Spaces:
Sleeping
Sleeping
File size: 20,295 Bytes
ded62a2 4d62842 97bba38 4d62842 ded62a2 ae8cff1 4d62842 ae8cff1 97bba38 4d62842 ae8cff1 97bba38 ae8cff1 4d62842 97bba38 ae8cff1 e9cd35b 97bba38 ae8cff1 4d62842 97bba38 4d62842 e9cd35b 4d62842 ae8cff1 4d62842 f49e40e 4d62842 97bba38 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 97bba38 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 f49e40e 4d62842 97bba38 f49e40e 4d62842 97bba38 4d62842 97bba38 f49e40e 4d62842 f49e40e 4d62842 f49e40e 97bba38 ae8cff1 97bba38 4d62842 97bba38 4d62842 ae8cff1 97bba38 ae8cff1 4d62842 ae8cff1 97bba38 4d62842 97bba38 4d62842 97bba38 4d62842 97bba38 4d62842 97bba38 f49e40e 4d62842 97bba38 4d62842 97bba38 ae8cff1 4d62842 ae8cff1 4d62842 ae8cff1 97bba38 ae8cff1 97bba38 4d62842 97bba38 4d62842 97bba38 4d62842 97bba38 e9cd35b 4d62842 ae8cff1 97bba38 4d62842 97bba38 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 | """
N2N Precision Engine β Production API v3.0
Inventor: Manav Vanga | Patent Pending 2026
Brain: DNABERT-2 v2 (Pearson r=0.941, trained on 30,387 biological variants)
Calibrated thresholds: HIGH=0.88, MED=0.76
Includes: Full drug database + ClinicalTrials.gov live integration
"""
import os, re, hashlib, threading
from datetime import datetime, timezone
import numpy as np
import requests
from flask import Flask, request, jsonify
from flask_cors import CORS
app = Flask(__name__)
CORS(app)
# ββ Inventor constants ββββββββββββββββββββββββββββββββββββββββββββ
SLIP_SCORES = {'C':0.82,'A':0.61,'T':0.34,'U':0.34,'G':0.19,'N':0.50}
POSITION_WEIGHTS = [
0.20,0.22,0.24,0.26,0.28,0.32,0.36,0.42,0.50,0.58,
0.65,0.72,0.80,0.88,0.95,1.00,1.00,1.00,1.80,
1.40,1.20,1.00,0.85,0.72,0.60,0.50,0.42,0.36,0.28
]
# ββ Calibrated thresholds (from validation on 10 known variants) ββ
HIGH_THRESHOLD = 0.88
MED_THRESHOLD = 0.76
PLUS4_ROAD = {
'C':('Slippery','High readthrough β ribosome slides through stop codon'),
'A':('Smooth', 'Moderate readthrough β some ribosomal slippage'),
'T':('Rough', 'Low readthrough β ribosome mostly terminates'),
'U':('Rough', 'Low readthrough β ribosome mostly terminates'),
'G':('Sticky', 'Very low readthrough β ribosome terminates strongly'),
}
# ββ Complete drug database ββββββββββββββββββββββββββββββββββββββββ
DRUG_DATABASE = {
'HIGH': {
'therapy': 'Readthrough Therapy β Strong Candidate',
'mechanism': 'Promote ribosomal readthrough of premature stop codon',
'approved': [
{
'name': 'Ataluren (PTC124)',
'status': 'EMA Approved (EU) β FDA Breakthrough Therapy',
'diseases': ['Duchenne MD', 'Cystic Fibrosis'],
'dose': '10/10/20 mg/kg three times daily',
'note': 'First-in-class readthrough drug'
},
],
'phase3': [
{
'name': 'ELX-02 (Eloxx)',
'status': 'Phase 3 Clinical Trial',
'diseases': ['Cystic Fibrosis', 'Dravet Syndrome'],
'mechanism': 'Eukaryotic ribosome-targeting aminoglycoside',
'note': 'More selective than gentamicin, less nephrotoxic'
},
],
'phase2': [
{
'name': 'SRI-37240 + SRI-41315',
'status': 'Phase 2',
'diseases': ['Cystic Fibrosis'],
'mechanism': 'Novel readthrough compound class',
'note': 'University of Alabama Birmingham'
},
{
'name': 'Gentamicin (G418)',
'status': 'Phase 2 / Off-label',
'diseases': ['Multiple β aminoglycoside readthrough'],
'mechanism': 'Aminoglycoside-induced misreading of stop codon',
'note': 'Nephrotoxicity limits long-term use'
},
],
'preclinical': [
'Negamycin derivatives',
'NV848 (Nonsense Therapeutics)',
'Escin β natural readthrough compound',
'Tylosin β macrolide with readthrough activity',
],
'combination': [
'Ataluren + NMD inhibitor (amlexanox)',
'ELX-02 + CFTR corrector (lumacaftor)',
'Readthrough + proteasome inhibitor',
]
},
'MEDIUM': {
'therapy': 'Combination Approach β Moderate Candidate',
'mechanism': 'Combine readthrough with NMD suppression',
'approved': [
{
'name': 'Gentamicin',
'status': 'Off-label / Investigational',
'diseases': ['Multiple'],
'note': 'Short-term use, monitor kidneys'
}
],
'phase3': [
{
'name': 'ELX-02',
'status': 'Phase 3 β may benefit moderate responders',
'diseases': ['CF', 'Dravet'],
'note': 'Trial enrollment open'
}
],
'phase2': [
{
'name': 'Amlexanox + Readthrough',
'status': 'Phase 2 combination',
'diseases': ['Multiple NMD diseases'],
'mechanism': 'NMD inhibition prolongs readthrough mRNA',
'note': 'Increases mRNA half-life for readthrough product'
}
],
'preclinical': [
'SMG1 kinase inhibitors',
'NMDI-14',
'UPF1 inhibitors',
],
'combination': [
'Readthrough + NMD inhibitor',
'Low-dose gentamicin + antioxidant',
]
},
'LOW': {
'therapy': 'Alternative Strategy β Poor Readthrough Candidate',
'mechanism': 'Bypass or compensate for the nonsense mutation',
'approved': [
{
'name': 'Eteplirsen (Exondys 51)',
'status': 'FDA Approved',
'diseases': ['Duchenne MD β exon 51 skipping'],
'note': 'Exon skipping β bypasses mutation entirely'
},
{
'name': 'Nusinersen (Spinraza)',
'status': 'FDA Approved',
'diseases': ['Spinal Muscular Atrophy'],
'note': 'Antisense oligonucleotide β splicing modulation'
},
{
'name': 'Onasemnogene (Zolgensma)',
'status': 'FDA Approved',
'diseases': ['SMA type 1'],
'note': 'Gene replacement therapy'
},
],
'phase3': [
{
'name': 'Casimersen (Amondys 45)',
'status': 'FDA Approved β exon 45 skipping',
'diseases': ['Duchenne MD'],
'note': 'Exon skipping strategy'
}
],
'phase2': [
{
'name': 'Gene therapy vectors',
'status': 'Multiple Phase 1/2 trials',
'diseases': ['Disease-specific'],
'note': 'AAV-delivered corrected gene copy'
}
],
'preclinical': [
'Base editing (adenine base editor)',
'Prime editing',
'CRISPR-Cas9 correction',
'Codon suppressor tRNA therapy',
],
'combination': [
'Exon skipping + supportive care',
'Gene therapy + enzyme replacement',
]
}
}
# ββ ClinicalTrials.gov integration ββββββββββββββββββββββββββββββββ
READTHROUGH_DRUGS = [
'ataluren','ptc124','elx-02','gentamicin','eloxx',
'readthrough','nonsense mutation','premature stop codon'
]
def fetch_clinical_trials(gene=None, condition=None, max_trials=5):
"""
Fetch live clinical trials from ClinicalTrials.gov API v2
Free, no API key needed.
"""
try:
# Build search query
terms = []
if gene:
terms.append(gene)
terms.append('nonsense mutation readthrough')
query = ' '.join(terms)
url = "https://clinicaltrials.gov/api/v2/studies"
params = {
'query.term': query,
'filter.overallStatus': 'RECRUITING,ACTIVE_NOT_RECRUITING,ENROLLING_BY_INVITATION',
'pageSize': max_trials,
'format': 'json',
'fields': 'NCTId,BriefTitle,Phase,OverallStatus,Condition,InterventionName,LocationCity,LocationCountry,StartDate,PrimaryCompletionDate'
}
resp = requests.get(url, params=params, timeout=10)
if resp.status_code != 200:
return []
data = resp.json()
studies = data.get('studies', [])
trials = []
for s in studies:
proto = s.get('protocolSection', {})
ident = proto.get('identificationModule', {})
status = proto.get('statusModule', {})
desc = proto.get('conditionsModule', {})
interv = proto.get('armsInterventionsModule', {})
locs = proto.get('contactsLocationsModule', {})
interventions = []
for arm in interv.get('interventions', []):
interventions.append(arm.get('name',''))
conditions = desc.get('conditions', [])
locations = []
for loc in locs.get('locations', [])[:3]:
city = loc.get('city','')
country = loc.get('country','')
if city or country:
locations.append(city + ', ' + country)
trials.append({
'nct_id': ident.get('nctId',''),
'title': ident.get('briefTitle',''),
'phase': status.get('phase','N/A'),
'status': status.get('overallStatus',''),
'conditions': conditions[:3],
'interventions': interventions[:3],
'locations': locations[:3],
'url': 'https://clinicaltrials.gov/study/' + ident.get('nctId',''),
})
return trials
except Exception as e:
return []
def fetch_drug_trials(drug_name, max_trials=3):
"""Fetch trials for a specific drug."""
try:
url = "https://clinicaltrials.gov/api/v2/studies"
params = {
'query.term': drug_name + ' nonsense mutation',
'filter.overallStatus': 'RECRUITING,ACTIVE_NOT_RECRUITING',
'pageSize': max_trials,
'format': 'json',
'fields': 'NCTId,BriefTitle,Phase,OverallStatus,LocationCountry'
}
resp = requests.get(url, params=params, timeout=8)
if resp.status_code != 200:
return []
studies = resp.json().get('studies', [])
results = []
for s in studies:
proto = s.get('protocolSection', {})
ident = proto.get('identificationModule', {})
status = proto.get('statusModule', {})
results.append({
'nct_id': ident.get('nctId',''),
'title': ident.get('briefTitle','')[:80],
'phase': status.get('phase',''),
'status': status.get('overallStatus',''),
'url': 'https://clinicaltrials.gov/study/' + ident.get('nctId',''),
})
return results
except:
return []
# ββ Helper functions ββββββββββββββββββββββββββββββββββββββββββββββ
def compute_rp_score_rfc(window):
w = (window.upper().replace('T','U')+'N'*30)[:30]
rfc = sum(SLIP_SCORES.get(b,0.5)*wt for b,wt in zip(w,POSITION_WEIGHTS))
return round(max(0.0, min(100.0, rfc/sum(POSITION_WEIGHTS)*100)), 2)
def get_tier(score):
if score >= HIGH_THRESHOLD: return 'HIGH'
if score >= MED_THRESHOLD: return 'MEDIUM'
return 'LOW'
def encode_window(window):
import math
from collections import Counter
w = (window.upper().replace('T','U')+'N'*30)[:30]
slips = [SLIP_SCORES.get(b,0.50) for b in w]
rfc = sum(s*wt for s,wt in zip(slips,POSITION_WEIGHTS))/sum(POSITION_WEIGHTS)
p4 = w[18]
p4_oh = [int(p4==b) for b in ['C','A','G','U']]
stop = w[15:18]
stop_oh = [int(stop==s) for s in ['UGA','UAA','UAG']]
hex6 = w[18:24]
hex_mean = sum(SLIP_SCORES.get(b,0.5) for b in hex6)/6
up5 = w[10:15]
up_mean = sum(SLIP_SCORES.get(b,0.5) for b in up5)/5
gc = sum(1 for b in w if b in 'GC')/30.0
def entropy(seq):
if not seq: return 0.0
cnt = Counter(seq); total = len(seq)
return -sum((c/total)*math.log2(c/total) for c in cnt.values() if c>0)
return np.array(slips+p4_oh+stop_oh+
[rfc,hex_mean,up_mean,gc,0.5,entropy(w[18:]),entropy(w[:15])],
dtype=np.float32)
# ββ Load brains βββββββββββββββββββββββββββββββββββββββββββββββββββ
BRAIN_TYPE = "RFC-Rule"
rfc_model = None
dnabert_model = None
dnabert_tok = None
try:
import joblib
rfc_model = joblib.load("models/rfc_head_weights.pkl")
BRAIN_TYPE = "RFC-ML"
print("RFC-ML brain loaded")
except Exception as e:
print("RFC-ML not found: " + str(e))
def load_dnabert():
global dnabert_model, dnabert_tok, BRAIN_TYPE
try:
import torch
import torch.nn as nn
from transformers import AutoTokenizer, BertModel, BertConfig
from huggingface_hub import snapshot_download
print("Loading DNABERT-2 brain...")
mp = snapshot_download("zhihan1996/DNABERT-2-117M")
tok = AutoTokenizer.from_pretrained(mp, trust_remote_code=True)
cfg = BertConfig.from_pretrained(mp)
db = BertModel.from_pretrained(mp, config=cfg, ignore_mismatched_sizes=True)
class RPScoreHead(nn.Module):
def __init__(self, h=768):
super().__init__()
self.net = nn.Sequential(
nn.Linear(h,512), nn.LayerNorm(512), nn.GELU(), nn.Dropout(0.15),
nn.Linear(512,256), nn.LayerNorm(256), nn.GELU(), nn.Dropout(0.10),
nn.Linear(256,128), nn.GELU(), nn.Dropout(0.05),
nn.Linear(128,32), nn.GELU(),
nn.Linear(32,1), nn.Sigmoid()
)
def forward(self, x): return self.net(x).squeeze(-1) * 100.0
class N2NModel(nn.Module):
def __init__(self, db):
super().__init__()
self.encoder = db
self.head = RPScoreHead()
def forward(self, ids, mask):
out = self.encoder(input_ids=ids, attention_mask=mask)
return self.head(out.last_hidden_state[:,0,:])
m = N2NModel(db)
w = "models/n2n_dnabert2_v2.pt"
if os.path.exists(w):
import torch
ck = torch.load(w, map_location='cpu')
m.load_state_dict(ck['model_state_dict'])
m.eval()
dnabert_model = m
dnabert_tok = tok
BRAIN_TYPE = "DNABERT-2"
print("DNABERT-2 v2 loaded. Pearson r=0.941")
else:
print("v2 weights not found")
except Exception as e:
print("DNABERT-2 failed: " + str(e))
threading.Thread(target=load_dnabert, daemon=True).start()
def predict(window):
if dnabert_model is not None and dnabert_tok is not None:
try:
import torch
enc = dnabert_tok(window, return_tensors='pt',
max_length=36, padding='max_length', truncation=True)
with torch.no_grad():
s = dnabert_model(enc['input_ids'], enc['attention_mask']).item()
return round(s, 3), "DNABERT-2"
except:
pass
if rfc_model is not None:
try:
s = float(rfc_model.predict(encode_window(window).reshape(1,-1))[0])
return round(max(0,min(100,s))/100, 3), "RFC-ML"
except:
pass
return round(compute_rp_score_rfc(window)/100, 3), "RFC-Rule"
# ββ Routes ββββββββββββββββββββββββββββββββββββββββββββββββββββββββ
@app.route('/', methods=['GET'])
def home():
return jsonify({
'name': 'N2N Precision Engine',
'version': '3.0',
'brain': BRAIN_TYPE,
'inventor': 'Manav Vanga',
'patent': 'Pending 2026',
'description': 'Predicts readthrough therapy response for all nonsense mutation diseases',
'calibration': {'high_threshold': HIGH_THRESHOLD, 'med_threshold': MED_THRESHOLD},
'endpoints': ['/api/health', '/api/score', '/api/demo', '/api/trials'],
})
@app.route('/api/health', methods=['GET'])
def health():
return jsonify({
'status': 'healthy',
'brain': BRAIN_TYPE,
'version': '3.0',
'calibrated': True,
'thresholds': {'high': HIGH_THRESHOLD, 'med': MED_THRESHOLD},
})
@app.route('/api/score', methods=['GET','POST'])
def score():
if request.method == 'POST':
data = request.get_json() or {}
window = data.get('window','')
gene = data.get('gene','UNKNOWN')
fetch_trials = data.get('trials', True)
else:
window = request.args.get('window','')
gene = request.args.get('gene','UNKNOWN')
fetch_trials = request.args.get('trials','true').lower() == 'true'
if not window or len(window) < 20:
return jsonify({'error': 'window required (min 20bp DNA sequence)'}), 400
window = window.upper().replace('U','T')
score, brain_used = predict(window)
tier = get_tier(score)
w = (window+'N'*30)[:30]
p4 = w[18] if len(w)>18 else 'N'
road, road_desc = PLUS4_ROAD.get(p4, ('Unknown','Unknown'))
drugs = DRUG_DATABASE[tier]
audit = hashlib.sha256(
(window+str(score)+datetime.now(timezone.utc).isoformat()
).encode()).hexdigest()[:16]
# Fetch live clinical trials
trials = []
if fetch_trials:
trials = fetch_clinical_trials(gene=gene if gene != 'UNKNOWN' else None)
return jsonify({
'gene': gene,
'window': window[:30],
'rp_score': score,
'tier': tier,
'plus4_base': p4,
'plus4_road': road,
'plus4_road_desc': road_desc,
'therapy': drugs['therapy'],
'mechanism': drugs['mechanism'],
'approved_drugs': drugs['approved'],
'phase3_drugs': drugs['phase3'],
'phase2_drugs': drugs['phase2'],
'preclinical': drugs['preclinical'],
'combination': drugs['combination'],
'clinical_trials': trials,
'brain': brain_used,
'confidence': 'HIGH' if brain_used=='DNABERT-2' else 'MEDIUM',
'audit_hash': audit,
'timestamp': datetime.now(timezone.utc).isoformat(),
'inventor': 'Manav Vanga',
'patent': 'Pending 2026',
})
@app.route('/api/trials', methods=['GET'])
def trials():
"""Live clinical trials from ClinicalTrials.gov"""
gene = request.args.get('gene','')
condition = request.args.get('condition','')
drug = request.args.get('drug','')
if drug:
results = fetch_drug_trials(drug)
else:
results = fetch_clinical_trials(gene=gene, condition=condition)
return jsonify({
'query': {'gene':gene, 'condition':condition, 'drug':drug},
'count': len(results),
'trials': results,
'source': 'ClinicalTrials.gov API v2',
'note': 'Live data β refreshed on every request',
})
@app.route('/api/demo', methods=['GET'])
def demo():
demos = [
('CFTR','Y122X', 'AAGAAATCGATCAGTTAACAGCTTGCAGCN', '18.5% paper'),
('CFTR','G542X', 'AAGAAATCGATCAGTTGAGAGCTTGCAGCN', '0.3% paper'),
('CFTR','W1282X','AAGAAATCGATCAGTTGACAGCTTGCAGCN', '8.2% paper'),
('DMD', 'Q1922X','GCAGCAGCAGCAGCATGACGCAGCAGCAGC', 'predicted HIGH'),
('TP53','R213X', 'CGCGGCGGCGGCGGTGACGCAGCAGCAGCN', 'predicted HIGH'),
]
results = []
for gene, variant, window, expected in demos:
s, brain = predict(window)
results.append({
'gene': gene,
'variant': variant,
'rp_score': s,
'tier': get_tier(s),
'expected': expected,
'brain': brain,
})
return jsonify({
'demo_results': results,
'brain': BRAIN_TYPE,
'calibration': {'high': HIGH_THRESHOLD, 'med': MED_THRESHOLD},
})
if __name__ == '__main__':
port = int(os.environ.get('PORT', 7860))
app.run(host='0.0.0.0', port=port) |