. This was characterized by hypotension (blood pressure: 97/50 mmHg with the use of vasoactive drugs) and severely impaired oxygen saturation (SPO2 80%) at twelve o\u2019clock. The patient\u2019s heart rate was measured at 148 beats per minute, and the lactate value was recorded as 2.9 mmol/L at that time. Despite the administration of dopamine and metaraminol bitartrate to stabilize the patient\u2019s vital signs, the cardiogenic shock remained uncorrected.\n\nThus, an IABP was initially used for cardiogenic shock management in cardiac catheterization room in hospital day one. An IABP device (Impella cardiac power, IAB-06840-U; Teleflex\u00ae, Arrow International LLC, USA) was placed to decrease afterload and improved diastolic BP in order to increase pulsatility and improve coronary perfusion. Because of reduced vigilance and ongoing hemodynamic instability, the patient was intubated and ventilated. Subsequently, on the first day of hospitalization in the evening, femoro-femoral veno-arterial extracorporeal membrane oxygenation (VA-ECMO) was administered using the Cardiohelp device (Getinge AB, G\u00f6teborg, Sweden). Following initiation, there was a partial reduction in aortic valve opening, leading to the discontinuation of metaraminol bitartrate. Additionally, a daily administration of human blood albumin (10 g) was implemented to enhance colloid osmotic pressure. Furthermore, fresh frozen plasma was administered to improve coagulation function and minimize the risk of bleeding associated with the instrumentation.\n\nOn the first day following the initiation of IABP (Counterpulsation pressure: 110 mmHg) and VA-ECMO (Rotation speed: 3495 RPM/min; Flow: 2.62 L/min), TTE still indicated a decrease in myocardial contractility, with an LVEF of 36.6%. High dose of dopamine combined with furosemide were continued as treatment, while the invasive radial arterial BP was measured at 95/56 mmHg. By the third day after instrument implantation, there was an improvement in myocardial contractility and hemodynamic stabilization was achieved, resulting in a gradual reduction in vasopressor levels to 1.5 ug/kg/min. Thus, extracorporeal membrane oxygenation (ECMO) was discontinued on the fourth day after implantation, resulting in arterial blood pressure (BP) of 112/72 mmHg without the use of dopamine. Due to the patient\u2019s hemodynamic stability, the intra-aortic balloon pump (IABP) was removed on the fifth day after implantation, resulting in arterial BP of 114/74 mmHg. The patient experienced a rapid recovery, as mechanical ventilation was discontinued the following day and arterial BP remained at 112/72 mmHg.\n\nEight days after she was admitted, TTE revealed that the patient had a normalized cardiac function with no sign of persisting heart failure (left ventricular end diastolic diameter (LVEDD), 42.5 mm; interventricular septum thickness (IVS), 10.5 mm; LVEF, 50.8%). We stopped using diuretics because of almost normal cardiac function.\n\nEtiology\nCoronary angiography revealed no artery stenosis in hospital day one. Fulminant myocarditis may be caused by a variety of factors, including viral, bacterial, toxic, and autoreactive. In this patient, legionella pneumophila A IgM antibody, mycoplasma and chlamydia IgM antibody, adenovirus IgM antibody, respiratory syncytial virus IgM antibody, influenza virus A and B IgM antibody, and parainfluenza virus antibody were negative. The laboratory test of toxoplasmosis, cytomegalovirus, rubivirus, herpes simplex virus type 1 and 2, parvovirus B19 IgM antibody showed negative but IgG antibody revealed positive. In addition, SARS-CoV-2 RNA was negative through the throat swab test.\n\nThe antinuclear antibody (ANA) was weakly positive (Spotty type 1:100), anti-mitochondrial antibody M2 was positive, anti-Ro-52 antibody and anti-SS-A antibodies were strongly positive. Both myeloperoxidase-ANCA (MPO-ANCA) and proteinase 3-ANCA (PR3-ANCA) were negative. Anti-double-stranded DNA and other autoimmunity anti-body were negative. We considered the patient might suffer from with Sjogren\u2019s syndrome but the labial gland biopsy data were lacking.\n\nFever and Depressive State\nOn hospital day 8, the patient developed fever, with body temperature fluctuating between 38 and 39 degrees. In addition, the inflammatory markers of white blood cell count, absolute neutrophil count, serum CRP and procalcitonin were 23.91\u00d710^9/L, 20.69\u00d710^9/L, 11.04 mg/L and 0.62 ng/mL, respectively. Serological tests for tuberculosis (T-SPOT, TB test), Widal reaction and blood cultures were negative. On the eighth day of hospitalization, a lung CT scan exhibited dispersed streaks in the lower right lung, prompting a modification in the antibiotic regimen to piperacillin sulbactam (4.5g intravenous every eight hours). Nevertheless, by the tenth day of hospitalization, the patient\u2019s temperature did not show any signs of reduction, raising doubts regarding the association between the fever and the progression of pneumonia. Subsequently, on the eleventh day of hospitalization, a comprehensive abdominal CT scan revealed colorectal dilatation, necessitating heightened awareness for the possibility of paralytic intestinal obstruction. Following the administration of warm saline retention enema, the patient\u2019s body temperature rapidly declined the following day.\n\nMoreover, the patient exhibited notable levels of anxiety, depression, and suicidal inclinations on the ninth day of hospitalization. To address these concerns, psychological counseling therapy and the administration of sertraline hydrochloride tablets were implemented. Over time, the patient experienced a gradual recovery, leading to their transfer to the intermediate care unit on the thirteenth day and eventual discharge on the fourteenth day. Follow-up for seven month after discharge showed the patient had no chest tightness and shortness of breath after activity and the cardiac function was maintained at grade I (New York Heart Association classification system).", "summary": "The current report described a severe instance of fulminant myocarditis in an 18-year-old young woman who presented with severe hypoxemia and hemodynamic instability. The patient was treated with a combination of optimal medical therapy, immunological modulation, extracorporeal membrane oxygenation (ECMO), and an intra-aortic balloon pump (IABP) to support him through his critical period of hemodynamic collapse.", "subclaim_evaluations": [ { "subclaim": "The report described a case of fulminant myocarditis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was an 18-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had severe hypoxemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hemodynamic instability.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with optimal medical therapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received immunological modulation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was supported with extracorporeal membrane oxygenation (ECMO).", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with an intra-aortic balloon pump (IABP).", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1357_en.txt", "fulltext": "A female aged two years and 11 months was brought to the ED by ambulance for a generalized tonic-clonic first-time seizure. The patient had otherwise been in her usual state of health with no recent febrile illnesses. Her mother noted that the patient had an acute episode of unresponsiveness with a blank stare and called 9\u20131\u20131. Upon emergency medical services arrival, the child developed generalized tonic-clonic seizure activity. She received a weight-based dose of 1.7 milligrams (mg) of midazolam en route to the hospital, which resolved the movements. Upon arrival to the hospital, the child was no longer actively seizing and appeared to be sleepy, consistent with a postictal state. The estimated total seizure length was approximately two minutes. The patient had no notable past medical history. Family history was notable for Graves disease in the patient\u2019s mother.\nVital signs on arrival were as follows: temperature 37.9\u00b0 Celsius measured rectally; heart rate 188 beats per minute; respiratory rate 27 breaths per minute; and blood pressure 125/62 millimeters of mercury. Her height was 103 centimeters, 99th percentile, and her weight was 16 kilograms, 87th percentile. Her physical exam was notable for exophthalmos and small goiter but was otherwise unremarkable, including a non-focal neurological examination. Of note, her tachycardia and widened pulse pressure persisted after resolution of her seizure and postictal period.\nHer electrocardiogram was notable for left ventricular hypertrophy and sinus tachycardia but had no evidence of ischemia or abnormal intervals. Her laboratory evaluation was notable for a normal fingerstick blood glucose, elevated alkaline phosphatase with mild transaminitis, mild microcytic anemia, undetectably low thyroid-stimulating hormone (TSH) and unmeasurably high free thyroxine.\nThe pediatric endocrinologist was consulted who, based on the patient\u2019s weight, recommended starting atenolol 12.5 mg, methimazole 7.5 mg, and 1 milliliter (mL) potassium iodide-iodine (Lugol\u2019s saturated solution of potassium iodide {SSKI}) solution (to be given one hour after atenolol and methimazole). After treatment was initiated, the patient\u2019s heart rate improved to the 160s, and she was admitted to the pediatric intensive care unit (PICU). While in the PICU, further levels were obtained and were notable for unmeasurably high free triiodothyronine (T3), unmeasurably high total T3, and elevated thyroid-stimulating immunoglobulins (328% baseline). While in the PICU, the patient was continued on atenolol, methimazole, Lugol\u2019s solution, and hydrocortisone 50 mg every eight hours. She was in the PICU for approximately 24 hours and then transferred to the medical ward.\nThe patient remained in the hospital for one week and was discharged home with methimazole, propranolol, and SSKI. She was followed in endocrinology clinic multiple times over the next few months. The SSKI was eventually stopped, and propranolol was changed to atenolol. She had trouble with compliance with medications as the formulations available for atenolol are not child friendly. She was referred to another hospital system for a total thyroidectomy given inability to tolerate swallowing pills. She has not had recurrent seizure activity since initiating thyroid treatment.", "summary": "We describe the case of a 3-year-old girl who presented to the ED with an afebrile seizure but was found to be in thyroid storm. This case should serve as a reminder for emergency physicians to consider thyroid disease when evaluating patients presenting with seizures.", "subclaim_evaluations": [ { "subclaim": "The patient was a 3-year-old girl.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient presented to the ED with an afebrile seizure.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was found to be in thyroid storm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency physicians should consider thyroid disease when evaluating patients presenting with seizures.", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_1328_en.txt", "fulltext": "A 28-year-old man complained of an abdominal mass and continuously increasing pain over the previous 2 months. Physical examination revealed a midabdominal mass on abdominal palpation, atrophy and minimal induration in the right testis on scrotal palpation. The left testis was found to be normal. No abnormal finding was noted on digital rectal examination. Examination of the other systems, including the endocrine system, was normal.\nHis white blood cell count and urine microscopy were normal. Aspartate aminotransferase (AST): 56 mg/dl (normally 1 to 40), alanine aminotransferase (ALT): 42 mg/dl (normally 1 to 38), alkaline phosphatase (ALP): 768 mg/dl (normally 80 to 306), gamma glutamyl transferase (GGT): 160 mg/dl (normally 6 to 50) and lactate dehydrogenase (LDH): 6302 mg/dl (normally 266 to 501) were found in the blood biochemistry. His erythrocyte sedimentation rate was high (110 mm/hour). Values for alpha-fetoprotein (AFP) (5.9 ng/ml (normally 0 to 10.0)) and beta human chorionic gonadotrophin hormone (\u03b2-hCG) (0.773 mIU/ml (normally <4)) were within normal limits. Chest X-ray was normal. Scrotal ultrasonogram revealed minimal hypoechogeneity and non-homogeneity in the right testis. Abdominal computed tomography (CT) revealed a very large retroperitoneal mass (13\u00d78 cm), extending across the midline . Thorax CT was normal.\nNeedle aspiration biopsy was performed for the retroperitoneal mass and malignant tumour infiltration was reported. After the immunohistochemical studies, cytokeratin (CK) (-), vimentin (-), leukocyte common antigen (LCA) (-), \u03b2-hCG (-) and placental alkaline phosphatase (PLAP) (+) immunoreactivity were noted, indicating a germ cell tumour.\nScrotal ultrasonogram revealed hypoechogeneity and non-homogeneity in the right testicle. Evidence of a tumour was not found. The left testicle and epididymis were normal. After pre-operative evaluation, right inguinal orchiectomy was performed to determine the primary site of the tumour. Histological examination of the biopsy specimen revealed a large area of hyalinization, tubular hyalinization, interstitial fibrosis and focal Leydig cell hyperplasia. There were no pathological findings in the epididymis and spermatic cord. The final pathological diagnosis was 'burned-out' testicular tumour .\nBecause of the large retroperitoneal lymph node metastasis, primary chemotherapeutic treatment was performed. Combination chemotherapy, consisting of bleomycin, etoposide and cisplatin, was given in three weekly cycles of four courses. After the four courses of chemotherapy treatment, the abdominal mass had regressed from 13\u00d78 cm to 3\u00d72 cm .\nAfter the chemotherapy, a control CT scan was obtained revealing regression in the para-aortic and para-caval lymph nodes (3\u00d72 cm and multiple lymph nodes). After 6 months, tumour markers had increased (AFP: 3.59 ng/ml (normally 0 to 10.0) and \u03b2-hCG: 20.95 mIU/ml (normally <4)). Because only the \u03b2-hCG level had increased, the histology of the primary tumour seemed to indicate a seminoma. For this reason, retroperitoneal lymph node dissection was planned. Exploratory laparotomy revealed a retroperitoneal mass which extended both sides of the midline and involved the major vessels and extended to the eosophogastric junction, indicating an unresectable mass. A biopsy was performed from the unresectable mass and histological examination of the biopsy specimen showed only necrotic tissue and no tumour cells.\nSalvage chemotherapy consisting of paclitaxel, ifosfamide and cisplatin (TIP) was given in monthly cycles of four courses. After this chemotherapy, an abdominal CT scan revealed regression in the para-aortic and para-caval lymph nodes (milimetrical). AFP and \u03b2-hCG levels were normal (AFP: 1 ng/ml (normally 0 to 10.0) and \u03b2-HCG: 0.180 mIU/ml (normally <4)).\nThe patient has been disease and recurrence free for 5 years since the primary surgical and medical treatment.", "summary": "A 28-year-old man complained of an abdominal mass and continuously increasing pain over the previous 2 months. A midabdominal mass, atrophy and minimal induration in the right testis were revealed on physical examination. Ultrasound findings revealed focally increased echogenicity, which is typical of burned-out tumours. Inguinal orchiectomy was performed, and the histological examination of the biopsy specimen revealed a large area of hyalinization, tubular hyalinization, interstitial fibrosis and focal Leydig cell hyperplasia, with no abnormal pathological findings in the epididymis and spermatic cord. The final pathological diagnosis was concluded as \"burned-out\" testicular tumour. Surgical treatment was followed by appropriate chemotherapy and in the follow-up, the abdominal mass was observed to regress. The patient is currently free of disease 5 years after diagnosis.", "subclaim_evaluations": [ { "subclaim": "The patient is a 28-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of an abdominal mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had continuously increasing pain over the previous 2 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "A midabdominal mass was revealed on physical examination.", "support_label": "supported", "is_refined": false }, { "subclaim": "Atrophy and minimal induration in the right testis were revealed on physical examination.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound findings revealed focally increased echogenicity.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Focally increased echogenicity is typical of burned-out tumours.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Inguinal orchiectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histological examination of the biopsy specimen revealed a large area of hyalinization.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histological examination revealed tubular hyalinization.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histological examination revealed interstitial fibrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histological examination revealed focal Leydig cell hyperplasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "No abnormal pathological findings were found in the epididymis.", "support_label": "supported", "is_refined": false }, { "subclaim": "No abnormal pathological findings were found in the spermatic cord.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final pathological diagnosis was concluded as 'burned-out' testicular tumour.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgical treatment was followed by appropriate chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The abdominal mass was observed to regress in follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is currently free of disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is 5 years post-diagnosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1257_en.txt", "fulltext": "This is a retrospective case study of a 56-year-old white man diagnosed as having an AOP infarct admitted to Ume\u00e5 University Hospital, Sweden. The relevant radiology images were obtained from the hospital\u2019s database (PACS) and evaluated by a neuroradiologist as bilateral paramedian thalamic infarcts as a result of an AOP occlusion. The medical records (SYStem Cross) at Ume\u00e5 University Hospital were accessed and reviewed for his medical history, neurological work-up, and laboratory work-up (ROS). The diagnosis was based on symptoms of AOP infarction as described in the literature, radiological signs of AOP infarction, as well as exclusion of differential diagnoses.\nHe was taken to our emergency department (ED) after he was found unconscious in his home with open doors and windows. He developed ventricular fibrillation on arrival at our ED. Cardiopulmonary resuscitation (CPR) was immediately initiated and sinus rhythm (SR) was achieved on second defibrillation. He was then put on cardiopulmonary bypass for rewarming. A third ventricular fibrillation then occurred and SR was achieved on first defibrillation within seconds of onset. The total estimated duration of ventricular fibrillation was less than 2 minutes.\nHis medical history included overconsumption of alcohol. He smoked 20 cigarettes per day. On admission to our hospital there was no information available concerning his medication. On arrival at our ED his body temperature was 24.5 \u00b0C, blood pressure 145/70, heart rate 35 beats/minute, and respiratory rate 8 to 10 breaths/minute. Auscultation of his heart and lungs was unremarkable. He was unconscious with a Reaction Level Scale 85 (RLS-85) score of 4. RLS-85 gives a score between 1 and 8. An RLS-85 score of 4 indicates an unconscious patient who localizes but does not ward off when pain stimulated. He exhibited a slight anisocoria with his right pupil slightly bigger than his left.\nThe laboratory work-up at admission included moderate electrolyte disturbances and elevated liver enzymes. Drug and alcohol screens were negative.\nAn emergency CT of his head was performed and initially misinterpreted as normal with no signs of hemorrhage or acute infarction . In our intensive care unit (ICU), he was initially sedated and intubated with ventilator treatment. An attempt to extubate and wake him was made on day 3, but he still required ventilator support. He was re-intubated and sedated, and later given a tracheotomy. A complicated disease course followed with pneumothorax after CPR, pneumonia treated with antibiotics, bilateral pleural effusion requiring drainage, intestinal paralysis, acute pancreatitis, and ascites requiring paracentesis. The sedation was discontinued 2 weeks after admission to our ICU. He still required ventilation support. At this stage he could open his eyes when spoken to but otherwise he gave no contact. On neurological examination he withdrew his arms, moved his left foot, and grimaced upon pain stimulation. He had slight anisocoria, this time with his left pupil slightly bigger than his right. His pupillary reflexes were, however, symmetrical on direct and indirect stimulation. A follow-up CT performed on day 24 revealed bilateral ischemia in the medial areas of the thalami, as well as a smaller ischemic area in the left part of pons . At this point a senior neuroradiologist re-evaluated the first CT performed on admission and concluded that bilateral thalamic ischemia was discernable also on this CT . Electroencephalography (EEG) was pathological and showed an irregular theta/delta activity. However, there was no epileptiform activity.\nFour weeks after admission it was possible to extubate him. His neurological function remained unchanged. He was transferred to our medical acute ward. On day 35 of hospitalization he died and the postmortem examination revealed pulmonary infarctions and pneumonia. A timeline of events is given in Fig. .", "summary": "This is a retrospective case study of a 56-year-old white man admitted to Ume\u00e5 University Hospital and diagnosed with an artery of Percheron infarction. Medical records and the neuroradiological database were reviewed, and the diagnosis was made based on typical symptoms and radiological findings of artery of Percheron infarction. We report the case of a 56-year-old man with a history of overconsumption of alcohol who was found in his home unconscious and hypothermic. He had a Reaction Level Scale-85 score of 4. He developed ventricular fibrillation on arrival at our emergency department, and cardiopulmonary resuscitation successfully restored sinus rhythm within an estimated 2 minutes of onset. He was then put on cardiopulmonary bypass for rewarming. The initial head computed tomography performed on admission was wrongly assessed as unremarkable. Bilateral ischemia in the paramedian thalamic nuclei and pons were first documented on a follow-up computed tomography on day 24 after hospitalization. He died on day 35 after hospitalization.", "subclaim_evaluations": [ { "subclaim": "The patient was a 56-year-old white man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was admitted to Ume\u00e5 University Hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was diagnosed with an artery of Percheron infarction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made based on typical symptoms and radiological findings.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of overconsumption of alcohol.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was found unconscious and hypothermic in his home.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a Reaction Level Scale-85 score of 4.", "support_label": "supported", "is_refined": false }, { "subclaim": "He developed ventricular fibrillation on arrival at the emergency department.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiopulmonary resuscitation restored sinus rhythm within an estimated 2 minutes.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was put on cardiopulmonary bypass for rewarming.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial head computed tomography performed on admission was wrongly assessed as unremarkable.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilateral ischemia in the paramedian thalamic nuclei and pons was first documented on a follow-up computed tomography on day 24 after hospitalization.", "support_label": "supported", "is_refined": false }, { "subclaim": "He died on day 35 after hospitalization.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_547_en.txt", "fulltext": "A 48-year-old male reported pain in the lateral part of his left lower leg and ankle during a badminton play. He was injured when he attempted to receive a high serve. The shuttlecock came to his left, so he stepped his right foot to the left first and jump to hit it. However, he felt pain at the left lower extremity when his left foot landed on the ground and immediately lost the ability to continue the play. He denied a direct impact injury to the proximal end of the left leg and confirmed no history of trauma or surgical treatment on the lower extremity.\nPhysical examination revealed no obvious deformity and intact skin of the left leg with mild tenderness upon palpation of the lateral malleolus, as well as the proximal aspect of the fibula. Medial or posterior tenderness was not presented. The initial motions of the ankle joint were limited and there was no distal neurovascular deficit. There were no other skeletal injuries and the systemic examination was unremarkable.\nPlain radiographs demonstrated a spinal fracture at the proximal fibula with no displacement of fragments. Evidence of a medial, lateral, or posterior malleolar fracture or other defects was not clear . Talar shift or widening of the ankle mortise was not noted.\nComputed tomography (CT) images of the ankle showed an avulsion fracture of the anterior tibia by the anterior inferior tibiofibular ligament (AITFL) with a nondisplaced bony fragment . However, magnetic resonance images suggested no injury of the posterior inferior tibiofibular ligament, interosseous tibiofibular ligament, deltoid ligament, and both the medial and lateral malleoli .\nConsidering the ankle was stable, we decided to perform nonoperative management. The injury was treated with rest, ice, and elevation. Immobilization of the left lower leg was done with a short leg cast for 6 weeks. Six weeks later, the cast was removed. After that, gradual resumption of ankle range of motion, leg strengthening exercises, and regular activities began. The patient initially walked with hand support. Three months after the injury, the patient started to walk with full body weight. The patient presented free of pain, good ankle motion, and functional recovery during follow-ups at 6 weeks, 3 months, and 6 months after the injury. Plain radiographs showed successful recovery of the fracture at the proximal fibula . At the final follow-up, his American Orthopaedic Foot and Ankle Society ankle-hindfoot (AOFAS) score was 100 out of 100 total points, and he returned to his regular sport, badminton.", "summary": "A 48-year-old male reported pain in the lateral part of his left lower leg and ankle during a badminton play. Physical examination revealed tenderness and swelling of the lateral aspects of the left ankle, as well as the proximal aspect of the fibula. Preoperative plain x-ray image, computed tomography, and magnetic resonance imaging revealed an avulsion fracture of the anterior tibia by the anterior inferior tibiofibular ligament without medial and posterior fracture, rupture of the deltoid ligament, or interosseous membrane. Nonoperative management was performed and successful recovery was observed at a 6-month follow-up.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported pain in the lateral part of his left lower leg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported pain in the lateral part of his left ankle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pain occurred during badminton play.", "support_label": "supported", "is_refined": false }, { "subclaim": "Physical examination revealed tenderness of the lateral aspects of the left ankle.", "support_label": "supported", "is_refined": false }, { "subclaim": "Physical examination revealed swelling of the lateral aspects of the left ankle.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Physical examination revealed tenderness of the proximal aspect of the fibula.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative plain x-ray image showed an avulsion fracture of the anterior tibia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The avulsion fracture was caused by the anterior inferior tibiofibular ligament.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no medial fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no posterior fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no rupture of the deltoid ligament.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no rupture of the interosseous membrane.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nonoperative management was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Successful recovery was observed at a 6-month follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1374_en.txt", "fulltext": "An 87-year-old Asian woman in good general health presented with a progressively enlarging mass located in her left preauricular region. Fine needle aspiration (FNA) cytology analysis performed in the clinic suggested malignant cells of uncertain origin, but the tumors showed a rapid and consistent regression after FNA. During six months of observation, the tumor regrew and the patient was referred to our hospital.\nA physical examination revealed a 55-mm tumor located in the parotid with extension to the retroparotid area, and swelling of her left laterocervical lymph node. A computed tomography scan showed a peripheral enhanced mass in her right parotid gland. Magnetic resonance imaging revealed low signal intensity on T1-weighted images and iso-high signal intensity on T2-weighted images. The images showed the lesion to be clearly circumscribed, with homogeneous hypo-iso signal intensity on T1-weighted images and heterogeneous high signal intensity on T2-weighted images. The tumor demonstrated circumscribed and heterogeneous enhancement on gadolinium-enhanced T1-weighted images . Computed tomography scans of her thorax and abdomen did not reveal involvement of other sites.\nFNA was performed again and a cytological examination revealed a Papanicolaou classification of Class V, suggesting SmCC. A total parotidectomy and modified neck dissection were performed. On histopathology, the tumor showed diffuse growth with confluent necrosis in the salivary gland. The tumor cells had scant cytoplasm and hyperchromatic nuclei without prominent nucleoli. Mitotic figures were frequently observed . Neoplasmic elements reveal positivity for cluster of differentiation 56, neuron specific enolase, synaptophysin and a dotted staining pattern with cytokeratin 20 . Based on our histopathological findings, a diagnosis of a Merkel-cell-like SmCC of the parotid gland was made. Additional studies were positive for Maspin.\nOur patient\u2019s postoperative course was uneventful, and no postoperative radiotherapy was administered. The nine-year clinical follow-up, which is the longest follow-up of head and neck SmCC in our knowledge, revealed no locoregional recurrence or distant metastasis.", "summary": "We present a locoregional advanced parotid small cell carcinoma with multiple lymph node metastases in an 87-year-old Asian woman. The tumor was controlled by surgery alone, and nine-year disease-free survival was achieved without any adjunctive therapy. To the best of our knowledge, this is the longest reported follow-up of head and neck small cell carcinoma.", "subclaim_evaluations": [ { "subclaim": "The patient is an 87-year-old Asian woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has locoregional advanced parotid small cell carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has multiple lymph node metastases.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumor was controlled by surgery alone.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nine-year disease-free survival was achieved.", "support_label": "supported", "is_refined": false }, { "subclaim": "No adjunctive therapy was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "This is the longest reported follow-up of head and neck small cell carcinoma.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_2715_en.txt", "fulltext": "A 23-year-old woman was referred to our hospital because of recurrent abdominal pain for 7 years, amenorrhea and dyspareunia. The patient\u2019s mental state and movement ability was normal. She had a history of fracture of both legs and skin injury of pubic caruncle caused by trauma about 20 years ago.\nGynecological examination showed the patient had a single orifice on the urogenital region located where the urethra would be expected. There is a normally located anal perineal orifice. When forced urination, urine flowed out of the single orifice on the urogenital region. The urethral catheter was inserted about 70 mm through the single orifice, and no urine flowed out.\nPelvic CT scan showed a large calculus and a urethral catheter in the vagina . Pelvic MRI scan demonstrated the urethra and the vagina merged into a common channel about 3.45 cm long , and a large calculus about 7.8 cm \u00d7 6.8 cm \u00d7 7.7 cm in size lodging in the upper vagina, the uterus was moved upward ; a urethral catheter entered the vagina through the opening on the urogenital region; both ovaries and bladder were normal and no other congenital malformation was noted . Transabdominal sonography imaging revealed a vaginal stone, and normal two kidneys, the bladder, uterus, cervix, and adnexa.\nUnder general anesthesia, entering the urogenital tract through the median perineum approach and a 2-cm incision was performed . A hard grayish-yellow abnormal mass was observed in the vaginal cavity , and there was no adhesion to the surrounding mucosa. The tissue around the calculus was carefully separated and the calculus was completely removed.\nDuring the exploration after lithotomy, the common channel formed by vagina and urethra was detected, and the orifice of urethra was about 3 cm from the anterior vault of the vagina. The urethral catheter was inserted about 20 mm through the orifice of urethra, the urine flow was observed. Therefore, the estimated length of the urethra was about 2 cm. Hysteroscopic insertion of the vagina revealed thin endometrium and normal cervix, no other abnormality was found. The patient was diagnosed with a vaginal stone, urogenital sinus anomaly and thin endometrium.\nVaginal reconstruction (vaginoplasty) and urethra reconstruction (urethroplasty) were performed. The mucosa near the urethral orifice was taken and wrapped by 20 fr Foley\u2019s catheter, forming a urethra about 4 cm and neourethral meatus. The vaginal mucosa was pulled down and intermittently sutured with the perineal skin to form a vagina about 8 cm that could hold two fingers.\nAfter the operation, the patient received the treatment of estrogen and progesterone, and menarche appeared 20 days later. One month after the operation, the patient recovered well, and could urinate by himself. After 8 months of follow-up, the patient had normal menstruation and urination. The patient is married and ready to conceive.", "summary": "We present a case of a 23-year-old woman with urogenital sinus anomaly who presented with a vaginal calculus. The patient was not suspected of a calculus in the vagina until the patient suffered amenorrhea and dyspareunia. Pelvic computed tomography (CT) and magnetic resonance imaging (MRI) confirmed the patient had urogenital sinus anomaly with vaginal calculus. For the reason, the calculus was removed by surgery, and the reconstruction of vagina and urethra was performed. The postoperative recovery and follow-up were uneventful.", "subclaim_evaluations": [ { "subclaim": "The patient is a 23-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a urogenital sinus anomaly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with a vaginal calculus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had amenorrhea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had dyspareunia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pelvic CT was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pelvic MRI was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The imaging confirmed urogenital sinus anomaly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The imaging confirmed the presence of a vaginal calculus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The calculus was removed by surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Vaginal reconstruction was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Urethral reconstruction was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative recovery was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "The follow-up was uneventful.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_497_en.txt", "fulltext": "A 48-year-old woman was admitted to the emergency department with sudden onset severe chest tightness whilst doing yoga. This was associated with pins and needles in both arms, nausea, and abdominal discomfort. It lasted for 1 hour before it self-resolved and was not related to exertion. She reported being under increased emotional stress in the preceding month prior to presentation. She had no significant past medical history and was not on any regular medications.\nShe had a mother who died suddenly from an ascending aortic dissection in her 50s. Her mother was not hypertensive and suffered no symptoms or comorbidity suggestive of systemic illness.\nThe patient was hypotensive with a blood pressure of 90/60 mmHg and a heart rate of 80 bpm with no respiratory compromise or fever. Her troponin I (high-sensitivity assay) was 54 ng/dl, 79 ng/dl, and 27 ng/dl, respectively. Her electrocardiogram (ECG) showed sinus bradycardia with no ischaemic changes. A CT pulmonary angiogram was performed and excluded pulmonary embolus and showed no other cause for chest pain. An echocardiogram showed preserved biventricular function with no significant valvulopathy and normal ascending aorta dimensions. A coronary angiogram performed on day 2 of admission showed type 1 distal left anterior descending (LAD) coronary artery dissection with thrombolysis in antiplatelets and myocardial infarction (TIMI) 3 flow . She was initially managed with fondaparinux (factor Xa inhibitor) and dual antiplatelets with low-dose beta blocker long term once spontaneous coronary artery dissection (SCAD) was confirmed.", "summary": "This case report describes a 48-year-old woman suffering from SCAD who had a mother who died from ascending aortic dissection in her 50s.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has spontaneous coronary artery dissection (SCAD).", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's mother died from ascending aortic dissection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's mother died in her 50s.", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_1734_en.txt", "fulltext": "A 75-year-old man with a history of persisting abdominal pain and mild diarrhoea for three months was referred by a general practitioner to the hospital. During this period the patient observed a weight loss of 2 kg, but did not show any B symptoms. A colonoscopy was performed without pathological findings. A subsequent CT examination of the abdomen showed two separate fat-containing retroperitoneal masses one in the adrenal gland and the second lateral of the psoas muscle inferior to the right kidney, outside the peri-renal adipose tissue. The lesions were separate and had no connecting tissue in between them . To further confirm the obtained CT scan results an MR imaging was performed and showed again a fat-containing lesion in the adrenal gland and a 7 \u00d7 5 \u00d7 7 cm soft tissue-tumour inferior to the right kidney without invasion of the right kidney, urethra or renal vasculature. Both lesions appeared similar in the CT and MR imaging and were consistent with a well-differentiated liposarcoma . Aware of the fact that a liposarcoma of the adrenal gland is extremely rare, a primary benign and fat containing tumour derived from the adrenal gland itself, such as a lipoma or myelolipoma was considered. Regarding tumour markers, only increased levels of CA 19-9 were detected (81.86 U/ml reference < 37 U/ml, CEA 2.2 \u03bcg/l, reference < 5 \u03bcg/l). To exclude a neuroendocrinological pathology additional tests were performed but did not reveal any noticeable conspicuities.\nConsequently, we assumed a combination of a retroperitoneal liposarcoma and a primary benign, lipomatous tumour of the adrenal gland. Alternatively, the very rare case of the combination of a retroperitoneal liposarcoma and an adrenal liposarcoma was taken into consideration. Therefore, two therapeutic options were considered on these accounts. In the unlikely case of simultaneous liposarcomas an enbloc resection including both masses would be required after pre-treatment. But, in the probable situation of a benign lipomatous primary lesion of the adrenal gland in combination with a retroperitoneal liposarcoma an adrenalectomy with an additive biopsy of the infrarenal mass was decided as the strategy of choice in this individual case.\nConcerning this strategy a neoadjuvant radiotherapy followed by radical surgery, preventing the kidney, could have been performed as it has been approved as follows. To perform a neoadjuvant therapy a positive biopsy for sarcoma would be a compulsory prerequisite. Prognostic survival markers for retroperitoneal liposarcomas are the histologic subtype and margin of resection . Response rates to neoadjuvant chemotherapy alone are less than 10% . Preoperative radiation therapy or combined radio-chemotherapy with consecutive radical resection improves survival [,]. Concerning surgery complete resection of the lesion is to be achieved. Extended resection including contiguous organs without pre-treatment is associated with an increased risk without influence on disease specific survival and is therefore considered to be inappropriate .\nAccording to our described strategy, the patient received a laparotomy. As expected, the adrenal tumour appeared well-encapsulated in accordance with a benign lipomatous tumour. Following the above mentioned second option first an adrenalectomy was performed. The rapid section of the adrenal lesion revealed the result of a myelolipoma. Having in mind that both lesions presented morphologically identical in CT and MR imaging and the assessed intraoperatively analogousness of the masses, we resigned a biopsy of the infrarenal tumour and removed it in toto without the kidney. Once more the rapid section revealed a myelolipoma. The final histology described a 4 cm sized and in weight 46 g well-encapsulated myelolipoma of the adrenal gland. Further a 14 cm sized and in weight 250 g well-encapsulated retroperitoneal myelolipoma was determined, without capsule involvement. Both tumours were composed of predominantly mature adipose tissue with mature myeloid elements, allowing the diagnosis of an extra-adrenal and adrenal myelolipoma. Consequently no other treatment than surgery was indicated and has not been performed in this case.\nPostoperatively, the patient's recovery was uneventful and he was subsequently discharged.", "summary": "We report a very seldom case of a simultaneous myelolipoma of the adrenal gland in association with an extra-adrenal myelolipoma in an 75-year-old man. With a review of the literature we describe and discuss the aetiology, differential diagnosis and treatment of patients with respect to adrenal and extra-adrenal lesions.", "subclaim_evaluations": [ { "subclaim": "The case involves a 75-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a myelolipoma of the adrenal gland.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient also had an extra-adrenal myelolipoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The coexistence of adrenal and extra-adrenal myelolipomas is very seldom.", "support_label": "supported", "is_refined": false }, { "subclaim": "The report includes a review of the literature.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The report discusses the aetiology of adrenal and extra-adrenal myelolipomas.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The report addresses the differential diagnosis of adrenal and extra-adrenal myelolipomas.", "support_label": "supported", "is_refined": false }, { "subclaim": "The report discusses the treatment of adrenal and extra-adrenal myelolipomas.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1478_en.txt", "fulltext": "In April 2017, a 72-year-old homeless male patient was admitted to the emergency department at the Ramos Mejia Hospital, Ciudad Aut\u00f3noma de Buenos Aires, Argentina. The patient was in very poor hygienic condition, malnourished and dehydrated. He presented a deep necrotic ulcer in the anterior aspect of his left tibia of 9-months\u2019 evolution, with exposure of both tibia and fibula, complete loss of muscle mass, severe ischaemia, foul discharge and heavy burden myiasis. Unfortunately, maggots had been rapidly discarded, allowing neither bacterial analysis nor entomological identification.\nThe patient had a history of alcohol abuse and pulmonar tuberculosis in 1980 which resolved after complete treatment.\nOn physical examination, his blood pressure was 100/60 mmHg, his heart rate 97 and his respiratory rate 20 breaths min\u22121. His body temperature was 36 \u00b0C. Haematological and biochemical exams on admission showed: leucocytes 24750 K \u00b5l\u22121, with 92.5 % neutrophils; glucose level of 237 mg dl\u22121, haematocrit 40 %, haemoglobin 13.3 g dl\u22121, uraemia 126 mg dl\u22121, creatinine 2017 mg dl\u22121; sodium 127 mmol l\u22121; potassium 5.5 mmol l\u22121; chloride 87 mmol l\u22121.\nTwo blood culture sets were taken at the time of admission, at two different times. Gram-negative rods were obtained in pure culture. With this preliminary report, the case was described as sepsis caused by skin and soft tissue infection. Intravenous therapy with ciprofloxacin 400 mg/12 h and clindamicin 600 mg/12 h was initiated.\nConventional phenotypic test and MALDI-TOF-MS (Bruker Daltonics) failed to identify the bacteria isolated.\nIn order to confirm genus and species identification, PCR amplification of the 16S rRNA was performed. The nearly complete sequence of the 16S rRNA gene was amplified by PCR with the conserved primers 8F (5\u2032-AGAGTTTGATYMTGGCTCAG-3\u2032) and 1942R (5\u2032-ACCTTGTTACGACTT-3\u2032), as described previously . The sequence obtained showed a 100 % identity with the sequence corresponding to the 16S RNA ribosomal gene of I. indica, type strain FFA1 (GenBank accession number. EU008088.2). The 16S rRNA sequence obtained was deposited in GenBank under number MF062521.\nDue to the severity of the lesions, a supracondylar amputation had to be performed in order to allow for adequate and prompt infection source control, and antibiotic treatment for 14 days was completed, which led to resolution of sepsis and normalization of laboratory parameters. The patient had a favourable outcome, with no surgical complications.\nMembers of the genus Ignatzschineria are difficult to identify using traditional methods, including classical biochemical tests and commercial bacterial identification systems. Even MALDI-TOF MS analysis has been unsuccessful. 16S ARNr gene sequencing has proved to be useful for identification, and is currently the most accurate method for clinical diagnostic laboratories.", "summary": "We report the first case of sepsis associated with complicated skin and soft tissue infection caused by I. indica in Latin America.", "subclaim_evaluations": [ { "subclaim": "The case reported is the first in Latin America.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The infection was associated with sepsis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infection was a complicated skin and soft tissue infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The causative organism was I. indica.", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_2911_en.txt", "fulltext": "A 59-year-old white European man with a history of epilepsy, treated with valproic acid and carbamazepine, was admitted to our emergency department for a serious head injury after falling down the stairs at home. His family contacted our emergency department soon after the accident. An initial medical examination found a Glasgow Coma Scale (GCS) of 9/15 with no pupillary defect. His heart rate was 50 beats per minute. His blood pressure was 100/50 mmHg and his blood oxygen was 80 %.\nHe underwent orotracheal intubation and vascular filling. A clinical examination revealed a large scalp wound, which was responsible for a significant blood loss, which continued until his arrival at our hospital despite a compression bandage. He was transferred to our emergency neurosurgery unit.\nOn admission, he underwent a vascular filling (1.0 L of saline). A neurological examination found a GCS of 3/15 and his pupils were intermediate, symmetric, and reactive. The admission laboratory tests, summarized in Table , showed anemia, thrombocytopenia, hypoproteinemia and coagulation disorders.\nA brain scan without contrast (performed 2 hours after his head injury) showed an isodense, extracerebral, homogeneous SDH, 40 Hounsfield units (HU) approximately, with an estimated maximum thickness of 20 mm, situated along the right convexity . There was also a subarachnoid hemorrhage in the fold of the left convexity . The SDH had a mass effect with a 15 mm deviation of midline structures to the left and cerebral compression. In the bone window, the scan showed multiple fractures of the cranial vault in the layers above and below . This initial damage assessment revealed no other lesions. The patient became hypotensive. His blood pressure was 70/40 mmHg. He underwent hemodynamic support by continuous administration of norepinephrine (1 mg/hour) associated with 1.0 L of saline and 500 mL of Gelafundin (succinylated gelatin). Four units of packed red blood cells were administered with six units of fresh frozen plasma.\nHe was immediately transferred to our operating room. A burr hole was first drilled through his right parietal bone to assess the consistency of the hematoma and relieve the cerebral compression as quickly as possible. Correction of coagulation disorders was carried out at the same time by our anesthetists. Fresh blood mixed with clots flowed through the burr hole, thus confirming the acute nature of the hematoma.\nIn order to evacuate the hematoma, the incision was extended to carve a frontotemporoparietal flap giving access to the entire convexity and confirming the clotted appearance of the acute SDH. The flap was not put back in place when closing due to a life-threatening cerebral edema.\nHe was admitted to our neurosurgical intensive care unit. The evolution was marked by the appearance of intracranial hypertension, which was refractory to medical treatment and led to the appearance of clinical signs of encephalic death, which was confirmed 72 hours after admission to our intensive care unit.", "summary": "We report the case of a 59-year-old white European man who had a serious head injury with an acute subdural hematoma. The trauma was also responsible for blood loss and hemostasis disorders. A cerebral computed tomography scan revealed an isodense subdural hematoma. Our intervention confirmed that it was an acute hematoma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 59-year-old white European man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a serious head injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had an acute subdural hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The trauma caused blood loss.", "support_label": "supported", "is_refined": false }, { "subclaim": "The trauma caused hemostasis disorders.", "support_label": "supported", "is_refined": false }, { "subclaim": "A cerebral computed tomography scan was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The computed tomography scan showed an isodense subdural hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The subdural hematoma was confirmed to be acute.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3323_en.txt", "fulltext": "The case report was approved by the Ethics Committee of the General Hospital of Veroia (decision No. 11, 10/12/2017). The patient\u2019s family provided verbal informed consent. A 64-year-old man with a medical history of bipolar disorder and arterial hypertension was hospitalized for a delayed presentation ST-elevation myocardial infarction. He was admitted to our hospital 24 hours after symptom onset. Diagnostic coronary angiography revealed 95% stenosis at the distal third of the right coronary artery, and he underwent a primary percutaneous coronary intervention to the culprit lesion. Loading doses of aspirin and ticagrelor were given. During his hospitalization, he reported palpitations and shortness of breath. Clinical examination revealed normal heart sounds and a grade III systolic murmur at the cardiac apex. The patient\u2019s blood pressure was 100/65\u2009mmHg, pulse rate was 95\u2009bpm, and respiratory rate was 14 breaths/minute. He had functional class II heart failure according to the New York Heart Association. Electrocardiography showed a sinus rhythm with Q-wave formation in the inferior wall leads (II, III, aVF), T-wave inversion in the same leads, and borderline QT prolongation (QTc of 490\u2009ms). No ST elevation suggestive of left ventricular aneurysm formation was noticed. The P2Y12 inhibitor was switched from ticagrelor to prasugrel, and 24-hour ambulatory electrocardiography revealed frequent premature atrial and ventricular complexes. Transthoracic echocardiography showed a hypokinetic posteroinferior wall with a mildly reduced ejection fraction of 45% (Simpson\u2019s method), moderate mitral regurgitation (vena contracta, 0.6\u2009cm; proximal isovelocity surface area, 0.7\u2009cm; effective regurgitant orifice area, 34\u2009mm2), and mild pericardial effusion.\n\nFurosemide was added to lisinopril and metoprolol, but only mild to moderate improvement of the patient\u2019s symptoms was noticed before he deteriorated. Furthermore, up-titration of these medications was difficult because of the borderline arterial pressure. The addition of ivabradine and the switch from ticagrelor to prasugrel did not change his clinical status. Ticagrelor may cause transient dyspnea in some patients, which reverses with discontinuation.3\n\nForty days after the myocardial infarction, the patient was readmitted because of exertional dyspnea and worsening shortness of breath. New transthoracic echocardiography showed a dyskinetic cavity that was connected to the posteroinferior wall and communicated with the left ventricle, causing damage to the posterior mitral valve leaflet (P1 scallop) and resulting in severe mitral regurgitation. A color Doppler study confirmed passage of blood from the left ventricle into the cavity through an opening in the left ventricular wall. No thrombus formation was detected. The diagnosis of left ventricular pseudoaneurysm was made.\n\nUnfortunately, the patient died while waiting to transfer for surgical treatment.", "summary": "A 64-year-old man with a history of bipolar disorder and arterial hypertension was hospitalized for delayed presentation ST-elevation myocardial infarction. He was admitted to our hospital 24 hours after symptom onset. Diagnostic coronary angiography revealed 95% stenosis at the distal third of the right coronary artery, and he underwent a primary percutaneous coronary intervention to the culprit lesion. Despite administration of a diuretic and optimization of other pharmaceutical treatment, his heart failure deteriorated. Electrocardiography showed a sinus rhythm with Q-wave formation in the inferior wall leads (II, III, aVF), T-wave inversion in the same leads, and borderline QT prolongation (QTc of 490 ms). No ST elevation suggestive of left ventricular aneurysm formation was noticed. Forty days later, cardiac ultrasound revealed a dyskinetic cavity (pseudoaneurysm) in continuity with the posterior\u2013inferior wall of the myocardium, resulting in severe mitral valve regurgitation. Unfortunately, the patient died while awaiting surgical treatment.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has a history of bipolar disorder.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has a history of arterial hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was hospitalized for delayed presentation ST-elevation myocardial infarction.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was admitted 24 hours after symptom onset.", "support_label": "supported", "is_refined": false }, { "subclaim": "Diagnostic coronary angiography revealed 95% stenosis at the distal third of the right coronary artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "He underwent a primary percutaneous coronary intervention to the culprit lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Electrocardiography showed Q-wave formation in the inferior wall leads (II, III, aVF).", "support_label": "supported", "is_refined": false }, { "subclaim": "Electrocardiography showed T-wave inversion in the inferior wall leads.", "support_label": "supported", "is_refined": false }, { "subclaim": "The QTc was 490 ms.", "support_label": "supported", "is_refined": false }, { "subclaim": "No ST elevation suggestive of left ventricular aneurysm formation was noticed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Forty days later, cardiac ultrasound revealed a dyskinetic cavity in continuity with the posterior\u2013inferior wall of the myocardium.", "support_label": "supported", "is_refined": false }, { "subclaim": "The dyskinetic cavity was diagnosed as a pseudoaneurysm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pseudoaneurysm resulted in severe mitral valve regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died while awaiting surgical treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1332_en.txt", "fulltext": "Following a right radical orchidectomy and four cycles of chemotherapy for a metastatic non-seminomatous germ cell tumor of the testis, our patient, a 21-year-old man of Caucasian origin, underwent RPLND for a residual mass. The procedure was prolonged and in order to achieve complete surgical excision, a right radical nephrectomy and excision of the inferior vena cava from the iliac veins to the level of the left renal vein was necessary due to tumor infiltration and encasement.\nThree days postoperatively, the patient developed bilateral leg pain, lower limb oedema and abdominal distension secondary to abdominal ascites . This continued to worsen and on day nine postoperatively, he developed a paralytic ileus, pleural effusions and respiratory failure, and was transferred to the intensive care unit for elective intubation, ventilatory support and chest tube drainage of the pleural effusions .\nWith fears that our patient would develop intra-abdominal compartment syndrome and that the respiratory compromise would be worsened, a 12 Fr pigtail drainage catheter was inserted under ultrasound guidance on postoperative day 22 into the abdominal cavity, immediately producing 11 litres of chylous fluid. Shortly after a drain was inserted, the respiratory compromise improved and the patient was extubated. The drain continued to maintain an output of six liters per day for a further four days before settling to an average output of between two and three liters per 24 hours. Conservative management consisted of a parenteral diet of medium chain triglycerides, diuretic therapy and 20% albumin three times a day. Daily intraperitoneal infusion of 200 mls of the water-soluble contrast medium Conray 280 mg I/ml (Iothalamate meglumine) in order to promote peritoneal lymphatic fibrosis was attempted but produced no real improvement. Blockage of the intra-abdominal drain necessitated its replacement on two separate occasions.\nOn day 41, the patient was discharged to the ward where he maintained this improvement. Total parenteral nutrition was commenced to supplement poor oral intake. The patient had also developed bilateral foot drop on day 22 postoperatively. This was felt to be due to pedal oedema compressing each peroneal nerve at the head of fibula. It improved gradually with resolving peripheral oedema and physiotherapy. He was discharged to a peripheral hospital for further care on day 53, with an average output of 1.5 liters. Histologically, all the resected retroperitoneal tissue was free from residual tumor and contained only lymphoid tissue with large areas of necrosis.", "summary": "We describe a 21-year old man of Caucasian origin who had metastatic non-seminomatous germ cell tumor of the testis, and underwent retroperitoneal lymph node dissection, nephrectomy and partial inferior vena cava excision for a residual mass. The patient subsequently developed persistent lymphatic drainage causing foot drop that eventually responded to conservative medical and surgical measures.", "subclaim_evaluations": [ { "subclaim": "The patient is a 21-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is of Caucasian origin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had metastatic non-seminomatous germ cell tumor of the testis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent retroperitoneal lymph node dissection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent nephrectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent partial inferior vena cava excision.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgeries were performed for a residual mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed persistent lymphatic drainage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The persistent lymphatic drainage caused foot drop.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The foot drop eventually responded to conservative medical and surgical measures.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2304_en.txt", "fulltext": "A 7-year-old Japanese boy was referred to our hospital because of painless swelling of the bilateral inguinal lymph nodes which had gradually increased for 7 months. His past medical history included atopic dermatitis, and his family history included type 1 diabetes mellitus in his mother. Hematological examination showed the following abnormal values: soluble interleukin-2 receptor, 2,599 U/mL; and immunoglobulin E, 568 IU/mL. A biopsy of a left inguinal lymph node lead to the diagnosis of Hodgkin lymphoma (nodular lymphocyte predominant type). Fluoro-18 fluorodeoxyglucose-positron emission tomography (F-18 FDG PET)/computed tomography (CT) showed a high accumulation (maximum standardized uptake value, SUVmax) at 17.02 in the left common iliac lymph node, left external and internal iliac nodes, and left inguinal lymph node. On the basis of the F-18 FDG PET/CT results and B symptoms, such as weight loss and night sweats, the final staging was determined to be IIB. The patient underwent chemotherapy according to the protocol of the EuroNet-PHL-C1 protocol with 2 cycles of the OEPA regimen (vincristine, etoposide, prednisone, and doxorubicin) and 2 cycles of the COPDAC regimen (cyclophosphamide, vincristine, prednisone, and dacarbazine). Chemotherapy was to be followed by radiotherapy at a dose of 19.8 Gy (11 fractions of 1.8 Gy per day) focused on residual lymph node lesions.\nTwo days after the end of the first cycle of the COPDAC regimen, the patient complained of headache and of blurred and decreased vision in both eyes. The first ophthalmologic examination showed a corrected visual acuity of 20/32 in the right eye and 20/40 in the left eye. Intraocular pressure could not be measured in the right eye and was 15 mmHg in the left eye. The anterior chamber depth was normal, with no evidence of inflammatory cells in the anterior chamber. Posterior ocular findings showed swelling of the optic nerve papillae in both eyes and serous retinal detachment. . Optical coherence tomography (OCT; Carl Zeiss Meditec AG) showed significant serous retinal detachment in the macular area and significant swelling of the optic nerve papillae in both eyes. Fluorescein angiography of the fundus showed fluorescent leakage from the optic nerve papilla in the early phase and petechial fluorescent leakage in both eyes . Indocyanine green angiography showed hypofluorescent dark dots in both eyes in the early phase . Ruled out as causes of a possible infectious uveitis via immunological examination were hepatitis B, hepatitis C, syphilis, and human T lymphotropic virus type 1, and ruled out via DNA analysis were herpes simplex virus, varicella-zoster virus, and cytomegalovirus. Cerebrospinal fluid examination revealed an increased cell count. Moreover, human leukocyte antigen (HLA)-DR4 was positive. Because the patient fulfilled items 1 to 4 of the revised diagnostic criteria proposed by the International Workshop on VKH , incomplete-type VKH disease was diagnosed.\nTo treat the VKH disease, the patient received steroid treatment with intravenous prednisolone 60 mg/m2/day for 7 days. After improvements in visual acuity and serous retinal detachment were confirmed, 1 cycle of the COPDAC regimen with the dosage increasing from 40 mg/m2/day to 60 mg/m2/day was started. Prednisolone (60 mg/m2/day) was administered for a total of 20 days. Thereafter, the administration of prednisolone was changed from intravenous to oral, after which the dose was gradually tapered. The minimum visual acuity before treatment was 20/400 in the right eye and 20/63 in the left eye. After 22 days of treatment with prednisolone, the visual acuity had improved to 20/20 in the right eye and 20/25 in the left eye, and the intra-anterior chamber inflammation and serous retinal detachment in the macula had disappeared. The steroid treatment was changed to hydrocortisone on day 65 after starting prednisolone. However, anterior chamber inflammation appeared on day 82 of steroid treatment, so the steroid treatment was changed to the dosage increased oral prednisolone again and dexamethasone eye drops were started. Subsequently, the flare-up of inflammation disappeared, and oral prednisolone and dexamethasone eye drops were discontinued.\nThe findings of OCT changed over the course of treatment . Serous retinal detachment was marked before treatment , but had disappeared after 21 days of steroid treatment . On day 43 of steroid treatment, visual acuity had improved, but irregular retinal pigment epithelial cells were observed . On day 82, when the intracameral inflammation flared up, the irregularity of retinal pigment epithelial cells worsened and continued .\nOne year after the diagnosis of Hodgkin lymphoma and 9 months after the diagnosis of VKH disease, multiple vitiligo appeared in the patient\u2019s abdomen, and complete VKH disease was finally diagnosed. However, a sunset glow fundus was seen, but Sugiura sign was not. The patient has been doing well and has improved visual function, without evidence of recurrent Hodgkin lymphoma and VKH disease for 10 months after treatment with prednisolone had discontinued.", "summary": "The patient was a 7-year-old boy with stage IIB Hodgkin lymphoma (nodular lymphocyte predominant type) who was undergoing chemotherapy, including 2 cycles of the OEPA regimen and 1 cycle of the COPDAC regimen. Two days after the end of the COPDAC regimen, the patient complained of headache and of blurred and decreased vision in both eyes. On the basis of optic symptoms, such as uveitis and serous retinal detachment in both eyes, increased cell counts in cerebrospinal fluid, and positivity for human leukocyte antigen (HLA)-DR4 in peripheral blood cells, incomplete VKH disease was diagnosed. Intravenous treatment with high-dose prednisolone (60mg/m2/day) for 7 days improved both visual acuity and serous retinal detachment and enabled the remains of the COPDAC chemotherapy cycle to be administered. With prednisolone treatment, visual acuity improved from 20/500 to 20/20 in the right eye and from 20/63 to 20/25 in the left eye. Because multiple vitiligo lesions later appeared in the abdomen, complete VKH disease was finally diagnosed.", "subclaim_evaluations": [ { "subclaim": "The patient was a 7-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had stage IIB Hodgkin lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Hodgkin lymphoma was nodular lymphocyte predominant type.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was undergoing chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received 2 cycles of the OEPA regimen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received 1 cycle of the COPDAC regimen.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two days after the end of the COPDAC regimen, the patient complained of headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two days after the end of the COPDAC regimen, the patient reported blurred vision in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two days after the end of the COPDAC regimen, the patient reported decreased vision in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had uveitis in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had serous retinal detachment in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cerebrospinal fluid had increased cell counts.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had positivity for HLA-DR4 in peripheral blood cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "Incomplete VKH disease was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received intravenous high-dose prednisolone (60mg/m2/day) for 7 days.", "support_label": "supported", "is_refined": false }, { "subclaim": "Visual acuity improved after prednisolone treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serous retinal detachment improved after prednisolone treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient completed the remaining COPDAC chemotherapy cycle.", "support_label": "supported", "is_refined": false }, { "subclaim": "Visual acuity in the right eye improved from 20/500 to 20/20.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Visual acuity in the left eye improved from 20/63 to 20/25.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multiple vitiligo lesions later appeared in the abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "Complete VKH disease was finally diagnosed.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1287_en.txt", "fulltext": "A 4-year-old boy (height, 100 cm; weight, 16 kg) was hit in the chest by a car. He was conscious and complained of chest tightness. Upon arrival to the local hospital at 18 min after the injury, he was semiconscious and cyanotic. Breath sounds were not heard in the right hemithorax, and his vital signs were unstable: heart rate( HR) of 162 beats per minute (bpm), blood pressure (Bp) of 102/56 mmHg, respiratory rate (RR) of 32 times per minute, and oxygen saturation (SPO2) of 70%. For sedation, 30 mg of propofol was administered intravenously, and emergency endotracheal tube above the carina was performed. Chest computed tomography (CT) showed right pneumothorax with lung compression of 90%, and the left clavicle was fractured . A chest tube was positioned in the right thoracic cavity, and a breathing balloon was used for ventilation. His vital signs were as follows: HR of 155 bpm, Bp of 97/50 mmHg, RR of 22 times per minute, and SPO2 of 98%. Twenty-four minutes later, he was admitted to the Emergency Department of our hospital for further treatment. The results of blood gas analysis were as follows: pH, 7.12; carbon dioxide partial pressure (PaCO2), 76 mmHg; oxygen partial pressure (PaO2), 68 mmHg. Bronchoscopy indicated that the right middle lobe bronchus was ruptured. Transthoracic echocardiography ruled out associated blunt cardiac injury. Emergency exploratory thoracotomy and right middle or right middle and lower lobectomy were planned. The patient went into sudden cardiac arrest after being sent to the operating room (SPO2, 76%; end-tidal carbon dioxide partial pressure (PetCO2), 46 mmHg). Return of spontaneous circulation after twelve minutes of external chest compression. He did not regain consciousness. Mainstem intubation of the left bronchus was performed under direct fibreoptic guidance to ventilate the left lung. With pressure control ventilation, the fraction of inspiration O2 was 100%, peak pressure was 32 cmH2O, and tidal volume was 45 mL; HR was 145 bpm, Bp was 92/48 mmHg (0.05 \u00b5g/kg/min norepinephrine), RR was 20 times per minute, and SPO2 was 70%. Blood gas analysis results at this time were as follows: pH, 6.87; PaCO2, 114 mmHg; PaO2, 46 mmHg; plasma lactic acid (Lac), 6.7 mmol/L; K + , 3.2 mmol/L; haemoglobin 7.3 g/dl; and Ca + + 1.21 mmol/L. As sudden cardiac arrest occurred due to severe respiratory acidosis, we decided to initiate V-V ECMO. Our hospital has an adult ECMO centre, and it is 300 km away from our nearest paediatric ECMO centre, approximately a 3.5-h drive. To prevent death, we decided to use small adult ECMO tubes. ECMO was initiated percutaneously in the left femoral vein, and an incision was made in the right internal jugular vein (MAQUET 2050, Cardiopulmonary GmbH BE-PLS, Germany; left femoral vein: 15 Fr/5 mm single-stage drainage cannula, MAQUET, Germany; right internal jugular vein: 14 Fr/ZX 4.7 return cannula, Changzhou Kangxin Medical Equipment Co., Ltd., China). The blood flow was 1.7 L/min, sweep gas was 1.5 L/min, and FiO2 was 100%. Cardiac arrest occurred again after ECMO, and we immediately administered cardiopulmonary resuscitation. Blood gas analysis results at this time were as follows: pH, 6.84; PaCO2, 72 mmHg; PaO2, 61 mmHg; Lac, 9.7 mmol/L; K + , 9.8 mmol/L; haemoglobin 7.3 g/dl; and Ca + + 1.21 mmol/L. Insulin (2 U) were added to the glucose injection (10%, 100 ml), and sodium bicarbonate (5%, 32 ml) and calcium chloride injection (3%, 0.1 g) were administered immediately. Spontaneous sinus rhythm was restored after 18 min. An exploratory thoracotomy was performed successfully; the root of the right middle lobe bronchus was found to be ruptured , as was a branch of the right middle lobe artery. Right middle lobectomy and right middle bronchoplasty were performed. The patient was admitted to the intensive care unit (ICU) after the operation. Mechanical ventilation and ECMO were continued, and we adjusted the ventilator parameters as follows: FiO2 at 30%; positive end expiratory pressure (PEEP) at 10 cmH2O; respiratory rate at 12 times/minute, and tidal volume at 6 mL/kg. Oxygen saturation was between 98 and 100%. Along with mild hypothermia for brain protection (34-36 \u00b0C for 30 h), piperacillin sodium and tazobactam injection for the prevention of infection, methylprednisolone injection (16 mg q12 h) to reduce pulmonary exudation, and norepinephrine 0.15 \u00b5g/kg/min to maintain blood pressure were applied. On postoperative day 2, he became conscious and was responsive. Due to the traumatic wet lung on the left and secondary pulmonary infection, ECMO was withdrawn on the 6th day after the operation, with a total ECMO time of 137 h. Mechanical ventilation was withdrawn on postoperative day 11. On postoperative day 12, chest CT showed a mass of a high-density shadow in the upper lobe of the left lung with cavitation, which was considered a large traumatic pseudocyst . The patient left the ICU on postoperative day 16 and was discharged from the hospital on postoperative day 31 without neurological deficit. He is able to communicate and play normally. The timeline of the treatment process is shown in Fig. .", "summary": "A 4-year-old boy with bronchial rupture and traumatic wet lung complicated by cardiac arrest after chest trauma was admitted to an adult ECMO centre. He experienced two cardiac arrests, one before and one during the operation. The total duration of cardiac arrest was 30\u00a0min. V-V ECMO was initiated because of severe hypoxia and hypercapnia during the operation. ECMO was performed for 6\u00a0days, and mechanical ventilation lasted 11\u00a0days. On the 31st day after surgery, he had recovered completely and was discharged without neurological deficit.", "subclaim_evaluations": [ { "subclaim": "The patient is a 4-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had bronchial rupture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had traumatic wet lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cardiac arrest after chest trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to an adult ECMO centre.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient experienced two cardiac arrests.", "support_label": "supported", "is_refined": false }, { "subclaim": "One cardiac arrest occurred before the operation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "One cardiac arrest occurred during the operation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The total duration of cardiac arrest was 30 minutes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "V-V ECMO was initiated because of severe hypoxia.", "support_label": "supported", "is_refined": false }, { "subclaim": "V-V ECMO was initiated because of hypercapnia.", "support_label": "supported", "is_refined": false }, { "subclaim": "ECMO was performed for 6 days.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Mechanical ventilation lasted 11 days.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged on the 31st day after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had recovered completely.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no neurological deficit at discharge.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_162_en.txt", "fulltext": "A 78-year-old woman with an unremarkable past medical history presented to the clinic with symptoms of progressively worsening myelopathy including gait dysfunction and impairment of upper extremity fine motor skills. Noncontrast MRI of the cervical spine demonstrated multilevel degenerative disease and a dorsal intradural extramedullary lesion extending from C3-C6.\nThe patient underwent an elective posterior C3-7 decompression, C3-T1 instrumented fusion, and resection of intradural tumor. Final pathology was psammomatous meningioma. The patient tolerated the procedure well and postoperatively was transferred to the neurological ICU for close monitoring.\nThe patient was initially discharged from the hospital to an inpatient rehabilitation facility on POD 6. At the time of discharge, she was awake, oriented, and followed commands in all extremities with some mild weakness in the right deltoid and biceps, graded 4/5; the remaining muscle groups were 5/5. On POD 10, the patient developed progressive lethargy and was readmitted to the hospital for further evaluation. Upon readmission, she opened her eyes to verbal command, had incomprehensible speech, and would move all extremities spontaneously with strength 3/5 but did not follow commands. She was afebrile with WBC = 6.9 and no metabolic abnormalities. Given her recent intradural surgery, a lumbar puncture was performed. CSF cytology demonstrated 397 WBC, 20 RBC, 291 protein, and 40 glucose. CSF PCR was positive for HSV 1. Interestingly, intracranial imaging did not demonstrate the typical findings associated with herpes encephalitis . She was initially placed on broad spectrum antibiotics in addition to antiviral therapy. She was also connected to continuous EEG monitoring, found to be in status epilepticus, and required escalating therapy to the point of intubation with midazolam infusion. Seizure control was ultimately achieved, and she was maintained on levetiracetam 1500 mg q12H for 30 days and lacosamide 200 mg q12H for 7 days. The remainder of her infectious work-up was unremarkable, allowing her to be narrowed to only a 21-day course of IV acyclovir 500 mg q12H. Due to acute respiratory failure from encephalopathy, she underwent tracheostomy and PEG placement (POD 29); she underwent repeat MRI approximately 2 weeks after HSV diagnosis which still lacked typical findings of HSV . However, she continued to improve clinically; at the time of discharge, she would open her eyes spontaneously and followed simple commands in all extremities. Approximately 3 months out from being diagnosed with HSV encephalitis, she was oriented twice and followed commands in all 4 extremities with 5/5 strength in the bilateral upper and 3/5 in the bilateral lower extremities.\nAt a three-month follow-up, the patient presented no new symptoms. The PEG was still in place and EEG revealed excessive theta waves during wakefulness and bilateral midtemporal delta slowing (left more prevalent than right). Though the patient had dysarthria and poor attention/processing, she followed commands in all 4 extremities consistent with her last evaluation. Vimpat 200 BID and 1500 mg of Keppra were prescribed for ongoing clonus spasticity. All other medications were continued as prescribed. In the following month, the patient had a normal LOC, very slight dysarthria, and improved situational awareness. No recent seizures had occurred. Lacosamide was reduced to 150 mg every 12 hours and Vimpat was reduced to 150 BID. Upon final examination, she followed commands in all 4 extremities with 5/5 strength in the bilateral upper and 4-/5 in the bilateral lower extremities.", "summary": "We report a case of a 78-year-old woman with no known prior history of HSVE and declining mental status eleven days after a posterior C3-T1 decompression and instrumented fusion following resection of an intradural extramedullary tumor, confirmed to be meningioma on final pathology. Reactivation of HSV-1 encephalitis was suspected to be the underlying cause of her symptoms, though MRI scans of the brain for HSVE were negative. The patient reacted positively to a 21-day treatment of acyclovir and was discharged with a neurological status comparable to her preoperative baseline. This case contributes to the literature in that it is the first reported instance of HSVE reactivation after intradural cervical spinal surgery with negative MRI findings.", "subclaim_evaluations": [ { "subclaim": "The patient was a 78-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had no known prior history of HSV encephalitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had declining mental status eleven days after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery was a posterior C3-T1 decompression and instrumented fusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery followed resection of an intradural extramedullary tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was confirmed to be meningioma on final pathology.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reactivation of HSV-1 encephalitis was suspected as the underlying cause of her symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI scans of the brain for HSV encephalitis were negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received a 21-day treatment of acyclovir.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged with a neurological status comparable to her preoperative baseline.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "This case is the first reported instance of HSV encephalitis reactivation after intradural cervical spinal surgery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The case had negative MRI findings.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_96_en.txt", "fulltext": "A 64-year-old male initially presented with painless hematuria in September 2017 and was treated by a partial cystectomy as stage I BC. The patient showed local recurrence in August 2018 and underwent transurethral resection of bladder tumor (TURBT) followed by regular intravesical chemotherapy with epirubicin after TURBT. In March 2020, the patient approached to our hospital complaining about severe anorexia and fatigue. Subsequent FDG-PET/CT scan showed bladder recurrence with local invasion of the adjacent right lower ureter, resulting in the upper urinary tract dilation. Multiple lymph node metastasis, liver metastasis and lumbar metastasis (L5) were also identified . Ureteral stent placement was performed due to obstructive renal insufficiency and hepatic biopsy confirmed metastatic high-grade urothelial carcinoma with positive PD-L1 expression on 1% of the tumor cells. Then, next-generation sequencing (NGS) by a commercial laboratory (Genecast Biotechnology Co., Ltd, Jiangsu, China) identified ERBB2 p.V842I in both circulating tumor DNA (ctDNA) and biopsy sample with an allele frequency of 3.94% and 26.07%, respectively .\nThe patient received one cycle of palliative reduced-dose albumin-bound paclitaxel due to elevated serum creatinine level (Scr 204\u03bcmol/L). The tumor biomarker CA199 was even higher after first cycle chemotherapy without any relief of his symptoms. Based on his NGS result, pyrotinib (400mg orally daily) was started from April 10, 2020. Within one month, his tumor markers dramatically improved with remission of clinical symptoms . Due to renal dysfunction, the patient performed FDG-PET/CT scan for treatment efficacy assessment, which showed significantly decreased FDG uptake of multiple metastatic sites in May 2020 . Even though the overall response was considered stable based on the RECIST 1.1 criteria, the decrease in FDG uptake and remission of clinical symptoms indicated the patient responded well to the HER2 targeting therapy. However, he developed G3 diarrhea and terminated the medication on May 20, 2020 (The pyrotinib treatment lasted for 40 days). The third-line treatment with the PD-1 inhibitor tislelizumab (200mg every three weeks) was next started but the disease progressed after 2 months . ctDNA was collected in August 2020 and ERBB2 p.V842I with an allele frequency of 2.06% was identified by NGS. Ureteral stent removal was performed with improved renal function. Four cycles of PD-L1 inhibitor durvalumab, oxaliplatin and gemcitabine were administered, but level of CA199 gradually increased. NGS was performed again showing the same ERBB2 mutation with an allele frequency of 1.58%. Reduced dose of pyrotinib (240mg orally daily) was added, the patient\u2019s tumor again responded with significant improvement of CA199 within 20 days. Dynamic monitoring of the ctDNA again confirmed ERBB2 p.V842I by NGS with a lower allele frequency of 0.41% . The regimen was generally tolerated this time but the tumor marker gradually increased in this patient. PET/CT evaluation revealed disease progression in March 2021, and the treatment was then discontinued . The length of time for reduced pyrotinib therapy was 4.5 months. The patient passed away on July 1st, 2021, and the post-recurrence survival was 16 months.", "summary": "We described a patient with metastatic bladder urothelial carcinoma (BUC) carrying a HER2 V842I mutation both in circulating tumor DNA (ctDNA) and biopsy sample. The patient was then treated with a HER2 tyrosine kinase inhibitor, pyrotinib, and responded well. However, the targeting treatment was terminated due to G3 diarrhea. Reduced dose of pyrotinib was later added to late-line treatment, the patient's tumor again responded with a significant decrease in CA199.", "subclaim_evaluations": [ { "subclaim": "The patient had metastatic bladder urothelial carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a HER2 V842I mutation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The HER2 V842I mutation was detected in circulating tumor DNA.", "support_label": "supported", "is_refined": false }, { "subclaim": "The HER2 V842I mutation was detected in a biopsy sample.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with pyrotinib.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient responded well to pyrotinib.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was terminated due to grade 3 diarrhea.", "support_label": "supported", "is_refined": false }, { "subclaim": "A reduced dose of pyrotinib was added to late-line treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's tumor responded to the reduced dose of pyrotinib.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a significant decrease in CA199.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3143_en.txt", "fulltext": "We report the case of an 11-year-old girl who had been presenting a severe asthenia for a month, orthostatic dizziness, headaches and abdominal pain. Patient familial history was remarkable due to the total absence of the pericardium associated with hypo-gammaglobulinemia and bronchiectasis in her 9-year-old sister [5]. Patient personal history was uneventful.\n\nA previous recent laboratory examination had revealed moderate inflammation (leucocyte count: 13,440/mm; CRP: 30 mg/L) but increased sedimentation rate (68 mm/h), and slightly increased fasting glycemia (106 mg/dL) with a normal insulin concentration. Urine analysis showed bacteriuria. On that basis, she received a treatment with sulfamethoxazol.\n\nPatient status did not improve, and thus, she was referred to our institution for endocrinological and cardiological advice. A physical examination confirmed recent weight loss (2.5 kg in 10 days), systemic arterial hypertension (147/104 mm Hg) in an upright position dropping in a supine position (80/60 mm Hg), a normal heart rate and normal transcutaneous oxygen saturation.\n\nThe patient was pale with wet and cold extremities. Precordium was hyperactive, and cardiac and pulmonary auscultation was normal as was abdominal palpation.\n\nAn electrocardiogram showed left ventricular hypertrophy according to Davignon\u2019s criteria with non-specific repolarization anomalies and a prolonged QT interval corrected by the Bazzett\u2019s formula (QTc: 470 ms).\n\nEchocardiography demonstrated global left ventricular hypertrophy with a dilated aortic root (Z-score calculated according to: 2.5) and grade I aortic insufficiency.\n\nAbdominal ultrasound showed the presence of a right-sided adrenal mass.\n\nThe left-sided adrenal gland and all other intra-abdominal organs were normal.\n\nAn oral glucose tolerance test showed moderate hyperglycemia associated with hyperinsulinemia. Cortisol- and thyroid hormone serum levels were normal. Noradrenaline and normetanephrine urine concentrations were strongly increased (>711 \u03bcg/24H and >9000 \u03bcg/24H, respectively). The right-sided adrenal mass was confirmed via magnetic resonance imaging, and iodine-123-metaiodobenzylguathdine ([123I]-mIBG) scintigraphy confirmed isolated tracer fixation on the right adrenal gland.\n\nThe patient was scheduled for surgery and stabilized until then using a combination of a \u03b2-blocker and calcium channel antagonist, allowing for blood pressure control. She underwent total adrenalectomy via laparoscopy. Anatomo-pathology confirmed the diagnosis of a typical pheochromocytoma without any signs of malignancy.\n\nMicroscopic analysis showed a nest-shaped tumor architecture with large polygonal cells. The central part of the tumor presented some ischemic necrotic areas and vascular structures with recent thrombosis but no signs of vascular invasion. There was no mitotic activity.\n\nImmune-histological examination proved a high degree of positivity for the neural cell adhesion molecule CD56 and for the markers of neuroendocrine tumors chromogranine and synatophysine. The level of cell proliferation was estimated to be lower than 1%.\n\nA genetic evaluation was carried out. DNA sequence analysis allowed for the exclusion of pathogenic gene mutations implicated in hereditary paragangliomas and pheochromocytoma (SDHA, SDHB, SDHC, SDHD, SDHAF2, TMEM 127, MAX, VHL, FH, MDH2 and exons 10, 11, 13, 14 and 16 of the RET gene) but demonstrated a somatic mutation c.57C>T in exon 3 of the tumor suppressor gene von Hippel-Lindau.\n\nCardiac examination, including echocardiography performed 2 weeks after right-sided adrenalectomy, showed residual left ventricular hypertrophy but normalization of the aortic root dimension (Z-score: 0.7) and QTc duration.\n\nTwo years after the operation, the patient complained about dizziness, palpitations and chest pain. The clinical examination, including blood pressure, was normal. Concentrations of blood and urine catecholamines were in the normal range. Abdominal MRI showed a normal left-sided adrenal gland an empty right-sided adrenal lodge. Endocrinological and cardiological examinations, including echocardiography and abdominal MRI, were repeated and remain normal after a follow-up period of 5 years.", "summary": "We report the case of an 11-year-old girl who complained about severe asthenia, orthostatic dizziness and abdominal pain for 4 weeks. The primary investigation concluded on febrile urinary tract infection treated by antibiotics. Symptom persistence prompted cardiological and endocrinological investigations. A fluctuation in blood pressure, long QT interval, dilation of the aortic root and left ventricular hypertrophy were documented. Elevated levels of urinary catecholamines together with the presence of a right-sided adrenal mass shown via abdominal ultrasound and magnetic resonance imaging were highly suggestive of a pheochromocytoma. This was confirmed by through iodine-123-metaiodobenzylguathdine ([123I]-mIBG) scintigraphy. Genetic analysis allowed for the exclusion of pathogenic mutations in genes implicated in hereditary paragangliomas and pheochromocytomas but showed a rare somatic mutation in exon 3 of the von Hippel-Lindau gene. The patient was treated with a \u03b2-blocker and calcium channel antagonist and underwent laparoscopic right-sided adrenalectomy. Cardiac manifestations resolved soon after surgery indicating that they were secondary to the pheochromocytoma. After 5 years of follow-up, the patient remains asymptomatic without any sign of tumor recurrence.", "subclaim_evaluations": [ { "subclaim": "The patient was an 11-year-old girl.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had symptoms of severe asthenia, orthostatic dizziness, and abdominal pain for 4 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The primary investigation concluded on febrile urinary tract infection.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The febrile urinary tract infection was treated by antibiotics.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Symptoms persisted after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Cardiological and endocrinological investigations were performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A fluctuation in blood pressure was documented.", "support_label": "supported", "is_refined": false }, { "subclaim": "A long QT interval was documented.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dilation of the aortic root was documented.", "support_label": "supported", "is_refined": false }, { "subclaim": "Left ventricular hypertrophy was documented.", "support_label": "supported", "is_refined": false }, { "subclaim": "Elevated levels of urinary catecholamines were found.", "support_label": "supported", "is_refined": false }, { "subclaim": "A right-sided adrenal mass was shown via abdominal ultrasound.", "support_label": "supported", "is_refined": false }, { "subclaim": "A right-sided adrenal mass was shown via magnetic resonance imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings were highly suggestive of pheochromocytoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pheochromocytoma was confirmed by iodine-123-metaiodobenzylguanidine ([123I]-mIBG) scintigraphy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Genetic analysis excluded pathogenic mutations in genes implicated in hereditary paragangliomas and pheochromocytomas.", "support_label": "supported", "is_refined": false }, { "subclaim": "A rare somatic mutation in exon 3 of the von Hippel-Lindau gene was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with a \u03b2-blocker.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with a calcium channel antagonist.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent laparoscopic right-sided adrenalectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac manifestations resolved soon after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cardiac manifestations were considered secondary to the pheochromocytoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 5 years of follow-up, the patient remained asymptomatic.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no sign of tumor recurrence after 5 years of follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3041_en.txt", "fulltext": "A 68-year-old man presented to the emergency department with progressive dyspnea and lower-limb edema leading to anasarca associated with neuropathic pain. The patient had no significant past medical history but reported undergoing outpatient evaluation in which a transthoracic echocardiogram (TTE) revealed reduced left ventricular ejection fraction (LVEF) and a pattern of left ventricular hypertrophy. His vital signs were within the normal limits but jugular engorgement, ascites, and lower limb edema up to the point of anasarca were observed. Physical examination notably revealed a rupture of the right biceps brachii tendon. Laboratory tests showed a hemoglobin level of 13.8 g/dL, creatinine 1.42 mg/ dL, blood urea nitrogen of 18 mg/dL, and N-terminal pro B-type natriuretic peptide (NT-proBNP) of 7461 pg/mL.\n\nChest X-ray reported cardiomegaly with aortic elongation. An electrocardiogram revealed sinus rhythm, right-axis deviation, low QRS voltage, first-degree atrioventricular block, pseudo-infarct pattern in precordial leads V1\u2013V3, poor R progression, and alterations in high lateral repolarization.\n\nThe TTE indicated a non-dilated left ventricle with concentric hypertrophy as well as severely thickened walls with a speckled appearance, LVEF of 30%, and severely reduced longitudinal strain (\u22126.2%), demonstrating higher strain in apical segments than basal segments in a relative apical sparing. The left ventricular posterior wall measured 21.3 mm, interatrial septum thickness was 5.35 mm, and there was severe dilation of the left atrium, dilated right ventricle with decreased global contractility, moderate mitral regurgitation, and a small pericardial effusion. A coronary angiogram was done to rule out ischemic cardiomyopathy.\n\nCardiac magnetic resonance imaging (CMRI) revealed severe symmetric hypertrophy, significant dilation of the left atrium, marked thickening with involvement of papillary muscles, diffuse thickening of both ventricles, severe biventricular systolic dysfunction with an LVEF of 32% and right ventricular ejection fraction of 26%. A native T1 value of 1225 ms (normal value is less than 1000 ms) was obtained at the septum on mid-cavity short-axis map. Post-gadolinium enhancement displayed marked hypointensity of the blood pool, patchy up-take involving the entire myocardium, subendocardium, and epicardium, and the zebra sign. T1 mapping post-gadolinium revealed a severely increased extracellular volume of 72% (normal less than 30%), consistent with cardiac amyloidosis. Pyrophosphate scintigraphy indicated Perugini grade 3.\n\nHematologic tests were conducted to rule out light-chain amyloidosis, which is revealed by free Lambda light chains of 32.6 mg/L and Kappa light chains of 95.7 mg/L (with a ratio of 2.9). Serum and urine immunofixation found that these light chains were undetectable, protein electrophoresis showed no monoclonal peaks, and bone marrow flow cytometry indicated no plasma cell neoplasia. A subcutaneous adipose tissue biopsy was negative by Congo red staining for amyloid. A myocardial biopsy revealed myocytes with broad cytoplasm surrounded by clear pinkish amorphous material, which was focal positive for Congo red staining, showing as apple green in color. A genetic study was conducted, reporting a variant c.424G>A (p.Val142Ile) in heterozygosity in the exon of the TTR gene, confirming the presence of TTRv amyloidosis.", "summary": "A 68-year-old man presented with heart failure symptoms, biceps tendon rupture, neuropathic pain in the extremities, and an electrocardiogram showing low QRS voltage and a pseudo-infarct pattern. Transthoracic echo-cardiogram revealed a left ventricular ejection fraction of 30%, severely thickened walls with a speckled appearance, a global longitudinal strain of \u22126.2% in a bull\u2019s eye pattern, and a left ventricular posterior wall thickness of 21.3 mm. Cardiac magnetic resonance imaging showed severe symmetric hypertrophy, moderate global dys-function, and an elevated native T1 value of 1225 milliseconds. Post-gadolinium T1 mapping revealed a significantly increased extracellular volume of 72%. Perugini grade 3 pyrophosphate scintigraphy, negative hemato-logical tests, and endomyocardial biopsy confirmed the diagnosis of amyloidosis, without monoclonal spikes. Genetic testing identified a heterozygous c.424G>A (p.Val142Ile) variant in the transthyretin gene, consistent with variant transthyretin amyloidosis.", "subclaim_evaluations": [ { "subclaim": "The patient is a 68-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had heart failure symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a biceps tendon rupture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had neuropathic pain in the extremities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The electrocardiogram showed low QRS voltage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The electrocardiogram showed a pseudo-infarct pattern.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiogram revealed a left ventricular ejection fraction of 30%.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiogram showed severely thickened walls with a speckled appearance.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiogram showed a global longitudinal strain of \u22126.2% in a bull\u2019s eye pattern.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiogram showed a left ventricular posterior wall thickness of 21.3 mm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac magnetic resonance imaging showed severe symmetric hypertrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac magnetic resonance imaging showed moderate global dysfunction.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Cardiac magnetic resonance imaging showed an elevated native T1 value of 1225 milliseconds.", "support_label": "supported", "is_refined": false }, { "subclaim": "Post-gadolinium T1 mapping revealed a significantly increased extracellular volume of 72%.", "support_label": "supported", "is_refined": false }, { "subclaim": "Perugini grade 3 pyrophosphate scintigraphy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endomyocardial biopsy confirmed the diagnosis of amyloidosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Genetic testing identified a heterozygous c.424G>A (p.Val142Ile) variant in the transthyretin gene.", "support_label": "supported", "is_refined": false }, { "subclaim": "The variant is consistent with variant transthyretin amyloidosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1773_en.txt", "fulltext": "A 74-year-old woman who was treated outside our hospital due to complaints of general weakness, hematuria, dysuria, and decreased renal function was transferred to Chosun University Hospital, Gwangju, Korea, as her renal function did not improve despite treatment.\nClinically, rapid progressive glomerulonephritis (RPGN) was suspected. Two days after admission, US-guided percutaneous renal biopsy was performed to confirm the pathologic diagnosis, before initiating steroid treatment. Contrary to expectations, the light microscopic examination identified diffuse infiltration of pleomorphic cells throughout the specimen. The pleomorphic cells were immunoreactive for CD20, bcl-2, bcl-6, and MUM-1, but negative for CD3, CD10, and Epstein-Barr encoding region in situ hybridization . No fluorescence deposit was identified during immunofluorescence examination. In electro-microscopic examination, no electron-dense deposit was observed, and the glomerular basement membrane appeared normal in thickness, contour, and texture. However, strikingly, diffuse prominent infiltration of atypical lymphocytes was observed in the interstitium. The cells displayed round to oval cleaved and non-cleaved nuclei with variable clumping of chromatin, and large prominent, marginated nucleoli . We diagnosed the condition as DLBCL, not medical renal disease. After pathologic diagnosis, radiologic re-evaluation was performed. Abdominal CT examination (with contrast) revealed diffuse homogeneous enhancement in both kidneys without definite visible cortico-medullary differentiation, and lymphomatous involvement was diagnosed. A few mild enlargements of lymph nodes in the pericardial and periaortic chains were identified, and such nodes were considered to indicate secondary lymphomatous involvement. On fluorodeoxyglucose-positron emission tomography CT, intense hypermetabolism (19.6) was identified in both kidneys, and some lymph nodes exhibited mild hypermetabolism . In the laboratory tests, serum lactate dehydrogenase (LDH) level was elevated to 376 U/L (125-220 U/L). The international prognostic index (IPI) was reported as 3 when the following laboratory data and clinicopathologic factors were considered [old age, 1; Eastern Cooperative Oncology Group (ECOG) performance status (PS), 1; Ann Arbor stages III\u2013IV, 0; serum level > 1 \u00d7 normal, 1; and > 1 extranodal site, 0].\nThe patient had no previous renal problems.\nThere was no specific personal or family history.\nThe patient looked ill.\nAfter admission, the blood urea nitrogen (normal range, 7.0-20.1 mg/dL)/creatinine (0.57-1.11 mg/dL) levels on June 30, July 9, and July 11, 2022 were as follows: 27.7/4.09; 41.0/6.61; and 48/7.62 mg/dL, respectively.\nRadiologically, renal US exhibited heterogeneously increased parenchymal echogenicity and a 1.43 cm-sized hypoechoic cystic lesion in the right kidney. Thus, the radiologist suggested probable medical renal disease with a right cystic lesion. During abdominal CT (contrast-free CT while admitted to the emergency room), no neoplastic lesion was suspected.", "summary": "Herein, we report a 74-year-old woman with primary diffuse large B-cell lymphoma who presented with AKI diagnosed by ultrasound-guided needle biopsy. We also report the clinicopathologic findings of 121 PRL cases reported since 1989, by conducting a literature review of published cases.", "subclaim_evaluations": [ { "subclaim": "The patient is a 74-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had primary diffuse large B-cell lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with acute kidney injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "Acute kidney injury was diagnosed by ultrasound-guided needle biopsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "A literature review of 121 PRL cases was conducted.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The literature review included cases reported since 1989.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_981_en.txt", "fulltext": "A 47-year-old man was initially diagnosed as dysphagia. On the next day, he developed dysarthria and tongue deviation to the left, and he visited our hospital. He had no history of trauma nor any other significant medical history. Blood pressure was 184/126 mmHg. Neurological examinations revealed leftward deviation of the tongue on protrusion and dysarthria, suggesting a left hypoglossal nerve palsy. There were no other neurological deficits. Diffusion-weighted magnetic resonance images (MRI) did not demonstrate any lesions that could cause left hypoglossal nerve palsy . Axial T2-CUBE MRI demonstrated a false lumen of ICAD that compressed the outlet portion of the hypoglossal nerve tube and dilation of the perineural space in the hypoglossal canal . The false lumen of ICAD was adjacent to the hypoglossal canal at its distal side and protruded toward the hypoglossal neural tube. These findings indicated that direct compression by the false lumen was the cause of hypoglossal nerve palsy . MR angiography (MRA) showed dissection of the left ICA accompanied with a false lumen . The patient was admitted and we started transoral administration of amlodipine (5 mg/day) and azilsartan (20 mg/day) for antihypertensive treatment. On the 2nd day, he felt headache, and transoral administration of loxoprofen was started. On the 7th day, he was started on aspirin (100 mg/day) and clopidogrel (75 mg/day) for prevention of thromboembolism from the dissected portion. Cerebral angiography performed on the 8th day showed an ICAD consistent with the findings on MRI and MRA . Cone-beam computed tomography (CBCT) showed protrusion of the false lumen to the hypoglossal canal .\nAlthough medical treatment was continued, his headache worsened, and the neurological symptoms were not improved. Therefore, CAS was performed on the 19th day to thrombose the false lumen and decompress the hypoglossal nerve. A 6Fr guiding catheter (Axcelguide MSK, Medikit, Tokyo, Japan) was inserted through the right brachial artery and a 4-6Fr catheter (Dymon catheter, Silux, Saitama, Japan) was placed in the left common carotid artery. An embolic protection device (FilterWire EZ, Boston Scientific, MA) was advanced through the lesion and a filter was deployed in the ICA at the petrous portion. A carotid stent (Wallstent, Boston Scientific) was advanced to the dissected portion and deployed. Angiography immediately after stenting showed dilatation of the true lumen and congestion of contrast medium in the false lumen . There were no neurological symptoms or vital changes throughout the procedures. Pre- or post-dilation was not performed because the vessel was sufficiently dilated and there was a risk of enlargement or rupture of the false lumen.\nHis headache gradually improved after CAS and disappeared on the 25th day. His postoperative course was uneventful and he was discharged on the 26th day. No improvement of hypoglossal nerve palsy was observed at the time of discharge. At 1 month after discharge, neurological symptoms, such as tongue deviation and dysarthria, improved. Cerebral angiography performed at month 6 showed well-dilated ICA and disappearance of false lumen .", "summary": "A 47-year-old man presented with headache, dysphagia, dysarthria, and tongue deviation to the left. He had no history of trauma nor any other significant medical history. Axial T2-CUBE MRI and MRA showed dissection of the left ICA accompanied with a false lumen. These findings indicated that direct compression by the false lumen was the cause of hypoglossal nerve palsy. Although medical treatment was continued, symptoms were not improved. Therefore, CAS was performed to thrombose the false lumen and decompress the hypoglossal nerve. His symptoms gradually improved after CAS and angiography performed at month 6 showed well-dilated ICA and disappearance of false lumen.", "subclaim_evaluations": [ { "subclaim": "The patient is a 47-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with dysphagia.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with dysarthria.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with tongue deviation to the left.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had no history of trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Axial T2-CUBE MRI showed dissection of the left ICA.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRA showed a false lumen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings indicated direct compression by the false lumen was the cause of hypoglossal nerve palsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Medical treatment was continued.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms were not improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "CAS was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "CAS was performed to thrombose the false lumen.", "support_label": "supported", "is_refined": false }, { "subclaim": "CAS was performed to decompress the hypoglossal nerve.", "support_label": "supported", "is_refined": false }, { "subclaim": "His symptoms gradually improved after CAS.", "support_label": "supported", "is_refined": false }, { "subclaim": "Angiography performed at month 6 showed well-dilated ICA.", "support_label": "supported", "is_refined": false }, { "subclaim": "Angiography performed at month 6 showed disappearance of false lumen.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1626_en.txt", "fulltext": "The case in question concerns a 64-year-old Caucasian postmenopausal woman presenting with pain, abdominal distension, and an altered intestinal transit.\nThoracic and abdominopelvic computed tomography (CT) scans revealed massive peritoneal carcinomatosis, extensive ascites, involvement of the major omentum, extensive involvement small intestine mesentery, diffuse involvement of the parietal peritoneum, implants at the bottom of the Douglas pouch, and probable implants on the ovarian surface, although of normal size . Her plasma CA-125 tumour marker levels were 1,110.9 U/mL, and those of the remaining tumour markers fell within a normal range. An omentum biopsy was compatible with high-grade serous carcinoma, with positive expression for WT-1, p53, CK-7 and negative expression for CK20 and TTF-1, with tube-ovarian-peritoneal origin.\nGiven the confirmed diagnosis of a primary peritoneal carcinoma of gynaecological origin stage IIIC and after assessment by a multidisciplinary committee that considers unresectable disease due to mesenteric involvement, neoadjuvant chemotherapy with intravenous (i.v.) paclitaxel 175 mg/m2 and i.v. carboplatin AUC 6 at three-week intervals was prescribed. The patient received three cycles of this treatment, showing a significant partial response on the follow-up CT scans, and plasma CA-125 tumour marker levels of 65 U/mL (levels at diagnosis: 1110.9 U/mL).\nSurgery was subsequently performed, achieving optimal cytoreduction, and the patient had a catheter placed for the administration of the intraperitoneal chemotherapy. The pathological study of all samples obtained during the procedure revealed a high-grade serous carcinoma.\nFollowing the intervention, a total of four cycles of adjuvant intraperitoneal (i.p.) chemotherapy consisting of i.v. paclitaxel 175 mg/m2 (day 1), i.p. cisplatin 75 mg/m2 (day 2), and i.p. paclitaxel 60 mg/m2 (day 8) were administered. The patient achieved a complete response, although she developed grade-2 asthenia and grade-3 neutropenia due to treatment-related toxicity that mandated a delay in the dosing and support with granulocyte-colony stimulating factors (G-CSFs).\nSeven months after receiving the last cycle of platinum-based chemotherapy, her CA-125 tumour marker levels were 104 U/mL, and mediastinal lymph node and peritoneal recurrence were identified in the follow-up CT scans. At this time, a germline mutation study was carried out in BRCA, being negative. Given that these findings were considered to be indicative of progression after a PFI of seven months, second-line chemotherapy was started with i.v. trabectedin 1.1 mg/m2 (day 1) in combination with i.v. PLD 30 mg/m2 (day 1) at 21-day cycles. The patient achieved a partial response after the third cycle (CA-125: 11.8 U/mL) .\nChemotherapy with trabectedin and PLD was continued; however, given that the patient experienced haematological toxicity (grade-4 neutropenia), the dose of PLD had to be reduced to 25 mg/m2 and that of trabectedin to 0.9 mg/m2 during the sixth cycle. PLD was subsequently discontinued altogether due to the onset of toxicity associated with this drug (grade-2 mucositis and grade-3 asthenia). From then on, she received i.v. trabectedin 0.9 mg/m2 in monotherapy at 21-day cycles, with good tolerance and referring only grade-1 asthenia that resolved within two to three days and did not limit her during her basic activities of daily living.\nAfter ten cycles of treatment, and specifically four cycles of trabectedin in monotherapy, the dose of trabectedin had to be reduced to 0.75 mg/m2 every 21 days due to the onset of grade-3 neutropenia and grade-2 thrombopenia, which mandated frequent delays in the dosing and even G-CSF support. Nevertheless, the subsequent follow-up CT scans performed periodically continued to show evidence of complete response. The patient received a total of 35 cycles of trabectedin (six in combination with PLD and then 29 in monotherapy). During this time, she maintained an excellent quality of life, experiencing no late or cumulative toxicity, and being able to perform her usual activities.\nBecause peritoneal progression was subsequently detected after a PFI of three years, a third line of treatment with i.v. carboplatin (area under the curve [AUC] = 4) (day 1), i.v. gemcitabine 1,000 mg/m2 (days 1 and 8 of every 21-day cycle), and i.v bevacizumab 15 mg/kg (day 1) was started. A subsequent follow-up CT scan carried out after the third cycle of this therapy showed signs of partial response. Given that the response persisted after six treatment cycles, chemotherapy was suspended and treatment with bevacizumab in monotherapy was started. The patient has received a total of 12 cycles of maintenance treatment with bevacizumab in monotherapy to date, having tolerated the treatment well and maintained a partial response.", "summary": "A 64-years-old postmenopausal woman with pain, abdominal distension, and an altered intestinal transit and with partially platinum-sensitive recurrent ovarian cancer, was successfully treated with a second line of trabectedin chemotherapy in combination with PLD, followed by trabectedin in monotherapy. This case proves the effectiveness of the combination of trabectedin and PLD and demonstrates how the administration of trabectedin, even in monotherapy, allows to maintain an adequate clinical response with good tolerance to the treatment during more than two years of drug administration.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64-year-old postmenopausal woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abdominal distension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had an altered intestinal transit.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had partially platinum-sensitive recurrent ovarian cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with a second line of trabectedin chemotherapy in combination with PLD.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was later treated with trabectedin in monotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The combination of trabectedin and PLD was effective.", "support_label": "supported", "is_refined": false }, { "subclaim": "Trabectedin in monotherapy allowed an adequate clinical response.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was well tolerated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment duration was more than two years.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_471_en.txt", "fulltext": "A 72-year-old woman (40.3 kg, 139 cm) was referred to our pain clinic for the treatment of low back pain after two back surgeries. She had first undergone back surgery [posterior lumbar interbody fusion (PLIF at L4\u20135) plus spinal stabilization (L3)] for lumbar spinal canal stenosis 4 years prior to the current presentation. Two weeks after the initial surgery, she underwent reoperation because of screw placement errors, and her symptoms disappeared after surgery. However, her low back pain recurred after a fall 5 months before the current presentation. Paralysis of the lower limbs was not apparent after this episode. A sensory disturbance that had existed before the surgeries remained unchanged. No new lesions such as a lateral recess or foraminal stenosis, herniated nucleus pulposus, or fracture were found on radiographs or magnetic resonance images . The previous medical institution prescribed acetaminophen and tramadol for low back pain and performed a caudal epidural block with 5 ml of 1% lidocaine and dexamethasone 1.65 mg. However, neither treatment provided pain relief, and the patient was referred to our pain clinic. She had several comorbidities, including diabetes mellitus, hypertension, renal dysfunction, hypothyroidism, rheumatic arthritis, and gastroesophageal regurgitation, and was prescribed 27 different drugs by clinicians from five different facilities. Accordingly, we decided not to use additional medication for first-line therapy because of polypharmacy concerns and renal dysfunction and performed bilateral ESP block with the patient in the prone position. A convex type transducer was placed in a longitudinal orientation at the level of the L2 transverse process, 3 cm lateral to the midline. The L4 and L5 transverse processes could not be identified because of the echogenic artifacts due to the surgical instruments. The posterior surface of the L2 transverse process was identified using an aseptic technique. After the puncture point was anesthetized with 2 ml of 1% lidocaine, the needle was inserted in the plane of the ultrasound beam in a cephalad to caudal direction. Following confirmation of the needle tip on the surface of the transverse process of L2, 20 ml of 0.1875% ropivacaine (fourfold dilution of commercial product) was injected into the target plane between the erector spinae muscles and the transverse process . This procedure was repeated on the contralateral side. Twenty-five minutes later, the patient reported a warm feeling in her low back and almost complete relief from pain, which was approximately < 10% of its original severity. There was an area of diminished cold sensation extending from T12 to L5, with no change in the anterior and lateral abdomen. Unfortunately, the pinprick test was not performed. Pain relief lasted for approximately 10 h after the initial block. We repeated this procedure for a total of three times in a month. Finally, the patient reported that her daily baseline level of low back pain had diminished to < 40% of its original severity. She was satisfied with the extent of pain control and did not wish to undergo further treatments such as epiduroscopy or spinal cord stimulation (SCS).", "summary": "Here we report a case involving a 72-year-old woman who experienced recurrent low back pain after undergoing two back surgeries. She was treated with erector spinae plane (ESP) block, which affected the dorsal rami of the spinal nerves from T12 to L5. Pain relief lasted for approximately 10\u00a0h after the initial block, and successful low back pain relief was achieved after a total of three trials.", "subclaim_evaluations": [ { "subclaim": "The patient was a 72-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had two back surgeries.", "support_label": "supported", "is_refined": false }, { "subclaim": "She experienced recurrent low back pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with an erector spinae plane block.", "support_label": "supported", "is_refined": false }, { "subclaim": "The block affected the dorsal rami of the spinal nerves.", "support_label": "supported", "is_refined": false }, { "subclaim": "The block affected spinal nerves from T12 to L5.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pain relief lasted approximately 10 hours after the initial block.", "support_label": "supported", "is_refined": false }, { "subclaim": "Successful low back pain relief was achieved.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment required a total of three trials.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2048_en.txt", "fulltext": "A 57-year-old man was referred to neuro-oncology for brain MRI findings concerning for cortical laminar necrosis in the setting of metastatic melanoma. He was originally diagnosed with Stage IIIB (pT4bN1aM0) BRAF V600E-mutated cutaneous melanoma 6 years before evaluation with positive sentinel lymph node biopsy. Brain MRI at that time was normal. He had received multiple treatments throughout the years but for the past 30 months had been treated only with encorafenib and binimetinib with stable systemic disease. His medical history was otherwise unremarkable and he had no risk factors for vascular disease.\nRoutine, asymptomatic surveillance brain MRI with contrast was obtained and was notable for gyriform T1 shortening in the right pars opercularis, new from most recent imaging performed 23 months prior . Contrast-enhanced T1-weighted imaging showed no discernable enhancement, T2-weighted sequences showed no local edema, and diffusion-weighted imaging showed no diffusion restriction. These findings were most consistent with cortical laminar necrosis from chronic infarction. Nonetheless, given his clinical history and lack of vascular risk factors, metastatic disease remained a diagnostic consideration and close interval follow-up was planned.\nRepeat MRI obtained 3 months later revealed gyral expansion in the region of the T1 shortening as well as a new contrast-enhancing adjacent nodule with vasogenic edema . Given imaging features, he underwent craniotomy revealing a subpial lesion that was grossly melanotic. The lesion followed and infiltrated gray matter in a gyriform pattern, with an adjacent melanotic nodule . A total resection was achieved utilizing subpial dissection to protect nearby Sylvian vessels. The surgical specimen showed cortical gray matter with infiltration by neoplastic cells in a primarily perivascular pattern with no definitive tumor mass. The neoplasm was composed of large cells with atypical nuclei and prominent nucleoli. The majority of the tumor cells showed melanin pigment. All these findings were consistent with a metastatic malignant melanoma. The tumor expressed the mutant BRAF V600E protein by immunohistochemistry. The patient recovered well without postoperative neurological deficit. He received Gamma Knife radiosurgery to the surgical bed with a dose of 9 Gy at the 50% isodose line.", "summary": "Here, we present a case of a 57-year-old man in whom a metastatic melanoma initially mimicked the imaging characteristics of cortical laminar necrosis.", "subclaim_evaluations": [ { "subclaim": "The patient was a 57-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had metastatic melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The metastatic melanoma initially mimicked the imaging characteristics of cortical laminar necrosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_6_en.txt", "fulltext": "A 24-year-old female presented with a 1 year history of a painful, large, irregular, lobular mass rapidly growing at the nape of the neck, accompanied by decreased sensation/numbness in the C1-C2 dermatomes . Computed tomography (CT) scans of both the head and neck revealed a moderately enhancing 10-12 cm lesion (in greatest diameter) extending from skull base to the thyroid gland. It additionally involved the posterior cervical muscles, eroded through the posterior arch of atlas and occipital bone, where it exhibited both extradural/intraspinal, and intracranial extension . An incisional biopsy documented a highly vascular lesion consistent with a cellular variant of a solitary fibrous tumor (SFT) with HPC-like features. Preoperative RT was administered to reduce the size and vascularity of the tumor, and was followed by aggressive subtotal resection of an encapsulated, soft, vascular tumor. Notably, radical resection was limited by the tumor's depth and vascularity. Further postoperative RT resulted in a good clinical outcome.\nHistopathology revealed a vascular neoplasm characterized by sheets/groups of spindle/oval cells with a stag horn pattern consistent with HPC located in between plentiful of thin-walled vessels . On immunohistochemistry, consistent with the diagnosis of HPC, the tumor cells were positive for both cluster of differentiation 34 (CD34) and vimentin . The postoperative CT scan documented only a minimal amount of residual tumor (near the atlanto-occipital junction) with near complete decompression of the craniovertebral (CV) junction . Two years postoperatively, the patient remains asymptomatic and disease free (e.g., no recurrence or metastases).", "summary": "We report a case of a 24-year-old female with a rapidly growing, highly vascular swelling in nape of the neck extending deep into the craniovertebral (CV) junction accompanied by extradural/intraspinal, and intracranial involvement. An incisional biopsy revealed a cellular, highly vascular tumor with HPC-like features. The patient received preoperative RT, which reduced both the size and vascularity of the lesion, facilitating subsequent near complete resection. Further postoperative RT resulted in a good clinical outcome, with no tumor recurrence observed at 2 postoperative years.", "subclaim_evaluations": [ { "subclaim": "The patient is a 24-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a rapidly growing, highly vascular swelling in the nape of the neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "The swelling extended deep into the craniovertebral junction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had extradural/intraspinal involvement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had intracranial involvement.", "support_label": "supported", "is_refined": false }, { "subclaim": "An incisional biopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy revealed a cellular, highly vascular tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had hemangiopericytoma-like features.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received preoperative radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative radiotherapy reduced the size of the lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative radiotherapy reduced the vascularity of the lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was near completely resected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received further postoperative radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no tumor recurrence at 2 postoperative years.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2526_en.txt", "fulltext": "35 years old female presented to the casualty with bilateral lower limb paralysis for 1 month following child birth, the condition occurred suddenly, it was associated with back pain and complete loss of sphintric control. On examination patient looks generally well, with normal vital signs readings, GCS 15/15, intact cranial nerves, normal power, tone and reflexes in upper limbs with intact sensation to all modalities, but lower limb showed power grade zero, hypertonia, hyper-reflexia grade 4 and positive Babinski\u2019s sign. Sensory modalities were examined and revealed sensory impairment up to the level of umbilicus (loss of vibration and position sense), and there was mild mid-dorsal tenderness.\nPatient haematological parameters were investigated and revealed normal readings. Dorsolumber MRI was done showed T1 weighted extradural hyperintense lesion from D5 to D8 compressing the spinal cord from posterior, T2 weighted images showed the lesion which is hyperintense in relation to spinal cord and almost isointense with normal fat signals and cord myelopathic changes and contrasted MRI images showed prevalent, a little inhomogeneous contrast uptake by the lesion. Surgical intervention was done through posterior approach dorsal decompressive laminectomies and total resection of the lesion with no intraoperative significant events was achieved, and specimen was sent for histopathology .", "summary": "A case of thoracic spinal extradural angiolipoma producing acute spinal cord compression in a 35-year old housewife is presented. Patient presented with sudden onset of lower limbs paralysis and urinary incontinence for 1 month after vaginal delivery. Patient was diagnosed as dorsal spine angiolipoma which was treated surgically with excellent outcome.", "subclaim_evaluations": [ { "subclaim": "The patient is a 35-year-old housewife.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a case of thoracic spinal extradural angiolipoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The angiolipoma produced acute spinal cord compression.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient presented with sudden onset of lower limbs paralysis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had urinary incontinence.", "support_label": "supported", "is_refined": false }, { "subclaim": "The symptoms lasted for 1 month.", "support_label": "supported", "is_refined": false }, { "subclaim": "The symptoms occurred after vaginal delivery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with dorsal spine angiolipoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was treated surgically.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgical treatment had an excellent outcome.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_520_en.txt", "fulltext": "A 56-year-old woman was referred to the emergency department due to a severe headache in the frontal area for 2 days before admission. The patient had nausea and vomiting in the morning but had no history of seizures or decreased consciousness. The examination of neurological symptoms was completely normal and showed no symptoms of meningeal irritation. The patient's vital signs were recorded as follows: blood pressure (BP)=130/85 mmHg, heart rate (HR)= 86/min, and temperature (T)=37.3 \u00b0C. In her past history, the patient had undergonetympano- mastoidectomy surgery and resection of the cholesteatoma 1 week earlier, and a canalwall down mastoidectomy (CWD) was performed due to right ear cholesteatoma. According to the information obtained from the previous surgeon, microtrauma was inflicted in the dural plate during surgery, but since no significant cerebrospinal fluid (CSF) leak occurred during the procedure, reconstruction was not necessary. After admission, examination and initial evaluation, the Mount Fuji sign was found on the brain CT scan of the patient, but no evidence of brain abscess or intracranial hemorrhage. The patient was immediately admitted to the intensive care unit (ICU).\nInitial treatments such as CBR, 30-degree head elevation, anti-fever therapy, analgesics and oxygen therapy, along with anti-compulsive drug (phenytoin), were prescribed. The patient did not undergo surgery due to a lack of neurological symptoms and a decreased level of consciousness or seizures. However, in the ICU, the patient was maintained under regular and continuous monitoring of vital and neurological signs and level of consciousness. The day after admission, the patient\u2019s headache had completely resolved. The patient was admitted to the ICU for 5 days and was monitored for volume ofpneumocephalus every day with a CT scan. At the end of 5 days, the patient's pneumocephalus was resolved completely, and she was transferred to the ward. The patient was discharged after complete recovery.", "summary": "A 56-year-old woman was referred to the emergency department due to a severe headache in the frontal area for 2 days before admission. The patient experienced nausea and vomiting in the morning and had no history of seizures or decreased consciousness. Examination of neurological symptoms was completely normal and showed no symptoms of meningeal irritation. In terms of past history, the patient had undergone tympanomastoidectomy surgery and resection of the cholesteatoma 1 week previously. The Mount Fuji sign was found on the brain computed tomography (CT) scan of the patient. Treatments such as CBR (complete bed rest), 30-degree head elevation, anti-fever, analgesics and oxygen therapy, along with anti-compulsive drug (phenytoin), were prescribed. At the end of 5 days, the patient's pneumocephalus was resolved completely.", "subclaim_evaluations": [ { "subclaim": "The patient is a 56-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was referred to the emergency department.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a severe headache in the frontal area for 2 days before admission.", "support_label": "supported", "is_refined": false }, { "subclaim": "She experienced nausea and vomiting in the morning.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had no history of seizures.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had no history of decreased consciousness.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neurological examination was completely normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no symptoms of meningeal irritation.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had undergone tympanomastoidectomy surgery 1 week previously.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had resection of the cholesteatoma 1 week previously.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Mount Fuji sign was found on the brain CT scan.", "support_label": "supported", "is_refined": false }, { "subclaim": "CBR (complete bed rest) was prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "30-degree head elevation was prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anti-fever medication was prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Analgesics were prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oxygen therapy was prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Phenytoin was prescribed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pneumocephalus was resolved completely after 5 days.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1348_en.txt", "fulltext": "A 76-year-old Japanese man with a history of hypertension, laryngeal cancer, chronic obstructive pulmonary disease (COPD), and type 2 diabetes mellitus developed a cerebral arteriovenous malformation hemorrhage and was hospitalized at Aichi Medical University Hospital, Japan. His vaccination history was unknown. Case characteristics and laboratory data on the first visit are summarized in Table . Following surgery for removal of the hematoma, he began rehabilitation and was encouraged to engage in early postoperative ambulation. In March, 2015, on the 66th day of hospitalization, he developed a sudden fever and exhibited a sharp decline in oxygenation.\nAt the onset of fever, the patient\u2019s vital signs were as follows: body temperature, 37.8 \u00b0C; blood pressure, 84/41 mmHg; heart rate, 107/min; respiration rate, 30/min; and SpO2, 82% (room air). Blood gas analysis (room air) showed pH 7.538, 25.7 mmHg, 47.6 mmHg, HCO3\n\u2212 21.4 mmol/L, and lactate 38.9 mg/dL. His level of consciousness was I-2 on the Japan Coma Scale. Physical examination showed coarse crackles and wheezes in the right lung. Based on chest radiography and computed tomography images , hospital-acquired aspiration pneumonia was diagnosed.\nPiperacillin/tazobactam 4.5 g was administered three times daily as initial treatment . Streptococcus pneumoniae infection was suspected based on a rapid identification test using a sputum smear, and a strain of S. pneumoniae was isolated from the blood culture sampled at the onset of fever. The patient was admitted to the intensive care unit and teicoplanin was added to his treatment regimen. However, his SpO2 and respiratory rate continued to be unstable. After 5 days of concomitant teicoplanin administration, the patient died.\nStreptococcus pneumoniae detected in the smear and the morphologic characteristics of the colonies on blood agar are shown in Fig. . The isolate was mucoid serotype strain 3, with a thick capsule. Antibiotic susceptibility to penicillins, cephalosporins, carbapenems, and levofloxacin was good, with resistance observed only to a macrolide (erythromycin) .", "summary": "The patient had a history of hypertension, laryngeal cancer, chronic obstructive pulmonary disease, and type 2 diabetes mellitus. Following a cerebral arteriovenous malformation hemorrhage, he underwent surgery to remove the hematoma and began rehabilitation. On day 66 of hospitalization, he suddenly developed a fever, and coarse crackles and wheezes were heard in his right lung. A diagnosis of hospital-acquired aspiration pneumonia was made, and initial treatment with piperacillin/tazobactam was started. Teicoplanin was added after S. pneumoniae was isolated from the blood culture, however, the patient died 5\u00a0days later. The S. pneumoniae detected in the sputum smear was serotype 3, showed mucoid colonies and susceptibility to penicillins, cephalosporins, carbapenems, and levofloxacin, but resistance to erythromycin.", "subclaim_evaluations": [ { "subclaim": "The patient had a history of hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of laryngeal cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of chronic obstructive pulmonary disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of type 2 diabetes mellitus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a cerebral arteriovenous malformation hemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent surgery to remove the hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient began rehabilitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "On day 66 of hospitalization, the patient suddenly developed a fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "Coarse crackles and wheezes were heard in the right lung.", "support_label": "supported", "is_refined": false }, { "subclaim": "A diagnosis of hospital-acquired aspiration pneumonia was made.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial treatment with piperacillin/tazobactam was started.", "support_label": "supported", "is_refined": false }, { "subclaim": "Teicoplanin was added after S. pneumoniae was isolated from the blood culture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died 5 days after teicoplanin was added.", "support_label": "supported", "is_refined": false }, { "subclaim": "The S. pneumoniae detected in the sputum smear was serotype 3.", "support_label": "supported", "is_refined": false }, { "subclaim": "The S. pneumoniae showed mucoid colonies.", "support_label": "supported", "is_refined": false }, { "subclaim": "The S. pneumoniae was susceptible to penicillins.", "support_label": "supported", "is_refined": false }, { "subclaim": "The S. pneumoniae was susceptible to cephalosporins.", "support_label": "supported", "is_refined": false }, { "subclaim": "The S. pneumoniae was susceptible to carbapenems.", "support_label": "supported", "is_refined": false }, { "subclaim": "The S. pneumoniae was susceptible to levofloxacin.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The S. pneumoniae was resistant to erythromycin.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2934_en.txt", "fulltext": "A 27-year-old man, a laborer from Vietnam, sustained head injury and severe pain as well as swelling and deformity in both lower limbs as a result of a road traffic accident on July 7, 2018.\nThe patient had no medical history.\nThe patient had no special past illness.\nThe patient had no history of drug allergies, smoking, or drinking, and no relevant family history.\nThe patient was brought by ambulance to our emergency room (ER) for treatment. A general examination revealed that the patient had a head injury with a Glasgow Coma Scale score of E4V5M3 and clear consciousness, and he was able to communicate. The initial vitals revealed hypotension (82/55 mmHg), tachycardia (107 beats/min), and a respiration rate of 26 breaths/min. During the clinical physical examination, the patient was bedridden and was incapable of stepping on or making small motions with either foot. Multiple bleeding lacerations were observed on the left forehead (3.0 \u00d7 2.0 cm), lower lip (2.0 \u00d7 1.0 cm), anterior neck (4.0 \u00d7 1.0 cm), left anterior thigh (2.5 \u00d7 2.0 cm), left posterior heel (4.0 \u00d7 1.0 cm), and right posterior thigh (3.0 \u00d7 1.0 cm). Multiple abrasions were also identified on his face, body and limbs. The thighs and lower limbs appeared deformed, with free floating bone fragments. Distal pulses, including in the bilateral popliteal artery, posterior tibial artery, and pedal dorsal artery, were palpable.\nRoutine blood tests revealed that hemoglobin was 9.5 mg/dL, and other blood chemistry results, including for liver and kidney function and electrolyte assessment, were all within the normal range.\nA plain radiograph revealed displaced bilateral femoral, tibial, and fibular midshaft fractures . Computed tomography (CT) identified no notable intracranial, intrathoracic, or intra-abdominal bleeding.", "summary": "A 27-year-old man sustained multiple injuries when the electric motorcycle he was riding was hit by a van. His injuries included traumatic hypovolemic shock, comminuted and open type II fractures of the left femoral shaft, fracture of the right femoral shaft, comminuted fracture of the bilateral tibial and fibular shaft, and multiple lacerations and abrasions on his forehead, lower lip, neck and limbs. The diagnosis was simultaneous bilateral floating knee complicated with soft tissue injuries. After emergency treatment and the exclusion of life-threating complications, open reduction and internal fixation were successfully performed using plates and screws in the bilateral femoral and tibial shafts.", "subclaim_evaluations": [ { "subclaim": "The patient is a 27-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was riding an electric motorcycle.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The motorcycle was hit by a van.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient sustained multiple injuries.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had traumatic hypovolemic shock.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had comminuted and open type II fractures of the left femoral shaft.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a fracture of the right femoral shaft.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had comminuted fractures of the bilateral tibial and fibular shafts.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had multiple lacerations and abrasions on his forehead.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had multiple lacerations and abrasions on his lower lip.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had multiple lacerations and abrasions on his neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had multiple lacerations and abrasions on his limbs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was simultaneous bilateral floating knee.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis included soft tissue injuries.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency treatment was provided.", "support_label": "supported", "is_refined": false }, { "subclaim": "Life-threatening complications were excluded.", "support_label": "supported", "is_refined": false }, { "subclaim": "Open reduction and internal fixation were performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The procedure was performed on the bilateral femoral shafts.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was performed on the bilateral tibial shafts.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Plates and screws were used for fixation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_1653_en.txt", "fulltext": "A 62-year-old man was treated with pembrolizumab for right lung adenocarcinoma, which showed high PD-L1 expression (80%), with multiple intestinal, lymph node, and bone metastases. The TNM classification for NSCLC was cT2N3M1c (OSS, LYM, PER, OTH), stage IVB (eighth edition). Tumor reduction was observed, but pembrolizumab was stopped after three courses owing to drug-induced pneumonitis. Dexamethasone was used for the treatment of pneumonitis. One month after drug withdrawal, the patient was transported to the emergency department of our hospital with the complaint of severe stomachache. On physical examination, he had a rigid abdomen and generalized tenderness. His blood pressure was in the normal range (110/82 mmHg), the heart rate was elevated but regular at 100 beats per minute, and the body temperature was elevated at 38.9 \u00b0C. The peripheral capillary oxygen saturation was 98% at room air. Laboratory evaluation showed a high inflammatory response with a white blood cell count of 18,200/mm3 and C-reactive protein level of 20.8 mg/dL. CT examination showed abdominal free air and ascites with perforation of the existing lung adenocarcinoma metastasis . We diagnosed bowel perforation with acute diffuse peritonitis. Emergency laparotomy was performed, and multiple small intestinal metastasis with mesenteric lymph node metastasis and ascites containing intestinal fluid were observed. The perforation site was located in the metastatic jejunum about 40 cm on the anal side from Treitz\u2019s ligament. We resected this part about 20 cm and anastomosed with functional end-to-end anastomosis. There was no complication after surgery, and he was discharged on post-operative day 15. Pathological examination indicated lung adenocarcinoma metastasis in the perforated intestine, and the metastasis was partly scarred owing to the effect of pembrolizumab . Tumor cells in the perforation site had a high degree of degeneration and necrosis, and the pathological response for the efficacy of pembrolizumab was grade 1b (Japanese Classification of the Colorectal Carcinoma, seventh edition) . In the perforated part, the tumor cells were observed in all layers, but in the vicinity on the serosa side. Inflammatory change due to enteritis was not found in this site. Pembrolizumab was re-administrated about 1 month after discharge. To prevent drug-induced pneumonitis, dexamethasone was used daily.", "summary": "A 62-year-old man was treated by pembrolizumab for PD-L1 highly expressed lung adenocarcinoma, with multiple metastasis (small intestinal, lymph nodes, and bone). The treatment was stopped owing to drug-induced pneumonitis. One month after drug withdrawal, the patient visited the emergency department of our hospital with the complaint of severe stomachache. He had a rigid abdomen and generalized tenderness, and computed tomography scans showed free air within the abdomen. We diagnosed bowel perforation and performed emergency surgery. Surgical findings revealed multiple small intestine metastasis and mesenteric lymph node metastasis. Perforation was found in the metastatic site in the jejunum located around 40\u2009cm anal to Treitz's ligament. This perforated part was resected, and functional end-to-end anastomosis was performed using linear staplers. The post-operative course was uneventful. Pathological examination revealed lung adenocarcinoma metastasis at the perforation site, and the effectiveness of pembrolizumab was grade 1b (Japanese Classification of the Colorectal Carcinoma, seventh edition).", "subclaim_evaluations": [ { "subclaim": "The patient is a 62-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with pembrolizumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had PD-L1 highly expressed lung adenocarcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had multiple metastases.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had small intestinal metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had lymph node metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had bone metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was stopped due to drug-induced pneumonitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "One month after drug withdrawal, the patient visited the emergency department with severe stomachache.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography scans showed free air within the abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was bowel perforation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency surgery was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgical findings revealed multiple small intestine metastases.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgical findings revealed mesenteric lymph node metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Perforation was found in the metastatic site in the jejunum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The perforated part was resected.", "support_label": "supported", "is_refined": false }, { "subclaim": "Functional end-to-end anastomosis was performed using linear staplers.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The post-operative course was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathological examination revealed lung adenocarcinoma metastasis at the perforation site.", "support_label": "supported", "is_refined": false }, { "subclaim": "The effectiveness of pembrolizumab was grade 1b according to the Japanese Classification of the Colorectal Carcinoma, seventh edition.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2019_en.txt", "fulltext": "A 74-year-old previously healthy man was referred to our institution for repeated palpitations over 6 months. A Holter electrocardiogram (ECG) from the local hospital showed persistent AT. No oral anti-arrhythmia drugs were prescribed. The initial workup included baseline ECG, routine blood tests, chest X-ray, echocardiogram, and coronary angiography. There was frequent unifocal initiating AT with a P-wave morphology of positive amplitude in I, II, III, aVF, and V1 .\nThe patient underwent an electrophysiological study and ablation. Endocardial mapping of the atrium was performed using a PentaRay catheter (Biosense Webster, Inc., CA, USA) and a smart-touch contact force (CF)-sensing catheter (Biosense Webster, Inc., CA, USA) with the CARTO mapping system (Carto, Biosense Webster). Spontaneous AT was identified and mapped throughout the procedure using activation mapping, voltage mapping, and ripple mapping. Intracardiac electrophysiology during AT [cycle length (CL) 184 ms] showed atrial signals with an eccentric pattern of atrial activation on the coronary sinus catheter . Further activation mapping showed the earliest activation zone of AT originated in the right atrial FO. Ripple mapping showed activation progressing from the FO to both the right atrium and left atrium . Voltage mapping revealed no low-voltage regions in either atrium .\nIn the FO, further high-density mapping (HDM) using the PentaRay catheter and point-to-point mapping using the CF-sensing catheter (Biosense Webster, Inc., CA, USA) demonstrated significantly long-duration fractionated electrograms covering a considerable percentage of the CL of the tachycardia within a localized region . About 107 points at 12 cm2 were taken for the map. The colours of the wavefront on the activation maps can be tracked by following the regions where red meets purple . Concealed entrainment was fulfilled only at the FO, which implied the tachycardia mechanism is micro-reentrant in nature.\nA radiofrequency catheter ablation (RFCA) current was delivered at 30 W in power-controlled mode at 43\u00b0C and a normal saline velocity of 17 mL per minutes. The RFCA was delivered to the middle of the micro-reentrant circuit, terminating the AT immediately after 3 s (, Video S2). No AT was induced during programme stimulation and isoproterenol infusion (10 \u00b5g/min). The patient had no further episodes of AT over the ensuing 12 months until he was discharged to his home without antiarrhythmic drugs.", "summary": "A 74-year-old man presented with paroxysmal atrial tachycardia (AT) presenting as palpitations. He was evaluated by an electrophysiological examination using a high-density CARTO mapping system. The mapping results showed the AT with a cycle length of 184\u2009ms was focused on his right atrial fossa ovalis (FO). In this small area, the high-density mapping demonstrated a significant micro-reentrant tachycardia. Radiofrequency ablation at the centre of the micro-reentrant circuit successfully terminated the AT. No recurrences were observed during a 12-month follow-up.", "subclaim_evaluations": [ { "subclaim": "The patient is a 74-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with paroxysmal atrial tachycardia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tachycardia was associated with palpitations.", "support_label": "supported", "is_refined": false }, { "subclaim": "An electrophysiological examination was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A high-density CARTO mapping system was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tachycardia had a cycle length of 184 ms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tachycardia was focused on the right atrial fossa ovalis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The high-density mapping showed a significant micro-reentrant tachycardia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Radiofrequency ablation was performed at the center of the micro-reentrant circuit.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ablation successfully terminated the tachycardia.", "support_label": "supported", "is_refined": false }, { "subclaim": "No recurrences were observed during a 12-month follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2618_en.txt", "fulltext": "A 77-year-old Japanese woman was diagnosed with malignant melanoma in the right sinonasal cavity using biopsy approximately three years ago. She complained of nasal bleeding at that time. She underwent proton beam radiation therapy with sequential chemotherapy; however, she experienced double vision, and 1.5 years later, MRI revealed a local recurrence. After several courses of additional chemotherapy, the disease remained stable for the last 1.5 years. She underwent follow-up PET\u2013CT and FDG uptake was detected at the gallbladder . Hematological examination revealed no specific findings. Contrast abdominal CT revealed an early enhanced mass in the gallbladder, and the enhancement persisted in the equilibrium phase . On MRI, the tumor showed low signal intensity on T1-weighted images and slightly high intensity on T2-weighted images . Endoscopic ultrasonography (EUS) showed no apparent tumor infiltration to the liver.\nThe patient did not present with any symptoms. Because of the remaining nasal melanoma, surgical indication for the gallbladder tumor was controversial. We, however, recommended surgical treatment and she agreed for fear of its malignant potential. The primary preoperative diagnosis of the lesion was gallbladder cancer, and the secondary assessment was metastatic melanoma. Her general condition was good. After obtaining informed consent, which included advisement of the risk of relapse of nasal melanoma, we performed laparotomy and cholecystectomy with partial liver resection. In addition, lymphadenectomy of the hepatoduodenal ligament was performed. No ascites or macroscopic peritoneal dissemination was observed, and the tumor was localized in the gallbladder. The distal margin of the cystic duct was cancer free and the common bile duct was preserved. The tumor was soft, whitish, and measured 7.5 cm \u00d7 5 cm . Microscopically, it was diagnosed as a poorly differentiated malignant melanoma. Immunohistochemical examination revealed that the tumor was not similar to nasal melanoma, i.e., HMB-45 staining was far less positive in the gallbladder tumor than in the nasal tumor . The tumor cells reached the subserosal layer with mild vascular involvement, and the lymph nodes gave negative results for metastasis. No gallstones were observed. The postoperative course was uneventful. No distal recurrence has been detected for more than 13 months after surgery.", "summary": "A 77-year-old Japanese woman diagnosed with malignant melanoma of the left sinonasal cavity three years ago underwent follow-up PET-CT and FDG uptake was detected only at the gallbladder. The nasal melanoma had been stable for the last 1.5 years after chemoradiation and her general condition was good. Cholecystectomy was performed with partial liver resection. Lymphadenectomy of the hepatoduodenal ligament was also performed. The tumor was soft and whitish, and was microscopically diagnosed as a poorly differentiated malignant melanoma that was not similar to the nasal cavity melanoma. No further metastasis is observed for more than 13 months after surgery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 77-year-old Japanese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with malignant melanoma of the left sinonasal cavity three years ago.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Follow-up PET-CT showed FDG uptake only at the gallbladder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nasal melanoma had been stable for the last 1.5 years after chemoradiation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her general condition was good.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cholecystectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Partial liver resection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lymphadenectomy of the hepatoduodenal ligament was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was soft and whitish.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was microscopically diagnosed as a poorly differentiated malignant melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The gallbladder tumor was not similar to the nasal cavity melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "No further metastasis is observed for more than 13 months after surgery.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2325_en.txt", "fulltext": "The patient was an 84-year-old man who was admitted to the emergency room with a 24-h history of acute colicky abdominal pain. He denied other signs or symptoms. The relevant surgical history included old appendectomy and inguinal hernioplasty. The patient's medical history includes coronary artery disease and atherosclerosis, despite an otherwise healthy status. The patient was hemodynamically stable and in good general condition. Abdominal palpation led to pain in the left lower abdominal quadrant with no signs of peritoneal irritation. Abdominal computed tomography (CT) revealed small-bowel loops with multiple air-fluid levels and dilated stomach with a large air-fluid level . Laboratory tests showed no significant alterations.\nDecompression with a nasogastric tube was performed, and 1250 mL of light yellow fluid was evacuated. However, the symptoms persisted and he was admitted to the surgery department for further diagnostic testing, observation, and treatment. Despite stable vital signs, the patient experienced mild residual pain during palpation without abdominal distension. The patient stated that he periodically experienced mild abdominal pain for most of his adult life. Examination with an oral water-soluble contrast revealed small-bowel obstruction which remained unresolved over several hours of observation, leading to the suspicion of adhesive small-bowel obstruction . After receiving information regarding diagnostic laparoscopy and the potential for further surgical treatment based on intraoperative evaluation, the patient provided consent to the procedure.\nLaparoscopy revealed multiple diverticula in the proximal small intestine with distinctly dilated jejunal loops. Given the extent of the disease and the high iatrogenic injury risk, the procedure was converted to open surgery. A midline laparotomy was performed, and chronic rotation of the mesentery (volvulus) was observed. Derotation of the small intestinal loops was performed. Further examination revealed extensive diverticulosis in the proximal 2-m section of the jejunum starting approximately 20 cm from Treitz's ligament . Chronic fibrous adhesions and strictures were also observed in the mesentery and the small intestine. The affected small bowel was resected to prevent recurrent volvulus and other complications, such as diverticulitis, perforation, and bleeding. Following the resection of the jejunal segment with multiple large diverticula, side-to-side entero\u2013entero anastomosis was performed. No diverticula were observed in the remaining bowel.\nThe postoperative period was uneventful, and the patient was discharged from the hospital on postoperative day 6. The histopathologic evaluation of the resected material confirmed substantial jejunal diverticulosis with chronic fibrosis, adhesions, and strictures.", "summary": "An 84-year-old man was admitted to the emergency room with a 24-h history of acute colicky abdominal pain. He denied other signs or symptoms. The preoperative diagnosis based on physical and radiologic evaluations was challenging, and only diagnostic laparoscopy revealed extensive small-bowel diverticulosis. Midline laparotomy was performed as definitive surgery, revealing diverticulosis in the proximal 2-m section of the jejunum, starting approximately 20\u00a0cm from Treitz's ligament; the affected section was resected. The postoperative recovery was excellent. The histopathologic report confirmed substantial jejunal diverticulosis with chronic fibrosis, adhesions, and strictures.", "subclaim_evaluations": [ { "subclaim": "The patient is an 84-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was admitted to the emergency room.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a 24-hour history of acute colicky abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "He denied other signs or symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The preoperative diagnosis was challenging.", "support_label": "supported", "is_refined": false }, { "subclaim": "Diagnostic laparoscopy revealed extensive small-bowel diverticulosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Midline laparotomy was performed as definitive surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The affected section of the jejunum was resected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histopathologic report confirmed substantial jejunal diverticulosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histopathologic report showed chronic fibrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histopathologic report showed adhesions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histopathologic report showed strictures.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative recovery was excellent.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_541_en.txt", "fulltext": "A 35-year-old Han Chinese male football player presented with abnormal ECGs for 8 years without any evident subjective discomfort. The patient recently complained about slight exertional dyspnea with reduced sport/physical tolerance and was admitted to our hospital. This patient had been employed as a professional football player from the age of 10 years and had been a physical education teacher from the age of 26 years. He was a longtime local resident and never went to any affected areas (areas with high prevalence of infectious diseases). He reported being formerly healthy without any medical histories or current comorbidities, and he reported taking no medications. He has smoked 20 cigarettes per day for 7 years and consumed alcohol for 10 years at 100 to 250 g per day. His parents were healthy, and his family history was unremarkable. His physical examination revealed no abnormal findings. His body temperature was 36.5 \u00b0C, blood pressure was 121/73 mmHg, respiratory rate was 18 breaths/min, pulse was 69/min, heart rate was 70 beats/min, and reflexes were normal. He had no pathology reflex, and his body mass index was 22.81 kg/m2. Laboratory evaluation revealed slightly elevated cardiac troponin T level of 0.017 ng/ml, N-terminal probrain natriuretic peptide level of 291.80 pg/ml, and C-reactive protein level of 0.40 mg/L. The patient\u2019s blood lipid levels, liver function, and renal function were within the normal range with glutamic oxaloacetic transaminase level of 23 U/L, glutamic-pyruvic transaminase level of 31 U/L, alkaline phosphatase level of 84 U/L, total protein level of 67.9 g/L, albumin level of 41 g/L, globulin level of 26.9 g/L, total cholesterol level of 4.01 mmol/L, triglyceride level of 1.42 mmol/L, high-density lipoprotein level of 1.08 mmol/L, low-density lipoprotein level of 2.14 mmol/L, uric acid level of 353 \u03bcmol/L, epidermal growth factor receptor level of 105.48 ml/min/1.73 m2; serum K+ level of 4.05 mmol/L, serum Ca2+ level of 2.16 mmol/L, serum Mg2+ level of 0.88 mmol/L, and serum Na+ level of 141 mmol/L. The results of routine blood test and urinalysis were negative, thyroid function was normal, and microorganisms were not detected. Chest radiography showed an apparently normal morphology of the heart and lungs . ECGs revealed progressively deepened and widened Q waves on the II, III, and avF leads and contiguous TWIs on the I and avL leads . Echocardiography revealed an increasingly thickened interventricular septum from 10 mm to 13 mm, an enlarged left atrium and ventricle, and a reduced left ventricular ejection fraction from 73% to 63% . Coronary angiography (CAG) was performed and showed no distinct stenosis. Emission computed tomography (ECT) revealed mild myocardial ischemia of the left ventricular inferior wall . All of these clinical tests supported the diagnosis of HCM, which became gradually evident with time. For further identification, we proposed other examination techniques for this patient, including cardiac magnetic resonance imaging (CMRI) to better evaluate the left ventricular wall thickness and to identify potential areas of myocardial fibrosis, Holter monitor recordings and an exercise test to evaluate possible \u201cdynamic\u201d changes of repolarization abnormalities, as well as genetic testing. However, the patient refused all of these suggestions and was discharged. In the subsequent follow-up visits at 1 month, 3 months, and 6 months after discharge, the patient showed poor compliance and was eventually lost to follow-up.", "summary": "A young Han Chinese male football player had abnormal electrocardiograms for 8\u2009years without any subjective discomfort. Electrocardiograms revealed that T-wave inversions increased from 1\u2009mm to a maximum of 5\u2009mm on lead I and fluctuated around 5\u2009mm on lead avL. Q-wave duration ranged from 40\u2009ms to 60\u2009ms, its depth increased to a maximum of 8\u2009mm and was much greater than 40% of the R waves in depth in II, III, and avF leads. Echocardiography showed increasingly thickened interventricular septum from 10\u2009mm to 13\u2009mm, enlarged left atrium and ventricle, and reduced left ventricular ejection fraction. Coronary angiography showed no distinct stenosis. Emission computed tomography revealed mild myocardial ischemia of the left ventricular inferior wall. These unusual electrocardiogram manifestations were initially regarded as benign alterations of a highly trained athlete. Upon reviewing the clinical information and the newest criteria for electrocardiographic interpretation in athletes, hypertrophic cardiomyopathy was identified. The misreading of electrocardiograms is not uncommon, thus predisposing such patients to high susceptibility to exercise-induced sudden cardiac death.", "subclaim_evaluations": [ { "subclaim": "The patient is a young Han Chinese male football player.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abnormal electrocardiograms for 8 years.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no subjective discomfort.", "support_label": "supported", "is_refined": false }, { "subclaim": "T-wave inversions increased from 1 mm to a maximum of 5 mm on lead I.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "T-wave inversions fluctuated around 5 mm on lead avL.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Q-wave duration ranged from 40 ms to 60 ms.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Q-wave depth increased to a maximum of 8 mm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Q-wave depth was much greater than 40% of the R waves in depth in II, III, and avF leads.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Echocardiography showed an interventricular septum thickness increasing from 10 mm to 13 mm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed an enlarged left atrium.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed an enlarged left ventricle.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed reduced left ventricular ejection fraction.", "support_label": "supported", "is_refined": false }, { "subclaim": "Coronary angiography showed no distinct stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emission computed tomography revealed mild myocardial ischemia of the left ventricular inferior wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The unusual electrocardiogram manifestations were initially regarded as benign alterations of a highly trained athlete.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Hypertrophic cardiomyopathy was identified after reviewing the clinical information and the newest criteria for electrocardiographic interpretation in athletes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Misreading of electrocardiograms is not uncommon.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Misreading of electrocardiograms predisposes patients to high susceptibility to exercise-induced sudden cardiac death.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2022_en.txt", "fulltext": "A 30-year-old Han Chinese man was riding his motorcycle at 80.5km/hour when he collided with an oncoming car. He complained of back pain and right shoulder pain and was admitted to a local hospital. He sustained double inferior lung contusion with a few hemothoraces, fractures of right clavicle and vertebrae T6 to T7 inclusive. After 6 hours, he was transferred to our hospital. On clinical examination, there was no neurological deficit. A three-dimensional reconstruction of computed tomography showed spinal fracture-dislocation of T6 to T7 , a fracture of right clavicle whereas fracture of ribs was not found , magnetic resonance imaging showed spinal fracture-dislocation of T6 to T7 , horizontal computed tomography scans showed a large bilateral hemothorax , fractures of bilateral pedicles of vertebral arch , three vertebral levels in one cut , and anteroposterior thoracic spine plain X-ray showed spinal fracture-dislocation of T6 to T7 and realignment of his fractured-dislocated spine .\nDespite the normal neurological systems below T7, the spine was considered unstable and an operation was planned. Chest drains were inserted bilaterally. A day later, the patient was put in the prone position under general anesthesia, the fascia was opened and his paravertebral muscles were dissected following a midline vertical incision of T4 to T11; the right pedicle of the T8 vertebra and the right lamina of the T6 vertebra were found to be fractured. Laminectomy of the T6 to T7 vertebra was done. The dura and spinal cord were found to be normal. Then the spinal canal was examined with a rubber catheter and found to be good. Transpedicular screws were put in the T5, T6, T9 and T10 vertebrae. Realignment of the thoracic spine was achieved with rods. Bony fusion of the transverse processes of the T5, T6, T7 and T8 vertebrae was done. The fracture of his right clavicle was also reduced and autologous bone graft was performed too. His nervous system was intact postoperatively. He was discharged on the 10th day after his operation. He was very well at the follow-up examination 3 months later.", "summary": "A 30-year-old Han Chinese man had T6 to T7 vertebral fracture and anterolateral dislocation without neurological symptoms and costal fractures. The three-dimensional reconstruction by computed tomography and magnetic resonance imaging indicated the injuries in detail. A patient with thoracic spinal fracture-dislocation without neurological symptoms inclines to further dislocation of the spine and secondary neurological injury; therefore, laminectomy, reduction and internal fixations with rods and screws were done. The outcome was good. Severe spinal fracture-dislocation without neurological symptoms should be evaluated in detail, especially with three-dimensional reconstruction by computed tomography. Although treatment is individualized, reduction and internal fixation are advised for the patient if the condition is suitable for operation.", "subclaim_evaluations": [ { "subclaim": "The patient is a 30-year-old Han Chinese man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had T6 to T7 vertebral fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had anterolateral dislocation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had no neurological symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had costal fractures.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Three-dimensional reconstruction by computed tomography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three-dimensional reconstruction by magnetic resonance imaging was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The three-dimensional reconstructions indicated the injuries in detail.", "support_label": "supported", "is_refined": false }, { "subclaim": "A patient with thoracic spinal fracture-dislocation without neurological symptoms inclines to further dislocation of the spine.", "support_label": "supported", "is_refined": false }, { "subclaim": "A patient with thoracic spinal fracture-dislocation without neurological symptoms inclines to secondary neurological injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laminectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reduction was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Internal fixation with rods and screws was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The outcome was good.", "support_label": "supported", "is_refined": false }, { "subclaim": "Severe spinal fracture-dislocation without neurological symptoms should be evaluated in detail.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three-dimensional reconstruction by computed tomography is advised for evaluation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Treatment is individualized.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reduction and internal fixation are advised if the condition is suitable for operation.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_3178_en.txt", "fulltext": "A 74-year-old woman was referred from the Department of Dermatology and Venereology to the Department of Oral Medicine Dr. Hasan Sadikin Hospital, Bandung. The patient has been hospitalized for 4 days and has been given dexamethasone 5 mg intravenously, cetirizine 10 mg tablets, and clindamycin tablets 300 mg. Based on the anamnesis, blisters on the skin that felt burning, sore, and itchy first appeared 1 week ago. Complaints of the painful canker sores in the oral cavity began to appear 2 days ago. The patient experienced of intense pain during the day. She has no medical history of any systemic disease and does not take any medication. Extraoral examination revealed a symmetrical face and the regional lymph nodes were not palpable and painless. She had multiple crusts on the neck, buttocks, and upper and lower extremities.\n\nIntraoral examination showed erosion covered by a yellowish white layer on the right and left buccal mucosa, haemorrhagic purpura on the right and left buccal mucosa and right lateral tongue, an ulcer with a diameter of 0.5 cm on the left lateral border of the tongue, and the root remnants of 12, 14, 15, 16, 17, 26, 27, 33, 34, 35, and 36 teeth. Hematology tests revealed increased values of leukocytes (15.93 x 103/\u00b5L), eosinophils (6%), and segmental neutrophils (77%). A skin biopsy of the lesion on the left thigh was performed to establish a definitive diagnosis. The results of histopathological examination showed a formation of a subepidermal blister containing eosinophil and neutrophil cells.\n\nBased on anamnesis, clinical examination, and appropriate investigations, the definitive diagnosis was oral lesions associated with dermatitis herpetiformis with a differential diagnosis of pemphigoid bullosa and linear IgA dermatoses. Additional diagnoses were exfoliative cheilitis, chronic traumatic ulcer on the left lateral border of the tongue, chronic apical periodontitis et causa the root remnants of 12, 14, 15, 16.17, 26, 27, 33, 34, 35, 36, and generalized chronic marginal gingivitis. The therapies provided by the Department of Oral Medicine including 0.025% hyaluronic acid mouthwash and petroleum jelly. Patients were instructed to brush their teeth regularly, not consume gluten-containing foods, rinse their mouths using 0.025% hyaluronic acid mouthwash three times a day, and apply petroleum jelly to moisturize the lips. Patients are also advised to do scaling and extraction of the tooth remnants of the upper and lower teeth. The prognosis of this case is good.\n\nThe oral lesions showed significant improvement at the second visit, 10 days after treatment. Erosive lesions in the oral cavity began to heal. She felt no pain at all and had no difficulties in eating solid foods. The patient uses 0.025% hyaluronic acid mouthwash and petroleum jelly regularly.\n\nThe patient was being infected with COVID-19 two months later and was treated in the COVID-19 isolation room at the Hasan Sadikin General Hospital in Bandung for 1 week. She experienced the typical symptoms of COVID-19 (fever, muscle aches, and shortness of breath) and decreased oxygen saturation (87.3%). Acute exacerbations of dermatitis herpetiformis lesions on the skin and perioral occurred after the patient was infected with COVID-19. Extraoral examination revealed crusts on the perioral, erosive lesions covered by white-yellowish plaque on the vermillion border of the upper lip. Laboratory tests revealed anti-SARS-CoV-2 IgG S-RBD values (>40,000 AU/mL), eosinophils (6%), total eosinophils (0.50 x 103/\u00b5L), C-reactive protein (2 mg/dl), quantitative D-dimer (3.72 \u00b5g/mL) during hospitalization. Chest X-ray image depicted a ground-glass appearance from the mid to the lower right lung. The patient was diagnosed with right bronchopneumonia.\n\nThe intraoral lesions healed after a month of the treatment. The patient admitted that she has avoided foods containing gluten and routinely uses medicines provided by the Department of Oral Medicine. There were no adverse events or unwanted reactions from the drugs that she had been consumed. Follow-up therapy from the Department of Dermatology and Venereology includes methylprednisolone tablets (24 mg/day), cetirizine 10 mg tablets, and ranitidine 150 mg tablets. The patient was approved and written informed consent of this case including the images, and the institution has also approved for publication.", "summary": "A 74-year-old woman was referred to the Oral Medicine Department with a chief complaint of the blisters on the skin for a week and ulcers in the oral cavity appeared two days ago. Extraoral examination revealed crusts on the neck and extremities. The lips appeared dry and desquamative. Intraoral examination revealed erosive lesions covered with a white-yellowish plaques on the right and left sides of the buccal mucosa, an ulcer with a diameter of 0.5 cm, and purpura hemorrhagic on left buccal mucosa and right lateral border of the tongue. Histopathological examination of the skin lesion revealed a subepithelial blister with eosinophils and neutrophil cells. The definitive diagnosis of dermatitis herpetiformis was made. She was given 5 mg intravenous dexamethasone, cetirizine 10 mg, and clindamycin 300 mg by the dermatologist. We gave hyaluronic acid 0.025% mouthwash for oral ulcers and petroleum jelly for the lips. The oral lesions had significant improvement after 4 weeks of treatment. Two months later, the patient experienced acute exacerbation after being infected with COVID-19 (anti-SARS-CoV-2 IgG S-RBD >40,000 AU/mL). The oral lesions healed after a month of treatment.", "subclaim_evaluations": [ { "subclaim": "The patient is a 74-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was referred to the Oral Medicine Department.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her chief complaint was blisters on the skin for a week.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oral ulcers appeared two days before the visit.", "support_label": "supported", "is_refined": false }, { "subclaim": "Extraoral examination revealed crusts on the neck and extremities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lips appeared dry and desquamative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraoral examination showed erosive lesions covered with white-yellowish plaques on the buccal mucosa.", "support_label": "supported", "is_refined": false }, { "subclaim": "An ulcer with a diameter of 0.5 cm was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "Purpura hemorrhagic was observed on the left buccal mucosa.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination showed a subepithelial blister.", "support_label": "supported", "is_refined": false }, { "subclaim": "The definitive diagnosis was dermatitis herpetiformis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received 5 mg intravenous dexamethasone.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was given cetirizine 10 mg.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was given clindamycin 300 mg.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hyaluronic acid 0.025% mouthwash was prescribed for oral ulcers.", "support_label": "supported", "is_refined": false }, { "subclaim": "Petroleum jelly was given for the lips.", "support_label": "supported", "is_refined": false }, { "subclaim": "The oral lesions showed significant improvement after 4 weeks of treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Two months later, the patient experienced an acute exacerbation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The exacerbation occurred after infection with COVID-19.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anti-SARS-CoV-2 IgG S-RBD level was >40,000 AU/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The oral lesions healed after a month of treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1030_en.txt", "fulltext": "A 42-year-old man, previously healthy, was living with his step father and other members of an extended family in a small farm. He presented with a first episode of a motor seizure that started on the left side of his body before becoming generalized. Shortly afterwards, he noticed left hemiparesis and dysarthria; he was admitted to our institution through the emergency department.\nAfter a physical examination, magnetic resonance imaging (MRI) of the patient revealed a well-defined, spherical lesion, located in the superior aspect of the anterior limb of the internal capsule and right striatum, with surrounding edema . Laboratory studies found no systemic compromise and no underlying immunocompromise. We decided to excise and analyze the aforementioned lesion. Performing an image-guided frontal craniotomy, using the Leksell Stereotactic G-Frame (Elekta Instruments AB, Stockholm, Sweden), we planned the trajectory to avoid the head of the caudate nucleus, the genu of the internal capsule, the putamen, and other critical structures. The mass was completely excised and the thalamostriate vein, which was adhered to the mass, was preserved. Craniotomy was performed, instead of a stereotactic biopsy, because we suspected the lesion to be a high-grade glioma that was accessible to surgical resection.\nIn the pathological analysis, there was an evident atypical T and B infiltrate; morphological and phenotypical characteristics of Grade 1 lymphomatoid granulomatosis. The patient was subjected to thoracic and abdominal screening, which revealed paratracheal, jugular, and inguinal adenopathies, but no other masses.\nAfter consulting with the hematology group, the patient received a four-cycle medical treatment with rituximab and prednisone. Clinically, he recovered almost completely with strength of 4/5 and complete reintegration to his daily activities, which involved bimanual work. Six months after his diagnosis, a new MRI showed the absence of new or residual lesions.\nTwo years after the surgery the patient continued to be free of seizures, and his MRI showed no evidence of new lesions, areas of restriction of diffusion, or anomalous enhancements that could indicate residual or recurrent tumor .", "summary": "A 42-year-old male presented with motor seizures and loss of consciousness for 10 minutes along with dysarthria and left hemiplegia. Neurological examination and imaging with magnetic resonance imaging (MRI) of the brain revealed a mass in the right striatum. The patient was hospitalized and underwent an image-guided right frontal craniotomy using the Leksell Stereotactic G-Frame. Pathology reported a lymphomatoid granulomatosis. Being immunocompetent, the patient received medical treatment with prednisone and rituximab. Two years after his diagnosis, the patient had no active disease and his brain MRI did not show contrast enhancement. After almost 3 years of follow-up, the patient has a mild weakness in the left-side of his body (4/5), is seizure-free, and can walk and perform daily activities.", "subclaim_evaluations": [ { "subclaim": "The patient is a 42-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had motor seizures.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient lost consciousness for 10 minutes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had dysarthria.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had left hemiplegia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "MRI of the brain showed a mass in the right striatum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent an image-guided right frontal craniotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Leksell Stereotactic G-Frame was used during the craniotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathology reported lymphomatoid granulomatosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was immunocompetent.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received prednisone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received rituximab.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two years after diagnosis, the patient had no active disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two years after diagnosis, brain MRI did not show contrast enhancement.", "support_label": "supported", "is_refined": false }, { "subclaim": "After almost 3 years of follow-up, the patient has mild left-side weakness (4/5).", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After almost 3 years of follow-up, the patient is seizure-free.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After almost 3 years of follow-up, the patient can walk.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_2962_en.txt", "fulltext": "A 52-year-old female was referred to our ophthalmology clinic with decreased vision and increased tearing.\nShe was diagnosed with stage III Alport syndrome two years prior which was currently stable per her nephrologist. During these two years had gradual decline in her visual acuity that was not correctable to 20/20.\nShe had a past medical history of asthma, diabetes mellitus, and hypertension.\nFamily history was positive for Alport syndrome in her mother and brother but without any known ocular or hearing abnormalities.\nOn initial examination , uncorrected distance visual acuity was 20/60 on the right and 20/30 on the left, with a corrected visual acuity of 20/30 bilaterally.\nSlit lamp examination showed bilateral eyelid laxity, papillary conjunctival changes, prominent nerves, superficial punctate keratitis, unilateral (OD) anterior basement membrane changes, with no guttata, apical scarring, or corneal striae. Dilated fundus exam revealed bilateral floaters in the vitreous humor and normal retinal vasculature.\nInitial Pentacam (Oculus, Wetzlar, Germany) tomography revealed mean keratometry of 47.9 D in the right and 48.3 D in the left, with a 2 mo follow-up scan revealing a mean keratometry of 48.1 D and 48.5 D respectively . During this 2 mo period progressive corneal thinning occurred bilaterally. There was also bilateral anterior curvature steepening with no appreciable changes in the posterior curvature.", "summary": "A 52-year-old female was referred to our ophthalmology clinic with decreased vision and increased tearing. She was diagnosed with stage III Alport syndrome two years prior. Upon examination she was found to have average keratometries of 48 D bilaterally with tomographic evidence of keratoconus.", "subclaim_evaluations": [ { "subclaim": "The patient is a 52-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was referred to an ophthalmology clinic.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported decreased vision.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported increased tearing.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with stage III Alport syndrome two years prior.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had average keratometries of 48 D bilaterally.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tomographic evidence showed keratoconus.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2098_en.txt", "fulltext": "In May 2018, a 43-year-old Chinese man was admitted to our hospital with lumbago and inguinal lymph node enlargement. Figure summarizes the important events of this patient according to the timeline. The blood routine examination showed an increase in lactate dehydrogenase (LDH; 887 U/L) and a decrease in hemoglobin (Hb; 105 g/L). PET/CT showed multiple lymph nodes enlargements, including a large abdominal mass which was 13.9 \u00d7 10.6 cm in size, together with multiple bone lesions. The biopsy of cervical lymph node demonstrated that the lymph node structure was destroyed completely, which was mainly composed of small to medium-sized lymphocytes with round or slightly irregular nucleus, deeply stained chromatin, inconspicuous nucleoli, scant pale cytoplasm and rare apoptosis . Also, significant hyperplasia of large cells with centroblastic and immunoblastic morphology was seen in the focal areas, with large and round nucleus, condensed chromatin, one or more small nucleoli . Immunohistochemical (IHC) staining demonstrated the cells were positive for CD20 , CD19, CD10, BCL6 , BCL2 and negative for TdT , C-MYC, Cyclin D1, SOX11, CD23, LEF1, CD21, CD43, CD3, CD5 and EBER. Ki-67 was 10% in small cell areas and 40% in large cell areas. Fluorescence in situ hybridization (FISH) showed the cells were positive for BCL2::IGH fusion , without translocation of MYC or BCL6 . Also, the biopsy of bone marrow was performed, and we observed the hyperplasia was extremely active with almost no adipose tissue, and the central mother large cells presented a diffuse growth pattern. The IHC result demonstrated that the cells were positive for CD19, CD20, CD79a, CD10, MUM1, Ki-67, BCL6, C-MYC and BCL2, while negative for CD3 and TdT. Thus, this patient was diagnosed with low grade FL (account for 80%) combined with DLBCL (20%) at a stage of IVB, and given R-CHOP regimen (rituximab, cyclophosphamide, doxorubicin, vindesine, prednisone). After 1 cycle of R-CHOP treatment, lumbago was significantly relieved and the treatment regimen was changed to HD-MTX (high dose methotrexate) combined with 80% dose R-EPOCH (rituximab, cyclophosphamide, doxorubicin, vindesine) due to the high IPI (international prognostic index) score of 4. The abdominal mass reduced to 7.5 \u00d7 3.5 and this patient achieved partial remission (PR) following 1 cycle of HD-MTX/R-EPOCH treatment. In the following 5 cycles of HD-MTX/R-EPOCH treatment, the abdominal mass was treated with additional 30 Gy radiotherapy. However, multiple masses in the abdominal cavity, many nodules around both kidneys and the right adrenal gland, were found after 6 cycles of the treatment, together with the increased glucose metabolism. Thus, he achieved progression disease (PD).\nIn Jan. 2019, a fine needle aspiration biopsy of the abdominal mass was taken. The biopsy demonstrated that the tumor cells presented with diffuse growth pattern, mainly composed of uniformly medium-sized blastoid cells with round or slightly irregular nuclei, dispersed chromatin, unclear nucleoli and scant bluish-grey cytoplasm . The cells were negative for CD20 , BCL6 and CD3 staining, while positive for TdT (Fg. I), PAX5, CD38, CD10, BCL2, C-MYC and MUM1 staining. Ki-67 was about 60%. FISH revealed fusions of BCL2::IGH and translocation of MYC , without BCL6 translocation . According to the 5th WHO classification, a diagnosis of TdT positive HGBL with MYC and BCL2 rearrangements (\u201cdouble hit\u201d) transformed from FL/DLBCL was made after 8 months of FL/DLBCL confirmation. Then, chidamide and pembrolizumab were given and the disease was mitigated, but he discontinued chemotherapy for 3 months due to the COVID-19 pandemic, and the disease progressed. The biopsy of the abdominal neoplasm was taken once again in Apr. 2020, and the diagnosis of TdT positive \u201cdouble hit\u201d HGBL remained valid. This patient died in Jul. 2021, with an OS time of 37.8 months.\nTo further understand the pathogenesis of TdT positive \u201cdouble hit\u201d HGBL after the treatment of FL/DLBCL, the targeted sequencing of 571 lymphoma-related genes (Supplementary Table 1) were carried out on Nova-seq (Illumina, San Diego, CA, USA). Variants, including SNVs (single nucleotide variations) and Indels (Insertion and deletion) were screened by Shanghai Rightongene Biotechnology Co., Ltd. (Shanghai, China) based on the following filter conditions: (1) SNVs or Indels with a mutation allele frequency (MAF) \u2265 0.001 in databases of 1000 genomes project , 1000 genome East Asian, ExAC all or ExAC East Asian and gnomAD were removed; (2) SNVs or Indels with a variant allele frequency (VAF) \u2265 5% was retained; (3) SNVs or Indels including stopgain, stoploss, frameshift, non-frameshift and splicing sites were retained; and (4) Missense mutations with sift \u2264 0.05, Polyphen2_HVAR_pred \u2265 0.447 and CADD > 4 were retained. KMT2D, FOXO1, CREBBP, ATM, STAT6, BCL7A, DDX3X, MUC4, FGFR3, ARID5B, DDX11 and PRKCSH were the co-mutations detected in both the primary and transformed tissues, while mutations in CCND3, BIRC6, ROBO1 and CHEK2 genes emerged when transformed into HGBL .", "summary": "This is a 43-year-old Chinese man who was diagnosed with low grade FL (account for 80%) combined with DLBCL (20%) at a stage of IVB. The patient presented with BCL2/IGH translocation without MYC rearrangement, as well as the expressions of CD20, CD19, CD10 and BCL2 at the initial diagnosis of FL/DLBCL. MYC rearrangement and TdT expression occurred after the treatment. The targeted sequencing revealed mutations in KMT2D, FOXO1, CREBBP, ATM, STAT6, BCL7A, DDX3X, MUC4, FGFR3, ARID5B, DDX11 and PRKCSH genes were the co-mutations shared by the FL/DLBCL and TdT positive \"double hit\" HGBL, while CCND3, BIRC6, ROBO1 and CHEK2 mutations specifically occurred after the treatment. The overall survival time was 37.8 and 17.8\u00a0months after the initial diagnosis of FL/DLBCL and TdT positive \"double hit\" HGBL, respectively.", "subclaim_evaluations": [ { "subclaim": "The patient is a 43-year-old Chinese man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with low grade FL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The FL accounts for 80% of the tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with DLBCL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The DLBCL accounts for 20% of the tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The stage at diagnosis was IVB.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had BCL2/IGH translocation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no MYC rearrangement at initial diagnosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had CD20 expression at initial diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had CD19 expression at initial diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had CD10 expression at initial diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had BCL2 expression at initial diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "MYC rearrangement occurred after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "TdT expression occurred after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in KMT2D.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in FOXO1.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in CREBBP.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in ATM.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in STAT6.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in BCL7A.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in DDX3X.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in MUC4.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in FGFR3.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in ARID5B.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in DDX11.", "support_label": "supported", "is_refined": false }, { "subclaim": "Targeted sequencing revealed mutations in PRKCSH.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mutations in KMT2D, FOXO1, CREBBP, ATM, STAT6, BCL7A, DDX3X, MUC4, FGFR3, ARID5B, DDX11, and PRKCSH were shared by FL/DLBCL and TdT positive 'double hit' HGBL.", "support_label": "supported", "is_refined": false }, { "subclaim": "CCND3 mutations specifically occurred after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "BIRC6 mutations specifically occurred after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "ROBO1 mutations specifically occurred after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "CHEK2 mutations specifically occurred after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The overall survival time after the initial diagnosis of FL/DLBCL was 37.8 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The overall survival time after the diagnosis of TdT positive 'double hit' HGBL was 17.8 months.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2135_en.txt", "fulltext": "A 69-year old female patient, with a previous history of hypertension, thyroidectomy due to hyperthyroidism and hysterectomy for uterus myomas, presented with a progressive swelling of the dorsal aspect of the right side of her neck without signs of vascular obstruction or venous stases. No abnormalities of neural status of the head and neck were observed. There was no functional or sensory loss of the right upper extremity. No signs of Horner's syndrome, dysphagia, cough or dyspnoe were evident. CT scan demonstrated a retroclavicular soft tissue tumour with a cranio-caudal extension of up to 4.5 cm which partially displaced the trachea to the left and compressed the subclavian vein. An adjacent tumour of dimensions 3.5 \u00d7 3.5 cm not clearly separated from the before mentioned tumour was located at the inferior right thyroid lobe, compressing the internal jugular vein. Near the confluence of these vessels a subtotal occlusion of the brachiocephalic vein is revealed . The MRI scan added no further information on the origin of the tumour or the cause of venous occlusion. There were no clear signs of tumour infiltration of the brachial plexus, brachial artery, esophagus or trachea. The preoperative chest x-ray displayed a right sided upper mediastinal enlargement . Additional venous angiography indicated a filiform stenosis of the subclavian vein. Within the brachicephalic vein a longitudinal, irregular partial displacement of the vascular lumen was depicted. Extensive blood flow in cervical and supraclavicular collateral vessels was present. Neither MRI, CT nor angiogram allowed for clear distinction of the intravascular process whether it was caused by intravascular tumour growth or thrombosis. Incisional biopsy one month prior to the oncological tumour resection revealed the histopathological diagnosis of a leiomyosarcoma.\nSurgical exposure was obtained via a triangular incision running from behind the right ear, along the anterior axillary line and across the sternum. First, the brachial plexus was dissected, the phrenic and recurrent nerves identified and followed distally. The upper border of the tumour became visible at the upper thoracic aperture. The recurrent nerve was observed to run through the tumour capsule. Further preparation was carried out from the distal edge of the wound. The pectoralis major muscle was elevated and care was taken to preserve the vascular pedicle (thoracoacromial A.V.). It was further observed that the first intercostal space was invaded by the tumour. Subsequently a thoracic wall resection including a partial resection of the right clavicle, the right half of the sternum and the costal attachment of the first three ribs was performed uncovering the mediastinum. The vena cava was revealed and trachea dissected. In this area the tumour was in close proximity to the trachea displacing it to the left but without tracheal infiltration. Next, the carotic artery and the jugular vein were exposed.\nThe tumour, located in the right supraclavicular region/upper mediastinum, was found to surround both the subclavian and the internal and external jugular vein. Hence a resection of the subclavian vein proximal to its conjunction with the superior vena cava was required. The internal as well as the external jugular vein were incorporated into the tumour conglomerate . The tumour was resected en bloc. A partial resection of the clavicle, partial resection of the sternum with removal of the brachiocephalic, sublcavian and right jugular vein and the recurrent nerve was necessary to obtain clear resection margins. The defect coverage was achieved by a pedicled myocutaneous pectoralis major island flap.\nWithin the surgical specimen multiple nodular polypoid tumour masses of soft consistence with diameters of up to 3.6 cm, immediately adjacent to vascular structures of the subclavian, internal jugular and brachiocephalic vein were present. The tumour with its intravascular and extravascular components comprised a total area of 7.6 \u00d7 8 \u00d7 3.3 cm. The largest intravascular tumour sprout extended close to the resection surface of the vessel.\nThe macroscopic appearance resembled an intravascular tumour originating from the subclavian vein with infiltration of extravascular structures.\nMicroscopically the spindle-shaped cells of this mesenchymal neoplasm originated from the media of the venous vessel wall . The tumour cells formed various fascicles interwoven with other longitudinal cross sectional neighbouring fascicles . The tumour cells were characterized by an eosinophilic cytoplasm and cigar shaped nuclei. The mitotic rate was 19/10 HPF (per high power field). Some foci of tumour necrosis were present.\nThe neoplasm derived from the media of the vessel wall, disrupted the existing vascular architecture and formed an intravascular tumour sprout.\nImmunohistochemically the majority of tumour cells were positive for smooth muscle actin and desmin. A positive reaction for the proliferation marker Ki 67 was found in 25% of all tumour cells,\nThus confirming the diagnosis of an intravascular leiomyosarcoma (malignancy grading GII)\nPostoperatively only mild signs of mixed venous and lymphatic stases of the upper extremity following the resection of the subclavian vein were observed due to the well established collateral blood flow (as seen in the preoperative angiogram). These symptoms could be positively influenced by elastic compression dressings and physical lymph drainage. Owing to the resection of the right recurrent nerve, right sided vocal cord palsy occurred. Logopaedic training was initiated. The patient recovered well and was discharged two weeks later. Both pre- and post-operatively no symptoms of pulmonary embolism were detected.\nUnfortunately the patient declined the recommended radiation therapy.\nAfter an initial 5 month of tumour free survival without evident signs of either local or systemic metastasis a tumour relapse was detected. At this stage the patient refused further treatment apart from a palliative chemotherapy.", "summary": "A 69-year old patient presented with a biopsy proven leiomyosarcoma of the right supraclavicular region. Tumour resection and histological assessment verified the intravascular tumour origin arising from the internal jugular vein and extending into the surrounding soft tissue.", "subclaim_evaluations": [ { "subclaim": "The patient is 69 years old.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a biopsy-proven leiomyosarcoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The leiomyosarcoma is located in the right supraclavicular region.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumour resection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histological assessment was conducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumour originated from the internal jugular vein.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumour extended into the surrounding soft tissue.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1511_en.txt", "fulltext": "A 39-year-old woman was admitted to our hospital for a laparoscopy-assisted vaginal hysterectomy under general anaesthesia (induced with midazolam, fentanyl and propofol, and maintained with sevoflurane in oxygen/air mixture). The patient reported an unremarkable medical and family history and stated that she had never smoked. She also denied the following: (a) regular exposure to environmental tobacco smoke (at home or at her workplace), (b) abuse of illicit or recreational drugs, (c) food or medication allergies, (d) recent camping or wild animal contact. A more detailed history revealed that the patient was otherwise healthy and had taken no medications prior to the present illness. Three days after her surgery (with prophylactic ampicillin/sulbactam administered as i.v. bolus), the patient experienced acute epigastric pain with vomiting and diarrhoea along with dyspnea that gradually increased in severity. The patient had a temperature of 38.2\u00b0C, blood pressure of 90/60 mmHg, hearth rate of 120 beats/min, and respiratory frequency of 30 breaths/min. Inspection of her thorax revealed decreased movement of the chest wall, a hyperresonant percussion note, diminished fremitus and reduced breath sounds on the right side. The abdominal examination showed distension, guarding, and diffuse tenderness. The patient\u2019s physical signs and radiographic findings were compatible with peritonitis and pneumothorax; the laboratory examination revealed a leukocyte count of 2,100 cells/\u03bcL, with 84% neutrophils and 3% eosinophils. A laparotomy revealed purulent fluid throughout the abdominal cavity, which was associated with fibrinous plaques covering most of the abdominal viscera; these findings were the result of a rectal perforation. A perforation closure was performed and peritoneal toilets (a 9-day-toilet plan) were initiated. The pneumothorax was managed with a thoracostomy tube drainage. The patient was admitted to the intensive care unit (ICU) and began an empirical treatment with piperacillin and tazobactam. On the day of admission, an arterial blood analysis yielded PaO2 of 67 mmHg and SaO2 of 91.2% on ambient air. Non-invasive ventilation was started under moderate sedation with propofol. In the meantime, Enterococcus and Escherichia coli were cultured from the peritoneal exudate. On the seventh postoperative day, the patient\u2019s clinical condition worsened, with increasing intra-abdominal fibrinous adhesions and paralytic ileus; the previous treatment was discontinued and an empirical administration of imipenem was begun on the conjecture of possible resistant enterococci. On the tenth postoperative day, she developed a new spontaneous pneumothorax on the right side , with respiratory rate increased to 28 breaths/min; the pathological event was managed with a thoracostomy tube drainage. Because the patient\u2019s clinical condition were worsened, imipenem was discontinued on the twelfth day and substituted with tigecycline based on the antibiotic-sensitivity results for Enterococcus faecium isolated from the peritoneal toilet on the tenth postoperative day. On the eighteenth postoperative day, the patient\u2019s respiratory distress increased (34 breaths/min and SaO2 of 88% with 6 L/min supplemental oxygen), her temperature was 37.6\u00b0C, her hearth rate 110 beats/min and her leukocyte count 19,400 cells/\u03bcL (neutrophils 86%; eosinophils 2%). Computed tomography (CT) of the chest revealed an abundant left-sided pleural effusion pressing on the lower pulmonary lobe, and multiple areas of alveolar infiltrates in the upper and middle right pulmonary lobes. The serology (hepatitis B virus, hepatitis C virus, human immunodeficiency virus, Cytomegalovirus, Chlamydia and Mycoplasma) eventually proved negative. Antinuclear antibody, anti-neutrophil cytoplasmatic antibody and rheumatoid factors were negative or non-specific. The levels of immunoglobulin [Ig] G, IgA, IgM, complement C3 and C4 were within the normal limits, and the IgE concentration was 112 kU/L. The CD4+/CD8+ T lymphocytes ratio was 1.7; since this value is usually significantly decreased in patients with various types of respiratory viral infections, the presence of influenza virus and/or bocavirus was not investigated.\nThe blood cultures for aerobic and anaerobic bacteria remained sterile. No pneumocystis was detected by polymerase chain reaction. The patient was then empirically treated withceftazidime and clarithromycin for atypical pneumonia, on the basis on the radiographic findings. Despite these measures, she did not improve and continued to have fever, with a temperature of approximately 37.5\u00b0C and mild leukocytosis. On the twenty-fifth postoperative day, a chest CT scan demonstrated a left-sided pneumothorax with dense consolidations of the left upper and middle pulmonary lobes along with multiple areas of alveolar infiltrates in the upper and middle right pulmonary lobes. As the patient gradually became more dyspneic and hypoxic, she was placed under ventilation with continuous positive airway pressure. Instead of previous antibiotics, rifampicin and moxifloxacin were administered because of a positive test for Legionella, which, however, was refuted by laboratory on the following day. Because the patient\u2019s respiratory failure further worsened, the previous treatment was discontinued and empirically substituted with three broad-spectrum antibiotics (linezolid, meropenem and moxifloxacin). Eosinophilic pneumonia was suspected when she showed no response to antibiotics within the next 2 days. Bronchoscopy demonstrated inflamed mucosa in both upper lungs with thick secretions in both lower lungs, and many nucleated cells (including 56% eosinophils) were detected in BAL fluid. These findings unequivocally supported a diagnosis of AEP, and parenteral methylprednisolone was initiated. Significant recovery occurred within the next 24 h, so the antibiotics were discontinued. The clinical symptoms further subsided and the patient was successfully extubated within 2 days after the initiation of steroids. The laboratory data and chest radiology revealed marked improvement. After 20 days in the surgery department, the patient was discharged with a course of oral prednisone that was tapered for 14 days. At 1 year following surgery, the patient did not have any recurrence of her pulmonary symptoms or infiltrates.", "summary": "A 39-year-old German woman was admitted to our hospital for a laparoscopy-assisted vaginal hysterectomy under general anaesthesia. The surgical intervention was followed by peritonitis in the early postoperative course. Following anaesthesia induction with propofol/midazolam and during the prolonged therapy with several broad-spectrum antibiotics, she developed AEP and three spontaneous (one left-sided and two right-sided) pneumothoraces, the latter ones observed in quick succession. Symptoms, laboratory markers, and chest radiology significantly improved after a one-day treatment with methylprednisolone.", "subclaim_evaluations": [ { "subclaim": "The patient is a 39-year-old German woman.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She was admitted for a laparoscopy-assisted vaginal hysterectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was performed under general anaesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She developed peritonitis in the early postoperative course.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anaesthesia was induced with propofol and midazolam.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received prolonged therapy with several broad-spectrum antibiotics.", "support_label": "supported", "is_refined": false }, { "subclaim": "She developed AEP.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had three spontaneous pneumothoraces.", "support_label": "supported", "is_refined": false }, { "subclaim": "One pneumothorax was left-sided.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Two pneumothoraces were right-sided.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right-sided pneumothoraces occurred in quick succession.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with methylprednisolone for one day.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms improved after one day of methylprednisolone treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory markers improved after one day of methylprednisolone treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest radiology improved after one day of methylprednisolone treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2596_en.txt", "fulltext": "A 67 years-old Tujia nationality man was admitted to our institution in June 2022 with a history of dysphagia, slight chest pain when obstruction, and dyspnea when climbing stairs or going uphill. Gastroscope showed that a new organism which was 29 to 35 cm away from the esophagus could be seen protruding from the lumen, with rigid wall, central ulceration, covered with filthy moss, brittle texture, and easy to bleed when touched. Then he was diagnosed with esophageal squamous cell carcinoma by endoscopic biopsy. On June 14th, echocardiography revealed the presence of an intracardiac mass inside the right ventricle . The echocardiography showed there is a slight increase in echogenicity in the right ventricle, and considering the possibility of an embolus based on medical history, a space occupying lesion needs to be excluded, further examination is recommended; widening of the aortic sinus and ascending part; mild symmetrical thickening of the left ventricular wall; mitral valve, tricuspid valve, aortic valve, pulmonary valve local regurgitation; left ventricular diastolic dysfunction. Then thoracic computed tomography was requested for a better assessment about the mass intracardiac . The thoracic computed tomography results were as follows: Space occupying lesions in the middle and lower thoracic segments of the esophagus. Considering the possibility of esophageal cancer, multiple lymph nodes in the mediastinum are shown, follow-up is recommended. There are scattered solid and sub-solid nodules in both lungs, and metastatic tumors need to be excluded. It is recommended to follow up closely. Double emphysema; there is a little chronic inflammation in the medial segment of the middle lobe of the right lung, the lower lingual segment of the upper lobe of the left lung, and the lower lobe of both lungs. Right ventricular filling defect shadow, considering thrombosis, reexamination is recommended.\nOverall, the mass was suspected to be tumor or embolus. Hypersensitive D dimer is 543 ng/mL and Color Doppler ultrasound of blood vessels in extremities showed no thrombus. We chose to treat esophageal cancer first after multi-department consultation and communication with the patient family. On June 17th, 2022, single drug chemotherapy of pabolizumab 200 mg\u2005+\u2005albumin paclitaxel 400 mg was performed successfully. After treatment, swallowing obstruction and chest pain slightly improved but the patient developed skin itching and rash.\nOn June 21st, Review color ultrasound showed a right intraventricular mass (48\u2005\u00d7\u200517 mm) , the boundary is clear, the shape is regular, and the base is wide. It swings with the heart beating. Part of the echo located in the outflow tract of the right ventricle, and part of the outflow tract is about 10.3 mm wide. After the consultation of cardiac surgery in our hospital, the patient underwent cardiac tumor resection and intraoperative frozen biopsy on June 27, 2022. The surgical process is as follows: after successful tracheal intubation under general anesthesia, the patient is placed in a flat position, with a jugular vein catheter, a radial artery catheter, and a urinary catheter. After routine iodine disinfection, the patient is covered with a cloth. The sternum is incised in the middle of the sternum, and the skin is cut subcutaneously. The sternum is longitudinally sawn, bone wax is used to stop bleeding, the sternum is opened, and a pericardium is cut. The patient is suspended, and the ascending aorta is intubated, the superior and inferior vena cava is intubated, and the left atrium is intubated. Extracorporeal circulation is established routinely. After cardiac arrest, cut open the right atrium and conduct intracardiac exploration: The tumor is located on the anterior wall of the right ventricle, widely distributed from the apex to the distal end of the right ventricular outflow tract. The surface of the tumor is uneven, crispy, and the base is wide. The pulmonary artery trunk is blocked, and the tumor is gradually removed. A small amount of tumor tissue is taken and sent for intraoperative frozen pathological examination. The heart cavity is repeatedly rinsed with ice and saline, and the pulmonary artery blocking forceps are removed. No tumor tissue is found in the pulmonary artery during exploration. The intraoperative frozen pathological report is \u201cmetastatic malignant tumor.\u201d The tricuspid valve was well closed during the right ventricular injection test, and the right atrial incision was sutured. After rewarming, the ascending aorta was opened. The heart was defibrillated once and the cardiopulmonary bypass was paralleled, gradually stopping the extracorporeal circulation. After removing the extracorporeal circulation, a temporary cardiac pacing lead was placed on the surface of the right ventricle, and a pericardial mediastinal drainage tube was placed to completely stop bleeding. After counting the number of pairs, the chest closure surgery was completed layer by layer. Return to the CCU ward safely.\nPathological examination (frozen section) on June 27, 2022 was reported: Cardiac space-occupying, malignant tumor with massive necrosis, consistent with the metastasis of poorly differentiated squamous cell carcinoma, it is recommended to examine the esophagus. Immunohistochemistry: 35BH11 (\u2212), CK (+++), P63 (+++). KI-67 35% (+), P40 (+++) . Besides that, the reason the mass has been considered as an esophagus metastasis is that intracardiac lesions from esophagus cancer are described in the literature.[\nThe second and third cycles of anti-tumor treatment were performed on August 4, 2022 and August 30, 2022. Review SD (stable disease). From September 26, 2022 to November 10, 2022, he was given palliative chest radiotherapy, prescription dose: PGTVnd: 69.0 Gy/30f. PCTV: 51.0 Gy/30f, PGTV: 60.0 Gy/30f. The patient maintained a stable weight during radiotherapy . By the computed tomography and enhanced CT, it can be seen that the treatment in the 3 months has significantly improved the patient condition .\nIt is pity that, due to the outbreak of COVID-19, the patient eventually suffered from severe pulmonary infection on Dec 19th. The infection rapidly progressed and worsened under the influence of various inflammatory factors. And the patient was died of the acute respiratory distress syndrome 2 weeks later.", "summary": "We reported a case of a 67 years-old man diagnosed as right ventricular metastasis from esophageal squamous cell with the help of echocardiography and pathological biopsy. Moreover, the patient survival period reached an astonishing 6 months, which far exceeded 4 weeks reported in previous literature.", "subclaim_evaluations": [ { "subclaim": "The patient was a 67-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with right ventricular metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The primary tumor was esophageal squamous cell carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography was used in the diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "A pathological biopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's survival period was 6 months.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Previous literature reported a survival period of 4 weeks.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1676_en.txt", "fulltext": "A 52-year-old female presented to our hospital with blurred vision in her left eye for approximately 1 wk.\nThe patient reported no headache or eye pain. She had no other diseases.\nUnremarkable.\nNo abnormalities were found on slit lamp examination.\nThe patient underwent a comprehensive ophthalmic examination, including decimal best corrected visual acuity, color fundus photography, spectral domain optical coherence tomography (OCT) and fluorescein fundus angiography. On first examination, her best corrected visual acuity was 20/40 in the left eye and 20/20 in the right eye. Anterior segment and intraocular pressure findings were normal in both eyes. Fundus photography of the left eye showed a seemingly normal adult oculus fundus without any obvious hard exudate or hemorrhage . OCT demonstrated a hypo-reflective space beneath both the neurosensory retina and the pigment epithelium layer . The late phase of fluorescein angiography revealed hyper fluorescence . On the basis of these findings, a diagnosis of CSC was made. As the patient lived thousands of miles from Shanghai and did not perceive obvious changes in her eyes, she declined follow-up visits to the hospital.\nOne month later, her visual acuity deteriorated suddenly. On examination, her best corrected visual acuity in the left eye was 20/100. A sub-retinal hemorrhage, hard exudate and reddish-orange nodules were found on fundus photography . OCT demonstrated a pigment epithelium detachment and sub-retinal fluid . The late phase of fluorescein angiography revealed increased hyper-fluorescence compared to that observed one year previously . These characteristics led to the diagnosis of PCV.", "summary": "A 52-year-old woman presented to our hospital with blurred vision in her left eye for approximately 1 wk. Anterior segment and intraocular pressure findings were normal in both eyes. Fundus photography of the left eye showed a seemingly normal adult oculus fundus without any obvious hard exudate or hemorrhage. Optical coherence tomography exhibited a hypo-reflective space beneath both the neurosensory retina and the pigment epithelium layer. The late phase of fluorescein angiography revealed increased leakage. The patient was initially diagnosed with CSC. At follow-up, however, the final diagnosis turned out to be PCV.", "subclaim_evaluations": [ { "subclaim": "The patient is a 52-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with blurred vision in her left eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "The blurred vision had been present for approximately 1 week.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anterior segment findings were normal in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraocular pressure findings were normal in both eyes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fundus photography of the left eye showed a seemingly normal adult oculus fundus.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fundus photography showed no obvious hard exudate.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fundus photography showed no obvious hemorrhage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Optical coherence tomography showed a hypo-reflective space beneath the neurosensory retina.", "support_label": "supported", "is_refined": false }, { "subclaim": "Optical coherence tomography showed a hypo-reflective space beneath the pigment epithelium layer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The late phase of fluorescein angiography revealed increased leakage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was initially diagnosed with central serous chorioretinopathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final diagnosis was polypoidal choroidal vasculopathy.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_2054_en.txt", "fulltext": "A 44-year-old male presented with chronic osteomyelitis of the right tibia. The patient presented to the orthopaedic clinic due to right leg pain and swelling, the inability to bear weight, and multiple attacks of subjective fever. The right leg pain suddenly progressed over the prior 3 mo, without a history of recent trauma. The pain increased at night and later became constant even during rest. The pain was located mainly on the proximal right tibia with radiation to the right knee and middle third of the right leg. The patient also experienced multiple attacks of fever and night sweats.\nThe patient had an open fracture 22 years ago with an infection and was diagnosed with chronic osteomyelitis with a discharging sinus. The sinus had closed, but the pain continued. He was treated with evacuation of the abscess and courses of antibiotics.\nThe patient had a history of hypertension.\nNo personal or family history relevant to the presentation. No history of allergy to medications was reported.\nOn inspection, there was swelling of the right leg and skin redness on the anterior aspect of the proximal third of the right leg. We observed a skin scar with thin scar tissue over the tibia directly. There was no underlying soft tissue on the anterior aspect of the proximal right tibia with massive swelling and tenderness around this area. The patient had an intact neurovascular examination.\nLaboratory findings included slightly increased leukocytes (12.3 \u00d7 109/L; normal range: 4.5-11.0 \u00d7 109/L), haematocrit (40.2%; normal range: 41%-50%), platelets (522,000 mcL; normal range: 150,000 to 450,000 mcL), elevated erythrocyte sedimentation rate (95 mm/h, normal range: < 20 mm/h), and high C-reactive protein (133 mg/L; normal range: 0-10 mg/L). The patient had a discharging sinus on the anterior proximal third of the right leg in the centre of the previous scar. Culture from the sinus grew Staphylococcus aureus.\nAnteroposterior and lateral X-ray views showed multiple opacities, and magnetic resonance imaging showed a collection with high signal intensity in the proximal right tibia. The radiological studies revealed an intramedullary collection of the proximal right tibia with the impression of subacute osteomyelitis with multiple Brodie\u2019s abscesses of the proximal right tibia .", "summary": "A 44-year-old male with a known case of hypertension, no history of allergies to medications, and a history of chronic osteomyelitis of the right tibia with discharging sinus over the anterolateral aspect of the leg. The pus culture grew Staphylococcus aureus, which was sensitive to clindamycin and vancomycin. The patient underwent irrigation and debridement with the placement of vancomycin cement beads made from 4 g of vancomycin powder and 40 g of polymethyl methacrylate. Three hours postoperatively, the patient developed a pruritic, erythematous, macular rash predominantly on his face, neck, chest, and lower extremities and to a lesser extent his upper extremities. A diagnosis of VFS was made and was successfully treated with cetirizine (10 mg, oral) and methylprednisolone sodium succinate (125 mg, intravenous). The patient continued to have itching with a facial rash for 12 h with gradual improvement. A decision was made to not remove the beads as the patient continued to improve. Gradually, the rash disappeared after 96 h with no further sequela.", "subclaim_evaluations": [ { "subclaim": "The patient is a 44-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a known case of hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has no history of allergies to medications.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of chronic osteomyelitis of the right tibia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a discharging sinus over the anterolateral aspect of the leg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pus culture grew Staphylococcus aureus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Staphylococcus aureus isolate was sensitive to clindamycin.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The Staphylococcus aureus isolate was sensitive to vancomycin.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient underwent irrigation and debridement.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Vancomycin cement beads were placed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The beads were made from 4 g of vancomycin powder.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The beads were made from 40 g of polymethyl methacrylate.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Three hours postoperatively, the patient developed a pruritic, erythematous, macular rash.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The rash was predominantly on the face, neck, chest, and lower extremities.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The rash was to a lesser extent on the upper extremities.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A diagnosis of VFS was made.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was treated with cetirizine 10 mg, oral.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was treated with methylprednisolone sodium succinate 125 mg, intravenous.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient continued to have itching with a facial rash for 12 hours.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The rash gradually improved.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The rash disappeared after 96 hours.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The beads were not removed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_3327_en.txt", "fulltext": "Mr. RR, a 23-year-old male, presented at the emergency room reporting a week-long period of weakness that had worsened prior to admission, significantly impeding his daily activities. He described a four-month history of recurring, small fluid-filled sacs on the skin. These lesions evolved from reddish patches to rupturing and oozing, accompanied by itching but no pain or fever. He denied experiencing chest pain, shortness of breath, or vomiting but mentioned recent episodes of nausea. Upon examination, he appeared moderately unwell, with normal vital signs and pale conjunctiva. Physical assessment revealed palpable splenomegaly (Schuffner 6) but no lymph node enlargement or cardiac murmurs. Dermatologic examination revealed oedematous urticaria-like plaques, scaling, erosions, excoriations, and crusts all over the body, as well as a ruptured hemorrhagic bulla on the anterior body and left leg.\n\nComplete blood test showed that the White Blood Cell Count (WBC) was 23\u2009\u00d7\u2009109/l, the Absolute Neutrophil Count (ANC) was 644 cells/\u03bcl, the Hemoglobin (Hb) was 99 g/, and the Platelet Count (Plt) was 28\u2009\u00d7\u2009109/l. Bone marrow aspiration consistent with acute lymphoblastic leukemia-L1, led to the diagnosis of acute lymphoblastic leukemia in the patient. The decision for chemotherapy has not been approved by the patient, so patient only received corticosteroids and supportive therapy. At the onset of therapeutic intervention, the patient presented with erythematous patches accompanied by vesicular lesions spanning almost the entirety of his body. Subsequently, platelet concentrate transfusions were administered on the fourth and sixth days of treatment, with a total of eight bags administered on each occasion. On the eighth day of treatment, a histopathological exam showed that the patient had bullous pemphigoid because there was necrotic epithelium and chronic inflammatory cells. The decision to forgo direct immunofluorescent assay (DIF) was predicated upon the patient\u2019s existing thrombocytopenia and heightened vulnerability to bleeding complications. Subsequently, on the twelfth day of treatment, the patient underwent a transfusion of one unit of packed red cells (PRC). Following this, on the thirteenth day of treatment, the patient received two units of PRC and eight units of platelet concentrates. On the fourteenth day of treatment, the patient experienced an abrupt loss of consciousness, preceded by a severe headache and anisocoric pupils. Laboratory findings revealed a post-transfusion platelet count of 7000/ul after eight bags of platelets were administered. Despite continued therapeutic interventions.", "summary": "A 23-year-old male with ALL-L1 diagnosis who developed bullous pemphigoid in this report. The patient exhibited typical ALL-L1 symptoms, including constitutional manifestations and signs of bone marrow compromise. Dermatological assessment revealed extensive edematous urticaria-like plaques, erosions, excoriations, crusts, and a hemorrhagic bulla. Severe thrombocytopenia was evident in laboratory tests, with histopathological examination confirming bullous pemphigoid. Despite aggressive treatment, including platelet transfusions, the patient's condition worsened.", "subclaim_evaluations": [ { "subclaim": "The patient is a 23-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has an ALL-L1 diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed bullous pemphigoid.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient exhibited constitutional manifestations.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had signs of bone marrow compromise.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dermatological assessment revealed extensive edematous urticaria-like plaques.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dermatological assessment revealed erosions.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dermatological assessment revealed excoriations.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dermatological assessment revealed crusts.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dermatological assessment revealed a hemorrhagic bulla.", "support_label": "supported", "is_refined": false }, { "subclaim": "Severe thrombocytopenia was evident in laboratory tests.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination confirmed bullous pemphigoid.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received platelet transfusions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's condition worsened despite treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_2870_en.txt", "fulltext": "A 30-year-old Korean woman was diagnosed with suspicious papillary thyroid carcinoma (PTC) by fine needle aspiration (FNA) at a local medical clinic. She was referred to our hospital for operation. She has no personal or family history of thyroid dysfunction and no specific medication history. Physical examination of neck revealed a diffusely enlarged and non-tender thyroid gland. There were no palpable cervical lymph nodes. US was carried out using a real time linear array 10-MHz transducer. The thyroid US demonstrated a diffusely enlarged thyroid gland with a 0.4\u00d70.3cm sized hypoechoic nodule in the left thyroid . She wanted to diagnose the thyroid nodule again in our hospital. US-guided FNA was performed again on that nodule, and FNA cytology was diagnosed as suspicious PTC. We also examined for BRAF V600E mutation using FNA cytology materials. BRAF V600E mutation was identified by multiplex real time polymerase chain reaction assay using Anyplex\u2122 BRAF V600E Real Time Detection (V2.0) (Seegene, Inc., Seoul, Korea), which allows for simultaneous amplification of total nucleic acid of V600E mutation of BRAF and internal control (human \u03b2 globin gene). Computed tomography scan using contrast agent was done three weeks before operation. No abnormal finding was noted. The patient had no thyrotoxic symptoms during one month of the preoperative period. She underwent a left thyroid lobectomy by endoscopic thyroidectomy via a transaxillary approach for the thyroid tumor. The right thyroid was not manipulated during operation. Pathologic finding revealed a papillary carcinoma, and other portions of the thyroid parenchyma revealed lymphocytic patches predominantly in peripheral portions. There were rarely lymphoid follicles with germinal center .\nOn laboratory examination, the preoperative laboratory test was performed one month before operation was within normal limits. The serial change of thyroid function tests and the titer of autoantibodies were summarized in Table . On postoperative day (POD) 1, she didn\u2019t definitive complain. A thyroid function test (TFT) showed hyperthyroid with Antithyroglobulin antibody and thyroglobulin (Tg) . On POD 8, the patient was consulted by the department of endocrinology. On physical examination, blood pressure was 120/80mmHg, and heart rate was 119beat/min and regular. Neck examination revealed no sign of tenderness and redness. TFT was still increased but Tg level was normalized . Tc-99m scintigraphy showed faint visualization of the right thyroid lobes, and 24-hour radioactive uptake of 131I was 0.7% , which suggested destructive thyroiditis. On POD 48, thyroid function tests revealed euthyroid. On POD 86, she complained of fatigue and weakness. A TFT revealed hypothyroidism . The patient was treated with levothyroxine for her symptoms of hypothyroidism. On POD 140, follow-up TFT revealed mild hyperthyroidism . The patient was treated with levothyroxine.", "summary": "A 30-year-old Korean woman was referred to our center for thyroid tumor operation. She was diagnosed with suspicious papillary thyroid carcinoma by fine needle aspiration at a local medical clinic. The thyroid ultrasonography demonstrated a diffusely enlarged thyroid gland with a 0.4\u00d70.3cm sized hypoechoic nodule in the left lobe. Left thyroid lobectomy by endoscopic thyroidectomy was performed via a transaxillary approach, and the nodule was confirmed to be a papillary thyroid carcinoma. On postoperative day 1, a thyroid function test revealed hyperthyroidism, and on postoperative day 8, a thyroid function test again revealed hyperthyroidism with decreased radioactive iodine uptake. Thyroid function tests showed euthyroid on postoperative day 48 and hypothyroidism on postoperative day 86. She was treated with levothyroxine.", "subclaim_evaluations": [ { "subclaim": "The patient is a 30-year-old Korean woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was referred for thyroid tumor operation.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with suspicious papillary thyroid carcinoma by fine needle aspiration.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made at a local medical clinic.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thyroid ultrasonography showed a diffusely enlarged thyroid gland.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thyroid nodule was 0.4\u00d70.3cm in size.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nodule was located in the left lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nodule was hypoechoic.", "support_label": "supported", "is_refined": false }, { "subclaim": "Left thyroid lobectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgery was performed via a transaxillary approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nodule was confirmed to be papillary thyroid carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "On postoperative day 1, a thyroid function test revealed hyperthyroidism.", "support_label": "supported", "is_refined": false }, { "subclaim": "On postoperative day 8, a thyroid function test again revealed hyperthyroidism.", "support_label": "supported", "is_refined": false }, { "subclaim": "On postoperative day 8, radioactive iodine uptake was decreased.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thyroid function tests showed euthyroid on postoperative day 48.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thyroid function tests showed hypothyroidism on postoperative day 86.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with levothyroxine.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2096_en.txt", "fulltext": "A 20-year-old female with no significant past medical history presented with progressive weakness of the right lower limb for 7 months with tingling and numbness of the same limb for 6 months. The weakness in her limb was insidious in onset, which was initially noticed by slipping of slippers but gradually progressed to the point that she needed support while walking. She had a history of mild back pain for 1 month. Her bowel and bladder habits were normal. She had no history of shortness of breath, difficulty swallowing, blurring of vision, double vision, auditory disturbances, abnormal body movements, or trauma of any kind. She had no family history of malignancy or other tumors.\nHer general condition was fair, her vitals were stable, and there were no positive findings on the general examination. The findings of higher mental function examination and other neurological examinations were within normal limits. Other neurological examination findings have been depicted in Table .\nWith this history and examination in mind, we suspected the possibility of a mass compressing the spinal cord clinically. Subsequently, MRI scans of her spine and brain were conducted to identify any apparent pathology.", "summary": "We describe a case of a 20-year-old female presenting with progressive weakness of the right lower limb for 7 months with a tingling sensation and numbness of the same limb for 6 months and was found to have schwannomatosis with multiple spinal and right cerebellopontine angle (CPA) (9th/10th cranial nerve) schwannomas and left anterior cranial fossa meningioma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 20-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had progressive weakness of the right lower limb for 7 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a tingling sensation in the right lower limb for 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had numbness in the right lower limb for 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was found to have schwannomatosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had multiple spinal schwannomas.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had a right cerebellopontine angle schwannoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The right CPA schwannoma involved the 9th/10th cranial nerves.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had a left anterior cranial fossa meningioma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_350_en.txt", "fulltext": "A 63-year-old woman with chronic hepatitis B virus infection was referred to our clinic due to incidental detection of a hepatic mass. Alpha-fetoprotein and protein induced by vitamin K absence or antagonist II (PIVKA II) levels were 25.24 ng/mL and 3021 mAU/mL, respectively. The patient was diagnosed with HCC in December 2014. Thereafter, she underwent hand-assisted laparoscopic partial hepatectomy for a solitary tumor with 5 cm in diameter in the right posterior sector. Pathological findings showed that the lesion was 40 mm in size, moderately differentiated, solitary HCC without any macroscopic vascular invasion (T1bN0M0 and stage IB, based on the 8th Union for International Cancer Control staging of HCC). Liver fibrosis was evident during initial surgery (METVIR F2-3).\nSix months after initial surgery, multiple recurrent lesions in the liver were observed. Consequently, the patient was treated with lipiodol-transcatheter arterial chemoembolization (TACE). After this successful TACE, sorafenib (400 mg per day) was administered. Six months later, she underwent laparoscopic left adrenalectomy for adrenal metastasis (pathology revealed metastatic, moderately differentiated HCC). Eight months after the adrenalectomy, the patient underwent laparoscopic partial hepatectomy for a solitary recurrence in the lateral sector (pathology revealed moderately differentiated HCC, background liver condition; METAVIR F3). Eight months after the second hepatectomy, the patient was treated with sorafenib (400 mg per day, followed by 600 mg per day) for increased PIVKA II levels. Despite 9-mo treatment with sorafenib, she was found to have a 43-mm mass in the spleen and portal vein tumor thrombosis (PVTT) that involved both the right and left portal branches down to the main trunk (Vp4) on computed tomography (CT) .\nHepatitis B infection.\nHer personal and family history was unremarkable.\nHer vital signs were normal. There were no remarkable findings other than abdominal distention.\nPIVKA II levels increased tremendously up to 46.291 mAU/mL. The BCLC staging system classified the patient into stage C. Aspartate aminotransferase, alanine aminotransferase, and platelet count were 49 IU/L, 40 IU/L, and 14.7 \u00d7 104/\u03bcL, respectively. The FIB-4 index was calculated as 3.71, suggesting that she was likely to be cirrhotic. Her cirrhosis was classified into Child-Pugh B (8) and modified albumin-bilirubin grade 1.\nCT findings revealed moderate ascites, which indicated portal hypertension due to tumor thrombosis. This also demonstrated irregularity of the external contour of the left lobe of the liver, suggesting cirrhosis.", "summary": "A 63-year-old woman with chronic hepatitis B virus infection was diagnosed with HCC. Subsequently, she underwent two rounds of laparoscopic partial hepatectomy, laparoscopic left adrenalectomy, and transcatheter arterial chemoembolization plus sorafenib for recurrence. Four years after initial hepatectomy, she presented with a 43-mm mass in the spleen and tumor thrombus involving the main portal vein trunk with ascites. Her liver function was Child-Pugh B (8), and protein induced by vitamin K absence or antagonist II (PIVKA II) levels were elevated up to 46.291 mAU/mL. Since initial treatment with regorafenib for three months was unsuccessful, the patient was administered lenvatinib. Ten months post-treatment, there was no contrast enhancement of PVTT or splenic metastasis. Chemotherapy was discontinued due to severe diarrhea. Afterward, splenic metastasis became viable, and PIVKA II increased. Therefore, hand-assisted laparoscopic splenectomy was performed. She experienced no clinical recurrence 14 mo after resection.", "subclaim_evaluations": [ { "subclaim": "The patient is a 63-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has chronic hepatitis B virus infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with hepatocellular carcinoma (HCC).", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent two rounds of laparoscopic partial hepatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent laparoscopic left adrenalectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received transcatheter arterial chemoembolization.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received sorafenib for recurrence.", "support_label": "supported", "is_refined": false }, { "subclaim": "Four years after initial hepatectomy, she presented with a 43-mm mass in the spleen.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was tumor thrombus involving the main portal vein trunk.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had ascites.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her liver function was Child-Pugh B (8).", "support_label": "supported", "is_refined": false }, { "subclaim": "Her PIVKA II levels were elevated up to 46.291 mAU/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial treatment with regorafenib for three months was unsuccessful.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was administered lenvatinib.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Ten months post-treatment, there was no contrast enhancement of PVTT.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "There was no contrast enhancement of splenic metastasis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Chemotherapy was discontinued due to severe diarrhea.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Splenic metastasis became viable.", "support_label": "supported", "is_refined": false }, { "subclaim": "PIVKA II increased.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hand-assisted laparoscopic splenectomy was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She experienced no clinical recurrence 14 months after resection.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2466_en.txt", "fulltext": "A 55-year-old female patient was referred to the orofacial pain unit of the OPH clinic for showing symptoms of temporomandibular joint arthralgia and osteoarthritis, orofacial myofascial pain, and sleep bruxism. An experienced Orofacial Pain Specialist performed a comprehensive clinical history and examination following the Diagnostic Criteria for Temporomandibular Disorders (DC/TMD) protocol and the International Classification of Orofacial Pain-1 (ICOP-1) criteria. At the moment of the examination, the patient was taking 150 mg of Venlafaxine for major depressive disorder, 4 mg of Clonazepam for sleep onset insomnia, and hormone replacement therapy for menopause.\nAnother major complaint of the patient was difficulty initiating and maintaining sleep. Thus, an Epworth Sleepiness Scale and Insomnia Severity Index were performed to complete the sleep evaluation. Due to the high scores presented by the patient and clinical history consistent with chronic sleep insomnia, polysomnography (PSG) was requested Even though the PSG revealed no sleep breathing disorders, the exam showed severe modifications in the patient\u2019s sleep architecture, a mild increase in the arousal index, and low-frequency sleep bruxism. The PSG results led us to hypothesize that the patient\u2019s sleep architecture alterations were because of the chronic consumption of benzodiazepines. Thus, the patient was derived to her treating psychiatrist to gradually diminish and eliminate the intake of Clonazepam.\nDuring this time, the patient successfully underwent her osteoarthritis and orofacial myofascial pain treatment. In addition, an upper oral occlusal splint was prescribed to manage low-frequency sleep bruxism.\nIn order to manage sleep initiation and maintenance insomnia, the psychiatrist tapered the dosage of Clonazepam and progressively replaced it with Trazodone until a target dose of 100 mg was reached. Throughout this period, the patient did not experience any extrapyramidal symptoms.\nAlmost three months later, after the end of the orofacial pain treatment, the patient returned complaining of a sudden worsening of her awake bruxism. The patient presented abrupt rhythmic involuntary muscle contractions, similar to jaw-closing and jaw-deviating dystonic-like movements affecting the right side of her masticatory muscles. (See , and ) The dystonic-like episodes were spontaneous or triggered by everyday activities such as talking, chewing, and yawning. The severity of these motor contractions tended to be exacerbated by emotional stress and nervousness produced by these uncontrollable movements. During these episodes, some typical features of oromandibular dystonia were noticed, such as some sensory tricks (gentle pressure on the inferior incisors would milden the jaw-deviating dystonia as the placement of a tongue depressor between the molars for jaw-closing dystonia), and phenomena (e.g., oromandibular dystonia overflowing the right eyelid, resulting in right blepharospasm).\nA video examination protocol suggested by Yoshida was carried out to assess the type and magnitude of involuntary movements . In addition, a complete haematological and biochemical blood examination was required and all the parameters were within normal range. Thus, both thyroid and parathyroid hormonal dysfunction were ruled out.\nSince the literature indicates that Trazodone can induce extrapyramidal symptoms and abnormal oromandibular movement disorders only start after the addition of this medication. The authors, in agreement with her treating physician, suggested performing a slow taper until complete discontinuation of Trazodone was achieved.\nA progressive dose reduction of 25 mg of Trazodone was scheduled every two weeks. In the meantime, an inferior occlusal splint was prescribed, considering that mild contact in the inferior incisor tended to ease the intensity of the dystonic-like movements.\nDuring the progressive discontinuation of Trazodone, the authors noticed an immediate attenuation of the dystonic symptoms. However, only achieving a partial but clear remission of them. No video protocol was recorded during the tampering of Trazodone.\nConsidering that the patient\u2019s mental health status was stable, it was decided to take a more conservative approach, only eliminating the most likely offending drug, namely, Trazodone. Consequently, the authors maintained that Venlafaxine intake was unchanged in order not to jeopardize the psychiatric treatment, and also closely monitored the evolution of the clinical symptoms. Additionally, the authors indicated the administration of 25 units of incobotulium toxin (Xeomin\u00ae, Merz, Germany) per masseter muscle, 20 units per temporalis muscle, and 15 units were applied to the inferior head of the right lateral pterygoid with electrical stimulation guidance (See anatomical landmarks in ).\nDuring the two-week follow-up consultation, the authors could recognize a substantial decrease in the magnitude and intensity of the oromandibular movement. Two months and seven months after the discontinuation of the offending drug and botulinum toxin application, the authors re-recorded Yoshida\u2019s video protocol to carry out an objective before and after comparison of the treatment results. See for comparison prior to and after the treatment.", "summary": "The authors will present a clinical case and management, from the dental specialist perspective, of a 55-year-old female patient who developed tardive oromandibular dystonia induced by Trazodone prescribed for sleep insomnia.", "subclaim_evaluations": [ { "subclaim": "The patient is a 55-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed tardive oromandibular dystonia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The dystonia was induced by Trazodone.", "support_label": "supported", "is_refined": false }, { "subclaim": "Trazodone was prescribed for sleep insomnia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The authors will present a clinical case and management.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case is presented from the dental specialist perspective.", "support_label": "supported", "is_refined": false } ], "readability_score": 1 }, { "id": "multiclinsum_test_467_en.txt", "fulltext": "A 70-year-old woman was diagnosed as having PD at 65 years of age after having difficulty with walking and clumsiness with her hands. She also had olfactory impairment. She had no family history of PD. Examinations revealed asymmetric parkinsonism with limb rigidity and bradykinesia that were more prominent on the left. There were no cerebellar signs or gaze palsy. Her Hoehn and Yahr stage was 2 and her Mini-Mental State Examination score was 30. Magnetic resonance imaging of her brain revealed normal findings. She was initially treated with levodopa (L-dopa), (200 mg/day), which markedly improved her symptoms. A reduced meta-iodobenzylguanidine (MIBG) cardiac uptake on myocardial scintigraphy was detected. On the basis of these findings, she was diagnosed as having PD. At 67 years of age, she developed orthostatic hypotension and was treated sequentially with fluids, compression stockings, and midodrine. Her disease slowly progressed over the next three years, and L-dopa dosage was increased to 600 mg/day. At 70 years of age, she had a mild head trauma with loss of consciousness. One month later, she developed acute-onset lateral flexion of her trunk to the left side while standing, and she was admitted to our hospital. On admission, her neurological examinations revealed slight weakness of her left upper and lower extremities in both proximal and distal muscles, as indicated by her Medical Research Council (MRC) scale score of 5-/5. She showed a sustained 10.1\u00b0lateral flexion of her trunk to the left side on standing . This posture was alleviated in the supine position. Her Pisa angle was assessed using NeuroPostureApp\u00a9 . Her right muscle strength was normal. Her sensory systems were normal and no cerebellar signs were detected. Her deep tendon reflexes were normal and her plantar reflex was flexor bilaterally. Her presurgical brain computed tomography (CT) showed CSDH in the right hemisphere resulting in a marked compression of the hemisphere . She was immediately referred to the neurosurgical department of our hospital and the subdural hematoma was successfully evacuated by single-burr-hole drainage. Her brain CT carried out four days after the operation showed improvement of her subdural hematoma . Seven days after her operation, her PS disappeared and she fully recovered to her preoperative level of function without any sequelae such as headaches and cognitive impairment caused by her CSDH. She is still being follow-up.", "summary": "A 70-year-old woman developed acute-onset lateral flexion of her trunk to the left side while standing, and she was admitted to our hospital. One month before, she had a mild head trauma with loss of consciousness. At 65 years of age, she noticed difficulty with walking and clumsiness with her hands. She was diagnosed as having PD (Hoehn and Yahr stage 2) and levodopa was initiated. Her symptoms were markedly improved. At 67 years of age, she developed orthostatic hypotension and was treated sequentially with fluids, compression stockings, and midodrine. Urgently performed brain computed tomography (CT) showed a CSDH in the right hemisphere resulting in a marked compression of the hemisphere. After surgical evacuation, her PS disappeared. She has fully recovered to her preoperative level of function.", "subclaim_evaluations": [ { "subclaim": "The patient is a 70-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She developed acute-onset lateral flexion of her trunk to the left side while standing.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted to the hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "One month before admission, she had a mild head trauma with loss of consciousness.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "At 65 years of age, she noticed difficulty with walking.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 65 years of age, she noticed clumsiness with her hands.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed as having Parkinson's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her Parkinson's disease was classified as Hoehn and Yahr stage 2.", "support_label": "supported", "is_refined": false }, { "subclaim": "Levodopa was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her symptoms were markedly improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 67 years of age, she developed orthostatic hypotension.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with fluids.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with compression stockings.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was treated with midodrine.", "support_label": "supported", "is_refined": false }, { "subclaim": "Urgently performed brain CT showed a chronic subdural hematoma in the right hemisphere.", "support_label": "supported", "is_refined": false }, { "subclaim": "The chronic subdural hematoma caused marked compression of the right hemisphere.", "support_label": "supported", "is_refined": false }, { "subclaim": "After surgical evacuation, her postural symptoms disappeared.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has fully recovered to her preoperative level of function.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2409_en.txt", "fulltext": "A 55-year-old man, with body mass index (BMI) of 18.36 kg/m2, was admitted into our hospital for left hip pain for 6 months. The symptom started with moderate pain after walking. Over the last few days, the pain got worsen with no remission after rest. The patient denied any history of trauma, glucocorticoid hormone consumption or radiotherapy. Examinations before admission revealed old fracture on the left femoral neck and an increase in blood uric acid. After admission, the function evaluations of his bilateral hip joint were summarized as follows: Visual Analogue Scale (VAS) score was 4, Harris score was 23 in the left hip joint, while VAS score was 0, Harris score was 90 in the right hip joint. The imaging examinations of the pelvis, including radiographs , CT and MRI scan , confirmed the existence of bilateral femoral neck fractures, with fracture nonunion and femoral neck shortening in his left femoral neck and double fracture lines in his right femoral neck. The Dual energy X-ray absorptiometry (DXA) examination of the lumbar spine showed reduced bone mineral density (BMD) and severe osteoporosis (L1\u2013L4: BMD0.514 g/cm2, T score = \u2212 4.6). In addition, tumor markers, tuberculosis antibodies, alkaline phosphatase and parathyroid hormone levels were found to be normal.\nWe recommended a left cementless THA, and a cannulated screws fixation on the right side. And the uric acid lowering treatment was performed on the patient. However, the patient only agreed to the left THA, while on the right side, conservative treatment was selected for patient because of financial reasons. The left THA through the lateral approach was performed for the patient under general anesthesia . During the surgery, we found sclerosis, fatty degeneration and necrosis of the fracture end of the left femoral neck . We used impactive bone grafting to strengthen the acetabular on the fracture region .\nAfter the operation, the patient was treated with 20 U Elcatonin injection (Sidinuo\u00ae, Shangdong Luye Pharmaceutical Co.LTD, Yantai, China) once a week, and 1 tablet of Calcium Carbonate D3 Granules (Langdi\u00ae, Beijing Kangyuan Pharmaceutical CO.LTD, Beijing, China) containing calcium carbonate (500 mg) and vitamin D (200 IU), twice a day. Meanwhile, He was required to exercise his quadriceps and calf muscle on bed, move with the help of wheelchairs, and avoid walking on crutches. The postoperative histological examination, as showed in Fig. , revealed that the left fracture gap was filled with fibrous tissues, with few new bone tissues and a large amount of necrotic bone tissue observed. Meanwhile, the plain radiograph of the pelvis one day after surgery revealed that the total hip replacement arthroplasty was very successful . Generally, the patient recovered well during the hospitalization and was successively discharged home.\nFour months after discharge, the radiograph image showed no signs of implant loosening or infection in his left hip . It was worth noting that CT images revealed fracture union of the right femoral neck, as shown in Fig. b and Fig. c. In addition, function evaluations of his bilateral hips at four months after surgery was satisfactory and summarized as follows: VAS score was 0, Harris score was 98 in the left hip joint and VAS score was 0, Harris score was 95 in the right hip joint.", "summary": "A 55-year-old male patient complained pain in his bilateral hip, with no history of trauma, glucocorticoid hormone consumption or radiotherapy, and imaging examination revealed fracture nonunion and shortening in his left femoral neck, and double fracture line on the right femoral neck. The patient received a cementless THA for the left femoral neck fracture and conservative treatment for the right side, followed by Elcatonin injection and oral administration of Carbonate D3 Granules. After 4\u2009months of fellow-up, the patient presented improved functional scorings in bilateral hip joints, with no signs of prothesis infection or loosening.", "subclaim_evaluations": [ { "subclaim": "The patient is a 55-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of pain in his bilateral hip.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no history of trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no history of glucocorticoid hormone consumption.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no history of radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging examination revealed fracture nonunion in the left femoral neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging examination revealed shortening in the left femoral neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "Imaging examination revealed a double fracture line on the right femoral neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received a cementless total hip arthroplasty for the left femoral neck fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received conservative treatment for the right femoral neck fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received Elcatonin injections.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received oral administration of Carbonate D3 Granules.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 4 months of follow-up, the patient had improved functional scorings in bilateral hip joints.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 4 months of follow-up, there were no signs of prosthesis infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 4 months of follow-up, there were no signs of prosthesis loosening.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_829_en.txt", "fulltext": "A 27-year-old man presented to the Department of Spine Surgery of our hospital with complaints of neck pain, limb numbness, and weakness.\nHis symptoms started suddenly, 4 d prior to hospital presentation.\nThe patient had no trauma history. A similar episode of transient limb numbness and weakness occurred 6 years earlier.\nHe denied any personal or family history of other diseases.\nPhysical examination revealed tenderness of the paraspinal muscle of the C6-T1 spinous process, muted sensory responsiveness to touch along the T1 dermatome, and grade IV muscle strength in the four limbs.\nThe results of all blood analyses \u2014 including coagulation markers, inflammatory indicators, and tumor markers \u2014 were within normal limits.\nSpinal radiography and computed tomography demonstrated no obvious bone destruction. Enhanced cervical magnetic resonance imaging (MRI) showed a homogenously enhanced epidural mass in the C6-T1 spinal canal. The mass compressed the spinal cord and extended into the left C7-T1 foramen. It appeared hypointense on T1-weighted images (T1WIs) and hyperintense on T2WI. Moreover, a 0.5 cm \u00d7 0.5 cm \u00d7 0.6 cm-sized heterogeneously enhanced hyperintense mass was found in the C7 vertebral body on T2WI, which was suggestive of a benign vertebral hemangioma (VH) .", "summary": "A 27-year-old man presented with acute-onset neck pain, numbness, and weakness in his extremities. Magnetic resonance imaging showed an epidural mass in the cervicothoracic (C6-T1) spinal canal and vertebral hemangioma (VH) involving the C7 vertebral body. C6-T1 Laminectomy and radical excision of the mass were performed. Histopathological examinations revealed papillary proliferation of vascular endothelial cells with thrombus formation, and an IPEH diagnosis was made. By his 6-mo follow-up appointment, his symptoms were relieved without recurrence. The possible pathogenesis, clinical and imaging features, differential diagnosis, and management of IPEH were reviewed.", "subclaim_evaluations": [ { "subclaim": "The patient is a 27-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with acute-onset neck pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had numbness in his extremities.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had weakness in his extremities.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance imaging showed an epidural mass in the cervicothoracic spinal canal.", "support_label": "supported", "is_refined": false }, { "subclaim": "The epidural mass was located at C6-T1.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was in the spinal canal.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was vertebral hemangioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vertebral hemangioma involved the C7 vertebral body.", "support_label": "supported", "is_refined": false }, { "subclaim": "C6-T1 laminectomy was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Radical excision of the mass was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological examination showed papillary proliferation of vascular endothelial cells.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Histopathological examination showed thrombus formation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The diagnosis was intraspinal epidural hemangioma (IPEH).", "support_label": "supported", "is_refined": false }, { "subclaim": "By the 6-month follow-up, his symptoms were relieved.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "There was no recurrence at the 6-month follow-up.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The possible pathogenesis of IPEH was reviewed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The clinical features of IPEH were reviewed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The imaging features of IPEH were reviewed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The differential diagnosis of IPEH was reviewed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The management of IPEH was reviewed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 4 }, { "id": "multiclinsum_test_3164_en.txt", "fulltext": "A 79-year-old Caucasian man presented to the emergency room with shortness of breath, bilateral leg oedema and fatigue. His medical history was notable for arterial hypertension and degenerative valve disease, with indication of aortic valve replacement which he refused. He did not use alcohol, tobacco or illicit drugs. There was no history of recent infection, or any invasive procedure in the last year. Besides taking antihypertensive drugs, he was not on any medications. He had not been consulted by a physician in the last 3 years.\n\nOn physical examination, he was afebrile, with bilateral lower extremity oedema, there was arrhythmia with a heart rate of 70/min, blood pressure was 180/80\u2009mm Hg; there was a grade 5/6 systolic murmur at the aortic area, and a grade 4/6 holosystolic murmur at the mitral area. Respiratory examination revealed dullness to conventional percussion, decreased tactile fremitus and decreased breath sounds at the bilateral lung bases with crackles. The remainder of the exam was unremarkable.\n\n\nInvestigations\n\nStandard 12-lead ECG showed atrial fibrillation with heart rate between 60\u201370 beats/min and left ventricular hypertrophy signs with secondary repolarisation changes.\n\nThe chest X-ray showed cardiomegaly with interstitial densities and pulmonary venous congestion. Large bilateral pleural effusions were noted.\n\nThe chemistry panel showed an N-terminal pro b-type natriuretic peptide level of 2000 pg/mL, increased creatinine with an estimated glomerular filtration rate of 30\u2009mL/min/1.73\u2009m2, high blood glucose, hyperuricaemia and hyponatraemia. The C reactive protein level was 9\u2009g/dL (normal <5\u2009g/dL), erythrocyte sedimentation rate was 30\u2009mm/hour and the fibrinogen level was 300\u2009mg/dL (normal <500\u2009mg/dL). There was mild normochromic normocytic anaemia (haemoglobin=99\u2009g/L) and leucocyte count was 9710/mm3 with 64% neutrophils, 7% eosinophils, 20% lymphocytes and 9% monocytes. The urinalysis was normal, with negative urine culture. Pharyngeal exudate was positive for Candida spp. and negative for Staphylococcus aureus and Streptococcus pyogenes. Further blood tests were in the normal range.\n\nTransthoracic echocardiography (TTE) showed mild left ventricle hypertrophy. Systolic function was normal with an ejection fraction estimated at about 60%. The right ventricle was mildly enlarged with normal longitudinal function. Both atria showed marked enlargement. The aortic valve was tricuspid with severe stenosis (aortic valve area 0.4\u2009cm2) and moderate regurgitation. The mitral valve showed a mobile hyperechogenic formation with the maximum diameter of 12\u2009mm seen in the left atrium which strongly indicated endocarditis. Doppler examination showed severe mitral regurgitation due to perforation of the mitral anterior leaflet and also moderate tricuspid regurgitation. The inferior vena cava was dilated, and the pulmonary systolic pressure was estimated at about 50\u2009mm Hg.\n\nTransoesophageal echocardiography confirmed the presence of vegetation.\n\nSonography of the abdominal organs was normal.\n\nBefore antibiotic treatment was started, four blood cultures where taken from separate venous sites, at 30\u2009min intervals. Each sample was placed into a pair of blood culture bottles that cultivate aerobic and anaerobic bacteria separately.\n\nThree out of four blood culture grew Gram-positive cocci in clusters. The organism grew on trypticase soy agar and was catalase-positive, oxidase-negative and coagulase-negative. It was identified as coagulase-negative Staphylococcus, and subsequently as S. warneri by the Vitek 2 GP card (BioM\u00e9rieux). After 72\u2009hours of treatment three other blood cultures were taken randomly and came out negative.\n\n\nTreatment\n\nEmpirical antibiotic treatment with vancomycin 30\u2009mg/kg/day intravenous in three doses and gentamicin 3\u2009mg/kg/day intravenous was started. Afterwards, following the discussion with the infectious disease physician and the microbiologist, we concluded that the isolation of S. warneri was not contamination, and we established the diagnosis of S. warneri endocarditis, based on two major diagnosis criteria\u2014echocardiography and positive blood cultures. The antibiogram revealed resistance to penicillin, tetracycline, erythromycin, clindamycin, clarithromycin, doxycycline, fosfomycin, rifampicin and susceptibility to fusidic acid, ciprofloxacin, daptomycin, gentamicin, vancomycin, levofloxacin, linezolid, moxifloxacin, norfloxacin, ofloxacin, oxacillin, pefloxacin, minocyclin and trimethoprime/sulfamethoxazole. We decided to continue treatment with oxacillin 12\u2009g/day intravenous in four doses according to current guidelines. The patient also received medication for heart failure and was anticoagulated with acenocoumarol for his atrial fibrillation. He was consulted by a psychologist and received sleep pills, for insomnia.\n\n\nOutcome and follow-up\n\nThe patient\u2019s clinical condition improved slowly, with gradual remission of congestion, and decrease of non-specific inflammation markers, and also there was an improvement in kidney function (with a decrease of creatinine from 2.0 to 1.4\u2009mg/dL). He was discharged after 1\u2009month with a good clinical condition. The patient was informed again about the firm indication for mitral and aortic valve replacement, but he refused again the intervention.\n\nOne month after discharge the patient had the same aspect of the TTE, with severe mitral regurgitation but with well-tolerated heart failure (New York Heart Association class II). The chemistry panel showed mild normochromic normocytic anaemia (haemoglobin 112\u2009g/L), and a creatinine level of 1.6\u2009mg/dL.\n\nAfter 3\u2009months he was again hospitalised for decompensated heart failure (pleural effusion and fatigue). All of the five blood cultures taken this time were negative. The symptoms improved after 6\u2009days of intravenous diuretics and the patient was discharged with the same recommendations.\n\nHe is still refusing the valve surgery.", "summary": "We report a rare case of native valve endocarditis caused by Staphylococcus warneri in an immunocompetent 79-year-old man with known degenerative valvular heart disease but no previous risk factors such as recent invasive treatment or medical implant. The patient presented with heart failure, due to perforation of the mitral valve, and lacked any signs of infection. The diagnosis of endocarditis with S. warneri was established by echocardiography and positive blood cultures.", "subclaim_evaluations": [ { "subclaim": "The patient was a 79-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was immunocompetent.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had degenerative valvular heart disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no previous risk factors for endocarditis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had no recent invasive treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no medical implant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with heart failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The heart failure was due to perforation of the mitral valve.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient lacked any signs of infection.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The diagnosis was native valve endocarditis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The causative organism was Staphylococcus warneri.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was established by echocardiography.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood cultures were positive for Staphylococcus warneri.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_52_en.txt", "fulltext": "A 37-year-old pregnant woman at 33 wk and 3 d of gestation had been diagnosed with RHD 4 mo ago. She was admitted to the intensive care unit (ICU) of our hospital complaining of orthopnea, anhelation and lower extremity edema.\nThe patient was first diagnosed with RHD at 12 wk of gestation. She developed cardiac enlargement with moderate pulmonary hypertension (PH) at 28 wk of gestation followed by atrial fibrillation (AF) at 29 wk of gestation. At 33 wk of gestation, she experienced severe heart failure which had worsened in the last 24 h.\nThe patient was gravida 5, 1-0-0-0-1, with 3 spontaneous abortions because of embryo hepatocytes. The outcome of her first pregnancy more than 10 years earlier was a natural birth without any discomfort.\nThe patient denied a history of thrombosis, smoking, tuberculosis, and alcohol or drug use. No family members had similar diseases.\nThe patient\u2019s heart rate was 145 beats/min, blood pressure was 113/82 mmHg, respiratory rate was 25 breaths/min, and oxygen saturation by pulse oximetry (SaO2) was 100% on room air. The patient\u2019s current weight was 82 kg, BMI (before pregnancy) was 25.3 kg/m2, a total weight gain was 15 kg during pregnancy. There were no obvious abnormalities in the fetus.\nThe patient\u2019s N-terminal pro brain-type natriuretic peptide was 1880 pg/mL, activated partial thromboplastin time (APTT) was 27.0 s, fibrinogen was 4.45 g/L, and D-dimer was 660 ng/mL. The cardiogram showed AF. The urine analysis and arterial blood gas was normal.\nThe TTE showed RHD with severe mitral regurgitation (MR), mild mitral stenosis, moderate aortic regurgitation (AR), severe tricuspid regurgitation (TR), heart dilatation, left ventricular ejection fraction (LVEF) of 52% and a pulmonary artery systolic pressure (PASP) of 75 mmHg. The patient\u2019s right heart (RH) chamber was enlarged and the left ventricle was hypokinetic. The routine TTE monitoring in pregnancy are shown in Table .\nDuring the CS, the TTE revealed a nascent thrombus that fluttered in a serpentine manner in the IVC after placental removal. The thrombus grew rapidly. From 81 mm at discovery to 155 mm in 18 min. The average growth rate was 4.1 mm/min. At 32 min after discovery, the thrombus detached to the tricuspid valve. At 43 min after discovery, the thrombus detached off to the pulmonary artery, where it fragmented and resulted in acute incomplete bilateral pulmonary embolism, and contemporaneously with the PASP increasing sharply to 93 mmHg, SaO2 decreased to 96%. Moreover, small thrombosis attachment to the mitral valve and left atrial appendage (LAA) were detected. The detailed thrombotic changes are shown in Figure . Postoperative computed tomography angiography showed that the right main pulmonary artery, the middle and lower branch of the right pulmonary artery and its branches, and the left lower branch of the pulmonary artery were embolized . Ultrasonic examination revealed no deep vein thrombus of the lower extremities during the perioperative period.", "summary": "A 37-year-old pregnant woman with rheumatic heart disease (RHD), gravida 5 and para 1 (G5P1), presented for emergency CS at 33 wk and 3 d of gestation under general anesthesia because of acute heart failure, pulmonary hypertension and arrhythmia. After placental removal during CS, TTE revealed a nascent thrombus in the inferior vena cava (IVC) that elongated, detached and fragmented leading to acute thromboembolic events and acute TPE. This report presents the whole process and details of TPE during CS and successful rescue without any sequelae in the patient. This case gives us new ideas for the diagnosis of death or cardiovascular accidents during CS in pregnant women with heart disease and the detailed presentation of the rapid development of TPE may also elucidate new ideas for treatment. This case also highlighted the importance of prophylactic anticoagulation in the management of heart disease during pregnancy.", "subclaim_evaluations": [ { "subclaim": "The patient was a 37-year-old pregnant woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had rheumatic heart disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was gravida 5 and para 1.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented for emergency cesarean section at 33 weeks and 3 days of gestation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cesarean section was performed under general anesthesia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The indication for the cesarean section was acute heart failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The indication for the cesarean section was pulmonary hypertension.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The indication for the cesarean section was arrhythmia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "After placental removal, a nascent thrombus was found in the inferior vena cava.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thrombus elongated, detached, and fragmented.", "support_label": "supported", "is_refined": false }, { "subclaim": "This led to acute thromboembolic events.", "support_label": "supported", "is_refined": false }, { "subclaim": "This led to acute thromboembolic pulmonary embolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent therapeutic pulmonary embolectomy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was successfully rescued without any sequelae.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The case provides new ideas for the diagnosis of death or cardiovascular accidents during cesarean section in pregnant women with heart disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case highlights the importance of prophylactic anticoagulation in the management of heart disease during pregnancy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2215_en.txt", "fulltext": "A 24-year-old virgin Persian woman presented with a labial mass that had emerged 12 years earlier and grown gradually in size, but caused no pain or discomfort until recently. Her medical history revealed no evidence of any underlying disease or mental disorder. She had a Bachelor\u2019s degree and was unemployed. Menarche occurred at the age of 11 years, and the patient\u2019s menstrual cycle was regular. She had no family history of breast or gynecological cancer. A pedunculated mass measuring 75 \u00d7 44 mm was observed in the upper left labium and looked exactly like a penis. Its texture was relatively soft, the skin temperature normal, and the lesion had clear boundaries with no ulceration . There was no connection between progressive growth of the lesion and the patient\u2019s menstrual cycle. The lesion was asymptomatic during menstruation. The patient sought no medical advice until she experienced discomfort in the genital area and had difficulty standing up and sitting down. At admission, her vital signs were blood pressure 115/75 mmHg, pulse rate 73 beats per minute, temperature 36.8 \u00b0C, and O2 at 99%. Chest examination was normal and she was well oriented. Breast and abdominal examinations were normal. Axillary and supraclavicular lymph nodes could not be palpated. The patient reported no pain on palpation and had no enlarged lymph nodes in the groin.\nUltrasonography of the lesion revealed a hyperechoic mass with clearly defined margins, internal echoes, and fibroglandular tissue measuring 70 \u00d7 40 mm in size. On pelvic ultrasound, there was no abnormality in the uterus and the ovaries. Blood, urine, and serology tests were normal.\nWe decided to perform a resection of the mass, which was then completely removed under local anesthesia and sedation . The tissue was sent for pathological examination. No postoperative complications were encountered. The patient was discharged from the hospital after a few days.\nThe pathological investigation revealed a benign lesion. It was an accessory breast composed of female breast tissue, with a proliferative and dilated ductus lined with two layers of endothelial and myoepithelial cells in fibrotic stroma, and invaded by mononuclear inflammatory cells . She was reviewed in the gynecology outpatient clinic at 2 weeks, 6 weeks, and 10 months post-surgery. Examinations confirmed full recovery with no evidence of recurrence.", "summary": "We report a 24-year-old virgin Persian woman with a left-sided vulvar mass and no pain or discomfort until shortly before her presentation at our department. Ectopic breast tissue in the vulva was diagnosed. We performed wide local resection of the lesion. Pathological investigation of the lesion confirmed the presence of ectopic breast tissue with secretory changes. She had no specific developmental abnormalities and had no relevant family history. She was followed up for 10\u00a0months and had recovered fully by this time.", "subclaim_evaluations": [ { "subclaim": "The patient is a 24-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is a virgin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is Persian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a left-sided vulvar mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no pain or discomfort until shortly before presentation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ectopic breast tissue in the vulva was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Wide local resection of the lesion was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathological investigation confirmed the presence of ectopic breast tissue.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ectopic breast tissue showed secretory changes.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had no specific developmental abnormalities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no relevant family history.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was followed up for 10 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had recovered fully by the 10-month follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2944_en.txt", "fulltext": "A 69-year-old hypertensive male was transferred to us with traumatic brain injury after sustaining a ground-level fall. On admission, his Glasgow Coma Scale was 12/15 (E4V2M6). CT scan depicted a left temporal hematoma with extensive acute subdural hematoma, diffuse edema and mass effect, and midline shift of 6.6 mm . He was admitted to the special care unit for observation where his GCS dropped to 9/15. He then underwent left-sided emergent DC and was discharged 4 weeks later. At the time of discharge, he was awake, alert, and intermittently following simple commands without gross motor or sensory deficits. His speech was slurred and intermittently, he had mildly agitated behavior (Richmond Agitation Sedation Scale or RASS + 1) with a Modified Rankin Scale of 4.\nOne week later, the patient returned to the hospital with progressively worsening agitation without a decline in consciousness. CT scan showed interval development of the right chronic subdural hematoma with interval resolution of the previous acute hematoma. The hematoma was evacuated through burr-hole craniotomy and drain placement. The procedure was uneventful but after the surgery, his agitation increased (RASS + 3) and cognitive dysfunction did not improve. Mini-Mental Score could not be assessed as his comprehension was not intact. At this point, patient was extensively evaluated for other causes of agitation such as electrolytes disturbances, endocrine abnormalities, infection, sepsis, drug intoxication, or alcohol withdrawal, all workup was within normal limits.\nOn serial CT scans, the right subdural collections decreased and his craniotomy skin flap started to sink. Suspecting \u201csyndrome of trephined\u201d and in view of his persistently unexplained behavioral dysfunction, we planned for early cranioplasty which was performed 6 weeks after the primary procedure . Within 48 h of cranioplasty, his agitation started to improve. On the 4th day, his RASS was + 1.\nAt 6-month follow-up, the patient was found able to walk unattended and only required minimal assistance with his activities of daily living (ADL) (MRS 3). His comprehension had also improved considerably and he was able to follow two-step commands with consistency.", "summary": "An elderly gentleman with traumatic brain injury underwent DC. He later developed a sinking flap and unexplained agitation which responded to cranioplasty by returning to a state of calm. His cognitive function further improved over a period of 6 months. This is an unusual observation reported in this case.", "subclaim_evaluations": [ { "subclaim": "The patient is an elderly gentleman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a traumatic brain injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent decompressive craniectomy (DC).", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient later developed a sinking flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had unexplained agitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The agitation responded to cranioplasty.", "support_label": "supported", "is_refined": false }, { "subclaim": "After cranioplasty, the patient returned to a state of calm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's cognitive function improved over 6 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "This is an unusual observation reported in this case.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_203_en.txt", "fulltext": "The patient was a 60-year-old male who presented to the emergency department (ED) for a syncopal episode in the setting of ventricular tachycardia while at his cardiologist\u2019s outpatient office. The patient has a past medical history of late presentation anterior ST-segment elevation MI 6 weeks prior to this event. During that time, he reported 1 week of anginal symptoms before his MI. He received two drug-eluting stents in the non-culprit right coronary artery and one in the culprit proximal left anterior descending artery. At time of his prior hospital discharge, echocardiogram demonstrated a left ventricular ejection fraction (LVEF) of 40\u201345% and an apical thrombus. He received antiplatelet therapy with aspirin 81\u2005mg daily and ticagrelor 90\u2005mg twice daily, as well as rivaroxaban 2.5\u2005mg twice daily for the apical thrombus.\nOn admission following his syncopal event, the patient was haemodynamically stable in normal sinus rhythm on an amiodarone infusion. A physical exam was significant for a prominent and laterally displaced point of maximal impulse, the presence of hepatojugular reflux, and muffled heart sounds.\nLaboratory findings were significant for a haemoglobin of 11.9\u2005g/dL (normal range is 13.5\u201317.5\u2005g/dL), an NT-pro BNP of 2549\u2005pg/mL (normal value is <300\u2005pg/mL), and a high sensitivity troponin T of 26\u2005ng/L (normal value is <59\u2005ng/L). Initial renal function, electrolytes, and liver function testing were within normal limits. Chest radiography showed an enlarged cardiac silhouette. Electrocardiogram revealed normal sinus rhythm with pathologic Q waves in inferior and anteroseptal leads along with low-voltage QRS complexes with an amplitude <5\u2005mm in the limb leads and 10\u2005mm in the chest leads (see , ). An urgent TTE showed a large circumferential pericardial effusion, severe left ventricular (LV) systolic dysfunction with an LVEF of <15%, and a large apical LVA with pathologic thinning and diastolic deformity ( and , ).\nThe patient was initiated on intravenous amiodarone, and anticoagulation was held in the setting of the pericardial effusion with associated LVA. Urgent diagnostic and therapeutic pericardiocentesis was completed with the removal of 600\u2005mL of sanguineous fluid. Incomplete effusion drainage was noted following the procedure suggesting loculated characteristics of the haemopericardium. Cardiothoracic surgery was consulted given the concern for contained LVA or pseudoaneurysm rupture as the underlying aetiology.\nSubsequent computed tomography angiography (CTA) of the chest showed a moderate volume pericardial effusion and a large lobulated LVA measuring 74\u2005mm \u00d7 84\u2005mm \u00d7 79\u2005mm without signs of active contrast extravasation into the pericardial space . Cardiac magnetic resonance imaging (cMRI) was suspicious for contained ruptured LVA; it showed striking dilation of the mid to distal LV wall with severe myocardial thinning and difficulty identifying myocardium at the apex ( and , ). Interval development of a large, mobile LV thrombus was also noted. Left heart catheterization revealed patency of all previously placed drug-eluting stents (see , ).\nDuring his hospitalization, the patient remained in the medical intensive care unit for bed rest and haemodynamic monitoring. Cardiothoracic surgery performed excision and repair of the LVA with placement of an LV endovascular patch (see , ). Intraoperative findings include the presence of a small rent at the apex of the aneurysm, which was tightly adhered to the overlying pericardium. Pathology reports confirm partially granular myocardial tissue composition of the specimen.\nPost-operative TTE was notable for an improved LVEF of 61% with continued apical akinesis and small aneurysm with possible small associated thrombus ( and , ). CTA revealed post-surgical changes with resolution of the pericardial effusion without evidence of an LV thrombus . Guideline-directed medical therapy was initiated with metoprolol succinate 25\u2005mg daily, losartan 25\u2005mg daily, and spironolactone 25\u2005mg daily; statin was initially held due to reported intolerance. Oral amiodarone 200\u2005mg daily was continued for 1 month for arrhythmia management. Antithrombic therapy with aspirin 81\u2005mg daily and clopidogrel 75\u2005mg daily was started. Anticoagulation was held in the setting of completed left atrial appendage ligation and without signs of further thrombus.\nThe patient was clinically well without further symptomatic concerns of haemopericardium or heart failure 1 month post-operatively. The patient continued to participate well in his cardiac rehabilitation program and was cleared to return to work.", "summary": "We describe a case of contained rupture of a large left ventricular aneurysm (LVA) presenting with syncope in a 60-year-old male with late presentation myocardial infarction (MI) 6 weeks prior on home triple antithrombotic therapy (TAT). Urgent pericardiocentesis along with imaging techniques including ultrasound, computed tomography angiography (CTA), and cardiac magnetic resonance imaging (MRI) were used for initial diagnosis. Definitive treatment was achieved with excision and repair of the LVA with return to prior functional status 1 month after intervention.", "subclaim_evaluations": [ { "subclaim": "The patient was a 60-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a late presentation myocardial infarction 6 weeks prior.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was on home triple antithrombotic therapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a contained rupture of a large left ventricular aneurysm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with syncope.", "support_label": "supported", "is_refined": false }, { "subclaim": "Urgent pericardiocentesis was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography angiography was used for diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac magnetic resonance imaging was used for diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Definitive treatment was excision and repair of the left ventricular aneurysm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient returned to prior functional status 1 month after intervention.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_647_en.txt", "fulltext": "A 57-year-old Caucasian man with a smoking habit who had a history of hypertension and dyslipidemia as well as a family history of thoracic aortic dissection presented to a community hospital complaining of sudden onset of chest discomfort and dyspnea. He was diaphoretic, with blood pressure of 114/60mmHg and no pulse deficit, heart rate of 114 beats per minute and respiratory rate of 20 breaths per minute. In addition, he required oxygen by nasal cannula to maintain oxygen saturation above 90%. He had a large-volume central pulse, no extra heart sounds and soft systolic and early diastolic murmurs over the aortic valve. His jugular venous pressure was 4cm above the sternal angle, and he had crackles at both lung bases. There were no features suggestive of Marfan syndrome or connective tissue diseases. The initial emergency work-up included an electrocardiogram (EKG), which showed left ventricular hypertrophy with repolarization abnormalities; a chest X-ray with increased interstitial markings suggesting acute pulmonary edema; a troponin I level of 0.41\u03bcg/L; and a brain natriuretic peptide level of 487ng/L.\nOn the basis of the patient\u2019s abrupt onset of symptoms, family history of aortic dissection and findings consistent with acute aortic insufficiency (large-volume pulse, early diastolic murmur and heart failure), an emergent contrast-enhanced CT scan was obtained . This scan showed a 5cm aortic root aneurysm but no aortic dissection. The patient was treated medically for acute coronary syndrome and heart failure, including dual anti-platelet therapy and anti-coagulation. He was subsequently transferred to a tertiary care hospital. Because of the high clinical suspicion of an acute aortic dissection based on his family history, sudden onset chest discomfort and findings of acute aortic insufficiency and heart failure , a transesophageal echocardiogram was taken, even in light of the negative CT scan . This test demonstrated an aortic dissection flap confined to the aortic root, superior to the aortic valve and associated with severe aortic insufficiency. The patient underwent successful repair of his Stanford type A aortic dissection with a 27mm mechanical valved conduit 21 hours after his initial presentation to the community hospital. The pathology report showed a structurally normal trileaflet native valve and cystic medial necrosis of the wall of the aortic root. Specialist cardiovascular radiologists who reviewed the initial CT scan post hoc reprocessed the raw data and correctly identified the dissection above the aortic valve . The dissection flap had initially been misinterpreted as a combination of normal aortic valve apparatus and motion artefact.", "summary": "We report the case of a 57-year-old Caucasian man with a typical presentation for acute type A aortic dissection in whom the initial non-cardiac gated computed tomographic angiogram was negative, leading to a delay in surgical management. Transesophageal echocardiography and post hoc 3D reconstruction of the original computed tomographic scan revealed a dissection flap confined to the aortic root, immediately superior to the sinuses of Valsalva and masquerading as part of the aortic valve apparatus.", "subclaim_evaluations": [ { "subclaim": "The patient was a 57-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had acute type A aortic dissection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial non-cardiac gated computed tomographic angiogram was negative.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Transesophageal echocardiography revealed a dissection flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "Post hoc 3D reconstruction of the original computed tomographic scan revealed a dissection flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "The dissection flap was confined to the aortic root.", "support_label": "supported", "is_refined": false }, { "subclaim": "The dissection flap was immediately superior to the sinuses of Valsalva.", "support_label": "supported", "is_refined": false }, { "subclaim": "The dissection flap masqueraded as part of the aortic valve apparatus.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_57_en.txt", "fulltext": "A 73-year-old female complained of back pain and weakness in lower limbs for 2 weeks. 3 months ago, after a minor trauma, she got back pain without weakness in lower limbs. Radiography including lateral radiographs and MRI performed at a local hospital. Initially, she was diagnosed with a L1 compression fracture and accepted conservative treatment. After an asymptomatic period, she complained progressive pain at the fracture position with weakness of both lower limbs and was referred to our hospital with suspicion of K\u00fcmmell\u2019s disease. The back pain evaluated by visual analog scale (VAS) scale was 9. According to American Spinal Injury Association (ASIA) grading criteria, the neurological function was rated as ASIA C. Sagittal MR images showed a fluid-containing IVC with high-signal intensity on T2-weighted images and STIR MR sequences at L1 and sagittal reconstruction CT scan showed a linear radiolucent IVC, accompanying spinal cord compression. The biochemical workup revealed no abnormal indications of infection (including C-reactive protein (CRP) levels, erythrocyte sedimentation rate (ESR) and T-SPOT). Furthermore, the patient denied the history of cancer or tuberculosis and she also denied hypothermia, night sweats and weakness.\nBefore surgery, we obtained the informed consent of the patient and her family to perform the operation. The patients were placed in a prone position under general anesthesia with somatosensory-evoked potentials and motor-evoked potentials for spinal cord monitoring. After the lesion was positioned with the C-arm, a standard posterior midline approach with subperiosteal stripping was used to expose the spinous processes, lamina, and facet joints. Considering the presence of osteoporosis in elder female patient, we performed a long segment pedicle screw fixation (Cox Spinal Screw-Rod System, Fule Science & Technology, Beijing, China) from T10-L3 to avoid implant failure . Then, a complete laminectomy-facetectomy was performed to decompress and fully visualize the dural sac. A temporary stabilizing rod was fixed on one side of the pedicle screws. On the contralateral side, the facet joints of the diseased vertebra were removed to reveal the pedicle. Then, the pedicle and vertebral body, including the superior and inferior disk, were piecemeal removed by rongeurs, osteotomes, or curettes. To our surprise, caseous necrosis and inflammatory granulation could be seen in the surgically resected lesions. The specimens were sent for pathologic examination. After osteotomy and debridement in anterior column at L1, we used a \u2018off-the-shelf\u2019 (OTS) three-dimensional (3D) printed artificial vertebral body instead of various materials, such as bone grafts, mesh cages, or expandable titanium cages, to reconstruct sagittal alignment . Based on preoperative 3D reconstruction of CT and MRI images, the artificial prosthesis was designed in conformity with the expected defects that may occur after the affected vertebral body resection.\nPathological examinations reported caseous necrosis tissue, epithelioid granuloma existed with the hyperplasia tissue and the acid-fast bacillus was also found .\nAfter surgery, the patient was treated with quadruple anti-tuberculous chemotherapy and hepatoprotective drug for 12 months and required to wear a brace for at least 3 months. Two weeks after surgery, the patient could walk and discharge from the hospital. Three months after surgery, the VAS scores decreased from preoperative 9 to 1 and the neurological function recovered to ASIA E. No internal fixation failure and recurrence of tuberculosis occur at last follow-up .", "summary": "A 73-year-old female complained of back pain and weakness in lower limbs for 2\u2009weeks. 3\u2009months ago, after a minor trauma, she got back pain without weakness in lower limbs. Initially, she was diagnosed with a L1 compression fracture and accepted conservative treatment. After an asymptomatic period, she complained progressive pain at the fracture position with weakness of both lower limbs and was referred to our hospital with suspicion of K\u00fcmmell's disease. The patient underwent posterior debridement and internal fixation for decompression and stabilization of the spine. Pathological examinations revealed the patient with spinal tuberculosis.", "subclaim_evaluations": [ { "subclaim": "The patient is a 73-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She complained of back pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had weakness in lower limbs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The symptoms lasted for 2 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three months ago, she had back pain after a minor trauma.", "support_label": "supported", "is_refined": false }, { "subclaim": "At that time, she did not have weakness in lower limbs.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with a L1 compression fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received conservative treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had an asymptomatic period.", "support_label": "supported", "is_refined": false }, { "subclaim": "She then had progressive pain at the fracture position.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had weakness of both lower limbs.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was referred to the hospital with suspicion of K\u00fcmmell's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent posterior debridement.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent internal fixation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was for decompression and stabilization of the spine.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathological examinations revealed spinal tuberculosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1167_en.txt", "fulltext": "A 74-year-old male was admitted to our hospital for the treatment of esophageal cancer. The patient had no symptoms with normal temperature at the time of admission. His past medical history included diabetes mellitus for 24 years. He underwent endoscopic submucosal dissection for early gastric cancer 4 years ago and video-assisted thoracic surgery for pulmonary adenocarcinoma in the right upper lobe 5 years ago. He occupation was making metal molds. He was ex-smoker: Brinkman index was 980. Laboratory studies showed white blood cells of 10.0 \u00d7 103/L, C-reactive protein of 6.07 mg/dL, hemoglobin A1c test of 8.8%, fasting blood sugar of 237 mg/dL on admission. Serum tumor markers, including CEA, CA19\u20139, SCC, CYFRA, were unremarkable. He underwent esophago-gastro-duodenoscopy for follow-up after endoscopic submucosal dissection for early gastric cancer. The upper endoscopy showed a 0-IIa lesion with relatively large granular nodules on the lower thoracic esophagus . The pathologic assessment of the biopsy revealed squamous cell carcinoma of the esophagus. The esophageal 0-IIa lesion with relatively large granular nodules let us consider the depth of esophageal cancer was deeper than M3/SM1. Chest X-Ray was normal, however, chest CT revealed a 1.3 cm \u00d7 0.9 cm pulmonary mass in the lower lobe of the right lung a month before admission . PET/CT showed the pulmonary mass had maximal standardized uptake value (SUVmax) of 3.88 (arrow) and part of the lower thoracic esophagus had SUVmax of 2.37 (arrowhead) 2 weeks before admission . Because the image of pulmonary mass had not changed between CT and PET/CT for 2 weeks and because he had no fever, even though he had inflammation reaction on laboratory studies, pulmonary mass was considered to be unlikely due to infection. Thus, he was initially diagnosed with esophageal cancer with a pulmonary metastasis or recurrence of a pulmonary adenocarcinoma. Considering the both possibilities, we started chemotherapy with cisplatin (CDDP) 70 mg/m2 day1 plus 5-fluorouracil (5-FU) 700 mg/m2 day1\u20134 on the day 4 after admission. On the day 8, CT revealed a slight pleural effusion in the right side . On the day 9, to rule out carcinomatous pleurisy, an ultrasound-guided aspiration of pleural effusion was performed. The effusion was serous and contained no malignant cells. After the aspiration, the patient got a high fever. Laboratory test showed white blood cells of 18.6 \u00d7 103/L (90.8% of Neutrophil), CRP of 25.87 mg/dL. Considering that fever was due to respiratory infection after the aspiration, intravenous Sulbactam/Ampicillin (6 g/day) was administered. On the day14, his fever was persistent and he also had a cough. Because CT revealed an increased amount of pleural effusion , we considered the mass was lung abscess. By the second ultrasound-guided aspiration of the pleural effusion, we got a 50 ml of white suppurative effusion. The effusion turned out to contain Actinomyces israelii , and proved pulmonary mass-like lesion was pulmonary actinomycosis. The patient received intravenous penicillin G (24 million units/day) for 4 weeks, followed by oral amoxicillin 2250 mg/day for 6 months. The patient received four courses of chemotherapy (CDDP/5-FU) and curative radiotherapy (1.8Gy/total 50.4Gy) as esophageal cancer deeper than M3/SM1. The pulmonary actinomycosis disappeared six months after the treatment with antibiotics . After the chemoradiation therapy without any complications, the esophageal cancer was in complete remission.", "summary": "A 74-year-old male who had esophageal cancer and a pulmonary mass that was positive for 18F-fluorodeoxyglucose positron emission tomography/computed tomography was initially diagnosed with esophageal cancer with a lung metastasis because he was asymptomatic. However, aspiration of pleural effusion revealed that the pulmonary lesion was actinomycosis.", "subclaim_evaluations": [ { "subclaim": "The patient is a 74-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had esophageal cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a pulmonary mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary mass was positive for 18F-fluorodeoxyglucose positron emission tomography/computed tomography.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was initially diagnosed with esophageal cancer with a lung metastasis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was asymptomatic.", "support_label": "supported", "is_refined": false }, { "subclaim": "Aspiration of pleural effusion was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary lesion was actinomycosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1851_en.txt", "fulltext": "A 51-year-old female patient with a 27-year history of bipolar disorder was admitted to the psychiatric clinic in September 2017 due to depressed mood, ideas of reference, delusions of persecution and anxiety. It was known from her medical history that her first psychotic episode (acute paranoid syndrome) occurred in 1990. The patient was hospitalized for a few weeks and was treated with antipsychotic drug (perazine) with a good result. Within the next 10 years the patient was hospitalized 4 times and diagnosed with depression and mania. The depressive episodes were treated with different antidepressant drugs (imipramine, perazine and venlafaxine) in combination with mood stabilizers (carbamazepine and/or lithium), whereas antipsychotic drugs were used to treat the mania. After the last hospitalization (in 2000) for depression, the patient continued her treatment (imipramine, perazine, lithium and carbamazepine) as an out-patient until 2008. The treatment of the patient was modified due to fluctuations in her mental state. Imipramine and carbamazepine were withdrawn and fluoxetine was commenced. In 2015, the patient was hospitalized owning to acute intoxication with lithium (> 1.2 mmol/l), renal failure and extrapyramidal symptoms. Lithium was withdrawn and gabapentine was initiated for the extrapyramidal symptoms. In addition, hypothyroidism was diagnosed and levothyroxine was prescribed, which patient took until 2016. Within the next 2 years the patient was taking fluoxetine (60 mg/d), perazine (150 mg/d) and gabapentine (800 mg/d). During that time carbamazepine was commenced (200 mg/d, max. to 800 mg/d) to stabilize the patient\u2019s mood, but owing to severe deterioration of her mental state (intensification of both psychotic and depressive symptoms), the drug was withdrawn and lithium (max.1000 mg/d) was reintroduced. Additionally, olanzapine (5 mg/d) for psychotic symptoms and biperiden (4 mg/d) for muscle stiffness were added. Throughout the disease (since the first psychotic episode in 1990 until the last hospitalization in 2017), there were no psychiatric comorbidities diagnosed. Periodic hypothyroidism (in 2015) treated with levothyroxine and renal failure caused by acute intoxication with lithium were notable for the patient\u2019s history.\nThe patient was admitted to the psychiatric clinic in September 2017 due to depressed mood, ideas of reference, delusions of persecution and anxiety. During her admission disturbances of consciousness were not observed and the patient was auto- and allopsychically orientated. The patient\u2019s general condition was good (blood pressure: 115/70 mmHg, pulse 72, respiratory rate16/min and BMI 27,22). A regular systolic murmur was noted and lungs were clear bilaterally. The abdomen was symmetrical without distention and bowel sounds were normal in quality and intensity in all areas. The patient had dry skin and varicose veins of the lower extremities. Her laboratory results showed lithium levels of 1.48 mmol/l, GFR 35 ml/min, creatinine 1.56 mg/dl and WBC 10.42 \u00d7 10^3/ml. A urinary tract infection was diagnosed (leukocytosis 10.2 \u00d7 10^3/ml, positive result of urine inoculation-Klebsiella oxytoca) and antibiotic therapy was initiated (sulfamethoxazole with trimethoprim). After 5 days of treatment her physical state deteriorated, she developed a fever of 38.4 \u00b0C and her laboratory results revealed a toxic level of lithium carbonate 2.34 mmol/l, creatinine 2.05 mg/dl and GFR 25 ml/min. Acute renal failure was diagnosed by a nephrologist and as a result the lithium was withdrawn and the antibiotic therapy was replaced with ceftriaxone 2 g/d (lower nephrotoxicity). Normal saline was administered to the patient for two days in order to decrease the toxic level of lithium. The patient\u2019s general condition and laboratory findings improved (level of lithium 1.34 mmol/l, creatinine 1.94 mg/l, GFR 27 ml/min), and 7 days later the antibiotic therapy was discontinued. Other laboratory results (biochemistry, hematology, lipidemia, ions and hormone levels- TSH, fT3, fT4) were found to be within normal range, so other somatic disorders, apart from renal failure, were excluded.\nAfter stabilization of her somatic condition, and despite her treatment (the patient was continuing treatment with fluoxetine 60 mg/d, olanzapine 5 mg/d, gabapentin 800 mg/d, perazine 150 mg/d and biperiden 4 mg/d), the patient\u2019s mental state deteriorated significantly (depressed mood, ideas of reference, aggravated delusions of persecution), so the treatment was changed accordingly. All drugs taken by the patient so far were gradually withdrawn (olanzapine and perazine over 6 days; fluoxetine over 4 weeks, gabapentine over 3 weeks and biperiden over 1 week) and lamotrigine (200 mg/d) and aripiprazole (30 mg/d) were initiated. Lamotrigine was used to replace lithium, as it is a good mood stabilizer without any nephrotoxic influence on the kidneys. Lamotrigine was commenced at a dose of 25 mg/d, which the patient took for 2 weeks. The dosage was then increased to 50 mg/d for a week, and then incrementally increased each week up to the final dose of 200 mg/d. Aripiprazole was initiated at a dose of 7.5 mg/d in order to reduce delusions and was uptitrated to the final dose of 30 mg/d over 2 weeks. As a result of the insufficient effectiveness of aripiprazole and lamotrigine treatment, which lasted 6 weeks, (ideas of reference, delusions of persecutions were maintained and problems with sleep), quetiapine was added (50 mg/d) in the 6th week. A partial good response to the treatment was observed after 7 days (partial reduction of delusions and mood stabilization), so the doctors decided to uptitrate the quetiapine dose to 400 mg/d, which took 9 days. Further treatment with aripirazole, lamotrigine and quetiapine resulted in NMS development. A description of NMS and its treatment is presented in Table .\nTo assess and quantify the causal role of antipsychotic drugs in the mediation of NMS, the Adverse Drug Reaction (ADR) Probability Scale was used. According to this scale each drug was assigned to a probability category on the basis of points, which were calculated as follows: aripiprazole 2, lamotrigine 3 and quetiapine 5. Number of points: > 9 means definitive adverse drug reaction; 5 to 8 points- probable adverse drug reaction; 1 to 4- possible adverse drug reaction and 0- doubtful adverse drug reaction .", "summary": "A 51-year-old female patient with a 27-year history of bipolar disorder, being treated with lithium, fluoxetine, olanzapine, gabapentine, perazine and biperiden, was admitted to the hospital due to depressed mood and delusions. A urinary tract infection was diagnosed and antibiotic therapy was initiated. After 5\u2009days of treatment her physical state deteriorated and she developed a fever of 38.4\u2009\u00b0C. Her laboratory results revealed a toxic level of lithium (2.34\u2009mmol/l). Acute renal failure was diagnosed and the lithium was withdrawn. After stabilization of her condition, and despite her antipsychotic treatment, further intensification of delusions and depressed mood were observed. All drugs being taken by the patient were withdrawn and lamotrigine and aripiprazole were initiated. Due to the insufficient effectiveness of aripiprazole treatment and because of problems with sleep, quetiapine was added, however further treatment with this drug combination and an increase of quetiapine to 400\u2009mg/d eventually caused NMS. Amantadine, lorazepam and bromocriptine were therefore initiated and the patient's condition improved.", "subclaim_evaluations": [ { "subclaim": "The patient is a 51-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a 27-year history of bipolar disorder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was being treated with lithium.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was being treated with fluoxetine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was being treated with olanzapine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was being treated with gabapentine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was being treated with perazine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was being treated with biperiden.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to the hospital due to depressed mood.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to the hospital due to delusions.", "support_label": "supported", "is_refined": false }, { "subclaim": "A urinary tract infection was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Antibiotic therapy was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 5 days of treatment, the patient's physical state deteriorated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed a fever of 38.4\u2009\u00b0C.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lithium level was 2.34\u2009mmol/l.", "support_label": "supported", "is_refined": false }, { "subclaim": "Acute renal failure was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lithium was withdrawn.", "support_label": "supported", "is_refined": false }, { "subclaim": "All drugs being taken by the patient were withdrawn.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lamotrigine was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Aripiprazole was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Quetiapine was added.", "support_label": "supported", "is_refined": false }, { "subclaim": "Quetiapine was increased to 400\u2009mg/d.", "support_label": "supported", "is_refined": false }, { "subclaim": "NMS occurred.", "support_label": "supported", "is_refined": false }, { "subclaim": "Amantadine was initiated.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Lorazepam was initiated.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Bromocriptine was initiated.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient's condition improved.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_2197_en.txt", "fulltext": "We report a case of a 54-year-old woman who presented with a new mass on the abdominal wall scar that had grown in the past 3 months. She had a cesarean sections 31 years ago. In 2017, she underwent laparoscopic right adnexectomy for a chocolate cyst of the right ovary.\nAn increased abdominal mass was reported in our hospital, and physical examination revealed a subcutaneous solid tumor with a diameter of 3 cm around the scar of laparoscopic surgery on the right lower abdomen. Transabdominal ultrasound showed a cystic tumor in the subcutaneous adipose layer of the right lower abdomen . Trans-vaginal ultrasonography showed normal findings.Routine laboratory findings and tumor markers (AFP, CA125, HE4 and CEA) were normal, but serums CA-199 were elevated at 41.48U/m U/mL. The patient was excised under general anesthesia. During the intraoperative exploration of the fat layer, a 3 \u00d7 2 cm mass with hard texture could be reached. After the fat was cut open, a cystic mass could be seen, in which coffee-colored fluid flowed out a poorly differentiated endometrioid carcinoma . PAX-8, ER, KI-67 and CD10 were positive, while STATB2, GATA3, CDX-2 and PR were negative. Combined with the patient's history of laparoscopic surgery, ultrasound and pathological findings, it was highly suspected that the tumor was a malignant transformation of laparoscopic trocar endometriosis.\nWhole-body positron emission tomography and computed tomography (18-FDG PET-CT) were performed at disease stage 14 days after surgery and showed slight hypermetabolism in the incision area. Multiple swollen lymph nodes in retrodiaphragmatic, retroperitoneal, bilateral iliac vessels and right inguinal area, abnormal metabolism.\nOur patient then underwent surgical staging, laparoscopy through the peritoneum. The abdominal and renal pelvis were carefully examined, intraoperative adhesions between the greater omentum, the abdominal wall and the fundus of the uterus were observed. Tumor nodules were observed on the surface of the sigmoid colon and rectum. Right total iliac, external iliac, internal iliac, obturator lymph nodes and para-aortic lymph nodes were enlarged and fused into masses. Final pathology revealed a metastatic poorly differentiated adenocarcinoma arising from a foci of endometriosis.Tumor metastasis was observed in right pelvic lymph node and right inguinal lymph node.The remainder of the specimens were negative for malignancy.\nSerum CA-125 and CA-199 increased to 36 one month after operation, 48 U/mL and 77.67U/mL, respectively. Serum CA-125 and CA-199 decreased to normal 4 months after surgery. After the operation, patients received systemic chemotherapy (6 cycles of tri-weekly liposomal doxorubicin 30 mg/m2 and carboplatin AUC = 5), which is similar to adjuvant chemotherapy for epithelial ovarian cancer. CT scans showed no evidence of recurrence after 6 cycles of chemotherapy. Three months after 6 times of chemotherapy, she underwent repeat 18-FDG PET-CT examination, which revealed most of the original enlarged lymph nodes disappeared, with only a few small lymph nodes behind the peritoneum and low metabolism.Our patients showed no signs of recurrence 16 months after initial diagnosis,CA199, AFP, CA125, HE4 and CEA were all normal.", "summary": "We report on a 54-year-old woman with trocar site endometriosis 2\u00a0years after laparoscopic ovarian endometrial resection. Physical examination revealed a subcutaneous solid tumor with a diameter of 3\u00a0cm surrounding the scar of laparoscopic surgery in the right lower abdomen. Transabdominal ultrasonography showed a cystic tumor in the subcutaneous adipose layer of the right lower abdomen. The pathological diagnosis was poorly differentiated endometrioid carcinoma. Hysterectomy, bilateral salpingo-oophorectomy and pelvic lymphadenectomy were then performed. Histological examination revealed mixed endometrioid carcinoma and clear cell carcinoma. After six cycles of chemotherapy, computed tomography showed no signs of recurrence.", "subclaim_evaluations": [ { "subclaim": "The patient is a 54-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had laparoscopic ovarian endometrial resection 2 years before the current presentation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She was diagnosed with trocar site endometriosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Physical examination revealed a subcutaneous solid tumor with a diameter of 3 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was located around the scar of laparoscopic surgery in the right lower abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transabdominal ultrasonography showed a cystic tumor in the subcutaneous adipose layer of the right lower abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pathological diagnosis was poorly differentiated endometrioid carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hysterectomy was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Bilateral salpingo-oophorectomy was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Pelvic lymphadenectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histological examination revealed mixed endometrioid carcinoma and clear cell carcinoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received six cycles of chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed no signs of recurrence after chemotherapy.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2044_en.txt", "fulltext": "A 57-year-old Asian man without relevant previous medical history was hospitalized following a fall from the 15th floor of a condominium. A witness said he had fallen from the condominium and had contacted electrical wires before hitting the ground. Prior to being transferred to the hospital, when the emergency medical service personnel arrived on scene, the patient had no pulse, but spontaneous circulation returned after 4 min of chest compression. On hospital arrival, the patient\u2019s airway was maintained spontaneously, respiratory rate was 30 breaths/min, blood pressure was unmeasurable but the left femoral artery pulse was weakly palpable, heart rate was regular at 136 beats/min, body temperature was 36.1 \u00b0C, and Glasgow Coma Scale was E3V1M5. His right inner thigh was lacerated halfway around, and he was actively bleeding from this site. Blood analysis data on admission are shown in Table . We immediately initiated a massive transfusion protocol, secured the airway of the patient with endotracheal intubation and temporarily ligated the proximal exposed superficial femoral artery (SFA), deep femoral artery (DFA) just distal part after branching lateral femoral circumflex artery (LFCA), and superficial femoral vein separately. As we could not detect backflow from the distal artery, possibly because of intimal injury, spasm, or thrombus, and also as there was no time to expose this artery, we could not temporarily shunt it. As well, a tourniquet could not be applied because the injury site was too proximal to the torso. In parallel with preparations to initiate resuscitative endovascular balloon occlusion of the aorta via the left femoral artery, we packed the thigh and sequentially searched for other sites of bleeding because of the patient\u2019s continued hemodynamic instability. Although we found no other sites of bleeding according to an extended focused assessment with sonography for trauma examination, subsequent plain pelvic radiography suggested the potential for retroperitoneal bleeding with iliac fracture. Considering the patient\u2019s hemodynamics, we performed retroperitoneal packing by making suprapubic incision and entering preperitoneal space comprising the para-vesical and presacral space and then packing pads were placed.\nAfter this was completed, the patient was stable enough to undergo contrast-enhanced computed tomography (CECT). CECT showed fractures of the 4th lumbar vertebra and right iliac body concomitant with arterial extravasation at this site , so we performed transcatheter arterial embolization . Although CECT showed that the right SFA and DFA just distal part after branching LFCA were interrupted , narrow blood flow in the distal popliteal artery seemed to be maintained by collateral perfusion from LFCA as pulse doppler detected a weak pulse in the dorsal pedis artery. The ankle brachial pressure index at this time was approximately 0.54. After confirming good consciousness of the patient and resolving resuscitation-related conditions such as hypothermia and acidosis, we decided to perform revascularization of the femoral artery and vein by bypassing them with great saphenous vein grafts at approximately 24 h after the initial injury. The operation was performed with the patient in the supine position. Minor fresh thrombus was obtained from distal side of SFA and SFV by Fogarty catheter insertion and we could obtain sufficient back flow from both vessels. We decided to sacrifice the DFA and vein and bypass the SFA. The great saphenous vein was harvested from the left limb, and a graft of about 7 cm in length was anastomosed to the intact intima of the SFA . As the superficial femoral vein also appeared to be bypassable, we bypassed it with a great saphenous vein . All anastomoses were performed by use of 6-0 monofilament suture with the parachute technique.\nThe soft tissue was also severely injured with some loss of tissue apparent. We initially considered covering the anastomosed vessels with viable muscle, but as the tissue deficit was not completely uncoverable, negative pressure wound therapy was applied over the muscle tissue.\nThe patient was extubated on the 4th hospital day, and musculocutaneous grafting was performed 22 days after the initial operation following completion of negative pressure wound therapy. Postoperative CECT showed the patency of flow through the femoral vessels and the score of ABI improved 1.15. As adjuvant therapy, although we could not administrate anticoagulant drugs prior to surgery on the basis of concomitant injury, systemic unfractionated heparin infusion was used during and post 10 days after bypass surgery. And then we converted to oral administration of warfarin and controlled the international normalized ratio of prothrombin time at the range of 2.0\u20132.5.\nThe patient was transferred to a rehabilitation hospital 52 days after admission without any symptom such as swelling or intermittent claudication.", "summary": "A 57-year-old Asian man was transferred to hospital after having fallen from the 15th floor of a condominium. The patient was in cardiac arrest at the scene, but was successfully resuscitated by emergency medical services staff. On arrival, the patient's hemodynamics were completely collapsed with active external bleeding from the thigh, so we immediately started resuscitation including activation of massive transfusion protocol and temporarily ligated the transected proximal superficial femoral artery, deep femoral artery just distal after branching lateral femoral circumflex artery and the superficial femoral vein. Following radiological findings showing a potential pelvic fracture with active bleeding, we also performed retroperitoneal packing in the resuscitation room and moved the patient to the angiography room for transcatheter arterial embolization. The patient's consciousness was preserved and perfusion of the injured limb was barely maintained after his hemodynamics were adequately stabilized. As we detected weak perfusion of the lower limb via a potential collateral flow from\u00a0the lateral femoral circumflex artery branches from deep femoral artery by pulse doppler of the dorsal pedis artery, we decided to reconstruct superficial femoral artery and vein at 24\u00a0h after injury using great saphenous vein bypass grafts. The patient was transferred to a rehabilitation hospital with good neurological and limb outcome after hospitalization for 52\u00a0days.", "subclaim_evaluations": [ { "subclaim": "The patient was a 57-year-old Asian man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was transferred to hospital after falling from the 15th floor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was in cardiac arrest at the scene.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency medical services staff successfully resuscitated the patient.", "support_label": "supported", "is_refined": false }, { "subclaim": "On arrival, the patient's hemodynamics were completely collapsed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had active external bleeding from the thigh.", "support_label": "supported", "is_refined": false }, { "subclaim": "Massive transfusion protocol was activated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The transected proximal superficial femoral artery was temporarily ligated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The deep femoral artery was ligated just distal after branching the lateral femoral circumflex artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The superficial femoral vein was temporarily ligated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Radiological findings showed a potential pelvic fracture with active bleeding.", "support_label": "supported", "is_refined": false }, { "subclaim": "Retroperitoneal packing was performed in the resuscitation room.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was moved to the angiography room for transcatheter arterial embolization.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's consciousness was preserved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Perfusion of the injured limb was barely maintained.", "support_label": "supported", "is_refined": false }, { "subclaim": "Weak perfusion of the lower limb was detected via a potential collateral flow from the lateral femoral circumflex artery branches.", "support_label": "supported", "is_refined": false }, { "subclaim": "The superficial femoral artery and vein were reconstructed at 24 hours after injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "Great saphenous vein bypass grafts were used for the reconstruction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was transferred to a rehabilitation hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had good neurological and limb outcome after hospitalization for 52 days.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1850_en.txt", "fulltext": "The patient was a 75-year-old woman who presented with severe bilateral leg edema and epigastralgia. There was no past history of chronic hepatitis or blood transfusion. Admission laboratory tests revealed an elevated serum aspartate aminotransferase level (48 U/L), mildly decreased serum albumin (3.6 g/dL), mildly decreased serum (74%), mildly elevated D-dimer (12.9 \u03bcg/mL), and mildly elevated fibrin degradation product (12.6 \u03bcg/mL). The tumor marker AFP was slightly elevated to 585 ng/mL. The Child-Pugh classification was A, and the indocyanine green retention rate at 15 min was 12%. CT scans showed a huge tumor, 21 cm in diameter, in the right liver and TT, 37 mm in diameter, in the right atrium . The TT was pedunculated, swung like a pendulum with the heartbeat, and reached the tricuspid valve on a transesophageal ultrasound video . The symptomatic patient had a risk of sudden death due to TT in the right atrium. Therefore, we explained the high surgical mortality rate to the patient and her family, and they decided to proceed with surgery.\nAt first, a partial sternotomy was made, and cardiopulmonary bypass (CPB) via the aorta, superior vena cava, and right femoral vein and electrical ventricular fibrillation were performed after intravenous injection of 25,000 units of heparin sodium. Although the TT in the right atrium was very soft and fragile, thrombectomy from the right atrium and inferior vena cava (IVC) was successful . After the removal of TT, the IVC was clamped with a tourniquet above the diaphragm and the right atrium was sutured with 5\u20130 Prolene. After DC defibrillation was carried out, CPB was stopped, the tourniquet on the IVC was released, and 100 mg protamine was administered for the neutralization of heparin. The open heart surgery time was 23 min, and the CPB time was 42 min. Next, a reverse T incision was made, and right hepatectomy by anterior approach and IVC tumor thrombectomy were performed. After ligation of the anterior and posterior Glissonean pedicles, the liver parenchyma was transected under the Pringle maneuver and IVC clamping below the liver. After the IVC and right hepatic vein were confirmed by anterior approach, the IVC was opened and a residual TT in the IVC was removed under total hepatic vascular exclusion (THVE) . Finally, the huge tumor was removed with the diaphragm without pulmonary embolism. The total operation time was 9 h, and the total blood loss was 8200 mL. The tumor was of the massive type macroscopically , and cancer cells showed moderately to poorly differentiated HCC with invasion to the portal vein, hepatic vein, and diaphragm. The patient\u2019s postoperative course was uneventful, and she was discharged 14 days after surgery. She is still alive 14 months after surgery with recurrence in the lung.", "summary": "Tumor thrombectomy under cardiopulmonary bypass with heparin and electrical ventricular fibrillation prior to hepatectomy was successfully performed to prevent sudden cardiac arrest or pulmonary embolism in a 75-year-old woman with a huge HCC and TT in the right atrium. After the neutralization of heparin, right hepatectomy with tumor thrombectomy in the inferior vena cava was performed. The total operation time was 9\u2009h, and the total blood loss was 8200\u2009mL. The patient's postoperative course was uneventful, and she was discharged 14\u2009days after surgery. One year after surgery, she is alive with HCC recurrence in the lung.", "subclaim_evaluations": [ { "subclaim": "The patient was a 75-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a huge hepatocellular carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a tumor thrombus in the right atrium.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor thrombectomy was performed under cardiopulmonary bypass.", "support_label": "supported", "is_refined": false }, { "subclaim": "Heparin was used during the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Electrical ventricular fibrillation was used during the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was performed prior to hepatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The goal was to prevent sudden cardiac arrest.", "support_label": "supported", "is_refined": false }, { "subclaim": "The goal was to prevent pulmonary embolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Right hepatectomy was performed after heparin neutralization.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tumor thrombectomy in the inferior vena cava was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The total operation time was 9 hours.", "support_label": "supported", "is_refined": false }, { "subclaim": "The total blood loss was 8200 mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged 14 days after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "One year after surgery, she is alive.", "support_label": "supported", "is_refined": false }, { "subclaim": "HCC recurrence in the lung was noted one year after surgery.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1992_en.txt", "fulltext": "A 26-year-old woman was admitted to the emergency department due to intense headache, chest discomfort, palpitations, and breathlessness, with 4 h of evolution.\nPhysical examination showed tachypnoea, tachycardia (145 b.p.m.), blood pressure of 158/95 mmHg, no fever, and oxygen saturation on room air of 92%. Cardiac auscultation was normal but pulmonary auscultation revealed bilaterally dispersed crackles. She was pale, with cold and clammy extremities and decreased capillary refill time but peripheral pulses were easily palpable.\nThe patient had a personal history of migraine and had been submitted to periodontal surgery on the previous day. She was medicated with amoxicillin/clavulanic acid and prednisolone. No relevant family history was reported.\nThe electrocardiogram (EKG) revealed sinus tachycardia, left axis deviation, V4\u2013V6 ST-segment depression, maximum 2 mm at V5, and an inverted T wave in aVL .\nTransthoracic echocardiography showed severe LV systolic dysfunction with midbasal segments akinesia and hypercontractility of the apical segments (, , Video S1).\nThe patient underwent aortic computed tomography angiography that excluded an acute aortic syndrome, but identified signs of severe pulmonary oedema and two heterogeneous solid masses in both adrenal glands, the largest on the right adrenal gland, measuring 9.2 \u00d7 9.2 \u00d7 10.8 cm, suggestive of a bilateral pheochromocytoma .\nThe patient progressed with respiratory failure and shock signs with poor peripheral perfusion, oligoanuria, and arterial hyperlactacidemia (41 mg/dL; normal range\u2264 18 mg/dL), despite her hypertensive profile (mean arterial pressure 110\u2013120 mmHg). At this stage, she was submitted to mechanical ventilation. Due to the rapidly deteriorated clinical status, she was referred and transported to the closest hospital with extracorporeal membrane oxygenation (ECMO) capability for immediate mechanical circulatory support.\nThe patient remained with veno-arterial ECMO (VA-ECMO) support for 14 days and progressive recovery of LV dysfunction was observed, enabling the weaning of the VA-ECMO support from the 10th day, without use of inotropics. There were no significant changes on the EKG on the following 2 days, with regression of repolarization changes at follow-up. The peak troponin I level was 1.73 ng/mL (normal range \u22640.015 mg/dL), on the first day of hospitalization with a slow but progressive fall and subsequent normalization.\nUrinary catecholamines and metanephrines in 24-h urine were elevated . Alpha-blockade was started with phenoxybenzamine and subsequently beta-blockade with metoprolol.\nOn the 35th day of hospitalization, open bilateral adrenalectomy was performed, without complications, and she began supplementation with gluco and mineralocorticoids. Anatomopathological examination confirmed the diagnosis of bilateral pheochromocytomas. The patient was discharged on the 49th day of hospitalization with complete recovery of the left ventricular systolic function and preserved neurologic status.\nAfter discharge, the patient performed body scintigraphy with MIBG-123 that excluded pheochromocytoma metastases or synchronous tumours, but she was diagnosed with bilateral thyroid medullary carcinoma. Total thyroidectomy was performed and the diagnose of Type 2 multiple endocrine neoplasia (MEN) syndrome was established.", "summary": "We present a case of a young woman was admitted to the emergency department due to intense headache, chest discomfort, palpitations, and breathlessness. An ITS secondary to a pheochromocytoma crisis presenting with CS was diagnosed. The patient was managed with veno-arterial extracorporeal membrane oxygenation, until recovery of LV function. On the 35th day of hospitalization, open bilateral adrenalectomy was performed.", "subclaim_evaluations": [ { "subclaim": "The patient was a young woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted to the emergency department.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had intense headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had chest discomfort.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had palpitations.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had breathlessness.", "support_label": "supported", "is_refined": false }, { "subclaim": "An ITS secondary to a pheochromocytoma crisis was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The presentation included CS.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was managed with veno-arterial extracorporeal membrane oxygenation.", "support_label": "supported", "is_refined": false }, { "subclaim": "LV function recovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Open bilateral adrenalectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The adrenalectomy was performed on the 35th day of hospitalization.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_251_en.txt", "fulltext": "A 33-year-old man without a previous medical or surgical history presented with chief complaints of abdominal pain and vomiting. Physical examination revealed tenderness in the lower abdomen. Laboratory data were unremarkable: C-reactive protein level, 0.16 mg/dL; white blood cell count, 9600 /\u03bcL; neutrophil count, 91.3%; and lymphocyte count, 5.4%. Ultrasonography and radiography revealed no findings that could cause abdominal pain. Contrast-enhanced computed tomography (CT) demonstrated a 45-mm-sized mass with partial calcification in the ileum , without any signs of invagination, obstruction, or volvulus. No other findings suggesting the cause of abdominal pain were observed on CT. The patient was diagnosed with an ileal tumor. After the examination, the patient\u2019s condition improved spontaneously. Several weeks later, for detailed examination of the tumor, magnetic resonance imaging (MRI) was performed, which revealed a tumor with hypointense signal on both T1-weighted (T1WI) and T2-weighted images (T2WI), and isointense signal on gadolinium-enhanced T1WI . Based on these findings, the differential diagnoses were a gastrointestinal stromal tumor, chronic distending hematoma, leiomyoma, and CFT.\nLaparoscopic surgery was performed for the pathological diagnosis and treatment. Two 5-mm ports were placed through a vertical 4-cm skin incision in the umbilicus using EZ access and Lap Protector (Hakko Medical, Nagano, Japan). Intraoperatively, a white-colored tumor was found in the ileum, 100 cm from the terminal ileum . Careful observation of the entire abdominal cavity did not detect any other tumors, lymph node metastasis, or dissemination. After careful observation, the tumor was lead extracorporeally through the umbilical incision and a partial resection of the ileum was performed. Reconstruction was performed with a functional end-to-end anastomosis. Macroscopic findings revealed that the tumor was pedunculated and located on the antimesenteric side. Microscopic findings revealed that the tumor extended from the muscularis propria to the subserosa. A few spindle cells and infiltration of lymphoplasmacytic cells were observed with dense hyalinized collagen and interspersed calcification in the background . Immunohistochemical findings revealed negative or nearly negative results for CD34, c-kit, DOG-1, desmin, S100, anaplastic lymphoma kinase, vimentin and smooth muscle actin. Factor-XIIIa was positive. The MIB-1 labeling index was less than 1%. Over 40% of the plasma cells in the stroma were IgG4 positive. The tumor was eventually diagnosed as a CFT. The patient was discharged on postoperative day 7 without any complications. No recurrence has been observed in the 6 months since the surgery.", "summary": "A 33-year-old man presented with chief complaints of abdominal pain and vomiting. Computed tomography demonstrated a 45-mm-sized pelvic mass with partial calcification in the ileum. The patient was diagnosed with an ileal tumor, and partial resection of the ileum was performed using the single-port laparoscopic technique. Pathologic findings revealed hypocellular spindle cells with dense hyalinized collagen, interspersed calcification, and infiltration of lymphoplasmacytic cells. Immunohistochemical analysis showed that the factor XIIIa was positive and other tumor-specific markers were negative. Based on these findings, the tumor was finally diagnosed as a CFT.", "subclaim_evaluations": [ { "subclaim": "The patient is a 33-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had vomiting.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed a 45-mm-sized pelvic mass.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The mass was located in the ileum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass had partial calcification.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with an ileal tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Partial resection of the ileum was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The resection was done using the single-port laparoscopic technique.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pathologic findings showed hypocellular spindle cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dense hyalinized collagen was present.", "support_label": "supported", "is_refined": false }, { "subclaim": "Interspersed calcification was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lymphoplasmacytic cell infiltration was noted.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical analysis showed factor XIIIa positivity.", "support_label": "supported", "is_refined": false }, { "subclaim": "Other tumor-specific markers were negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was diagnosed as a CFT.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2816_en.txt", "fulltext": "A 79 year old man was admitted at our emergency department due to exertion dyspnoea and swelling of the upper limbs, head and neck. Five years ago the patient had undergone elective replacement of the aortic valve with a prosthetic one (Carbomedics 23 mm) and a concomitant ascending aorta aneurysm replacement with a 28 mm synthetic graft. On admission the patient was dyspnoic with malaise. His blood pressure was normal (128/82 mmHg) and the oxygen saturation without oxygen supply was 92%. Pulses were irregular and increased in rate. ECG showed atrial fibrillation with fast ventricular response (135 to 145 beats/min). The physical examination documented cyanotic and swollen head and neck and distended jugular veins. Superior vena cava syndrome (SVCS) was clinically diagnosed. Laboratory data included a prolonged INR of 7 and Ht: 35.6%. Other elements of blood count and coagulation time were within physiologic values. Cardiac enzymes were negative. LDH was 620 IU/L. The rest of his biochemical profile was normal. Arterial blood gases showed mild respiratory acidosis (PH: 7.33) due to elevated PCO2: 48mmHg.\nChest x-rays was further confirmatory of the clinical diagnosis showing a widened mediastinum. However the contrast CT angiography of the chest was remarkable, revealing a large pseudoaneurysm of the ascending aorta with a maximum diameter of 13cm compressing the superior vena cava and an extensive collateral circulation .\nTransfusions with 2 units of fresh frozen plasma were enough to lower the INR to 1.8 and the patient was then transferred to the operating room. Femoro-femoral cannulation was undertaken in order to establish cardiopulmonary bypass and decrease the patient's temperature to down to 16\u00b0C to safely commence circulatory arrest. After the completion of cooling with collection of the patient's blood within the reservoir of the extracorporeal device, repeat sternotomy was performed through safe surgical means. Retrograde cardioplegia was installed. The pseudoaneurysm was incised and the thrombotic material was carefully removed. Two sites of major leakage originating from the anterior and posterior segment of the distal anastomosis were revealed. Suturing with 3/0 prolene, reinforced by teflon patches, was performed. Eventually extracorporeal circulation was recommenced, gradual rewarming was carried out and successful weaning from cardiopulmonary bypass was achieved.\nThe patient was extubated 6 hours later and he remained in the intensive care unit for 18 hours. His postoperative course was uneventful. Ten days following his admission the patient was discharged in good condition, presenting however atrial fibrillation with good rate control under Amiodarone treatment. Three months following his discharge he remains free of symptoms.", "summary": "We present the case of a large pseudoaneurysm of the ascending aorta, five years after primary surgery, with a significant compression of the right mediastinal venous system causing superior vena cava syndrome, detected at chest CT angiography. Perioperative findings showed two rush out points both coming from the distal aortic suture line which was performed five years ago. The patient underwent reoperation under circulatory arrest facilitating safe exploration and repair of the distal anastomotic leaks", "subclaim_evaluations": [ { "subclaim": "The patient had a large pseudoaneurysm of the ascending aorta.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pseudoaneurysm was five years after primary surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pseudoaneurysm caused significant compression of the right mediastinal venous system.", "support_label": "supported", "is_refined": false }, { "subclaim": "The compression caused superior vena cava syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The condition was detected at chest CT angiography.", "support_label": "supported", "is_refined": false }, { "subclaim": "Perioperative findings showed two rush out points.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both rush out points came from the distal aortic suture line.", "support_label": "supported", "is_refined": false }, { "subclaim": "The distal aortic suture line was performed five years ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent reoperation under circulatory arrest.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reoperation facilitated safe exploration and repair of the distal anastomotic leaks.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2889_en.txt", "fulltext": "A 33-year-old Bangladeshi woman with hypertension and diabetes had initially presented to a different hospital with intermittent episodes of palpitations for 2 years, with documented electrocardiographic (ECG) evidence of AF during the episodes. She had previously been on oral propafenone, amiodarone, and metoprolol, at separate times, but continued to experience paroxysmal AF.\nShe had a 2-year history of hypertension that was well controlled with metoprolol 50 mg twice daily and ramipril 5 mg once daily. She had type 2 diabetes mellitus, diagnosed 3 years previously, that was well controlled with metformin 500 mg twice daily. There was no evidence of diabetic nephropathy or microalbuminuria. Furthermore, other etiologies of AF, such as thyrotoxicosis, were excluded by her thyroid profile, which comprised normal levels of TSH, free triiodothyronine, and free thyroxine. Ischemic heart disease was excluded by a CT coronary angiogram, which revealed normal epicardial coronary arteries.\nGiven the indication of drug-refractory AF, our patient had undergone EPS at a different hospital from which she had been discharged 24 hours after the procedure. The EPS has comprised right femoral venous catheterization followed by the insertion of three venous sheaths into her femoral vein.\nBecause an inducible arrhythmia could not be reproduced, her pulmonary vein (PV) potentials were mapped and complete PV isolation was planned. But, because there was difficulty in isolating some of the PVs along with an extended procedural time, the procedure was abandoned. A plan was made to identify all PVs more specifically using other imaging techniques such as magnetic resonance imaging (MRI), prior to attempting the procedure again.\nShe presented to our hospital 48 hours after the EPS with shortness of breath and chest heaviness, associated with palpitations and recurrent episodes of syncope. When queried, she confirmed that these symptoms were not like those she had previously experienced during her paroxysms of AF, and reiterated that they only developed after the EPS.\nShe had no prior history of thromboembolic events, long flights, prolonged immobilization, or oral contraceptive use, and she denied any family history of thrombophilia. There was no evidence of either hypertensive or diabetic nephropathy. A urine dipstick test was negative for protein. A thrombophilia work-up revealed normal levels for protein C and S, antinuclear antibody, and anticardiolipin antibody, thus eliminating other causes of hypercoagulability as possible etiologies of thrombosis.\nOn examination, she was hemodynamically stable and heart and lung auscultation was unremarkable. There was no unilateral leg swelling. An ECG showed T inversions in leads III, aVF, and V1\u20134. It also revealed mild tricuspid regurgitation and a pulmonary artery systolic pressure (PASP) of 50 mmHg. Her right ventricle (RV) was dilated, with diameters measuring 38 mm at the basal level and 40 mm at mid-level, with a longitudinal measurement of 90 mm on the apical 4 chamber view. Tricuspid annular plane systolic excursion (TAPSE) was measured at 12 mm. Her left atrium (LA) was of normal size and measured 33 mm. Qualitative assessment revealed that right atrium was larger than her LA. There was no evidence of left ventricular (LV) hypertrophy. Her LV ejection fraction (EF) was 65 % and there were no regional wall motion abnormalities of her LV. There was no evidence of thrombus in any of the cardiac chambers.\nA CT coronary and pulmonary angiogram revealed normal coronaries with filling defects in the descending branch of her left pulmonary artery extending into the segmental arteries, suggesting thrombus .\nSubsequently, a duplex ultrasound study of her lower limb venous system showed absent blood flow in her right external and common femoral veins, confirming acute DVT affecting her right ilio-femoral segment without signs of recanalization .\nGiven the sequence of events and their temporal relationship with the EPS, and in the absence of other risk factors for DVT, it was established that the acute DVT occurred as a consequence of the femoral vein catheterization and multiple venous sheaths inserted for EPS, subsequently leading to PE. She was treated with subcutaneous enoxaparin 60 mg twice daily for 5 days along with the administration of oral warfarin. She continued taking the warfarin for 6 months, with a target therapeutic international normalized ratio of 2.5\u20133. She was asymptomatic at follow-up at six months, and, due to the resolution of the DVT, oral anticoagulation was discontinued.", "summary": "A 33-year-old Bangladeshi woman with hypertension and diabetes had initially presented with recurrent episodes of paroxysmal atrial fibrillation that manifested as palpitations for 2 years. Her atrial fibrillation was drug-refractory and could not be attributed to a treatable etiology. She had undergone an electrophysiological study at a different hospital, where right femoral venous catheterization was performed followed by the insertion of three venous sheaths. However, tachyarrhythmia could not be induced and a procedure to isolate the pulmonary vein was postponed because all the veins could not be isolated. Forty-eight hours later, she presented to our hospital with shortness of breath, chest heaviness, palpitations, and recurrent episodes of syncope. She had normal coronary arteries and no other risk factors for venous thromboembolism. She was hemodynamically stable on examination. There was echocardiographic evidence of pulmonary hypertension and right ventricular dilatation and dysfunction. A computed tomography pulmonary angiogram confirmed pulmonary embolus in the descending branch of her left pulmonary artery, extending up to the segmental arteries. Subsequently, a duplex ultrasound confirmed acute deep vein thrombosis affecting her right ilio-femoral segment. She was successfully managed with subcutaneous enoxaparin and oral warfarin (target international normalized ratio 2.5-3).", "subclaim_evaluations": [ { "subclaim": "The patient is a 33-year-old Bangladeshi woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has diabetes.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had recurrent episodes of paroxysmal atrial fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The atrial fibrillation manifested as palpitations for 2 years.", "support_label": "supported", "is_refined": false }, { "subclaim": "The atrial fibrillation was drug-refractory.", "support_label": "supported", "is_refined": false }, { "subclaim": "The atrial fibrillation could not be attributed to a treatable etiology.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had undergone an electrophysiological study at a different hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "Right femoral venous catheterization was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three venous sheaths were inserted.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tachyarrhythmia could not be induced.", "support_label": "supported", "is_refined": false }, { "subclaim": "A procedure to isolate the pulmonary vein was postponed.", "support_label": "supported", "is_refined": false }, { "subclaim": "All the veins could not be isolated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Forty-eight hours later, she presented with shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had chest heaviness.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had palpitations.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had recurrent episodes of syncope.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had normal coronary arteries.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no other risk factors for venous thromboembolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed right ventricular dilatation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed right ventricular dysfunction.", "support_label": "supported", "is_refined": false }, { "subclaim": "A computed tomography pulmonary angiogram confirmed pulmonary embolus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary embolus was in the descending branch of the left pulmonary artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary embolus extended up to the segmental arteries.", "support_label": "supported", "is_refined": false }, { "subclaim": "A duplex ultrasound confirmed acute deep vein thrombosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The deep vein thrombosis affected the right ilio-femoral segment.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was managed with subcutaneous enoxaparin.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was managed with oral warfarin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The target international normalized ratio was 2.5-3.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_181_en.txt", "fulltext": "Our patient was 35 year old male who presented to emergency department with history of fall by tripping on a stone (fall on outstretched hand). Post trauma patient had pain and difficulty moving both the shoulders. Patient was a known alcoholic, with previous history of one episode of shoulder dislocation on right side about 2 years prior to the present episode, which was adequately treated with closed reduction and immobilisation for 3 weeks. Patient does not give any history of convulsions (past or present) and no other neuro-muscular problems. On clinical examination, patient's both upper limbs were abducted and externally rotated. Bilaterally shoulder contour was lost with flattening. Other classical signs of shoulder dislocation viz, Bryants test, Callway sign, Hamilton's ruler test were positive. Radiographs of both shoulders were obtained and clinical diagnosis of SBAD was confirmed. Both shoulders were reduced in emergency operation theater under general anaesthesia by Kocher's method and were immobilized in sling. The left was immobilized with 90\u00b0 elbow flexion and the right at 110\u00b0 flexion for 3 weeks. Reduction was confirmed post operatively with X-rays. Intermitted assisted excercises where started from second week onwards and at the end of immobilization patient was advised vigorous supervised physiotherapy. By six week post injury patient had full range of adduction, flexion and internal rotation. Abduction up to 110\u00b0 was possible. Patient was advised to be cautious while doing overhead activities especially which require abduction and external rotation of shoulder.", "summary": "35 year old male presented to emergency department with history fall by tripping on a stone (fall on outstretched hand). He complained of pain and difficulty in moving both the shoulders. On clinical examination, patient's both upper limbs were abducted and externally rotated. Bilaterally shoulder contour was lost with flattening. Other classical signs of shoulder dislocation viz, Bryants test, Callway sign, Hamilton's ruler test were positive. Diagnosis was confirmed on X rays. Both shoulders were reduced in emergency operation theater under general anaesthesia by Kocher's method and were immobilised in sling.", "subclaim_evaluations": [ { "subclaim": "The patient is a 35 year old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented to the emergency department.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a history of a fall by tripping on a stone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fall was on an outstretched hand.", "support_label": "supported", "is_refined": false }, { "subclaim": "He complained of pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had difficulty moving both shoulders.", "support_label": "supported", "is_refined": false }, { "subclaim": "On clinical examination, both upper limbs were abducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "On clinical examination, both upper limbs were externally rotated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilaterally, shoulder contour was lost.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilaterally, there was flattening.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bryant's test was positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "Callaway sign was positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hamilton's ruler test was positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "Diagnosis was confirmed on X-rays.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both shoulders were reduced in the emergency operation theater.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reduction was performed under general anesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Kocher's method was used for reduction.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both shoulders were immobilized in a sling.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2945_en.txt", "fulltext": "A 63-year-old male presented with dorsal pain of a 3 month duration. He had undergone gross-total resection of an invasive mixed AB thymoma (Masaoka-Koga II\u2013III) 21 years ago, followed by local radiotherapy (52 Gy). After staying disease free for 12 years, he developed three pleural nodules; subsequent biopsy demonstrated pleural recurrent thymoma that was then treated with gamma knife radiosurgery (13 \u00d7 300 cGy in each lesion). The pleural lesions remained stable for the next 10 years. The patient was referred to our institution at the time radiographic spinal cord compression at T8-T9 level was discovered in addition to pleural thickening involving both hemithoraces . Examination did not evidence any neurological deficits.\nThe magnetic resonance imaging showed an irregular, dumbbell-shaped lesion at the T8\u2013T9 level with an intraspinal component occupying 60% of the canal, displacing the cord toward the left .\nThe spinal and foraminal components of the tumor were removed through a one-level laminectomy with right-sided foraminotomy and medial T8\u2013T9 facetectomy . The right T8 root was encased by an epidural solid tumor mass . Following gross total resection, a small dural hole was repaired at the right-sided T8 exiting nerve root . Intraoperatively, neurophysiologic recordings remained stable . The patient's postoperative course was uneventful. Postoperative MRI confirmed complete removal of the spinal tumor component . He declined postoperative adjuvant chemotherapy. Six months postoperatively, he remained neurologically intact without pain.\nThe histological analysis revealed an admixture of neoplastic epithelial cells and nonneoplastic small lymphocytes. The morphological and immunostaining features of the tumor corresponded to metastatic thymoma .", "summary": "A 63-year-old man, with a history of invasive type AB thymoma treated 21 years ago, newly presented to the hospital with a dumbbell-shaped T8-T9 lesion compressing the spinal cord. A review of the literature showed only 16 previous cases of thymic tumors with thoracic spine involvement. Here, we report the lengthiest interval between the initial tumor diagnosis and the detection of spinal involvement, that was secondary to a pleural recurrence from his thymoma. The patient did well following successful excision of the intraspinal mass which had encased the T8 nerve root.", "subclaim_evaluations": [ { "subclaim": "The patient is a 63-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has a history of invasive type AB thymoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thymoma was treated 21 years ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with a dumbbell-shaped T8-T9 lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was compressing the spinal cord.", "support_label": "supported", "is_refined": false }, { "subclaim": "A review of the literature found 16 previous cases of thymic tumors with thoracic spine involvement.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "This case had the longest interval between initial tumor diagnosis and spinal involvement.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The spinal involvement was secondary to a pleural recurrence from his thymoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had successful excision of the intraspinal mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass had encased the T8 nerve root.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_235_en.txt", "fulltext": "In August 2008, a 44-year-old female had undergone surgery for resection of a malignant melanoma in the right lower leg and a right inguinal metastatic lymph node , followed by chemotherapy with doxorubicin, adriamycin, vincristine, and interferon beta (DAV-feron). In March 2012, computed tomography (CT) revealed brain and lung metastases, so the patient began radiation therapy to treat these lesions.\nIn September 2012, the patient was admitted to our hospital for back pain. Abdominal CT and magnetic resonance imaging detected new multiple hepatic metastases of melanoma. A transcatheter arterial infusion of cisplatin was administered, and transcatheter arterial embolization (TAE) was performed. In October 2012, she began treatment with vemurafenib, based on the finding of a positive BRAF V600E mutation in the resected primary site of the skin, which was analyzed by direct sequencing analysis using DNA from the paraffin-embedded primary cutaneous melanoma. She tolerated the treatment remarkably well, and the size of the multiple hepatic and lung metastases decreased, while the size of the brain metastases did not. In addition, the serum concentration of 5-S-cysteinyldopa (5-S-CD), a biological marker of melanoma progression, was also decreased from 40.1 ng/mL to 5.2 ng/mL.\nIn December 2012, she suddenly developed severe abdominal pain. Abdominal CT revealed ruptured hepatic metastases accompanied by massive intra-peritoneal hemorrhage. A retrospective and sequential analysis of the CT images suggested that a part of the liver metastases had enlarged rapidly and then ruptured with intratumoral hemorrhage during vemurafenib treatment . An emergency TAE was performed by selective occlusion of the right hepatic artery using gelatin sponge particles. The postoperative course was uneventful for several days. However, on the 26th postoperative day, she developed hemorrhagic shock and died of renewed intra-abdominal bleeding.\nAn autopsy examination revealed hemoperitoneum due to rupture of the liver metastases. Metastases were also discovered in the brain and lungs as well as in the kidneys, adrenal gland, and lymph nodes, although these had not been detected on imaging while she was alive. There was also massive bloody ascites (1700 mL). The background liver was completely normal, whereas exposed necrotic tissue and intratumoral hemorrhage were observed at the site of tumor rupture . We concluded that the cause of death was hemorrhagic shock from ruptured hepatic metastases of malignant melanoma. Finally, for improved understanding of the mechanism of refractory metastasis, we conducted an immunohistochemical analysis of the signal transduction molecules, phosphorylated extracellular signal-regulated kinase (p-ERK), and phosphorylated Akt (p-Akt), as well as the melanocyte marker Melan-A and Ki-67 in tumor cells of the primary malignant melanoma obtained from the right lower leg and in hepatic and lymph node metastases obtained on autopsy . Our findings showed that hepatic and lymph node metastases were positive for p-ERK and negative for p-AKT, even though the primary tumor was negative for both.", "summary": "A 44-year-old female had previously undergone surgery for resection of a malignant melanoma in the lower right leg. Four years later, hepatic metastases became apparent, and transcatheter arterial embolization (TAE) was performed. Then she underwent treatment with vemurafenib. The size of the hepatic metastases markedly decreased. Two months later, they enlarged rapidly and ruptured, requiring emergency TAE. However, the patient developed hemorrhagic shock and died of renewed intra-abdominal bleeding on the 26th postoperative day.", "subclaim_evaluations": [ { "subclaim": "The patient is a 44-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had previously undergone surgery for resection of a malignant melanoma in the lower right leg.", "support_label": "supported", "is_refined": false }, { "subclaim": "Four years later, hepatic metastases became apparent.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transcatheter arterial embolization (TAE) was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent treatment with vemurafenib.", "support_label": "supported", "is_refined": false }, { "subclaim": "The size of the hepatic metastases markedly decreased.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two months later, the hepatic metastases enlarged rapidly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hepatic metastases ruptured.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergency TAE was required.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed hemorrhagic shock.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died of renewed intra-abdominal bleeding.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died on the 26th postoperative day.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1822_en.txt", "fulltext": "The patient, cmh000720, is currently a 6-year-old male who was referred for whole exome sequencing at 4 years of age. The patient was conceived via artificial insemination and was born at an estimated 38 weeks gestation via C-section to a 32-year-old G3P2 mother and distantly related 27-year-old father (5th cousins once removed). The pregnancy was complicated by gestational diabetes that was well managed with diet. Decreased fetal movements were noted throughout pregnancy, however the results from ultrasound exams and maternal serum AFP testing were normal. At birth the patient was noted to have a week cry, hypotonia, joint hypermobility, and an undescended testicle. Apgar scores were 8 and 9 at 1 and 5 min respectively; weight was 3.1 kg (30th%ile) and length 50.8 cm (68th%ile). He was discharged home at 2 days of life. Newborn screening was reported to be normal. At a routine pediatric follow up appointment at two weeks of age the patient was hospitalized for additional evaluation due to concerns of his persistent low tone and cardiac murmur. At that time he was noted to have both a left hip dislocation and right hip subluxation, with bilateral acetabular dysplasia. Use of a Pavlik harness failed correct the hip dislocation due to profound ligamentous laxity. Echocardiogram revealed a PFO and biscupid aortic valve. The patient had inconsistent TSH levels and thus was treated with levothyroxine. An MRI was suggestive of an arachnoid cyst, but was otherwise unremarkable. At 2.5 months of age an EEG revealed abnormal sharp waves, and CSF glucose levels were found to be 38. Due to a concern for a GLUT1 deficiency, a ketogenic diet was trialed but discontinued after the patient became lethargic on the diet and repeat testing was normal. The patient has had no documented clinical seizure activity.\nIn addition to his hip dysplasia, cmh000720 was also noted to have significant kyphoscoliosis and osteopenia by 4 months of age. He has had multiple fractures associated with little to no trauma including his left tibia (12 months), right femur (19 months), right tibia (20 months), left femur (2.5 years), right femur shaft (3.75 years), distal right femur (3.8 years), and left femur (4.2 years). Pamidronate infusions were trialed but an increase in fractures was noted. He has significant osteoporosis; bone density by dexa of the left forearm at 4 years of age was measured as Z score of -5.8. Spinal fusion rods were placed at 3 years of age and removed at 5 years of age. He is currently in a hard brace. Stabilization rods were also placed in both femurs .\nThe patient had developmental delay of gross motor milestones; currently he is able to walk with a walker and bear weight but cannot walk independently. Cognitively he is normal; he was able to say single words at 12 months and currently only has problems with articulation. At 6 years of age, in addition to the aforementioned symptoms, the patient is followed for mild aortic root and ascending aorta dilation, restrictive lung disease requiring C-PAP/BiPAP due to scoliosis and chronic obstructive pulmonary disease, bilateral hyperopia, astigmatism, amblyopia, and mild left ptosis, and hypoglycemia with illness. His weight 24.76 kg (85th%ile) and length 111 cm (13th%ile) are within normal limits, although he still receives supplemental nutrition overnight through a G-tube that was placed at 20 months of age. He is macrocephalic with an OFC of 54.8 cm (>98th%ile). He is only mildly dysmorphic with downslanting palpebral fissures, bluish/grey sclera, a high arched palate, short neck, arachnodactyly, and hyperextensible skin with no striae . His bone age is estimated at 4 years 6 months (>2 SD below expected for chronological age). He completed kindergarten with an IEP that includes occupational, speech and physical therapies.\nThe family history is notable for an older brother who was found to have a biscuspid aortic valve, after recommended screening. He has a healthy younger sister. Echocardiograms of both parents and younger sister were normal. Both parents are tall, and reportedly healthy.", "summary": "In this study, a 4-year-old patient with a severe phenotype of osteoporosis, hypotonia, joint laxity, fractures, scoliosis, biscuspid aortic valve and myopia was referred for next generation sequencing after extensive negative clinical testing. Whole exome sequencing was performed on the proband and his unaffected parents to identify the molecular basis of his disease. Sequencing revealed compound heterozygous variants in B3GAT3: c.1A\u2009>\u2009G (p.Met1?) and c.671\u00a0T\u2009>\u2009A (p.L224Q). Clinical and in vitro functional studies were then completed to verify the pathogenicity of the genotype and further characterize the functional basis of the patient's disease demonstrating the patient had a decrease both in the protein level of B3GAT3 and in the glucuronyltransferase activity when compared to control samples. Independent in vitro assessment of each variant confirmed the B3GAT3: c.1A\u2009>\u2009G (p.Met1?) variant is functionally null and the c.671\u00a0T\u2009>\u2009A (p.L224Q) missense variant has significantly reduced glucuronyltransferase activity (~3% of control).", "subclaim_evaluations": [ { "subclaim": "The patient is a 4-year-old.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient has a severe phenotype of osteoporosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has hypotonia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has joint laxity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has fractures.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has scoliosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a biscuspid aortic valve.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has myopia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was referred for next generation sequencing.", "support_label": "supported", "is_refined": false }, { "subclaim": "Extensive clinical testing was negative.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Whole exome sequencing was performed on the proband.", "support_label": "supported", "is_refined": false }, { "subclaim": "Whole exome sequencing was performed on the proband's unaffected parents.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Compound heterozygous variants in B3GAT3 were identified.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The variants are c.1A\u2009>\u2009G (p.Met1?) and c.671\u00a0T\u2009>\u2009A (p.L224Q).", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Clinical and in vitro functional studies were completed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had decreased B3GAT3 protein levels compared to controls.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had decreased glucuronyltransferase activity compared to controls.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Independent in vitro assessment of each variant was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The B3GAT3: c.1A\u2009>\u2009G (p.Met1?) variant is functionally null.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The B3GAT3: c.671\u00a0T\u2009>\u2009A (p.L224Q) variant has significantly reduced glucuronyltransferase activity.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The B3GAT3: c.671\u00a0T\u2009>\u2009A (p.L224Q) variant has ~3% of control glucuronyltransferase activity.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_614_en.txt", "fulltext": "A 39-year-old, healthy, non-smoking female patient with no family history of cancer was referred on suspicion of rectal cancer. Digital rectal examination and subsequent rigid proctoscopy revealed a low rectal tumor and multiple polyps in the rectum. Subsequent colonoscopy showed extensive polyposis of the entire colon. The tumor biopsy confirmed the presence of a rectal adenocarcinoma, while dysplastic changes were found in the polyp biopsies. No distant metastases were detected on the thoracoabdominal computed tomography (CT) scan, and baseline carcinoembryonic antigen (CEA) was 8 \u03bcg/L. Pelvic magnetic resonance imaging (MRI) revealed a locally advanced rectal cancer with extra-mesorectal growth into the rectovaginal septum and the lower posterior vaginal wall as well as a suspected growth into the anterior aspect of the coccygeal bone with multiple suspected malignant lymph nodes within the mesorectum (T4N2). Upon evaluation by our multidisciplinary team (MDT), she was scheduled for neoadjuvant chemoradiotherapy (CRT) followed by surgery. Neoadjuvant treatment was given as CT planned radiotherapy (daily 2-Gy fractions, 5 days per week; the initial 23 fractions to the macroscopic tumor and areas at risk, and the two final fractions adapted to the macroscopic tumor) with concomitant capecitabine (825 mg/m2) on days of RT. The response evaluation showed excellent tumor volume response, but with similar organ involvement as at baseline, and she proceeded to surgery 8 weeks after CRT completion. Surgery involved total colectomy, APE with resection of the posterior vaginal wall and coccygeal bone with subsequent reconstruction of the perineum with right-sided VRAM flap, and a terminal ileostomy. After an uneventful recovery, she was discharged 15 days postoperatively. Histologic examination of the specimen showed a 35-mm large adenosquamous carcinoma removed with free resection margins and metastasis in one of four local lymph nodes (pT2N1). In addition, multiple dysplastic adenomas were present in the entire colon.\nAt the routine follow-up 6 months postoperatively, clinical examination revealed a 2 \u00d7 2 cm tumor located in the muscle tissue of the VRAM flap, and an early local recurrence was suspected. Pelvic MRI showed a 10 \u00d7 16 mm rich vascularized and cell dense lesion corresponding to the clinically detected tumor . No other pathological findings were made on CT or MRI, and CEA was 1 \u03bcg/L. The lesion was surgically excised with a wide local resection of the tumor. Interestingly, histologic examination of the removed lesion described a mass composed of fatty tissue, fibrocytes, and fibroblasts arranged in broad, sweeping fascicles infiltrating the adjacent striated muscle tissue. No dysplasia was observed, but mitoses were present. Immunohistochemistry showed positive staining for \u03b2-catenin (ABCAM, Cambridge, USA), and the tumor was diagnosed as a fibromatosis . The medical geneticists suspected familial adenomatous polyposis (FAP), and testing of the APC gene, revealed a known disease-causing mutation c.3317dupG (p.Ala1107Serfs*12), confirming this diagnosis.", "summary": "A 39-year-old female patient with low rectal cancer and extensive colorectal polyposis was treated with neoadjuvant chemoradiotherapy followed by colectomy and abdominoperineal excision with resection of the dorsal vaginal wall and subsequent reconstruction of the perineum using the vertical rectus abdominis myocutaneous flap. At the 6-month follow-up, a suspected 2\u2009\u00d7\u20092 cm tumor recurrence was detected in the transposed tissue and was subsequently surgically removed. Histologic examination concluded with fibromatosis. Genetic testing revealed a known disease-causing mutation in the adenomatous polyposis coli gene, confirming the diagnosis of familial adenomatous polyposis.", "subclaim_evaluations": [ { "subclaim": "The patient is a 39-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had low rectal cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had extensive colorectal polyposis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received neoadjuvant chemoradiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent colectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent abdominoperineal excision.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had resection of the dorsal vaginal wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had perineal reconstruction using the vertical rectus abdominis myocutaneous flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 6 months post-surgery, a 2\u2009\u00d7\u20092 cm tumor recurrence was suspected in the transposed tissue.", "support_label": "supported", "is_refined": false }, { "subclaim": "The suspected tumor recurrence was surgically removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histologic examination of the removed tissue concluded with fibromatosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Genetic testing revealed a known disease-causing mutation in the adenomatous polyposis coli gene.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of familial adenomatous polyposis was confirmed.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_746_en.txt", "fulltext": "A 26-year-old male presented with severe dyspnea, palpitation, orthopnea, and paroxysmal nocturnal dyspnea. He had hypertension, medical history of ischemic stroke 5 months ago, and repeated hospitalization caused by congestive heart failure. His blood pressure in the right arm was 180/64 mmHg. The heart rate was irregular with 150 beats/min. The jugular venous pulse was elevated to 9 cm of water. There was murmur systolic on intercostal space (ICS) 5 anterior axilla line (AAL) sinistra and murmur diastolic on ICS 2 parasternal line (PSL) dextra. Respiratory rate of 28 breaths/min, oxygen saturation at the right arm was 92% without supplemental oxygen, and body mass index of 19,5 kg/m2.\nAn electrocardiogram showed atrial fibrillation (AF) with a rapid ventricular response. A routine laboratory examination did not show any abnormality. Chest X-ray showed cardiomegaly with calcification aortic arch and pulmonary edema. Echocardiography found that left ventricular ejection fraction (LVEF) was decreased (48,5%) with left atrial and ventricular dilatation. Echocardiography also found severe aortic and mitral valve regurgitation . He was diagnosed with congestive heart failure with mildly reduced ejection fraction (HFmrEF) and classified in New York Heart Association (NYHA) class IV.\nAfter one day of hospitalization, the patient also complained of intermittent claudication in the left arm. Clinical examination found an absence of the left brachial pulse and the left carotid artery bruit. Four limbs blood pressure discrepancy was present (right arm 163/50 mmHg, left arm 96/55 mmHg, right leg 90/60 mmHg, left leg 95/55 mmHg). Computed tomography angiography (CTA) showed calcification in the left common carotid artery leading to stenosis and total occlusion of the left subclavian artery with the collateral artery branch from the left common carotid artery that supplies vascularization of the left arm. There was vascular thickness and calcification from the peri-aortic valve, ascending aorta, aortic arch, and thoracic descending aorta until abdominal aorta with high-grade stenosis on the inferior side of the renal artery branching accompanied by a post-stenotic dilatation . Inflammatory markers evaluation that needed notable are elevation C-reactive protein (CRP) level (45,1 mg/L) and erythrocyte sedimentation rate (ESR) level (25 mm/h). Other laboratory evaluations were antinuclear antibody (ANA) titer, antistreptolysin O (ASO) titer, and interferon-gamma release assay (IGRA) showed negative results. He has subsequently diagnosed with Takayasu arteritis according to the American College of Rheumatology criteria.\nFor treatment of hypertension and HFmrEF, beta-blocker bisoprolol 2,5 mg/day, angiotensin-converting enzyme inhibitor (ACE-I) ramipril 5 mg/day, and mineralocorticoid receptor antagonists (MRA) spironolactone 25 mg/day therapy were initiated. Loop diuretic furosemide 40 mg/day is given to treat congestive symptoms of heart failure and glycoside digoxin 0,25 mg/day is given as rate control of atrial fibrillation. Anticoagulant warfarin 2 mg/day was given to prevent thromboembolism. A combination of methotrexate 7,5 mg/week and high-dose methylprednisolone at 48 mg/day with subsequent tapering was given for induction of remission to inhibition vasculitis of TA. After 3 months of high-dose steroid and methotrexate therapy, the patient showed a decrease in symptoms of NYHA class II for heart failure and a decrease in the frequency of rehospitalization. The patient also did not complain of claudication in the left arm. On physical examination, the patient's right arm blood pressure was 146/55 mmHg and the left arm was 105/50 mmHg. Follow-up evaluation of inflammatory markers CRP and ESR showed normal results.", "summary": "We report a 26-year-old male presented with severe dyspnea, palpitation, orthopnea, paroxysmal nocturnal dyspnea, and claudication in the left arm. Four limbs blood pressure discrepancy was present. Chest X-ray showed cardiomegaly with calcification aortic arch and pulmonary edema. Echocardiography revealed that left ventricular ejection fraction decreased with severe aortic and mitral valve regurgitation. Computed tomography angiography showed stenosis of the left common carotid artery and total occlusion of the left subclavian artery with collateral artery. There was vascular thickness and calcification from the peri-aortic valve, ascending aorta, aortic arch, and thoracic descending aorta until abdominal aorta with high-grade stenosis on the inferior side of the renal artery branching accompanied by a post-stenotic dilatation.", "subclaim_evaluations": [ { "subclaim": "The patient is a 26-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had severe dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had palpitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had orthopnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had paroxysmal nocturnal dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had claudication in the left arm.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a four limbs blood pressure discrepancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest X-ray showed cardiomegaly.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest X-ray showed calcification of the aortic arch.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest X-ray showed pulmonary edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed decreased left ventricular ejection fraction.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed severe aortic valve regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed severe mitral valve regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography angiography showed stenosis of the left common carotid artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography angiography showed total occlusion of the left subclavian artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography angiography showed collateral artery formation.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was vascular thickness from the peri-aortic valve.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was vascular calcification from the ascending aorta.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was vascular calcification from the aortic arch.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was vascular calcification from the thoracic descending aorta.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was vascular calcification from the abdominal aorta.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was high-grade stenosis on the inferior side of the renal artery branching.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was post-stenotic dilatation.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3047_en.txt", "fulltext": "A 27-year-old female smoker with no regular medication, with no previous history of SARS-CoV-2 infection, vaccinated with BCG at birth in her left arm, received the first dose of the COVID-19 mRNA vaccine (Moderna\u00ae), also in her left arm, without symptoms or immediate intercorrerences, reporting no additional changes in the following days, namely, redness, heat, change in pigmentation or exudate. Eight days after administration of the anti-SARS-CoV2 mRNA vaccine, the young woman developed a reaction of a round shape and poorly defined edges with about 2 cm in diameter at the site of the BCG scar, characterized by erythema, induration and pain, and distanced about 4 cm from the site of inoculation of the anti-SARS-CoV2 vaccine. The patient did not report fever, myalgia or other symptoms. No changes were detected in the objective examination, namely, adenopathies. The symptoms persisted for three days, and the patient opted not to be medicated. After 11 days since the onset of symptoms, a complementary analytical study was performed, revealing a positive result for anti-SARS-CoV2 IgG, with the remaining values within the normal range, including lymphocytes and viral serologies. The incident was submitted as a possible adverse reaction to medicines in the National Pharmacovigilance System.\n", "summary": "Here is a case of a 27-year-old woman with no relevant history, including SARS-CoV-2 infection, who developed inflammation of the BCG scar eight days after the first administration of anti-SARS-CoV-2 mRNA vaccine.\n", "subclaim_evaluations": [ { "subclaim": "The patient is a 27-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no relevant medical history.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no prior SARS-CoV-2 infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed inflammation of the BCG scar.", "support_label": "supported", "is_refined": false }, { "subclaim": "The inflammation occurred eight days after the first administration of an anti-SARS-CoV-2 mRNA vaccine.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2292_en.txt", "fulltext": "A 65-year-old female with a history of type 2 diabetes mellitus, systemic arterial hypertension and long-standing right hearing loss. She began his condition 21 days before his initial evaluation in July 2023, presenting with moderate to intense holocranial headache that partially subsided with the use of non-steroidal anti-inflammatory drugs. She had previously been diagnosed with dementia due to retrograde memory and language disorders. In the neurological examination with Glasgow 13 points (O:4, V:3, M:6), mental functions with global aphasia, isocoria of 3 mm, preserving photomotor and consensual reflexes, right side conduction hearing loss, preserved motor function, sensitive without response to pain in the right hemibody. No evidence of intracranial hypertension or history of seizures. A simple and contrasted tomography was performed, showing the presence of two lesions at the level of both ventricular trigone each one apparently, which were confirmed by magnetic resonance imaging (MRI) scan indicating periventricular lesions with extension to the white matter of the temporal and parietal lobes, a clear reduction of the ventricular space of both atrium was observed, no communication between these lesions through fibers of the corpus callosum, with mostly uniform enhancement at gadolinium contrast , and restriction to diffusion. Metastasis, high-grade glioma, and lymphoma were considered as a differential diagnosis, which was complemented by a thoracic and abdominal tomography without evidence of systemic lesions. Serological studies were performed , viral profiles for EBV, CMV, and HIV, as well as tumor markers, which were all negative. Subsequently, a spectroscopy study was performed 8 days before treatment with dexamethasone, where peaks of choline and creatine were observed, a high choline/creatine (Cho/Cr) ratio, with peaks of lipids and lactate, as well as a decrease in N-acetyl aspartate (NAA), suggestive of malignancy and presence of areas of necrosis.\nA temporal craniotomy with a transulcal T2\u2013T3 approach guided by a neuronavigation system was performed. Biopsy samples were taken. The tumor was identified as infiltrative and diffused in the white matter, with gray color, soft consistency, and necrotic core. The ventricle was not opened. No complications were presented.\nHistopathology revealed diffuse large B-cell lymphoma with an angiocentric pattern with positive immunohistochemical staining for CD20 and Ki67 in 70% .\nThe patient had a complicated course due to pneumonia, was discharged from the hospital 15 days after surgery, and was referred to an oncology center.", "summary": "A 65-year-old female presented progressing headache, loss of memory and language alterations, as well as sensory alterations. Neuroimaging showed the presence of two equidistant periventricular lesions at the level of both ventricular atria, a spectroscopy study suggestive of malignancy. Serological studies showed no evidence of immunodeficiency or the presence of positive tumor markers; however, a biopsy was performed, which revealed a histopathological result of primary lymphoma of the CNS.", "subclaim_evaluations": [ { "subclaim": "The patient is a 65-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had progressing headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had loss of memory.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had language alterations.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had sensory alterations.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neuroimaging showed two equidistant periventricular lesions at the level of both ventricular atria.", "support_label": "supported", "is_refined": false }, { "subclaim": "A spectroscopy study was suggestive of malignancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serological studies showed no evidence of immunodeficiency.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serological studies showed no presence of positive tumor markers.", "support_label": "supported", "is_refined": false }, { "subclaim": "A biopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histopathological result was primary lymphoma of the CNS.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2759_en.txt", "fulltext": "A 66-year-old Maori man presented to our hospital with a history of an enlarged left testicle of 10 weeks\u2019 duration. His clinical examination revealed nontender swelling of the left testicle. His alpha-fetoprotein (AFP) and beta-human chorionic gonadotropin (BHCG) levels were within normal limits. His lactate dehydrogenase (LDH) concentration was mildly elevated at 267 U/L (normal range 120\u2013250 U/L). Ultrasonography of his testes demonstrated an enlarged left testicle measuring 7 \u00d7 5.5 \u00d7 4.3 cm with an estimated volume of 87 ml. A large, heterogeneous mass involved the entire testicle with increased vascularity . The patient\u2019s right testicle measured 3.7 \u00d7 2.5 \u00d7 1.8 cm with an estimated volume of 8.8 ml. He underwent left orchiectomy. The macroscopic specimen consisted of well-circumscribed nodular lesions of varying sizes, with the largest measuring 45 \u00d7 15 mm and containing solid and gelatinous components . Sections of the specimen showed tumor composed of sheets of small, blue, round cells divided into nodules by fibrous septae . Immunostaining showed the tumor to be cytokeratin 20 (CK20)-positive with a typical paranuclear dotlike staining pattern . The stain showed a positive result for CD56, a neuroendocrine marker , as were CD117 and CK (paranuclear dots). The result was negative for CK7, placental alkaline phosphatase (PLAP), CD30, CD20, AFP, S100, SOX10, prostate-specific antigen (PSA), chromogranin, and thyroid transcription factor 1 (TTF-1). The Ki-67 level was >50 %. This immunostaining pattern raised the possibility of metastatic MCC.\nThe patient presented \ufeffagain to our hospital 3 months later this time with a right testicular mass. Tumor markers, including LDH, AFP, and BHCG, were within normal limits. Ultrasonographic imaging demonstrated a new lesion in the right testis measuring 3 \u00d7 2.6 \u00d7 2.3 cm. He underwent a right orchiectomy, and sections of the specimen showed diffuse infiltration of small, blue, round cells. Immunostains were positive for CD117, CD56, synaptophysin, CK20 (dotlike), and cytokeratin AE1/AE3 (dotlike). The tumor cells were negative for inhibin, PLAP, PSA, S100, CD30, CD45, CD3, CD20, TTF-1, and napsin A. The Ki-67 level was 80 %. This pattern was consistent with a poorly differentiated neuroendocrine tumor in keeping with metastatic MCC. Detailed histology reports can be found in Additional files and . A primary site was not identified, and a staging computed tomographic scan did not show evidence of other metastases. The patient received six cycles of adjuvant carboplatin and etoposide chemotherapy. He remained disease-free 18 months following completion of chemotherapy.", "summary": "A 66-year-old Maori man presented to our hospital with left testicular swelling. His alpha-fetoprotein and beta-human chorionic gonadotrophin levels were within normal limits. His lactate dehydrogenase concentration was elevated to 267 U/L. Ultrasound imaging confirmed a large testicular mass, and he underwent left orchiectomy. His histological examination revealed a neuroendocrine tumor with an immunostaining pattern suggesting Merkel cell carcinoma. He presented to our hospital again 3 months later with right testicular swelling that was confirmed on ultrasound sonography to be a tumor. He underwent a right orchiectomy, and his histological examination revealed metastatic Merkel cell carcinoma. A primary lesion was not identified, and computed tomographic imaging did not reveal spread to other organs. He received six cycles of adjuvant carboplatin and etoposide chemotherapy and remained disease-free 18 months after completion of chemotherapy.", "subclaim_evaluations": [ { "subclaim": "The patient is a 66-year-old Maori man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with left testicular swelling.", "support_label": "supported", "is_refined": false }, { "subclaim": "His alpha-fetoprotein levels were within normal limits.", "support_label": "supported", "is_refined": false }, { "subclaim": "His beta-human chorionic gonadotrophin levels were within normal limits.", "support_label": "supported", "is_refined": false }, { "subclaim": "His lactate dehydrogenase concentration was elevated to 267 U/L.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound imaging confirmed a large testicular mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "He underwent left orchiectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histological examination revealed a neuroendocrine tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The immunostaining pattern suggested Merkel cell carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented again 3 months later with right testicular swelling.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound sonography confirmed a tumor in the right testicle.", "support_label": "supported", "is_refined": false }, { "subclaim": "He underwent right orchiectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histological examination revealed metastatic Merkel cell carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "A primary lesion was not identified.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomographic imaging did not reveal spread to other organs.", "support_label": "supported", "is_refined": false }, { "subclaim": "He received six cycles of adjuvant carboplatin and etoposide chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "He remained disease-free 18 months after completion of chemotherapy.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3113_en.txt", "fulltext": "A 41-year old male was in good health before. He suffered from progressive exertional dyspnea and visited an outpatient department of local hospital, but then was transferred to our hospital because of LV thrombus which was found on transthoracic echocardiogram. After admission to our ward, transthoracic echocardiogram showed global hypokinetic LV (the EF of LV was 28%), dilated LV size and a pedunculated apical thrombus measuring 1.75 \u00d7 1.68\u200acm. Coronary angiogram was performed to rule out ischemic cardiomyopathy and it subsequently revealed no significant obstructive lesion. He was discharged from our hospital and had taken warfarin 3.75\u200amg/day for AF and LV thrombus since then.\n\nHowever, he developed sudden onset of right-hand clumsiness and expressive aphasia after 1 month and was sent to our emergency department immediately for help. Right eye blurred vision and drooling from the right mouth angle were noted at the same time. The blood examination in the emergency department showed supratherapeutic range of prothrombin time and international normalized ratio (INR) 7.64. His symptoms totally recovered within 1 day, but the brain magnetic resonance imaging (MRI) showed multiple acute infarctions in the cortex of the bilateral frontal lobes, left parietal lobe, and bilateral central semiovale, which highly suggested embolic stroke. The transthoracic echocardiogram performed on the same day of stroke still revealed LV thrombus (1.27 \u00d7 0.90\u200acm). Due to acute infarction even under high INR level, we discontinued warfarin first and shifted to edoxaban (60\u200amg/day) use after INR decreased to less than 2.\n\nTo our surprise, follow-up echocardiography showed resolution of LV thrombus after receiving edoxaban for 23 days. The patient tolerated edoxaban well and did not get recurrent stroke in the following 6 months.", "summary": "Patient concerns:\nA 41-year-old man who presented with acute onset of right-hand clumsiness and aphasia even under high international normalized ratio (INR: 7.64) from warfarin use. He was previously treated with warfarin for the LV thrombus and non-valvular AF. Brain magnetic resonance imaging (MRI) showed multiple acute infarction in the cortex of the bilateral frontal lobes, left parietal lobe, and bilateral central semiovale, which highly suggested embolic stroke.\n\nDiagnosis:\nThe repeated transthoracic echocardiogram still revealed LV thrombus (1.27 \u00d7 0.90\u200acm), which failed to respond to warfarin therapy.\n\nInterventions:\nDue to acute infarctions occurred under supratherapeutic range of INR, we switched warfarin to edoxaban (dose: 60\u200amg/day) after INR decreased to less than 2.\n\nOutcomes:\nThe thrombus disappeared after receiving edoxaban for 23 days, and no more recurrent stroke was noted for more than 6 months.", "subclaim_evaluations": [ { "subclaim": "The patient is a 41-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with acute onset of right-hand clumsiness.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had aphasia.", "support_label": "supported", "is_refined": false }, { "subclaim": "His international normalized ratio (INR) was 7.64.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was using warfarin.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a history of left ventricular (LV) thrombus.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had non-valvular atrial fibrillation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Brain MRI showed multiple acute infarctions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infarctions were in the cortex of the bilateral frontal lobes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infarctions were in the left parietal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infarctions were in the bilateral central semiovale.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI findings suggested embolic stroke.", "support_label": "supported", "is_refined": false }, { "subclaim": "A transthoracic echocardiogram showed LV thrombus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The LV thrombus measured 1.27 \u00d7 0.90 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The LV thrombus did not respond to warfarin therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Warfarin was switched to edoxaban.", "support_label": "supported", "is_refined": false }, { "subclaim": "The switch occurred after INR decreased to less than 2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The edoxaban dose was 60 mg/day.", "support_label": "supported", "is_refined": false }, { "subclaim": "The LV thrombus disappeared after 23 days of edoxaban.", "support_label": "supported", "is_refined": false }, { "subclaim": "No recurrent stroke was noted for more than 6 months.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_612_en.txt", "fulltext": "We present a case of a 54-year-old Chinese man with a history of treated hypertension and diabetes mellitus, referred for suspected spontaneous left dural CCF. The patient complained of a chronically red left eye and double vision in the left gaze. Initial examination disclosed best corrected visual acuity 20/20 in the right eye and 20/25 in the left eye, associated with a left relative afferent pupillary defect and severely reduced color vision on Ishihara testing in his left eye only. Humphrey visual field assessment disclosed diffuse defects in the left eye, but was normal in the right eye. Slit lamp examination disclosed a red left eye with dilated corkscrew vessels, but no evidence of angle closure, blood in the Schlemm canal, or other causes of raised intraocular pressure. Intraocular pressure (IOP) was 28 mmHg in the left eye, and 14 mmHg in the right, healthy eye. Fundoscopy disclosed dilated retinal veins on the left side, but no venous stasis retinopathy, or choroidal detachment. The remainder of the ophthalmic examination disclosed mild left abduction deficit, mild ptosis and 3 mm proptosis on the left side. Partial embolization of the angiographically confirmed left dural CCF resulted in incomplete clinical recovery: despite complete regression of the left optic neuropathy and of the left abduction deficit, the left eye remained red, associated with raised intraocular pressure requiring topical medication. Optical coherence tomography angiography of the anterior segment was performed, using a described technique , with optic disc imaging as well using the AngioVue (Optovue Inc. Fremont, CA, USA). Our study followed the principles of the Declaration of Helsinki, with informed consent obtained and ethics approval obtained from our local Institutional Review Board (CIRB Ref no: 2015/3078). OCTA showed engorged episcleral vessels, which were better delineated than using clinical evaluation alone . The OCTA was able to analyze the location and depth of the tortuous, abnormal vessels, as well as the increased flow detected on the B-scan cross-sectional OCTA scans . Posterior pole OCTA of the affected eye disclosed glaucomatous nerve damage and reduction in the peripapillary flow .", "summary": "We describe a novel clinical application of OCTA in a patient with dural carotid-cavernous sinus fistula (CCF), which was complicated by increased intra-ocular pressure (IOP). In this case report, we used the OCTA to delineate increased epsicleral venous flow in the affected eye with secondary raised IOP. Current measurements of episcleral venous pressure are either invasive or provide highly variable results, thus the OCTA may have the potential to provide a more reliable approach to assess episcleral vasculature. We also describe the use of OCTA to detect early glaucomatous nerve damage, associated with focal reductions in peripapillary retinal perfusion.", "subclaim_evaluations": [ { "subclaim": "The patient had a dural carotid-cavernous sinus fistula.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had increased intra-ocular pressure.", "support_label": "supported", "is_refined": false }, { "subclaim": "OCTA was used to delineate increased episcleral venous flow in the affected eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "The increased episcleral venous flow was associated with secondary raised intra-ocular pressure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Current measurements of episcleral venous pressure are either invasive or provide highly variable results.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "OCTA may provide a more reliable approach to assess episcleral vasculature.", "support_label": "supported", "is_refined": false }, { "subclaim": "OCTA was used to detect early glaucomatous nerve damage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Early glaucomatous nerve damage was associated with focal reductions in peripapillary retinal perfusion.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2609_en.txt", "fulltext": "In June 2018, a 57-year-old woman presented with a massive, painless mass in the right orbit which had developed over 19 years. As the tumor grew, vision in the right eye gradually deteriorated until it was completely lost approximately 15 years before presentation. Due to budgetary constraints, the patient avoided seeking appropriate medical care.\nUpon ophthalmological examination, she had a best-corrected visual acuity of no light perception and 20/20 of the right and left eyes, respectively. In the right orbit, a large rubbery mass stretched horizontally from the bridge of the nose to the lateral canthus, and vertically from the eyebrow to the center of the cheek. The upper eyelid covering the tumor was pushed forward due to the large size of the mass. The vessels of the eyelids were dilated and tortuous . The palpebral fissure was elongated and widened; the eyeball, covered with soft tissue, was displaced anteromedially . No abnormalities were observed in the left eye. There was no associated lymphadenopathy and a systemic examination revealed no abnormalities.\nOrbital CT revealed a huge mass in the right orbit measuring 10.6 \u00d7 9.5 \u00d7 11 cm. After administration of contrast material, inhomogeneous enhancement and vascular-like enhancing structures were observed. The mass was closely related to the internal rectus muscle. The eyeball appeared totally engulfed and compressed by the large mass and was displaced anteromedially. In the bone structures, no evident erosion or extension damage was found; however, the temporal orbital wall was observed to be slightly thinner than anticipated .\nOrbital cavernous hemangioma was suspected. The patient underwent lid-sparing orbital exenteration under general anesthesia, a procedure that involved removal of the tumor, globe, orbital contents, and most of the upper eyelid. Using a preserved part of the normal eyelid skin, the orbital cavity was covered and sutured with a skin incision margin.\nOn gross pathological examination, the orbital lesion consisted of a 15 \u00d7 13 \u00d7 9 cm well-circumscribed solid tumor covered with a 16 \u00d7 14 cm flap . The cut surface was composed of gray-white or gray-red soft tissue with foci of hemorrhage identified in some areas. Nerve tissue of approximately 2.5 cm in length and 0.2 cm in diameter was observed in the adipose tissue next to the tumor. On microscopic examination, H&E staining showed that the tumor tissue constituted spindle-shaped cells arranged in bundles or irregular shapes. Cell nuclei were oval or spindle-shaped. No necrosis, mitoses, or nuclear pleomorphisms were present. .\nIHC testing demonstrated strong and diffuse spindle cells with antibodies against CD34, signal transducer and activator of transcription 6 (STAT6) , B-cell lymphoma 2 (BCL-2), and progesterone receptors (PR). Approximately 2% of these cells were reactive to Ki-67. Staining for antibodies against P53, glial fibrillary acidic protein, and S-100 was negative. These findings were compatible with a diagnosis of a benign SFT.\nThe patient had good cosmetic results and exhibited no symptoms of recurrence during the 4-year follow-up.", "summary": "A 57-year-old woman presented with a 19-year history of a giant right orbital mass. Orbital computed tomography (CT) revealed an inhomogeneously-enhancing mass compressing and engulfing the eyeball and optic nerve. She underwent lid-sparing orbital exenteration. Microscopic characteristics and immunohistochemistry (IHC) tests were indicative of a benign SFT. No recurrence was observed at the 4-year follow-up.", "subclaim_evaluations": [ { "subclaim": "The patient is a 57-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a 19-year history of a giant right orbital mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "Orbital CT showed an inhomogeneously-enhancing mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was compressing and engulfing the eyeball.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was compressing and engulfing the optic nerve.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She underwent lid-sparing orbital exenteration.", "support_label": "supported", "is_refined": false }, { "subclaim": "Microscopic characteristics were indicative of a benign SFT.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemistry tests were indicative of a benign SFT.", "support_label": "supported", "is_refined": false }, { "subclaim": "No recurrence was observed at the 4-year follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_785_en.txt", "fulltext": "Left limb weakness for 1 d.\nA 38-year-old female presented to the Moyamoya Disease Research and Treatment Center of Henan Provincial People's Hospital with \"left limb weakness\" as the main symptom, in addition to difficulty in lifting the left arm and walking with dragging of the left leg. On further inquiry, her regular medication included the long-term consumption of aspirin (100 mg/d) for recurrent transient ischemic attack.\nFour months previously, she had been diagnosed with an acute cerebral infarction by a brain MRI in our hospital following the complaints of \"weakness of lower limbs\" . Additionally, she had also experienced abnormal uterine bleeding for a month, which was heavy at times.\nThere was no significant past personal history or any diseases running in the family. She was not a smoker and did not drink alcohol.\nThe patient was conscious but in poor spirits. The tongue appeared skewed to the left on extension. The left upper and lower limbs had muscle strengths of grade 3 and grade 4, respectively, with a positive Babinski sign on the left.\nThe blood investigation showed a low hemoglobin level of 61.0 (normal reference value: 115-150 g/L), RBC count 3.1 \u00d7 1012/L (reference value 3.5-5.0), platelet count 350 \u00d7 109/L (reference value 100-300), and abnormal thromboelastogram (residual platelet function after taking ADP drugs = 14.2 mm, normal reference value: 31-47 mm). The coagulation was slightly low.\nUpon admission, the first brain magnetic resonance imaging (MRI) (diffusion weighted imaging sequence) revealed acute cerebral infarction in the bilateral fronto-parietal lobes and posterior horn of the left ventricle . Preoperatively, the digital subtraction angiography (DSA) demonstrated bilateral internal carotid artery occlusion , with cerebral perfusion perfusion-weighted imaging (PWI) suggesting severe cerebral ischemia in both hemispheres .", "summary": "A 38-year-old female presented to the Research and Treatment Center of Moyamoya Disease in our hospital with \"left limb weakness\" as the main symptom. She was diagnosed with acute cerebral infarction and moyamoya disease through magnetic resonance imaging and digital subtraction angiography. Prior to this, she had experienced a prolonged menstrual period of one-month duration. This was investigated and adenomyosis was diagnosed. After passing the acute cerebral infarction phase, the patient underwent surgery for adenomyosis followed by combined cerebral revascularization. During the postoperative follow-up, improvements of the perfusion imaging stage and modified Rankin Scale were observed. A review of the literature showed only 16 reported cases of gynecological diseases complicated with stroke. The clinical characteristics, pathogenesis, therapeutic effects, and long-term prognosis of these cases have been studied and discussed.", "subclaim_evaluations": [ { "subclaim": "The patient is a 38-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented to the Research and Treatment Center of Moyamoya Disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her main symptom was left limb weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with acute cerebral infarction.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with moyamoya disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made through magnetic resonance imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made through digital subtraction angiography.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a prolonged menstrual period of one-month duration.", "support_label": "supported", "is_refined": false }, { "subclaim": "Adenomyosis was diagnosed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient underwent surgery for adenomyosis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient underwent combined cerebral revascularization.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Improvements of the perfusion imaging stage were observed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Improvements of the modified Rankin Scale were observed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A review of the literature showed 16 reported cases of gynecological diseases complicated with stroke.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The clinical characteristics of these cases have been studied.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The pathogenesis of these cases has been discussed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The therapeutic effects of these cases have been studied.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The long-term prognosis of these cases has been discussed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1242_en.txt", "fulltext": "A 61-year-old German woman presented to our orthopedic clinic after Felix IV fracture in revision total knee arthroplasty. Two years ago, the patient had undergone revision TKA with a rotating hinge prosthesis complicated by an intraoperative fracture of the tibial tubercle. Screw fixation had been performed, but 3 months later nonunion of the fragment had persisted, resulting in plate osteosynthesis with a one-third tubular plate. After another dislocation of the tibial tubercle, the patient presented to our clinic with anterior knee pain, loss of extension strength, and a feeling of rotational instability. On clinical examination, pressure pain of the proximal tibia, decreased extension strength to Janda 3/5, and inability to raise the extended knee were noticed. This maintained extensor function is the result of an intact medial and lateral retinaculum. The knee\u2019s range of motion was 0\u2013110\u00b0 of flexion with preserved mediolateral and anterior/posterior stability. X-ray showed the rotation hinge prosthesis without loosening signs, the one-third tubular plate, and the dislocated tibial tubercle fragment indicating persistent Felix IV C fracture .\nReconstruction of the knee joint\u2019s extension system was planned. After preparation of the subcutaneous tissue, the dislocated tibial tubercle appeared surrounded by extensive metallosis presumably induced by the contact between the one-third tubular plate and the tibial prosthesis. Following the removal of the plate, the fragment proved to be necrotic requiring a total extirpation instead of mobilization and refixation. Subsequently, the ventral surface of the tibial prosthesis was exposed . Reconstruction of the extension system should be performed by the implantation of MUTARS attachment tube made of polyethylene terephthalate. Since the tibial prosthesis did not offer any connecting points for the synthetic graft, cement was used as an extender to simultaneously serve as fixing point and to preserve the prosthesis from loosening. Afterwards, the tube was doubled into a laminar sheet and fixed with two cancellous bone screws in the ventral tibia . ORTHOCORD sutures were used to attach the tube to the articular capsule still beyond the patella . Extensive jet lavage was performed before wound closure. Check of patellar tracking was promising; likewise, postoperative X-ray showed regular patella position .\nTo support the integration of the tube in the surrounding subcutaneous tissue, knee flexion was at first limited to 30\u00b0 and then escalated to 60\u00b0 and 90\u00b0 every 2 weeks with full weight-bearing.\nFollow-up was performed after 3 and 10 months. On clinical examination , the patient showed irritant-free skin and soft tissue conditions; no redness or overheating; extension/flexion 0\u20130\u2013110\u00b0; straight-leg raise completely possible; and force level 4/5 on side comparison of the knee stretchers. Active knee stretching with a flexed knee joint was possible without any problems. There was a centered patella run and no subluxation of the patella. Peripheral circulation, motor skills, and sensitivity were intact. X-ray confirmed correct implant position and central patella tracking . The patient was highly pleased by the restored extension function and significantly reduced knee pain.", "summary": "A 61-year-old German patient presented to our clinic with Felix IV C fracture, persistent knee pain, and reduced knee extension strength. In this special case, mobilization and reattachment of the tibial tubercle was not possible because of necrosis and underlying tibial component. Therefore, we covered the defect with cement and used an polyethylene terephthalate\u00a0tube for knee extension system augmentation. Follow-up after 10\u00a0months demonstrated a good clinical result.", "subclaim_evaluations": [ { "subclaim": "The patient is a 61-year-old German.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a Felix IV C fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had persistent knee pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had reduced knee extension strength.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mobilization and reattachment of the tibial tubercle was not possible.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reason for not reattaching the tibial tubercle was necrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reason for not reattaching the tibial tubercle was an underlying tibial component.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The defect was covered with cement.", "support_label": "supported", "is_refined": false }, { "subclaim": "A polyethylene terephthalate tube was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tube was used for knee extension system augmentation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Follow-up occurred after 10 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical result after 10 months was good.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_869_en.txt", "fulltext": "The patient was a 3 years old girl who for 2 months had symptoms and signs of disease with fever and reduced general condition. The last week she had nose bleedings, petechiae, and pain from the throat and abdomen. The initial blood tests showed hemoglobin 4.3 g/dL (normal 11\u201314 g/dL), leukocytes 72 \u00d7 109/L (normal 4 \u00d7 109/L\u201315 \u00d7 109/L), and thrombocytes 19 \u00d7 109/L (normal 150 \u00d7 109/L\u2013450 \u00d7 109/L). The blood and bone marrow smears revealed that the patient had acute lymphoblastic leukemia. Immunophenotyping of peripheral blood showed 80% pre-B-lymphoblasts, in the bone marrow 88%. The patient was treated according to the NOPHO ALL 2008 protocol, high-risk group . She started with induction treatment, but the bone marrow on day 15 showed 90% lymphoblasts. The treatment was therefore changed to block treatment according to the protocol, and on day 34 minimal residual disease (MRD) was less than 0.01%. Also repeated later measurements have shown MRD of less than 0.01%.\nThe G-banding analysis at diagnosis of bone marrow and blood metaphase cells revealed a normal karyotype, 46,XX, in all 25 examined metaphases . Interphase FISH analyses with the Cytocell (Cytocell, Banbury, Oxfordshire, UK) multiprobe ALL panel did not detect aberrations of MYC, CDKN2A, TCF3, MLL, and IGH, no ETV6-RUNX1 or BCR-ABL1 fusions, nor was hyperdiploidy seen in 200 examined nuclei (data not shown). FISH with the PDGFRB breakapart probe (Cytocell) showed loss of the distal part of the probe in 176 out of 201 examined interphase nuclei from white blood cells and 42 out of 100 examined interphase nuclei from bone marrow cells, suggesting a genetic breakpoint in the PDGFRB locus in 5q32 .\naCGH was performed with genomic DNA extracted from the patient\u02bcs peripheral blood cells using the Maxwell 16 Instrument System and the Maxwell 16 Cell DNA Purification Kit (Promega, Madison, USA). Promega\u02bcs human genomic female DNA (Promega, Madison, USA) was used as reference DNA. For aCGH, the CytoSure array products were used (Oxford Gene Technology, Begbroke, Oxfordshire, UK) following the company\u2019s protocols. The CytoSure Genomic DNA Labelling Kit was used for labelling of one \u03bcg of patient\u2019s and reference DNA, the CytoSure Cancer +SNP array was used for hybridization, and the CytoSure Interpret analysis software was used to analyse the results.\naCGH revealed submicroscopic deletions in chromosome bands 5q32q35.3, 7q34 (within TCRB), 9p13 (PAX5), 10q26.13 (DMBT1), 14q11.2 (TRAC), and 14q32.33 (within the IGH locus) . The deletion on 5q was 30 Mb long, started between exons 8 and 9 of PDGFRB (5q32), and finished in the CANX locus (5q35.3). The result was in agreement with the FISH data obtained with the PDGFRB breakapart probe . Because both FISH and aCGH findings indicated a possible PDGFRB-fusion gene, one \u00b5g of the total RNA, extracted from the patient\u00b4s bone marrow at the time of diagnosis using miRNeasy Mini Kit (Qiagen Nordic, Oslo, Norway), was sent to the Genomics Core Facility at the Norwegian Radium Hospital, Oslo University Hospital for high-throughput paired-end RNA-sequencing. For library preparation from total RNA the Illumina TruSeq RNA Access Library Prep kit was used according to Illumina\u02bcs protocol (Illumina, San Diego, CA, USA; ). Sequencing was performed on NextSeq 550 System (Illumina) and 16 million reads were generated.\nBecause the raw fastq RNA sequencing data were in the text-based format, we used the \u201cgrep\u201d command-line utility to search for sequences which contained part of the ninth exon of PDGFRB . Using the search term \u201cTCCCTGTCCGAGTGCTGG\u201d, which corresponds to 1713\u20131730 nt in the PDGFRB reference sequence with accession number NM_002609.3, only one 76 bp long sequence was extracted . BLAT of this sequence on the human genome browser-hg19 assembly showed that the sequence between nucleotides 26\u201376 mapped on chromosome 5 at position 149510177\u2013149510227 and was part of exon 9 of PDGFRB. The sequence between nucleotides 1\u201327 (GCCAGTTGGAAGTTCCAGCCACAGAAG) mapped on chromosome 7 at three different positions: (a) chr7:74172307\u201374172333 (exon 32 of general transcription factor Iii, GTF2I, reference sequence: NM_032999.3), (b) chr7: 74603796\u201374603822 (exon 22 of general transcription factor IIi pseudogene 1, GTF2IP1, reference sequence: NR_002206.3), and (c) chr7:72618618\u201372618644 (exon 22 of general transcription factor IIi pseudogene 4, GTF2IP4, reference sequence: NR_003580.2). These data were verified when we used the BLAST algorithm to compare the sequence with the reference sequences NM_002609.3 (PDGFRB), NM_032999.3 (GTF2I), NR_002206.3 (GTF2IP1), and NR_003580.2 (GTF2IP4).\nIn order to confirm the existence of the GTF2I\u2013PDGFRB fusion gene, reverse transcription (RT) and genomic PCR analyses were performed as previously described . The primers used for PCR amplifications and Sanger sequencing analyses are shown in Table . RT-PCR with the primers GTF2I-3306F1/PDGFRB-1732R1 amplified an 84 bp long cDNA fragment. Sanger sequencing of the PCR products verified the fusion which was found upon searching the RNA sequencing data using the \u201cgrep\u201d command . Thus, the leukemic cells carried either the fusion transcript GTF2IP1-PDGFRB, or GTF2I\u2013PDGFRB, or GTF2IP4-PDGFRB. Genomic PCR with the primers GTF2I-3317F1 and PDGFRB-1737R1 amplified a single 1200 bp fragment which by Sanger sequencing was shown to be a hybrid genomic DNA fragment in which intron 8 of PDGFRB is fused with either intron 22 of GTF2IP1, intron 32 of GTF2I, or intron 22 of GTF2IP4 . Additional interphase FISH experiments were performed to detect the GTF2I\u2013PDGFRB fusion gene . BACs RP11-21I20 and RP11-137E8 were retrieved from the Human \u201c32K\u201d BAC Re-Array library (BACPAC Resources, ). RP11-21I20, the probe for the PDGFRB gene, mapped to band 5q32 (Position: chr5: 149,320,375\u2013149,496,703; UCSC Genome Browser on Human February 2009 GRCh37/hg19 Assembly) and was labeled red . RP11-137E8, the probe for the GTF2I gene, mapped to band 7q11.23 (Position: chr7: 73,944,720\u201374,129,587) and was labeled green . Detailed information about the FISH procedure was given previously . Fluorescent signals were captured and analyzed using the CytoVision system (Leica Biosystems, Newcastle, UK). FISH analysis showed a fusion signal in 44 out of 100 examined interphase nuclei from bone marrow cells suggesting a GTF2I\u2013PDGFRB fusion gene . Thus, FISH with specific probes for PDGFRB and GTF2I was crucial to show that a novel GTF2I\u2013PDGFRB fusion gene had been formed .\nUsing the FusionCatcher software with the fastq files of the RNA sequencing data, an out-of-frame IKZF1\u2013TYW1 fusion transcript was found .\nRT-PCR with the primers IKZF1-469F1/TYW1-1282R1 amplified a 319 bp long cDNA fragment which by Sanger sequencing was shown to contain IKZF1\u2013TYW1 . The fusion point thus detected was identical to that found by analysis of the RNA sequencing data using the FusionCatcher software . In the IKZF1\u2013TYW1 transcript, exon 4 of IKZF1 (nt 642 in sequence with accession number NM_006060 version 6) was fused out-of-frame to exon 8 of TYW1 (nt 1131 in NM_018264 version 4) .\nThe IKZF1\u2013TYW1 fusion gene would encode a putative truncated 159 aa IKZF1 protein containing the first 140 aa of IKZF1 (NP_006051) and 19 aa from the fused TYW1. This protein would not contain the functional domains of the normal IKZF1 protein. Alterations of IKZF1 (often deletions) are strongly associated with BCR-ABL1-positive as well as Ph-like ALL [, ].\nAdditional interphase FISH experiments were performed to detect the IKZF1\u2013TYW1 fusion gene using a home-made dual color dual fusion probe. The probes were made from commercial BACs which were purchased from BACPAC Resources Center . The probe for the IKZF1 gene was constructed from a pool of the clones RP11-813K3 (Accesion number AC020743; Position: chr7: 50157413\u201350339940) and RP11-95E2 (Accesion number AC018705; chr7: 50475184\u201350648153) and was labeled red . The probe for the TYW1 gene was constructed from a pool of the clones RP11-458F8 (Accesion number AC073335; Position: chr7: 66297269\u201366454983) and RP11-166O4 (Accesion number AC006480; Position: Chr7: 66699524\u201366859231) and was labeled green .\nFISH analysis showed double fusion signals in 91 out of 100 examined interphase nuclei from white blood cells suggesting an IKZF1\u2013TYW1 fusion gene .", "summary": "We used fluorescence in situ hybridization (FISH), array comparative genomic hybridization (aCGH), RNA sequencing, reverse transcription (RT) and genomic polymerase chain reaction (PCR), as well as Sanger sequencing to investigate a case of pediatric ALL with a normal karyotype. FISH with a commercial PDGFRB breakapart probe showed loss of the distal part of the probe suggesting a breakpoint within the PDGFRB locus. aCGH revealed submicroscopic deletions in chromosome bands 5q32q35.3 (about 30\u00a0Mb long, starting within PDGFRB and finishing in the CANX locus), 7q34 (within TCRB), 9p13 (PAX5), 10q26.13 (DMBT1), 14q11.2 (TRAC), and 14q32.33 (within the IGH locus). RNA sequencing detected an in-frame GTF2I-PDGFRB and an out-of-frame IKZF1-TYW1 fusion transcript. Both fusion transcripts were verified by RT-PCR together with Sanger sequencing and interphase FISH. The GTF2I-PDGFRB fusion was also verified by genomic PCR and FISH. The corresponding GTF2I-PDGFRB fusion protein would consist of almost the entire GTF2I and that part of PDGFRB which harbors the catalytic domain of the tyrosine kinase. It would therefore seem to lead to abnormal tyrosine kinase activity in a manner similar to what has been seen for other PDGFRB fusion proteins.", "subclaim_evaluations": [ { "subclaim": "Fluorescence in situ hybridization (FISH) was used to investigate a case of pediatric ALL with a normal karyotype.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization (aCGH) was used to investigate the case.", "support_label": "supported", "is_refined": false }, { "subclaim": "RNA sequencing was used to investigate the case.", "support_label": "supported", "is_refined": false }, { "subclaim": "Reverse transcription (RT) and genomic polymerase chain reaction (PCR) were used to investigate the case.", "support_label": "supported", "is_refined": false }, { "subclaim": "Sanger sequencing was used to investigate the case.", "support_label": "supported", "is_refined": false }, { "subclaim": "FISH with a commercial PDGFRB breakapart probe showed loss of the distal part of the probe.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization revealed submicroscopic deletions in chromosome bands 5q32q35.3.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization revealed submicroscopic deletions in chromosome band 7q34.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization revealed submicroscopic deletions in chromosome band 9p13.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization revealed submicroscopic deletions in chromosome band 10q26.13.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization revealed submicroscopic deletions in chromosome band 14q11.2.", "support_label": "supported", "is_refined": false }, { "subclaim": "Array comparative genomic hybridization revealed submicroscopic deletions in chromosome band 14q32.33.", "support_label": "supported", "is_refined": false }, { "subclaim": "RNA sequencing detected an in-frame GTF2I-PDGFRB fusion transcript.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "RNA sequencing detected an out-of-frame IKZF1-TYW1 fusion transcript.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both fusion transcripts were verified by RT-PCR.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both fusion transcripts were verified by Sanger sequencing.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both fusion transcripts were verified by interphase FISH.", "support_label": "supported", "is_refined": false }, { "subclaim": "The GTF2I-PDGFRB fusion was also verified by genomic PCR.", "support_label": "supported", "is_refined": false }, { "subclaim": "The GTF2I-PDGFRB fusion was also verified by FISH.", "support_label": "supported", "is_refined": false }, { "subclaim": "The GTF2I-PDGFRB fusion protein would consist of almost the entire GTF2I.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The GTF2I-PDGFRB fusion protein would include that part of PDGFRB which harbors the catalytic domain of the tyrosine kinase.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The GTF2I-PDGFRB fusion protein would lead to abnormal tyrosine kinase activity.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The GTF2I-PDGFRB fusion protein would lead to abnormal tyrosine kinase activity similar to other PDGFRB fusion proteins.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_354_en.txt", "fulltext": "In august 2018, an 81-year-old caucasian man presented to the emergency department with fever, progressive dyspnea, dry cough and left pleuritic chest pain.\nPatients symptoms started 3 wk ago and worsened progressively.\nHis medical history was consistent with chronic lymphocytic leukemia, initially treated in 2007 with Fludarabine, Cyclophosphamide and Rituximab therapy with chronic lymphocytosis, type 2 diabetes mellitus, hypertension, hyperlipidemia and chronic kidney failure with an eGFR of 28 mL/min/1.73 m2. He reported no smoking or alcohol abuse and used to work as an upholsterer.\nNone.\nPhysical examination revealed fever (38.1\u00b0C), tachycardia (105 bpm), peripheral percutaneous oxygen saturation was 100% with 2 liters of oxygen with tachypnea, normal blood pressure and almost abolished left vesicular murmur. Adenopathy, hepatomegaly or splenomegaly were not observed. Cardiovascular and neurologic examination were normal.\nBiology tests revealed neutrophilia (18.7 g/L) and elevated CRP (297 mg/L) consistent with inflammatory response, along with stable lymphocytosis (242 g/L) and anemia (7.8 g/L).\nChest X-ray at admission showed a large left pleural effusion with contralateral tracheal deviation. Complementary computed tomography confirmed a walled-off, loculated left pleural effusion, with right lung parenchyma considered normal.\nFirst bedside pleural puncture showed a citrine exudate (pleural protein 37 g/L, pleural fluid protein to serum ratio 0.61), unfortunately cytological examination was not performed.\nDespite intravenous treatment with cefotaxime, the patient condition worsened with persistence of fever, neutrophilia, and severe hypoxemia appeared. Bacteriological standard culture of the pleural liquid sample was negative, as well as repeated blood cultures. In order to look for a tuberculosis etiology, auramine stained sputum smears and cultures were performed but remained negative. Spot-test for tuberculosis was not performed. Ten days after his admission, because of the uncontrolled large pleural effusion with acute hypoxemic respiratory failure, the patient underwent surgical thoracentesis with evacuation of 2 liters of purulent liquid. We chose surgery instead of repeated pleural drawings, because local sepsis was not controlled nor bacteriologically documented. Pleura was thick and nodular, with white pseudo-membranes. Treatment with metronidazole was added to cefotaxime after the surgery in order to cover anaerobic bacteria. Cytobacteriological examination and cultures of the liquid were negative. Lymphocyte phenotyping ruled out B-cell lymphoma as a complication of his chronic lymphocytic leukemia. Three days after, the patient progressively developed multiple organ failure requiring intensive care unit admission. As no massive transfusion was initiated during surgery and shock was the main matter, fluid overload could not explain the evolution in multiple organ failure. After a slow unfavorable evolution during the ten first days of hospitalization, the patient\u2019s condition worse brutaly three days after surgical thoracocentesis leading to septic shock complicated of multiple organ failure. Despite antibiotherapy with cefepime and amikacin, invasive mechanical ventilation, vasopressor infusion and renal replacement therapy, the patient died of uncontrolled septic shock few hours after ICU admission.\nThe day after, mycobacterial culture of surgical pleural samples yielded Gram-negative bacilli . Rapid identification using matrix-assisted desorption ionization\u2013time of flight mass spectrometry (MALDI-TOF MS; Microflex LT; Bruker Daltonics, Leipzig, Germany) was performed and L. pneumophila was identified. The bacteria were addressed to the National Reference Center of Legionella and molecular typing analysis by sequence-based typing was performed and showed that the strain of L. pneumophila serogroup 1 belonged to Sequence Type 1. Urinary antigen research retrospectively performed on a urine sample of the patient confirmed the presence of L. pneumophila serogroup 1.\nWe believe that chances of super infection or co-infection with another bacterium are scarce. Patient indeed received broad spectrum antibiotics directed against common bacteria causing pleural empyema (including anaerobic bacteria, gram-negative bacillus, streptococci and staphylococci), and repeated standard bacteriological cultures remained negative.\nRetrospectively, our patient presented the following risk factors: Male sex, aged more than 50 years, chronic lymphocytic leukemia with history of immunocompromising treatments, chronic kidney failure, diabetes mellitus and weaned smoking.", "summary": "An 81-year-old man presented to the emergency with a 3 wk dyspnea, fever and left chest pain. His previous medical conditions were chronic lymphocytic leukemia, diabetes mellitus, chronic kidney failure, hypertension and hyperlipidemia, without tobacco use. Chest X-ray and comouted tomography-scan confirmed a large left pleural effusion, which puncture showed a citrine exudate with negative standard bacterial cultures. Despite intravenous cefotaxime antibiotherapy, patient's worsening condition after 10 d led to thoracocentesis and evacuation of 2 liters of pus. The patient progressively developed severe hypoxemia and multiorgan failure occurred. The patient was treated by antibiotherapy with cefepime and amikacin and with adequate symptomatic shock treatment, but died of uncontrolled sepsis. The next day, cultures of the surgical pleural liquid samples yielded L. pneumophila serogroup 1, consistent with the diagnosis of pleural legionellosis.", "subclaim_evaluations": [ { "subclaim": "The patient is an 81-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He presented with 3 weeks of dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had left chest pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has chronic lymphocytic leukemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has diabetes mellitus.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has chronic kidney failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has hyperlipidemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest X-ray showed a large left pleural effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography confirmed a large left pleural effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracentesis showed a citrine exudate.", "support_label": "supported", "is_refined": false }, { "subclaim": "Standard bacterial cultures were negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "He received intravenous cefotaxime.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 10 days, his condition worsened.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracocentesis evacuated 2 liters of pus.", "support_label": "supported", "is_refined": false }, { "subclaim": "He developed severe hypoxemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multiorgan failure occurred.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was treated with cefepime.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was treated with amikacin.", "support_label": "supported", "is_refined": false }, { "subclaim": "He received adequate symptomatic shock treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "He died of uncontrolled sepsis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cultures of surgical pleural fluid yielded L. pneumophila serogroup 1.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was pleural legionellosis.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_659_en.txt", "fulltext": "A 35-year-old female patient arrived at our department complaining of back pain, heart palpitations, and fatigue due to the large size of pericardial mass causing a pressure symptom. No symptoms of hypertension, fever, extrasystoles were found on physical examination, and no arrhythmia or rhythm disturbances were found on the electrocardiography. No previous medical and family history was declared by the patient. A chest X-ray showed that the patient\u2019s cardiothoracic ratio was enlarged and that her cardiophrenic sinus was obscured on the right side (see Fig. ). A transthoracic echocardiography indicated pericardial effusion, tricuspid, and pulmonary insufficiencies and showed a large echogenic mass involving the pericardium beside the right heart. Pericardiocentesis was performed, and a cytologic examination of the bloody pericardial fluid obtained though fine needle aspiration (FNA) showed monotonous cells with oval-spindle vesicular nuclei with less amphophilic cytoplasm, evenly distributed chromatin, and inconspicuous nucleoli that formed groups in hypocellular samples (see Fig. ). Overlapping nuclei were observed locally. During pre-diagnosis, a spindle cell mesenchymal tumor with uncertain malignant potential was considered. Adequate sample cannot be obtained from aspiration for cell block preparation.\nA contrasted CT scan of the chest showed a heterogeneously enhanced lesion measuring 12 cm x 11 cm x 6.5 cm located in the right mid-anterior of the pericardial area (see Fig. ). The mass had a heterogeneous internal structure, creating significant pressure on the right heart and superior vena cava. There was no radiological space between the mass and the right heart, and no significant vascular, cardiac, or thoracic wall invasions were observed. No lymph node involvement was observed in the mediastinal or hilar regions. The trachea, including both main bronchi and bronchial trees, was open. Neither an active infiltrative appearance nor any nodular lesions could not be seen in the lung parenchyma (see Fig. ). All radiological findings were indicative of either a pericardial fibroma or a pericardial sarcoma, both of which were noted in the differential diagnosis. On positron emission tomography (PET)-CT imaging, only the pericardial mass showed increased F-18 fluorodeoxyglucose (FDG) uptake with a maximum standard uptake of 5.3. No lymph node metastasis was detected radiologically.\nAfter the radiological examinations, the pericardial mass was decided to be resected. During thoracotomy, the pericardial mass was found to invade the ventricular wall and main vascular structures, therefore, the mass was resected incompletely. Due to the location, extent and nature of the tumor, debulking surgery was performed and R0 surgery could not be performed. Macroscopically, any palpable lymph node was not detected during the surgery.\nHistopathologically, a spindle cell mesenchymal tumor with infiltrative limited hypercellular fascicular structure containing a small amount of loose myxoid stroma hyalinized, and necrotic areas showing mild to moderate pleomorphism were observed in fragmented mass samples (see Fig. a). A nuclear palisade was noted in the neoplastic cells, and the mitotic rate was 18 mitotic cells per 10 high power fields (see Fig. b). Mesothelioma, fibrosarcoma, a solitary fibrous tumor, leiomyosarcoma, and synovial sarcoma were all included as possibilities in the differential diagnosis. Immunohistochemical staining showed a positive reaction with vimentin, Bcl-2, TLE-1 (see Fig. c), and a negative reaction with pan-cytokeratin, HBME-1, calretinin, CD99, actin, desmin, CD34, STAT6, and S100. The Ki67 proliferation index was increased in the tumor (see Fig. d). A sample was sent to an external center where molecular studies could be performed for genetic analysis, and a real-time polymerase chain reaction (RT-PCR) test detected SYT-SSX1 fusion. With these findings, the patient was given a definitive diagnosed of monophasic synovial sarcoma.\nPostoperative radiotherapy and chemotherapy were advised but refused by the patient at first place. On postoperative 4th month, the patient decided to undergo the oncological therapies, however, a six-week pregnancy was detected, therefore, only radiotherapy was applied due to the enlargement of pericardial mass. The chemotherapy was postponed for one year. After the term delivery, the patient suffered from the respiratory distress due to enlargement of the mass in the pericardial region to 14 cm in diameter, therefore, six cycles of doxorubicin and ifosfamide combination were administered. An emboli in the left main pulmonary artery, a pleural effusion in the right hemithorax, and a metastatic mass in the liver were detected. The patient whose respiratory parameters deteriorated was followed up in the intensive care unit. During this follow-up, the patient, who had myocardial infarction 21 months after the operation, died.", "summary": "The case with back pain, palpitation and weakness, was diagnosed with pericardial effusion and suspicious mass adjacent to right heart in ultrasonography. Computerized tomography showed mass 12\u2009\u00d7\u200911\u2009\u00d7\u20096.5\u00a0cm in size, located in right mid-anterior pericardial area, with heterogeneous internal structure, heterogeneously contrasting right heart and prominent pressure on superior vena cava. Cytopathology of pericardial effusion showed monotonous cells with oval-spindle vesicular nuclei, less amphophilic cytoplasm, evenly distributed chromatin and inconspicuous nucleoli. The pericardial mass was resected incompletely, spindle cell mesenchymal tumor with hypercellular fascicular structure and with infiltrative margins, containing a small amount of loose myxoid stroma, occasionally necrotic areas was observed histopathologically. Immunohistochemical positive reaction was for vimentin, Bcl-2, TLE-1. Accordingly, the case was diagnosed with monophasic PSS.", "subclaim_evaluations": [ { "subclaim": "The patient had back pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had palpitations.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasonography showed pericardial effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasonography showed a suspicious mass adjacent to the right heart.", "support_label": "supported", "is_refined": false }, { "subclaim": "CT showed a mass measuring 12\u2009\u00d7\u200911\u2009\u00d7\u20096.5 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was located in the right mid-anterior pericardial area.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass had a heterogeneous internal structure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass heterogeneously contrasted the right heart.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass caused prominent pressure on the superior vena cava.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cytopathology of pericardial effusion showed monotonous cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cells had oval-spindle vesicular nuclei.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cells had less amphophilic cytoplasm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cells had evenly distributed chromatin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cells had inconspicuous nucleoli.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pericardial mass was resected incompletely.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathology showed a spindle cell mesenchymal tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had a hypercellular fascicular structure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor had infiltrative margins.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor contained a small amount of loose myxoid stroma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor occasionally had necrotic areas.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical staining was positive for vimentin.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical staining was positive for Bcl-2.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunohistochemical staining was positive for TLE-1.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case was diagnosed with monophasic PSS.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3084_en.txt", "fulltext": "A 66-year-old asymptotic male with hypertension, hyperlipidaemia, and a history of syncope was admitted to the hospital after ambulatory 24\u2005h Holter electrocardiography monitoring, which revealed non-sustained ventricular tachycardia. His physical examination was unremarkable. Electrocardiogram revealed sinus rhythm without any ST-segment changes. 2D echocardiography showed preserved left ventricular ejection fraction of 65%. Non-invasive coronary computed tomography angiography (CCTA) showed 60% stenosis of the LMCA bifurcation with the minimal lumen area of 5\u2005mm2, 40% stenosis in the proximal LAD, and 60% stenosis in the proximal LCx. Invasive coronary angiography confirmed stenosis of the LMCA bifurcation as well as revealed two obstructive stenoses of the second diagonal branch (DB) and the distal LCx. The SYNTAX score was 26, which indicates moderate complexity of coronary artery disease and require careful consideration between PCI and CABG. After the heart team\u2019s (cardiologists, interventional cardiologists, cardiac surgeon) decision and patient\u2019s consent, the complex PCI using DK crush bifurcation stenting technique was planned. Firstly, using the right radial approach, successful PCIs of the distal LCx and the second DB were performed. Secondly, LMCA LAD/LCx procedure was carried out. A 7F (French size) EBU (Extra Back Up, a guiding catheter used to provide maximal support and control during PCI) 3.75\u2005mm guiding catheter was used and two Sion Blue ES (Sion Blue Extra Stiff, a guiding catheter used for high torque control and support) guidewires were placed in the distal segments of LCx and LAD. Then, an Ultimaster Nagomi 3.5/18\u2005mm stent was implanted into the LMCA towards the LCx and partially crushed by a 3.0/15\u2005mm semi-compliant balloon. Subsequently, after rewiring, balloon kissing was performed with a 3.0/15\u2005mm semi-compliant balloon in LCx and a 3.5/15\u2005mm semi-compliant balloon in LAD. Ultimaster Nagomi 4.0/15\u2005mm stent was implanted into the LMCA towards the LAD. Proximal optimization technique (a technique involving inflating a balloon in the proximal part of the larger branch to optimize the opening and ensure better stent apposition and expansion before further stenting of the smaller branch) was performed with a 4.0/8\u2005mm non-compliant balloon and, after rewiring the LCx, re-kissing was performed with a 3.0/15\u2005mm balloon in LCx and a 3.5/15\u2005mm balloon in LAD. Finally, an adequate apposition of LMCA/LCx and LAD stents was confirmed by the intravascular ultrasound monitoring. The final angiography revealed an excellent angiographic result, with optimal stent expansion, lesions covered, and TIMI 3 flow in all coronary arteries. The 1-month follow-up of the patient was uneventful.\n\n", "summary": "We describe a 66-year-old Caucasian male with a risk factor for coronary artery disease, but free of angina, who presented to the hospital after syncope and nsVT diagnosis in the 24\u2005h Holter electrocardiography monitoring. Coronary computed tomography angiography revealed LMCA bifurcation stenosis with concomitant left circumflex artery (LCx) and diagonal branch stenosis. Subsequent coronary angiography confirmed diagnosis. Successful percutaneous coronary intervention (PCI) of bifurcation/distal LMCA disease involving ostium of LAD and LCx has been a challenging procedure.", "subclaim_evaluations": [ { "subclaim": "The patient is a 66-year-old Caucasian male.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient has a risk factor for coronary artery disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was free of angina.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented to the hospital after syncope.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a diagnosis of non-sustained ventricular tachycardia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made by 24\u2005h Holter electrocardiography monitoring.", "support_label": "supported", "is_refined": false }, { "subclaim": "Coronary computed tomography angiography revealed LMCA bifurcation stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Coronary computed tomography angiography showed concomitant left circumflex artery stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Coronary computed tomography angiography showed concomitant diagonal branch stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Subsequent coronary angiography confirmed the diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Percutaneous coronary intervention was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The PCI targeted bifurcation/distal LMCA disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The PCI involved the ostium of the LAD.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The PCI involved the LCx.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2535_en.txt", "fulltext": "A 62-year-old man (175.6 cm 75 kg) was scheduled for sternum closure using the right latissimus dorsi muscle flap for mediastinitis. He had gone CABG using the bilateral internal thoracic arteries 8 months before. He underwent debridement and vacuum-assisted closure (VAC) of the infected wounds 1 month after surgery. Although sternum closure using an omental flap was performed thereafter, debridement and VAC were reintroduced because of infection. His medical history included diabetes mellitus with end-stage diabetic nephropathy. He has been receiving hemodialysis, and the right lower leg amputated for diabetic gangrene. He was receiving linagliptin and mitiglinide calcium hydrate and aspirin. His laboratory data showed renal dysfunction (estimated glomerular filtration rate 6.2 ml/min) and anemia (hemoglobin 9.6 d/dl), but no abnormal coagulation was observed, and the platelet count was 145,000/\u03bcl. He also complained of postoperative nausea and vomiting (PONV) probably due to fentanyl after multiple anesthesia histories.\nConsidering the possibility of widespread surgical wound and he was taking aspirin, continuous ultrasound-guided ESPB was planned. Aspirin was continued until the day of surgery. He received no premedication. Standard monitoring and intra-arterial blood pressure monitoring were performed. General anesthesia was induced with propofol 70 mg, fentanyl 250 \u03bcg, and rocuronium 60 mg and maintained with 1.5% sevoflurane in an inhaled oxygen concentration of 60% with a total flow of 3 l/min and remifentanil 0.1\u20130.2 \u03bcg/kg/min. After tracheal intubation, he was placed in the left lateral decubitus position. After performing standard skin asepsis, the linear transducer (12 MHz, LOGIQ e; GE Healthcare, Chicago IL), within a sterile sleeve, was positioned on the patient in a transverse orientation and the T6 spinous process image was taken. The transducer was moved right laterally to identify the transverse process of T6 and then rotated 90\u00b0 to visualize the right transverse process and the erector spinae muscles above it. A continuous nerve block set (Contiplex Tuohy Ultra set; B BRAUN, Melsungen, Germany) with an 18-G, 100-mm Tuohy needle was inserted in-plane in a caudal to cranial direction until contact with the right T6 transverse process was made. After confirming that there was no reverse blood flow, hydrodissection with 2 ml of 0.375% ropivacaine was used to confirm the correct needle tip position. Eighteen milliliters of 0.375% ropivacaine was injected, and a 20-G catheter was advanced through the needle. After injecting 20 ml of 0.375% ropivacaine again from the catheter 55 min after the initial injection, 0.2% ropivacaine was continuously infused at 5 ml/h before the start of surgery. Hemodynamic stability was achieved without the need for an additional bolus administration of fentanyl during surgery. One gram of acetaminophen was intravenously infused 30 min before the end of the operation. There were no other events of note during the operation. The operative time was 5 h and 49 min, and the anesthesia time was 8 h and 2 min.\nAfter extubation in the operating room and admission to the intensive care unit (ICU), the nerve blockade area and Numerical Rating Scale (NRS) were confirmed when sufficient consciousness was reached. Regarding nerve blockade, the cold sign was T2\u2013T8, pinprick was T3\u2013T8, and NRS at rest was 1/10 immediately after surgery. The main pain area was the wound where the right latissimus dorsi muscle flap was collected, but pain of the median sternum wound was not noted. Acetaminophen at 500 mg was administered orally because the NRS temporarily increased to 7/10 due to body movement. However, the NRS at rest was 1\u20132/10 and that while active was 4/10. For pain during movement, 3 ml of patient-controlled analgesia (PCA) consisting of 0.2% ropivacaine was flushed, and this was performed twice in the ICU. After leaving the ICU 24 h after the operation and being transported to the general ward, pain was not aggravated and the ESPB catheter was removed 56 h after the operation. After removal of the catheter, oral administration of acetaminophen during pain provided good pain control. No ESPB-related complications were observed during ESPB catheter placement or after removal. Regarding PONV, nausea was observed immediately after admission to the ICU and only a single intravenous injection of 10 mg of metoclopramide was administered. Thereafter, the patient had no PONV.", "summary": "A 62-year-old man with mediastinitis was scheduled for sternum closure using a latissimus dorsi muscle flap. He had gone coronary artery bypass grafting and was taking aspirin. After induction of general anesthesia and tracheal intubation, a catheter was inserted for ESPB from the T6 level under ultrasound monitoring and infusion of ropivacaine was started. Tracheal tube was removed in the operating room, cold sense was absent between T2-8, and analgesia was between T3-T8 after uneventful surgery. There were no complications associated with ESPB postoperatively.", "subclaim_evaluations": [ { "subclaim": "The patient is a 62-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had mediastinitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was scheduled for sternum closure using a latissimus dorsi muscle flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had undergone coronary artery bypass grafting.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was taking aspirin.", "support_label": "supported", "is_refined": false }, { "subclaim": "General anesthesia was induced.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tracheal intubation was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "An ESPB catheter was inserted from the T6 level.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ESPB catheter insertion was performed under ultrasound monitoring.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ropivacaine infusion was started.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tracheal tube was removed in the operating room.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cold sense was absent between T2-8.", "support_label": "supported", "is_refined": false }, { "subclaim": "Analgesia was between T3-T8 after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no complications associated with ESPB postoperatively.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_268_en.txt", "fulltext": "A 46-year-old woman had undergone mastectomy for breast cancer (estrogen receptor 2+, progesterone receptor 3+, and HER2 3+) 5 years before presentation and had subsequently remained under observation without any postoperative adjuvant therapy. Multiple lung, liver, and bone metastases were identified in year 3 postoperatively, and systemic chemotherapy was introduced. The chemotherapy regimen included docetaxel, trastuzumab, pertuzumab, and bisphosphonates, and radiotherapy for lumbar spinal bone metastases (20 Gy/5 Fr). However, she developed multiple brain metastases (BM) 1 year later, which were treated with whole-brain radiotherapy (30 Gy/10 Fr) and placement of a ventriculoperitoneal shunt for hydrocephalus. The systemic chemotherapy regimen was subsequently switched to trastuzumab emtansine, but further LM developed, and the patient was referred to our hospital.\nAt the time of referral, Eastern Cooperative Oncology Group (ECOG) performance status was 4, level of consciousness as assessed by Glasgow coma scale score was E3V4M6, and she was suffering from intractable headaches, severe nausea and vomiting, and cerebellar ataxia. T1-weighted gadolinium- enhanced magnetic resonance imaging (MRI) revealed diffuse contrast enhancement of the meninges, mainly in the posterior cranial fossa, with compression of the cerebellum by the significantly thickened meninges [,]. In light of the clinical course, treatment options were limited, and best supportive care was presented as an option.\nHowever, the patient requested further therapy, and given her good karnofsky performance status (KPS), an aggressive treatment strategy was pursued. The first step in the treatment was to relieve intracranial hypertension, and decompression of the posterior cranial fossa was performed . After surgery, headaches, nausea, and vomiting were immediately improved and her performance status improved.\nTreatment with lapatinib at 1250 mg and capecitabine 1200 mg was started on postoperative day 14. As early as 2 weeks later, the diffuse abnormal signal enhancement across her tissues shrunk dramatically on T1-weighted gadolinium- enhanced MRI after starting this new regimen [,]. Further imaging revealed that the LM had almost disappeared on MRI by 2 months of therapy [,]. At present, no recurrence has been observed more than 1 year after the treatment. The patient is continuing to attend our hospital unit for treatment under the same regimen and currently remains well with an ECOG Performance Status 1.", "summary": "We report on a 46-year-old woman with LM from human epidermal growth factor receptor 2 (HER2)-positive breast cancer. She was suffering from intractable headaches, severe nausea and vomiting, and cerebellar ataxia. Contrast-enhanced magnetic resonance imaging (MRI) revealed diffuse enhancement of the meninges, mainly in the posterior cranial fossa, and compression of the cerebellum by the profoundly thickened meninges. The first step in the treatment was decompression of the posterior cranial fossa to relieve intracranial hypertension. After surgery, her symptoms immediately improved. The second step was treatment with lapatinib at 1250 mg and capecitabine 1200 mg, which dramatically improved her symptoms and disappeared diffuse abnormal signal enhancement on MRI.", "subclaim_evaluations": [ { "subclaim": "The patient is a 46-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has leptomeningeal metastasis from HER2-positive breast cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had intractable headaches.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had severe nausea and vomiting.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had cerebellar ataxia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast-enhanced MRI showed diffuse enhancement of the meninges.", "support_label": "supported", "is_refined": false }, { "subclaim": "The meningeal enhancement was mainly in the posterior cranial fossa.", "support_label": "supported", "is_refined": false }, { "subclaim": "The meninges were profoundly thickened.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thickened meninges compressed the cerebellum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The first treatment step was decompression of the posterior cranial fossa.", "support_label": "supported", "is_refined": false }, { "subclaim": "Decompression was performed to relieve intracranial hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms improved immediately after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second treatment step was lapatinib at 1250 mg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second treatment step was capecitabine at 1200 mg.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Treatment with lapatinib and capecitabine dramatically improved symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "Diffuse abnormal signal enhancement on MRI disappeared after treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_688_en.txt", "fulltext": "A 48-year-old white man with a medical history of recurrent pneumonitis and therapy-resistant ulcerative colitis over 10 years presented with fever and cough with sputum production for 10 d. He reported resting dyspnea and pain over the right thoracic wall.\nUnder antibiotic therapy with moxifloxacin, no clinical improvement was reported. A chest roentgenogram showed an effaced right costo-phrenic angle and nonvisualization of the right hilar shadow suggestive of right lower lobe collapse .\nBronchoscopy revealed complete occlusion of the right bronchus intermedius due to a smooth-walled vascular mass with intact overlying epithelium. A computed tomography (CT) scan revealed a well-defined round-to-oval, smoothly marginated tumor measuring 43 mm \u00d7 56 mm in size located endobronchially in the proximal right main stem bronchus causing complete collapse of the right middle and lower lobe . A PET-CT scan showed a low metabolically active mass in the lower lobe, consistent with a carcinoid tumor, and metabolically active prominent and probably reactive mediastinal and hilar lymph nodes.", "summary": "We report the case of a 48-year-old male who presented with cough, dyspnea, a history of recurrent pneumonitis, and therapy-refractory ulcerative colitis that completely subsided after the resection of a pulmonary carcinoid.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cough.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of recurrent pneumonitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had therapy-refractory ulcerative colitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's ulcerative colitis completely subsided.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The subsidence occurred after the resection of a pulmonary carcinoid.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 1 }, { "id": "multiclinsum_test_1657_en.txt", "fulltext": "A 36-year-old woman with a 2-month history of abdominal and back pain was referred and admitted to our hospital for treatment. The patient had no history of disease. On physical examination, a hard, elastic, poorly flexible mass was palpable in the right upper abdomen. No signs of obstructive jaundice or abdominal tenderness were identified. Laboratory analysis revealed anemia (hemoglobin = 10.6 g/dL), thrombocytosis (43.9 \u00d7 104/\u03bcL), and elevation of C-reactive protein (2.71 mg/dl). The remaining laboratory examinations were within normal ranges, including tumor markers \u03b1-fetoprotein (AFP), carcinoembryonic antigen (CEA), and cancer antigen (CA)19-9. Abdominal ultrasonography revealed an extensive space-occupying lesion in the right lobe of the liver, 15 cm in diameter, showing a heterogeneous internal component including hemorrhage and hypervascular mural nodule . Contrast-enhanced computed tomography (CT) of the abdomen showed a cystic mass measuring 13 \u00d7 14 \u00d7 11 cm in the right lobe of the liver with enhanced mural nodule . Magnetic resonance imaging (MRI) of the abdomen showed hyperintense components on T2-weighted imaging, compatible with the hemorrhagic area . Abnormal accumulation was seen on 18F-fluorodeoxyglucose positron emission tomography (FDG-PET) of the liver and lower abdomen . We then planned excision of the tumor and performed hepatectomy of the posterior segment and partial resection of the omentum, which had been detected on FDG-PET. Gross examination of the hepatic tumor showed a massive cystic tumor measuring 18 \u00d7 15 cm containing hemorrhagic fluid, and mucinous, hemorrhagic brownish or yellowish multinodular tumors were observed in the extra cystic wall area . The omental tumors were two slightly brownish, nodular tumors measuring 2.1 \u00d7 1.3 and 0.3 \u00d7 0.3 cm . Microscopically, both hepatic and omental tumors comprised tubular, cystic, or spindle structures of epithelioid cells with clear or eosinophilic cytoplasm . Immunohistochemically, tumor cells were positive for AE1/AE3, EMA, CK19, CK7, CD10, and calretinin , partly or weakly positive for CK5/6, D2-40, vimentin, and WT-1, and negative for HepPer1, chromogranin A, synaptophysin, CEA, inhibin \u03b1, MUC1, melan A, HMB45, CA19-9, ER, PgR, CD34, bcl-2, and \u03b2-catenin . Ki-67 index was 5\u20136% . The final pathological diagnosis was multiple low-grade malignant epithelioid mesothelioma. As of the time of writing, 6 months postoperatively, the patient has shown no disease recurrence.\nMalignant mesothelioma commonly arises from the pleura, but can also arise from the peritoneum, pericardium, and tunica vaginalis testis . However, malignant mesothelioma of the liver is extremely rare and coexistence with malignant mesothelioma of the greater omentum has not been addressed in the literature. Mesothelioma of the liver may arise from Glisson\u2019s capsule, the hepatic falciform ligament or fibrous connective tissue, and then expand to the liver parenchyma . To search the literatures, we used key words of intrahepatic, malignant, and mesothelioma and found 12 case reports which have described primary intrahepatic malignant mesothelioma [\u2013] . In detail, these cases involved six men and six women, with a mean age of 58.4 years (range, 41\u201368 years). Our case represents the youngest female case among these reported cases. Although conventional mesothelioma is frequently associated with asbestos exposure, only 1 case had a clear history of asbestos exposure. Among the remaining 10 cases, 8 cases had no history of asbestos exposure and 3 were not evaluated. One case had a history of viral hepatitis, and 9 cases did not. Mean tumor size was 12.2 cm (range, 3.2\u201324 cm), and our case showed the third largest mass. Gross finding of the tumor was a cystic mass which is not common, and there was no report of case with cystic tumor ever. This tumor contained hemorrhagic fluid; therefore, we thought that the tumor might have bled and formed cystic mass. In 10 cases, the tumor arose in the right lobe, as in our case, and only one tumor arose in the left lobe. Surgery was performed in 10 cases, and only 1 case received best supportive care, due to systemic lymph node swelling and rupture of the tumor . Pathologically, malignant mesothelioma is classifiable into three subtypes: epithelioid, sarcomatoid, and biphasic. The epithelioid type is the most common type, and tubulopapillary or solid variations can be seen in the tumor . The tumor in our case was also diagnosed as epithelioid type, but showed atypical findings such as solid and tubular, cystic, or spindle components in the tumor, clearly partitioned from normal liver tissue by a fibrous capsule. The tumor showed partial hyalinization, but no necrosis. Typical immunohistochemical features are positive results for calretinin, vimentin, cytokeratin, WT-1, and D2-40 and negative results for CD34, CEA, AFP, and Ber-EP4, as seen in our case . In terms of tumor proliferative activity, Ki-67 index in the typical malignant mesothelioma is 15\u201320% , but was 5\u20136% in our case. The tumor was therefore diagnosed as a low-grade malignant tumor, and metastasis was considered unlikely, although a primary malignant omental mesothelioma is also a rare disease. We found only 2 case reports of malignant mesothelioma of the omentum researching with key words of greater omentum, malignant, and mesothelioma [, ]. It was difficult to distinguish multiple tumor from metastatic omental tumor in our case. Multiple malignant mesotheliomas and metastasis of low-grade malignant mesothelioma are both unlikely. The omental tumor cells were positive for AE1/AE3, CK19, CK7, EMA, C D10, and calretinin, partly for CK5/6, D2-40, and vimentin, and negative for HepPer1, chromogranin A, synaptophysin, CEA, inhibin, MUC1, melan A, HMB45, CA19-9, ER, PgR, CD34, bcl-2, and \u03b2-catenin that was same findings with hepatic tumor. However, both tumors have fibrous capsule without invasion of tumor cells. Moreover, both tumors had lower proliferated activity and considered to be low-grade malignant tumor. Basing on these pathological findings, we should diagnose the tumors as multiple mesotheliomas, although we are not able to deny a possibility of dissemination. Concerning about the outcome, lymph node relapse has only been reported in 2 cases, and they were alive at 2 or 36 months after relapse without hematogenous metastatic disease [, ]. Our patient remains alive as of 6 months after surgery without relapse.", "summary": "A 36-year-old woman was admitted to our hospital for the evaluation of an elastic hard mass in the right upper abdomen. Abdominal contrast computed tomography showed a cystic mass measuring 13\u2009\u00d7\u200914\u2009\u00d7\u200911\u00a0cm in the right liver lobe with enhanced mural nodule. Abnormal accumulation was identified in the liver and lower abdominal area on 18F-fluorodeoxyglucose positron emission tomography. The patient underwent hepatectomy of the posterior segment and partial resection of the omentum. The final pathological diagnosis was low-grade multiple malignant epithelioid mesothelioma based on characteristic immunohistochemical findings. As of 6\u00a0months postoperatively, the patient has shown no disease recurrence.", "subclaim_evaluations": [ { "subclaim": "The patient is a 36-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted for evaluation of an elastic hard mass in the right upper abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "Abdominal contrast computed tomography showed a cystic mass in the right liver lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass measured 13\u2009\u00d7\u200914\u2009\u00d7\u200911 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass had an enhanced mural nodule.", "support_label": "supported", "is_refined": false }, { "subclaim": "18F-fluorodeoxyglucose positron emission tomography showed abnormal accumulation in the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "18F-fluorodeoxyglucose positron emission tomography showed abnormal accumulation in the lower abdominal area.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent hepatectomy of the posterior segment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent partial resection of the omentum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final pathological diagnosis was low-grade multiple malignant epithelioid mesothelioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was based on characteristic immunohistochemical findings.", "support_label": "supported", "is_refined": false }, { "subclaim": "As of 6 months postoperatively, the patient has shown no disease recurrence.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_723_en.txt", "fulltext": "We report the case of a 2 years and-5-month-old boy admitted in our clinic for fever with the onset 3 days before admission associating abdominal pain and diarrhea within the last 24 hours. The anamnesis did not reveal any possible exposure to COVID-19 infections or other chronic underlying pathologies.\nThe clinical exam at the time of admission revealed influenced general status, bilateral palpebral edema and conjunctivitis, mucocutaneous signs of dehydration, abdominal tenderness at palpation. The patient weighed 15 kilograms.\nThe laboratory test performed on the day of admission pointed out lymphopenia (1560/mm3), thrombocytopenia (108x103/mm3), anemia (hemoglobin \u2013 Hb 10.9 g/dL), elevated C-reactive protein \u2013 CRP (162 mg/L), erythrocyte sedimentation rate (50 mm/h) and ferritin levels (389.3 ng/mL), hyponatremia (132 mmol/ L), hypopotassemia (3.94 mmol/L), hypertriglyceridemia (476.3 mg/dL), elevated D-dimer (>5 \u03bcg/ml), increased troponin (16.6 ng/L) and NT-proBNP (19,831 pg/ml). The rapid urine exam was negative. The chest X-ray, abdominal ultrasound and echocardiography showed no pathological findings. The blood and urine culture were negative. Corroborating the previously mentioned findings we raised the suspicion of pediatric inflammatory multisystem syndrome possibly associated to COVID-19. We performed a RT-PCR test for SARS-CoV-2 infection, but it was negative. Nevertheless, the serology (IgG anti-SARS-CoV-2) for this infection was positive. Thus, established the diagnosis of PIMS-TS.\nWe initiated intravenous immunoglobulin in a dose of 2 g/kg/day associated with empirical antibiotic (ceftriaxone), anticoagulation therapy (low-molecular weight heparin) and symptomatic drugs (antipyretics, antiemetics, and antidiarrheics). In spite of this therapeutic approach, the fever persisted for the following 36 hours with no clinical improvement. Moreover, the laboratory test performed on the 3rd day of admission showed an increase of the CRP value (216.65 mg/L), and the persistence of elevated NT-proBNP (9,884.2 pg/mL) and D-dimer (1,198 ng/mL), associating also hypoalbuminemia (2.45 g/dL). Therefore, we initiated intravenous methylprednisolone (10 mg/kg/day) for 3 days followed by slow tapering and substitutive treatment with human albumin. We also repeated the echocardiography and we found minimal pericardial effusion, slight dilation of the left cavities (left ventricle - LV z score: 1.6, LV sphericity index: 1.66), regional wall motion abnormalities with dyskinesia of the inferior and infero-septal basal segments of the LV. Moreover, the LV systolic dysfunction was affected, with LV ejection fraction of 40%, with mild mitral regurgitation ; but no coronary impairment. Thus, following pediatric cardiologist\u2019s recommendation, we associated angiotensin converting enzyme inhibitors (Lisinopril), Spironolactone and Hydrochlorothiazide. The serial echocardiography performed during the following days of admission revealed the resorption of the pericardial effusion, with improvement of LV function, correlated with decreased serum levels of NT-proBNP (123.1 pg/mL) and troponin (5.2 pg/mL).\nThe patient was discharged on the 11th day of admission without any complaints and most of the laboratory parameters within normal ranges, except of D-dimer. We recommended the continuation of anticoagulant therapy for another week, as well as Lisinopril, Spironolactone and Hydrochlorothiazide for the following 2 weeks.", "summary": "We report the case of a 2 years and-5-month-old boy admitted in our clinic for fever, abdominal pain and diarrhea. The clinical exam at the time of admission revealed influenced gen-eral status, bilateral palpebral edema and conjunctivitis, mucocutaneous signs of dehydration, and abdominal tenderness at palpation. The laboratory tests performed pointed out lymphopenia, thrombocytopenia, anemia, elevated C-reactive protein - CRP, erythrocyte sedimentation rate and ferritin levels, hyponatremia, hypopotassemia, hypertriglyceridemia, elevated D-dimer, in-creased troponin and NT-proBNP. The real-time polymerase chain reaction (RT-PCR) test for SARS-CoV-2 infection was negative, but the serology was positive. Thus, established the diagnosis of PIMS-TS. We initiated intravenous immunoglobulin, empirical antibiotic, anticoagulation therapy and symptomatic drugs. Nevertheless, the clinical course and laboratory parameters worsened, and the 2nd echocardiography pointed out minimal pericardial effusion, slight dilation of the left cavities, dyskinesia of the inferior and septal basal segments of the left ventricle (LV), and LV systolic dysfunction. Therefore, we associated intravenous methylprednisolone, angiotensin converting enzyme inhibitors, spironolactone and hydrochlorothiazide, with outstanding favorable evolution.", "subclaim_evaluations": [ { "subclaim": "The patient is a 2 years and 5-month-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted for fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted for abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted for diarrhea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical exam at admission showed influenced general status.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical exam at admission showed bilateral palpebral edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical exam at admission showed conjunctivitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical exam at admission showed mucocutaneous signs of dehydration.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical exam at admission showed abdominal tenderness at palpation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed lymphopenia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed thrombocytopenia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed anemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed elevated C-reactive protein.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed elevated erythrocyte sedimentation rate.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed elevated ferritin levels.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed hyponatremia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed hypokalemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed hypertriglyceridemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed elevated D-dimer.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed increased troponin.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory tests showed increased NT-proBNP.", "support_label": "supported", "is_refined": false }, { "subclaim": "The RT-PCR test for SARS-CoV-2 was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "The SARS-CoV-2 serology was positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of PIMS-TS was established.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intravenous immunoglobulin was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Empirical antibiotic therapy was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Anticoagulation therapy was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptomatic drugs were initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical course worsened.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second echocardiography showed minimal pericardial effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second echocardiography showed slight dilation of the left cavities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second echocardiography showed dyskinesia of the inferior and septal basal segments of the left ventricle.", "support_label": "supported", "is_refined": false }, { "subclaim": "The second echocardiography showed left ventricular systolic dysfunction.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intravenous methylprednisolone was added.", "support_label": "supported", "is_refined": false }, { "subclaim": "Angiotensin converting enzyme inhibitors were added.", "support_label": "supported", "is_refined": false }, { "subclaim": "Spironolactone was added.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hydrochlorothiazide was added.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical evolution was favorable.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_855_en.txt", "fulltext": "A 14-year-old male patient came to our clinic presenting a traumatic crown fracture of the permanent, maxillary right central incisor .\nThe patient had preserved the broken fragment in saline solution and it was checked for goodness of adaptation to the tooth .\nTo lessen the ordeal for the already traumatized young patient, we decided to treat him using Er:YAG and Nd:YAG lasers we had at hand at our practice (Fidelis III Plus; Fotona, Ljubljana, Slovenia). Due to the patient\u2019s age, an informed consent form for the procedure was signed by his parents.\nThe trauma had left the pulp exposed ; our first decision was to perform Nd: YAG laser (SP mode, 4 W, 40 Hz, 300 \u03bcm contact fiber) pulp capping .\nWe then proceeded to use the same Er:YAG device with a different wavelength (SSP mode, 200 mJ, 10 Hz, quasi-contact tip-less handpiece) to prepare the bonding surfaces of both the fragment and the tooth .\nThe same surfaces were further prepared with orthophosphoric acid ( and ); bonding agent was applied, and flow composite resin was used to replace the fragment ( and ).\nFor esthetic purposes, we prepared the borderline area surface with the Er:YAG laser before applying orthophosphoric acid and flow composite resin once more .\nNo form of anesthesia was required nor requested by the patient. Follow-up visits performed after one, three, six, twelve, and sixteen months demonstrated the vitality of the tooth .", "summary": "A 14-year-old patient who came to our clinic with a traumatic crown fracture of the permanent, right central incisor is described. The patient had preserved the fragment that had broken off into his mouth and it was rebonded to the tooth using lasers (LightWalker device; Fotona, Ljubljana, Slovenia) with the following parameters: Er:YAG, SSP mode; 200 mJ; 10 Hz; quasi-contact tipless handpiece; Nd:YAG, SP mode; 4 W; 40 Hz; 300 \u03bcm contact fiber. The whole procedure was performed without the need for anesthesia.", "subclaim_evaluations": [ { "subclaim": "The patient is 14 years old.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a traumatic crown fracture of the permanent, right central incisor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had preserved the fragment that had broken off into his mouth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fragment was rebonded to the tooth using lasers.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lasers used were from the LightWalker device.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The device was manufactured by Fotona.", "support_label": "supported", "is_refined": false }, { "subclaim": "The device is based in Ljubljana, Slovenia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Er:YAG laser was used in SSP mode.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Er:YAG laser had a pulse energy of 200 mJ.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Er:YAG laser had a frequency of 10 Hz.", "support_label": "supported", "is_refined": false }, { "subclaim": "A quasi-contact tipless handpiece was used for the Er:YAG laser.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Nd:YAG laser was used in SP mode.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Nd:YAG laser had a power of 4 W.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Nd:YAG laser had a frequency of 40 Hz.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 300 \u03bcm contact fiber was used for the Nd:YAG laser.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was performed without the need for anesthesia.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1013_en.txt", "fulltext": "A 15 year old Caucasian female was transferred from a secondary care paediatric unit. She presented with a two-day history of progressive dyspnoea, cough and palpitations on a background of recent onset arthralgia, alopecia and oral ulceration. Clinical examination revealed hypertension (blood pressure 170/110 mmHg), pallor with a malar rash, symmetrical polyarthritis of the interphalangeal and metacarpophalangeal joints, alopecia and oral ulceration.\nInvestigations revealed normocytic anaemia, haemoglobin 95 g/l (normal 120-160 g/l), lymphopaenia, lymphocytes 0.9 \u00d7 109/l (normal 1.2\u20135.2 \u00d7 109/l)), elevated inflammatory markers with an erythrocyte sedimentation rate (ESR) of 77 mm/hr. (normal 1-9 mm/hr) and c-reactive protein (CRP) of 38 mg/l (normal < 10 mg/l) and moderately impaired renal function with urea 14.4 mmol/l (normal 2.0\u20136.0 mmol/l), creatinine 154 \u03bcmol/l (normal 30-90 \u03bcmol/l). Coagulation screen showed a slightly prolonged prothrombin time (PT) of 13 s (normal 10.2\u201312.0 s) but was otherwise normal. Albumin was low (28 g/l, normal 36-50 g/l) and liver function tests were normal. Microscopic haematuria and proteinuria were present with an elevated urine albumin:creatinine ratio of 1217 mg/mmol (normal < 3.4 mg/mmol). Antinuclear antibody titres were strongly positive with a titre of 1:160, speckled pattern. Anti double-stranded DNA was positive with a titres of > 379 IU/ml (normal 0-10 IU/ml) and positive Crithidia assay >/= 1:160. Anti-Smith and anti-RNP antibodies were both positive with titres of > 480 U/ml (normal 0\u20135.0 U/ml) and > 240 U/ml (normal 0-5 U/ml) respectively. There was marked hypocomplementaemia with C3 0.44 g/l (normal 0.7\u20131.7 g/l), C4 0.06 g/l (normal 0.1\u20130.7 g/l) and absent CH100 classical and alternative pathway components. Antiphospholipid, anti-SSA and anti-SSB antibodies were all negative. Chest x-ray showed bilateral pleural effusions and cardiomegaly with a cardiothoracic ratio of 0.67. Initial echocardiography showed a large pericardial effusion with diastolic compression of the right atrium and ventricle suggestive of cardiac tamponade. The left ventricle was dilated with an ejection fraction of 25% and there was mild mitral, tricuspid and aortic valvular regurgitation. Treatment was commenced with high-dose intravenous methylprednisolone (30 mg/kg/dose, maximum dose of 1 g) and diuretics and immediate transfer to a tertiary paediatric intensive care unit was arranged.\nOn admission to the intensive care unit she had developed periorbital oedema and ascites with worsening dyspnoea and reduced oxygen saturation. Echocardiography revealed a large pericardial effusion, oedematous myocardium and valvulitis with an ejection fraction of 13% with no evidence of tamponade (see Fig. ). Renal function deteriorated further with a creatinine increase to 270 \u03bcmol/l (normal range 30-90 \u03bcmol/l) and the patient became anuric. Intermittent positive pressure ventilation, inotropic support, plasma exchange and haemodialysis were required. High-dose intravenous methylprednisolone was continued for 3 days and then changed to oral prednisolone at 1 g/kg/day. Cyclophosphamide was commenced at a dose of 850 mg/m2 on day four of admission due to severe renal impairment and ongoing need for haemodialysis and multiorgan involvement.\nFollow-up echocardiography showed normalisation of function by day five of admission with a small pericardial effusion as the only persistent abnormality. Renal biopsy revealed grade 4 lupus nephritis. The patient was discharged from the intensive care unit on day seven of admission and subsequently discharged from the hospital on day fourteen. Treatment at discharge included a weaning dose of prednisolone, hydroxychloroquine, enalapril and carvedilol. Cyclophosphamide treatment was continued monthly for a total of six doses after which the patient was maintained on further immunosuppression. Remission has been maintained with mycophenolate mofetil and hydroxychloroquine over the past 2 years.", "summary": "We report a case of jSLE in a 15 year old Caucasian female presenting with an acute episode of pancarditis and multiorgan dysfunction who was successfully treated with systemic corticosteroids and cyclophosphamide.", "subclaim_evaluations": [ { "subclaim": "The patient is a 15 year old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has juvenile systemic lupus erythematosus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with an acute episode of pancarditis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had multiorgan dysfunction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with systemic corticosteroids.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with cyclophosphamide.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was successful.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3016_en.txt", "fulltext": "A 53-year-old man, who was morbidly obese with a BMI of 75 kg/m2, presented with shortness of breath (SOB) and hypercapnia. He had never smoked but had a history of hypertension and severe obstructive sleep apnea with an apnea-hypopnea index (AHI) >30 per hour. There was no known family history of cardiac disease, and the patient did not have a history of syncope.\n\nOn examination, his blood pressure was 132/83 mmHg, and he had a regular pulse of 98 bpm, a respiratory rate of 20 breaths/minute, a temperature of 98.7\u00b0F, with oxygen saturation (SaO2) of 88% on room air. His heart sounds were normal without murmurs. Lung auscultation showed reduced but clear breath sounds, and mild lower limb edema was present.\n\nBlood gases showed a pH of 7.31, PaO2 of 57 mmHg, a PaCO2 of 61 mmHg, and a SaO2 of 86% on room air. Serum bicarbonate was 30 mmol/L, brain natriuretic peptide (BNP) 160 pg/ml, troponin 0.030 ng/ml, and thyroid function tests were normal. An electrocardiogram (ECG) showed normal sinus rhythm with a rate of 95 beats/min, a normal electrical axis with good R wave progression in the precordial leads. No epsilon waves were seen in the precordial leads.\n\nPulmonary function tests showed no obstruction or restriction with a normal diffusing capacity of the lungs for carbon monoxide (DLCO) and normal total lung capacity (TLC). The patient had a reduced forced expiratory volume in one second (FEV1) and forced vital capacity (FVC) with a normal FEV1/FVC ratio, which are commonly seen with obesity hypoventilation syndrome (OHS).\n\nChest computed tomography (CT) showed normal lung parenchyma without pulmonary embolism. Two-dimensional transthoracic echocardiogram (TTE) showed normal left ventricular function and a dilated right ventricle (RV) with a flattened septal wall (1.3 cm in diameter), moderate tricuspid regurgitation, an estimated right ventricular systolic pressure of 55\u201360 mmHg, right and left atrial dilatation, mild concentric left ventricular hypertrophy, and a left ventricular ejection fraction of 50%. The right ventricle was severely dilated and dysfunctional. There was moderate tricuspid regurgitation (max. velocity 303 cm/sec) with an estimated right ventricular systolic pressure (RVSP) of 55\u201360 mmHg. Pulse-wave tissue Doppler imaging (TDI) of the anterior and posterior mitral annulus showed abnormal left ventricle relaxation. The patient was discharged on continuous positive airway pressure (CPAP) and oxygen at night, and as needed during the day.", "summary": "Patient: Male, 53\n\nFinal Diagnosis: Right ventricular dysfunction secondary to obesity hypoventilation syndrome\n\nSymptoms: Shortness of breath\n\nMedication: \u2014\n\nClinical Procedure: Echocardiogram (TTE)\n\nSpecialty: Cardiology\n\nA 53-year-old man, who was morbidly obese with a BMI of 75 kg/m2, presented with shortness of breath (SOB) and hypercapnia. He had never smoked but had a history of severe OSA and hypertension. On examination, the patient was obese with normal lung auscultation and mild pitting edema of the lower extremities. A spiral computed tomography (CT) angiogram showed no evidence of pulmonary embolism or interstitial lung disease. Pulmonary function testing showed no obstructive airway disease and a normal diffusion capacity. Two-dimensional transthoracic echocardiogram (TTE) showed normal left ventricular function and a dilated right ventricle (RV) with a flattened septal wall, moderate tricuspid regurgitation, and an estimated right ventricular systolic pressure of 55\u201360 mmHg. The patient was discharged on continuous positive airway pressure (CPAP) and oxygen at night, and as needed during the day.", "subclaim_evaluations": [ { "subclaim": "The patient is a 53-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is morbidly obese with a BMI of 75 kg/m2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypercapnia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of severe obstructive sleep apnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "On examination, the patient was obese.", "support_label": "supported", "is_refined": false }, { "subclaim": "A spiral CT angiogram showed no evidence of pulmonary embolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "A spiral CT angiogram showed no evidence of interstitial lung disease.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Pulmonary function testing showed no obstructive airway disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pulmonary function testing showed a normal diffusion capacity.", "support_label": "supported", "is_refined": false }, { "subclaim": "A transthoracic echocardiogram showed a dilated right ventricle.", "support_label": "supported", "is_refined": false }, { "subclaim": "A transthoracic echocardiogram showed a flattened septal wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "A transthoracic echocardiogram showed moderate tricuspid regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The estimated right ventricular systolic pressure was 55\u201360 mmHg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final diagnosis was right ventricular dysfunction secondary to obesity hypoventilation syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged on continuous positive airway pressure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged on oxygen at night.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_5_en.txt", "fulltext": "A 24-year-old Sundanese primigravid woman was referred from a peripheral hospital at 38 weeks of gestation due to her deteriorating condition. She presented initially for 5 days of high grade fever, retro-orbital pain, and a blood examination which revealed thrombocytopenia, elevated liver enzymes, and a positive immunoglobulin M (IgM) and immunoglobulin G (IgG) dengue serology. She was diagnosed as having dengue fever in pregnancy and treated with fluid administered intravenously and antipyretics. However, her condition started to worsen on day five of hospitalization with repeated bouts of vomiting and she became lethargic. Her weight was 45 kg and her antenatal history did not reveal hypertension, pre-eclampsia, coagulation abnormalities, or epilepsy.\nDuring her transport, she received 10 liters of oxygen by non-rebreathing mask and had experienced two episodes of generalized tonic\u2013clonic seizure, each lasting less than 1 minute which terminated with 10 mg diazepam administered intravenously. On admission to our ICU, she was responsive only to pain with a blood pressure of 92/76 mmHg, heart rate 124/minute, respiratory rate 30/minute, body temperature 36.6 \u00b0C, and oxygen saturation of 95%. A physical examination revealed diffuse rales on both lungs with cold and clammy extremities. Her chest X-ray revealed marked bronchovascular marking on her left and right basal lung regions . Arterial blood gas analysis revealed an acute metabolic alkalosis: pH 7.510, partial pressure of oxygen in arterial blood (PaO2) 166 mmHg, partial pressure of carbon dioxide in arterial blood (PaCO2) 41.3 mmHg, bicarbonate (HCO3\n-) 33.0 mmol/L, and base excess (BE) 9.3 mmol/L. An initial diagnosis of dengue encephalitis, and dengue shock syndrome with acute pulmonary edema was made.\nShe was immediately intubated and placed on mechanical ventilation using adaptive support ventilation mode with the following settings: minute ventilation of 4.5 L, positive end-expiratory pressure (PEEP) 5 cmH2O, and fraction of inspired oxygen (FiO2) of 50% and received continuous sedation under morphine and midazolam infusion. During anesthesia induction, her blood pressure dropped to 60/40 mmHg and a fluid bolus of 300 mL normal saline was given to which she responded. Arterial blood gas analyses taken 2 hours post-intubation with a FiO2 0.7 were as follows: pH 7.475, PaO2 159.1 mmHg, PaCO2 32.1 mmHg, HCO3\n- 24.2 mmol/L and BE 1.1 mmol/L. Another important event included traumatic gum bleeding from biting during her seizure episode which took 1 hour to attain hemostasis, and insertion of a nasogastric tube which yielded 100 mL of dark brown fluid.\nOn day 1, hematologic results revealed hemoglobin (Hgb) of 11.7 g/dL (normal range, N, 11.70 to 15.50 g/dL), hematocrit (Hct) of 36.80% (N, 35.00 to 47.00), and white cell count (WBC) of 10,430/mm3 (N, 3600 to 11,000/ mm3) with 53% neutrophil predominance and 35% lymphocytes. Her platelet (Plt) count was 25,000/uL (N, 150,000 to 440,000), prothrombin time (PT) 10.40 seconds (N, 9.4 to 11.3) with an international normalized ratio (INR) of 1.00, activated partial thromboplastin time (aPTT) of 48.70 (N, 31 to 45 seconds), and a slightly elevated D-dimer of 1.91 ng/mL (N, 0.00 to 0.30). Her bilirubin levels were normal, she had an alanine aminotransferase (ALT) level of 116 U/L (N, 0 to 55), aspartate transaminase (AST) of 359 U/L (N, 5 to 34), urea of 49.0 mg/dL (N, <50), creatinine of 0.85 mg/dL (N, 0.5 to 1.1), lactic acid of 4.7 mmol/L (N, <0.6 to 2.2) and procalcitonin of 0.25 ng/mL (N, <0.15). Her urine was tinted red and complete analysis revealed the presence of slight proteinuria (100 mg/dL) and occult blood (200 cells/uL). Cardiotocography (CTG) monitoring revealed a fetal heart rate of 177 beats per minute (bpm) with no uterine contractions.\nOn day 2, a routine CTG monitoring revealed fetal distress which prompted an emergency cesarean section. She received 500 mL fresh frozen plasma (FFP) before being rushed for cesarean section under general anesthesia. Intraoperative bleeding was 500 mL, an intra-abdominal drain was placed and she received 460 mL of packed red cell (PRC), intraoperatively. A 2.1 kg baby girl was delivered with an appearance, pulse, grimace, activity and respiration (APGAR) score of 4/7. The baby was intubated and transferred to our neonatal ICU (NICU) due to hypoventilation. Our patient was transferred back to ICU and fundal height was noted at the level of umbilicus with good contractions.\nOn day 3, blood clots were seen oozing from her vagina and a vaginal exploration evacuated 200 mL of blood. The intra-abdominal drain collected 50 mL/24 hours of hemoserous fluid and hematologic results revealed Hgb 5.9 g/dL, Hct 18.20%, and Plt 141,000/uL. Upon this substantial drop, 680 mL of PRC, 210 mL of FFP, and 2 units of thrombocyte concentrate apheresis (TCA) were given. Her vital parameters were stable and she remained sedated. A follow-up chest radiography revealed improved clearance of vascular markings on both lung fields confirmed by vesicular lung sounds and a normal acid-base balance with a PaO2/FiO2 of 600 .\nOn day 4, a follow up hematologic examination revealed Hgb 6.96 g/dL, Hct 20.16%, WBC 10,660/mm3, Plt 98,630/uL, albumin 2.63 g/dL, fibrinogen 140 mg/dL (N, 300 to 600), PT 10.90 seconds, and a prolonged aPTT of 56.90 seconds. The intra-abdominal drain collected 450 mL/24 hours of hemoserous fluid and her lower abdomen was noted to be slightly distended. Thereafter, another 230 mL of PRC, 240 mL of FFP, and 2 units of thrombocyte concentrate (TC) was transfused.\nOn day 5, 3 days post-cesarean section, our patient became tachycardic with a blood pressure of 80/60 mmHg, which prompted the use of norepinephrine at 0.08 \u03bcg/kg/minute. Uterine contractions were adequate with normal colored lochia, but her lower abdomen appeared distended as before. The intra-abdominal drain collected 360 mL/24 hours of hemoserous fluid and laboratory results were as follow: Hgb 5.90 g/dL, Hct 17.80%, WBC14,020/mm3, Plt 107,000/uL, and albumin of 2.26 g/dL. She was given 20% albumin infusion, 230 mL of PRC, and 220 mL of FFP.\nOn day 6, she remained tachycardic and her mentation did not improve despite stopping sedation. At this time, her lower abdomen appeared more distended and abdominal guarding was noted upon palpation. The intra-abdominal drain had collected 850 mL/24 hours of hemoserous fluid. An urgent blood workup revealed a drop in Hgb to 4.20 g/dL, Hct 12.50%, WBC 10,160/mm3, Plt 84,000/uL, PT 10.40 seconds, aPTT 49.50 seconds, and a spiked D-dimer level (20.25 ug/mL). An emergent ultrasound revealed free fluid on her lower abdominal region which required her to be rushed for an exploratory laparotomy. The procedure evacuated 2000 mL of blood intra-abdominally, and she received 640 mL of PRC and 500 mL FFP, intraoperatively.\nOn day 7, her hematologic examination revealed Hgb 9.60 g/dL, Hct 28.50%, WBC 8,150/mm3, Plt 67,000/uL, normalized coagulation profile, and a lowered D-dimer level (13.98 ug/mL). One unit of TC was transfused and norepinephrine infusion was tapered down with strict vital sign monitoring. Sedation was stopped and her mentation greatly improved. A follow-up chest radiograph revealed clear lung fields and she was placed on a spontaneous breathing trial which was successful and she was later extubated.\nOn day 8, an additional 230 mL PRC was given and her hematologic examination revealed Hgb 11.50 g/dL, Hct 34.40%, and Plt 83,000/uL. Aside from transfusions and vasopressors, she received meropenem 1 gram every 8 hours, early enteral nutrition of 1000 kcal/24 hours, gastric acid prophylaxis agent, gastric motility agents, and anticonvulsants. She was transferred to our general ward on day 8 and discharged from our hospital on day 11, uneventfully. Her neonate was extubated on day 2 of her NICU stay, after complete recovery from sedative drugs in utero and discharged home at day 5 without any negative sequel .", "summary": "A 24-year-old primigravid Sundanese woman presented to our intensive care unit due to acute pulmonary edema secondary to massive plasma leakage caused by severe dengue. She tested positive for both immunoglobulin G and immunoglobulin M dengue serology indicating she had secondary dengue infection, which placed her at risk for an exaggerated cytokine response as was evident clinically. She had to undergo an emergency cesarean section which was later complicated by rebleeding and hemodynamic instability due to an atypical defervescence period. She was successfully managed by multiple blood transfusions and was discharged from our intensive care unit on day 8 without any negative sequel.", "subclaim_evaluations": [ { "subclaim": "The patient is a 24-year-old primigravid Sundanese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented to the intensive care unit due to acute pulmonary edema.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary edema was secondary to massive plasma leakage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The plasma leakage was caused by severe dengue.", "support_label": "supported", "is_refined": false }, { "subclaim": "She tested positive for immunoglobulin G dengue serology.", "support_label": "supported", "is_refined": false }, { "subclaim": "She tested positive for immunoglobulin M dengue serology.", "support_label": "supported", "is_refined": false }, { "subclaim": "The positive serology indicated a secondary dengue infection.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She had an emergency cesarean section.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cesarean section was complicated by rebleeding.", "support_label": "supported", "is_refined": false }, { "subclaim": "The rebleeding was due to an atypical defervescence period.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She was managed by multiple blood transfusions.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was discharged from the intensive care unit on day 8.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had no negative sequel at discharge.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_357_en.txt", "fulltext": "The patient described is a 28-year-old man with a history of hypertension who initially presented to the ophthalmology department with a 2-year history of progressive, bilateral vision loss. Findings on exam included poor visual acuity, bilateral optic atrophy, reduced foveal threshold, and nonspecific inferior defects. Fundoscopic exam at this time revealed optic disc pallor and a cup-to-disc ratio of 0.3 bilaterally. Given these findings, the patient was subsequently referred to the department of neurology for evaluation of possible MS. Brain MRI revealed T2 FLAIR hyperintense lesions involving the body of the corpus callosum and the periventricular white matter without contrast enhancement, suggestive of demyelinating plaques . CSF testing showed normal protein and cells (0 WBC/mm3, 17 RBC/mm3, 33 mg/dL protein, and 66 mg/dL glucose) along with elevated IgG index and 4 CNS specific oligoclonal bands, strongly increasing the suspicion for MS. MRI of the spine showed no additional lesions. Serological testing for MS mimics was largely unrevealing except for serum copper which was marginally low at 66 ug/dl (normal range 72\u2013166 ug/dl).\nThree months after the diagnosis of MS, the patient presented to an outside hospital with a severe right-sided headache and he was referred to our hospital for further evaluation secondary to imaging demonstrating hydrocephalus and intracranial mass. Of note, the patient had not begun treatment for MS at the time of his hospital admission. At time of presentation, the patient was alert and in no apparent distress. The patient characterized the headache as constant for the past month, and worsened in the week before presentation. He denied any vomiting or nausea and his neurological examination was unremarkable. No upper motor neuron findings or visual field deficits were present at the time of examination. Fundoscopic exam showed no relative afferent pupillary defect. MRI of his brain demonstrated an intraventricular mass located in the posterior third ventricle, obstructive hydrocephalus and worsening of corpus callosum and periventricular T2 hyperintense lesions . An endoscopic third ventriculostomy was successfully performed to treat hydrocephalus and a biopsy was taken of the mass for pathological evaluation.\nTwo small biopsy specimens were submitted for examination. The tumor contained solid sheets of polygonal cells of moderate size and centrally located nuclei. The cytoplasm was pale in some areas [ and ] but was more eosinophilic in other areas. The nuclei were moderately sized and showed a limited variation in size. Prominent nucleoli were noted in many of the tumor cells [Arrow in and ] and were best appreciated in the cytologic preparation obtained during intraoperative consultation. On immunohistochemistry with Ki67, an average labeling index of about 30% was demonstrated. The tumor cells were positive for OCT3/4 , CD117 (c-kit) , placental alkaline phosphatase, cytokeratin AE1/AE3, and cytokeratin 7. The tumor cells were negative for H3 K27M , glial fibrillary acidic protein, Olig2, IDH1-R132H, synaptophysin, Sox10, Melan-A, CD30, thyroid transcription factor 1, and thyroglobulin. The tumor cells were also positive for BAF47 (INI1) indicating no loss of INI1 gene. A diagnosis of germinoma was made based on these characteristics.\nThe patient\u2019s neurologic exam was normal postoperatively and he was discharged home after a 2-day hospital stay. Two months after surgery, the patient was started on carboplatin + etoposide to attempt cytoreduction before radiation therapy to treat intracranial germinoma. Interestingly, brain MRI 4 months after surgery showed resolution of hydrocephalus, periventricular T2 hyperintense changes (thought to possibly be related to trans-ependymal flow initially) and decrease in size of corpus callosum plaques . To rule out paraneoplastic optic neuritis, serum studies were performed and common markers for the disease, anti-CRMP-5, and anti-amphiphysin, were both negative. At the time of this manuscript, the patient had not undergone adjuvant radiation treatment nor started disease modifying treatment for MS as this was held secondary to initial focus on oncologic treatment after discussion among the patient\u2019s treating physicians.", "summary": "A 28-year-old man presented initially with bilateral optic neuritis, manifesting as persistently worsening vision for 2 years, and demyelinating plaques identified within the corpus callosum on magnetic resonance imaging. Initial work-up, in addition to clinical presentation, led to diagnosis of MS. Three months following the diagnosis of MS, the patient then presented with obstructive hydrocephalus due to a newly diagnosed intraventricular mass. The patient underwent an endoscopic third ventriculostomy and biopsy which confirmed diagnosis of CNS germinoma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 28-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had bilateral optic neuritis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The optic neuritis had been persistently worsening for 2 years.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Demyelinating plaques were identified within the corpus callosum on magnetic resonance imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "The initial work-up led to a diagnosis of multiple sclerosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three months after the MS diagnosis, the patient presented with obstructive hydrocephalus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The obstructive hydrocephalus was due to a newly diagnosed intraventricular mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent an endoscopic third ventriculostomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "A biopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The biopsy confirmed the diagnosis of CNS germinoma.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_626_en.txt", "fulltext": "In December 2013, a 58-year-old man with a history of type-2 diabetes mellitus (DM2), systemic arterial hypertension (SAH) and dyslipidemia was referred to our centre, the Hospital de Cl\u00ednicas de Sao Paulo, a large academic and public centre located in Sao Paulo, Brazil, from the primary care service to investigate uncontrolled blood pressure and blood glucose. At initial clinical examination, he presented facial phletora, hirsutism, violaceous striae and centripetal obesity, and a CS clinical diagnosis was suspected. Initial examinations identified hypercortisolism and elevation of ACTH . The ACTH increment in the corticotropin-releasing hormone (CRH) stimulation test was 14%, suggesting an ectopic ACTH-producing tumour. To confirm this hypothesis, the patient underwent an inferior petrosal sinus sampling with CRH stimulation. The central/peripheral ACTH gradient was less than 2 at 0, 3, 5 and 10 min after desmopressin injection, confirming the ectopic ACTH producing. Magnetic resonance image (MRI) of the abdomen showed an expansive lesion in the tail of the pancreas measuring 5.0 cm in the largest diameter, multiple small nodules in hepatic segment III and increased volume of both adrenals . In January 2014, he was referred to our institution, the Instituto do Cancer do Estado de Sao Paulo, where he underwent an R0 body-caudal pancreatectomy, splenectomy and removal of the segment III of the liver, which was compatible with PNET, infiltrating the liver tissue. The final diagnosis was of a well-differentiated PNET, with positive immunohistochemistry staining of synaptophysin and chromogranin A, three mitosis/10 high-power fields and Ki67 index of 6%. There was adequate clinical control of DM2 and SAH after resection. In July 2014, a Gallium-68-DOTATATE PET-CT was performed and did not show any measurable metastatic disease. However, in November 2014, he presented hyperglycaemia and high blood pressure again, associated with elevation of both serum cortisol and ACTH, which were resultant from hepatic recurrence with a new lesion of 1.2 cm in segment VI of the liver. Because the patient was quite sick to undergo new hepatic resection due to uncontrolled CS and also because of the short interval from last metastasectomy, new surgical resection was contraindicated. Octreotide LAR 20 mg IM once every 28 days was started but was unsuccessful in controlling symptoms. Subsequent hepatic embolisation did not improve his condition either. Due to uncontrolled CS in February 2015, bilateral adrenalectomy was performed and the CS finally resolved. The pathology report revealed a metastatic neuroendocrine tumour in the left adrenal, with immunohistochemistry staining positive for synaptophysin, chromogranin A positive and ACTH, negative staining for CD56, CDX2 and TTF1 negative and ki67 index of 30%.\nAfter symptom control, the patient was lost to follow up, returning six months with recurrent hyperglycaemia and skin hyperpigmentation; at that time, the elevation of plasma ACTH was identified. A new MRI of the abdomen showed a progression of hepatic metastases. Octreotide LAR was tried again, but there was disease progression after two doses. In October 2015, he received the combination of oxaliplatin 130 mg/m2 given on day one and capecitabine 1000 mg/m2 (CapOx) orally for 14 days, in a 21-days cycle. At this time, he presented diffuse exuberant hyperpigmented lesions of the skin, mainly in interphalangeal joints and tongue . After two cycles, there was significant improvement in cutaneous hyperpigmentation and the patient was restaged with new CT scans that showed stable disease. Despite good tolerance, the patient requested to stop chemotherapy and he went on chemoholiday. In March 2016, after three months without treatment, the hyperpigmented lesions of the skin worsened and imaging tests evidenced new progression of liver disease. Re-exposure to CapOx was indicated. He received three more cycles, when in in April/2016, CT scans demonstrated partial response in liver lesions. The patient chose to pause the chemotherapy once again. At the last image evaluation, in June 2017, the tumour has remained stabilised and three has been no further worsening of skin hyperpigmentation.", "summary": "A 58-year-old man with a history of type-2 diabetes mellitus and arterial hypertension was diagnosed with Cushing's syndrome (CS) secondary to an ACTH ectopic production from a well-differentiated neuroendocrine tumour of the pancreas metastatic to the liver. The patient underwent initial body-caudal pancreatectomy, splenectomy and hepatic nodulectomy with subsequent recurrence. Hepatic embolisation and somatostatin analogues were used to control CS but without success. Bilateral adrenalectomy led to CS control, while capecitabine and oxaliplatin (CAPOX) was effective in controlling tumour growth and ACTH production.", "subclaim_evaluations": [ { "subclaim": "The patient is a 58-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of type-2 diabetes mellitus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of arterial hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with Cushing's syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Cushing's syndrome was secondary to an ACTH ectopic production.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ACTH ectopic production was from a well-differentiated neuroendocrine tumour of the pancreas.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumour was metastatic to the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent body-caudal pancreatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent splenectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent hepatic nodulectomy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumour recurred after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hepatic embolisation was used to control Cushing's syndrome.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Somatostatin analogues were used to control Cushing's syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hepatic embolisation and somatostatin analogues were without success.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilateral adrenalectomy led to Cushing's syndrome control.", "support_label": "supported", "is_refined": false }, { "subclaim": "Capecitabine and oxaliplatin (CAPOX) was effective in controlling tumour growth.", "support_label": "supported", "is_refined": false }, { "subclaim": "Capecitabine and oxaliplatin (CAPOX) was effective in controlling ACTH production.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2501_en.txt", "fulltext": "A 76-year-old woman presented at our department with an abdominal pulsatile mass. She had hypertension (nifedipine 20 mg, candesartan 4 mg, indapamide 0.5 mg), dyslipidemia, congestive heart failure, and complete atrioventricular block. She had previously undergone an operation that included endovascular aneurysm repair and prophylactic accessory renal artery coil embolization for advanced uterine cancer. Enhanced computed tomography (CT) imaging revealed an abdominal aortic aneurysm (AAA) with a maximum diameter of 53 \u00d7 57 mm and a right ARA (4 mm in diameter) . Since open repair was considered risky due to her coexisting diseases, we decided to perform EVAR despite the presence of ARA.\nUnder general anesthesia, bilateral transfemoral access was obtained via surgical cutdown, and 7Fr short sheaths were placed in both common femoral arteries. Prior to EVAR, the ARA was selectively catheterized with a 6Fr RDC guiding catheter and a 5Fr RDC catheter, and embolization was performed with two 0.018-in coils (Interlock, Boston Scientific, Marlborough, MA, USA). After coiling, the main body of the stentgraft (Aorfix\u2122, Lombard Medical, Oxfordshire, UK) was deployed with its proximal end just below the renal arteries, and bilateral common iliac arteries were used as distal landing zones. We completed the procedures having seen no perfusion defect of the inferior pole of the right kidney from the right renal artery on completion angiography .\nThe postoperative course was uneventful, and the patient was discharged 7 days later. Postoperative eGFR (58.4 ml/min) was not significantly different from preoperative (56.7 ml/min). After surgery, blood pressure was under control, and no additional blood pressure medicines were required. Postoperative enhanced CT showed that there was no endoleak. The distal portion of her right ARA from coils including the right kidney was well perfused .", "summary": "A 76-year-old woman was admitted to our hospital after noticing an abdominal pulsatile mass. Computed tomography (CT) imaging revealed an abdominal aortic aneurysm (AAA) with a maximum diameter of 53\u00a0mm. Preoperative CT scan showed a right ARA, 4\u00a0mm in diameter, which was considered likely to lead to type II endoleak following EVAR. ARA coil embolization was performed at the time of EVAR. We observed no endoleaks and no infarct of the inferior pole of the right kidney on completion angiography. The postoperative course was uneventful, and the patient was discharged 7\u00a0days later. Postoperative eGFR (58.4\u00a0ml/min) was not significantly different from preoperative level (56.7\u00a0ml/min). After EVAR, blood pressure was under control, and no additional anti-hypertensive medicines were required. Postoperative enhanced CT image showed that the distal portion of the ARA was well perfused without type II endoleak from ARA.", "subclaim_evaluations": [ { "subclaim": "The patient was a 76-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted after noticing an abdominal pulsatile mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography imaging revealed an abdominal aortic aneurysm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The maximum diameter of the aneurysm was 53 mm.", "support_label": "supported", "is_refined": false }, { "subclaim": "A right accessory renal artery was identified on preoperative CT.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right accessory renal artery was 4 mm in diameter.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right accessory renal artery was considered likely to lead to type II endoleak following EVAR.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent EVAR.", "support_label": "supported", "is_refined": false }, { "subclaim": "ARA coil embolization was performed at the time of EVAR.", "support_label": "supported", "is_refined": false }, { "subclaim": "No endoleaks were observed on completion angiography.", "support_label": "supported", "is_refined": false }, { "subclaim": "No infarct of the inferior pole of the right kidney was observed on completion angiography.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative course was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged 7 days after the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative eGFR was 58.4 ml/min.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative eGFR was 56.7 ml/min.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative eGFR was not significantly different from preoperative eGFR.", "support_label": "supported", "is_refined": false }, { "subclaim": "Blood pressure was under control after EVAR.", "support_label": "supported", "is_refined": false }, { "subclaim": "No additional anti-hypertensive medicines were required after EVAR.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative enhanced CT showed the distal portion of the ARA was well perfused.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative enhanced CT showed no type II endoleak from the ARA.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_697_en.txt", "fulltext": "Our patient was a 43-year-old man with a weight of 93 kg and height of 174 cm. He had been undergoing hemodialysis for 20 years because of chronic renal failure. He had been taking cinacalcet, calcium carbonate, montelukast, loratadine, and nalfurafine before the surgery. There were no preoperative symptoms of suspected pheochromocytoma and no history of hypertension. His blood pressure was 140/82 mmHg, heart rate 76 beats/min, body temperature 36.2 \u00b0C, and normal respiratory rhythm with an O2 saturation of 96% on room air. Blood tests demonstrated BUN of 60.2 mg/dL and creatinine of 13.3 mg/dL, but coagulability, liver function, and electrolytes were normal.\nA close examination of hematuria revealed a tumor in the right renal pelvis, and retroperitoneal total right nephroureterectomy was scheduled. The tumor in the right adrenal gland was followed up because there was no clear malignant finding on CT. On the day before surgery, 5100 mL of body fluid was removed by hemodialysis. Propofol and remifentanil were used for the induction and maintenance of anesthesia. After tracheal intubation, periodic systolic blood pressure fluctuations within the range of 70\u2013260 mmHg, diastolic blood pressure fluctuations within the range of 40\u201390 mmHg, and heart rate of 80\u2013110 beats/min were observed at intervals of approximately 8 min . Intermittent and continuous administration of nicardipine was not effective for suppressing the fluctuation, which lasted for approximately 3 h and disappeared spontaneously after completion of laparoscopic surgery. Intermittent and continuous administration of nicardipine was performed because of this circulatory fluctuation; however, it could not be suppressed. Periodic blood pressure fluctuations disappeared spontaneously at the end of laparoscopic surgery. Blood samples were collected during the cycle of circulatory fluctuations. The catecholamine levels of the blood samples were as follows: first blood pressure fluctuation: adrenaline 3.22 ng/mL, noradrenaline 1.98 ng/mL, and dopamine 0.02 ng/mL; second blood pressure fluctuation: adrenaline 6.32 ng/mL, noradrenaline 3.12 ng/mL, and dopamine 0.02 ng/mL; and at the end of blood pressure fluctuation: adrenaline 0.36 ng/mL, noradrenaline 0.47 ng/mL, and dopamine 0.02 ng/mL. A postoperative examination revealed that the highest blood catecholamine levels were adrenaline, with 0.03 ng/mL (normal value: 0\u20130.10 ng/mL); noradrenaline, with 0.52 ng/mL (normal value: 0.10\u20130.50 ng/mL); and dopamine, with 0.03 ng/mL (normal value: 0\u20130.03 ng/ml). In addition, scintigraphy identified an increased uptake of 131iodine-metaiodobenzylguanidine corresponding to the left adrenal gland, suggesting pheochromocytoma . After the diagnosis of pheochromocytoma, oral treatment with doxazosin 2 mg/day was administered, and left adrenalectomy was performed 4 months after the initial surgery.\nBefore surgery, his blood pressure was 170/92 mmHg, heart rate 80 beats/min, body temperature 36.5 \u00b0C, and normal respiratory rhythm with an O2 saturation of 96% on room air. Blood tests demonstrated Hb of 10.4 g/dL, BUN of 46.9 mg/dL, and creatinine of 11.6 mg/dL, but coagulability, liver function, and electrolytes were normal. Echocardiography showed left ventricular hypertrophy and mild left ventricular wall hypokinesis. On the day before surgery, 4300 mL of body fluid was removed by hemodialysis. Pheochromocytoma resection was performed under general anesthesia with propofol and remifentanil. As with the initial surgery, periodic circulation fluctuations occurred after tracheal intubation at the time of anesthesia induction, but the fluctuations were approximately 10 min apart, and the degree of fluctuation was smaller than that of the first surgery. Intermittent and continuous administration of nicardipine and landiolol was performed for circulatory fluctuation; however, once again, the fluctuations could not be suppressed. Dopamine was administered to maintain circulation after tumor removal. The periodic fluctuations disappeared after the ligation of the left adrenal artery and did not occur thereafter. The intraoperative course of the second surgery is shown in Fig. .", "summary": "A 43-year-old man presented with periodic blood pressure fluctuations during surgery for a renal pelvic tumor. His blood levels of catecholamines (ng/mL) changed dramatically over a short time during blood pressure fluctuations: adrenaline 0.36 to 3.22, noradrenaline 0.47 to 1.98, and dopamine 0.02. After the diagnosis of pheochromocytoma, oral treatment with doxazosin 2\u00a0mg/day was administered, and left adrenalectomy was performed 4\u00a0months after the initial surgery. Periodic circulation fluctuations occurred after tracheal intubation at the time of anesthesia induction, but the degree of fluctuation was smaller than that of the first surgery.", "subclaim_evaluations": [ { "subclaim": "The patient is a 43-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had surgery for a renal pelvic tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had periodic blood pressure fluctuations during surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "His blood levels of catecholamines changed dramatically during blood pressure fluctuations.", "support_label": "supported", "is_refined": false }, { "subclaim": "Adrenaline levels ranged from 0.36 to 3.22 ng/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "Noradrenaline levels ranged from 0.47 to 1.98 ng/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dopamine levels were 0.02 ng/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was pheochromocytoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oral doxazosin 2 mg/day was administered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Left adrenalectomy was performed 4 months after the initial surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Periodic circulation fluctuations occurred after tracheal intubation at the time of anesthesia induction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The degree of fluctuation was smaller than that of the first surgery.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_73_en.txt", "fulltext": "A 48-year-old man was admitted to Jinhua People's Hospital on June 29, 2021 due to change in stool habit for 5 d.\nHis symptoms started 5 d previously and were accompanied by a change in stool habit (yellow, thin, pasty stools 3-5 times a day, without mucus and blood). No significant change in body weight was noted.\nThe patient had a history of surgery for hypofractionated adenocarcinoma of the stomach 6 mo ago. According to the World Health Organization (WHO) Classification of Digestive System Tumor, hypofractionated adenocarcinoma is defined as the cancer cells are short columnar or indefinite, arranged in small nests or strands, and basically without glandular tube structure.\nThe patient had no relevant personal and family history.\nOn examination, his abdomen was soft, old surgical scars were visible in the upper abdomen, and no pressure pain, rebound pain, or masses were found.\nLaboratory examinationsshowed that routine blood, urine, stool, liver and kidney function, carcinoembryonic antigen, alpha-fetoprotein and carbohydrate antigen 199 were all within the normal range.\nThe patient was advised to undergo abdominal enhanced computed tomography (CT) and colonoscopy, and the results of colonoscopy on July 1, 2021 suggested a submucosal bulge approximately 1.0 cm \u00d7 1.0 cm in the rectum 8 cm from the anal verge, with red surface erosion . Narrow band imaging (NBI) and magnification colonoscopy showed uneven caliber and distribution of blood vessels. Type2B was considered according to JNET staging .", "summary": "We describe a case of rectal adenoma with submucosal pseudoinvasion in a 48-year-old man. The patient was admitted to Jinhua People's Hospital due to a change in stool habit for 5 d. We performed colonoscopy, and the results suggested a submucosal bulge approximately 1.0 cm \u00d7 1.0 cm in size in the rectum 8 cm from the anal verge, with red surface erosion. Ultrasound colonoscopy was also performed and a homogeneous hypoechoic mass about 0.52 cm \u00d7 0.72 cm in size was seen at the lesion, protruding into the lumen with clear borders and invading the submucosa. Endoscopic surgery was then performed and the pathological specimen showed a tubular adenoma with high-grade intraepithelial neoplasia (intramucosal carcinoma) involving the adenolymphatic complex. In addition, we performed a literature review of rectal tubular adenoma with submucosal pseudoinvasion to obtain a deeper understanding of this disease.", "subclaim_evaluations": [ { "subclaim": "The patient was a 48-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a change in stool habit for 5 days.", "support_label": "supported", "is_refined": false }, { "subclaim": "Colonoscopy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A submucosal bulge approximately 1.0 cm \u00d7 1.0 cm in size was found in the rectum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The submucosal bulge was 8 cm from the anal verge.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion had red surface erosion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound colonoscopy showed a homogeneous hypoechoic mass about 0.52 cm \u00d7 0.72 cm in size.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The mass protruded into the lumen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass had clear borders.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass invaded the submucosa.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endoscopic surgery was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The pathological specimen showed a tubular adenoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tubular adenoma had high-grade intraepithelial neoplasia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The high-grade intraepithelial neoplasia was classified as intramucosal carcinoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The intramucosal carcinoma involved the adenolymphatic complex.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A literature review of rectal tubular adenoma with submucosal pseudoinvasion was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_322_en.txt", "fulltext": "A 50 year-old Caucasian American man with history of chronic obstructive pulmonary disease was admitted for loss of consciousness. He was found on the floor by his son, who brought him to the emergency department. The son denied noticing any tongue bite or bowel or bladder incontinence. The patient was unresponsive on arrival to the emergency department.\nThe patient's home medications included albuterol inhaler as needed. He was smoking two packs of cigarettes daily, but the son denied history of alcohol or illicit drug intake. His vitals on presentation were: BP - 90/50 mmHg, HR - 116/min, RR - 28/min and Temp - 98.8\u00b0F, and he was saturating 92 percent on 2L oxygen via nasal cannula.\nHis physical examination was significant for unresponsiveness, crackles in his left lung base and scattered wheezes throughout the lungs. His lab work showed a high WBC of 26,400/L, with 72.5% neutrophils and 13.5% bands, potassium of 5.3 mEq/L, BUN of 15 mg/dL and creatinine of 1.9 mg/dL (his baseline creatinine was 1.1 mg/dL). Urine toxicology screen was positive for opioid. Other labs included elevated creatine kinase of 15,860 U/L and elevated myoglobin of 46,651 ng/ml. Urine was positive for pneumococcal antigen. CT scan of the head without contrast was normal. Chest x-ray showed an infiltrate in the left mid lung field.\nThe patient was admitted with a diagnosis of chronic obstructive pulmonary disease exacerbation secondary to pneumonia, fall with loss of consciousness secondary to severe sepsis, opioid abuse and acute renal failure secondary to rhabdomyolysis. He was started on intravenous steroids, antibiotics and bronchodilators. He was given intravenous fluid for his rhabdomyolysis and hypotension. Despite aggressive treatment of rhabdomyolysis his creatine kinase increased from 15,000 U/L on the day of admission to 45,000 U/L on day two and 80,000 U/L on day three. His serum creatinine level increased from 1.9 mg/dL on admission to 2.3 mg/dL on day two and 2.6 mg/dL on day three.\nOn day three, the patient became slightly responsive and started complaining of pain in his right hip. On inspection, the patient's right hip was swollen, and it was very firm and tender on palpation .\nCT scan of pelvis was done which demonstrated fullness of the right gluteal muscles secondary to edema or inflammation or compartment syndrome .\nAn MRI of the pelvis was recommended for further evaluation which showed enlargement of right gluteus minimus and medius muscles secondary to edema or hemorrhage with compartment syndrome . Gluteal compartment pressure was not checked as there seemed to be enough evidence from physical examination and rising serum creatinine and creatine kinase levels, that the patient's worsening rhabdomyolysis was secondary to the gluteal compartment syndrome.\nThe patient was taken to the operating room where he underwent multiple fasciotomies. A large area of clot was noted between gluteus maximus and medius which was evacuated and the area was irrigated. The patient's creatine kinase and serum creatinine level improved to normal on discharge to home, five days after the surgical procedure. On follow-up visit to the office, two weeks after the patient's discharge, he was doing fine with normalization of his renal function and absence of gait abnormality, sensory dysfunction or muscle weakness.", "summary": "A 50-year-old Caucasian American man with history of chronic obstructive pulmonary disease was admitted status post fall and loss of consciousness for an unknown duration. Initial work-up revealed severe rhabdomyolysis, opioid abuse and acute renal failure. Inspite of three days of intensive therapy his condition did not improve and his renal failure worsened. On improvement of his condition three days later, he indicated some discomfort in his right hip. Physical examination was significant for swelling of the right gluteal region, which was tender and firm on palpation. A non-contrast CT scan showed evidence of gluteal compartment syndrome and emergent surgery resulted in significant improvement of his condition.", "subclaim_evaluations": [ { "subclaim": "The patient is a 50-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is Caucasian American.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of chronic obstructive pulmonary disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted after a fall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a loss of consciousness of unknown duration.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial work-up revealed severe rhabdomyolysis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial work-up revealed opioid abuse.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial work-up revealed acute renal failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "After three days of intensive therapy, his condition did not improve.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "His renal failure worsened.", "support_label": "supported", "is_refined": false }, { "subclaim": "On improvement of his condition three days later, he indicated some discomfort in his right hip.", "support_label": "supported", "is_refined": false }, { "subclaim": "Physical examination showed swelling of the right gluteal region.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right gluteal region was tender on palpation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right gluteal region was firm on palpation.", "support_label": "supported", "is_refined": false }, { "subclaim": "A non-contrast CT scan showed evidence of gluteal compartment syndrome.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Emergent surgery resulted in significant improvement of his condition.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_606_en.txt", "fulltext": "A 56-year-old man presented to our department with headache, vomiting, and gait disturbance (for 1 month). He had a past medical history of hepatitis type B virus infection and hepatic failure. He had been medically treated for hypertension and hepatitis for the previous 4 years. On admission, he had an impaired consciousness [Glasgow coma scale (GCS), 14]. Cerebellar ataxia and gait disturbance were evident. Diffusion weighted imaging (DWI) demonstrated multiple cerebellar infarctions at several intensities with perilesional edema of the left cerebellar hemisphere . Brain magnetic resonance imaging (MRI) did not reveal any prominent meningeal gadolinium enhancement or nodule . MR angiography revealed no abnormal findings. The main venous sinuses were confirmed to be patent by 3-dimensional reconstructions of MRI with gadolinium . Chest X-ray did not reveal any abnormal lesions, and the results of serum examination for infectious diseases, including human immunodeficiency virus (HIV), were negative except for hepatitis B virus surface antigen.\nSubsequently, the patient was diagnosed with subacute cerebellar infarction due to arteriosclerosis and was administered glycerol to control the intracranial pressure; however, 1 week after admission, his GCS decreased to 11. Computed tomography confirmed worsened cerebellar edema and hydrocephalus. External and internal decompression surgery were performed to control the intracranial pressure . A section of the swollen cerebellar hemisphere was removed and submitted as a surgical specimen. Additionally, external continuous ventricular drainage was performed to control hydrocephalus. Lumbar puncture to collect cerebral spinal fluid (CSF) was not performed until this time because of the risk of cerebral herniation. CSF from continuous ventricular drainage demonstrated mild inflammation (cell count, 36 /mm3; protein, 16 mg/dl; glucose, 113 mg/dl). C. neoformans was detected in CSF as well as in the surgical specimen of the cerebellum.\nHistopathologic examination of the surgical specimen revealed strong hyperplasia of the arachnoid mater . Fungi were mainly localized in the subarachnoid space and rarely in the parenchyma . Lymphocytes and multinucleated giant cells forming granulomata invaded the arachnoid and subarachnoid spaces and pia with heavy fibrosis . Small arteries were occasionally observed to be occluded with internal endothelial proliferation. While there were arteries in the sample, veins were rarely observed in the subarachnoid space . In addition, venules in the parenchyma were frequently observed to be congested. The patient was diagnosed with granulomatous meningitis due to C. neoformans and was immediately treated using liposomal amphotericin B and fluconazole; however, the ischemic lesion of the cerebellum continued to bilaterally worsen along with worsening perilesional edema . The patient\u2019s course subsequently deteriorated. He developed renal failure and ultimately died 25 days after admission.\nAutopsy confirmed that the pathological changes were confined to the central nervous system and predominantly localized at the surface of the cerebellar hemisphere. Fungal bodies were widely spread along the surface and bilaterally into the deep sulcus of the cerebellum . Few fungi were observed in the supratentorial and intraparenchymal lesions. The lesion in the arachnoid mater of the cerebellum was roughly the same as that in the surgical specimen although it was more deeply spread into the peripheral sulcus and the granulomatous inflammation was not as severe .", "summary": "A 56-year-old man who suffered from dizziness and gait disturbance for one month was admitted to our hospital and subsequently diagnosed with a cerebellar infarction. He had a past medical history of hepatitis type B virus infection and hepatic failure. Although the findings on magnetic resonance imaging (MRI) imitated an arterial infarction of the posterior inferior cerebellar artery, an accompanying irregular peripheral edema was observed. The ischemic lesion progressed, subsequently exerting a mass effect and leading to impaired consciousness. External and internal decompression surgeries were performed. Cryptococcus neoformans was confirmed in the surgical specimen, and the patient was diagnosed with CM. In addition, venule congestion in the parenchyma was observed with extensive fibrosis and compressed veins in the subarachnoid space. The patient died 26\u00a0days after admission. Autopsy revealed that pathological changes were localized in the cerebellum.", "subclaim_evaluations": [ { "subclaim": "The patient was a 56-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had dizziness and gait disturbance for one month.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was admitted to the hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was diagnosed with a cerebellar infarction.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a past medical history of hepatitis type B virus infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a past medical history of hepatic failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI findings imitated an arterial infarction of the posterior inferior cerebellar artery.", "support_label": "supported", "is_refined": false }, { "subclaim": "An irregular peripheral edema was observed.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The ischemic lesion progressed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion exerted a mass effect.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass effect led to impaired consciousness.", "support_label": "supported", "is_refined": false }, { "subclaim": "External and internal decompression surgeries were performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cryptococcus neoformans was confirmed in the surgical specimen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with CM.", "support_label": "supported", "is_refined": false }, { "subclaim": "Venule congestion in the parenchyma was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Extensive fibrosis was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Compressed veins in the subarachnoid space were observed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient died 26 days after admission.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Autopsy revealed that pathological changes were localized in the cerebellum.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2071_en.txt", "fulltext": "A 51-year-old man inadvertently noticed a cervical mass that had been growing rapidly for 1 month. On May 26, 2020, the patient went to the outpatient department of Fudan University Shanghai Cancer Center. He had no dyspnea and was in good clinical condition with an Eastern Cooperative Oncology Group performance status score of 0. However, he complained of pain on touching the mass. Therefore, cervical ultrasound (US) and thyroid computed tomography (CT) were performed in May 2020. Imaging results showed calcified masses on both the lobes and isthmus of the thyroid, suggesting the possibility of thyroid carcinoma. The trachea was shifted to the right and invasion of the internal jugular vein and common carotid artery was observed . Additionally, thyroid CT revealed multiple enlarged cervical nodes at levels II, III, and IV on the left side, each measuring approximately 20 mm. Core needle biopsy (CNB) of the prevailing thyroid nodule confirmed the diagnosis of ATC . Our center performs either immunohistochemistry and/or next-generation sequencing (88-gene somatic mutation analysis panel) as a standard of care for molecular testing of the tumor. NGS revealed three mutations: NRAS c.182A > T (variant allele frequency [VAF] 4.0%), TP53 c.742C > T (VAF 4.9%), and TERT C228T (VAF 3.5%). It was showed in immunohistochemically stained slides that tumor cells were positive for AE1/AE3, CK19, PAX8, P53 (70%), Ki67 (80%), TTF-1, HBME-1 . The cells were negative for thyroglobulin, desmin, and p63. Physical examination revealed a hard nodule sized 2\u20133 cm in the thyroid region and the trachea was displaced to the right. Abdominal US, brain CT, and chest CT detected no additional metastases. The patient was diagnosed with ATC (cT4bN1bM0, IVB according to the American Joint Committee on Cancer [AJCC] Cancer Staging Manual, 8th Edition) and the tumor was considered unresectable.\nIn June 2020, the patient was recruited for a clinical trial that combined multiple-target kinase inhibitors and anti-PD-1 antibodies in patients with advanced thyroid cancer (NCT04521348). He was administered three cycles of famitinib (20 mg/qd) and camrelizumab (200 mg/q3w). The patient exhibited a good clinical status, but suffered from famitinib-induced grade 3 hypertension, which was controlled with nifedipine and valsartan. Famitinib was discontinued for 3 days during the second cycle.\nAfter three cycles of treatment, CT showed partial response (PR) of the lesion according to the Response Evaluation Criteria in Solid Tumors (version 1.1) . The invaded internal jugular and common carotid arteries were separated. A multidisciplinary team for head and neck cancer offered the patient two main therapeutic options: surgical intervention or medical therapy. After discussion with the patient and his family members, the patient consented to total thyroidectomy and radical neck dissection, followed by radiotherapy.\nTotal thyroidectomy with removal of lymph node group VI and left radical neck dissection (groups II, III, IV, and V) were performed in July 2020. Postoperative pathological examination identified a 35-mm (maximum diameter) lesion in the left thyroid lobe and some poorly differentiated tumor nests with degeneration. Necrosis, desmoplasia, calcification, chronic inflammatory infiltration, and foamy histiocyte aggregates were found in the surrounding areas. Cholesterol crystals were observed occasionally, which was consistent with the changes observed after treatment . A 12-mm (maximum diameter) lesion in the right thyroid lobe was diagnosed as papillary thyroid cancer. Necrosis, chronic inflammatory cell infiltration, foam cell aggregation, cholesterol crystals, and multinucleated giant cell reaction were observed in the anterior cervical mass, which was consistent with the changes after treatment. No definite residual carcinomas were observed. None of the 33 neck lymph nodes involved in neck dissection showed signs of metastatic carcinoma. Thus, the diagnosis of ATC was confirmed (ypT2N0M0, IVA according to AJCC Cancer Staging Manual, 8th Edition).\nPostoperative therapy included L-thyroxine (125 \u03bcg/d). Positron emission tomography CT showed no masses in the thyroid or neck lymph nodes and no distant metastasis. By August 2020, the patient had recovered well and received intensity-modulated radiation therapy (IMRT) with a dose of 60 Gy (in 30 fractions) to the thyroid bed and cervical nodal regions and 54 Gy to the mediastinal nodes . Following radiation therapy, camrelizumab (200 mg/q3w) was administered for maintenance for 11 cycles. CT was performed to assess the response to camrelizumab in January 2021 .\nSurveys of patient-reported outcomes were obtained approximately 24 months after the diagnosis. They showed a very good quality of life, including continuation of normal activities such as jogging.", "summary": "In our phase II study, patients having advanced/metastatic solid ATCs were treated with famitinib and camrelizumab, a combination therapy involving a multi-targeted kinase inhibitor and an anti-PD-1 antibody. We report a case of a patient with locally advanced unresectable ATC who underwent this combination therapy, allowing us to perform complete surgical resection followed by post-operative radiation therapy.", "subclaim_evaluations": [ { "subclaim": "The study was a phase II trial.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The study involved patients with advanced/metastatic solid ATCs.", "support_label": "supported", "is_refined": false }, { "subclaim": "Patients were treated with famitinib.", "support_label": "supported", "is_refined": false }, { "subclaim": "Patients were treated with camrelizumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "Famitinib is a multi-targeted kinase inhibitor.", "support_label": "supported", "is_refined": false }, { "subclaim": "Camrelizumab is an anti-PD-1 antibody.", "support_label": "supported", "is_refined": false }, { "subclaim": "The therapy combination included famitinib and camrelizumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "A case of a patient with locally advanced unresectable ATC was reported.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent combination therapy with famitinib and camrelizumab.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had complete surgical resection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received post-operative radiation therapy.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_12_en.txt", "fulltext": "A 15-year-old boy presented to our University Hospital, a tertiary care neurology facility, with fever, headache, and altered sensorium of 12-day duration. At admission, he was febrile (101 \u00b0F), with a pulse rate of 110/min and a blood pressure recording of 114/74 mmHg; his Glasgow Coma Scale score was 10 (E3M4V3). There were no petechiae or signs of bleeding over the skin or any mucosal surface. There was no focal neurological deficit and neurological examination was normal, including (absence of) signs of meningeal irritation. Laboratory evaluation revealed the following estimations: hemoglobin of 11 g/dl, total leukocyte count of 3300 cells/mm3, and platelet count of 22,000 cells/mm3 which dropped to 8000 cells/mm3 on next day. His aspartate aminotransferase level was 155 U/L, alanine aminotransferase was 140 U/L and alkaline phosphatase was 56 U/L. Additional biochemical parameters, renal function tests, blood sugar, electrolytes, and arterial blood gas analysis, were normal. Malarial parasite was not detected in the peripheral blood smear. The cerebrospinal fluid examination, cytological and biochemical, was normal. IgM antibody against dengue virus was positive both in serum and cerebrospinal fluid; meanwhile, dengue NS1 antigen was negative. Electroencephalography revealed generalized slowing. On magnetic resonance imaging of the brain, signal changes were seen in bilateral parietooccipital and left frontal region (left hemisphere was more involved than the right hemisphere). There were diffuse subcortical white matter changes along with suggestion of hemorrhage on gradient echo sequence. Subtle hyperintensity on T2 W images was also noted in bilateral basal ganglia. Gadolinium-contrast study revealed a gyriform enhancement suggestive of cortical laminar necrosis . He was managed conservatively and given platelet transfusion. The patient responded well to management and became fully conscious in 7 days.", "summary": "A 15-year boy presented with fever, the headache and altered sensorium of 12-day duration. On neurological examination, his Glasgow Coma Scale score was 10 (E3M4V3). There was no focal neurological deficit. Laboratory evaluation revealed leukopenia and marked thrombocytopenia. Dengue virus IgM antibody was positive both in serum and cerebrospinal fluid. Magnetic resonance imaging of the brain revealed signal changes in bilateral parietooccipital and left frontal regions (left hemisphere more involved than the right hemisphere). There was gyriform enhancement bilateral parietooccipital regions consistent with cortical laminar necrosis. Bilaterally diffuse subcortical white matter was also involved and subtle T2 hyperintensity involving both basal ganglia was noted. Gradient echo sequence revealed presence of hemorrhage in the subcortical white matter. Patient was treated conservatively and received platelet transfusion. Patient became fully conscious after 7\u00a0days.", "subclaim_evaluations": [ { "subclaim": "The patient is a 15-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had fever, headache, and altered sensorium for 12 days.", "support_label": "supported", "is_refined": false }, { "subclaim": "On neurological examination, his Glasgow Coma Scale score was 10.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no focal neurological deficit.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory evaluation showed leukopenia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laboratory evaluation showed marked thrombocytopenia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dengue virus IgM antibody was positive in serum.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dengue virus IgM antibody was positive in cerebrospinal fluid.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed signal changes in bilateral parietooccipital and left frontal regions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The left hemisphere was more involved than the right hemisphere.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was gyriform enhancement in bilateral parietooccipital regions.", "support_label": "supported", "is_refined": false }, { "subclaim": "The enhancement was consistent with cortical laminar necrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bilaterally diffuse subcortical white matter was involved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Subtle T2 hyperintensity was noted in both basal ganglia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Gradient echo sequence showed hemorrhage in subcortical white matter.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received platelet transfusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient became fully conscious after 7 days.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_959_en.txt", "fulltext": "We reported a case of a 46 years old woman admitted to our hospital because of prolonged recurrent vomiting in a severe state of malnutrition. A year before she had been submitted to duodenopancreatectomy because of a stenotic duodenal adenocarcinoma. Immediately, after hospital admission she underwent to a new explorative laparotomy because of worsening symptoms. In this second abdominal surgery she underwent to gastric enteric anastomosis because of sub-occlusion.\nHer ability to absorb substances was already compromised by the first operation. During the last year she did not received an adequate nutrition, moreover she had no vitamins supplement in her diet. After the second surgery she was fed by total parenteral nutrition with glucose solutions, amino-acids solutions and vitamins complex (Cernevit \u2013 Baxter@ spa, Roma, Italy) commonly administered to post-surgical patients containing 3,51 mg of thiamine.\nAfter five days from the gastric enteric anastomosis, she developed a Pseudomonas Aeruginosa\u2019s severe sepsis with acute renal failure; so, she was transferred to our Intensive Care Unit (ICU). At ICU admission, she was agitated but she still had a normal Glasgow Coma Scale (GCS 15/15). Brain Computed Tomography (CT) scan control was negative and altered neurological status of the patient was imputed to the severe sepsis. Her blood tests showed leucopenia (1680/ml) and thrombocytopenia (34000/\u03bcl).\nWe performed an electroencephalogram (EEG) control that evidenced slow diffused anomalies, without paroxysms or focal signs. During the night she was sedated with benzodiazepines and intubated because of respiratory worsening.\nThe following day, at the neurological examination she was drowsy, she had no response to pain stimuli, no oculocephalic reflex, limbs areflexia and negative Babinski reflex. A new EEG control pointed out a diffused cerebral suffering state. Simultaneously her renal and liver function got worse due to the evolution of the septic state. Her feeding was still composed by glucose solutions, vitamins (Cernevit \u2013 Baxter@ spa, Roma, Italy) and amino acid intravenously administered. Then, we decided to perform a new brain CT scan with contrast in order to diagnose the cause of the worsening. This CT scan was performed at day 7 after surgery. The report of the CT scan showed a faded hyperdensity of the mammillary bodies and symmetrical hemorrhagic lesions in the quadrigeminal plate . The report suggested the need of a further diagnostic study with MRI because of the suspicion of a possible metabolic encephalopathy compatible with WE complicated by petechial hemorrhages.After the CT scan, we introduced thiamine 100 mg intravenously once a day, as supplement to the usual feeding. At the following neurological examination her GCS was 7/15, she did not open her eyes, did not emit verbal responses and localized with the right arm to painful stimuli. So 2 days later, we performed a brain magnetic resonance imaging (MRI). The MRI confirmed the lesions described in the CT scan and also added some elements compatible with WE: hyperintensity lesions in T-2 weighted images in the hypothalamus, medial thalamus, periaqueductal grey matter, anatomical regions of the mammillary bodies and superior cerebellar peduncles. , Mammillary bodies and optic tracts were difficult to assess due to a sub acute blood clot occupying the lower anterior portion of the third ventricle. The study was concluded with the MRI angiography to exclude a malformation of the vessels that had been able to generate the bleeding. Anyway, MRI angiography 3D-TOF was negative for vascular malformations. All these radiological findings were consistent with the diagnosis of WE. In the meantime, patients developed septic shock due to multi-resistant drug Enterococcus Faecium with severe low platelets count needing a mean of 20 Units of platelets transfused per day to maintain a serum level greater than 30000/\u03bcl.\nNo neurosurgical indications were given for the hemorrhagic brain lesions. So, we increased thiamine dosage up to 250 mg intravenously three times per day. This therapy was prolonged for one week, and after 4 days of high-dose thiamine supplementation neurological status of the patient had a significant improvement despite severe septic shock, she was able to open her eyes spontaneously and she performed simple commands.\nNevertheless, septic shock worsened and thrombocytopenia became refractory to platelets transfusions, hemodynamic instability became unresponsive to vasopressors and liver hypoperfusion worsened. Despite severe efforts used to control septic shock and thrombocytopenia, she died on the 21st day after surgery because of massive cerebral bleeding and unresponsive cerebral edema. The macroscopic autopsy of the brain was not nullifying because intracerebral hemorrhage and severe cerebral edema led to colliquation the typical areas of the Wernicke\u2019s disease.", "summary": "We reported a case of a 46 years old woman who underwent, one year before, to cephalic duodenopancreatectomy complicated with prolonged recurrent vomiting. She underwent to a second surgical operation for intestinal sub-occlusion and postoperatively she developed septic shock and hemorrhagic Wernicke's disease. After ICU admission, because of neurological deterioration, she underwent CT scan and MRI that highlighted a strong suspicion for Wernicke's disease. We treated her with an initially wrong low dose of thiamine, then after MRI we increased the dosage with a neurological status improvement. Despite therapeutic efforts used to control septic shock and thrombocytopenia, she died on the 21st day after surgery because of massive cerebral bleeding and unresponsive cerebral edema.", "subclaim_evaluations": [ { "subclaim": "The patient was a 46-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had undergone a cephalic duodenopancreatectomy one year before.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cephalic duodenopancreatectomy was complicated by prolonged recurrent vomiting.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent a second surgical operation for intestinal sub-occlusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "After the second operation, she developed septic shock.", "support_label": "supported", "is_refined": false }, { "subclaim": "After the second operation, she developed hemorrhagic Wernicke's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was admitted to the ICU due to neurological deterioration.", "support_label": "supported", "is_refined": false }, { "subclaim": "A CT scan and MRI were performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The CT scan and MRI showed a strong suspicion for Wernicke's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was initially treated with a low dose of thiamine.", "support_label": "supported", "is_refined": false }, { "subclaim": "After the MRI, the thiamine dosage was increased.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neurological status improved after increasing the thiamine dosage.", "support_label": "supported", "is_refined": false }, { "subclaim": "She died on the 21st day after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cause of death was massive cerebral bleeding.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cause of death was unresponsive cerebral edema.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2123_en.txt", "fulltext": "A 76 year old \u2018never smoker\u2019 female with no past medical history was diagnosed with locally advanced NSCLC during investigations for a community-acquired lower respiratory tract infection. The Medical Research Council (MRC) Dyspnoea Score was 3 and there was a dry cough. Computed tomography (CT) of the chest demonstrated a 4.5 cm (anterior-posterior) \u00d7 4.1 cm (craniocaudal) left lung upper lobe mass with abutment of the mediastinal pleura and distal atelectasis and pneumonitis .\nAn 8 mm ipsilateral lymph node was visible at station 10. Multiple sub-centimetre lung nodules were noted throughout the right lung. Histological and immunohistochemical assessment of core biopsies from the primary lesion via bronchoscopy favoured the adenocarcinoma subtype of NSCLC (see Table ). The molecular analysis revealed ALK fusion protein overexpression along with ALK rearrangement. This result is in keeping with an ALK rearranged adenocarcinoma. The main lesion had an SUVmax of 16 on 18fluorodeoxyglucose positron emission topography-CT (PET-CT) imaging and no other lesions were avid. Following a review of the imaging at the multidisciplinary meeting (MDM), staging was offered at T2 N0 M0 (TNM 8 ), and in light of the patient\u2019s fitness, radical treatment was recommended.\nDuring the assessment period for a primary lobectomy, the patient developed symptomatic atrial fibrillation. She underwent a successful direct current (DC) cardioversion and was discharged on edoxaban. Three weeks later the patient was noted to be in atrial fibrillation once more during an inpatient admission for the management of chest sepsis, for which she was discharged on digoxin. She was electively admitted to the Cardiology ward 6 weeks later for a second DC cardioversion procedure. Under conscious sedation, the patient received one synchronised shock of 120 J delivered via anterior-posterior paddles ie one placed at the left parasternal edge, one at the corresponding position on the patient\u2019s back. One week post-procedure the patient attended the Emergency Department complaining of dysarthria and left-sided hemiparesis. CT and magnetic resonance imaging (MRI) of the brain confirmed the presence of a dense right-sided middle cerebral artery territory infarction (see Fig. ). The patient was in sinus rhythm, transthoracic echocardiography was unremarkable and mild bilateral carotid atheroma only was noted on ultrasonography (< 50% stenosis), suggestive for a stroke secondary to a delayed cardiogenic embolus related to atrial fibrillation, despite anticoagulation.\nFive days later, haemorrhagic transformation of the stoke was detected on MRI following clinical deterioration. A 3.5 cm intracerebral haematoma was identified within the right basal ganglia, causing effacement of the right lateral ventricle frontal horn, which was managed conservatively. The clinical condition stabilised and both her speech and weakness improved with rehabilitation from the department of Stroke Medicine.\nAs the patient\u2019s ECOG PS recovered to 2 and her breathlessness resolved, work-up for radical treatment resumed, given her ongoing determination to gain control over the cancer. Updated cross-sectional imaging demonstrated complete regression of the left upper lobe lesion and a reduction of the previously documented mediastinal lymph node. Remaining atelectasis had a maximum standard uptake value (SUVmax) 2.7 on repeat PET-CT imaging (8 months since first PET). A review of the patient\u2019s medications was undertaken searching for possible effects on FDG uptake, which was negative. The merits and risks of radical radiotherapy versus active surveillance were explored with the patient who elected to proceed with the latter.\nClinical review after 6 months of active surveillance, dry cough and mild dyspnoea were reported by the patient. Corresponding with the imaging findings, thoracic imaging with CT showed increased patchy parenchymal changes at the site of the previous left upper lobe lesion without associated hilar or mediastinal lymphadenopathy. Repeat PET-CT imaging demonstrated increased uptake (SUVmax 10.2) in a sub-pleural 4 cm mass in keeping with local relapse (see Fig. ), and no additional sites of disease.\nAs the pulmonary function tests (FEV1 90% predicted; TLCO 80% predicted) were favourable and physical fitness had stabilised (ECOG PS 2) the patient was consented for a course of radical thoracic radiotherapy without chemotherapy. She completed 55 Gy in 20 fractions planned with the intensity modulated radiotherapy technique and delivered as 6 MV arc therapy, with daily online cone beam-CT image guidance, treating Monday to Friday for 4 weeks . Target volumes were subject to peer review . Tumour shrinkage was noted during routine offline imaging review.\nThere were no acute toxicities during routine clinical assessments on treatment, or at 6 weeks post-radiotherapy. On clinical review 4 months after treatment completion the patient was more frail and had continued respiratory symptoms. Around this time, the first radiological follow-up scan demonstrated radiation pneumonitis focally in left upper lobe. At 1 year the patient returned to ECOG PS 1 and the imaging demonstrated stable disease locally and no evidence of distant relapse. At 18 months post-radiotherapy there was radiologic progression in the lungs with new pulmonary nodules and effusion and new bone metastases correlating with new symptoms of dyspnoea, cough and back pain. Owing to poor performance status, she was not considered fit for systemic therapy including ALK-targeted therapy and was managed with multi-disciplinary best supportive care until her death 5 months later.", "summary": "A 76\u2009year old 'never smoker' female with an ALK-rearranged left upper lobe T2 N0 NSCLC experienced a stroke following elective DC cardioversion for new atrial fibrillation. Following a good recovery, updated imaging demonstrated complete regression of the left upper lobe lesion and a reduction of the previously documented mediastinal lymph node. Remaining atelectasis was non-avid on repeat PET-CT imaging, 8\u2009months from the baseline PET-CT. When the patient developed new symptoms 6\u2009months later a further PET-CT demonstrated FDG-avid local recurrence. She completed 55\u2009Gy in 20 fractions but at 18\u2009months post-radiotherapy there was radiological progression in the lungs with new pulmonary metastases and effusion and new bone metastases. Owing to poor performance status, she was not considered fit for targeted therapy and died 5\u2009months later.", "subclaim_evaluations": [ { "subclaim": "The patient is a 76-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is a 'never smoker'.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has an ALK-rearranged left upper lobe T2 N0 NSCLC.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient experienced a stroke.", "support_label": "supported", "is_refined": false }, { "subclaim": "The stroke occurred following elective DC cardioversion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cardioversion was for new atrial fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Updated imaging demonstrated complete regression of the left upper lobe lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The previously documented mediastinal lymph node was reduced.", "support_label": "supported", "is_refined": false }, { "subclaim": "Remaining atelectasis was non-avid on repeat PET-CT imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "The repeat PET-CT was 8 months from the baseline PET-CT.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed new symptoms 6 months later.", "support_label": "supported", "is_refined": false }, { "subclaim": "A further PET-CT demonstrated FDG-avid local recurrence.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient completed 55 Gy in 20 fractions.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 18 months post-radiotherapy, there was radiological progression in the lungs.", "support_label": "supported", "is_refined": false }, { "subclaim": "New pulmonary metastases were present.", "support_label": "supported", "is_refined": false }, { "subclaim": "A new effusion was present.", "support_label": "supported", "is_refined": false }, { "subclaim": "New bone metastases were present.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was not considered fit for targeted therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died 5 months after the radiological progression.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_822_en.txt", "fulltext": "A 69-year-old woman presented with pericardial discomfort and was subsequently diagnosed with advanced gastric cancer after upper gastrointestinal endoscopy. The patient underwent laparoscopic distal gastrectomy with D2 lymph node dissection, and the final pathological diagnosis was U, Less, Type 2, 46 \u00d7 38 mm, adenocarcinoma with enteroblastic differentiation, pT4a, INFa, Ly0, V0, pPM0, pDM0, pN2, and pStageIIIA (Japanese Classification of Gastric Carcinoma) . Human epidermal growth factor type 2 was negative, combined positive score of programmed cell death ligand 1 was 5 or higher and microsatellite instability was negative. The patient received oral S-1 (80 mg/m2 twice a day for 1\u201328 days) as postoperative adjuvant chemotherapy, but liver metastases were observed 8 months later in segments 4 (41 \u00d7 39 mm) and 8 (24 \u00d7 22 mm). The location and number of metastases were confirmed by contrast-enhanced computed tomography (CT), magnetic resonance imaging (MRI) and positron emission tomography (PET)\u2013CT. There was no elevation observed in the tumor markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9). The patient was switched to weekly paclitaxel plus ramucirumab, but Grade 4 neutropenia was observed during the first cycle, and nivolumab monotherapy was initiated (3 mg/kg intravenously every 2 weeks) after consultation with the patient .\nAfter eight cycles, the target lesion of liver metastasis achieved a PR by Response Evaluation Criteria in Solid Tumors (RECIST), and nivolumab treatment was continued. After 18 cycles, liver metastases had shrunk to 24 \u00d7 22 mm in segment 4 and 11 \u00d7 9 mm in segment 8, and PET\u2013CT showed no abnormal fluorodeoxyglucose (FDG) accumulation in liver metastases, and no new metastases appeared. CEA and CA19-9 did not show any significant changes within the normal range during the course of treatment. However, at this point, the patient developed a Grade 3 immune-related adverse event (irAE), a pemphigoid skin disorder, and the nivolumab treatment was discontinued.\nAs the metastases were controllable with anticancer agents, no new lesions appeared, and the patient\u2019s performance status was maintained, it was decided to resect the liver metastases. The patient underwent laparoscopic partial hepatectomy for segments 4 and 8, resulting in pathological CR . After a medication withdrawal period due to the surgery, the skin disorder had resolved, and postoperative chemotherapy with nivolumab was resumed. However, due to a recurrence of the skin disorder, the chemotherapy was immediately stopped. The patient was followed up without treatment, and no recurrence findings were observed for 25 months postoperatively.", "summary": "A 69-year-old female presented with pericardial discomfort and was diagnosed with advanced gastric cancer following upper gastrointestinal endoscopy. Laparoscopic distal gastrectomy with D2 lymph node dissection was performed, resulting in a final pathological diagnosis of Stage IIIA. The patient received postoperative adjuvant chemotherapy with oral S-1 therapy, but was found to have multiple liver metastases at 8\u00a0months postsurgery. Weekly paclitaxel and ramucirumab therapy was initiated, but the patient experienced adverse side effects, leading to the discontinuation of treatment. Nivolumab monotherapy was then administered for 18 cycles, resulting in a partial therapeutic response and PET-CT revealed a complete metabolic response. However, the patient developed a Grade 3 pemphigoid as an immune-related adverse event, leading to the cessation of nivolumab. The patient underwent laparoscopic partial hepatectomy. Postoperative pathology showed no residual tumor cells, indicating a complete response. At present, 25\u00a0months after surgery, the patient was alive without recurrence.", "subclaim_evaluations": [ { "subclaim": "The patient is a 69-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with pericardial discomfort.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with advanced gastric cancer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made following upper gastrointestinal endoscopy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laparoscopic distal gastrectomy with D2 lymph node dissection was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final pathological diagnosis was Stage IIIA.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received postoperative adjuvant chemotherapy with oral S-1 therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Multiple liver metastases were found at 8 months postsurgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Weekly paclitaxel and ramucirumab therapy was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient experienced adverse side effects.", "support_label": "supported", "is_refined": false }, { "subclaim": "Treatment with paclitaxel and ramucirumab was discontinued.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nivolumab monotherapy was administered for 18 cycles.", "support_label": "supported", "is_refined": false }, { "subclaim": "A partial therapeutic response was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "PET-CT revealed a complete metabolic response.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed a Grade 3 pemphigoid as an immune-related adverse event.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nivolumab was discontinued.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent laparoscopic partial hepatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative pathology showed no residual tumor cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a complete response.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was alive without recurrence 25 months after surgery.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1659_en.txt", "fulltext": "A 30 year old primagravid woman at 17 weeks gestation was found on routine prenatal ultrasound to have a complex right ovarian mass. She underwent surgery and was found to have a ruptured appendiceal mucinous neoplasm with a large volume pseudomyxoma peritonei syndrome. The right ovary and appendix were removed and an omental biopsy was performed. The final pathology confirmed a well-differentiated mucinous adenocarcinoma of appendiceal origin. She recovered without incident from this surgery and was referred for assessment to the Washington Hospital Center at 26 weeks gestation. In consultation with the patient and her obstetrician it was decided to preserve the pregnancy and schedule an early vaginal delivery at 35 weeks gestation.\nFollowing an uncomplicated vaginal delivery of a healthy baby, she underwent a staging CT. It showed no evidence of metastases within the liver parenchyma or outside of the peritoneal cavity. A large volume of mucinous cancer was imaged beneath right and left hemidiaphragm and in the pelvis. Small bowel except for the terminal ileum was spared. Preoperative tumor markers revealed an elevated CEA at 68.2 ng/mL (normal 0\u20135 ng/mL), CA-125 of 177 units/mL (normal 0\u201335 units/mL) and CA 19-9 of 361 units/mL (normal 0\u201337 units/mL).\nAt 2 1/2 weeks after delivery, the patient underwent an abdominal exploration followed by cytoreductive surgery. She had thick, densely packed tumor covering most of the parietal peritoneal surface, with an especially large volume of disease in the lesser omentum, omental bursa and surrounding the porta hepatis. The stomach and the small bowel except for the terminal ileum were spared. An extensive cytoreduction surgery was performed including total anterior parietal peritonectomy and resection of tumor in the abdominal wall scar, greater and lesser omentectomy with stripping of the omental bursa, right and left upper quadrant peritonectomies including total diaphragm stripping bilaterally, splenectomy, electroevaporation of tumor on liver capsule, cholecystectomy, and a right hemicolectomy including the distal 15 cm of terminal ileum. A total pelvic peritonectomy with abdominal hysterectomy, left salpingo-oophorectomy and rectosigmoid colon resection was performed. The peritoneal cancer index score was 28 (out of a maximum of 39), and the cytoreduction was scored as complete (residual tumor less than 2.5 mm) . Intraoperative intraperitoneal heated chemotherapy was administered through the open coliseum technique, with 15 mg/m2 mitomycin C at 41.5\u00b0C for 90 minutes. A Tenckhoff catheter and Jackson-Pratt drains were inserted for early postoperative intraperitoneal 5-fluorouracil chemotherapy . Following completion of the hyperthermic intraoperative intraperitoneal chemotherapy an ileocolic and colorectal anastomosis was performed. The total operating time was 9 hours, and the blood loss was estimated at 350 mL, with 2 units of packed red blood cells and 4 units of fresh frozen plasma administered during the operation.\nOn postoperative day 1 through 5, 900 mg intraperitoneal 5-fluorouracil in 1.5% dextrose peritoneal dialysis solution was administered daily for 23 hours. The patient developed uncomplicated neutropenia on postoperative day 16, with neutrophil count of 0.9 \u00d7 103/uL and a total leukocyte count of 1.3 \u00d7 103/uL, which was treated successfully with granulocyte colony stimulating factor. On postoperative day 18 she was diagnosed with a left lower extremity deep venous thrombosis and was treated with intravenous heparin which was converted to warfarin prior to discharge from the hospital. She had a postoperative ileus requiring nasogastric drainage for 2 weeks and received total parenteral nutrition during this time. She was discharged in good condition on postoperative day 24.\nThree weeks following surgery her tumor marker levels decreased with CEA at 0.5 ng/mL, CA 125 at 92.1 units/mL, and CA 19-9 at 10.6 units/mL. CA 125 normalized by 2 months post-operatively.\nAfter recovery from surgery, she was treated with the Xelox regimen (Xeloda 1000 mg/m2 bid for 14 days then 7 day rest and oxaliplatin 130 mg/m2 intravenous over 90 minutes on day 1) for 8 cycles over 24 weeks.\nIn follow-up at five years after, the patient and her child are in good condition. She has had two episodes of transient small bowel obstruction treated conservatively. On her most recent clinical, radiologic and biochemical assessment at 5 years after her initial diagnosis she remains disease-free.", "summary": "The medical history of a 30 year old woman diagnosed at 17 weeks gestation with an appendiceal mucinous tumor with large volume pseudomyxoma peritonei was presented. Her pregnancy was preserved and she had an early vaginal delivery of a healthy baby at 35 weeks. At 2 1/2 weeks postpartum the patient underwent extensive cytoreductive surgery and intraperitoneal chemotherapy. She remains disease-free 5 years after her initial diagnosis. A literature review of this clinical situation and a discussion of treatment plans were presented.", "subclaim_evaluations": [ { "subclaim": "The patient is a 30 year old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed at 17 weeks gestation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was an appendiceal mucinous tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had large volume pseudomyxoma peritonei.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her pregnancy was preserved.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had an early vaginal delivery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The delivery occurred at 35 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The baby was healthy.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 2 1/2 weeks postpartum, she underwent extensive cytoreductive surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "She received intraperitoneal chemotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "She remains disease-free 5 years after her initial diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "A literature review of this clinical situation was presented.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A discussion of treatment plans was presented.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2476_en.txt", "fulltext": "A 28-year-old mestizo man with a 3-year history of inflammatory arthritis and dry mouth and eyes was admitted to our hospital. He was admitted to our hospital at the request of an external consultant in January 2008; the initial laboratory evaluation is listed in Table . Methotrexate was initiated with good response; 1 year later methotrexate was changed to leflunomide because of liver toxicity. Globulin levels at admission and 1 year after were 5.2 and 7.2g/dL, respectively. Of interest, although he also had positive anti-double-stranded deoxyribonucleic acid (DNA) and anti-nucleosomes antibodies, which normally have a higher specificity for the diagnosis of SLE, at admission we could not make a diagnosis because of the absence of clinical manifestations other than arthritis and sicca.\nHyperemia and mild eye pain appeared in March 2009, and a diffuse scleritis was diagnosed. Therefore leflunomide was suspended and he received prednisone (1mg/kg), tapered to 5mg/day in 1 month and suspended after another month because a mouth ulcer appeared.\nMultiple important mucosal bleeding episodes (epistaxis and gingival hemorrhage) started in 2009, and coagulation tests were conducted through 2010, with the following results: prothrombin time, international normalized ratio and activated partial thromboplastin times were normal (11/10.4 seconds; 1.2; 31.1/26.9 seconds, respectively), VWF activity was observed with low ristocetin cofactor (RCo) at 33.6UI/dL, high VWF antigen (VWF:Ag) >200UI/dL, and a low VWF:RCo to VWF:Ag ratio. Furthermore, an Ivy bleeding time test of more than 15 minutes and normal factor VIII activity (70UI/dL) were observed. An in vitro test showed that the patient\u2019s IgG inhibited the VWF:RCo of normal plasma, therefore the RCo activity inhibition test was positive, although this was not necessary for the diagnosis. A characteristic aVWD laboratory test with the identification of a causal underlying disease, integrated the diagnosis .\nThe patient was admitted to the ER in April 2011 with a 24-hour evolution of progressive dyspnea, cough, thoracic pain, and palpitations, 104beats/minute, 60/40mmHg, temperature of 38\u00b0C, pulse oximetric saturation 88% and 30 breaths/minute. Cold, pale and mottled skin was also observed; laboratory values at ER admission are listed in Table . There were no signs of arthritis or bleeding. Initial crystalloid reanimation was made with partial response, and persistent tachypnea and hypoxemia (arterial oxygen tension/fraction of inspired oxygen = 245.7) precluded a rapid intubation sequence. He was then transferred to the intensive care unit (ICU) 12 hours later. Initial laboratory ER patient data are listed in Table ; Acute Physiology and Chronic Health Evaluation II and Sequential Organ Failure Assessment values at ICU admission were 11 and 27 points respectively.\nAn electrocardiogram showed an incomplete right bundle block not previously detected. A chest X-ray revealed no infiltrates, and complementary laboratory tests did not suggest a related infection. The placement of a pulmonary artery catheter (PAC) was made under the indication of a differentiation between cardiogenic and non-cardiogenic shock (see Table ). The initial patterns showed a precapillary pulmonary hypertension; therefore, in the autoimmune context of the patient, although serial negative antiphospholipid antibodies were noted in his history, acute pulmonary embolism was the first choice for diagnosis. Pulmonary angiography was conducted, and when no clot was discovered, PAH associated with connective tissue disease was considered because pulmonary hypertension has been historically associated with connective tissue diseases.\nThese PAC parameters were the same as observed by Condliffe et al. and Murata et al. except for the pulmonary vascular resistance index, which was greater in our patient in comparison to the Condliffe et al. cases (715 versus 1525 dyne\u00b7second/(cm5\u00b7m2)). Because connective tissue disease may cause PAH because of the vasculature pathology, the difference in more severe resistance may be explained by the changes in the rheological properties (1 poise (P) = 1g\u00b7(second\u00b7cm)-1 = 1dyne\u00b7second/cm2) present in the HVS, where a decrease in the blood flow can explain the resistance increase. Laboratory blood samples hinted about the thickness of blood, so viscosity was measured and found to be 65.8cP (<1.9cP).\nLymphadenopathy and organomegaly were ruled out. A bone marrow biopsy did not show clonality of plasma cells. Serum protein electrophoresis confirmed the presence of a massive polyclonal hypergammaglobulinemia, and no paraproteinemia or monoclonal cell population was found from the electrophoretic pattern of the patient\u2019s plasma. Hypergammaglobulinemia was the cause of HVS associated with autoantibodies. Three sessions of plasma exchange therapy were made. Albumin and frozen fresh plasma were used as the expander, and one circulating blood volume was utilized. Significant mental, hemodynamic recovery and clinical outcomes became evident. A negative Q value was observed in the HVS in this patient after taking into account the Starling vascular permeability formula, where the microvasculature is influenced by protein content and transcapillary fluid flux, specifically, where Q is equal to volume of flow across the capillary wall. This finding led to the conclusion that dilution of protein content may alleviate the HVS, and the fluid administration was considered supportive therapy with judicious consideration of the compartment shift of the solutions. His renal function returned to basal state and he was extubated on day 7 of ICU admission. He was then discharged from the ICU and hospital, respectively with good prognosis (Charlson comorbidity index of 0 points).\nThe patient now attends external consult without respiratory symptoms. One month after hospital discharge his arthritis returned and methotrexate was resumed with good clinical response. Hydroxychloroquine with steroids were initiated because of persistent elevated anti-double stranded DNA (last value at February 2013, 20.2U/mL), no bleeding sign had been present with persistent positive VWF:Ag values.", "summary": "A 28-year-old mestizo man with a 3-year history of inflammatory arthritis was admitted to our hospital. An overlap of rheumatoid arthritis with systemic lupus erythematosus was suspected; therefore methotrexate was initiated, and later changed to leflunomide because of liver toxicity. Prothrombin time, international normalized ratio and activated partial thromboplastin times were normal (11/10.4 seconds; 1.2; 31.1/26.9 seconds, respectively), von Willebrand factor activity was observed with low ristocetin cofactor at 33.6UI/dL, high von Willebrand factor antigen >200UI/dL, and a low von Willebrand factor: ristocetin cofactor to von Willebrand factor antigen ratio. He was admitted to the emergency room with a 24-hour evolution of progressive dyspnea, cough, thoracic pain, and palpitations, 104 beats/min, 60/40 mmHg, temperature of 38\u00b0C, pulse oximetric saturation 88% and 30 breaths/minute. Cold, pale and mottled skin was also observed. He was then transferred to the intensive care unit. The placement of a pulmonary artery catheter was made. The initial patterns showed a precapillary pulmonary hypertension; acute pulmonary embolism was the first choice for diagnosis. Pulmonary angiography was conducted, and when no clot was discovered, pulmonary artery hypertension associated with connective tissue disease was considered. Serum protein electrophoresis confirmed the presence of a massive polyclonal hypergammaglobulinemia, and no paraproteinemia or monoclonal cell population was found from the electrophoretic pattern of the patient's plasma. Hypergammaglobulinemia was the cause of hyperviscosity syndrome associated with autoantibodies. Three sessions of plasma exchange therapy were made, and clinical improvement was observed. He was then discharged from the intensive care unit and hospital, respectively. He is now attended by an external consult and has no respiratory symptomatology.", "subclaim_evaluations": [ { "subclaim": "The patient is a 28-year-old mestizo man.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has a 3-year history of inflammatory arthritis.", "support_label": "supported", "is_refined": false }, { "subclaim": "An overlap of rheumatoid arthritis with systemic lupus erythematosus was suspected.", "support_label": "supported", "is_refined": false }, { "subclaim": "Methotrexate was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Methotrexate was later changed to leflunomide.", "support_label": "supported", "is_refined": false }, { "subclaim": "The change was due to liver toxicity.", "support_label": "supported", "is_refined": false }, { "subclaim": "Prothrombin time was 11 seconds.", "support_label": "supported", "is_refined": false }, { "subclaim": "International normalized ratio was 1.2.", "support_label": "supported", "is_refined": false }, { "subclaim": "Activated partial thromboplastin time was 31.1 seconds.", "support_label": "supported", "is_refined": false }, { "subclaim": "Von Willebrand factor activity was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ristocetin cofactor was 33.6UI/dL.", "support_label": "supported", "is_refined": false }, { "subclaim": "Von Willebrand factor antigen was greater than 200UI/dL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to the emergency room.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had progressive dyspnea.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a 24-hour evolution of symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a temperature of 38\u00b0C.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pulse oximetric saturation was 88%.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had cold, pale, and mottled skin.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was transferred to the intensive care unit.", "support_label": "supported", "is_refined": false }, { "subclaim": "A pulmonary artery catheter was placed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Initial patterns showed precapillary pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Acute pulmonary embolism was the first choice for diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pulmonary angiography was conducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "No clot was discovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pulmonary artery hypertension associated with connective tissue disease was considered.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum protein electrophoresis confirmed massive polyclonal hypergammaglobulinemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "No paraproteinemia was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "No monoclonal cell population was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hypergammaglobulinemia was the cause of hyperviscosity syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three sessions of plasma exchange therapy were made.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical improvement was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was discharged from the intensive care unit.", "support_label": "supported", "is_refined": false }, { "subclaim": "He was discharged from the hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "He is now attended by an external consult.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has no respiratory symptomatology.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_75_en.txt", "fulltext": "A 63-year-old male presented to the First Hospital of Jilin University with a 2-month history of a cervical mass. He had no history of neoplasms and no family history of tumors. Blood tests showed slightly increased thyroid stimulating hormone levels (56 \u03bcIU/mL) and decreased T3 (2.4 pmol/L) and T4 (10 pmol/L) levels. His antithyroglobulin antibody levels were within the normal range. Computed tomography imaging showed a mass, approximately 4.5 \u00d7 4.0 \u00d7 4.5 cm in size, with calcification in the left thyroid lobe and two smooth and homogeneous nodules in the right thyroid lobe. The trachea was compressed and deflected toward the left side . The patient underwent total thyroidectomy with cervical lymph node resection. Neck MRI showed that the epicenter of the left lobe mass was in the thyroid gland and that it did not originate from the surrounding thyroid cartilage .\nMacroscopic examination of the resected specimen revealed a lobulated mass with calcification that occupied the majority of the left thyroid lobe and two homogeneous, oval nodules in the right thyroid lobe .\nHistopathologically, the majority of the tumor in the left thyroid lobe comprised low-grade hyaline-type cartilage, and some spindle cells were observed around the hyaline cartilage . In some areas, the tumor infiltrated the remaining thyroid tissue . A high-grade spindle cell sarcoma could be seen in some areas , in which the high-grade sarcoma cells exhibited extensive pleomorphism, atypia, and a high mitotic rate . One of the two nodules in the right thyroid lobe had a gray-white appearance, and it comprised a prominently collagenous stroma and some bland spindle cells infiltrating the surrounding thyroid tissue . The other nodule had a brown appearance; it was completely enclosed within a thin, fibrous capsule and exhibited normofollicular and microfollicular architecture . We carefully examined all hematoxylin and eosin\u2013stained sections; however, we did not observe any definite necrosis.\nTable shows the summary of immunohistochemical findings. The spindle tumor cells in both thyroid lobes were positive for vimentin but negative for cytokeratin and epithelial membrane antigen. These spindle cells showed high expression of Ki-67 . The low-grade hyaline-type cartilage in the left thyroid tumor was positive for vimentin . The positive rate of expression of vimentin in both the thyroid tumors was 90%. The positive rate of expression of Ki-67 in the spindle cells of the left thyroid tumor was 50%. The positive rate of expression of Ki-67 in the spindle cells of the right thyroid gray-white nodule was 20%.\nThe patient received postoperative radiotherapy and was free of local and regional recurrence or distant metastases at the 8-month follow-up evaluation.", "summary": "Computed tomography imaging of a 63-year-old male with a 2-month history of a cervical mass revealed a 4.5-cm lesion with heterogeneous enhancement in the left thyroid lobe and two smooth and homogeneous nodules in the right thyroid lobe. The patient underwent total thyroidectomy and cervical lymph node resection. Histologically, the tumor boundary in the left lobe was clear, with a few mitotically active, spindle sarcoma-like tumor cells observed in some areas. Immunohistochemically, these spindle cells were positive for vimentin and negative for cytokeratin, paired box-8, epithelial membrane antigen, calcitonin, thyroglobulin, and thyroid transcription factor-1. In other areas, abundant cartilage matrix production and irregularly shaped lobules of cartilage, often separated by fibrous bands, were observed. The chondrocytes appeared mildly/moderately atypical and contained enlarged, hyperchromatic nucleoli. One of the two nodules in the right thyroid lobe had a clear boundary and comprised some bland spindle cells in a prominently collagenous stroma with clear boundaries. The other nodule in the right thyroid lobe was completely enclosed within a thin, fibrous capsule and exhibited normofollicular and microfollicular architecture. The patient received adjuvant radiotherapy after the surgery and was free of any local or regional recurrence or distant metastases at the 8-month follow-up evaluation.", "subclaim_evaluations": [ { "subclaim": "The patient is a 63-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a 2-month history of a cervical mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography imaging showed a 4.5-cm lesion in the left thyroid lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion in the left thyroid lobe had heterogeneous enhancement.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "There were two smooth and homogeneous nodules in the right thyroid lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent total thyroidectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent cervical lymph node resection.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histologically, the tumor boundary in the left lobe was clear.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Some areas of the tumor contained mitotically active, spindle sarcoma-like tumor cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spindle cells were positive for vimentin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spindle cells were negative for cytokeratin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spindle cells were negative for paired box-8.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The spindle cells were negative for epithelial membrane antigen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spindle cells were negative for calcitonin.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The spindle cells were negative for thyroglobulin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spindle cells were negative for thyroid transcription factor-1.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Abundant cartilage matrix production was observed in some areas.", "support_label": "supported", "is_refined": false }, { "subclaim": "Irregularly shaped lobules of cartilage were observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The chondrocytes appeared mildly/moderately atypical.", "support_label": "supported", "is_refined": false }, { "subclaim": "The chondrocytes contained enlarged, hyperchromatic nucleoli.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "One of the two nodules in the right thyroid lobe had a clear boundary.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nodule with a clear boundary comprised some bland spindle cells.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nodule with a clear boundary had a prominently collagenous stroma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The other nodule in the right thyroid lobe was completely enclosed within a thin, fibrous capsule.", "support_label": "supported", "is_refined": false }, { "subclaim": "The other nodule exhibited normofollicular and microfollicular architecture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received adjuvant radiotherapy after the surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was free of local recurrence at the 8-month follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was free of regional recurrence at the 8-month follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was free of distant metastases at the 8-month follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_719_en.txt", "fulltext": "A 49-year-old man presented with exertional dyspnea. Physical examination revealed a loud S1 and a diastolic murmur in the apical region. Transthoracic echocardiography revealed severe rheumatic MS with mild MR, as well as mild functional tricuspid regurgitation and a pulmonary pressure of 55 mmHg. Then, the patient underwent a three-dimensional transesophageal echocardiography to assess the mitral apparatus more accurately and exclude the presence of left atrial appendage thrombus . His Wilkins score was 8. This is a borderline score to take BMV. However, the patient prefers to take the percutaneous intervention rather than thoracotomy. Thus, BMV was performed via the antegrade approach under local anesthesia and X-ray fluoroscopy guidance. After transseptal puncture, a 24-mm balloon was used to achieve a single dilatation of 22 mm, after which the mean transmitral pressure gradient decreased from 19 to 11 mmHg. Intraoperative transthoracic echocardiography performed immediately afterwards revealed a significant increase in mitral regurgitation. However, the subvalvular structure could not be observed clearly because the patient was in a supine position. His vital signs remained stable with no definite symptoms, and he refused mitral valve replacement. He was discharged 4 days later after undergoing BMV. Two-dimensional transthoracic echocardiography follow-up performed one month later revealed severe MR caused by a freely mobile part of the mitral papillary muscle . The left ventricular cavity and the two groups of papillary muscle were then imaged using three-dimensional transthoracic echocardiography, which showed avulsion of the posterior papillary muscle (PMA) from the left ventricular trabecular muscle. No residual papillary muscle attachment to the left ventricular wall was observed, confirming avulsion of the posterior papillary rather than its rupture . In addition, the left ventricular end-diastolic dimension increased from 45 to 53 mm. The estimated systolic pulmonary pressure increased from 55 mmHg to 81 mmHg. Therefore, the patient underwent mechanical mitral valve replacement and tricuspid annuloplasty. After surgery, the patient recovered without symptoms. At 1-month and three-month follow ups, the patient was asymptomatic, and transthoracic echocardiography showed that the left ventricular volume and pulmonary systolic pressure were significantly lower than before surgery.", "summary": "In this case report, we describe a patient with rheumatic mitral stenosis, who experienced avulsion of the mitral papillary muscle from the left ventricular wall after undergoing balloon mitral valvotomy. Papillary muscle alvusion resulted in severe mitral regurgitation, which was finally treated by mitral valve replacement.", "subclaim_evaluations": [ { "subclaim": "The patient had rheumatic mitral stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent balloon mitral valvotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient experienced avulsion of the mitral papillary muscle from the left ventricular wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The avulsion occurred after balloon mitral valvotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Papillary muscle avulsion resulted in severe mitral regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The severe mitral regurgitation was treated by mitral valve replacement.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_486_en.txt", "fulltext": "A 26-year-old Japanese male presented with severe headache and nausea for approximately 3 weeks. He had a prior episode of suspected convulsion of which magnetic resonance imaging (MRI) revealed a cystic nodular lesion measuring approximately 60 mm in diameter, located in the left parietal lobe of the cerebrum. The patient was administered medication, and symptoms were subsequently relieved. However, 12 days later, he experienced worsened symptoms and was transferred and admitted to the emergency department of the University of Miyazaki Hospital.\nMRI showed a mass of 70 \u00d7 53 \u00d7 57 mm in the left temporoparietal lobe . A solid element with slight hypointensity on T1-weighted and hyperintensity on T2-weighted images along the dura mater was noted. Cystic changes were likely associated with the sanguineous fluid. A peritumoral band with hyperintensity on T2-weighted image was observed at the periphery of the lesion, suggesting an extra-axial lesion . A dural tail sign was also noted on the gadolinium-enhanced T1-weighted image . The lesion appeared to be focally infiltrative to the brain surface, but no apparent connection to the ventricle was observed . Preoperative clinical diagnosis was meningioma, but hemangiopericytoma and ependymoma were included as differential diagnoses. Left parietotemporal craniotomy was performed. The tumor was an extra-axial mass and had partially infiltrated the dura mater and surface of the brain parenchyma in the left temporal lobe. Small pieces of tumor tissue were removed for intraoperative diagnosis. Under an emergency setting, near-total resection was achieved even if the lesion was in the eloquent area. The patient received postoperative adjuvant radiotherapy (total dose 54 Gy). However, within 1 year postsurgery, the tumor recurred and a second resection surgery was performed. Four years after the first surgery, the tumor metastasized to the spinal cord and the patient eventually died (total postoperative follow-up period was 4 years and 4 months).", "summary": "A 26-year-old Japanese man with headache and nausea was referred to our medical facility. Magnetic resonance imaging revealed a cystic mass of 70\u2009\u00d7\u200953\u2009\u00d7\u200957\u00a0mm in the left temporoparietal lobe. A peritumoral band with hyperintensity on T2-weighted imaging was observed at the periphery of the lesion, suggesting an extra-axial lesion with no apparent connection to the ventricle. A dural tail sign was also noted on the gadolinium-enhanced T1-weighted image. Preoperative clinical diagnosis was meningioma. Proliferated tumor cells in sheets with intermingled branching vessels were observed in the frozen tissue. Perivascular rosettes were inconspicuous, and the tumor cells had rhabdoid cytoplasm. The tumor was intraoperatively diagnosed as a meningioma, suspected to be a rhabdoid meningioma. Perivascular rosettes were evident in the formalin-fixed paraffin-embedded tissues, suggesting ependymoma. The tumor cells had eosinophilic cytoplasm without a rhabdoid appearance. Anaplastic features, such as high tumor cellularity, increased mitotic activity, microvascular proliferation, and necrosis, were observed. Ependymal differentiation was confirmed on the basis of ultrastructural analysis. Molecular analysis detected C11orf95-RELA fusion gene. The final diagnosis was RELA fusion-positive ependymoma, World Health Organization grade III.", "subclaim_evaluations": [ { "subclaim": "The patient is a 26-year-old Japanese man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had headache.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had nausea.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance imaging revealed a cystic mass in the left temporoparietal lobe.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass measured 70\u2009\u00d7\u200953\u2009\u00d7\u200957 mm.", "support_label": "supported", "is_refined": false }, { "subclaim": "A peritumoral band with hyperintensity on T2-weighted imaging was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was suggested to be extra-axial.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion had no apparent connection to the ventricle.", "support_label": "supported", "is_refined": false }, { "subclaim": "A dural tail sign was noted on the gadolinium-enhanced T1-weighted image.", "support_label": "supported", "is_refined": false }, { "subclaim": "The preoperative clinical diagnosis was meningioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Proliferated tumor cells in sheets were observed in the frozen tissue.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor cells had rhabdoid cytoplasm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumor was intraoperatively diagnosed as meningioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was suspected to be a rhabdoid meningioma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Perivascular rosettes were evident in the formalin-fixed paraffin-embedded tissues.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumor cells had eosinophilic cytoplasm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Anaplastic features were observed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Ependymal differentiation was confirmed by ultrastructural analysis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Molecular analysis detected C11orf95-RELA fusion gene.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The final diagnosis was RELA fusion-positive ependymoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The tumor was classified as World Health Organization grade III.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_1784_en.txt", "fulltext": "We report the case of a 48-year-old female who checked into the emergency room (ER) having experienced pain in her chest and left shoulder since the previous evening. The patient was of normal weight and reported a positive family history for coronary artery disease, but denied other cardiovascular risk factors such as hypercholesterinaemia, hypertension, diabetes, or nicotine consumption. The patient had no past medical history and was taking no medication. At presentation, her vital signs were stable. The physical and cardiovascular examination revealed no abnormalities. The chest pain receded after one gram of paracetamol.\nA 12-lead electrocardiogram (ECG) was performed in the ER at presentation, showing inverted T-waves in II, III, aVF, V4, V5, and V6 . Bedside echocardiography revealed hypokinesis in the apical inferior segment of the left ventricle. The laboratory results showed significantly increased values for high-sensitivity troponin I (upward of 25 000 pg/mL, reference range: 0.0\u201351.4 pg/mL) and creatine kinase (CK) (540 U/L, reference range: 0\u2013145 U/L). Therefore, a non-ST-elevation myocardial infarction was suspected, and the local interventional cardiology centre was contacted to perform coronary angiography (CAG).\nThe patient was swabbed before transfer to exclude a SARS-CoV-2 infection, as per the Medical University of Innsbruck (MUI) guidelines during the SARS-CoV-2 pandemic; surprisingly she tested positive for SARS-CoV-2 on the real-time reverse transcriptase-polymerase chain reaction assay. After further questioning, she reported having experienced isolated throat discomfort since the beginning of February, but denied contact with individuals with confirmed infections or flu-like symptoms; she also denied fever, cough, malaise, dyspnoea, or anosmia.\nAfter further discussion with the cardiology department, the ER team revised the working diagnosis to viral myocarditis and referred the patient to our infectious diseases ward, where she was promptly isolated and received cardiac and haemodynamic monitoring. We started therapy with acetylsalicylic acid, prophylactic-dose low-molecular-weight heparin, a statin, and a proton-pump inhibitor.\nA computed tomography coronary angiography (CTCA) was performed to exclude a coronary origin for the complaints and for the laboratory and ECG abnormalities, which revealed no significant coronary obstruction (Coronary Artery Disease Reporting and Data System: 0; Coronary Artery Calcium \u2013 Data and Reporting System: 0) .\nTo further confirm the diagnosis of viral myocarditis, a cardiac magnetic resonance imaging (CMR) was arranged. Surprisingly, CMR showed features of myocardial oedema restricted to the mid-ventricular to apical territory of the right coronary artery (RCA), as evidenced on T2 short tau inversion recovery sequence (signal intensity ratio of myocardium over skeletal muscle 2.3, ) and on T1 maps (increased native T1 of 1313 ms at inferior wall; reference value 980 ms, ). Based on subendocardial to partially transmural late gadolinium enhancement in the mid-ventricular to apical inferior wall, an acute myocardial infarction was diagnosed .\nMeanwhile, troponin T and CK values decreased , and episodes of mild chest pain were sufficiently controlled with paracetamol.\nAfter further communication with our interventional cardiology department the diagnosis was revised to a posterior MINOCA; the cardiologists advised against a CAG, due to the absence of coronary obstruction on the CTCA scan.\nFurther diagnostics with cardiac positron emission tomography\u2013computed tomography showed evidence of reduced metabolic activity in the area affected by the infarction .\nWe prescribed dual anti-platelet therapy and an angiotensin-converting-enzyme inhibitor. A beta-blocker was not started due to a resting heart rate of 60 beats per minute. After two negative SARS-CoV-2 swab results in over 24 h and absence of COVID-19 typical symptoms, the patient was no longer considered infectious and could be assigned to a cardiac rehabilitation program. Follow-up echocardiography 2 days after discharge revealed a normal ejection fraction (58%) despite persistent inferior apical akinesia.", "summary": "A 48-year-old female, presenting with chest pain radiating to her left shoulder with no cardiovascular risk factors other than genetic predisposition, was screened for Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) and tested positive. Although computed tomography angiography excluded obstructive coronary heart disease, cardiac magnetic resonance imaging showed an acute myocardial infarction with no obstructive coronary arteries of the inferior wall. The patient was treated with dual anti-platelet therapy, an angiotensin-converting-enzyme inhibitor and a statin, and assigned to a cardiac rehabilitation program.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had chest pain radiating to her left shoulder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no cardiovascular risk factors other than genetic predisposition.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was screened for SARS-CoV-2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient tested positive for SARS-CoV-2.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography angiography excluded obstructive coronary heart disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac magnetic resonance imaging showed an acute myocardial infarction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The myocardial infarction involved the inferior wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "The myocardial infarction occurred with no obstructive coronary arteries.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with dual anti-platelet therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with an angiotensin-converting-enzyme inhibitor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with a statin.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was assigned to a cardiac rehabilitation program.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3270_en.txt", "fulltext": "A Japanese 11-month-old baby boy presented at our institution with symptoms including fever, weight loss, and gallop rhythm. His fever persisted for 3 days before presentation but no treatment was provided. He was born by vaginal delivery at 37 weeks of gestation with a weight of 2612 g (36th percentile) and a head circumference of 33.7 cm. There was no family history of aortic disease and sudden death. When he was 7-months old, he had a fever of unknown origin that persisted for 2 weeks. He was poor in weight gain and was 7.55 kg (6th percentile) at the age of 10 months; his body weight decreased by 0.57 kg in the 3 weeks before presentation.\n\nOn examination at the presentation, his height was 70.8 cm, his weight was 6.98 kg, and his head circumference was 43 cm. He was ill-appearing and febrile to 38.4 \u00b0C. His blood pressure was 124/62 mmHg and pulse 146/minute. There was a notable S3 gallop and systolic murmur at the apex (Levine scale grade III/VI); however, there were no signs of rales or peripheral edema. Other physical and neurological examinations were normal. A chest X-ray revealed cardiomegaly, with 58% cardiothoracic rate. Echocardiography indicated left ventricular (LV) enlargement and dysfunction with LV diastolic dimension of 32 mm (130% of normal), LV ejection fraction 48%, moderate mitral regurgitation, and slight aortic regurgitation. Blood tests indicated the following: white blood cell count, 11.07 \u00d7 103/\u03bcl; hemoglobin, 10.6 g/dl; C-reactive protein, 5.59 mg/dl; creatine phosphokinase, 294 U/l; creatine phosphokinase-MB isozyme, 27 U/l; fibrin degradation products D-dimer, 2.1 \u03bcg/ml; brain natriuretic peptide, 2841 pg/ml; human atrial natriuretic peptide, 1360 pg/ml; and serum troponin T, 0.26 ng/ml. His blood culture at admission was negative.\n\nAs dilated cardiomyopathy was diagnosed, we initiated diuretics. However, his fever and high blood pressure (systolic blood pressure, 130\u2013140 mmHg), which rarely present with dilated cardiomyopathy, persisted. To investigate the causes of high blood pressure, computed tomography was performed and revealed thoracic and abdominal aortic aneurysms on hospital day 3. It also revealed severe celiac artery stenosis and bilateral renal artery stenosis. From these findings, TA was diagnosed and 1 mg/kg per day prednisolone was consequently initiated as first-line therapy. His fever had resolved on day 5; his C-reactive protein levels returned to normal on day 10.\n\nAlthough his general condition improved, deterioration of vascular lesions was evident, as shown by echocardiography, on day 15. Celiac artery occlusion, severe right renal artery stenosis, and new superior mesenteric artery stenosis were also observed on day 15. We increased the dose of prednisolone to 2 mg/kg per day for 1 week due to the possibility of active inflammation around vascular lesions. In addition, we attempted continuous intravenous infusion of lipo-PGE1 at 10 ng/kg per minute to suppress the progression of angiostenosis. We performed vascular echocardiography twice a week and confirmed that there was no progression of angiostenosis following initiation of lipo-PGE1. We terminated infusion of lipo-PGE1 on day 36 and performed cardiac catheterization on day 45. His right renal artery was not visualized by angiography, and his right kidney was fed by collateral arteries, while vascular echocardiography revealed patency of his right renal artery with severe stenosis. We also confirmed celiac artery occlusion and superior mesenteric artery stenosis to be the same as those observed in previous echocardiography findings. His cardiac function gradually improved. After his C-reactive protein levels returned to normal, 1 mg/kg per day of prednisolone was administered for 1 month, after which the dose was tapered every other 2 weeks. We observed him for 13 months after the termination of lipo-PGE1. The inflammatory findings remained negative and the diameters of abdominal aortic vessels were stable.", "summary": "A Japanese 11-month-old baby boy presented with Takayasu\u2019s arteritis and heart failure, possibly due to afterload mismatch caused by high blood pressure. Computed tomography was performed and revealed thoracic and abdominal aortic aneurysms. It also revealed severe celiac artery stenosis and bilateral renal artery stenosis. Prednisolone was initiated as first-line therapy. The fever resolved, and C-reactive protein levels returned to normal. Although his general condition improved, deterioration of vascular lesions was evident. Celiac artery occlusion, severe right renal artery stenosis, and new superior mesenteric artery stenosis were observed. We decided to use a continuous infusion of lipo-prostaglandin E1 for prevention of branch stenosis of his abdominal aorta. The progression of vascular stenosis was stopped and our patient\u2019s cardiac function gradually improved.", "subclaim_evaluations": [ { "subclaim": "The patient is an 11-month-old Japanese boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with Takayasu\u2019s arteritis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had heart failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography revealed thoracic aortic aneurysms.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography revealed abdominal aortic aneurysms.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed severe celiac artery stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed bilateral renal artery stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Prednisolone was initiated as first-line therapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fever resolved after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "C-reactive protein levels returned to normal.", "support_label": "supported", "is_refined": false }, { "subclaim": "Deterioration of vascular lesions was evident.", "support_label": "supported", "is_refined": false }, { "subclaim": "Celiac artery occlusion was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Severe right renal artery stenosis was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "New superior mesenteric artery stenosis was observed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A continuous infusion of lipo-prostaglandin E1 was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "The progression of vascular stenosis was stopped.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient\u2019s cardiac function gradually improved.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_777_en.txt", "fulltext": "A 58-year-old man underwent laparoscopic radical resection of sigmoid carcinoma and ileostomy in the local hospital in June 2017. After the operation, he underwent intermittent chemotherapy six times. His physical condition recovered, and the re-examination showed no tumor recurrence. The patient was expected to undergo ileostomy takedown in the local hospital in June 2018 and April 2019, respectively, but the operation was not performed because of the COA, which was found by colonoscopy. The patient was admitted to the Department of Gastroenterology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei Province, China in May 2019. To address the difficult and complicated post-surgery problems of this cancer patient, the medical team conducted a comprehensive and careful related examination and disease evaluation. The abdominal enhanced computed tomography (CT) showed postoperative changes of sigmoid carcinoma. The intestinal lumen above the anastomotic stoma was narrow and adhered to the anterior sacral fascia. The stoma was unobstructed after the right lower abdominal fistulation . Further barium enema examination suggested that the anastomotic stoma in rectum is completely closed and separated . Blind ends were present on both sides of the sigmoid colon and the rectum, and the bilateral blind ends were approximately 3.0 cm apart. The laboratory examination of the patients showed that there was no obvious abnormality in the general hemogram and no significant change in the level of tumor markers. Physical examination showed no obvious discomfort.\nDespite the presence of COA with anastomotic separation, the examination results indicated that the blind end of the anastomotic site grew well. No obvious defect was found in the surrounding tissue. At the same time, the additional surgical operation would bring more trauma. Therefore, after speaking with the patient and his family, we planned to perform endoscopic operation on the patient to treat his disease. If endoscopic surgery cannot solve the problem, then surgery can be performed immediately or postponed as an alternative.\nAfter the improvement of the preoperative examination, along with adequate preoperative communication and informed consent of patients, endoscopic surgery was proposed. In endoscopic surgery , we first observed the two blind ends of the anastomotic stoma through colonoscopy. On the one hand, the COA can be seen at about 8 cm through the anus side of colonoscopy. The closure line showed a fine line scar, and the intestinal wall at the blind end was soft. On the other hand, the colonoscope entered through the ileostomy side to reach the rectal segment. The front of the blind end of the bowel was found to also be truncated and closed with a white linear scar, and a titanium clip was placed at the proximal blind end. The intestinal wall of this blind end was also soft when touched. Second, the distance between the blind ends of both sides of the intestine was 3\u20134 cm, as measured by fluoroscopy at different positions. Subsequently, the colonoscope re-entered through the anal side. The hook knife (KDL-620LR; Olympus Optical) was used to slowly cut through the scar tissue layer by layer in the center of the blind end of the intestinal canal, and the yellow adipose tissue became visible. The direction of incision was determined to be parallel to the direction of the titanium clip at the proximal blind end, as shown by repeated fluoroscopic observation. The adipose tissue was carefully cut open, and the proximal intestinal muscular layer was still not visible after 4 cm of advance. Third, EUS-FNA (19 Ga, 1.10 mm; Boston Scientific) puncture needle was used to puncture along the direction of the titanium clip under fluoroscopy, and a small amount of contrast agent was injected to observe the flow direction and the visualization of the intestinal canal. The intestine was visualized after the needle touched the titanium clip, and a yellow zebra guide wire was placed after the needle entered the proximal intestine. Finally, colonoscopy was performed through one side of ileostomy to confirm that the guide wire was located in the proximal intestine tube. The dilation tube and balloon (M00558430; Boston Scientific) were inserted over the guide wire, and the incised bowel was gradually dilated to 12 mm under fluoroscopy. Subsequently, a 60 mm * 20 mm self-expandable full-coated metal stent (Cook Medical, Bloomington, IN, USA) was placed over the guide wire to bridge both sides of the intestine, thereby achieving the repair of anastomotic closure with separation through the endoscopic operation. After completion of the operation, the patency of the stent was checked, no bleeding was found on the wound surface, and the anal canal was retained. Compared with the \u201cdrastic\u201d surgical operation, this endoscopic surgery solved the intractable problem of COA with anastomotic separation with a more delicate and subtle operation and with minimal trauma. Endoscopic stent removal was performed on the patient 10 days later. The continuity of the bowel was observed intraoperatively, and an anal tube was placed in the proximal part of the anastomosis to observe the postoperative recovery.\nOne month later, stenosis was observed at the original anastomotic recanalization site during endoscopic examination, and scar-like hyperplasia was observed in the surrounding tissues. We successfully leaped over the narrow segment through inserting a new self-expandable full-coated metal stent of the same specification, and the stent expanded smoothly . After 1 week, the patient underwent stent removal and came to our hospital for follow-up and reexamination for several times after discharge. The anastomotic stenosis of the patient was gradually relieved. At 1 year after the endoscopic recanalization procedure for COA with anastomotic separation, the patient came to our hospital in June 2020 for ileostomy takedown. No related complications occurred during and after the operation. No obvious abnormality was found in the relevant post-operation laboratory and imaging examinations.\nThe follow-up situation at 3 months after discharge was as follows. The patient returned to a normal diet from a fluid diet and achieved normal exhaust and defecation. The results of colonoscopy showed that the anastomotic stoma healed well, and no obvious stenosis was found. At the same time, biopsy and pathological examination were carried out on the new tissue of the original anastomotic closure with anastomotic separation. The pathological results indicated that this site was normal intestinal mucosal tissue . Further endoscopic ultrasonography also confirmed the growth of normal intestinal mucosal tissues at the original anastomotic recanalization site .", "summary": "In this article, we present a case of endoscopic treatment of anastomotic closure and separation after radical resection for sigmoid carcinoma. After imaging examination and endoscopic evaluation, we found that the patient had a COA accompanied by a 3-4\u00a0cm anastomotic separation. With the aid of fluoroscopy, we attempted to use the titanium clip marker as a guide to perform an endoscopic incision and successfully achieved recanalization. We used a self-expanding covered metal stent to bridge the intestinal canal to resolve the anastomotic separation. Finally, the patient underwent ileostomy takedown, and the postoperative recovery was smooth. The follow-up evaluation results showed that the anastomotic stoma was unobstructed.", "subclaim_evaluations": [ { "subclaim": "The case involves endoscopic treatment of anastomotic closure and separation after radical resection for sigmoid carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a COA.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a 3-4 cm anastomotic separation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fluoroscopy was used during the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "A titanium clip marker was used as a guide.", "support_label": "supported", "is_refined": false }, { "subclaim": "An endoscopic incision was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Recanalization was achieved.", "support_label": "supported", "is_refined": false }, { "subclaim": "A self-expanding covered metal stent was used to bridge the intestinal canal.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent ileostomy takedown.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative recovery was smooth.", "support_label": "supported", "is_refined": false }, { "subclaim": "Follow-up evaluation showed the anastomotic stoma was unobstructed.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_807_en.txt", "fulltext": "A 75-year-old woman with a 1-week history of diplopia was referred to the ophthalmology clinic from the medical ward, where she was being treated for atypical pneumonia. She had been unwell for a few months with loss of appetite and weight. Sputum acid-fast bacillus smear and culture tests for tuberculosis were negative. There were no specific symptoms or signs suggestive of giant cell arteritis (GCA) but the erythrocyte sedimentation rate (ESR) was 98 mm/hour and the C-reactive protein was more than 139 mg/dl, which prompted the physicians to arrange a temporal artery biopsy. This was later reported as normal.\nOphthalmic examination showed corrected visual acuity of 6/6 bilaterally. There was subtle localized episcleral injection near the right lateral rectus muscle insertion. The posterior segment revealed a normal optic disc and macula bilaterally. Ocular motility revealed an abduction deficit in the right eye .\nComputed tomography (CT) scanning of the head and orbits revealed a mass in the belly of the right lateral rectus suggestive of a metastatic lesion . Subsequent CT and magnetic resonance imaging (MRI) of the thorax and abdomen showed multiple secondary metastatic lesions in the lung and enlargement of retroperitoneal lymph nodes. The patient underwent an endoscopic retrograde cholangiopancreatography and the cytology of the brushings was highly suggestive of anaplasia. Pancreatic carcinoma was suspected but abdominal CT scanning and ultrasonic studies revealed no evidence. The patient later developed a supraclavicular lymph node mass, bilateral axillary lymphadenopathy and enlarged spleen. A supraclavicular lymph node biopsy was inconclusive. The suspected diagnosis of pancreatic cancer remained unconfirmed. The general condition of the patient had deteriorated, precluding further invasive investigations such as orbital biopsy. The patient died 4 months after her initial diagnosis of orbital metastasis. Autopsy was not performed on the body.", "summary": "We present the case of a 75-year-old woman who was generally unwell, developed acute diplopia and was found to have a right abduction deficit in a quiet eye with no gross orbital signs and symptoms. A computed tomography scan of the head and orbits revealed a metastatic mass in the right lateral rectus muscle. Systemic evaluation confirmed widespread thoracic and abdominal metastases from an occult systemic malignancy. Lateral rectus metastasis from an occult systemic malignancy was masquerading as abducens palsy.", "subclaim_evaluations": [ { "subclaim": "The patient was a 75-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was generally unwell.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed acute diplopia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a right abduction deficit in a quiet eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no gross orbital signs and symptoms.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A computed tomography scan of the head and orbits was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The scan revealed a metastatic mass in the right lateral rectus muscle.", "support_label": "supported", "is_refined": false }, { "subclaim": "Systemic evaluation confirmed widespread thoracic and abdominal metastases.", "support_label": "supported", "is_refined": false }, { "subclaim": "The metastases were from an occult systemic malignancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lateral rectus metastasis was masquerading as abducens palsy.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1363_en.txt", "fulltext": "A 77-year-old African American woman with a medical history of hypertension presented with a systolic blood pressure of 200 mmHg. There was no significant family or social history. A renal ultrasound showed a 12 \u00d7 9 \u00d7 7.5 cm mass medial to the left kidney. A follow-up computed tomography (CT) scan showed an enhancing 9 \u00d7 6 cm mass anterior and medial to the left kidney. Laboratory studies revealed a normal dexamethasone suppression test and an elevated androstenedione level of 182 ng/dl. Given these results, an androgen-producing adrenal tumor was suspected. The differential diagnosis also included pheochromocytoma, lymphoma, and mesenteric gastrointestinal stromal tumor. The patient underwent robotic-assisted left adrenalectomy. The intraoperative finding of \u201cfocal invasion\u201d into the renal parenchyma raised the possibility of adrenal cortical carcinoma; therefore, an additional left upper pole partial nephrectomy was performed. The specimen received was an 11 \u00d7 7.2 \u00d7 6.8 cm adrenal mass with attached portion of kidney. The mass was golden yellow, well circumscribed, and grossly adherent to the kidney. Histologic evaluation revealed an adrenal cortical adenoma without any features of malignancy, with a Weiss score of 0 . The adjacent adrenal parenchyma shared an incomplete capsule with the kidney and was in direct contact with the renal cortex, establishing the diagnosis of fusion between the two organs . The postoperative course was uneventful.", "summary": "Our patient is a 77-year-old African American female who presented with a systolic blood pressure of 200\u00a0mmHg. Computed tomography showed an enhancing 9\u00a0\u00d7\u20096\u00a0cm mass anterior and medial to the left kidney. The patient underwent a left adrenalectomy with partial nephrectomy. Gross and histologic examinations revealed an adrenal cortical adenoma and renal-adrenal fusion.", "subclaim_evaluations": [ { "subclaim": "The patient is a 77-year-old African American female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a systolic blood pressure of 200 mmHg.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography showed an enhancing 9 \u00d7 6 cm mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The mass was anterior and medial to the left kidney.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a left adrenalectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent a partial nephrectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Gross examination revealed an adrenal cortical adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histologic examination revealed an adrenal cortical adenoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Gross examination revealed renal-adrenal fusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histologic examination revealed renal-adrenal fusion.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3120_en.txt", "fulltext": "36-year-old man with no medical history who was admitted to the intensive care unit with a presumptive diagnosis of malaria on 7/12/2021. His medical history included a stay in Nigeria from January to October 2021; he did not receive malaria prophylaxis. He arrived in the country on 28/11/21 from Germany. He began with continuous fever, sweating, chills and myo-artralgia of 1 week evolution, oligoanuria, copuria and abdominal pain were added. He was admitted to the intensive care unit lucid, tachycardic and tachypneic, with skin and mucous jaundice and a decrease in diuretic rhythm. He evolved with arterial hypertension and a requirement for nitroglycerine. A thick drop of peripheral blood was performed that evidenced PF, with parasitemia greater than 20%. A transfusion of blood was performed (volume 3.4 liters) and intravenous artesunate 400 mg on the 1st day, then 200 mg per day, for 7 days. In clinical analyses, an acute renal lesion and hyperbilirubinemia with platelopenia were detected. He evolved oligoanuric and confused, with a Glasgow score of 14/15 points. The initiation of veno-venous continuous haemodiafiltration (HDFVVC) was decided. After 24 hours, due to a sudden increase in bilirubinemia and a deepening of his encephalopathy, plasma filtration was performed coupled with adsorption (CPFA). Subsequently, high-exchange plasmaferesis was performed to control the liver failure. An improvement in the neurological state and a significant decrease in the serum bilirubin and analyte levels were detected.\n\nLucid, but with persistently high uremia and creatinine levels, he continued with continuous renal replacement techniques until the eighth day of admission. The evolution was favorable with improvement of the organ failures and on the 20th day of admission he was discharged. The case described presented MG according to WHO definition. No adverse events related to the procedures were detected.\n", "summary": "A case of a 36-year-old man with a diagnosis of severe malaria according to the criteria of the World Health Organization (WHO) who began with treatment with intravenous artesunate and a torpid evolution, a sudden increase in bilirrubinemia with encephalopathy, parameters of acute renal injury and acute pulmonary edema, performed sequential extracorporeal treatment, plasma filtration coupled to adsorption, high-exchange plasmapheresis and continuous hemodiafiltration with a favorable evolution is described.\n", "subclaim_evaluations": [ { "subclaim": "The patient was a 36-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a diagnosis of severe malaria according to WHO criteria.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received intravenous artesunate as treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a torpid evolution.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a sudden increase in bilirrubinemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed encephalopathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had parameters of acute renal injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had acute pulmonary edema.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received sequential extracorporeal treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received plasma filtration coupled to adsorption.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received high-exchange plasmapheresis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received continuous hemodiafiltration.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a favorable evolution.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1999_en.txt", "fulltext": "A 15-year-old male presented with the sudden onset of a hemiparesis (i.e., left upper limb 4/5 and left lower limb 4/5). The laboratory work up was negative for any coagulation abnormalities; normal international normalized ratio, prothrombin time, activated partial thrombin time, and bleeding/clotting times. The brain MRI was normal, thus largely ruling out a stroke. However, the cervical MR showed a dorsolateral left-sided epidural hematoma extending from C7 to D1 causing severe cord compression. The lesion was hyperintense on T1, hyperintense with a hypointense band on T2 studies, but did not enhance with contrast [- and ]. These findings were diagnostic for a SSEH. The patient underwent an emergent C7-D1 laminectomy for excision of the SSEH. Postoperatively, the patient regained normal function.", "summary": "A 15-year-old male presented with the sudden onset of a hemiparesis which recovered (4/5 weakness). The brain MR was negative, but spinal MRI revealed a dorsolateral extradural lesion extending from C7 to D1. At surgery, this proved to be a hematoma that we readily removed.", "subclaim_evaluations": [ { "subclaim": "The patient is a 15-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a sudden onset of hemiparesis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hemiparesis recovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "The brain MRI was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spinal MRI showed a dorsolateral extradural lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion extended from C7 to D1.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was a hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hematoma was removed surgically.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_223_en.txt", "fulltext": "A 64-year-old Asian gentleman was admitted for fever (101.6F), worsening cough and shortness of breath for 10 days. He is a non-smoker and has a remote history of fungal infection of lung over 20 years ago while being a farmer. For the past 3\u20134 years, he has been taken care in our hospital for persistent and exacerbated asthma, chronic obstructive pulmonary disease (COPD), diabetes, coronary heart disease and congestive heart disease. His home medications for asthma and COPD are albuterol sulfate HFA \u2212 1.25 mg/3 ml, PRN Q4H, Duoneb (a combination of albuterol and Ipratropium Bromide), Budesonid (Pulmicort, cortisone like medicine, NEB 0.5 mg/2 ml) inhalation. During previous asthma exacerbation 13 months ago, methylprednisone injection 40 mg IVP, Q8H and antibiotics Amoxicillin/clavulanic acid were used additionally. During his COPD exacerbation 2 years ago, PrednioSONE TAB\u201420MG, 40MG PO, daily was also given. In current attack, dexamethasone 10 mg per day, Duoneb and empirical antibiotics azithromycin were initiated in the outpatient setting before admission. The COVID19 nasopharyngeal RT-PCR test performed in doctor's office outside hospital on day 5 of symptom onset was negative.\nOn admission, his BMI was 21.10 kg/m2. His arterial blood gas oxygen was 74 mmHg (normal 75\u2013100) with saturation 96.1% (normal 92\u201398.5%), and the partial pressure of carbon dioxide pCO2 was 32 mmHg (normal 35\u201345), pH was 7.48.\nThe laboratory work showed high white cell count up to 22 \u00d7 103/ul with predominant neutrophils (neutrophils 79% and 17 \u00d7 103/ul, and the eosinophils accounting for 0\u20133%), moderate anemia (8\u201310 g/dl), and reactive thrombocytosis (500\u2013650 \u00d7 103/ul). Immunoglobulin E was high (875, normal < = 114). D-dimer was slightly elevated (2.73 ug/ml, reference < 0.5), as well as N-terminal prohormone of brain natriuretic peptide (NT-PROBNP 1270 pg/ml, reference 0\u2013900). Lactic acid was high 4.6 nmol/L (0.7\u20131.9). C-reactive protein was also elevated. Ferritin and procalcitonin were within normal limit. The extensive antigen, antibody and culture workups for common infectious disease pathogens such as tuberculosis, hepatitis, HIV, bacteria (including Streptococcus, Legionella etc.), fungi (including coccidioidomycosis, Cryptococcus etc.) were all negative. There was no autoantibody (antinuclear antibody, anti-neutrophil cytoplasmic antibody) either. The repeated nasopharyngeal tests on day 10, 13 and 14 of symptom onset performed in hospital after initial negative result on day 5 were all negative, and IgG antibody for COVID19 on day 16 was also negative.\nThe chest CT and X-ray showed peripherally based ground-glass opacities and consolidation, in contrast with the more centrally located shadings during asthma acceleration 13 months ago . This is an established imaging manifestation of active COVID-19 infection, but remains nonspecific, as other infections and airspace diseases have a similar appearance. No pulmonary embolism was identified by pulmonary CT.\nHe was precautiously isolated because of the uncertainty for COVID19. He was managed by empirical antibiotics, inhaled corticosteroid and bronchodilator as well as systemic steroids, besides aspirin, diuresis and diabetic medicines. The major medications addressing the lung disease are:\n- Antibiotics: azithromycin (500 mg oral daily, days 5 \u2013 14), ceftriaxone (1 gm, iv, days 9\u201315), Zosyn (3.375 gm, days 15\u201319), cefepime (1gm, days 21\u201331), fluconazole (200 mg, days 22\u201333), meropenem (1 gm, days 36\u201340), vancomycin (750\u20131000 mg, days 36\u201340).\n- Corticosteroid and bronchodilator inhalation medicines for asthma and COPD: Advair (Flutica-Salmet, which is a steroid and bronchodilator combination, MDI 250-50 MCG/puff, days 11\u201325), Budesonide (Pulmicort, cortisone like medicine, 0.5 mg \u00d7 2 per day inhalation, days 16\u201350), Duoneb (Ipratr-albut, which is a bronchodilator containing beta adrenergic and anticholinergic medicines, 0.5\u20133 mg/3 ml, Q4H, days 5\u201350).\n-Systemic steroid: dexamethasone (10 mg on days 5\u201310, 6 mg on days 11\u201337), methylPRED SUC (Solu-MEDROL, 40 mg, days 16\u201320, 24\u201333 and 37\u201350), and Prednisone (10 mg, days 33\u201337).\nHis disease was stabilized initially . On day 18, his symptoms deteriorated with Sat.O2 dropped from 74 to 54 mmHg. The chest X-ray showed increased bilateral lung opacity . The aforementioned medications including antifungal, antibacterial, bronchodilator, inhaled and systemic steroids were no longer helpful improving symptoms .\nAt this time, bronchoalveolar lavage (BAL) was performed to identify an infectious etiology and open lung wedge biopsy was due to rule out interstitial lung disease.\nThe bronchoalveolar lavage showed some pneumocytes with acinar arrangement showing enlarged nuclei, prominent nucleoli, open chromatin and mild accentuation of chromatin to nuclear membrane in a background of neutrophilic histiocytic inflammation and occasional eosinophils .\nThe left lingula lung wedge biopsy revealed central bronchiole with thickened smooth muscle wall, and mucus plug, findings consistent with known history of asthma. The presence of central squamous metaplasia and peripheral emphysema indicates chronic airway damage and obstruction suggesting COPD from repeated episodes of asthma. On top of these, there is an active airway centered lesion causing 40\u201350% alveolar collapse, characterized by fibrosing organizing pneumonia with alveolar damage , intraalveolar edematous exudates, fibrosis from intraalveoli extending to interstitial , associated with rare syncytial cells in squamous metaplasia foci and capillary endothelial injury accompanied by mixed inflammation comprising neutrophils, lymphoplasmacytic cells, histiocytes and eosinophils in all the process. Again, similar to cytology, reactive large pneumocytes are seen lining hemorrhagic alveoli, showing prominent nucleoli, open chromatin and nuclear membrane accentuation, suspicious for viral cytopathic effect . Cytomegalovirus, adenovirus and herpes virus infection is excluded by immunohistochemical stains.\nSARS-CoV-2 was detected from both BAL (Quest Laboratory) and lung wedge biopsy (Viral and Rickettsial Disease Laboratory (VRDL), Department of Public Health, California) by RT-PCR. No respiratory syncytial virus (RSV), influenza A or B, parainfluenza virus or adenovirus is identified by PCR (Quest Laboratory). All three laboratories (nasopharyngeal swab RT-PCR performed by Fulgent Genetics, BAL specimen tested by Quest Laboratory, presence of COVID19 in formalin fixed paraffin-embedded lung wedge biopsy tissue verified by VRDL) use the same primer sets unique to SARS-CoV-2 as designed by Center for disease control and prevention (CDC), US. COVID19 pneumonia is confirmed. The repeated nasopharyngeal RT-PCR tests were positive on day 40 and day 49 of disease.\nAfter the diagnosis of COVID19 pneumonia, patient was treated with Remdesivir (200 mg, day 41\u201345) and COVID19 convalescent plasma (1 unit, on day 44) besides continuous corticosteroid, bronchodilator and supportive management. The granulocytosis subsided to a nadir of 12 K/ul following treatment. The lung opacity started to dissolve a bit slowly but his hypoxemia persisted which still needed ventilation. Gram negative bacteria was isolated from central catheter on day 50. The infected central line was immediately replaced and patient was treated with antibiotics meropenem, transferred to another hospital for continuous care. Patient unfortunately succumbed to septic complications after two months of disease onset.", "summary": "A 64-year-old male with history of pulmonary fungal infection, asthma and chronic pulmonary obstructive disease (COPD), diabetes, coronary artery disease presented with shortness of breath, fever and chest image of ground opacity, reticular interstitial thickening, highly suspicious for COVID19. However, nasopharyngeal swab tests were discordantly negative for four times in two weeks, and IgG antibody for COVID19 was also negative. However, serum IgE level was elevated. No other pathogens are identified. His symptoms deteriorated despite corticosteroid, antibiotics and bronchodilator treatment. Bronchoalveolar lavage (BAL) and open lung wedge biopsy were performed for etiology diagnosis. They demonstrated COVID19 viral RNA positive fibrosing organizing pneumonia with respiratory tract damage characterized by suspicious viral cytopathic effect, mixed neutrophilic, lymphoplasmacytic, histiocytic and eosinophilic inflammation and fibrosis besides expected asthma and COPD change. One week later, repeated COVID19 nasopharyngeal tests on day 40 and day 49 became positive.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of pulmonary fungal infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has asthma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has chronic pulmonary obstructive disease (COPD).", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has diabetes.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has coronary artery disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The chest image showed ground opacity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The chest image showed reticular interstitial thickening.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The chest image was highly suspicious for COVID19.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nasopharyngeal swab tests were negative four times over two weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum IgG antibody for COVID19 was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serum IgE level was elevated.", "support_label": "supported", "is_refined": false }, { "subclaim": "No other pathogens were identified.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms deteriorated despite corticosteroid treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms deteriorated despite antibiotic treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms deteriorated despite bronchodilator treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Bronchoalveolar lavage (BAL) was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Open lung wedge biopsy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "BAL and open lung wedge biopsy demonstrated fibrosing organizing pneumonia.", "support_label": "supported", "is_refined": false }, { "subclaim": "BAL and open lung wedge biopsy showed respiratory tract damage.", "support_label": "supported", "is_refined": false }, { "subclaim": "BAL and open lung wedge biopsy showed suspicious viral cytopathic effect.", "support_label": "supported", "is_refined": false }, { "subclaim": "BAL and open lung wedge biopsy showed mixed neutrophilic, lymphoplasmacytic, histiocytic, and eosinophilic inflammation.", "support_label": "supported", "is_refined": false }, { "subclaim": "BAL and open lung wedge biopsy showed fibrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had expected asthma and COPD changes.", "support_label": "supported", "is_refined": false }, { "subclaim": "Repeated nasopharyngeal tests on day 40 and day 49 became positive.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2275_en.txt", "fulltext": "A 68-year-old Caucasian man was referred to our out-patients clinic following the incidental discovery of a 6 \u00d7 8 cm distended iliac vessel whilst having an ultrasound for surveillance of liver cirrhosis. His clinical history revealed a progressive history of right flank pain, worsening right leg claudication and a persistently cold sensation in his right foot. He also complained of progressive breathlessness on exertion, clinically suggestive of deteriorating CCF. There was no history of trauma or previous surgery. Ankle-brachial pressure measurements revealed a reduced index of 0.76 on the right, and a normal index of 1.35 on the left with corresponding toe pressures of 55 mmHg and 143 mmHg respectively. A contrast enhanced computed tomography (CT) scan showed an isolated right common iliac artery (CIA) to right common iliac vein AVF . His aorta was normal in caliber, measuring 19 mm at the aortic bifurcation. The aneurysmal segment began immediately distal to the aortic bifurcation at the origin of the right CIA, with no normal segment of CIA evident. The aneurysm measured 9.4 cm in maximal diameter and extended to within 17 mm of the right iliac bifurcation. It was impossible to differentiate the arterial wall from the venous wall in the aneurysmal segment on either ultrasound or CT scans. His inferior vena cava (IVC) was grossly distended with a uniform diameter of 36 mm in its full course.\nPre-operative discussions focused on finding an endovascular strategy to solve the problem. As no normal caliber proximal right CIA existed, an isolated iliac covered stent was impossible as no proximal sealing zone existed. This required sealing a proximal stent in his aorta. Bifurcated endografts have been used to seal ilio-iliac fistulae previously . The aortic bifurcation diameter was 19 mm in this case and although some devices have reported success negotiating smaller aortic bifurcations , we felt an aorto-bi-iliac graft would be in danger of being compressed at the bifurcation with a high risk of occlusion. As a result, a hybrid approach with deployment of an aorto-uni-iliac (AUI) device followed by a femoro-femoral bypass was planned. Our patient was operated upon in our endovascular suite (Siemens) under spinal anesthesia. Both common femoral arteries (CFA) were controlled and cannulated with 6Fr sheaths (Johnston & Johnston). His aorta was cannulated with a 0.035 wire Bentson wire (Cook Medical, Bloomington, IN, USA) via each CFA with the assistance of an angled catheter (Kumpe, Cook Medical). A diagnostic flush pigtail catheter was placed in his aorta via the contralateral limb. A stiff 0.035 Amplatz wire (Amplatz Super Stiff, Boston Scientific) was exchanged as access to the ipsilateral limb. Following an angiogram to confirm renal anatomy, an aorto-uni-iliac device (Zenith Renu, Cook Medical) was deployed from immediately below his renal arteries to his mid right external iliac artery, thus occluding his right internal iliac artery. A 14 \u00d7 10 mm Amplatzer occlusion device (AGA Medical Corp, MN, USA) was deployed via the contralateral limb to his proximal left CIA. A completion angiogram confirmed exclusion of the ilio-iliac AVF. A right to left femoro-femoral bypass with 8 mm polytetrafluoroethylene (PTFE) was performed to re-establish flow to his left leg as well as providing left internal iliac perfusion.\nOn the first postoperative day, the mass was no longer pulsatile and the machinery-like murmur in the right iliac fossa was absent. A CT scan on postoperative day two confirmed a patent AUI endovascular graft and patent femoro-femoral bypass, as well as confirming exclusion of contrast from the right iliocaval system . His right foot no longer felt cool and the postoperative ankle brachial index (ABI) confirmed an index of 1.05 on the right and 0.95 on the left, with corresponding toe pressures of 119 mmHg and 117 mmHg respectively. He was discharged after seven days without complication. At a clinic one month later, his claudication had resolved completely and he no longer had symptoms suggestive of CCF. A duplex ultrasound confirmed exclusion of arterial flow from the iliocaval vessels.", "summary": "We report a case of a spontaneous ilio-iliac arteriovenous fistula in a 68-year-old Caucasian man detected following presentation with unilateral claudication and congestive cardiac failure. Following computed tomography evaluation, the fistula was successfully treated with a combined endovascular (aorto-uni-iliac device) and open (femoro-femoral crossover) approach.", "subclaim_evaluations": [ { "subclaim": "The patient was a 68-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a spontaneous ilio-iliac arteriovenous fistula.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The fistula was detected following presentation with unilateral claudication.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fistula was detected following presentation with congestive cardiac failure.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Computed tomography was used to evaluate the fistula.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fistula was treated with a combined endovascular and open approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "The endovascular treatment used an aorto-uni-iliac device.", "support_label": "supported", "is_refined": false }, { "subclaim": "The open treatment used a femoro-femoral crossover.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment was successful.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1650_en.txt", "fulltext": "A 37-year-old woman presented at the emergency department (ED) with exertional dyspnoea New York Class Association (NYHA) functional classes II and III, syncope, and new onset of T-wave inversions in the ECG . She presented in a clinically stable condition with a blood pressure of 130/80\u2005mmHg, a pulse of 90/min, and an oxygen saturation of 96%. The clinical examination was unremarkable. Her only significant medical history was Crohn\u2019s disease, which had been well controlled with adalimumab for 3 years. Computed tomography (CT) ruled out a pulmonary embolism and parenchymal lung disease . The transthoracic echocardiographic (TTE) findings were consistent with a cor pulmonale without signs of an intracardiac shunt or a left ventricular (LV) pathology (see , ). Right heart catheterization proved a precapillary PH with a negative vasoreactivity testing (mPAP 33\u2005mmHg, pulmonary vascular resistance 4.8\u2005WU, pulmonary arterial wedge pressure 7\u2005mmHg, and central venous pressure 4\u2005mmHg). Perfusion\u2013ventilation scintigraphy displays small peripheral perfusion defects .\nThe presence of peripheral perfusion defects in scintigraphy was initially interpreted as possible chronic thromboembolic PH, and anticoagulation with heparin was started. However, the findings were later interpreted as in context of PH Group 1. Therefore, a PH specific therapy with macitentan and tadalafil was initiated under the continuation of heparin. The short-term course was then complicated by a heparin-induced thrombocytopenia (HIT) that was confirmed by a positive antibody test (HIT antibodies: IgG 6.96\u2005U/mL) with otherwise normal coagulation parameters. Shortly thereafter, an episode of haematemesis occurred, and gastroscopy revealed a gastric adenocarcinoma. An escape chemotherapy regimen was launched before completion of tumour staging. Staging CT revealed subpleural nodular ground glass opacities with \u2018feeding vessel sign\u2019 compatible with PH but no metastatic spread of gastric cancer . Consequently, oncologic treatment was changed to a neoadjuvant chemotherapy and subsequent gastrectomy. The patient\u2019s symptoms improved shortly after the first administration of chemotherapy and resolved completely within 2 months. Retrospectively, we considered a pulmonary tumour thrombotic microangiopathy (PTTM) the most probable cause of PH. Follow-up after successful oncologic treatment and cumulative 10 months of specific PH medication showed an excellent clinical response; hence, specific PH therapy was ceased (see , ; ). A subsequently performed RHC confirmed complete remission of PH at rest (mPAP 17\u2005mmHg, pulmonary vascular resistance 1.6\u2005WU, pulmonary arterial wedge pressure 9\u2005mmHg, and central venous pressure 5\u2005mmHg).", "summary": "A 37-year-old woman presented with exertional dyspnoea and syncope. The transthoracic echocardiographic findings were consistent with a cor pulmonale. Right heart catheterization (RHC) proved a precapillary PH. Specific PH therapy with macitentan and tadalafil was initiated. Shortly thereafter, a gastric carcinoma was diagnosed, and oncologic treatment with neoadjuvant chemotherapy and subsequent gastrectomy was promptly initiated. Retrospectively, we considered a pulmonary tumour thrombotic microangiopathy the most probable cause of PH. Follow-up after successful oncologic treatment and cumulative 10 months of specific PH medication showed an excellent clinical response with complete remission of PH confirmed by RHC at rest.", "subclaim_evaluations": [ { "subclaim": "The patient is a 37-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with exertional dyspnoea.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with syncope.", "support_label": "supported", "is_refined": false }, { "subclaim": "Transthoracic echocardiographic findings were consistent with cor pulmonale.", "support_label": "supported", "is_refined": false }, { "subclaim": "Right heart catheterization proved a precapillary pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Specific pulmonary hypertension therapy with macitentan was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Specific pulmonary hypertension therapy with tadalafil was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "A gastric carcinoma was diagnosed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oncologic treatment with neoadjuvant chemotherapy was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Oncologic treatment with gastrectomy was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pulmonary tumour thrombotic microangiopathy was considered the most probable cause of pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Follow-up after 10 months of specific pulmonary hypertension medication showed an excellent clinical response.", "support_label": "supported", "is_refined": false }, { "subclaim": "Right heart catheterization at rest confirmed complete remission of pulmonary hypertension.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2585_en.txt", "fulltext": "A 25-year-old woman was admitted to our emergency department after a fall from a chair onto her outstretched left hand. Due to mild alcohol consumption, communication with her was unsatisfactory. She complained of pain and inability to use her elbow, while no other injuries were found. She had a clear medical history, with no comorbidities, except smoking. Physical examination revealed swelling and \u201cdinner fork\u201d deformity of her left wrist, tenderness over her left elbow without any bruises or open wounds, while no obvious neurovascular injury was recognised. Frontal and lateral plain roentgenograms of her left forearm revealed a type-1 Bado Monteggia lesion accompanied with an ipsilateral type 1 Frykman distal radius fracture (Colles\u2019 fracture) with dorsal comminution (, ). Fortunately, no other fractures were found around her elbow, such as coronoid process or radial head fracture. Presence of such associated injuries compromises the final outcome. The patient was operated on within 8 h after admission, under general anesthesia and tourniquet. At the operating room, the neurological examination was repeated, but no neurological disorder was indicated. The ulna was anatomically reduced and fixed through the classical lateral approach between flexor and extensor carpi ulnaris. Osteosynthesis was performed using a dynamic compression plate (3.5 mm limited contact dynamic compression plate [LC-DCP]). Intraoperative, fluoroscopy showed a spontaneous reduction of the anteriorly dislocated radial head after the ulna\u2019s fixation. Subsequently, through a Henry approach, the distal radius fracture was reduced and fixed with a 3.5 mm T-shaped buttress locking plate . Intraoperatively, after the fixation of both fractures, the elbow was found to be stable in all directions with a full range of motion of wrist, elbow, and forearm. The post-operative course was uneventful, and our patient was discharged 2 days after surgery with a dorsal plaster splint. The cast was removed 2 weeks after surgery, and then gradually the mobilization began. The range of wrist (arc: 108\u00b0) and elbow (arc: 0\u2014\u00b0) motion, as well as the supination and pronation (overall arc: 175\u00b0) of the forearm recovered completely 2.5 months postoperatively . Roentgenograms and clinical evaluation showed completed bone union of both fractures\u2019 sides 3.5 months after surgery (, ). The patient returned to her daily routine within 4 months following injury. At last follow-up, 6 months postoperatively, the Broberg and Morrey (98/100) and Quick Dash scores (2.27% of disability) were excellent, without any decline in motion, strength, and stability, accompanied by no pain.", "summary": "A 25-year-old woman fell from a chair, injuring her left forearm and wrist. On admission, plain roentgenograms of the left upper extremity revealed an anterior, Bado type-1 Monteggia fracture-dislocation associated with an ipsilateral distal radius fracture. The patient underwent surgical treatment of both injuries with a 3.5 limited contact dynamic compression plate for ulna and a 3.5 mm T-type buttress locking plate for distal radius. Intraoperative roentgenogram showed a spontaneous reduction of the ipsilateral dislocated radial head following osteosynthesis. An above, the elbow plaster cast was applied for 2 weeks because of the radial head dislocation. 10 weeks postoperatively the patient regained full range of motion of her wrist, elbow, and supination/pronation in her forearm. 4 months postoperatively she was returned to her previous daily activity after roentgenograms showed complete bone healing.", "subclaim_evaluations": [ { "subclaim": "The patient is a 25-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She fell from a chair.", "support_label": "supported", "is_refined": false }, { "subclaim": "She injured her left forearm and wrist.", "support_label": "supported", "is_refined": false }, { "subclaim": "Plain roentgenograms of the left upper extremity were obtained.", "support_label": "supported", "is_refined": false }, { "subclaim": "The roentgenograms revealed an anterior, Bado type-1 Monteggia fracture-dislocation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The roentgenograms revealed an ipsilateral distal radius fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent surgical treatment of both injuries.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 3.5 limited contact dynamic compression plate was used for the ulna.", "support_label": "supported", "is_refined": false }, { "subclaim": "A 3.5 mm T-type buttress locking plate was used for the distal radius.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraoperative roentgenogram showed a spontaneous reduction of the ipsilateral dislocated radial head.", "support_label": "supported", "is_refined": false }, { "subclaim": "An above-the-elbow plaster cast was applied.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The plaster cast was applied for 2 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cast was applied because of the radial head dislocation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "10 weeks postoperatively, the patient regained full range of motion of her wrist.", "support_label": "supported", "is_refined": false }, { "subclaim": "10 weeks postoperatively, the patient regained full range of motion of her elbow.", "support_label": "supported", "is_refined": false }, { "subclaim": "10 weeks postoperatively, the patient regained full range of supination/pronation in her forearm.", "support_label": "supported", "is_refined": false }, { "subclaim": "4 months postoperatively, roentgenograms showed complete bone healing.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "4 months postoperatively, the patient was returned to her previous daily activity.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_374_en.txt", "fulltext": "A 71-year-old man who suffered from CLL was admitted to our hospital on June 23th, 2020 due to fever. In 2001, he was admitted to a hospital due to submaxillary mass. On physical examination, multiple enlarged lymph nodes of the bilateral jaw bone were touched with nontender and of medium in quality, among which the largest lymph node was about 1.0\u00d71.5 cm2. Routine blood results showed white blood cell (WBC) of 148.52\u00d7109/L, lymphocyte ratio of 81.5%, hemoglobin of 101 g/L and platelet of 68\u00d7109/L. Bone marrow smear revealed active hyperplasia of nucleated cells in bone marrow and increased proportion of lymphocytes, including mature lymphocytes (91%) and immature lymphocytes (2.5%). Likewise, peripheral blood films also suggested significantly augmented proportion of lymphocytes, with 91% of mature lymphocytes and 3% of immature lymphocytes, which was consistent with the bone marrow smear of CLL. Subsequently, the patient was subjected to bone marrow biopsy. Results indicated active bone marrow hyperplasia and nodular or patchy proliferation of mature lymphocytes, without granulocyte, erythrocyte and megakaryocyte, as well as germinal center and macrocell transformation. Flow cytometric immunophenotyping showed CD5(+)81%, CD19(+)70%, CD20(+)25% and CD22(+)8%. Finally, the patient was diagnosed with CLL at Binet C stage and was given 4 courses of combination therapy of rituximab, cyclophosphamide, doxorubicin, vincristine and prednisone (R-CHOP). After discharge, he received daily oral chlorambucil 2 mg for a long time, and the disease was controlled.\nOn May 20th, 2020, the patient revisited the hospital. The bone marrow smear still conformed to CLL, and the bone marrow biopsy indicated that tumor cells were scattered or clustered (10\u201320%). Flow cytometric immunophenotyping performed on the peripheral blood showed that abnormal cell population accounted for 87.16% of nuclear cells, expressing CD19, CD23, CD5, CD200 and CD22, partially expressed CD20, CD123 and CD11c, and weakly expressing CD81 and CD43, suggesting CLL/small lymphocytic lymphoma (CLL/SLL) phenotype. The karyotype of the chromosome was 45,X,-Y[4]/47,XY,+12[6]/46,XY[15]. Fluorescence in situ hybridization (FISH) showed negative IGH/BCL2, ATM/CEP11, RB-1, CCND1/IGH, CEP12 and P53/CE P17. The second-generation sequencing showed that Y220C and I195F mutations in exon 6 of TP53 mutation were positive, with a mutation rate of 4.1% and 1.5%, respectively. Somatically mutated monoclonal IGHV4-34 gene rearrangement was demonstrated, with 6.7% of mutation rate. Taken together, these findings indicated that this patient was diagnosed with RaiIII-phase CLL at Binet stage C, with IgHV and TP53 mutation. Oral ibrutinib tablet 420 mg was given once a day. No increase in hemoglobin was observed in blood routine monitoring during the oral administration of ibrutinib, and intermittent transfusion for the treatment was conducted in our hospital.\nOn June 23th, 2020, the patient was referred to our hospital when he presented with fever, fatigue and anorexia. On admission, the physical examination revealed anemia, a body temperature of 37.9\u00b0C, pulse rate of 102/min, breathing rate of 20 times/min and blood pressure of 120/67 mmHg, without obvious abnormalities in the heart and lungs. There were enlarged lymph nodes in the bilateral neck and groin, with the most being 2\u00d73 cm2, as well as splenomegaly (line A and B of 5 cm, line A and C of 6 cm, line D and V of \u22126 cm) with small-medium in size, nontender and pitting edema of lower limbs. Routine blood results showed WBC of 59.16\u00d7109/L, lymphocyte count of 121.04\u00d7109/L, hemoglobin of 89 g/L and neutrophile granulocyte of 17.78\u00d7109/L. Bone marrow smear indicated active bone marrow hyperplasia, and we observed 46.5% of protogranulocytes (small and unequal in size and some cytoplasm containing a few azurophilic granules), many basophilic erythroblast, megakaryocytes and small megakaryocytes, but little immature lymphocytes . The positive rate of POX staining was about 65%, indicating CLL accompanied by AML-M2 . As shown in , abnormal myeloid primordial cells were found in the specimens, accounting for 32.86% of the nuclear cells, which was in line with AML phenotype. In addition to expressing myeloid antigens, CD56-positive lymphocytes were also noticed, which could be used as a monitoring indicator for minor residual disease. A cluster of abnormal B lymphocytes with small forward scatter (FSC) intensity and side scatter (SSC) intensity was observed in the specimen of the patients, and the phenotype of the cluster of cells was consistent with CLL/SLL. Moreover, the patient\u2019s karyotype was 44, X,-Y,del(5)(q31),-7add(12)(p13)der(17)der(18), 22,+mar([8]/44,idem,del(4)(q22)[12] .\nOn the basis of the data above, a final diagnosis of AML-M2 secondary to CLL was made, with -Y,del(4q),del(5q),-7,add(12p),der(17),der(18),-22,+mar. Azacitidine combined with B-cell lymphoma 2 (Bcl-2) inhibitor was recommended for the treatment, which was rejected by his family, and the patient died of pulmonary infection on October 17, 2020. This study followed the principles of the Declaration of Helsinki, and informed consent was obtained from the patient\u2019s family.", "summary": "We reported a case of a 71-year-old man with a history of CLL. The patient was administrated with chlorambucil for 19 years and was admitted to our hospital due to fever. Then he was subjected with routine blood tests, bone marrow smear examination, flow cytometric immunophenotyping and cytogenetic analysis. A final diagnosis of AML-M2 secondary to CLL with -Y,del(4q),del(5q),-7,add(12p),der(17),der(18),-22,+mar was made. After rejecting the therapy with Azacitidine combined with B-cell lymphoma-2 (Bcl-2) inhibitor, the patient died of pulmonary infection.", "subclaim_evaluations": [ { "subclaim": "The patient was a 71-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of chronic lymphocytic leukemia (CLL).", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was administered chlorambucil for 19 years.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was admitted to the hospital due to fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent routine blood tests.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent bone marrow smear examination.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent flow cytometric immunophenotyping.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent cytogenetic analysis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The final diagnosis was AML-M2 secondary to CLL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The karyotype included -Y, del(4q), del(5q), -7, add(12p), der(17), der(18), -22, +mar.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient rejected therapy with Azacitidine combined with a Bcl-2 inhibitor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died of pulmonary infection.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_298_en.txt", "fulltext": "A 55-year-old Chinese female was admitted for a 10-month history of painless decline in her vision of the right eye. The patient was initially diagnosed with chronic uveitis and received glucocorticoid-based therapy; however, she responded poorly and was thus referred to our hospital. She reported a transient history of eye redness but no history of photophobia, floaters, flashes, or scotoma in her right eye. During the systemic review of the patient, no symptoms of oral ulcers, vitiligo, alopecia, headaches, or joint pain were revealed. The patient did not experience any eye trauma or surgery.\nHer ophthalmic examination revealed a visual acuity measuring 20/125 OD and 20/25 OS, and her noncontact intraocular pressure values were 13 and 15 mmHg, respectively. The results of both the extraocular appearance and muscle movement examinations were normal. The patient's pupillary light reflex was satisfactory, and her relative afferent pupillary defect was absent. Meticulous slip-lamp examination of the patient's right eye revealed diffuse mutton-fat keratic precipitates, 2 + anterior chamber (AC) cells, and 2 + AC flares. Severe vitreous opacities in the right eye obscured the dilated fundus examination (CLARUS\u2122 500, Carl Zeiss Meditec AG, Germany) . OCT (Cirrus HD-OCT, Carl Zeiss Meditec, Inc., United States) of the right eye showed high-density reflective spots (indicated by the arrow in Fig. a) in the retinal pigment epithelium (RPE) layer, while Bruch\u2019s membrane remained intact. Spotted hypofluorescence was observed at the posterior pole and mid-peripheral retina, with clustered hyperfluorescent points at the mid-peripheral retina being observed on the ICGA OD . The results of fundoscopy, OCT, or ICGA of her left eye were unremarkable .\nDiagnostic aspiration of the right vitreous was subsequently performed. The cytometric bead array results showed that the ratio of interleukin (IL)-10/IL-6 in the vitreous humour was 1.05, slightly exceeding the upper normal limit (usually set as 1). Specifically, the IL-10 level in the vitreous humour was 39.4 pg/mL, while the IL-6 level was 37.5 pg/mL. The vitreous humour was positive for Epstein\u2013Barr virus (EBV) DNA as determined by the polymerase chain reaction (9.90E + 03 copy/mL), and the vitreous was negative for EBV-IgG. Genetic testing by next-generation sequencing of the vitreous humour revealed several oncogenic mutations, including TP53, JAK2, and FAS. Vitreoretinal lymphoma of the right eye was suspected. Subsequently, whole-body positron emission tomography (PET-CT) showed a hypermetabolic nodule in the retroperitoneal left adrenal area, suggesting a malignant tumour. A core-needle biopsy of the retroperitoneal mass revealed malignant morphological features, including an irregular karyotype, karyokinesis, and karyorrhexis . Further immunohistochemistry and fluorescence in situ hybridization (by a Nikon camera and software, \u00d7 400 magnification. Scale bar, 50 \u03bcm) proved that the lump was ENKTL; the lump was CD7 + , CD2 + , CD3\u03b5 + , CD5-, T-cell intracellular antigen 1 (TIA-1) + , Granzyme B (GrB) + , Ki-67 + and EBV-encoded mRNA (EBER) + . Considering the homology of the two lesions, this patient was confirmed to have metastatic vitreoretinal lymphoma secondary to retroperitoneal ENKTL. Moreover, the positive EBV testing result and oncogenic mutations related to T-cell-derived lymphomas supported the diagnosis. Lymphomatous infiltrates are commonly confined to the space between the RPE and Bruch's membrane in metastatic intraocular ENKTL . Her nasopharyngeal area, a common site for ENKTL, was specifically examined to exclude possible lesions.\nSubsequently, the patient received radiotherapy and sintilimab-based chemotherapy treatment at a tumour specialist hospital. Moreover, 0.4 mg of methotrexate was intravitreally injected into her right eye once a week for two months and once a month for the following three months. At the time of submission, the vision of her right eye was improved from 20/125 to 20/32, and the vitreous opacity was significantly improved, as demonstrated in the fundoscopy photos . OCT at follow-up revealed irregular humps inward into the RPE, while Bruch\u2019s membrane remained intact (indicated by the arrowheads in Fig. c, d). PET-CT reexamination showed that the retroperitoneal nodule decreased in size following treatment, and no new lesions were found.", "summary": "This case report describes a 55-year-old female reporting a 10-month history of painless decline in her vision of the right eye. Optical coherence tomography of the patient revealed hyperreflective nodules and irregular humps in the retinal pigment epithelium layer. The right vitreous was aspirated for diagnostic assessment, revealing an interleukin-10 level of 39.4\u00a0pg/mL and an interleukin-10/interleukin-6 ratio of 1.05. The right vitreous\u00a0humor\u00a0was positive for Epstein-Barr virus DNA. Upon a systemic examination, a high metabolic nodule was found in the retroperitoneal area and proven to be positive for Epstein-Barr virus-encoded mRNA, CD2, CD3\u03b5, TIA-1, and Ki-67. Considering the homology of the two lesions, the patient was diagnosed with metastatic vitreoretinal lymphoma secondary to retroperitoneal extranodal natural killer/T-cell derived lymphoma. The patient received systemic chemotherapy and regular intravitreal injections of methotrexate. Her visual acuity of the right eye had improved from 20/125 to 20/32 at the latest follow-up. No new lesions were found.", "subclaim_evaluations": [ { "subclaim": "The patient is a 55-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported a 10-month history of painless decline in vision of the right eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "Optical coherence tomography revealed hyperreflective nodules in the retinal pigment epithelium layer.", "support_label": "supported", "is_refined": false }, { "subclaim": "Optical coherence tomography revealed irregular humps in the retinal pigment epithelium layer.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right vitreous was aspirated for diagnostic assessment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The interleukin-10 level in the right vitreous was 39.4 pg/mL.", "support_label": "supported", "is_refined": false }, { "subclaim": "The interleukin-10/interleukin-6 ratio in the right vitreous was 1.05.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right vitreous humor was positive for Epstein-Barr virus DNA.", "support_label": "supported", "is_refined": false }, { "subclaim": "A high metabolic nodule was found in the retroperitoneal area.", "support_label": "supported", "is_refined": false }, { "subclaim": "The retroperitoneal nodule was positive for Epstein-Barr virus-encoded mRNA.", "support_label": "supported", "is_refined": false }, { "subclaim": "The retroperitoneal nodule was positive for CD2.", "support_label": "supported", "is_refined": false }, { "subclaim": "The retroperitoneal nodule was positive for CD3\u03b5.", "support_label": "supported", "is_refined": false }, { "subclaim": "The retroperitoneal nodule was positive for TIA-1.", "support_label": "supported", "is_refined": false }, { "subclaim": "The retroperitoneal nodule was positive for Ki-67.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with metastatic vitreoretinal lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vitreoretinal lymphoma was secondary to retroperitoneal extranodal natural killer/T-cell derived lymphoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received systemic chemotherapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received regular intravitreal injections of methotrexate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's visual acuity of the right eye improved from 20/125 to 20/32 at the latest follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "No new lesions were found at the latest follow-up.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1759_en.txt", "fulltext": "A 57-year-old male presented with 3 months of left pulsatile tinnitus and hemicranial headache without any other neurological deficits. He had no history of head trauma or central nervous system infections. Digital subtraction angiography revealed DAVF with afferents from the left external carotid artery (LECA), notably with the occipital and middle meningeal arteries draining into the ipsilateral sigmoid sinus, without leptomeningeal cortical retrograde venous drainage, and grade I of the Cognard classification .\nThe transvenous approach was chosen, together with closure of the affected sinus using coils, but the surgical team experienced difficulties when passing the microcatheter from the transverse to the sigmoid sinus, which was likely isolated. Thus, two sessions of transarterial embolization were performed 2 months apart . During the first session, the fistulous branch of the left occipital artery was occluded with Onyx\u00ae [Figure and ]. The patient recovered uneventfully and tinnitus decreased, although headaches persisted. During the second session conducted with Onyx\u00ae, the feeder branch of the left middle meningeal artery was occluded [Figure and ]. Angiography revealed complete exclusion of the fistula and successful embolization . On the first day postoperatively, the patient presented with ipsilateral peripheral facial palsy, House Brackmann grade 4 , and no other physical or neurological signs. Tomography showed no ischemic or hemorrhagic complications . The patient received 4 mg of intravenous dexamethasone every 6 h and showed progressive improvement with complete recovery in 4 days . After 4 months, the patient remains under our care, with no complaints of headache or tinnitus. A follow-up appointment is scheduled for 6 months after his last session.", "summary": "We present a male patient who complained of headaches and left-sided pulsatile tinnitus due to DAVF from the external carotid artery branches draining directly into the ipsilateral sigmoid sinus. Embolization with Onyx\u00ae was successful, obtaining angiographic occlusion and symptom remission. However, on postoperative day 4, the patient presented with left facial palsy and spontaneous regression.", "subclaim_evaluations": [ { "subclaim": "The patient is male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of headaches.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had left-sided pulsatile tinnitus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cause was a dural arteriovenous fistula.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fistula originated from external carotid artery branches.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fistula drained directly into the ipsilateral sigmoid sinus.", "support_label": "supported", "is_refined": false }, { "subclaim": "Embolization with Onyx\u00ae was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Angiographic occlusion was achieved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Symptoms resolved after the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "On postoperative day 4, the patient developed left facial palsy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The facial palsy spontaneously regressed.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1712_en.txt", "fulltext": "An 81-year-old woman, who had a history of resection of a benign eccrine spiradenoma from the parietal scalp 12 years earlier, presented with a large swelling on the same region that had been growing over the preceding 5 years without any neurological deficit. Radiological examinations demonstrated that the lesion was a single, large cystic mass invading bilateral parietal bones and attached to but not occluding the superior sagittal sinus (SSS) . Whole-body positron emission tomography revealed no lymph node or distant metastases.\nThe lesion was excised along with surrounding scalp and bone, and detached from the SSS. The dura mater covering the SSS was electrocoagulated. Reconstruction of the removed skull and scalp was then performed using titanium mesh and a pedicled skin flap from the occipital region which was replaced by a skin graft from the femoral area . Histopathological examination revealed the features of low-grade eccrine SC. Two distinct cell types were observed, comprising eosinophilic cuticular cells surrounded by poroid cells with a high nuclear-cytoplasmic ratio forming palisading or solid nests, accompanied by glandular lumens and ducts. Overall cytoplasmic atypia, some mitotic figures and partial loss of the two-cell structures were also observed . Cytokeratin 7 was broadly expressed, and Ki-67 labeling index was approximately 30% . Close follow-up was continued considering the risk of recurrence.\nThirty-three months after the first surgery, solid tumor was seen to have recurred in the SSS and a second resection was performed . The tumor was totally excised, again preserving the SSS, adjacent dura and pedicled scalp flap . Histopathological diagnosis was similar to the previous lesion, other than the loss of the large cyst formation. No adjuvant therapy was administered, in consideration of the lack of evidence of efficacy, the age of the patient, and a recent history of ischemic brainstem infarction prior to the second surgery.\nTwelve months after the second surgery, a heterogeneous contrast-enhancing mass was observed in the epidural region with extracranial extension pushing against the titanium mesh. The SSS was compressed but not occluded, and the scalp skin was about to rupture . No metastatic lesion was evident on whole-body examination.\nThe third operation was performed with resection of the skin flap, titanium mesh, and surrounding bone edge. The tumor invading the SSS could not be resected due to marked bleeding. An artificial bone flap made from polyethylene was used for the cranioplasty instead of metallic material, which would reduce the scattered radiation dose to the surrounding tissue. Scalp reconstruction was performed with a new pedicled skin flap from the left temporal region . The histopathological diagnosis was compatible with the first lesion. Two months after the third surgery, the patient received 6 MV X-ray EBRT using simultaneous integrated boost (SIB) volumetric-modulated arc therapy (VMAT) with the prescribed dose of 50 Gy in 25 fractions to the planning target volume margin (residual gross tumor invading the SSS + 5 mm, tumor cavity + 3 mm) as well as SIB with 57.5 Gy to the residual gross tumor margin. The median dose to the gross tumor volume was 60.4 Gy. The residual tumor rapidly shrank and had vanished by 3 months after completion of the EBRT .\nTwenty months after the third surgery, the patient developed left hemiparesis and a recurrent tumor was observed with intracerebral extension arising from the SSS forming a cystic lesion . The patient concurrently developed rectal carcinoma with lower gastrointestinal bleeding. Palliative endoscopic partial resection of the cystic lesion was performed, followed by stereotactic radiotherapy using CyberKnife\u00ae (Accuray Incorporated, Sunnyvale, CA) with 42.2 Gy in 10 fractions to the margin of the residual cyst wall and the tumor involving the SSS . Histopathological examination demonstrated that the features of low-grade SC had been sustained .\nThe patient was transferred to another hospital and died 7 months after the last treatment, 7 years after the first surgery, with no apparent swelling of the scalp.", "summary": "An 81-year-old woman presented with a large swelling on the parietal scalp 12\u00a0years after resection of spiradenoma from the same site. The tumor showed intracranial invasion with involvement of the superior sagittal sinus and repeated recurrences after four surgeries with preservation of the sinus. The histopathological diagnosis was eccrine SC. Adjuvant high-precision external beam radiotherapy (EBRT) proved effective after the third surgery, achieving remission of the residual tumor. The patient died 7\u00a0years after the first surgery for SC.", "subclaim_evaluations": [ { "subclaim": "The patient was an 81-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a large swelling on the parietal scalp.", "support_label": "supported", "is_refined": false }, { "subclaim": "The swelling occurred 12 years after resection of spiradenoma from the same site.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor showed intracranial invasion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor involved the superior sagittal sinus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The histopathological diagnosis was eccrine spiradenocarcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "Adjuvant high-precision external beam radiotherapy was used after the third surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The radiotherapy achieved remission of the residual tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died 7 years after the first surgery for spiradenocarcinoma.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3037_en.txt", "fulltext": "A 70-year-old female patient with a medical history of fibromyalgia, dystonia, and Sjogren\u2019s disease, presented to our outpatient department complaining of unilateral right wrist joint pain with limited ROM, which worsened over several months. She reported tenderness over the scaphoid. Her active ROM was limited to 20\u00b0 of dorsal flexion and 10\u00b0 of palmar flexion, ROM stiffness was observed upon passive movement. A contralateral examination of the left wrist was unremarkable. Her symptoms began two years prior after sustaining a forceful dorsal impact to the wrist. She reported no pain and an intact range of motion before that injury. Initial radiographs did not demonstrate any acute fractures or other abnormalities. The patient was treated nonoperatively with non-steroidal anti-inflammatories (NSAIDs) and physiotherapy.\n\nAt follow-up one year later, the patient had mild improvement in symptoms, but pain persisted. Interval radiographs and computerized tomography (CT) were suggestive of arthritis and sclerosis at the proximal pole of the scaphoid. The scapholunate (SL) and lunotriquetral (LT) joint spaces were not altered. No acute or residual fractures were identified.\n\nIn retrospect, a CT scan revealed a subchondral crescent sign on the scaphoid, suggesting impending articular collapse due to osteonecrosis. The patient continued with non-operative management.\n\nAt two-years of follow-up, wrist pain had not improved. Magnetic resonance imaging (MRI) and repeat radiographs demonstrated diffused altered marrow signals in the scaphoid, which were suggestive of AVN. There was marked flattening of the scaphoid with collapse of the cancellous bone. Once again, no evidence of a fracture was appreciated. The presence of AVN, associated pain, and worsening symptoms were indications for surgical management.\n\nThe patient was consented for proximal row carpectomy. The wrist joint was accessed by a minimally invasive dorsal approach over the fourth extensor compartment with preservation of the retinaculum. The scaphoid, lunate, and triquetrum bones were excised. A neo-articulation between the capitate and lunate fossa of the radius was created. The scaphoid was excised en-bloc and was collapsed and flattened proximally with evidence of fragmentation, but no fracture.\n\nCross-section histological analysis of the scaphoid demonstrated diffuse AVN, suggestive of Preiser\u2019s disease. These findings were supported by intramedullary fat necrosis of the bone with resulting acellular bone trabeculae. Histology further examined the cross sections of the scaphoid bone and discovered the presence of marrow fibrosis.\n\nFor histological analysis, the specimen was placed in 10% buffered formalin for a minimum of 24\u2009h after the operation. Following fixation, the samples were placed in an adequate volume of demineralization solution (Cal-ExTM Decalcifying Fluid, Fisher ChemicalTM) and subsequently checked daily by a histotechnologist until deemed adequately demineralized for routine tissue processing, paraffin embedding, microtomy, and hematoxylin and eosin staining.\n\nPostoperatively, the patient experienced pain relief and improved wrist function. Wrist range of motion was still limited, but improved to injury baseline, and hand therapy was recommended.\n\nThe Herbert and Lanzetta grading scale [9] is used to assess the four stages of Preiser\u2019s disease, beginning with density (sclerotic) changes to the proximal pole of the scaphoid, to complete collapse of the carpal bones with osteoarthritis: Stage I \u2013 Normal radiograph and CT, may show MRI signal change; Stage II \u2013 Increased sclerotic density of proximal pole of scaphoid; Stage III \u2013 Fragmentation of proximal pole of scaphoid without pathologic fracture; Stage IV \u2013 Carpal collapse with osteoarthritis. MRI signal changes can be further graded using the Kalainov criteria, whereby Type I and II are differentiated by complete or incomplete necrosis of the scaphoid bone, respectively [10]. In line with these grading scales, our patient had Stage III Herbert and Lanzetta, with Type II Kalainov idiopathic AVN of the scaphoid.", "summary": "We describe a case of Preiser's disease in a 70-year-old female, with worsening pain and loss of range of motion in her right wrist over a two-year period. Past medical history was significant for Sjogren's disease, fibromyalgia, and dystonia. Pain began several months following traumatic right dorsal wrist injury. Diagnosis of traumatic scaphoid fracture was originally suspected. Conservative treatment was unsuccessful. Radiographs did not demonstrate evidence of primary fracture. CT scan and MRI demonstrated osteonecrosis of the proximal pole of the scaphoid, but no evidence of fracture, either residual or healing, was found. Proximal row carpectomy was performed for avascular necrosis of the scaphoid. Histology confirmed diagnosis and verified absence of fracture. Postoperatively, the patient's pain and range of motion improved.", "subclaim_evaluations": [ { "subclaim": "The patient is a 70-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had worsening pain in her right wrist over a two-year period.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had loss of range of motion in her right wrist.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her past medical history included Sjogren's disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her past medical history included fibromyalgia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her past medical history included dystonia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pain began several months after a traumatic right dorsal wrist injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "Traumatic scaphoid fracture was originally suspected.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Conservative treatment was unsuccessful.", "support_label": "supported", "is_refined": false }, { "subclaim": "Radiographs did not show evidence of primary fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "CT scan showed osteonecrosis of the proximal pole of the scaphoid.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed osteonecrosis of the proximal pole of the scaphoid.", "support_label": "supported", "is_refined": false }, { "subclaim": "No evidence of fracture was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "Proximal row carpectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was for avascular necrosis of the scaphoid.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histology confirmed the diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histology verified absence of fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperatively, the patient's pain improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperatively, the patient's range of motion improved.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_634_en.txt", "fulltext": "A 43-year-old man visited our hospital with left facial swelling involving the buccal and submandibular areas.\nA 43-year-old male patient was admitted to our outpatient department complaining of swelling and pain in the left hemifacial area which started two weeks prior to consult. The patient had fever for approximately 10 d, but no other systemic symptoms occurred. At the time of the visit, the patient had fever with a temperature of 38.0 \u00b0C.\nThe patient was diagnosed with diabetes mellitus treated with insulin. In addition, the patient had no history of illness associated with CNF, such as dental procedures, including tooth extraction, skin trauma, head and neck infections, and other facial fractures.\nThe patient had no medical history other than diabetes mellitus, and no family history of CNF.\nPreoperative: On physical examination, trismus and thinning of the skin with crepitation were observed on the left cheek. There were also no pathological findings on dental examination.\nPostoperative: On postoperative day (POD) 1, after surgical decompression by incision and drainage, the patient\u2019s systemic condition worsened, accompanied by tachycardia, hypotension, and overall deterioration of the patient\u2019s condition; hence, septic shock was considered.\nAt the time of hospitalization, the glycated hemoglobin (HbA1C) level was elevated at 17.1, indicating uncontrolled diabetes. The Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) scoring system was used for proper diagnosis of necrotizing fasciitis. Laboratory findings showed a high white blood cell (WBC) count (15170/\u03bcL; LRINEC score 1 point), a low hemoglobin level (10.5 g/dL; LRINEC score 2 points), an elevated high-sensitivity C-reactive protein (hs-CRP) level (212.94 mg/L; LRINEC score 4 points), a high glucose level (242 mg/dL; LRINEC score 1 point), and a slightly low sodium level (134 mmol/L; LRINEC score 2 points). The following results were normal: Creatinine, bilirubin, aspartate aminotransferase, and alanine aminotransferase. The patient had a score of 10 points in the LRINEC, indicating a high risk of CNF. In addition, the albumin level was low at 2.3 g/dL. Procalcitonin, measured on the 3rd d after admission, was elevated at 1.140 ng/mL (normal range: < 0.1 ng/mL). Blood cultures after admission, wound swabs, and tissue cultures of the surgical field showed gram-negative Klebsiella pneumoniae (K. pneumoniae).\nPreoperative: On facial CT, multiple abscesses with air bubble in the left temporal, masticator, and buccal spaces along the fascial layer were observed . Pleomorphic wall-enhancing lesions were also observed in the left masseter and temporalis muscles .\nPostoperative: On POD 1, follow-up CT revealed that the abscess pocket had become smaller. However, after decompression of the CNF, the patient\u2019s general condition deteriorated and progressed to septic shock. Contrast-enhanced chest CT was performed because multiple nodules were observed on chest X-ray upon admission . On chest CT on POD 2, septic emboli and pneumonia were observed in both lungs . In addition, a lesion suspected as renal abscess was observed on chest CT. On POD 3, contrast-enhanced abdominopelvic CT (APCT) was also done, which showed multiple variably-sized renal abscesses in both kidneys . This raised the suspicion that septic pneumonia and renal abscesses were the sources of sepsis.", "summary": "A 43-year-old man visited our hospital with left hemifacial swelling involving the buccal and submandibular areas. The patient had fever for approximately 10 d before visiting the hospital, but did not report any other systemic symptoms. Computed tomography scan demonstrated an abscess with gas formation. After surgical drainage of the facial abscess, the patient's systemic condition worsened and progressed to septic shock. Further examination revealed pulmonary and renal abscesses. Renal percutaneous catheter drainage was performed at the renal abscess site, which caused improvement of symptoms. The patient showed no evidence of systemic complications during the 4-mo post-operative follow-up period.", "subclaim_evaluations": [ { "subclaim": "The patient is a 43-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had left hemifacial swelling involving the buccal and submandibular areas.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had fever for approximately 10 days before visiting the hospital.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography scan demonstrated an abscess with gas formation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgical drainage of the facial abscess was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's systemic condition worsened after surgical drainage.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient progressed to septic shock.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pulmonary abscesses were found.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Renal abscesses were found.", "support_label": "supported", "is_refined": false }, { "subclaim": "Renal percutaneous catheter drainage was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient showed improvement of symptoms after renal percutaneous catheter drainage.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had no evidence of systemic complications during the 4-month post-operative follow-up period.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1523_en.txt", "fulltext": "A 20-years-old, British, male sustained cervical spinal cord injury (ASIA impairment scale B) at C-5 level in 1970 while teaching gymnastics. He was a physical training instructor in army and he landed on the wrong side of a trampoline. This gentleman had been managing his bladder by penile sheath drainage until 2013 when he underwent surgery for upper gastrointestinal bleeding. Since then, he had been draining urine by urethral Foley catheter.\nFollowing a routine change of urethral catheter by a health professional, this patient started sweating profusely. The Foley catheter was draining urine; there was no bypassing, no bleeding per urethra, and no haematuria. Patient\u2019s wife, who had been looking after her tetraplegic husband for more than forty years, told the health professionals that the catheter might have been placed incorrectly but her concerns were ignored by health professionals. Therefore, this patient came to spinal unit for advice. On clinical examination, this patient was sweating profusely over his head and face. Blood pressure was 140/70 mm Hg. The patient did not have symptoms of urine infection nor did he feel unwell. Ultrasound scan of urinary tract revealed no urinary calculi, no hydronephrosis. The balloon of Foley catheter was not seen in urinary bladder but this finding was not recognised by radiologist and spinal cord physician. Patient continued to sweat profusely; therefore, Computed Tomography (CT) of pelvis was performed, but there was a delay of ten days. Special attention was taken to include the entire urethra in addition to urinary bladder for scanning, as misplacement of urethral catheter was suspected by the spinal cord physician. CT revealed the balloon of Foley catheter in the over-stretched prostato-membranous urethra . The tip of Foley catheter was not located within the urinary bladder but was lying distal to bladder neck . Flexible cystoscopy was performed and Foley catheter was inserted into the bladder over a guide wire. The intensity of sweating decreased; noxious stimuli arising from traumatised urethra might take a long while to settle.\n24-hours ECG monitoring revealed bradycardia: slowest being 39 beats per minute , 214 episodes, and 36 beats at 00:09:04. There was a pause of 2.08 seconds at 22:14:51 . X-ray of pelvis revealed marked osteoarthritic changes in both hips; X-ray of lumbar spine revealed slight scoliosis concave to the right; anterior hyperostosis, most marked at L4/5; disc spacing was well maintained.\nUltrasound scan revealed normal size right kidney measuring 12.5 cm with no hydronephrosis or calculi. The left kidney was atrophic measuring 8.4 cm, cortical depth of 14.1 mm. No calculus was seen. Blood tests: Urea: 5.9 mmol/L; Creatinine: 69 micromol/L; HbA1c: 36 mmol/mol; PSA: 0.15 ug/L. Urine culture yielded growth of >108/L of Staphylococcus aureus. Cytology of urine revealed abundant neutrophils and red cells. Groups of urothelial cells were seen with slightly enlarged nuclei. Some of the groups have a vaguely papillary appearance, which could be seen in low-grade urothelial neoplasms, infection, instrumentation or stones. A follow-up urine cytology revealed a few inflammatory cells and urothelial cells. No malignant cells were seen.", "summary": "A tetraplegic patient started sweating profusely following insertion of a Foley catheter per urethra. The catheter was draining urine; there was no bypassing, no bleeding per urethra, and no haematuria. Patient's wife, who had been looking after her tetraplegic husband for more than forty years, told the health professionals that the catheter might have been placed incorrectly but her concerns were ignored. Ultrasound scan of urinary tract revealed no urinary calculi, no hydronephrosis. The balloon of Foley catheter was not seen in urinary bladder but this finding was not recognised by radiologist and spinal cord physician. Patient continued to sweat profusely; therefore, CT of pelvis was performed, but there was a delay of ten days. CT revealed the balloon of Foley catheter in the over-stretched prostate-membranous urethra; the tip of catheter was not located within the urinary bladder but was lying distal to bladder neck. Flexible cystoscopy was performed and Foley catheter was inserted into the bladder over a guide wire. The intensity of sweating decreased; noxious stimuli arising from traumatised urethra might take a long while to settle.", "subclaim_evaluations": [ { "subclaim": "The patient is tetraplegic.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient started sweating profusely after insertion of a Foley catheter per urethra.", "support_label": "supported", "is_refined": false }, { "subclaim": "The catheter was draining urine.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no bypassing of the catheter.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no bleeding per urethra.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no haematuria.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's wife had been caring for her husband for more than forty years.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's wife suggested the catheter might have been placed incorrectly.", "support_label": "supported", "is_refined": false }, { "subclaim": "The wife's concerns were ignored.", "support_label": "supported", "is_refined": false }, { "subclaim": "An ultrasound scan of the urinary tract showed no urinary calculi.", "support_label": "supported", "is_refined": false }, { "subclaim": "The ultrasound scan showed no hydronephrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The balloon of the Foley catheter was not seen in the urinary bladder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The radiologist did not recognize the balloon's location.", "support_label": "supported", "is_refined": false }, { "subclaim": "The spinal cord physician did not recognize the balloon's location.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient continued to sweat profusely.", "support_label": "supported", "is_refined": false }, { "subclaim": "A CT of the pelvis was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a ten-day delay before the CT was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The CT revealed the balloon of the Foley catheter in the over-stretched prostate-membranous urethra.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tip of the catheter was not located within the urinary bladder.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tip of the catheter was lying distal to the bladder neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "Flexible cystoscopy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The Foley catheter was inserted into the bladder over a guide wire.", "support_label": "supported", "is_refined": false }, { "subclaim": "The intensity of sweating decreased after the catheter was correctly placed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Noxious stimuli from the traumatised urethra might take a long while to settle.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_1756_en.txt", "fulltext": "A 76-year-old Caucasian female with known hypertension and dyslipidaemia presented with 2 weeks of intermittent palpitations, orthopnoea, and New York Heart Association functional class III\u2013IV shortness of breath. On exam, the patient was not in acute distress; however, extremities were cool and clammy. Heart auscultation revealed normal heart sounds, no murmurs, rubs, or gallops but the rhythm was irregularly irregular at \u223c100 b.p.m. The jugular venous pressure was elevated at the angle of the jaw and there was a positive abdominojugular reflux sign. Auscultation of the lungs revealed bilateral crackles up to mid chest with decreased air entry at the bases. The abdomen was soft, non-tender, and non-distended.\nIn the emergency department, she was in uncontrolled atrial fibrillation (AF) with a left bundle branch block with clinical evidence of decompensated heart failure and her chest X-ray confirming evidence of pulmonary oedema with bilateral pleural effusions. There was no prior electrocardiogram for comparison. She was admitted for intravenous diuresis [initially with Furosemide 80 mg intravenously (IV) once then Furosemide infusion 20 mg/h] and rate control (initially with metoprolol 5 mg IV once then transitioned to oral metoprolol with an intravenous digoxin load). Over the next few hours, she became increasingly diaphoretic, tachycardic, and hypotensive at 60/30 mmHg. High-sensitivity troponin increased to 2040 ng/L (reference value \u226430 ng/L) from 13 ng/L, and serum lactate was 7.1 mmol/L (reference value 0.5\u20132.2 mmol/L). She also developed anuric acute kidney injury with an increase in serum creatinine from 58 to 122 \u03bcmol/L (reference value 50\u201398 \u03bcmol/L). Other admission labs are shown in . She was started on dual antiplatelet therapy (ASA 81 mg orally daily, clopidogrel 75 mg orally daily, and fondaparinux 2.5 mg subcutaneously daily) for suspected acute coronary syndrome and vasopressors to maintain perfusion. Point-of-care ultrasound demonstrated significant biventricular systolic dysfunction, a plethoric non-collapsible inferior vena cava, and diastolic flattening of the interventricular septum suggesting volume overload of the right ventricle.\nThe following differential diagnoses were considered at that time:\nAcute coronary syndrome and possible mechanical complication with right ventricular (RV) infarction.\nUnderlying cardiomyopathy and/or pulmonary hypertension and superimposed acute decompensation.\nMassive pulmonary embolism.\nAs the patient was in extremis, she was intubated for emergent cardiac catheterization. She was initiated on epinephrine, norepinephrine, and vasopressin prior to arrival to the catheterization lab. Angiographically, the left main coronary artery (LMCA), left anterior descending (LAD), and left circumflex (LCx) arteries were very large, ectatic vessels with no flow-limiting stenosis. The right coronary artery (RCA) ostium could not be engaged from the aorta despite multiple attempts. Contrast injection into the left coronary system showed what appeared to be retrograde filling of the RCA via multiple left-to-right collateral vessels ( and Video 1A and B). On further review, it was felt that the RCA was emptying back into the pulmonary artery/right ventricular outflow tract (RVOT).\nThe possibility of an anomalous coronary artery (ACA) as the underlying aetiology of the patient\u2019s shock prompted an ad hoc right heart catheterization for haemodynamic assessment. Measurements are shown in . An oximetry run did not suggest the presence of an intra-cardiac left-to-right shunt. Pulmonary artery angiography did not identify any pulmonary embolus or fistula involving the RVOT. The pulmonary vascular resistance was 0.87 Wood units and the systemic vascular resistance was 6.39 Wood units. An RV angiogram demonstrated significant tricuspid regurgitation (TR) with a dilated and severely dysfunctional right ventricle. It was felt that the cause of the patient\u2019s cardiogenic shock was due to underlying severe RV dysfunction with either AF or other catecholaminergic state triggering decompensation. The elevated cardiac index prompted consideration of sepsis on the differential diagnosis and the patient accordingly received empiric antibiotics (Piperacillin/Tazobactam 4.5 g IV every 6 h, Vancomycin 1 g IV every 12 h, and Doxycycline 100 mg orally twice daily). She returned to the cardiovascular intensive care unit (CVICU) for further physiologic support.\nFormal echocardiography while in the CVICU demonstrated severely reduced RV systolic function, right atrial dilatation, and severe TR. The overall left ventricular systolic function was low-normal with an ejection fraction between 50% and 55% and no regional wall motion abnormalities. A transoesophageal echocardiogram ruled out vegetations but corroborated findings from the patient\u2019s cardiac catheterization including a dilated and tortuous LMCA and branches, as well as a dilated and tortuous vessel draining into the pulmonary artery. This vessel was felt to be likely the RCA. Overall, these findings were consistent with a diagnosis of ARCAPA (see and Video 2).\nIn the CVICU, the patient was maintained on inotropes and vasopressors. High-sensitivity troponin plateaued at 26 040 ng/L and this was felt to be consistent with an RV infarction. In the setting of concomitant volume overload and anuric acute kidney injury, continuous renal replacement therapy was initiated. She was subsequently found to be bacteremic with positive blood cultures for Streptococcus bovis but not stable enough to pursue a colonoscopy to rule out a gastrointestinal malignancy; management consisted of antimicrobial therapy (ceftriaxone/metronidazole) with consultation from infectious diseases.\nThe patient\u2019s clinical status eventually stabilized enough to be extubated and transferred to the cardiology ward, although she remained dependent on intermittent haemodialysis without expected renal recovery. Potential therapeutic options for ARCAPA were discussed at interdisciplinary heart team rounds but unfortunately, she was felt not to be a surgical candidate in view of her age and clinical status. The patient decided to pursue comfort measures and requested cessation of dialysis. She was transferred to a hospice for palliative care and passed away just over a month later.", "summary": "We present a case of a 76-year-old female presenting with 2 weeks of palpitations and shortness of breath who was found to be in rapid atrial fibrillation (AF) with congestive heart failure. Despite initial medical management, the patient developed cardiogenic shock with anuric renal failure. Emergent right and left heart catheterization did not demonstrate any significant obstructive coronary artery disease but showed severe right ventricular (RV) failure and raised the possibility of an ARCAPA. This diagnosis was further corroborated by findings on a subsequent transoesophageal echocardiogram. In view of profound decline and limited anticipated improvement, the patient ultimately decided to pursue comfort measures in a hospice setting.", "subclaim_evaluations": [ { "subclaim": "The patient is a 76-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had 2 weeks of palpitations.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had shortness of breath.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was found to be in rapid atrial fibrillation.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had congestive heart failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "She developed cardiogenic shock.", "support_label": "supported", "is_refined": false }, { "subclaim": "She developed anuric renal failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Emergent right and left heart catheterization did not show significant obstructive coronary artery disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The catheterization showed severe right ventricular failure.", "support_label": "supported", "is_refined": false }, { "subclaim": "The catheterization raised the possibility of an ARCAPA.", "support_label": "supported", "is_refined": false }, { "subclaim": "A transoesophageal echocardiogram corroborated the ARCAPA diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient decided to pursue comfort measures.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient chose hospice care.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2523_en.txt", "fulltext": "A 69-year-old female presented with chest and severe upper back pain, but neurologically intact. The first chest computed tomography (CT) was interpreted as normal . Over the next 2 months, she progressively developed anorexia and the inability to belch. Esophageal stricture and thoracic vertebra OVF were suspected based on the results of the second chest CT . Thoracic magnetic resonance (MR) and CT studies revealed a T7 OVF with a kyphotic deformity . Twice, she underwent esophagogastroscopy that showed no obstruction. As her symptoms were attributed, therefore, to the T7 OVF, she underwent a T7 BKP resulting in an improved kyphotic angle from 22.4 degrees to 17 degrees . In addition, this resulted in resolution of her symptoms.", "summary": "A 69-year-old female presented with back pain. 2 months later, she developed anorexia and difficulty belching. The thoracic magnetic resonance (MR) demonstrated a T7 OVF. As she ultimately underwent a balloon kyphoplasty (BKP), as conservative treatment was unsuccessful.", "subclaim_evaluations": [ { "subclaim": "The patient is a 69-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with back pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two months later, she developed anorexia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had difficulty belching.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thoracic MR demonstrated a T7 OVF.", "support_label": "supported", "is_refined": false }, { "subclaim": "She ultimately underwent a balloon kyphoplasty.", "support_label": "supported", "is_refined": false }, { "subclaim": "Conservative treatment was unsuccessful.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2173_en.txt", "fulltext": "A 47-year-old woman presented with complex bilateral renal stones and was referred to our hospital for surgical treatment due to failure of conventional PCNL performed at another hospital. Initially, we performed mini-ECIRS for the right renal stone, which was later identified as calcium oxalate, without any complications and residual stones.\nThree months after the first mini-ECIRS, she underwent a second mini-ECIRS for the left renal stone. Laboratory studies showed normal values of serum inflammatory markers, liver and renal function, mineral markers, and urinary parameters. Multi-slice computed tomography and kidney-ureter-bladder radiography revealed a stone (size, 6.5 \u00d7 2.2 \u00d7 2.4 cm3) with left calyceal fragment . Mini-ECIRS was performed in the prone position, and supra-12th rib access was obtained with a single pass of the 16.5/17.5-Fr metal sheath with a 12-Fr nephroscope under combined US and ureteroscopy guidance. During puncture, we identified the pleural space and pleural line under US to avoid penetration. After puncture, we checked intraoperative fluoroscopy to evaluate potential chest complications. Using the holmium YAG-laser through the rigid nephroscope, all parts of the collecting system and a part of the main stone were cleared. Finally, an ureteral stent without a nephrostomy tube was placed after the procedure. The operative time was 3 h, with no intraoperative complications and an estimated blood loss of <100 cc.\nOn POD 1, the patient developed shortness of breath. Tachypnea with normal vital signs was noted with deteriorating breath sounds on the left side. Chest radiography confirmed left pleural collection . Her hemoglobin level, which was 12.0 g/dL at discharge, had dropped to 11.0 g/dL. On consultation with the thoracic surgeon, she was conservatively managed without any treatment for several days. On POD 5, a 16-Fr tube was placed for left intercostal drainage under local anesthesia with ultrasonography guidance by the standard technique because of the aggravation of hemothorax . A small volume of old blood was drained without improved expansion of the left lower and middle lobes . On POD 9, VATD was performed for the hemothorax. During intraoperative monitoring, some abscesses were observed in the hemothorax, which appeared to be empyema; moreover, a scar hole that had been punctured through the pleural cavity during mini-ECIRS was identified . Thereafter, blood clot evacuation, decortication, and ablation were performed by VATD. At the end of the procedure, the 20-Fr chest tubes were retained . On POD 14, she was discharged after retrieval of the chest tube. Follow-up evaluation showed satisfactory expansion of the left lung with complete resolution of all chest symptoms .", "summary": "A 47-year-old woman with left staghorn kidney stone underwent mini-endoscopic combined intrarenal surgery, after which she developed shortness of breath. Chest radiography and computed tomography confirmed left hemothorax. Conservative management and left intercostal chest drainage were performed without improvement. Subsequently, video-assisted thoracoscopic debridement was performed.", "subclaim_evaluations": [ { "subclaim": "The patient is a 47-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a left staghorn kidney stone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent mini-endoscopic combined intrarenal surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed shortness of breath after the surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest radiography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Computed tomography was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chest imaging confirmed left hemothorax.", "support_label": "supported", "is_refined": false }, { "subclaim": "Conservative management was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Left intercostal chest drainage was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no improvement after conservative management and chest drainage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Video-assisted thoracoscopic debridement was performed.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_927_en.txt", "fulltext": "We report here two cases of pulmonary hypertension after the second dose of the Pfizer mRNA COVID-19 vaccine (BNT162b2).\nCase #1 is a previously healthy 49-year-old male physician athlete, body mass index (BMI) 23, non-smoker with a history of mild exercise-induced asthma treated with albuterol. The patient completed the primary series of Pfizer mRNA COVID-19 vaccine (BNT162b2), Dose 1 in December 2020 and Dose 2 in January 2021. Approximately three weeks after the second dose, the patient suddenly developed severe fatigue, flu-like symptoms, tachycardia, palpitations, orthostasis, right-sided chest pressure and dyspnea on exertion. SARS-CoV-2 polymerase chain reaction (PCR) testing was negative at the time of the onset of these symptoms. Transthoracic echocardiogram revealed normal left ventricular function with an ejection fraction (EF) of 65%, normal right ventricular size and function and a maximal tricuspid regurgitation velocity (TRVmax) of 3.09 m/s. The estimated right ventricular systolic pressure (RVSP) of 42 mmHg was interpreted as mild/moderate pulmonary hypertension . Laboratory studies including measurement of brain natriuretic peptide (BNP) (22 pg/mL; reference range < 900 pg/mL) were unremarkable except for elevated low-density lipoprotein (LDL) cholesterol and a hematocrit of 50%. Pulmonary computer tomography (CT) angiogram with 3D reconstruction of the PA tree was normal without evidence of pulmonary clots . The patient subsequently developed 15 lbs of fluid gain and generalized swelling, neck pressure, headaches and a feeling of \u201cbeing hung upside down\u201d consistent with jugular vein distention (JVD) and cerebral venous congestion. The resting oxygen saturation (SpO2) was 92% and there was new onset systolic and diastolic arterial hypertension. Symptoms and chest pressure occurred at rest and were exacerbated by exertion. Exercise and functional limitations were consistent with New York Heart Association (NYHA) Class 3\u20134. Serial echocardiograms showed no worsening of RVSP and continued normal RV function . Symptoms and exercise tolerance improved to NYHA class 1\u20132 over one year. Fluid weight gain, swelling, tachycardia and arterial hypertension resolved and the resting SpO2 increased to 98\u2013100%. Flu-like symptoms and fatigue diminished but did not disappear. RVSP remained elevated and essentially unchanged by follow up echocardiography . This case was reported to the Vaccine Adverse Event Reporting System (VAERS ID 1039123).\nCase #2 is a previously healthy and active 56-year-old male, BMI 25, non-smoker, with a history of spontaneous deep venous thrombosis (DVT) on two occasions which were resolved with courses of anticoagulation without symptoms of pulmonary emboli. Hematologic investigation identified no clotting abnormalities. In 2005, an incidental isolated left superior vena cava was suspected by an otherwise normal transthoracic echocardiogram and confirmed by cardiac magnetic resonance imaging (MRI). The patient completed the primary series of Pfizer mRNA COVID-19 vaccine (BNT162b2) Dose 1 and Dose 2 in April 2021. Twelve days after the second dose, the patient experienced sudden onset fatigue, flu-like symptoms and dyspnea on exertion. SARS-CoV-2 PCR testing was negative at the time of the onset of these symptoms. Exercise tolerance was consistent with NYHA Class 2. The patient sought medical attention two weeks later, but a stress echocardiogram and CT pulmonary angiography were not performed until almost 4 months after vaccination. The stress echocardiogram revealed normal left ventricular function, an ejection fraction (EF) of 60%, ventricular ectopy and mild right-sided chamber enlargement. No right-sided pressures were measured. A pulmonary CT angiogram with 3D reconstruction revealed mosaic attenuation of lung parenchyma with relative pruning of distal pulmonary vessels and mild enlargement of the PA without evidence of pulmonary emboli . A Ventilation Perfusion (V/Q) scan was interpreted as near normal and a very low probability for pulmonary emboli. Despite the negative studies, anti-coagulation with rivaroxaban was started out of an abundance of caution due to patient\u2019s distant history of DVT. A complete echocardiogram performed 5 months after vaccination measured a TRVmax of 2.82 m/s and calculated an RVSP of 40 mm Hg , suggesting a diagnosis of pulmonary hypertension. Follow-up echocardiography three months later measured a TRVmax of 3.22 m/s and estimated an RVSP of 46 mmHg . Subsequent right heart catheterization confirmed the diagnosis with directly measured systolic and diastolic PA pressures (PAP) of 44/18 mm Hg (mean 28 mm Hg) and elevated pulmonary vascular resistance (PVR) calculated at 3.6 Woods units. An endothelin receptor antagonist was prescribed and then a phosphodiesterase inhibitor. Fifteen months after vaccination, the patient\u2019s exercise tolerance remained unchanged and consistent with NYHA Class 2 and the RVSP remained elevated at 49 mm Hg, estimated by a TRVmax of 3.22 m/s . The patient\u2019s course was complicated by transient episodes of new onset atrial fibrillation. BNP remained in normal range at 99 pg/mL. A subsequent Cardiac MRI revealed a mildly enlarged right ventricle with normal systolic function and normal main PA. A pulmonary hypertension screening panel by Invitae Genomics was negative for twelve genetic predisposition markers.\nThe clinical findings of the two cases are summarized in .", "summary": "Pulmonary hypertension in previously healthy adult males occurred within three weeks of receiving the second dose of the Pfizer (BNT162b2) mRNA COVID-19 vaccine from different lots. Both patients experienced a sudden onset of severe fatigue and dyspnea on exertion with negative severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) polymerase chain reaction (PCR) testing. The diagnosis was made by serial transthoracic echocardiography in the first case and by both transthoracic echocardiography and right heart catheterization in the second. Both cases resulted in functional limitations and likely permanent organ damage. No evidence of pulmonary emboli was detected in either case.", "subclaim_evaluations": [ { "subclaim": "Two previously healthy adult males developed pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pulmonary hypertension occurred within three weeks of receiving the second dose of the Pfizer (BNT162b2) mRNA COVID-19 vaccine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The vaccines were from different lots.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Both patients experienced sudden onset of severe fatigue.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both patients experienced dyspnea on exertion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both patients had negative SARS-CoV-2 PCR testing.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made by serial transthoracic echocardiography in the first case.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was made by right heart catheterization in the second case.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both cases resulted in functional limitations.", "support_label": "supported", "is_refined": false }, { "subclaim": "Both cases likely resulted in permanent organ damage.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "No evidence of pulmonary emboli was detected in either case.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_339_en.txt", "fulltext": "We present a case of 49 years old Caucasian male suffering from congenital lymphoedema of the left lower extremity who developed composite haemangioendothelioma during his adulthood. Because of the lymphoedema, the patient was first operated on at the age of 6 years, which had only a minor effect on overall condition of the patient. Later on in his life, he experienced multiple erysipelas and at the age of 47 a vascular tumour was detected in the setting of the lymphoedema as its complication. In another institution, a microscopically non-radical (R1) resection was performed and a diagnosis of angiosarcoma was concluded based on the histopathological evaluation of the tumour. The patient was not indicated for any adjuvant therapy, or re-resection. He was followed up and the first control PET/CT scan showed neither local relapse nor distant spread. Local progression was detected after one year of follow up and the patient was re-operated. Second R1 resection was performed and subsequent histopathological examination revealed an angiosarcoma again. This diagnosis was supported by an early second local relapse after a month. After that, the patient was reported to our sarcoma centre for further treatment.\nDuring the clinical investigation, two purple skin affections in the popliteal area at the edges of the dermo-epidermal mesh skin graft were found . The left lower extremity showed chronic disfiguration as a result of multiple erysipelas and chronic lymphoedema. Scattered ecchymoses were also present. In the left gluteal area, multiple small nonspecific purple skin affections were visible. For staging purposes, whole-body PET/MR was performed and revealed multiple small subcutaneous nodules located in the left gluteal area, left calf and left hamstring area . Every nodule demonstrated low metabolic activity; however, the finding raised clinical suspicion for metastases of the previously diagnosed angiosarcoma. During the multidisciplinary tumour board, a bioptic confirmation of the process within gluteal space was indicated. Under local anaesthesia excision biopsy of the skin affection in the gluteal area was performed and sent for histopathological analysis. Within dermis, there was a cavernous vascular tumour (diameter 5 mm) detected, which consisted of dilated thin-walled lymphatic vessels containing papillary protrusions at the periphery. The papillary protrusions contained hyalinised cores in the centre and were covered with columnar endothelial cells with hobnail or even matchstick-like features. There were present neither mitoses nor severe nuclear atypia. Immunohistochemistry (IHC) showed diffuse positivity of the neoplastic cells for CD31, ERG and FLI-1. Tumour showed also focal D2-40 positivity within slit-like spaces at the periphery. IHC markers CD34, HHV-8, CK-KL1 and smooth muscle actin were negative. Based on the clinical background (localization within the dermis of the gluteal area), morphology and immunophenotype of tumorous cells, the suspicion for papillary intralymphatic angioendothelioma (PILA) was raised in contrast to the previous diagnosis . The expected structures of angiosarcoma were not identified within the sample.\nTo evaluate the uncertain undergoing process, the next multidisciplinary meeting led to an indication for excision of the recurrent focus and bioptic evaluation of the nodules of the calf and gluteal area. The operation was performed in February 2022 in form of an excision of two skin affections of the popliteal area (diameter 43 and 78 mm) and another biopsy of the tumour in the calf and gluteal area (diameter 20 mm and 10 mm). Histopathological examinations showed a new finding \u2013 the dermal-based vascular tumour with the retiform arrangement was detected, which consisted of branching vascular channels lined with hobnail-shaped bland endothelial cells. At some portions, papillary protrusions with hyalinised cores were found. There were neither mitoses nor nuclear atypia again. On the other hand, no association with the lymphatic vessels was found this time. IHC showed diffuse CD31 positivity and CD34 negativity of the neoplastic cells. Proliferation marker Ki-67 was low with positivity in approximately 10% of the cells within hot spots. Even though the histopathological finding was similar to the previous sample, due to the multifocality of the process, arborizing retiform architecture of the tumour and lacking association with lymphatic vessels in the current biopsy, the diagnosis of retiform haemangioendothelioma was made.\nBecause of the absence of angiosarcomatous structures, the original bioptic material was obtained from the first resection for the second opinion. But, the second look examination confirmed the former diagnosis of HG angiosarcoma: at the border between dermis and sub-cutis there was an infiltration of solid tumour consisting of elongated oval to spindle shaped cells showing marked nuclear atypia and numerous mitoses, including atypical forms. Erythrocytes filled slit-like spaced dissecting the solid areas were detected. IHC showed a similar immune profile of the neoplastic cells (CD31 positive; CD34 and D2-40 negative) and significantly higher proliferation (40\u201350%) based on the Ki-67 proliferation marker. Such a finding was consistent with the original diagnosis of HG angiosarcoma . However, at the base of the sample, small areas with a morphology of retiform haemangoendothelioma similar to the previous finding were spotted.\nBased on the histopathological findings of three different vascular components resembling PILA, retiform haemangioendothelioma and HG angiosarcoma, the final diagnosis of CHE with HG angiosarcoma-like areas was established.\nRecently it has been discovered that CHE can harbour a fusion gene YAP1::MAML2, especially among children with acral localisation of the tumour . We performed next-generation sequencing (NGS) to investigate this gene fusion and to exclude other entities which could mimic such lesion. Using Fusion Plex Sarcoma V2 panel (Archer) the fusions of the following genes were excluded: ALK, BCOR, BRAF, CAMTA1, CCNB3, CIC, CSF1, EGFR, EPC1, ERG, ESR1, ETV1, ETV4, ETV5, ETV6, EWSR1, FGFR1, FGFR2, FGFR3, FOS, FOSB, FOXO1, FUS, GLI1, HMGA2, JAZF1, MBTD1, MDM2, MEAF6, MET, MGEA5, MKL2, NCOA1, NCOA2, NCOA3, NR4A3, NTRK1, NTRK2, NTRK3, NUTM1, PAX3, PDGFB, PDGFRA, PHF1, PLAG1, PRKCA, PRKCD, RAF1, RET, ROS1, SS18, STAT6, TAF15, TCF12, TFE3, TFG, USP6, VGLL2, YAP1, YWHAE).\nIn conclusion no gene fusion was identified, including YAP1::MAML2. However this finding does not exclude the diagnosis of CHE as for such gene fusion usually does not occur among adult patients outside acral localisations . Moreover, we also examined MYC amplification using fluorescent in situ hybridisation (FISH) as there is an evidence in literature that high-level MYC gene amplifications (at 8q24.21) occur in majority of post-irradiation and chronic lymphoedema-associated angiosarcomas . However MYC amplification was not found in this case, which further supports the diagnosis of CHE favouring it over angiosarcoma.\nEven though CHE usually shows indolent behaviour, the multifocality of the process in the setting of chronic lymphoedema allowed radical surgical treatment, which would have to be hemipelvectomy in this case. Such a procedure was rejected by the patient. Therefore, the current course of action is the follow up with periodical PET/MR scans. In case of local progression of any nodule, the patient would be indicated for the extirpation of the lesion. However, no growth of the remaining lesions was detected in the follow-up so far and there has been no metastatic spread of the disease since the first detection of the tumour two years ago.", "summary": "We present a case of 49 years old male suffering from chronic lymphoedema of the left lower extremity who had developed a composite haemangioendothelioma with high grade angiosarcoma-like areas mimicking the Stewart-Treves syndrome. Given the multifocality of the disease, the only potentially curable surgical treatment would be hemipelvectomy, which was refused by the patient. The patient has been followed-up, with no signs of local progression of the remaining disease, nor a distant spread outside the involved extremity for two years.", "subclaim_evaluations": [ { "subclaim": "The patient is a 49-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has chronic lymphoedema of the left lower extremity.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed a composite haemangioendothelioma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The haemangioendothelioma had high-grade angiosarcoma-like areas.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion mimicked Stewart-Treves syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The disease was multifocal.", "support_label": "supported", "is_refined": false }, { "subclaim": "Hemipelvectomy was considered the only potentially curable surgical treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient refused hemipelvectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was followed up for two years.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no signs of local progression of the remaining disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no distant spread outside the involved extremity.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3374_en.txt", "fulltext": "A 27-year-old black (\u201cHabesha\u201d) lactating woman with gravida 2, para 1, and abortion 1 was referred to our hospital from one of the local health centres with the diagnosis of chronic pelvic pain. Over the previous year, she had multiple visits to different health centers, was repeatedly given medications for acute PID, and was also prescribed different anti-pain medications. Her last delivery was one year ago; it was via cesarean section and uncomplicated. A CU-IUD was provided six weeks after her delivery while she was still breast-feeding. The procedure was followed by abdominal cramps and mild bleeding, which lasted several days.\n\nThree months after insertion, she went to the health center because she could not feel the strings. At that time, a presumptive diagnosis of spontaneous expulsion was made. No further attempts were made to confirm its location. She was also not provided with another family planning during that visit. Upon arrival at our hospital, she complained of dull and aching pain in the lower quadrant of eight-month duration. Otherwise, she has no other complaints. Her vital signs were within the normal range; her BMI (20.5) and CBC parameters were within normal limits. A bimanual examination was performed to reveal a tender 3 cm by 3 cm cul-de-sac mass with no clear distinction from the uterus, and a speculum examination was nonrevealing. Pelvic ultrasound showed an undefined posterior cul-de-sac mass. Futher investigation modalities such as laparoscopy and CT were discussed with the patient, but she could not afford them.\n\nSubsequently, suspecting an intraperitoneal IUD from history and the finding of pelvic mass on ultrasound, the radiologist performed an abdominal erect X-ray with a uterine probe inside in the AP and lateral planes, which both showed that the T-shaped CU-IUD is near and posterior (in the lateral plane) to the uterus.\n\nFinally, a laparotomy was decided and the abdominal cavity was accessed by making a 5-cm incision on a previous transverse skin incision. A careful palpation of the pelvic cavity was performed to determine the specific location, and a string was palpated over the posterior wall of the uterus. On close examination, the IUD was found to be enclosed in a mass formed by the left ovary and the left fallopian tube, which adhered to the posterior wall of the uterus at the junction of the body and the cervix.\n\nConsidering that part of the string was protruding from the mass, the bowel, vessels, and other pelvic structures were examined for perforation, and there was no perforation. Subsequently, after adhesion was removed, the entire IUD (stem, arms, and string) was retrieved from the mass. The uterus was examined and was in a normal anatomic position. Minor surface bleeding from the posterior wall of the uterus and the adnexa was arrested with pressure. After ascertaining hemostasis, the operation was completed. As part of family planning, she was counseled, provided Implanon-NXT, and discharged without complications two days after surgery. Two weeks following the surgery, she stated that her pain had significantly decreased.", "summary": "We discuss the case of a 27-year-old black Ethiopian woman who presented with chronic pelvic pain and had a perforated intrauterine device discovered in the cul-de-sac. The device had been inserted at six weeks postpartum. The client was unable to feel the strings three months after insertion, and a wrong diagnosis of expulsion was made. After one year of insertion, the intrauterine device was located on a plain abdominal radiograph and removed via laparotomy without complications.", "subclaim_evaluations": [ { "subclaim": "The patient is a 27-year-old black Ethiopian woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She presented with chronic pelvic pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "A perforated intrauterine device was discovered in the cul-de-sac.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The intrauterine device had been inserted at six weeks postpartum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The client was unable to feel the strings three months after insertion.", "support_label": "supported", "is_refined": false }, { "subclaim": "A wrong diagnosis of expulsion was made.", "support_label": "supported", "is_refined": false }, { "subclaim": "After one year of insertion, the intrauterine device was located on a plain abdominal radiograph.", "support_label": "supported", "is_refined": false }, { "subclaim": "The intrauterine device was removed via laparotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The removal was performed without complications.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1313_en.txt", "fulltext": "A 9-year-old boy presented to our clinic with myopia, and he had reported a history of myopic progression that had not been arrested using orthokeratology lenses for 23 months. He had no medical history of glaucoma or pigment dispersion syndrome. On ocular examination, his best-corrected distance visual acuity (BCVA) was 20/20 in both eyes. The refractive power was \u22121.50 Dsph \u22120.25 Dcyl Axis 110 in the right eye and \u22122.00 Dsph \u22120.25 Dcyl Axis 50 in the left eye. The refractive corneal power was 42.18 D in the right eye and 41.77 D in the left eye. On slit-lamp examination, the cornea and conjunctiva were unremarkable, and there was no evidence of active inflammation in the anterior chamber or neovascularization in the iris. Corneal topography showed slight lateral decentration in both eyes (shown in ). The axial length was 25.39 mm in the right eye and 25.24 mm in the left eye, and the anterior chamber depth was 3.79 mm in the right eye and 3.77 mm in the left eye, as measured by AL-Scan (Nidek Co., Ltd., Gamagori, Japan) (shown in ). The intraocular pressure measured using air-puff non-contact tonometer was 20 mm Hg in the right eye and 21 mm Hg in the left eye. An intraocular pressure of between 10 and 21 mm Hg is defined as the normal range, as reported in previous studies.\nOn ocular examination 2 weeks after the patient discontinued the use of orthokeratology lenses, his refraction was \u22122.50 Diopter in the right eye and \u22123.50 Diopter in the left eye, and the best-corrected distance visual acuity was 20/20 in both eyes. We recommended that the patient\u2019s parents refit the orthokeratology lens; however, the parents wanted to keep the orthokeratology lens because of cost considerations. The patient was prescribed topical 0.125% atropine eye drops two times a day in both eyes to prevent myopia progression and maintain the orthokeratology lenses.\nThree days after the treatment, his intraocular pressure rose to 36 mm Hg in the right eye and 32 mm Hg in the left eye, and the best-corrected distance visual acuity was 20/200 in the right eye and 20/100 in the left eye. On slit-lamp examination, the cornea and conjunctiva were unremarkable, and there was no evidence of active inflammation in the anterior chamber. The patient did not use any eye drops or medications, including steroids, did not eat any unusual foods, and did not exhibit any behaviors that increased intraocular pressure, such as Valsalva.\nBecause of the high intraocular pressure, the patient was started on dorzolamide and timolol eye drops twice daily, and 0.125% atropine eye drops and orthokeratology lenses were discontinued. One day later, the intraocular pressure was 26/24 mm Hg, and 2 days later, the intraocular pressure was 21/20 mm Hg. Two months after the discontinuation of all eye drops and orthokeratology lenses, the best-corrected distance visual acuity was 20/20 in both eyes, and the intraocular pressure was 19/20 mm Hg.", "summary": "A 9-year-old boy presented to our clinic with myopia, and he had been wearing orthokeratology lenses overnight for 23 months. He was treated previously with a once-daily administration of topical 0.125% atropine eye drops to reduce myopic progression. Three days after treatment, his intraocular pressure was 36 mm Hg in the right eye and 32 mm Hg in the left eye. Two days after the discontinuation of atropine eye drops and overnight orthokeratology lenses, the intraocular pressure was 18/20 mm Hg in both eyes.", "subclaim_evaluations": [ { "subclaim": "The patient is a 9-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with myopia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had been wearing orthokeratology lenses overnight.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had been wearing orthokeratology lenses for 23 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with once-daily topical 0.125% atropine eye drops.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The treatment with atropine eye drops was intended to reduce myopic progression.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three days after treatment, the intraocular pressure was 36 mm Hg in the right eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three days after treatment, the intraocular pressure was 32 mm Hg in the left eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "The atropine eye drops were discontinued.", "support_label": "supported", "is_refined": false }, { "subclaim": "The orthokeratology lenses were discontinued.", "support_label": "supported", "is_refined": false }, { "subclaim": "Two days after discontinuation, the intraocular pressure was 18 mm Hg in the right eye.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Two days after discontinuation, the intraocular pressure was 20 mm Hg in the left eye.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2880_en.txt", "fulltext": "An 11-month-old female infant presented with bilateral corneal opacity, which was first noted at the age of 3 months. The patient was born full term with an uneventful birth history, and no history of maternal infection or family history of ophthalmologic disease. Ophthalmic examination revealed central corneal opacity approximately 3.0 mm in diameter in the right eye and 2.0 mm in diameter in the left eye, with an underlying keratolenticular adhesion and a cloudy cataract, and that the patient could not trace the light . Contact ultrasound A-scans revealed axial lengths of 18.28 mm and 18.39 mm in the right and left eyes, respectively. Intraocular pressure (IOP) were 14 mmHg in both eyes, measured by a handheld tonometer (Icare Finland Oy Vantaa, Finland). There were no systemic anomalies.\nThe patient\u2019s parents hesitated to accept PKP and fully understood the risks of performing PKP in infants because they had consulted several surgeons before coming to our clinic to seek a second opinion. Her parents were subsequently offered an option of adhesiolysis and adhesive membrane removal combined with lensectomy and vitrectomy. Surgeries were performed at the age of 11 months on 17th and 19th October 2017 in the right and left eye, respectively.\nSurgeries were performed by an experienced surgeon (Y.E.Z.) under general anesthesia using the Accurus with the venturi vacuum system (Alcon Laboratories, Inc.); the cut rate was 2000 per minute and vacuum was 350 mmHg. A corneoscleral incision was made superiorly and four 1.0 mm paracentesis were created in each quadrant. The anterior chamber was initially filled with ophthalmic viscosurgical device (OVD), and the neck of the keratolenticular adhesion was cut using intraocular scissors. There was comprehensive iris posterior synechia. The pupillary aperture was enlarged by four iris hooks through paracentesis in each quadrant after adhesiolysis. Then, a partially resorbed lens and peripheral anterior capsule contraction with zonular elongation were noted underneath the keratolenticular adhesion. The anterior capsular defect was extended to an anterior capsulorhexis of approximately 5.0 mm diameter using a 23-gauge vitrector, while the anterior chamber was maintained by a 23-gauge infusion cannula. After the mode was switched to irrigation/aspiration, the cortex was carefully aspirated. Next, a posterior capsulotomy with a 3.0 mm diameter was performed with the vitrector and the anterior part of the vitreous volume was removed using the same vitrectomy settings. Before the end of the procedure, the residual adhesion was gently peeled off by capsulorhexis forceps curvilinearly following the demarcation line. Surgery was concluded with reformation of the anterior chamber with balanced salt solution and closure of the corneoscleral incision with 10\u20130 nylon sutures, leaving both eyes aphakic (Additional file 1). No unexpected intraoperative complications were encountered. Clinical manifestations were similar in both eyes.\nTopical treatment consisted of steroidal eye drops gradually tapering over 4 weeks, antibiotic eye drops 4 times daily for 2 weeks, and mydriatic eye drops (phenylephrine hydrochloride and tropicamide compound) once a day for 4 weeks. A gradual reduction in central corneal opacity and improvement in the visual acuity (VA) was noted . Non-contact specular microscopy at one year postoperatively showed large heteromorphic endothelial cells at the borderline between the normal endothelium and the central defect . At the latest follow-up that was two years after surgery, the corneal had excellent transparency, with corrected Teller VA of 20/50 in both eyes and IOP of 15 mmHg in the right eye and 14 mmHg in the left eye. There was no evidence of glaucoma.", "summary": "An 11-month-old female infant of type 2 Peters anomaly presented with bilateral corneal opacity with distinct demarcation, keratolenticular adhesion and cataract, which was first noted at the age of 3\u2009months. By peeling off the adhesion from corneal endothelium combined with lensectomy and vitrectomy, there was a gradual reduction in corneal opacity and improvement in visual acuity after surgery over a 2-year period. Her visual acuity had improved from light perception preoperatively to 20/50 at the latest follow-up. No sight-threatening postoperative complications were noted.", "subclaim_evaluations": [ { "subclaim": "The patient is an 11-month-old female infant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has type 2 Peters anomaly.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had bilateral corneal opacity with distinct demarcation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had keratolenticular adhesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cataract.", "support_label": "supported", "is_refined": false }, { "subclaim": "The corneal opacity was first noted at the age of 3 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The adhesion was peeled off from the corneal endothelium.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lensectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Vitrectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a gradual reduction in corneal opacity after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Visual acuity improved after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The improvement in visual acuity occurred over a 2-year period.", "support_label": "supported", "is_refined": false }, { "subclaim": "Preoperative visual acuity was light perception.", "support_label": "supported", "is_refined": false }, { "subclaim": "The latest follow-up visual acuity was 20/50.", "support_label": "supported", "is_refined": false }, { "subclaim": "No sight-threatening postoperative complications were noted.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1305_en.txt", "fulltext": "A 25-year-old gentleman presented to our clinic with a complaint of recurrent pain and swelling on his right cheek of three-month duration. He visited a general practitioner each time, and the condition was resolved with analgesic and antibiotics. However, his symptoms got worse and he attended our Oral Surgery Clinic for consultation.\nThe patient is a fit and healthy young man with no relevant medical history and no known history of allergy. Past surgical history revealed that he had underwent bimaxillary orthognathic surgery one and half year earlier in a local hospital. Although the postoperative period was uneventful, the surgical team informed him that there was a dislodged orthodontic appliance in his right cheek that must have occurred during the operation. The team explained to the patient that this accident was realized later on the next day after the surgery when the molar tube from the right maxillary second molar was found missing, and its presence was confirmed high up in the right maxillary-zygomatic buttress area shown in the postoperative X-ray image taken on the next day following the surgery. A series of further postoperative radiographs confirmed its location, lying outside the right maxillary antrum. Due to the pronounced postoperative facial oedema at that time, no attempt was made to remove the appliance. The absence of sign and symptoms during further follow-up sessions confirmed the decision to leave it in-situ with continuous clinical observation.\nOn examination, there was no extraoral swelling noted. The mandible and maxilla seemed firm indicating good healing following previous mandibular saggital split and maxillary Le Fort I osteotomy sites and a stable class I dental occlusion. Intraorally, there was a sinus with slight pus discharge on the upper right buccal sulcus region adjacent to the upper right first premolar. All teeth in that quadrant were firm and vital. Tenderness was elicited upon palpation on the upper right vestibular region. We suspected the sinus track may originate from the dislodged appliance embedded in the cheek soft tissue. A periapical view was then taken with gutta-percha inserted into the sinus for foreign body localization purpose. The radiograph revealed the gutta-percha pointed towards the site of titanium plate and screws placed used for rigid fixation, and with the molar orthodontic tube appliance in its vicinity . A cone beam CT was performed to provide a 3D detailed location of the appliance and confirmed it to be located outside the maxillary antrum.\nThe presence of the molar orthodontic tube foreign body reaction was suspected as the most probable cause of the recurrent right cheek pain and swelling associated with an intraoral discharging sinus. Exploration of the site was performed through the sulcular incision under general anesthesia. The dislodged molar tube was identified lying on the zygomatic bone just beneath the raised flap. It was removed by dividing some surrounding fibrous tissue strands. Just below it, one titanium straight bone plate with four screws used for fixing the previous Le Fort I osteotomy site was inspected and found to be rigidly embedded in normal bone. However, a decision was made to remove them based on the fact that they are present in an infected area. . The Le Fort I osteotomy site showed good healing with new bone formation. Patient had an uneventful recovery thereafter, and the orthognathic surgical team who attended him previously was informed of his progress.", "summary": "A 25-year-old gentleman presented with recurrent upper right vestibular abscess three months following a bimaxillary orthognathic surgery. A bonded molar orthodontic tube had dislodged into the wound during the operation. The clinical presentation initially mimics an odontogenic infection until our investigations revealed that it originated from the dislodged appliance. The abscess was drained, the wound site was explored, and the molar tube and neighbouring rigid fixation plates and screws were removed. The patient recovered well following the procedure.", "subclaim_evaluations": [ { "subclaim": "The patient is a 25-year-old gentleman.", "support_label": "supported", "is_refined": false }, { "subclaim": "He had a bimaxillary orthognathic surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "He developed a recurrent upper right vestibular abscess.", "support_label": "supported", "is_refined": false }, { "subclaim": "The abscess occurred three months after the surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "A bonded molar orthodontic tube had dislodged into the wound during the operation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinical presentation initially mimicked an odontogenic infection.", "support_label": "supported", "is_refined": false }, { "subclaim": "Investigations revealed the abscess originated from the dislodged appliance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The abscess was drained.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The wound site was explored.", "support_label": "supported", "is_refined": false }, { "subclaim": "The molar tube was removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Neighbouring rigid fixation plates and screws were removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient recovered well following the procedure.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3269_en.txt", "fulltext": "29-year-old female patient with chronic renal disease due to primary focal and segmental glomerulosclerosis, who received a renal transplant in 2017 and was taking tacrolimus, everolimus and prednisone 5 mg daily, was non-diabetic. After a year of progressive deterioration of renal function, diagnosed by gradual increase in serum creatinine and without associated symptoms, a biopsy of the renal graft was performed, which showed findings consistent with pauciimmune vasculitis, so it was decided to hospitalize her to intensify the immunosuppression with methylprednisolone and cyclophosphamide.\n\nThe patient was admitted in a stable condition, afebrile and without urinary symptoms. The examination revealed low inflammatory parameters (C-reactive protein: 17.9 mg/L, white blood cell count: 7,600 cells/uL, absolute neutrophil count: 6,000 cells/uL), but with a urine sediment of 5 leukocytes per field and few bacteria. The urine culture was negative, so 7 urine bacilloscopies were performed, with 3 positive results, reporting 4 to 9 acid-fast bacilli per 100 fields. 6 urine mycobacteria cultures were performed, all negative, as well as a urine sample polymerase chain reaction (PCR) against M. tuberculosis (GeneXpert\u00ae) also negative. The study was complemented with a Mycobacterium tuberculosis interferon-gamma release assay (Quantiferon TB-Gold-Plus\u00ae) that was negative and a non-contrast computed tomography of the abdomen that did not show structural alterations suggestive of mycobacterial infection.\n\nDue to the context of the patient with an immunosuppression plan, it was decided to postpone the start of immunosuppressive therapy and request the identification of the species of mycobacteria from a urine sample using panmicrobacterial PCR with sequencing of the amplified product. The sequence obtained was compared with the GenBank\u00ae database and was compatible with Lawsonella clevelandensis. Following the result, amoxicillin with clavulanic acid 500/125 mg was indicated every 12 h for 3 to 6 months. The patient progressed 4 months later with a severe COVID-19 case, requiring mechanical ventilation and renal replacement therapy, so the antibiotic therapy was extended for 7 months, and the immunosuppressive therapy was restarted after hospital discharge and clinical stabilisation.\n", "summary": "We present the case of a 29-year-old female patient with renal transplant and progressive worsening of renal function in the context of a pauciimmune vasculitis requiring greater immunosuppression. In the laboratory, asymptomatic leukocyturia was noted, with a negative urine culture, so 7 urine bacilloscopies were performed, with positive results in 3, but with PCR of M. tuberculosis and negative mycobacterial culture. Sequencing of the gene that codes for the 16s RNA of the bacterial ribosome was performed from a urine sample, obtaining a sequence compatible with Lawsonella clevelandensis. Following the result, therapy with amoxicillin-clavulanic acid was indicated for 7 months.\n", "subclaim_evaluations": [ { "subclaim": "The patient is a 29-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a renal transplant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had progressive worsening of renal function.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had pauciimmune vasculitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient required greater immunosuppression.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had asymptomatic leukocyturia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The urine culture was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Seven urine bacilloscopies were performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three urine bacilloscopies were positive.", "support_label": "supported", "is_refined": false }, { "subclaim": "M. tuberculosis PCR was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "Mycobacterial culture was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "16s RNA gene sequencing was performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The sequence was compatible with Lawsonella clevelandensis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received amoxicillin-clavulanic acid.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment duration was 7 months.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2685_en.txt", "fulltext": "A 30-year-old woman presented with long lasting arthralgia, Raynaud phenomenon, and dyspnoea New York Heart Association (NYHA) Class II. Physical examination at the University Hospital of Brussels revealed cutaneous lesions, a facial butterfly rash and a grade three systolic murmur. Laboratorial investigation revealed an elevated anti-nuclear antibody (ANA) (1:200, normal range \u22641:40 is a negative test, \u22651:160 is a positive test), in the absence of SLE-specific antibodies, reduction of complement factors C3 and C4 (48 mg/dL, normal range 93\u2013177 mg/dL and 6 mg/dl, normal range 14\u201338 mg/dL, respectively) and severe renal dysfunction (CKD Stage 4, a creatinine of 2.4 mg/dL, normal range 0.4\u20131.2 mg/dL or an estimated glomerular filtration rate (eGFR) of 24 mL/min/1.73 m2, normal range \u226560 mL/min/1.73 m) with proteinuria. Subsequently, a renal biopsy was performed. A lupus nephritis Class II with mesangioproliferative glomerulonephritis was found. In addition, a skin biopsy confirmed cutaneous involvement.\nTransthoracic echocardiography (TTE) demonstrated a slight restrictive mitral valve motion with minimal thickening of the anterior mitral leaflet-compatible with Libman Sacks (LS) endocarditis, moderate regurgitation (effective regurgitant orifice area 0.19 cm2, regurgitant volume 39 mL), normal left atrial dimension (36 mm, 29.3 mL/m2), and moderate systolic pulmonary hypertension (PHT) of 45 mmHg at rest ( and ).\nSubsequent exercise echocardiography revealed an elevation in systolic pulmonary pressures from 39 to 53 mmHg without increased dyspnoea. Mitral valve (MV) gradients went from a peak and mean of 9/4 mmHg to peak and mean of 22/13 mmHg with a calculated mitral valve area (MVA) of 2.0 cm2. Three-dimensional echocardiography confirmed the severity of the stenotic orifice with a MVA of 3.0 cm2 (see ).\nImmunosuppressive therapy, with cyclophosphamide 500 mg intravenous every 2 weeks and methylprednisolone 64 mg daily for 1 week and afterwards a subsequent progressively decreasing dose, was started. Cyclophosphamide had to be interrupted after two cycles due to recurrent infections. Methylprednisolone 4 mg once a day (q.d.) was continued with clinical improvement (NYHA Class I) and normalization of systolic pulmonary pressure (24 mmHg) after 6 months. After 1 year azathioprine 100 mg q.d. was added to the treatment.\nThe patient was loss to follow-up during a period of 8 years until she presented with complaints of fatigue and progressive exertional dyspnoea NYHA Class III with a grade five systolic murmur and a facial butterfly rash upon clinical examination. Anti-nuclear antibody increased up to 1:1520 with anti-double stranded DNA (anti-dsDNA) 1:20 (normal range \u22641:10 is a negative test). Furthermore, NT-pro-BNP was significantly elevated (10 066 ng/L, normal range 300\u2013450 ng/L). Cardiac re-evaluation with TTE ( and ) demonstrated a more restrictive mitral valve motion with increased and nodular thickening of the anterior leaflet, reduced mitral valve opening with severe mitral valve stenosis (mean gradient of 6.1 mmHg and MVA 1.0 cm2) [0.7 cm2 on three dimensional echo (see )], stable moderate mitral regurgitation, severe left atrial dilatation (48 mm, 59 mL/m2), a normal pericardium and moderate systolic PHT of 40 mmHg at rest. On apical four-chamber view (see ) a ball-like density due to the nodular thickening of the anterior leaflet is appreciated.\nA subsequent exercise echocardiography permitted us to confirm the severity of the disease since gradients are also flow dependent. At 100 W a significant increase of mean MV gradients from 6.1 to 34 mmHg with an increase of systolic PHT from 40 to 67 mmHg and development of severe dyspnoea were appreciated .\nA coronary angiogram with right heart catheterization showed normal coronary arteries and confirmed the moderate PHT of 40 mmHg.\nMethylprednisolone 32 mg twice a day (b.i.d) and cyclophosphamide 500 mg intravenous, every 2 weeks for 3 months, were started in combination with hydroxychloroquine 200 mg b.i.d, bumetadine 2.5 mg q.d, and lisinopril 2.5 mg q.d.\nSubsequently, a mitral valve replacement was performed by a minimally invasive port-access cardiac surgery (mechanical mitral valve St Jude Medical 31 mm). Histopathology of the valve showed fibrosis, neovascularization, inflammatory cell infiltration (plasma cells), and calcification, consistent with valvular involvement of SLE (LS endocarditis) .\nEchocardiography after surgery showed a non-dilatated, normotrophic left ventricle with normal systolic function, mild left atrial dilatation (43 mL/m2), well-functioning mitral valve prosthesis (mean gradient 3.7 mmHg, MVA 1.4\u20131.5 cm2), and reduced right systolic PHT (23 mmHg).\nOne year later, the clinical condition of the patient was significantly improved with a good exercise capacity and stable SLE under methylprednisolone 4 mg q.d, mycophenolate 500 mg three times a day, and hydroxychloroquine 200 mg b.i.d.", "summary": "A 30-year-old woman with arthralgia, butterfly rash, and Raynaud phenomenon presented with a systolic murmur and renal impairment. Based on the kidney biopsy the diagnosis of SLE was made. Echocardiography revealed the presence of pulmonary hypertension, restrictive mitral valve disease with nodular thickening of the anterior leaflet and moderate regurgitation, compatible with Libman Sacks (LS) endocarditis. Immunosuppressive therapy was started and the patient status improved with normalization of systolic pulmonary artery pressure. After 8 years without follow-up, she presented with fatigue and dyspnoea based on a severe mitral valve stenosis. Subsequently, she underwent a minimal invasive mitral valve replacement and the diagnosis of LS endocarditis could be confirmed upon histopathological examination.", "subclaim_evaluations": [ { "subclaim": "The patient is a 30-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had arthralgia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a butterfly rash.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had Raynaud phenomenon.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had a systolic murmur.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had renal impairment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of SLE was made based on the kidney biopsy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Echocardiography revealed pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed restrictive mitral valve disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anterior leaflet had nodular thickening.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was moderate mitral regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The findings were compatible with Libman Sacks endocarditis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunosuppressive therapy was started.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's status improved.", "support_label": "supported", "is_refined": false }, { "subclaim": "Systolic pulmonary artery pressure normalized.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 8 years without follow-up, she presented with fatigue.", "support_label": "supported", "is_refined": false }, { "subclaim": "After 8 years without follow-up, she presented with dyspnoea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The cause was severe mitral valve stenosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent a minimal invasive mitral valve replacement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis of Libman Sacks endocarditis was confirmed on histopathological examination.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1652_en.txt", "fulltext": "A healthy 10-year-old male patient presented to the Department of Pediatric and Preventive Dentistry, M.S. Ramaiah Faculty of Dental Sciences, Bengaluru, Karnataka, India, for routine dental care. Oral examination revealed mixed dentition, with deficient space for eruption of second premolar teeth ( and ). The treatment planned was distalization of maxillary first permanent molars by intra-arch pendulum appliance developed by Hilgers. Both the maxillary first permanent molars and first premolars were banded and impression of maxillary arch was made. The pendulum appliance design consisted of anterior acrylic nance portion with two posteriorly extending TMA coil springs made of 0.032\". The plane of the coil springs should be parallel to the maxillary plane; the extensions of TMA wire are then soldered to the molar and premolar bands . The appliance was cemented onto the molars and premolars. The appliance was activated extraorally and was cemented. The appliance was monitored at monthly intervals and the appliance was removed for reactivation and recementation.\nAt the end of 4th month sufficient space was regained and second premolars started erupting into the space gained. At 7th month with the complete eruption of premolars and canines proper maxillary arch alignment was achieved ( and ). The results of this case study have shown that the pendulum appliance is an effective and reliable method for distalization of maxillary molar teeth.", "summary": "The purpose of this paper is to report a case of 10-year-old male patient with loss of space in maxillary molar teeth treated by intra-arch appliance-pendulum appliance by distalization of maxillary first permanent molar teeth. Distaliza-tion of the permanent molar teeth helped in proper eruption of second premolar teeth without any extensive treatment procedures.", "subclaim_evaluations": [ { "subclaim": "The patient is a 10-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had loss of space in maxillary molar teeth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment involved an intra-arch appliance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The appliance used was a pendulum appliance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment involved distalization of maxillary first permanent molar teeth.", "support_label": "supported", "is_refined": false }, { "subclaim": "Distalization helped in the proper eruption of second premolar teeth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment did not require extensive procedures.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2444_en.txt", "fulltext": "On 24 January 2020, a 48-year-old male patient with a history of asthma was transferred to our department due to acute myocarditis of unknown origin. The patient described a sudden onset of high-grade fever without prodromal symptoms beginning on 12 January. Within a few days, he developed dyspnoea and haemoptysis requiring hospital admission.\nLaboratory testing showed high levels of the inflammatory markers creatine phosphokinase (CPK) and lactate dehydrogenase (LDH; see ). Ferritin was only marginally elevated. His differential blood count showed prominent eosinophilia (19%) and lymphopenia (18%). Testing for autoantibodies only yielded antinuclear antibodies (ANAs) at a very low titre without any detectable specificity against a broad panel of nuclear antigens. However, myositis-associated antibodies, antineutrophilic cytoplasmic antibodies (ANCAs), as well as antiphospholipid antibodies were negative. The measurement of vital signs revealed tachycardia (100 b.p.m.) with hypotonic blood pressure (90/65 mmHg) and fever (39\u00b0C). On physical examination, lower leg oedema was present. The auscultation of heart and lungs was unremarkable.\nThoracic computed tomography (CT) showed bilateral, patchy peripheral ground-glass opacities with a crazy-paving pattern, focal consolidations, and mild pleural effusions . Due to highly elevated cardiac markers [N-terminal probrain natriuretic peptide (NT-proBNP) and troponin T], echocardiography and cardiac magnetic resonance imaging (MRI) were performed. Both showed highly reduced ventricular function [left ventricular ejection fraction (LVEF) 22%, right ventricular ejection fraction (RVEF) 28%]. Furthermore, late gadolinium enhancement (LGE) of the entire left ventricular myocardium with intracardial thrombi was detected on MRI . T1 and T2 times were markedly prolonged, reflecting acute oedema following myocardial inflammation. In light of a multifaceted differential diagnosis, pulmonary and myocardial biopsies were performed. Histopathological analysis of the pulmonary biopsy showed interstitial alveolitis with capillaritis, necrosis, and mild eosinophilia. The cardiac specimen revealed active lymphocytic myocarditis . PCR analysis for usual cardiotropic viruses was negative. A few days after admission, the patient developed an acute renal injury with microhaematuria.\nBased on these findings and the clinical presentation at that point, the diagnosis of an ANCA-negative small-vessel vasculitis was established. Given the known asthma, eosinophilia, renal injury with microhaematuria, and cardiopulmonary inflammation, the patient fulfilled the criteria for eosinophilic granulomatosis with polyangiitis (EGPA) despite the lack of ANCAs.\nIn accordance with current guidelines, pulse therapy with cyclophosphamide and high-dose steroids was initiated, and the patient recovered adequately after several weeks of treatment. On discharge, the patient was afebrile without dyspnoea, but a wearable defibrilator was prescribed. .\nAfter discharge of the patient from our hospital, the COVID-19 pandemic had evolved to affect Europe as well. Individual cases were reported at the end of January and early February in France, Italy, and Austria. Owing to the initial broad spectrum of differential diagnoses, we revisited the complete medical history and contacted the patient, who reported a prior vacation in Tyrol, Austria, from which the patient and his family had returned 1 day before the sudden onset of his symptoms. It is of interest that Austria is considered the origin of the COVID-19 outbreak in Europe. The distance from Tyrol to our department in Germany is \u223c500 km. One week later, the patient arrived at the hospital because of a progressive fever and weakness. Moreover, the patient reported that his 8-year-old daughter developed flu-like symptoms with a high-grade fever (40.7\u00b0C/105\u00b0F) \u223c1 week after his first symptoms.\nSubsequently, PCR testing for SARS-CoV-2 RNA was initiated on the histological specimens of the heart using quantitative reverse transcription\u2013PCR (RT\u2013qPCR) kits targeting the E gene and RdRp gene (TIB MOLBIOL, Roche Diagnostics, Germany), and the N2 assay (N gene). Unexpectedly, those tests were positive for SARS-CoV-2 RNA. Therefore, we revised the diagnosis from small-vessel vasculitis to COVID-19-associated myocarditis and immediately stopped immunosuppressive treatment with cyclophosphamide. The steroid dose was also tapered. The course of resolving the intracardial thrombus was accomplished with a therapy that included coumarin-type drugs. The normalization of elevated laboratory inflammation markers, improvement of cardiac function on echocardiography, and the absence of cardiac inflammation on cardiac MRI confirmed the patient\u2019s recovery.\nThe pulmonary specimen showed mild eosinophilia with parenchymal necrosis and alveolitis. Staining for CD31, factor VIII, and CD68 were positive, while all other staining experiments were negative. In the cardiac specimen, markedly elevated counts of lymphocytes (positive for LFA-1, CD45R0, and CD3) and elevated counts of macrophages (positive for MAC-1) could be detected along with the expression of adhesion molecules (ICAM-1). In contrast, perforin-expressing cytotoxic cells were not present. While PCR did not detect typical cardiotropic viruses, additional testing for SARS-CoV-2 RNA revealed a positive signal in the myocardium.", "summary": "A 48-year-old male patient presented with fever, dyspnoea, and haemoptysis. Laboratory findings showed highly elevated inflammatory and cardiac damage markers. Thoracic computed tomography (CT) revealed bilateral, patchy peripheral ground-glass opacities with a crazy-paving pattern, focal consolidations, and mild pleural effusions. Cardiac imaging with echocardiography and magnetic resonance imaging (MRI) detected a reduced biventricular function. MRI additionally showed myocardial oedema and late gadolinium enhancement. Lung and heart biopsies were performed, revealing alveolitis with necrosis and acute lymphocytic myocarditis. Testing for usual cardiotropic viruses was negative, and no aspects of vasculitis or granuloma could be found. Due to fulfilling the criteria, the patient was diagnosed with rheumatic vasculitis. Treatment with cyclophosphamide and steroids was initiated. Later, the patient reported a history of travel to Tyrol in mid January. Consequently, PCR testing for SARS-CoV-2 was performed, which was positive in the heart specimen. Immunosuppressive treatment was discontinued. During a follow-up visit at the end of April, the patient's recovery was stable.", "subclaim_evaluations": [ { "subclaim": "The patient is a 48-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with dyspnoea.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient presented with haemoptysis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracic CT revealed bilateral, patchy peripheral ground-glass opacities.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracic CT showed a crazy-paving pattern.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracic CT showed focal consolidations.", "support_label": "supported", "is_refined": false }, { "subclaim": "Thoracic CT showed mild pleural effusions.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac imaging detected reduced biventricular function.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed myocardial oedema.", "support_label": "supported", "is_refined": false }, { "subclaim": "MRI showed late gadolinium enhancement.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lung biopsies revealed alveolitis with necrosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Heart biopsies revealed acute lymphocytic myocarditis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Testing for usual cardiotropic viruses was negative.", "support_label": "supported", "is_refined": false }, { "subclaim": "No aspects of vasculitis were found.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was diagnosed with rheumatic vasculitis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Treatment with cyclophosphamide and steroids was initiated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient reported a history of travel to Tyrol in mid January.", "support_label": "supported", "is_refined": false }, { "subclaim": "PCR testing for SARS-CoV-2 was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "PCR testing for SARS-CoV-2 was positive in the heart specimen.", "support_label": "supported", "is_refined": false }, { "subclaim": "Immunosuppressive treatment was discontinued.", "support_label": "supported", "is_refined": false }, { "subclaim": "During a follow-up visit at the end of April, the patient's recovery was stable.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2082_en.txt", "fulltext": "The patient was a 49-year-old man from Shanxi province who was born to non-consanguineous parents. He presented with a history of progressive shortness of breath and edema of both lower limbs for 7 days. One week before admission, the patient developed shortness of breath in a supine position at night, which improved after 3-5 minutes of rest in the sitting position. The shortness of breath recurred 3\u20134 times per night, accompanied by progressive edema of both lower extremities. The patient denied any history of hypertension, diabetes, or smoking. Starting from the age of 8 years, the patient showed signs of bilateral upper and lower limb weakness during exercise and his sports tests never met the standard. At the age of 35 years, he started to complain of difficulty in swallowing solid food. Mild bilateral ptosis was noticed from the age of 45 years. He had a family history of MM. His eldest sister was diagnosed with MM based on histochemical analysis of skeletal muscle biopsy. However, no records of the exact site of mutation in the eldest sister were available. She developed respiratory failure at the age of 52 years and died of respiratory failure several years ago. The second sister showed progressive ptosis and bilateral limb weakness; however, she has not yet undergone skeletal muscle biopsy. The parents and the little sister of the patient appear in good health at present. The pedigree map of three generations of the family is shown in Fig. . The patient in our report is the family member, II-3.\nThe patient had acute symptoms, but had normal sensorium at the time of hospitalization. He looked very thin and his height was 1.83 meters and weight was 49 kg. His vital signs were: body temperature, 36.6\u00b0C; pulse rate, 89 beats/min; respiratory rate, 25 beats/min; blood pressure, 124/85 mmHg. There was ptosis and facial weakness. Chest percussion showed dullness on the right chest wall and no significant enlargement of the heart; no cardiac murmur was heard on auscultation. Neurological examination showed no cranial nerve deficit. His cognitive abilities were normal. Ptosis was mild on the right and moderate on the left side. At rest, muscle strength and tone were normal in all 4 limbs. Serum creatine kinase (CK) level was 2280 IU/L (normal value < 200) while liver enzyme levels were slightly increased, including aspartate aminotransferase (AST) (120 IU/L; normal value <40 IU/L) and alanine aminotransferase (ALT) (57 IU/L; normal value <40 IU/L). Serum antinuclear autoantibodies/extractable nuclear antigens (ANA/ENA) levels were normal. Electrocardiogram and D-dimer level were normal. The B-type natriuretic peptide (BNP) level was 606 pg/mL and the level of soluble growth stimulating gene protein (sST2) was 97.64 ng/mL (normal value <35 ng/ml). Findings of arterial blood gas (ABG) analysis were: pH 7.286; PaCO2 73.6 mmHg; PaO2 62.7 mmHg; lactate 2.82 mmol/L (normal value <2.2 mmol/L); hemoglobin 177g/L. Although the PaO2 level was within the normal range on low-flow oxygen inhalation, the diagnosis of type II respiratory failure was considered because of hypercapnia. Pulmonary function test suggested severe restrictive ventilatory impairment. Chest high resolution CT showed bilateral pleural effusion (more on the right side) and increased thickness of pulmonary artery trunk and branches. The patient showed none of emboli, mosaic perfusion, disparity in segmental vessel size, parenchymal densities and thickening of bilateral pulmonary arteries in Computed tomographic pulmonary angiography (CTPA). Echocardiography revealed right heart overload characterized by dilated right ventricle (RV diastolic dimension: 44 mm) and right atrium (RA dimension: 45 mm) . Color Doppler ultrasound revealed mild tricuspid regurgitation and mild to moderate pulmonary hypertension; the systolic pulmonary arterial pressure was 56 mmHg. The tricuspid annular plane systolic excursion (TAPSE) level was 22 mm. Echocardiography showed normal left ventricular chamber volume with normal systolic function (estimated ejection fraction 71%) and normal filling pressures. Left ventricle short-axial view showed symmetric slight thickening of the left ventricle (LV) and the LV mass indexed for BSA was 118.07g/m2. At the end diastolic phase of the left ventricle, the thickness of both the ventricular septum and the posterior left ventricular wall is 13 mm.\nNeedle electromyography (EMG) examination showed rapid recruitment of short-duration, low-amplitude motor unit potentials (MUPs) in bilateral deltoid muscles. He underwent muscle biopsy of left lateral thigh, which revealed variable size and shape of muscle fibers, with coexistence of oblong or small round fibers, occasional necrosis or regeneration of muscle fibers, hypertrophic fibers and split fibers in addition to typical features of mitochondrial dysfunction, including 8% ragged red fibers (RRF) and 42% COX-negative fibers.\nGene sequencing analysis conducted by BGI Clinical Laboratory Center (Shenzhen, China) revealed a novel TK2 mutation at c.584T>C. The predicted amino acid change was p. Leu195 Pro. Whole exon gene results of the proband and family members showed that the mother had wild-type and the father, sister, and the patient had heterozygote TK2 variant (NM_001172644: c.584T>C, p.Leu195Pro). In-depth analysis revealed a heterozygous variant in an intron of TK2 (NM_004614.4:c.156+958G>A; rs1965661603) in the mother of the proband, the sister, and the proband. Based on the findings of muscle biopsy and DNA sequencing, the patient was diagnosed as a case of MM .\nHe was administered intravenous diuretic and recombinant human brain natriuretic peptide. Round-the-clock non-invasive ventilation was provided during the first 10 days of hospitalization; subsequently, artificial ventilation was provided only at night. The shortness of breath was significantly alleviated with complete resolution of bilateral lower limb edema. ABG analysis results prior to discharge were: pH 7.388; PaCO2 52.7 mmHg; PaO2 123.5 mmHg; and hemoglobin 155 g/L. The patient was prescribed with the nocturnal non-invasive ventilation and coenzyme Q10 (CoQ10) at discharge. CoQ10 can promote oxidative phosphorylation and protect the integrity of biological cell membrane, it increases adenosine triphosphate (ATP) generation and cellular energy by mediating electron transfer in the electron transport chain. CoQ10 can be used as an adjunctive therapy for mitochondrial myopathy or heart failure. Echocardiography performed after one month showed no obvious abnormalities in cardiac structure or function. Echocardiography findings also showed improvement after treatment . No abnormalities were observed in BNP and sST2 levels. CK was reduced to 1250 IU/L and liver enzyme levels were restored to normal. ABG parameters were within the normal range (pH 7.411; PaCO2 42.9 mmHg; PaO2 86.5 mmHg; lactate 2.0 mmol/L; hemoglobin 151 g/L). A one-year follow-up, the patient was found to have well tolerated non-invasive ventilation support. He was able to perform his routine activities with no restrictions. Echocardiography showed normal cardiac structure and function. Currently, nocturnal bilevel positive airway pressure (BiPAP) therapy via a basal mask had been well-tolerated and ABG analysis was performed every 1 month, the ventilation pattern had not been changed after discharge. The patient is regularly receiving CoQ10.", "summary": "A 49-year-old man presented with clinical features suggestive of MM, i.e., ophthalmoparesis, weakness of the pharyngeal and extremity muscles, and respiratory muscles which gradually progressed to respiratory insufficiency. He had a family history of mitochondrial myopathy. He had increased levels of serum creatine kinase and lactate. Muscle biopsy of left lateral thigh revealed 8% ragged red fibers (RRF) and 42% COX-negative fibers. Gene sequencing revealed a novel heterozygote TK2 variant (NM_001172644: c.584T>C, p.Leu195Pro) and another heterozygous variant (NM_004614.4:c.156+958G>A; rs1965661603) in the intron of TK2 gene. Based on these findings, we diagnosed the patient as a case of MM. Echocardiography revealed right heart enlargement, pulmonary hypertension, left ventricular hypertrophy, and thickening of the main pulmonary artery and its branches. The patient received non-invasive ventilation and coenzyme Q10 (CoQ10). The cardiac structure and function were restored at 1-month follow-up.", "subclaim_evaluations": [ { "subclaim": "The patient is a 49-year-old man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had ophthalmoparesis.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had weakness of the pharyngeal muscles.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had weakness of the extremity muscles.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had weakness of the respiratory muscles.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's respiratory muscle weakness progressed to respiratory insufficiency.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a family history of mitochondrial myopathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had increased serum creatine kinase.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had increased serum lactate.", "support_label": "supported", "is_refined": false }, { "subclaim": "Muscle biopsy of the left lateral thigh showed 8% ragged red fibers.", "support_label": "supported", "is_refined": false }, { "subclaim": "Muscle biopsy of the left lateral thigh showed 42% COX-negative fibers.", "support_label": "supported", "is_refined": false }, { "subclaim": "Gene sequencing revealed a novel heterozygous TK2 variant (NM_001172644: c.584T>C, p.Leu195Pro).", "support_label": "supported", "is_refined": false }, { "subclaim": "Gene sequencing revealed another heterozygous variant (NM_004614.4:c.156+958G>A; rs1965661603) in the intron of the TK2 gene.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with mitochondrial myopathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed right heart enlargement.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed pulmonary hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed left ventricular hypertrophy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed thickening of the main pulmonary artery and its branches.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received non-invasive ventilation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received coenzyme Q10.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 1-month follow-up, the cardiac structure and function were restored.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1603_en.txt", "fulltext": "A 57-year-old Caucasian woman reported a decrease in visual acuity for 2 weeks. Her best-corrected visual acuity for her right eye was 20/20 and for her left eye 20/100. A slit-lamp examination and intraocular pressure were unremarkable in both eyes. Fundus examination of her left eye revealed temporal intraretinal infiltrates and vitreous opacities . Her right eye was unremarkable.\nFluorescein angiography showed hyperfluorescence of her optic disc, leakage along the vessels, and chorioretinal hyperfluorescent infiltrates . The diagnosis of OT was based on the typical morphology of her ocular lesions and a positive serological testing for Toxoplasma gondii (immunoglobulin G concentration = 537IU/mL).\nShe was treated with clindamycin (Clindamycin\u00ae H) 4 \u00d7 300mg daily over 3 days without any significant improvement of visual acuity. On the fourth day of hospitalization, she received 100mg prednisolone-21-hydrogensuccinate (Solu-Decortin\u00ae H) intravenously in addition to her treatment with clindamycin (Clindamycin\u00ae H). Within 2 minutes she developed an acute erythema, particularly of her legs and abdomen , angioedema, hypotension (blood pressure 80/40mmHg), tachycardia (heart rate 140/minute), hyperthermia (38.8\u00b0C), and respiratory distress. Subsequently, she was transferred to the Intensive Care Unit to be monitored and treated with clemastine fumarate (Tavegil\u00ae), ranitidin (Ranitic\u00ae), and intravenous fluids. After 1 hour she recovered and after 12 hours she was transferred back to the ophthalmological ward. Her erythema and angioedema persisted for 32 hours. She had no history of previous steroid use. Subsequent allergy testing was conducted after 3 months in the Department of Dermatology in our hospital. The testing showed a positive skin-prick test for prednisolone and methylprednisolone in the form of a 5mm wheal, and negative results for dexamethasone and hydrocortisone , which confirmed her suspected allergy to prednisolone. Because of her allergic reaction to class A (prednisone-type) corticosteroids and possible complications due to cross-reactions to class D2 (prednicarbate-type) corticosteroids, we avoided any further treatment with systemic or intravitreal corticosteroids.\nIn addition, an oral exposure test with a step-by-step elevation of doses up to 2.0mg of dexamethasone (Fortecortin\u00ae) and 1.5mg betamethasone (Celestamine\u00ae) was conducted to find alternative corticosteroids for future treatments. For both substances, no local or systemic side effects were observed.\nAfter 1 month of treatment with clindamycin (Clindamycin\u00ae H) monotherapy without any increase in visual acuity, the patient underwent a vitrectomy with balanced salt solution filling because of heavy vitreous opacities, and to obtain a sample of the vitreous body. The polymerase chain reaction (PCR) on the sample was positive for Toxoplasma gondii.\nThe postoperative examination of her left eye revealed chorioretinal scars and infiltrates . Her right eye was still unremarkable. Fluorescein angiography of her left eye also revealed hyperfluorescent intraretinal infiltrates of the temporal hemisphere and a scar of the inferotemporal retinal vein branch . Her visual acuity recovered to right eye 20/20 and left eye 20/40.", "summary": "We present the case of a 57-year-old Caucasian woman with an anaphylactic reaction after intravenous injection of prednisolone-21-hydrogensuccinate (Solu-Decortin\u00ae H) given for the treatment of toxoplasmosis-associated chorioretinitis. Immediately after the injection, she developed an acute erythema of the legs and abdomen, angioedema, hypotension (blood pressure 80/40mmHg), tachycardia (heart rate 140/minute), hyperthermia (38.8\u00b0C), and respiratory distress. Allergological examinations showed a positive skin-prick test to prednisolone and methylprednisolone. In addition, an oral exposure test with dexamethasone (Fortecortin\u00ae) and betamethasone (Celestamine\u00ae) was conducted to find alternative corticosteroids for future treatments. After oral application, no local or systemic reactions were observed for these two substances.", "subclaim_evaluations": [ { "subclaim": "The patient is a 57-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is Caucasian.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had an anaphylactic reaction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anaphylactic reaction occurred after intravenous injection of prednisolone-21-hydrogensuccinate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The prednisolone-21-hydrogensuccinate was given for the treatment of toxoplasmosis-associated chorioretinitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed an acute erythema of the legs and abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient developed angioedema.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypotension with a blood pressure of 80/40mmHg.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had tachycardia with a heart rate of 140/minute.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hyperthermia with a temperature of 38.8\u00b0C.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had respiratory distress.", "support_label": "supported", "is_refined": false }, { "subclaim": "Allergological examinations showed a positive skin-prick test to prednisolone.", "support_label": "supported", "is_refined": false }, { "subclaim": "Allergological examinations showed a positive skin-prick test to methylprednisolone.", "support_label": "supported", "is_refined": false }, { "subclaim": "An oral exposure test with dexamethasone was conducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "An oral exposure test with betamethasone was conducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "No local or systemic reactions were observed after oral application of dexamethasone.", "support_label": "supported", "is_refined": false }, { "subclaim": "No local or systemic reactions were observed after oral application of betamethasone.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_810_en.txt", "fulltext": "A 15-year-old female, the eldest sibling of patient 1, was diagnosed with\ntyrosinemia type III at eight years of age, after a family screening\nfollowing her brother\u2019s diagnosis.\nShe was born at term by cesarean section (pelvic presentation) following an\nuneventful pregnancy, with an Apgar score of 8 and 9 at 1 and 5 minutes,\nrespectively. Her birth weight was 4,030 g (87th percentile),\nlength 53 cm (87th percentile), and head circumference 36 cm\n(83rd percentile). Her neonatal period was unremarkable, as\nwas her early psychomotor development. She had a history of primary\nnocturnal enuresis and vesical instability, treated with desmopressin and\noxybutynin hydrochloride since the age of six.\nShe was diagnosed with ADHD at the age of five and treated with\nmethylphenidate and risperidone. She presented learning difficulties when\nshe attended elementary school (2nd grade), and was included in a\nspecial education program at the age of ten.\nAt the time of diagnosis, her initial tyrosine level was 1,769 \u00b5mol/L. On the\nfirst nutritional status evaluation, her daily natural protein intake was\n1.4 g/kg. This value dropped to 1.08 g/kg, and she started taking\nsupplementation with 0.7 g of amino acids/kg from phenylalanine- and\ntyrosine-free amino acid mixtures, enabling a consistent decrease of\ntyrosine levels below 300 \u00b5mol/L.\nHer physical examination and growth were normal (weight and height at the\n50\u201285th percentile), with an unremarkable neurological\nexamination. The genetic study revealed the same mutation as her brother in\nhomozygosity.\nAfter initiating a low-protein diet, her behavior and school performance did\nnot improve. The minimum level of daily natural protein intake reached was\n0.65 g/kg at 14 years of age. She is currently in 7th grade,\nstill in the special education program, and under treatment with\nmethylphenidate. Her latest formal developmental assessment (Wechsler\nIntelligence Scale for Children\u00ae, third edition, Portuguese\nversion) revealed a global IQ score of 68, with a verbal IQ of 68 and a\nperformance IQ of 77 .\nShe slowly began diet liberalization and is now with a daily natural protein\nintake of 0.9 g/kg, combined with 0.8 g of amino acids/kg, maintaining\ntyrosine levels below 300 \u00b5mol/L nevertheless.", "summary": "The index case was diagnosed by newborn screening for endocrine and metabolic disorders, starting a low-protein diet immediately, with a consistent decrease in tyrosine levels. By the age of three, the child displayed a hyperactive behavior, starting treatment for ADHD two years later. At seven years of age, he shows a slight improvement in terms of behavior and attention span and has a cognitive performance slightly lower than his peers, despite maintaining acceptable tyrosine levels. His sister, who had a history of ADHD since age five, was diagnosed with HT III after family screening at the age of eight. Despite initiating a dietetic treatment, her behavior did not improve, and she has a mild intellectual impairment.", "subclaim_evaluations": [ { "subclaim": "The index case was diagnosed by newborn screening for endocrine and metabolic disorders.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A low-protein diet was started immediately.", "support_label": "supported", "is_refined": false }, { "subclaim": "Tyrosine levels consistently decreased.", "support_label": "supported", "is_refined": false }, { "subclaim": "By the age of three, the child displayed hyperactive behavior.", "support_label": "supported", "is_refined": false }, { "subclaim": "Treatment for ADHD started two years after the age of three.", "support_label": "supported", "is_refined": false }, { "subclaim": "At seven years of age, the child showed slight improvement in behavior and attention span.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The child's cognitive performance is slightly lower than his peers.", "support_label": "supported", "is_refined": false }, { "subclaim": "The child has acceptable tyrosine levels.", "support_label": "supported", "is_refined": false }, { "subclaim": "The child's sister had a history of ADHD since age five.", "support_label": "supported", "is_refined": false }, { "subclaim": "The sister was diagnosed with HT III after family screening at the age of eight.", "support_label": "supported", "is_refined": false }, { "subclaim": "Dietetic treatment was initiated for the sister.", "support_label": "supported", "is_refined": false }, { "subclaim": "The sister's behavior did not improve.", "support_label": "supported", "is_refined": false }, { "subclaim": "The sister has mild intellectual impairment.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_953_en.txt", "fulltext": "A 54-year-old white man with a past medical history of right maxillary sinus adenoid cystic carcinoma with metastatic lesions to lung and vertebrae, hypertension, hypothyroidism, and nonalcoholic steatohepatitis presented to our emergency room in June 2016 with mental status changes accompanied by abdominal pain, dyspnea, and fever. He was not on active therapy for his malignancy. He previously received a trial regimen of coenzyme Q10, 12 g every 3 days, from October 2015 to April 2016. His past medical history was remarkable for two prior episodes of ascites and 3 months of progressive liver dysfunction and coagulopathy . He had atorvastatin-induced myalgias leading to its discontinuation in April 2016 although his creatine kinase levels were not elevated. He was taking increasing doses of acetaminophen (2 grams daily) prior to admission. His physical examination vital signs were stable with one recorded febrile episode. In general, he appeared ill and lethargic, and was only oriented to person. He exhibited diminished bibasilar breath sounds, ascites with guarding, hypoactive bowel sounds, right lower quadrant tenderness, and hepatosplenomegaly.\nLaboratory data were remarkable for hyperferritinemia, hypofibrinogenemia, anemia, and thrombocytopenia along with elevated transaminases and coagulopathy . A peripheral blood smear showed neutrophilia, monocytosis, and reticulocytopenia. No microangiopathic changes were seen. Extensive platelet clumping was noted.\nImaging studies revealed small pleural effusions, ascites, and hepatosplenomegaly with no evidence of portal hypertension or splanchnic thrombosis. We were suspicious of HLH in light of laboratory and physical examination findings. Additional differential diagnosis workup \u2013 infectious, autoimmune, acetaminophen levels \u2013 yielded unremarkable results, including: serology for hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis E virus (HEV), cytomegalovirus (CMV), Epstein\u2013Barr virus (EBV), herpes simplex virus (HSV), alpha 1-antitrypsin levels, and antinuclear, anti-mitochondrial, anti-smooth muscle, and transglutaminase antibodies (immunoglobulin A (IgA) and immunoglobulin G (IgG)). ADAMTS 13 activity was >34%. HLH-specific laboratory studies were sent, including soluble CD25 (sCD25), NK cell activity studies, and bone marrow biopsy.\nHe continued to deteriorate with multiple organ failure including renal failure, myocardial injury, and respiratory failure requiring intubation. Empiric therapy, considering the evidence of liver injury and the possibility of HLH, with N-acetylcysteine on a 20-hour intravenous protocol and dexamethasone 8 mg intravenously administered three times daily was initiated. HLH chemotherapy was not done during this time as hepatotoxicity risk outweighed benefits and a definite diagnosis was not confirmed.\nAs an attempt to expedite the evaluation of possible HLH, we isolated mononuclear cells from peripheral blood and evaluated expression of surface markers in cytokine-producing NK cells and cytotoxic NK cells by flow cytometry. We compared the profile with normal controls. The results, available after 36 hours, were remarkable for an increased expression of CD69 in cytotoxic NK cells, and decreased NKG2A in cytokine-producing NK cells in our case. The expression of CD69 and NKG2A in NK cells was evaluated in four other normal donors and the results were similar to the one acquired in parallel to the HLH sample . No differences in protein expression of other markers were observed by flow cytometry (data not shown). These findings included similar surface levels of OX40, GITR, 4-1BB, TIM-3, PD-1, CTLA-4, LAG-3, and ICOS in CD8+ CD3+ T cells, as well as effector (CD127+, FoxP3-) and regulatory (CD127-, FoxP3+) CD4+ CD3+ T cells; similar expression of NKp44, NKG2C, NKG2D, 4-1BB, NKp30, and NKp46 in NK cells (CD56+ CD3-); and similar expression of CD28, CD27, ICOS, Eomes, Blimp-1, Bcl-6, T-bet, Ki-67, and cMyc in na\u00efve (CCR7+ CD45RA+), effector (CCR7- CD45RA+), effector memory (CCR7-CD45RA-), and central memory (CCR7+ CD45RA-) CD4+ and CD8+ T cells. The frequency of all the evaluated immune cell populations was also similar, when comparing cells from our patient with those ones from a healthy control.\nOur patient\u2019s bone marrow biopsy was performed 10 days after admission and delayed due to severe coagulopathy and demonstrated normocellularity (40 to 50%), megakaryocytic hypoplasia, and clusters of foamy histiocytes with ingested marrow cells. Fifteen days after admission, he fulfilled multiple HLH-2004 diagnostic criteria including hyperferritinemia, fever, splenomegaly, cytopenias, hemophagocytosis on biopsy of bone marrow, elevated CD25, and decreased NK cell activity by standardized studies .\nHe steadily recovered with the steroid therapy instituted for 12 days and supportive measures. He was weaned off intubation and sedation. However, he refused further interventions for HLH, namely etoposide-based therapy and continuation of steroid treatment; he chose palliative care and died 2 weeks later.", "summary": "We describe the case of a 54-year-old white man with history of metastatic maxillary sinus adenoid cystic carcinoma who had severe liver injury and cytopenias with progressive clinical deterioration. We performed an evaluation, by flow cytometry, of the expression of surface markers in his natural killer cells that revealed remarkable abnormalities. His syndrome eventually fulfilled criteria for hemophagocytic lymphohistiocytosis and he received therapy with steroids with interval clinical improvement. Unfortunately, he refused further cytotoxic treatment and died 2 weeks later.", "subclaim_evaluations": [ { "subclaim": "The patient is a 54-year-old white man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a history of metastatic maxillary sinus adenoid cystic carcinoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had severe liver injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cytopenias.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had progressive clinical deterioration.", "support_label": "supported", "is_refined": false }, { "subclaim": "An evaluation of the expression of surface markers in his natural killer cells was performed by flow cytometry.", "support_label": "supported", "is_refined": false }, { "subclaim": "The evaluation revealed remarkable abnormalities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The syndrome eventually fulfilled criteria for hemophagocytic lymphohistiocytosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient received therapy with steroids.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had interval clinical improvement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient refused further cytotoxic treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient died 2 weeks later.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_992_en.txt", "fulltext": "A 23-year-old woman was referred to the Oral and Maxillofacial Surgery Service of\nAssocia\u00e7\u00e3o Paulista de Cirurgi\u00f5es-Dentistas 30 days after accidental extraction of a\nmandibular second molar during extraction of a third molar on the left side. and show the panoramic radiographs taken before and after extractions, respectively. The\npatient also reported that the surgeon had considerable difficulty during the surgical\nprocedure, which imposed an extensive period of time with the mouth opened. She reported\nsevere joint pain on the right side soon after surgery, accompanied by difficulty in\nmouth opening and a deviation to the opposite side of the extractions.\nClinical examination also revealed 23-mm mouth opening , with normal eccentric movement to the ipsilateral side and\nrestriction of eccentric movement to the contralateral side . The following hypotheses were considered: permanent trismus,\nmandibular fracture or ADDWoR on the right side of the TMJ. Patient denied having\nhistory of symptoms related to TMD before surgery. Magnetic resonance imaging (MRI)\nconfirmed ADDWoR on the right side of the TMJ .\nThe patient was advised to try to reduce deviation by performing lateral movements, as\nmuch as possible, to the contralateral side of displacement, and, from this position,\ntry to reach maximum mouth opening. At that time, no increase in mandibular opening and\nlaterality was observed. Thus, two attempts of manual manipulation were performed within\nthe period of one week. In the first attempt, we chose to test mandibular reduction\nusing extraoral anesthesia alone. Due to failure and patient's discomfort, we decided to\nwait a week before making a new attempt. At this time, we applied the same type of\nextraoral anesthesia associated with intravenous sedation, thus contributing to\nsuccessful reduction of disc displacement.\nExtraoral anesthesia was applied by blocking the auriculotemporal nerve with 1.8 ml of\n2% lidocaine hydrochloride associated with norepinephrine 1:200,000, followed by\nanesthesia of masseteric and posterior deep temporal nerves with the same amount of\nanesthetics. With a view to providing the patient with greater comfort, an intravenous\ninjection of 2 g midazolam hydrochloride was administered ten minutes before the manual\nreduction procedure . Thus, 40-mm mouth\nopening and immediate improvement of mandibular functions were achieved .\nMinagi et al's technique for mandibular\nmanipulation was used. It assists patients in performing maximum lateral excursive jaw\nmovements to the nonaffected side with teeth slightly occluded, and in making maximal\njaw opening movements through lateral border movements, as follows: 1) Place the thumb\nand forefinger on the maxillary canine on the nonaffected side and the mandibular canine\non the affected side. Hold the gonion with the forefinger and middle finger of the other\nhand. 2) Instruct the patient to make maximal lateral gliding excursive jaw movements to\nthe nonaffected side with teeth slightly occluded. Support movement with fingers and\nensure that lateral excursive position is maximal. Lateral excursion with the jaw\nprotruding is not adequate for this procedure. 3) Subsequently, instruct the patient to\nmake jaw opening movements through the lateral border path on the nonaffected side.\nSupport this opening movement with assisting fingers. 4) Continue to support voluntary\nmouth opening up to the maximal opening position.\nThe patient received a prescription of anti-inflammatory drugs (100 mg of nimesulide,\n12/12 hours, orally) during five days, and also was advised not to force mandibular\nmovements after reduction. The patient was instructed to use a stabilizer plate\nimmediately after correct manipulation, so as to avoid a new disc displacement and\nreduce muscle hyperactivity. There were no complications after the manipulation\nmaneuver, and an immediate 40-mm mouth opening was achieved after manual manipulation\n. The patient was followed-up on a\nweekly basis in the first month and every two weeks until the third month, showing no\nepisodes of TMD within this period. and show MRI sagittal slices of the right TMJ\nwith closed mouth presenting disc displacement and in maximum mouth opening movement,\nevincing reduction of TMJ articular disc.", "summary": "The patient presented severe limitation to fully open the mouth, interfering in her ability to eat. Clinical examination also revealed maximum assisted jaw opening (passive stretch) with less than 40 mm of maximum interincisal opening. Magnetic resonance imaging was the method of choice to identify the temporomandibular disorders.", "subclaim_evaluations": [ { "subclaim": "The patient had severe limitation to fully open the mouth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The limitation interfered with her ability to eat.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed maximum assisted jaw opening.", "support_label": "supported", "is_refined": false }, { "subclaim": "The maximum interincisal opening was less than 40 mm.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Magnetic resonance imaging was the method of choice.", "support_label": "supported", "is_refined": false }, { "subclaim": "Magnetic resonance imaging was used to identify temporomandibular disorders.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_1996_en.txt", "fulltext": "Our work is a single case report and has been reported in line with the SCARE criteria .\nA healthy 59-year-old woman on long-term therapy with Hydroxyurea 500 mg daily for essential thrombocytosis, presented with a painless slow-growing lesion of the jaw that had persisted and increased in size for six months, the appearance of the lesion is correlated to the administration of the hydroxyurea treatment. There was no history of local trauma, radiotherapy, HPV infections, or family history of malignancy. She was referred to our department's consultation for specialized care. No other personal or family history was raised during the patient interrogation. Clinical examination revealed a large nodular lesion with irregular borders of the right cheek, infiltrated into underlying tissue, the lesion extending to the free border of the right lower eyelid with dimensions 4 \u00d7 4 cm, without sensory disturbances or diplopia (.). In the nose, black horn-shaped hyperkeratosis lesion in the nasal pyramid (.).\nThere were no palpable neck lymph nodes on the left side.\nA biopsy of surgical material was performed, showing a well-differentiated squamous cell carcinoma.\nThe definitive diagnosis of malignancy was made; metastatic investigations were performed, including chest radiography, abdominal echography, PET scan. The results of these exams were normal.\nThe computed tomography (CT) was performed and found free lymph node.\nOn the biological level, the patient presented anemia at 7.4 g / dl for which she was transfused; a thrombocytosis at 548.000, the rest of the assessment was without particularities.\nBased on the positive medical history and clinical examination, the patient was diagnosed clinically with hydroxyurea-induced squamous cell carcinoma, the hydroxyurea was ceased and the hematological therapy was switched to busulfan. The surgery was indicated and performed by the chief professor of our department who has 15 years of operative experience. The surgical procedure had the aim of the restoration of the anatomic landmarks after a large excision of the tumor and reconstruction of full-thickness eyelid defect with a local flap under general anesthesia.\nDuration of surgery: 60 min; estimation of blood loss: 150 ml; duration of hospital stay: 3 days.\nThe patient received amoxicillin/clavulanic acid 1 g twice daily and antalgics for 8 days.\nPost-operative histopathology confirmed SCC proliferation; the different margins of excision were healthy.\nThe multidisciplinary team deciding on the treatment options included surgeons, oncologists, radiotherapists, ophthalmologist surgeons, radiologists. The decision was made to treat the patient with the surgical approach (surgical excision of the tumor) with 1.5 cm free margins and reconstruction; the authors used the superior pedicle nasolabial island flap; with postoperative radiotherapy (PORT) and postoperative chemotherapy (POCRT). Considering the patient's age, general history, the size of the tumor, the prognosis was average.\nPostoperative periods were favorable; the scar was clean and non-inflammatory.\nRoutine follows up 3, 6, and 12 months showed no signs of recurrence.", "summary": "The authors report the case of a healthy 59-year-old woman on long-term therapy with Hydroxyurea 500\u00a0mg daily for essential thrombocytosis, presented with a painless slow-growing lesion of the jaw that had persisted and increased in size for six months, the appearance of the lesion is correlated to the administration of the hydroxyurea treatment. Clinical examination revealed a large nodular lesion 4\u00a0\u00d7\u00a04\u00a0cm with irregular borders of the right cheek, infiltrated into underlying tissue, the lesion extending to the free border of the right lower eyelid without sensory disturbances or diplopia. The surgery was indicated. The surgical procedure had the aim of the restoration of the anatomic landmarks after a large excision of the tumor and reconstruction of full-thickness eyelid defect with a local flap under general anesthesia.", "subclaim_evaluations": [ { "subclaim": "The patient is a 59-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had essential thrombocytosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was on long-term therapy with Hydroxyurea 500 mg daily.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a painless slow-growing lesion of the jaw.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion had persisted and increased in size for six months.", "support_label": "supported", "is_refined": false }, { "subclaim": "The appearance of the lesion is correlated to the administration of hydroxyurea treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed a 4 \u00d7 4 cm nodular lesion of the right cheek.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion had irregular borders.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion infiltrated into underlying tissue.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion extended to the free border of the right lower eyelid.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no sensory disturbances.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no diplopia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Surgery was indicated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgical procedure aimed to restore anatomic landmarks.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgical procedure involved a large excision of the tumor.", "support_label": "supported", "is_refined": false }, { "subclaim": "The surgical procedure included reconstruction of a full-thickness eyelid defect.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reconstruction was performed with a local flap.", "support_label": "supported", "is_refined": false }, { "subclaim": "The procedure was performed under general anesthesia.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_310_en.txt", "fulltext": "A 64-year-old man visited the local medical center on March 4th with a complaint of general weakness, myalgia, and abdominal pain, which had begun a week prior to the visit.\nThe patient underwent computed tomography (CT) at the local medical center where he was diagnosed with thrombosis of the SMV, and was subsequently transferred to our hospital. The abdominal CT scan revealed a large thrombus running straight from the SMV gastrocolic trunk to the distal site, totally obstructing a segmental portion of the SMV. Additionally, the surrounding fat stranding and bowel wall edema of the ascending colon were confirmed.\nThe patient had a fever of 37.9 \u00b0C at the time of the visit, and complained that he felt hot. He also complained of a headache, but there was no cough, sputum, diarrhea, or vomiting.\nOver the previous 5-years, the patient had been prescribed 1000 mg metformin once daily (Q.D.), 1 mg glimepiride Q.D., 2.5 mg linagliptin Q.D., 50 mg losartan Q.D., and 10 mg rosuvastatin Q.D. for hypertension and diabetes.\nThe patient continued to complain of a dull pressing pain in the right upper quadrant, with mild tenderness in the area during the physical examination. The bowel sound was hypo-active, and there were no other specific findings in other physical examinations.\nBlood tests revealed that the white blood cell count was 16160 /mL, the level of ESR was 86 mm/hr, and the level of HS-CRP was 16 mg/dL. Although SMV thrombosis was diagnosed, the patient only complained of mild tenderness, and no rebound tenderness. However, there were complaints of fever and muscle pain throughout the body. Since the patient\u2019s symptoms were considered atypical for SMV thrombosis, a sample was collected through a nasopharyngeal swab and an Influenza A/B rapid antigen test was performed. The influenza test was performed using \"The BD Veritor\u2122 Plus System for Rapid Detection of Flu A+B\" kit, sensitivity 81.3% (71.1%, 88.5%, 95% confidence interval), specificity 98.2% (95.7%, 99.3%, 95% confidence interval). In addition, after collecting samples through nasopharyngeal swab, coronavirus disease-2019 (COVID-19) test by RT-PCR was performed by taking account of recent pandemic situation.\nThe abdominal CT scan revealed a large thrombus running straight from the SMV gastrocolic trunk to the distal site, totally obstructing a segmental portion of the SMV. Additionally, the surrounding fat stranding and bowel wall edema of the ascending colon were confirmed.", "summary": "A 64-year-old male visited the hospital with general weakness, muscle aches, fever, and abdominal pain. The patient underwent computed tomography (CT) and was diagnosed with SMV thrombosis. Since the patient's muscle pain and fever could not be explained by the SMV thrombosis, the clinician performed a test for influenza, which produced a positive result for influenza B. The patient had a thrombus in the SMV only, with no invasion of the portal or splenic veins, and was clinically stable. Anticoagulation treatment was prescribed without surgery or other procedures. The follow-up CT scan showed improvement, and the patient was subsequently discharged with continued oral anticoagulant treatment.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had general weakness.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had muscle aches.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had fever.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent computed tomography.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with SMV thrombosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's muscle pain could not be explained by the SMV thrombosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient's fever could not be explained by the SMV thrombosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinician performed a test for influenza.", "support_label": "supported", "is_refined": false }, { "subclaim": "The influenza test result was positive for influenza B.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a thrombus in the SMV.", "support_label": "supported", "is_refined": false }, { "subclaim": "The thrombus did not invade the portal vein.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The thrombus did not invade the splenic vein.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was clinically stable.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Anticoagulation treatment was prescribed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "No surgery was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "No other procedures were performed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The follow-up CT scan showed improvement.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was discharged.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received continued oral anticoagulant treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_3354_en.txt", "fulltext": "62-year-old previously healthy female hiker and climber presented with dizziness, imbalance, and gait instability that developed rapidly within a few weeks in 2016. Subacute cerebellar ataxia was suspected and a number of studies including oncological blood tests, oncological neuronal antibodies, brain and body PET, cerebrospinal fluid examination, brain imaging, and genetic testing for ataxia were performed with no positive findings. After an initial plateau of symptoms, the patient entered a slow and progressive neurological decline with late-onset idiopathic cerebellar ataxia as the most likely diagnosis. After multiple medical consultations, she came to our center in 2022. The patient denied a family history, frequent cough, digestive problems, and autonomic disorders. The neurological examination showed unstable, wide-based gait and a positive Romberg test. She presented dysarthria, vertical descending nystagmus in primary gaze, and lateral gaze nystagmus. The slow eye tracking was fragmented and the visual suppression of the normal vestibulo-ocular reflex was observed. The head impulse test and dynamic visual acuity were abnormal. In addition, symmetrical bilateral inframalleolar hypalesthesia and presenting vestibulo-neuromuscular reflexes were observed. No autonomic weakness or muscle weakness was detected in the extremities. In summary, the patient with no relevant family history developed a late-onset idiopathic cerebellar ataxia with diverse neurological manifestations including sensory and vestibular disorders, while the studies performed did not yield a specific diagnosis. Complementary studies: To revalidate the clinical diagnosis of a mixed vestibulo-cerebellar dysfunction, a 3 Tesla magnetic resonance of the brain (MRI), a video head impulse test (VHIT) and vestibulo-myogenic evoked potentials (VEMPS) were performed along with sensory potentials of the four limbs. The MRI of the brain showed a discrete cerebellar vermiform and para-vermiform atrophy without focal structural damage. The vestibulo-myogenic evoked potentials showed a severe global vestibular hyporeflexia. Genetic studies: A clinical exome study was performed, using next-generation sequencing (NGS), to search for point and small insertion/deletion variants on a panel of 677 candidate genes according to the patient's phenotype, mainly associated with spinocerebellar ataxia, which was negative. Subsequently, a specific genetic study for intronic expansion in the RFC1 gene was performed, which was consistent with the presence of a pathogenic AAGGG motif biallelic expansion. These findings of bilateral vestibulopathy associated with cerebellar ataxia and sensory neuronopathy suggested the diagnosis of CANVAS, which was confirmed by the identification of biallelic expansion of the RFC1 gene in genetic testing.\n", "summary": "We present the case of a 62-year-old woman with a history of bi-phasic onset gait imbalance and deterioration, with a rapid onset of symptoms followed by slow and progressive neurological deterioration. The diagnostic process was complex and numerous tests were performed to exclude acquired and genetic causes of ataxia, leading to the diagnosis of idiopathic late-onset cerebellar ataxia. Subsequently, vestibular function tests identified a severe bilateral vestibulopathy. This led to consideration of CANVAS as a diagnosis, which was finally confirmed by genetic testing (biallelic expansion of the penta-nucleotide AAGGG in the RFC1 gene).\n", "subclaim_evaluations": [ { "subclaim": "The patient is a 62-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had bi-phasic onset gait imbalance and deterioration.", "support_label": "supported", "is_refined": false }, { "subclaim": "Her symptoms had a rapid onset followed by slow and progressive neurological deterioration.", "support_label": "supported", "is_refined": false }, { "subclaim": "Numerous tests were performed to exclude acquired and genetic causes of ataxia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The diagnosis was idiopathic late-onset cerebellar ataxia.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Vestibular function tests identified a severe bilateral vestibulopathy.", "support_label": "supported", "is_refined": false }, { "subclaim": "CANVAS was considered as a diagnosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "CANVAS was confirmed by genetic testing.", "support_label": "supported", "is_refined": false }, { "subclaim": "The genetic test showed biallelic expansion of the penta-nucleotide AAGGG in the RFC1 gene.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2163_en.txt", "fulltext": "A 64-year-old man who came to our emergency department complaining of left shoulder pain.\nHe had mild left shoulder trauma due to accidental falling from the standing position while walking 3 h ago.\nHis past medical history included atrial fibrillation treated with aspirin enteric-coated tablets (Bayer SPA), metoprolol succinate sustained-release tablets (AstraZeneca AB), and chronic atrophic gastritis.\nThe patient denied a history of smoking, alcohol consumption, drug intake, and a family history of pathological fracture or osteoporosis.\nPhysical examination demonstrated swelling of the left shoulder, localized tenderness, percussion pain on the proximal humerus, and limited shoulder motion. The muscular tone of the upper limb was normal with no hypoesthesia. Physiological reflexes were present without pathological reflexes.\nIn contrast, routine laboratory evaluation on admission, with the exception of anemia, was unremarkable. Hematopoiesis accounted for 40%, the ratio of granulocytes to erythrocytes was approximately 2:1, and megakaryocytes were 2-7/high power field. Multifocal plasmacytoid cell aggregation was also observed. Immunochemistry showed CD38 (+), kappa (+), lambda (+); MPO (+), CD61 (+) and CK (-) .\nInitial X-ray films of the left shoulder were obtained, which showed only a comminuted fracture and degenerative changes in the upper left humerus . Magnetic resonance imaging (MRI) was then performed and showed an abnormal signal intensity of the proximal humerus associated with a comminuted fracture, and multiple soft tissue masses around the fracture, ranging from 4.8 cm to 3.9 cm, which presented as hypointensity and isointensity, as well as hybrid hyperintensity on T1-weighted (T1-W) and T2-W images, respectively. The left humerus, glenoid, and clavicle had multiple sheet-like hyperintensity on T2-W images . A neoplastic lesion with radiological characteristics was highly suspected.\nFurther laboratory tests and imaging examinations were performed. Computed tomography (CT) scans and X-ray examinations revealed multiple areas of reduced bone density throughout the body. In addition, high 18-F-fluorodeoxyglucose metabolism was observed in several ribs on bone scans, and in the fifth lumbar vertebra (L5), and left proximal humerus .", "summary": "A 64-year-old male patient complaining of serious left shoulder pain and limited movement was admitted. The patient was finally diagnosed with MM (IgA\u03bb, IIIA/II). After treatment of the pathological fracture with IM nailing, the patient's function recovered and his pain was rapidly relieved. Histopathological examination demonstrated plasma cell myeloma. The patient received chemotherapy in the Hematology Department. The humeral fracture displayed good union during the 40-mo follow-up, with complete healing of the fracture, and the clinical outcome was satisfactory. At the most recent follow-up, the patient's function was assessed using the Musculoskeletal Tumor Society score, which was 29.", "subclaim_evaluations": [ { "subclaim": "The patient is a 64-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient complained of serious left shoulder pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had limited movement.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with MM (IgA\u03bb, IIIA/II).", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient had a pathological fracture.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pathological fracture was treated with IM nailing.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient's function recovered after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient's pain was rapidly relieved after treatment.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Histopathological examination demonstrated plasma cell myeloma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received chemotherapy in the Hematology Department.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The humeral fracture displayed good union during the 40-mo follow-up.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The fracture completely healed.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The clinical outcome was satisfactory.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient's function was assessed using the Musculoskeletal Tumor Society score.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The Musculoskeletal Tumor Society score was 29.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2745_en.txt", "fulltext": "A 29-year-old woman was diagnosed with aortic coarctation and a bicuspid aortic valve. The patient underwent a left subclavian flap aortoplasty 1 month after birth and balloon dilatation for re-coarctation at the age of 8 years. She subsequently self-discontinued outpatient follow-ups. At the age of 26 years, she was diagnosed with hypertension and referred to our hospital as her contrast-enhanced computerized tomography scan revealed re-coarctation. Her height was 152\u2005cm, weight 53\u2005kg, heart rate 90\u2005b.p.m., percutaneous arterial oxygen saturation 97% (room air), right upper extremity blood pressure (BP) 152/89\u2005mmHg, and right lower extremity BP 120/93\u2005mmHg. She had a Levine III/VI systolic murmur at the second intercostal space left sternal border and left back. The patient occasionally noticed fatigue in her legs when walking. Laboratory findings revealed an N-terminal prohormone of brain natriuretic peptide of 50.6\u2005pg/mL. A chest radiography revealed a cardiothoracic ratio of 48% and no rib notch sign. A 12-lead electrocardiogram revealed sinus rhythm with sV1 + rV5 of 2.6\u2005mV. Echocardiography revealed an LV end-diastolic diameter of 44.6\u2005mm, a posterior wall of 7.9\u2005mm, and an ejection fraction rate of 79%. The LV inflow waveform had a normal pattern with E/A > 1. The blood flow velocity at the re-coarctation was 3.2\u2005m/s. The abdominal aortic blood flow waveform was blunted, and the systolic upstroke delayed. Cardiac catheterization revealed an LV pressure of 152/e12\u2005mmHg, a re-coarctation area of 7.0 \u00d7 5.3\u2005mm, and a systolic pressure gradient (PG) of 40\u2005mmHg . One month after catheterization, the patient underwent balloon dilatation. Subsequently, the re-coarctation area expanded to 10.0\u2005mm \u00d7 10.5\u2005mm, and the systolic PG improved to 6\u2005mmHg . After patient consent, we used 4D flow MRI for research purposes to evaluate the large vessel and LV blood flow before and after treatment. Cardiac MRI was a 3.0\u2005T whole-body imager (MAGNETOM Vida 3\u2005T; Siemens Healthcare, Erlangen, Germany). Scan parameters included: acceleration method, GRAPPA 3; field of view, 340 \u00d7 340\u2005mm; flip angle, 8\u00b0; temporal resolution, 41\u2005ms; a retrospectively electrocardiogram triggered. The acquired voxel size was 2.5 \u00d7 2.5 \u00d7 2.5\u2005mm3, with velocity encoding 150\u2005cm/s, Segment 2, and 30 frames/cycle. A workstation (cvi42, ver 5.17.0, Circle, Cardiovascular Imaging, Calgary, Canada) was used for the analysis.\nPreoperatively, helical flow was observed in the ascending and descending aorta ( and ). The LV blood flow analysis revealed 39.1% direct flow, 21.7% delayed ejection flow, 23.4% retained inflow, and 15.9% residual volume. Details of the four blood flow components and data on normal subjects are shown ( and , ). No obvious intraventricular blood flow ratio abnormality was observed . However, kinetic energy (KE) values of direct flow and delayed ejection flow decreased during systole . Postoperatively, helical flow in the descending aorta was alleviated ( and ). Left ventricular blood flow analysis revealed 39% direct flow, 19.4% delayed ejection flow, 22% retained inflow, and 19.5% residual volume . Although no change was observed in the direct flow ratio, an increase in KE values of direct flow and delayed ejection flow during systole was observed . Left ventricular function and volumes did not change before and after treatment. Two months after treatment, the systolic BP decreased by 20\u2005mmHg.", "summary": "A 29-year-old female was diagnosed with coarctation of the aorta and a bicuspid aortic valve after birth and underwent surgery at 1 month. At 8 years of age, she underwent balloon dilatation for re-coarctation. At the age of 28 years, she was diagnosed with re-coarctation triggered by hypertension. She underwent balloon dilatation as her cardiac catheterization revealed a systolic pressure gradient of 40\u2005mmHg. Pretreatment 4D flow MRI demonstrated helical flow in the ascending aorta and descending thoracic aorta and LV blood flow analysis revealed a decrease in LV kinetic energy during systole; these improved after treatment.", "subclaim_evaluations": [ { "subclaim": "The patient is a 29-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with coarctation of the aorta after birth.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was diagnosed with a bicuspid aortic valve after birth.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent surgery for coarctation of the aorta at 1 month of age.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 8 years of age, she underwent balloon dilatation for re-coarctation.", "support_label": "supported", "is_refined": false }, { "subclaim": "At 28 years of age, she was diagnosed with re-coarctation.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Her re-coarctation at 28 years was triggered by hypertension.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She underwent balloon dilatation for re-coarctation.", "support_label": "supported", "is_refined": false }, { "subclaim": "Cardiac catheterization revealed a systolic pressure gradient of 40 mmHg.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pretreatment 4D flow MRI showed helical flow in the ascending aorta.", "support_label": "supported", "is_refined": false }, { "subclaim": "Pretreatment 4D flow MRI showed helical flow in the descending thoracic aorta.", "support_label": "supported", "is_refined": false }, { "subclaim": "LV blood flow analysis showed a decrease in LV kinetic energy during systole.", "support_label": "supported", "is_refined": false }, { "subclaim": "LV kinetic energy improved after treatment.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_2309_en.txt", "fulltext": "A 4-day-old male infant, who was born at 40 weeks\u2019 gestational age and weighing 3660 g. He was delivered at term by episiotomy combined with forceps and admitted to the Department of Neonatology of The Second Hospital of Jilin University due to dyspnea in February 2022. No cutaneous lesions were observed. The patient underwent brain magnetic resonance imaging (MRI), the results of which showed a short T1 strip signal shadow (hemorrhage) under the cranial plate of the occipital region on both sides. He had no family history of diseases.The right eye appeared normal in the routine retinal screening performed with RetCam 3 (Clarity Medical Systems, Inc., Pleasanton, CA, USA). However, a color fundus photograph of the left eye revealed a solitary yellowish-white flat mass with an approximate size of 1.5-disc diameters located in the nasal retina . Diffuse hyperfluorescence with slight fluorescence leakage was observed by fluorescein angiography (FA) . On B-scan ultrasound, the mass was inapparent, with no distinct foci of calcification. No treatment was administered and follow-up reexaminations were recommended. Three months later, regression in the size of the retinal mass was observed . FA showed decreased vascularization of the lesion and slight mottled hyperfluorescence over its surface . Seven months later, the fundus examination indicated no lesion in the left eye . FA showed mild tortuous vessels without leakage . The right retina was normal, and thus the clinical course suggested that the isolated RAH may undergo spontaneous regression.", "summary": "An isolated retinal astrocytic hamartoma was detected in the nasal retina of the left eye of a 4-day-old male infant. At the time of initial presentation, we detected a solitary yellowish-white flat mass with an approximate size of 1.5 disc diameters in the nasal retina. Fluorescein angiography (FA) revealed a diffuse hyperfluorescence with slight fluorescence leakage. Seven months later, the fundus examination showed no lesion in the left eye, FA revealed mild tortuous vessels without leakage.", "subclaim_evaluations": [ { "subclaim": "An isolated retinal astrocytic hamartoma was detected in the nasal retina of the left eye of a 4-day-old male infant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was a solitary yellowish-white flat mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was approximately 1.5 disc diameters in size.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fluorescein angiography revealed diffuse hyperfluorescence.", "support_label": "supported", "is_refined": false }, { "subclaim": "Fluorescein angiography showed slight fluorescence leakage.", "support_label": "supported", "is_refined": false }, { "subclaim": "Seven months later, the fundus examination showed no lesion in the left eye.", "support_label": "supported", "is_refined": false }, { "subclaim": "Seven months later, fluorescein angiography revealed mild tortuous vessels.", "support_label": "supported", "is_refined": false }, { "subclaim": "Seven months later, fluorescein angiography showed no leakage.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3199_en.txt", "fulltext": "A 20-year-old primigravida woman who did not remember her last menstrual period but stated that she had been amenorrheic for the past 6 months was referred to our hospital with a diagnosis of second trimester pregnancy plus disseminated intravascular coagulation (DIC) plus missed abortion and complained of lower abdominal pain for 1-week duration. Associated with this, she experienced easy fatigability, dizziness, blurred vision, and vertigo of the same duration.\n\nPhysical examination revealed blood pressure of 85/50 mmHg, with a pulse rate of 126 beats per minute (bpm). The patient had pale conjunctiva and tender abdomen. Obstetric ultrasound examination revealed a 22-week consistent pregnancy in the peritoneum, negative fetal heartbeat, empty uterus, and free fluid in Douglas and Morrison\u2019s pouch. Laboratory results showed a hemoglobin concentration of 4.3 g/dL.\n\nOwing to unstable vital signs, the patient was transfused with three units of screened, cross-matched whole blood. After informed consent was obtained, the patient was rushed to the operating theatre with a preoperative diagnosis of uterine rupture.\n\nIntraoperative findings revealed hemoperitoneum of 2L, 500gm freshly dead male fetus and placenta, respectively. Further inspection revealed a bicornuate uterus and fundal uterine rupture in the left uterine segment. The hemoperitoneum was suctioned, the placenta and fetus were removed, and the uterus was repaired using a size 1 Vicryl suture.\n\nThe patient\u2019s postoperative recovery was uneventful, and she was discharged on her fifth postoperative day. The patient was counselled on family planning for at least one year, and any future pregnancy would require elective cesarean delivery.", "summary": "A 20-year-old primigravid woman at 22 weeks of gestation, with no prior surgery, presented with severe abdominal pain, anemia, and hemodynamic instability. With a preoperative diagnosis of uterine rupture, she was transfused with three units of cross-matched whole blood and underwent emergency laparotomy. Intraoperative findings showed a ruptured bicornuate uterus and a dead fetus in the abdomen with huge hemoperitoneum. Postoperative recovery was smooth, and the patient was discharged after being counselled on family planning and subsequent pregnancy.", "subclaim_evaluations": [ { "subclaim": "The patient is a 20-year-old primigravid woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She is at 22 weeks of gestation.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has no prior surgery.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "She presented with severe abdominal pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had anemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had hemodynamic instability.", "support_label": "supported", "is_refined": false }, { "subclaim": "The preoperative diagnosis was uterine rupture.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was transfused with three units of cross-matched whole blood.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent emergency laparotomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "Intraoperative findings showed a ruptured bicornuate uterus.", "support_label": "supported", "is_refined": false }, { "subclaim": "A dead fetus was found in the abdomen.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was a huge hemoperitoneum.", "support_label": "supported", "is_refined": false }, { "subclaim": "Postoperative recovery was smooth.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was discharged after being counselled on family planning.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was counselled on subsequent pregnancy.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_62_en.txt", "fulltext": "A 60-year-old male patient with metastatic colon cancer of the liver was referred to interventional radiology for right PVE prior to major hepatic resection.\nHe was diagnosed with sigmoid colon cancer and underwent anterior resection surgery 6 mo back. He developed liver metastasis for which right liver lobe resection was planned by a hepatobiliary surgeon. Due to a small left liver lobe, preoperative right PVE is requested to enhance the volume of the residual left liver lobe.\nHe is a known case of diabetes mellitus Type 2 Stage 3 on insulin and metformin for 9 years.\nHis personal and family history is unremarkable.\nGeneral examinations did not reveal any abnormality. Abdominal examinations revealed surgical scars from previous laparoscopic surgery and a stoma. No others abnormality could be detected.\nThe laboratory results of routine hematological testing, blood sedimentation rate, and tumor-associated markers were within normal limits. Alpha-fetoprotein is 14 ng/mL. Carcinoembryonic antigen is 2.4 ng/mL. Carbohydrate antigen 19-9 is 19 U/mL.\nHe underwent contrast-enhanced CT, which showed multiple right hepatic metastasis, small left hepatic lobe, and a normal patent portal venous system with a standard anatomy .", "summary": "A 60-year-old male presented with metastatic colon cancer of the liver. The patient underwent preoperative right PVE. During the embolization procedure, a small amount of glue and lipiodol emulsion was embolized to the heart and lungs through an unrecognized intrahepatic portosystemic fistula. The patient remained clinically stable and underwent the planned hepatic resection after 4 wk, with an uneventful postoperative course.", "subclaim_evaluations": [ { "subclaim": "The patient is a 60-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had metastatic colon cancer of the liver.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent preoperative right portal vein embolization.", "support_label": "supported", "is_refined": false }, { "subclaim": "During the embolization procedure, a small amount of glue and lipiodol emulsion was embolized to the heart.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "During the embolization procedure, a small amount of glue and lipiodol emulsion was embolized to the lungs.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The embolization occurred through an unrecognized intrahepatic portosystemic fistula.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient remained clinically stable.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent the planned hepatic resection after 4 weeks.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The postoperative course was uneventful.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 5 }, { "id": "multiclinsum_test_2467_en.txt", "fulltext": "The patient was a 70-year-old Japanese man (172.0\u2005cm tall, weighing 68.0\u2005kg, body\nmass index 23.0\u2005kg/m2) who had smoked 20 cigarettes a day for 47 years\nuntil 5 years ago. He was under treatment and follow-up for essential hypertension,\ndyslipidemia and chronic kidney disease, and his blood pressure and lipid levels\nwere well controlled with administration of 40\u2005mg of olmesartan medoxomil (Olm) and\n5\u2005mg of atorvastatin calcium hydrate. His renal function was stable. The patient\npresented with nasal discharge, malaise and a mild cough, and tested positive for\nSARS-CoV-2 by the polymerase chain reaction (PCR) test three days after coming in\nextended contact with a colleague who was also diagnosed with SARS-CoV-2. Since he\nhad many risk factors for disease aggravation, he was urgently admitted to our\nhospital (Day 1) the day after symptom onset and confirmation of the diagnosis.\nAt admission, his body temperature was 36.4 \u00b0C, blood pressure was 185/72\u2005mm Hg,\npulse was 86\u2005beats/min, respiratory rate was 20\u2005beats/min and peripheral oxygen\nsaturation on pulse oximetry (SpO2) was 97.0%. Laboratory findings at\nthis time showed lymphocyte depletion and coagulation abnormalities [lymphocytes\n8.5%, fibrinogen 518\u2005mg/dL, fibrinogen degradation products 5.26\u2005\u03bcg/mL and D-dimer\n(D-D) 1.68\u2005\u03bcg/mL] . In addition, iron deficiency anemia was observed (he was\nscheduled for close examination of the gastrointestinal tract after COVID-19 was\ncured), and hence, it was difficult to evaluate the clinical implication of the\nobserved low ferritin level . CT showed emphysematous changes in the lung field. Ground\nglass opacities with neither a crazy-paving pattern nor consolidation was found\nbelow the dorsal pleura of the upper right lobe, and the total CT score was 1/25\npoints (upper right lobe 1/5 points, middle lobe 0/5 points, lower right lobe 0/5\npoints, upper left lobe 0/5 points and lower left lobe 0/5 points), based on the\nscoring system described by Pan et al. In addition, fibrosis, subpleural lines, the reversed \u201chalo sign\u201d, pleural\neffusion and lymphadenopathy were not observed. It was considered to be a typical\nfindings of early mild COVID-19 pneumonia .\nAlthough no decrease in SpO2 was observed, administration of favipiravir\n(Fav) 3600\u2005mg daily was started from the evening of the same day, due to the\npresence of mild pneumonia as seen on CT and the presence of multiple comorbidities.\nIn addition, since SpO2 decreased a little the following day, 1\u2005L/min\noxygen administration via a nasal cannula was also started. Weakness and a decreased\nlevel of consciousness (tendency to somnolence) appeared from the early morning of\nDay 2, but a neurologist ruled out stroke. Since somnolence and weakness were\nconsidered as side effects of Fav, the drug was discontinued on the evening of Day\n2, and his symptoms improved by the morning of Day 3. Thereafter, since his\ntemperature increased again, the frequency of administration of acetaminophen 500\u2005mg\nwas increased from 0 to 3 times a day. In addition, his CRP level increased and\nSpO2 decreased, requiring an increase in oxygen flow rate from 1 to\n3\u2005L/min by nasal cannula. CT performed on Day 4 showed slight deterioration in the\npneumonia. The total CT score was 2/25 points (ground-glass opacities only below the\ndorsal pleura of the upper right lobe) . Therefore, 200\u2005mg of remdesivir\n(Rem) was administered on Day 4, with 100\u2005mg daily being administered from Day 5\nuntil Day 10, for a total of seven days . On Day 7, blood gas data under\nadministration of 4\u2005L/min oxygen by nasal cannula showed that the alveolar-arterial\noxygen difference (A-aDO2) had increased to 122.1\u2005mm Hg , indicating an\nimbalance between ventilation and blood flow. However, no pulmonary hypertension was\nobserved on electrocardiogram or echocardiography. Furthermore, since a tendency of\nincreasing D-D levels was also observed , the combination of nafamostat\nmesylate (Naf) 100\u2005mg daily by continuous intravenous infusion and dexamethasone\n(Dex) 6\u2005mg daily was administered for four days from Day 7 . The treatment was remarkably\neffective, resulting in fever reduction and a decrease in CRP and D-D levels (, c and d). On Day\n10, oxygen administration could be discontinued, and at the same time , his blood\npressure control improved . By Day 13, A-aDO2 had also significantly improved\nto 33.2\u2005mm Hg without supplementary oxygen , and CT showed a tendency for\nimprovement in pneumonia. The total CT score at this time was still 2/25 points\n(ground-glass opacities only below the dorsal pleura of the upper right lobe) .\nFor blood pressure control during the course of his hospitalization, continuous\nintravenous infusion of pernidipine (4-9\u2005mg/h) was performed for two days when oral\nintake was difficult due to the decreased consciousness level, and from day 4, Olm\n40\u2005mg and nifedipine 20\u2005mg were administered in combination. With the treatment of\nCOVID-19, his blood pressure gradually stabilized, and the dose of nifedipine was\nreduced from Day 14 to 10\u2005mg, and nifedipine was discontinued from Day 19 .\nIt took some more time for SpO2 to stabilize, but it eventually improved\nand the patient was discharged on Day 21 .", "summary": "A 70-year-old Japanese man with essential hypertension, dyslipidemia, chronic kidney disease and emphysema was hospitalized with the novel coronavirus disease. He had hypoxemia that was disproportionate to the severity of pneumonia indicated by computed tomography (CT), along with coagulation abnormalities. We speculated that there was a high possibility that he had developed ventilation and blood flow imbalance due to pulmonary intravascular coagulopathy (PIC) or hypoxic pulmonary vasoconstriction (HPV). In this case, early, short-term combination therapy with remdesivir, nafamostat mesylate and low-dose dexamethasone (Dex) was successful.", "subclaim_evaluations": [ { "subclaim": "The patient is a 70-year-old Japanese man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has essential hypertension.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has dyslipidemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has chronic kidney disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has emphysema.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was hospitalized with the novel coronavirus disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had hypoxemia.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hypoxemia was disproportionate to the severity of pneumonia indicated by CT.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had coagulation abnormalities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinicians speculated that the patient had a high possibility of developing ventilation and blood flow imbalance.", "support_label": "supported", "is_refined": false }, { "subclaim": "The clinicians speculated that the imbalance was due to pulmonary intravascular coagulopathy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The clinicians speculated that the imbalance was due to hypoxic pulmonary vasoconstriction.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient received early, short-term combination therapy.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The therapy included remdesivir.", "support_label": "supported", "is_refined": false }, { "subclaim": "The therapy included nafamostat mesylate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The therapy included low-dose dexamethasone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The combination therapy was successful.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_493_en.txt", "fulltext": "A 62-year old male patient had a robot-assisted laparoscopic prostatectomy in August 2014 for a Gleason 4 + 3 multifocal adenocarcinoma with tertiary grade 5 disease and extraprostatic extension (pT3aN0Mx). The pre-operative PSA was 5.3 \u03bcg/L and the post-operative PSA was unchanged at 5.63 \u03bcg/L, despite negative surgical margins . The PSA, 6 months post-operatively, had increased to 10.06 \u03bcg/L. Pelvic MRI showed no local recurrence or residual prostatic tissue and a bone scan was also negative. Androgen deprivation therapy (ADT) was commenced with a subsequent fall in PSA to < 0.02 \u03bcg/L, but it was discontinued after a year due to side effects.\nSerum PSA tests were undertaken regularly . 4.5 years post-operatively, the PSA increased to 2.33 \u03bcg/L and staging CT and whole-body bone scintigram showed no evidence of metastatic disease.\nFive years after prostatectomy, the PSA reached 10.6 \u03bcg/L, and the patient underwent a [68Ga]Ga-THP-PSMA PET/CT using a cold kit PSMA formulation [\u2013]. Sixty minutes after intravenous injection of 204 MBq of tracer a [68Ga]Ga-THP-PSMA PET/CT was acquired from proximal thighs to skull base on a GE Discovery 690 PET-CT scanner (GE Healthcare, Chicago, USA) according to current guidelines (4 min per bed position with 23% overlap and axial field of view of 16 cm). A low-dose unenhanced CT scan (120 kVp, 0.5 s rotation time, 3.75 mm slices, Noise Index 45, 10\u2013180 mA) was performed for attenuation correction and localization purposes. PET reconstructions included corrections for radiotracer decay, attenuation, modeled scatter, randoms and dead-time, both for time-of-flight (TOF ordered subset expectation maximisation with 24 subsets and 2 iterations) and scatter-limit correction series. The PET/CT showed increased focal uptake in the right mid-cranial fossa, with no focal uptake in the rest of the body. The differential considered at this point was a meningioma, glioma or a prostate metastasis, all known to express PSMA [\u2013]. The patient had no neurological symptoms at the time of presentation.\nA subsequent contrast-enhanced MRI head showed a well-demarcated enhancing dural-based lesion in the floor of the right middle cranial fossa, projecting into the right temporal lobe, with surrounding T2 hyperintense changes in the right temporal lobe, believed to be extra-axial on MRI. The lesion was thought initially to represent a meningioma, both on the [68Ga]Ga-THP-PSMA PET/CT (SUVmax TOF = 6.2) and contrast-enhanced MRI, although the PET/CT had raised the suspicion of a prostate cancer metastasis given its unusually intense uptake .\nAs uncertainty remained between the two possible diagnoses (meningioma or prostate cancer metastasis) in the neuro-oncology multidisciplinary team meeting, the patient was referred for a neurosurgical opinion, which advised the lesion\u2019s surgical resection and dexamethasone 4 mg bd, to reduce surrounding oedema. A second MRI head, performed 1 month later for pre-surgical planning, confirmed a 23 \u00d7 18 mm solitary tumour with surrounding oedema in the anterior part of the right inferior temporal gyrus. The tumour contained heterogeneous low and high areas of T2 signal, patchy heterogeneous contrast enhancement and dural extension to the brain surface inferiorly. The second MRI suggested that the lesion was intra-axial. The contrast-enhanced post-operative MRI head showed complete resection of the tumour with a reduction in serum PSA to 2.93 \u03bcg/L. The histopathology report confirmed an intra-axial right temporal lobe metastatic prostatic adenocarcinoma with dural extension and intense PSA and PSAP staining. Three months after neurosurgery the patient had recovered well with only mild neurological deficit (left foot drop). Surveillance MRI showed no intracranial mass or abnormal contrast enhancement to indicate residual or recurrent tumour and only expected post-operative encephalomalacia in the anterior inferior part of the right temporal lobe. The serum PSA remained elevated (2.28 \u03bcg/l). Currently, the patient is followed up with 3-monthly MRIs and PSA monitoring. ADT has not been restarted. Although the post-operative MRI head showed complete resection, the fact that histopathology documented dural involvement could explain the elevated PSA after surgery and potential presence of residual microscopic meningeal disease. The patient is currently asymptomatic, but he will undergo further PSMA PET/CT if the PSA continues to rise.", "summary": "We report the case of a prostate cancer patient presenting 5 years after robot-assisted laparoscopic prostatectomy with biochemical recurrence, no neurological symptoms, and in the absence of metastatic lesions in the body on conventional imaging. A solitary cerebral metastasis was detected using", "subclaim_evaluations": [ { "subclaim": "The patient is a prostate cancer patient.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a robot-assisted laparoscopic prostatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had biochemical recurrence.", "support_label": "supported", "is_refined": false }, { "subclaim": "The recurrence occurred 5 years after the prostatectomy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had no neurological symptoms.", "support_label": "supported", "is_refined": false }, { "subclaim": "There were no metastatic lesions in the body on conventional imaging.", "support_label": "supported", "is_refined": false }, { "subclaim": "A solitary cerebral metastasis was detected.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2451_en.txt", "fulltext": "A 59-year-old man had a history of four years of paroxysmal AF. He was normotensive and euglycemic. Due to recurrent symptomatic AF episodes and subsequent failure of antiarrhythmic drugs, he underwent a cryoballoon ablation of the PV. Under local anesthesia, His and coronary sinus catheter were inserted via the left groin. Cryoconsole was switched on for cryotherapy, but it displayed \u201clow refrigerant level\u201d. After trans-septal puncture, angiogram of the left atrium revealed left-sided common PV ostia of 29.4 mm, right superior PV of 24 mm, and right inferior PV of 14 mm. Successful ablation of all other PVs except for the right inferior PV were performed using six application cycles of four minutes each with 28 mm cryoballoon (Arctic FrontTM, Medtronic; CB, Medtronic, Minneapolis, MN, USA). Then cryoballoon was positioned to the ostium of right inferior PV. Vein occlusion was monitored for cryoballoon-to-PV contact by observing during the injection of a 50%-diluted contrast medium distally into the PV. This is graded on a 1 to 4 scale, with 1 being minimum occlusion and 4 being complete occlusion. For this PV, the grade of occlusion obtained was 4/4 . Freezing was started. In spite of waiting for more than 60 seconds, the minimum temperature did not cross beyond -34\u00b0C. Special maneuvers as \u201cpull-down technique\u201d and \u201chockey stick technique\u201d were tried, without any success (11). The application was stopped considering the nonoptimal temperature (9). The cryoballoon was repositioned for better PV contact, reverified by diluted contrast injection to be 4/4 of grade of occlusion. However, the temperature again did not cross beyond -30\u00b0C. The application was again stopped at 60 seconds. After optimal positioning cryoablation was reattempted. Surprisingly, again, the temperature did not cross beyond -28\u00b0C. We were intrigued for the reason behind this. Afterwards, a final try with cryoballoon was thought for before switching to cryocatheter for AchieveTM (Medtronic Inc.) guided touchups. Finally, after observing the 4/4 occlusion grade, freezing was restarted for the third time. To our disappointment even after 60 seconds, the temperature was still hovering around -9\u00b0C. The moment the freezing application was to be stopped, the cryoconsole screen flashed, \u201cThe pressure is low in the system. Ensure the refrigerant tank is open\u201d. Ultimately, the refrigerant cylinder was changed. Cryoablation was reinitiated after ensuring the 4/4 occlusion and optimal positioning. Minimum ablation temperature of -47\u00b0C was reached with acute successful isolation of PVs . We faced similar situation described above three times in a span of nine months for different PVs. After communicating about this problem to Medtronic\u2019s local representative, data was retrospectively collected from cryoconsole for further investigations. The flow of the gas through the umbilical (displayed at a cryoconsole) was measured and investigated in the data files. However, the analysis showed no known technical issues.\nIf nonoptimal temperature is obtained in spite of good grade of occlusion of cryoballoon and optimal positioning, early change of a refrigerant cylinder ought to be considered in case of \u201clow refrigerant level\u201d cryoconsole display. Earlier change may be considered in spite of absence of the system notice, stating \u201cThe pressure is low in the system\u201d, to decrease the procedure time and unnecessary radiation exposure. Retrospectively, it may be suggested to the device manufacturer for use of better pressure-sensitive refrigerant cylinder valve or earlier system notification for change of the refrigerant cylinder.", "summary": "At the start of the procedure, the cryoconsole displayed \"low refrigerant level\". After a few cycles of successful cryoballoon applications, for a fresh application for a new PV, the optimal temperature was not obtained in spite of obtaining good grade of occlusion and ostial positioning for right inferior pulmonary vein (RIPV). Later, immediately after changing the refrigerant cylinder, suitable temperature was obtained. We faced this situation thrice in a span of eight months.", "subclaim_evaluations": [ { "subclaim": "The cryoconsole displayed 'low refrigerant level' at the start of the procedure.", "support_label": "supported", "is_refined": false }, { "subclaim": "Successful cryoballoon applications were performed before the issue occurred.", "support_label": "supported", "is_refined": false }, { "subclaim": "The issue occurred during a fresh application for a new pulmonary vein.", "support_label": "supported", "is_refined": false }, { "subclaim": "The optimal temperature was not obtained during the application.", "support_label": "supported", "is_refined": false }, { "subclaim": "Good grade of occlusion was achieved during the application.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ostial positioning for the right inferior pulmonary vein was adequate.", "support_label": "supported", "is_refined": false }, { "subclaim": "The refrigerant cylinder was changed.", "support_label": "supported", "is_refined": false }, { "subclaim": "Suitable temperature was obtained after changing the refrigerant cylinder.", "support_label": "supported", "is_refined": false }, { "subclaim": "This situation occurred three times in eight months.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_998_en.txt", "fulltext": "The patient was a 43-year-old Japanese woman who underwent 70 Gy heavy-particle radiotherapy administered as 5 fractions of 14 Gy for a right choroidal malignant melanoma (T3a, N0, M0 clinical-stage IIB according to the 8th edition of the International Union Against Cancer classification) . Positron emission tomography-computed tomography (PET-CT) performed post-treatment revealed no abnormal accumulation of 2-deoxy-2-(fluorine-18) fluoro-d-glucose, and the complete response was recorded . PET-CT examination was subsequently performed regularly every 6 months, and no recurrence was noted up to 4 years after treatment, when contrast accumulation (maximum standardized uptake value 10.9) was observed on the posterior wall of the stomach .\nGastrointestinal endoscopic examination revealed a smooth, protruding lesion on the wall of the greater curvature of the stomach . Endoscopic ultrasonography (EUS) revealed extramural growth of a hypoechoic tumor with the presence of blood flow inside, on the posterior wall of the stomach that was approximately 2.2 \u00d7 2.0 cm in size . CT showed a mass with contrast enhancement in contact with the stomach wall . Based on the imaging findings, a gastrointestinal stromal tumor (GIST) at the posterior wall of the lower gastric corpus with extramural growth was suspected. Therefore, the patient was referred to our hospital for treatment.\nLaparoscopic surgery was performed under general anesthesia. A black-pigmented tumor originating from the body of the pancreas was discovered to be in contact with the posterior wall of the stomach , but continuity was not observed. Based on the intraoperative findings, metastasis of the malignant choroidal melanoma to the pancreas was diagnosed. Since no other lesions were discovered in the abdominal cavity, it was determined that resection would be possible, and laparoscopic pancreatic tail resection was performed.\nThe resected tumor comprised a single black nodule with a long-axis diameter of 27 mm . Hematoxylin and eosin staining revealed spindle cells with melanin pigment production . Immunohistological examination showed positive signals for the S100 protein, HNB-45, and Melan A, confirming the diagnosis . On postoperative day 20, a grade IIIa pancreatic fistula (Clavien\u2013Dindo classification version 2) developed, but amelioration was achieved using conservative treatment. The patient was discharged on postoperative day 50.\nAdministration of 3 mg/kg nivolumab was initiated as adjuvant chemotherapy 2 months after surgery, but 2 months later multiple lung metastases were detected by CT. Therefore, administration of 3 mg/kg ipilimumab was initiated. Following the first dose, the patient developed colitis as an immune-related adverse event and grade 3 diarrhea (based on the Common Terminology Criteria for Adverse Events version 5.0 classification), the latter of which was ameliorated by oral administration of 30 mg prednisolone. There was an outbreak of dermatitis, which was also judged to be an immune-related adverse event, and the administration of ipilimumab was discontinued. Two courses of 800 mg/m2 dacarbazine were administered 12 months postoperatively, but the treatment was discontinued due to metastasis to the left kidney. Nivolumab administration resumed 28 months after surgery. The patient was alive after 17 courses of nivolumab without symptoms or exacerbation of the lesion.", "summary": "A 43-year-old Japanese woman underwent 70\u00a0Gy heavy-particle radiotherapy for a right choroidal malignant melanoma. Positron emission tomography-computed tomography examination was performed 4\u00a0years after treatment, when contrast accumulation was observed on the posterior wall of the stomach. Endoscopic ultrasonography and computed tomography showed a mass with contrast enhancement in contact with the stomach wall. Based on the imaging findings, a gastrointestinal stromal tumor of the posterior wall of the lower gastric corpus with extramural growth was suspected. Laparoscopic surgery was performed under general anesthesia. A black-pigmented tumor originating from the pancreas was discovered. Following an intraoperative diagnosis of metastasis of malignant melanoma, a laparoscopic distal pancreatectomy was performed. The pathological diagnosis was pancreatic metastasis of malignant melanoma. The patient was treated with adjuvant immune checkpoint inhibitors and chemotherapy after surgery, which led to long-term survival.", "subclaim_evaluations": [ { "subclaim": "The patient is a 43-year-old Japanese woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She underwent 70 Gy heavy-particle radiotherapy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The radiotherapy was for a right choroidal malignant melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "A positron emission tomography-computed tomography examination was performed 4 years after treatment.", "support_label": "supported", "is_refined": false }, { "subclaim": "Contrast accumulation was observed on the posterior wall of the stomach.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endoscopic ultrasonography showed a mass with contrast enhancement in contact with the stomach wall.", "support_label": "supported", "is_refined": false }, { "subclaim": "A gastrointestinal stromal tumor of the posterior wall of the lower gastric corpus with extramural growth was suspected.", "support_label": "supported", "is_refined": false }, { "subclaim": "Laparoscopic surgery was performed under general anesthesia.", "support_label": "supported", "is_refined": false }, { "subclaim": "A black-pigmented tumor originating from the pancreas was discovered.", "support_label": "supported", "is_refined": false }, { "subclaim": "An intraoperative diagnosis of metastasis of malignant melanoma was made.", "support_label": "supported", "is_refined": false }, { "subclaim": "A laparoscopic distal pancreatectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The pathological diagnosis was pancreatic metastasis of malignant melanoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with adjuvant immune checkpoint inhibitors after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was treated with chemotherapy after surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment led to long-term survival.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2906_en.txt", "fulltext": "A 28-year-old Caucasian Greek woman presented to the emergency department after sustaining an injury to her right knee during dancing. The mechanism of her injury compromised vigorous internal rotation of the femur on the tibia with the knee in flexion. She complained of mild pain in both the medial and lateral aspects of her knee joint. Her right knee was locked in 35\u00b0 of flexion.\nPhysical examination demonstrated negative Lachman-Noulis and anterior drawer tests. Clicks or catches were not detected by palpation during flexion, extension, and rotary motions of her knee joint. There was tenderness in her medial and lateral joint line. Results of standard anteroposterior and lateral roentgenograms were normal. A magnetic resonance imaging (MRI) evaluation demonstrated the tears in both menisci of the right knee , while the anterior and posterior cruciate ligaments were found to be intact .\nOur patient had no relevant medical history. Her physical examination and laboratory tests were unremarkable. No diseases of the connective tissue or other deficiency of the ligaments were detected.\nShe underwent a knee arthroscopy in the next 24 hours, and the diagnosis of combined injury of bicompartmental bucket-handle tears with an intact anterior cruciate ligament was confirmed . Arthroscopic evaluation also revealed a discoid lateral meniscus. Moreover, a grade III chondral lesion (graded on the Outerbridge classification), less than 1 cm2 in size, was detected on the medial femoral condyle . A partial medial and lateral meniscectomy was then performed. The decision was made because of the discoid lateral meniscus and the quality of the ruptured part of the medial meniscus. The torn tissue - approximately 40% of the mediolateral width of each meniscus - was removed. The cartilage defect was repaired by drilling therapeutic holes (approximately 0.5 to 1.0 mm in diameter) into the subchondral bone marrow space underlying the region of the cartilage lesion (microfracture technique) .\nAt our patient's follow-up examination six months after her injury, clinical tests demonstrated that her right knee was stable, had a full range of motion and had no tenderness. The functional outcome was evaluated using Lysholm scoring. At the time of her presentation to our emergency department she had a Lysholm score of 75, while six months after her injury, her Lysholm score had increased to 85 . She was satisfied with the outcome of the operation and returned to her pre-injury activities.", "summary": "A 28-year-old Caucasian Greek woman presented to the emergency department after sustaining an injury to her right knee during dancing. An MRI evaluation demonstrated tears in both menisci of the right knee, while the anterior and posterior cruciate ligaments were found to be intact. A partial medial and lateral meniscectomy was then performed. At a follow-up examination six months after her injury, clinical tests demonstrated that our patient's right knee was stable, had a full range of motion and had no tenderness. She was satisfied with the outcome of the operation and returned to her pre-injury activities.", "subclaim_evaluations": [ { "subclaim": "The patient is a 28-year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is of Caucasian Greek descent.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient sustained an injury to her right knee.", "support_label": "supported", "is_refined": false }, { "subclaim": "The injury occurred during dancing.", "support_label": "supported", "is_refined": false }, { "subclaim": "An MRI was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The MRI showed tears in both menisci of the right knee.", "support_label": "supported", "is_refined": false }, { "subclaim": "The anterior cruciate ligament was intact.", "support_label": "supported", "is_refined": false }, { "subclaim": "The posterior cruciate ligament was intact.", "support_label": "supported", "is_refined": false }, { "subclaim": "A partial medial meniscectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A partial lateral meniscectomy was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "A follow-up examination was conducted six months after the injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right knee was stable at the six-month follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right knee had a full range of motion at the six-month follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "There was no tenderness in the right knee at the six-month follow-up.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was satisfied with the outcome of the operation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient returned to her pre-injury activities.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3115_en.txt", "fulltext": "A 56-year-old postmenopausal woman presented with a history of intermittent mastalgia, mild lumpiness, and clear nipple discharge of the right breast, which started a year ago. She has a previous known history of right breast intraductal papilloma without atypia 8 years ago, for which she refused the intervention at that time. Her mammogram two years ago was reassuring.\n\nAn ultrasound scan revealed a highly suspicious mass at the 2 o\u2019clock position of the right breast periareolar area, measuring 17 mm, with a hypoechoic dilated duct measuring over 50 mm in length and 3.4 mm in diameter at the medial aspect of the right nipple. The axilla appeared normal on the ultrasound scan.\n\nUpon comparison of mammograms from eight years ago and two years ago, the lesion was identified as a new development. An ultrasound-guided core biopsy of the right breast mass was performed. The histopathological evaluation revealed a Grade II Invasive Ductal Carcinoma.\n\nAfter a multidisciplinary team meeting, a Magnetic Resonance Imaging (MRI) and breast tomosynthesis were ordered to assess the disease extent. The known malignancy of the upper inner quadrant was identified, measuring 26 mm in the longest dimension. The MRI study identified an anterior extension accounting for an overall extent of 31 mm.\n\nA SS reflector was placed at the site of the tumour under ultrasound guidance. No immediate complications were noted. Post-insertion mammogram has been obtained.\n\nImaging revealed that the scout was successfully placed in the lesion.\n\nTwo days later, the patient presented to the breast clinic complaining of severe stabbing pain in the right nipple. An ultrasound and mammogram scan revealed that the scout had migrated from the site of the cancer into the duct at the tip of the nipple.\n\nUnder local anaesthesia, a small incision was made on the skin over the tip of the scout, and it was removed. The patient visited the clinic the next day and reported reduced pain and discomfort since the scout was removed.\n\nThe patient declined to have another SS reflector due to distress during the initial procedure. The decision has been made to proceed with skin marker-guided wide local excision, which she has had. Postoperative histopathological evaluation showed 27 mm grade 2 invasive ductal carcinoma (IDC) no special type, with no associated ductal carcinoma in situ, which is completely excised, and sentinel node biopsy was negative.", "summary": "A 56-year-old postmenopausal woman with a history of right breast intraductal papilloma which transformed to Grade II Invasive Ductal Carcinoma (IDC) has a Savi Scout reflector placed in the tumour. However, it migrated through a dilated duct and emerged at the nipple, causing severe pain. The reflector was then surgically removed, and the patient subsequently underwent wide local excision with skin marker localisation.", "subclaim_evaluations": [ { "subclaim": "The patient is a 56-year-old postmenopausal woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "She has a history of right breast intraductal papilloma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The intraductal papilloma transformed to Grade II Invasive Ductal Carcinoma.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A Savi Scout reflector was placed in the tumour.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reflector migrated through a dilated duct.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reflector emerged at the nipple.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reflector caused severe pain.", "support_label": "supported", "is_refined": false }, { "subclaim": "The reflector was surgically removed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient underwent wide local excision.", "support_label": "supported", "is_refined": false }, { "subclaim": "Skin marker localisation was used during the excision.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2908_en.txt", "fulltext": "Our patient was initially referred to another hospital with mild head injury when he was 8 years old. An intra-axial tumor located in the right insular cortex was incidentally detected on MRI. Surgical resection was waived and followed-up for 10 years until the patient was 18 years old because of slowly growing tumor without symptoms. At the end of the observation period, the tumor size was measured to be one and a half times the diameter measured on the first MRI scan. After the end of the follow-up period, he visited our hospital for intensive examination and treatment.\nThe patient had no neurological deficit. Computed tomography (CT) imaging showed a low-density lesion with no calcification located in the right insular cortex . T1-weighted MRI demonstrated a hypointense lesion in the right insular cortex . T2-weighted MRI showed a hyperintense lesion that corresponded with the hypointensity on the T1-weighted image . T1-weighted MRI with gadolinium administration did not show any enhanced lesions [Figure and ]. Arterial spin labeling study suggested decreased blood flow at the lesion .\nThe lesion located in the right insular cortex demonstrated gradual growth for 10 years [Figure -]. The change in lesion volume was assessed using polygonal tracing with fusion. Fluid-attenuated inversion recovery (FLAIR) signals were assessed using the DICOM image viewer OsiriX (\u00ae) (v. 7.0; Pixmeo SARL, Bernex, Switzerland) by slice-by-slice region of interest tracings. The growth rate of this lesion was found to be almost directly proportional to time .\nIn order to remove the lesion and obtain histopathological diagnosis, an awake craniotomy was performed using cortical and subcortical stimulation mapping with a bipolar direct electrical stimulator at 3.5 mA/60 Hz biphasic current to monitor motor and somatosensory response, speech or language difficulties, and other higher brain functions. An anarthria was induced by stimulation of the ventral precentral gyrus . Tumor resection was performed via a transopercular approach. Intraoperatively, the nature of the tumor was gray, soft, and jelly-like tissue with clear boundaries. Fiber structures in the peripheral zone were relatively well-defined and we promoted excision of the tumor using an ultrasonic surgical aspirator. A postoperative MRI showed gross total resection of the tumor . Postoperative course was uneventful without neurological deficits. No recurrence was recognized postoperatively for 12 months.\nHistological examination of the hypointense area on T1-weighted MRI showed multiple cystic structures with myxomatous background and proliferation of oligodendroglia-like cells with oval nuclei in the wall of the cystic spaces . Neuronal elements featuring \u201cfloating neurons\u201d were observed, indicating a glioneuronal lesion within the cystic cavity . Immunohistochemical analysis revealed intense positive staining for Olig2, S-100 and synaptophysin, and less reactivity for IDH-1 . The Ki-67 staining index (SI) was 1% . A combined deletion of 1p and 19q chromosomes was absent. The histological diagnosis was WHO grade I DNET.", "summary": "We report the first DNET case with the growth rate analyzed in the natural course of development for a period of 10 years. The patient was a right-handed man who was initially referred to another hospital with mild head injury when he was 8 years old. A tumor located in the right insular cortex was incidentally detected on magnetic resonance imaging (MRI) and followed-up with annual MRI for 10 years.", "subclaim_evaluations": [ { "subclaim": "This is the first reported case of DNET with growth rate analyzed over 10 years.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was a right-handed man.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "He was initially referred to another hospital at age 8 with mild head injury.", "support_label": "supported", "is_refined": false }, { "subclaim": "A tumor was incidentally detected in the right insular cortex on MRI.", "support_label": "supported", "is_refined": false }, { "subclaim": "The tumor was followed up with annual MRI for 10 years.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true } ], "readability_score": 3 }, { "id": "multiclinsum_test_1722_en.txt", "fulltext": "A 10-month-old child, assigned as female at birth, resident in the countryside of the Northeast region of Brazil, was referred to our team for genetic assessment due to genital ambiguity late recognized. Pregnancy and delivery were uneventful. Parents reported a clitoris enlargement and gonadal descent when the child was 30 days old, at the end of minipuberty. Afterward, they decided to rear him as a boy despite the maintenance of female legal sex. The patient is the second child in a consanguineous marriage (double first cousins once removed), with no recurrence in the family .\nUpon physical examination there was a phallus measuring 25 mm \u00d7 10 mm, palpable gonads at labioscrotal folds (1 cm3 left-sided and 0.5 cm3 right-sided), and an urogenital sinus with a perineal opening . As these clinical findings indicate male prenatal under- instead of female hyper- virilization we assumed that Quigley type 4 was the best classification for the ambiguous genitalia. The karyotype of peripheral lymphocytes was 46,XY. Basal FSH and LH levels were normal (1.32 mUl/mL and 0.34 mUI/mL, respectively) while those for testosterone were low (< 8 ng/dL). Abdominal ultrasound showed no Mullerian derivative structures.\nThe etiologic investigation included androgen receptor (RA \u2013 OMIM * 313700), steroid 5\u03b1-reductase 2 (SRD5A2 \u2013 OMIM * 607306), nuclear receptor subfamily 5 group A member 1 (NR5A1\u2013 OMIM * 184757), and HSD17B3 genes sequencing and predictive analyzes (Additional file ).\nSequencing studies showed a novel homozygous c.785G > T nucleotide change in exon 10 of the HSD17B3 gene (Additional file ), which was inherited from both heterozygous parents. The c.785G > T substitution leads to the replacement of glycine by valine in residue 262 (p.Gly262Val).\nGlycine 262 is a highly conserved residue (Additional file ) and the comparison between them did not reveal changes on the protein internal contacts (Additional file ). Four out of six predictive analyzes were compatible with a damaging missense variant and indicated that valine 262 destabilizes the protein structure (Additional file ).", "summary": "We report on a child presenting severe ambiguous genitalia. Due to access constraints, specialized care did not start until the child was 10\u00a0months old. Parents are consanguineous and were born in an area of high isonymy that is a cluster for rare recessive diseases. A new homozygous missense variant c.785G\u2009>\u2009T was found in exon 10 of the HSD17B3 gene.", "subclaim_evaluations": [ { "subclaim": "The child presented with severe ambiguous genitalia.", "support_label": "supported", "is_refined": false }, { "subclaim": "Specialized care did not start until the child was 10 months old.", "support_label": "supported", "is_refined": false }, { "subclaim": "The parents are consanguineous.", "support_label": "supported", "is_refined": false }, { "subclaim": "The parents were born in an area of high isonymy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The area is a cluster for rare recessive diseases.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A new homozygous missense variant c.785G\u2009>\u2009T was found.", "support_label": "supported", "is_refined": false }, { "subclaim": "The variant was found in exon 10 of the HSD17B3 gene.", "support_label": "supported", "is_refined": false } ], "readability_score": 4 }, { "id": "multiclinsum_test_2866_en.txt", "fulltext": "A 16-year-old male of East Asian descent arrived at night via air ambulance intubated and ventilated to our Heart Attack Centre with a history that during high-intensity interval training at the gym he suffered a cardiac arrest. On site, he received three shocks for ventricular fibrillation with a return of spontaneous circulation (ROSC) after 17 min. An electrocardiogram (ECG) recorded 11 min after ROSC demonstrated marked anterolateral ST-segment elevation. An ECG recorded 116 min post-ROSC on arrival to our centre showed normalization of the ST segments . On examination, he was intubated and ventilated, invasive blood pressure was 105/75 mmHg, and his heart rate was 86 b.p.m. in sinus rhythm. His heart sounds were normal, and there were no murmurs. His chest was clear to auscultation. Bedside echocardiography demonstrated a structurally normal heart with preserved left ventricular (LV) systolic function and no regional wall motion abnormalities. Initial troponin T was 798 ng/L (0\u201314 ng/L) and peaked at 3073 ng/L 2 h later. His parents gave a past medical history of Kawasaki disease, but that he was not taking any medications.\nIn view of the patient's stable clinical status, the lack of persistent ST-segment elevation on the ECG, and normal echocardiogram, we did not perform emergent coronary angiography as we did not suspect an acute coronary artery occlusion. He received a 300 mg loading dose of aspirin, a 180 mg loading dose of ticagrelor and continued on 75 mg aspirin once daily, and ticagrelor 90 mg twice daily with lansoprazole 30 mg once daily. In addition to antiplatelet therapy, he received a single 2.5 mg dose of fondaparinux, bisoprolol 2.5 mg once daily, and atorvastatin 80 mg once daily. He was admitted to the adult cardiac intensive care unit where he remained stable. Coronary angiography was performed the following morning.\nKawasaki disease was diagnosed at the age of 3 months in his country of origin for which he received intravenous immunoglobulin (IVIG) therapy on day 21 of his illness. He was not treated with acetylsalicylic acid nor was he anticoagulated. Echocardiography 6 days after IVIG treatment showed an aneurysm in the left main coronary artery measuring 5.5 mm. He responded well to treatment and remained under follow-up for mild left main coronary artery dilatation.\nAged 7 years following routine surveillance echocardiography suggestive of left anterior descending artery (LAD) stenosis, he underwent invasive coronary angiography. This demonstrated a small aneurysm followed by an 80% calcific stenosis of the proximal LAD, and a chronic total occlusion (CTO) of the dominant right coronary artery (RCA). Cardiac magnetic resonance (CMR) imaging showed reversible ischaemia in the inferior, inferolateral, and anterolateral walls.\nIn 2012 aged 8 years, he underwent elective intravascular ultrasound-guided rotablation-assisted percutaneous coronary intervention (PCI) to the proximal LAD with a 3.0 mm \u00d7 18 mm Multi-Link Vision bare-metal stent (Abbott Vascular, Chicago, USA; ). This corrected the CMR perfusion abnormalities initially, but from 2015 he was lost to follow-up and was not taking any medications.\nCoronary angiography during the current admission demonstrated an unobstructed left main stem; however, the previous LAD stent was occluded with the distal vessel filling retrogradely via septal and well-developed epicardial collaterals from the RCA. The left circumflex artery (LCx) was unobstructed . There was a CTO in the RCA, as before, in the mid vessel . The likeliest explanation for his presentation was the insufficient ability of the collateral circulation to meet the metabolic demand of the heart during exercise, resulting in ischaemia and ventricular fibrillation.\nComputed tomography of the brain demonstrated no acute intracranial abnormality, and his neurological course was unremarkable.\nFollowing a local Heart Team discussion, he was transferred to a different centre with expertise in both adult and paediatric cardiology and cardiac surgery. He underwent further imaging. Computed tomography established that the internal mammary arteries (IMAs) were free of disease. CMR demonstrated increased indexed LV end-diastolic volume (118 mL/m2) and normal LV wall thickness and normal indexed LV mass with preserved global LV systolic function and no regional wall motion abnormalities at rest. There was a limited infarct in the apical anterior wall and part of the apical septum . There was inducible ischaemia in 5/7 segments of the LAD territory and 4/5 segments of the RCA territory. All segments were viable.\nAt the Heart Team meeting, it was felt that either percutaneous or surgical revascularization were suitable strategies. Two days later, the case was discussed with international colleagues and a consensus reached to revascularize him surgically with the opinion being that this would provide him with a more durable result. This was particularly pertinent in his case given the RCA CTO and previously occluded stent. Following detailed discussion with the patient and his parents, he received a left IMA to the LAD and free right IMA to the posterior descending artery. His immediate post-operative course was uncomplicated. He was discharged home 7 days after surgery on aspirin 75 mg once daily, clopidogrel 75 mg once daily, ranitidine 300 mg once daily, bisoprolol 1.25 mg once daily, atorvastatin 80 mg once daily, and paracetamol as required.\nHe was last seen in clinic in December 2019. Symptomatically, he was well and had returned to the gym but was refraining from heavy weights given his sternotomy scar. Clinical examination revealed a well-healed wound, no murmurs and a clear chest. All medications were stopped except aspirin and atorvastatin. He underwent repeat CMR in January 2020, which showed no inducible myocardial ischaemia.", "summary": "Our patient, a 16-year-old boy with Kawasaki disease, presented with cardiac arrest during exercise. Coronary angiography showed that a proximal left anterior descending artery stent implanted at the age of 8 years had occluded some time ago and his right coronary artery was also chronically occluded. He has discussed in several Heart Team meetings and with international colleagues and a consensus reached to revascularize him surgically.", "subclaim_evaluations": [ { "subclaim": "The patient is a 16-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has Kawasaki disease.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had cardiac arrest during exercise.", "support_label": "supported", "is_refined": false }, { "subclaim": "Coronary angiography showed a proximal left anterior descending artery stent.", "support_label": "supported", "is_refined": false }, { "subclaim": "The stent was implanted at the age of 8 years.", "support_label": "supported", "is_refined": false }, { "subclaim": "The stent had occluded some time ago.", "support_label": "supported", "is_refined": false }, { "subclaim": "The right coronary artery was chronically occluded.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has discussed his case in several Heart Team meetings.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has discussed his case with international colleagues.", "support_label": "supported", "is_refined": false }, { "subclaim": "A consensus was reached to revascularize him surgically.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_1100_en.txt", "fulltext": "The proband was a preterm newborn boy, the first child of non-consanguineous parents, born at 31 weeks gestation to a 44-year old father and a 43-year old mother by cesarean section. At birth, the child weighed 1,480 g, measured 44 cm in crown-to-heel length, and exhibited multiple congenital anomalies. The newborn was transferred to the Intensive Care Units (ICU) immediately after birth. His general health condition deteriorated progressively, leading to his death at 105th days after birth. The newborn had brain malformation, including ventriculomegaly and corpus callosum dysgenesis, cleft lip and palate, retrognathism, hypertelorism, clenched hands with overlapping fingers, and hypotonia. Additionally, he revealed mild heart septal hypertrophy, ambiguous genitalia, enlarged kidneys without corticomedullary differentiation, and gallbladder with tiny cystic formations . His mother had three miscarriages from previous marriages and one miscarriage with her current husband. The remaining of his family history was otherwise unremarkable.\nBoth parents signed a written informed consent and the mother signed as the legal representative for the child. Peripheral blood was obtained to isolate genomic DNA for CMA using Qiagen QIAamp\u00ae DNA Mini kit (Hilden, Germany). Karyotyping was performed in a private laboratory through conventional cell culture, harvesting, and GTG banding with a > 550 bands resolution following standard procedures . Chromosome analyses were done using Zeiss Axio Scope (Jena, Germany) and the software IKAROS\u00ae (Metasystems Corporation, Altlussheim, Germany). All laboratory procedures were carried out following international standardized protocols and consensual criteria of quality.\nThe CMA was carried out on proband and his biological parents using the GeneChip\u00ae CytoScanHD\u2122 (Affymetrix, Santa Clara, USA) following the manufacturer\u2019s recommendations without modifications. Chromosomal analyses were done using the Chromosome Analysis Suite (ChAS\u00ae) software (Affymetrix, Santa Clara, USA) and the CNVs found in the patient were analyzed in comparison with public databases, including Database of Genomic Variants (DGV), Database of Chromosomal Imbalance and Phenotype in Humans using Ensemble Resources (DECIPHER), and CytoScanHD\u2122 Array Database. Furthermore, CNVs were classified according to their nature, based on [, ].\nThe proband showed a male karyotype with a large submetacentric SMC in 90% of the analyzed metaphases after counting 50 metaphase spreads. His karyotype was 47,XY,+mar[45]/46,XY[5], suggesting 10% mosaicism. The parental karyotypes and CMA results had no visible numerical or structural alterations. The proband\u2019s CMA revealed the marker chromosome corresponded to a de novo 70.77 Mb gain at arr[GRCh37] 9p24.3q21.11(203,861_70,974,662)\u00d7 4[0.3] dn with 30% mosaicism, encompassing 286 genes, including 152 OMIM morbid genes .", "summary": "Herein, we reported a postnatal case of a newborn who died in early infancy with multiple congenital malformations due to a mosaic de novo tetrasomy 9p detected by Chromosomal Microarray Analysis. Conventional cytogenetics analysis of the proband was 47,XY,+mar", "subclaim_evaluations": [ { "subclaim": "The case involved a postnatal newborn.", "support_label": "supported", "is_refined": false }, { "subclaim": "The newborn died in early infancy.", "support_label": "supported", "is_refined": false }, { "subclaim": "The newborn had multiple congenital malformations.", "support_label": "supported", "is_refined": false }, { "subclaim": "A mosaic de novo tetrasomy 9p was detected.", "support_label": "supported", "is_refined": false }, { "subclaim": "Chromosomal Microarray Analysis was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "Conventional cytogenetics analysis of the proband was 47,XY,+mar.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1665_en.txt", "fulltext": "A 15-year-old averagely built male, having no significant medical history, presented to the casualty with a history of closed trauma of the right knee following self-fall while playing. The mechanism of injury was hyperextension of the knee joint with a valgus stress. On physical examination, the patient had difficulty to move and was unable to stand on his right lower limb. There was visible swelling over his right knee and distal third of thigh with no skin defect. The attitude of the affected limb was that of abduction and external rotation with visible deformity around the right knee. There was a limb shortening of about 3 cm of the right lower limb as compared to the normal limb. The pulsations of the popliteal, tibialis posterior, and dorsalis pedis arteries were positionally palpable.\nAn urgent color Doppler of the right lower limb was done which revealed positional variability in the pulsatality of the popliteal artery with compromised lumen and showing triphasic waveform in certain positions only. The anterior and posterior tibial arteries and dorsalis pedis artery also showed positional variability in the pulsatality with biphasic waveform in certain positions. Thus, the limb was maintained in the position where pulsations of the major arteries were felt . The capillary refill and toe movements were present. No motor or sensory defect was found. Plain AP and lateral X-ray of the right knee revealed a distal femur physeal fracture (Salter and Harris type I) with complete metaphyseal fragment displacement .\nThe patient was operated within 12 h after the injury. Under spinal anesthesia, patient was positioned supine. Closed reduction was attempted using a proximal tibial Steinman pin for skeletal traction and manipulation of the right lower limb. After a gentle continuous traction, manipulation was done in the form of downward pressure on the distal epiphysis and an upward pressure on the proximal metaphyseal fragment of the femur. The reduction was not achieved and hence the fracture site was opened up using a Lateral approach. After the fracture site was visualized, the proximal fragment was held using bone holding forceps and the distal fragment fixed using a clamp , and traction and manipulation was done to achieve anatomic reduction of the fracture site. Reduction was confirmed under fluoroscopy and fixed using three 2.5 mm K-wires in a crossing manner , 2 from lateral to medial side and 1 from medial to lateral side. For additional stability, a long leg splint was given anteriorly in 20\u201330 degrees flexion of the knee.\nPost-operative radiographs revealed anatomic reduction of the physis of the distal femur with restoration of the normal axis of femur . Post-operative surgical outcome was satisfactory. Close monitoring of the patient was done for the first 24 h postoperatively and no signs of secondary vascular thrombosis were found. Patient was started with hamstring and quadriceps strengthening exercises postoperatively. The slab was kept for 6 weeks, following which the K wires were removed. A review X-ray done showed healing of the fracture , and partial weight bearing was initiated with the help of walker. On subsequent follow-up, after 4 and 8 months, correct limb axis alignment and no significant post-operative complications were found. After 6 months, the patient had become free of pain and had a complete range of movement in the right knee joint . There was no significant angular deformity or shortening in the right lower extremity.", "summary": "Here is a case of right sided distal femur physeal fracture dislocation in a 15-year-old boy having positional vascular compromise (popliteal vessel involvement) as a result of the fracture displacement. He was immediately planned for open reduction and fixation using multiple K wires due to limb threatening condition. We focus on the potential immediate and remote complications, the treatment modality and the functional outcome of the fracture.", "subclaim_evaluations": [ { "subclaim": "The patient is a 15-year-old boy.", "support_label": "supported", "is_refined": false }, { "subclaim": "He has a right-sided distal femur physeal fracture dislocation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fracture resulted in positional vascular compromise.", "support_label": "supported", "is_refined": false }, { "subclaim": "The popliteal vessel was involved.", "support_label": "supported", "is_refined": false }, { "subclaim": "The fracture displacement caused the vascular compromise.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was immediately planned for open reduction.", "support_label": "supported", "is_refined": false }, { "subclaim": "The treatment included fixation using multiple K wires.", "support_label": "supported", "is_refined": false }, { "subclaim": "The decision was made due to a limb-threatening condition.", "support_label": "supported", "is_refined": false }, { "subclaim": "The focus is on potential immediate complications.", "support_label": "supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The focus is on potential remote complications.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The focus is on the treatment modality.", "support_label": "supported", "is_refined": false }, { "subclaim": "The focus is on the functional outcome of the fracture.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_2732_en.txt", "fulltext": "An 85 year old left hand dominant female presented with a six week history of rapidly growing lump on the thenar eminence. Clinical examination revealed a non-tender large lobulated mobile swelling measuring 5 \u00d7 4 cm and involving the whole thenar eminence. A sarcoma was initially suspected. Plain X-ray revealed severe osteopenia with erosive changes in the first Carpometacarpal joint, and a soft tissue swelling around an osteophyte detached from the base of the first metacarpal. MRI reported a septate thin walled cystic structure extending from the first carpo-metacarpal joint space against a background of diffuse active synovitis . In operating theater, a multilobulated lesion with a neck extending to the first CMC joint was observed. The histological analysis revealed a 3.4 g previously opened specimen consistent with a ganglion cyst. The patient made an excellent post-operative recovery with no evidence of recurrence.", "summary": "An 85 year old left hand dominant female presented with a six week history of rapidly growing lump on the thenar eminence. Clinical examination revealed a non-tender large lobulated mobile swelling measuring 5 x 4 cm and involving the whole thenar eminence.", "subclaim_evaluations": [ { "subclaim": "The patient is an 85 year old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient is left hand dominant.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a six week history of a rapidly growing lump.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lump was on the thenar eminence.", "support_label": "supported", "is_refined": false }, { "subclaim": "Clinical examination revealed a non-tender swelling.", "support_label": "supported", "is_refined": false }, { "subclaim": "The swelling was large, lobulated, and mobile.", "support_label": "supported", "is_refined": false }, { "subclaim": "The swelling measured 5 x 4 cm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The swelling involved the whole thenar eminence.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_1399_en.txt", "fulltext": "A 62-year-old female with MFS was presented to the hospital for an emergency after being diagnosed with cerebral thromboembolism due to atrial fibrillation (AF). Apart from the acute endovascular thrombectomy, the patient was treated for congestive heart failure associated with aortic valve regurgitation with tachycardic AF. Echocardiography revealed severe regurgitation with reduced left ventricular ejection function (32%) and massive left ventricular diastolic dimension (88 mm). Aortic valve was tricuspid, and the eccentric regurgitation jet revealed prolapse of right coronary cusp. The aortic root was moderately dilated (42 mm). After 2 months of treatment, the patient was referred to our hospital for the surgical treatment of aortic valve regurgitation. The patient was free from the sequela of brain stroke, but complained of general fatigue consistent with a New York Heart Association class III condition with weakened leg muscle strength due to disuse syndrome. N-terminal pro-brain natriuretic peptide (NT-proBNP) level at admission was 3964 pg/mL. Sinus rhythm had been maintained after initiating oral amiodarone. The diameter of the aortic root in this patient was below the size required for indicating surgical treatment for MFS . In addition, the dimension and systolic function of the left ventricle suggested the progression of ventricular remodeling. Therefore, aortic valve replacement was selected primarily for the prevention of heart failure. In contrast, there were various options for the management of AF in the present case. Left atrial appendage closure was thought to be an appropriate treatment option to prevent recurrence of cerebral thromboembolism because AF had been effectively controlled by antiarrhythmics and the patient would receive coumadin following mechanical valve implantation. Thus, combined surgery involving aortic valve replacement and left atrial appendage (LAA) closure was planned in order to achieve early rehabilitation and return to daily life. Her chest XP revealed severe scoliosis . Spirometry showed normal lung function. A computed tomography was performed to determine the optimal intercostal space to access both the aortic valve and LAA . Three-dimensional reconstruction imaging showed that right lower hemisternotomy in a reverse \u201cL\u201d fashion was the optimal approach for clamping and incising the aorta with the ectopic origin of the right coronary artery arising from anteromedial surface of ascending aorta .\nThe patient was intubated using a double-lumen tube and laterally positioned at approximately 30 degrees right-side up. A skin incision was made from the second intercostal space down to the xiphoid process, after which the chest was opened via right lower hemisternotomy. The surgical field was secured using a Kent retractor (Takasago medical Inc., Tokyo, Japan) and sternal retractor with the costal arch folded back. Cardiopulmonary bypass was established with femoral arterial and cavoatrial cannulation. The ascending aorta was cross-clamped using flexible aortic clamp . Cardiac arrest was obtained using bidirectional cardioplegia. An oblique aortotomy was created 10 mm medial to the ostium of the right coronary artery. The aortic valve cusp was then resected, and a 25-mm mechanical valve was implanted in the intra-annular position. After closing the aortotomy, the 40-mm AtriClip (Atricure Inc, Westchester, OH, USA) was applied to the stump of the LAA before releasing the aortic cross-clamp. The patient was carefully weaned from cardiopulmonary bypass, which required an intraaortic balloon pump for the treatment of perioperative low-output syndrome due to reduced left ventricular function. The extracorporeal circulation time and aortic cross-clamp time were 165 and 87 min, respectively. The total operative time was 303 min. Transfusion of 4 units of red blood cells and 6 units of fresh frozen plasma was required during the surgery.\nThe patient was extubated on postoperative day 2, and the intraaortic balloon pump was removed 2 days after the extubation. Further, she was then transferred to the rehabilitation center for the management of her disuse syndrome on postoperative day 21; thereafter, she has been living independently without any cardiac and cerebrovascular event.", "summary": "A 62-year-old female with MFS was referred to our hospital after being diagnosed with severe aortic regurgitation and paroxysmal atrial fibrillation with a history of cerebral thromboembolism. The aortic valve showed severe insufficiency due to cusp prolapse, whereas the aortic root was moderately dilated (42\u00a0mm). Echocardiography revealed severe regurgitation with reduced left ventricular ejection function (32%) and massive left ventricular diastolic dimension (88\u00a0mm). Moreover, combined aortic valve replacement and left atrial appendage closure was indicated. However, the patient had chest deformity due to severe scoliosis. Thus, conventional full sternotomy or thoracotomy was considered an inappropriate surgical approach. Lower hemisternotomy was selected on the basis of three-dimensional reconstruction imaging of the aorta, left atrial appendage, sternum, and rib. Sternal elevation and rib retraction with the costal arch folded back provided enough surgical field for the combined procedures to be safely conducted. The postoperative course was uneventful, except for predicted prolonged mechanical ventilation with the assistance of intraaortic balloon pumping. Thereafter, the patient has been free from any cardiac and cerebrovascular event.", "subclaim_evaluations": [ { "subclaim": "The patient is a 62-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has Marfan syndrome.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was diagnosed with severe aortic regurgitation.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has a history of cerebral thromboembolism.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed aortic cusp prolapse.", "support_label": "supported", "is_refined": false }, { "subclaim": "The aortic root was 42 mm in diameter.", "support_label": "supported", "is_refined": false }, { "subclaim": "Echocardiography showed a left ventricular ejection fraction of 32%.", "support_label": "supported", "is_refined": false }, { "subclaim": "The left ventricular diastolic dimension was 88 mm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Combined aortic valve replacement and left atrial appendage closure was indicated.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had chest deformity due to severe scoliosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "Conventional full sternotomy was considered an inappropriate surgical approach.", "support_label": "supported", "is_refined": false }, { "subclaim": "Lower hemisternotomy was selected.", "support_label": "supported", "is_refined": false }, { "subclaim": "Three-dimensional reconstruction imaging was used to plan the surgery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Sternal elevation and rib retraction provided enough surgical field.", "support_label": "supported", "is_refined": false }, { "subclaim": "The combined procedures were safely conducted.", "support_label": "supported", "is_refined": false }, { "subclaim": "The postoperative course was uneventful.", "support_label": "supported", "is_refined": false }, { "subclaim": "Prolonged mechanical ventilation was predicted.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "Intraaortic balloon pumping was used.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has been free from any cardiac event.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has been free from any cerebrovascular event.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_3302_en.txt", "fulltext": "The patient is a five-year-old female with a past medical history of Wolff\u2013Parkinson\u2013 White syndrome, asthma, and oppositional defiant disorder who presented to the emergency department with unwitnessed ingestion of a foreign body. The patient\u2019s mother endorsed that on 29 November 2020 at 21:00, the patient complained of chest pain and admitted to previously swallowing a silver object. Upon arrival at the hospital, she had four episodes of non-bloody, nonbilious emesis, and epigastric pain. A chest X-ray showed a round metallic object projecting over the mid esophagus, with a double halo and step-off appearance, consistent with button battery (BB) ingestion. Due to the potential for rapid onset of damage following BB ingestion, the patient was subsequently admitted for emergent endoscopic removal of the BB, and directions were given that she was to receive nothing by mouth (NPO).\n\nWe performed an esophogastroduodenoscopy (EGD) 6 h after ingestion and discovered a 20 mm BB in the middle third of the esophagus. We successfully removed the BB with rat tooth forceps without complications. Visualization of the site showed mucosal ulceration and erosion. According to the commonly used Zargar classification of esophageal injuries, this lesion was determined to be Grade 2B due to the erosion\u2019s circumferential nature. The endoscope was advanced to the stomach and showed no damage. A nasogastric (NG) tube was not placed at the time of the endoscopy.\n\nThe following day, the patient endorsed substernal chest pain and dysphagia with saliva. Her diet remained NPO, and she was started on ceftriaxone and intravenous (IV) pantoprazole. A follow-up chest X-ray on day two showed no evidence of cardiopulmonary disease, pneumomediastinum, or pneumothorax. An esophagram on day three showed mild irregularity in the mid-esophagus but no contrast extravasation to suggest perforation.\n\nWe performed a repeat EGD on day four to assess esophageal mucosa healing and place an NG tube for feeds. The endoscope was progressed to the middle third of the esophagus, revealing a single, non-bleeding, posterior erosion with sloughing of necrotic tissue. A 10 French NG tube was placed under direct visualization. Post endoscopy, we initiated feeds via NG tube, but the patient developed a fever of 38.8 \u00b0C. We then added IV cefepime and metronidazole to her medication regimen and held feeds due to the concern for mediastinitis. An MRI showed possible inflammation in the posterior mediastinum. However, the patient\u2019s fever subsided, and a chest X-ray did not reveal signs of esophageal perforation. On day six, we restarted feeds via NG tube and discontinued antibiotics. On day eight, a repeat esophagram showed persistent irregularity of the posterior esophageal wall consistent with ulceration. She was discharged the same day on NG tube feeds, omeprazole, and instructed to avoid food and water by mouth.\n\nThe patient returned to the ED the following day with bilious vomiting following bolus tube feeds. An X-ray revealed that the tip of the NG tube had been displaced to the duodenum, which was then pulled back to the stomach without complication.\n\nAt clinic follow-up 4 weeks following ingestion, the patient was tolerating feeds via NG tube and sips of water. The following day, we used a GIF-HQ 190 endoscope of 9.9 mm diameter that showed moderate stenosis with friable mucosa in the middle third of the esophagus. We could not traverse the stenosis with the endoscope. Due to the lack of equipment available and the endoscopist\u2019s minimal experience with strictures, we did not attempt dilation at that time. We performed an esophagram two days later to assess the length of the stricture, but there was no evidence of strictures, perforation, or fistulas on imaging in neither the lateral view or the AP view.\n\nAbout seven weeks post ingestion, she returned for an EGD with possible stricture dilation and NG tube removal. The patient was tolerating a full liquid diet by mouth in addition to NG tube feeds, with no symptoms of fever, chest pain, or dysphagia. Upon introduction, the endoscope could not pass through a severe esophageal stenosis 15 cm from the incisors. Balloon dilation was performed to 10 mm, 12 mm, 13.5 mm, and twice to 15 mm, after which we passed the endoscope to the stomach and removed the NG tube. The patient tolerated the procedure well and was discharged to home once she tolerated liquids by mouth.", "summary": "We present the case of a five-year-old female who presented with vomiting following unwitnessed button battery ingestion. The battery was impacted in the middle esophagus for at least six hours. Endoscopy was performed for immediate removal and showed a Grade 2B erosion, warranting nasogastric tube placement. The patient remained asymptomatic following discharge and had a barium swallow that was read as normal. However, a repeat endoscopy one month later visualized stricture formation at the previous battery injury site.", "subclaim_evaluations": [ { "subclaim": "The patient is a five-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had vomiting following unwitnessed button battery ingestion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The battery was impacted in the middle esophagus.", "support_label": "supported", "is_refined": false }, { "subclaim": "The battery was impacted for at least six hours.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endoscopy was performed for immediate removal.", "support_label": "supported", "is_refined": false }, { "subclaim": "Endoscopy showed a Grade 2B erosion.", "support_label": "supported", "is_refined": false }, { "subclaim": "Nasogastric tube placement was performed.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was asymptomatic following discharge.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A barium swallow was read as normal.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "A repeat endoscopy was performed one month later.", "support_label": "supported", "is_refined": false }, { "subclaim": "Stricture formation was visualized at the previous battery injury site.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 }, { "id": "multiclinsum_test_3363_en.txt", "fulltext": "A 52-year-old Hispanic woman from Kern county, southern California, with a past medical history of gastroesophageal reflux disease, osteopenia, complex regional pain syndrome of the right upper extremity status post-carpal tunnel release surgery, lumbar spondylosis at L5-S1, and iron deficiency anemia, presented to her primary care physician for the evaluation of tender erythematous nodules on her thighs that had been present for approximately 1 month. Based on the clinical appearance and the geographical region of presentation, the patient was suspected of having erythema nodosum secondary to valley fever (coccidioidomycosis). The patient was prescribed fluconazole 200 mg daily, pending results from serological testing for coccidioidal immunoglobin M (IgM) and immunoglobin G (IgG). However, there was no improvement when the patient returned for a follow-up visit after 30 days of treatment. Additionally, the coccidioidal IgM and IgG tests were negative. Thus, treatment with fluconazole was discontinued and the patient was referred to a pulmonologist, who ordered tests to rule out sarcoidosis, tuberculosis, and thrombosis.\n\nThe following results were obtained: angiotensin 1-converting enzyme levels (<5 U/L) (reference range: 9\u201367 U/L); QuantiFERON tuberculosis gold (interferon-gamma release assay [negative]); activated partial thromboplastin time (27 s); prothrombin time (9.6 s); international normalized ratio (0.9); and von Willebrand factor antigen (121 IU/dL). Based on these results, sarcoidosis, tuberculosis, and thrombosis were ruled out and no definitive diagnosis was made. The patient was then referred to a dermatologist, who suspected a diagnosis of LET based on clinical presentation. A punch biopsy of the skin lesion measuring 0.4 \u00d7 0.4 \u00d7 0.5 cm was taken from the right lateral thigh.\n\nThe histopathology report on the punch biopsy was as follows: \u201csuperficial and deep perivascular and interstitial mononuclear inflammatory cell infiltrate with increased dermal mucin deposition. Periodic acid-Schiff staining was negative for fungal organisms; colloidal iron (mucin stain) showed increased dermal mucin deposition. There was no evidence of vasculitis or malignancy.\u201d The histopathologist commented that these findings would be compatible with connective tissue disease/LET or an interstitial variant of granuloma annulare in an appropriate clinical setting. To arrive at a definitive diagnosis, the histopathologist advised to correlate clinical findings with serologic studies and to perform a direct immunofluorescence study to rule out morphea versus LET. Direct immunofluorescence study of a biopsy of the lesion, measuring 0.3 \u00d7 0.3 \u00d7 0.6 cm which was taken from the right lateral thigh, showed no specific immune deposits. Due to the high index of suspicion of LET, and its association with other autoimmune conditions, especially systemic lupus erythematosus, the patient was subsequently referred to a rheumatologist.\n\nThe rheumatologist\u2019s physical examination demonstrated a left thigh nodule, and the right thigh exhibited warmth, erythema, and tenderness to palpation. A full screening for autoimmune diseases was done, which included the following diagnostic studies: complete blood count, comprehensive metabolic panel, c-antineutrophilic cytoplasmic antibody, p-antineutrophilic cytoplasmic antibody, anti-nuclear antibody, proteinase-3 antibody, beta-2-glycoprotein IgG/IgM/IgA, cardiolipin IgG/IgM/IgA, anti-Ro antibodies and anti-La antibodies, anti-Smith antibody, ribonucleoprotein antibody, erythrocyte sedimentation rate, C-reactive protein, complement C3 and complement C4, dilute Russell\u2019s viper venom time, thyroid peroxidase antibody, double-stranded deoxyribonucleic acid antibody enzyme immunoassay, cyclic citrulline peptide antibody IgG, rheumatoid factor, and thyroid-stimulating hormone. Remarkably, all diagnostic studies were within normal limits, except the erythrocyte sedimentation rate, which was elevated at 39 (reference range: <25 mm/h). Thus, based on clinical, laboratory, and histopathological findings, LET was diagnosed, and other autoimmune conditions were ruled out. The patient was treated with hydroxychloroquine 200 mg daily and she showed significant improvement within 2 weeks of the follow-up visit.", "summary": "A 52-year-old Hispanic female presented with tender erythematous nodules on her thighs for approximately 1 month. She was suspected of having erythema nodosum secondary to coccidioidomycosis and was prescribed fluconazole 200 mg for 30 days but showed no improvement. However, histopathological and direct immunofluorescence tests later confirmed a diagnosis of LET. The patient was treated with hydroxychloroquine, and the lesions improved remarkably after 2 weeks.", "subclaim_evaluations": [ { "subclaim": "The patient is a 52-year-old Hispanic female.", "support_label": "supported", "is_refined": false }, { "subclaim": "She had tender erythematous nodules on her thighs.", "support_label": "supported", "is_refined": false }, { "subclaim": "The nodules had been present for approximately 1 month.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was suspected of having erythema nodosum.", "support_label": "supported", "is_refined": false }, { "subclaim": "The suspected cause was coccidioidomycosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "She was prescribed fluconazole 200 mg for 30 days.", "support_label": "supported", "is_refined": false }, { "subclaim": "She showed no improvement with fluconazole.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathological tests confirmed a diagnosis of LET.", "support_label": "supported", "is_refined": false }, { "subclaim": "Direct immunofluorescence tests confirmed a diagnosis of LET.", "support_label": "not_supported", "original_label": "not_supported", "reasoning_audit": "No explicit tags provided.", "is_refined": true }, { "subclaim": "The patient was treated with hydroxychloroquine.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesions improved remarkably after 2 weeks.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_1366_en.txt", "fulltext": "A 63-year-old woman presented with a firm 7 cm multilobular tender mass located in the region of the right sternocleidomastoid directly above the clavicle. She had multiple comorbidities including renal failure, systemic lupus erythematosus, and protein S deficiency, a history of transient ischemic attack, deep vein thrombosis, and pulmonary embolism, and longstanding malnourishment requiring jejunostomy tube placement. The firm mass was identified 1 month after an unsuccessful attempt at placing a right internal jugular vein central line. When the central line was originally placed, she developed pain and swelling of her neck. The swelling was pulsatile at that time and enlarging. She was offered surgery as the standard of care for her condition which she refused because she did not want to undergo an invasive procedure and was aware of the risks involved with holding her anticoagulant medication. She had two thrombin injections in the mass since without success. She complained of right neck pain. She was not having any difficulty breathing and denied shortness of breath.\nSoft tissue ultrasound after the two thrombin injections showed pseudoaneurysm and a 7 \u00d7 3.3 \u00d7 4 cm multilobular hematoma at the base of the right neck. CTA of the neck showed a corresponding heterogeneous mass. The pseudoaneurysm was seen measuring 1.5 cm at the internal margin of the hematoma. Serial imaging with CTA demonstrated enlargement over a 2-week interval .\nAngiogram showed blush of contrast coming off of the sternocleidomastoid branch of the superior thyroid artery identifying the location of the pseudoaneurysm . This branch was embolized using glue. Repeat angiogram showed successful embolization and no contrast blush.\nOn follow-up one month later, the mass was no longer pulsatile but still present on physical exam. CTA of the neck showed a decrease in size from the previous CTA .\nOn follow-up 8 months later, she was found to have a soft neck with no mass on physical exam.", "summary": "A 63-year-old female with multiple comorbidities presented with a firm 7\u2009cm tender mass located in the right neck. Ultrasound showed pseudoaneurysm and a 7\u2009\u00d7\u20093.3\u2009\u00d7\u20094\u2009cm multilobular hematoma in the location of the previous central line. CTA showed a corresponding heterogeneous mass. Serial imaging demonstrated enlargement over 2 weeks. Angiogram showed contrast blush off of the SBSTA.", "subclaim_evaluations": [ { "subclaim": "The patient is a 63-year-old female.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient has multiple comorbidities.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had a firm 7\u2009cm tender mass in the right neck.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound showed a pseudoaneurysm.", "support_label": "supported", "is_refined": false }, { "subclaim": "Ultrasound showed a 7\u2009\u00d7\u20093.3\u2009\u00d7\u20094\u2009cm multilobular hematoma.", "support_label": "supported", "is_refined": false }, { "subclaim": "The hematoma was in the location of the previous central line.", "support_label": "supported", "is_refined": false }, { "subclaim": "CTA showed a corresponding heterogeneous mass.", "support_label": "supported", "is_refined": false }, { "subclaim": "Serial imaging demonstrated enlargement over 2 weeks.", "support_label": "supported", "is_refined": false }, { "subclaim": "Angiogram showed contrast blush off of the SBSTA.", "support_label": "supported", "is_refined": false } ], "readability_score": 5 }, { "id": "multiclinsum_test_707_en.txt", "fulltext": "A 30-year-old male with a known history of KTS presented with a rapidly enlarging subcutaneous central frontal mass, measuring 41 \u00d7 47 \u00d7 54 mm since its formation just 3 months earlier causing pain and an obvious cosmetic defect. The patient had no demonstrable neurological signs on examination with normal pre-operative laboratory studies, however, had previous episodes of significant hemorrhage arising from the lesion as a result of minor trauma.\nClinically, the patient was dysmorphic, most notably severe soft tissue overgrowth, bilateral lower limb lymphoedema, and cellulitis. Despite this, he had no history of other complications arising as a result of his KTS such as malignancy or peripheral hemangioma.\nRadiological findings initially began with computed tomography angiogram, which revealed a destructive expansile arterially-enhancing lesion arising from the frontal bone. Heterogenous contrast enhancement on magnetic resonance imaging further defined the lesional dural involvement and invasion into the superior sagittal sinus sparring cerebral parenchyma.\nGross total resection consisted of a T-shaped incision followed by bilateral frontal craniectomies . The vascular lesion was identified arising from frontal bone and within the superior saggital sinus. The lesion was resected en bloc from calvaria. A custom-made titanium implant was used for cranioplasty .\nPostoperatively, the patient had a full recovery. Histopathological hemotoxylin and eosin stains revealed the lesion extending through bone, with a small foci of extramedullary hemopoiesis, consistent with hemangioma. There has been no evidence of recurrence 6 months post resection.", "summary": "A 30-year-old male presented with a rapidly enlarging frontal skull lesion that had developed in only 3 months. Radiological investigation revealed a highly vascular lesion attached to the frontal bone. The lesion was surgically resected with the patient making complete recovery. Histopathology was consistent with an osseous hemangioma.", "subclaim_evaluations": [ { "subclaim": "The patient is a 30-year-old male.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was located on the frontal skull.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion had developed over 3 months.", "support_label": "supported", "is_refined": false }, { "subclaim": "Radiological investigation showed a highly vascular lesion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was attached to the frontal bone.", "support_label": "supported", "is_refined": false }, { "subclaim": "The lesion was surgically resected.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient made a complete recovery.", "support_label": "supported", "is_refined": false }, { "subclaim": "Histopathology was consistent with an osseous hemangioma.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_2089_en.txt", "fulltext": "A 25-year-old woman with liver cirrhosis secondary to autoimmune hepatitis diagnosed at a local hospital presented with fatigue, painless jaundice and lower limb swelling for two weeks, there was no evidence of hypertension or protenuria excluding the possibility of pre-eclampsia or eclampsia. There was no history of ascites, spontaneous bacterial peritonitis or hepatic encephathy. Pregnancy was terminated at 27th week at the local hospital. She was on 40 mg of Prednisolone daily for possible autoimmune hepatitis, soon after, she developed steroid induced diabetes. She was referred to our hospital after 6 weeks of the intial presentation with two episodes of hematemesis, tachycardia (heart rate 120) and blood pressure of 84/50. The patient was admitted to ICU and started on octreotide and Piperacillin/Tazobactam. Gastroscopy revealed gastric varices and bleeding was endoscopically controlled. During admission, liver function tests worsened, and transjugular liver biopsy showed established liver cirrhosis with no obvious active pathology. We started tapering the steroids slowly after being on 40 mg for 4 weeks with no improvement of jaundice without evidence of active inflammation on liver biopsy. During admission, she developed painful, erythematous lesion on her right forearm at the IV access area that became necrotic and spread quickly and increased in size over a period of 24 hours. The lesion included the skin and subcutaneous tissue and was flecked with tiny black spots. Vital signs: temp 37.4\u00baC, BP 128/80 mmHg, pulse 66 /min, RR 20 /min, SaO2 100% on room air.\nChest was clear to auscultation and cardiovascular exam was normal. Abdomen was soft and lax, distended with ascites but no tenderness. Extremities showed mild lower limb edema. Her investigations showed a white cell count 14.24 x 103/mm3 with Neutrophils of 86%, hemoglobin 9.2 g/dl, and platelets of 103000 /mm3 , LFT: total bilirubin 457 umol/L, direct 321, alkaline phosphatase 430U/L, ALT 174U/L, AST 248U/L, gamma GT 227, total protein 51g/L, albumin 18g/L, PT 19.4 and INR was 1.7, PTT 58, renal function test was within normal, fasting glucose 9.8 mmol/L. ESR was 2, Blood culture showed no growth after 5 days.\nMRI of the right upper extremity showed inflammatory changes through the anterior compartment of the forearm suggestive of fasciitis.\nShe was taken to the operating room for debridement after 24 hours, delay was due to anesthesia issues in this high risk patients. At this point after 18 days of admission, Prednisolone dose reached 20 mg daily and antibiotic changed from Piperacillin/Tazobactam to Imipenem when the culture results from tissue biopsy grew Klebsiella Pneumonia extended spectrum b lactamase producer (ESBL).\nHistopathological examination of the debrided soft tissue revealed necrotic subcutaneous fat and skeletal muscle fibers invaded by broad hyphae, irregularly branched, with rare septations suggestive of mucormycosis ( and ). There were no clinical symptoms or signs of visceral dissemination of infection to warrant further imaging or biopsy. The patient started on Amphotericin B (Abelcet\u00ae) 300mg IV OD after 20 days of admission and was continued on imipenem. In spite of surgical debridement, her condition continued to deteriorate and ended up after 6 days with above elbow amputation, tissue-cultures for both bacteria and fungi were negative. Amphotericin B was stopped after amputation as it was considered that the source of infection was eliminated but was restarted again 3 days after discontinuation with imipenem continued all through with the addition of vancomycin. The patient continued to deteriorate and the stump showed signs of disseminated infection, which proved to be invasive mucormycosis infection. Right shoulder disarticulation done but she passed away 2 days later due to multi-organ failure after 35 days in the hospital.", "summary": "We described a rare case of forearm infection originating in a traumatic intravenous access portal in a 25 year-old woman with liver cirrhosis secondary to autoimmune hepatitis.", "subclaim_evaluations": [ { "subclaim": "The patient was a 25 year-old woman.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient had liver cirrhosis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The liver cirrhosis was secondary to autoimmune hepatitis.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infection originated in a traumatic intravenous access portal.", "support_label": "supported", "is_refined": false }, { "subclaim": "The infection was in the forearm.", "support_label": "supported", "is_refined": false }, { "subclaim": "The case was described as rare.", "support_label": "supported", "is_refined": false } ], "readability_score": 2 }, { "id": "multiclinsum_test_1133_en.txt", "fulltext": "A 27-year-old male involved in a motor vehicle accident was brought to Emergency Department room with respiratory distress. He was intubated upon arrival due to low Glasgow Coma Scale (GCS) with extensive maxillofacial injuries. Thoracic examination showed reduced air entry at right chest wall region with palpable crepitus on his right neck region due to subcutaneous emphysema from the neck to the anterior chest wall. The heart sound was barely audible. A curvilinear transducer on the right second intercostal ribs shows the absence of sliding signs, suggestive of right pneumothorax. A FAST scan was performed, but, on subxiphoid view of the heart, only the right ventricle is seen during diastole. Part of the cardiac image was obscured by A-lines . This raised a suspicion of pneumopericardium given the subxiphoid window was showing partly A-lines and the other half of anatomy partially obscured. We proceeded with focused cardiac ultrasound, and only A-lines were visible on parasternal long axis (PLAX), parasternal short axis (PSAX), and apical four chamber (A4C) views.\nThe patient underwent head and chest CT scan that confirmed the diagnosis of Le Fort II facial bone injury, right pneumothorax, and right pulmonary contusion with pneumopericardium . The pneumopericardium was treated conservatively, but other injuries were treated accordingly.", "summary": "A young man involved in a car accident and sustained blunt thoracic injuries, among others. As part of primary survey, FAST scan was performed. Subxiphoid view to look for evidence of pericardial effusion showed part of the cardiac image obscured by A-lines. Other cardiac windows showed only A-lines, as well. A suspicion of pneumopericardium was raised and CT scan confirmed the diagnosis.", "subclaim_evaluations": [ { "subclaim": "The patient is a young man.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient was involved in a car accident.", "support_label": "supported", "is_refined": false }, { "subclaim": "The patient sustained blunt thoracic injuries.", "support_label": "supported", "is_refined": false }, { "subclaim": "A FAST scan was performed as part of the primary survey.", "support_label": "supported", "is_refined": false }, { "subclaim": "A subxiphoid view was obtained to look for pericardial effusion.", "support_label": "supported", "is_refined": false }, { "subclaim": "The subxiphoid view showed part of the cardiac image obscured by A-lines.", "support_label": "supported", "is_refined": false }, { "subclaim": "Other cardiac windows showed only A-lines.", "support_label": "supported", "is_refined": false }, { "subclaim": "A suspicion of pneumopericardium was raised.", "support_label": "supported", "is_refined": false }, { "subclaim": "A CT scan confirmed the diagnosis of pneumopericardium.", "support_label": "supported", "is_refined": false } ], "readability_score": 3 } ]