DOC: Update example to use BertForTokenClassification instead of AutoModel

README.md

@@ -13,7 +13,7 @@ A pre-trained transformer model for inference on insect DNA barcoding data.
 To use **BarcodeBERT** as a feature extractor:
 
 ```python
-from transformers import AutoTokenizer, AutoModel
+from transformers import AutoTokenizer, BertForTokenClassification
 
 # Load the tokenizer
 tokenizer = AutoTokenizer.from_pretrained(
@@ -21,7 +21,7 @@ tokenizer = AutoTokenizer.from_pretrained(
 )
 
 # Load the model
-model = AutoModel.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
+model = BertForTokenClassification.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
 
 # Sample sequence
 dna_seq = "ACGCGCTGACGCATCAGCATACGA"