|
|
--- |
|
|
language: |
|
|
- en |
|
|
license: mit |
|
|
pipeline_tag: feature-extraction |
|
|
library_name: transformers |
|
|
--- |
|
|
|
|
|
# BarcodeBERT for Taxonomic Classification |
|
|
|
|
|
A pre-trained transformer model for inference on insect DNA barcoding data, as presented in the paper [BarcodeBERT: Transformers for Biodiversity Analysis](https://huggingface.co/papers/2311.02401). |
|
|
|
|
|
Code: https://github.com/bioscan-ml/BarcodeBERT |
|
|
|
|
|
[Colab](https://colab.research.google.com/drive/1MUEQVHIOX2ks7tLsMoQtNlbvsbSuYgs1) |
|
|
|
|
|
To use **BarcodeBERT** as a feature extractor: |
|
|
|
|
|
```python |
|
|
from transformers import AutoTokenizer, BertForTokenClassification |
|
|
|
|
|
# Load the tokenizer |
|
|
tokenizer = AutoTokenizer.from_pretrained( |
|
|
"bioscan-ml/BarcodeBERT", trust_remote_code=True |
|
|
) |
|
|
|
|
|
# Load the model |
|
|
model = BertForTokenClassification.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True) |
|
|
|
|
|
# Sample sequence |
|
|
dna_seq = "ACGCGCTGACGCATCAGCATACGA" |
|
|
|
|
|
# Tokenize |
|
|
input_seq = tokenizer(dna_seq, return_tensors="pt")["input_ids"] |
|
|
|
|
|
# Pass through the model |
|
|
output = model(input_seq.unsqueeze(0))["hidden_states"][-1] |
|
|
|
|
|
# Compute Global Average Pooling |
|
|
features = output.mean(1) |
|
|
``` |
|
|
|
|
|
## Citation |
|
|
|
|
|
If you find BarcodeBERT useful in your research please consider citing: |
|
|
|
|
|
@misc{arias2023barcodebert, |
|
|
title={{BarcodeBERT}: Transformers for Biodiversity Analysis}, |
|
|
author={Pablo Millan Arias |
|
|
and Niousha Sadjadi |
|
|
and Monireh Safari |
|
|
and ZeMing Gong |
|
|
and Austin T. Wang |
|
|
and Scott C. Lowe |
|
|
and Joakim Bruslund Haurum |
|
|
and Iuliia Zarubiieva |
|
|
and Dirk Steinke |
|
|
and Lila Kari |
|
|
and Angel X. Chang |
|
|
and Graham W. Taylor |
|
|
}, |
|
|
year={2023}, |
|
|
eprint={2311.02401}, |
|
|
archivePrefix={arXiv}, |
|
|
primaryClass={cs.LG}, |
|
|
doi={10.48550/arxiv.2311.02401}, |
|
|
} |