import os import gzip import numpy as np import pandas as pd import tensorflow as tf from Bio import SeqIO GUIDE_LEN = 23 CONTEXT_5P = 3 CONTEXT_3P = 0 TARGET_LEN = CONTEXT_5P + GUIDE_LEN + CONTEXT_3P NUCLEOTIDE_TOKENS = dict(zip(['A', 'C', 'G', 'T'], [0, 1, 2, 3])) NUCLEOTIDE_COMPLEMENT = dict(zip(['A', 'C', 'G', 'T'], ['T', 'G', 'C', 'A'])) NUM_TOP_GUIDES = 10 NUM_MISMATCHES = 3 def sequence_complement(sequence: list): return [''.join([NUCLEOTIDE_COMPLEMENT[nt] for nt in list(seq)]) for seq in sequence] def one_hot_encode_sequence(sequence: list, add_context_padding: bool = False): # stack list of sequences into a tensor sequence = tf.ragged.stack([tf.constant(list(seq)) for seq in sequence], axis=0) # tokenize sequence nucleotide_table = tf.lookup.StaticVocabularyTable( initializer=tf.lookup.KeyValueTensorInitializer( keys=tf.constant(list(NUCLEOTIDE_TOKENS.keys()), dtype=tf.string), values=tf.constant(list(NUCLEOTIDE_TOKENS.values()), dtype=tf.int64)), num_oov_buckets=1) sequence = tf.RaggedTensor.from_row_splits(values=nucleotide_table.lookup(sequence.values), row_splits=sequence.row_splits).to_tensor(255) # add context padding if requested if add_context_padding: pad_5p = 255 * tf.ones([sequence.shape[0], CONTEXT_5P], dtype=sequence.dtype) pad_3p = 255 * tf.ones([sequence.shape[0], CONTEXT_3P], dtype=sequence.dtype) sequence = tf.concat([pad_5p, sequence, pad_3p], axis=1) # one-hot encode sequence = tf.one_hot(sequence, depth=4) return sequence def process_data(transcript_seq: str): # convert to upper case transcript_seq = transcript_seq.upper() # get all target sites target_seq = [transcript_seq[i: i + TARGET_LEN] for i in range(len(transcript_seq) - TARGET_LEN)] # prepare guide sequences guide_seq = sequence_complement([seq[CONTEXT_5P:len(seq) - CONTEXT_3P] for seq in target_seq]) # model inputs model_inputs = tf.concat([ tf.reshape(one_hot_encode_sequence(target_seq, add_context_padding=False), [len(target_seq), -1]), tf.reshape(one_hot_encode_sequence(guide_seq, add_context_padding=True), [len(guide_seq), -1]), ], axis=-1) return target_seq, guide_seq, model_inputs def tiger_predict(transcript_seq: str): # load model if os.path.exists('model'): tiger = tf.keras.models.load_model('model') else: print('no saved model!') exit() # parse transcript sequence target_seq, guide_seq, model_inputs = process_data(transcript_seq) # get predictions normalized_lfc = tiger.predict_step(model_inputs) predictions = pd.DataFrame({'Guide': guide_seq, 'Normalized LFC': tf.squeeze(normalized_lfc).numpy()}) predictions = predictions.set_index('Guide').sort_values('Normalized LFC') return predictions def find_off_targets(guides, batch_size=1000): with gzip.open(os.path.join('transcripts', 'gencode.v19.pc_transcripts.fa.gz'), 'rt') as file: df_transcripts = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(file, 'fasta')], columns=['id', 'seq']) df_transcripts['id'] = df_transcripts['id'].apply(lambda s: s.split('|')[4]) df_transcripts.set_index('id', inplace=True) # one-hot encode guides to form a filter guide_filter = one_hot_encode_sequence(sequence_complement(guides), add_context_padding=False) guide_filter = tf.transpose(guide_filter, [1, 2, 0]) # loop over transcripts in batches i = 0 print('Scanning for off-targets') df_off_targets = pd.DataFrame() while i < len(df_transcripts): # select batch df_batch = df_transcripts.iloc[i:min(i + batch_size, len(df_transcripts))] i += batch_size # find and log off-targets transcripts = one_hot_encode_sequence(df_batch['seq'].values.tolist(), add_context_padding=False) num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME') loc_off_targets = tf.where(num_mismatches <= NUM_MISMATCHES).numpy() df_off_targets = pd.concat([df_off_targets, pd.DataFrame({ 'Guide': np.array(guides)[loc_off_targets[:, 2]], 'Isoform': df_batch.index.values[loc_off_targets[:, 0]], 'Mismatches': tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int), 'Midpoint': loc_off_targets[:, 1], 'Target': df_batch['seq'].values[loc_off_targets[:, 0]], })]) # progress update print('\rPercent complete: {:.2f}%'.format(100 * min(i / len(df_transcripts), 1)), end='') print('') # trim transcripts to targets dict_off_targets = df_off_targets.to_dict('records') for row in dict_off_targets: start_location = row['Midpoint'] - (GUIDE_LEN // 2) - CONTEXT_5P row['Target'] = row['Target'][start_location:start_location + TARGET_LEN] if row['Mismatches'] == 0: assert row['Guide'] == sequence_complement([row['Target'][CONTEXT_5P:TARGET_LEN-CONTEXT_3P]])[0] df_off_targets = pd.DataFrame(dict_off_targets) return df_off_targets if __name__ == '__main__': # simple test case transcript_sequence = 'ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC'.lower() # first 50 from EIF3B-003's CDS sorted_predictions = tiger_predict(transcript_sequence) # report top guides only sorted_predictions = sorted_predictions.iloc[:NUM_TOP_GUIDES] print(sorted_predictions) # scan for off-targets for top guides off_targets = find_off_targets(sorted_predictions.index.values.tolist()) print(off_targets)