Update app.py

app.py

@@ -830,7 +830,7 @@ def create_interface():
                     
                     gr.Markdown("\n".join(model_status))
         
-        with gr.Tab("📊 Results"):
+                with gr.Tab("📊 Results"):
             with gr.Row():
                 with gr.Column():
                     # Text outputs
@@ -863,11 +863,9 @@ def create_interface():
             gr.Markdown("### 🌲 Phylogenetic Tree Visualization (ML Simplified Tree)")
             tree_html = gr.HTML(
                 label="Interactive Tree",
-                value="<p>Click 'Show Tree' to view the ML Simplified Tree in a new tab or 'Download Tree' to save it.</p>"
+                value="<p>Click 'Show Tree' to view the ML Simplified Tree in a new tab.</p>"
             )
-            with gr.Row():
-                show_tree_btn = gr.Button("👁️ Show Tree", variant="secondary")
-                download_tree_btn = gr.Button("⬇️ Download Tree", variant="secondary")
+            show_tree_btn = gr.Button("👁️ Show Tree", variant="secondary")
 
             # File downloads
             gr.Markdown("### 📁 Download Results")
@@ -887,7 +885,6 @@ def create_interface():
                     interactive=False
                 )
         
-          
         # Event handlers
         def run_analysis_text(dna_seq, sim_score, build_tree):
             return run_pipeline(dna_seq, sim_score, build_tree)
@@ -908,18 +905,13 @@ def create_interface():
         def show_tree(html_file):
             if html_file and os.path.exists(html_file):
                 try:
-                    # Serve the file directly using Gradio's file endpoint
+                    # Use the same file-serving URL as the download link
                     file_url = f"/file={html_file}"
                     return gr.update(value=f"<script>window.open('{file_url}', '_blank');</script>")
                 except Exception as e:
-                    return gr.update(value=f"<p>Error showing tree: {str(e)}. Please use the 'Download Tree' button and open manually.</p>")
+                    return gr.update(value=f"<p>Error showing tree: {str(e)}. Please download and open the file manually.</p>")
             return gr.update(value="<p>No tree file available. Run analysis to generate one.</p>")
         
-        def download_tree(html_file):
-            if html_file and os.path.exists(html_file):
-                return gr.File.update(value=html_file, visible=True)
-            return gr.File.update(value=None, visible=False)
-        
         # Connect events
         run_btn.click(
             fn=run_analysis_combined,
@@ -942,16 +934,6 @@ def create_interface():
             outputs=[tree_html]
         )
         
-        download_tree_btn.click(
-            fn=download_tree,
-            inputs=[html_file],
-            outputs=[html_file]
-        )
-        
-        # Example data loading
-        gr.Markdown("### 🧪 Example Data")
-        example_btn = gr.Button("Load Example F Gene Sequence", variant="secondary")
-        
         def load_example():
             example_seq = "ATGAAACTGTCAACACTCACTGAGTACATTAGCCAAGTTCTCAAGACTGAGTGTTTACCTTTGTGAATACACTGAGTCCTTGTCAACGTTCGGCTGCAGTCACACTGATGGTCTTGTCTTCAGGAGCAACTGCAGTCTGTGCTGTGTACTATAGTGCTAAGAGTGATAATGCACTGTTCAGTACCTTTGACAGTGTGTCTCTGTCACCTGGTGCTATGCAGAGCTGCGATGAGATCTACATTGGTCTGATCGATAAGACTGAGTCCAAGGGTGTTGCTGTGTGTACTGTAGAGTGTGATAGTGTTGCCTGCACTGTGTCTATGGCTGATCTTGAGGCTCTGCTTATGTCAACACTGAGTGTGAAATGTTCATTTGCTACTTCAAGACTGATGTGAAGACTGTGTATTGTACTCAGTCATGCAGAGTGAAGTCCTTGAGCCACTTGCTTTGTACAATGTGGGTGATGAGATGTTGTGCTGCAGTGTCAAGGGGCCACAGTCTTGCCTTGATAGTGCGATTGCTGTGATGATGTGCACTTCAATGAGTGGTCGAGATGCTGCTGTGTGTAAGGATGCTGCTGTGTGTAAGAAGGATGCTGCTGTGTGTAAGA"
             return example_seq, "Example F gene sequence loaded"