Spaces:
No application file
No application file
Update app.py
Browse files
app.py
CHANGED
|
@@ -1,442 +1,17 @@
|
|
| 1 |
import gradio as gr
|
| 2 |
-
import torch
|
| 3 |
-
import numpy as np
|
| 4 |
-
import os
|
| 5 |
-
import traceback
|
| 6 |
-
import logging
|
| 7 |
-
import sys
|
| 8 |
|
| 9 |
-
|
| 10 |
-
|
| 11 |
-
logger = logging.getLogger(__name__)
|
| 12 |
|
| 13 |
-
|
| 14 |
-
|
| 15 |
-
|
| 16 |
-
|
| 17 |
-
|
| 18 |
-
|
| 19 |
-
|
| 20 |
-
# Global variables
|
| 21 |
-
predictor = None
|
| 22 |
-
model_loaded = False
|
| 23 |
-
error_message = ""
|
| 24 |
-
|
| 25 |
-
def initialize_model():
|
| 26 |
-
"""Initialize the model with proper error handling"""
|
| 27 |
-
global predictor, model_loaded, error_message
|
| 28 |
-
|
| 29 |
-
try:
|
| 30 |
-
print("Attempting to import predictor...")
|
| 31 |
-
|
| 32 |
-
# Try different import approaches
|
| 33 |
-
try:
|
| 34 |
-
from predictor import GenePredictor
|
| 35 |
-
print("✅ Imported from predictor module")
|
| 36 |
-
except ImportError:
|
| 37 |
-
try:
|
| 38 |
-
# If predictor.py is in the same directory
|
| 39 |
-
import importlib.util
|
| 40 |
-
spec = importlib.util.spec_from_file_location("predictor", "predictor.py")
|
| 41 |
-
predictor_module = importlib.util.module_from_spec(spec)
|
| 42 |
-
spec.loader.exec_module(predictor_module)
|
| 43 |
-
GenePredictor = predictor_module.GenePredictor
|
| 44 |
-
print("✅ Imported predictor.py directly")
|
| 45 |
-
except Exception as e:
|
| 46 |
-
print(f"Failed to import predictor: {e}")
|
| 47 |
-
raise ImportError(f"Could not import GenePredictor: {e}")
|
| 48 |
-
|
| 49 |
-
# Look for model file
|
| 50 |
-
possible_model_paths = [
|
| 51 |
-
'best_boundary_aware_model.pth',
|
| 52 |
-
'model/best_boundary_aware_model.pth',
|
| 53 |
-
'./best_boundary_aware_model.pth'
|
| 54 |
-
]
|
| 55 |
-
|
| 56 |
-
model_path = None
|
| 57 |
-
for path in possible_model_paths:
|
| 58 |
-
if os.path.exists(path):
|
| 59 |
-
model_path = path
|
| 60 |
-
break
|
| 61 |
-
|
| 62 |
-
if not model_path:
|
| 63 |
-
available_models = [f for f in os.listdir('.') if f.endswith('.pth')]
|
| 64 |
-
if os.path.exists('model'):
|
| 65 |
-
available_models.extend([f"model/{f}" for f in os.listdir('model') if f.endswith('.pth')])
|
| 66 |
-
|
| 67 |
-
error_message = f"❌ Model file not found. Searched: {possible_model_paths}. Available: {available_models}"
|
| 68 |
-
print(error_message)
|
| 69 |
-
return False
|
| 70 |
-
|
| 71 |
-
print(f"Found model file: {model_path}")
|
| 72 |
-
print(f"Model file size: {os.path.getsize(model_path)} bytes")
|
| 73 |
-
|
| 74 |
-
# Initialize predictor
|
| 75 |
-
predictor = GenePredictor(model_path=model_path)
|
| 76 |
-
model_loaded = True
|
| 77 |
-
print("✅ Model initialized successfully")
|
| 78 |
-
return True
|
| 79 |
-
|
| 80 |
-
except Exception as e:
|
| 81 |
-
error_message = f"❌ Model initialization failed: {str(e)}"
|
| 82 |
-
print(error_message)
|
| 83 |
-
print("Full traceback:")
|
| 84 |
-
traceback.print_exc()
|
| 85 |
-
return False
|
| 86 |
-
|
| 87 |
-
def predict_genes(sequence):
|
| 88 |
-
"""Gene prediction function with comprehensive error handling"""
|
| 89 |
-
try:
|
| 90 |
-
# Check if model is loaded
|
| 91 |
-
if not model_loaded or predictor is None:
|
| 92 |
-
return f"🚫 **Model Error**\n\n{error_message}\n\nPlease check that:\n1. predictor.py is in the same directory\n2. Model file (.pth) exists\n3. All dependencies are installed"
|
| 93 |
-
|
| 94 |
-
# Input validation
|
| 95 |
-
if not sequence or not sequence.strip():
|
| 96 |
-
return "⚠️ **Input Error**\n\nPlease enter a DNA sequence."
|
| 97 |
-
|
| 98 |
-
# Clean sequence
|
| 99 |
-
sequence = sequence.strip().upper()
|
| 100 |
-
sequence = sequence.replace(' ', '').replace('\n', '').replace('\t', '').replace('\r', '')
|
| 101 |
-
|
| 102 |
-
# Character validation
|
| 103 |
-
valid_chars = set('ATCGN')
|
| 104 |
-
invalid_chars = set(sequence) - valid_chars
|
| 105 |
-
if invalid_chars:
|
| 106 |
-
return f"⚠️ **Invalid Characters**\n\nFound invalid characters: {', '.join(sorted(invalid_chars))}\n\nPlease use only: A, T, C, G, N"
|
| 107 |
-
|
| 108 |
-
# Length validation
|
| 109 |
-
if len(sequence) < 3:
|
| 110 |
-
return f"⚠️ **Sequence Too Short**\n\nMinimum length: 3 nucleotides\nYour sequence: {len(sequence)} nucleotides"
|
| 111 |
-
|
| 112 |
-
if len(sequence) > 10000:
|
| 113 |
-
return f"⚠️ **Sequence Too Long**\n\nMaximum length: 10,000 nucleotides\nYour sequence: {len(sequence)} nucleotides\n\nFor longer sequences, consider splitting them into smaller chunks."
|
| 114 |
-
|
| 115 |
-
print(f"Processing sequence of length: {len(sequence)}")
|
| 116 |
-
|
| 117 |
-
# Make prediction
|
| 118 |
-
predictions, probs_dict, confidence = predictor.predict(sequence)
|
| 119 |
-
regions = predictor.extract_gene_regions(predictions, sequence)
|
| 120 |
-
|
| 121 |
-
# Format results
|
| 122 |
-
result = f"🧬 **Gene Prediction Results**\n\n"
|
| 123 |
-
result += f"📊 **Analysis Summary:**\n"
|
| 124 |
-
result += f"• Sequence length: {len(sequence):,} bp\n"
|
| 125 |
-
result += f"• Gene regions found: {len(regions)}\n"
|
| 126 |
-
result += f"• Overall confidence: {confidence:.3f}\n"
|
| 127 |
-
result += f"• Analysis completed successfully ✅\n\n"
|
| 128 |
-
|
| 129 |
-
if not regions:
|
| 130 |
-
result += f"🔍 **No Gene Regions Detected**\n\n"
|
| 131 |
-
result += f"The model did not detect any gene regions meeting the minimum criteria in this sequence.\n"
|
| 132 |
-
result += f"This could mean:\n"
|
| 133 |
-
result += f"• The sequence may not contain protein-coding genes\n"
|
| 134 |
-
result += f"• Genes may be partial or fragmented\n"
|
| 135 |
-
result += f"• The sequence may be non-coding DNA\n"
|
| 136 |
-
return result
|
| 137 |
-
|
| 138 |
-
result += f"📍 **Detected Gene Regions:**\n\n"
|
| 139 |
-
|
| 140 |
-
total_gene_length = 0
|
| 141 |
-
for i, region in enumerate(regions, 1):
|
| 142 |
-
result += f"**🧬 Gene Region {i}:**\n"
|
| 143 |
-
result += f"├─ Position: {region['start']:,} - {region['end']:,} bp\n"
|
| 144 |
-
result += f"├─ Length: {region['length']:,} bp\n"
|
| 145 |
-
result += f"├─ In-frame: {'Yes' if region.get('in_frame', False) else 'No'}\n"
|
| 146 |
-
|
| 147 |
-
# Start codon info
|
| 148 |
-
start_codon = region.get('start_codon')
|
| 149 |
-
if start_codon:
|
| 150 |
-
result += f"├─ Start codon: {start_codon}\n"
|
| 151 |
-
else:
|
| 152 |
-
result += f"├─ Start codon: Not detected\n"
|
| 153 |
-
|
| 154 |
-
# Stop codon info
|
| 155 |
-
stop_codon = region.get('stop_codon')
|
| 156 |
-
if stop_codon:
|
| 157 |
-
result += f"├─ Stop codon: {stop_codon}\n"
|
| 158 |
-
else:
|
| 159 |
-
result += f"├─ Stop codon: Not detected\n"
|
| 160 |
-
|
| 161 |
-
# Sequence preview
|
| 162 |
-
seq = region.get('sequence', '')
|
| 163 |
-
if seq:
|
| 164 |
-
if len(seq) <= 120:
|
| 165 |
-
result += f"└─ Sequence: `{seq}`\n"
|
| 166 |
-
else:
|
| 167 |
-
preview = seq[:60] + '...' + seq[-60:]
|
| 168 |
-
result += f"└─ Sequence: `{preview}`\n"
|
| 169 |
-
|
| 170 |
-
total_gene_length += region['length']
|
| 171 |
-
result += "\n"
|
| 172 |
-
|
| 173 |
-
# Summary statistics
|
| 174 |
-
result += f"📈 **Statistics:**\n"
|
| 175 |
-
result += f"• Total gene content: {total_gene_length:,} bp ({total_gene_length/len(sequence)*100:.1f}% of sequence)\n"
|
| 176 |
-
result += f"• Average gene length: {total_gene_length//len(regions):,} bp\n"
|
| 177 |
-
result += f"• Gene density: {len(regions)/(len(sequence)/1000):.2f} genes per kb\n"
|
| 178 |
-
|
| 179 |
-
return result
|
| 180 |
-
|
| 181 |
-
except Exception as e:
|
| 182 |
-
error_msg = f"🚫 **Prediction Error**\n\n"
|
| 183 |
-
error_msg += f"An error occurred during prediction:\n\n"
|
| 184 |
-
error_msg += f"```\n{str(e)}\n```\n\n"
|
| 185 |
-
error_msg += f"**Troubleshooting:**\n"
|
| 186 |
-
error_msg += f"• Check that predictor.py is in the same directory\n"
|
| 187 |
-
error_msg += f"• Verify model file exists and is not corrupted\n"
|
| 188 |
-
error_msg += f"• Ensure sequence contains only valid DNA characters\n"
|
| 189 |
-
|
| 190 |
-
print(f"Prediction error: {e}")
|
| 191 |
-
traceback.print_exc()
|
| 192 |
-
return error_msg
|
| 193 |
-
|
| 194 |
-
def get_sequence_stats(sequence):
|
| 195 |
-
"""Get basic statistics about the input sequence"""
|
| 196 |
-
if not sequence or not sequence.strip():
|
| 197 |
-
return ""
|
| 198 |
-
|
| 199 |
-
sequence = sequence.strip().upper().replace(' ', '').replace('\n', '').replace('\t', '')
|
| 200 |
-
|
| 201 |
-
if not sequence:
|
| 202 |
-
return ""
|
| 203 |
-
|
| 204 |
-
stats = f"**Sequence Info:** {len(sequence)} bp"
|
| 205 |
-
|
| 206 |
-
# Base composition
|
| 207 |
-
a_count = sequence.count('A')
|
| 208 |
-
t_count = sequence.count('T')
|
| 209 |
-
c_count = sequence.count('C')
|
| 210 |
-
g_count = sequence.count('G')
|
| 211 |
-
n_count = sequence.count('N')
|
| 212 |
-
|
| 213 |
-
total_valid = a_count + t_count + c_count + g_count
|
| 214 |
-
if total_valid > 0:
|
| 215 |
-
gc_content = (c_count + g_count) / total_valid * 100
|
| 216 |
-
stats += f" | GC: {gc_content:.1f}%"
|
| 217 |
-
|
| 218 |
-
if n_count > 0:
|
| 219 |
-
stats += f" | N's: {n_count}"
|
| 220 |
-
|
| 221 |
-
return stats
|
| 222 |
-
|
| 223 |
-
def create_interface():
|
| 224 |
-
"""Create the Gradio interface"""
|
| 225 |
-
# Initialize model on startup
|
| 226 |
-
print("Initializing model...")
|
| 227 |
-
model_status = initialize_model()
|
| 228 |
-
|
| 229 |
-
# Create custom CSS for better styling
|
| 230 |
-
custom_css = """
|
| 231 |
-
.gene-app {
|
| 232 |
-
font-family: 'Segoe UI', Tahoma, Geneva, Verdana, sans-serif;
|
| 233 |
-
}
|
| 234 |
-
|
| 235 |
-
.status-ready {
|
| 236 |
-
background: linear-gradient(135deg, #d4edda 0%, #c3e6cb 100%);
|
| 237 |
-
border: 2px solid #28a745;
|
| 238 |
-
border-radius: 10px;
|
| 239 |
-
padding: 15px;
|
| 240 |
-
color: #155724;
|
| 241 |
-
font-weight: bold;
|
| 242 |
-
box-shadow: 0 2px 10px rgba(40, 167, 69, 0.2);
|
| 243 |
-
}
|
| 244 |
-
|
| 245 |
-
.status-error {
|
| 246 |
-
background: linear-gradient(135deg, #f8d7da 0%, #f5c6cb 100%);
|
| 247 |
-
border: 2px solid #dc3545;
|
| 248 |
-
border-radius: 10px;
|
| 249 |
-
padding: 15px;
|
| 250 |
-
color: #721c24;
|
| 251 |
-
font-weight: bold;
|
| 252 |
-
box-shadow: 0 2px 10px rgba(220, 53, 69, 0.2);
|
| 253 |
-
}
|
| 254 |
-
|
| 255 |
-
.main-title {
|
| 256 |
-
text-align: center;
|
| 257 |
-
background: linear-gradient(135deg, #2E8B57 0%, #20B2AA 100%);
|
| 258 |
-
-webkit-background-clip: text;
|
| 259 |
-
-webkit-text-fill-color: transparent;
|
| 260 |
-
background-clip: text;
|
| 261 |
-
font-size: 2.5rem;
|
| 262 |
-
font-weight: bold;
|
| 263 |
-
margin-bottom: 1rem;
|
| 264 |
-
}
|
| 265 |
-
|
| 266 |
-
.instructions {
|
| 267 |
-
background: #f8f9fa;
|
| 268 |
-
border-radius: 10px;
|
| 269 |
-
padding: 20px;
|
| 270 |
-
border-left: 4px solid #2E8B57;
|
| 271 |
-
margin: 1rem 0;
|
| 272 |
-
}
|
| 273 |
-
|
| 274 |
-
.sequence-stats {
|
| 275 |
-
font-size: 0.9rem;
|
| 276 |
-
color: #6c757d;
|
| 277 |
-
font-style: italic;
|
| 278 |
-
margin-top: 5px;
|
| 279 |
-
}
|
| 280 |
-
"""
|
| 281 |
-
|
| 282 |
-
print("Creating Gradio interface...")
|
| 283 |
-
|
| 284 |
-
# Determine status message and styling
|
| 285 |
-
if model_loaded:
|
| 286 |
-
status_html = '''
|
| 287 |
-
<div class="status-ready">
|
| 288 |
-
<strong>✅ Model Status:</strong> Ready for gene prediction!<br>
|
| 289 |
-
<small>🔬 Boundary-aware deep learning model loaded successfully</small>
|
| 290 |
-
</div>
|
| 291 |
-
'''
|
| 292 |
-
else:
|
| 293 |
-
status_html = f'''
|
| 294 |
-
<div class="status-error">
|
| 295 |
-
<strong>❌ Model Status:</strong> Model initialization failed<br>
|
| 296 |
-
<small>📋 Details: {error_message}</small>
|
| 297 |
-
</div>
|
| 298 |
-
'''
|
| 299 |
-
|
| 300 |
-
# Example sequences
|
| 301 |
-
examples = [
|
| 302 |
-
# Short example with clear gene
|
| 303 |
-
["ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTAA"],
|
| 304 |
-
# Longer example
|
| 305 |
-
["ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAATAG"],
|
| 306 |
-
]
|
| 307 |
-
|
| 308 |
-
# Create the interface with custom theme
|
| 309 |
-
with gr.Blocks(
|
| 310 |
-
title="🧬 Gene Prediction Tool",
|
| 311 |
-
theme=gr.themes.Soft(primary_hue="emerald", secondary_hue="teal"),
|
| 312 |
-
css=custom_css
|
| 313 |
-
) as interface:
|
| 314 |
-
|
| 315 |
-
gr.HTML('<h1 class="main-title">🧬 Advanced Gene Prediction Tool</h1>')
|
| 316 |
-
gr.HTML('<p style="text-align: center; font-size: 1.1rem; color: #6c757d; margin-bottom: 2rem;">AI-powered boundary-aware gene detection system</p>')
|
| 317 |
-
|
| 318 |
-
gr.HTML(status_html)
|
| 319 |
-
|
| 320 |
-
with gr.Row():
|
| 321 |
-
gr.HTML('''
|
| 322 |
-
<div class="instructions">
|
| 323 |
-
<h3>🔬 How to Use:</h3>
|
| 324 |
-
<ol>
|
| 325 |
-
<li><strong>Enter DNA sequence:</strong> Paste your sequence using A, T, C, G, N characters</li>
|
| 326 |
-
<li><strong>Click Analyze:</strong> The AI model will predict gene regions</li>
|
| 327 |
-
<li><strong>Review results:</strong> View detected genes with positions, codons, and confidence</li>
|
| 328 |
-
</ol>
|
| 329 |
-
|
| 330 |
-
<h4>📏 Requirements:</h4>
|
| 331 |
-
<ul>
|
| 332 |
-
<li>Characters: Only A, T, C, G, N allowed</li>
|
| 333 |
-
<li>Length: 3 - 10,000 nucleotides</li>
|
| 334 |
-
<li>Format: Raw sequence (FASTA headers will be ignored)</li>
|
| 335 |
-
</ul>
|
| 336 |
-
</div>
|
| 337 |
-
''')
|
| 338 |
-
|
| 339 |
-
with gr.Row():
|
| 340 |
-
with gr.Column(scale=1):
|
| 341 |
-
sequence_input = gr.Textbox(
|
| 342 |
-
label="🧬 DNA Sequence Input",
|
| 343 |
-
placeholder="Enter or paste your DNA sequence here...\nExample: ATGAAACGCATTAGCACC...",
|
| 344 |
-
lines=10,
|
| 345 |
-
max_lines=20,
|
| 346 |
-
show_copy_button=True,
|
| 347 |
-
container=True
|
| 348 |
-
)
|
| 349 |
-
|
| 350 |
-
# Real-time sequence stats
|
| 351 |
-
sequence_stats = gr.HTML(value="", elem_classes=["sequence-stats"])
|
| 352 |
-
|
| 353 |
-
with gr.Row():
|
| 354 |
-
submit_btn = gr.Button("🔬 Analyze Sequence", variant="primary", size="lg", scale=2)
|
| 355 |
-
clear_btn = gr.Button("🗑️ Clear", variant="secondary", size="lg", scale=1)
|
| 356 |
-
|
| 357 |
-
# Example buttons
|
| 358 |
-
gr.Markdown("### 📝 Quick Examples:")
|
| 359 |
-
with gr.Row():
|
| 360 |
-
example1_btn = gr.Button("Short Gene", variant="secondary", size="sm")
|
| 361 |
-
example2_btn = gr.Button("Longer Sequence", variant="secondary", size="sm")
|
| 362 |
-
|
| 363 |
-
with gr.Column(scale=2):
|
| 364 |
-
output = gr.Textbox(
|
| 365 |
-
label="🔬 Analysis Results",
|
| 366 |
-
lines=25,
|
| 367 |
-
max_lines=35,
|
| 368 |
-
show_copy_button=True,
|
| 369 |
-
container=True,
|
| 370 |
-
placeholder="Results will appear here after analysis..."
|
| 371 |
-
)
|
| 372 |
-
|
| 373 |
-
# Footer
|
| 374 |
-
gr.HTML('''
|
| 375 |
-
<div style="text-align: center; margin-top: 2rem; padding: 1rem; border-top: 1px solid #dee2e6; color: #6c757d;">
|
| 376 |
-
<small>🧬 Powered by boundary-aware deep learning | Built with PyTorch & Gradio</small>
|
| 377 |
-
</div>
|
| 378 |
-
''')
|
| 379 |
-
|
| 380 |
-
# Event handlers
|
| 381 |
-
def update_stats(sequence):
|
| 382 |
-
return get_sequence_stats(sequence)
|
| 383 |
-
|
| 384 |
-
# Real-time sequence stats update
|
| 385 |
-
sequence_input.change(
|
| 386 |
-
fn=update_stats,
|
| 387 |
-
inputs=sequence_input,
|
| 388 |
-
outputs=sequence_stats
|
| 389 |
-
)
|
| 390 |
-
|
| 391 |
-
# Main prediction
|
| 392 |
-
submit_btn.click(
|
| 393 |
-
fn=predict_genes,
|
| 394 |
-
inputs=sequence_input,
|
| 395 |
-
outputs=output
|
| 396 |
-
)
|
| 397 |
-
|
| 398 |
-
# Clear functionality
|
| 399 |
-
clear_btn.click(
|
| 400 |
-
fn=lambda: ("", "", ""),
|
| 401 |
-
outputs=[sequence_input, output, sequence_stats]
|
| 402 |
-
)
|
| 403 |
-
|
| 404 |
-
# Example buttons
|
| 405 |
-
example1_btn.click(
|
| 406 |
-
fn=lambda: examples[0][0],
|
| 407 |
-
outputs=sequence_input
|
| 408 |
-
)
|
| 409 |
-
|
| 410 |
-
example2_btn.click(
|
| 411 |
-
fn=lambda: examples[1][0],
|
| 412 |
-
outputs=sequence_input
|
| 413 |
-
)
|
| 414 |
-
|
| 415 |
-
# Allow Enter key to submit
|
| 416 |
-
sequence_input.submit(
|
| 417 |
-
fn=predict_genes,
|
| 418 |
-
inputs=sequence_input,
|
| 419 |
-
outputs=output
|
| 420 |
-
)
|
| 421 |
|
| 422 |
-
|
|
|
|
| 423 |
|
| 424 |
-
# Create and launch the interface
|
| 425 |
if __name__ == "__main__":
|
| 426 |
-
|
| 427 |
-
|
| 428 |
-
# Create the interface
|
| 429 |
-
demo = create_interface()
|
| 430 |
-
|
| 431 |
-
print(f"Model loaded: {model_loaded}")
|
| 432 |
-
print(f"Open your browser to see the interface")
|
| 433 |
-
|
| 434 |
-
# Launch with Hugging Face Spaces compatible settings
|
| 435 |
-
demo.launch(
|
| 436 |
-
server_name="0.0.0.0",
|
| 437 |
-
server_port=7860,
|
| 438 |
-
share=False,
|
| 439 |
-
debug=False,
|
| 440 |
-
show_error=True,
|
| 441 |
-
quiet=False
|
| 442 |
-
)
|
|
|
|
| 1 |
import gradio as gr
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 2 |
|
| 3 |
+
def test_function(text):
|
| 4 |
+
return f"You entered: {text}"
|
|
|
|
| 5 |
|
| 6 |
+
# Simple test interface
|
| 7 |
+
with gr.Blocks(title="Test App") as demo:
|
| 8 |
+
gr.Markdown("# Test Interface")
|
| 9 |
+
with gr.Row():
|
| 10 |
+
input_box = gr.Textbox(label="Input")
|
| 11 |
+
output_box = gr.Textbox(label="Output")
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 12 |
|
| 13 |
+
btn = gr.Button("Process")
|
| 14 |
+
btn.click(test_function, inputs=input_box, outputs=output_box)
|
| 15 |
|
|
|
|
| 16 |
if __name__ == "__main__":
|
| 17 |
+
demo.launch()
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|