Spaces:
No application file
No application file
Update app.py
Browse files
app.py
CHANGED
|
@@ -8,390 +8,127 @@ import os
|
|
| 8 |
import traceback
|
| 9 |
|
| 10 |
# Configure logging
|
| 11 |
-
logging.basicConfig(level=logging.INFO
|
| 12 |
logger = logging.getLogger(__name__)
|
| 13 |
|
| 14 |
-
# Debug info
|
| 15 |
-
print("===
|
| 16 |
-
print(f"
|
| 17 |
-
print(f"Files
|
| 18 |
-
print(f"Python path: {os.environ.get('PYTHONPATH', 'Not set')}")
|
| 19 |
print(f"PyTorch version: {torch.__version__}")
|
| 20 |
-
print(
|
| 21 |
-
print(f"Device count: {torch.cuda.device_count() if torch.cuda.is_available() else 0}")
|
| 22 |
-
if torch.cuda.is_available():
|
| 23 |
-
print(f"Current device: {torch.cuda.current_device()}")
|
| 24 |
-
print(f"Device name: {torch.cuda.get_device_name()}")
|
| 25 |
-
print("==========================================")
|
| 26 |
|
| 27 |
-
# Initialize
|
| 28 |
predictor = None
|
| 29 |
initialization_error = None
|
| 30 |
|
| 31 |
try:
|
| 32 |
-
print("Attempting to import predictor...")
|
| 33 |
from predictor import GenePredictor
|
| 34 |
-
print("✅ Predictor module imported successfully")
|
| 35 |
-
|
| 36 |
-
# Check if model file exists
|
| 37 |
model_path = 'best_boundary_aware_model.pth'
|
|
|
|
| 38 |
if os.path.exists(model_path):
|
| 39 |
-
print(f"✅ Model file found: {model_path}")
|
| 40 |
predictor = GenePredictor(model_path=model_path)
|
| 41 |
-
print("✅
|
| 42 |
-
logger.info("Gene predictor initialized successfully")
|
| 43 |
else:
|
| 44 |
-
print(f"❌ Model file not found: {model_path}")
|
| 45 |
-
print(f"Available files: {[f for f in os.listdir('.') if f.endswith('.pth')]}")
|
| 46 |
initialization_error = f"Model file {model_path} not found"
|
|
|
|
| 47 |
|
| 48 |
-
except ImportError as e:
|
| 49 |
-
print(f"❌ Import Error: {e}")
|
| 50 |
-
print("Make sure predictor.py is in the same directory as app.py")
|
| 51 |
-
logger.error(f"Failed to import predictor: {e}")
|
| 52 |
-
initialization_error = f"Import error: {e}"
|
| 53 |
-
except FileNotFoundError as e:
|
| 54 |
-
print(f"❌ File Error: {e}")
|
| 55 |
-
logger.error(f"Model file not found: {e}")
|
| 56 |
-
initialization_error = f"File not found: {e}"
|
| 57 |
except Exception as e:
|
| 58 |
-
|
| 59 |
-
|
| 60 |
-
initialization_error = f"Initialization error: {e}"
|
| 61 |
|
| 62 |
-
def
|
| 63 |
-
|
| 64 |
-
ground_truth_start: Optional[int] = None,
|
| 65 |
-
ground_truth_end: Optional[int] = None) -> Tuple[str, str, str]:
|
| 66 |
-
"""
|
| 67 |
-
Main prediction function for Gradio interface
|
| 68 |
-
|
| 69 |
-
Returns:
|
| 70 |
-
- regions_display: Formatted string showing predicted regions
|
| 71 |
-
- metrics_display: Formatted string showing accuracy metrics (if ground truth provided)
|
| 72 |
-
- detailed_json: JSON string with full prediction details
|
| 73 |
-
"""
|
| 74 |
-
|
| 75 |
try:
|
| 76 |
-
if
|
| 77 |
-
|
| 78 |
-
|
| 79 |
-
Error: {initialization_error or 'Unknown initialization error'}
|
| 80 |
-
|
| 81 |
-
Please check:
|
| 82 |
-
1. predictor.py file exists
|
| 83 |
-
2. best_boundary_aware_model.pth file exists
|
| 84 |
-
3. All dependencies are installed
|
| 85 |
-
4. Check the Hugging Face Spaces logs for specific errors"""
|
| 86 |
-
return error_msg, "", "{}"
|
| 87 |
|
| 88 |
-
# Input validation
|
| 89 |
if not sequence or not sequence.strip():
|
| 90 |
-
return "❌
|
| 91 |
|
| 92 |
sequence = sequence.strip().upper()
|
| 93 |
|
| 94 |
-
#
|
| 95 |
valid_chars = set('ACTGN')
|
| 96 |
-
|
| 97 |
-
|
| 98 |
-
return f"❌ Sequence contains invalid characters: {', '.join(sorted(invalid_chars))}. Only A, C, T, G, N allowed", "", "{}"
|
| 99 |
|
| 100 |
-
# Check sequence length
|
| 101 |
if len(sequence) < 3:
|
| 102 |
-
return "❌ Sequence too short
|
| 103 |
|
| 104 |
-
if len(sequence) > 10000:
|
| 105 |
-
return "❌ Sequence too long
|
| 106 |
-
|
| 107 |
-
# Process ground truth if provided
|
| 108 |
-
labels = None
|
| 109 |
-
try:
|
| 110 |
-
if ground_truth_labels and ground_truth_labels.strip():
|
| 111 |
-
# Parse comma-separated labels
|
| 112 |
-
label_strings = [x.strip() for x in ground_truth_labels.split(',')]
|
| 113 |
-
labels = [int(x) for x in label_strings if x] # Skip empty strings
|
| 114 |
-
|
| 115 |
-
if len(labels) != len(sequence):
|
| 116 |
-
return f"❌ Labels length ({len(labels)}) must match sequence length ({len(sequence)})", "", "{}"
|
| 117 |
-
|
| 118 |
-
if not all(x in (0, 1) for x in labels):
|
| 119 |
-
return "❌ Labels must be 0 or 1", "", "{}"
|
| 120 |
-
|
| 121 |
-
elif ground_truth_start is not None and ground_truth_end is not None:
|
| 122 |
-
start = int(ground_truth_start)
|
| 123 |
-
end = int(ground_truth_end)
|
| 124 |
-
|
| 125 |
-
if start < 0 or end > len(sequence) or start >= end:
|
| 126 |
-
return f"❌ Invalid coordinates: start={start}, end={end}, sequence_length={len(sequence)}", "", "{}"
|
| 127 |
-
|
| 128 |
-
# Create labels array
|
| 129 |
-
labels = [0] * len(sequence)
|
| 130 |
-
for i in range(start, end):
|
| 131 |
-
labels[i] = 1
|
| 132 |
-
|
| 133 |
-
except ValueError as e:
|
| 134 |
-
return f"❌ Invalid ground truth format: {str(e)}", "", "{}"
|
| 135 |
|
| 136 |
# Make prediction
|
| 137 |
-
print(f"Making prediction for sequence of length {len(sequence)}")
|
| 138 |
predictions, probs_dict, confidence = predictor.predict(sequence)
|
| 139 |
-
print(f"Prediction completed. Confidence: {confidence}")
|
| 140 |
-
|
| 141 |
-
# Extract gene regions
|
| 142 |
regions = predictor.extract_gene_regions(predictions, sequence)
|
| 143 |
-
print(f"Extracted {len(regions)} regions")
|
| 144 |
-
|
| 145 |
-
# Format regions display
|
| 146 |
-
regions_display = format_regions_display(regions, confidence)
|
| 147 |
|
| 148 |
-
#
|
| 149 |
-
|
| 150 |
-
|
| 151 |
-
if labels is not None:
|
| 152 |
-
print("Computing accuracy metrics...")
|
| 153 |
-
metrics = predictor.compute_accuracy(predictions, labels)
|
| 154 |
-
metrics_display = format_metrics_display(metrics)
|
| 155 |
|
| 156 |
-
|
| 157 |
-
detailed_response = {
|
| 158 |
-
"regions": regions,
|
| 159 |
-
"confidence": float(confidence),
|
| 160 |
-
"metrics": metrics,
|
| 161 |
-
"sequence_length": len(sequence),
|
| 162 |
-
"num_predicted_genes": len(regions),
|
| 163 |
-
"prediction_summary": {
|
| 164 |
-
"total_gene_positions": int(np.sum(predictions)),
|
| 165 |
-
"gene_coverage": float(np.sum(predictions) / len(predictions))
|
| 166 |
-
}
|
| 167 |
-
}
|
| 168 |
|
| 169 |
-
|
| 170 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 171 |
|
| 172 |
-
return
|
| 173 |
|
| 174 |
except Exception as e:
|
| 175 |
-
print(f"
|
| 176 |
-
|
| 177 |
-
print(f"Full traceback: {traceback.format_exc()}")
|
| 178 |
-
logger.error(f"Prediction failed: {e}")
|
| 179 |
-
|
| 180 |
-
error_msg = f"❌ Prediction failed: {str(e)}\n\nError type: {type(e).__name__}"
|
| 181 |
-
return error_msg, "", "{}"
|
| 182 |
|
| 183 |
-
def
|
| 184 |
-
"""
|
| 185 |
-
|
| 186 |
-
|
| 187 |
-
|
| 188 |
-
|
| 189 |
-
|
| 190 |
-
|
| 191 |
-
|
| 192 |
-
|
| 193 |
-
|
| 194 |
-
display += f" • Length: {region['length']} bp\n"
|
| 195 |
-
display += f" • Start Codon: {region.get('start_codon', 'None detected') or 'None detected'}\n"
|
| 196 |
-
display += f" • Stop Codon: {region.get('stop_codon', 'None detected') or 'None detected'}\n"
|
| 197 |
-
display += f" • In Frame: {'✅ Yes' if region.get('in_frame', False) else '❌ No'}\n"
|
| 198 |
-
|
| 199 |
-
# Safe sequence preview
|
| 200 |
-
seq = region.get('sequence', '')
|
| 201 |
-
if seq:
|
| 202 |
-
preview = seq[:60] + ('...' if len(seq) > 60 else '')
|
| 203 |
-
display += f" • Sequence Preview: {preview}\n\n"
|
| 204 |
-
else:
|
| 205 |
-
display += f" • Sequence Preview: Not available\n\n"
|
| 206 |
-
|
| 207 |
-
return display
|
| 208 |
|
| 209 |
-
|
| 210 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 211 |
|
| 212 |
-
|
| 213 |
-
display += f" • **Accuracy:** {metrics.get('accuracy', 0):.3f} ({metrics.get('accuracy', 0)*100:.1f}%)\n"
|
| 214 |
-
display += f" • **Precision:** {metrics.get('precision', 0):.3f}\n"
|
| 215 |
-
display += f" • **Recall:** {metrics.get('recall', 0):.3f}\n"
|
| 216 |
-
display += f" • **F1 Score:** {metrics.get('f1', 0):.3f}\n\n"
|
| 217 |
-
display += f"**Confusion Matrix:**\n"
|
| 218 |
-
display += f" • True Positives: {metrics.get('true_positives', 0)}\n"
|
| 219 |
-
display += f" • False Positives: {metrics.get('false_positives', 0)}\n"
|
| 220 |
-
display += f" • False Negatives: {metrics.get('false_negatives', 0)}\n"
|
| 221 |
|
| 222 |
-
|
| 223 |
-
|
| 224 |
-
|
| 225 |
-
|
| 226 |
-
|
| 227 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
| 228 |
|
| 229 |
-
|
| 230 |
-
"""Clear all input fields"""
|
| 231 |
-
return "", None, None, ""
|
| 232 |
-
|
| 233 |
-
# Create the Gradio interface with simpler structure
|
| 234 |
-
def create_interface():
|
| 235 |
-
try:
|
| 236 |
-
# Show setup status
|
| 237 |
-
if predictor:
|
| 238 |
-
status_message = "✅ Model loaded successfully!"
|
| 239 |
-
status_color = "green"
|
| 240 |
-
else:
|
| 241 |
-
status_message = f"❌ Model failed to load: {initialization_error}"
|
| 242 |
-
status_color = "red"
|
| 243 |
-
|
| 244 |
-
# Create interface with minimal configuration
|
| 245 |
-
interface = gr.Blocks(
|
| 246 |
-
title="Gene Prediction Tool",
|
| 247 |
-
theme=gr.themes.Default() # Use default theme instead of Soft
|
| 248 |
-
)
|
| 249 |
-
|
| 250 |
-
with interface:
|
| 251 |
-
# Header
|
| 252 |
-
gr.HTML(f"""
|
| 253 |
-
<div style="text-align: center; padding: 20px;">
|
| 254 |
-
<h1>🧬 Gene Prediction Tool</h1>
|
| 255 |
-
<p>This tool predicts gene regions in DNA sequences using a boundary-aware deep learning model.</p>
|
| 256 |
-
<div style="padding: 10px; border-left: 4px solid {status_color}; background-color: #f9f9f9; margin: 10px 0;">
|
| 257 |
-
<strong>Status:</strong> {status_message}
|
| 258 |
-
</div>
|
| 259 |
-
</div>
|
| 260 |
-
""")
|
| 261 |
-
|
| 262 |
-
# Input section
|
| 263 |
-
gr.Markdown("## 📝 Input")
|
| 264 |
-
|
| 265 |
-
sequence_input = gr.Textbox(
|
| 266 |
-
label="DNA Sequence",
|
| 267 |
-
placeholder="Enter your DNA sequence (A, C, T, G, N only)...",
|
| 268 |
-
lines=5,
|
| 269 |
-
info="Maximum length: 10,000 nucleotides"
|
| 270 |
-
)
|
| 271 |
-
|
| 272 |
-
with gr.Row():
|
| 273 |
-
example_btn = gr.Button("📋 Load Example", size="sm")
|
| 274 |
-
clear_btn = gr.Button("🗑️ Clear", size="sm")
|
| 275 |
-
predict_btn = gr.Button("🔬 Predict Genes", variant="primary")
|
| 276 |
-
|
| 277 |
-
# Ground truth section (optional)
|
| 278 |
-
with gr.Accordion("🎯 Ground Truth (Optional)", open=False):
|
| 279 |
-
gr.Markdown("*Provide ground truth data to calculate accuracy metrics*")
|
| 280 |
-
|
| 281 |
-
with gr.Row():
|
| 282 |
-
gt_start = gr.Number(
|
| 283 |
-
label="Start Position",
|
| 284 |
-
precision=0,
|
| 285 |
-
minimum=0
|
| 286 |
-
)
|
| 287 |
-
gt_end = gr.Number(
|
| 288 |
-
label="End Position",
|
| 289 |
-
precision=0,
|
| 290 |
-
minimum=0
|
| 291 |
-
)
|
| 292 |
-
|
| 293 |
-
gt_labels = gr.Textbox(
|
| 294 |
-
label="OR: Labels (comma-separated 0s and 1s)",
|
| 295 |
-
placeholder="0,0,1,1,1,0,0...",
|
| 296 |
-
info="Alternative to start/end positions"
|
| 297 |
-
)
|
| 298 |
-
|
| 299 |
-
# Output section
|
| 300 |
-
gr.Markdown("## 🔬 Prediction Results")
|
| 301 |
-
|
| 302 |
-
regions_output = gr.Markdown(
|
| 303 |
-
value="*Results will appear here after prediction...*"
|
| 304 |
-
)
|
| 305 |
-
|
| 306 |
-
metrics_output = gr.Markdown(
|
| 307 |
-
value="*Metrics will appear here if ground truth is provided...*"
|
| 308 |
-
)
|
| 309 |
-
|
| 310 |
-
# Detailed JSON output (collapsible)
|
| 311 |
-
with gr.Accordion("📄 Detailed JSON Output", open=False):
|
| 312 |
-
json_output = gr.Code(
|
| 313 |
-
language="json",
|
| 314 |
-
value="{}",
|
| 315 |
-
lines=10
|
| 316 |
-
)
|
| 317 |
-
|
| 318 |
-
# Event handlers
|
| 319 |
-
example_btn.click(
|
| 320 |
-
fn=load_example_sequence,
|
| 321 |
-
outputs=sequence_input
|
| 322 |
-
)
|
| 323 |
-
|
| 324 |
-
clear_btn.click(
|
| 325 |
-
fn=clear_inputs,
|
| 326 |
-
outputs=[sequence_input, gt_start, gt_end, gt_labels]
|
| 327 |
-
)
|
| 328 |
-
|
| 329 |
-
predict_btn.click(
|
| 330 |
-
fn=predict_gene_regions,
|
| 331 |
-
inputs=[sequence_input, gt_labels, gt_start, gt_end],
|
| 332 |
-
outputs=[regions_output, metrics_output, json_output]
|
| 333 |
-
)
|
| 334 |
-
|
| 335 |
-
# Also trigger prediction on Enter in the sequence box
|
| 336 |
-
sequence_input.submit(
|
| 337 |
-
fn=predict_gene_regions,
|
| 338 |
-
inputs=[sequence_input, gt_labels, gt_start, gt_end],
|
| 339 |
-
outputs=[regions_output, metrics_output, json_output]
|
| 340 |
-
)
|
| 341 |
-
|
| 342 |
-
# Footer
|
| 343 |
-
gr.Markdown("""
|
| 344 |
-
---
|
| 345 |
-
**Model Info:** Boundary-aware gene prediction using multi-task deep learning
|
| 346 |
-
**Supported:** DNA sequences with A, C, T, G, N nucleotides
|
| 347 |
-
**Output:** Gene regions with start/end positions, codons, and confidence scores
|
| 348 |
-
""")
|
| 349 |
-
|
| 350 |
-
return interface
|
| 351 |
-
|
| 352 |
-
except Exception as e:
|
| 353 |
-
print(f"❌ Error creating interface: {e}")
|
| 354 |
-
print(f"Full traceback: {traceback.format_exc()}")
|
| 355 |
-
|
| 356 |
-
# Create a minimal fallback interface
|
| 357 |
-
fallback_interface = gr.Interface(
|
| 358 |
-
fn=lambda x: f"Error: {str(e)}",
|
| 359 |
-
inputs=gr.Textbox(label="DNA Sequence"),
|
| 360 |
-
outputs=gr.Textbox(label="Output"),
|
| 361 |
-
title="Gene Prediction Tool - Error Recovery Mode"
|
| 362 |
-
)
|
| 363 |
-
return fallback_interface
|
| 364 |
-
|
| 365 |
-
# Main execution
|
| 366 |
if __name__ == "__main__":
|
| 367 |
-
|
| 368 |
-
print("Creating Gradio interface...")
|
| 369 |
-
interface = create_interface()
|
| 370 |
-
print("✅ Gradio interface created successfully")
|
| 371 |
-
|
| 372 |
-
# Launch the interface
|
| 373 |
-
# Remove custom CSS and use default settings for HF Spaces
|
| 374 |
-
interface.launch(
|
| 375 |
-
server_name="0.0.0.0", # Important for HF Spaces
|
| 376 |
-
server_port=7860, # Standard port for HF Spaces
|
| 377 |
-
share=False, # Don't create public link on HF Spaces
|
| 378 |
-
debug=False, # Turn off debug mode for production
|
| 379 |
-
show_error=True # Show errors in interface
|
| 380 |
-
)
|
| 381 |
-
|
| 382 |
-
except Exception as e:
|
| 383 |
-
print(f"❌ Failed to launch interface: {e}")
|
| 384 |
-
print(f"Full traceback: {traceback.format_exc()}")
|
| 385 |
-
|
| 386 |
-
# Last resort - create the simplest possible interface
|
| 387 |
-
try:
|
| 388 |
-
simple_interface = gr.Interface(
|
| 389 |
-
fn=lambda x: "Simple interface loaded - main interface failed",
|
| 390 |
-
inputs=gr.Textbox(label="Test Input"),
|
| 391 |
-
outputs=gr.Textbox(label="Test Output"),
|
| 392 |
-
title="Gene Prediction Tool - Minimal Mode"
|
| 393 |
-
)
|
| 394 |
-
simple_interface.launch()
|
| 395 |
-
except Exception as e2:
|
| 396 |
-
print(f"❌ Even simple interface failed: {e2}")
|
| 397 |
-
raise
|
|
|
|
| 8 |
import traceback
|
| 9 |
|
| 10 |
# Configure logging
|
| 11 |
+
logging.basicConfig(level=logging.INFO)
|
| 12 |
logger = logging.getLogger(__name__)
|
| 13 |
|
| 14 |
+
# Debug info
|
| 15 |
+
print("=== Debug Info ===")
|
| 16 |
+
print(f"Working directory: {os.getcwd()}")
|
| 17 |
+
print(f"Files: {os.listdir('.')}")
|
|
|
|
| 18 |
print(f"PyTorch version: {torch.__version__}")
|
| 19 |
+
print("==================")
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 20 |
|
| 21 |
+
# Initialize predictor
|
| 22 |
predictor = None
|
| 23 |
initialization_error = None
|
| 24 |
|
| 25 |
try:
|
|
|
|
| 26 |
from predictor import GenePredictor
|
|
|
|
|
|
|
|
|
|
| 27 |
model_path = 'best_boundary_aware_model.pth'
|
| 28 |
+
|
| 29 |
if os.path.exists(model_path):
|
|
|
|
| 30 |
predictor = GenePredictor(model_path=model_path)
|
| 31 |
+
print("✅ Model loaded successfully")
|
|
|
|
| 32 |
else:
|
|
|
|
|
|
|
| 33 |
initialization_error = f"Model file {model_path} not found"
|
| 34 |
+
print(f"❌ {initialization_error}")
|
| 35 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 36 |
except Exception as e:
|
| 37 |
+
initialization_error = str(e)
|
| 38 |
+
print(f"❌ Error: {e}")
|
|
|
|
| 39 |
|
| 40 |
+
def predict_genes(sequence):
|
| 41 |
+
"""Simple prediction function"""
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 42 |
try:
|
| 43 |
+
if not predictor:
|
| 44 |
+
return f"❌ Model not loaded: {initialization_error}"
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 45 |
|
|
|
|
| 46 |
if not sequence or not sequence.strip():
|
| 47 |
+
return "❌ Please enter a DNA sequence"
|
| 48 |
|
| 49 |
sequence = sequence.strip().upper()
|
| 50 |
|
| 51 |
+
# Validate sequence
|
| 52 |
valid_chars = set('ACTGN')
|
| 53 |
+
if not set(sequence).issubset(valid_chars):
|
| 54 |
+
return "❌ Invalid characters. Use only A, C, T, G, N"
|
|
|
|
| 55 |
|
|
|
|
| 56 |
if len(sequence) < 3:
|
| 57 |
+
return "❌ Sequence too short (minimum 3 nucleotides)"
|
| 58 |
|
| 59 |
+
if len(sequence) > 10000:
|
| 60 |
+
return "❌ Sequence too long (maximum 10,000 nucleotides)"
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 61 |
|
| 62 |
# Make prediction
|
|
|
|
| 63 |
predictions, probs_dict, confidence = predictor.predict(sequence)
|
|
|
|
|
|
|
|
|
|
| 64 |
regions = predictor.extract_gene_regions(predictions, sequence)
|
|
|
|
|
|
|
|
|
|
|
|
|
| 65 |
|
| 66 |
+
# Format output
|
| 67 |
+
if not regions:
|
| 68 |
+
return f"🔍 No gene regions detected (Confidence: {confidence:.3f})"
|
|
|
|
|
|
|
|
|
|
|
|
|
| 69 |
|
| 70 |
+
result = f"🧬 Found {len(regions)} gene region(s) (Confidence: {confidence:.3f})\n\n"
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 71 |
|
| 72 |
+
for i, region in enumerate(regions, 1):
|
| 73 |
+
result += f"**Gene {i}:**\n"
|
| 74 |
+
result += f" • Position: {region['start']} - {region['end']}\n"
|
| 75 |
+
result += f" • Length: {region['length']} bp\n"
|
| 76 |
+
|
| 77 |
+
# Safe sequence preview
|
| 78 |
+
seq = region.get('sequence', '')
|
| 79 |
+
if seq:
|
| 80 |
+
preview = seq[:60] + ('...' if len(seq) > 60 else '')
|
| 81 |
+
result += f" • Preview: {preview}\n\n"
|
| 82 |
+
else:
|
| 83 |
+
result += f" • Preview: Not available\n\n"
|
| 84 |
|
| 85 |
+
return result
|
| 86 |
|
| 87 |
except Exception as e:
|
| 88 |
+
print(f"Prediction error: {e}")
|
| 89 |
+
return f"❌ Prediction failed: {str(e)}"
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 90 |
|
| 91 |
+
def load_example():
|
| 92 |
+
"""Load example DNA sequence"""
|
| 93 |
+
return "ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGGGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCCGGCCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCGATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGAATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAACGGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAGCCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGG"
|
| 94 |
+
|
| 95 |
+
# Status message
|
| 96 |
+
if predictor:
|
| 97 |
+
status_msg = "✅ Model loaded successfully!"
|
| 98 |
+
status_color = "green"
|
| 99 |
+
else:
|
| 100 |
+
status_msg = f"❌ Model loading failed: {initialization_error}"
|
| 101 |
+
status_color = "red"
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 102 |
|
| 103 |
+
# Try gr.Interface first (simpler approach)
|
| 104 |
+
demo = gr.Interface(
|
| 105 |
+
fn=predict_genes,
|
| 106 |
+
inputs=gr.Textbox(
|
| 107 |
+
label="DNA Sequence",
|
| 108 |
+
placeholder="Enter DNA sequence (A, C, T, G, N)...",
|
| 109 |
+
lines=6
|
| 110 |
+
),
|
| 111 |
+
outputs=gr.Textbox(
|
| 112 |
+
label="Prediction Results",
|
| 113 |
+
lines=15
|
| 114 |
+
),
|
| 115 |
+
title="🧬 Gene Prediction Tool",
|
| 116 |
+
description=f"""
|
| 117 |
+
Predict gene regions in DNA sequences using deep learning.
|
| 118 |
|
| 119 |
+
**Status:** {status_msg}
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 120 |
|
| 121 |
+
**Instructions:**
|
| 122 |
+
1. Enter a DNA sequence using only A, C, T, G, N characters
|
| 123 |
+
2. Click Submit
|
| 124 |
+
3. View predicted gene regions with positions and confidence scores
|
| 125 |
+
""",
|
| 126 |
+
examples=[
|
| 127 |
+
["ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGGGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGCCGGTAATGAAAAAGGCGAACTGGTGGTGCTTGGACGCAACGGTTCCGACTACTCTGCTGCGGTGCTGGCTGCCTGTTTACGCGCCGATTGTTGCGAGATTTGGACGGACGTTGACGGGGTCTATACCTGCGACCCGCGTCAGGTGCCCGATGCGAGGTTGTTGAAGTCGATGTCCTACCAGGAAGCGATGGAGCTTTCCTACTTCGGCGCTAAAGTTCTTCACCCCCGCACCATTACCCCCATCGCCCAGTTCCAGATCCCTTGCCTGATTAAAAATACCGGAAATCCTCAAGCACCAGGTACGCTCATTGGTGCCAGCCGTGATGAAGACGAATTACCGGTCAAGGGCATTTCCAATCTGAATAACATGGCAATGTTCAGCGTTTCCGGCCCGGGGATGAAAGGGATGGTCGGCATGGCGGCGCGCGTCTTTGCAGCGATGTCACGCGCCCGTATTTCCGTGGTGCTGATTACGCAATCATCTTCCGAATACAGCATCAGTTTCTGCGTTCCACAAAGCGACTGTGTGCGAGCTGAACGGGCAATGCAGGAAGAGTTCTACCTGGAACTGAAAGAAGGCTTACTGGAGCCGCTGGCAGTGACGGAACGGCTGGCCATTATCTCGGTGGTAGG"]
|
| 128 |
+
],
|
| 129 |
+
allow_flagging="never"
|
| 130 |
+
)
|
| 131 |
|
| 132 |
+
# Launch the app
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 133 |
if __name__ == "__main__":
|
| 134 |
+
demo.launch()
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|