Spaces:
Running on CPU Upgrade
Running on CPU Upgrade
massive cleanup with better table columns
Browse files
tiger.py
CHANGED
|
@@ -1,6 +1,7 @@
|
|
| 1 |
import argparse
|
| 2 |
import os
|
| 3 |
import gzip
|
|
|
|
| 4 |
import numpy as np
|
| 5 |
import pandas as pd
|
| 6 |
import tensorflow as tf
|
|
@@ -14,6 +15,13 @@ NUCLEOTIDE_TOKENS = dict(zip(['A', 'C', 'G', 'T', 'N'], [0, 1, 2, 3, 255]))
|
|
| 14 |
NUCLEOTIDE_COMPLEMENT = dict(zip(['A', 'C', 'G', 'T'], ['T', 'G', 'C', 'A']))
|
| 15 |
NUM_TOP_GUIDES = 10
|
| 16 |
NUM_MISMATCHES = 3
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 17 |
REFERENCE_TRANSCRIPTS = ('gencode.v19.pc_transcripts.fa.gz', 'gencode.v19.lncRNA_transcripts.fa.gz')
|
| 18 |
BATCH_SIZE_COMPUTE = 500
|
| 19 |
BATCH_SIZE_SCAN = 20
|
|
@@ -35,18 +43,18 @@ def load_transcripts(fasta_files):
|
|
| 35 |
try:
|
| 36 |
if os.path.splitext(file)[1] == '.gz':
|
| 37 |
with gzip.open(file, 'rt') as f:
|
| 38 |
-
df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(f, 'fasta')], columns=[
|
| 39 |
else:
|
| 40 |
-
df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(file, 'fasta')], columns=[
|
| 41 |
except Exception as e:
|
| 42 |
print(e, 'while loading', file)
|
| 43 |
continue
|
| 44 |
transcripts = pd.concat([transcripts, df])
|
| 45 |
|
| 46 |
# set index
|
| 47 |
-
transcripts[
|
| 48 |
-
transcripts.set_index(
|
| 49 |
-
assert not transcripts.index.has_duplicates, "duplicate transcript ID's detected"
|
| 50 |
|
| 51 |
return transcripts
|
| 52 |
|
|
@@ -101,6 +109,9 @@ def process_data(transcript_seq: str):
|
|
| 101 |
|
| 102 |
|
| 103 |
def prediction_transform(predictions: np.array, **params):
|
|
|
|
|
|
|
|
|
|
| 104 |
|
| 105 |
if UNIT_INTERVAL_MAP == 'sigmoid':
|
| 106 |
return 1 - 1 / (1 + np.exp(params['a'] * predictions + params['b']))
|
|
@@ -135,23 +146,47 @@ def prediction_transform(predictions: np.array, **params):
|
|
| 135 |
raise NotImplementedError
|
| 136 |
|
| 137 |
|
| 138 |
-
def
|
| 139 |
-
return 1 - np.clip(parent - guide, a_min=0.0, a_max=1.0)
|
| 140 |
|
|
|
|
|
|
|
|
|
|
| 141 |
|
| 142 |
-
|
|
|
|
| 143 |
|
| 144 |
-
|
| 145 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 146 |
|
| 147 |
-
|
| 148 |
-
|
| 149 |
-
|
| 150 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
| 151 |
|
| 152 |
return predictions
|
| 153 |
|
| 154 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 155 |
def find_off_targets(top_guides: pd.DataFrame, status_bar, status_text):
|
| 156 |
|
| 157 |
# load reference transcripts
|
|
@@ -171,7 +206,7 @@ def find_off_targets(top_guides: pd.DataFrame, status_bar, status_text):
|
|
| 171 |
i += BATCH_SIZE_SCAN
|
| 172 |
|
| 173 |
# find locations of off-targets
|
| 174 |
-
transcripts = one_hot_encode_sequence(df_batch[
|
| 175 |
num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME')
|
| 176 |
loc_off_targets = tf.where(tf.round(num_mismatches) <= NUM_MISMATCHES).numpy()
|
| 177 |
|
|
@@ -183,7 +218,7 @@ def find_off_targets(top_guides: pd.DataFrame, status_bar, status_text):
|
|
| 183 |
'On-target ID': top_guides.iloc[loc_off_targets[:, 2]]['On-target ID'],
|
| 184 |
'Guide': top_guides.iloc[loc_off_targets[:, 2]]['Guide'],
|
| 185 |
'Off-target ID': df_batch.index.values[loc_off_targets[:, 0]],
|
| 186 |
-
'Target': df_batch[
|
| 187 |
'Mismatches': tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int),
|
| 188 |
'Midpoint': loc_off_targets[:, 1],
|
| 189 |
}).to_dict('records')
|
|
@@ -224,12 +259,12 @@ def predict_off_target(off_targets: pd.DataFrame, model: tf.keras.Model):
|
|
| 224 |
tf.reshape(one_hot_encode_sequence(off_targets['Target'], add_context_padding=False), [len(off_targets), -1]),
|
| 225 |
tf.reshape(one_hot_encode_sequence(off_targets['Guide'], add_context_padding=True), [len(off_targets), -1]),
|
| 226 |
], axis=-1)
|
| 227 |
-
off_targets[
|
| 228 |
|
| 229 |
-
return off_targets.sort_values(
|
| 230 |
|
| 231 |
|
| 232 |
-
def tiger_exhibit(transcripts: pd.DataFrame, status_bar=None, status_text=None
|
| 233 |
|
| 234 |
# load model
|
| 235 |
if os.path.exists('model'):
|
|
@@ -238,31 +273,30 @@ def tiger_exhibit(transcripts: pd.DataFrame, status_bar=None, status_text=None,
|
|
| 238 |
print('no saved model!')
|
| 239 |
exit()
|
| 240 |
|
| 241 |
-
#
|
| 242 |
-
|
| 243 |
-
on_target_predictions = pd.DataFrame(columns=['On-target ID', 'Guide', 'Normalized LFC'])
|
| 244 |
-
for i, (index, row) in enumerate(transcripts.iterrows()):
|
| 245 |
-
df = predict_on_target(row['seq'], model=tiger)
|
| 246 |
-
df['On-target ID'] = index
|
| 247 |
-
on_target_predictions = pd.concat([on_target_predictions, df.iloc[:NUM_TOP_GUIDES]])
|
| 248 |
|
| 249 |
-
|
| 250 |
-
if status_bar:
|
| 251 |
-
status_text.text("Scanning for on-targets Percent complete: {:.2f}%".format(100 * min((i + 1) / len(transcripts), 1)))
|
| 252 |
-
status_bar.progress(int(100 * min((i + 1) / len(transcripts), 1)))
|
| 253 |
-
print('\rPercent complete: {:.2f}%'.format(100 * min((i + 1) / len(transcripts), 1)), end='')
|
| 254 |
-
print('')
|
| 255 |
-
|
| 256 |
-
# predict off-target effects for top guides
|
| 257 |
off_target_predictions = pd.DataFrame()
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 258 |
if check_off_targets:
|
| 259 |
off_targets = find_off_targets(on_target_predictions, status_bar, status_text)
|
| 260 |
off_target_predictions = predict_off_target(off_targets, model=tiger)
|
| 261 |
|
| 262 |
# reverse guide sequences
|
| 263 |
-
on_target_predictions[
|
| 264 |
if check_off_targets and len(off_target_predictions) > 0:
|
| 265 |
-
off_target_predictions[
|
| 266 |
|
| 267 |
return on_target_predictions.reset_index(drop=True), off_target_predictions.reset_index(drop=True)
|
| 268 |
|
|
@@ -279,9 +313,11 @@ if __name__ == '__main__':
|
|
| 279 |
# simple test case
|
| 280 |
if args.simple_test:
|
| 281 |
# first 50 from EIF3B-003's CDS
|
| 282 |
-
simple_test = pd.DataFrame(
|
| 283 |
-
|
| 284 |
-
|
|
|
|
|
|
|
| 285 |
df_on_target.to_csv('on_target.csv')
|
| 286 |
if args.check_off_targets:
|
| 287 |
df_off_target.to_csv('off_target.csv')
|
|
@@ -306,7 +342,9 @@ if __name__ == '__main__':
|
|
| 306 |
|
| 307 |
# run batch
|
| 308 |
idx_stop = min(idx + BATCH_SIZE_TRANSCRIPTS, len(df_transcripts))
|
| 309 |
-
df_on_target, df_off_target = tiger_exhibit(df_transcripts[idx:idx_stop],
|
|
|
|
|
|
|
| 310 |
|
| 311 |
# save batch results
|
| 312 |
df_on_target.to_csv('on_target.csv', header=batch == 1, index=False, mode='a')
|
|
|
|
| 1 |
import argparse
|
| 2 |
import os
|
| 3 |
import gzip
|
| 4 |
+
import pickle
|
| 5 |
import numpy as np
|
| 6 |
import pandas as pd
|
| 7 |
import tensorflow as tf
|
|
|
|
| 15 |
NUCLEOTIDE_COMPLEMENT = dict(zip(['A', 'C', 'G', 'T'], ['T', 'G', 'C', 'A']))
|
| 16 |
NUM_TOP_GUIDES = 10
|
| 17 |
NUM_MISMATCHES = 3
|
| 18 |
+
ID_COL = 'Transcript ID'
|
| 19 |
+
SEQ_COL = 'Sequence'
|
| 20 |
+
TARGET_COL = 'Target Sequence'
|
| 21 |
+
GUIDE_COL = 'Guide Sequence'
|
| 22 |
+
SCORE_COL = 'Guide Score'
|
| 23 |
+
RUN_MODE_ALL_PM = 'All on-target guides per transcript'
|
| 24 |
+
RUN_MODE_TITRATION = 'Top guides per transcript'
|
| 25 |
REFERENCE_TRANSCRIPTS = ('gencode.v19.pc_transcripts.fa.gz', 'gencode.v19.lncRNA_transcripts.fa.gz')
|
| 26 |
BATCH_SIZE_COMPUTE = 500
|
| 27 |
BATCH_SIZE_SCAN = 20
|
|
|
|
| 43 |
try:
|
| 44 |
if os.path.splitext(file)[1] == '.gz':
|
| 45 |
with gzip.open(file, 'rt') as f:
|
| 46 |
+
df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(f, 'fasta')], columns=[ID_COL, SEQ_COL])
|
| 47 |
else:
|
| 48 |
+
df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(file, 'fasta')], columns=[ID_COL, SEQ_COL])
|
| 49 |
except Exception as e:
|
| 50 |
print(e, 'while loading', file)
|
| 51 |
continue
|
| 52 |
transcripts = pd.concat([transcripts, df])
|
| 53 |
|
| 54 |
# set index
|
| 55 |
+
transcripts[ID_COL] = transcripts[ID_COL].apply(lambda s: s.split('|')[0])
|
| 56 |
+
transcripts.set_index(ID_COL, inplace=True)
|
| 57 |
+
assert not transcripts.index.has_duplicates, "duplicate transcript ID's detected in fasta file"
|
| 58 |
|
| 59 |
return transcripts
|
| 60 |
|
|
|
|
| 109 |
|
| 110 |
|
| 111 |
def prediction_transform(predictions: np.array, **params):
|
| 112 |
+
if len(params) == 0:
|
| 113 |
+
with open('transform_params.pkl', 'rb') as f:
|
| 114 |
+
params = pickle.load(f)
|
| 115 |
|
| 116 |
if UNIT_INTERVAL_MAP == 'sigmoid':
|
| 117 |
return 1 - 1 / (1 + np.exp(params['a'] * predictions + params['b']))
|
|
|
|
| 146 |
raise NotImplementedError
|
| 147 |
|
| 148 |
|
| 149 |
+
def get_on_target_predictions(transcripts: pd.DataFrame, model: tf.keras.Model, status_bar=None, status_text=None):
|
|
|
|
| 150 |
|
| 151 |
+
# loop over transcripts
|
| 152 |
+
predictions = pd.DataFrame()
|
| 153 |
+
for i, (index, row) in enumerate(transcripts.iterrows()):
|
| 154 |
|
| 155 |
+
# parse transcript sequence
|
| 156 |
+
target_seq, guide_seq, model_inputs = process_data(row[SEQ_COL])
|
| 157 |
|
| 158 |
+
# get predictions
|
| 159 |
+
lfc_estimate = model.predict(model_inputs, batch_size=BATCH_SIZE_COMPUTE, verbose=False)
|
| 160 |
+
scores = prediction_transform(tf.squeeze(lfc_estimate).numpy())
|
| 161 |
+
predictions = pd.concat([predictions, pd.DataFrame({
|
| 162 |
+
ID_COL: [index] * len(scores),
|
| 163 |
+
TARGET_COL: [seq[CONTEXT_5P:len(seq) - CONTEXT_3P] for seq in target_seq],
|
| 164 |
+
GUIDE_COL: guide_seq,
|
| 165 |
+
SCORE_COL: scores})])
|
| 166 |
|
| 167 |
+
# progress update
|
| 168 |
+
percent_complete = 100 * min((i + 1) / len(transcripts), 1)
|
| 169 |
+
update_text = 'Evaluating on-target guides for each transcript: {:.2f}%'.format(percent_complete)
|
| 170 |
+
if status_bar:
|
| 171 |
+
status_text.text()
|
| 172 |
+
status_bar.progress(int(100 * min((i + 1) / len(transcripts), 1)))
|
| 173 |
+
print('\r' + update_text, end='')
|
| 174 |
+
print('')
|
| 175 |
|
| 176 |
return predictions
|
| 177 |
|
| 178 |
|
| 179 |
+
def top_guides_per_transcript(predictions: pd.DataFrame):
|
| 180 |
+
|
| 181 |
+
top_guides = pd.DataFrame()
|
| 182 |
+
for transcript in predictions[ID_COL].unique():
|
| 183 |
+
df = predictions.loc[predictions[ID_COL] == transcript]
|
| 184 |
+
df = df.sort_values(SCORE_COL, ascending=False).reset_index(drop=True).iloc[:NUM_TOP_GUIDES]
|
| 185 |
+
top_guides = pd.concat([top_guides, df])
|
| 186 |
+
|
| 187 |
+
return top_guides.reset_index(drop=True)
|
| 188 |
+
|
| 189 |
+
|
| 190 |
def find_off_targets(top_guides: pd.DataFrame, status_bar, status_text):
|
| 191 |
|
| 192 |
# load reference transcripts
|
|
|
|
| 206 |
i += BATCH_SIZE_SCAN
|
| 207 |
|
| 208 |
# find locations of off-targets
|
| 209 |
+
transcripts = one_hot_encode_sequence(df_batch[SEQ_COL].values.tolist(), add_context_padding=False)
|
| 210 |
num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME')
|
| 211 |
loc_off_targets = tf.where(tf.round(num_mismatches) <= NUM_MISMATCHES).numpy()
|
| 212 |
|
|
|
|
| 218 |
'On-target ID': top_guides.iloc[loc_off_targets[:, 2]]['On-target ID'],
|
| 219 |
'Guide': top_guides.iloc[loc_off_targets[:, 2]]['Guide'],
|
| 220 |
'Off-target ID': df_batch.index.values[loc_off_targets[:, 0]],
|
| 221 |
+
'Target': df_batch[SEQ_COL].values[loc_off_targets[:, 0]],
|
| 222 |
'Mismatches': tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int),
|
| 223 |
'Midpoint': loc_off_targets[:, 1],
|
| 224 |
}).to_dict('records')
|
|
|
|
| 259 |
tf.reshape(one_hot_encode_sequence(off_targets['Target'], add_context_padding=False), [len(off_targets), -1]),
|
| 260 |
tf.reshape(one_hot_encode_sequence(off_targets['Guide'], add_context_padding=True), [len(off_targets), -1]),
|
| 261 |
], axis=-1)
|
| 262 |
+
off_targets[SCORE_COL] = model.predict(model_inputs, batch_size=BATCH_SIZE_COMPUTE, verbose=False)
|
| 263 |
|
| 264 |
+
return off_targets.sort_values(SCORE_COL)
|
| 265 |
|
| 266 |
|
| 267 |
+
def tiger_exhibit(transcripts: pd.DataFrame, run_mode: str, check_off_targets: bool, status_bar=None, status_text=None):
|
| 268 |
|
| 269 |
# load model
|
| 270 |
if os.path.exists('model'):
|
|
|
|
| 273 |
print('no saved model!')
|
| 274 |
exit()
|
| 275 |
|
| 276 |
+
# evaluate all on-target guides per transcript
|
| 277 |
+
on_target_predictions = get_on_target_predictions(transcripts, tiger, status_bar, status_text)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 278 |
|
| 279 |
+
# initialize other outputs
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 280 |
off_target_predictions = pd.DataFrame()
|
| 281 |
+
|
| 282 |
+
if run_mode == RUN_MODE_ALL_PM:
|
| 283 |
+
return on_target_predictions, off_target_predictions
|
| 284 |
+
|
| 285 |
+
elif run_mode == RUN_MODE_TITRATION: # TODO: and titration candidates
|
| 286 |
+
on_target_predictions = top_guides_per_transcript(on_target_predictions)
|
| 287 |
+
|
| 288 |
+
else:
|
| 289 |
+
raise NotImplementedError
|
| 290 |
+
|
| 291 |
+
# check off-target effects for top guides
|
| 292 |
if check_off_targets:
|
| 293 |
off_targets = find_off_targets(on_target_predictions, status_bar, status_text)
|
| 294 |
off_target_predictions = predict_off_target(off_targets, model=tiger)
|
| 295 |
|
| 296 |
# reverse guide sequences
|
| 297 |
+
on_target_predictions[GUIDE_COL] = on_target_predictions[GUIDE_COL].apply(lambda s: s[::-1])
|
| 298 |
if check_off_targets and len(off_target_predictions) > 0:
|
| 299 |
+
off_target_predictions[GUIDE_COL] = off_target_predictions[GUIDE_COL].apply(lambda s: s[::-1])
|
| 300 |
|
| 301 |
return on_target_predictions.reset_index(drop=True), off_target_predictions.reset_index(drop=True)
|
| 302 |
|
|
|
|
| 313 |
# simple test case
|
| 314 |
if args.simple_test:
|
| 315 |
# first 50 from EIF3B-003's CDS
|
| 316 |
+
simple_test = pd.DataFrame({
|
| 317 |
+
ID_COL: ['ManualEntry'],
|
| 318 |
+
SEQ_COL: ['ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC']})
|
| 319 |
+
simple_test.set_index(ID_COL, inplace=True)
|
| 320 |
+
df_on_target, df_off_target = tiger_exhibit(simple_test, check_off_targets=args.off_target)
|
| 321 |
df_on_target.to_csv('on_target.csv')
|
| 322 |
if args.check_off_targets:
|
| 323 |
df_off_target.to_csv('off_target.csv')
|
|
|
|
| 342 |
|
| 343 |
# run batch
|
| 344 |
idx_stop = min(idx + BATCH_SIZE_TRANSCRIPTS, len(df_transcripts))
|
| 345 |
+
df_on_target, df_off_target = tiger_exhibit(df_transcripts[idx:idx_stop],
|
| 346 |
+
run_mode=RUN_MODE_TITRATION,
|
| 347 |
+
check_off_targets=args.check_off_targets)
|
| 348 |
|
| 349 |
# save batch results
|
| 350 |
df_on_target.to_csv('on_target.csv', header=batch == 1, index=False, mode='a')
|