|
|
--- |
|
|
license: cc-by-nc-sa-4.0 |
|
|
widget: |
|
|
- text: ACCTGA<mask>TTCTGAGTC |
|
|
tags: |
|
|
- DNA |
|
|
- biology |
|
|
- genomics |
|
|
- segmentation |
|
|
--- |
|
|
# segment-nt-30kb |
|
|
|
|
|
Segment-NT-30kb is a segmentation model leveraging the [Nucleotide Transformer](https://huggingface.co/InstaDeepAI/nucleotide-transformer-v2-500m-multi-species) (NT) DNA foundation model to predict the location of several types of genomics |
|
|
elements in a sequence at a single nucleotide resolution. It was trained on 14 different classes of human genomics elements in input sequences up to 30kb. These |
|
|
include gene (protein-coding genes, lncRNAs, 5’UTR, 3’UTR, exon, intron, splice acceptor and donor sites) and regulatory (polyA signal, tissue-invariant and |
|
|
tissue-specific promoters and enhancers, and CTCF-bound sites) elements. |
|
|
|
|
|
|
|
|
**Developed by:** InstaDeep, NVIDIA and TUM |
|
|
|
|
|
### Model Sources |
|
|
|
|
|
<!-- Provide the basic links for the model. --> |
|
|
|
|
|
- **Repository:** [Nucleotide Transformer](https://github.com/instadeepai/nucleotide-transformer) |
|
|
- **Paper:** [Segmenting the genome at single-nucleotide resolution with DNA foundation models]() TODO: Add link to preprint |
|
|
|
|
|
### How to use |
|
|
|
|
|
<!-- Need to adapt this section to our model. Need to figure out how to load the models from huggingface and do inference on them --> |
|
|
Until its next release, the `transformers` library needs to be installed from source with the following command in order to use the models: |
|
|
```bash |
|
|
pip install --upgrade git+https://github.com/huggingface/transformers.git |
|
|
``` |
|
|
|
|
|
A small snippet of code is given here in order to retrieve both logits and embeddings from a dummy DNA sequence. |
|
|
```python |
|
|
# Load model and tokenizer |
|
|
from transformers import AutoTokenizer, AutoModel |
|
|
import torch |
|
|
|
|
|
tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/segment_nt_30kb", use_auth_token=hf_token, trust_remote_code=True) |
|
|
model = AutoModel.from_pretrained("InstaDeepAI/segment_nt_30kb", use_auth_token=hf_token, trust_remote_code=True) |
|
|
|
|
|
|
|
|
# Choose the length to which the input sequences are padded. By default, the |
|
|
# model max length is chosen, but feel free to decrease it as the time taken to |
|
|
# obtain the embeddings increases significantly with it. |
|
|
max_length = tokenizer.model_max_length |
|
|
|
|
|
# Create a dummy dna sequence and tokenize it |
|
|
sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"] |
|
|
tokens_ids = tokenizer.batch_encode_plus(sequences, return_tensors="pt", padding="max_length", max_length = max_length)["input_ids"] |
|
|
|
|
|
# Compute the embeddings |
|
|
attention_mask = torch_tokens != tokenizer.pad_token_id |
|
|
outs = model( |
|
|
torch_tokens, |
|
|
attention_mask=attention_mask, |
|
|
output_hidden_states=True |
|
|
) |
|
|
|
|
|
logits = outs.logits.detach().numpy() |
|
|
probabilities = torch.nn.functional.softmax(logits, dim=-1) |
|
|
``` |
|
|
|
|
|
|
|
|
## Training data |
|
|
|
|
|
The **segment-nt-30kb** model was trained on all human chromosomes except for chromosomes 20 and 21, kept as test set, and chromosome 22, used as a validation set. |
|
|
|
|
|
## Training procedure |
|
|
|
|
|
### Preprocessing |
|
|
|
|
|
The DNA sequences are tokenized using the Nucleotide Transformer Tokenizer, which tokenizes sequences as 6-mers tokens as described in the [Tokenization](https://github.com/instadeepai/nucleotide-transformer#tokenization-abc) section of the associated repository. This tokenizer has a vocabulary size of 4105. The inputs of the model are then of the form: |
|
|
|
|
|
``` |
|
|
<CLS> <ACGTGT> <ACGTGC> <ACGGAC> <GACTAG> <TCAGCA> |
|
|
``` |
|
|
|
|
|
### Training |
|
|
|
|
|
The model was trained on a DGXH100 on a total of 23B tokens. The model was trained on 3kb, 10kb, 20kb and finally 30kb sequences, at each time with an effective batch size of 256 sequences. |
|
|
|
|
|
|
|
|
### Architecture |
|
|
|
|
|
The model is composed of the [nucleotide-transformer-v2-50m-multi-species](https://huggingface.co/InstaDeepAI/nucleotide-transformer-v2-500m-multi-species) encoder, from which we removed |
|
|
the language model head and replaced it by a 1-dimensional U-Net segmentation head [4] made of 2 downsampling convolutional blocks and 2 upsampling convolutional blocks. Each of these |
|
|
blocks is made of 2 convolutional layers with 1, 024 and 2, 048 kernels respectively. This additional segmentation head accounts for 53 million parameters, bringing the total number of parameters |
|
|
to 562M. |
|
|
|
|
|
### BibTeX entry and citation info |
|
|
|
|
|
#TODO: Add bibtex citation here |
|
|
```bibtex |
|
|
|
|
|
``` |