Spaces:
Running
Running
File size: 4,160 Bytes
6b844e3 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 |
import argparse
import subprocess
from typing import Generator, Tuple, List, Iterable, Optional, Dict
def RNAsubopt(
seq: str, RNAsubopt_bin: str = "RNAsubopt", delta_energy: float = 5.0
) -> List[Tuple[str, float]]:
"""
Uses RNAsubpot to return a list of secondary structures
and their associated energies in kcal/mol.
"""
try:
cmd = " ".join(
[
"bash -c '",
f"{RNAsubopt_bin}",
f"--deltaEnergy {delta_energy}",
f"-i <(echo {seq})" "'",
]
)
out = subprocess.check_output(cmd, shell=True).decode()
typify = lambda t: (str(t[0]), float(t[1]))
processed = [typify(line.split()) for line in out.split("\n")[1:-1]]
return processed
except subprocess.CalledProcessError as exc:
print(exc)
return []
def RNAsample(
seqs: List[str], RNAfold_bin: str = "RNAsubopt", temperature: float = 37.0, num_structs: int = 5, maxBPspan: int = 0
) -> List[List[str]]:
"""
Uses RNAsubopt to sample num_structs structures from the Boltzmann distribution. Accepts a list of sequences, and calls RNAsubopt in a batched way on them.
"""
try:
input_binary = b"\n".join([seqs[i].encode('ascii') for i in range(len(seqs))]) # convert to binary
out = subprocess.check_output([RNAfold_bin, f"--stochBT={num_structs}", f"-T {temperature}"] +
([f"--maxBPspan={maxBPspan}"] if maxBPspan != 0 else []),
input=input_binary).decode().split("\n")[:-1] # remove the new line at the end
assert(len(out) == (num_structs+1)*len(seqs))
ret_value = [ out[(num_structs+1)*i+1:(num_structs+1)*(i+1)] for i in range(len(seqs))]
return ret_value
except subprocess.CalledProcessError as exc:
print(exc)
return 0.0
def RNAfold(
seqs: List[str], RNAfold_bin: str = "RNAfold", temperature: float = 37.0, maxBPspan: int = 0, commands_file: str = ""
) -> (str, float):
"""
Uses RNAfold to return MFE energy. Accepts a list of sequences, and calls RNAfold in a batched way on them.
"""
try:
input_binary = b"\n".join([seqs[i].encode('ascii') for i in range(len(seqs))]) # convert to binary
out = subprocess.check_output([RNAfold_bin, "-j 8", "--noPS", f"-T {temperature}"] +
(["--commands="+commands_file] if commands_file != "" else []) +
([f"--maxBPspan={maxBPspan}"] if maxBPspan != 0 else []),
input=input_binary).decode().split("\n")
mfe_lines = [out[i].split(maxsplit=1) for i in range(1,len(out),2)]
ret_value = [[mfe_lines[i][0], float(mfe_lines[i][1].strip('() '))] for i in range(len(mfe_lines))]
return ret_value
except subprocess.CalledProcessError as exc:
print(exc)
return 0.0
def RNA_partition_function(
seqs: List[str], constraints: List[str], RNAfold_bin: str = "RNAfold", temperature: float = 37.0, commands_file: str = ""
) -> (str, float):
"""
Uses RNAfold to compute partition function with constraints on the structure
"""
assert(len(seqs)==len(constraints))
try:
input_binary = b"\n".join([(seqs[i]+"\n"+constraints[i]).encode('ascii') for i in range(len(seqs))]) # convert to binary
out = subprocess.check_output([RNAfold_bin, "-j 8", "--noPS", "--noDP", "-p0" ,"-C", f"-T {temperature}"] + (["--commands="+commands_file] if commands_file != "" else []), input=input_binary).decode().split("\n")
ret_value = [float(out[i].split(sep=" ")[-2]) for i in range(2,len(out),4)] # take the third line in each group of 4 lines
return ret_value
except subprocess.CalledProcessError as exc:
print(exc)
return 0.0
if __name__ == "__main__":
parser = argparse.ArgumentParser()
parser.add_argument(
"--seq",
type=str,
default="AGUAGUCUAGUAUGACUGUA",
help="RNA sequence to process",
)
args = parser.parse_args()
output = RNAsubopt(seq=args.seq)
print(output)
|