Spaces:
Sleeping
Sleeping
File size: 13,656 Bytes
0e34be9 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 | """
DeepCRISPR Enterprise API β 2-Stage Pipeline
=============================================
Stage 1: PyTorch CRISPRMegaModel β 256-dim embeddings
Stage 2: AutoGluon TabularPredictor β Safety prediction
Takes sgRNA + off-target sequences, runs them through the trained neural
network to extract learned embeddings, combines with hand-crafted bio
features, and feeds the full feature vector to AutoGluon for the final
safety confidence score.
Architected by Mujahid
Usage:
uvicorn api:app --reload
β Docs: http://127.0.0.1:8000/docs
"""
import os
import re
import warnings
from datetime import datetime, timezone
import numpy as np
import pandas as pd
from pathlib import Path
from fastapi import FastAPI, HTTPException
from fastapi.responses import HTMLResponse
from pydantic import BaseModel, Field
# βββββββββββββββββββββββββββ APP INSTANCE βββββββββββββββββββββββββββββββββββ
app = FastAPI(
title="DeepCRISPR Enterprise API",
version="1.0.0",
description=(
"2-Stage AI pipeline for CRISPR-Cas9 off-target safety prediction.\n\n"
"**Stage 1:** PyTorch CRISPRMegaModel (CNN + Transformer + BiLSTM) β "
"256-dimensional learned embeddings.\n\n"
"**Stage 2:** AutoGluon TabularPredictor β Final safety confidence.\n\n"
"**Architected by Mujahid**"
),
contact={"name": "Mujahid"},
)
# βββββββββββββββββββββββββββ MODEL LOADING ββββββββββββββββββββββββββββββββββ
BASE_DIR = os.path.dirname(os.path.abspath(__file__))
# Paths β check both root and subfolder locations
PTH_CANDIDATES = [
os.path.join(BASE_DIR, "mega_model_best.pth"),
os.path.join(BASE_DIR, "DeepCRISPR_Mega_Model_Full", "mega_model_best.pth"),
]
AG_CANDIDATES = [
os.path.join(BASE_DIR, "autogluon_mega"),
os.path.join(BASE_DIR, "DeepCRISPR_Mega_Model_Full", "autogluon_mega"),
]
# ββ Stage 1: PyTorch ββ
torch_model = None
torch_device = None
try:
import torch
from core_engine import CRISPRMegaModel, encode_pair, extract_bio_features, cfg
torch_device = torch.device('cpu')
# Find the .pth file
pth_path = None
for candidate in PTH_CANDIDATES:
if os.path.exists(candidate):
pth_path = candidate
break
if pth_path:
torch_model = CRISPRMegaModel()
checkpoint = torch.load(pth_path, map_location=torch_device, weights_only=False)
# Handle wrapped state dicts (checkpoint saves with extra metadata)
if isinstance(checkpoint, dict):
if 'state' in checkpoint:
state_dict = checkpoint['state'] # your Kaggle format
elif 'model_state_dict' in checkpoint:
state_dict = checkpoint['model_state_dict']
elif 'state_dict' in checkpoint:
state_dict = checkpoint['state_dict']
else:
state_dict = checkpoint # assume bare state dict
else:
state_dict = checkpoint
torch_model.load_state_dict(state_dict)
torch_model.eval()
print(f"β
PyTorch CRISPRMegaModel loaded from: {pth_path}")
else:
warnings.warn("β οΈ mega_model_best.pth not found. PyTorch stage disabled.")
except ImportError as e:
warnings.warn(f"β οΈ PyTorch / core_engine import failed: {e}. Install with: pip install torch")
except Exception as e:
warnings.warn(f"β οΈ PyTorch model load error: {e}. Running without neural embeddings.")
torch_model = None
# ββ Stage 2: AutoGluon ββ
ag_predictor = None
try:
from autogluon.tabular import TabularPredictor
ag_path = None
for candidate in AG_CANDIDATES:
if os.path.isdir(candidate):
ag_path = candidate
break
if ag_path:
ag_predictor = TabularPredictor.load(ag_path)
print(f"β
AutoGluon predictor loaded from: {ag_path}")
else:
warnings.warn("β οΈ autogluon_mega/ directory not found. AutoGluon stage disabled.")
except ImportError:
warnings.warn("β οΈ AutoGluon not installed. Install with: pip install autogluon.tabular")
except Exception as e:
warnings.warn(f"β οΈ AutoGluon load error: {e}")
# ββ Status summary ββ
PIPELINE_STATUS = {
"pytorch": "loaded" if torch_model is not None else "unavailable",
"autogluon": "loaded" if ag_predictor is not None else "unavailable",
}
if torch_model and ag_predictor:
PIPELINE_MODE = "live"
print("π LIVE MODE β Full 2-stage pipeline active.")
elif torch_model:
PIPELINE_MODE = "partial-pytorch"
print("β‘ PARTIAL MODE β PyTorch only (no AutoGluon).")
else:
PIPELINE_MODE = "demo"
print("β‘ DEMO MODE β Returning synthetic predictions.")
# βββββββββββββββββββββββββββ PYDANTIC SCHEMAS βββββββββββββββββββββββββββββββ
class GuideRNAInput(BaseModel):
"""Input schema: an sgRNA sequence and its candidate off-target site."""
sgRNA_seq: str = Field(
...,
min_length=10,
max_length=30,
description="The 20β23nt sgRNA guide sequence (A/T/C/G/U/N/-).",
json_schema_extra={"examples": ["GAGTCCGAGCAGAAGAAGAA"]},
)
off_target_seq: str = Field(
...,
min_length=10,
max_length=30,
description="The candidate off-target DNA site (A/T/C/G/N/-).",
json_schema_extra={"examples": ["GAGTCCAAGCAGAAGAAGAA"]},
)
class SafetyScoreResponse(BaseModel):
"""Output schema for the safety prediction."""
sgRNA_seq: str
off_target_seq: str
safety_confidence_percentage: float = Field(
..., ge=0, le=100,
description="AI-predicted safety confidence (0β100%). Higher = safer.",
)
status: str = Field(
..., description="'Safe' (>80%) or 'Risky' (β€80%).",
)
n_mismatches: int = Field(
..., description="Number of mismatches between sgRNA and off-target.",
)
mode: str = Field(
..., description="Pipeline mode: 'live', 'partial-pytorch', or 'demo'.",
)
pipeline: dict = Field(
..., description="Status of each pipeline stage.",
)
timestamp: str
# βββββββββββββββββββββββββββ INFERENCE HELPERS ββββββββββββββββββββββββββββββ
def _run_pytorch_inference(sgrna: str, offtarget: str) -> np.ndarray:
"""Run Stage 1: PyTorch model β 256-dim embedding vector."""
sg_tok, off_tok, mm_tok = encode_pair(sgrna, offtarget)
sg_t = torch.tensor([sg_tok], dtype=torch.long, device=torch_device)
off_t = torch.tensor([off_tok], dtype=torch.long, device=torch_device)
mm_t = torch.tensor([mm_tok], dtype=torch.long, device=torch_device)
with torch.no_grad():
output = torch_model(sg_t, off_t, mm_t)
return output['embedding'].cpu().numpy().flatten() # (256,)
def _build_feature_row(sgrna: str, offtarget: str, embeddings: np.ndarray) -> pd.DataFrame:
"""Combine 256 neural embeddings + bio features into a single-row DataFrame."""
# Embedding columns: emb_0 β¦ emb_255
row = {f'emb_{i}': float(embeddings[i]) for i in range(len(embeddings))}
# Biological features
bio = extract_bio_features(sgrna, offtarget)
row.update(bio)
return pd.DataFrame([row])
# βββββββββββββββββββββββββββ ENDPOINTS ββββββββββββββββββββββββββββββββββββββ
@app.get("/", response_class=HTMLResponse, tags=["UI"])
def dashboard():
"""Premium web dashboard for DeepCRISPR Enterprise."""
html_path = Path(BASE_DIR) / "templates" / "dashboard.html"
return HTMLResponse(content=html_path.read_text(encoding="utf-8"), status_code=200)
@app.get("/health", tags=["Health"])
def health_check():
"""Health check and pipeline status."""
return {
"message": "DeepCRISPR Enterprise API is Live.",
"mode": PIPELINE_MODE,
"pipeline": PIPELINE_STATUS,
}
@app.post(
"/predict/safety-score",
response_model=SafetyScoreResponse,
tags=["Prediction"],
summary="Predict off-target safety for an sgRNA / off-target pair",
)
def predict_safety_score(payload: GuideRNAInput):
"""
**2-Stage AI Pipeline:**
1. The sgRNA + off-target pair is tokenized and passed through the
PyTorch CRISPRMegaModel (CNN + Transformer + BiLSTM) to extract
256-dimensional learned embeddings.
2. The embeddings are combined with 50 hand-crafted biological features
and fed to the AutoGluon TabularPredictor for the final safety score.
**Classification:** Safe (>80%) or Risky (β€80%).
"""
sgrna = payload.sgRNA_seq.strip().upper().replace('U', 'T')
offtarget = payload.off_target_seq.strip().upper().replace('U', 'T')
# ββ Validate characters ββ
valid_chars = re.compile(r'^[ATCGN\-]+$')
if not valid_chars.match(sgrna):
raise HTTPException(
status_code=422,
detail="sgRNA_seq contains invalid characters. Allowed: A, T, C, G, U, N, -",
)
if not valid_chars.match(offtarget):
raise HTTPException(
status_code=422,
detail="off_target_seq contains invalid characters. Allowed: A, T, C, G, U, N, -",
)
# ββ Count mismatches for response ββ
sg_padded = sgrna[:cfg.SEQ_LEN].ljust(cfg.SEQ_LEN, 'N')
off_padded = offtarget[:cfg.SEQ_LEN].ljust(cfg.SEQ_LEN, 'N')
n_mm = sum(1 for a, b in zip(sg_padded, off_padded) if a != b)
# ββ Stage 1: PyTorch embeddings ββ
if torch_model is not None:
try:
embeddings = _run_pytorch_inference(sgrna, offtarget)
except Exception as e:
raise HTTPException(
status_code=500,
detail=f"PyTorch inference failed: {e}",
)
else:
# Synthetic 256-dim embeddings for demo mode
import hashlib
seed = int(hashlib.md5((sgrna + offtarget).encode()).hexdigest()[:8], 16)
rng = np.random.RandomState(seed)
embeddings = rng.randn(256).astype(np.float32) * 0.1
# ββ Build feature DataFrame ββ
bio_feats = extract_bio_features(sgrna, offtarget)
row = {f'emb_{i}': float(embeddings[i]) for i in range(len(embeddings))}
row.update(bio_feats)
df_features = pd.DataFrame([row])
# ββ Stage 2: AutoGluon prediction ββ
if ag_predictor is not None:
try:
proba = ag_predictor.predict_proba(df_features)
if hasattr(proba, 'shape') and len(proba.shape) == 2:
safety_pct = float(proba.iloc[0, 0] * 100)
else:
safety_pct = float(proba.iloc[0] * 100)
except Exception as e:
raise HTTPException(
status_code=500,
detail=f"AutoGluon prediction failed: {e}",
)
elif torch_model is not None:
# Partial mode: use PyTorch off_prob directly
sg_tok, off_tok, mm_tok = encode_pair(sgrna, offtarget)
sg_t = torch.tensor([sg_tok], dtype=torch.long, device=torch_device)
off_t = torch.tensor([off_tok], dtype=torch.long, device=torch_device)
mm_t = torch.tensor([mm_tok], dtype=torch.long, device=torch_device)
with torch.no_grad():
output = torch_model(sg_t, off_t, mm_t)
safety_pct = float((1 - output['off_prob'].item()) * 100)
else:
# Demo mode: hash-based deterministic score
import hashlib
seed = int(hashlib.md5((sgrna + offtarget).encode()).hexdigest()[:8], 16)
rng = np.random.RandomState(seed)
safety_pct = round(float(rng.uniform(0, 100)), 2)
safety_pct = round(max(0.0, min(100.0, safety_pct)), 2)
status = "Safe" if safety_pct > 80 else "Risky"
return SafetyScoreResponse(
sgRNA_seq=sgrna,
off_target_seq=offtarget,
safety_confidence_percentage=safety_pct,
status=status,
n_mismatches=n_mm,
mode=PIPELINE_MODE,
pipeline=PIPELINE_STATUS,
timestamp=datetime.now(timezone.utc).isoformat(),
)
# βββββββββββββββββββββββββββ LOCAL SERVER βββββββββββββββββββββββββββββββββββ
if __name__ == "__main__":
import uvicorn
print("=" * 60)
print(" DeepCRISPR Enterprise API β 2-Stage Pipeline")
print(" Architected by Mujahid")
print("=" * 60)
print(f" PyTorch: {PIPELINE_STATUS['pytorch']}")
print(f" AutoGluon: {PIPELINE_STATUS['autogluon']}")
print(f" Mode: {PIPELINE_MODE.upper()}")
print(" Starting server β http://127.0.0.1:8000")
print(" Swagger UI β http://127.0.0.1:8000/docs")
print("=" * 60)
uvicorn.run(app, host="127.0.0.1", port=8000)
|