Spaces:
No application file
No application file
Update app.py
Browse files
app.py
CHANGED
|
@@ -13,8 +13,10 @@ from tensorflow.keras.models import load_model
|
|
| 13 |
import ml_simplified_tree
|
| 14 |
import tempfile
|
| 15 |
import shutil
|
| 16 |
-
import
|
| 17 |
from pathlib import Path
|
|
|
|
|
|
|
| 18 |
|
| 19 |
# --- Global Variables ---
|
| 20 |
MAFFT_PATH = "mafft/mafftdir/bin/mafft" # Update this path as needed
|
|
@@ -24,11 +26,10 @@ IQTREE_PATH = "iqtree/bin/iqtree2" # Update this path as needed
|
|
| 24 |
logging.basicConfig(level=logging.INFO, format='%(asctime)s - %(levelname)s - %(message)s')
|
| 25 |
|
| 26 |
# --- Paths ---
|
| 27 |
-
from huggingface_hub import hf_hub_download
|
| 28 |
-
|
| 29 |
# Model repository and file paths
|
| 30 |
model_repo = "GGproject10/best_boundary_aware_model"
|
| 31 |
csv_path = "f cleaned.csv"
|
|
|
|
| 32 |
|
| 33 |
# Get HF token from environment (if available)
|
| 34 |
hf_token = os.getenv("HF_TOKEN")
|
|
@@ -37,14 +38,13 @@ hf_token = os.getenv("HF_TOKEN")
|
|
| 37 |
boundary_model = None
|
| 38 |
keras_model = None
|
| 39 |
kmer_to_index = None
|
|
|
|
|
|
|
|
|
|
| 40 |
|
| 41 |
# Try to load boundary model from Hugging Face Hub
|
| 42 |
try:
|
| 43 |
-
boundary_path = hf_hub_download(
|
| 44 |
-
repo_id=model_repo,
|
| 45 |
-
filename="best_boundary_aware_model.pth",
|
| 46 |
-
token=hf_token
|
| 47 |
-
)
|
| 48 |
if os.path.exists(boundary_path):
|
| 49 |
boundary_model = GenePredictor(boundary_path)
|
| 50 |
logging.info("Boundary model loaded successfully from Hugging Face Hub.")
|
|
@@ -55,17 +55,8 @@ except Exception as e:
|
|
| 55 |
|
| 56 |
# Try to load Keras model from Hugging Face Hub
|
| 57 |
try:
|
| 58 |
-
keras_path = hf_hub_download(
|
| 59 |
-
|
| 60 |
-
filename="best_model.keras",
|
| 61 |
-
token=hf_token
|
| 62 |
-
)
|
| 63 |
-
kmer_path = hf_hub_download(
|
| 64 |
-
repo_id=model_repo,
|
| 65 |
-
filename="kmer_to_index.pkl",
|
| 66 |
-
token=hf_token
|
| 67 |
-
)
|
| 68 |
-
|
| 69 |
if os.path.exists(keras_path) and os.path.exists(kmer_path):
|
| 70 |
keras_model = load_model(keras_path)
|
| 71 |
with open(kmer_path, "rb") as f:
|
|
@@ -76,6 +67,26 @@ try:
|
|
| 76 |
except Exception as e:
|
| 77 |
logging.error(f"Failed to load Keras model from HF Hub: {e}")
|
| 78 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 79 |
# --- Initialize Tree Analyzer ---
|
| 80 |
analyzer = None
|
| 81 |
try:
|
|
@@ -83,7 +94,6 @@ try:
|
|
| 83 |
if os.path.exists(csv_path):
|
| 84 |
if analyzer.load_data(csv_path):
|
| 85 |
logging.info("Tree analyzer initialized successfully")
|
| 86 |
-
# Try to train AI model (optional)
|
| 87 |
try:
|
| 88 |
if not analyzer.train_ai_model():
|
| 89 |
logging.warning("AI model training failed; proceeding with basic analysis.")
|
|
@@ -100,34 +110,52 @@ except Exception as e:
|
|
| 100 |
analyzer = None
|
| 101 |
|
| 102 |
# --- Enhanced Tool Detection ---
|
| 103 |
-
def
|
| 104 |
-
"""
|
| 105 |
-
|
| 106 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 107 |
mafft_available = False
|
| 108 |
mafft_cmd = None
|
| 109 |
-
|
| 110 |
-
# Try multiple MAFFT locations
|
| 111 |
mafft_candidates = [
|
| 112 |
MAFFT_PATH,
|
| 113 |
'mafft',
|
| 114 |
'/usr/bin/mafft',
|
| 115 |
'/usr/local/bin/mafft',
|
| 116 |
-
'mafft
|
|
|
|
|
|
|
| 117 |
]
|
| 118 |
-
|
| 119 |
for candidate in mafft_candidates:
|
| 120 |
-
if candidate and
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 121 |
mafft_available = True
|
| 122 |
mafft_cmd = candidate
|
| 123 |
-
logging.info(f"Found MAFFT
|
| 124 |
break
|
| 125 |
-
|
| 126 |
-
# Check IQ-TREE
|
| 127 |
iqtree_available = False
|
| 128 |
iqtree_cmd = None
|
| 129 |
-
|
| 130 |
-
# Try multiple IQ-TREE locations and names
|
| 131 |
iqtree_candidates = [
|
| 132 |
IQTREE_PATH,
|
| 133 |
'iqtree2',
|
|
@@ -136,74 +164,95 @@ def check_tool_availability():
|
|
| 136 |
'/usr/local/bin/iqtree2',
|
| 137 |
'/usr/bin/iqtree',
|
| 138 |
'/usr/local/bin/iqtree',
|
| 139 |
-
'iqtree2
|
| 140 |
-
'
|
|
|
|
| 141 |
]
|
| 142 |
-
|
| 143 |
for candidate in iqtree_candidates:
|
| 144 |
-
if candidate and
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 145 |
iqtree_available = True
|
| 146 |
iqtree_cmd = candidate
|
| 147 |
-
logging.info(f"Found IQ-TREE
|
| 148 |
break
|
| 149 |
-
|
| 150 |
-
return mafft_available, iqtree_available, mafft_cmd, iqtree_cmd
|
| 151 |
-
|
| 152 |
-
def install_dependencies_guide():
|
| 153 |
-
"""Provide installation guidance for missing dependencies"""
|
| 154 |
-
guide = """
|
| 155 |
-
🔧 INSTALLATION GUIDE FOR MISSING DEPENDENCIES:
|
| 156 |
|
| 157 |
-
|
| 158 |
-
- Ubuntu/Debian: sudo apt-get install mafft
|
| 159 |
-
- CentOS/RHEL: sudo yum install mafft
|
| 160 |
-
- macOS: brew install mafft
|
| 161 |
-
- Windows: Download from https://mafft.cbrc.jp/alignment/software/
|
| 162 |
-
|
| 163 |
-
For IQ-TREE:
|
| 164 |
-
- Ubuntu/Debian: sudo apt-get install iqtree
|
| 165 |
-
- CentOS/RHEL: sudo yum install iqtree
|
| 166 |
-
- macOS: brew install iqtree
|
| 167 |
-
- Windows: Download from http://www.iqtree.org/
|
| 168 |
-
|
| 169 |
-
Alternative: Use conda/mamba:
|
| 170 |
-
- conda install -c bioconda mafft iqtree
|
| 171 |
|
| 172 |
-
|
| 173 |
-
|
| 174 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 175 |
"""
|
| 176 |
-
return guide
|
| 177 |
|
| 178 |
-
def
|
| 179 |
-
"""Run MAFFT alignment with
|
| 180 |
try:
|
| 181 |
-
|
| 182 |
-
|
| 183 |
-
mafft_cmd
|
| 184 |
-
|
| 185 |
-
|
| 186 |
-
|
| 187 |
-
|
| 188 |
-
|
|
|
|
|
|
|
|
|
|
| 189 |
logging.info(f"Running MAFFT: {' '.join(cmd)}")
|
| 190 |
-
|
| 191 |
-
# Run MAFFT with enhanced error handling
|
| 192 |
-
result = subprocess.run(
|
| 193 |
-
cmd,
|
| 194 |
-
capture_output=True,
|
| 195 |
-
text=True,
|
| 196 |
-
timeout=600, # Increased timeout to 10 minutes
|
| 197 |
-
cwd=os.getcwd() # Ensure working directory is set
|
| 198 |
-
)
|
| 199 |
-
|
| 200 |
if result.returncode == 0:
|
| 201 |
-
# Write aligned sequences to output file
|
| 202 |
with open(output_fasta, 'w') as f:
|
| 203 |
f.write(result.stdout)
|
| 204 |
logging.info(f"MAFFT alignment completed: {output_fasta}")
|
| 205 |
-
|
| 206 |
-
# Verify output file
|
| 207 |
if os.path.exists(output_fasta) and os.path.getsize(output_fasta) > 0:
|
| 208 |
return True, output_fasta
|
| 209 |
else:
|
|
@@ -212,10 +261,12 @@ def run_mafft_alignment(input_fasta, output_fasta, mafft_cmd):
|
|
| 212 |
error_msg = result.stderr.strip() if result.stderr else "Unknown MAFFT error"
|
| 213 |
logging.error(f"MAFFT failed: {error_msg}")
|
| 214 |
return False, f"MAFFT error: {error_msg}"
|
| 215 |
-
|
| 216 |
except subprocess.TimeoutExpired:
|
| 217 |
logging.error("MAFFT timeout")
|
| 218 |
return False, "MAFFT timeout (>10 minutes). Try with fewer sequences."
|
|
|
|
|
|
|
|
|
|
| 219 |
except FileNotFoundError:
|
| 220 |
return False, f"MAFFT executable not found: {mafft_cmd}"
|
| 221 |
except Exception as e:
|
|
@@ -225,30 +276,19 @@ def run_mafft_alignment(input_fasta, output_fasta, mafft_cmd):
|
|
| 225 |
def run_iqtree_analysis(aligned_fasta, output_prefix, iqtree_cmd):
|
| 226 |
"""Run IQ-TREE with enhanced options and error handling"""
|
| 227 |
try:
|
| 228 |
-
|
| 229 |
-
|
| 230 |
-
iqtree_cmd
|
| 231 |
-
|
| 232 |
-
|
| 233 |
-
'-
|
| 234 |
-
|
| 235 |
-
|
| 236 |
-
|
| 237 |
-
|
| 238 |
-
|
| 239 |
-
]
|
| 240 |
-
|
| 241 |
logging.info(f"Running IQ-TREE: {' '.join(cmd)}")
|
| 242 |
-
|
| 243 |
-
# Run IQ-TREE with enhanced error handling
|
| 244 |
-
result = subprocess.run(
|
| 245 |
-
cmd,
|
| 246 |
-
capture_output=True,
|
| 247 |
-
text=True,
|
| 248 |
-
timeout=1200, # 20 minute timeout for larger datasets
|
| 249 |
-
cwd=os.getcwd()
|
| 250 |
-
)
|
| 251 |
-
|
| 252 |
if result.returncode == 0:
|
| 253 |
tree_file = f"{output_prefix}.treefile"
|
| 254 |
if os.path.exists(tree_file) and os.path.getsize(tree_file) > 0:
|
|
@@ -261,10 +301,12 @@ def run_iqtree_analysis(aligned_fasta, output_prefix, iqtree_cmd):
|
|
| 261 |
error_msg = result.stderr.strip() if result.stderr else "Unknown IQ-TREE error"
|
| 262 |
logging.error(f"IQ-TREE failed: {error_msg}")
|
| 263 |
return False, f"IQ-TREE error: {error_msg}"
|
| 264 |
-
|
| 265 |
except subprocess.TimeoutExpired:
|
| 266 |
logging.error("IQ-TREE timeout")
|
| 267 |
return False, "IQ-TREE timeout (>20 minutes). Try with fewer sequences or simpler model."
|
|
|
|
|
|
|
|
|
|
| 268 |
except FileNotFoundError:
|
| 269 |
return False, f"IQ-TREE executable not found: {iqtree_cmd}"
|
| 270 |
except Exception as e:
|
|
@@ -274,50 +316,33 @@ def run_iqtree_analysis(aligned_fasta, output_prefix, iqtree_cmd):
|
|
| 274 |
def create_simple_neighbor_joining_tree(sequences_dict):
|
| 275 |
"""Create a simple distance-based tree when ML tools are not available"""
|
| 276 |
try:
|
| 277 |
-
# This is a simplified implementation
|
| 278 |
-
# In a real scenario, you'd want to use a proper NJ implementation
|
| 279 |
import random
|
| 280 |
-
|
| 281 |
seq_names = list(sequences_dict.keys())
|
| 282 |
n_seqs = len(seq_names)
|
| 283 |
-
|
| 284 |
if n_seqs < 2:
|
| 285 |
return None, "Need at least 2 sequences for tree construction"
|
| 286 |
-
|
| 287 |
-
# Create a simple Newick tree structure
|
| 288 |
if n_seqs == 2:
|
| 289 |
tree_str = f"({seq_names[0]}:0.1,{seq_names[1]}:0.1);"
|
| 290 |
else:
|
| 291 |
-
# Simple clustering approach
|
| 292 |
tree_str = "(" + ",".join([f"{name}:0.1" for name in seq_names[:5]]) + ");"
|
| 293 |
-
|
| 294 |
-
# Save to temporary file
|
| 295 |
tree_file = "simple_tree.nwk"
|
| 296 |
with open(tree_file, 'w') as f:
|
| 297 |
f.write(tree_str)
|
| 298 |
-
|
| 299 |
return tree_file, "Simple distance-based tree created"
|
| 300 |
-
|
| 301 |
except Exception as e:
|
| 302 |
return None, f"Simple tree creation failed: {str(e)}"
|
| 303 |
|
| 304 |
def create_multi_fasta_with_query(query_sequence, query_id="Query_F_Gene"):
|
| 305 |
"""Create a multi-FASTA file with query sequence and reference sequences"""
|
| 306 |
try:
|
| 307 |
-
# Create temporary FASTA file
|
| 308 |
temp_fasta = tempfile.NamedTemporaryFile(mode='w', suffix='.fasta', delete=False)
|
| 309 |
-
|
| 310 |
-
# Add query sequence
|
| 311 |
temp_fasta.write(f">{query_id}\n{query_sequence}\n")
|
| 312 |
-
|
| 313 |
-
# Add reference sequences from existing aligned FASTA if available
|
| 314 |
ref_fasta_path = "f_gene_sequences_aligned.fasta"
|
| 315 |
if os.path.exists(ref_fasta_path):
|
| 316 |
with open(ref_fasta_path, 'r') as ref_file:
|
| 317 |
temp_fasta.write(ref_file.read())
|
| 318 |
logging.info(f"Added reference sequences from {ref_fasta_path}")
|
| 319 |
else:
|
| 320 |
-
# If no reference file, try to create from CSV data
|
| 321 |
if analyzer and hasattr(analyzer, 'data'):
|
| 322 |
count = 0
|
| 323 |
for idx, row in analyzer.data.iterrows():
|
|
@@ -326,13 +351,11 @@ def create_multi_fasta_with_query(query_sequence, query_id="Query_F_Gene"):
|
|
| 326 |
sequence = str(row['sequence']).upper()
|
| 327 |
temp_fasta.write(f">{seq_id}\n{sequence}\n")
|
| 328 |
count += 1
|
| 329 |
-
if count >= 20:
|
| 330 |
break
|
| 331 |
logging.info(f"Added {count} reference sequences from CSV")
|
| 332 |
-
|
| 333 |
temp_fasta.close()
|
| 334 |
return temp_fasta.name
|
| 335 |
-
|
| 336 |
except Exception as e:
|
| 337 |
logging.error(f"Failed to create multi-FASTA: {e}")
|
| 338 |
return None
|
|
@@ -340,189 +363,86 @@ def create_multi_fasta_with_query(query_sequence, query_id="Query_F_Gene"):
|
|
| 340 |
def build_maximum_likelihood_tree(f_gene_sequence):
|
| 341 |
"""Build maximum likelihood phylogenetic tree with comprehensive fallback options"""
|
| 342 |
try:
|
| 343 |
-
|
| 344 |
-
mafft_available, iqtree_available, mafft_cmd, iqtree_cmd = check_tool_availability()
|
| 345 |
-
|
| 346 |
-
# Prepare status message
|
| 347 |
status_msg = "🔍 Checking dependencies...\n"
|
| 348 |
-
|
| 349 |
-
if not
|
| 350 |
-
|
| 351 |
-
|
| 352 |
-
|
| 353 |
-
|
| 354 |
-
if not iqtree_available:
|
| 355 |
-
status_msg += "❌ IQ-TREE not found\n"
|
| 356 |
-
else:
|
| 357 |
-
status_msg += f"✅ IQ-TREE found: {iqtree_cmd}\n"
|
| 358 |
-
|
| 359 |
-
# If neither tool is available, provide installation guide
|
| 360 |
-
if not mafft_available and not iqtree_available:
|
| 361 |
-
guide = install_dependencies_guide()
|
| 362 |
-
return False, f"{status_msg}\n{guide}", None, None
|
| 363 |
-
|
| 364 |
-
# If only one tool is missing, provide specific guidance
|
| 365 |
-
if not mafft_available:
|
| 366 |
-
return False, f"{status_msg}\n❌ MAFFT is required for sequence alignment. Please install MAFFT first.", None, None
|
| 367 |
-
|
| 368 |
-
if not iqtree_available:
|
| 369 |
-
status_msg += "\n⚠️ IQ-TREE not available. Attempting simple tree construction...\n"
|
| 370 |
-
|
| 371 |
-
# Try to create a simple tree as fallback
|
| 372 |
-
multi_fasta = create_multi_fasta_with_query(f_gene_sequence)
|
| 373 |
-
if multi_fasta:
|
| 374 |
-
# Read sequences
|
| 375 |
-
sequences = {}
|
| 376 |
-
current_seq = ""
|
| 377 |
-
current_name = ""
|
| 378 |
-
|
| 379 |
-
with open(multi_fasta, 'r') as f:
|
| 380 |
-
for line in f:
|
| 381 |
-
line = line.strip()
|
| 382 |
-
if line.startswith('>'):
|
| 383 |
-
if current_name and current_seq:
|
| 384 |
-
sequences[current_name] = current_seq
|
| 385 |
-
current_name = line[1:]
|
| 386 |
-
current_seq = ""
|
| 387 |
-
else:
|
| 388 |
-
current_seq += line
|
| 389 |
-
if current_name and current_seq:
|
| 390 |
-
sequences[current_name] = current_seq
|
| 391 |
-
|
| 392 |
-
simple_tree, simple_msg = create_simple_neighbor_joining_tree(sequences)
|
| 393 |
-
os.unlink(multi_fasta)
|
| 394 |
-
|
| 395 |
-
if simple_tree:
|
| 396 |
-
return True, f"{status_msg}✅ {simple_msg}", None, simple_tree
|
| 397 |
-
else:
|
| 398 |
-
return False, f"{status_msg}❌ {simple_msg}", None, None
|
| 399 |
-
else:
|
| 400 |
-
return False, f"{status_msg}❌ Failed to create input sequences", None, None
|
| 401 |
-
|
| 402 |
-
# Both tools available - proceed with full ML analysis
|
| 403 |
-
# Create output directory
|
| 404 |
output_dir = "ml_tree_output"
|
| 405 |
os.makedirs(output_dir, exist_ok=True)
|
| 406 |
-
|
| 407 |
-
# Step 1: Create multi-FASTA file with query and reference sequences
|
| 408 |
logging.info("Creating multi-FASTA file...")
|
| 409 |
multi_fasta = create_multi_fasta_with_query(f_gene_sequence)
|
| 410 |
if not multi_fasta:
|
| 411 |
return False, f"{status_msg}❌ Failed to create input FASTA", None, None
|
| 412 |
-
|
| 413 |
-
# Step 2: Run MAFFT alignment
|
| 414 |
logging.info("Running MAFFT alignment...")
|
| 415 |
aligned_fasta = os.path.join(output_dir, "aligned_sequences.fasta")
|
| 416 |
-
mafft_success, mafft_result =
|
| 417 |
-
|
| 418 |
-
# Clean up temporary file
|
| 419 |
os.unlink(multi_fasta)
|
| 420 |
-
|
| 421 |
if not mafft_success:
|
| 422 |
return False, f"{status_msg}❌ MAFFT failed: {mafft_result}", None, None
|
| 423 |
-
|
| 424 |
-
# Step 3: Run IQ-TREE analysis
|
| 425 |
logging.info("Running IQ-TREE analysis...")
|
| 426 |
tree_prefix = os.path.join(output_dir, "ml_tree")
|
| 427 |
iqtree_success, iqtree_result = run_iqtree_analysis(aligned_fasta, tree_prefix, iqtree_cmd)
|
| 428 |
-
|
| 429 |
if not iqtree_success:
|
| 430 |
return False, f"{status_msg}❌ IQ-TREE failed: {iqtree_result}", aligned_fasta, None
|
| 431 |
-
|
| 432 |
-
# Step 4: Prepare output files
|
| 433 |
tree_file = iqtree_result
|
| 434 |
log_file = f"{tree_prefix}.log"
|
| 435 |
-
|
| 436 |
-
# Copy to standard names for compatibility
|
| 437 |
standard_aligned = "f_gene_sequences_aligned.fasta"
|
| 438 |
standard_tree = "f_gene_sequences.phy.treefile"
|
| 439 |
-
|
| 440 |
if os.path.exists(aligned_fasta):
|
| 441 |
shutil.copy2(aligned_fasta, standard_aligned)
|
| 442 |
if os.path.exists(tree_file):
|
| 443 |
shutil.copy2(tree_file, standard_tree)
|
| 444 |
-
|
| 445 |
-
success_msg = f"{status_msg}✅ Maximum likelihood tree built successfully!\n"
|
| 446 |
-
success_msg += f"- Alignment: {os.path.basename(aligned_fasta)}\n"
|
| 447 |
-
success_msg += f"- Tree: {os.path.basename(tree_file)}\n"
|
| 448 |
-
|
| 449 |
if os.path.exists(log_file):
|
| 450 |
try:
|
| 451 |
with open(log_file, 'r') as f:
|
| 452 |
log_content = f.read()
|
| 453 |
-
# Extract model information
|
| 454 |
if "Best-fit model:" in log_content:
|
| 455 |
model_lines = [line for line in log_content.split('\n') if "Best-fit model:" in line]
|
| 456 |
if model_lines:
|
| 457 |
success_msg += f"- {model_lines[0].strip()}\n"
|
| 458 |
except Exception as e:
|
| 459 |
logging.warning(f"Could not read log file: {e}")
|
| 460 |
-
|
| 461 |
logging.info("Maximum likelihood tree construction completed")
|
| 462 |
return True, success_msg, aligned_fasta, tree_file
|
| 463 |
-
|
| 464 |
except Exception as e:
|
| 465 |
logging.error(f"ML tree construction failed: {e}")
|
| 466 |
return False, f"ML tree construction failed: {str(e)}", None, None
|
| 467 |
|
| 468 |
-
# --- Tree Analysis Function (Based on old Gradio API) ---
|
| 469 |
def analyze_sequence_for_tree(sequence: str, matching_percentage: float) -> str:
|
| 470 |
-
"""
|
| 471 |
-
Analyze sequence and create phylogenetic tree using the working Gradio API pattern
|
| 472 |
-
"""
|
| 473 |
try:
|
| 474 |
if not analyzer:
|
| 475 |
return "Error: Tree analyzer not initialized. Please check if the CSV data file is available."
|
| 476 |
-
|
| 477 |
if not sequence:
|
| 478 |
return "Error: Please provide a sequence."
|
| 479 |
-
|
| 480 |
if not (1 <= matching_percentage <= 99):
|
| 481 |
return "Error: Matching percentage must be between 1 and 99."
|
| 482 |
-
|
| 483 |
-
# Find query sequence
|
| 484 |
if not analyzer.find_query_sequence(sequence):
|
| 485 |
return "Error: Invalid query sequence or sequence not found in dataset."
|
| 486 |
-
|
| 487 |
-
# Set matching percentage
|
| 488 |
analyzer.matching_percentage = matching_percentage
|
| 489 |
-
|
| 490 |
-
# Find similar sequences
|
| 491 |
matched_ids, actual_percentage = analyzer.find_similar_sequences(matching_percentage)
|
| 492 |
-
|
| 493 |
if not matched_ids:
|
| 494 |
return f"No similar sequences found at {matching_percentage}% similarity. Try lowering the threshold."
|
| 495 |
-
|
| 496 |
logging.info(f"Found {len(matched_ids)} similar sequences at {actual_percentage:.1f}% similarity")
|
| 497 |
-
|
| 498 |
-
# Build tree structure
|
| 499 |
tree_structure = analyzer.build_tree_structure(matched_ids)
|
| 500 |
if not tree_structure:
|
| 501 |
return "Error: Failed to build tree structure."
|
| 502 |
-
|
| 503 |
-
# Create interactive tree
|
| 504 |
fig = analyzer.create_interactive_tree(matched_ids, actual_percentage)
|
| 505 |
if not fig:
|
| 506 |
return "Error: Failed to create tree visualization."
|
| 507 |
-
|
| 508 |
-
# Generate HTML content
|
| 509 |
html_content = fig.to_html(full_html=True, include_plotlyjs='cdn')
|
| 510 |
-
|
| 511 |
-
# Save to output folder
|
| 512 |
output_dir = "output"
|
| 513 |
os.makedirs(output_dir, exist_ok=True)
|
| 514 |
-
|
| 515 |
-
# Create a safe filename
|
| 516 |
safe_seq_name = re.sub(r'[^a-zA-Z0-9]', '_', sequence[:20])
|
| 517 |
html_filename = os.path.join(output_dir, f"tree_{safe_seq_name}_{matching_percentage}.html")
|
| 518 |
-
|
| 519 |
with open(html_filename, "w", encoding='utf-8') as f:
|
| 520 |
f.write(html_content)
|
| 521 |
-
|
| 522 |
logging.info(f"Tree HTML saved to {html_filename}")
|
| 523 |
-
|
| 524 |
return html_content
|
| 525 |
-
|
| 526 |
except Exception as e:
|
| 527 |
error_msg = f"Tree analysis error: {str(e)}"
|
| 528 |
logging.error(error_msg)
|
|
@@ -530,43 +450,87 @@ def analyze_sequence_for_tree(sequence: str, matching_percentage: float) -> str:
|
|
| 530 |
logging.error(f"Full traceback: {traceback.format_exc()}")
|
| 531 |
return error_msg
|
| 532 |
|
| 533 |
-
# --- Keras Prediction ---
|
| 534 |
def predict_with_keras(sequence):
|
|
|
|
| 535 |
try:
|
| 536 |
if not keras_model or not kmer_to_index:
|
| 537 |
return f"Keras model not available. Input sequence: {sequence[:100]}..."
|
| 538 |
-
|
| 539 |
if len(sequence) < 6:
|
| 540 |
return "Sequence too short for k-mer prediction (minimum 6 nucleotides required)."
|
| 541 |
-
|
| 542 |
-
# Generate k-mers
|
| 543 |
kmers = [sequence[i:i+6] for i in range(len(sequence)-5)]
|
| 544 |
indices = [kmer_to_index.get(kmer, 0) for kmer in kmers]
|
| 545 |
-
|
| 546 |
-
# Prepare input
|
| 547 |
input_arr = np.array([indices])
|
| 548 |
prediction = keras_model.predict(input_arr, verbose=0)[0]
|
| 549 |
-
|
| 550 |
-
# Format prediction as probabilities/scores (not a sequence)
|
| 551 |
result = ''.join([str(round(p, 3)) for p in prediction])
|
| 552 |
return result
|
| 553 |
except Exception as e:
|
| 554 |
logging.error(f"Keras prediction failed: {e}")
|
| 555 |
return f"Keras prediction failed: {str(e)}"
|
| 556 |
|
| 557 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 558 |
def read_fasta_file(file_obj):
|
|
|
|
| 559 |
try:
|
| 560 |
if file_obj is None:
|
| 561 |
return ""
|
| 562 |
-
|
| 563 |
-
# Handle file object
|
| 564 |
if hasattr(file_obj, 'name'):
|
| 565 |
with open(file_obj.name, "r") as f:
|
| 566 |
content = f.read()
|
| 567 |
else:
|
| 568 |
content = file_obj.read().decode("utf-8") if hasattr(file_obj, "read") else str(file_obj)
|
| 569 |
-
|
| 570 |
lines = content.strip().split("\n")
|
| 571 |
seq_lines = [line.strip() for line in lines if not line.startswith(">")]
|
| 572 |
return ''.join(seq_lines)
|
|
@@ -574,86 +538,75 @@ def read_fasta_file(file_obj):
|
|
| 574 |
logging.error(f"Failed to read FASTA file: {e}")
|
| 575 |
return ""
|
| 576 |
|
| 577 |
-
# --- Full Pipeline ---
|
| 578 |
def run_pipeline_from_file(fasta_file_obj, similarity_score, build_ml_tree):
|
|
|
|
| 579 |
try:
|
| 580 |
dna_input = read_fasta_file(fasta_file_obj)
|
| 581 |
if not dna_input:
|
| 582 |
-
return "Failed to read FASTA file", "", "", "", "", None, None, None, "No input sequence"
|
| 583 |
return run_pipeline(dna_input, similarity_score, build_ml_tree)
|
| 584 |
except Exception as e:
|
| 585 |
error_msg = f"Pipeline error: {str(e)}"
|
| 586 |
logging.error(error_msg)
|
| 587 |
-
return error_msg, "", "", "", "", None, None, None, error_msg
|
| 588 |
|
| 589 |
def run_pipeline(dna_input, similarity_score=95.0, build_ml_tree=False):
|
|
|
|
| 590 |
try:
|
| 591 |
-
# Clean input
|
| 592 |
dna_input = dna_input.upper().strip()
|
| 593 |
if not dna_input:
|
| 594 |
-
return "Empty input", "", "", "", "", None, None, None, "No input provided"
|
| 595 |
-
|
| 596 |
-
# Sanitize DNA sequence
|
| 597 |
if not re.match('^[ACTGN]+$', dna_input):
|
| 598 |
dna_input = ''.join(c if c in 'ACTGN' else 'N' for c in dna_input)
|
| 599 |
logging.info("DNA sequence sanitized")
|
| 600 |
|
| 601 |
-
# Step 1: Boundary Prediction
|
| 602 |
-
processed_sequence = dna_input
|
| 603 |
boundary_output = ""
|
| 604 |
-
|
| 605 |
if boundary_model:
|
| 606 |
try:
|
| 607 |
predictions, probs, confidence = boundary_model.predict(dna_input)
|
| 608 |
regions = boundary_model.extract_gene_regions(predictions, dna_input)
|
| 609 |
if regions:
|
| 610 |
-
processed_sequence = regions[0]["sequence"]
|
| 611 |
-
boundary_output = processed_sequence
|
| 612 |
logging.info(f"F gene extracted: {len(processed_sequence)} bp (confidence: {confidence:.3f})")
|
| 613 |
else:
|
| 614 |
boundary_output = f"No F gene regions found in input sequence"
|
| 615 |
-
processed_sequence = dna_input
|
| 616 |
logging.warning("No gene regions found, using full sequence")
|
| 617 |
-
logging.info("Boundary model prediction completed")
|
| 618 |
except Exception as e:
|
| 619 |
logging.error(f"Boundary model failed: {e}")
|
| 620 |
boundary_output = f"Boundary model error: {str(e)}"
|
| 621 |
-
processed_sequence = dna_input # Fall back to original sequence
|
| 622 |
else:
|
| 623 |
boundary_output = f"Boundary model not available. Using original input: {len(dna_input)} bp"
|
| 624 |
-
processed_sequence = dna_input
|
| 625 |
|
| 626 |
-
# Step 2: Keras Prediction
|
| 627 |
keras_output = ""
|
| 628 |
if processed_sequence and len(processed_sequence) >= 6:
|
| 629 |
keras_prediction = predict_with_keras(processed_sequence)
|
| 630 |
-
|
| 631 |
-
if keras_prediction and not keras_prediction.startswith(("Keras", "Sequence too short")):
|
| 632 |
-
# You might want to add logic here to interpret the prediction scores
|
| 633 |
-
# For now, just show the prediction
|
| 634 |
-
keras_output = f"F gene validation scores: {keras_prediction[:100]}..."
|
| 635 |
-
else:
|
| 636 |
-
keras_output = keras_prediction
|
| 637 |
-
else:
|
| 638 |
-
keras_output = "Skipped: sequence too short for F gene validation"
|
| 639 |
|
| 640 |
-
# Step 3:
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 641 |
aligned_file = None
|
| 642 |
phy_file = None
|
| 643 |
ml_tree_output = ""
|
| 644 |
-
|
| 645 |
if build_ml_tree and processed_sequence and len(processed_sequence) >= 50:
|
| 646 |
try:
|
| 647 |
logging.info("Starting maximum likelihood tree construction...")
|
| 648 |
ml_success, ml_message, ml_aligned, ml_tree = build_maximum_likelihood_tree(processed_sequence)
|
| 649 |
-
|
| 650 |
if ml_success:
|
| 651 |
ml_tree_output = ml_message
|
| 652 |
aligned_file = ml_aligned
|
| 653 |
phy_file = ml_tree
|
| 654 |
else:
|
| 655 |
-
ml_tree_output = ml_message
|
| 656 |
-
|
| 657 |
except Exception as e:
|
| 658 |
ml_tree_output = f"❌ ML Tree construction failed: {str(e)}"
|
| 659 |
logging.error(f"ML Tree failed: {e}")
|
|
@@ -662,32 +615,23 @@ def run_pipeline(dna_input, similarity_score=95.0, build_ml_tree=False):
|
|
| 662 |
else:
|
| 663 |
ml_tree_output = "ML tree construction skipped (not requested)"
|
| 664 |
|
| 665 |
-
# Step
|
| 666 |
html_file = None
|
| 667 |
tree_html_content = "No tree generated"
|
| 668 |
simplified_ml_output = ""
|
| 669 |
-
|
| 670 |
if analyzer and processed_sequence and len(processed_sequence) >= 10:
|
| 671 |
try:
|
| 672 |
logging.info(f"Starting simplified ML tree analysis with F gene sequence length: {len(processed_sequence)}")
|
| 673 |
-
|
| 674 |
-
# Use the existing tree analysis function with user-specified similarity
|
| 675 |
tree_result = analyze_sequence_for_tree(processed_sequence, matching_percentage=similarity_score)
|
| 676 |
-
|
| 677 |
if tree_result and not tree_result.startswith("Error:"):
|
| 678 |
-
# Success - we have HTML content
|
| 679 |
tree_html_content = tree_result
|
| 680 |
simplified_ml_output = "✅ Simplified phylogenetic tree generated successfully!"
|
| 681 |
-
|
| 682 |
-
# Check if HTML file was created
|
| 683 |
output_dir = "output"
|
| 684 |
if os.path.exists(output_dir):
|
| 685 |
html_files = [f for f in os.listdir(output_dir) if f.endswith('.html')]
|
| 686 |
if html_files:
|
| 687 |
-
html_file = os.path.join(output_dir, html_files[-1])
|
| 688 |
simplified_ml_output += f"\n- Tree file: {html_files[-1]}"
|
| 689 |
-
|
| 690 |
-
# Count sequences analyzed
|
| 691 |
if analyzer.find_query_sequence(processed_sequence):
|
| 692 |
matched_ids, perc = analyzer.find_similar_sequences(similarity_score)
|
| 693 |
simplified_ml_output += f"\n- {len(matched_ids)} sequences analyzed"
|
|
@@ -695,7 +639,6 @@ def run_pipeline(dna_input, similarity_score=95.0, build_ml_tree=False):
|
|
| 695 |
else:
|
| 696 |
simplified_ml_output = f"❌ Simplified ML tree failed: {tree_result}"
|
| 697 |
tree_html_content = f"<p>Error: {tree_result}</p>"
|
| 698 |
-
|
| 699 |
except Exception as e:
|
| 700 |
logging.error(f"Simplified ML tree analysis failed: {e}")
|
| 701 |
simplified_ml_output = f"❌ Simplified ML tree analysis failed: {str(e)}"
|
|
@@ -708,264 +651,141 @@ def run_pipeline(dna_input, similarity_score=95.0, build_ml_tree=False):
|
|
| 708 |
|
| 709 |
# Return all results
|
| 710 |
return (
|
| 711 |
-
boundary_output,
|
| 712 |
-
keras_output,
|
| 713 |
-
|
| 714 |
-
|
| 715 |
-
|
| 716 |
-
|
| 717 |
-
|
| 718 |
-
|
| 719 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
| 720 |
)
|
| 721 |
-
|
| 722 |
except Exception as e:
|
| 723 |
error_msg = f"Pipeline execution failed: {str(e)}"
|
| 724 |
logging.error(error_msg)
|
| 725 |
import traceback
|
| 726 |
logging.error(f"Full traceback: {traceback.format_exc()}")
|
| 727 |
return (
|
| 728 |
-
error_msg, "", "", "", f"<p>Error: {error_msg}</p>",
|
| 729 |
None, None, None, error_msg
|
| 730 |
)
|
| 731 |
|
| 732 |
# --- Gradio Interface ---
|
| 733 |
def create_interface():
|
| 734 |
"""Create the Gradio interface with enhanced layout and features"""
|
| 735 |
-
|
| 736 |
-
# Custom CSS for better styling
|
| 737 |
custom_css = """
|
| 738 |
-
.gradio-container {
|
| 739 |
-
|
| 740 |
-
}
|
| 741 |
-
.tab-nav button {
|
| 742 |
-
font-size: 16px !important;
|
| 743 |
-
}
|
| 744 |
-
.output-html {
|
| 745 |
-
height: 600px !important;
|
| 746 |
-
overflow: auto;
|
| 747 |
-
}
|
| 748 |
"""
|
| 749 |
-
|
| 750 |
with gr.Blocks(css=custom_css, title="F Gene Analysis Pipeline") as iface:
|
| 751 |
gr.Markdown("""
|
| 752 |
# 🧬 F Gene Analysis Pipeline
|
| 753 |
|
| 754 |
This tool provides comprehensive analysis of F genes including:
|
| 755 |
-
- **Gene Boundary Detection**: Extract F gene sequences
|
| 756 |
-
- **Gene Validation**: Validate
|
| 757 |
-
- **
|
|
|
|
| 758 |
|
| 759 |
**Instructions:**
|
| 760 |
-
1. Enter your sequence
|
| 761 |
-
2. Adjust similarity threshold
|
| 762 |
-
3. Choose whether to build
|
| 763 |
-
4. Click "Run Analysis" to start
|
| 764 |
""")
|
| 765 |
|
| 766 |
with gr.Tab("🔬 Analysis Pipeline"):
|
| 767 |
with gr.Row():
|
| 768 |
with gr.Column(scale=2):
|
| 769 |
-
# Input section
|
| 770 |
gr.Markdown("### Input Sequence")
|
| 771 |
-
dna_input = gr.Textbox(
|
| 772 |
-
|
| 773 |
-
placeholder="Enter your DNA sequence here (ATCG format)...",
|
| 774 |
-
lines=5,
|
| 775 |
-
max_lines=10
|
| 776 |
-
)
|
| 777 |
-
|
| 778 |
-
fasta_file = gr.File(
|
| 779 |
-
label="Or Upload FASTA File",
|
| 780 |
-
file_types=[".fasta", ".fa", ".fas", ".txt"]
|
| 781 |
-
)
|
| 782 |
-
|
| 783 |
with gr.Row():
|
| 784 |
-
similarity_score = gr.Slider(
|
| 785 |
-
|
| 786 |
-
maximum=99,
|
| 787 |
-
value=95.0,
|
| 788 |
-
step=1.0,
|
| 789 |
-
label="Similarity Threshold (%)",
|
| 790 |
-
info="Minimum similarity for phylogenetic analysis"
|
| 791 |
-
)
|
| 792 |
-
|
| 793 |
-
build_ml_tree = gr.Checkbox(
|
| 794 |
-
label="Build ML Tree",
|
| 795 |
-
value=False,
|
| 796 |
-
info="Build maximum likelihood tree (requires MAFFT & IQ-TREE)"
|
| 797 |
-
)
|
| 798 |
-
|
| 799 |
-
# Action buttons
|
| 800 |
with gr.Row():
|
| 801 |
run_btn = gr.Button("🚀 Run Analysis", variant="primary", size="lg")
|
| 802 |
clear_btn = gr.Button("🗑️ Clear", variant="secondary")
|
| 803 |
-
|
| 804 |
with gr.Column(scale=1):
|
| 805 |
-
# Status and info
|
| 806 |
gr.Markdown("### Analysis Status")
|
| 807 |
-
status_display = gr.Textbox(
|
| 808 |
-
label="Status",
|
| 809 |
-
value="Ready to analyze",
|
| 810 |
-
interactive=False,
|
| 811 |
-
lines=3
|
| 812 |
-
)
|
| 813 |
-
|
| 814 |
-
# Model status
|
| 815 |
gr.Markdown("### Available Models")
|
| 816 |
model_status = []
|
| 817 |
if boundary_model:
|
| 818 |
model_status.append("✅ Boundary Detection Model")
|
| 819 |
else:
|
| 820 |
model_status.append("❌ Boundary Detection Model")
|
| 821 |
-
|
| 822 |
if keras_model:
|
| 823 |
model_status.append("✅ Gene Validation Model")
|
| 824 |
else:
|
| 825 |
model_status.append("❌ Gene Validation Model")
|
| 826 |
-
|
|
|
|
|
|
|
|
|
|
| 827 |
if analyzer:
|
| 828 |
model_status.append("✅ Tree Analysis Module")
|
| 829 |
else:
|
| 830 |
model_status.append("❌ Tree Analysis Module")
|
| 831 |
-
|
| 832 |
gr.Markdown("\n".join(model_status))
|
| 833 |
|
| 834 |
with gr.Tab("📊 Results"):
|
| 835 |
with gr.Row():
|
| 836 |
with gr.Column():
|
| 837 |
-
|
| 838 |
-
|
| 839 |
-
|
| 840 |
-
|
| 841 |
-
|
| 842 |
-
)
|
| 843 |
-
|
| 844 |
-
keras_output = gr.Textbox(
|
| 845 |
-
label="🔍 Gene Validation",
|
| 846 |
-
lines=3,
|
| 847 |
-
interactive=False
|
| 848 |
-
)
|
| 849 |
-
|
| 850 |
with gr.Column():
|
| 851 |
-
ml_tree_output = gr.Textbox(
|
| 852 |
-
|
| 853 |
-
lines=5,
|
| 854 |
-
interactive=False
|
| 855 |
-
)
|
| 856 |
-
|
| 857 |
-
simplified_ml_output = gr.Textbox(
|
| 858 |
-
label="📈 Simplified Phylogenetic Analysis",
|
| 859 |
-
lines=3,
|
| 860 |
-
interactive=False
|
| 861 |
-
)
|
| 862 |
-
|
| 863 |
-
# Tree visualization
|
| 864 |
gr.Markdown("### 🌲 Phylogenetic Tree Visualization")
|
| 865 |
-
tree_html = gr.HTML(
|
| 866 |
-
label="Interactive Tree",
|
| 867 |
-
value="<p>No tree generated yet. Run analysis to see results.</p>"
|
| 868 |
-
)
|
| 869 |
-
|
| 870 |
-
# File downloads
|
| 871 |
gr.Markdown("### 📁 Download Results")
|
| 872 |
with gr.Row():
|
| 873 |
-
aligned_file = gr.File(
|
| 874 |
-
|
| 875 |
-
|
| 876 |
-
)
|
| 877 |
-
|
| 878 |
-
phy_file = gr.File(
|
| 879 |
-
label="Phylogenetic Tree File",
|
| 880 |
-
interactive=False
|
| 881 |
-
)
|
| 882 |
-
|
| 883 |
-
html_file = gr.File(
|
| 884 |
-
label="Interactive Tree (HTML)",
|
| 885 |
-
interactive=False
|
| 886 |
-
)
|
| 887 |
|
| 888 |
with gr.Tab("ℹ️ Help & Info"):
|
| 889 |
gr.Markdown("""
|
| 890 |
## About This Tool
|
| 891 |
|
| 892 |
### F Gene Analysis Pipeline
|
| 893 |
-
|
| 894 |
-
|
| 895 |
-
|
| 896 |
-
-
|
| 897 |
-
- Provides confidence scores for detected boundaries
|
| 898 |
-
- Automatically trims sequences to focus on the F gene region
|
| 899 |
-
|
| 900 |
-
#### 🔍 Gene Validation
|
| 901 |
-
- Employs k-mer based machine learning models to validate extracted sequences
|
| 902 |
-
- Provides probability scores indicating likelihood of being a genuine F gene
|
| 903 |
-
- Uses 6-mer frequency patterns for classification
|
| 904 |
-
|
| 905 |
-
#### 🌳 Phylogenetic Analysis
|
| 906 |
-
|
| 907 |
-
**Maximum Likelihood Trees:**
|
| 908 |
-
- Requires MAFFT (sequence alignment) and IQ-TREE (phylogenetic reconstruction)
|
| 909 |
-
- Performs model selection and bootstrap analysis
|
| 910 |
-
- Generates publication-quality phylogenetic trees
|
| 911 |
-
- Provides detailed evolutionary analysis
|
| 912 |
-
|
| 913 |
-
**Simplified Trees:**
|
| 914 |
-
- Uses built-in algorithms for quick phylogenetic analysis
|
| 915 |
-
- Interactive visualization with similarity-based clustering
|
| 916 |
-
- Faster alternative when external tools are not available
|
| 917 |
|
| 918 |
### Input Requirements
|
| 919 |
-
-
|
| 920 |
-
-
|
| 921 |
-
-
|
| 922 |
|
| 923 |
### Dependencies
|
| 924 |
-
|
| 925 |
-
**Required for ML Trees:**
|
| 926 |
```bash
|
| 927 |
-
# Ubuntu/Debian
|
| 928 |
-
|
| 929 |
-
|
| 930 |
-
# macOS
|
| 931 |
-
brew install mafft iqtree
|
| 932 |
-
|
| 933 |
-
# Conda
|
| 934 |
-
conda install -c bioconda mafft iqtree
|
| 935 |
```
|
| 936 |
|
| 937 |
-
### Output Files
|
| 938 |
-
- **Aligned FASTA**: Multiple sequence alignment in FASTA format
|
| 939 |
-
- **Tree File**: Newick format phylogenetic tree
|
| 940 |
-
- **HTML Tree**: Interactive visualization for web browsers
|
| 941 |
-
|
| 942 |
### Troubleshooting
|
| 943 |
-
|
| 944 |
-
*
|
| 945 |
-
- *"
|
| 946 |
-
- *"
|
| 947 |
-
- *"MAFFT/IQ-TREE not found"*: Install required dependencies
|
| 948 |
-
- *"Model not available"*: Check model files are properly downloaded
|
| 949 |
-
|
| 950 |
-
**Performance Tips:**
|
| 951 |
-
- Use sequences between 100-2000 bp for optimal performance
|
| 952 |
-
- Limit to <50 sequences for faster tree construction
|
| 953 |
-
- Lower similarity thresholds find more distant relatives
|
| 954 |
-
- Higher thresholds focus on closely related sequences
|
| 955 |
-
|
| 956 |
-
### Citation
|
| 957 |
-
If you use this tool in your research, please cite the appropriate methods and tools used.
|
| 958 |
""")
|
| 959 |
|
| 960 |
-
# Event handlers
|
| 961 |
-
def run_analysis_text(dna_seq, sim_score, build_tree):
|
| 962 |
-
return run_pipeline(dna_seq, sim_score, build_tree)
|
| 963 |
-
|
| 964 |
-
def run_analysis_file(file_obj, sim_score, build_tree):
|
| 965 |
-
return run_pipeline_from_file(file_obj, sim_score, build_tree)
|
| 966 |
-
|
| 967 |
def run_analysis_combined(dna_seq, file_obj, sim_score, build_tree):
|
| 968 |
-
# Priority: file upload over text input
|
| 969 |
if file_obj is not None:
|
| 970 |
return run_pipeline_from_file(file_obj, sim_score, build_tree)
|
| 971 |
else:
|
|
@@ -974,51 +794,39 @@ def create_interface():
|
|
| 974 |
def clear_inputs():
|
| 975 |
return "", None, 95.0, False, "Ready to analyze"
|
| 976 |
|
| 977 |
-
# Connect events
|
| 978 |
run_btn.click(
|
| 979 |
fn=run_analysis_combined,
|
| 980 |
inputs=[dna_input, fasta_file, similarity_score, build_ml_tree],
|
| 981 |
outputs=[
|
| 982 |
-
boundary_output, keras_output,
|
| 983 |
-
|
| 984 |
-
phy_file, html_file, status_display
|
| 985 |
]
|
| 986 |
)
|
| 987 |
-
|
| 988 |
clear_btn.click(
|
| 989 |
fn=clear_inputs,
|
| 990 |
outputs=[dna_input, fasta_file, similarity_score, build_ml_tree, status_display]
|
| 991 |
)
|
| 992 |
|
| 993 |
-
# Example data loading
|
| 994 |
-
gr.Markdown("### 🧪 Example Data")
|
| 995 |
example_btn = gr.Button("Load Example F Gene Sequence", variant="secondary")
|
| 996 |
-
|
| 997 |
def load_example():
|
| 998 |
example_seq = "ATGAAACTGTCAACACTCACTGAGTACATTAGCCAAGTTCTCAAGACTGAGTGTTTACCTTTGTGAATACACTGAGTCCTTGTCAACGTTCGGCTGCAGTCACACTGATGGTCTTGTCTTCAGGAGCAACTGCAGTCTGTGCTGTGTACTATAGTGCTAAGAGTGATAATGCACTGTTCAGTACCTTTGACAGTGTGTCTCTGTCACCTGGTGCTATGCAGAGCTGCGATGAGATCTACATTGGTCTGATCGATAAGACTGAGTCCAAGGGTGTTGCTGTGTGTACTGTAGAGTGTGATAGTGTTGCCTGCACTGTGTCTATGGCTGATCTTGAGGCTCTGCTTATGTCAACACTGAGTGTGAAATGTTCATTTGCTACTTCAAGACTGATGTGAAGACTGTGTATTGTACTCAGTCATGCAGAGTGAAGTCCTTGAGCCACTTGCTTTGTACAATGTGGGTGATGAGATGTTGTGCTGCAGTGTCAAGGGGCCACAGTCTTGCCTTGATAGTGCGATTGCTGTGATGATGTGCACTTCAATGAGTGGTCGAGATGCTGCTGTGTGTAAGGATGCTGCTGTGTGTAAGAAGGATGCTGCTGTGTGTAAGA"
|
| 999 |
return example_seq, "Example F gene sequence loaded"
|
| 1000 |
-
|
| 1001 |
-
example_btn.click(
|
| 1002 |
-
fn=load_example,
|
| 1003 |
-
outputs=[dna_input, status_display]
|
| 1004 |
-
)
|
| 1005 |
|
| 1006 |
return iface
|
| 1007 |
|
| 1008 |
# --- Main Execution ---
|
| 1009 |
if __name__ == "__main__":
|
| 1010 |
-
# Initialize and launch interface
|
| 1011 |
interface = create_interface()
|
| 1012 |
-
|
| 1013 |
-
# Launch with enhanced configuration
|
| 1014 |
interface.launch(
|
| 1015 |
-
server_name="0.0.0.0",
|
| 1016 |
-
server_port=7860,
|
| 1017 |
-
share=False,
|
| 1018 |
-
debug=True,
|
| 1019 |
-
show_error=True,
|
| 1020 |
-
max_threads=4,
|
| 1021 |
-
auth=None,
|
| 1022 |
-
ssl_verify=False,
|
| 1023 |
-
quiet=False
|
| 1024 |
)
|
|
|
|
| 13 |
import ml_simplified_tree
|
| 14 |
import tempfile
|
| 15 |
import shutil
|
| 16 |
+
import stat
|
| 17 |
from pathlib import Path
|
| 18 |
+
from huggingface_hub import hf_hub_download
|
| 19 |
+
from tensorflow.keras.preprocessing.sequence import pad_sequences
|
| 20 |
|
| 21 |
# --- Global Variables ---
|
| 22 |
MAFFT_PATH = "mafft/mafftdir/bin/mafft" # Update this path as needed
|
|
|
|
| 26 |
logging.basicConfig(level=logging.INFO, format='%(asctime)s - %(levelname)s - %(message)s')
|
| 27 |
|
| 28 |
# --- Paths ---
|
|
|
|
|
|
|
| 29 |
# Model repository and file paths
|
| 30 |
model_repo = "GGproject10/best_boundary_aware_model"
|
| 31 |
csv_path = "f cleaned.csv"
|
| 32 |
+
classifier_model_dir = "model" # Directory for second model files
|
| 33 |
|
| 34 |
# Get HF token from environment (if available)
|
| 35 |
hf_token = os.getenv("HF_TOKEN")
|
|
|
|
| 38 |
boundary_model = None
|
| 39 |
keras_model = None
|
| 40 |
kmer_to_index = None
|
| 41 |
+
classifier_model = None
|
| 42 |
+
classifier_kmer_to_index = None
|
| 43 |
+
classifier_maxlen = None
|
| 44 |
|
| 45 |
# Try to load boundary model from Hugging Face Hub
|
| 46 |
try:
|
| 47 |
+
boundary_path = hf_hub_download(repo_id=model_repo, filename="best_boundary_aware_model.pth", token=hf_token)
|
|
|
|
|
|
|
|
|
|
|
|
|
| 48 |
if os.path.exists(boundary_path):
|
| 49 |
boundary_model = GenePredictor(boundary_path)
|
| 50 |
logging.info("Boundary model loaded successfully from Hugging Face Hub.")
|
|
|
|
| 55 |
|
| 56 |
# Try to load Keras model from Hugging Face Hub
|
| 57 |
try:
|
| 58 |
+
keras_path = hf_hub_download(repo_id=model_repo, filename="best_model.keras", token=hf_token)
|
| 59 |
+
kmer_path = hf_hub_download(repo_id=model_repo, filename="kmer_to_index.pkl", token=hf_token)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 60 |
if os.path.exists(keras_path) and os.path.exists(kmer_path):
|
| 61 |
keras_model = load_model(keras_path)
|
| 62 |
with open(kmer_path, "rb") as f:
|
|
|
|
| 67 |
except Exception as e:
|
| 68 |
logging.error(f"Failed to load Keras model from HF Hub: {e}")
|
| 69 |
|
| 70 |
+
# Try to load classifier model (second model)
|
| 71 |
+
os.environ["TF_CPP_MIN_LOG_LEVEL"] = "3"
|
| 72 |
+
try:
|
| 73 |
+
classifier_path = os.path.join(classifier_model_dir, "best_model.keras")
|
| 74 |
+
classifier_kmer_path = os.path.join(classifier_model_dir, "kmer_to_index.pkl")
|
| 75 |
+
classifier_maxlen_path = os.path.join(classifier_model_dir, "maxlen.txt")
|
| 76 |
+
if os.path.exists(classifier_path) and os.path.exists(classifier_kmer_path) and os.path.exists(classifier_maxlen_path):
|
| 77 |
+
classifier_model = load_model(classifier_path)
|
| 78 |
+
with open(classifier_kmer_path, "rb") as f:
|
| 79 |
+
classifier_kmer_to_index = pickle.load(f)
|
| 80 |
+
with open(classifier_maxlen_path, "r") as f:
|
| 81 |
+
classifier_maxlen = int(f.read().strip())
|
| 82 |
+
logging.info("Classifier model loaded successfully.")
|
| 83 |
+
else:
|
| 84 |
+
logging.warning(f"Classifier model files not found in {classifier_model_dir}")
|
| 85 |
+
except Exception as e:
|
| 86 |
+
logging.error(f"Failed to load classifier model: {e}")
|
| 87 |
+
|
| 88 |
+
LABELS = ["Random", "F", "P", "N", "M", "HN", "L"]
|
| 89 |
+
|
| 90 |
# --- Initialize Tree Analyzer ---
|
| 91 |
analyzer = None
|
| 92 |
try:
|
|
|
|
| 94 |
if os.path.exists(csv_path):
|
| 95 |
if analyzer.load_data(csv_path):
|
| 96 |
logging.info("Tree analyzer initialized successfully")
|
|
|
|
| 97 |
try:
|
| 98 |
if not analyzer.train_ai_model():
|
| 99 |
logging.warning("AI model training failed; proceeding with basic analysis.")
|
|
|
|
| 110 |
analyzer = None
|
| 111 |
|
| 112 |
# --- Enhanced Tool Detection ---
|
| 113 |
+
def check_and_fix_executable_permissions(filepath):
|
| 114 |
+
"""Check and fix executable permissions for a file"""
|
| 115 |
+
try:
|
| 116 |
+
if os.path.exists(filepath):
|
| 117 |
+
if not os.access(filepath, os.X_OK):
|
| 118 |
+
logging.info(f"File {filepath} is not executable, attempting to fix permissions...")
|
| 119 |
+
current_permissions = os.stat(filepath).st_mode
|
| 120 |
+
os.chmod(filepath, current_permissions | stat.S_IEXEC | stat.S_IXUSR | stat.S_IXGRP)
|
| 121 |
+
logging.info(f"Fixed permissions for {filepath}")
|
| 122 |
+
return True
|
| 123 |
+
return True
|
| 124 |
+
return False
|
| 125 |
+
except Exception as e:
|
| 126 |
+
logging.error(f"Failed to fix permissions for {filepath}: {e}")
|
| 127 |
+
return False
|
| 128 |
+
|
| 129 |
+
def enhanced_check_tool_availability():
|
| 130 |
+
"""Enhanced check for MAFFT and IQ-TREE availability with permission fixing"""
|
| 131 |
mafft_available = False
|
| 132 |
mafft_cmd = None
|
|
|
|
|
|
|
| 133 |
mafft_candidates = [
|
| 134 |
MAFFT_PATH,
|
| 135 |
'mafft',
|
| 136 |
'/usr/bin/mafft',
|
| 137 |
'/usr/local/bin/mafft',
|
| 138 |
+
'/opt/homebrew/bin/mafft',
|
| 139 |
+
'/usr/local/homebrew/bin/mafft',
|
| 140 |
+
'mafft.bat',
|
| 141 |
]
|
|
|
|
| 142 |
for candidate in mafft_candidates:
|
| 143 |
+
if candidate and os.path.exists(candidate):
|
| 144 |
+
if "/" in candidate and not candidate.startswith("/usr/") and not candidate.startswith("/opt/"):
|
| 145 |
+
check_and_fix_executable_permissions(candidate)
|
| 146 |
+
if os.access(candidate, os.X_OK) or shutil.which(candidate) is not None:
|
| 147 |
+
mafft_available = True
|
| 148 |
+
mafft_cmd = candidate
|
| 149 |
+
logging.info(f"Found MAFFT at: {candidate}")
|
| 150 |
+
break
|
| 151 |
+
elif candidate and shutil.which(candidate) is not None:
|
| 152 |
mafft_available = True
|
| 153 |
mafft_cmd = candidate
|
| 154 |
+
logging.info(f"Found MAFFT in PATH: {candidate}")
|
| 155 |
break
|
| 156 |
+
|
|
|
|
| 157 |
iqtree_available = False
|
| 158 |
iqtree_cmd = None
|
|
|
|
|
|
|
| 159 |
iqtree_candidates = [
|
| 160 |
IQTREE_PATH,
|
| 161 |
'iqtree2',
|
|
|
|
| 164 |
'/usr/local/bin/iqtree2',
|
| 165 |
'/usr/bin/iqtree',
|
| 166 |
'/usr/local/bin/iqtree',
|
| 167 |
+
'/opt/homebrew/bin/iqtree2',
|
| 168 |
+
'iqtree2.exe',
|
| 169 |
+
'iqtree.exe',
|
| 170 |
]
|
|
|
|
| 171 |
for candidate in iqtree_candidates:
|
| 172 |
+
if candidate and os.path.exists(candidate):
|
| 173 |
+
if "/" in candidate and not candidate.startswith("/usr/") and not candidate.startswith("/opt/"):
|
| 174 |
+
check_and_fix_executable_permissions(candidate)
|
| 175 |
+
if os.access(candidate, os.X_OK) or shutil.which(candidate) is not None:
|
| 176 |
+
iqtree_available = True
|
| 177 |
+
iqtree_cmd = candidate
|
| 178 |
+
logging.info(f"Found IQ-TREE at: {candidate}")
|
| 179 |
+
break
|
| 180 |
+
elif candidate and shutil.which(candidate) is not None:
|
| 181 |
iqtree_available = True
|
| 182 |
iqtree_cmd = candidate
|
| 183 |
+
logging.info(f"Found IQ-TREE in PATH: {candidate}")
|
| 184 |
break
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 185 |
|
| 186 |
+
return mafft_available, iqtree_available, mafft_cmd, iqtree_cmd
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 187 |
|
| 188 |
+
def get_installation_instructions():
|
| 189 |
+
"""Get detailed installation instructions based on the current system"""
|
| 190 |
+
import platform
|
| 191 |
+
system = platform.system().lower()
|
| 192 |
+
if system == "linux":
|
| 193 |
+
try:
|
| 194 |
+
with open('/etc/os-release', 'r') as f:
|
| 195 |
+
os_info = f.read().lower()
|
| 196 |
+
if 'ubuntu' in os_info or 'debian' in os_info:
|
| 197 |
+
return """
|
| 198 |
+
📦 INSTALLATION INSTRUCTIONS (Ubuntu/Debian):
|
| 199 |
+
1. Update package list: sudo apt-get update
|
| 200 |
+
2. Install MAFFT and IQ-TREE: sudo apt-get install mafft iqtree
|
| 201 |
+
3. Verify installation: mafft --version, iqtree2 --version
|
| 202 |
+
Alternative using Conda: conda install -c bioconda mafft iqtree
|
| 203 |
+
"""
|
| 204 |
+
elif 'centos' in os_info or 'rhel' in os_info or 'fedora' in os_info:
|
| 205 |
+
return """
|
| 206 |
+
📦 INSTALLATION INSTRUCTIONS (CentOS/RHEL/Fedora):
|
| 207 |
+
1. Install EPEL repository (CentOS/RHEL): sudo yum install epel-release
|
| 208 |
+
2. Install packages: sudo yum install mafft iqtree
|
| 209 |
+
3. Verify installation: mafft --version, iqtree2 --version
|
| 210 |
+
"""
|
| 211 |
+
except:
|
| 212 |
+
pass
|
| 213 |
+
elif system == "darwin":
|
| 214 |
+
return """
|
| 215 |
+
📦 INSTALLATION INSTRUCTIONS (macOS):
|
| 216 |
+
Using Homebrew: 1. Install Homebrew: /bin/bash -c "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/HEAD/install.sh)"
|
| 217 |
+
2. Install MAFFT and IQ-TREE: brew install mafft iqtree
|
| 218 |
+
3. Verify installation: mafft --version, iqtree2 --version
|
| 219 |
+
Using Conda: conda install -c bioconda mafft iqtree
|
| 220 |
+
"""
|
| 221 |
+
elif system == "windows":
|
| 222 |
+
return """
|
| 223 |
+
📦 INSTALLATION INSTRUCTIONS (Windows):
|
| 224 |
+
Option 1 - Using Conda: 1. Install Miniconda 2. Run: conda install -c bioconda mafft iqtree
|
| 225 |
+
Option 2 - Manual: 1. Download MAFFT: https://mafft.cbrc.jp/alignment/software/
|
| 226 |
+
2. Download IQ-TREE: http://www.iqtree.org/
|
| 227 |
+
3. Add to PATH
|
| 228 |
+
"""
|
| 229 |
+
return """
|
| 230 |
+
📦 GENERAL INSTALLATION INSTRUCTIONS:
|
| 231 |
+
Using Conda: 1. Install Miniconda 2. Run: conda install -c bioconda mafft iqtree
|
| 232 |
+
Manual: 1. MAFFT: https://mafft.cbrc.jp/alignment/software/
|
| 233 |
+
2. IQ-TREE: http://www.iqtree.org/
|
| 234 |
"""
|
|
|
|
| 235 |
|
| 236 |
+
def run_mafft_alignment_improved(input_fasta, output_fasta, mafft_cmd):
|
| 237 |
+
"""Run MAFFT alignment with improved permission and error handling"""
|
| 238 |
try:
|
| 239 |
+
if not os.access(mafft_cmd, os.X_OK):
|
| 240 |
+
logging.warning(f"MAFFT executable {mafft_cmd} is not executable")
|
| 241 |
+
if not check_and_fix_executable_permissions(mafft_cmd):
|
| 242 |
+
return False, f"Cannot make {mafft_cmd} executable"
|
| 243 |
+
try:
|
| 244 |
+
test_result = subprocess.run([mafft_cmd, '--version'], capture_output=True, text=True, timeout=10)
|
| 245 |
+
if test_result.returncode != 0:
|
| 246 |
+
return False, f"MAFFT version check failed: {test_result.stderr}"
|
| 247 |
+
except Exception as e:
|
| 248 |
+
return False, f"MAFFT version check failed: {str(e)}"
|
| 249 |
+
cmd = [mafft_cmd, '--auto', '--quiet', '--thread', '2', input_fasta]
|
| 250 |
logging.info(f"Running MAFFT: {' '.join(cmd)}")
|
| 251 |
+
result = subprocess.run(cmd, capture_output=True, text=True, timeout=600, cwd=os.getcwd())
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 252 |
if result.returncode == 0:
|
|
|
|
| 253 |
with open(output_fasta, 'w') as f:
|
| 254 |
f.write(result.stdout)
|
| 255 |
logging.info(f"MAFFT alignment completed: {output_fasta}")
|
|
|
|
|
|
|
| 256 |
if os.path.exists(output_fasta) and os.path.getsize(output_fasta) > 0:
|
| 257 |
return True, output_fasta
|
| 258 |
else:
|
|
|
|
| 261 |
error_msg = result.stderr.strip() if result.stderr else "Unknown MAFFT error"
|
| 262 |
logging.error(f"MAFFT failed: {error_msg}")
|
| 263 |
return False, f"MAFFT error: {error_msg}"
|
|
|
|
| 264 |
except subprocess.TimeoutExpired:
|
| 265 |
logging.error("MAFFT timeout")
|
| 266 |
return False, "MAFFT timeout (>10 minutes). Try with fewer sequences."
|
| 267 |
+
except PermissionError as e:
|
| 268 |
+
logging.error(f"Permission error running MAFFT: {e}")
|
| 269 |
+
return False, f"Permission denied: {mafft_cmd}. Please check file permissions."
|
| 270 |
except FileNotFoundError:
|
| 271 |
return False, f"MAFFT executable not found: {mafft_cmd}"
|
| 272 |
except Exception as e:
|
|
|
|
| 276 |
def run_iqtree_analysis(aligned_fasta, output_prefix, iqtree_cmd):
|
| 277 |
"""Run IQ-TREE with enhanced options and error handling"""
|
| 278 |
try:
|
| 279 |
+
if not os.access(iqtree_cmd, os.X_OK):
|
| 280 |
+
logging.warning(f"IQ-TREE executable {iqtree_cmd} is not executable")
|
| 281 |
+
if not check_and_fix_executable_permissions(iqtree_cmd):
|
| 282 |
+
return False, f"Cannot make {iqtree_cmd} executable"
|
| 283 |
+
try:
|
| 284 |
+
test_result = subprocess.run([iqtree_cmd, '--version'], capture_output=True, text=True, timeout=10)
|
| 285 |
+
if test_result.returncode != 0:
|
| 286 |
+
return False, f"IQ-TREE version check failed: {test_result.stderr}"
|
| 287 |
+
except Exception as e:
|
| 288 |
+
return False, f"IQ-TREE version check failed: {str(e)}"
|
| 289 |
+
cmd = [iqtree_cmd, '-s', aligned_fasta, '-m', 'MFP', '-bb', '1000', '-alrt', '1000', '-nt', 'AUTO', '--prefix', output_prefix, '-redo', '--quiet']
|
|
|
|
|
|
|
| 290 |
logging.info(f"Running IQ-TREE: {' '.join(cmd)}")
|
| 291 |
+
result = subprocess.run(cmd, capture_output=True, text=True, timeout=1200, cwd=os.getcwd())
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 292 |
if result.returncode == 0:
|
| 293 |
tree_file = f"{output_prefix}.treefile"
|
| 294 |
if os.path.exists(tree_file) and os.path.getsize(tree_file) > 0:
|
|
|
|
| 301 |
error_msg = result.stderr.strip() if result.stderr else "Unknown IQ-TREE error"
|
| 302 |
logging.error(f"IQ-TREE failed: {error_msg}")
|
| 303 |
return False, f"IQ-TREE error: {error_msg}"
|
|
|
|
| 304 |
except subprocess.TimeoutExpired:
|
| 305 |
logging.error("IQ-TREE timeout")
|
| 306 |
return False, "IQ-TREE timeout (>20 minutes). Try with fewer sequences or simpler model."
|
| 307 |
+
except PermissionError as e:
|
| 308 |
+
logging.error(f"Permission error running IQ-TREE: {e}")
|
| 309 |
+
return False, f"Permission denied: {iqtree_cmd}. Please check file permissions."
|
| 310 |
except FileNotFoundError:
|
| 311 |
return False, f"IQ-TREE executable not found: {iqtree_cmd}"
|
| 312 |
except Exception as e:
|
|
|
|
| 316 |
def create_simple_neighbor_joining_tree(sequences_dict):
|
| 317 |
"""Create a simple distance-based tree when ML tools are not available"""
|
| 318 |
try:
|
|
|
|
|
|
|
| 319 |
import random
|
|
|
|
| 320 |
seq_names = list(sequences_dict.keys())
|
| 321 |
n_seqs = len(seq_names)
|
|
|
|
| 322 |
if n_seqs < 2:
|
| 323 |
return None, "Need at least 2 sequences for tree construction"
|
|
|
|
|
|
|
| 324 |
if n_seqs == 2:
|
| 325 |
tree_str = f"({seq_names[0]}:0.1,{seq_names[1]}:0.1);"
|
| 326 |
else:
|
|
|
|
| 327 |
tree_str = "(" + ",".join([f"{name}:0.1" for name in seq_names[:5]]) + ");"
|
|
|
|
|
|
|
| 328 |
tree_file = "simple_tree.nwk"
|
| 329 |
with open(tree_file, 'w') as f:
|
| 330 |
f.write(tree_str)
|
|
|
|
| 331 |
return tree_file, "Simple distance-based tree created"
|
|
|
|
| 332 |
except Exception as e:
|
| 333 |
return None, f"Simple tree creation failed: {str(e)}"
|
| 334 |
|
| 335 |
def create_multi_fasta_with_query(query_sequence, query_id="Query_F_Gene"):
|
| 336 |
"""Create a multi-FASTA file with query sequence and reference sequences"""
|
| 337 |
try:
|
|
|
|
| 338 |
temp_fasta = tempfile.NamedTemporaryFile(mode='w', suffix='.fasta', delete=False)
|
|
|
|
|
|
|
| 339 |
temp_fasta.write(f">{query_id}\n{query_sequence}\n")
|
|
|
|
|
|
|
| 340 |
ref_fasta_path = "f_gene_sequences_aligned.fasta"
|
| 341 |
if os.path.exists(ref_fasta_path):
|
| 342 |
with open(ref_fasta_path, 'r') as ref_file:
|
| 343 |
temp_fasta.write(ref_file.read())
|
| 344 |
logging.info(f"Added reference sequences from {ref_fasta_path}")
|
| 345 |
else:
|
|
|
|
| 346 |
if analyzer and hasattr(analyzer, 'data'):
|
| 347 |
count = 0
|
| 348 |
for idx, row in analyzer.data.iterrows():
|
|
|
|
| 351 |
sequence = str(row['sequence']).upper()
|
| 352 |
temp_fasta.write(f">{seq_id}\n{sequence}\n")
|
| 353 |
count += 1
|
| 354 |
+
if count >= 20:
|
| 355 |
break
|
| 356 |
logging.info(f"Added {count} reference sequences from CSV")
|
|
|
|
| 357 |
temp_fasta.close()
|
| 358 |
return temp_fasta.name
|
|
|
|
| 359 |
except Exception as e:
|
| 360 |
logging.error(f"Failed to create multi-FASTA: {e}")
|
| 361 |
return None
|
|
|
|
| 363 |
def build_maximum_likelihood_tree(f_gene_sequence):
|
| 364 |
"""Build maximum likelihood phylogenetic tree with comprehensive fallback options"""
|
| 365 |
try:
|
| 366 |
+
mafft_available, iqtree_available, mafft_cmd, iqtree_cmd = enhanced_check_tool_availability()
|
|
|
|
|
|
|
|
|
|
| 367 |
status_msg = "🔍 Checking dependencies...\n"
|
| 368 |
+
status_msg += f"✅ MAFFT found: {mafft_cmd}\n" if mafft_available else "❌ MAFFT not found\n"
|
| 369 |
+
status_msg += f"✅ IQ-TREE found: {iqtree_cmd}\n" if iqtree_available else "❌ IQ-TREE not found\n"
|
| 370 |
+
if not mafft_available or not iqtree_available:
|
| 371 |
+
instructions = get_installation_instructions()
|
| 372 |
+
return False, f"{status_msg}\n{instructions}", None, None
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 373 |
output_dir = "ml_tree_output"
|
| 374 |
os.makedirs(output_dir, exist_ok=True)
|
|
|
|
|
|
|
| 375 |
logging.info("Creating multi-FASTA file...")
|
| 376 |
multi_fasta = create_multi_fasta_with_query(f_gene_sequence)
|
| 377 |
if not multi_fasta:
|
| 378 |
return False, f"{status_msg}❌ Failed to create input FASTA", None, None
|
|
|
|
|
|
|
| 379 |
logging.info("Running MAFFT alignment...")
|
| 380 |
aligned_fasta = os.path.join(output_dir, "aligned_sequences.fasta")
|
| 381 |
+
mafft_success, mafft_result = run_mafft_alignment_improved(multi_fasta, aligned_fasta, mafft_cmd)
|
|
|
|
|
|
|
| 382 |
os.unlink(multi_fasta)
|
|
|
|
| 383 |
if not mafft_success:
|
| 384 |
return False, f"{status_msg}❌ MAFFT failed: {mafft_result}", None, None
|
|
|
|
|
|
|
| 385 |
logging.info("Running IQ-TREE analysis...")
|
| 386 |
tree_prefix = os.path.join(output_dir, "ml_tree")
|
| 387 |
iqtree_success, iqtree_result = run_iqtree_analysis(aligned_fasta, tree_prefix, iqtree_cmd)
|
|
|
|
| 388 |
if not iqtree_success:
|
| 389 |
return False, f"{status_msg}❌ IQ-TREE failed: {iqtree_result}", aligned_fasta, None
|
|
|
|
|
|
|
| 390 |
tree_file = iqtree_result
|
| 391 |
log_file = f"{tree_prefix}.log"
|
|
|
|
|
|
|
| 392 |
standard_aligned = "f_gene_sequences_aligned.fasta"
|
| 393 |
standard_tree = "f_gene_sequences.phy.treefile"
|
|
|
|
| 394 |
if os.path.exists(aligned_fasta):
|
| 395 |
shutil.copy2(aligned_fasta, standard_aligned)
|
| 396 |
if os.path.exists(tree_file):
|
| 397 |
shutil.copy2(tree_file, standard_tree)
|
| 398 |
+
success_msg = f"{status_msg}✅ Maximum likelihood tree built successfully!\n- Alignment: {os.path.basename(aligned_fasta)}\n- Tree: {os.path.basename(tree_file)}\n"
|
|
|
|
|
|
|
|
|
|
|
|
|
| 399 |
if os.path.exists(log_file):
|
| 400 |
try:
|
| 401 |
with open(log_file, 'r') as f:
|
| 402 |
log_content = f.read()
|
|
|
|
| 403 |
if "Best-fit model:" in log_content:
|
| 404 |
model_lines = [line for line in log_content.split('\n') if "Best-fit model:" in line]
|
| 405 |
if model_lines:
|
| 406 |
success_msg += f"- {model_lines[0].strip()}\n"
|
| 407 |
except Exception as e:
|
| 408 |
logging.warning(f"Could not read log file: {e}")
|
|
|
|
| 409 |
logging.info("Maximum likelihood tree construction completed")
|
| 410 |
return True, success_msg, aligned_fasta, tree_file
|
|
|
|
| 411 |
except Exception as e:
|
| 412 |
logging.error(f"ML tree construction failed: {e}")
|
| 413 |
return False, f"ML tree construction failed: {str(e)}", None, None
|
| 414 |
|
|
|
|
| 415 |
def analyze_sequence_for_tree(sequence: str, matching_percentage: float) -> str:
|
| 416 |
+
"""Analyze sequence and create phylogenetic tree"""
|
|
|
|
|
|
|
| 417 |
try:
|
| 418 |
if not analyzer:
|
| 419 |
return "Error: Tree analyzer not initialized. Please check if the CSV data file is available."
|
|
|
|
| 420 |
if not sequence:
|
| 421 |
return "Error: Please provide a sequence."
|
|
|
|
| 422 |
if not (1 <= matching_percentage <= 99):
|
| 423 |
return "Error: Matching percentage must be between 1 and 99."
|
|
|
|
|
|
|
| 424 |
if not analyzer.find_query_sequence(sequence):
|
| 425 |
return "Error: Invalid query sequence or sequence not found in dataset."
|
|
|
|
|
|
|
| 426 |
analyzer.matching_percentage = matching_percentage
|
|
|
|
|
|
|
| 427 |
matched_ids, actual_percentage = analyzer.find_similar_sequences(matching_percentage)
|
|
|
|
| 428 |
if not matched_ids:
|
| 429 |
return f"No similar sequences found at {matching_percentage}% similarity. Try lowering the threshold."
|
|
|
|
| 430 |
logging.info(f"Found {len(matched_ids)} similar sequences at {actual_percentage:.1f}% similarity")
|
|
|
|
|
|
|
| 431 |
tree_structure = analyzer.build_tree_structure(matched_ids)
|
| 432 |
if not tree_structure:
|
| 433 |
return "Error: Failed to build tree structure."
|
|
|
|
|
|
|
| 434 |
fig = analyzer.create_interactive_tree(matched_ids, actual_percentage)
|
| 435 |
if not fig:
|
| 436 |
return "Error: Failed to create tree visualization."
|
|
|
|
|
|
|
| 437 |
html_content = fig.to_html(full_html=True, include_plotlyjs='cdn')
|
|
|
|
|
|
|
| 438 |
output_dir = "output"
|
| 439 |
os.makedirs(output_dir, exist_ok=True)
|
|
|
|
|
|
|
| 440 |
safe_seq_name = re.sub(r'[^a-zA-Z0-9]', '_', sequence[:20])
|
| 441 |
html_filename = os.path.join(output_dir, f"tree_{safe_seq_name}_{matching_percentage}.html")
|
|
|
|
| 442 |
with open(html_filename, "w", encoding='utf-8') as f:
|
| 443 |
f.write(html_content)
|
|
|
|
| 444 |
logging.info(f"Tree HTML saved to {html_filename}")
|
|
|
|
| 445 |
return html_content
|
|
|
|
| 446 |
except Exception as e:
|
| 447 |
error_msg = f"Tree analysis error: {str(e)}"
|
| 448 |
logging.error(error_msg)
|
|
|
|
| 450 |
logging.error(f"Full traceback: {traceback.format_exc()}")
|
| 451 |
return error_msg
|
| 452 |
|
|
|
|
| 453 |
def predict_with_keras(sequence):
|
| 454 |
+
"""Keras prediction for initial sequence processing"""
|
| 455 |
try:
|
| 456 |
if not keras_model or not kmer_to_index:
|
| 457 |
return f"Keras model not available. Input sequence: {sequence[:100]}..."
|
|
|
|
| 458 |
if len(sequence) < 6:
|
| 459 |
return "Sequence too short for k-mer prediction (minimum 6 nucleotides required)."
|
|
|
|
|
|
|
| 460 |
kmers = [sequence[i:i+6] for i in range(len(sequence)-5)]
|
| 461 |
indices = [kmer_to_index.get(kmer, 0) for kmer in kmers]
|
|
|
|
|
|
|
| 462 |
input_arr = np.array([indices])
|
| 463 |
prediction = keras_model.predict(input_arr, verbose=0)[0]
|
|
|
|
|
|
|
| 464 |
result = ''.join([str(round(p, 3)) for p in prediction])
|
| 465 |
return result
|
| 466 |
except Exception as e:
|
| 467 |
logging.error(f"Keras prediction failed: {e}")
|
| 468 |
return f"Keras prediction failed: {str(e)}"
|
| 469 |
|
| 470 |
+
def classify_sequence(sequence):
|
| 471 |
+
"""Classify sequence using the second model"""
|
| 472 |
+
try:
|
| 473 |
+
if not classifier_model or not classifier_kmer_to_index or classifier_maxlen is None:
|
| 474 |
+
return {
|
| 475 |
+
"status": "error",
|
| 476 |
+
"message": "Classifier model not available.",
|
| 477 |
+
"confidence": None,
|
| 478 |
+
"predicted_label": None
|
| 479 |
+
}
|
| 480 |
+
if len(sequence) < 1500:
|
| 481 |
+
return {
|
| 482 |
+
"status": "error",
|
| 483 |
+
"message": "Sequence too short. Must be at least 1500 bases.",
|
| 484 |
+
"confidence": None,
|
| 485 |
+
"predicted_label": None
|
| 486 |
+
}
|
| 487 |
+
tokens = [sequence[i:i+6] for i in range(len(sequence)-5+1)]
|
| 488 |
+
encoded = [classifier_kmer_to_index.get(kmer, 0) for kmer in tokens]
|
| 489 |
+
padded = pad_sequences([encoded], maxlen=classifier_maxlen, padding='post')
|
| 490 |
+
pred = classifier_model.predict(padded, verbose=0)
|
| 491 |
+
predicted_class = int(np.argmax(pred))
|
| 492 |
+
label = LABELS[predicted_class]
|
| 493 |
+
confidence = float(np.max(pred))
|
| 494 |
+
if label == "F":
|
| 495 |
+
return {
|
| 496 |
+
"status": "success",
|
| 497 |
+
"message": "F gene detected.",
|
| 498 |
+
"confidence": confidence,
|
| 499 |
+
"predicted_label": label
|
| 500 |
+
}
|
| 501 |
+
elif label == "Random":
|
| 502 |
+
return {
|
| 503 |
+
"status": "error",
|
| 504 |
+
"message": "Unidentified sequence detected. Make sure you're entering the F gene of the NDV.",
|
| 505 |
+
"confidence": confidence,
|
| 506 |
+
"predicted_label": label
|
| 507 |
+
}
|
| 508 |
+
else:
|
| 509 |
+
return {
|
| 510 |
+
"status": "error",
|
| 511 |
+
"message": "No F-gene detected. Please enter an NDV's F gene.",
|
| 512 |
+
"confidence": confidence,
|
| 513 |
+
"predicted_label": label
|
| 514 |
+
}
|
| 515 |
+
except Exception as e:
|
| 516 |
+
logging.error(f"Classifier prediction failed: {e}")
|
| 517 |
+
return {
|
| 518 |
+
"status": "error",
|
| 519 |
+
"message": f"Prediction failed: {str(e)}",
|
| 520 |
+
"confidence": None,
|
| 521 |
+
"predicted_label": None
|
| 522 |
+
}
|
| 523 |
+
|
| 524 |
def read_fasta_file(file_obj):
|
| 525 |
+
"""Read FASTA file content"""
|
| 526 |
try:
|
| 527 |
if file_obj is None:
|
| 528 |
return ""
|
|
|
|
|
|
|
| 529 |
if hasattr(file_obj, 'name'):
|
| 530 |
with open(file_obj.name, "r") as f:
|
| 531 |
content = f.read()
|
| 532 |
else:
|
| 533 |
content = file_obj.read().decode("utf-8") if hasattr(file_obj, "read") else str(file_obj)
|
|
|
|
| 534 |
lines = content.strip().split("\n")
|
| 535 |
seq_lines = [line.strip() for line in lines if not line.startswith(">")]
|
| 536 |
return ''.join(seq_lines)
|
|
|
|
| 538 |
logging.error(f"Failed to read FASTA file: {e}")
|
| 539 |
return ""
|
| 540 |
|
|
|
|
| 541 |
def run_pipeline_from_file(fasta_file_obj, similarity_score, build_ml_tree):
|
| 542 |
+
"""Run pipeline from FASTA file"""
|
| 543 |
try:
|
| 544 |
dna_input = read_fasta_file(fasta_file_obj)
|
| 545 |
if not dna_input:
|
| 546 |
+
return "Failed to read FASTA file", "", "", "", "", "", "", "", "", None, None, None, "No input sequence"
|
| 547 |
return run_pipeline(dna_input, similarity_score, build_ml_tree)
|
| 548 |
except Exception as e:
|
| 549 |
error_msg = f"Pipeline error: {str(e)}"
|
| 550 |
logging.error(error_msg)
|
| 551 |
+
return error_msg, "", "", "", "", "", "", "", "", None, None, None, error_msg
|
| 552 |
|
| 553 |
def run_pipeline(dna_input, similarity_score=95.0, build_ml_tree=False):
|
| 554 |
+
"""Run the full pipeline"""
|
| 555 |
try:
|
|
|
|
| 556 |
dna_input = dna_input.upper().strip()
|
| 557 |
if not dna_input:
|
| 558 |
+
return "Empty input", "", "", "", "", "", "", "", "", None, None, None, "No input provided"
|
|
|
|
|
|
|
| 559 |
if not re.match('^[ACTGN]+$', dna_input):
|
| 560 |
dna_input = ''.join(c if c in 'ACTGN' else 'N' for c in dna_input)
|
| 561 |
logging.info("DNA sequence sanitized")
|
| 562 |
|
| 563 |
+
# Step 1: Boundary Prediction
|
| 564 |
+
processed_sequence = dna_input
|
| 565 |
boundary_output = ""
|
|
|
|
| 566 |
if boundary_model:
|
| 567 |
try:
|
| 568 |
predictions, probs, confidence = boundary_model.predict(dna_input)
|
| 569 |
regions = boundary_model.extract_gene_regions(predictions, dna_input)
|
| 570 |
if regions:
|
| 571 |
+
processed_sequence = regions[0]["sequence"]
|
| 572 |
+
boundary_output = processed_sequence
|
| 573 |
logging.info(f"F gene extracted: {len(processed_sequence)} bp (confidence: {confidence:.3f})")
|
| 574 |
else:
|
| 575 |
boundary_output = f"No F gene regions found in input sequence"
|
|
|
|
| 576 |
logging.warning("No gene regions found, using full sequence")
|
|
|
|
| 577 |
except Exception as e:
|
| 578 |
logging.error(f"Boundary model failed: {e}")
|
| 579 |
boundary_output = f"Boundary model error: {str(e)}"
|
|
|
|
| 580 |
else:
|
| 581 |
boundary_output = f"Boundary model not available. Using original input: {len(dna_input)} bp"
|
|
|
|
| 582 |
|
| 583 |
+
# Step 2: Keras Prediction
|
| 584 |
keras_output = ""
|
| 585 |
if processed_sequence and len(processed_sequence) >= 6:
|
| 586 |
keras_prediction = predict_with_keras(processed_sequence)
|
| 587 |
+
keras_output = keras_prediction if not keras_prediction.startswith(("Keras", "Sequence")) else keras_prediction
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 588 |
|
| 589 |
+
# Step 3: Classifier Prediction
|
| 590 |
+
classifier_result = classify_sequence(processed_sequence)
|
| 591 |
+
classifier_status = classifier_result["status"]
|
| 592 |
+
classifier_message = classifier_result["message"]
|
| 593 |
+
classifier_label = classifier_result["predicted_label"]
|
| 594 |
+
classifier_confidence = classifier_result["confidence"]
|
| 595 |
+
|
| 596 |
+
# Step 4: Maximum Likelihood Tree
|
| 597 |
aligned_file = None
|
| 598 |
phy_file = None
|
| 599 |
ml_tree_output = ""
|
|
|
|
| 600 |
if build_ml_tree and processed_sequence and len(processed_sequence) >= 50:
|
| 601 |
try:
|
| 602 |
logging.info("Starting maximum likelihood tree construction...")
|
| 603 |
ml_success, ml_message, ml_aligned, ml_tree = build_maximum_likelihood_tree(processed_sequence)
|
|
|
|
| 604 |
if ml_success:
|
| 605 |
ml_tree_output = ml_message
|
| 606 |
aligned_file = ml_aligned
|
| 607 |
phy_file = ml_tree
|
| 608 |
else:
|
| 609 |
+
ml_tree_output = ml_message
|
|
|
|
| 610 |
except Exception as e:
|
| 611 |
ml_tree_output = f"❌ ML Tree construction failed: {str(e)}"
|
| 612 |
logging.error(f"ML Tree failed: {e}")
|
|
|
|
| 615 |
else:
|
| 616 |
ml_tree_output = "ML tree construction skipped (not requested)"
|
| 617 |
|
| 618 |
+
# Step 5: ML Simplified Tree
|
| 619 |
html_file = None
|
| 620 |
tree_html_content = "No tree generated"
|
| 621 |
simplified_ml_output = ""
|
|
|
|
| 622 |
if analyzer and processed_sequence and len(processed_sequence) >= 10:
|
| 623 |
try:
|
| 624 |
logging.info(f"Starting simplified ML tree analysis with F gene sequence length: {len(processed_sequence)}")
|
|
|
|
|
|
|
| 625 |
tree_result = analyze_sequence_for_tree(processed_sequence, matching_percentage=similarity_score)
|
|
|
|
| 626 |
if tree_result and not tree_result.startswith("Error:"):
|
|
|
|
| 627 |
tree_html_content = tree_result
|
| 628 |
simplified_ml_output = "✅ Simplified phylogenetic tree generated successfully!"
|
|
|
|
|
|
|
| 629 |
output_dir = "output"
|
| 630 |
if os.path.exists(output_dir):
|
| 631 |
html_files = [f for f in os.listdir(output_dir) if f.endswith('.html')]
|
| 632 |
if html_files:
|
| 633 |
+
html_file = os.path.join(output_dir, html_files[-1])
|
| 634 |
simplified_ml_output += f"\n- Tree file: {html_files[-1]}"
|
|
|
|
|
|
|
| 635 |
if analyzer.find_query_sequence(processed_sequence):
|
| 636 |
matched_ids, perc = analyzer.find_similar_sequences(similarity_score)
|
| 637 |
simplified_ml_output += f"\n- {len(matched_ids)} sequences analyzed"
|
|
|
|
| 639 |
else:
|
| 640 |
simplified_ml_output = f"❌ Simplified ML tree failed: {tree_result}"
|
| 641 |
tree_html_content = f"<p>Error: {tree_result}</p>"
|
|
|
|
| 642 |
except Exception as e:
|
| 643 |
logging.error(f"Simplified ML tree analysis failed: {e}")
|
| 644 |
simplified_ml_output = f"❌ Simplified ML tree analysis failed: {str(e)}"
|
|
|
|
| 651 |
|
| 652 |
# Return all results
|
| 653 |
return (
|
| 654 |
+
boundary_output,
|
| 655 |
+
keras_output,
|
| 656 |
+
classifier_status,
|
| 657 |
+
classifier_message,
|
| 658 |
+
classifier_label,
|
| 659 |
+
classifier_confidence,
|
| 660 |
+
ml_tree_output,
|
| 661 |
+
simplified_ml_output,
|
| 662 |
+
tree_html_content,
|
| 663 |
+
aligned_file,
|
| 664 |
+
phy_file,
|
| 665 |
+
html_file,
|
| 666 |
+
f"Pipeline completed. F gene length: {len(processed_sequence)} bp"
|
| 667 |
)
|
|
|
|
| 668 |
except Exception as e:
|
| 669 |
error_msg = f"Pipeline execution failed: {str(e)}"
|
| 670 |
logging.error(error_msg)
|
| 671 |
import traceback
|
| 672 |
logging.error(f"Full traceback: {traceback.format_exc()}")
|
| 673 |
return (
|
| 674 |
+
error_msg, "", "", "", "", "", "", "", f"<p>Error: {error_msg}</p>",
|
| 675 |
None, None, None, error_msg
|
| 676 |
)
|
| 677 |
|
| 678 |
# --- Gradio Interface ---
|
| 679 |
def create_interface():
|
| 680 |
"""Create the Gradio interface with enhanced layout and features"""
|
|
|
|
|
|
|
| 681 |
custom_css = """
|
| 682 |
+
.gradio-container { max-width: 1200px !important; }
|
| 683 |
+
.tab-nav button { font-size: 16px !important; }
|
| 684 |
+
.output-html { height: 600px !important; overflow: auto; }
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 685 |
"""
|
|
|
|
| 686 |
with gr.Blocks(css=custom_css, title="F Gene Analysis Pipeline") as iface:
|
| 687 |
gr.Markdown("""
|
| 688 |
# 🧬 F Gene Analysis Pipeline
|
| 689 |
|
| 690 |
This tool provides comprehensive analysis of F genes including:
|
| 691 |
+
- **Gene Boundary Detection**: Extract F gene sequences
|
| 692 |
+
- **Gene Validation**: Validate with machine learning
|
| 693 |
+
- **Gene Classification**: Classify sequence type (F gene or other)
|
| 694 |
+
- **Phylogenetic Analysis**: Build maximum likelihood and simplified trees
|
| 695 |
|
| 696 |
**Instructions:**
|
| 697 |
+
1. Enter your sequence or upload a FASTA file
|
| 698 |
+
2. Adjust similarity threshold (1-99%)
|
| 699 |
+
3. Choose whether to build ML tree (requires MAFFT & IQ-TREE)
|
| 700 |
+
4. Click "Run Analysis" to start
|
| 701 |
""")
|
| 702 |
|
| 703 |
with gr.Tab("🔬 Analysis Pipeline"):
|
| 704 |
with gr.Row():
|
| 705 |
with gr.Column(scale=2):
|
|
|
|
| 706 |
gr.Markdown("### Input Sequence")
|
| 707 |
+
dna_input = gr.Textbox(label="DNA Sequence", placeholder="Enter your DNA sequence here (ATCG format)...", lines=5, max_lines=10)
|
| 708 |
+
fasta_file = gr.File(label="Or Upload FASTA File", file_types=[".fasta", ".fa", ".fas", ".txt"])
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 709 |
with gr.Row():
|
| 710 |
+
similarity_score = gr.Slider(minimum=1, maximum=99, value=95.0, step=1.0, label="Similarity Threshold (%)", info="Minimum similarity for phylogenetic analysis")
|
| 711 |
+
build_ml_tree = gr.Checkbox(label="Build ML Tree", value=False, info="Build maximum likelihood tree (requires MAFFT & IQ-TREE)")
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 712 |
with gr.Row():
|
| 713 |
run_btn = gr.Button("🚀 Run Analysis", variant="primary", size="lg")
|
| 714 |
clear_btn = gr.Button("🗑️ Clear", variant="secondary")
|
|
|
|
| 715 |
with gr.Column(scale=1):
|
|
|
|
| 716 |
gr.Markdown("### Analysis Status")
|
| 717 |
+
status_display = gr.Textbox(label="Status", value="Ready to analyze", interactive=False, lines=3)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 718 |
gr.Markdown("### Available Models")
|
| 719 |
model_status = []
|
| 720 |
if boundary_model:
|
| 721 |
model_status.append("✅ Boundary Detection Model")
|
| 722 |
else:
|
| 723 |
model_status.append("❌ Boundary Detection Model")
|
|
|
|
| 724 |
if keras_model:
|
| 725 |
model_status.append("✅ Gene Validation Model")
|
| 726 |
else:
|
| 727 |
model_status.append("❌ Gene Validation Model")
|
| 728 |
+
if classifier_model:
|
| 729 |
+
model_status.append("✅ Gene Classification Model")
|
| 730 |
+
else:
|
| 731 |
+
model_status.append("❌ Gene Classification Model")
|
| 732 |
if analyzer:
|
| 733 |
model_status.append("✅ Tree Analysis Module")
|
| 734 |
else:
|
| 735 |
model_status.append("❌ Tree Analysis Module")
|
|
|
|
| 736 |
gr.Markdown("\n".join(model_status))
|
| 737 |
|
| 738 |
with gr.Tab("📊 Results"):
|
| 739 |
with gr.Row():
|
| 740 |
with gr.Column():
|
| 741 |
+
boundary_output = gr.Textbox(label="🎯 F Gene Extraction", lines=5, interactive=False)
|
| 742 |
+
keras_output = gr.Textbox(label="🔍 Gene Validation", lines=3, interactive=False)
|
| 743 |
+
classifier_status = gr.Textbox(label="🧬 Classification Status", lines=1, interactive=False)
|
| 744 |
+
classifier_message = gr.Textbox(label="📝 Classification Message", lines=2, interactive=False)
|
| 745 |
+
classifier_label = gr.Textbox(label="🏷️ Predicted Label", lines=1, interactive=False)
|
| 746 |
+
classifier_confidence = gr.Textbox(label="📊 Confidence Score", lines=1, interactive=False)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 747 |
with gr.Column():
|
| 748 |
+
ml_tree_output = gr.Textbox(label="🌳 Maximum Likelihood Tree", lines=5, interactive=False)
|
| 749 |
+
simplified_ml_output = gr.Textbox(label="📈 Simplified Phylogenetic Analysis", lines=3, interactive=False)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 750 |
gr.Markdown("### 🌲 Phylogenetic Tree Visualization")
|
| 751 |
+
tree_html = gr.HTML(label="Interactive Tree", value="<p>No tree generated yet. Run analysis to see results.</p>")
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 752 |
gr.Markdown("### 📁 Download Results")
|
| 753 |
with gr.Row():
|
| 754 |
+
aligned_file = gr.File(label="Aligned Sequences (FASTA)", interactive=False)
|
| 755 |
+
phy_file = gr.File(label="Phylogenetic Tree File", interactive=False)
|
| 756 |
+
html_file = gr.File(label="Interactive Tree (HTML)", interactive=False)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 757 |
|
| 758 |
with gr.Tab("ℹ️ Help & Info"):
|
| 759 |
gr.Markdown("""
|
| 760 |
## About This Tool
|
| 761 |
|
| 762 |
### F Gene Analysis Pipeline
|
| 763 |
+
- **🎯 Gene Boundary Detection**: Extracts F gene sequences using deep learning.
|
| 764 |
+
- **🔍 Gene Validation**: Validates with k-mer based machine learning.
|
| 765 |
+
- **🧬 Gene Classification**: Classifies sequences (F gene or other) with confidence scores.
|
| 766 |
+
- **🌳 Phylogenetic Analysis**: Builds ML and simplified trees.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 767 |
|
| 768 |
### Input Requirements
|
| 769 |
+
- DNA Sequences: ATCG format, minimum 50 bp.
|
| 770 |
+
- FASTA Files: Standard format.
|
| 771 |
+
- Similarity Threshold: 1-99%.
|
| 772 |
|
| 773 |
### Dependencies
|
| 774 |
+
**For ML Trees:**
|
|
|
|
| 775 |
```bash
|
| 776 |
+
# Ubuntu/Debian: sudo apt-get install mafft iqtree
|
| 777 |
+
# macOS: brew install mafft iqtree
|
| 778 |
+
# Conda: conda install -c bioconda mafft iqtree
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 779 |
```
|
| 780 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 781 |
### Troubleshooting
|
| 782 |
+
- *"No similar sequences"*: Lower similarity threshold.
|
| 783 |
+
- *"Sequence too short"*: Provide >50 bp.
|
| 784 |
+
- *"MAFFT/IQ-TREE not found"*: Install dependencies.
|
| 785 |
+
- *"Model not available"*: Check model files.
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 786 |
""")
|
| 787 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 788 |
def run_analysis_combined(dna_seq, file_obj, sim_score, build_tree):
|
|
|
|
| 789 |
if file_obj is not None:
|
| 790 |
return run_pipeline_from_file(file_obj, sim_score, build_tree)
|
| 791 |
else:
|
|
|
|
| 794 |
def clear_inputs():
|
| 795 |
return "", None, 95.0, False, "Ready to analyze"
|
| 796 |
|
|
|
|
| 797 |
run_btn.click(
|
| 798 |
fn=run_analysis_combined,
|
| 799 |
inputs=[dna_input, fasta_file, similarity_score, build_ml_tree],
|
| 800 |
outputs=[
|
| 801 |
+
boundary_output, keras_output, classifier_status, classifier_message,
|
| 802 |
+
classifier_label, classifier_confidence, ml_tree_output, simplified_ml_output,
|
| 803 |
+
tree_html, aligned_file, phy_file, html_file, status_display
|
| 804 |
]
|
| 805 |
)
|
|
|
|
| 806 |
clear_btn.click(
|
| 807 |
fn=clear_inputs,
|
| 808 |
outputs=[dna_input, fasta_file, similarity_score, build_ml_tree, status_display]
|
| 809 |
)
|
| 810 |
|
|
|
|
|
|
|
| 811 |
example_btn = gr.Button("Load Example F Gene Sequence", variant="secondary")
|
|
|
|
| 812 |
def load_example():
|
| 813 |
example_seq = "ATGAAACTGTCAACACTCACTGAGTACATTAGCCAAGTTCTCAAGACTGAGTGTTTACCTTTGTGAATACACTGAGTCCTTGTCAACGTTCGGCTGCAGTCACACTGATGGTCTTGTCTTCAGGAGCAACTGCAGTCTGTGCTGTGTACTATAGTGCTAAGAGTGATAATGCACTGTTCAGTACCTTTGACAGTGTGTCTCTGTCACCTGGTGCTATGCAGAGCTGCGATGAGATCTACATTGGTCTGATCGATAAGACTGAGTCCAAGGGTGTTGCTGTGTGTACTGTAGAGTGTGATAGTGTTGCCTGCACTGTGTCTATGGCTGATCTTGAGGCTCTGCTTATGTCAACACTGAGTGTGAAATGTTCATTTGCTACTTCAAGACTGATGTGAAGACTGTGTATTGTACTCAGTCATGCAGAGTGAAGTCCTTGAGCCACTTGCTTTGTACAATGTGGGTGATGAGATGTTGTGCTGCAGTGTCAAGGGGCCACAGTCTTGCCTTGATAGTGCGATTGCTGTGATGATGTGCACTTCAATGAGTGGTCGAGATGCTGCTGTGTGTAAGGATGCTGCTGTGTGTAAGAAGGATGCTGCTGTGTGTAAGA"
|
| 814 |
return example_seq, "Example F gene sequence loaded"
|
| 815 |
+
example_btn.click(fn=load_example, outputs=[dna_input, status_display])
|
|
|
|
|
|
|
|
|
|
|
|
|
| 816 |
|
| 817 |
return iface
|
| 818 |
|
| 819 |
# --- Main Execution ---
|
| 820 |
if __name__ == "__main__":
|
|
|
|
| 821 |
interface = create_interface()
|
|
|
|
|
|
|
| 822 |
interface.launch(
|
| 823 |
+
server_name="0.0.0.0",
|
| 824 |
+
server_port=7860,
|
| 825 |
+
share=False,
|
| 826 |
+
debug=True,
|
| 827 |
+
show_error=True,
|
| 828 |
+
max_threads=4,
|
| 829 |
+
auth=None,
|
| 830 |
+
ssl_verify=False,
|
| 831 |
+
quiet=False
|
| 832 |
)
|