| | --- |
| | metrics: |
| | - matthews_correlation |
| | - f1 |
| | tags: |
| | - biology |
| | - medical |
| | --- |
| | # DNABERT-2 (modified) |
| |
|
| | Modified to configure the use of flash attention. |
| |
|
| | ## Below are works from the original repository and jaandoui. |
| |
|
| | This version of DNABERT2 has been changed to be able to output the attention too, for attention analysis. |
| |
|
| | **To the author of DNABERT2, feel free to use those modifications.** |
| |
|
| | Use ```--model_name_or_path jaandoui/DNABERT2-AttentionExtracted``` instead of the original repository to have access to the attention. |
| |
|
| | Most of the modifications were done in Bert_Layer.py. |
| | It has been modified especially for fine tuning and hasn't been tried for pretraining. |
| | Before or next to each modification, you can find ```"JAANDOUI"``` so to see al modifications, search for ```"JAANDOUI"```. |
| | ```"JAANDOUI TODO"``` means that if that part is going to be used, maybe something might be missing. |
| | |
| | Now in ```Trainer``` (or ```CustomTrainer``` if overwritten) in ```compute_loss(..)``` when defining the model: |
| | ```outputs = model(**inputs, return_dict=True, output_attentions=True)``` |
| | activate the extraction of attention: ```output_attentions=True``` (and ```return_dict=True``` (optional)). |
| | You can now extract the attention in ```outputs.attentions``` |
| | Note than the output has a third dimension, mostly of value 12, referring to the layer ```outputs.attentions[-1]``` refers to the attention of the last layer. |
| | Read more about model outputs here: https://huggingface.co/docs/transformers/v4.40.2/en/main_classes/output#transformers.utils.ModelOutput |
| | |
| | I'm also not using Triton, therefore cannot guarantee that it will work with it. |
| | |
| | I also read that there were some problems with extracting attention when using Flash Attention here: https://github.com/huggingface/transformers/issues/28903 |
| | Not sure if that is relevant for us, since it's about Mistral models. |
| | |
| | I'm still exploring this attention, please don't take it as if it works 100%. I'll update the repository when I'm sure. |
| | |
| | The official link to DNABERT2 [DNABERT-2: Efficient Foundation Model and Benchmark For Multi-Species Genome |
| | ](https://arxiv.org/pdf/2306.15006.pdf). |
| | |
| | READ ME OF THE OFFICIAL DNABERT2: |
| | We sincerely appreciate the MosaicML team for the [MosaicBERT](https://openreview.net/forum?id=5zipcfLC2Z) implementation, which serves as the base of DNABERT-2 development. |
| | |
| | DNABERT-2 is a transformer-based genome foundation model trained on multi-species genome. |
| | |
| | To load the model from huggingface: |
| | ``` |
| | import torch |
| | from transformers import AutoTokenizer, AutoModel |
| | |
| | tokenizer = AutoTokenizer.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True) |
| | model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True) |
| | ``` |
| | |
| | To calculate the embedding of a dna sequence |
| | ``` |
| | dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC" |
| | inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"] |
| | hidden_states = model(inputs)[0] # [1, sequence_length, 768] |
| | |
| | # embedding with mean pooling |
| | embedding_mean = torch.mean(hidden_states[0], dim=0) |
| | print(embedding_mean.shape) # expect to be 768 |
| | |
| | # embedding with max pooling |
| | embedding_max = torch.max(hidden_states[0], dim=0)[0] |
| | print(embedding_max.shape) # expect to be 768 |
| | ``` |