""" DeepCRISPR Enterprise API — 2-Stage Pipeline ============================================= Stage 1: PyTorch CRISPRMegaModel → 256-dim embeddings Stage 2: AutoGluon TabularPredictor → Safety prediction Takes sgRNA + off-target sequences, runs them through the trained neural network to extract learned embeddings, combines with hand-crafted bio features, and feeds the full feature vector to AutoGluon for the final safety confidence score. Architected by Mujahid Usage: uvicorn api:app --reload → Docs: http://127.0.0.1:8000/docs """ import os import re import warnings from datetime import datetime, timezone import numpy as np import pandas as pd from pathlib import Path from fastapi import FastAPI, HTTPException from fastapi.responses import HTMLResponse from pydantic import BaseModel, Field # ─────────────────────────── APP INSTANCE ─────────────────────────────────── app = FastAPI( title="DeepCRISPR Enterprise API", version="1.0.0", description=( "2-Stage AI pipeline for CRISPR-Cas9 off-target safety prediction.\n\n" "**Stage 1:** PyTorch CRISPRMegaModel (CNN + Transformer + BiLSTM) → " "256-dimensional learned embeddings.\n\n" "**Stage 2:** AutoGluon TabularPredictor → Final safety confidence.\n\n" "**Architected by Mujahid**" ), contact={"name": "Mujahid"}, ) # ─────────────────────────── MODEL LOADING ────────────────────────────────── BASE_DIR = os.path.dirname(os.path.abspath(__file__)) # Paths — check both root and subfolder locations PTH_CANDIDATES = [ os.path.join(BASE_DIR, "mega_model_best.pth"), os.path.join(BASE_DIR, "DeepCRISPR_Mega_Model_Full", "mega_model_best.pth"), ] AG_CANDIDATES = [ os.path.join(BASE_DIR, "autogluon_mega"), os.path.join(BASE_DIR, "DeepCRISPR_Mega_Model_Full", "autogluon_mega"), ] # ── Stage 1: PyTorch ── torch_model = None torch_device = None try: import torch from core_engine import CRISPRMegaModel, encode_pair, extract_bio_features, cfg torch_device = torch.device('cpu') # Find the .pth file pth_path = None for candidate in PTH_CANDIDATES: if os.path.exists(candidate): pth_path = candidate break if pth_path: torch_model = CRISPRMegaModel() checkpoint = torch.load(pth_path, map_location=torch_device, weights_only=False) # Handle wrapped state dicts (checkpoint saves with extra metadata) if isinstance(checkpoint, dict): if 'state' in checkpoint: state_dict = checkpoint['state'] # your Kaggle format elif 'model_state_dict' in checkpoint: state_dict = checkpoint['model_state_dict'] elif 'state_dict' in checkpoint: state_dict = checkpoint['state_dict'] else: state_dict = checkpoint # assume bare state dict else: state_dict = checkpoint torch_model.load_state_dict(state_dict) torch_model.eval() print(f"✅ PyTorch CRISPRMegaModel loaded from: {pth_path}") else: warnings.warn("⚠️ mega_model_best.pth not found. PyTorch stage disabled.") except ImportError as e: warnings.warn(f"⚠️ PyTorch / core_engine import failed: {e}. Install with: pip install torch") except Exception as e: warnings.warn(f"⚠️ PyTorch model load error: {e}. Running without neural embeddings.") torch_model = None # ── Stage 2: AutoGluon ── ag_predictor = None try: from autogluon.tabular import TabularPredictor ag_path = None for candidate in AG_CANDIDATES: if os.path.isdir(candidate): ag_path = candidate break if ag_path: ag_predictor = TabularPredictor.load(ag_path) print(f"✅ AutoGluon predictor loaded from: {ag_path}") else: warnings.warn("⚠️ autogluon_mega/ directory not found. AutoGluon stage disabled.") except ImportError: warnings.warn("⚠️ AutoGluon not installed. Install with: pip install autogluon.tabular") except Exception as e: warnings.warn(f"⚠️ AutoGluon load error: {e}") # ── Status summary ── PIPELINE_STATUS = { "pytorch": "loaded" if torch_model is not None else "unavailable", "autogluon": "loaded" if ag_predictor is not None else "unavailable", } if torch_model and ag_predictor: PIPELINE_MODE = "live" print("🚀 LIVE MODE — Full 2-stage pipeline active.") elif torch_model: PIPELINE_MODE = "partial-pytorch" print("⚡ PARTIAL MODE — PyTorch only (no AutoGluon).") else: PIPELINE_MODE = "demo" print("⚡ DEMO MODE — Returning synthetic predictions.") # ─────────────────────────── PYDANTIC SCHEMAS ─────────────────────────────── class GuideRNAInput(BaseModel): """Input schema: an sgRNA sequence and its candidate off-target site.""" sgRNA_seq: str = Field( ..., min_length=10, max_length=30, description="The 20–23nt sgRNA guide sequence (A/T/C/G/U/N/-).", json_schema_extra={"examples": ["GAGTCCGAGCAGAAGAAGAA"]}, ) off_target_seq: str = Field( ..., min_length=10, max_length=30, description="The candidate off-target DNA site (A/T/C/G/N/-).", json_schema_extra={"examples": ["GAGTCCAAGCAGAAGAAGAA"]}, ) class SafetyScoreResponse(BaseModel): """Output schema for the safety prediction.""" sgRNA_seq: str off_target_seq: str safety_confidence_percentage: float = Field( ..., ge=0, le=100, description="AI-predicted safety confidence (0–100%). Higher = safer.", ) status: str = Field( ..., description="'Safe' (>80%) or 'Risky' (≤80%).", ) n_mismatches: int = Field( ..., description="Number of mismatches between sgRNA and off-target.", ) mode: str = Field( ..., description="Pipeline mode: 'live', 'partial-pytorch', or 'demo'.", ) pipeline: dict = Field( ..., description="Status of each pipeline stage.", ) timestamp: str # ─────────────────────────── INFERENCE HELPERS ────────────────────────────── def _run_pytorch_inference(sgrna: str, offtarget: str) -> np.ndarray: """Run Stage 1: PyTorch model → 256-dim embedding vector.""" sg_tok, off_tok, mm_tok = encode_pair(sgrna, offtarget) sg_t = torch.tensor([sg_tok], dtype=torch.long, device=torch_device) off_t = torch.tensor([off_tok], dtype=torch.long, device=torch_device) mm_t = torch.tensor([mm_tok], dtype=torch.long, device=torch_device) with torch.no_grad(): output = torch_model(sg_t, off_t, mm_t) return output['embedding'].cpu().numpy().flatten() # (256,) def _build_feature_row(sgrna: str, offtarget: str, embeddings: np.ndarray) -> pd.DataFrame: """Combine 256 neural embeddings + bio features into a single-row DataFrame.""" # Embedding columns: emb_0 … emb_255 row = {f'emb_{i}': float(embeddings[i]) for i in range(len(embeddings))} # Biological features bio = extract_bio_features(sgrna, offtarget) row.update(bio) return pd.DataFrame([row]) # ─────────────────────────── ENDPOINTS ────────────────────────────────────── @app.get("/", response_class=HTMLResponse, tags=["UI"]) def dashboard(): """Premium web dashboard for DeepCRISPR Enterprise.""" html_path = Path(BASE_DIR) / "templates" / "dashboard.html" return HTMLResponse(content=html_path.read_text(encoding="utf-8"), status_code=200) @app.get("/health", tags=["Health"]) def health_check(): """Health check and pipeline status.""" return { "message": "DeepCRISPR Enterprise API is Live.", "mode": PIPELINE_MODE, "pipeline": PIPELINE_STATUS, } @app.post( "/predict/safety-score", response_model=SafetyScoreResponse, tags=["Prediction"], summary="Predict off-target safety for an sgRNA / off-target pair", ) def predict_safety_score(payload: GuideRNAInput): """ **2-Stage AI Pipeline:** 1. The sgRNA + off-target pair is tokenized and passed through the PyTorch CRISPRMegaModel (CNN + Transformer + BiLSTM) to extract 256-dimensional learned embeddings. 2. The embeddings are combined with 50 hand-crafted biological features and fed to the AutoGluon TabularPredictor for the final safety score. **Classification:** Safe (>80%) or Risky (≤80%). """ sgrna = payload.sgRNA_seq.strip().upper().replace('U', 'T') offtarget = payload.off_target_seq.strip().upper().replace('U', 'T') # ── Validate characters ── valid_chars = re.compile(r'^[ATCGN\-]+$') if not valid_chars.match(sgrna): raise HTTPException( status_code=422, detail="sgRNA_seq contains invalid characters. Allowed: A, T, C, G, U, N, -", ) if not valid_chars.match(offtarget): raise HTTPException( status_code=422, detail="off_target_seq contains invalid characters. Allowed: A, T, C, G, U, N, -", ) # ── Count mismatches for response ── sg_padded = sgrna[:cfg.SEQ_LEN].ljust(cfg.SEQ_LEN, 'N') off_padded = offtarget[:cfg.SEQ_LEN].ljust(cfg.SEQ_LEN, 'N') n_mm = sum(1 for a, b in zip(sg_padded, off_padded) if a != b) # ── Stage 1: PyTorch embeddings ── if torch_model is not None: try: embeddings = _run_pytorch_inference(sgrna, offtarget) except Exception as e: raise HTTPException( status_code=500, detail=f"PyTorch inference failed: {e}", ) else: # Synthetic 256-dim embeddings for demo mode import hashlib seed = int(hashlib.md5((sgrna + offtarget).encode()).hexdigest()[:8], 16) rng = np.random.RandomState(seed) embeddings = rng.randn(256).astype(np.float32) * 0.1 # ── Build feature DataFrame ── bio_feats = extract_bio_features(sgrna, offtarget) row = {f'emb_{i}': float(embeddings[i]) for i in range(len(embeddings))} row.update(bio_feats) df_features = pd.DataFrame([row]) # ── Stage 2: AutoGluon prediction ── if ag_predictor is not None: try: proba = ag_predictor.predict_proba(df_features) if hasattr(proba, 'shape') and len(proba.shape) == 2: safety_pct = float(proba.iloc[0, 0] * 100) else: safety_pct = float(proba.iloc[0] * 100) except Exception as e: raise HTTPException( status_code=500, detail=f"AutoGluon prediction failed: {e}", ) elif torch_model is not None: # Partial mode: use PyTorch off_prob directly sg_tok, off_tok, mm_tok = encode_pair(sgrna, offtarget) sg_t = torch.tensor([sg_tok], dtype=torch.long, device=torch_device) off_t = torch.tensor([off_tok], dtype=torch.long, device=torch_device) mm_t = torch.tensor([mm_tok], dtype=torch.long, device=torch_device) with torch.no_grad(): output = torch_model(sg_t, off_t, mm_t) safety_pct = float((1 - output['off_prob'].item()) * 100) else: # Demo mode: hash-based deterministic score import hashlib seed = int(hashlib.md5((sgrna + offtarget).encode()).hexdigest()[:8], 16) rng = np.random.RandomState(seed) safety_pct = round(float(rng.uniform(0, 100)), 2) safety_pct = round(max(0.0, min(100.0, safety_pct)), 2) status = "Safe" if safety_pct > 80 else "Risky" return SafetyScoreResponse( sgRNA_seq=sgrna, off_target_seq=offtarget, safety_confidence_percentage=safety_pct, status=status, n_mismatches=n_mm, mode=PIPELINE_MODE, pipeline=PIPELINE_STATUS, timestamp=datetime.now(timezone.utc).isoformat(), ) # ─────────────────────────── LOCAL SERVER ─────────────────────────────────── if __name__ == "__main__": import uvicorn print("=" * 60) print(" DeepCRISPR Enterprise API — 2-Stage Pipeline") print(" Architected by Mujahid") print("=" * 60) print(f" PyTorch: {PIPELINE_STATUS['pytorch']}") print(f" AutoGluon: {PIPELINE_STATUS['autogluon']}") print(f" Mode: {PIPELINE_MODE.upper()}") print(" Starting server → http://127.0.0.1:8000") print(" Swagger UI → http://127.0.0.1:8000/docs") print("=" * 60) uvicorn.run(app, host="127.0.0.1", port=8000)