cleanup

app.py

@@ -9,89 +9,76 @@ def convert_df(df):
     # IMPORTANT: Cache the conversion to prevent computation on every rerun
     return df.to_csv().encode('utf-8')
 
-# title and instructions
+
+# title and initialization
 st.title('TIGER Cas13 Efficacy Prediction')
-st.session_state["fasta_seq"] = ""
-st.session_state["text_seq"] = ""
-status_bar, status_text = None, None
+st.session_state['manual_seq'] = ''
+st.session_state['fasta_seq'] = ''
 
+# run mode selection
 with st.form(key='calc_options'):
-    c1_names = ['On Target Only', 'On and Off Target']
-    option = st.radio('Calculation Options', c1_names, index=0)
-    submitButton = st.form_submit_button(label='Choose Options')
+    c1_names = ['On-target', 'On- and off-target']
+    option = st.radio('Select mode:', c1_names, index=0)
+    submitButton = st.form_submit_button(label='Choose options')
 
-# UserInput Form from text input
-text_form = st.form("text")
-text_input = text_form.text_input(
+# text input
+manual_entry = st.form('text')
+manual_input = manual_entry.manual_input(
     label='Enter a target transcript:',
     #value='ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC',
     placeholder='Upper or lower case')
-if text_input:
-    # input is too short
-    if len(text_input) < TARGET_LEN:
-        transcript_len = len(text_input)
-        text_form.write('Transcript length ({:d}) must be at least {:d} bases.'.format(transcript_len, TARGET_LEN))
+if manual_input:
+    if len(manual_input) < TARGET_LEN:
+        manual_entry.write('Transcript must be at least {:d} bases.'.format(TARGET_LEN))
     else:
-        st.session_state["text_seq"] = text_input
-text_calc = text_form.form_submit_button(label="calculate")
-#status bar
-status_text_textform = text_form.empty()
-status_bar_textform = text_form.progress(0)
-
+        st.session_state['manual_seq'] = manual_input
 
-# UserInput Form from file
-fasta_form = st.form("fasta")
-fasta = fasta_form.file_uploader(label="upload fasta file") 
-if fasta:
-    if os.path.exists("temp"):
-        shutil.rmtree("temp")
-    os.makedirs("temp")
-    fname = fasta.name 
-    st.write(fname)
-    fpath = os.path.join("temp", fname)
-    with open(fpath, "w") as f:
-        f.write(fasta.getvalue().decode("utf-8"))
+# fasta input
+fasta_form = st.form('fasta')
+fasta_input = fasta_form.file_uploader(label='Upload a fasta file:')
+if fasta_input:
+    if os.path.exists('temp'):
+        shutil.rmtree('temp')
+    os.makedirs('temp')
+    st.write(fasta_input.name)
+    fpath = os.path.join('temp', fasta_input.name)
+    with open(fpath, 'w') as f:
+        f.write(fasta_input.getvalue().decode('utf-8'))
     transcript_tbl = load_transcripts([fpath])
-    fasta_form.text("fasta file contents")
+    fasta_form.text('fasta file contents')
     fasta_form.write(transcript_tbl)
     seq = transcript_tbl['seq'][0]
-    st.session_state["fasta_seq"] = seq
-fasta_calc = fasta_form.form_submit_button(label="calculate")
-status_text_fastaform = fasta_form.empty()
-status_bar_fastaform = fasta_form.progress(0)
-#st.write(text_calc)
-#st.write(fasta_calc)
+    st.session_state['fasta_seq'] = seq
 
-#Calculation
-if text_calc:
-    src_seq = st.session_state["text_seq"]
-    status_text = status_text_textform
-    status_bar= status_bar_textform
-elif fasta_calc:
-    src_seq = st.session_state["fasta_seq"]
-    status_text = status_text_fastaform
-    status_bar= status_bar_fastaform
+# input-specific configuration
+if manual_entry.form_submit_button(label='Calculate'):
+    src_seq = st.session_state['manual_seq']
+    status_text = manual_entry.empty()
+    status_bar = manual_entry.progress(0)
+elif fasta_form.form_submit_button(label='Calculate'):
+    src_seq = st.session_state['fasta_seq']
+    status_text = fasta_form.empty()
+    status_bar = fasta_form.progress(0)
 else:
-    src_seq = ""
-#st.write(src_seq)
+    src_seq = status_bar = status_text = None
 
 # valid input
 if src_seq and all([True if nt.upper() in NUCLEOTIDE_TOKENS.keys() else False for nt in src_seq]):
     on_target, off_target = tiger_exhibit(pd.DataFrame(dict(id=['ManualEntry'], seq=[src_seq])),
-            status_bar, status_text, check_off_targets=option == 'On and Off Target')
-    on_target.rename(columns={"Guide":"23 nt guide sequence"}, inplace=True)
-    if len(on_target)>0:
-        if on_target.iloc[0]["On-target ID"] == 0:
-            on_target.drop(["On-target ID"], axis=1, inplace=True)
+                                          status_bar, status_text, check_off_targets=option == 'On and Off Target')
+    on_target.rename(columns={'Guide': '23 nt guide sequence'}, inplace=True)
+    if len(on_target) > 0:
+        if on_target.iloc[0]['On-target ID'] == 0:
+            on_target.drop(['On-target ID'], axis=1, inplace=True)
     st.write('On-target predictions: ', on_target)
     st.download_button(label='Download', data=convert_df(on_target), file_name='on_target.csv', mime='text/csv')
-    if len(off_target) > 0:
-        off_target.rename(columns={"Guide":"23 nt guide sequence"}, inplace=True)
+    if option == 'On and Off Target' and len(off_target) > 0:
+        off_target.rename(columns={'Guide': '23 nt guide sequence'}, inplace=True)
         st.write('Off-target predictions: ', off_target)
         st.download_button(label='Download', data=convert_df(off_target), file_name='off_target.csv', mime='text/csv')
-    else:
+    elif option == 'On and Off Target' and len(off_target) == 0:
         st.write('We did not find any off-target effects!')
 
 # invalid input
-#else:
-#    st.write('Nucleotides other than ACGT detected!')
+else:
+    st.write('Invalid input!')