Model Overview

Orthrus is a mature RNA foundation model for RNA property prediction. Orthrus is pre-trained using contrastive learning on 45M+ mature RNA transcripts to capture functional and evolutionary relationships across all Mammalian organisms. Orthrus is built on a Mamba encoder backbone, enabling the embedding of arbitrarily long RNA sequence data.

Orthrus Model Overview

We offer two sizes of Orthrus: small (~1M parameters) and the standard size (~10M parameters).

Multiple versions of Orthrus are available on HuggingFace:

Orthrus v1

These are the latest versions of the models.

Orthrus v0

These are the original models, available for reproducibility (See v0 collection).

The model cards in the above versions contain instructions to use Orthrus directly from HuggingFace. See below for more comprehensive instructions to run Orthrus from this HF repo based on the original github repo.

Why the Mamba Backbone? The mamba architecture is an extension of the S4 (structured state-space) model family, which excels at handling long sequences like mRNAs that can reach over 12,000 nucleotides. This makes it an ideal fit for RNA property prediction models for several reasons:

  • Efficient Memory Usage: Unlike transformers, which require quadratic memory scaling with sequence length, the mamba backbone scales linearly, making it computationally efficient for long sequences.
  • Variable Context Filtering: RNA sequences often contain functionally relevant motifs separated by variable spacing. The mamba model is capable of selectively focusing on these important elements
  • Selective Context Compression: Genomic sequences often have uneven information density, with critical regulatory elements scattered across regions of varying importance. The mamba model selectively compresses less informative regions while preserving the context of key functional areas

Using Orthrus

Orthrus was trained on full RNA sequences, making its usage different from models like DNABERT or Enformer, which focus on arbitrary DNA segments. Orthrus was instead trained on full mature RNA sequences so if you pass an incomplete piece of a spliced RNA the input sample will be out of distribution.

To generate embeddings using Orthrus for spliced mature RNA sequences, follow the steps below:

Create and Set Up the Environment

We recommend using Mamba (a faster alternative to Conda) for environment creation, but Conda works as well. Follow these steps to set up your environment:

  1. Install Mamba or Conda if you haven't already.

  2. Create and activate the environment:

# Create the environment from the provided YAML file
mamba env create -f env.yml
# Activate the environment
conda activate orthrus
  1. Install additional dependencies:
# Install necessary dependencies for the Mamba model (not the environment manager)
pip install causal_conv1d==1.1.1
pip install mamba-ssm==1.2.0.post1 --no-cache-dir
  1. Set up GenomeKit:
# Download the GenomeKit setup script
wget -O starter_build.sh https://raw.githubusercontent.com/deepgenomics/GenomeKit/main/starter/build.sh
# Make the script executable
chmod +x starter_build.sh
# Run the script to download genomes and annotations
./starter_build.sh

Now you're ready to use Orthrus for generating embeddings!

Generating Embeddings

4-Track Model

The 4-track model requires only a one-hot encoded sequence of your mRNA. This representation captures the basic nucleotide information of the mRNA sequence.

Here is example code

>>> from src.model import seq_to_oh, load_model
>>> import torch
# Sequence for short mRNA
>>> seq=(
'TCATCTGGATTATACATATTTCGCAATGAAAGAGAGGAAGAAAAGGAAGCAGCAAAATATGTGGAGGCCCA'
 'ACAAAAGAGACTAGAAGCCTTATTCACTAAAATTCAGGAGGAATTTGAAGAACATGAAGTTACTTCCTCC'
 'ACTGAAGTCTTGAACCCCCCAAAGTCATCCATGAGGGTTGGAATCAACTTCTGAAAACACAACAAAACCA'
 'TATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAG'
 'CAGTGAAGAATGCAGCAGACCCAGCTTACCTTGAGGGTTATTTCAGTGAAGAGCAGTTAAGAGCCTTGAA'
 'TAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCAGTTGGAAATTAGGAAGGCCATGGAA'
 'TCTGCTGAACAAAAGGAACAAGGTTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTC'
)
# One hot encode function
>>> oh = seq_to_oh(seq)
>>> one_hot = seq_to_oh(seq)
>>> one_hot = one_hot.T
>>> torch_one_hot = torch.tensor(one_hot, dtype=torch.float32)
>>> torch_one_hot = torch_one_hot.unsqueeze(0)
>>> print(torch_one_hot.shape)
>>> torch_one_hot = torch_one_hot.to(device='cuda')
>>> lengths = torch.tensor([torch_one_hot.shape[2]]).to(device='cuda')
# Load Orthrus
>>> run_name="orthrus_v1_4_track"
>>> checkpoint="epoch=6-step=20000.ckpt"
>>> model_repository="./models/"
>>> model = load_model(f"{model_repository}{run_name}", checkpoint_name=checkpoint)
>>> model = model.to(torch.device('cuda'))
>>> print(model)
# Generate embedding
>>> reps = model.representation(torch_one_hot, lengths)
>>> print(reps.shape)
# torch.Size([1, 256])

6-Track Model (Recommended)

The 6-track model offers a more detailed representation by incorporating additional biological context, including splice site and coding sequence information. To generate embeddings for this model:

We're going to be using an awesome library called GenomeKit to extract DNA sequences and build 4/6 track representations of mRNA transcripts, which will be used as input for Orthrus. GenomeKit makes it easy to work with genomic data, such as sequences and annotations, by providing tools to access and manipulate reference genomes and variants efficiently. It's built by the awesome folks at Deep Genomics

For more details, you can refer to the GenomeKit documentation.

To install it:

mamba install "genomekit>=6.0.0"
# we now want to download the genome annotations and the 2bit genome files
wget -O starter_build.sh https://raw.githubusercontent.com/deepgenomics/GenomeKit/main/starter/build.sh
chmod +x starter_build.sh
./starter_build.sh

We can now generate six track encodings for any transcript!

# import Genome, Interval, instantiate Genome
>>> from genome_kit import Genome, Interval
>>> from src.model import seq_to_oh, load_model
>>> from src.gk_utils import find_transcript_by_gene_name, create_six_track_encoding
>>> import torch
>>> genome = Genome("gencode.v29")
>>> interval = Interval("chr7", "+", 117120016, 117120201, genome)
>>> genome.dna(interval)
# CTCTTATGCTCGGGTGATCC

# Load Orthrus 6 track
>>> run_name="orthrus_v1_6_track"
>>> checkpoint="epoch=6-step=20000.ckpt"
>>> model_repository="./models/"
>>> model = load_model(f"{model_repository}{run_name}", checkpoint_name=checkpoint)
>>> model = model.to(torch.device('cuda'))
>>> print(model)
# Generate embedding
>>> transcripts = find_transcript_by_gene_name(genome, 'BCL2L1')
>>> print(transcripts)
>>> t = transcripts[0]
>>> sixt = create_six_track_encoding(t, genome=genome)
>>> sixt = torch.tensor(sixt, dtype=torch.float32)
>>> sixt = sixt.unsqueeze(0)
>>> sixt = sixt.to(device='cuda')
>>> lengths = torch.tensor([sixt.shape[2]]).to(device='cuda')
>>> embedding = model.representation(sixt, lengths)
>>> print(embedding.shape)
# torch.Size([1, 512])

Alternatively, this information can be extracted from genePred files available for download from the UCSC Genome Browser here.

Fine-Tuning Orthrus

All the data for fine tuning, linear probing, and homology splitting is available at this zenodo link: https://zenodo.org/records/13910050

To fine tune orthrus you can use the pre-specified configurations lockated in ./orthrus/rna_task_config for data, model, optimizer, projector, and training parameters. Here is an example command that will fine tune Orthrus on an RNA half-life dataset:

cd orthrus

python finetune.py \
 --data_config "rnahl_human" \
 --model_config "contrastive_only_small" \
 --projector_config "mamba_base_projector" \
 --optimizer_config "no_wd_1e-3" \
 --train_config "bs_64_3k_steps" \
 --seed_override "0" \
 --note "test"

Before running the command please remember to update your data storage directory and your model weights directory in configs.

If you're interested in running data ablation experiments simply use one of the configured data configurations in ./orthrus/rna_task_config or create a new one. Here is an example of fine tuning RNA half-life regression with 30 training data samples.

python finetune.py \
 --data_config "rnahl_human" \
 --model_config "contrastive_only_small" \
 --projector_config "mamba_base_projector" \
 --optimizer_config "no_wd_1e-3" \
 --train_config "bs_16_2000_steps" \
 --subset_n_samples "30" \
 --seed_override "0" \
 --note "test"

Linear Probing

For linear probing, we recommend using mRNABench to evaluate Orthrus and other models. mRNABench is a comprehensive benchmarking framework that evaluates the embedding quality of genomic foundation models on mRNA-specific tasks. It provides a standardized catalogue of datasets and training split logic, enabling fair comparison across different models.

Alternatively, linear probing can still be accomplished using the Orthrus repository with the following command:

python linear_probe_eval.py \
--run_name="orthrus_v1_6_track" \
--model_name="epoch=6-step=20000.ckpt" \
--model_repository="../../hf_orthrus/models/" \
--npz_dir="/data1/morrisq/ian/rna_contrast/linear_probe_data2" \
--verbose 1 \
--n_seeds 1 \
--n_tracks 6 \
--load_state_dict=true \
--full_eval \
--homology_split=true 
@article{orthrus_fradkin_shi_2024,
  title = {Orthrus: Towards Evolutionary and Functional RNA Foundation Models},
  url = {http://dx.doi.org/10.1101/2024.10.10.617658},
  DOI = {10.1101/2024.10.10.617658},
  publisher = {Cold Spring Harbor Laboratory},
  author = {Fradkin,  Philip and Shi,  Ruian and Isaev,  Keren and Frey,  Brendan J and Morris,  Quaid and Lee,  Leo J and Wang,  Bo},
  year = {2024},
  month = oct 
}
Downloads last month

-

Downloads are not tracked for this model. How to track
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support