# Copyright 2003-2009 by Bartek Wilczynski. All rights reserved. # Copyright 2012-2013 by Michiel JL de Hoon. All rights reserved. # Revisions copyright 2019 by Victor Lin. All rights reserved. # # This file is part of the Biopython distribution and governed by your # choice of the "Biopython License Agreement" or the "BSD 3-Clause License". # Please see the LICENSE file that should have been included as part of this # package. """Tools for sequence motif analysis. Bio.motifs contains the core Motif class containing various I/O methods as well as methods for motif comparisons and motif searching in sequences. It also includes functionality for parsing output from the AlignACE, MEME, and MAST programs, as well as files in the TRANSFAC format. """ from urllib.parse import urlencode from urllib.request import urlopen, Request def create(instances, alphabet="ACGT"): """Create a Motif object.""" instances = Instances(instances, alphabet) return Motif(instances=instances, alphabet=alphabet) def parse(handle, fmt, strict=True): """Parse an output file from a motif finding program. Currently supported formats (case is ignored): - AlignAce: AlignAce output file format - ClusterBuster: Cluster Buster position frequency matrix format - XMS: XMS matrix format - MEME: MEME output file motif - MINIMAL: MINIMAL MEME output file motif - MAST: MAST output file motif - TRANSFAC: TRANSFAC database file format - pfm-four-columns: Generic position-frequency matrix format with four columns. (cisbp, homer, hocomoco, neph, tiffin) - pfm-four-rows: Generic position-frequency matrix format with four row. (scertf, yetfasco, hdpi, idmmpmm, flyfactor survey) - pfm: JASPAR-style position-frequency matrix - jaspar: JASPAR-style multiple PFM format - sites: JASPAR-style sites file As files in the pfm and sites formats contain only a single motif, it is easier to use Bio.motifs.read() instead of Bio.motifs.parse() for those. For example: >>> from Bio import motifs >>> with open("motifs/alignace.out") as handle: ... for m in motifs.parse(handle, "AlignAce"): ... print(m.consensus) ... TCTACGATTGAG CTGCACCTAGCTACGAGTGAG GTGCCCTAAGCATACTAGGCG GCCACTAGCAGAGCAGGGGGC CGACTCAGAGGTT CCACGCTAAGAGAAGTGCCGGAG GCACGTCCCTGAGCA GTCCATCGCAAAGCGTGGGGC GAGATCAGAGGGCCG TGGACGCGGGG GACCAGAGCCTCGCATGGGGG AGCGCGCGTG GCCGGTTGCTGTTCATTAGG ACCGACGGCAGCTAAAAGGG GACGCCGGGGAT CGACTCGCGCTTACAAGG If strict is True (default), the parser will raise a ValueError if the file contents does not strictly comply with the specified file format. """ fmt = fmt.lower() if fmt == "alignace": from Bio.motifs import alignace return alignace.read(handle) elif fmt == "meme": from Bio.motifs import meme return meme.read(handle) elif fmt == "minimal": from Bio.motifs import minimal return minimal.read(handle) elif fmt == "clusterbuster": from Bio.motifs import clusterbuster return clusterbuster.read(handle) elif fmt in ("pfm-four-columns", "pfm-four-rows"): from Bio.motifs import pfm return pfm.read(handle, fmt) elif fmt == "xms": from Bio.motifs import xms return xms.read(handle) elif fmt == "mast": from Bio.motifs import mast return mast.read(handle) elif fmt == "transfac": from Bio.motifs import transfac return transfac.read(handle, strict) elif fmt in ("pfm", "sites", "jaspar"): from Bio.motifs import jaspar return jaspar.read(handle, fmt) else: raise ValueError("Unknown format %s" % fmt) def read(handle, fmt, strict=True): """Read a motif from a handle using the specified file-format. This supports the same formats as Bio.motifs.parse(), but only for files containing exactly one motif. For example, reading a JASPAR-style pfm file: >>> from Bio import motifs >>> with open("motifs/SRF.pfm") as handle: ... m = motifs.read(handle, "pfm") >>> m.consensus Seq('GCCCATATATGG') Or a single-motif MEME file, >>> from Bio import motifs >>> with open("motifs/meme.psp_test.classic.zoops.xml") as handle: ... m = motifs.read(handle, "meme") >>> m.consensus Seq('GCTTATGTAA') If the handle contains no records, or more than one record, an exception is raised: >>> from Bio import motifs >>> with open("motifs/alignace.out") as handle: ... motif = motifs.read(handle, "AlignAce") Traceback (most recent call last): ... ValueError: More than one motif found in handle If however you want the first motif from a file containing multiple motifs this function would raise an exception (as shown in the example above). Instead use: >>> from Bio import motifs >>> with open("motifs/alignace.out") as handle: ... record = motifs.parse(handle, "alignace") >>> motif = record[0] >>> motif.consensus Seq('TCTACGATTGAG') Use the Bio.motifs.parse(handle, fmt) function if you want to read multiple records from the handle. If strict is True (default), the parser will raise a ValueError if the file contents does not strictly comply with the specified file format. """ fmt = fmt.lower() motifs = parse(handle, fmt, strict) if len(motifs) == 0: raise ValueError("No motifs found in handle") if len(motifs) > 1: raise ValueError("More than one motif found in handle") motif = motifs[0] return motif class Instances(list): """Class containing a list of sequences that made the motifs.""" def __init__(self, instances=None, alphabet="ACGT"): """Initialize the class.""" from Bio.Seq import Seq, MutableSeq if isinstance(instances, (Seq, MutableSeq, str)): raise TypeError( "instances should be iterator of Seq objects or strings. " "If a single sequence is given, will treat each character " "as a separate sequence." ) length = None if instances is not None: sequences = [] for instance in instances: if length is None: length = len(instance) elif length != len(instance): message = ( "All instances should have the same length (%d found, %d expected)" % (len(instance), length) ) raise ValueError(message) if not isinstance(instance, Seq): instance = Seq(str(instance)) sequences.append(instance) # no errors were raised; store the instances: self.extend(sequences) self.length = length self.alphabet = alphabet def __str__(self): """Return a string containing the sequences of the motif.""" text = "" for instance in self: text += str(instance) + "\n" return text def count(self): """Count nucleotides in a position.""" counts = {} for letter in self.alphabet: counts[letter] = [0] * self.length for instance in self: for position, letter in enumerate(instance): counts[letter][position] += 1 return counts def search(self, sequence): """Find positions of motifs in a given sequence. This is a generator function, returning found positions of motif instances in a given sequence. """ for pos in range(0, len(sequence) - self.length + 1): for instance in self: if instance == sequence[pos : pos + self.length]: yield (pos, instance) break # no other instance will fit (we don't want to return multiple hits) def reverse_complement(self): """Compute reverse complement of sequences.""" from Bio.Seq import Seq, MutableSeq from Bio.SeqRecord import SeqRecord instances = Instances(alphabet=self.alphabet) instances.length = self.length for instance in self: # TODO: remove inplace=False if isinstance(instance, (Seq, MutableSeq)): instance = instance.reverse_complement(inplace=False) elif isinstance(instance, (str, SeqRecord)): instance = instance.reverse_complement() else: raise RuntimeError("instance has unexpected type %s" % type(instance)) instances.append(instance) return instances class Motif: """A class representing sequence motifs.""" def __init__(self, alphabet="ACGT", instances=None, counts=None): """Initialize the class.""" from . import matrix self.name = "" if counts is not None and instances is not None: raise Exception( ValueError, "Specify either instances or counts, don't specify both" ) elif counts is not None: self.instances = None self.counts = matrix.FrequencyPositionMatrix(alphabet, counts) self.length = self.counts.length elif instances is not None: self.instances = instances alphabet = self.instances.alphabet counts = self.instances.count() self.counts = matrix.FrequencyPositionMatrix(alphabet, counts) self.length = self.counts.length else: self.counts = None self.instances = None self.length = None self.alphabet = alphabet self.pseudocounts = None self.background = None self.mask = None def __get_mask(self): return self.__mask def __set_mask(self, mask): if self.length is None: self.__mask = () elif mask is None: self.__mask = (1,) * self.length elif len(mask) != self.length: raise ValueError( "The length (%d) of the mask is inconsistent with the length (%d) of the motif", (len(mask), self.length), ) elif isinstance(mask, str): self.__mask = [] for char in mask: if char == "*": self.__mask.append(1) elif char == " ": self.__mask.append(0) else: raise ValueError( "Mask should contain only '*' or ' ' and not a '%s'" % char ) self.__mask = tuple(self.__mask) else: self.__mask = tuple(int(bool(c)) for c in mask) mask = property(__get_mask, __set_mask) del __get_mask del __set_mask def __get_pseudocounts(self): return self._pseudocounts def __set_pseudocounts(self, value): self._pseudocounts = {} if isinstance(value, dict): self._pseudocounts = {letter: value[letter] for letter in self.alphabet} else: if value is None: value = 0.0 self._pseudocounts = dict.fromkeys(self.alphabet, value) pseudocounts = property(__get_pseudocounts, __set_pseudocounts) del __get_pseudocounts del __set_pseudocounts def __get_background(self): return self._background def __set_background(self, value): if isinstance(value, dict): self._background = {letter: value[letter] for letter in self.alphabet} elif value is None: self._background = dict.fromkeys(self.alphabet, 1.0) else: if sorted(self.alphabet) != ["A", "C", "G", "T"]: raise ValueError( "Setting the background to a single value only works for DNA motifs" " (in which case the value is interpreted as the GC content)" ) self._background["A"] = (1.0 - value) / 2.0 self._background["C"] = value / 2.0 self._background["G"] = value / 2.0 self._background["T"] = (1.0 - value) / 2.0 total = sum(self._background.values()) for letter in self.alphabet: self._background[letter] /= total background = property(__get_background, __set_background) del __get_background del __set_background @property def pwm(self): """Compute position weight matrices.""" return self.counts.normalize(self._pseudocounts) @property def pssm(self): """Compute position specific scoring matrices.""" return self.pwm.log_odds(self._background) def __str__(self, masked=False): """Return string representation of a motif.""" text = "" if self.instances is not None: text += str(self.instances) if masked: for i in range(self.length): if self.__mask[i]: text += "*" else: text += " " text += "\n" return text def __len__(self): """Return the length of a motif. Please use this method (i.e. invoke len(m)) instead of referring to m.length directly. """ if self.length is None: return 0 else: return self.length def reverse_complement(self): """Return the reverse complement of the motif as a new motif.""" alphabet = self.alphabet if self.instances is not None: instances = self.instances.reverse_complement() res = Motif(alphabet=alphabet, instances=instances) else: # has counts counts = { "A": self.counts["T"][::-1], "C": self.counts["G"][::-1], "G": self.counts["C"][::-1], "T": self.counts["A"][::-1], } res = Motif(alphabet=alphabet, counts=counts) res.__mask = self.__mask[::-1] res.background = { "A": self.background["T"], "C": self.background["G"], "G": self.background["C"], "T": self.background["A"], } res.pseudocounts = { "A": self.pseudocounts["T"], "C": self.pseudocounts["G"], "G": self.pseudocounts["C"], "T": self.pseudocounts["A"], } return res @property def consensus(self): """Return the consensus sequence.""" return self.counts.consensus @property def anticonsensus(self): """Return the least probable pattern to be generated from this motif.""" return self.counts.anticonsensus @property def degenerate_consensus(self): """Return the degenerate consensus sequence. Following the rules adapted from D. R. Cavener: "Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates." Nucleic Acids Research 15(4): 1353-1361. (1987). The same rules are used by TRANSFAC. """ return self.counts.degenerate_consensus def weblogo(self, fname, fmt="PNG", version="2.8.2", **kwds): """Download and save a weblogo using the Berkeley weblogo service. Requires an internet connection. The parameters from ``**kwds`` are passed directly to the weblogo server. Currently, this method uses WebLogo version 3.3. These are the arguments and their default values passed to WebLogo 3.3; see their website at http://weblogo.threeplusone.com for more information:: 'stack_width' : 'medium', 'stacks_per_line' : '40', 'alphabet' : 'alphabet_dna', 'ignore_lower_case' : True, 'unit_name' : "bits", 'first_index' : '1', 'logo_start' : '1', 'logo_end': str(self.length), 'composition' : "comp_auto", 'percentCG' : '', 'scale_width' : True, 'show_errorbars' : True, 'logo_title' : '', 'logo_label' : '', 'show_xaxis': True, 'xaxis_label': '', 'show_yaxis': True, 'yaxis_label': '', 'yaxis_scale': 'auto', 'yaxis_tic_interval' : '1.0', 'show_ends' : True, 'show_fineprint' : True, 'color_scheme': 'color_auto', 'symbols0': '', 'symbols1': '', 'symbols2': '', 'symbols3': '', 'symbols4': '', 'color0': '', 'color1': '', 'color2': '', 'color3': '', 'color4': '', """ if set(self.alphabet) == set("ACDEFGHIKLMNPQRSTVWY"): alpha = "alphabet_protein" elif set(self.alphabet) == set("ACGU"): alpha = "alphabet_rna" elif set(self.alphabet) == set("ACGT"): alpha = "alphabet_dna" else: alpha = "auto" frequencies = format(self, "transfac") url = "https://weblogo.threeplusone.com/create.cgi" values = { "sequences": frequencies, "format": fmt.lower(), "stack_width": "medium", "stacks_per_line": "40", "alphabet": alpha, "ignore_lower_case": True, "unit_name": "bits", "first_index": "1", "logo_start": "1", "logo_end": str(self.length), "composition": "comp_auto", "percentCG": "", "scale_width": True, "show_errorbars": True, "logo_title": "", "logo_label": "", "show_xaxis": True, "xaxis_label": "", "show_yaxis": True, "yaxis_label": "", "yaxis_scale": "auto", "yaxis_tic_interval": "1.0", "show_ends": True, "show_fineprint": True, "color_scheme": "color_auto", "symbols0": "", "symbols1": "", "symbols2": "", "symbols3": "", "symbols4": "", "color0": "", "color1": "", "color2": "", "color3": "", "color4": "", } values.update({k: "" if v is False else str(v) for k, v in kwds.items()}) data = urlencode(values).encode("utf-8") req = Request(url, data) response = urlopen(req) with open(fname, "wb") as f: im = response.read() f.write(im) def __format__(self, format_spec): """Return a string representation of the Motif in the given format. Currently supported formats: - clusterbuster: Cluster Buster position frequency matrix format - pfm : JASPAR single Position Frequency Matrix - jaspar : JASPAR multiple Position Frequency Matrix - transfac : TRANSFAC like files """ return self.format(format_spec) def format(self, format_spec): """Return a string representation of the Motif in the given format. Currently supported formats: - clusterbuster: Cluster Buster position frequency matrix format - pfm : JASPAR single Position Frequency Matrix - jaspar : JASPAR multiple Position Frequency Matrix - transfac : TRANSFAC like files """ if format_spec in ("pfm", "jaspar"): from Bio.motifs import jaspar motifs = [self] return jaspar.write(motifs, format_spec) elif format_spec == "transfac": from Bio.motifs import transfac motifs = [self] return transfac.write(motifs) elif format_spec == "clusterbuster": from Bio.motifs import clusterbuster motifs = [self] return clusterbuster.write(motifs) else: raise ValueError("Unknown format type %s" % format_spec) def write(motifs, fmt): """Return a string representation of motifs in the given format. Currently supported formats (case is ignored): - clusterbuster: Cluster Buster position frequency matrix format - pfm : JASPAR simple single Position Frequency Matrix - jaspar : JASPAR multiple PFM format - transfac : TRANSFAC like files """ fmt = fmt.lower() if fmt in ("pfm", "jaspar"): from Bio.motifs import jaspar return jaspar.write(motifs, fmt) elif fmt == "transfac": from Bio.motifs import transfac return transfac.write(motifs) elif fmt == "clusterbuster": from Bio.motifs import clusterbuster return clusterbuster.write(motifs) else: raise ValueError("Unknown format type %s" % fmt) if __name__ == "__main__": from Bio._utils import run_doctest run_doctest(verbose=0)