Spaces:
Running on CPU Upgrade
Running on CPU Upgrade
find top guides for all transcripts and then scan off-targets simultaneously
Browse files- .gitignore +2 -0
- tiger.py +53 -25
.gitignore
ADDED
|
@@ -0,0 +1,2 @@
|
|
|
|
|
|
|
|
|
|
| 1 |
+
off_target.csv
|
| 2 |
+
on_target.csv
|
tiger.py
CHANGED
|
@@ -1,7 +1,6 @@
|
|
| 1 |
import argparse
|
| 2 |
import os
|
| 3 |
import gzip
|
| 4 |
-
import numpy as np
|
| 5 |
import pandas as pd
|
| 6 |
import tensorflow as tf
|
| 7 |
from Bio import SeqIO
|
|
@@ -15,6 +14,7 @@ NUCLEOTIDE_COMPLEMENT = dict(zip(['A', 'C', 'G', 'T'], ['T', 'G', 'C', 'A']))
|
|
| 15 |
NUM_TOP_GUIDES = 10
|
| 16 |
NUM_MISMATCHES = 3
|
| 17 |
REFERENCE_TRANSCRIPTS = ('gencode.v19.pc_transcripts.fa.gz', 'gencode.v19.lncRNA_transcripts.fa.gz')
|
|
|
|
| 18 |
|
| 19 |
# configure GPUs
|
| 20 |
for gpu in tf.config.list_physical_devices('GPU'):
|
|
@@ -105,41 +105,42 @@ def predict_on_target(transcript_seq: str, model: tf.keras.Model):
|
|
| 105 |
# get predictions
|
| 106 |
normalized_lfc = model.predict_step(model_inputs)
|
| 107 |
predictions = pd.DataFrame({'Guide': guide_seq, 'Normalized LFC': tf.squeeze(normalized_lfc).numpy()})
|
| 108 |
-
predictions = predictions.
|
| 109 |
|
| 110 |
return predictions
|
| 111 |
|
| 112 |
|
| 113 |
-
def find_off_targets(
|
| 114 |
|
| 115 |
# load reference transcripts
|
| 116 |
reference_transcripts = load_transcripts([os.path.join('transcripts', f) for f in REFERENCE_TRANSCRIPTS])
|
| 117 |
|
| 118 |
# one-hot encode guides to form a filter
|
| 119 |
-
guide_filter = one_hot_encode_sequence(sequence_complement(
|
| 120 |
guide_filter = tf.transpose(guide_filter, [1, 2, 0])
|
| 121 |
guide_filter = tf.cast(guide_filter, tf.float16)
|
| 122 |
|
| 123 |
# loop over transcripts in batches
|
| 124 |
i = 0
|
| 125 |
print('Scanning for off-targets')
|
| 126 |
-
|
| 127 |
while i < len(reference_transcripts):
|
| 128 |
# select batch
|
| 129 |
-
df_batch = reference_transcripts.iloc[i:min(i +
|
| 130 |
-
i +=
|
| 131 |
|
| 132 |
# find and log off-targets
|
| 133 |
transcripts = one_hot_encode_sequence(df_batch['seq'].values.tolist(), add_context_padding=False)
|
| 134 |
transcripts = tf.cast(transcripts, guide_filter.dtype)
|
| 135 |
num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME')
|
| 136 |
loc_off_targets = tf.where(tf.round(num_mismatches) <= NUM_MISMATCHES).numpy()
|
| 137 |
-
|
| 138 |
-
'
|
| 139 |
-
'
|
|
|
|
|
|
|
| 140 |
'Mismatches': tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int),
|
| 141 |
'Midpoint': loc_off_targets[:, 1],
|
| 142 |
-
'Target': df_batch['seq'].values[loc_off_targets[:, 0]],
|
| 143 |
})])
|
| 144 |
|
| 145 |
# progress update
|
|
@@ -147,7 +148,7 @@ def find_off_targets(guides, batch_size=500):
|
|
| 147 |
print('')
|
| 148 |
|
| 149 |
# trim transcripts to targets
|
| 150 |
-
dict_off_targets =
|
| 151 |
for row in dict_off_targets:
|
| 152 |
start_location = row['Midpoint'] - (GUIDE_LEN // 2)
|
| 153 |
if start_location < CONTEXT_5P:
|
|
@@ -160,9 +161,9 @@ def find_off_targets(guides, batch_size=500):
|
|
| 160 |
row['Target'] = row['Target'][start_location - CONTEXT_5P:start_location + GUIDE_LEN + CONTEXT_3P]
|
| 161 |
if row['Mismatches'] == 0 and 'N' not in row['Target']:
|
| 162 |
assert row['Guide'] == sequence_complement([row['Target'][CONTEXT_5P:TARGET_LEN-CONTEXT_3P]])[0]
|
| 163 |
-
|
| 164 |
|
| 165 |
-
return
|
| 166 |
|
| 167 |
|
| 168 |
def predict_off_target(off_targets: pd.DataFrame, model: tf.keras.Model):
|
|
@@ -174,12 +175,12 @@ def predict_off_target(off_targets: pd.DataFrame, model: tf.keras.Model):
|
|
| 174 |
tf.reshape(one_hot_encode_sequence(off_targets['Target'], add_context_padding=False), [len(off_targets), -1]),
|
| 175 |
tf.reshape(one_hot_encode_sequence(off_targets['Guide'], add_context_padding=True), [len(off_targets), -1]),
|
| 176 |
], axis=-1)
|
| 177 |
-
off_targets['Normalized LFC'] = model.
|
| 178 |
|
| 179 |
-
return off_targets.
|
| 180 |
|
| 181 |
|
| 182 |
-
def tiger_exhibit(
|
| 183 |
|
| 184 |
# load model
|
| 185 |
if os.path.exists('model'):
|
|
@@ -188,20 +189,47 @@ def tiger_exhibit(transcript):
|
|
| 188 |
print('no saved model!')
|
| 189 |
exit()
|
| 190 |
|
| 191 |
-
#
|
| 192 |
-
on_target_predictions =
|
| 193 |
-
|
| 194 |
-
|
| 195 |
-
|
|
|
|
| 196 |
|
| 197 |
# predict off-target effects for top guides
|
| 198 |
-
off_targets = find_off_targets(on_target_predictions
|
| 199 |
off_target_predictions = predict_off_target(off_targets, model=tiger)
|
| 200 |
|
| 201 |
-
return on_target_predictions, off_target_predictions
|
| 202 |
|
| 203 |
|
| 204 |
if __name__ == '__main__':
|
| 205 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 206 |
# simple test case
|
| 207 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 1 |
import argparse
|
| 2 |
import os
|
| 3 |
import gzip
|
|
|
|
| 4 |
import pandas as pd
|
| 5 |
import tensorflow as tf
|
| 6 |
from Bio import SeqIO
|
|
|
|
| 14 |
NUM_TOP_GUIDES = 10
|
| 15 |
NUM_MISMATCHES = 3
|
| 16 |
REFERENCE_TRANSCRIPTS = ('gencode.v19.pc_transcripts.fa.gz', 'gencode.v19.lncRNA_transcripts.fa.gz')
|
| 17 |
+
BATCH_SIZE = 500
|
| 18 |
|
| 19 |
# configure GPUs
|
| 20 |
for gpu in tf.config.list_physical_devices('GPU'):
|
|
|
|
| 105 |
# get predictions
|
| 106 |
normalized_lfc = model.predict_step(model_inputs)
|
| 107 |
predictions = pd.DataFrame({'Guide': guide_seq, 'Normalized LFC': tf.squeeze(normalized_lfc).numpy()})
|
| 108 |
+
predictions = predictions.sort_values('Normalized LFC')
|
| 109 |
|
| 110 |
return predictions
|
| 111 |
|
| 112 |
|
| 113 |
+
def find_off_targets(top_guides: pd.DataFrame):
|
| 114 |
|
| 115 |
# load reference transcripts
|
| 116 |
reference_transcripts = load_transcripts([os.path.join('transcripts', f) for f in REFERENCE_TRANSCRIPTS])
|
| 117 |
|
| 118 |
# one-hot encode guides to form a filter
|
| 119 |
+
guide_filter = one_hot_encode_sequence(sequence_complement(top_guides['Guide']), add_context_padding=False)
|
| 120 |
guide_filter = tf.transpose(guide_filter, [1, 2, 0])
|
| 121 |
guide_filter = tf.cast(guide_filter, tf.float16)
|
| 122 |
|
| 123 |
# loop over transcripts in batches
|
| 124 |
i = 0
|
| 125 |
print('Scanning for off-targets')
|
| 126 |
+
off_targets = pd.DataFrame()
|
| 127 |
while i < len(reference_transcripts):
|
| 128 |
# select batch
|
| 129 |
+
df_batch = reference_transcripts.iloc[i:min(i + BATCH_SIZE, len(reference_transcripts))]
|
| 130 |
+
i += BATCH_SIZE
|
| 131 |
|
| 132 |
# find and log off-targets
|
| 133 |
transcripts = one_hot_encode_sequence(df_batch['seq'].values.tolist(), add_context_padding=False)
|
| 134 |
transcripts = tf.cast(transcripts, guide_filter.dtype)
|
| 135 |
num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME')
|
| 136 |
loc_off_targets = tf.where(tf.round(num_mismatches) <= NUM_MISMATCHES).numpy()
|
| 137 |
+
off_targets = pd.concat([off_targets, pd.DataFrame({
|
| 138 |
+
'On-target ID': top_guides.iloc[loc_off_targets[:, 2]]['On-target ID'],
|
| 139 |
+
'Guide': top_guides.iloc[loc_off_targets[:, 2]]['Guide'],
|
| 140 |
+
'Off-target ID': df_batch.index.values[loc_off_targets[:, 0]],
|
| 141 |
+
'Target': df_batch['seq'].values[loc_off_targets[:, 0]],
|
| 142 |
'Mismatches': tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int),
|
| 143 |
'Midpoint': loc_off_targets[:, 1],
|
|
|
|
| 144 |
})])
|
| 145 |
|
| 146 |
# progress update
|
|
|
|
| 148 |
print('')
|
| 149 |
|
| 150 |
# trim transcripts to targets
|
| 151 |
+
dict_off_targets = off_targets.to_dict('records')
|
| 152 |
for row in dict_off_targets:
|
| 153 |
start_location = row['Midpoint'] - (GUIDE_LEN // 2)
|
| 154 |
if start_location < CONTEXT_5P:
|
|
|
|
| 161 |
row['Target'] = row['Target'][start_location - CONTEXT_5P:start_location + GUIDE_LEN + CONTEXT_3P]
|
| 162 |
if row['Mismatches'] == 0 and 'N' not in row['Target']:
|
| 163 |
assert row['Guide'] == sequence_complement([row['Target'][CONTEXT_5P:TARGET_LEN-CONTEXT_3P]])[0]
|
| 164 |
+
off_targets = pd.DataFrame(dict_off_targets)
|
| 165 |
|
| 166 |
+
return off_targets
|
| 167 |
|
| 168 |
|
| 169 |
def predict_off_target(off_targets: pd.DataFrame, model: tf.keras.Model):
|
|
|
|
| 175 |
tf.reshape(one_hot_encode_sequence(off_targets['Target'], add_context_padding=False), [len(off_targets), -1]),
|
| 176 |
tf.reshape(one_hot_encode_sequence(off_targets['Guide'], add_context_padding=True), [len(off_targets), -1]),
|
| 177 |
], axis=-1)
|
| 178 |
+
off_targets['Normalized LFC'] = model.predict(model_inputs, batch_size=BATCH_SIZE, verbose=False)
|
| 179 |
|
| 180 |
+
return off_targets.sort_values('Normalized LFC')
|
| 181 |
|
| 182 |
|
| 183 |
+
def tiger_exhibit(transcripts: pd.DataFrame):
|
| 184 |
|
| 185 |
# load model
|
| 186 |
if os.path.exists('model'):
|
|
|
|
| 189 |
print('no saved model!')
|
| 190 |
exit()
|
| 191 |
|
| 192 |
+
# find top guides for each transcript
|
| 193 |
+
on_target_predictions = pd.DataFrame(columns=['On-target ID', 'Guide', 'Normalized LFC'])
|
| 194 |
+
for index, row in transcripts.iterrows():
|
| 195 |
+
df = predict_on_target(row['seq'], model=tiger)
|
| 196 |
+
df['On-target ID'] = index
|
| 197 |
+
on_target_predictions = pd.concat([on_target_predictions, df.iloc[:NUM_TOP_GUIDES]])
|
| 198 |
|
| 199 |
# predict off-target effects for top guides
|
| 200 |
+
off_targets = find_off_targets(on_target_predictions)
|
| 201 |
off_target_predictions = predict_off_target(off_targets, model=tiger)
|
| 202 |
|
| 203 |
+
return on_target_predictions.reset_index(drop=True), off_target_predictions.reset_index(drop=True)
|
| 204 |
|
| 205 |
|
| 206 |
if __name__ == '__main__':
|
| 207 |
|
| 208 |
+
# common arguments
|
| 209 |
+
parser = argparse.ArgumentParser()
|
| 210 |
+
parser.add_argument('--fasta_path', type=str, default=None)
|
| 211 |
+
parser.add_argument('--simple_test', action='store_true', default=False)
|
| 212 |
+
args = parser.parse_args()
|
| 213 |
+
|
| 214 |
# simple test case
|
| 215 |
+
if args.simple_test:
|
| 216 |
+
# first 50 from EIF3B-003's CDS
|
| 217 |
+
simple_test = pd.DataFrame(dict(id=['user entry'], seq=['ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC']))
|
| 218 |
+
simple_test.set_index('id', inplace=True)
|
| 219 |
+
df_on_target, df_off_target = tiger_exhibit(simple_test)
|
| 220 |
+
df_on_target.to_csv('on_target.csv')
|
| 221 |
+
df_off_target.to_csv('off_target.csv')
|
| 222 |
+
|
| 223 |
+
# # directory of fasta files
|
| 224 |
+
# elif args.dir_in is not None and os.path.exists(args.fasta_path):
|
| 225 |
+
# transcripts = pd.DataFrame()
|
| 226 |
+
# for fasta in os.listdir(args.fasta_path):
|
| 227 |
+
# df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(fasta, 'fasta')], columns=['id', 'seq'])
|
| 228 |
+
#
|
| 229 |
+
# try:
|
| 230 |
+
# for tran in SeqIO.parse(os.path.join(in_path, f), 'fasta'):
|
| 231 |
+
# on_targets, off_targets = tiger_exhibit(str(tran.seq))
|
| 232 |
+
# on_targets.to_csv(os.path.join(out_path, tran.id + '-top-guides.csv'))
|
| 233 |
+
# off_targets.to_csv(os.path.join(out_path, tran.id + '-off-targets.csv'))
|
| 234 |
+
# except Exception:
|
| 235 |
+
# warnings.warn(f)
|