Spaces:
No application file
No application file
| # Copyright 2006-2018 by Peter Cock. All rights reserved. | |
| # This file is part of the Biopython distribution and governed by your | |
| # choice of the "Biopython License Agreement" or the "BSD 3-Clause License". | |
| # Please see the LICENSE file that should have been included as part of this | |
| # package. | |
| r"""Sequence input/output as SeqRecord objects. | |
| Bio.SeqIO is also documented at SeqIO_ and by a whole chapter in our tutorial: | |
| - `HTML Tutorial`_ | |
| - `PDF Tutorial`_ | |
| .. _SeqIO: http://biopython.org/wiki/SeqIO | |
| .. _`HTML Tutorial`: http://biopython.org/DIST/docs/tutorial/Tutorial.html | |
| .. _`PDF Tutorial`: http://biopython.org/DIST/docs/tutorial/Tutorial.pdf | |
| Input | |
| ----- | |
| The main function is Bio.SeqIO.parse(...) which takes an input file handle | |
| (or in recent versions of Biopython alternatively a filename as a string), | |
| and format string. This returns an iterator giving SeqRecord objects: | |
| from Bio import SeqIO | |
| for record in SeqIO.parse("Fasta/f002", "fasta"): | |
| print("%s %i" % (record.id, len(record))) | |
| gi|1348912|gb|G26680|G26680 633 | |
| gi|1348917|gb|G26685|G26685 413 | |
| gi|1592936|gb|G29385|G29385 471 | |
| Note that the parse() function will invoke the relevant parser for the | |
| format with its default settings. You may want more control, in which case | |
| you need to create a format specific sequence iterator directly. | |
| Some of these parsers are wrappers around low-level parsers which build up | |
| SeqRecord objects for the consistent SeqIO interface. In cases where the | |
| run-time is critical, such as large FASTA or FASTQ files, calling these | |
| underlying parsers will be much faster - in this case these generator | |
| functions which return tuples of strings: | |
| from Bio.SeqIO.FastaIO import SimpleFastaParser | |
| from Bio.SeqIO.QualityIO import FastqGeneralIterator | |
| Input - Single Records | |
| ---------------------- | |
| If you expect your file to contain one-and-only-one record, then we provide | |
| the following 'helper' function which will return a single SeqRecord, or | |
| raise an exception if there are no records or more than one record: | |
| from Bio import SeqIO | |
| record = SeqIO.read("Fasta/f001", "fasta") | |
| print("%s %i" % (record.id, len(record))) | |
| gi|3318709|pdb|1A91| 79 | |
| This style is useful when you expect a single record only (and would | |
| consider multiple records an error). For example, when dealing with GenBank | |
| files for bacterial genomes or chromosomes, there is normally only a single | |
| record. Alternatively, use this with a handle when downloading a single | |
| record from the internet. | |
| However, if you just want the first record from a file containing multiple | |
| record, use the next() function on the iterator: | |
| from Bio import SeqIO | |
| record = next(SeqIO.parse("Fasta/f002", "fasta")) | |
| print("%s %i" % (record.id, len(record))) | |
| gi|1348912|gb|G26680|G26680 633 | |
| The above code will work as long as the file contains at least one record. | |
| Note that if there is more than one record, the remaining records will be | |
| silently ignored. | |
| Input - Multiple Records | |
| ------------------------ | |
| For non-interlaced files (e.g. Fasta, GenBank, EMBL) with multiple records | |
| using a sequence iterator can save you a lot of memory (RAM). There is | |
| less benefit for interlaced file formats (e.g. most multiple alignment file | |
| formats). However, an iterator only lets you access the records one by one. | |
| If you want random access to the records by number, turn this into a list: | |
| from Bio import SeqIO | |
| records = list(SeqIO.parse("Fasta/f002", "fasta")) | |
| len(records) | |
| 3 | |
| print(records[1].id) | |
| gi|1348917|gb|G26685|G26685 | |
| If you want random access to the records by a key such as the record id, | |
| turn the iterator into a dictionary: | |
| from Bio import SeqIO | |
| record_dict = SeqIO.to_dict(SeqIO.parse("Fasta/f002", "fasta")) | |
| len(record_dict) | |
| 3 | |
| print(len(record_dict["gi|1348917|gb|G26685|G26685"])) | |
| 413 | |
| However, using list() or the to_dict() function will load all the records | |
| into memory at once, and therefore is not possible on very large files. | |
| Instead, for *some* file formats Bio.SeqIO provides an indexing approach | |
| providing dictionary like access to any record. For example, | |
| from Bio import SeqIO | |
| record_dict = SeqIO.index("Fasta/f002", "fasta") | |
| len(record_dict) | |
| 3 | |
| print(len(record_dict["gi|1348917|gb|G26685|G26685"])) | |
| 413 | |
| record_dict.close() | |
| Many but not all of the supported input file formats can be indexed like | |
| this. For example "fasta", "fastq", "qual" and even the binary format "sff" | |
| work, but alignment formats like "phylip", "clustalw" and "nexus" will not. | |
| In most cases you can also use SeqIO.index to get the record from the file | |
| as a raw string (not a SeqRecord). This can be useful for example to extract | |
| a sub-set of records from a file where SeqIO cannot output the file format | |
| (e.g. the plain text SwissProt format, "swiss") or where it is important to | |
| keep the output 100% identical to the input). For example, | |
| from Bio import SeqIO | |
| record_dict = SeqIO.index("Fasta/f002", "fasta") | |
| len(record_dict) | |
| 3 | |
| print(record_dict.get_raw("gi|1348917|gb|G26685|G26685").decode()) | |
| >gi|1348917|gb|G26685|G26685 human STS STS_D11734. | |
| CGGAGCCAGCGAGCATATGCTGCATGAGGACCTTTCTATCTTACATTATGGCTGGGAATCTTACTCTTTC | |
| ATCTGATACCTTGTTCAGATTTCAAAATAGTTGTAGCCTTATCCTGGTTTTACAGATGTGAAACTTTCAA | |
| GAGATTTACTGACTTTCCTAGAATAGTTTCTCTACTGGAAACCTGATGCTTTTATAAGCCATTGTGATTA | |
| GGATGACTGTTACAGGCTTAGCTTTGTGTGAAANCCAGTCACCTTTCTCCTAGGTAATGAGTAGTGCTGT | |
| TCATATTACTNTAAGTTCTATAGCATACTTGCNATCCTTTANCCATGCTTATCATANGTACCATTTGAGG | |
| AATTGNTTTGCCCTTTTGGGTTTNTTNTTGGTAAANNNTTCCCGGGTGGGGGNGGTNNNGAAA | |
| <BLANKLINE> | |
| print(record_dict["gi|1348917|gb|G26685|G26685"].format("fasta")) | |
| >gi|1348917|gb|G26685|G26685 human STS STS_D11734. | |
| CGGAGCCAGCGAGCATATGCTGCATGAGGACCTTTCTATCTTACATTATGGCTGGGAATC | |
| TTACTCTTTCATCTGATACCTTGTTCAGATTTCAAAATAGTTGTAGCCTTATCCTGGTTT | |
| TACAGATGTGAAACTTTCAAGAGATTTACTGACTTTCCTAGAATAGTTTCTCTACTGGAA | |
| ACCTGATGCTTTTATAAGCCATTGTGATTAGGATGACTGTTACAGGCTTAGCTTTGTGTG | |
| AAANCCAGTCACCTTTCTCCTAGGTAATGAGTAGTGCTGTTCATATTACTNTAAGTTCTA | |
| TAGCATACTTGCNATCCTTTANCCATGCTTATCATANGTACCATTTGAGGAATTGNTTTG | |
| CCCTTTTGGGTTTNTTNTTGGTAAANNNTTCCCGGGTGGGGGNGGTNNNGAAA | |
| <BLANKLINE> | |
| record_dict.close() | |
| Here the original file and what Biopython would output differ in the line | |
| wrapping. Also note that the get_raw method will return a bytes object, | |
| hence the use of decode to turn it into a string. | |
| Also note that the get_raw method will preserve the newline endings. This | |
| example FASTQ file uses Unix style endings (b"\n" only), | |
| from Bio import SeqIO | |
| fastq_dict = SeqIO.index("Quality/example.fastq", "fastq") | |
| len(fastq_dict) | |
| 3 | |
| raw = fastq_dict.get_raw("EAS54_6_R1_2_1_540_792") | |
| raw.count(b"\n") | |
| 4 | |
| raw.count(b"\r\n") | |
| 0 | |
| b"\r" in raw | |
| False | |
| len(raw) | |
| 78 | |
| fastq_dict.close() | |
| Here is the same file but using DOS/Windows new lines (b"\r\n" instead), | |
| from Bio import SeqIO | |
| fastq_dict = SeqIO.index("Quality/example_dos.fastq", "fastq") | |
| len(fastq_dict) | |
| 3 | |
| raw = fastq_dict.get_raw("EAS54_6_R1_2_1_540_792") | |
| raw.count(b"\n") | |
| 4 | |
| raw.count(b"\r\n") | |
| 4 | |
| b"\r\n" in raw | |
| True | |
| len(raw) | |
| 82 | |
| fastq_dict.close() | |
| Because this uses two bytes for each new line, the file is longer than | |
| the Unix equivalent with only one byte. | |
| Input - Alignments | |
| ------------------ | |
| You can read in alignment files as alignment objects using Bio.AlignIO. | |
| Alternatively, reading in an alignment file format via Bio.SeqIO will give | |
| you a SeqRecord for each row of each alignment: | |
| from Bio import SeqIO | |
| for record in SeqIO.parse("Clustalw/hedgehog.aln", "clustal"): | |
| print("%s %i" % (record.id, len(record))) | |
| gi|167877390|gb|EDS40773.1| 447 | |
| gi|167234445|ref|NP_001107837. 447 | |
| gi|74100009|gb|AAZ99217.1| 447 | |
| gi|13990994|dbj|BAA33523.2| 447 | |
| gi|56122354|gb|AAV74328.1| 447 | |
| Output | |
| ------ | |
| Use the function Bio.SeqIO.write(...), which takes a complete set of | |
| SeqRecord objects (either as a list, or an iterator), an output file handle | |
| (or in recent versions of Biopython an output filename as a string) and of | |
| course the file format:: | |
| from Bio import SeqIO | |
| records = ... | |
| SeqIO.write(records, "example.faa", "fasta") | |
| Or, using a handle:: | |
| from Bio import SeqIO | |
| records = ... | |
| with open("example.faa", "w") as handle: | |
| SeqIO.write(records, handle, "fasta") | |
| You are expected to call this function once (with all your records) and if | |
| using a handle, make sure you close it to flush the data to the hard disk. | |
| Output - Advanced | |
| ----------------- | |
| The effect of calling write() multiple times on a single file will vary | |
| depending on the file format, and is best avoided unless you have a strong | |
| reason to do so. | |
| If you give a filename, then each time you call write() the existing file | |
| will be overwritten. For sequential files formats (e.g. fasta, genbank) each | |
| "record block" holds a single sequence. For these files it would probably | |
| be safe to call write() multiple times by re-using the same handle. | |
| However, trying this for certain alignment formats (e.g. phylip, clustal, | |
| stockholm) would have the effect of concatenating several multiple sequence | |
| alignments together. Such files are created by the PHYLIP suite of programs | |
| for bootstrap analysis, but it is clearer to do this via Bio.AlignIO instead. | |
| Worse, many fileformats have an explicit header and/or footer structure | |
| (e.g. any XMl format, and most binary file formats like SFF). Here making | |
| multiple calls to write() will result in an invalid file. | |
| Conversion | |
| ---------- | |
| The Bio.SeqIO.convert(...) function allows an easy interface for simple | |
| file format conversions. Additionally, it may use file format specific | |
| optimisations so this should be the fastest way too. | |
| In general however, you can combine the Bio.SeqIO.parse(...) function with | |
| the Bio.SeqIO.write(...) function for sequence file conversion. Using | |
| generator expressions or generator functions provides a memory efficient way | |
| to perform filtering or other extra operations as part of the process. | |
| File Formats | |
| ------------ | |
| When specifying the file format, use lowercase strings. The same format | |
| names are also used in Bio.AlignIO and include the following: | |
| - abi - Applied Biosystem's sequencing trace format | |
| - abi-trim - Same as "abi" but with quality trimming with Mott's algorithm | |
| - ace - Reads the contig sequences from an ACE assembly file. | |
| - cif-atom - Uses Bio.PDB.MMCIFParser to determine the (partial) protein | |
| sequence as it appears in the structure based on the atomic coordinates. | |
| - cif-seqres - Reads a macromolecular Crystallographic Information File | |
| (mmCIF) file to determine the complete protein sequence as defined by the | |
| _pdbx_poly_seq_scheme records. | |
| - embl - The EMBL flat file format. Uses Bio.GenBank internally. | |
| - fasta - The generic sequence file format where each record starts with | |
| an identifier line starting with a ">" character, followed by | |
| lines of sequence. | |
| - fasta-2line - Stricter interpretation of the FASTA format using exactly | |
| two lines per record (no line wrapping). | |
| - fastq - A "FASTA like" format used by Sanger which also stores PHRED | |
| sequence quality values (with an ASCII offset of 33). | |
| - fastq-sanger - An alias for "fastq" for consistency with BioPerl and EMBOSS | |
| - fastq-solexa - Original Solexa/Illumnia variant of the FASTQ format which | |
| encodes Solexa quality scores (not PHRED quality scores) with an | |
| ASCII offset of 64. | |
| - fastq-illumina - Solexa/Illumina 1.3 to 1.7 variant of the FASTQ format | |
| which encodes PHRED quality scores with an ASCII offset of 64 | |
| (not 33). Note as of version 1.8 of the CASAVA pipeline Illumina | |
| will produce FASTQ files using the standard Sanger encoding. | |
| - gck - Gene Construction Kit's format. | |
| - genbank - The GenBank or GenPept flat file format. | |
| - gb - An alias for "genbank", for consistency with NCBI Entrez Utilities | |
| - ig - The IntelliGenetics file format, apparently the same as the | |
| MASE alignment format. | |
| - imgt - An EMBL like format from IMGT where the feature tables are more | |
| indented to allow for longer feature types. | |
| - nib - UCSC's nib file format for nucleotide sequences, which uses one | |
| nibble (4 bits) to represent each nucleotide, and stores two nucleotides in | |
| one byte. | |
| - pdb-seqres - Reads a Protein Data Bank (PDB) file to determine the | |
| complete protein sequence as it appears in the header (no dependencies). | |
| - pdb-atom - Uses Bio.PDB to determine the (partial) protein sequence as | |
| it appears in the structure based on the atom coordinate section of the | |
| file (requires NumPy for Bio.PDB). | |
| - phd - Output from PHRED, used by PHRAP and CONSED for input. | |
| - pir - A "FASTA like" format introduced by the National Biomedical | |
| Research Foundation (NBRF) for the Protein Information Resource | |
| (PIR) database, now part of UniProt. | |
| - seqxml - SeqXML, simple XML format described in Schmitt et al (2011). | |
| - sff - Standard Flowgram Format (SFF), typical output from Roche 454. | |
| - sff-trim - Standard Flowgram Format (SFF) with given trimming applied. | |
| - snapgene - SnapGene's native format. | |
| - swiss - Plain text Swiss-Prot aka UniProt format. | |
| - tab - Simple two column tab separated sequence files, where each | |
| line holds a record's identifier and sequence. For example, | |
| this is used as by Aligent's eArray software when saving | |
| microarray probes in a minimal tab delimited text file. | |
| - qual - A "FASTA like" format holding PHRED quality values from | |
| sequencing DNA, but no actual sequences (usually provided | |
| in separate FASTA files). | |
| - uniprot-xml - The UniProt XML format (replacement for the SwissProt plain | |
| text format which we call "swiss") | |
| - xdna - DNA Strider's and SerialCloner's native format. | |
| Note that while Bio.SeqIO can read all the above file formats, it cannot | |
| write to all of them. | |
| You can also use any file format supported by Bio.AlignIO, such as "nexus", | |
| "phylip" and "stockholm", which gives you access to the individual sequences | |
| making up each alignment as SeqRecords. | |
| """ | |
| # TODO | |
| # - define policy on reading aligned sequences with more than | |
| # one gap character (see also AlignIO) | |
| # | |
| # - How best to handle unique/non unique record.id when writing. | |
| # For most file formats reading such files is fine; The stockholm | |
| # parser would fail. | |
| # | |
| # - MSF multiple alignment format, aka GCG, aka PileUp format (*.msf) | |
| # http://www.bioperl.org/wiki/MSF_multiple_alignment_format | |
| # | |
| # FAO BioPython Developers | |
| # ------------------------ | |
| # The way I envision this SeqIO system working as that for any sequence file | |
| # format we have an iterator that returns SeqRecord objects. | |
| # | |
| # This also applies to interlaced file formats (like clustal - although that | |
| # is now handled via Bio.AlignIO instead) where the file cannot be read record | |
| # by record. You should still return an iterator, even if the implementation | |
| # could just as easily return a list. | |
| # | |
| # These file format specific sequence iterators may be implemented as: | |
| # - Classes which take a handle for __init__ and provide the __iter__ method | |
| # - Functions that take a handle, and return an iterator object | |
| # - Generator functions that take a handle, and yield SeqRecord objects | |
| # | |
| # It is then trivial to turn this iterator into a list of SeqRecord objects, | |
| # an in memory dictionary, or a multiple sequence alignment object. | |
| # | |
| # For building the dictionary by default the id property of each SeqRecord is | |
| # used as the key. You should always populate the id property, and it should | |
| # be unique in most cases. For some file formats the accession number is a good | |
| # choice. If the file itself contains ambiguous identifiers, don't try and | |
| # dis-ambiguate them - return them as is. | |
| # | |
| # When adding a new file format, please use the same lower case format name | |
| # as BioPerl, or if they have not defined one, try the names used by EMBOSS. | |
| # | |
| # See also http://biopython.org/wiki/SeqIO_dev | |
| # | |
| # --Peter | |
| from Bio.Align import MultipleSeqAlignment | |
| from Bio.File import as_handle | |
| from Bio.SeqIO import AbiIO | |
| from Bio.SeqIO import AceIO | |
| from Bio.SeqIO import FastaIO | |
| from Bio.SeqIO import GckIO | |
| from Bio.SeqIO import IgIO # IntelliGenetics or MASE format | |
| from Bio.SeqIO import InsdcIO # EMBL and GenBank | |
| from Bio.SeqIO import NibIO | |
| from Bio.SeqIO import PdbIO | |
| from Bio.SeqIO import PhdIO | |
| from Bio.SeqIO import PirIO | |
| from Bio.SeqIO import QualityIO # FastQ and qual files | |
| from Bio.SeqIO import SeqXmlIO | |
| from Bio.SeqIO import SffIO | |
| from Bio.SeqIO import SnapGeneIO | |
| from Bio.SeqIO import SwissIO | |
| from Bio.SeqIO import TabIO | |
| from Bio.SeqIO import TwoBitIO | |
| from Bio.SeqIO import UniprotIO | |
| from Bio.SeqIO import XdnaIO | |
| from Bio.SeqRecord import SeqRecord | |
| # Convention for format names is "mainname-subtype" in lower case. | |
| # Please use the same names as BioPerl or EMBOSS where possible. | |
| # | |
| # Note that this simple system copes with defining | |
| # multiple possible iterators for a given format/extension | |
| # with the -subtype suffix | |
| # | |
| # Most alignment file formats will be handled via Bio.AlignIO | |
| _FormatToIterator = { | |
| "abi": AbiIO.AbiIterator, | |
| "abi-trim": AbiIO._AbiTrimIterator, | |
| "ace": AceIO.AceIterator, | |
| "fasta": FastaIO.FastaIterator, | |
| "fasta-2line": FastaIO.FastaTwoLineIterator, | |
| "ig": IgIO.IgIterator, | |
| "embl": InsdcIO.EmblIterator, | |
| "embl-cds": InsdcIO.EmblCdsFeatureIterator, | |
| "gb": InsdcIO.GenBankIterator, | |
| "gck": GckIO.GckIterator, | |
| "genbank": InsdcIO.GenBankIterator, | |
| "genbank-cds": InsdcIO.GenBankCdsFeatureIterator, | |
| "imgt": InsdcIO.ImgtIterator, | |
| "nib": NibIO.NibIterator, | |
| "cif-seqres": PdbIO.CifSeqresIterator, | |
| "cif-atom": PdbIO.CifAtomIterator, | |
| "pdb-atom": PdbIO.PdbAtomIterator, | |
| "pdb-seqres": PdbIO.PdbSeqresIterator, | |
| "phd": PhdIO.PhdIterator, | |
| "pir": PirIO.PirIterator, | |
| "fastq": QualityIO.FastqPhredIterator, | |
| "fastq-sanger": QualityIO.FastqPhredIterator, | |
| "fastq-solexa": QualityIO.FastqSolexaIterator, | |
| "fastq-illumina": QualityIO.FastqIlluminaIterator, | |
| "qual": QualityIO.QualPhredIterator, | |
| "seqxml": SeqXmlIO.SeqXmlIterator, | |
| "sff": SffIO.SffIterator, | |
| "snapgene": SnapGeneIO.SnapGeneIterator, | |
| "sff-trim": SffIO._SffTrimIterator, # Not sure about this in the long run | |
| "swiss": SwissIO.SwissIterator, | |
| "tab": TabIO.TabIterator, | |
| "twobit": TwoBitIO.TwoBitIterator, | |
| "uniprot-xml": UniprotIO.UniprotIterator, | |
| "xdna": XdnaIO.XdnaIterator, | |
| } | |
| _FormatToString = { | |
| "fasta": FastaIO.as_fasta, | |
| "fasta-2line": FastaIO.as_fasta_2line, | |
| "tab": TabIO.as_tab, | |
| "fastq": QualityIO.as_fastq, | |
| "fastq-sanger": QualityIO.as_fastq, | |
| "fastq-solexa": QualityIO.as_fastq_solexa, | |
| "fastq-illumina": QualityIO.as_fastq_illumina, | |
| "qual": QualityIO.as_qual, | |
| } | |
| # This could exclude file formats covered by _FormatToString? | |
| # Right now used in the unit tests as proxy for all supported outputs... | |
| _FormatToWriter = { | |
| "fasta": FastaIO.FastaWriter, | |
| "fasta-2line": FastaIO.FastaTwoLineWriter, | |
| "gb": InsdcIO.GenBankWriter, | |
| "genbank": InsdcIO.GenBankWriter, | |
| "embl": InsdcIO.EmblWriter, | |
| "imgt": InsdcIO.ImgtWriter, | |
| "nib": NibIO.NibWriter, | |
| "phd": PhdIO.PhdWriter, | |
| "pir": PirIO.PirWriter, | |
| "fastq": QualityIO.FastqPhredWriter, | |
| "fastq-sanger": QualityIO.FastqPhredWriter, | |
| "fastq-solexa": QualityIO.FastqSolexaWriter, | |
| "fastq-illumina": QualityIO.FastqIlluminaWriter, | |
| "qual": QualityIO.QualPhredWriter, | |
| "seqxml": SeqXmlIO.SeqXmlWriter, | |
| "sff": SffIO.SffWriter, | |
| "tab": TabIO.TabWriter, | |
| "xdna": XdnaIO.XdnaWriter, | |
| } | |
| def write(sequences, handle, format): | |
| """Write complete set of sequences to a file. | |
| Arguments: | |
| - sequences - A list (or iterator) of SeqRecord objects, or a single | |
| SeqRecord. | |
| - handle - File handle object to write to, or filename as string. | |
| - format - lower case string describing the file format to write. | |
| Note if providing a file handle, your code should close the handle | |
| after calling this function (to ensure the data gets flushed to disk). | |
| Returns the number of records written (as an integer). | |
| """ | |
| from Bio import AlignIO | |
| # Try and give helpful error messages: | |
| if not isinstance(format, str): | |
| raise TypeError("Need a string for the file format (lower case)") | |
| if not format: | |
| raise ValueError("Format required (lower case string)") | |
| if not format.islower(): | |
| raise ValueError(f"Format string '{format}' should be lower case") | |
| if isinstance(handle, SeqRecord): | |
| raise TypeError("Check arguments, handle should NOT be a SeqRecord") | |
| if isinstance(handle, list): | |
| # e.g. list of SeqRecord objects | |
| raise TypeError("Check arguments, handle should NOT be a list") | |
| if isinstance(sequences, SeqRecord): | |
| # This raised an exception in older versions of Biopython | |
| sequences = [sequences] | |
| # Map the file format to a writer function/class | |
| format_function = _FormatToString.get(format) | |
| if format_function is not None: | |
| count = 0 | |
| with as_handle(handle, "w") as fp: | |
| for record in sequences: | |
| fp.write(format_function(record)) | |
| count += 1 | |
| return count | |
| writer_class = _FormatToWriter.get(format) | |
| if writer_class is not None: | |
| count = writer_class(handle).write_file(sequences) | |
| if not isinstance(count, int): | |
| raise RuntimeError( | |
| "Internal error - the underlying %s writer " | |
| "should have returned the record count, not %r" % (format, count) | |
| ) | |
| return count | |
| if format in AlignIO._FormatToWriter: | |
| # Try and turn all the records into a single alignment, | |
| # and write that using Bio.AlignIO | |
| alignment = MultipleSeqAlignment(sequences) | |
| alignment_count = AlignIO.write([alignment], handle, format) | |
| if alignment_count != 1: | |
| raise RuntimeError( | |
| "Internal error - the underlying writer " | |
| "should have returned 1, not %r" % alignment_count | |
| ) | |
| count = len(alignment) | |
| return count | |
| if format in _FormatToIterator or format in AlignIO._FormatToIterator: | |
| raise ValueError(f"Reading format '{format}' is supported, but not writing") | |
| raise ValueError(f"Unknown format '{format}'") | |
| def parse(handle, format, alphabet=None): | |
| r"""Turn a sequence file into an iterator returning SeqRecords. | |
| Arguments: | |
| - handle - handle to the file, or the filename as a string | |
| (note older versions of Biopython only took a handle). | |
| - format - lower case string describing the file format. | |
| - alphabet - no longer used, should be None. | |
| Typical usage, opening a file to read in, and looping over the record(s): | |
| >>> from Bio import SeqIO | |
| >>> filename = "Fasta/sweetpea.nu" | |
| >>> for record in SeqIO.parse(filename, "fasta"): | |
| ... print("ID %s" % record.id) | |
| ... print("Sequence length %i" % len(record)) | |
| ID gi|3176602|gb|U78617.1|LOU78617 | |
| Sequence length 309 | |
| For lazy-loading file formats such as twobit, for which the file contents | |
| is read on demand only, ensure that the file remains open while extracting | |
| sequence data. | |
| If you have a string 'data' containing the file contents, you must | |
| first turn this into a handle in order to parse it: | |
| >>> data = ">Alpha\nACCGGATGTA\n>Beta\nAGGCTCGGTTA\n" | |
| >>> from Bio import SeqIO | |
| >>> from io import StringIO | |
| >>> for record in SeqIO.parse(StringIO(data), "fasta"): | |
| ... print("%s %s" % (record.id, record.seq)) | |
| Alpha ACCGGATGTA | |
| Beta AGGCTCGGTTA | |
| Use the Bio.SeqIO.read(...) function when you expect a single record | |
| only. | |
| """ | |
| # NOTE - The above docstring has some raw \n characters needed | |
| # for the StringIO example, hence the whole docstring is in raw | |
| # string mode (see the leading r before the opening quote). | |
| from Bio import AlignIO | |
| # Try and give helpful error messages: | |
| if not isinstance(format, str): | |
| raise TypeError("Need a string for the file format (lower case)") | |
| if not format: | |
| raise ValueError("Format required (lower case string)") | |
| if not format.islower(): | |
| raise ValueError(f"Format string '{format}' should be lower case") | |
| if alphabet is not None: | |
| raise ValueError("The alphabet argument is no longer supported") | |
| iterator_generator = _FormatToIterator.get(format) | |
| if iterator_generator: | |
| return iterator_generator(handle) | |
| if format in AlignIO._FormatToIterator: | |
| # Use Bio.AlignIO to read in the alignments | |
| return (r for alignment in AlignIO.parse(handle, format) for r in alignment) | |
| raise ValueError(f"Unknown format '{format}'") | |
| def read(handle, format, alphabet=None): | |
| """Turn a sequence file into a single SeqRecord. | |
| Arguments: | |
| - handle - handle to the file, or the filename as a string | |
| (note older versions of Biopython only took a handle). | |
| - format - string describing the file format. | |
| - alphabet - no longer used, should be None. | |
| This function is for use parsing sequence files containing | |
| exactly one record. For example, reading a GenBank file: | |
| >>> from Bio import SeqIO | |
| >>> record = SeqIO.read("GenBank/arab1.gb", "genbank") | |
| >>> print("ID %s" % record.id) | |
| ID AC007323.5 | |
| >>> print("Sequence length %i" % len(record)) | |
| Sequence length 86436 | |
| If the handle contains no records, or more than one record, | |
| an exception is raised. For example: | |
| >>> from Bio import SeqIO | |
| >>> record = SeqIO.read("GenBank/cor6_6.gb", "genbank") | |
| Traceback (most recent call last): | |
| ... | |
| ValueError: More than one record found in handle | |
| If however you want the first record from a file containing | |
| multiple records this function would raise an exception (as | |
| shown in the example above). Instead use: | |
| >>> from Bio import SeqIO | |
| >>> record = next(SeqIO.parse("GenBank/cor6_6.gb", "genbank")) | |
| >>> print("First record's ID %s" % record.id) | |
| First record's ID X55053.1 | |
| Use the Bio.SeqIO.parse(handle, format) function if you want | |
| to read multiple records from the handle. | |
| """ | |
| iterator = parse(handle, format, alphabet) | |
| try: | |
| record = next(iterator) | |
| except StopIteration: | |
| raise ValueError("No records found in handle") from None | |
| try: | |
| next(iterator) | |
| raise ValueError("More than one record found in handle") | |
| except StopIteration: | |
| pass | |
| return record | |
| def to_dict(sequences, key_function=None): | |
| """Turn a sequence iterator or list into a dictionary. | |
| Arguments: | |
| - sequences - An iterator that returns SeqRecord objects, | |
| or simply a list of SeqRecord objects. | |
| - key_function - Optional callback function which when given a | |
| SeqRecord should return a unique key for the dictionary. | |
| e.g. key_function = lambda rec : rec.name | |
| or, key_function = lambda rec : rec.description.split()[0] | |
| If key_function is omitted then record.id is used, on the assumption | |
| that the records objects returned are SeqRecords with a unique id. | |
| If there are duplicate keys, an error is raised. | |
| Since Python 3.7, the default dict class maintains key order, meaning | |
| this dictionary will reflect the order of records given to it. For | |
| CPython and PyPy, this was already implemented for Python 3.6, so | |
| effectively you can always assume the record order is preserved. | |
| Example usage, defaulting to using the record.id as key: | |
| >>> from Bio import SeqIO | |
| >>> filename = "GenBank/cor6_6.gb" | |
| >>> format = "genbank" | |
| >>> id_dict = SeqIO.to_dict(SeqIO.parse(filename, format)) | |
| >>> print(list(id_dict)) | |
| ['X55053.1', 'X62281.1', 'M81224.1', 'AJ237582.1', 'L31939.1', 'AF297471.1'] | |
| >>> print(id_dict["L31939.1"].description) | |
| Brassica rapa (clone bif72) kin mRNA, complete cds | |
| A more complex example, using the key_function argument in order to | |
| use a sequence checksum as the dictionary key: | |
| >>> from Bio import SeqIO | |
| >>> from Bio.SeqUtils.CheckSum import seguid | |
| >>> filename = "GenBank/cor6_6.gb" | |
| >>> format = "genbank" | |
| >>> seguid_dict = SeqIO.to_dict(SeqIO.parse(filename, format), | |
| ... key_function = lambda rec : seguid(rec.seq)) | |
| >>> for key, record in sorted(seguid_dict.items()): | |
| ... print("%s %s" % (key, record.id)) | |
| /wQvmrl87QWcm9llO4/efg23Vgg AJ237582.1 | |
| BUg6YxXSKWEcFFH0L08JzaLGhQs L31939.1 | |
| SabZaA4V2eLE9/2Fm5FnyYy07J4 X55053.1 | |
| TtWsXo45S3ZclIBy4X/WJc39+CY M81224.1 | |
| l7gjJFE6W/S1jJn5+1ASrUKW/FA X62281.1 | |
| uVEYeAQSV5EDQOnFoeMmVea+Oow AF297471.1 | |
| This approach is not suitable for very large sets of sequences, as all | |
| the SeqRecord objects are held in memory. Instead, consider using the | |
| Bio.SeqIO.index() function (if it supports your particular file format). | |
| This dictionary will reflect the order of records given to it. | |
| """ | |
| # This is to avoid a lambda function: | |
| def _default_key_function(rec): | |
| return rec.id | |
| if key_function is None: | |
| key_function = _default_key_function | |
| d = {} | |
| for record in sequences: | |
| key = key_function(record) | |
| if key in d: | |
| raise ValueError(f"Duplicate key '{key}'") | |
| d[key] = record | |
| return d | |
| def index(filename, format, alphabet=None, key_function=None): | |
| """Indexes a sequence file and returns a dictionary like object. | |
| Arguments: | |
| - filename - string giving name of file to be indexed | |
| - format - lower case string describing the file format | |
| - alphabet - no longer used, leave as None | |
| - key_function - Optional callback function which when given a | |
| SeqRecord identifier string should return a unique key for the | |
| dictionary. | |
| This indexing function will return a dictionary like object, giving the | |
| SeqRecord objects as values. | |
| As of Biopython 1.69, this will preserve the ordering of the records in | |
| file when iterating over the entries. | |
| >>> from Bio import SeqIO | |
| >>> records = SeqIO.index("Quality/example.fastq", "fastq") | |
| >>> len(records) | |
| 3 | |
| >>> list(records) # make a list of the keys | |
| ['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_540_792', 'EAS54_6_R1_2_1_443_348'] | |
| >>> print(records["EAS54_6_R1_2_1_540_792"].format("fasta")) | |
| >EAS54_6_R1_2_1_540_792 | |
| TTGGCAGGCCAAGGCCGATGGATCA | |
| <BLANKLINE> | |
| >>> "EAS54_6_R1_2_1_540_792" in records | |
| True | |
| >>> print(records.get("Missing", None)) | |
| None | |
| >>> records.close() | |
| If the file is BGZF compressed, this is detected automatically. Ordinary | |
| GZIP files are not supported: | |
| >>> from Bio import SeqIO | |
| >>> records = SeqIO.index("Quality/example.fastq.bgz", "fastq") | |
| >>> len(records) | |
| 3 | |
| >>> print(records["EAS54_6_R1_2_1_540_792"].seq) | |
| TTGGCAGGCCAAGGCCGATGGATCA | |
| >>> records.close() | |
| When you call the index function, it will scan through the file, noting | |
| the location of each record. When you access a particular record via the | |
| dictionary methods, the code will jump to the appropriate part of the | |
| file and then parse that section into a SeqRecord. | |
| Note that not all the input formats supported by Bio.SeqIO can be used | |
| with this index function. It is designed to work only with sequential | |
| file formats (e.g. "fasta", "gb", "fastq") and is not suitable for any | |
| interlaced file format (e.g. alignment formats such as "clustal"). | |
| For small files, it may be more efficient to use an in memory Python | |
| dictionary, e.g. | |
| >>> from Bio import SeqIO | |
| >>> records = SeqIO.to_dict(SeqIO.parse("Quality/example.fastq", "fastq")) | |
| >>> len(records) | |
| 3 | |
| >>> list(records) # make a list of the keys | |
| ['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_540_792', 'EAS54_6_R1_2_1_443_348'] | |
| >>> print(records["EAS54_6_R1_2_1_540_792"].format("fasta")) | |
| >EAS54_6_R1_2_1_540_792 | |
| TTGGCAGGCCAAGGCCGATGGATCA | |
| <BLANKLINE> | |
| As with the to_dict() function, by default the id string of each record | |
| is used as the key. You can specify a callback function to transform | |
| this (the record identifier string) into your preferred key. For example: | |
| >>> from Bio import SeqIO | |
| >>> def make_tuple(identifier): | |
| ... parts = identifier.split("_") | |
| ... return int(parts[-2]), int(parts[-1]) | |
| >>> records = SeqIO.index("Quality/example.fastq", "fastq", | |
| ... key_function=make_tuple) | |
| >>> len(records) | |
| 3 | |
| >>> list(records) # make a list of the keys | |
| [(413, 324), (540, 792), (443, 348)] | |
| >>> print(records[(540, 792)].format("fasta")) | |
| >EAS54_6_R1_2_1_540_792 | |
| TTGGCAGGCCAAGGCCGATGGATCA | |
| <BLANKLINE> | |
| >>> (540, 792) in records | |
| True | |
| >>> "EAS54_6_R1_2_1_540_792" in records | |
| False | |
| >>> print(records.get("Missing", None)) | |
| None | |
| >>> records.close() | |
| Another common use case would be indexing an NCBI style FASTA file, | |
| where you might want to extract the GI number from the FASTA identifier | |
| to use as the dictionary key. | |
| Notice that unlike the to_dict() function, here the key_function does | |
| not get given the full SeqRecord to use to generate the key. Doing so | |
| would impose a severe performance penalty as it would require the file | |
| to be completely parsed while building the index. Right now this is | |
| usually avoided. | |
| See Also: Bio.SeqIO.index_db() and Bio.SeqIO.to_dict() | |
| """ | |
| # Try and give helpful error messages: | |
| if not isinstance(filename, str): | |
| raise TypeError("Need a filename (not a handle)") | |
| if not isinstance(format, str): | |
| raise TypeError("Need a string for the file format (lower case)") | |
| if not format: | |
| raise ValueError("Format required (lower case string)") | |
| if not format.islower(): | |
| raise ValueError(f"Format string '{format}' should be lower case") | |
| if alphabet is not None: | |
| raise ValueError("The alphabet argument is no longer supported") | |
| # Map the file format to a sequence iterator: | |
| from ._index import _FormatToRandomAccess # Lazy import | |
| from Bio.File import _IndexedSeqFileDict | |
| try: | |
| proxy_class = _FormatToRandomAccess[format] | |
| except KeyError: | |
| raise ValueError(f"Unsupported format {format!r}") from None | |
| repr = "SeqIO.index(%r, %r, alphabet=%r, key_function=%r)" % ( | |
| filename, | |
| format, | |
| alphabet, | |
| key_function, | |
| ) | |
| return _IndexedSeqFileDict( | |
| proxy_class(filename, format), key_function, repr, "SeqRecord" | |
| ) | |
| def index_db( | |
| index_filename, filenames=None, format=None, alphabet=None, key_function=None | |
| ): | |
| """Index several sequence files and return a dictionary like object. | |
| The index is stored in an SQLite database rather than in memory (as in the | |
| Bio.SeqIO.index(...) function). | |
| Arguments: | |
| - index_filename - Where to store the SQLite index | |
| - filenames - list of strings specifying file(s) to be indexed, or when | |
| indexing a single file this can be given as a string. | |
| (optional if reloading an existing index, but must match) | |
| - format - lower case string describing the file format | |
| (optional if reloading an existing index, but must match) | |
| - alphabet - no longer used, leave as None. | |
| - key_function - Optional callback function which when given a | |
| SeqRecord identifier string should return a unique | |
| key for the dictionary. | |
| This indexing function will return a dictionary like object, giving the | |
| SeqRecord objects as values: | |
| >>> from Bio import SeqIO | |
| >>> files = ["GenBank/NC_000932.faa", "GenBank/NC_005816.faa"] | |
| >>> def get_gi(name): | |
| ... parts = name.split("|") | |
| ... i = parts.index("gi") | |
| ... assert i != -1 | |
| ... return parts[i+1] | |
| >>> idx_name = ":memory:" #use an in memory SQLite DB for this test | |
| >>> records = SeqIO.index_db(idx_name, files, "fasta", key_function=get_gi) | |
| >>> len(records) | |
| 95 | |
| >>> records["7525076"].description | |
| 'gi|7525076|ref|NP_051101.1| Ycf2 [Arabidopsis thaliana]' | |
| >>> records["45478717"].description | |
| 'gi|45478717|ref|NP_995572.1| pesticin [Yersinia pestis biovar Microtus str. 91001]' | |
| >>> records.close() | |
| In this example the two files contain 85 and 10 records respectively. | |
| BGZF compressed files are supported, and detected automatically. Ordinary | |
| GZIP compressed files are not supported. | |
| See Also: Bio.SeqIO.index() and Bio.SeqIO.to_dict(), and the Python module | |
| glob which is useful for building lists of files. | |
| """ | |
| # Try and give helpful error messages: | |
| if not isinstance(index_filename, str): | |
| raise TypeError("Need a string for the index filename") | |
| if isinstance(filenames, str): | |
| # Make the API a little more friendly, and more similar | |
| # to Bio.SeqIO.index(...) for indexing just one file. | |
| filenames = [filenames] | |
| if filenames is not None and not isinstance(filenames, list): | |
| raise TypeError("Need a list of filenames (as strings), or one filename") | |
| if format is not None and not isinstance(format, str): | |
| raise TypeError("Need a string for the file format (lower case)") | |
| if format and not format.islower(): | |
| raise ValueError(f"Format string '{format}' should be lower case") | |
| if alphabet is not None: | |
| raise ValueError("The alphabet argument is no longer supported") | |
| # Map the file format to a sequence iterator: | |
| from ._index import _FormatToRandomAccess # Lazy import | |
| from Bio.File import _SQLiteManySeqFilesDict | |
| repr = "SeqIO.index_db(%r, filenames=%r, format=%r, key_function=%r)" % ( | |
| index_filename, | |
| filenames, | |
| format, | |
| key_function, | |
| ) | |
| def proxy_factory(format, filename=None): | |
| """Given a filename returns proxy object, else boolean if format OK.""" | |
| if filename: | |
| return _FormatToRandomAccess[format](filename, format) | |
| else: | |
| return format in _FormatToRandomAccess | |
| return _SQLiteManySeqFilesDict( | |
| index_filename, filenames, proxy_factory, format, key_function, repr | |
| ) | |
| # TODO? - Handling aliases explicitly would let us shorten this list: | |
| _converter = { | |
| ("genbank", "fasta"): InsdcIO._genbank_convert_fasta, | |
| ("gb", "fasta"): InsdcIO._genbank_convert_fasta, | |
| ("embl", "fasta"): InsdcIO._embl_convert_fasta, | |
| ("fastq", "fasta"): QualityIO._fastq_convert_fasta, | |
| ("fastq-sanger", "fasta"): QualityIO._fastq_convert_fasta, | |
| ("fastq-solexa", "fasta"): QualityIO._fastq_convert_fasta, | |
| ("fastq-illumina", "fasta"): QualityIO._fastq_convert_fasta, | |
| ("fastq", "tab"): QualityIO._fastq_convert_tab, | |
| ("fastq-sanger", "tab"): QualityIO._fastq_convert_tab, | |
| ("fastq-solexa", "tab"): QualityIO._fastq_convert_tab, | |
| ("fastq-illumina", "tab"): QualityIO._fastq_convert_tab, | |
| ("fastq", "fastq"): QualityIO._fastq_sanger_convert_fastq_sanger, | |
| ("fastq-sanger", "fastq"): QualityIO._fastq_sanger_convert_fastq_sanger, | |
| ("fastq-solexa", "fastq"): QualityIO._fastq_solexa_convert_fastq_sanger, | |
| ("fastq-illumina", "fastq"): QualityIO._fastq_illumina_convert_fastq_sanger, | |
| ("fastq", "fastq-sanger"): QualityIO._fastq_sanger_convert_fastq_sanger, | |
| ("fastq-sanger", "fastq-sanger"): QualityIO._fastq_sanger_convert_fastq_sanger, | |
| ("fastq-solexa", "fastq-sanger"): QualityIO._fastq_solexa_convert_fastq_sanger, | |
| ("fastq-illumina", "fastq-sanger"): QualityIO._fastq_illumina_convert_fastq_sanger, | |
| ("fastq", "fastq-solexa"): QualityIO._fastq_sanger_convert_fastq_solexa, | |
| ("fastq-sanger", "fastq-solexa"): QualityIO._fastq_sanger_convert_fastq_solexa, | |
| ("fastq-solexa", "fastq-solexa"): QualityIO._fastq_solexa_convert_fastq_solexa, | |
| ("fastq-illumina", "fastq-solexa"): QualityIO._fastq_illumina_convert_fastq_solexa, | |
| ("fastq", "fastq-illumina"): QualityIO._fastq_sanger_convert_fastq_illumina, | |
| ("fastq-sanger", "fastq-illumina"): QualityIO._fastq_sanger_convert_fastq_illumina, | |
| ("fastq-solexa", "fastq-illumina"): QualityIO._fastq_solexa_convert_fastq_illumina, | |
| ( | |
| "fastq-illumina", | |
| "fastq-illumina", | |
| ): QualityIO._fastq_illumina_convert_fastq_illumina, | |
| ("fastq", "qual"): QualityIO._fastq_sanger_convert_qual, | |
| ("fastq-sanger", "qual"): QualityIO._fastq_sanger_convert_qual, | |
| ("fastq-solexa", "qual"): QualityIO._fastq_solexa_convert_qual, | |
| ("fastq-illumina", "qual"): QualityIO._fastq_illumina_convert_qual, | |
| } | |
| def convert(in_file, in_format, out_file, out_format, molecule_type=None): | |
| """Convert between two sequence file formats, return number of records. | |
| Arguments: | |
| - in_file - an input handle or filename | |
| - in_format - input file format, lower case string | |
| - out_file - an output handle or filename | |
| - out_format - output file format, lower case string | |
| - molecule_type - optional molecule type to apply, string containing | |
| "DNA", "RNA" or "protein". | |
| **NOTE** - If you provide an output filename, it will be opened which will | |
| overwrite any existing file without warning. | |
| The idea here is that while doing this will work:: | |
| from Bio import SeqIO | |
| records = SeqIO.parse(in_handle, in_format) | |
| count = SeqIO.write(records, out_handle, out_format) | |
| it is shorter to write:: | |
| from Bio import SeqIO | |
| count = SeqIO.convert(in_handle, in_format, out_handle, out_format) | |
| Also, Bio.SeqIO.convert is faster for some conversions as it can make some | |
| optimisations. | |
| For example, going from a filename to a handle: | |
| >>> from Bio import SeqIO | |
| >>> from io import StringIO | |
| >>> handle = StringIO("") | |
| >>> SeqIO.convert("Quality/example.fastq", "fastq", handle, "fasta") | |
| 3 | |
| >>> print(handle.getvalue()) | |
| >EAS54_6_R1_2_1_413_324 | |
| CCCTTCTTGTCTTCAGCGTTTCTCC | |
| >EAS54_6_R1_2_1_540_792 | |
| TTGGCAGGCCAAGGCCGATGGATCA | |
| >EAS54_6_R1_2_1_443_348 | |
| GTTGCTTCTGGCGTGGGTGGGGGGG | |
| <BLANKLINE> | |
| Note some formats like SeqXML require you to specify the molecule type | |
| when it cannot be determined by the parser: | |
| >>> from Bio import SeqIO | |
| >>> from io import BytesIO | |
| >>> handle = BytesIO() | |
| >>> SeqIO.convert("Quality/example.fastq", "fastq", handle, "seqxml", "DNA") | |
| 3 | |
| """ | |
| if molecule_type: | |
| if not isinstance(molecule_type, str): | |
| raise TypeError(f"Molecule type should be a string, not {molecule_type!r}") | |
| elif ( | |
| "DNA" in molecule_type | |
| or "RNA" in molecule_type | |
| or "protein" in molecule_type | |
| ): | |
| pass | |
| else: | |
| raise ValueError(f"Unexpected molecule type, {molecule_type!r}") | |
| f = _converter.get((in_format, out_format)) | |
| if f: | |
| count = f(in_file, out_file) | |
| else: | |
| records = parse(in_file, in_format) | |
| if molecule_type: | |
| # Edit the records on the fly to set molecule type | |
| def over_ride(record): | |
| """Over-ride molecule in-place.""" | |
| record.annotations["molecule_type"] = molecule_type | |
| return record | |
| records = (over_ride(_) for _ in records) | |
| count = write(records, out_file, out_format) | |
| return count | |
| if __name__ == "__main__": | |
| from Bio._utils import run_doctest | |
| run_doctest() | |