Spaces:
Sleeping
Sleeping
jennzhuge commited on
Commit ·
8465e44
1
Parent(s): 040747a
added tsne graph, chanaged default coords
Browse files- .gitignore +2 -1
- __pycache__/app.cpython-39.pyc +0 -0
- __pycache__/config.cpython-39.pyc +0 -0
- app.py +122 -31
- default_inputs.json +2 -2
.gitignore
CHANGED
|
@@ -1,4 +1,5 @@
|
|
| 1 |
.venv
|
| 2 |
flagged
|
| 3 |
*.tif
|
| 4 |
-
*.tiff
|
|
|
|
|
|
| 1 |
.venv
|
| 2 |
flagged
|
| 3 |
*.tif
|
| 4 |
+
*.tiff
|
| 5 |
+
.env
|
__pycache__/app.cpython-39.pyc
ADDED
|
Binary file (10.7 kB). View file
|
|
|
__pycache__/config.cpython-39.pyc
ADDED
|
Binary file (1.29 kB). View file
|
|
|
app.py
CHANGED
|
@@ -60,7 +60,8 @@ embeddings_model.eval()
|
|
| 60 |
classification_model.eval()
|
| 61 |
|
| 62 |
# Load datasets
|
| 63 |
-
amazon_ds = load_dataset(DATASETS["amazon"])
|
|
|
|
| 64 |
|
| 65 |
def set_default_inputs():
|
| 66 |
return (DEFAULT_INPUTS["dna_sequence"],
|
|
@@ -148,6 +149,22 @@ def predict_genus(method: str, dna_sequence: str, latitude: str, longitude: str)
|
|
| 148 |
index=[ID_TO_GENUS_MAP[i] for i in top_k.indices.detach().numpy()]
|
| 149 |
)
|
| 150 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 151 |
fig, ax = plt.subplots()
|
| 152 |
ax.bar(top_k.index.astype(str), top_k.values)
|
| 153 |
ax.set_ylim(0, 1)
|
|
@@ -162,12 +179,12 @@ def predict_genus(method: str, dna_sequence: str, latitude: str, longitude: str)
|
|
| 162 |
return PIL.Image.frombytes("RGB", fig.canvas.get_width_height(), fig.canvas.tostring_rgb())
|
| 163 |
|
| 164 |
|
| 165 |
-
def cluster_dna(
|
| 166 |
-
df = amazon_ds
|
| 167 |
-
df = df[df["genus"].notna()]
|
| 168 |
-
|
| 169 |
genus_counts = df["genus"].value_counts()
|
| 170 |
-
top_genuses = genus_counts.head(
|
| 171 |
df = df[df["genus"].isin(top_genuses)]
|
| 172 |
tsne = TSNE(
|
| 173 |
n_components=2, perplexity=30, learning_rate=200,
|
|
@@ -180,16 +197,59 @@ def cluster_dna(top_k: float):
|
|
| 180 |
|
| 181 |
label_encoder = LabelEncoder()
|
| 182 |
y_encoded = label_encoder.fit_transform(y)
|
|
|
|
| 183 |
|
| 184 |
fig, ax = plt.subplots()
|
| 185 |
-
ax.scatter(X_tsne[:, 0], X_tsne[:, 1], c=y_encoded, cmap="
|
| 186 |
-
|
|
|
|
|
|
|
| 187 |
# Reduce unnecessary whitespace
|
| 188 |
ax.set_xlim(X_tsne[:, 0].min() - 0.1, X_tsne[:, 0].max() + 0.1)
|
| 189 |
fig.canvas.draw()
|
| 190 |
|
| 191 |
return PIL.Image.frombytes("RGB", fig.canvas.get_width_height(), fig.canvas.tostring_rgb())
|
| 192 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 193 |
with gr.Blocks() as demo:
|
| 194 |
# Header section
|
| 195 |
gr.Markdown(("""
|
|
@@ -209,9 +269,9 @@ with gr.Blocks() as demo:
|
|
| 209 |
|
| 210 |
with gr.Column():
|
| 211 |
with gr.Row():
|
| 212 |
-
inp_lat = gr.Textbox(label="Latitude", placeholder="e.g.
|
| 213 |
with gr.Row():
|
| 214 |
-
inp_lng = gr.Textbox(label="Longitude", placeholder="e.g. -
|
| 215 |
|
| 216 |
with gr.Row():
|
| 217 |
btn_defaults = gr.Button("I'm feeling lucky")
|
|
@@ -224,13 +284,12 @@ with gr.Blocks() as demo:
|
|
| 224 |
A demo of predicting the genus of a DNA sequence using multiple
|
| 225 |
approaches (method dropdown):
|
| 226 |
|
| 227 |
-
- **fine_tuned_model**:
|
| 228 |
-
`LofiAmazon/BarcodeBERT-Finetuned-Amazon` which predicts the genus
|
| 229 |
based on the DNA sequence and environmental data.
|
| 230 |
- **cosine**: computes a cosine similarity between the DNA sequence
|
| 231 |
embedding generated by our model and the embeddings of known samples
|
| 232 |
-
that we precomputed and stored
|
| 233 |
-
DOES NOT examine ecological layer data.
|
| 234 |
""")
|
| 235 |
|
| 236 |
with gr.Row():
|
|
@@ -243,34 +302,66 @@ with gr.Blocks() as demo:
|
|
| 243 |
genus_output = gr.Image()
|
| 244 |
|
| 245 |
predict_button.click(
|
| 246 |
-
fn=
|
| 247 |
inputs=[method_dropdown, inp_dna, inp_lat, inp_lng],
|
| 248 |
outputs=genus_output
|
| 249 |
)
|
| 250 |
|
| 251 |
with gr.Tab("DNA Embedding Space Visualizer"):
|
| 252 |
gr.Markdown("""
|
| 253 |
-
|
| 254 |
-
|
| 255 |
-
|
| 256 |
-
|
| 257 |
-
|
| 258 |
-
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 259 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 260 |
with gr.Row():
|
| 261 |
with gr.Column():
|
| 262 |
-
|
| 263 |
-
|
| 264 |
-
|
| 265 |
-
|
| 266 |
-
visualize_button = gr.Button("Visualize Embedding Space")
|
| 267 |
-
with gr.Column():
|
| 268 |
visualize_output = gr.Image()
|
| 269 |
|
| 270 |
-
|
| 271 |
-
|
| 272 |
-
|
| 273 |
-
|
| 274 |
)
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 275 |
|
| 276 |
demo.launch()
|
|
|
|
| 60 |
classification_model.eval()
|
| 61 |
|
| 62 |
# Load datasets
|
| 63 |
+
amazon_ds = load_dataset(DATASETS["amazon"])['train'].to_pandas()
|
| 64 |
+
amazon_ds = amazon_ds[amazon_ds["genus"].notna()]
|
| 65 |
|
| 66 |
def set_default_inputs():
|
| 67 |
return (DEFAULT_INPUTS["dna_sequence"],
|
|
|
|
| 149 |
index=[ID_TO_GENUS_MAP[i] for i in top_k.indices.detach().numpy()]
|
| 150 |
)
|
| 151 |
|
| 152 |
+
# fig, ax = plt.subplots()
|
| 153 |
+
# ax.bar(top_k.index.astype(str), top_k.values)
|
| 154 |
+
# ax.set_ylim(0, 1)
|
| 155 |
+
# ax.set_title("Genus Prediction")
|
| 156 |
+
# ax.set_xlabel("Genus")
|
| 157 |
+
# ax.set_ylabel("Probability")
|
| 158 |
+
# ax.set_xticks(range(len(top_k)))
|
| 159 |
+
# ax.set_xticklabels(top_k.index.astype(str), rotation=90)
|
| 160 |
+
# fig.subplots_adjust(bottom=0.3)
|
| 161 |
+
# fig.canvas.draw()
|
| 162 |
+
|
| 163 |
+
# return PIL.Image.frombytes("RGB", fig.canvas.get_width_height(), fig.canvas.tostring_rgb())
|
| 164 |
+
return top_k
|
| 165 |
+
|
| 166 |
+
def genus_hist(method: str, dna_sequence: str, latitude: str, longitude: str):
|
| 167 |
+
top_k = predict_genus(method, dna_sequence, latitude, longitude)
|
| 168 |
fig, ax = plt.subplots()
|
| 169 |
ax.bar(top_k.index.astype(str), top_k.values)
|
| 170 |
ax.set_ylim(0, 1)
|
|
|
|
| 179 |
return PIL.Image.frombytes("RGB", fig.canvas.get_width_height(), fig.canvas.tostring_rgb())
|
| 180 |
|
| 181 |
|
| 182 |
+
def cluster_dna(k: float):
|
| 183 |
+
df = amazon_ds
|
| 184 |
+
# df = df[df["genus"].notna()]
|
| 185 |
+
k = int(k)
|
| 186 |
genus_counts = df["genus"].value_counts()
|
| 187 |
+
top_genuses = genus_counts.head(k).index
|
| 188 |
df = df[df["genus"].isin(top_genuses)]
|
| 189 |
tsne = TSNE(
|
| 190 |
n_components=2, perplexity=30, learning_rate=200,
|
|
|
|
| 197 |
|
| 198 |
label_encoder = LabelEncoder()
|
| 199 |
y_encoded = label_encoder.fit_transform(y)
|
| 200 |
+
classes = list(label_encoder.inverse_transform(range(len(df['genus'].unique()))))
|
| 201 |
|
| 202 |
fig, ax = plt.subplots()
|
| 203 |
+
plot = ax.scatter(X_tsne[:, 0], X_tsne[:, 1], c=y_encoded, cmap="tab20", alpha=0.7)
|
| 204 |
+
handles, _ = plot.legend_elements(prop='colors')
|
| 205 |
+
ax.legend(handles, classes)
|
| 206 |
+
ax.set_title(f"DNA Embedding Space (of {str(k)} most common genera)")
|
| 207 |
# Reduce unnecessary whitespace
|
| 208 |
ax.set_xlim(X_tsne[:, 0].min() - 0.1, X_tsne[:, 0].max() + 0.1)
|
| 209 |
fig.canvas.draw()
|
| 210 |
|
| 211 |
return PIL.Image.frombytes("RGB", fig.canvas.get_width_height(), fig.canvas.tostring_rgb())
|
| 212 |
|
| 213 |
+
def cluster_dna2(k: float, method: str, dna_sequence: str, latitude: str, longitude: str):
|
| 214 |
+
top_genuses = predict_genus(method, dna_sequence, latitude, longitude)
|
| 215 |
+
embed = get_embedding(dna_sequence).tolist()
|
| 216 |
+
# df = amazon_ds["train"].to_pandas()
|
| 217 |
+
df = amazon_ds
|
| 218 |
+
# df = df[df["genus"].notna()]
|
| 219 |
+
k = int(k)
|
| 220 |
+
# genus_counts = df["genus"].value_counts()
|
| 221 |
+
top_genuses = top_genuses.head(k).index
|
| 222 |
+
df = df[df["genus"].isin(top_genuses)]
|
| 223 |
+
tsne = TSNE(
|
| 224 |
+
n_components=2, perplexity=30, learning_rate=200,
|
| 225 |
+
n_iter=1000, random_state=0,
|
| 226 |
+
)
|
| 227 |
+
X = np.vstack([df['embeddings'].tolist(), embed])
|
| 228 |
+
# X = np.stack(df["embeddings"].tolist())
|
| 229 |
+
y = df["genus"].tolist()
|
| 230 |
+
|
| 231 |
+
X_tsne = tsne.fit_transform(X)
|
| 232 |
+
tsne_embed_space = X_tsne[:-1]
|
| 233 |
+
tsne_single = X_tsne[-1]
|
| 234 |
+
|
| 235 |
+
label_encoder = LabelEncoder()
|
| 236 |
+
y_encoded = label_encoder.fit_transform(y)
|
| 237 |
+
classes = list(label_encoder.inverse_transform(range(len(df['genus'].unique()))))
|
| 238 |
+
|
| 239 |
+
fig, ax = plt.subplots()
|
| 240 |
+
plot = ax.scatter(tsne_embed_space[:, 0], tsne_embed_space[:, 1], c=y_encoded, cmap="tab20", alpha=0.7)
|
| 241 |
+
ax.scatter(tsne_single[0], tsne_single[1], color='red', edgecolor='black')
|
| 242 |
+
handles, _ = plot.legend_elements(prop='colors')
|
| 243 |
+
ax.legend(handles, classes)
|
| 244 |
+
# ax.legend(loc='best')
|
| 245 |
+
ax.text(tsne_single[0], tsne_single[1], 'Your DNA Seq', fontsize=10, color='black')
|
| 246 |
+
ax.set_title(f"DNA Embedding Space Around Your DNA's Embedding")
|
| 247 |
+
# Reduce unnecessary whitespace
|
| 248 |
+
ax.set_xlim(X_tsne[:, 0].min() + 0.1, X_tsne[:, 0].max() + 0.1)
|
| 249 |
+
fig.canvas.draw()
|
| 250 |
+
|
| 251 |
+
return PIL.Image.frombytes("RGB", fig.canvas.get_width_height(), fig.canvas.tostring_rgb())
|
| 252 |
+
|
| 253 |
with gr.Blocks() as demo:
|
| 254 |
# Header section
|
| 255 |
gr.Markdown(("""
|
|
|
|
| 269 |
|
| 270 |
with gr.Column():
|
| 271 |
with gr.Row():
|
| 272 |
+
inp_lat = gr.Textbox(label="Latitude", placeholder="e.g. 2.009083")
|
| 273 |
with gr.Row():
|
| 274 |
+
inp_lng = gr.Textbox(label="Longitude", placeholder="e.g. -41.68281")
|
| 275 |
|
| 276 |
with gr.Row():
|
| 277 |
btn_defaults = gr.Button("I'm feeling lucky")
|
|
|
|
| 284 |
A demo of predicting the genus of a DNA sequence using multiple
|
| 285 |
approaches (method dropdown):
|
| 286 |
|
| 287 |
+
- **fine_tuned_model**: uses our
|
| 288 |
+
`LofiAmazon/BarcodeBERT-Finetuned-Amazon` model which predicts the genus
|
| 289 |
based on the DNA sequence and environmental data.
|
| 290 |
- **cosine**: computes a cosine similarity between the DNA sequence
|
| 291 |
embedding generated by our model and the embeddings of known samples
|
| 292 |
+
that we precomputed and stored. This method DOES NOT use ecological layer data.
|
|
|
|
| 293 |
""")
|
| 294 |
|
| 295 |
with gr.Row():
|
|
|
|
| 302 |
genus_output = gr.Image()
|
| 303 |
|
| 304 |
predict_button.click(
|
| 305 |
+
fn=genus_hist,
|
| 306 |
inputs=[method_dropdown, inp_dna, inp_lat, inp_lng],
|
| 307 |
outputs=genus_output
|
| 308 |
)
|
| 309 |
|
| 310 |
with gr.Tab("DNA Embedding Space Visualizer"):
|
| 311 |
gr.Markdown("""
|
| 312 |
+
## DNA Embedding Space Visualizer
|
| 313 |
+
|
| 314 |
+
Use this tool to visualize how our DNA Transformer model
|
| 315 |
+
learns to cluster similar DNA sequences together.
|
| 316 |
+
""")
|
| 317 |
+
|
| 318 |
+
# with gr.Row():
|
| 319 |
+
# with gr.Column():
|
| 320 |
+
# top_k_slider = gr.Slider(
|
| 321 |
+
# minimum=1, maximum=10, step=1, value=5,
|
| 322 |
+
# label="Choose **k**, the number of top genera to visualize",
|
| 323 |
+
# )
|
| 324 |
+
# visualize_button = gr.Button("Visualize Embedding Space")
|
| 325 |
+
# with gr.Column():
|
| 326 |
+
# visualize_output = gr.Image()
|
| 327 |
+
|
| 328 |
+
# visualize_button.click(
|
| 329 |
+
# fn=cluster_dna,
|
| 330 |
+
# inputs=top_k_slider,
|
| 331 |
+
# outputs=visualize_output
|
| 332 |
+
# )
|
| 333 |
|
| 334 |
+
with gr.Row():
|
| 335 |
+
top_k_slider = gr.Slider(
|
| 336 |
+
minimum=1, maximum=10, step=1, value=5,
|
| 337 |
+
label="Choose **k**, the number of top genera to visualize",
|
| 338 |
+
)
|
| 339 |
+
visualize_button = gr.Button("Visualize Embedding Space")
|
| 340 |
with gr.Row():
|
| 341 |
with gr.Column():
|
| 342 |
+
gr.Markdown("""
|
| 343 |
+
t-SNE plot of the DNA embedding spaces of the **k** most common
|
| 344 |
+
genera in our dataset.
|
| 345 |
+
""")
|
|
|
|
|
|
|
| 346 |
visualize_output = gr.Image()
|
| 347 |
|
| 348 |
+
visualize_button.click(
|
| 349 |
+
fn=cluster_dna,
|
| 350 |
+
inputs=top_k_slider,
|
| 351 |
+
outputs=visualize_output
|
| 352 |
)
|
| 353 |
+
with gr.Column():
|
| 354 |
+
gr.Markdown("""
|
| 355 |
+
t-SNE plot of the DNA embedding spaces of the **k** most likely
|
| 356 |
+
genera for the DNA sequence you provided.
|
| 357 |
+
""")
|
| 358 |
+
visualize_output2 = gr.Image()
|
| 359 |
+
|
| 360 |
+
visualize_button.click(
|
| 361 |
+
fn=cluster_dna2,
|
| 362 |
+
inputs=[top_k_slider, method_dropdown, inp_dna, inp_lat, inp_lng],
|
| 363 |
+
outputs=visualize_output2
|
| 364 |
+
)
|
| 365 |
+
|
| 366 |
|
| 367 |
demo.launch()
|
default_inputs.json
CHANGED
|
@@ -1,5 +1,5 @@
|
|
| 1 |
{
|
| 2 |
"dna_sequence": "AACAATGTATTTGATTTTCGCCCTTGTGAATTTATTCGCTGGCGGAACAATGGCATTGTTGATTCGTTTGGAGTTGTTCCAACCTGGCTTGCAATTTTTAAGACCTGAGTTTTTTAATCAGTTAACAACTATGCACGGCCTTATAATGGTTTTCGGTGCAATTATGCCGGCCTTTGTGGGTTTTGCTAACTTGATGATTCCTTTGCAAATTGGTGCCTCTGATATGGCGTTTGCAAGAATGAACAATTTTAGTTTCTGGATTATGCCTGTTGCAGGGATGTTATTATTTGGCTCATTTTTGGCTCCTGGTGGCGCTACTGCAGCTGGTTGGACTTTGTATGCTCCTTTGTCGGTCCAAATGGGGCCTGGTATGGACATGACTATTTTTGCTGTTCACTTGATGGGTGCTTCATCCATTATGGGATCCATTAATATCATTGTGACAATTCTGAATATGCGTGCTCCTGGACTGTCTTTGATGAAGATGCCAATGTTCTGTTGGACATGGTTGATTACTGCATATTTGTTAATTGCGGTTATGCCTGTTTTAGCTGGTGCTATCACTATGGTTCTAACAGACCGTCACTTTGGAACAAGCTTTTTTGCAGCTGCTGGCGGTGGAGACCCTGTAATGTATCAACATATCTTC",
|
| 3 |
-
"latitude": "
|
| 4 |
-
"longitude": "-
|
| 5 |
}
|
|
|
|
| 1 |
{
|
| 2 |
"dna_sequence": "AACAATGTATTTGATTTTCGCCCTTGTGAATTTATTCGCTGGCGGAACAATGGCATTGTTGATTCGTTTGGAGTTGTTCCAACCTGGCTTGCAATTTTTAAGACCTGAGTTTTTTAATCAGTTAACAACTATGCACGGCCTTATAATGGTTTTCGGTGCAATTATGCCGGCCTTTGTGGGTTTTGCTAACTTGATGATTCCTTTGCAAATTGGTGCCTCTGATATGGCGTTTGCAAGAATGAACAATTTTAGTTTCTGGATTATGCCTGTTGCAGGGATGTTATTATTTGGCTCATTTTTGGCTCCTGGTGGCGCTACTGCAGCTGGTTGGACTTTGTATGCTCCTTTGTCGGTCCAAATGGGGCCTGGTATGGACATGACTATTTTTGCTGTTCACTTGATGGGTGCTTCATCCATTATGGGATCCATTAATATCATTGTGACAATTCTGAATATGCGTGCTCCTGGACTGTCTTTGATGAAGATGCCAATGTTCTGTTGGACATGGTTGATTACTGCATATTTGTTAATTGCGGTTATGCCTGTTTTAGCTGGTGCTATCACTATGGTTCTAACAGACCGTCACTTTGGAACAAGCTTTTTTGCAGCTGCTGGCGGTGGAGACCCTGTAATGTATCAACATATCTTC",
|
| 3 |
+
"latitude": "2.009083",
|
| 4 |
+
"longitude": "-41.68281"
|
| 5 |
}
|