Spaces:
Running on CPU Upgrade
Running on CPU Upgrade
Commit ·
d3204b1
1
Parent(s): 89ee386
Handle fasta file input seperately
Browse files
app.py
CHANGED
|
@@ -1,6 +1,7 @@
|
|
| 1 |
import pandas as pd
|
| 2 |
import streamlit as st
|
| 3 |
-
|
|
|
|
| 4 |
|
| 5 |
|
| 6 |
@st.cache
|
|
@@ -8,25 +9,66 @@ def convert_df(df):
|
|
| 8 |
# IMPORTANT: Cache the conversion to prevent computation on every rerun
|
| 9 |
return df.to_csv().encode('utf-8')
|
| 10 |
|
| 11 |
-
|
| 12 |
# title and instructions
|
| 13 |
st.title('TIGER Cas13 Efficacy Prediction')
|
| 14 |
-
st.session_state[
|
| 15 |
-
st.session_state[
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 16 |
label='Enter a target transcript:',
|
| 17 |
-
#
|
| 18 |
placeholder='Upper or lower case')
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 19 |
#status bar
|
| 20 |
-
|
| 21 |
-
|
| 22 |
-
|
| 23 |
-
|
| 24 |
-
|
| 25 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 26 |
|
| 27 |
# valid input
|
| 28 |
-
|
| 29 |
-
on_target, off_target = tiger_exhibit(pd.DataFrame(dict(id=['ManualEntry'], seq=[
|
| 30 |
status_bar, status_text)
|
| 31 |
st.write('On-target predictions: ', on_target)
|
| 32 |
st.download_button(label='Download', data=convert_df(on_target), file_name='on_target.csv', mime='text/csv')
|
|
@@ -37,5 +79,5 @@ elif all([True if nt.upper() in NUCLEOTIDE_TOKENS.keys() else False for nt in st
|
|
| 37 |
st.write('We did not find any off-target effects!')
|
| 38 |
|
| 39 |
# invalid input
|
| 40 |
-
else:
|
| 41 |
-
st.write('Nucleotides other than ACGT detected!')
|
|
|
|
| 1 |
import pandas as pd
|
| 2 |
import streamlit as st
|
| 3 |
+
import os
|
| 4 |
+
from tiger import tiger_exhibit, load_transcripts, TARGET_LEN, NUCLEOTIDE_TOKENS
|
| 5 |
|
| 6 |
|
| 7 |
@st.cache
|
|
|
|
| 9 |
# IMPORTANT: Cache the conversion to prevent computation on every rerun
|
| 10 |
return df.to_csv().encode('utf-8')
|
| 11 |
|
|
|
|
| 12 |
# title and instructions
|
| 13 |
st.title('TIGER Cas13 Efficacy Prediction')
|
| 14 |
+
st.session_state["fasta_seq"] = ""
|
| 15 |
+
st.session_state["text_seq"] = ""
|
| 16 |
+
status_bar, status_text = None, None
|
| 17 |
+
|
| 18 |
+
# UserInput Form from text input
|
| 19 |
+
text_form = st.form("text")
|
| 20 |
+
text_input = text_form.text_input(
|
| 21 |
label='Enter a target transcript:',
|
| 22 |
+
#value='ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC',
|
| 23 |
placeholder='Upper or lower case')
|
| 24 |
+
if text_input:
|
| 25 |
+
# input is too short
|
| 26 |
+
if len(text_input) < TARGET_LEN:
|
| 27 |
+
transcript_len = len(text_input)
|
| 28 |
+
text_form.write('Transcript length ({:d}) must be at least {:d} bases.'.format(transcript_len, TARGET_LEN))
|
| 29 |
+
else:
|
| 30 |
+
st.session_state["text_seq"] = text_input
|
| 31 |
+
text_calc = text_form.form_submit_button(label="calculate")
|
| 32 |
#status bar
|
| 33 |
+
status_text_textform = text_form.empty()
|
| 34 |
+
status_bar_textform = text_form.progress(0)
|
| 35 |
+
|
| 36 |
+
|
| 37 |
+
# UserInput Form from file
|
| 38 |
+
fasta_form = st.form("fasta")
|
| 39 |
+
fasta = fasta_form.file_uploader(label="upload fasta file")
|
| 40 |
+
if fasta:
|
| 41 |
+
fname = fasta.name
|
| 42 |
+
st.write(fname)
|
| 43 |
+
with open(fname,"w") as f:
|
| 44 |
+
f.write(fasta.getvalue().decode("utf-8"))
|
| 45 |
+
transcript_tbl = load_transcripts([fname])
|
| 46 |
+
fasta_form.text("fasta file contents")
|
| 47 |
+
fasta_form.write(transcript_tbl)
|
| 48 |
+
seq = transcript_tbl['seq'][0]
|
| 49 |
+
st.session_state["fasta_seq"] = seq
|
| 50 |
+
fasta_calc = fasta_form.form_submit_button(label="calculate")
|
| 51 |
+
status_text_fastaform = fasta_form.empty()
|
| 52 |
+
status_bar_fastaform = fasta_form.progress(0)
|
| 53 |
+
#st.write(text_calc)
|
| 54 |
+
#st.write(fasta_calc)
|
| 55 |
+
|
| 56 |
+
#Calculation
|
| 57 |
+
if text_calc:
|
| 58 |
+
src_seq = st.session_state["text_seq"]
|
| 59 |
+
status_text = status_text_textform
|
| 60 |
+
status_bar= status_bar_textform
|
| 61 |
+
elif fasta_calc:
|
| 62 |
+
src_seq = st.session_state["fasta_seq"]
|
| 63 |
+
status_text = status_text_fastaform
|
| 64 |
+
status_bar= status_bar_fastaform
|
| 65 |
+
else:
|
| 66 |
+
src_seq = ""
|
| 67 |
+
#st.write(src_seq)
|
| 68 |
|
| 69 |
# valid input
|
| 70 |
+
if src_seq and all([True if nt.upper() in NUCLEOTIDE_TOKENS.keys() else False for nt in src_seq]):
|
| 71 |
+
on_target, off_target = tiger_exhibit(pd.DataFrame(dict(id=['ManualEntry'], seq=[src_seq])),
|
| 72 |
status_bar, status_text)
|
| 73 |
st.write('On-target predictions: ', on_target)
|
| 74 |
st.download_button(label='Download', data=convert_df(on_target), file_name='on_target.csv', mime='text/csv')
|
|
|
|
| 79 |
st.write('We did not find any off-target effects!')
|
| 80 |
|
| 81 |
# invalid input
|
| 82 |
+
#else:
|
| 83 |
+
# st.write('Nucleotides other than ACGT detected!')
|