Spaces:
Running
Running
File size: 42,818 Bytes
82b332c 6deb231 81d44ef 82b332c 36d6eee 2c7fcdf 28da395 36d6eee 82b332c 36d6eee 82b332c 447804f 82b332c f3c2164 82b332c 447804f 82b332c 447804f 82b332c 447804f 82b332c 447804f 82b332c f3c2164 82b332c f3c2164 82b332c f3c2164 447804f f3c2164 447804f f3c2164 447804f f3c2164 81d44ef 82b332c f3c2164 82b332c 6deb231 82b332c 447804f 82b332c f3c2164 82b332c f3c2164 82b332c 447804f 82b332c f3c2164 82b332c 447804f 82b332c 447804f 82b332c 447804f 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 6deb231 82b332c 81d44ef 82b332c 81d44ef f3c2164 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 81d44ef 82b332c 6deb231 82b332c 6deb231 82b332c f3c2164 82b332c f3c2164 82b332c f3c2164 82b332c 6deb231 82b332c 28da395 82b332c 28da395 82b332c 28da395 82b332c 6deb231 82b332c 6deb231 82b332c c3ba1ed 82b332c c3ba1ed 82b332c c3ba1ed 81d44ef 82b332c 81d44ef 82b332c 6deb231 82b332c 6deb231 82b332c 6deb231 82b332c c3ba1ed 82b332c 81d44ef 82b332c f3c2164 82b332c 6deb231 82b332c 903be3b 82b332c 995508e 16ec856 82b332c | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 | #!/usr/bin/env python3
"""
miRBind2 Gradio Interface
Interactive web app for miRNA-mRNA binding prediction with explainability
"""
import sys
import os
from pathlib import Path
# Add code directory to path
CODE_DIR = Path(__file__).parent / "miRBind_2.0-main" / "code" / "pairwise_binding_site_model"
sys.path.insert(0, str(CODE_DIR))
import torch
import torch.nn.functional as F
import numpy as np
import pandas as pd
import gradio as gr
import matplotlib.pyplot as plt
from matplotlib.colors import LinearSegmentedColormap
from matplotlib.backends.backend_pdf import PdfPages
import io
from PIL import Image
from datetime import datetime
import tempfile
from sklearn.metrics import average_precision_score
from alignment_plot import plot_alignment_image
from shared.models import load_model
from shared.constants import get_pair_to_index, get_num_pairs, get_device, NUCLEOTIDE_COLORS
from shared.encoding import pad_or_trim, encode_complementarity
# Try to import Captum for SHAP, but make it optional
try:
from captum.attr import GradientShap
CAPTUM_AVAILABLE = True
except ImportError:
CAPTUM_AVAILABLE = False
print("Warning: Captum not installed. SHAP explainability will not be available.")
print("Install with: pip install captum")
# Global model variables
MODEL = None
MODEL_PARAMS = None
DEVICE = None
PAIR_TO_INDEX = None
NUM_PAIRS = None
# Global batch results cache
BATCH_RESULTS = None
BATCH_SHAP_CACHE = {}
MODEL_FILENAME = "pairwise_onehot_model_20260105_200141.pt"
MODEL_REPO_ID = os.getenv("MIRBIND2_MODEL_REPO", "dimostzim/mirbind2-weights")
DEFAULT_MIRNA_SEQUENCE = "UAGCUUAUCAGACUGAUGUUGA"
DEFAULT_TARGET_SEQUENCE = "GGGCACUUUUUCAACAUCAGUCUGAUAAGCUAAGUGUCUUCCAGGGAAUU"
def resolve_model_path():
"""Resolve model path locally, or download from Hugging Face Hub if missing."""
local_model_path = Path(__file__).parent / "miRBind_2.0-main" / "models" / MODEL_FILENAME
if local_model_path.exists():
return local_model_path
print(f"Local model not found at {local_model_path}")
print(f"Downloading model from Hugging Face Hub repo: {MODEL_REPO_ID}")
try:
from huggingface_hub import hf_hub_download
except ImportError as exc:
raise FileNotFoundError(
"Model file missing locally and huggingface_hub is not installed."
) from exc
downloaded_path = hf_hub_download(
repo_id=MODEL_REPO_ID,
filename=MODEL_FILENAME,
repo_type="model",
)
return Path(downloaded_path)
def load_pretrained_model():
"""Load the pre-trained model once at startup."""
global MODEL, MODEL_PARAMS, DEVICE, PAIR_TO_INDEX, NUM_PAIRS
model_path = resolve_model_path()
DEVICE = get_device()
PAIR_TO_INDEX = get_pair_to_index()
NUM_PAIRS = get_num_pairs()
print(f"Loading model from {model_path}")
print(f"Using device: {DEVICE}")
MODEL, checkpoint = load_model(str(model_path), "pairwise_onehot", DEVICE)
MODEL_PARAMS = checkpoint['model_params']
print(f"Model loaded successfully!")
print(f"Model parameters: {MODEL_PARAMS}")
return True
def validate_sequence(seq, seq_type="sequence"):
"""Validate nucleotide sequence."""
if not seq or len(seq.strip()) == 0:
return False, f"{seq_type} cannot be empty"
seq = seq.strip().upper()
valid_nucleotides = set('ATCGUN')
invalid = set(seq) - valid_nucleotides
if invalid:
return False, f"{seq_type} contains invalid characters: {invalid}. Only A, T, C, G, U, N are allowed."
# Convert U to T for consistency
seq = seq.replace('U', 'T')
return True, seq
def encode_sequence_pair(target_seq, mirna_seq):
"""Encode a target-miRNA sequence pair for the model."""
target_length = MODEL_PARAMS['target_length']
mirna_length = MODEL_PARAMS['mirna_length']
# Pad or trim sequences
target_seq = pad_or_trim(target_seq, target_length)
mirna_seq = pad_or_trim(mirna_seq, mirna_length)
# Encode as integer indices
indices = encode_complementarity(
target_seq, mirna_seq, target_length, mirna_length,
PAIR_TO_INDEX, NUM_PAIRS
)
# Convert to one-hot encoding
indices_tensor = torch.tensor(indices, dtype=torch.long)
X_onehot = F.one_hot(indices_tensor, num_classes=NUM_PAIRS + 1).float()
# Add batch dimension
X_onehot = X_onehot.unsqueeze(0)
return X_onehot, target_seq, mirna_seq
def predict_binding(target_seq, mirna_seq):
"""Run binding prediction on a sequence pair."""
MODEL.eval()
with torch.no_grad():
X, _, _ = encode_sequence_pair(target_seq, mirna_seq)
X = X.to(DEVICE)
output = MODEL(X)
score = output.item()
return score
def compute_shap_values(target_seq, mirna_seq):
"""Compute SHAP attribution values for explainability."""
if not CAPTUM_AVAILABLE:
return None
MODEL.eval()
X, _, _ = encode_sequence_pair(target_seq, mirna_seq)
X = X.to(DEVICE)
X.requires_grad = True
# Create baseline (all zeros)
baseline = torch.zeros_like(X)
# Compute SHAP values
explainer = GradientShap(MODEL)
attributions = explainer.attribute(X, baselines=baseline, target=0)
# Convert to numpy and reduce from 3D to 2D by summing over pair dimension
shap_3d = attributions[0].cpu().detach().numpy()
shap_2d = np.sum(shap_3d, axis=2) # Shape: [mirna_length, target_length]
return shap_2d
def plot_shap_heatmap(shap_2d, mirna_seq, target_seq, prediction_score):
"""Create SHAP heatmap visualization."""
fig_width = max(16, len(target_seq) * 0.32)
fig_height = max(8, len(mirna_seq) * 0.3)
fig, ax = plt.subplots(figsize=(fig_width, fig_height))
# Create custom colormap (red-white-blue)
colors = ['#2166ac', '#4393c3', '#92c5de', '#d1e5f0', '#f7f7f7',
'#fddbc7', '#f4a582', '#d6604d', '#b2182b']
n_bins = 256
cmap = LinearSegmentedColormap.from_list('shap', colors, N=n_bins)
# Plot heatmap
vmax = np.abs(shap_2d).max()
im = ax.imshow(shap_2d, cmap=cmap, aspect='auto', vmin=-vmax, vmax=vmax)
# Add colorbar
cbar = plt.colorbar(im, ax=ax, fraction=0.046, pad=0.04)
cbar.set_label('SHAP Attribution Value', rotation=270, labelpad=20, fontsize=11)
# Set labels
ax.set_xlabel('mRNA/Target Position', fontsize=12)
ax.set_ylabel('miRNA Position', fontsize=12)
ax.set_title(f'miRNA-mRNA Target Site Explainability (Prediction: {prediction_score:.3f})',
fontsize=14, pad=20)
# Add sequence labels on axes
mirna_length = len(mirna_seq)
target_length = len(target_seq)
mirna_ticks = list(range(mirna_length))
target_ticks = list(range(target_length))
x_fontsize = max(5, min(8, 300 / max(target_length, 1)))
y_fontsize = max(6, min(9, 240 / max(mirna_length, 1)))
ax.set_yticks(mirna_ticks)
ax.set_yticklabels([f"{i:>2} {mirna_seq[i]}" for i in mirna_ticks],
fontsize=y_fontsize, fontfamily='monospace')
ax.set_xticks(target_ticks)
ax.set_xticklabels([f"{target_seq[i]}\n{i}" for i in target_ticks],
fontsize=x_fontsize, rotation=0)
ax.tick_params(axis='x', pad=6)
ax.tick_params(axis='y', pad=6)
# Add grid
ax.grid(True, alpha=0.2, linewidth=0.5)
plt.tight_layout()
# Convert to image
buf = io.BytesIO()
plt.savefig(buf, format='png', dpi=120, bbox_inches='tight')
buf.seek(0)
img = Image.open(buf)
plt.close()
return img
def plot_sequence_explainability(mirna_seq, target_seq, shap_2d=None):
"""Create sequence explainability visualization with SHAP importance bars."""
if shap_2d is None:
# If no SHAP values, just show sequences
fig, (ax1, ax2) = plt.subplots(2, 1, figsize=(14, 4))
# Plot miRNA sequence
for i, nuc in enumerate(mirna_seq):
color = NUCLEOTIDE_COLORS.get(nuc, 'gray')
ax1.text(i, 0, nuc, ha='center', va='center', fontsize=9,
bbox=dict(boxstyle='round,pad=0.5', facecolor=color, alpha=0.3))
ax1.text(-2, 0, 'miRNA:', ha='right', va='center', fontsize=11, fontweight='bold')
ax1.set_xlim(-3, len(mirna_seq))
ax1.set_ylim(-0.5, 0.5)
ax1.axis('off')
ax1.set_title('miRNA Sequence', fontsize=11, pad=10)
# Plot target sequence
for i, nuc in enumerate(target_seq):
color = NUCLEOTIDE_COLORS.get(nuc, 'gray')
ax2.text(i, 0, nuc, ha='center', va='center', fontsize=9,
bbox=dict(boxstyle='round,pad=0.5', facecolor=color, alpha=0.3))
ax2.text(-2, 0, 'mRNA:', ha='right', va='center', fontsize=11, fontweight='bold')
ax2.set_xlim(-3, len(target_seq))
ax2.set_ylim(-0.5, 0.5)
ax2.axis('off')
ax2.set_title('mRNA/Target Sequence', fontsize=11, pad=10)
else:
# With SHAP values - show importance bars
# Max SHAP per miRNA position (max across target positions - axis 1)
mirna_importance = np.max(np.abs(shap_2d), axis=1)
# Max SHAP per target position (max across miRNA positions - axis 0)
target_importance = np.max(np.abs(shap_2d), axis=0)
fig_width = max(16, len(target_seq) * 0.28)
fig, (ax1, ax2) = plt.subplots(2, 1, figsize=(fig_width, 6.5))
# --- miRNA subplot ---
# Bar plot for importance
_draw_sequence_importance_axis(
ax1,
mirna_seq,
mirna_importance,
'steelblue',
'miRNA Position',
'miRNA Sequence Importance (Max SHAP per position)',
label='Max SHAP Score'
)
# --- Target subplot ---
_draw_sequence_importance_axis(
ax2,
target_seq,
target_importance,
'coral',
'mRNA/Target Position',
'mRNA/Target Sequence Importance (Max SHAP per position)',
label='Max SHAP Score'
)
plt.tight_layout()
# Convert to image
buf = io.BytesIO()
plt.savefig(buf, format='png', dpi=120, bbox_inches='tight')
buf.seek(0)
img = Image.open(buf)
plt.close()
return img
def _draw_sequence_importance_axis(ax, sequence, importance, bar_color, xlabel, title,
label=None, title_fontsize=11, label_fontsize=9,
nucleotide_fontsize=8, y_fontsize=10):
"""Render per-position importance with nucleotide boxes and separate position numbers."""
x_positions = np.arange(len(sequence))
if label is None:
ax.bar(x_positions, importance, alpha=0.6, color=bar_color, width=0.8)
else:
ax.bar(x_positions, importance, alpha=0.6, color=bar_color, width=0.8, label=label)
max_importance = float(np.max(importance)) if len(importance) else 0.0
y_top = max(max_importance * 1.15, 0.1)
nucleotide_y = -0.08 * y_top
ax.set_ylim(-0.22 * y_top, y_top)
for i, nuc in enumerate(sequence):
color = NUCLEOTIDE_COLORS.get(nuc, 'gray')
ax.text(i, nucleotide_y, nuc, ha='center', va='top',
fontsize=nucleotide_fontsize, fontweight='bold',
bbox=dict(boxstyle='round,pad=0.3', facecolor=color, alpha=0.4))
ax.set_xlim(-0.5, len(sequence) - 0.5)
ax.set_xticks(x_positions)
ax.set_xticklabels([str(i) for i in x_positions],
fontsize=max(5, min(8, 300 / max(len(sequence), 1))))
ax.tick_params(axis='x', length=0, pad=10)
ax.set_xlabel(xlabel, fontsize=10, labelpad=12)
ax.set_ylabel('Max SHAP Score', fontsize=y_fontsize)
ax.set_title(title, fontsize=title_fontsize, pad=10)
ax.grid(True, alpha=0.3, axis='y')
if label is not None:
ax.legend(loc='upper right', fontsize=label_fontsize)
def create_shap_visualizations(mirna_seq, target_seq, score, shap_2d):
"""Build the explainability visualizations used across the app."""
explainability_img = plot_sequence_explainability(mirna_seq, target_seq, shap_2d)
heatmap_img = None
alignment_img = None
if shap_2d is not None:
heatmap_img = plot_shap_heatmap(shap_2d, mirna_seq, target_seq, score)
try:
alignment_img = plot_alignment_image(mirna_seq, target_seq, shap_2d)
except Exception as alignment_error:
print(f"Warning: alignment plot generation failed: {alignment_error}")
return explainability_img, heatmap_img, alignment_img
def generate_pdf_report(mirna_seq, target_seq, score, binding_prediction, confidence, shap_2d=None):
"""Generate a PDF report with all visualizations and results."""
# Create temporary file for PDF
pdf_file = tempfile.NamedTemporaryFile(delete=False, suffix='.pdf')
pdf_path = pdf_file.name
pdf_file.close()
# Pad sequences to model length
mirna_seq_padded = pad_or_trim(mirna_seq, MODEL_PARAMS['mirna_length'])
target_seq_padded = pad_or_trim(target_seq, MODEL_PARAMS['target_length'])
with PdfPages(pdf_path) as pdf:
# Page 1: Title and Summary
fig = plt.figure(figsize=(8.5, 11))
ax = fig.add_subplot(111)
ax.axis('off')
# Title
title_text = "miRBind2 Target Site Prediction Report"
ax.text(0.5, 0.95, title_text, ha='center', va='top',
fontsize=20, fontweight='bold', transform=ax.transAxes)
# Date
date_text = f"Generated: {datetime.now().strftime('%Y-%m-%d %H:%M:%S')}"
ax.text(0.5, 0.91, date_text, ha='center', va='top',
fontsize=10, color='gray', transform=ax.transAxes)
# Divider
ax.plot([0.1, 0.9], [0.89, 0.89], 'k-', linewidth=1, transform=ax.transAxes)
# Results section
y_pos = 0.85
ax.text(0.5, y_pos, "Prediction Results", ha='center', va='top',
fontsize=16, fontweight='bold', transform=ax.transAxes)
y_pos -= 0.06
ax.text(0.1, y_pos, f"Binding Score:", ha='left', va='top',
fontsize=12, fontweight='bold', transform=ax.transAxes)
ax.text(0.5, y_pos, f"{score:.4f}", ha='left', va='top',
fontsize=12, transform=ax.transAxes)
y_pos -= 0.04
ax.text(0.1, y_pos, f"Prediction:", ha='left', va='top',
fontsize=12, fontweight='bold', transform=ax.transAxes)
# Color code the prediction
pred_color = 'green' if binding_prediction == "BINDING" else 'red'
ax.text(0.5, y_pos, binding_prediction, ha='left', va='top',
fontsize=12, color=pred_color, fontweight='bold', transform=ax.transAxes)
y_pos -= 0.04
ax.text(0.1, y_pos, f"Confidence:", ha='left', va='top',
fontsize=12, fontweight='bold', transform=ax.transAxes)
ax.text(0.5, y_pos, f"{confidence:.1%}", ha='left', va='top',
fontsize=12, transform=ax.transAxes)
# Sequences section
y_pos -= 0.08
ax.text(0.5, y_pos, "Input Sequences", ha='center', va='top',
fontsize=16, fontweight='bold', transform=ax.transAxes)
y_pos -= 0.06
ax.text(0.1, y_pos, "miRNA Sequence:", ha='left', va='top',
fontsize=12, fontweight='bold', transform=ax.transAxes)
y_pos -= 0.03
ax.text(0.1, y_pos, mirna_seq, ha='left', va='top',
fontsize=10, family='monospace', transform=ax.transAxes)
y_pos -= 0.03
ax.text(0.1, y_pos, f"(Length: {len(mirna_seq)} nt, padded to {MODEL_PARAMS['mirna_length']} nt)",
ha='left', va='top', fontsize=9, color='gray', transform=ax.transAxes)
y_pos -= 0.05
ax.text(0.1, y_pos, "mRNA/Target Sequence:", ha='left', va='top',
fontsize=12, fontweight='bold', transform=ax.transAxes)
y_pos -= 0.03
# Wrap long sequences
target_wrapped = '\n'.join([target_seq[i:i+60] for i in range(0, len(target_seq), 60)])
ax.text(0.1, y_pos, target_wrapped, ha='left', va='top',
fontsize=10, family='monospace', transform=ax.transAxes)
lines_used = len(target_seq) // 60 + 1
y_pos -= 0.03 * lines_used
ax.text(0.1, y_pos, f"(Length: {len(target_seq)} nt, padded to {MODEL_PARAMS['target_length']} nt)",
ha='left', va='top', fontsize=9, color='gray', transform=ax.transAxes)
# Model info
y_pos -= 0.06
ax.text(0.5, y_pos, "Model Information", ha='center', va='top',
fontsize=16, fontweight='bold', transform=ax.transAxes)
y_pos -= 0.05
ax.text(0.1, y_pos, "Model: miRBind2 v1.0", ha='left', va='top',
fontsize=10, transform=ax.transAxes)
y_pos -= 0.03
ax.text(0.1, y_pos, "Training Data: AGO2 eCLIP (Manakov et al. 2022)", ha='left', va='top',
fontsize=10, transform=ax.transAxes)
pdf.savefig(fig, bbox_inches='tight')
plt.close()
# Page 2: Sequence Explainability (if SHAP available)
if shap_2d is not None:
# Create the sequence explainability plot
mirna_importance = np.max(np.abs(shap_2d), axis=1)
target_importance = np.max(np.abs(shap_2d), axis=0)
fig, (ax1, ax2) = plt.subplots(
2, 1, figsize=(max(12, len(target_seq_padded) * 0.24), 10)
)
# miRNA importance
_draw_sequence_importance_axis(
ax1,
mirna_seq_padded,
mirna_importance,
'steelblue',
'miRNA Position',
'miRNA Sequence Importance (Max SHAP per position)',
title_fontsize=13,
nucleotide_fontsize=7,
y_fontsize=11
)
# mRNA importance
_draw_sequence_importance_axis(
ax2,
target_seq_padded,
target_importance,
'coral',
'mRNA/Target Position',
'mRNA/Target Sequence Importance (Max SHAP per position)',
title_fontsize=13,
nucleotide_fontsize=7,
y_fontsize=11
)
plt.tight_layout()
pdf.savefig(fig, bbox_inches='tight')
plt.close()
# Page 3: SHAP Heatmap
fig, ax = plt.subplots(
figsize=(max(12, len(target_seq_padded) * 0.24), max(10, len(mirna_seq_padded) * 0.3))
)
# Create colormap
colors = ['#2166ac', '#4393c3', '#92c5de', '#d1e5f0', '#f7f7f7',
'#fddbc7', '#f4a582', '#d6604d', '#b2182b']
cmap = LinearSegmentedColormap.from_list('shap', colors, N=256)
vmax = np.abs(shap_2d).max()
im = ax.imshow(shap_2d, cmap=cmap, aspect='auto', vmin=-vmax, vmax=vmax)
cbar = plt.colorbar(im, ax=ax, fraction=0.046, pad=0.04)
cbar.set_label('SHAP Attribution Value', rotation=270, labelpad=20, fontsize=11)
ax.set_xlabel('mRNA/Target Position', fontsize=11)
ax.set_ylabel('miRNA Position', fontsize=11)
ax.set_title(f'SHAP Explainability Heatmap\nTarget site prediction: {score:.3f}',
fontsize=13, fontweight='bold', pad=15)
# Add sequence labels
mirna_ticks = list(range(len(mirna_seq_padded)))
target_ticks = list(range(len(target_seq_padded)))
x_fontsize = max(5, min(7, 260 / max(len(target_seq_padded), 1)))
y_fontsize = max(6, min(8, 220 / max(len(mirna_seq_padded), 1)))
ax.set_yticks(mirna_ticks)
ax.set_yticklabels([f"{i:>2} {mirna_seq_padded[i]}" for i in mirna_ticks],
fontsize=y_fontsize, fontfamily='monospace')
ax.set_xticks(target_ticks)
ax.set_xticklabels([f"{target_seq_padded[i]}\n{i}" for i in target_ticks],
fontsize=x_fontsize, rotation=0)
ax.tick_params(axis='x', pad=6)
ax.tick_params(axis='y', pad=6)
ax.grid(True, alpha=0.2, linewidth=0.5)
# Add explanation text
explanation = ("Red regions: Positive contribution to binding\n"
"Blue regions: Negative contribution to binding\n"
"White regions: Minimal contribution")
fig.text(0.5, 0.02, explanation, ha='center', va='bottom',
fontsize=9, style='italic', bbox=dict(boxstyle='round',
facecolor='wheat', alpha=0.3))
plt.tight_layout()
pdf.savefig(fig, bbox_inches='tight')
plt.close()
try:
alignment_img = plot_alignment_image(mirna_seq_padded, target_seq_padded, shap_2d)
fig, ax = plt.subplots(figsize=(max(12, alignment_img.width / 110), 4.5))
ax.imshow(alignment_img)
ax.axis('off')
ax.set_title('SHAP-Guided Target Site Alignment', fontsize=13, fontweight='bold', pad=12)
plt.tight_layout()
pdf.savefig(fig, bbox_inches='tight')
plt.close()
except Exception as alignment_error:
print(f"Warning: alignment plot PDF page failed: {alignment_error}")
return pdf_path
def run_prediction(mirna_input, target_input, show_shap=True):
"""Main prediction function called by Gradio."""
# Validate inputs
valid_mirna, mirna_result = validate_sequence(mirna_input, "miRNA sequence")
if not valid_mirna:
return mirna_result, None, None, None, None, None
valid_target, target_result = validate_sequence(target_input, "mRNA sequence")
if not valid_target:
return target_result, None, None, None, None, None
mirna_seq = mirna_result
target_seq = target_result
mirna_padded = pad_or_trim(mirna_seq, MODEL_PARAMS['mirna_length'])
target_padded = pad_or_trim(target_seq, MODEL_PARAMS['target_length'])
try:
# Run prediction
score = predict_binding(target_seq, mirna_seq)
# Determine binding prediction
binding = "BINDING" if score >= 0.5 else "NO BINDING"
confidence = score if score >= 0.5 else (1 - score)
# Format result text
result_text = f"""
### Prediction Results
**Binding Score:** {score:.4f}
**Prediction:** {binding} (Confidence: {confidence:.1%})
**Model:** miRBind2 v1.0
**Sequences Used:**
- miRNA length: {len(mirna_seq)} nt (padded to {MODEL_PARAMS['mirna_length']})
- mRNA length: {len(target_seq)} nt (padded to {MODEL_PARAMS['target_length']})
"""
# Compute SHAP if requested
shap_2d = None
shap_img = None
shap_text = ""
explainability_img = None
alignment_img = None
if show_shap and CAPTUM_AVAILABLE:
shap_text = "Computing SHAP values..."
shap_2d = compute_shap_values(target_seq, mirna_seq)
if shap_2d is not None:
shap_text = """
### SHAP Explainability
**Position Pairs Heatmap** shows which miRNA-mRNA position combinations contribute most:
- **Red regions:** Positive contribution to binding
- **Blue regions:** Negative contribution to binding
- **White regions:** Minimal contribution
**Sequence Explainability** above shows per-nucleotide importance (max SHAP score across all positions).
**Alignment View** shows a SHAP-guided target site alignment between the miRNA and target sequence.
This helps identify the specific target sites and key nucleotides driving the prediction.
"""
elif show_shap and not CAPTUM_AVAILABLE:
shap_text = "SHAP visualization requires Captum library. Install with: pip install captum"
explainability_img, shap_img, alignment_img = create_shap_visualizations(
mirna_padded,
target_padded,
score,
shap_2d
)
# Generate PDF report
pdf_path = None
if shap_2d is not None:
try:
pdf_path = generate_pdf_report(
mirna_seq, target_seq, score, binding, confidence, shap_2d
)
except Exception as pdf_error:
print(f"Warning: PDF generation failed: {pdf_error}")
pdf_path = None
return result_text, explainability_img, shap_img, alignment_img, shap_text, pdf_path
except Exception as e:
return f"Error during prediction: {str(e)}", None, None, None, None, None
# ============================================================================
# BATCH PREDICTION FUNCTIONS
# ============================================================================
def parse_batch_file(file_path):
"""Parse uploaded TSV/CSV file with miRNA-target pairs."""
try:
# Try reading as TSV first
df = pd.read_csv(file_path, sep='\t')
# If only one column, try CSV
if len(df.columns) == 1:
df = pd.read_csv(file_path)
# Check for required columns
if len(df.columns) < 2:
return None, "File must have at least 2 columns (target, miRNA)"
# Standardize column names
col_names = df.columns.tolist()
# Try to detect labels
if 'label' in col_names or 'class' in col_names:
has_labels = True
else:
has_labels = len(df.columns) >= 3
# Rename columns for consistency
if has_labels:
df.columns = ['target_seq', 'mirna_seq', 'label'] + col_names[3:]
else:
df.columns = ['target_seq', 'mirna_seq'] + col_names[2:]
df['label'] = -1 # Unknown
return df, None
except Exception as e:
return None, f"Error parsing file: {str(e)}"
def run_batch_predictions(df, compute_shap=False, progress=gr.Progress()):
"""Run predictions on all pairs in the dataframe."""
global BATCH_RESULTS, BATCH_SHAP_CACHE
results = []
BATCH_SHAP_CACHE = {}
total = len(df)
for idx, row in progress.tqdm(df.iterrows(), total=total, desc="Processing pairs"):
target_seq = str(row['target_seq'])
mirna_seq = str(row['mirna_seq'])
true_label = row.get('label', -1)
# Validate sequences
valid_target, target_result = validate_sequence(target_seq, "Target")
valid_mirna, mirna_result = validate_sequence(mirna_seq, "miRNA")
if not valid_target or not valid_mirna:
results.append({
'index': idx,
'mirna_seq': mirna_seq,
'target_seq': target_seq,
'true_label': true_label,
'prediction_score': None,
'predicted_class': None,
'status': 'Invalid sequence'
})
continue
target_seq = target_result
mirna_seq = mirna_result
# Run prediction
try:
score = predict_binding(target_seq, mirna_seq)
pred_class = 1 if score >= 0.5 else 0
results.append({
'index': idx,
'mirna_seq': mirna_seq,
'target_seq': target_seq,
'true_label': true_label,
'prediction_score': score,
'predicted_class': pred_class,
'status': 'Success'
})
# Compute SHAP if requested (cached for detail view)
if compute_shap and CAPTUM_AVAILABLE:
shap_2d = compute_shap_values(target_seq, mirna_seq)
BATCH_SHAP_CACHE[idx] = shap_2d
except Exception as e:
results.append({
'index': idx,
'mirna_seq': mirna_seq,
'target_seq': target_seq,
'true_label': true_label,
'prediction_score': None,
'predicted_class': None,
'status': f'Error: {str(e)}'
})
BATCH_RESULTS = pd.DataFrame(results)
return BATCH_RESULTS
def format_results_table(results_df):
"""Format results for display in Gradio table."""
if results_df is None or len(results_df) == 0:
return None
display_df = results_df.copy()
# Format columns
display_df['Score'] = display_df['prediction_score'].apply(
lambda x: f"{x:.4f}" if x is not None else "N/A"
)
display_df['Prediction'] = display_df['predicted_class'].apply(
lambda x: "BINDING" if x == 1 else "NO BINDING" if x == 0 else "N/A"
)
display_df['True Label'] = display_df['true_label'].apply(
lambda x: "BINDING" if x == 1 else "NO BINDING" if x == 0 else "Unknown"
)
# Truncate sequences for display
display_df['miRNA'] = display_df['mirna_seq'].apply(
lambda x: x[:20] + "..." if len(x) > 20 else x
)
display_df['Target'] = display_df['target_seq'].apply(
lambda x: x[:30] + "..." if len(x) > 30 else x
)
# Select and reorder columns
display_cols = ['index', 'miRNA', 'Target', 'True Label', 'Score', 'Prediction', 'status']
return display_df[display_cols]
def show_batch_detail_view(current_table_state, evt: gr.SelectData):
"""Show detailed view for selected row from batch results.
Args:
current_table_state: The current state of the displayed table (including any sorting)
evt: Selection event containing row/column info
"""
global BATCH_RESULTS, BATCH_SHAP_CACHE
if BATCH_RESULTS is None:
return "No results available", None, None, None, None
if current_table_state is None or len(current_table_state) == 0:
return "No data in table", None, None, None, None
# Get the visual row position in the currently displayed (possibly sorted) table
visual_row_idx = evt.index[0]
if visual_row_idx >= len(current_table_state):
return "Invalid selection", None, None, None, None
# Get the index from the DISPLAYED table at this position
# This works correctly even if the table is sorted
actual_idx = current_table_state.iloc[visual_row_idx]['index']
# Find the row in the original results using the actual index
row = BATCH_RESULTS[BATCH_RESULTS['index'] == actual_idx].iloc[0]
mirna_seq = row['mirna_seq']
target_seq = row['target_seq']
score = row['prediction_score']
pred_class = row['predicted_class']
true_label = row['true_label']
idx = row['index']
if score is None:
return f"**Error:** {row['status']}", None, None, None, None
# Format result text
binding = "BINDING" if pred_class == 1 else "NO BINDING"
confidence = score if pred_class == 1 else (1 - score)
true_label_str = "BINDING" if true_label == 1 else "NO BINDING" if true_label == 0 else "Unknown"
result_text = f"""
### Detailed Results for Pair #{idx}
**Binding Score:** {score:.4f}
**Prediction:** {binding} (Confidence: {confidence:.1%})
**True Label:** {true_label_str}
**Sequences:**
- **miRNA:** {mirna_seq}
- **mRNA:** {target_seq}
"""
# Get or compute SHAP
shap_2d = BATCH_SHAP_CACHE.get(idx)
if shap_2d is not None:
# Pad sequences
mirna_padded = pad_or_trim(mirna_seq, MODEL_PARAMS['mirna_length'])
target_padded = pad_or_trim(target_seq, MODEL_PARAMS['target_length'])
explainability_img, heatmap_img, alignment_img = create_shap_visualizations(
mirna_padded,
target_padded,
score,
shap_2d
)
explanation = (
"**SHAP values** computed during batch processing. "
"The alignment view is derived from the same SHAP matrix."
)
else:
explainability_img = None
heatmap_img = None
alignment_img = None
explanation = "β οΈ **SHAP not computed.** Re-run batch with 'Compute SHAP' enabled to see explainability."
return result_text, explainability_img, heatmap_img, alignment_img, explanation
def process_uploaded_file(file, compute_shap):
"""Process uploaded file and run predictions."""
if file is None:
return "Please upload a file", None
# Parse file
df, error = parse_batch_file(file.name)
if error:
return error, None
# Run predictions
results_df = run_batch_predictions(df, compute_shap=compute_shap)
# Format for display
display_df = format_results_table(results_df)
# Summary statistics
total = len(results_df)
successful = len(results_df[results_df['status'] == 'Success'])
if 'true_label' in results_df.columns:
known_labels = results_df[results_df['true_label'] != -1]
if len(known_labels) > 0:
correct = len(known_labels[known_labels['predicted_class'] == known_labels['true_label']])
accuracy = correct / len(known_labels) * 100
scored = known_labels.dropna(subset=['prediction_score'])
aps_line = ""
if len(scored) > 0:
aps = average_precision_score(scored['true_label'], scored['prediction_score'])
aps_line = f"\n**APS (Average Precision):** {aps:.4f}"
summary = f"""
### Batch Processing Complete β
**Total pairs:** {total}
**Successful:** {successful}
**Failed:** {total - successful}
**Accuracy:** {accuracy:.1f}% ({correct}/{len(known_labels)} correct){aps_line}
π Click any row in the table below to view detailed SHAP analysis.
"""
else:
summary = f"""
### Batch Processing Complete β
**Total pairs:** {total}
**Successful:** {successful}
**Failed:** {total - successful}
π Click any row in the table below to view detailed results.
"""
else:
summary = f"""
### Batch Processing Complete β
**Total pairs:** {total}
**Successful:** {successful}
**Failed:** {total - successful}
π Click any row in the table below to view detailed results.
"""
return summary, display_df
def create_gradio_interface():
"""Create the Gradio web interface with tabs."""
with gr.Blocks(title="miRBind2: miRNA-mRNA Target Site Predictor") as app:
gr.Markdown("""
# miRBind2: miRNA-mRNA Target Site Predictor
Predict miRNA-mRNA target sites using deep learning with explainability.
**Model:** miRBind2 v1.0
""")
with gr.Tabs():
# ================================================================
# TAB 1: SINGLE PREDICTION
# ================================================================
with gr.Tab("Single Prediction"):
with gr.Row():
with gr.Column(scale=1):
gr.Markdown("### Input Sequences")
mirna_input = gr.Textbox(
label="miRNA Sequence",
placeholder=f"Enter miRNA sequence (e.g., {DEFAULT_MIRNA_SEQUENCE})",
lines=3,
value=DEFAULT_MIRNA_SEQUENCE
)
target_input = gr.Textbox(
label="mRNA/Target Sequence",
placeholder="Enter mRNA target sequence",
lines=5,
# Demo target embeds a reverse-complement site for clearer default explainability.
value=DEFAULT_TARGET_SEQUENCE
)
show_shap = gr.Checkbox(
label="Show SHAP Explainability (slower)",
value=True
)
predict_btn = gr.Button("Predict Binding", variant="primary", size="lg")
gr.Markdown("""
**Instructions:**
1. Enter your miRNA sequence (RNA or DNA notation accepted)
2. Enter your mRNA target sequence
3. Check SHAP box for detailed explainability (recommended)
4. Click 'Predict Binding'
**Sequence length:** miRNA is padded/trimmed to 28 nt, mRNA to 50 nt. Sequences longer than these limits are trimmed from the 3β² end; shorter sequences are padded with N.
""")
with gr.Column(scale=2):
gr.Markdown("### Results")
result_output = gr.Markdown(label="Prediction Results")
gr.Markdown("#### Sequence Explainability")
explainability_output = gr.Image(show_label=False, type="pil")
gr.Markdown("#### SHAP Explainability Heatmap (Position Pairs)")
shap_output = gr.Image(show_label=False, type="pil")
gr.Markdown("#### SHAP-Guided Alignment View")
alignment_view_output = gr.Image(show_label=False, type="pil")
shap_text_output = gr.Markdown()
# PDF download button
with gr.Row():
pdf_download = gr.File(label="Download PDF Report", visible=True)
# Connect prediction button
predict_btn.click(
fn=run_prediction,
inputs=[mirna_input, target_input, show_shap],
outputs=[
result_output,
explainability_output,
shap_output,
alignment_view_output,
shap_text_output,
pdf_download,
]
)
# ================================================================
# TAB 2: BATCH PREDICTIONS
# ================================================================
with gr.Tab("Batch Predictions"):
gr.Markdown("""
Upload a TSV/CSV file with multiple miRNA-mRNA pairs and browse through predictions interactively.
""")
with gr.Row():
with gr.Column(scale=1):
gr.Markdown("### π Upload File")
file_upload = gr.File(
label="Upload TSV/CSV File",
file_types=['.tsv', '.csv', '.txt']
)
gr.Markdown("""
**Expected format (column order matters, headers optional):**
- Column 1: mRNA/target sequence
- Column 2: miRNA sequence
- Column 3 (optional): Label (0 or 1)
TSV (tab-separated) or CSV format.
**Sequence length:** miRNA is padded/trimmed to 28 nt, mRNA to 50 nt. Sequences longer than these limits are trimmed from the 3β² end.
See `example_batch.tsv` for reference.
""")
compute_shap_batch = gr.Checkbox(
label="Compute SHAP for all pairs (slower)",
value=True,
info="Enable for detailed explainability. Increases processing time."
)
process_btn = gr.Button("Process File", variant="primary", size="lg")
with gr.Column(scale=2):
gr.Markdown("### π Results Summary")
summary_output = gr.Markdown()
gr.Markdown("### π Browse Results")
gr.Markdown("π Click any row to view detailed SHAP analysis")
results_table = gr.Dataframe(
label="Prediction Results",
interactive=False,
wrap=True
)
gr.Markdown("### π Detailed View")
with gr.Row():
with gr.Column(scale=1):
detail_text = gr.Markdown()
with gr.Column(scale=2):
gr.Markdown("#### Sequence Explainability")
detail_explainability = gr.Image(show_label=False, type="pil")
gr.Markdown("#### SHAP Heatmap")
detail_heatmap = gr.Image(show_label=False, type="pil")
gr.Markdown("#### SHAP-Guided Alignment View")
detail_alignment = gr.Image(show_label=False, type="pil")
detail_explanation = gr.Markdown()
# Connect batch events
process_btn.click(
fn=process_uploaded_file,
inputs=[file_upload, compute_shap_batch],
outputs=[summary_output, results_table]
)
# Pass the table itself as input so we can see current state (including sorting)
results_table.select(
fn=show_batch_detail_view,
inputs=[results_table], # Pass current table state
outputs=[
detail_text,
detail_explainability,
detail_heatmap,
detail_alignment,
detail_explanation,
]
)
# About section (outside tabs)
gr.Markdown("""
---
### About
**miRBind2** uses a convolutional neural network trained on CLIP experimental data to predict
miRNA-mRNA target sites. The model learns complementarity patterns between miRNA and target sequences.
**GitHub:** [BioGeMT/miRBind_2.0](https://github.com/BioGeMT/miRBind_2.0)
**Device:** {}
""".format(DEVICE))
return app
def main():
"""Main entry point."""
print("=" * 60)
print("miRBind2 Gradio Interface")
print("=" * 60)
# Load model
try:
load_pretrained_model()
except Exception as e:
print(f"Error loading model: {e}")
sys.exit(1)
# Create and launch interface
app = create_gradio_interface()
print("\n" + "=" * 60)
print("Launching Gradio interface...")
print("=" * 60)
app.launch(
share=False, # Set to True to create public link
server_name="0.0.0.0", # Required for containerized hosting (HF Spaces)
server_port=7860,
show_error=True,
theme=gr.themes.Soft()
)
if __name__ == "__main__":
main()
|