# Setup CAI package before any other imports import sys import os # Check and setup CAI package if needed def setup_cai_if_needed(): try: import CAI return True except ImportError: print("CAI not found, attempting to install...") try: import subprocess import tempfile import shutil # Clone the repository to a temporary directory with tempfile.TemporaryDirectory() as temp_dir: repo_dir = os.path.join(temp_dir, "cai") print("Cloning CAI repository...") subprocess.check_call([ "git", "clone", "https://github.com/Benjamin-Lee/CodonAdaptationIndex.git", repo_dir ], stdout=subprocess.DEVNULL, stderr=subprocess.DEVNULL) # Checkout specific commit subprocess.check_call([ "git", "checkout", "b6e017a92c58829f6a5aec8c26a21262bc2a6610" ], cwd=repo_dir, stdout=subprocess.DEVNULL, stderr=subprocess.DEVNULL) print("Installing CAI from local directory...") # Force legacy setup.py installation to bypass wheel building issues subprocess.check_call([ sys.executable, "setup.py", "install" ], cwd=repo_dir) # Force Python to reload site-packages after installation import site import importlib site.main() # Reload site-packages importlib.invalidate_caches() # Clear import caches import CAI print("โœ… CAI installed successfully") return True except Exception as e: print(f"โŒ Failed to install CAI: {e}") return False # Setup CAI before any other imports that might need it setup_cai_if_needed() import streamlit as st import torch import pandas as pd import numpy as np import plotly.graph_objects as go import plotly.express as px from transformers import AutoTokenizer, BigBirdForMaskedLM from huggingface_hub import hf_hub_download from datasets import load_dataset import time import threading from typing import Dict, Optional, Tuple import warnings warnings.filterwarnings("ignore") # Import CodonTransformer modules sys.path.append(os.path.dirname(os.path.dirname(os.path.abspath(__file__)))) from CodonTransformer.CodonPrediction import ( predict_dna_sequence, load_model ) from CodonTransformer.CodonEvaluation import ( get_GC_content, calculate_tAI, get_ecoli_tai_weights, scan_for_restriction_sites, count_negative_cis_elements, calculate_homopolymer_runs ) from CAI import CAI, relative_adaptiveness from CodonTransformer.CodonUtils import get_organism2id_dict import json # Try to import post-processing features try: from CodonTransformer.CodonPostProcessing import ( polish_sequence_with_dnachisel, DNACHISEL_AVAILABLE ) POST_PROCESSING_AVAILABLE = True except ImportError: POST_PROCESSING_AVAILABLE = False DNACHISEL_AVAILABLE = False # Page configuration st.set_page_config( page_title="CodonTransformer GUI", page_icon="๐Ÿงฌ", layout="wide", initial_sidebar_state="expanded" ) # Initialize session state if 'model' not in st.session_state: st.session_state.model = None if 'tokenizer' not in st.session_state: st.session_state.tokenizer = None if 'device' not in st.session_state: st.session_state.device = torch.device("cuda" if torch.cuda.is_available() else "cpu") if 'optimization_running' not in st.session_state: st.session_state.optimization_running = False if 'results' not in st.session_state: st.session_state.results = None if 'post_processed_results' not in st.session_state: st.session_state.post_processed_results = None if 'cai_weights' not in st.session_state: st.session_state.cai_weights = None if 'tai_weights' not in st.session_state: st.session_state.tai_weights = None def get_organism_tai_weights(organism: str) -> Dict[str, float]: """Get organism-specific tAI weights from pre-calculated data""" try: # Load organism-specific tAI weights weights_file = os.path.join(os.path.dirname(os.path.dirname(os.path.abspath(__file__))), 'organism_tai_weights.json') with open(weights_file, 'r') as f: all_weights = json.load(f) if organism in all_weights: return all_weights[organism] else: # Fallback to E. coli if organism not found st.warning(f"tAI weights for {organism} not found, using E. coli weights") return all_weights.get("Escherichia coli general", get_ecoli_tai_weights()) except Exception as e: st.error(f"Error loading organism-specific tAI weights: {e}") return get_ecoli_tai_weights() def load_model_and_tokenizer(): """Load the model and tokenizer with progress tracking""" if st.session_state.model is None or st.session_state.tokenizer is None: with st.spinner("Loading CodonTransformer model... This may take a few minutes."): progress_bar = st.progress(0) status_text = st.empty() status_text.text("Loading tokenizer...") progress_bar.progress(25) st.session_state.tokenizer = AutoTokenizer.from_pretrained("adibvafa/CodonTransformer") status_text.text("Loading fine-tuned model from Hugging Face...") progress_bar.progress(50) try: from huggingface_hub import hf_hub_download hf_token = os.environ.get("HF_TOKEN") status_text.text("โฌ‡๏ธ Downloading model from saketh11/ColiFormer...") model_path = hf_hub_download( repo_id="saketh11/ColiFormer", filename="balanced_alm_finetune.ckpt", cache_dir="./hf_cache", token=hf_token ) status_text.text("๐Ÿ”„ Loading downloaded model...") st.session_state.model = load_model( model_path=model_path, device=st.session_state.device, attention_type="original_full" ) status_text.text("โœ… Fine-tuned model loaded from Hugging Face (6.2% better CAI)") st.session_state.model_type = "fine_tuned_hf" except Exception as e: status_text.text(f"โš ๏ธ Failed to load from Hugging Face: {str(e)[:50]}...") status_text.text("Loading base model as fallback...") st.session_state.model = BigBirdForMaskedLM.from_pretrained("adibvafa/CodonTransformer") if isinstance(st.session_state.model, torch.nn.Module): st.session_state.model = st.session_state.model.to(st.session_state.device) else: st.warning("Fallback model loaded is not a PyTorch module. Cannot move to device.") st.session_state.model_type = "base" progress_bar.progress(100) time.sleep(0.5) status_text.empty() progress_bar.empty() @st.cache_data def download_reference_data(): """Download and cache reference data from Hugging Face""" try: from huggingface_hub import hf_hub_download hf_token = os.environ.get("HF_TOKEN") file_path = hf_hub_download( repo_id="saketh11/ColiFormer-Data", filename="ecoli_processed_genes.csv", repo_type="dataset", token=hf_token ) df = pd.read_csv(file_path) return df['dna_sequence'].tolist() except Exception as e: st.warning(f"Could not download reference data from Hugging Face: {e}") return [ "ATGGCGAAAGCGCTGTATCGCGAAAGCGCTGTATCGCGAAAGCGCTGTATCGC", "ATGAAATTTATTTATTATTATAAATTTATTTATTATTATAAATTTATTTAT", "ATGGGTCGTCGTCGTCGTGGTCGTCGTCGTCGTGGTCGTCGTCGTCGTGGT" ] @st.cache_data def download_tai_weights(): """Download and cache tAI weights from Hugging Face""" try: from huggingface_hub import hf_hub_download hf_token = os.environ.get("HF_TOKEN") file_path = hf_hub_download( repo_id="saketh11/ColiFormer-Data", filename="organism_tai_weights.json", repo_type="dataset", token=hf_token ) with open(file_path, 'r') as f: all_weights = json.load(f) return all_weights.get("Escherichia coli general", get_ecoli_tai_weights()) except Exception as e: st.warning(f"Could not download tAI weights from Hugging Face: {e}") return get_ecoli_tai_weights() def load_reference_data(organism: str = "Escherichia coli general"): """Load reference sequences and tAI weights for E. coli""" if 'cai_weights' not in st.session_state or st.session_state['cai_weights'] is None: try: # Download reference sequences from Hugging Face with st.spinner("๐Ÿ“ฅ Downloading E. coli reference sequences from Hugging Face..."): ref_sequences = download_reference_data() st.session_state['cai_weights'] = relative_adaptiveness(sequences=ref_sequences) if len(ref_sequences) > 100: # If we got the full dataset st.success(f"โœ… Downloaded {len(ref_sequences):,} E. coli reference sequences for CAI calculation") else: st.info(f"โš ๏ธ Using {len(ref_sequences)} minimal reference sequences (full dataset unavailable)") except Exception as e: st.error(f"Error loading E. coli reference data: {e}") st.session_state['cai_weights'] = {} # tAI weights (E. coli only) if 'tai_weights' not in st.session_state or st.session_state['tai_weights'] is None: try: with st.spinner("๐Ÿ“ฅ Downloading E. coli tAI weights from Hugging Face..."): st.session_state['tai_weights'] = download_tai_weights() st.success("โœ… Downloaded E. coli tAI weights") except Exception as e: st.error(f"Error loading E. coli tAI weights: {e}") st.session_state['tai_weights'] = {} def validate_sequence(sequence: str) -> Tuple[bool, str, str, str]: """Validate sequence and return status, message, sequence type, and possibly fixed sequence""" if not sequence: return False, "Sequence cannot be empty", "unknown", sequence # Remove whitespace and convert to uppercase sequence = sequence.strip().upper() # Check if it's a DNA sequence dna_chars = set("ATGC") protein_chars = set("ACDEFGHIKLMNPQRSTVWY*_") sequence_chars = set(sequence) # If all characters are DNA nucleotides, treat as DNA if sequence_chars.issubset(dna_chars): if len(sequence) < 3: return False, "DNA sequence must be at least 3 nucleotides long", "dna", sequence # Auto-fix DNA sequences not divisible by 3 if len(sequence) % 3 != 0: remainder = len(sequence) % 3 fixed_sequence = sequence[:-remainder] message = f"Valid DNA sequence (auto-fixed: removed {remainder} nucleotides from end to make divisible by 3)" else: fixed_sequence = sequence message = "Valid DNA sequence" return True, message, "dna", fixed_sequence # If contains protein-specific amino acids, treat as protein elif sequence_chars.issubset(protein_chars): if len(sequence) < 3: return False, "Protein sequence must be at least 3 amino acids long", "protein", sequence return True, "Valid protein sequence", "protein", sequence # Invalid characters else: invalid_chars = sequence_chars - (dna_chars | protein_chars) return False, f"Invalid characters found: {', '.join(invalid_chars)}", "unknown", sequence def calculate_input_metrics(sequence: str, organism: str, sequence_type: str) -> Dict: """Calculate metrics for the input sequence using E. coli reference only""" # Load reference data (E. coli only) load_reference_data() if sequence_type == "dna": dna_sequence = sequence.upper() metrics = { 'length': len(dna_sequence) // 3, 'gc_content': get_GC_content(dna_sequence), 'baseline_dna': dna_sequence, 'sequence_type': 'dna' } try: if 'cai_weights' in st.session_state and st.session_state['cai_weights']: metrics['cai'] = CAI(dna_sequence, weights=st.session_state['cai_weights']) else: metrics['cai'] = None except: metrics['cai'] = None try: if 'tai_weights' in st.session_state and st.session_state['tai_weights']: metrics['tai'] = calculate_tAI(dna_sequence, st.session_state['tai_weights']) else: metrics['tai'] = None except: metrics['tai'] = None else: most_frequent_codons = { 'A': 'GCG', 'C': 'TGC', 'D': 'GAT', 'E': 'GAA', 'F': 'TTT', 'G': 'GGC', 'H': 'CAT', 'I': 'ATT', 'K': 'AAA', 'L': 'CTG', 'M': 'ATG', 'N': 'AAC', 'P': 'CCG', 'Q': 'CAG', 'R': 'CGC', 'S': 'TCG', 'T': 'ACG', 'V': 'GTG', 'W': 'TGG', 'Y': 'TAT', '*': 'TAA', '_': 'TAA' } baseline_dna = ''.join([most_frequent_codons.get(aa, 'NNN') for aa in sequence]) metrics = { 'length': len(sequence), 'gc_content': get_GC_content(baseline_dna), 'baseline_dna': baseline_dna, 'sequence_type': 'protein' } try: if 'cai_weights' in st.session_state and st.session_state['cai_weights']: metrics['cai'] = CAI(baseline_dna, weights=st.session_state['cai_weights']) else: metrics['cai'] = None except: metrics['cai'] = None try: if 'tai_weights' in st.session_state and st.session_state['tai_weights']: metrics['tai'] = calculate_tAI(baseline_dna, st.session_state['tai_weights']) else: metrics['tai'] = None except: metrics['tai'] = None try: analysis_dna = metrics['baseline_dna'] # scan_for_restriction_sites returns an int, not a list, so no need for len() metrics['restriction_sites'] = scan_for_restriction_sites(analysis_dna) metrics['negative_cis_elements'] = count_negative_cis_elements(analysis_dna) metrics['homopolymer_runs'] = calculate_homopolymer_runs(analysis_dna) except: metrics['restriction_sites'] = 0 metrics['negative_cis_elements'] = 0 metrics['homopolymer_runs'] = 0 return metrics def translate_dna_to_protein(dna_sequence: str) -> str: """Translate DNA sequence to protein sequence""" codon_table = { 'TTT': 'F', 'TTC': 'F', 'TTA': 'L', 'TTG': 'L', 'TCT': 'S', 'TCC': 'S', 'TCA': 'S', 'TCG': 'S', 'TAT': 'Y', 'TAC': 'Y', 'TAA': '*', 'TAG': '*', 'TGT': 'C', 'TGC': 'C', 'TGA': '*', 'TGG': 'W', 'CTT': 'L', 'CTC': 'L', 'CTA': 'L', 'CTG': 'L', 'CCT': 'P', 'CCC': 'P', 'CCA': 'P', 'CCG': 'P', 'CAT': 'H', 'CAC': 'H', 'CAA': 'Q', 'CAG': 'Q', 'CGT': 'R', 'CGC': 'R', 'CGA': 'R', 'CGG': 'R', 'ATT': 'I', 'ATC': 'I', 'ATA': 'I', 'ATG': 'M', 'ACT': 'T', 'ACC': 'T', 'ACA': 'T', 'ACG': 'T', 'AAT': 'N', 'AAC': 'N', 'AAA': 'K', 'AAG': 'K', 'AGT': 'S', 'AGC': 'S', 'AGA': 'R', 'AGG': 'R', 'GTT': 'V', 'GTC': 'V', 'GTA': 'V', 'GTG': 'V', 'GCT': 'A', 'GCC': 'A', 'GCA': 'A', 'GCG': 'A', 'GAT': 'D', 'GAC': 'D', 'GAA': 'E', 'GAG': 'E', 'GGT': 'G', 'GGC': 'G', 'GGA': 'G', 'GGG': 'G' } protein = "" for i in range(0, len(dna_sequence), 3): codon = dna_sequence[i:i+3].upper() if len(codon) == 3: aa = codon_table.get(codon, 'X') if aa == '*': # Stop codon break protein += aa return protein def create_gc_content_plot(sequence: str, window_size: int = 50) -> go.Figure: """Create a sliding window GC content plot""" if len(sequence) < window_size: window_size = len(sequence) // 3 positions = [] gc_values = [] for i in range(0, len(sequence) - window_size + 1, 3): # Step by codons window = sequence[i:i + window_size] gc_content = get_GC_content(window) positions.append(i // 3) # Position in codons gc_values.append(gc_content) fig = go.Figure() fig.add_trace(go.Scatter( x=positions, y=gc_values, mode='lines', name='GC Content', line=dict(color='blue', width=2) )) # Add target range fig.add_hline(y=45, line_dash="dash", line_color="red", annotation_text="Min Target (45%)") fig.add_hline(y=55, line_dash="dash", line_color="red", annotation_text="Max Target (55%)") fig.update_layout( title=f'GC Content (sliding window: {window_size} bp)', xaxis_title='Position (codons)', yaxis_title='GC Content (%)', height=300 ) return fig def create_gc_comparison_chart(before_metrics: Dict, after_metrics: Dict) -> go.Figure: """Create a comparison chart for GC Content""" fig = go.Figure() fig.add_trace(go.Bar( name='Before Optimization', x=['GC Content (%)'], y=[before_metrics.get('gc_content', 0)], marker_color='lightblue', text=[f"{before_metrics.get('gc_content', 0):.1f}%"], textposition='auto' )) fig.add_trace(go.Bar( name='After Optimization', x=['GC Content (%)'], y=[after_metrics.get('gc_content', 0)], marker_color='darkblue', text=[f"{after_metrics.get('gc_content', 0):.1f}%"], textposition='auto' )) fig.update_layout( title='GC Content Comparison: Before vs After', xaxis_title='Metric', yaxis_title='Value (%)', barmode='group', height=300 ) return fig def create_expression_comparison_chart(before_metrics: Dict, after_metrics: Dict) -> go.Figure: """Create a comparison chart for expression metrics (CAI, tAI)""" metrics_names = ['CAI', 'tAI'] before_values = [ before_metrics.get('cai', 0) if before_metrics.get('cai') else 0, before_metrics.get('tai', 0) if before_metrics.get('tai') else 0 ] after_values = [ after_metrics.get('cai', 0) if after_metrics.get('cai') else 0, after_metrics.get('tai', 0) if after_metrics.get('tai') else 0 ] fig = go.Figure() fig.add_trace(go.Bar( name='Before Optimization', x=metrics_names, y=before_values, marker_color='lightblue', text=[f"{v:.3f}" for v in before_values], textposition='auto' )) fig.add_trace(go.Bar( name='After Optimization', x=metrics_names, y=after_values, marker_color='darkblue', text=[f"{v:.3f}" for v in after_values], textposition='auto' )) fig.update_layout( title='Expression Metrics Comparison: Before vs After', xaxis_title='Metric', yaxis_title='Value', barmode='group', height=300 ) return fig def smart_codon_replacement(dna_sequence: str, target_gc_min: float = 0.45, target_gc_max: float = 0.55, max_iterations: int = 100) -> str: """Smart codon replacement to optimize GC content while maximizing CAI""" # Codon alternatives with their GC content codon_alternatives = { # Serine: high GC options 'TCT': ['TCG', 'TCC', 'TCA', 'AGT', 'AGC'], # 33% -> 67%, 67%, 33%, 33%, 67% 'TCA': ['TCG', 'TCC', 'TCT', 'AGT', 'AGC'], 'AGT': ['TCG', 'TCC', 'TCT', 'TCA', 'AGC'], # Leucine: various GC options 'TTA': ['TTG', 'CTT', 'CTC', 'CTA', 'CTG'], # 0% -> 33%, 33%, 67%, 33%, 67% 'TTG': ['TTA', 'CTT', 'CTC', 'CTA', 'CTG'], 'CTT': ['CTG', 'CTC', 'TTA', 'TTG', 'CTA'], 'CTA': ['CTG', 'CTC', 'CTT', 'TTA', 'TTG'], # Arginine: various GC options 'AGA': ['CGT', 'CGC', 'CGA', 'CGG', 'AGG'], # 33% -> 67%, 100%, 67%, 100%, 67% 'AGG': ['CGT', 'CGC', 'CGA', 'CGG', 'AGA'], 'CGT': ['CGC', 'CGG', 'CGA', 'AGA', 'AGG'], 'CGA': ['CGC', 'CGG', 'CGT', 'AGA', 'AGG'], # Proline 'CCT': ['CCG', 'CCC', 'CCA'], # 67% -> 100%, 100%, 67% 'CCA': ['CCG', 'CCC', 'CCT'], # Threonine 'ACT': ['ACG', 'ACC', 'ACA'], # 33% -> 67%, 67%, 33% 'ACA': ['ACG', 'ACC', 'ACT'], # Alanine 'GCT': ['GCG', 'GCC', 'GCA'], # 67% -> 100%, 100%, 67% 'GCA': ['GCG', 'GCC', 'GCT'], # Glycine 'GGT': ['GGG', 'GGC', 'GGA'], # 67% -> 100%, 100%, 67% 'GGA': ['GGG', 'GGC', 'GGT'], # Valine 'GTT': ['GTG', 'GTC', 'GTA'], # 67% -> 100%, 100%, 67% 'GTA': ['GTG', 'GTC', 'GTT'], } def get_codon_gc(codon): return (codon.count('G') + codon.count('C')) / 3.0 current_sequence = dna_sequence.upper() current_gc = get_GC_content(current_sequence) if target_gc_min <= current_gc <= target_gc_max: return current_sequence codons = [current_sequence[i:i+3] for i in range(0, len(current_sequence), 3)] for iteration in range(max_iterations): current_gc = get_GC_content(''.join(codons)) if target_gc_min <= current_gc <= target_gc_max: break # Find best codon to replace best_improvement = 0 best_pos = -1 best_replacement = None for pos, codon in enumerate(codons): if codon in codon_alternatives: for alt_codon in codon_alternatives[codon]: # Calculate GC change old_gc_contrib = get_codon_gc(codon) new_gc_contrib = get_codon_gc(alt_codon) gc_change = new_gc_contrib - old_gc_contrib # Check if this change moves us toward target if current_gc < target_gc_min and gc_change > best_improvement: best_improvement = gc_change best_pos = pos best_replacement = alt_codon elif current_gc > target_gc_max and gc_change < best_improvement: best_improvement = abs(gc_change) best_pos = pos best_replacement = alt_codon if best_pos >= 0: if isinstance(best_replacement, str): codons[best_pos] = best_replacement else: break # No more improvements possible return ''.join(codons) def run_optimization(protein: str, organism: str, use_post_processing: bool = False): """Run the optimization using the exact method from run_full_comparison.py with auto GC correction""" st.session_state.optimization_running = True st.session_state.post_processed_results = None # Debug logging print(f"๐Ÿ” DEBUG: Starting optimization") print(f"๐Ÿ” DEBUG: Protein length: {len(protein)}") print(f"๐Ÿ” DEBUG: Protein (first 50): {protein[:50]}...") print(f"๐Ÿ” DEBUG: Organism: {organism}") try: # Use the exact same method that achieved best results in evaluation result = predict_dna_sequence( protein=protein, organism=organism, device=st.session_state.device, model=st.session_state.model, deterministic=True, match_protein=True, ) # Debug logging for result _res = result[0] if isinstance(result, list) else result print(f"๐Ÿ” DEBUG: Model returned DNA length: {len(_res.predicted_dna)}") print(f"๐Ÿ” DEBUG: Model returned DNA (first 50): {_res.predicted_dna[:50]}...") # Check GC content and auto-correct if out of optimal range _res = result[0] if isinstance(result, list) else result initial_gc = get_GC_content(_res.predicted_dna) if initial_gc < 45.0 or initial_gc > 55.0: # Auto-correct GC content silently optimized_dna = smart_codon_replacement(_res.predicted_dna, 0.45, 0.55) smart_gc = get_GC_content(optimized_dna) if 45.0 <= smart_gc <= 55.0: from CodonTransformer.CodonUtils import DNASequencePrediction result = DNASequencePrediction( organism=_res.organism, protein=_res.protein, processed_input=_res.processed_input, predicted_dna=optimized_dna ) else: # Fall back to constrained beam search silently try: result = predict_dna_sequence( protein=protein, organism=organism, device=st.session_state.device, model=st.session_state.model, deterministic=True, match_protein=True, use_constrained_search=True, gc_bounds=(0.45, 0.55), beam_size=20 ) _res2 = result[0] if isinstance(result, list) else result final_gc = get_GC_content(_res2.predicted_dna) except Exception as e: # If constrained search fails, use smart replacement result anyway from CodonTransformer.CodonUtils import DNASequencePrediction result = DNASequencePrediction( organism=_res.organism, protein=_res.protein, processed_input=_res.processed_input, predicted_dna=optimized_dna ) st.session_state.results = result # Post-processing if enabled if use_post_processing and POST_PROCESSING_AVAILABLE and result: try: _res = result[0] if isinstance(result, list) else result polished_sequence = polish_sequence_with_dnachisel( dna_sequence=_res.predicted_dna, protein_sequence=protein, gc_bounds=(45.0, 55.0), cai_species=organism.lower().replace(' ', '_'), avoid_homopolymers_length=6 ) # Create enhanced result object from CodonTransformer.CodonUtils import DNASequencePrediction st.session_state.post_processed_results = DNASequencePrediction( organism=_res.organism, protein=_res.protein, processed_input=_res.processed_input, predicted_dna=polished_sequence ) except Exception as e: st.session_state.post_processed_results = f"Post-processing error: {str(e)}" except Exception as e: st.session_state.results = f"Error: {str(e)}" finally: st.session_state.optimization_running = False def main(): st.title("๐Ÿงฌ ColiFormer") # Remove the performance highlights expander (details/summary block) # (No expander here anymore) # Load model load_model_and_tokenizer() # Create the main tabbed interface tab1, tab2, tab3, tab4 = st.tabs(["๐Ÿงฌ Single Optimize", "๐Ÿ“ Batch Process", "๐Ÿ“Š Comparative Analysis", "โš™๏ธ Advanced Settings"]) with tab1: single_sequence_optimization() with tab2: batch_processing_interface() with tab3: comparative_analysis_interface() with tab4: advanced_settings_interface() def single_sequence_optimization(): """Single sequence optimization interface - enhanced from original functionality""" # Sidebar configuration st.sidebar.header("๐Ÿ”ง Configuration") organism_options = [ "Escherichia coli general", "Saccharomyces cerevisiae", "Homo sapiens", "Bacillus subtilis", "Pichia pastoris" ] organism = st.sidebar.selectbox("Select Target Organism", organism_options) load_reference_data(organism) with st.sidebar.expander("๐Ÿ”ง Advanced Optimization Settings"): st.markdown("**Model Parameters**") use_deterministic = st.checkbox("Deterministic Mode", value=True, help="Use deterministic decoding for reproducible results") match_protein = st.checkbox("Match Protein Validation", value=True, help="Ensure DNA translates back to exact protein") st.markdown("**GC Content Control**") gc_target_min = st.slider("GC Target Min (%)", 30, 70, 45, help="Minimum GC content target") gc_target_max = st.slider("GC Target Max (%)", 30, 70, 55, help="Maximum GC content target") st.markdown("**Quality Constraints**") avoid_restriction_sites = st.multiselect( "Avoid Restriction Sites", ["EcoRI", "BamHI", "HindIII", "XhoI", "NotI"], default=["EcoRI", "BamHI"] ) st.sidebar.subheader("๐Ÿ”ฌ Post-Processing") use_post_processing = st.sidebar.checkbox( "Enable DNAChisel Post-Processing", value=False, disabled=not POST_PROCESSING_AVAILABLE, help="Polish sequences to remove restriction sites, homopolymers, and synthesis issues" ) if not POST_PROCESSING_AVAILABLE: st.sidebar.warning("โš ๏ธ DNAChisel not available. Install with: pip install dnachisel") # Dataset Information st.sidebar.markdown("---") st.sidebar.markdown("### ๐Ÿ“Š Dataset Information") st.sidebar.markdown(""" - **Dataset**: [ColiFormer-Data](https://huggingface.co/datasets/saketh11/ColiFormer-Data) - **Training**: 4,300 high-CAI E. coli sequences - **Reference**: 50,000+ E. coli gene sequences - **Auto-download**: CAI weights & tAI coefficients """) # Model Information st.sidebar.markdown("### ๐Ÿค– Model Information") st.sidebar.markdown(""" - **Model**: [ColiFormer](https://huggingface.co/saketh11/ColiFormer) - **Improvement**: +6.2% CAI vs base model - **Architecture**: BigBird Transformer + ALM - **Auto-download**: From Hugging Face Hub """) col1, col2 = st.columns([1, 1]) with col1: st.header("๐Ÿงฌ Input Sequence") sequence_input = st.text_area( "Enter Protein or DNA Sequence", height=300, placeholder="Enter protein sequence (MKWVT...) or DNA sequence (ATGGCG...)\n\nExample protein: MKWVTFISLLFLFSSAYSRGVFRRDAHKSEVAHRFKDLGEENFKALVLIAFAQYLQQCPFEDHVKLVNEVTEFAKTCVADESAENCDKSLHTLFGDKLCTVATLRETYGEMADCCAKQEPERNECFLQHKDDNPNLPRLVRPEVDVMCTAFHDNEETFLKKYLYEIARRHPYFYAPELLFFAKRYKAAFTECCQAADKAACLLPKLDELRDEGKASSAKQRLKCASLQKFGERAFKAWAVARLSQRFPKAEFAEVSKLVTDLTKVHTECCHGDLLECADDRADLAKYICENQDSISSKLKECCEKPLLEKSHCIAEVENDEMPADLPSLAADFVESKDVCKNYAEAKDVFLGMFLYEYARRHPDYSVVLLLRLAKTYETTLEKCCAAADPHECYAKVFDEFKPLVEEPQNLIKQNCELFEQLGEYKFQNALLVRYTKKVPQVSTPTLVEVSRNLGKVGSKCCKHPEAKRMPCAEDYLSVVLNQLCVLHEKTPVSDRVTKCCTE" ) analyze_btn = st.button("Analyze Sequence", type="primary") if sequence_input and analyze_btn: is_valid, message, sequence_type, fixed_sequence = validate_sequence(sequence_input) if is_valid: st.success(f"โœ… {message}") # Store in session state for use by Optimize Sequence st.session_state.sequence_clean = fixed_sequence st.session_state.sequence_type = sequence_type st.session_state.input_metrics = calculate_input_metrics(fixed_sequence, organism, sequence_type) st.session_state.organism = organism else: st.error(f"โŒ {message}") if "Invalid characters" in message: st.info("๐Ÿ’ก **Suggestion:** Remove spaces, numbers, and special characters. Use only standard amino acid letters (A-Z) for proteins or nucleotides (ATGC) for DNA.") elif "too long" in message: st.info("๐Ÿ’ก **Suggestion:** Consider breaking long sequences into smaller segments for optimization.") elif "too short" in message: st.info("๐Ÿ’ก **Suggestion:** Minimum length is 3 characters. Ensure your sequence is complete.") # Clear session state if invalid st.session_state.sequence_clean = None st.session_state.sequence_type = None st.session_state.input_metrics = None st.session_state.organism = None elif not sequence_input: st.session_state.sequence_clean = None st.session_state.sequence_type = None st.session_state.input_metrics = None st.session_state.organism = None # Always display the last analysis if it exists in session state if st.session_state.get('input_metrics') and st.session_state.get('sequence_type'): input_metrics = st.session_state.input_metrics sequence_type = st.session_state.sequence_type st.subheader("๐Ÿ“Š Input Analysis") metrics_col1, metrics_col2, metrics_col3 = st.columns(3) with metrics_col1: unit = "codons" if sequence_type == "dna" else "AA" length = input_metrics.get('length', 0) if input_metrics else 0 gc_content = input_metrics.get('gc_content', 0) if input_metrics else 0 st.metric("Length", f"{length} {unit}") st.metric("GC Content", f"{gc_content:.1f}%") with metrics_col2: cai_val = input_metrics.get('cai') if input_metrics else None if cai_val: label = "CAI" if sequence_type == "dna" else "CAI (baseline)" st.metric(label, f"{cai_val:.3f}") else: st.metric("CAI", "N/A") with metrics_col3: tai_val = input_metrics.get('tai') if input_metrics else None if tai_val: label = "tAI" if sequence_type == "dna" else "tAI (baseline)" st.metric(label, f"{tai_val:.3f}") else: st.metric("tAI", "N/A") st.subheader("๐Ÿ” Sequence Quality Analysis") analysis_col1, analysis_col2, analysis_col3 = st.columns(3) with analysis_col1: sites_count = input_metrics.get('restriction_sites', 0) if input_metrics else 0 color = "normal" if sites_count <= 2 else "inverse" st.metric("Restriction Sites", sites_count) with analysis_col2: neg_elements = input_metrics.get('negative_cis_elements', 0) if input_metrics else 0 st.metric("Negative Elements", neg_elements) with analysis_col3: homo_runs = input_metrics.get('homopolymer_runs', 0) if input_metrics else 0 st.metric("Homopolymer Runs", homo_runs) baseline_dna = input_metrics.get('baseline_dna', '') if input_metrics else '' if baseline_dna and len(baseline_dna) > 150: st.subheader("๐Ÿ“ˆ GC Content Distribution") fig = create_gc_content_plot(baseline_dna) fig.update_layout( title="Input Sequence GC Content Analysis", xaxis_title="Position (codons)", yaxis_title="GC Content (%)", hovermode='x unified' ) st.plotly_chart(fig, use_container_width=True) with col2: st.header("๐Ÿš€ Optimization Results") # Enhanced optimization button if ( st.session_state.get('sequence_clean') and st.session_state.get('sequence_type') and not st.session_state.optimization_running ): st.markdown("**Ready to optimize your sequence!**") strategy_info = st.container() with strategy_info: st.info(f""" **Optimization Strategy:** โ€ข Target organism: {st.session_state.organism} โ€ข Model: Fine-tuned CodonTransformer (89.6M parameters) โ€ข GC target: {gc_target_min}-{gc_target_max}% โ€ข Mode: {'Deterministic' if use_deterministic else 'Stochastic'} """) if st.button("๐Ÿš€ Optimize Sequence", type="primary", use_container_width=True): st.session_state.results = None if st.session_state.sequence_type == "dna": original_dna = str(st.session_state.sequence_clean) protein_sequence = translate_dna_to_protein(original_dna) print(f"๐Ÿ” DEBUG: Original DNA length: {len(original_dna)}") print(f"๐Ÿ” DEBUG: Translated protein length: {len(protein_sequence)}") print(f"๐Ÿ” DEBUG: Original DNA (first 50): {original_dna[:50]}...") print(f"๐Ÿ” DEBUG: Translated protein (first 30): {protein_sequence[:30]}...") run_optimization(protein_sequence, str(st.session_state.organism), use_post_processing) else: run_optimization(str(st.session_state.sequence_clean), str(st.session_state.organism), use_post_processing) # Enhanced progress display if st.session_state.optimization_running: st.info("๐Ÿ”„ **Optimizing sequence with our model...**") # Create progress container progress_container = st.container() with progress_container: progress_bar = st.progress(0) status_text = st.empty() # Enhanced progress steps steps = [ "๐Ÿ” Analyzing input sequence structure...", "๐Ÿงฌ Loading fine-tuned CodonTransformer model...", "โšก Running optimization algorithm...", "๐ŸŽฏ Optimizing GC content for synthesis...", "โœ… Finalizing optimized sequence..." ] for i, step in enumerate(steps): progress_value = int((i + 1) / len(steps) * 100) progress_bar.progress(progress_value) status_text.text(step) time.sleep(0.8) # Realistic timing progress_bar.empty() status_text.empty() # Enhanced results display if st.session_state.results and not st.session_state.optimization_running: if isinstance(st.session_state.results, str): st.error(f"โŒ **Optimization Failed:** {st.session_state.results}") else: display_optimization_results( st.session_state.results, st.session_state.get('organism', organism), st.session_state.get('sequence_clean', ''), st.session_state.get('sequence_type', 'protein'), st.session_state.get('input_metrics', {}) ) def display_optimization_results(result, organism, original_sequence, sequence_type, input_metrics): """Enhanced results display with publication-quality visualizations""" # Calculate optimized metrics optimized_metrics = { 'gc_content': get_GC_content(result.predicted_dna), 'length': len(result.predicted_dna) } # Calculate CAI and tAI try: if 'cai_weights' in st.session_state and st.session_state['cai_weights']: optimized_metrics['cai'] = CAI(result.predicted_dna, weights=st.session_state['cai_weights']) else: optimized_metrics['cai'] = None except: optimized_metrics['cai'] = None try: if 'tai_weights' in st.session_state and st.session_state['tai_weights']: optimized_metrics['tai'] = calculate_tAI(result.predicted_dna, st.session_state['tai_weights']) else: optimized_metrics['tai'] = None except: optimized_metrics['tai'] = None # Success header st.success("โœ… **Optimization Complete!** ") # Key improvements summary st.subheader("๐ŸŽฏ Optimization Improvements") imp_col1, imp_col2, imp_col3 = st.columns(3) if input_metrics is not None: with imp_col1: if input_metrics.get('gc_content') and optimized_metrics.get('gc_content'): gc_change = optimized_metrics['gc_content'] - input_metrics['gc_content'] print(f"๐Ÿ” DEBUG: GC change: {input_metrics['gc_content']:.3f} -> {optimized_metrics['gc_content']:.3f} (ฮ”{gc_change:+.3f})") st.metric("GC Content", f"{optimized_metrics['gc_content']:.1f}%", delta=f"{gc_change:+.1f}%") with imp_col2: if input_metrics.get('cai') and optimized_metrics.get('cai'): cai_change = optimized_metrics['cai'] - input_metrics['cai'] print(f"๐Ÿ” DEBUG: CAI change: {input_metrics['cai']:.6f} -> {optimized_metrics['cai']:.6f} (ฮ”{cai_change:+.6f})") print(f"๐Ÿ” DEBUG: Are sequences identical? {original_sequence == result.predicted_dna}") if hasattr(result, 'predicted_dna') and len(original_sequence) > 0: print(f"๐Ÿ” DEBUG: Sequence lengths - Original: {len(original_sequence)}, Optimized: {len(result.predicted_dna)}") st.metric("CAI Score", f"{optimized_metrics['cai']:.3f}", delta=f"{cai_change:+.3f}") with imp_col3: if input_metrics.get('tai') and optimized_metrics.get('tai'): tai_change = optimized_metrics['tai'] - input_metrics['tai'] st.metric("tAI Score", f"{optimized_metrics['tai']:.3f}", delta=f"{tai_change:+.3f}") # Optimized DNA sequence display st.subheader("๐Ÿงฌ Optimized DNA Sequence") # Calculate dynamic height for the text area estimated_chars_per_line = 100 # Rough estimate for wide layout line_height_px = 20 # Rough estimate for font size min_height_px = 150 num_lines = (len(result.predicted_dna) // estimated_chars_per_line) + 1 dynamic_height = max(min_height_px, num_lines * line_height_px) st.text_area("Optimized DNA Sequence", result.predicted_dna, height=dynamic_height) # Enhanced download and export options col1, col2, col3 = st.columns(3) with col1: st.download_button( label="๐Ÿ“ฅ Download DNA (FASTA)", data=f">Optimized_{organism.replace(' ', '_')}\n{result.predicted_dna}", file_name=f"optimized_sequence_{organism.replace(' ', '_')}.fasta", mime="text/plain" ) with col2: # Create CSV report csv_data = f"Metric,Original,Optimized,Improvement\n" csv_data += f"GC Content (%),{input_metrics['gc_content']:.1f},{optimized_metrics['gc_content']:.1f},{optimized_metrics['gc_content'] - input_metrics['gc_content']:+.1f}\n" if input_metrics['cai'] and optimized_metrics['cai']: csv_data += f"CAI Score,{input_metrics['cai']:.3f},{optimized_metrics['cai']:.3f},{optimized_metrics['cai'] - input_metrics['cai']:+.3f}\n" if input_metrics['tai'] and optimized_metrics['tai']: csv_data += f"tAI Score,{input_metrics['tai']:.3f},{optimized_metrics['tai']:.3f},{optimized_metrics['tai'] - input_metrics['tai']:+.3f}\n" st.download_button( label="๐Ÿ“Š Download Metrics (CSV)", data=csv_data, file_name=f"optimization_metrics_{organism.replace(' ', '_')}.csv", mime="text/csv" ) with col3: st.button("๐Ÿ“„ Generate PDF Report", help="Coming soon: Publication-quality PDF report") # Enhanced comparison visualizations st.subheader("๐Ÿ“Š Before vs After Analysis") # Create enhanced comparison charts create_enhanced_comparison_charts(input_metrics, optimized_metrics, original_sequence, result.predicted_dna, sequence_type) def create_enhanced_comparison_charts(input_metrics, optimized_metrics, original_dna, optimized_dna, sequence_type): """Create publication-quality comparison visualizations""" if input_metrics is None or optimized_metrics is None: st.info("No comparison data available.") return # GC Content comparison gc_comp_fig = create_gc_comparison_chart(input_metrics, optimized_metrics) gc_comp_fig.update_layout( title="GC Content Optimization Results", font=dict(size=12), height=350 ) st.plotly_chart(gc_comp_fig, use_container_width=True) # Expression metrics comparison if input_metrics.get('cai') and optimized_metrics.get('cai'): expr_comp_fig = create_expression_comparison_chart(input_metrics, optimized_metrics) expr_comp_fig.update_layout( title="Expression Potential Improvement", font=dict(size=12), height=350 ) st.plotly_chart(expr_comp_fig, use_container_width=True) # Side-by-side GC distribution analysis st.subheader("๐Ÿ“ˆ GC Content Distribution Analysis") col1, col2 = st.columns(2) with col1: st.write(f"**{'Original DNA' if sequence_type == 'dna' else 'Baseline (Most Frequent Codons)'}**") baseline_dna = input_metrics.get('baseline_dna') if input_metrics else None plot_dna = baseline_dna if baseline_dna is not None else original_dna if plot_dna is not None and isinstance(plot_dna, str) and len(plot_dna) > 150: fig_before = create_gc_content_plot(plot_dna) fig_before.update_layout(title="Before Optimization", height=300) st.plotly_chart(fig_before, use_container_width=True) else: st.info("Sequence too short for sliding window analysis") with col2: st.write("** Model Optimized**") if optimized_dna is not None and isinstance(optimized_dna, str) and len(optimized_dna) > 150: fig_after = create_gc_content_plot(optimized_dna) fig_after.update_layout(title="After Optimization", height=300) st.plotly_chart(fig_after, use_container_width=True) else: st.info("Sequence too short for sliding window analysis") def batch_processing_interface(): """Batch processing interface for multiple sequences""" st.header("๐Ÿ“ Batch Processing") st.markdown("**Process multiple protein sequences simultaneously with optimization**") # File upload section st.subheader("๐Ÿ“ค Upload Sequences") uploaded_file = st.file_uploader( "Choose a file with multiple sequences", type=['csv', 'xlsx', 'fasta', 'txt', 'fa'], help="Upload CSV, Excel (XLSX, with 'sequence' column) or FASTA format files" ) if uploaded_file: st.success(f"โœ… File uploaded: {uploaded_file.name}") # Process uploaded file try: def find_column(df, target): # Find column name case-insensitively and ignoring spaces for col in df.columns: if col.strip().lower() == target: return col return None if uploaded_file.name.endswith('.csv'): df = pd.read_csv(uploaded_file) seq_col = find_column(df, 'sequence') name_col = find_column(df, 'name') if seq_col: sequences = df[seq_col].tolist() if name_col: names = df[name_col].tolist() else: names = [f"Sequence_{i+1}" for i in range(len(sequences))] else: st.error("CSV file must contain a column named 'sequence' (case-insensitive, spaces ignored)") return elif uploaded_file.name.endswith('.xlsx'): df = pd.read_excel(uploaded_file) seq_col = find_column(df, 'sequence') name_col = find_column(df, 'name') if seq_col: sequences = df[seq_col].tolist() if name_col: names = df[name_col].tolist() else: names = [f"Sequence_{i+1}" for i in range(len(sequences))] else: st.error("Excel file must contain a column named 'sequence' (case-insensitive, spaces ignored)") return else: # Handle FASTA format content = uploaded_file.read().decode('utf-8') sequences, names = parse_fasta_content(content) st.info(f"๐Ÿ“Š Found {len(sequences)} sequences ready for optimization") # Batch configuration col1, col2 = st.columns(2) with col1: batch_organism = st.selectbox("Target Organism", [ "Escherichia coli general", "Saccharomyces cerevisiae", "Homo sapiens" ]) with col2: max_sequences = st.number_input("Max sequences to process", 1, len(sequences), min(10, len(sequences))) # Start batch processing if st.button("๐Ÿš€ Start Batch Optimization", type="primary"): run_batch_optimization(sequences[:max_sequences], names[:max_sequences], batch_organism) except Exception as e: st.error(f"Error processing file: {str(e)}") # Batch results display if 'batch_results' in st.session_state and st.session_state.batch_results: display_batch_results() def parse_fasta_content(content): """Parse FASTA format content""" sequences = [] names = [] current_seq = "" current_name = "" for line in content.split('\n'): line = line.strip() if line.startswith('>'): if current_seq: sequences.append(current_seq) names.append(current_name) current_name = line[1:] if len(line) > 1 else f"Sequence_{len(sequences)+1}" current_seq = "" else: current_seq += line if current_seq: sequences.append(current_seq) names.append(current_name) return sequences, names def run_batch_optimization(sequences, names, organism): """Run batch optimization with progress tracking""" st.session_state.batch_results = [] st.session_state.batch_logs = [] # Collect info logs for auto-fixes # Load reference data for CAI/tAI load_reference_data(organism) cai_weights = st.session_state.get('cai_weights', None) tai_weights = st.session_state.get('tai_weights', None) # Create progress tracking progress_bar = st.progress(0) status_text = st.empty() for i, (seq, name) in enumerate(zip(sequences, names)): progress = (i + 1) / len(sequences) progress_bar.progress(progress) status_text.text(f"Processing {name} ({i+1}/{len(sequences)})") try: # Validate sequence and get possibly fixed sequence is_valid, message, sequence_type, fixed_seq = validate_sequence(seq) if is_valid: # Log if auto-fixed if 'auto-fixed' in message: st.session_state.batch_logs.append(f"{name}: {message}") # Calculate original metrics (use fixed_seq for DNA) if sequence_type == "dna": orig_gc = get_GC_content(fixed_seq) orig_cai = CAI(fixed_seq, weights=cai_weights) if cai_weights else None orig_tai = calculate_tAI(fixed_seq, tai_weights) if tai_weights else None else: # For protein, create baseline DNA most_frequent_codons = { 'A': 'GCG', 'C': 'TGC', 'D': 'GAT', 'E': 'GAA', 'F': 'TTT', 'G': 'GGC', 'H': 'CAT', 'I': 'ATT', 'K': 'AAA', 'L': 'CTG', 'M': 'ATG', 'N': 'AAC', 'P': 'CCG', 'Q': 'CAG', 'R': 'CGC', 'S': 'TCG', 'T': 'ACG', 'V': 'GTG', 'W': 'TGG', 'Y': 'TAT', '*': 'TAA', '_': 'TAA' } baseline_dna = ''.join([most_frequent_codons.get(aa, 'NNN') for aa in fixed_seq]) orig_gc = get_GC_content(baseline_dna) orig_cai = CAI(baseline_dna, weights=cai_weights) if cai_weights else None orig_tai = calculate_tAI(baseline_dna, tai_weights) if tai_weights else None # Run optimization using the fixed sequence result = predict_dna_sequence( protein=fixed_seq if sequence_type == "protein" else translate_dna_to_protein(fixed_seq), organism=organism, device=st.session_state.device, model=st.session_state.model, deterministic=True, match_protein=True, ) # If result is a list, use the first element if isinstance(result, list): result_obj = result[0] else: result_obj = result # Calculate optimized metrics opt_gc = get_GC_content(result_obj.predicted_dna) opt_cai = CAI(result_obj.predicted_dna, weights=cai_weights) if cai_weights else None opt_tai = calculate_tAI(result_obj.predicted_dna, tai_weights) if tai_weights else None metrics = { 'name': name, 'original_sequence': fixed_seq, 'optimized_dna': result_obj.predicted_dna, 'gc_content_before': orig_gc, 'gc_content_after': opt_gc, 'cai_before': orig_cai, 'cai_after': opt_cai, 'tai_before': orig_tai, 'tai_after': opt_tai, 'length_before': len(fixed_seq), 'length_after': len(result_obj.predicted_dna), 'validation_message': message } st.session_state.batch_results.append(metrics) else: # Only skip if truly invalid (not auto-fixable) st.session_state.batch_logs.append(f"{name}: {message}") except Exception as e: st.session_state.batch_logs.append(f"{name}: Error processing: {str(e)}") progress_bar.empty() status_text.empty() st.success(f"โœ… Batch optimization complete! Processed {len(st.session_state.batch_results)} sequences.") def display_batch_results(): """Display batch processing results""" st.subheader("๐Ÿ“Š Batch Results") # Show all logs (auto-fixes and errors) if hasattr(st.session_state, 'batch_logs') and st.session_state.batch_logs: for log in st.session_state.batch_logs: st.info(log) results_df = pd.DataFrame(st.session_state.batch_results) # Summary statistics col1, col2, col3, col4 = st.columns(4) with col1: st.metric("Sequences Processed", len(results_df)) with col2: st.metric("Avg GC Before", f"{results_df['gc_content_before'].mean():.1f}%") st.metric("Avg GC After", f"{results_df['gc_content_after'].mean():.1f}%") with col3: st.metric("Avg CAI Before", f"{results_df['cai_before'].mean():.3f}") st.metric("Avg CAI After", f"{results_df['cai_after'].mean():.3f}") with col4: st.metric("Avg tAI Before", f"{results_df['tai_before'].mean():.3f}") st.metric("Avg tAI After", f"{results_df['tai_after'].mean():.3f}") # CAI Extremes Analysis st.subheader("๐ŸŽฏ CAI Performance Analysis") # Filter out rows with NaN CAI values for analysis valid_cai_df = results_df.dropna(subset=['cai_after']) if len(valid_cai_df) > 0: # Find lowest and highest CAI sequences lowest_cai_idx = valid_cai_df['cai_after'].idxmin() highest_cai_idx = valid_cai_df['cai_after'].idxmax() lowest_cai_row = results_df.loc[lowest_cai_idx] highest_cai_row = results_df.loc[highest_cai_idx] col1, col2 = st.columns(2) with col1: st.markdown("**๐Ÿ”ป Lowest CAI Sequence**") st.write(f"**Name:** {lowest_cai_row['name']}") st.metric("CAI Score", f"{lowest_cai_row['cai_after']:.3f}") st.metric("GC Content", f"{lowest_cai_row['gc_content_after']:.1f}%") st.metric("tAI Score", f"{lowest_cai_row['tai_after']:.3f}") st.metric("Length", f"{lowest_cai_row['length_after']} bp") # Show improvement if pd.notna(lowest_cai_row['cai_before']): cai_improvement = lowest_cai_row['cai_after'] - lowest_cai_row['cai_before'] st.metric("CAI Improvement", f"{cai_improvement:+.3f}") with col2: st.markdown("**๐Ÿ”บ Highest CAI Sequence**") st.write(f"**Name:** {highest_cai_row['name']}") st.metric("CAI Score", f"{highest_cai_row['cai_after']:.3f}") st.metric("GC Content", f"{highest_cai_row['gc_content_after']:.1f}%") st.metric("tAI Score", f"{highest_cai_row['tai_after']:.3f}") st.metric("Length", f"{highest_cai_row['length_after']} bp") # Show improvement if pd.notna(highest_cai_row['cai_before']): cai_improvement = highest_cai_row['cai_after'] - highest_cai_row['cai_before'] st.metric("CAI Improvement", f"{cai_improvement:+.3f}") # CAI Distribution Chart st.subheader("๐Ÿ“Š CAI Distribution") fig = go.Figure() fig.add_trace(go.Histogram( x=valid_cai_df['cai_after'], nbinsx=20, name='Optimized CAI Scores', marker_color='darkblue', opacity=0.7 )) # Add vertical lines for lowest and highest fig.add_vline( x=lowest_cai_row['cai_after'], line_dash="dash", line_color="red", annotation_text=f"Lowest: {lowest_cai_row['cai_after']:.3f}" ) fig.add_vline( x=highest_cai_row['cai_after'], line_dash="dash", line_color="green", annotation_text=f"Highest: {highest_cai_row['cai_after']:.3f}" ) fig.update_layout( title="Distribution of Optimized CAI Scores", xaxis_title="CAI Score", yaxis_title="Number of Sequences", height=400, showlegend=False ) st.plotly_chart(fig, use_container_width=True) # GC Content Distribution Chart st.subheader("๐Ÿ“Š GC Content Distribution") valid_gc_df = results_df.dropna(subset=['gc_content_after']) if len(valid_gc_df) > 0: lowest_gc_idx = valid_gc_df['gc_content_after'].idxmin() highest_gc_idx = valid_gc_df['gc_content_after'].idxmax() lowest_gc_row = results_df.loc[lowest_gc_idx] highest_gc_row = results_df.loc[highest_gc_idx] fig_gc = go.Figure() fig_gc.add_trace(go.Histogram( x=valid_gc_df['gc_content_after'], nbinsx=20, name='Optimized GC Content', marker_color='teal', opacity=0.7 )) fig_gc.add_vline( x=lowest_gc_row['gc_content_after'], line_dash="dash", line_color="red", annotation_text=f"Lowest: {lowest_gc_row['gc_content_after']:.1f}%" ) fig_gc.add_vline( x=highest_gc_row['gc_content_after'], line_dash="dash", line_color="green", annotation_text=f"Highest: {highest_gc_row['gc_content_after']:.1f}%" ) fig_gc.update_layout( title="Distribution of Optimized GC Content", xaxis_title="GC Content (%)", yaxis_title="Number of Sequences", height=400, showlegend=False ) st.plotly_chart(fig_gc, use_container_width=True) else: st.warning("โš ๏ธ No valid GC content values found in the batch results.") else: st.warning("โš ๏ธ No valid CAI scores found in the batch results. Check if CAI weights are properly loaded.") # Sequence selector seq_names = results_df['name'].tolist() selected_seq = st.selectbox("Select a sequence to view details", seq_names) seq_row = results_df[results_df['name'] == selected_seq].iloc[0] st.markdown(f"### Details for: {selected_seq}") if 'validation_message' in seq_row and 'auto-fixed' in seq_row['validation_message']: st.info(seq_row['validation_message']) col1, col2 = st.columns(2) with col1: st.markdown("**Original Sequence**") st.text_area("Original Sequence", seq_row['original_sequence'], height=100) st.metric("GC Content (Before)", f"{seq_row['gc_content_before']:.1f}%") st.metric("CAI (Before)", f"{seq_row['cai_before']:.3f}") st.metric("tAI (Before)", f"{seq_row['tai_before']:.3f}") st.metric("Length (Before)", f"{seq_row['length_before']}") with col2: st.markdown("**Optimized Sequence**") st.text_area("Optimized Sequence", seq_row['optimized_dna'], height=100) st.metric("GC Content (After)", f"{seq_row['gc_content_after']:.1f}%") st.metric("CAI (After)", f"{seq_row['cai_after']:.3f}") st.metric("tAI (After)", f"{seq_row['tai_after']:.3f}") st.metric("Length (After)", f"{seq_row['length_after']}") # Plots for before/after GC content st.subheader("GC Content Distribution (Before vs After)") if len(seq_row['original_sequence']) > 150 and len(seq_row['optimized_dna']) > 150: fig_before = create_gc_content_plot(seq_row['original_sequence']) fig_before.update_layout(title="Before Optimization", height=300) fig_after = create_gc_content_plot(seq_row['optimized_dna']) fig_after.update_layout(title="After Optimization", height=300) st.plotly_chart(fig_before, use_container_width=True) st.plotly_chart(fig_after, use_container_width=True) else: st.info("Sequence(s) too short for sliding window analysis") # Download batch results if st.button("๐Ÿ“ฅ Download Batch Results"): csv_data = results_df.to_csv(index=False) st.download_button( label="Download CSV", data=csv_data, file_name="batch_optimization_results.csv", mime="text/csv" ) def comparative_analysis_interface(): """Comparative analysis interface""" st.header("๐Ÿ“Š Comparative Analysis") st.markdown("**Compare optimization strategies side-by-side**") st.info("๐Ÿšง **Coming Soon:** Compare our model against traditional methods (HFC, BFC, URC) and generate publication-quality comparative analysis.") # Placeholder for future implementation col1, col2 = st.columns(2) with col1: st.subheader("Algorithm Comparison") st.write("โ€ข ColiFormer (Our Model)") st.write("โ€ข High Frequency Choice (HFC)") st.write("โ€ข Background Frequency Choice (BFC)") st.write("โ€ข Uniform Random Choice (URC)") with col2: st.subheader("Comparison Metrics") st.write("โ€ข CAI Score Comparison") st.write("โ€ข tAI Score Comparison") st.write("โ€ข GC Content Analysis") st.write("โ€ข Statistical Significance Testing") def advanced_settings_interface(): """Advanced settings and configuration interface""" st.header("โš™๏ธ Advanced Settings") st.markdown("**Configure advanced parameters and model settings**") # Model configuration st.subheader("๐Ÿค– Model Configuration") col1, col2 = st.columns(2) with col1: st.write("**Current Model Status:**") if st.session_state.model: model_type = getattr(st.session_state, 'model_type', 'unknown') st.success(f"โœ… Model loaded: {model_type}") st.write(f"Device: {st.session_state.device}") else: st.warning("โš ๏ธ Model not loaded") with col2: st.write("**Model Information:**") st.write("โ€ข Architecture: BigBird Transformer") st.write("โ€ข Parameters: 89.6M") st.write("โ€ข Training: 4,316 high-CAI E. coli genes") st.write("โ€ข Performance: +5.1% CAI, +8.6% tAI") # Performance tuning st.subheader("โšก Performance Tuning") # Memory management col1, col2 = st.columns(2) with col1: if st.button("๐Ÿงน Clear Cache"): st.cache_data.clear() st.success("Cache cleared successfully") with col2: if st.button("๐Ÿ”„ Reload Model"): st.session_state.model = None st.session_state.tokenizer = None st.rerun() # System information st.subheader("๐Ÿ’ป System Information") import torch col1, col2, col3 = st.columns(3) with col1: st.write("**PyTorch:**") st.write(f"Version: {torch.__version__}") st.write(f"CUDA Available: {torch.cuda.is_available()}") with col2: st.write("**Device:**") st.write(f"Current: {st.session_state.device}") if torch.cuda.is_available(): st.write(f"GPU: {torch.cuda.get_device_name()}") with col3: st.write("**Memory:**") if torch.cuda.is_available(): gpu_memory = torch.cuda.get_device_properties(0).total_memory / 1e9 st.write(f"GPU Memory: {gpu_memory:.1f} GB") # Footer st.markdown("---") st.markdown("**ColiFormer **") st.markdown("๐Ÿš€ Built for Nature Communications-level research โ€ข Targeting >20% CAI improvements โ€ข Aug 2025 experimental validation") if __name__ == "__main__": main()