text stringlengths 8 5.77M |
|---|
Background
==========
The transforming growth factor β (TGFβ) superfamily is involved in many developmental decisions from primitive animals such as *Cnidaria*and sponges to higher animals \[[@B1]-[@B4]\]. The core of the signaling pathway has been elucidated in the last few years and reveals a rather simple signaling cascade. These ligands transmit the TGFβ signal by binding transmembrane receptor serine-threonine kinases (RSKs). Once ligand is bound, the type II RSK phosphorylates the type I RSK in a cytoplasmic region rich in glycine and serine residues (GS domain). Phosphorylation activates the type I RSK and enables it to phosphorylate downstream mediators referred to as the Smads. Once the receptor-regulated Smads (R-Smads) are phosphorylated, they are able to physically interact with another subset of Smads identified as the common Smads (Co-Smads) and translocate to the nucleus where they affect target gene transcription \[[@B3],[@B5]-[@B7]\].
Of the five TGFβ-like ligands in *C. elegans*, *dbl-1*(*[d]{.ul}pp*and [B]{.ul}MP-[l]{.ul}ike) and *daf-7*([da]{.ul}uer [f]{.ul}ormation abnormal) are the best characterized. *dbl-1*transmits the Sma/Mab ([s]{.ul}mall/[m]{.ul}ale tail [ab]{.ul}normal) pathway signal while *daf-7*regulates formation of dauer, an alternative life stage entered in response to low food or high population density \[[@B8]-[@B10]\]. These two pathways share a common type II RSK, *daf-4*. *daf-4*animals are small, exhibit fused male tail sensory rays and constitutively form dauer larvae \[[@B11],[@B12]\]. Mutants of all other known components of the dauer pathway are either dauer constitutive (*daf-c*) like *daf-7*or dauer defective (*daf-d*) \[[@B3],[@B13]\]. Based on the Sma/Mab phenotypes of *daf-4*mutants, *sma-2*, *sma-3*, *sma-4*and *sma-6*were identified and cloned. *sma-2*, *sma-3*and *sma-4*encode Smads while *sma-6*encodes a type I RSK \[[@B12],[@B14]\]. The Sma/Mab signal is transmitted upon binding of the ligand, DBL-1, to the type II and type I RSKs, DAF-4 and SMA-6 respectively. Once stimulated, SMA-6 activates the Smads, SMA-2, -3 and -4, causing them to affect target gene transcription.
Although the core TGFβ pathway is known, additional components that may further refine signaling remain to be identified. To address this issue, we previously conducted a genetic screen for Sma animals and isolated several new mutants, including *kin-29*(also known as *sma-11*) \[[@B15]\]. We find that *kin-29*is able to suppress the long mutant phenotype generated by animals over-expressing the ligand *dbl-1*. Additionally, we observe that *lon-1*, a Sma/Mab pathway target gene whose product shows homology to proteins of the cysteine-rich secretory protein (CRISP) family, is up-regulated in *kin-29(lf)*mutant animals in a similar manner to that seen in a *sma-6*null mutant background \[[@B16],[@B17]\]. *kin-29*mutant animals are also developmentally delayed and this defect is partially suppressed by loss of *lon-1*function. These data suggest that *kin-29*genetically interacts with Sma/Mab pathway signaling downstream of *dbl-1*but upstream of *lon-1*.
Several of the Sma/Mab pathway components have been shown to function in the hypodermis to regulate body size morphogenesis. *sma-3*, *sma-6*and *lon-1*, when specifically expressed in the hypodermis, have been shown to rescue the body size defects associated with each of these loss-of-function mutations \[[@B15]-[@B18]\]. The Sma/Mab ligand DBL-1 is primarily expressed in neuronal tissues \[[@B8]\]. It is likely that DBL-1 is secreted from these tissues and targets the hypodermis in order to regulate body size formation. We find that tissue-specific expression of *kin-29(+)*in the hypodermis rescues the small body size phenotype of *kin-29(lf)*animals. In addition, we find that *kin-29(+)*, when expressed in the same tissues as *dbl-1*, also rescues the small body size phenotype of *kin-29(lf)*animals. Therefore, *kin-29*can function in both hypodermal and neuronal tissues with known Sma/Mab pathway components to regulate body size morphogenesis.
In order to understand how *kin-29*functions in Sma/Mab pathway signaling, we undertook the molecular characterization of *kin-29*. It is encoded by F58H12.1, which has an N-terminal kinase domain and a novel C-terminal region. Its kinase domain makes it a distant member of the EMK kinase family, which modulates microtubule organization. *kin-29*has a role in olfaction \[[@B19]\], suggesting that the ability to sense environmental signals influences body size regulation.
Results
=======
*kin-29*encodes a serine threonine kinase
-----------------------------------------
Mutations in members of the Sma/Mab TGFβ-like signaling pathway result in animals that are phenotypically smaller than wild-type. These Sma/Mab mutants are approximately 70% the size of their wild-type counterparts \[[@B8],[@B9],[@B11],[@B12],[@B14]\]. Based on this small body size phenotype, we set out to isolate additional loci which when mutated resulted in small animals. From an F2 EMS screen of N2 wild-type animals, we identified *kin-29(wk61*) \[[@B15]\]. *kin-29(lf)*animals are small, like known Sma/Mab pathway components (Table [1](#T1){ref-type="table"}). However, unlike the known pathway components, *kin-29*does not possess male tail ray fusions or crumpled spicules, suggesting that *kin-29*is involved in regulation of body size morphogenesis but not male tail development.
######
Body size measurements of *kin-29*alleles
Genotype\* Perimeter (mm)\*\* %N2 n
---------------------------- -------------------- ------ ----
N2 2.60 ± 0.14 45
*sma-6(wk7)* 1.85 ± 0.20 71% 46
*kin-29(wk61)* 1.97 ± 0.19 76% 41
*kin-29(oy38)* 2.20 ± 0.18 85% 42
*kin-29(oy39)* 1.98 ± 0.22 76% 38
*lon-1(wk50)* 2.72 ± 0.19 105% 48
*lon-1(wk50);kin-29(wk61)* 2.49 ± 0.17 96% 35
\* All animals were measured 48 hours after L4.
\*\* Data are means ± std.
In comparison to N2, all animals are significantly different in size (p \< 0.0001).
*kin-29*was mapped to linkage group X between *unc-2*and *fax-1*. Appropriate YACs, cosmids, and DNA fragments were used to rescue the gene. The longest cDNA available, y293c7 (Y. Kohara, National Institute of Genetics), spanning this open reading frame was obtained. Based on the ORF sequenced from y293c7, a 10 kb region of genomic DNA containing *kin-29*was fused in frame with GFP. This construct, *kin-29p::kin-29 gfp*, was then injected into *kin-29*mutant animals and conferred rescue (Table [3](#T3){ref-type="table"}).
######
Rescue of *kin-29(wk61)*by promoter fusion constructs
Genotype\* Perimeter (mm)\*\* %N2 n
------------------------------------------------ -------------------- ----- ----
*kin-29(wk61)* 2.06 ± 0.13 79% 36
*kin-29(wk61);kin-29p::kin-29:gfp* 2.60 ± 0.12 99% 33
*kin-29(wk61);elt-3p::kin-29:gfp (hypodermal)* 2.41 ± 0.19 92% 35
*kin-29(wk61);dbl-1p::kin-29:gfp (neuronal)* 2.47 ± 0.18 94% 35
\* All animals were measured 48 hours after L4.
\*\* Data are means ± std.
In comparison to *kin-29(wk61)*, all animals are significantly different in size from control (p \< 0.0001).
We searched for molecular lesions in *kin-29(wk61)*. Genomic DNA spanning the entire coding region of *kin-29*was isolated from *kin-29(wk61)*animals, sequenced and compared to sequence obtained from EST y293c7. Sequence analysis reveals *kin-29*to consist of 16 exons that encode a protein of 822 amino acids in length (Fig. [1](#F1){ref-type="fig"}). A mutation found in the eighth exon of *kin-29(wk61)*changes a single nucleotide from cytosine to thymine. This change results in a premature termination codon and a truncated protein of 273 amino acids. While this work was in progress, *kin-29*was cloned as a modifier of olfactory gene expression \[[@B19]\]. Two alleles from that study, *kin-29(oy38)*and *kin-29(oy39)*, result from a 526 bp deletion, which is replaced by sequence found on LG X, and a missense mutation in the kinase domain, respectively \[[@B19]\].
{#F1}
*kin-29*encodes a predicted serine-threonine kinase. Within its kinase domain, KIN-29 is homologous to members of the [E]{.ul}LKL [m]{.ul}otif [k]{.ul}inase (EMK) family and salt-induced kinase family (\~66% identity)(Fig. [2A,2B](#F2){ref-type="fig"}). Members of the EMK family include *C. elegans*PAR-1, *Drosophila*PAR-1, *S. pombe*KIN-1, and mammalian MARK ([m]{.ul}icrotubule-[a]{.ul}ffinity-[r]{.ul}egulating [k]{.ul}inase) \[[@B20]-[@B23]\]. EMK family members have been shown to affect cell polarity as well as microtubule stability \[[@B20],[@B22],[@B23]\]. The kinase domain of KIN-29 also shows significant homology salt-induced kinases \[[@B24],[@B25]\]. Salt induced kinases (SIK) were cloned from subtractive libraries derived from genes expressed in the adrenal glands after high salt diets in rat. The biological function of these kinases is not clear. The C-terminal domain of KIN-29 is more divergent and shows little homology with domains in other kinases.
{#F2}
KIN-29 encodes a functional kinase
----------------------------------
In order to assess whether KIN-29 acts as a functional kinase, 293T cells were transfected with either C-terminal FLAG-tagged full length *kin-29*or various constructs, which truncate the carboxy terminal region of the protein. As controls, both the kinase active and kinase inactive mammalian TGFβ type II RSK were also transfected. Lysates were immuniprecipitated with anti-Flag antibody and *in vitro*kinase assays performed. We observe that full length KIN-29 is capable of autophophorylation (Fig. [3](#F3){ref-type="fig"}). However, when we truncate the C-terminal domain, we find that the kinase domain, along with the ubiquitin-associated domain (UBA) or the kinase domain (with or without lysine 45 changed to arginine) are no longer capable of autophosphorylation. Lysine 45 is a conserved residue essential for catalytic function in kinases. This indicates that the C-terminal domain is required for autophosphorylation. The C-terminal domain could be required for kinase activity or it may simply be the substrate for autophosphorylation. Lanjuin and colleagues have previously shown that animals possessing a mutation (oy39) in the kinase domain have a small body size \[[@B19]\], indicating that the kinase domain is required for proper body size.
{#F3}
Placement of *kin-29*in the Sma/Mab pathway
-------------------------------------------
Epistasis between *kin-29*and *dbl-1*or *lon-1*was examined in order to determine the relationship between *kin-29*and Sma/Mab pathway signaling. Double mutant analysis between several of the known pathway components and *lon-1*results in animals that are long (Lon) \[[@B16],[@B17]\], making it the most downstream gene in the pathway. We examined *lon-1(wk50); kin-29(wk61)*double mutants to determine whether *kin-29*can be placed in a similar position in the pathway as the current Sma/Mab components. We find that double mutants are longer than the single mutants of *kin-29(wk61)*, suggesting that *lon-1*suppresses the Sma phenotype of *kin-29*(Table [1](#T1){ref-type="table"}).
Next, we examined the relationship between *dbl-1*and *kin-29*. Over-expression of *dbl-1*results in Lon animals, suggesting more ligand causes an increase in the TGFβ signal output. When *dbl-1*over-expressing animals are crossed into *sma-2*, *sma-3*, *sma-4*, *sma-6*or *daf-4*mutant backgrounds, the Lon phenotype is suppressed \[[@B8]\] and the animals are Sma. This places the type I receptor and the Smads downstream of the ligand, *dbl-1*. When *dbl-1*is over-expressed in a *kin-29(wk61)*background, the animals are also Sma (Table [2](#T2){ref-type="table"}). Additionally, using a weak allele of *sma-6*, we generated a *sma-6(e1482)unc4(e120); kin-29(wk61)*double mutant and examined its body size. We find that these animals are similar in size to that observed for *sma-6(e1482)unc4(e120)*mutants alone suggesting that *sma-6*and *kin-29*may not function in parallel pathways (Table [2](#T2){ref-type="table"}). This indicates that *kin-29*behaves in a manner consistent with known Sma/Mab pathway signaling molecules and is likely to function within this signaling cascade.
######
*kin-29*suppresses the *dbl-1*over-expression phenotype
Genotype\* Perimeter (mm)\*\* %N2 n
----------------------------------------------- -------------------- ------ ----
*kin-29(wk61)1, 2)* 1.90 ± 0.15 73% 42
*ctIs40 \[pTG96(sur-5::gfp)\]dbl-1(+)2* 2.76 ± 0.12 106% 42
*kin-29(wk61); ctIs40 \[pTG96(sur-5::gfp)\]1* 1.84 ± 0.20 71% 51
*sma-6(e1482) unc-4(e120)3* 1.47 ± 0.13 57% 37
*sma-6(e1482) unc-4(e120);kin-29(wk61)3* 1.48 ± 0.17 57% 38
\* All animals were measured 48 hours after L4.
\*\* Data are means ± std.
1-Animals are not significantly different from each other (p \> 0.05).
2-Animals are significantly different from each other (p \< 0.0001)).
3-Animals are not significantly different from each other (p \> 0.05).
Since *lon-1*is genetically downstream of the Sma/Mab pathway signaling, we examined whether *lon-1*mRNA levels are altered in *kin-29*mutants. We have previously shown that *lon-1*mRNA levels are up-regulated in *sma-6(wk7)*mutants and down-regulated in animals that over-express *dbl-1*\[[@B16],[@B17]\]. To test whether *lon-1*mRNA is regulated in *kin-29*animals, we examined *lon-1*mRNA levels in a *kin-29(wk61)*background (Fig. [4](#F4){ref-type="fig"}). *kin-29(wk61)*animals show an increase in the expression level of the *lon-1*transcript. This increase is comparable to that previously observed in *sma-6(wk7)*mutant animals \[[@B16]\].
{#F4}
*kin-29*has been shown to affect the expression of a subset of olfactory receptor genes \[[@B19]\]. Several olfactory receptors expressed in AWB, ASH and ASK sensory neurons were either reduced or up-regulated in the *kin-29*mutant background. Given that *kin-29*affects mRNA levels of these olfactory receptors, we asked whether *kin-29*alters the mRNA expression levels of the Sma/Mab components. We examined *sma-6*mRNA expression (the type I receptor) in a *kin-29*background and find no changes in expression levels of *sma-6*mRNA. Because *kin-29*and *dbl-1*expression patterns overlap, we examined mRNA expression levels of *dbl-1*in a *kin-29*mutant background. We find that *kin-29*does not affect *dbl-1*mRNA expression levels (data not shown).
*kin-29*expression is diverse and dynamic
-----------------------------------------
In efforts to elucidate the function of *kin-29*in TGFβ signaling, we examined its expression pattern. A construct consisting of the *kin-29*promoter and coding region fused in frame to *gfp*was injected into *kin-29(wk61)*animals. As described above, this construct was able to rescue the small body size phenotype of *kin-29(wk61)*to wild-type (Table [3](#T3){ref-type="table"}). Upon examination of the expression pattern, we observe KIN-29 to be localized to various tissue types (Fig. [5](#F5){ref-type="fig"}). Most notably, KIN-29 is seen in several neuronal cells in the head and tail throughout the course of development. Several of the sensory neurons found in the head express KIN-29, including ASH, AFD and ASI \[[@B19]\]. Additional neuronal staining is observed in both CAN cells and the ventral nerve cord (Fig. [5A](#F5){ref-type="fig"}). We find expression both in pharyngeal and body wall muscle (Fig. [5B](#F5){ref-type="fig"}). During the L1, L3 and L4 stages, we see expression throughout the intestine both in the nuclei and to a lesser extent in the cytoplasm (Fig. [5C](#F5){ref-type="fig"}) and in cells in the tail (Fig. [5D](#F5){ref-type="fig"}). This intestinal expression is rarely seen in later stages of development. Occasionally, expression is seen in vulval muscles as well.
{#F5}
Hypodermal and neuronal expression of *kin-29*rescues the small body size phenotype
-----------------------------------------------------------------------------------
In order to determine where *kin-29*activity is required, we examined the body size of *kin-29(lf)*animals transformed with constructs expressing *kin-29*in specific tissues. *elt-3*and *rol-6*promoters drive expression in the hypodermis, while *dbl-1*drives expression in a subset of neurons. All three promoters were fused to *kin-29*genomic DNA sequences. Each of these constructs was injected into *kin-29(wk61)*animals and transgenic strains were analyzed for body size. Several of the Sma/Mab pathway components, *sma-3*, *sma-6*, and *lon-1*, when specifically expressed in hypodermal tissues, rescue the body size defects associated with loss-of-function mutations in each of these genes \[[@B16]-[@B18],[@B26]\]. Using the *rol-6*and *elt-3*promoters to drive hypodermal expression of the genomic region of *kin-29*results in rescue of the small body size phenotype of *kin-29(wk61*). Since KIN-29 expression overlaps that of the Sma/Mab pathway ligand DBL-1 in the amphid neurons, ventral nerve cord, CAN cells and body wall muscle, we reasoned that KIN-29 and DBL-1 may function together in the same tissues to regulate body size morphogenesis \[[@B8],[@B9]\]. We find that *kin-29*under the control of the *dbl-1*promoter rescues the small body size phenotype of *kin-29(wk61)*animals (Table [3](#T3){ref-type="table"}). These data suggest that KIN-29 functions in neuronal and hypodermal tissues to regulate body size morphogenesis (Table [3](#T3){ref-type="table"} and data not shown).
*kin-29*mutants are small, have delayed growth rates, and reduced brood sizes
-----------------------------------------------------------------------------
The growth properties of Sma/Mab animals differ from other small animals. For example, mutants of the spectrin gene, *sma-1*, which have been shown to affect embryonic elongation but not thought to be involved in TGFβ signaling, are approximately 50% the size of wild-type animals at hatching \[[@B27]\]. This is in contrast to the body size of L1 animals mutant in known Sma/Mab pathway components. For example, *sma-3*, *sma-6*, *dbl-1*, and *lon-1*are indistinguishable in length from wild-type L1 animals at hatching \[[@B26]\]. This suggests that the Sma/Mab pathway components are defective in post-embryonic rather than embryonic stages of development. Sma/Mab pathway mutant animals grow at a slower rate as development progresses through the later larval stages into adulthood \[[@B26]\]. There is no defining switch during development that regulates body growth. We tested whether *kin-29*mutations cause body size defects in a similar manner to Sma/Mab pathway mutations or whether *kin-29*possessed embryonic defects. We examined the body size of *kin-29*mutant animals in comparison to *sma-6(wk7)*and N2 animals at hatching and then at 24 hour intervals to 96 hours. We find that all three alleles of *kin-29*are similar in length at the L1 stage to N2 animals. This is also what we observe for *sma-6(wk7)*which suggests that *kin-29*delays growth post-embryonically, as do Sma/Mab pathway components (Fig. [6](#F6){ref-type="fig"}). The Sma body size of *kin-29*is therefore due to a delay in development in later larval stages.
{#F6}
In addition, we find that *kin-29*grows more slowly than N2 and Sma/Mab pathway mutants do. Animals hatched and grown at 20°C were scored based on their developmental stage after 72 hours. We find that 99% of wild-type animals are adults at this time point, while only 2% of *kin-29(wk61)*animals are adults (Table [4](#T4){ref-type="table"}). Lanjuin and colleagues report a similar observation; 98% of wild-type animals hatched and grown at 25°C for 3 days were adults in comparison to approximately 24% of *kin-29(oy38)*animals \[[@B19]\]. We asked if *lon-1(lf)*could suppress the developmental delay characteristic of *kin-29(wk61)*animals (Table [4](#T4){ref-type="table"}). *lon-1(wk50)*mutants on their own show a slight delay in development, but which is distinguishable from the Sma/Mab mutants. In the double mutant *lon-1(wk50);kin-29(wk61)*, we find that the developmental defect of *kin-29(wk61)*can be partially suppressed by *lon-1(wk50)*. This result is consistent with our conclusion that *lon-1*is genetically downstream of *kin-29*.
######
*lon-1*partially suppresses the developmental defect of *kin-29(wk61)*
\% Adult animals \% Adults 4 animals
---------------------------- ------------------ ---------------------
N2 99 (185) 99 (185)
*lon-1(wk50)* 64 (245) 80 (245)
*kin-29(wk61)* 2 (475) 43 (475)
*lon-1(wk50);kin-29(wk61)* 40 (202) 63 (202)
Number of animals scored is shown in parentheses.
We observed that Sma/Mab pathway mutants have a reduced brood size. In addition to the developmental defects, *kin-29(wk61)*also has a reduced brood size (Table [5](#T5){ref-type="table"}). Like *sma-6(lf)*and *lon-1(lf)*, *kin-29(wk61)*shows a brood size approximately 30% the size of that seen in wild-type animals. We find that *sma-6(wk7)*and *lon-1(wk50)*along with *kin-29(oy38)*and *kin-29(oy39)*have a reduction in brood size as well. Although brood size is affected, embryonic survival rate appears to be normal.
######
Brood size analysis of *kin-29*alleles
Genotype \% of wild-type brood size
---------------- ----------------------------
N2 100 (270)
*sma-6(wk7)* 64 (172)
*lon-1(wk50)* 81 (219)
*kin-29(wk61)* 32 (86)
*kin-29(oy38)* 81 (218)
*kin-29(oy39)* 80 (217)
Number of eggs scored for each genotype is shown in parentheses.
*kin-29*affects dauer pathway signaling
---------------------------------------
Several components of the Sma/Mab pathway have been shown to genetically interact with members of the dauer pathway \[[@B9],[@B14]\]. The dauer-constitutive (Daf-c) phenotype of the type I receptor *daf-1*is enhanced by mutations in *sma-6*. At 15°C, *daf-1*mutant strains exhibit a very weak dauer-constitutive phenotype. However, *sma-6(wk7); daf-1(m40)*mutants show a 50% increase in the number of dauered animals at 15°C \[[@B14]\]. In addition, double mutants between the ligand *daf-7(e1372)*and either *dbl-1(kk3)*or *sma-2(e502)*also have been shown to enhance the weak Daf-c phenotype of *daf-7(e1372)*at 20°C \[[@B9]\]. These data suggest that there is some crosstalk between the Sma/Mab pathway and the TGFβ-like *daf-7*dauer pathway.
Based on these findings, we examined the effects of the *kin-29*alleles on dauer formation. Double homozygotes were made between *daf-7(e1372)*and each of the three alleles of *kin-29*. Genetic interactions were analyzed at 15°C, 20°C and 25°C. For comparison, *daf-7(e1372)*mutants raised at 25°C show almost 100% dauered animals compared to no dauered animals at 15°C or 20°C. At 15°C and 20°C, *kin-29(oy38)*is able to enhance dauer formation of *daf-7(e1372)*similar to the enhancement observed in *sma-6(wk7); daf-7(e1372)*mutant animals (Fig. [7A,B](#F7){ref-type="fig"}). We also see that *kin-29(wk61)*shows a weak enhancement of dauer formation while the missense mutant *kin-29(oy39)*shows no genetic interaction at all. These results are consistent with genetic interactions previously observed between Sma/Mab and dauer pathway components. However, at 25°C, we find that *kin-29*can also suppress the constitutive dauer formation of *daf-7(e1372)*. *kin-29(wk61)*and *kin-29(oy39)*are able to suppress the Daf-c defects of *daf-7(e1372)*while *kin-29(oy38)*does not (Fig. [7C](#F7){ref-type="fig"}).
{#F7}
Discussion
==========
KIN-29 functions in hypodermal and neuronal tissues to regulate body size
-------------------------------------------------------------------------
Expression of the Sma/Mab pathway components in the hypodermis is sufficient to rescue the body size defects seen in mutants. Specific expression of *sma-3*, *sma-6*and *lon-1*in the hypodermal tissues has been shown to restore body length in these respective mutant animals \[[@B16]-[@B18],[@B26]\]. This implies that body size is regulated largely via hypodermal function. Our work presented here further supports that *C. elegans*body size is regulated in hypodermal tissues. When the genomic region of *kin-29*is specifically expressed in the hypodermis, under the control of the *elt-3*and *rol-6*promoters, we see that the small body size phenotype of *kin-29(wk61)*is partially rescued. Although KIN-29 functions in the hypodermis to regulate body size morphogenesis, we do not see KIN-29::GFP, under the control of its own promoter, expressed in the hypodermal tissues, suggesting that KIN-29 expression levels are relatively low in these tissues.
DBL-1 is expressed primarily in neurons, which includes several amphid and pharyngeal neurons, ventral nerve cord, and CAN cells \[[@B8],[@B17]\]. Since KIN-29 expression closely parallels that seen for DBL-1, we also examined whether the *dbl-1*promoter driving *kin-29*genomic sequences is capable of rescuing the body size defect of *kin-29(wk61)*. When *kin-29*is expressed in the same tissues as *dbl-1*, we observe partial rescue of the small body size defect seen in *kin-29(lf)*animals. It has been demonstrated that *kin-29*under the control of the *unc-14*and *odr-4*promoters is able to rescue the body size defect of *kin-29*mutant animals \[[@B19]\]. *unc-14*is expressed in all neuronal cells while *odr-4*is expressed in a subset of the sensory neurons including the AFD neurons where DBL-1 and KIN-29 are also expressed \[[@B28],[@B29]\]. This suggests that neuronal expression of KIN-29 is also sufficient to regulate body size morphogenesis. Determining how this occurs will require further study.
*kin-29*is a tissue specific factor that affects the Sma/Mab pathway
--------------------------------------------------------------------
Mutations in the ligand *dbl-1*, the receptors *sma-6*and *daf-4*, and Smads *sma-2*, *sma-3*and *sma-4*, result in animals that are approximately 70% the size of wild-type animals \[[@B8],[@B9],[@B11],[@B12],[@B14]\]. Additional defects are seen as male tail ray fusions and crumpled spicules. However, the negatively regulated Sma/Mab target gene *lon-1*, suppresses the small body size phenotype of *sma-2*, *sma-3, sma-4*and *sma-6*but not the male tail defects observed in each of these loss-of-function mutants \[[@B16],[@B17]\]. This implies that Sma/Mab pathway signaling may branch downstream of the Smads to regulate a subset of genes that control body size morphogenesis while others specifically affect male tail development. We find that *kin-29(lf)*animals do not posses ray fusions or crumpled spicules and may exert its effects upstream of this branch point in the signaling pathway. In addition, we see that *lon-1*is genetically downstream of *kin-29*and that *kin-29*suppresses the Lon phenotype associated with over expression of *dbl-1*. Taken together, this data suggests that *kin-29*may function in tissues with Sma/Mab pathway components to regulate body size but not male tail formation.
The EMK kinase family and *kin-29*
----------------------------------
Members of the EMK family have been shown to affect cell polarity and microtubule stability. Mammalian MARK phosphorylates microtubule associated proteins and has been shown to destabilize microtubules when over expressed in CHO cells \[[@B23]\]. *Drosophila*PAR-1 influences the cytoskeletal organization of the oocyte \[[@B21]\]. In wild-type *Drosophila*oocytes, the microtubules are arranged in an anterior to posterior gradient with no microtubules observed at the most posterior region of the oocyte. Microtubules in *Drosophila par-1*mutants, however, are organized around the cortex of the oocyte. In this reorganization, microtubules are now observed in the most posterior region of the oocyte. In addition, posterior localization of *Drosophila oskar*is dependent on microtubule polarity. *oskar*is mislocalized in *dpar-1*mutants, further supporting the involvement of *dpar-1*in regulating microtubule dynamics. *C. elegans*PAR-1 regulates the early asymmetrical cell divisions of the embryo but has not been shown to have any affects on the microtubule network \[[@B20]\]. KIN-29 only shows homology to the EMK family members within its N-terminal kinase domain, indicating that KIN-29 is a more distantly related member of the EMK family. However, lack of homology between the C-termini of KIN-29 and EMK family proteins suggests that KIN-29 activity may diverge from that observed for members of this family.
How does *kin-29*function?
--------------------------
We have observed that KIN-29 functions in both neuronal and hypodermal tissues. How *kin-29*functions in each of these tissues to regulate body size morphogenesis is unclear. Since *kin-29*encodes a kinase it might act to regulate the activities of a variety of molecules that affect Sma/Mab pathway signaling. Recently, it has been shown that several olfactory receptors are misexpressed in *kin-29(lf)*animals, suggesting that KIN-29 may regulate proper expression levels of various genes \[[@B19]\]. One model is that KIN-29 phosphorylates a transcription factor and/or co-factor, which leads to the transcriptional mis-regulation of some component important for Sma/Mab pathway signaling. We have examined the expression levels of the Sma/Mab ligand *dbl-1*and the type I RSK *sma-6*and do not see any alteration in their levels of expression. However, this does not rule out that other genes that impinge on pathway signaling might be affected at the transcriptional level in neurons and hypodermal cells. Alternatively, KIN-29 may function in microtubule dynamics as described above \[[@B21],[@B23]\]. *kin-29*might therefore influence microtubule (MT) organization in both neuronal and hypodermal tissues and affect Sma/Mab pathway signaling in each of these cell types.
Dauer interactions show that *kin-29(lf)*mutants may not sense external cues properly
-------------------------------------------------------------------------------------
We have shown that KIN-29 helps to promote dauer formation at 25°C and to suppress dauer formation at 15°C. *ttx-3*, a LIM homeobox gene, shows a similar genetic interaction with *daf-7*\[[@B30]\]. Like *kin-29*, *ttx-3*single mutants do not affect dauer formation. *daf-7(e1372); ttx-3(ks5)*double mutant animals show an enhanced Daf-c phenotype of *daf-7*at 15°C while suppressing it at 25°C. In wild-type animals, high temperatures contribute to dauer formation, while lower temperatures suppress dauer formation. *ttx-3*decouples both hot and cold inputs from the dauer pathway, and *kin-29*may act similarly \[[@B30]\]. *tph-1*, a tryptophan hydroxylase involved in the synthesis of serotonin, has been shown to form 10--15 % dauers in the presence of food and this defect is not dependent on temperature which implicates serotonergic signaling in modulating temperature sensitive dauer arrest \[[@B31]\]. *tph-1*is also able to enhance the constitutive dauer phenotype of *daf-7*mutants at 15°C similar to the enhancement observed for *kin-29*\[[@B31]\]. Sze and colleagues did not examine the affects of *tph-1*mutants on *daf-7*at 25°C. They did show, however, that over-expression of *tph-1*in a *daf-7*background at 25°C suppresses the Daf-c phenotype of *daf-7*. This is opposite to what we observe for *kin-29*. Although there are some similarities between *tph-1*and *kin-29*, *tph-1(mg280); kin-29(oy38)*double mutants are synthetic-*daf*at 20°C and 25°C suggesting that *kin-29*may not function in a linear pathway with *tph-1*but rather parallel to *tph-1*\[[@B19]\]. *tph-1*has also been shown to regulate the expression of *daf-7*while *kin-29*does not, suggesting that *kin-29*functions downstream or in parallel to *daf-7*production to affect TGFβ signaling outputs \[[@B19],[@B31]\]. *kin-29*may partly influence dauer formation through a serotonin mediated pathway and a non-serotonin mediated pathway such as the Sma/Mab pathway. The Sma/Mab pathway has been shown to influence dauer formation in combination with the TGFβ-like *daf-7*pathway \[[@B9],[@B14]\].
Starved animals are smaller than animals grown with abundant food supplies, indicating that environmental conditions influence body size morphogenesis \[[@B13]\]. *Drosophila*S6 kinase mutants are smaller in body size due to decreased cell size, which is similar to the body size defect observed in nutrient deprived flies \[[@B32],[@B33]\]. It is thought that S6 kinase alters cell growth in response to nutrients and growth factors by regulating the efficiency of the translational apparatus \[[@B34]\]. Recently, it has been shown that a deletion found within the *C. elegans*homolog of S6 kinase *(sv31)*also results in a reduced body size in the adult stage (J. Friberg and S, Tuck, personal communication). S6 kinase *(sv31)*and *kin-29(lf)*animals also show other similar phenotypes, including reduced brood size and slow growth defects. In addition, fat accumulation is also observed in S6 kinase *(sv31)*animals similar to that observed in dauered animals. Previously, it has been demonstrated that animals that show pheromone hypersensitivity are unable to sense food or temperature signals properly \[[@B35]-[@B39]\]. Recently, *kin-29*mutants have been shown to be hypersensitive to pheromone \[[@B19]\]. In addition, *kin-29*mutants also possess hyperforaging activity in the presence of abundant food supplies \[[@B19]\]. Hyperforaging is normally observed in animals that have been deprived of food. These defects suggest that *kin-29(lf)*mutant animals may not sense food or temperature signals properly and this may influence body size regulation. Taken together, this evidence supports an environmental role in regulation of body size. *kin-29*may function to transmit these environmental cues to the Sma/Mab TGFβ signaling pathway, thereby affecting proper body size morphogenesis.
Conclusion
==========
In this study, *kin-29*was identified in a genetic screen designed to identify modifiers of body size in *C. elegans*. Mutants in *kin-29*result in small animals, and we show that *kin-29*affects the *dbl-1*signaling pathway in *C. elegans*. *kin-29*also modifies phenotypes from a second TGFβ pathway in *C. elegans*, the dauer pathway. Further, we show that KIN-29 does contain kinase activity, and that it is capable of phosphorylating itself. KIN-29 functions in neurons and in the hypodermis to control aspects of body size.
Methods
=======
Strains
-------
*C. elegans*strains were grown using standard methods \[[@B40]\]. *kin-29(wk61)*was used for body size rescue experiments. N2, *sma-6(wk7)*, *kin-29(wk61)*, *kin-29(oy38)*and *kin-29(oy39)*were used in generating growth curves \[[@B19]\]. Interactions between *kin-29*and the dauer pathway were examined using *daf-7(e1372)*. Total RNA used for northern blot analysis was isolated from N2, *sma-6(wk7)*, *sma-3(wk30)*, and *kin-29(wk61*) animals. Epistasis was determined using *kin-29(wk61)*, *lon-1(wk50)*, *dbl-1*over expressing strain *ctIs40 \[pTG96 (sur-5::gfp)\]*, and *lon-1(wk50); kin-29(wk61)*mutant animals.
Isolation of *kin-29(wk61)*
---------------------------
*kin-29(wk61)*was generated from an EMS F2 screen designed to isolate small body size mutants \[[@B15]\]. *kin-29(oy38)*and *kin-29(oy39)*were obtained from P. Sengupta \[[@B19]\].
Cloning of *kin-29*
-------------------
*kin-29(wk61)*was mapped to a small region on the X chromosome between *unc-2*and *fax-1*using genetic markers and deficiencies. The YAC clone Y76F7 from this interval was purified from total yeast DNA using pulse field gel electrophoresis. Injection of YAC Y76F7 into *kin-29(wk61)*rescued the small body size phenotype. Next DNA from cosmids contained within the region of Y76F7 was isolated and transgenic lines were generated. Cosmid F58H12, with one predicted open reading frame (ORF), conferred rescue. ESTs spanning this region were obtained from the *C. elegans*cDNA project (Y. Kohara, National Institute of Genetics). The longest EST, y293c7, was sequenced and shows minor differences from the Genefinder prediction. A 10 kb genomic region fused in frame to GFP, which contained the corresponding sequence from y293c7, was generated by PCR as described below. This *kin-29p::kin-29:gfp*fusion construct rescued the small body size of *kin-29(wk61)*. Genomic DNA from homozygous *kin-29(wk61)*animals was sequenced. Two independent PCR amplifications were generated for each of the three regions spanning the *kin-29*coding region using the following primer sets: CGCTGCGGCCGCTTCAGGCGCCGCCACACCAA/ CGCCGCTGCAGCCGCCGGCAACGAGAATGTA; CGCTGCGGCCGCCCAAGCCAACGTTGCAGGTA/ CGCCGCTGCAGGATAACATGCTCCACTGGCTA; CGCTGCGGCCGCCACCGCACGGGCTAGATATT/ CGCCGCTGCAGCCATTCACTCCGAGCTCCAG. Each PCR product was digested with Not I and Pst I, subcloned into pBluescript SK+, and sequenced.
GFP fusion and tissue-specific expression constructs
----------------------------------------------------
*kin-29p::kin-29 gfp*contains the 10 kb genomic region of *kin-29*fused in frame to *gfp*. This construct was generated using the primers CGCGCTGCAGCAGACCATGGACGT GTTTTAATG and CCGGGGATCCTCCGAGCTCCAGCTTGGATCA, digesting with Pst I and BamH I, and inserting the PCR product into the promoterless vector pPD95.75. *kin-29p::gfp*was generated by cloning 1.4 kb upstream of the predicted *kin-29*ATG into the Hind III and Xba I sites of the GFP insertion vector pPD95.69 (A. Fire, Stanford University). The 1.4 kb piece was generated by PCR using primers CCGGAAGCTTCAGACCATGGACGTGTTTTAATG and CGCGTCTAGATGCAGTGTTGGTGTGGCGGC. Fluorescent GFP expression patterns were examined in larval and adult animals using a Zeiss compound microscope.
*kin-29*genomic DNA was ectopically expressed in specific tissues using the promoters *rol-6*, *elt-3*and *dbl-1*\[[@B8],[@B41],[@B42]\]. The *rol-6*and *elt-3*promoters express in the hypodermis, while the *dbl-1*promoter expresses primarily in neuronal tissues. PCR fragments containing the *elt-3*, *rol-6*and *dbl-1*promoters were generated using the primer sets CCGGAAGCTTGTGACACGTTGTTTCACGGTCAT/ CCGGCTGCAGGAAGTTTGAAATACCAGGTAGCCGA, CCGGCTGCAGCTTCGTATTAGATCTCAGCAGC/ CGCGCGTCGACAGTTAGATCTAAAGATATATCCAG, and CCGGCTGCAGCCCGGAAATCACGACCAAATGGGTC/ CGCGCGTCGACAGTTGAGTTGGGCGCATCAGGCAG respectively. *elt-3*PCR products were digested with Hind III and Pst I while *rol-6*and *dbl-1*products were digested with Pst I and Sal I. 7.7 kb PCR fragments comprising *kin-29*genomic DNA were generated using the primer sets CCCGGGTCGACATGGCTGCGCCACGGCGGCGTAT/CCGGGGATCCTC CGAGCTCCAGCTTGGATCA and CGCGCTGCAGCAGACCATGGACGTGTT TTAATG/ CCGGGGATCCTCCGAGCTCCAGCTTGGATCA and digested with either Sal I and Bam HI or Pst I and Bam HI respectively. Fragments were inserted in frame into the promoterless *gfp*insertion vector pPD95.75. All constructs were injected into *kin-29(wk61)*and transformants were analyzed for body size rescue.
Analysis of body size, brood size and growth rates
--------------------------------------------------
For body size measurements, animals were photographed 48 hours after the L4 stage using a Nikon SMZ-U dissecting microscope set at 3.5× magnification and software from Strata Video Shop (Strata Inc.). Screen dimensions were 680 X 460 pixels. Perimeter analysis was done using Image Pro Plus (Mediacybernetics).
For brood size analyses, single L4 animals were picked to individual plates. Every 12 hours, animals were transferred to new plates to continue egg laying. All eggs were counted. 24 hours later, hatchlings were scored.
For growth rate analyses, animals were synchronized. Gravid animals were treated with a hypochlorite/NaOH solution in order to isolate eggs. The eggs were allowed to hatch in M9 for at least 24 hours. Approximately 30 L1 animals were placed onto plates seeded with OP50. Animals were initially measured at the L1 stage (time zero) and then at 24 hour intervals thereafter. The final time point was taken 96 hours after the L1 stage. Images were obtained and perimeter analyses were performed as described above.
Genetic interactions with *daf-7(e1372)*
----------------------------------------
Double mutants were generated between *daf-7(e1372)*and the following mutants: *sma-6(wk7)*, *kin-29(wk61)*, *kin-29(oy38)*, and *kin-29(oy39)*. Gravid animals were placed onto plates well seeded with OP50 and allowed to lay eggs at room temperature. Animals were removed from plates after approximately 30 -- 50 eggs were laid. Eggs were allowed to hatch at 15°C, 20°C and 25°C. The number of dauered animals was counted and graphed.
Northern blot analysis
----------------------
Total RNA from L4 animals was isolated from N2, *sma-6(wk7)*, *sma-3(wk30)*and *kin-29(wk61)*as described previously (previously described in \[[@B16]\]. Equal amounts (20--30 μg) of total RNA were loaded per lane onto a 1.2% agarose/6.6% formaldehyde gel and resolved by electrophoresis. Samples were transferred to nitrocellulose (Osmonics Inc.) and baked at 80°C for 2 hours. The *lon-1*and *dbl-1*probes were generated by digesting both the *lon-1*cDNA B1.11 and the *dbl-1*cDNA with Eco RI. The *sma-6*probe was generated by PCR using the primer set: GCCGCCTCGAGATGAACATCACCTTTATATTTATTCTC/ GCCGCGGATCCTTAAGATTGATTGGTGGCTGAC. Elongation factor-2 and α-tubulin were used as controls to indicate the amount of total RNA loaded per lane. Before probes were added, the nitrocellulose blots were prehybridized with 1 mM EDTA, 0.5 M NaPO4, pH7.2, 7% SDS, and 1% BSA fraction V (Sigma) for at least 30 minutes. Probes were labeled using the Prime It II kit (Stratagene), added to the prehybridization solution, and incubated overnight at 65°C. Blots were washed (1 mM Na~2~EDTA, 40 mM NaPO~4~, pH 7.2, and 1% SDS) at least three times at 65°C for 15 minutes. Each blot was placed onto a phosphorimager screen for at least 48 hours and analyzed using a Molecular Dynamics Phosphorimager (Amersham Pharmacia Biotech) and IQMacv1.2 software. For each band, intensity levels were corrected for background and normalized according to the loading control (*eft-2*mRNA). Relative transcript levels of the mutants were normalized to the intensity ratio of *lon-1*/*eft-2*of N2.
Kinase assays
-------------
C-terminally tagged Flag *kin-29*constructs were generated in the mammalian vector pRK5. KIN-29-KU contains amino acids 1--354 which includes the kinase domain and UBA domain. KIN-29K contains amino acids 1--300 which includes only the kinase domain and KIN-29K(K45R) contains amino acids 1--300 with a point mutation at position 45 that changes a lysine to an arginine. Cell transfection, immunoprecipitation and kinase assays were carried out as previously described \[[@B41]\]. Human 293T cells at 30% confluency were transfected with each construct (2 μg in 100 mm plates) using LipofectAMINE (Life Technologies, Inc.). Forty eight h after transfection, cells were lysed in the lysis buffer (25 mM Tris-HCl, 300 mM NaCl, and 1% Triton X-100). Lysates were immunoprecipitated using anti-Flag antibody M2 (Sigma), washed 3 times in the same buffer and a final wash in the kinase buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl~2~, and 5 mM CaCl~2~). For *in vitro*kinase assays, the immunoprecipitated protein samples were divided into two aliquots. One aliquot was analyzed by anti-Flag western blotting. The second aliquot was subjected to a kinase autophosphorylation assay at room temperature for 30 min in the kinase buffer containing 5 μCi of ^32^P-ATP (5000 μCi/mmol). The reaction was terminated by adding an equal volume of 2 × SDS sample buffer (80 mM Tris, pH 6.8, 3.2% SDS, 16% glycerol, 200 mM dithiothreitol, 0.02% bromphenol blue), then subjected to SDS-PAGE and visualized by autoradiography.
Authors\' contributions
=======================
L.L.M. performed the majority of experiments, including the mapping and molecular cloning of *kin-29*. S.C initiated the early phases of mapping *kin-29*. A.F.R. analyzed brood size. C.M.Z. and A.F.R. assisted with generating transgenic nematode lines. H.W. and L.C. provided assistance in construct design and scoring of genetic experiments. X.L. and X-H.F. performed the kinase assays. R. W. P. implemented and supervised the project and R.W.P. and L.L.M. prepared the manuscript.
Acknowledgements
================
We thank A. Lanjiun and P. Sengupta for exchanging information and strains prior to publication and for useful discussions, and Y. Kohara for cDNA clones. We are grateful to T. Gumienny and C. Savage-Dunn and for useful comments on the manuscript, and lab members for useful scientific discussions. We also thank J. Friberg and S. Tuck for communicating unpublished work regarding *S6 kinase*. This work was supported by a grant from the NIH to R.W.P. L.L.M. was supported by the American Association of University Women Dissertation Fellowship and by the New Jersey Commission on Cancer Research. C.M.Z. was supported by the New Jersey Commission on Cancer Research and A.F.R. was supported by a Charles and Joanna Busch Predoctoral Fellowship and Biotechnology Training Grant from the NIH. Some mutant nematode strains were obtained from the *Caenorhabditis*Genetics Center, which is supported by the NIH National Center for Research Resources (NCRR).
|
Tembleque a Puerto Rican coconut milk pudding
A few weeks ago I stumbled upon a Hispanic bakery that changed my understanding of what a delicious pudding could be.
When I think pudding, I think mostly of rice- or egg-based recipes made with milk. Rich and sweet, creamy and smooth, these puddings ooze comfort. But this bakery offered something entirely different.
Stacked in one of the shop’s refrigerated cases were small, plastic deli containers of something that resembled white butter sprinkled with cinnamon. It looked solid, far more dense than the puddings I grew up with. The baker explained that they were tembleque and she had made them just that morning.
Tembleque is a Puerto Rican pudding made from coconut milk and cornstarch. And when I dug in, I realized I had been missing something incredible. The pudding was sweet without being cloying, and thick without being chewy.
I also realized that the clean, yet rich flavors of this simple pudding made it a perfect finish to a Sunday dinner. I had to learn how to make it myself. This is not a traditional recipe. But it is inspired by what I tasted that day. And it is delicious.
Orange-cinnamon coconut pudding (tembleque)
1/2 cup plus 2 tablespoons sugar, divided
1/2 cup cornstarch
2 13 1/2-ounce cans coconut milk
Zest of 1 medium orange
Pinch salt
1 teaspoon cinnamon
In a medium saucepan, whisk together 1/2 cup of the sugar and the cornstarch. Whisk in the coconut milk, orange zest and salt, then set over medium-high heat. Whisk until simmering and thickened. Pour the pudding into a 9-by-9-inch baking dish or individual ramekins.
In a small bowl or cup, mix together the remaining 2 tablespoons of sugar with the cinnamon. Sprinkle the mixture over the pudding, then cover and refrigerate until set and completely chilled, about 2 hours. |
Monday
Gone Missing? Here's the Fix~~
It seems the internet gremlins have been up to no-good and many of my lovely Plumrose Lane images have gone missing, humph!! If you find they're missing from your blog and you installed the images yourself then use the steps below to easily fix them. If I installed the theme for you, then click my signature at the bottom of this message to send me an email and we'll get things back up for you~ ♥
To fix the missing images you will be replacing a single word in some code on your blog. Here's a quick key of where to find the different codes for each image type.
Background
Click on the "Layout" section of your blog then locate the "Html/Java Script" gadget for your background.
Post Divider
Click on the "Template" section of your blog, then click on "Customize". Click on "Advanced", then scroll down to "Add CSS". The code should appear under the "Add custom CSS" area.
Blog Signature
Click on the "Settings" page of your blog. Click "Posts and comments", code will be found in the "Post Template" area, 2nd choice from the top.
Button, Badge, or Tag
Click on the "Layout" section of your blog then locate the "Html/Java Script" gadget for missing button, badge, or tag.
The Fix
Once you find the code to fix the missing image you will simply need to replace the word: "prl-images" with "plumroselane". This word may appear several times within one snippet of code so I recommend using the "Find" feature in your browser to make sure you replaced them all.
Subscribe To
Reviews
Woven Key Holder"This was calling to me as I browsed the wonderful selection of keyholders and bracelets and I knew I had to have it! These keyholders are amazing--substantial, playful, soulful, and practical. Suction cups are provided for hanging if you can't bear to use these for keys. :-) I highly recommend these lovely creations by Sharon Henry."
Sew Creative Blog Header"I love the work Sharon does. She has a wonderful attention to detail and I never tire of looking at the work she done!"
Woven Bracelet "Phases""Just received my beautiful bracelet; far exceeds the pic! Thank you for sharing your talent & creativity. This Texas girl is pretty darn pleased; will definitely know where to look for gifts! The service & communication was great!"
"Cotton Delight" Theme"Plumrose Lane is a great source for blog themes! I've purchased several and have gotten prompt service every time! Highly recommend!"
Facebook Cover Image"I am so pleased with my cover image! it is beautiful and it matches me. Thank you Sharon for doing such beautiful, excellent work! I would definitely want you to create for me again!!!." |
Asset Size Chunks Chunk Names
bundle.js 1.86 kB 0 [emitted] main
chunk {0} bundle.js (main) 302 bytes [rendered]
[0] ./.test/constEnumReExportWatch/app.ts 76 bytes {0}
[1] ./.test/constEnumReExportWatch/foo.ts 77 bytes {0}
[2] ./.test/constEnumReExportWatch/bar.ts 149 bytes {0} [built] |
CONCORD, N.C. – We’re halfway into the 2012 WKA Mazda / Bridgestone Manufacturers Cup Series and it appears the 2-cycle national sprint series will have a new Manufacturer (chassis) champion for the first time since 2007.
Birel has won the last four Man Cup chassis point championships, which is awarded to the chassis make with the most national wins on the season and one of the most prestigious laurels in the history of WKA.
The last manufacturer to win the chassis points other than Birel was Margay, which won the title an unprecedented six years in a row from 2002 through 2007.
After three Manufacturers Cup national events in 2012, which comprise 20 feature events per event, Birel has only four national wins.
Those four wins have the popular Italian make 10 victories behind Top Kart, which leads the standings with 14 wins on the season thus far.
Many of those Top Kart victories have come at the hands of Houston, Texas’ Mason Chelootz, who has seven wins thus far and is coming off a four-win performance earlier this month at Pittsburgh. Scott Ferris, John Ferris III, Garrett Johnston and Chris Wehrheim have all contributed to Top Kart’s 14-win total.
Sitting second with 10 wins and still very much in the hunt is the Australian-made Arrow Chassis. Sportsman driver Zach Holden has led the Arrow charge in 2012 with six wins in the first three events. Only Chelootz has won more main events thus far.
Haase has come on strong in 2012. Pilots of the Mike Doty Racing-imported mounts have stood atop the podium nine times this season. Wins have come at the hands of Jared Cordova, Brandon Jarsocrak, John McCusker and Alex Verhagen. Haase won the Man Cup chassis points back in 2001, which was the last time a make other than Birel or Margay won the prestigious title.
Merlin and PCR round out the top five with eight and six wins, respectively. Tony Kart is sixth with four triumphs, all in the junior ranks at the hands of Ashley Rogero and Joel Jens. Birel is seventh with the aforementioned four wins.
CRG, Exprit, JMK and Kosmic have one win each in Man Cup.
With three national events left on the schedule – beginning with the July 6-8 MKP Nationals at South Bend, Indiana’s Michiana Raceway Park – 60 feature wins are still up for grabs.
While Birel still has a shot, it will take a monumental effort and it appears the Manufacturers Cup Series will have a new “Manufacturer” champion for the first time since 2007. |
Trump won't say if Sessions' job is safe past November: Report President Trump made the comments about Sessions in a new interview.
President Donald Trump would not say whether embattled Attorney General Jeff Sessions — who he has repeatedly criticized throughout his tenure — would be safe in his job after the November election, according to a report.
“I just would love to have him do a great job,” Trump said of Sessions on Thursday in an Oval Office interview with Bloomberg News.
The president declined to comment on whether Sessions' job is safe through the midterm election on Nov. 6, telling Bloomberg: “I’d love to have him look at the other side,” underscoring his demand for Sessions to reopen the investigation into Hillary Clinton and the origins of the Russia investigation.
Trump made the comments in an interview Thursday with Bloomberg News.
Last week, in an interview with Fox, Trump lashed out at Sessions, saying he failed to take control of the Department of Justice.
In his most forceful public rebuke yet, Sessions hit back, saying he "will not be improperly influenced by political considerations."
Sen. Lindsey Graham of South Carolina, a close Trump confidante, predicted Sessions would be out of his job in the near future, but insisted Trump should wait until after November's midterm elections.
"The president’s entitled to an attorney general he has faith in, somebody that’s qualified for the job, and I think there will come a time, sooner rather than later, where it will be time to have a new face and a fresh voice at the Department of Justice," Graham said. "Clearly, Attorney General Sessions doesn’t have the confidence of the president."
Trump also continues to dance around the question of whether he will grant an interview to special counsel Robert Mueller.
“I’ll see what happens," Trump told Bloomberg. "I view it differently. I view it as an illegal investigation” because “great scholars” have said that “there never should have been a special counsel." |
学院
部门
International Faculty Wanted at Sanya University
2017/4/1 10:49:12
Ⅰ. Sanya University Profile
Established in 2005, Sanya University (USY) is located in “the Oriental Hawaii” Sanya City of Hainan Province, the biggest special economic zone in China. Sponsored by Geely Holding Group, one of the global enterprises, USY is the earliest and largest private university in Sanya City and also one of the fastest developing and most competitive private universities in China.
USY covers a campus area of 233 hectares and has 16 schools with 63 subjects and specialties in Bachelor Degree, covering 9 disciplines in Law, Humanities, Economics, Management, Engineering, Natural Sciences, Agriculture, Education and Art and initially forming a rather reasonable, mutual-support and well-matched discipline system. USY has accommodated 20,000 undergraduate students since 2010 and provides students with cooperative postgraduate education programs. Simultaneously, Sanya Polytechnic Vocational College, with the same investor and legal representative as USY, offers three-year higher vocational education with a student population of near 5,000. Currently, USY has grown into the top 3 private universities in China and has been listed on China’s top 50 universities for graduate employability by the Ministry of Education (MoE). In December of 2014, USY accepted the assessment for the undergraduate work of the emerging universities and successfully passed the accreditation by the MoE. In 2016, at the Hainan Provincial First “Opal Living Cup” Top Ten Buildings Series Selection, USY’s Library and Campus were separately awarded prizes of “The Top Ten Buildings of Contemporary Hainan” and “The Top Ten Ecological Buildings in Hainan”.
By adhering to the educational mission of “preparing students to be more valuable contributors for society in the future” and in accordance with the general development of the “great special economic zone” in Hainan and the new developmental trend of Hainan International Tourism Island, USY builds discipline and specialty group in line with developmental orientation of “business discipline” and tourism industry chain since its establishment. In March of 2016, the world’s first Silk Road Business School was co-established by USY and the International Cooperation Center of National Development and Reform Commission, in which 3 English teaching specialties, including Business Administration (Concentration on International Production Capacity Cooperation Service ), International Economics & Trade (Concentration on Trade Management and Services for FTZ) and Hospitality Management (Sino-foreign Cooperatively Running Program), are offered and have officially recruited students in September of 2016. Currently, 7 universities in countries of the Northern Europe, South Asia and East Africa have been involved into comprehensive cooperation. USY devotes to building platforms and expands international cooperation and exchange. So far, USY has established rather comprehensive partnerships with over 50 universities in America, U.K., France, Germany, Russia, Thailand and dozens of other countries. Meanwhile, Continuous efforts are made to improve the enrollment of international students.
During the National 13th Five Year Plan, USY will proactively dock 12 key industries in Hainan. Based on regional advantage of “One Belt One Road” pivot city, USY is devoting to pursuing sustainable and harmonious development with more open vision and distinct goals. Actively responding to the national strategic of “going global”, USY is committing to build itself into an excellent representative of modern Chinese private universities by fulfilling its outstanding development period and mapping out deeper international cooperation and stronger capability of international expansion.
Ⅱ. Job Description
－Language Teacher:
Position 1: Teacher For Undergraduate Students (English Majors)
Position 2: Teacher For Undergraduate Students (Non-English Majors) at relevant Schools
－Professional Lecture:
Position 3: Lecture For Undergraduate Students (Business Administration)
Position 4: Lecture For Undergraduate Students (International Economics and Trade)
Position 5: Lecture For Undergraduate Students (Hospitality Management)
Note: Positions aforementioned should be English teaching. Courses are to be assigned based on the applicant’s qualifications and demand specifications in relevant Schools of USY.
Ⅲ. Teaching Staff Criteria
1. QualificationThe qualified candidates should be: under 60 years old;native speaker of English;
Bachelor Degree at least, with 2 years formal teaching experience in higher educational institute (Priority is given to Master and Doctorate Degree holders).2. Workload: 16 class hours per week normally plus a couple of office hours.
3. in excellent physical condition; all applicants should take and pass the physical examination.
4. no undesirable conduct.
5. professional and wholehearted commitment to teaching; willingness to cooperate with colleagues and departmental leaders is of utmost importance.
3. Passport-sized photo4. Copy of passport photo page5. Copies of relevant certificates and diplomas, esp. the highest degree6. Recommendation Letter or Employment Certificate from the previous employers for all teaching experiences, to confirm the years of teaching experience (if it is a Chinese institution, Recommendation Letter Form for the Foreign Teacher or Expert (see attachment two) should be provided, as required for visa; if it is outside boarders, no limited form requirements)7. Detailed Health Check Report recently (report in the latest one year is preferable)8. Application Deadline: Faculty recruitment will continue until the positions are filled
Note: These documentations should be sent to this email: sanya_university@126.com, with the file name of “Position ** + your name”, eg: Position 1 + Tom.
Ⅴ. Payment Standards for All Positions
1. Salary: In line with the regulations of the Human Resources Department of USY and the candidate’s qualifications. |
Q:
Save Azure Pipelines Agent workspace for debugging
When you run build pipelines on e.g. Jenkins there is the capability to look at the workspace after the build has been executed. This often helps to debug build issues.
I am wondering how such a similar goal could be achieved with Azure pipelines. Or what in general is the best approach to debug build issues on a local machine?
Thank you
A:
what in general is the best approach to debug build issues on a local machine?
As far as I know, we could directly check the build message with the Build log in Azure Devops.
For example：
Generally, the error message will be included in the Build log.
You also could set the variable system.debug = true in Pipeline definition. Then you could get the detailed debug log.
On the other hand, the azure devops agents also have the WorkSpace. You can determine the location of the workspace by checking this variable($(Pipeline.WorkSpace)). The workspcace contains the source files and output files.
For Self-Hosted agent, you could directly navigate to the workspace path on your local machine.
If you want to check the files in Azure Devops, you could use Publish Build Artifacts task to publish the workspace files to artifacts.
For example:
- task: PublishBuildArtifacts@1
displayName: 'Publish Artifact'
inputs:
PathtoPublish: '$(pipeline.workspace)'
ArtifactName: drop
condition: succeededOrFailed()
Hope this helps
|
The Steleers signed outside linebacker Jason Worilds to a 1-year, $9.75 million contract this off-season after designating him their Transition Player. The hope in doing so was to buy some time to negotiate a long-term deal after Worilds was among the best pass-rushing OLBs in the NFL during the second half of last season.
He hasn't exactly duplicated that performance so far in 2014.
We break Worilds down in plays from the Steelers' games Weeks 1-3 and notice a trend that's perhaps telling for the entire Steelers defense; he's one player in the first half, he's a completely different, less effective player in the second half, and the fourth quarter in particular.
The plays we highlight don't show the full scope of Worilds' work so far this season, but they do show situations in which the talented but, so far, inconsistent Worilds should be able to win the vast majority of the time.
It's correctable but currently represents an issue for a Steelers' defense that has ability, but still is finding its way in the NFL. |
Q:
Get relative path for a file asp.net
I have an MVC4 application, one controller method takes some files (this files has some Json Objects), read it proccessit then deleteit.
Those files are uploaded to my site using ftp. My Project structures is sometrhing like this
wwwroot
bin
content
images
scripts
suscribers // This is my ftp folder
_suscriber1
_proccess1
file1.txt //This is a Json file
file2.txt
...
_proccess2
...
_suscriber2
...
All my files (file1.txt...) are loaded ok. At my controller, i'm trying to read file1.txt this way:
string suscriberDir= string.Format("_{0}", suscriber.Id);
string[] laPath = {System.AppDomain.CurrentDomain.BaseDirectory, "suscribers", suscriberDir};
string lcPath = Path.Combine(laPath);
string[] laPath2 = { lcPath, "_proccess1" , "_File1.txt" };
lcPath = Path.Combine(laPath2);
StreamReader reader = new StreamReader(lcPath);
string personas = reader.ReadToEnd();
reader.Close();
My problema is that it is throwing me a filenotfound exception.
What is the right way to read file1.txt and get its content?
A:
Try using Server.MapPath("_File1.txt");
|
<?xml version="1.0" encoding="utf-8"?>
<Project DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003">
<ItemGroup Label="ProjectConfigurations">
<ProjectConfiguration Include="Release|x64">
<Configuration>Release</Configuration>
<Platform>x64</Platform>
</ProjectConfiguration>
</ItemGroup>
<PropertyGroup Label="Globals">
<VCProjectVersion>16.0</VCProjectVersion>
<Keyword>Win32Proj</Keyword>
<ProjectGuid>{0E4BAB8F-E6E0-47A8-8E99-8D451839967E}</ProjectGuid>
</PropertyGroup>
<Import Project="$(VCTargetsPath)\Microsoft.Cpp.Default.props" />
<PropertyGroup Condition="'$(Configuration)|$(Platform)'=='Release|x64'" Label="Configuration">
<ConfigurationType>Application</ConfigurationType>
<UseDebugLibraries>false</UseDebugLibraries>
<PlatformToolset>$(DefaultPlatformToolset)</PlatformToolset>
<WholeProgramOptimization>true</WholeProgramOptimization>
<CharacterSet>Unicode</CharacterSet>
<SpectreMitigation>false</SpectreMitigation>
</PropertyGroup>
<Import Project="$(VCTargetsPath)\Microsoft.Cpp.props" />
<Import Project="$(SolutionDir)\EfiGuard.props" />
<Import Project="$(VCTargetsPath)\Microsoft.Cpp.targets" />
<ItemDefinitionGroup>
<ClCompile>
<PreprocessorDefinitions Condition="'$(Configuration)|$(Platform)'=='Release|x64'">CONFIGURE_DRIVER=1;%(PreprocessorDefinitions)</PreprocessorDefinitions>
<AdditionalIncludeDirectories Condition="'$(Configuration)|$(Platform)'=='Release|x64'">$(SolutionDir)Include;$(EDK_PATH)\OvmfPkg\Csm\Include</AdditionalIncludeDirectories>
</ClCompile>
<Link>
<AdditionalDependencies>UefiApplicationEntryPoint.lib;BaseMemoryLib.lib;%(AdditionalDependencies)</AdditionalDependencies>
<SubSystem>EFI Application</SubSystem>
</Link>
</ItemDefinitionGroup>
<ItemGroup>
<ClInclude Include="..\..\Include\Protocol\EfiGuard.h" />
</ItemGroup>
<ItemGroup>
<ClCompile Include="Loader.c" />
</ItemGroup>
</Project> |
import pyaf.Bench.TS_datasets as tsds
import tests.artificial.process_artificial_dataset as art
art.process_dataset(N = 128 , FREQ = 'D', seed = 0, trendtype = "MovingMedian", cycle_length = 5, transform = "BoxCox", sigma = 0.0, exog_count = 100, ar_order = 12); |
Job configuration for semiconductor manufacturing is the technique in which silicon chips are assigned to sites on wafers, wafers are assigned to jobs, and jobs are released into the manufacturing line, so as to meet the demand for chips. The process is complicated by yield uncertainties of the line and the configuration constraints imposed by the technology of the line. Yield losses can occur at a job level, where every chip within a job is bad, at a wafer level, where every chip on a wafer is bad, or at the site level, where one or more individual chips are bad.
In the static job configuration problem, the configuration is determined in an open loop fashion from data on the demanded numbers of chips and the yield uncertainties. A decision is made on the configuration, and the configuration is released into the line; neither cycle time nor the status of the jobs within the line are considered.
There are several measures of performance for meeting the demand. The semiconductor supplier may be measured on its "volume serviceability," the percent of the volume of the demand that is met. In a more stringent measure of performance called "mix serviceability," the supplier is measured in terms of the volume of demand supplied, but is not credited for shipping parts in excess of their demand. "Set serviceability" is another measure of performance. A customer may order a specified number of sets of components, for example, the set of chips needed for a printed circuit board or module. In set serviceability, the supplier is measured in terms of the demand for complete sets that is supplied. Set serviceability is more difficult to meet than mix or volume serviceability.
In meeting set serviceability requirements for the static job configuration problem, it is desirable that the configurations achieve the serviceability with the fewest number of wafers. Minimizing the number of wafers reduces the costs for the raw materials and reduces the number of wafers flowing through the line.
The technologies used to expose wafers (optical, e-beam and retical) and test equipment limitations may impose constraints on the possible job configurations. Some semiconductor manufacturing lines process single part jobs, where every chip within a job is identical. The job configuration required for such a line is referred to as a single part job or SPJ configuration scenario. Other manufacturing lines have more flexibility and allow for multiple part jobs having single part wafers, where every chip within a wafer is identical, but wafers within a job may be different. The job configuration required for such a line is referred to as a single part wafer or SPW configuration scenario. Some manufacturing lines process multiple part jobs having multiple part wafers, where a wafer (and therefore a job) may be made up of a plurality of different chips. The job configuration required for such a line is referred to as a multiple part wafer or MPW configuration scenario.
The logistics systems controlling the flow of jobs through the line may impose additional constraints on the allowable job configurations. For example, these systems may require that a job configuration having multiple part jobs with single part wafers be composed of several copies of the same standard job. In the multiple part jobs with multiple part wafers case, the systems may require that every multiple part wafer be identical, that is, there be a standard wafer, and every job within the configuration contains the standard wafer.
A conventional approach to semiconductor job configuration is known as ground start ratio. According to ground start ratio, the number of chip starts is the ratio of the demand for the chip type to the overall yield of the chip type. This ratio is computed independently for each chip in the set.
Because the job configuration data for each of the chip types is computed without reference to demand data, yield data or configuration data of any other chip type, the computation required for the ground start ratio is straightforward and does not require an excessive amount of time to compute. However, the survival rates of the chip types which make up a set are not independent of one another in determining the survival rate of the entire set. Consequently, the ground start ratio approach is ill-suited to suppliers measured by set serviceability.
Furthermore, because the ground start ratio is computed independently for each chip type, it cannot be used to take advantage of the substantial potential serviceability increases gained by using single part wafer and multiple part wafer configurations.
Therefore, what is needed is an apparatus and method for manufacturing sets of chips that achieves the desired serviceability using a reasonable number of wafers. |
---
abstract: 'We investigate cosmological scenarios of generalized Chaplygin gas in a universe governed by Hořava-Lifshitz gravity. We consider both the detailed and non-detailed balance versions of the gravitational background, and we include the baryonic matter and radiation sectors. We use observational data from Type Ia Supernovae (SNIa), Baryon Acoustic Oscillations (BAO), and Cosmic Microwave Background (CMB), along with requirements of Big Bang Nucleosynthesis (BBN), to constrain the parameters of the model, and we provide the corresponding likelihood contours. We deduce that the present scenario is compatible with observations. Additionally, examining the evolution of the total equation-of-state parameter, we find in a unified way the succession of the radiation, matter, and dark energy epochs, consistently with the thermal history of the universe.'
author:
- Amna Ali
- Sourish Dutta
- 'Emmanuel N. Saridakis'
- 'Anjan A. Sen'
title: 'Hořava-Lifshitz cosmology with generalized Chaplygin gas'
---
Introduction
============
Recently Hořava proposed a power-counting renormalizable theory with consistent ultra-violet (UV) behavior [@hor2; @hor1; @hor3; @hor4]. Although presenting an infrared (IR) fixed point, namely General Relativity, in the UV the theory exhibits an anisotropic, Lifshitz scaling between time and space. Due to these novel features, there has been a large amount of effort in examining and extending the properties of the theory itself [@Cai:2009ar; @Cai:2009dx; @Nishioka:2009iq; @Charmousis:2009tc; @Li:2009bg; @Visser:2009fg; @Sotiriou:2009bx; @Germani:2009yt; @Chen:2009bu; @Bogdanos:2009uj; @Kluson:2009rk; @Afshordi:2009tt; @Myung:2009ur; @Alexandre:2009sy; @Blas:2009qj; @Capasso:2009fh; @Chen:2009vu; @Kluson:2009xx; @Kiritsis:2009vz; @Garattini:2009ns; @Kluson:2010aw; @Son:2010qh; @Carloni:2010nx; @Eune:2010qk; @Wang:2010mw; @Gullu:2010wb]. Additionally, application of Hořava-Lifshitz gravity as a cosmological framework gives rise to Hořava-Lifshitz cosmology, which proves to lead to interesting behavior [@Calcagni:2009ar; @Kiritsis:2009sh]. In particular, one can examine specific solution subclasses [@Lu:2009em; @Minamitsuji:2009ii; @Wu:2009ah; @Cho:2009fc; @Boehmer:2009yz; @Momeni:2009au; @Cai:2010ud; @Huang:2010rq], the phase-space behavior [@Carloni:2009jc; @Leon:2009rc; @Myung:2009if; @Bakas:2009ku; @Myung:2010qg], the gravitational wave production [@Mukohyama:2009zs; @Park:2009gf; @Park:2009hg; @Myung:2009ug], the perturbation spectrum [@Mukohyama:2009gg; @Piao:2009ax; @Chen:2009jr; @Gao:2009ht; @Cai:2009hc; @Wang:2009yz; @Kobayashi:2009hh; @Wang:2009azb; @Kobayashi:2010eh], the matter bounce [@Brandenberger:2009yt; @Brandenberger:2009ic; @Cai:2009in; @Gao:2009wn; @Saridakis:2011pk], the black hole properties [@Danielsson:2009gi; @Cai:2009pe; @Kehagias:2009is; @Myung:2009va; @Park:2009zra; @BottaCantcheff:2009mp; @Lee:2009rm; @Kiritsis:2009rx; @Greenwald:2009kp], the dark energy phenomenology [@Saridakis:2009bv; @Park:2009zr; @Chaichian:2010yi; @Jamil:2010vr], the observational constraints on the parameters of the theory [@Dutta:2009jn; @Dutta:2010jh], the astrophysical phenomenology [@Kim:2009dq; @Harko:2009qr; @Iorio:2009qx; @Iorio:2009ek; @Izumi:2009ry; @Lobo:2010hv; @Cardone:2010tb; @Saridakis:2011eq], the thermodynamic properties [@Wang:2009rw; @Cai:2009qs; @Cai:2009ph; @Wei:2010yw; @Jamil:2010di] etc. However, despite this extended research, there are still many ambiguities if Hořava-Lifshitz gravity is reliable and capable of a successful description of the gravitational background of our world, as well as of the cosmological behavior of the universe [@Charmousis:2009tc; @Li:2009bg; @Sotiriou:2009bx; @Bogdanos:2009uj; @Koyama:2009hc; @Papazoglou:2009fj; @Kimpton:2010xi; @Bellorin:2010je].
Although the foundations and the possible conceptual and phenomenological problems of Hořava-Lifshitz gravity and its associated cosmology are still an open issue, it is worth investigating different cosmological scenarios in this gravitational background. In this regard, it would be interesting to examine cosmological scenarios where apart from the gravitational sector there exists a generalized Chaplygin gas [@kamenshchik; @Bilic:2001cg; @Bento:2002ps; @Gorini:2002kf; @Bento:2002yx; @Bento:2003we; @Bento:2003dj; @Bertolami:2004ic].
The generalized Chaplygin gas (GCG) is an alternative to the Quintessence model which had attracted great interest in recent times. The scenario can explain the acceleration of the universe via an exotic equation of state, which mimics a pressureless fluid at the early stages of evolution of the Universe, and a cosmological constant at late times. It is therefore interesting to consider the GCG scenario as a unified description for dark matter and dark energy [@Bento:2002ps]. The background evolution fits well the observational data [@Bento:2002yx; @Bento:2003we], however the cosmological behavior is indistinguishable from that of the $\Lambda$CDM scenario while fitting with the structure formation data as well as with data from Cosmic Microwave Background radiation [@Sn; @bean]. Additionally, the scenario is plagued by the presence of instabilities as well as oscillations which are not observed in the matter power spectrum. Although this is a serious drawback of GCG scenario it is not the final verdict for its fate as a model for the unified description of dark matter and dark energy. As it was shown by Reis [*[et al.]{}*]{} in [@reis:2003], allowing for small entropy perturbations can eliminate instabilities and oscillations in the matter power spectrum, even in the linear regime, for a region of the parameter space where the GCG model behaves quite differently from the $\Lambda$CDM one. Furthermore, as it was shown by Avelino [*[et al.]{}*]{} in [@Large], in the GCG scenario the transition from dark matter to dark energy behavior is never smooth, and hence the linear theory which was used by [@Sn; @bean] to rule out GCG as a unified model, may break down late in the matter-dominated era, even on large cosmological scales. Therefore, nonlinear effects should be necessarily taken into account when confronting cosmological observations. Moreover, the addition of baryons in the GCG scenario can also improve the behavior of the matter power spectrum [@Large2]. In summary, the GCG as a unified model of dark matter and dark energy is not completely ruled out and it deserves further investigations. Finally, we mention that GCG in the presence of cold dark matter as well as baryonic matter (where GCG acts as a normal dark energy candidate) is one of the most well-fit scenarios with cosmological observations, amongst all the exotic models that have been considered so far [@davis].
In the present work we construct the cosmology of a generalized Chaplygin Gas in a universe governed by Hořava-Lifshitz gravity. Additionally, we use observational data from Type Ia Supernovae (SNIa) [@SNIadata], Baryon Acoustic Oscillations (BAO) [@BAOdata] and Cosmic Microwave Background (CMB) [@CMBdata], together with the Big Bang Nucleosynthesis (BBN) conditions, to constrain the various parameters of the model. Furthermore, in order to be general we perform the analysis both with and without the detailed-balance condition of the gravitational sector.
The manuscript is organized as follows: In section \[model\] we present Hořava-Lifshitz cosmology in both its detailed-balance and beyond-detailed-balance version. In section \[GCGHL\] we construct the scenario of a generalized Chaplygin Gas in Hořava-Lifshitz gravitational background and we extract the cosmological equations. In section \[observations\] we use observational data in order to constrain the various parameters of the scenario. In section \[cosmimpl\] we discuss the cosmological implications, focusing on the evolution of the total equation-of-state parameter of the universe and of the expansion rate. Finally, section \[conclusions\] is devoted to the summary of our results.
Hořava-Lifshitz cosmology {#model}
=========================
In this section we briefly review the scenario where the cosmological evolution is governed by Hořava-Lifshitz gravity [@Calcagni:2009ar; @Kiritsis:2009sh]. The dynamical variables are the lapse and shift functions, $N$ and $N_i$ respectively, and the spatial metric $g_{ij}$ (roman letters indicate spatial indices). In terms of these fields the full metric is written as: $$\begin{aligned}
ds^2 = - N^2 dt^2 + g_{ij} (dx^i + N^i dt ) ( dx^j + N^j dt ) ,\end{aligned}$$ where indices are raised and lowered using $g_{ij}$. The scaling transformation of the coordinates reads: $
t \rightarrow l^3 t~~~{\rm and}\ \ x^i \rightarrow l x^i
$.
Detailed Balance
----------------
The gravitational action is decomposed into a kinetic and a potential part as $S_g = \int dt d^3x \sqrt{g} N ({\cal L}_K+{\cal
L}_V)$. The assumption of detailed balance [@hor3] reduces the possible terms in the Lagrangian, and it allows for a quantum inheritance principle [@hor2], since the $(D+1)$-dimensional theory acquires the renormalization properties of the $D$-dimensional one. Under the detailed balance condition the full action of Hořava-Lifshitz gravity is given by $$\begin{aligned}
S_g &=& \int dt d^3x \sqrt{g} N \left\{
\frac{2}{\kappa^2}
(K_{ij}K^{ij} - \lambda K^2) \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \right. \nonumber \\
&+&\left.\frac{\kappa^2}{2 w^4} C_{ij}C^{ij}
-\frac{\kappa^2 \mu}{2 w^2}
\frac{\epsilon^{ijk}}{\sqrt{g}} R_{il} \nabla_j R^l_k +
\frac{\kappa^2 \mu^2}{8} R_{ij} R^{ij}
\right. \nonumber \\
&-&\left. \frac{\kappa^2 \mu^2}{8( 3 \lambda-1)} \left[ \frac{1
- 4 \lambda}{4} R^2 + \Lambda R - 3 \Lambda ^2 \right] \right\},
\label{acct}\end{aligned}$$ where $$\begin{aligned}
K_{ij} = \frac{1}{2N} \left( {\dot{g_{ij}}} - \nabla_i N_j -
\nabla_j N_i \right)\end{aligned}$$ is the extrinsic curvature and $$\begin{aligned}
C^{ij} \, = \, \frac{\epsilon^{ijk}}{\sqrt{g}} \nabla_k
\bigl( R^j_i - \frac{1}{4} R \delta^j_i \bigr)\end{aligned}$$ the Cotton tensor, and the covariant derivatives are defined with respect to the spatial metric $g_{ij}$. $\epsilon^{ijk}$ is the totally antisymmetric unit tensor, $\lambda$ is a dimensionless constant and the variables $\kappa$, $w$ and $\mu$ are constants with mass dimensions $-1$, $0$ and $1$, respectively. Finally, we mention that in action (\[acct\]) we have already performed the usual analytic continuation of the parameters $\mu$ and $w$ of the original version of Hořava-Lifshitz gravity, since such a procedure is required in order to obtain a realistic cosmology [@Lu:2009em; @Minamitsuji:2009ii; @Wang:2009rw; @Park:2009zra] (although it could fatally affect the gravitational theory itself). Therefore, in the present work $\Lambda $ is a positive constant, which as usual is related to the cosmological constant in the IR limit.
In order to add the matter component we follow the hydrodynamical approach (which is most suitable for phenomenological analysis) of adding a cosmological stress-energy tensor to the gravitational field equations, by demanding to recover the usual general relativity formulation in the low-energy limit [@Sotiriou:2009bx; @Chaichian:2010yi; @Carloni:2009jc]. Thus, this matter-tensor is a hydrodynamical approximation with $\rho_m$ and $p_m$ (or $\rho_m$ and $w_m$) as parameters. Note that this $\rho_m$ is the total matter energy density, that is it accounts for both the baryonic $\rho_b$ as well as the dark matter $\rho_{\rm dm}$. Similarly, one can additionally include the standard-model-radiation component (corresponding to photons and neutrinos), with the additional parameters $\rho_r$ and $p_r$ (or $\rho_r$ and $w_r$).
In order to investigate cosmological frameworks, we impose the projectability condition [@Charmousis:2009tc] and we use an FRW metric $$\begin{aligned}
N=1~,~~g_{ij}=a^2(t)\gamma_{ij}~,~~N^i=0~,\end{aligned}$$ with $$\begin{aligned}
\gamma_{ij}dx^idx^j=\frac{dr^2}{1- K r^2}+r^2d\Omega_2^2~,\end{aligned}$$ where $ K<,=,> 0$ corresponding to open, flat, and closed universe respectively (we have adopted the convention of taking the scale factor $a(t)$ to be dimensionless and the curvature constant $ K$ to have mass dimension 2). By varying $N$ and $g_{ij}$, we extract the Friedmann equations: $$\begin{aligned}
\label{Fr1fluid}
H^2 &=&
\frac{\kappa^2}{6(3{\lambda}-1)}\Big(\rho_m+\rho_r\Big)\nonumber\\
&+&\frac{\kappa^2}{6(3{\lambda}-1)}\left[ \frac{3\kappa^2\mu^2
K^2}{8(3\lambda-1)a^4} +\frac{3\kappa^2\mu^2\Lambda
^2}{8(3\lambda-1)}
\right]\nonumber\\
&-&\frac{\kappa^4\mu^2\Lambda K}{8(3\lambda-1)^2a^2} \ ,\end{aligned}$$ $$\begin{aligned}
\label{Fr2fluid}
\dot{H}+\frac{3}{2}H^2 &=&
-\frac{\kappa^2}{4(3{\lambda}-1)}\Big(w_m\rho_m+w_r\rho_r\Big)\nonumber\\
&-&\frac{\kappa^2}{4(3{\lambda}-1)}\left[\frac{\kappa^2\mu^2
K^2}{8(3\lambda-1)a^4} -\frac{3\kappa^2\mu^2\Lambda
^2}{8(3\lambda-1)}
\right]\nonumber\\
&-&\frac{\kappa^4\mu^2\Lambda K}{16(3\lambda-1)^2a^2}\ ,\end{aligned}$$ where $H\equiv\frac{\dot a}{a}$ is the Hubble parameter.
The term proportional to $a^{-4}$ is the usual “dark radiation term”, present in Hořava-Lifshitz cosmology [@Calcagni:2009ar; @Kiritsis:2009sh], while the constant term is just the explicit cosmological constant. Finally, as usual, $\rho_m$ follows the standard evolution equation $$\begin{aligned}
\label{rhodotfluid}
&&\dot{\rho}_m+3H(\rho_m+p_m)=0,\end{aligned}$$ while $\rho_r$ (standard-model radiation) follows $$\begin{aligned}
\label{rhodotfluidrad}
&&\dot{\rho}_r+3H(\rho_r+p_r)=0.\end{aligned}$$
If we require expressions (\[Fr1fluid\]) to coincide with the standard Friedmann equations, in units where $c=1$ we set [@Calcagni:2009ar; @Kiritsis:2009sh]: $$\begin{aligned}
G_{\rm cosmo}&=&\frac{\kappa^2}{16\pi(3\lambda-1)}\nonumber\\
\frac{\kappa^4\mu^2\Lambda}{8(3\lambda-1)^2}&=&1,
\label{simpleconstants0}\end{aligned}$$ where $G_{\rm cosmo}$ is the “cosmological” Newton’s constant, that is the one that is read from the Friedmann equations. We mention that in theories with Lorentz invariance breaking $G_{\rm
cosmo}$ does not coincide with the “gravitational” Newton’s constant $G_{\rm grav}$, that is the one that is read from the action, unless Lorentz invariance is restored [@Carroll:2004ai]. For completeness we mention that in our case $$\begin{aligned}
G_{\rm grav}=\frac{\kappa^2}{32\pi}\label{Ggrav},\end{aligned}$$ as it can be straightforwardly read from the action (\[acct\]) (our definitions of $G_{\rm cosmo}$, $G_{\rm grav}$ coincide with those of [@Blas:2009qj; @Papazoglou:2009fj]). Thus, it becomes obvious that in the IR ($\lambda=1$), where Lorentz invariance is restored, $G_{\rm cosmo}$ and $G_{\rm grav}$ coincide.
In our work the running of $\lambda$ is not a problem, since the whole relevant cosmological history, that is after inflation, is obviously inside the IR limit, that is with $\lambda=1$. On the other hand, the divergence of $\lambda$ from $1$, that is the quantum gravitational features of the theory, become significant at very early times, that is close to the Big Bang or the cosmological bounce. This was additionally shown in [@Dutta:2010jh], where a detailed analysis based on SNIa, BAO and CMB observations, as well as BBN considerations, constrained $\lambda$ inside a narrow window around its infrared value: $|\lambda-1|<0.02$. In summary, since in this work we are interested in post-inflation evolution, we set $\lambda=1$, and thus we simplify our notation using $G$ for the (coincided gravitational and cosmological) Newton’s constant.
Beyond Detailed Balance
-----------------------
The aforementioned formulation of Hořava-Lifshitz cosmology has been performed under the imposition of the detailed-balance condition. However, in the literature there is a discussion whether this condition leads to reliable results or if it is able to reveal the full information of Hořava-Lifshitz gravity [@Calcagni:2009ar; @Kiritsis:2009sh]. Therefore, one needs to investigate also the Friedman equations in the case where detailed balance is relaxed. In such a case one can in general write [@Charmousis:2009tc; @Sotiriou:2009bx; @Bogdanos:2009uj; @Carloni:2009jc; @Leon:2009rc]: $$\begin{aligned}
\label{Fr1c}
H^2 &=&
\frac{2\sigma_0}{(3{\lambda}-1)}\Big(\rho_m+\rho_r\Big)\nonumber\\
&+&\frac{2}{(3{\lambda}-1)}\left[ \frac{\sigma_1}{6}+\frac{\sigma_3
K^2}{6a^4} +\frac{\sigma_4 K}{6a^6}
\right]\nonumber\\&+&\frac{\sigma_2}{3(3{\lambda}-1)}\frac{ K}{a^2}\end{aligned}$$ $$\begin{aligned}
\label{Fr2c}
\dot{H}+\frac{3}{2}H^2 &=&
-\frac{3\sigma_0}{(3{\lambda}-1)}\Big(w_m\rho_m+w_r\rho_r\Big)\nonumber\\
&-&\frac{3}{(3{\lambda}-1)}\left[ -\frac{\sigma_1}{6}+\frac{\sigma_3
K^2}{18a^4} +\frac{\sigma_4 K}{6a^6}
\right]\nonumber\\&+&
\frac{\sigma_2}{6(3{\lambda}-1)}\frac{ K}{a^2},\end{aligned}$$ where $\sigma_0\equiv \kappa^2/12$, and the constants $\sigma_i$ are arbitrary (with $\sigma_2$ being negative and $\sigma_4$ positive). As we observe, the effect of the detailed-balance relaxation is the decoupling of the coefficients, together with the appearance of a term proportional to $a^{-6}$.
Finally, if we force (\[Fr1c\]),(\[Fr2c\]) to coincide with the standard Friedmann equations, we obtain: $$\begin{aligned}
&&G_{\rm cosmo}=\frac{6\sigma_0}{8\pi(3\lambda-1)}\nonumber\\
&&\sigma_2=-3(3\lambda-1), \label{simpleconstants0nd}\end{aligned}$$ while in this case the “gravitational” Newton’s constant $G_{\rm
grav}$ reads [@Sotiriou:2009bx]: $$\begin{aligned}
G_{\rm grav}=\frac{6\sigma_0}{16\pi}\label{Ggravbdb}.\end{aligned}$$ Similarly to the detailed balance case, in the IR ($\lambda=1$) $G_{\rm cosmo}$ and $G_{\rm grav}$ coincide, and thus in the following we will use $G$ to denote the (coincided gravitational and cosmological) Newton’s constant.
Generalized Chaplygin gas in Hořava-Lifshitz cosmology {#GCGHL}
======================================================
As discussed in the introduction, Chaplygin gas scenarios have been studied extensively as possible candidates for a unified description of dark matter and dark energy through a single fluid. The generalized Chaplygin gas is a fluid with an equation of state given by: $$\label{rhochaplygin} p_c=-\frac{A}{\rho_c^\beta},$$ with $A$ a positive constant and $0<\beta\leq1$. $\rho_c$ and $p_c$ denote the energy density and pressure of the Chaplygin gas, and henceforth a subscript “c” will denote quantities pertaining to the Chaplygin gas. The simple Chaplygin gas is the special case of $\beta=1$. Finally, considering the covariant conservation of energy-momentum, $\rho_c$ satisfies the standard evolution equation $$\begin{aligned}
\label{rhodotfluid}
&&\dot{\rho}_c+3H(\rho_c+p_c)=0.\end{aligned}$$
Equations (\[rhochaplygin\]) and (\[rhodotfluid\]) can be easily solved to yield [@Bilic:2001cg; @Bento:2002ps]: $$\begin{aligned}
\label{rhochaplsol}
\rho_c=\rho_{c0}{\left[}A_s+\frac{1-A_s}{a^{3{\left(}1+\beta{\right)}}}{\right]}^{\frac{1}{1+\beta}}\end{aligned}$$ where $\rho_{c0}$ denotes the present-day density of the Chaplygin gas (in what follows, a subscript 0 will always denote the present-day value of a quantity), and we have introduced the parameter $$\begin{aligned}
A_s\equiv
A\rho_{c0}^{-(1+\beta)} .\end{aligned}$$ Thus, (\[rhochaplygin\]) provides the pressure of the Chaplygin gas as $$\begin{aligned}
\label{pchaplsol}
p_c=-\rho_{c0}A_s{\left[}A_s+\frac{1-A_s}{a^{3{\left(}1+\beta{\right)}}}{\right]}^{-\frac{\beta}{1+\beta}}.\end{aligned}$$ Clearly, $A_s$ is therefore just the present value of the equation-of-state parameter of the generalized Chaplygin gas. Furthermore, $\beta$ is related to the sound velocity of the Chaplygin gas at the present time, which is given by $\beta A_s$ [@Bento:2003we].
The most important advantage of the Chaplygin gas scenario is that it behaves like dark matter at early times ($a\ll1$) and as a cosmological constant at late times ($a\gg1$), smoothly interpolating between the two phases. Thus, since in this work we are interested in investigating the generalized Chaplygin gas in Hořava-Lifshitz cosmology, we first separate the total matter energy density $\rho_m$, that was present in the Friedmann equations of the previous section, into the baryonic $\rho_b$ and the dark matter $\rho_{\rm dm}$ parts, and then we use the generalized Chaplygin gas energy density $\rho_c$ instead of $\rho_{\rm dm}$. Therefore, using also the definitions (\[simpleconstants0\]), the Friedmann equations , of the detailed balance case take the form: $$\label{Fr1finalb}
H^2 = \frac{8\pi G}{3}\left[\rho_b+ \rho_c+\rho_r \right]+\left[
\frac{K^2}{2\Lambda a^4}+\frac{\Lambda}{2} \right]-\frac{K}{a^2}$$ $$\label{Fr2finalb}
\dot{H}+\frac{3}{2}H^2 = -4\pi G
\left[p_c+\frac13\rho_r\right]-\left[\frac{K^2}{4\Lambda
a^4}-\frac{3\Lambda}{4}\right]-\frac{K}{2a^2}.$$ Similarly, for the beyond-detailed-balance case the Friedmann equations (\[Fr1c\]),(\[Fr2c\]), using also the identifications (\[simpleconstants0nd\]), become $$\begin{aligned}
\label{Fr1finalbbdb}
H^2 =& \frac{8\pi
G}{3}\left[\rho_b+ \rho_c+\rho_r \right]\nonumber\\
&+\frac{2}{(3{\lambda}-1)}\left[ \frac{\sigma_1}{6}+\frac{\sigma_3
K^2}{6a^4} +\frac{\sigma_4 K}{6a^6}
\right]-\frac{K}{a^2}\end{aligned}$$ $$\begin{aligned}
\label{Fr2finalbbdb}
&&\dot{H}+\frac{3}{2}H^2 = -4\pi G
\left[p_c+\frac13\rho_r\right]\nonumber\\
&&\ \ \ \ \ \ \ -\frac{3}{(3{\lambda}-1)}\left[
-\frac{\sigma_1}{6}+\frac{\sigma_3 K^2}{18a^4} +\frac{\sigma_4
K}{6a^6}
\right]-\frac{K}{2a^2}.\ \ \\end{aligned}$$
Observational Constraints {#observations}
=========================
In the conventional gravitational background of general relativity, the cosmological scenarios of generalized Chaplygin gas have been extensively constrained using observational data. In particular, in [@Bertolami:2004ic; @Gravsn; @Large; @Sn; @Sn2] SNIa observations were used, in [@Large; @Large2] data from large scale structure, in [@Cmb; @Cmb2] CMB data, while in [@Gravsn] the authors used gravitational lensing observations. Finally, constraints from combined data sources have been obtained in [@Park:2009np] and [@delCampo:2009cz].
In the present work we will consider observations in order to constraint the scenario of a generalized Chaplygin gas in a universe governed by Hořava-Lifshitz gravity. In particular we will use data from SNIa, BAO, CMB and BBN to constrain the Chaplygin gas parameters together with the parameters of Hořava-Lifshitz gravity. For completeness, we perform our analysis separately for the detailed-balance and the beyond-detailed-balance scenario.
Constraints on the Detailed-Balance scenario
--------------------------------------------
We first consider the detailed-balance version of the theory. It proves more convenient to use the redshift $z$ instead of the scale factor as the independent variable, through the relation $1+z\equiv a_0/a=1/a$. Furthermore, we use the dimensionless density parameters $$\begin{aligned}
\label{densparam} \Omega_i\equiv \frac{8\pi G}{3H^2}\rho_i,\ \
\Omega_ K\equiv - \frac{K}{H^2a^2},\end{aligned}$$ and we introduce the dimensionless parameter $$\begin{aligned}
\label{densparam2} \omega\equiv \frac{\Lambda}{2 H_0^2}.\end{aligned}$$ Finally, we use the dimensionless expansion rate $$\begin{aligned}
\label{fidexprate}
E(z)\equiv \frac{H(z)}{H_0}.\end{aligned}$$
Using the above definitions, the Friedman equation (\[Fr1finalb\]) becomes: $$\begin{aligned}
E^2(z)=&\,\Omega_{b0}(1+z)^3+\Omega_{c0}F(z)+\Omega_{r0}(1+z)^4\nonumber\\
&+\,\Omega_{ K0}(1+z)^2+\Big[\omega+\frac{\Omega_{ K
0}^2}{4\omega}(1+z)^4\Big],
\label{Frdbfinal}\end{aligned}$$ where F(z)=\^. Obviously, is subject to the present-time constraint $E(z=0)=1$, which leads to the condition: \[cond1\] \_[b0]{}+\_[c0]{}+\_[r0]{}+\_[K0]{}++=1.
-- --
-- --
As we have already mentioned above, the term $\Omega_{ K
0}^2/(4\omega)$ is the coefficient of the dark radiation term, which is a characteristic feature of the Hořava-Lifshitz gravitational background. Since this dark radiation component has been present also during the time of nucleosynthesis, it is subject to bounds from Big Bang Nucleosynthesis (BBN). As discussed in detail in [@Dutta:2009jn], if the upper limit on the total amount of Hořava-Lifshitz dark radiation and kination-like (a quintessence field dominated by kinetic energy [@kination; @kination1]) components allowed during BBN is expressed through the parameter $\Delta N_\nu$ of the effective neutrino species [@BBNrefs; @BBNrefs1; @BBNrefs2; @Malaney:1993ah], then we obtain the following constraint: \[cond2\] =0.135\_[r0]{}. In this work, in order to ensure consistency with BBN, we adopt an upper limit of $\dn\leq2.0$ following [@BBNrefs2].
In most studies of dark energy models it is usual to ignore curvature (e.g.[@DaveCaldwellSteinhardt; @LiddleScherrer; @Dutta; @Dutta1; @Dutta2; @Dutta3; @Dutta4; @Dutta5; @Dutta6]), especially concerning observational constraints. This consideration is well motivated since most inflationary scenarios predict a high degree of spatial flatness, and moreover the CMB data impose stringent constraints on spatial flatness in the context of constant-$w$ models (for example a combination of WMAP+BAO+SNIa data [@Komatsu:2008hk] provides the tight simultaneous constraints $-0.0179\leq\Omega_{K0}\leq0.0081$ and $-0.12\leq1+w\leq0.14$, both at 95% confidence).
However, it is important to keep in mind that due to degeneracies in the CMB power spectrum (see [@crooks] and references therein), the limits on curvature depend on assumptions regarding the underlying dark energy scenario. For example, if we use a linear $w$ (that is $w{\left(}a{\right)}=w_0+{\left(}1-a{\right)}w_a$) instead of a constant one, the error on $\Omega_{K0}$ is of the order of a few percent, that is much larger [@Wang2; @Verde; @Ichi1] (see [@Wright; @Ichi2; @Ichi3] for the constraints on curvature for different parameterizations). Additionally, in [@Ichi3] it was shown that for some models of dark energy the constraint on the curvature is at the level of $5\%$ around a flat universe, whereas for others the data are consistent with an open universe with $\Omega_{K0}\sim0.2$. In [@Verde] it was proposed that geometrical tests, such as the combination of the Hubble parameter $H(z)$ and the angular diameter distance $D_A(z)$, using (future) data up to sufficiently high redshifts $z\sim 2$, might be able to disentangle curvature from dark energy evolution, though not in a model-independent way. Furthermore, in [@Cortes; @Virey] the authors highlighted the pitfalls arising from ignoring curvature in studies of dynamical dark energy, and recommended to treat $\Omega_{K0}$ as a free parameter to be fitted along with the other model parameters. Lastly, note that in the present work the spatial curvature plays a very crucial role, since Hořava-Lifshitz cosmology coincides completely with $\Lambda$CDM if one ignores curvature [@Calcagni:2009ar; @Kiritsis:2009sh]. Therefore, and following the discussion above, we prefer to treat $\Omega_{K0}$ as a free parameter.
In summary, the scenario at hand involves the following parameters: $\Omega_{b0}$, $\Omega_{r0}$, $\Omega_{c0}$, $\Omega_{k0}$, $\omega$, $\dn$, $H_0$, $A_s$ and $\beta$. We fix the parameters $\Omega_{m0}(\equiv\Omega_{b0}+\Omega_{c0})$, $\Omega_{b0}$, $H_0$ and $\Omega_{r0}$ at their 7-year WMAP best-fit values [@Komatsu:2010fb], namely $\Omega_{m0}=0.27$, $\Omega_{r0}=8.14\times 10^{-5}$ and $H_0=$71.4 Km/sec/Mpc. Therefore, there are five remaining parameters, namely $\Omega_{k0}$, $\omega$, $\dn$, $A_s$ and $\beta$, which are subject to the two constraint equations (\[cond1\]) and (\[cond2\]). We choose to treat $\dn$, $A_s$ and $\beta$ as free parameters and use these constraints to eliminate $\Omega_{K0}$ and $\omega$ for a given choice of curvature, as: \[invert1\] $K;\dn, A_s,\beta$=1-\_[m0]{}-(1-.135)\_[r0]{}&&\
-0.73$K$&& and \[invert2\] \_[K0]{}$\dn,A_s,\beta$=. Note that in order to obtain $\omega$ and $\Omega_{K0}$ from the above equations and , the type of curvature $K$ has to be chosen a priori. Therefore, we treat positive ($K>0$) and negative ($K<0$) curvature separately. Finally, note that according to if $\dn=0$ then it forces the spatial curvature to be zero.
Let us now proceed to constrain the three free parameters $\dn$, $A_s$ and $\beta$. We perform a likelihood analysis using the SNIa, BAO and CMB data (see the appendix of [@Dutta:2009jn] for the details of the procedure). In Fig. \[dbcontours\] we present the likelihood contours of $A_s$ and $\dn$ for three different choices of $\beta$, one at its best-fit value, and the other two at the extremes of its allowed values. As we observe, the scenario at hand is in general compatible with observations. Furthermore, note that the contours are smaller for negative curvature, indicating that negative curvature is generally disfavored for these models. Finally, the best-fit values together with the corresponding $1\sigma$ bounds arising from the analysis, for the two choices of curvature, are shown in Table \[db\_bestfits\].
**$K<0$** **$K>0$**
--------- ------------------------------------------------ ------------------------------------------------
$A_s$ $1.96\times10^{-13};\,{\left(}0,0.04{\right)}$ $3.75\times10^{-11};\,{\left(}0,0.04{\right)}$
$\dn$ $0;\,{\left(}0,0.09{\right)}$ $2.75\times10^{-2};\,{\left(}0,0.09{\right)}$
$\beta$ $3.21\times10^{-5};\,{\left(}0,1{\right)}$ $3.89\times10^{-3};\,{\left(}0,1{\right)}$
: Best-fit values and $1\sigma$ confidence intervals for the free parameters $A_s$, $\dn$ and $\beta$ in the detailed balance scenario, arising from a likelihood analysis using SNIa, BAO and CMB data.[]{data-label="db_bestfits"}
Constraints on the Beyond-Detailed-Balance scenario
---------------------------------------------------
In this subsection we consider the cosmology of a generalized Chaplygin gas in Hořava-Lifshitz gravity where the detailed balance condition has been relaxed. Our cosmic fluid consists of the baryonic matter, the standard-model radiation and the Chaplygin gas. Starting with the Friedmann equation and proceeding similarly to the previous subsection, we can write the dimensionless Hubble parameter $E(z)$ as: $$\begin{aligned}
E^2(z)=&\,\Omega_{b0}(1+z)^3+\Omega_{c0}F(z)\nonumber\\
+&\,\Omega_{r0}(1+z)^4+\Omega_{ K0}(1+z)^2\nonumber\\
+&\,\Big[\omega_1+\omega_3(1+z)^4+\omega_4(1+z)^6\Big],
\label{Frndbfinal}\end{aligned}$$ where as usual F(z)=\^. In (\[Frndbfinal\]) we have introduced the dimensionless parameters $\w_1$, $\w_3$ and $\w_4$, related to the model parameters $\sigma_1$, $\sigma_3$ and $\sigma_4$ through: \_1&=&\
\_3&=&\
\_4&=&-. Furthermore, we consider the combination $\omega_4$ to be positive, in order to ensure that the Hubble parameter is real for all redshifts (note that $\omega_4>0$ is required also for the stability of the gravitational perturbations of the theory [@Sotiriou:2009bx; @Bogdanos:2009uj]). For convenience we moreover assume $\sigma_3\geq0$, that is $\omega_3\geq0$.
-- --
-- --
-- --
-- --
The present scenario involves the following parameters: $H_0$, $\Omega_{b0}$, $\Omega_{c0}$, $\Omega_{r0}$, $\Omega_{K0}$, $\w_1$, $\w_3$ and $\omega_4$, $A_s$ and $\beta$. Similarly to the detailed-balance case, we fix the parameters $\Omega_{m0}$,$\Omega_{b0}$, $H_0$ and $\Omega_{r0}$ at their 7-year WMAP best-fit values [@Komatsu:2010fb]. Thus, the remaining free parameters are $\Omega_{K0}$, $\w_1$, $\w_3$ and $\omega_4$, $A_s$ and $\beta$, which are subject to the same two constraints as discussed in the previous subsection. The first one arises from the Friedman equation at $z=0$, which leads to \[ndbcond1\] \_[m0]{}+\_[r0]{}+\_[K0]{}+\_1+\_3+\_4=1. We use this constraint to eliminate the parameter $w_1$.
The second constraint arises from BBN considerations. The term involving $\w_3$ represents the usual dark-radiation component. In addition, the $\w_4$-term represents a kination-like component (a quintessence field dominated by kinetic energy [@kination; @kination1]), also called a “stiff fluid”. If $\dn$ represents the BBN upper limit on the total energy density of the universe beyond standard model constituents, then as shown in the Appendix of [@Dutta:2009jn], we have the following constraint at the time of BBN ($z=z_{\rm BBN}$) [@BBNrefs; @BBNrefs1; @BBNrefs2; @Malaney:1993ah]: \[ndbcond2\] \_3+\_4$1+z_{\rm
BBN}$\^2=\_[3]{}0.135\_[r0]{}. It is clear that BBN imposes an extremely strong constraint on $\w_4$, since its largest possible value (corresponding to $\w_3=0$) is $\sim 10^{-24}$. This is in agreement with precision constraints on stiff fluid densities at the time of BBN derived in [@BobSourishBBN]. Finally, $\w_{3\text{max}}$ denotes the upper limit on $\w_3$. In the following, we use expression (\[ndbcond2\]) to eliminate $\w_4$. For convenience, instead of $\w_3$ we define a new parameter $$\alpha\equiv \frac{\w_3}{\w_{3\text{max}}},$$ which has the interesting physical meaning of denoting the ratio of the energy density of the Hořava-Lifshitz dark radiation to the total energy density of Hořava-Lifshitz dark radiation and kination-like components at the time of BBN.
In summary, in the scenario at hand we have the following five free parameters: $\dn$, $\Omega_{K0}$, $\alpha$, $A_s$ and $\beta$. We use SNIa, BAO and CMB data to perform a likelihood analysis, and we construct the likelihood contours for the parameters $A_s$ and $\dn$ for various fixed choices of the other parameters $\alpha$, $\beta$ and $\Omega_{K0}$.
\
In Fig. \[cont\_varying\_alpha\] we present the contours of $A_s$ and $\dn$ obtained by varying $\alpha$ around its best-fit value, while keeping $\beta$ and $\Omega_{K0}$ fixed at their best-fit values. We find that as $\alpha$ increases, the contours shrink and rotate counter-clockwise, placing tighter constraints on $\dn$.
In Fig. \[cont\_varying\_omega\] we present the contours of $A_s$ and $\dn$ for four different choices of spatial curvature, with $\alpha$ and $\beta$ fixed at their best-fit values. We observe that curvature constraints are quite tight. For example the 1-$\sigma$ regions shrink as $|\Omega_{k0}|$ increases from 0.001 to 0.002 (as shown in the figure) and they almost completely disappear for $|\Omega_{k0}|\gtrsim0.003$ (which is not shown).
In Fig. \[cont\_varying\_beta\] we show the likelihood contours of $A_s$ and $\dn$, with $\alpha$ and $\Omega_{K0}$ fixed to their best-fit values, and two extreme choices of $\beta$. We deduce that the contours expand slightly for the larger value of $\beta$.
Finally, the best-fit values, along with the corresponding $1\sigma$ confidence intervals are presented in Table \[ndb\_bestfits\].
$A_s$ $2.47\times10^{-10};\,{\left(}0,2{\right)}$
--------------- -----------------------------------------------------
$\dn$ $5.23\times10^{-4};\,{\left(}0,2.0{\right)}$
$\alpha$ $5.17\times10^{-4};\,{\left(}0,1{\right)}$
$\Omega_{K0}$ $1.29\times10^{-3};\,{\left(}-0.003,0.003{\right)}$
$\beta$ $4.89\times10^{-5};\,{\left(}0,1{\right)}$
: Best-fit values and $1\sigma$ confidence intervals for the free parameters $A_s$, $\dn$, $\alpha$, $\Omega_{K0}$ and $\beta$, in the beyond-detailed-balance scenario, arising from a likelihood analysis using SNIa, BAO and CMB data.[]{data-label="ndb_bestfits"}
Cosmological implications {#cosmimpl}
=========================
In the previous sections we constructed cosmological scenarios of a generalized Chaplygin gas in a universe governed by Hořava-Lifshitz, and we used observational data in order to impose constraints on the model parameters. In recent past, people have discussed different cosmological scenarios in Hořava-Lifshitz gravity. Maeda et al [@maeda; @2010] have recently studied the bouncing as well as oscillating universe in Hořava-Lifshitz gravity in presence of both curvature and cosmological constant. One very interesting feature of their study is the possibility of a quantum tunneling from the oscillating spacetime to an inflationary scenario. In another interesting work, Bertolami and Zarro [@berto; @2011] have discussed quantum cosmology via minisuperspace model for projectable Hořava-Lifshitz gravity without detailed balanced condition. They considered the presence of a cosmological constant and when it is positive they recovered the classical GR solution with accelerating expansion. In the present section we discuss some of the cosmological implications in our case where we consider the presence of generalised Chaplygin gas . In particular, we focus on the evolution of the dimensionless expansion rate defined in (\[fidexprate\]), and on the evolution of the equation-of-state parameter of the total cosmic fluid of the universe, defined as $w=p_{tot}/\rho_{tot}$, with the total pressure and energy density given by p\_[tot]{}=p\_c+\_[r]{} +\_[tot]{}=\_c+\_b+\_[r]{} +for the detailed-balanced scenario, and p\_[tot]{}=p\_c+\_[r]{} +$$\begin{aligned}
\rho_{tot}=\rho_c+\rho_b+\rho_{r}
+\left[\frac{\sigma_1}{6\sigma_0}+\frac{\sigma_3
K^2}{6\sigma_0a^4} +\frac{\sigma_4 K}{6\sigma_0a^6}\right],\end{aligned}$$ for the beyond-detailed-balance one, as it can be easily extracted from the corresponding Friedmann equations. Therefore, replacing the scale factor by the redshift, and using the density parameters (\[densparam\]) at present, as well as the Hubble parameter as a function of the redshift (from relations (\[Frdbfinal\]) and (\[Frndbfinal\]), for the detailed and beyond detailed-balance case respectively), we straightforwardly acquire the total equation-of-state parameter as a function of the redshift $w(z)$.
Detailed Balance
----------------
Let us first examine the evolution of the total equation-of-state parameter $w(z)$ of the universe. In order to make our presentation simpler we will use the best-fit value set of Table \[db\_bestfits\] as our fiducial choice for the various model parameters, denoting by $w_{bf}(z)$ the corresponding $w(z)$. That is, the subscript “bf” for a parameter will imply the best-fit value of the parameter and for a variable will imply that all parameters determining that variable have been fixed to their best-fit values. In Fig. \[db\_w\_bf\] we present the evolution of $w_{bf}(z)$.
\
As we observe, at very early times the cosmic equation of state is close to $1/3$, since the standard-model radiation and the dark radiation from the Hořava-Lifshitz gravitational background dominate, as expected. At intermediate redshifts, the Chaplygin gas dominates and it behaves like a dust for quite a long time, leading to an equation of state close to zero. Finally at late times, the de Sitter phase of the Chaplygin gas dominates. Interestingly, this evolution is consistent with the thermal history of our universe, with the succession of the radiation, matter, and “dark energy” epochs, and this feature acts as an advantage of the scenario at hand. Furthermore, note that we do not need any additional mechanism to describe the late-time universe acceleration (that is the dark energy), since this is obtained through a unified way by the generalized Chaplygin gas. That is, this crucial property of the Chaplygin gas is still exhibited by the present Hořava-Lifshitz embedded scenario.
\
-- --
-- --
We now focus on the evolution of the dimensionless expansion rate $E(z)$ defined in (\[fidexprate\]). In order to acquire the basic information, in Fig. \[db\_E\_bf\] we depict the evolution of the fiducial expansion rate $E_{bf}(z)$, that is with all parameters fixed to their best-fit values presented in Table \[db\_bestfits\]. As expected, $E_{bf}(z)$ starts from very large values, and it steadily decreases towards its present value $1$.
It would be interesting to investigate how the expansion rate is affected by each parameter. In order to quantify this, we define the quantity $Q(z)$, which is the fractional change in the expansion rate $E_{bf}(z)$ as each parameter is varied within its allowed limits, while all the other parameters are kept fixed at their best-fit values, that is $$Q(z)\equiv\frac{E(z)-E_{bf}(z)}{E_{bf}(z)}.$$ Note that $A_s$ and $\beta$ have well-defined upper and lower limits, while for $\dn$ we use the standard BBN upper limit of $\dn<2.0$ [@BBNrefs]. In Fig. \[db\_variations\] we present $Q(z)$ for all the parameters of the scenario. As we see, both $A_s$ and $\dn$ can have a strong impact on the expansion rate, while $\beta$ has a very weak impact. The fact that the effect of $\beta$ is small was expected, since in the contour plots of Fig. \[dbcontours\] we did not obtain a significant change upon varying $\beta$.
Finally, from Fig. \[db\_variations\] we deduce that the impact of both the generalized Chaplygin gas parameters $A_s$ and $\beta$ is realized mainly at low redshifts, while it weakens at high ones. This is explained by the fact that at high redshifts the Chaplygin gas is subdominant and thus the expansion dynamics is driven by the (standard-model and dark) radiation. On the other hand, $\dn$, which is directly related to the amount of dark radiation, can have a significant impact on the expansion rate at arbitrarily high redshifts.
Beyond Detailed Balance
-----------------------
Let us now repeat the analysis of the previous subsection, in the beyond-detailed-balance version of the examined scenario.
In Fig. \[w\_bf\] we depict the evolution of $w_{bf}(z)$, that is the total equation-of-state parameter of the universe, with all the model parameters fixed to their best-fit values presented in Table \[ndb\_bestfits\]. As we observe, the behavior of $w_{bf}(z)$ is similar to that of the detailed-balance case, that is we obtain an initial radiation era, a relatively long matter one, and finally an era of accelerated expansion.
![(Color online) [*[**Beyond Detailed Balance:** Evolution of the fiducial total equation-of-state parameter of the cosmic fluid $w_{bf}(z)$, with all parameters fixed to best-fit values presented in Table \[ndb\_bestfits\].]{}*]{} []{data-label="w_bf"}](w_bf.eps){width="6cm"}
Concerning the dimensionless expansion rate of the universe $E(z)$, in Fig. \[E\_bf\] we depict its fiducial value $E_{bf}(z)$ as a function of the redshift. Again we see that $E_{bf}(z)$ starts from very large values and it steadily decreases, compatibly with observations.
![(Color online) [*[**Beyond Detailed Balance:** Evolution of the fiducial dimensionless Hubble parameter $E_{bf}(z)$, with all parameters fixed to their best-fit values presented in Table \[ndb\_bestfits\].]{}*]{} []{data-label="E_bf"}](E_bf.eps){width="6cm"}
![(Color online) [*[**Beyond Detailed Balance:** Fractional variation $Q(z)$ of the dimensionless Hubble parameter $E_{bf}(z)$, upon varying the parameter $A_s$ within its allowed limits, as indicated in the graph. All the other parameters are kept fixed to their fiducial values presented in Table \[ndb\_bestfits\].]{}*]{}[]{data-label="H_varying_As"}](H_varying_As.eps){width="6cm"}
![ (Color online) [*[ **Beyond Detailed Balance:** Fractional variation $Q(z)$ of the dimensionless Hubble parameter $E_{bf}(z)$, upon varying the parameter $\dn$ within its allowed limits, as indicated in the graph. All the other parameters are kept fixed to their fiducial values presented in Table \[ndb\_bestfits\].]{}*]{}[]{data-label="H_varying_Dn"}](H_varying_Dn.eps){width="6cm"}
![(Color online) [*[**Beyond Detailed Balance:** Fractional variation $Q(z)$ of the dimensionless Hubble parameter $E_{bf}(z)$, upon varying the parameter $\Omega_{K0}$ as indicated in the graph. All the other parameters are kept fixed to their fiducial values presented in Table \[ndb\_bestfits\].]{}*]{}[]{data-label="H_varying_Omk"}](H_varying_Omk.eps){width="6cm"}
We now proceed to the investigation of the effect that the various model parameters have on the expansion rate. In Figures \[H\_varying\_As\]-\[H\_varying\_beta\] we demonstrate the fractional change $Q(z)$ of the expansion rate $E_{bf}(z)$ as each parameter is varied within its allowed limits, as it is indicated in the graphs, while all other parameters are kept fixed at their best-fit values. From Fig. \[H\_varying\_As\] we deduce that $A_s$ can have a strong impact on the expansion rate at low redshifts, while from Fig. \[H\_varying\_Dn\] we see that $\dn$ can affect significantly the expansion rate at large redshifts. On the other hand, form Figures \[H\_varying\_Omk\], \[H\_varying\_alpha\] and \[H\_varying\_beta\] we observe that $\Omega_{k0}$ and especially the parameters $\alpha$ and $\beta$ have negligible impacts. Similarly to the detailed balance case, the fact that the effect of $\beta$ is small was expected, since in the contour plots of Fig. \[cont\_varying\_beta\] we did not obtain a significant change upon varying $\beta$.
![(Color online) [*[ **Beyond Detailed Balance:** Fractional variation in the dimensionless Hubble parameter $E_{bf}(z)$, upon varying the parameter $\alpha$ within its allowed limits, as indicated in the graph. All the other parameters are kept fixed to their fiducial values presented in Table \[ndb\_bestfits\].]{}*]{}[]{data-label="H_varying_alpha"}](H_varying_alpha.eps){width="6cm"}
![(Color online) [*[**Beyond Detailed Balance:** Fractional variation in the dimensionless Hubble parameter $E_{bf}(z)$, upon varying the parameter $\beta$ within its allowed limits indicated, as in the graph. All the other parameters are kept fixed to their fiducial values presented in Table \[ndb\_bestfits\].]{}*]{}[]{data-label="H_varying_beta"}](H_varying_beta.eps){width="6cm"}
The explanation of the effect of the various parameters on the expansion rate is easily obtained, knowing the behavior of the various terms as a function of the redshift. In particular, at high redshifts the radiation (standard-model and dark one) dominates and drives the expansion, while the Chaplygin gas is subdominant. However $\dn$, which quantifies the Hořava-Lifshitz dark radiation and kination-like components, can have a significant impact on the expansion rate at arbitrarily high redshifts.
Conclusions
===========
In this work we investigated the cosmological scenario of generalized Chaplygin Gas in a universe governed by Hořava-Lifshitz gravity, both in the detailed-balance as well as in the beyond-detailed balance version of the theory. Furthermore, in order to obtain a realistic cosmology we have included the baryonic matter and standard-model radiation sectors.
After extracting the cosmological equations, we used data from SNIa, BAO and CMB observations, as well as arguments from Big Bang Nucleosynthesis, in order to impose constraints on the various parameters of the scenario. For the detailed-balance case we have three free parameters, namely the exponent $\beta$ of the generalized Chaplygin Gas, its present equation-of-state parameter value $A_{s}$, and the effective neutrino parameter $\Delta
N_{\nu}$ which quantifies the total amount of Hořava-Lifshitz dark-radiation and kination-like components allowed during BBN. The best fit values of the parameters together with the corresponding $1\sigma$ confidence intervals, arisen from the likelihood analysis for open and closed universe, were shown in Table \[db\_bestfits\], while in Fig. \[dbcontours\] we presented the corresponding likelihood contours. We deduced that the scenario at hand is compatible with observations, however the data lead to strong bounds on $A_{s}$ and $\Delta N_{\nu}$ and the spatial curvature $\Omega_{K0}$. Finally, the scenario at hand depends only slightly on $\beta$.
In the beyond-detailed-balance scenario the free parameters are five, namely $\beta$, $A_{s}$, $\Delta N_{\nu}$, the curvature density $\Omega_{K0}$, and the parameter $\alpha$, which is the ratio of the dark-radiation energy density to the sum of dark-radiation and kination-like energy densities at the time of BBN. The best fit values of the parameters together with the corresponding $1\sigma$ confidence intervals, arisen from the likelihood analysis, were shown in Table \[ndb\_bestfits\]. Additionally, in Figures \[cont\_varying\_alpha\]-\[cont\_varying\_beta\] we presented the likelihood contours of the model parameters. From this analysis we deduced that the entire (consistently with BBN) range of $0\leq\Delta N_{\nu}\leq2.0$ is allowed, for suitable choices of the other parameters. We also found tight constraints on the curvature and on $A_s$.
After the observational elaboration, we investigated the cosmological implications of the examined scenarios. In particular, we focused on the evolution of the total equation-of-state parameter of the universe, and of the expansion rate. In the detailed-balance case, we saw that in general at very early-times is radiation that dominates, at intermediate redshifts is the Chaplygin gas that dominates, behaving like matter for a long time, and finally at late times the dominant Chaplygin gas behaves like dark energy, triggering the accelerating expansion (see Fig \[db\_w\_bf\]). This evolution is consistent with the thermal history of the universe, and this is an advantage of the present scenario. Note moreover that the present accelerated era is described in a unified way, without the need of any additional mechanism. Concerning the qualitative dependence on the various parameters, we found that the expansion rate has a strong dependence on both $A_{s}$ and $\Delta N_{\nu}$ at low redshifts, while at high redshifts, where the Chaplygin gas is not dominant, this dependence weakens and disappears (see Fig \[db\_variations\]). Lastly, the dependence on $\beta$ is very weak at all redshifts.
In the beyond-detailed-balance scenario we found a similar behavior for the total equation-of-state parameter of the universe, that is we obtained successively a radiation, a matter, and a dark energy era (see Fig \[w\_bf\]). Qualitatively, $A_{s}$ has a weak impact on the expansion rate at lower redshifts, $\Delta N_{\nu}$ has a significant effect at large redshifts, while $\Omega_{K0}$ and especially $\alpha$ and $\beta$ have a negligible impact on the expansion rate at all redshifts (see Figures \[H\_varying\_As\]-\[H\_varying\_beta\]).
In summary, the generalized Chaplygin gas in Hořava-Lifshitz gravitational background is compatible with observations, and can successfully reproduce the expansion history of the universe. However, we should mention that the present analysis does not enlighten the discussion about the possible conceptual problems and instabilities of Hořava-Lifshitz gravity, nor it can address the questions concerning the validity of its theoretical background, which is the subject of interest of other studies. It just analyzes the phenomenological consequences and the cosmological implications of the generalized Chaplygin Gas in such a gravitational background, and thus its results can be taken into account only if Hořava-Lifshitz gravity passes successfully the necessary theoretical tests.
In the same lines, the present work does not address the problem of undesirable instabilities and oscillations in the matter power spectra, that GCG scenario faces in standard Einstein gravity. Although, as discussed in the Introduction, there are several approaches which try to solve this problem in conventional gravity, it may be quite interesting to see whether it can be addressed in the context of Hořava-Lifshitz gravity. Let us make some comments in this perspective. As discussed in [@Bento:2002ps; @Bertolami:2004ic], GCG can be modelled in terms of scalar fields having both canonical as well as non-canonical kinetic energy terms, and thus perturbing the GCG one has to essentially perturb these scalar fields. In the case of Hořava-Lifshitz gravity one expects in general the linear perturbations to be quite different due to higher-order curvature-terms present in the action. These higher-order gradient terms can in principle generate non-adiabatic pressure perturbation, which can help to cure the instabilities or oscillations in the power spectra even in the large scales. The effect can be prominent with scalar fields having non-canonical kinetic energy terms, for instance of Dirac-Born-Infeld form, which is typical for GCG-like equation of state.
In conclusion, the generalized Chaplygin gas scenario in Hořava-Lifshitz cosmology, can have rich cosmological consequences. The present study is a first step in this direction, where we have considered the background evolution and have confronted the model with a variety of currently available observational data. The next step is to consider the inhomogeneous GCG model in Hořava-Lifshitz gravity, which will be our goal in the near future.
A.A.S acknowledges the financial support provided by the University Grants Commission, Govt. Of India, through major research project grant (Grant No:33-28/2007(SR)). S.D wishes to thank Ujjaini Alam for useful discussions.
[99]{}
P. Horava, Phys. Lett. [**B694**]{}, 172-176 (2010). \[arXiv:0811.2217 \[hep-th\]\].
P. Horava, JHEP [**0903**]{}, 020 (2009) \[arXiv:0812.4287 \[hep-th\]\]. P. Horava, Phys. Rev. D [**79**]{}, 084008 (2009) \[arXiv:0901.3775 \[hep-th\]\]. P. Horava, Phys. Rev. Lett. [**102**]{}, 161301 (2009) \[arXiv:0902.3657 \[hep-th\]\]. R. G. Cai, Y. Liu and Y. W. Sun, JHEP [**0906**]{}, 010 (2009) \[arXiv:0904.4104 \[hep-th\]\].
R. G. Cai, B. Hu and H. B. Zhang, Phys. Rev. D [**80**]{}, 041501 (2009) \[arXiv:0905.0255 \[hep-th\]\].
T. Nishioka, Class. Quant. Grav. [**26**]{}, 242001 (2009) \[arXiv:0905.0473 \[hep-th\]\].
C. Charmousis, G. Niz, A. Padilla and P. M. Saffin, JHEP [**0908**]{}, 070 (2009) \[arXiv:0905.2579 \[hep-th\]\].
T. P. Sotiriou, M. Visser and S. Weinfurtner, JHEP [**0910**]{}, 033 (2009) \[arXiv:0905.2798 \[hep-th\]\]. C. Germani, A. Kehagias and K. Sfetsos, JHEP [**0909**]{}, 060 (2009) \[arXiv:0906.1201 \[hep-th\]\]. C. Bogdanos and E. N. Saridakis, Class. Quant. Grav. [**27**]{}, 075005 (2010) \[arXiv:0907.1636 \[hep-th\]\].
J. Kluson, JHEP [**0911**]{}, 078 (2009) \[arXiv:0907.3566 \[hep-th\]\]. N. Afshordi, Phys. Rev. D [**80**]{}, 081502 (2009) \[arXiv:0907.5201 \[hep-th\]\]. Y. S. Myung, Phys. Lett. B [**679**]{}, 491 (2009) \[arXiv:0907.5256 \[hep-th\]\].
J. Alexandre, K. Farakos, P. Pasipoularides and A. Tsapalis, Phys. Rev. D [**81**]{}, 045002 (2010) \[arXiv:0909.3719 \[hep-th\]\]. D. Blas, O. Pujolas, S. Sibiryakov, Phys. Rev. Lett. [**104**]{}, 181302 (2010). \[arXiv:0909.3525 \[hep-th\]\].
D. Capasso and A. P. Polychronakos, JHEP [**1002**]{}, 068 (2010) \[arXiv:0909.5405 \[hep-th\]\].
B. Chen, S. Pi and J. Z. Tang, arXiv:0910.0338 \[hep-th\].
J. Kluson, Phys. Rev. [**D81**]{}, 064028 (2010). \[arXiv:0910.5852 \[hep-th\]\].
E. Kiritsis, Phys. Rev. D [**81**]{}, 044009 (2010) \[arXiv:0911.3164 \[hep-th\]\].
R. Garattini, arXiv:0912.0136 \[gr-qc\]. J. Kluson, Phys. Rev. [**D82**]{}, 086007 (2010). \[arXiv:1002.2849 \[hep-th\]\].
E. J. Son, W. Kim, JCAP [**1006**]{}, 025 (2010). \[arXiv:1003.3055 \[hep-th\]\].
S. Carloni, M. Chaichian, S. ’i. Nojiri, S. D. Odintsov, M. Oksanen, A. Tureanu, Phys. Rev. [**D82**]{}, 065020 (2010). \[arXiv:1003.3925 \[hep-th\]\].
M. Eune, W. Kim, Mod. Phys. Lett. [**A25**]{}, 2923-2927 (2010). \[arXiv:1003.4052 \[hep-th\]\].
A. Wang, Mod. Phys. Lett. [**A26**]{}, 387-398 (2011). \[arXiv:1003.5152 \[hep-th\]\].
I. Gullu, T. C. Sisman, B. Tekin, Phys. Rev. [**D81**]{}, 104018 (2010). \[arXiv:1004.0611 \[hep-th\]\].
M. Li and Y. Pang, JHEP [**0908**]{}, 015 (2009) \[arXiv:0905.2751 \[hep-th\]\]. M. Visser, Phys. Rev. [**D80**]{}, 025011 (2009). \[arXiv:0902.0590 \[hep-th\]\].
J. Chen, Y. Wang, Int. J. Mod. Phys. [**A25**]{}, 1439-1448 (2010). \[arXiv:0905.2786 \[gr-qc\]\].
G. Calcagni, JHEP [**0909**]{}, 112 (2009) \[arXiv:0904.0829 \[hep-th\]\].
E. Kiritsis and G. Kofinas, Nucl. Phys. B [**821**]{}, 467 (2009) \[arXiv:0904.1334 \[hep-th\]\].
H. Lu, J. Mei and C. N. Pope, Phys. Rev. Lett. [**103**]{}, 091301 (2009) \[arXiv:0904.1595 \[hep-th\]\].
M. Minamitsuji, Phys. Lett. [**B684**]{}, 194-198 (2010). \[arXiv:0905.3892 \[astro-ph.CO\]\].
P. Wu, H. W. Yu, Phys. Rev. [**D81**]{}, 103522 (2010). \[arXiv:0909.2821 \[gr-qc\]\].
I. Cho, G. Kang, JHEP [**1007**]{}, 034 (2010). \[arXiv:0909.3065 \[hep-th\]\].
C. G. Boehmer, F. S. N. Lobo, Eur. Phys. J. [**C70**]{}, 1111-1118 (2010). \[arXiv:0909.3986 \[gr-qc\]\].
D. Momeni, Int. J. Theor. Phys. [**50**]{}, 1493-1514 (2011). \[arXiv:0910.0594 \[gr-qc\]\].
R. -G. Cai, A. Wang, Phys. Lett. [**B686**]{}, 166-174 (2010). \[arXiv:1001.0155 \[hep-th\]\].
Y. Huang, A. Wang, Q. Wu, Mod. Phys. Lett. [**A25**]{}, 2267-2279 (2010). \[arXiv:1003.2003 \[hep-th\]\].
S. Carloni, E. Elizalde, P. J. Silva, Class. Quant. Grav. [**27**]{}, 045004 (2010). \[arXiv:0909.2219 \[hep-th\]\].
G. Leon and E. N. Saridakis, JCAP [**0911**]{}, 006 (2009) \[arXiv:0909.3571 \[hep-th\]\]. Y. S. Myung, Y. -W. Kim, W. -S. Son, Y. -J. Park, Phys. Rev. [**D82**]{}, 043506 (2010). \[arXiv:0911.2525 \[gr-qc\]\].
I. Bakas, F. Bourliot, D. Lust and M. Petropoulos, Class. Quant. Grav. [**27**]{}, 045013 (2010) \[arXiv:0911.2665 \[hep-th\]\]. Y. S. Myung, Y. W. Kim, W. S. Son and Y. J. Park, arXiv:1001.3921 \[gr-qc\].
Y. S. Myung, Y. -W. Kim, W. -S. Son, Y. -J. Park, JHEP [**1003**]{}, 085 (2010). \[arXiv:1001.3921 \[gr-qc\]\].
M. -i. Park, Class. Quant. Grav. [**28**]{}, 015004 (2011). \[arXiv:0910.1917 \[hep-th\]\].
M. i. Park, arXiv:0910.5117 \[hep-th\]. Y. S. Myung, Phys. Lett. [**B684**]{}, 1-5 (2010). \[arXiv:0911.0724 \[hep-th\]\].
S. Mukohyama, JCAP [**0906**]{}, 001 (2009) \[arXiv:0904.2190 \[hep-th\]\].
Y. S. Piao, Phys. Lett. B [**681**]{}, 1 (2009) \[arXiv:0904.4117 \[hep-th\]\].
B. Chen, S. Pi and J. Z. Tang, JCAP [**0908**]{}, 007 (2009) \[arXiv:0905.2300 \[hep-th\]\]. X. Gao, Y. Wang, R. Brandenberger, A. Riotto, Phys. Rev. [**D81**]{}, 083508 (2010). \[arXiv:0905.3821 \[hep-th\]\].
Y. F. Cai and X. Zhang, Phys. Rev. D [**80**]{}, 043520 (2009) \[arXiv:0906.3341 \[astro-ph.CO\]\].
A. Wang and R. Maartens, Phys. Rev. D [**81**]{}, 024009 (2010) \[arXiv:0907.1748 \[hep-th\]\]. T. Kobayashi, Y. Urakawa, M. Yamaguchi, JCAP [**0911**]{}, 015 (2009). \[arXiv:0908.1005 \[astro-ph.CO\]\].
A. Wang, D. Wands, R. Maartens, JCAP [**1003**]{}, 013 (2010). \[arXiv:0909.5167 \[hep-th\]\].
T. Kobayashi, Y. Urakawa, M. Yamaguchi, JCAP [**1004**]{}, 025 (2010). \[arXiv:1002.3101 \[hep-th\]\].
R. Brandenberger, Phys. Rev. D [**80**]{}, 043516 (2009) \[arXiv:0904.2835 \[hep-th\]\]. R. H. Brandenberger, Phys. Rev. [**D80**]{}, 023535 (2009). \[arXiv:0905.1514 \[hep-th\]\].
Y. F. Cai and E. N. Saridakis, JCAP [**0910**]{}, 020 (2009) \[arXiv:0906.1789 \[hep-th\]\]. X. Gao, Y. Wang, W. Xue, R. Brandenberger, JCAP [**1002**]{}, 020 (2010). \[arXiv:0911.3196 \[hep-th\]\].
E. N. Saridakis, Int. J. Mod. Phys. [**D20**]{}, 1485-1504 (2011). \[arXiv:1101.0300 \[astro-ph.CO\]\].
U. H. Danielsson and L. Thorlacius, JHEP [**0903**]{}, 070 (2009) \[arXiv:0812.5088 \[hep-th\]\]. R. G. Cai, L. M. Cao and N. Ohta, Phys. Rev. D [**80**]{}, 024003 (2009) \[arXiv:0904.3670 \[hep-th\]\].
A. Kehagias and K. Sfetsos, Phys. Lett. B [**678**]{}, 123 (2009) \[arXiv:0905.0477 \[hep-th\]\]. Y. S. Myung, Phys. Lett. B [**678**]{}, 127 (2009) \[arXiv:0905.0957 \[hep-th\]\].
M. i. Park, JHEP [**0909**]{}, 123 (2009) \[arXiv:0905.4480 \[hep-th\]\].
M. Botta-Cantcheff, N. Grandi, M. Sturla, Phys. Rev. [**D82**]{}, 124034 (2010). \[arXiv:0906.0582 \[hep-th\]\].
H. W. Lee, Y. -W. Kim, Y. S. Myung, Eur. Phys. J. [**C68**]{}, 255-263 (2010). \[arXiv:0907.3568 \[hep-th\]\].
E. Kiritsis and G. Kofinas, JHEP [**1001**]{}, 122 (2010); J. Greenwald, A. Papazoglou, A. Wang, Phys. Rev. [**D81**]{}, 084046 (2010). \[arXiv:0912.0011 \[hep-th\]\].
E. N. Saridakis, Eur. Phys. J. [**C67**]{}, 229-235 (2010) \[arXiv:0905.3532 \[hep-th\]\].
M. i. Park, JCAP [**1001**]{}, 001 (2010) \[arXiv:0906.4275 \[hep-th\]\]. M. Chaichian, S. ’i. Nojiri, S. D. Odintsov, M. Oksanen, A. Tureanu, Class. Quant. Grav. [**27**]{}, 185021 (2010). \[arXiv:1001.4102 \[hep-th\]\].
M. Jamil, E. N. Saridakis, JCAP [**1007**]{}, 028 (2010) \[arXiv:1003.5637 \[physics.gen-ph\]\].
S. Dutta and E. N. Saridakis, JCAP [**1001**]{}, 013 (2010) \[arXiv:0911.1435 \[hep-th\]\]. S. Dutta, E. N. Saridakis, JCAP [**1005**]{}, 013 (2010) \[arXiv:1002.3373 \[hep-th\]\].
S. S. Kim, T. Kim and Y. Kim, Phys. Rev. D [**80**]{}, 124002 (2009) \[arXiv:0907.3093 \[hep-th\]\]. T. Harko, Z. Kovacs, F. S. N. Lobo, Proc. Roy. Soc. Lond. A Math. Phys. Eng. Sci. [**467**]{}, 1390-1407 (2011). \[arXiv:0908.2874 \[gr-qc\]\].
L. Iorio, M. L. Ruggiero, Int. J. Mod. Phys. [**A25**]{}, 5399-5408 (2010). \[arXiv:0909.2562 \[gr-qc\]\].
L. Iorio, M. L. Ruggiero, Open Astron. J. [**3**]{}, 167-171 (2010). \[arXiv:0909.5355 \[gr-qc\]\].
K. Izumi, S. Mukohyama, Phys. Rev. [**D81**]{}, 044008 (2010). \[arXiv:0911.1814 \[hep-th\]\].
F. S. N. Lobo, T. Harko and Z. Kovacs, arXiv:1001.3517 \[gr-qc\].
V. F. Cardone, N. Radicella, M. L. Ruggiero and M. Capone, arXiv:1003.2144 \[astro-ph.CO\]. E. N. Saridakis, \[arXiv:1110.0697 \[gr-qc\]\].
A. Wang and Y. Wu, JCAP [**0907**]{}, 012 (2009) \[arXiv:0905.4117 \[hep-th\]\].
R. -G. Cai, L. -M. Cao, N. Ohta, Phys. Lett. [**B679**]{}, 504-509 (2009). \[arXiv:0905.0751 \[hep-th\]\].
R. -G. Cai, N. Ohta, Phys. Rev. [**D81**]{}, 084061 (2010). \[arXiv:0910.2307 \[hep-th\]\].
S. W. Wei, Y. X. Liu, Y. Q. Wang and H. Guo, arXiv:1002.1550 \[hep-th\]. M. Jamil, E. N. Saridakis, M. R. Setare, JCAP [**1011**]{}, 032 (2010). \[arXiv:1003.0876 \[hep-th\]\].
K. Koyama, F. Arroja, JHEP [**1003**]{}, 061 (2010). \[arXiv:0910.1998 \[hep-th\]\].
D. Blas, O. Pujolas, S. Sibiryakov, Phys. Lett. [**B688**]{}, 350-355 (2010). \[arXiv:0912.0550 \[hep-th\]\].
I. Kimpton, A. Padilla, JHEP [**1007**]{}, 014 (2010). \[arXiv:1003.5666 \[hep-th\]\].
J. Bellorin and A. Restuccia, arXiv:1004.0055 \[hep-th\]. A. Y. Kamenshchik, U. Moschella and V. Pasquier, Phys. Lett. B [**511**]{}, 265 (2001) \[arXiv:gr-qc/0103004\].
N. Bilic, G. B. Tupper and R. D. Viollier, Phys. Lett. B [**535**]{}, 17 (2002) \[arXiv:astro-ph/0111325\]. M. C. Bento, O. Bertolami and A. A. Sen, Phys. Rev. [**D 66**]{}, 043507 (2002).
V. Gorini, A. Kamenshchik and U. Moschella, Phys. Rev. D [**67**]{}, 063509 (2003) \[arXiv:astro-ph/0209395\]. M. C. Bento, O. Bertolami and A. A. Sen, Phys. Rev. D [**67**]{}, 063003 (2003) \[arXiv:astro-ph/0210468\]. M. C. Bento, O. Bertolami and A. A. Sen, Phys. Lett. B [**575**]{}, 172 (2003) \[arXiv:astro-ph/0303538\]. M. C. Bento, O. Bertolami and A. A. Sen, Gen. Rel. Grav. [**35**]{}, 2063 (2003) \[arXiv:gr-qc/0305086\]. O. Bertolami, A. A. Sen, S. Sen and P. T. Silva, Mon. Not. Roy. Astron. Soc. [**353**]{}, 329 (2004) \[arXiv:astro-ph/0402387\]. H. Sandvik, M. Tegmark, M. Zaldarriaga and I. Waga, Phys. Rev. D [**69**]{}, 123524 (2004) \[arXiv:astro-ph/0212114\]. R. Bean and O. Dore Phys. Rev. D [**68**]{} 023515 (2003).
R. .R. R. Reis, I. Waga, .M. O. Calvao and S. E. Joras, Phys. Rev. D [**68**]{} 061302 (2003).
P. P. Avelino, L. M. G. Beca, J. P. M. de Carvalho, C. J. A. Martins and P. Pinto, Phys. Rev. D [**67**]{}, 023511 (2003) \[arXiv:astro-ph/0208528\]. L. M. G. Beca, P. P. Avelino, J. P. M. de Carvalho and C. J. A. Martins, Phys. Rev. D [**67**]{}, 101301 (2003) \[arXiv:astro-ph/0303564\]. T. Davis et al., Astrophys.J. [**666**]{} 716 (2007).
R. Amanullah [*et al.*]{}, Astrophys. J. [**716**]{}, 712 (2010) \[arXiv:1004.1711 \[astro-ph.CO\]\]. B. A. Reid [*et al.*]{} \[SDSS Collaboration\], “Baryon Acoustic Oscillations in the Sloan Digital Sky Survey Data Release 7 Mon. Not. Roy. Astron. Soc. [**401**]{}, 2148 (2010) \[arXiv:0907.1660 \[astro-ph.CO\]\].
E. Komatsu [*et al.*]{} \[WMAP Collaboration\], Astrophys. J. Suppl. [**192**]{}, 18 (2011) \[arXiv:1001.4538 \[astro-ph.CO\]\].
S. M. Carroll and E. A. Lim, Phys. Rev. D [**70**]{}, 123525 (2004) \[arXiv:hep-th/0407149\]. M. Makler, S. Quinet de Oliveira and I. Waga, Phys. Rev. D [**68**]{}, 123521 (2003) \[arXiv:astro-ph/0306507\]. J. V. Cunha, J. S. Alcaniz and J. A. S. Lima, Phys. Rev. D [**69**]{}, 083501 (2004) \[arXiv:astro-ph/0306319\]. Y. Urakawa, T. Kobayashi, JCAP [**1007**]{}, 027 (2010). \[arXiv:0907.1191 \[astro-ph.CO\]\].
T. Barreiro, O. Bertolami and P. Torres, Phys. Rev. D [**78**]{}, 043530 (2008) \[arXiv:0805.0731 \[astro-ph\]\]. C. G. Park, J. c. Hwang, J. Park and H. Noh, Phys. Rev. D [**81**]{}, 063532 (2010) \[arXiv:0910.4202 \[astro-ph.CO\]\].
S. del Campo and J. Villanueva, Int. J. Mod. Phys. D [**18**]{}, 2007 (2009) \[arXiv:0909.5258 \[astro-ph.CO\]\]. M. Joyce, Phys. Rev. D [**55**]{}, 1875 (1997) \[arXiv:hep-ph/9606223\]. M. Joyce and T. Prokopec, Phys. Rev. D [**57**]{}, 6022 (1998) \[arXiv:hep-ph/9709320\].
K. Hagiwara [*et al.*]{} \[Particle Data Group\], Phys. Rev. D [**66**]{}, 010001 (2002). K. A. Olive, G. Steigman and T. P. Walker, Phys. Rept. [**333**]{}, 389 (2000) \[arXiv:astro-ph/9905320\].
G. Steigman, Int. J. Mod. Phys. E [**15**]{}, 1 (2006) \[arXiv:astro-ph/0511534\]. R. A. Malaney and G. J. Mathews, Phys. Rept. [**229**]{}, 145 (1993). S. Dutta and R. J. Scherrer, Phys. Rev. D [**82**]{}, 083501 (2010) \[arXiv:1006.4166 \[astro-ph.CO\]\]. K. Maeda, Y. Misonoh and T. Kobayashi, Phys. Rev. D [**82**]{}, 064024 (2010).
O. Bertolami, C. A. D. Zarro, Phys. Rev. [**D84**]{}, 044042 (2011). \[arXiv:1106.0126 \[hep-th\]\].
A. R. Liddle and R. J. Scherrer, Phys. Rev. D [**59**]{}, 023509 (1999) \[arXiv:astro-ph/9809272\].
R. Dave, R. R. Caldwell and P. J. Steinhardt, Phys. Rev. D [**66**]{}, 023516 (2002) \[arXiv:astro-ph/0206372\].
D. C. Dai, S. Dutta and D. Stojkovic, Phys. Rev. D [**80**]{}, 063522 (2009) \[arXiv:0909.0024 \[astro-ph.CO\]\]. T. Chiba, S. Dutta and R. J. Scherrer, Phys. Rev. D [**80**]{}, 043517 (2009) \[arXiv:0906.0628 \[astro-ph.CO\]\]. S. Dutta, E. N. Saridakis and R. J. Scherrer, Phys. Rev. D [**79**]{}, 103005 (2009) \[arXiv:0903.3412 \[astro-ph.CO\]\].
S. Dutta and R. J. Scherrer, Phys. Lett. B [**676**]{}, 12 (2009) \[arXiv:0902.1004 \[astro-ph.CO\]\]. S. Dutta and R. J. Scherrer, Phys. Rev. D [**78**]{}, 123525 (2008) \[arXiv:0809.4441 \[astro-ph\]\]. S. Dutta and R. J. Scherrer, Phys. Rev. D [**78**]{}, 083512 (2008) \[arXiv:0805.0763 \[astro-ph\]\]. S. Dutta, S. D. H. Hsu, D. Reeb and R. J. Scherrer, Phys. Rev. D [**79**]{}, 103504 (2009) \[arXiv:0902.4699 \[astro-ph.CO\]\]. E. Komatsu [*et al.*]{} \[WMAP Collaboration\], Astrophys. J. Suppl. [**180**]{}, 330 (2009) \[arXiv:0803.0547 \[astro-ph\]\]. J. L. Crooks, J. O. Dunn, P. H. Frampton, H. R. Norton and T. Takahashi, Astropart. Phys. [**20**]{}, 361 (2003) \[arXiv:astro-ph/0305495\].
K. Ichikawa and T. Takahashi, Phys. Rev. D [**73**]{}, 083526 (2006) \[arXiv:astro-ph/0511821\].
G. Barenboim, E. Fernandez-Martinez, O. Mena, L. Verde, JCAP [**1003**]{}, 008 (2010). \[arXiv:0910.0252 \[astro-ph.CO\]\].
Y. Wang and P. Mukherjee, Phys. Rev. D [**76**]{}, 103533 (2007) \[arXiv:astro-ph/0703780\].
E. L. Wright, Astrophys. J. [**664**]{}, 633 (2007) \[arXiv:astro-ph/0701584\].
K. Ichikawa, M. Kawasaki, T. Sekiguchi and T. Takahashi, JCAP [**0612**]{}, 005 (2006) \[arXiv:astro-ph/0605481\].
K. Ichikawa and T. Takahashi, JCAP [**0702**]{}, 001 (2007) \[arXiv:astro-ph/0612739\].
C. Clarkson, M. Cortes and B. A. Bassett, JCAP [**0708**]{}, 011 (2007) \[arXiv:astro-ph/0702670\].
J. M. Virey, D. Talon-Esmieu, A. Ealet, P. Taxil and A. Tilquin, JCAP [**0812**]{}, 008 (2008) \[arXiv:0802.4407 \[astro-ph\]\].
E. Komatsu [*et al.*]{} \[ WMAP Collaboration \], Astrophys. J. Suppl. [**192**]{}, 18 (2011). \[arXiv:1001.4538 \[astro-ph.CO\]\].
|
Q:
OfflineIMAP and Mutt with Gmail's All Mail folder
OfflimeIMAP
I am trying to sync my Gmail - All Mail folder with idlefolders through offlineimap. My .offlineimaprc config has this -
idlefolders = ['INBOX', '[Gmail].All Mail']
My name of my All Mail folder in .mail (where my mailboxes are) looks like
drwx------ 5 ry ry 4096 Oct 12 18:13 [Gmail].All Mail
I think the name is wrong in idlefolders. I see a lot of people online using [Gmail]/All Mail.
My INBOX folder sync fine but All Mail does not.
MUTT
Also trying to set a macro shortcut to All Mail in .muttrc I have -
macro index ga "<change-folder> =[Gmail].All Mail<enter>"
This does not work, but my macro for INBOX does work
macro index gi "<change-folder> =INBOX<enter>"
What's wrong? How should I call my All Mail folder?
A:
for my Mutt 1.5.21, percent encoding works:
macro index ga "<change-folder>=[Gmail]/All%20Mail<enter>"
A:
I think the problem here is the whitespace in the folder. Possible solutions:
Update: As winchendonsprings pointed out, there is a way to escape the whitespace in the folder name. Now we can use a macro to change to All Mail:
bind editor <space> noop
macro index ga "<change-folder>=[Gmail].All Mail<enter>" "Go to all mail"
You use a name transalation to create mailboxes without a
whitespace as described in the
documentation.
For example the translation could look like this:
nametrans = lambda x: re.sub('\[|\]|\s', '_', x)
You should make sure, as the documentation states, that no folder
ends up with the same translated name. You can check this by running
offlineimap with --info.
Another possible solution could be, to register your mailboxes and
simply use a macro to toggle between the index and your list of configured
mailboxes, eg. in your .muttrc:
mailboxes =[Gmail].All\ Mail =[Gmail].Important =[Gmail].Starred
macro index <left> ':mailboxes <enter>c?<toggle-mailboxes>
That provides the benefit that mutt monitors your local mailbox and
tells you if you've got new mail. You can even automate this if you want. Examples can be found here.
|
Wave energy buoys convert the energy of waves on a surface of a body of water, for example, from ocean surface waves, or waves formed in lakes, rivers, tidal estuaries, or other bodies of water, into electricity, which can be used to satisfy commercial and residential energy needs. Accordingly, wave energy buoys can, inter alia, reduce dependence on conventional fossil fuels. Conventional wave energy buoys use the rising and falling of the ocean waves to cause the buoy to move up and down, producing a resultant mechanical stroking within the buoy which is used to drive an electrical generator. Another conventional method of converting kinetic ocean wave energy into electricity is through the use of permanent magnets oscillating in relation to a conductive coil. As the magnets and coil oscillate relative to each other due to wave motion, electric current is created in the conductive coils. These conventional methods of converting kinetic ocean wave energy into electricity are generally inefficient since they only capture a small percentage of wave energy. This limitation is due in part to the device not being able to adjust to varying wave swells to maximize the generation of electricity. Thus, a conventional wave energy buoy cannot distinguish a wave having a greater height, wavelength, and/or speed, from a wave having a smaller height, wavelength, or speed. A conventional wave energy buoy with a fixed-strength magnet is prevented from maximizing the potential energy generated from waves with varying heights and force because where the magnet is too strong, the oscillation of the buoy is impeded reducing the amount of electric current generated in the coils. Further, where the fixed-strength magnet is too weak, the buoy will freely oscillate in relation to the coils, but the electric current generated in the coils will be less than the amount that could have been produced with a stronger magnetic field. Therefore, a conventional wave energy buoy using fixed-strength magnets of a constant strength magnetic field will not be able to optimize the potential electricity generated from each wave.
Wave energy buoys can be organized into a wave farm, such as a coastal buoy farm. However, it is difficult to manage and control a plurality of buoys organized into a wave farm so that electricity can be efficiently generated on a large scale. The inefficiencies described herein with regard to individual conventional buoys are magnified when a plurality of buoys are networked together in a buoy farm. |
Moscow has assigned a new envoy to the Central African Republic (CAR) as the country faces fresh internal conflicts. However, appointing a new ambassador is nothing out of the ordinary, a veteran diplomat told RT.
Vladimir Titorenko was appointed ambassador to CAR on Tuesday. He replaced Sergei Lobanov, who had been Moscow's envoy since 2011. A career diplomat, Titorenko, 60, was stationed in Iraq in the 1990s, following the Gulf War. He eventually became chief envoy to the Arab nation not long before US President George W. Bush launched an invasion in 2003. Moscow ordered the evacuation of its mission as US troops were storming Baghdad. Titorenko was wounded when the diplomats' motorcade was caught in crossfire. He was awarded with the Order of Courage soon after, becoming the first ambassador Russia to receive this state decoration.
Upon leaving Iraq and recovering, Titorenko served as ambassador to Algeria and then to Qatar. In 2011, he was injured while defending diplomatic correspondence after security staff at an airport in Qatar's capital Doha attempted to check it. This, despite the Russian diplomat having permission to carry the documents without screening.
Foreign Ministry spokesperson Maria Zakharova said that the envoy to CAR was changed as part of routine rotation. Titorenko's appointment is "not something extraordinary," former envoy to Sub-Saharan nations Burkina Faso and Mali, Yevgeny Korendyasov told RT.
Ambassadors rarely spend more than five years in a country. There are, of course, exceptions but they are seldom.
Korendyasov, who now leads the Center for the Study of Russian-African Relations and African States Foreign Policy at the Russian Academy of Sciences, believes that Titorenko is a "good choice."
"He's the right man for the job. He is experienced, especially after working in Iraq," the former diplomat noted.
"In recent years, Central African Republic has been in focus of Russia's African policy."
Moscow trains the nation's army and police, with the UN's permission, and also seeks to foster economic ties with CAR.
Read more
The African nation itself is plagued by years of civil tensions with a number of rebel factions fighting against the government. Despite the presence of the UN peacekeepers, CAR remains one of the world's most dangerous places.
The situation on the ground grabbed headlines last summer after three veteran Russian investigative journalists were murdered on the road while travelling from CAR's capital Bangui, to the central town of Sibut. Media rights group Reporters Without Borders (RSF) called for an international inquiry into the incident.
While the full picture of events is still to be established, some details are known. The journalists entered the African country on tourist visas, without notifying the Russian Foreign Ministry or the Russian mission in CAR.
The Investigation Control Center (ICC) run by self-exiled Russian tycoon Mikhail Khodorkovsky, who funded the journalists' trip, said that the deceased reporters planned to film a documentary on the supposed activities of an alleged Russian private military company known as 'Wagner Group.'
Another of Khodorkovsky's projects, the 'Dossier' Center, claimed last week that the slain journalists were under constant surveillance by the group's paramilitaries. Notably, the Russian authorities never confirmed the existence of 'Wagner Group.' Moscow stressed that it only dispatches military instructors to CAR and does so under the official military cooperation agreement with Bangui.
The Russian Investigative Committee (Sledcom), which is leading the official probe into the journalists' deaths, said last week that Khodorkovsky's team offered the journalists $20,000 for the trip to CAR and failed to provide any security on the ground.
In addition, local military officials warned them that travelling unarmed down the countryside at night was highly dangerous due to criminal gangs being active in the area, investigators said.
Also on rt.com Lawmakers urge bill on journalists’ protection after Russian reporters murdered in Africa
The journalists decided to head for Sibut after nightfall anyway. On July 31, they were stopped by a group of "unidentified people" who spoke Arabic. They demanded the journalists to exit their vehicle and surrender their equipment and personal belongings, according to investigators.
The journalists were gunned down after trying to resist the armed men, the Investigative Committee reported, noting that the probe is still ongoing.
The former head of the ICC, Andrey Konyakhin dismissed the Investigative Committee's findings.
The officials at Sledcom, however, stated that by blasting the investigators' efforts Khodorkovsky's team has ulterior motives in mind. They want to "justify their own errors in preparing the dangerous trip" to CAR, Sledcom noted.
Think your friends would be interested? Share this story! |
Monday, January 30, 2006
It is time. This week, I plan to purchase with my own hard-earned cash (which shows how much I loved it), a bike I reviewed not too long ago: the Cannondale Synapse. Being the unable-to-decide-on-my-own type, I'm struggling with which color to pick. So, I'm putting it up to you. Do I go for carbon, or silver.
Right on the heels of that decision: Do I keep the Ksyrium SLs, or go with a set of Topolinos? If I go with the Topolinos, anyone interested in a new set of Ksyrium SLs? I hope to order the bike sometime this week, so start posting! The Topolinos will shave a few grams off the bike, and they'd look cool with the matte carbon frame, but I can't buy them until I sell the Ksyriums... which means buying them might delay me being able to ride the bike by a few weeks.
Another thing to consider: There is snow on the ground, so even if I got it today, I wouldn't be riding out on the roads.
Do you see now why I can't decide?
*Note: I reserve the right to decide for myself, if I ever figure it out--though your comments will definately be considered.
Thursday, January 19, 2006
My day job has been taking up entirely too much time. I'm starting to get through it, though, so I hope to post more. Meanwhile, James just posted a VERY comprehensive LED light review (probably the best on the net). Click here to read it.
All this time away from the blog has given me lots of ideas. Hopefully, I'll get them down and posted soon. Stay tuned... |
From Haaretz.com: The biggest Swedish pension fund has barred Israeli defense electronics company Elbit Systems from its investment portfolios on ethical grounds, Israel Radio reported Monday.
Following the lead of Norway's state oil fund, the Första AP-Fonden pension fund said it had banned investment in Elbit because the Israeli company had built and is operating a surveillance system for the much debated West Bank separation barrier......................................Full Article: Source |
Ocular delivery of cyanidin-3-glycoside in liposomes and its prevention of selenite-induced oxidative stress.
Cataracts have become the leading cause of blindness around the world, which is mainly mediated by oxidative stress. N-trimethyl chitosan (TMC)-coated liposomes of cyanidin-3-glycoside (C3G) (C3G-TCL) were prepared to attenuate oxidative stress induced by selenite sodium in rats. C3G-TCL were prepared by reverse-phase evaporation method and then coated with self-synthesized TMC. The physicochemical properties were determined. A gamma-scintigraphy study was employed to evaluate the precorneal elimination of the radioactive preparations. The transcorneal visualization for fluorescence-labeled samples was determined by confocal laser scanning microscopy (CLSM). The in vivo anti-oxidative study using C3G-TCL was carried out in rats with selenite-induced cataracts by topical administration. The sphere-like morphological characterization of the vesicles was confirmed by TEM, with a size of 158.3 ± 2.8 nm and a zeta potential of 31.7 mV. The encapsulation efficiency was (53.7 ± 0.2) % as measured by ultrafiltration. C3G-TCL showed a 3.3-fold increment in precorneal residence time when compared with that of the (99m)Tc-solution. A TMC coating enhanced the transepithelial transport of liposomes to a depth of 40-μm in the cornea. Moreover, C3G-TCL could significantly elevate the activity of superoxide dismutase and catalase in lens and also show a considerable reversal of reduced glutathione activity. The lipid peroxidation in lens was strongly prevented when compared with that of groups treated with uncoated C3G-loaded liposomes. The coating material TMC for liposomes helps improve the anti-oxidative effect of C3G in vivo through prolonged residence time on the cornea and improved permeability in the corneal epithelium. |
Q:
Fetching new JSON data each time Javascript function is called
I have a Java REST API, with some JSOn data, that I'm working with, in javascript.
I have two methods one to show data, and when to add new data:
so I have added an EventListener to my first bata to submit data:
btn.addEventListener("click", function() {
var request = new XMLHttpRequest();
request.open('GET', 'http://localhost:8084/RestandJson/api/Person');
request.onload = function(){
var data = JSON.parse(request.responseText);
addPerson(data);
};
request.send();
});
with the addPerson method like this:
const addPerson = (data) => {
var fName = document.getElementById("fname").value;
var lName = document.getElementById("lname").value;
var age = document.getElementById("age").value;
var id = data[data.length-1].id +1;
const person = {fName, lName, age, id};
data.push(person);
console.log(person);
for(i = 0; i< data.length; i++){
console.log(data[i]);
}
}
the problem is, that new data is generated for each GET request, so I only want to fetch the data once, and save that in an array, and then add new persons from there on.
I have a method to show the JSON data as well after converting it into objects:
I added an event listener to another button like before where I'm calling this method:
render HTML = (data) => {
let htmlString = "";
for(i = 0; i < data.length; i++){
htmlString += "<p> " + data[i].fName +" " + " " + data[i].lName + " " + data[i].age + " " + data[i].id + "</p>"
}
root.insertAdjacentHTML('beforeend', htmlString);
}
A:
//bind click event on button to add person info
addPersonbtn.addEventListener('click', function() {
addPerson();
});
// fetch all person data from api (call this function when app load)
function getPersonList() {
var request = new XMLHttpRequest();
request.open('GET', 'http://localhost:8084/RestandJson/api/Person');
request.onload = function(){
var data = JSON.parse(request.responseText);
renderHTML(data);
};
request.send();
}
function postPersonData(personInfo) {
// your api to add single persion info
// on success call getPersonList(), it will update the list
}
const addPerson = () => {
var fName = document.getElementById("fname").value;
var lName = document.getElementById("lname").value;
var age = document.getElementById("age").value;
//var id = data[data.length-1].id +1; // handle it on db side, Primary key, auto generation
const person = {fName, lName, age};
postPersonData(person);
}
renderHTML = (data) => {
let htmlString = "";
for(i = 0; i < data.length; i++){
htmlString += "<p> " + data[i].fName +" " + " " + data[i].lName + " " + data[i].age + " " + data[i].id + "</p>"
}
root.insertAdjacentHTML('beforeend', htmlString);
}
i have made pseudo code for you , hope it will helps you a little bit
|
Alternatively, if you are interested in personal growth, Udemy has a variety of personal development courses aimed at increasing self esteem and productivity. Writing With Flair: How To Become An Exceptional
Discount prescription glasses online
eyeglass retailer. Under each category, we have four main lens material types: Clear Lens, Tinted Prescription Sunglasses, Polarized Sunglasses, Transition Sunglasses, Sport prescription sunglasses, Safety prescription sunglasses, and, motorcycle Goggles, what type of glasses frames do you carry? Cheap glasses frequently bend or break. But it is to be corrected that today, there are many firms offering low rates in eye wear variety. Below are a few points that can help you in your search. Discount eyeglasses online is what we are. We have eliminated distributor and wholesaler ebay coupon generator mark-ups on our whole line of prescription eyeglasses and prescription sunglasses along with the costs of retail space, behind-the-counter employees, and warehousing. Higher-quality glasses have a guarantee or warranty that allows you to have piece of mind when purchasing their glasses over an unknown name.
Trademarks AND domain names, the trademarks, logos, service marks, trade dress, and domain names (collectively, the "Trademarks and Domain Names displayed on the Site are registered and unregistered Trademarks and Domain Names of Arlington Contact Lens Service and its subsidiaries, as well as other companies. You also may be subject to additional terms and conditions that may apply when you use affiliate services, third-party content or third-party software. You have not been advised by an eye care professional to stop or suspend wearing contact lenses for any medical reason.
Piece auto discountHertz discount cdp
Any reproduction, distribution, transmission, modification, publication, broadcast, or other exploitation of the Content, design, layout, or other individual elements of this Web Site without the express written consent of discount glasses is strictly prohibited and may constitute a violation of proprietary rights. If you would like to edit or delete a published submission, please email. About Clearance Sale-50 Off, are you looking for discount glasses or glasses promo code/coupon online? Before using your contact lenses, you agree to carefully review all instructions and information provided by your eye care professional and/or by the contact lens manufacturer. Terms Conditions Contact Lens Sales Please read the following Terms Conditions carefully before submitting your order. You agree that our sole obligation to you is to provide the Web Site as-is. You agree that regardless of any statute or law to the contrary, any claim or cause of action arising out of or related to use of the Site or the Terms of Use must be filed within one year after such claim or cause. THE information, services, AND products contained IN this site ARE provided "AS IS" without warranty OF ANY kind, express OR implied. Instead, this website IS provided FOR free. We take your privacy seriously.
Cellular, Virgin Mobile, ACS Wireless, Appalachian Wireless, Bluegrass Cellular, Carolina West Wireless, Cellcom, C-Spire Wireless (formerly Cellsouth Cellular One of East Central Illinois, Cincinnati Bell Wireless, Cross (dba Sprocket Duet IP, Element Mobile, EpicTouch, GCI Communications, Golden State, Hawkeye (Chat Mobility Hawkeye (NW Missouri Cellular. You agree that regardless of any statute or law to the contrary, any claim or cause of action arising out of or related to use of the website or the Terms of Use must be filed within one year after such claim or cause. Further, you agree that we shall not be liable to you or any third-party for any termination of your access to the Site. |
We plan to continue the combined application of behavioral, neurophysiological and, more recently adopted, neuroanatomical approaches to the electrosensitive system of fish. This system offers the advantage of natural behavioral responses which still function in neurophysiological preparations and thus allows for the direct testing of a single unit's significance for the behavior under study. By applying modern anatomical methods (HRP and (3H)-3-Deoxyglucose) we plan to demonstrate neuronal structures and pathways whose existence so far can only be postulated on the basis of behavioral and neurophysiological observations. We want to focus on the following problems: 1) Species specific differences in processing of electroreceptive information. 2) The neuronal connection between torus semicircularis and medullary pacemaker in gymnotoid fish. This is the last unknown link in a chain of neuronal structures which control the jamming avoidance response. This response protects electrolocation performance against jamming signals. It is one of the few cases of a vertebrate behavior whose entire neuronal substrate will be known, from receptor to effector. |
T <-
1000
y <-
c(-1.31843640899496, -3.03435276673709, -2.05595107514121, -2.49971412966407,
-2.15760642885652, -1.67746381792674, -1.08415744637158, -0.756897553586938,
-1.43505684489539, -1.12638483127496, -1.51343652158237, -2.64791691764075,
-3.41101085478297, -2.32794650707637, -1.52545207735426, -1.31143703115258,
-1.08618519458451, -0.0146924490800988, -1.90966644135984, -1.97599814062289,
-1.19723446920436, -1.72931207158962, -1.29362502946648, -2.16314440735002,
-1.94633377285511, -1.47107102712539, -0.78526980102897, -1.815125731463,
-3.06510490735219, -1.84306216888823, -0.348269284033192, -1.83589846005158,
-1.74501007983173, -2.25027338287056, -1.1318875929701, -2.00124549001275,
-2.52622445040489, -2.99699032334309, -2.81125678325273, -1.71304405304588,
-1.85192384781473, -2.46587499280594, -2.54606610530854, -1.94504526851189,
-1.47929005165508, -1.55441008658197, -0.878110883011127, -0.374788651983851,
-1.70168831581456, -2.50562792317315, -2.72435319177748, -3.00039389491271,
-2.34321274809133, -1.07262371141524, -0.483277584165653, -1.07319092867007,
-2.35213413202187, -1.600785793802, 0.06609634562185, -1.42084702901875,
-1.93774582532015, -0.537427694396825, -0.686571849560499, -1.25078931751062,
-2.07316348465435, -1.55063513398381, -0.898910422167872, -0.37248923219366,
-2.02562667437341, -2.24921245659566, -0.512800902598888, -1.41117855979704,
-1.86923828099091, -1.66283136003228, -1.12715373561589, -0.431369835840456,
-1.28504214654847, -1.84144126720918, -1.74675956885658, -1.39167735934357,
-2.47240362471331, -2.47560625938438, -2.84673098232052, -1.72287071266933,
-0.388813955534641, -1.33682016516331, -2.46398153974355, -2.41441723743533,
-0.820675884290552, -1.93450268693661, -3.0847302690423, -1.09928469523253,
-1.35092862414635, -1.25440026214178, -1.05304379223735, -1.12146524872618,
-1.65396642410902, -1.86836258174101, -1.00648390901363, -0.901936788920978,
-2.48473848134748, -2.87714918221893, -2.1275283521053, -0.841469655272068,
-0.690461171629779, -1.66899698707815, -0.969487721344827, -0.665092107402493,
-1.25486194314901, -2.38189116898264, -2.89026988217757, -2.18231102372699,
-1.64784440276957, -1.71038135304349, -2.18649501975359, -1.29454074361562,
-1.47202794136853, -1.66037882954595, -2.76367473715456, -3.4927383911636,
-2.70105955177501, -2.90786037470953, -1.51115630543446, 0.275618131641362,
-1.05863334057581, -2.64733362945267, -1.97003423152805, -2.43788246619512,
-2.92720620038322, -0.952692215443152, -0.306892021385483, -1.53645161098221,
-2.73817508455007, -3.65861220910193, -2.80325931570357, -1.64716904204535,
-0.962306778003556, -0.336975933872696, -1.21438665514779, -2.78187113599013,
-2.72221697230676, -1.46017821673314, -0.238663127093572, -0.7307831921717,
-0.856202623204496, -2.06098919280814, -2.06108957966418, -1.93240929215644,
-1.76437652600309, -1.17344249492852, -1.30245262625193, -2.489849499249,
-2.90625474007012, -1.50526983217591, -1.41070347108813, -1.57506247420409,
-1.00108088954077, -2.26682004401184, -2.03047660349544, -1.35257334554596,
-1.41917964066681, -1.49323396181173, -1.62741119196697, -0.969405534099739,
-0.771578802073499, -1.73397240796056, -0.865876206029811, -0.722959561546479,
-0.687510893818905, -1.27810079244279, -1.32943936092775, -0.58507499976788,
-2.91368178158553, -2.57235520043949, -2.03147447685745, -1.24299313848944,
0.0453592588635123, 1.39147848842277, -0.590681089110548, -1.6414416411482,
-1.62675263352799, -1.21734459631659, -1.64750444724584, -2.35316627218357,
-0.859207241883338, -1.20091524791196, -2.52974617887026, -2.22665772541811,
-0.773362581962806, -1.31533719136971, -2.094441062316, -1.20112620715899,
-1.67129935159756, -1.66029821777314, -1.392217873303, -1.13462125623475,
-2.23347051384659, -2.42730875514098, -1.71586474665054, -0.84666470638675,
-0.620938860497003, -1.53546189401747, -1.27250782008113, -1.02615350832573,
-1.12598204701595, -0.998399002705055, -0.26630374493495, 0.0911241053064779,
0.256717319061919, -1.54370320140824, -1.10509784091079, -1.33267941100423,
-1.23352062509737, -2.35519789144501, -2.26312416351454, -1.04118133770447,
-1.59668043085389, -1.89307346302643, -0.945106316656187, 0.0119356839126576,
0.0761467369422769, -1.47067567960387, -1.79320504736332, -0.65925413450578,
-1.85722629286291, -2.14565007158283, -1.9037732722487, -1.22787092339835,
-1.00396997948214, 0.344843025809417, -0.355841945128259, -0.859213038433417,
-2.01024976308673, -2.79436843566918, -2.54399026567047, -1.62001389261086,
-2.24751142818766, -1.48529002843004, -2.75326924261314, -0.793949086768922,
-0.35423903930976, -1.61356716279388, -1.29376475057861, -0.806136009331006,
-0.911885443956202, -1.05762210207445, -3.01670667139847, -3.38089631344912,
-1.89350980716188, -2.22681343975141, -1.41616358354121, 0.817922504721043,
-0.133009734379706, -0.220673010778525, -0.535208426395562, -1.59015589107588,
-1.54658306671083, -2.8880405612824, -2.22355038438895, -0.508170570312851,
-0.142858778779315, -0.408343783494149, -0.522023612175719, -1.03529049701841,
-1.47009440495346, -1.00832806322612, -0.0472686946195087, -0.53949608587434,
-0.41208555104002, -0.252670717045967, -0.188986196842378, -1.38650374854575,
-3.23308770904181, -2.95420268560939, -3.90043521332898, -2.73687127744155,
-1.96825791760207, -1.86226317895053, -2.06385818237821, -1.97866900776766,
-2.28954778554853, -1.43236813207618, -1.78158577483667, -2.50723286841986,
-2.06755613059571, -1.87243567625153, -1.92761068209526, -2.36583401784516,
-2.27087881031878, -2.94334944256777, -3.70715387214766, -2.40673940948455,
-1.77320176374283, -0.0828010232528684, 0.333525363620607, -1.89197253953967,
-1.41066859854717, -2.07944930558436, -1.42168238374146, -2.44077071356577,
-2.98429643746524, -2.88934590826397, -2.25255633866697, -1.08237669069293,
-1.48318457139126, -0.56438967563953, 0.428638663459764, -1.39348164219995,
-2.48171817810957, -1.23150394084296, 0.204262697026483, -0.873213883462223,
-1.61370562657535, -0.454921805319989, 0.439579336462561, -1.2044395332089,
-2.26090042335136, -0.690030749026239, -2.03224266641336, -2.02446050370263,
-1.71589006892605, -1.00134931478056, -1.31032187379809, -2.05044640439931,
-2.19095140490497, -1.10387675601201, -0.250420599851919, -0.0891309199925232,
-0.771666067618483, -0.500936343455192, -0.574425286567037, -1.00014405285305,
-2.16945680088524, -1.79965015260322, -2.1119089880621, -1.79176691159643,
-2.98652095754565, -1.3575949684412, 0.635706760640707, -0.918610981643997,
-1.98165167016288, -1.5352846478073, -0.559414213597136, -0.252226331381572,
-0.736612571935979, -1.16253074783201, -0.98940116676287, -1.81867614437046,
-2.26411781935575, -1.18047406164974, -0.522122026719869, -1.68029842800484,
-0.836708352662652, -0.936324002218457, -2.20752316556003, -2.3447737052474,
-2.83721757875043, -2.77836176635327, -2.10365597251107, -2.28424469379124,
-1.84770221415409, -0.789024798884389, -1.12085470988926, -2.2754961775247,
-1.97399501931201, -0.42599175905138, -1.262890565062, -2.15108764068306,
-1.09219680677499, -2.02908208634663, -2.91597434861937, -1.6875138071408,
-1.18910102549777, -1.06101035411008, -0.244349194756623, -0.376991317263254,
-2.28664586451938, -2.12937302497246, -1.52930345543414, -1.48388958924616,
-1.60210602245377, -2.66816095704569, -1.92957100102687, -1.64754719554928,
-2.84674994662041, -0.689092166555642, 1.50037338376994, -0.210204118951465,
-2.06520662163674, -1.34816691218181, 0.463258520660646, -0.954709512843694,
-0.320608682142538, -0.0680002369714001, -1.98959812248438, -2.38759113166272,
-3.18900152727623, -3.43547775375756, -0.642228214872689, -0.132326667671158,
-2.68615948587117, -2.26701072018911, -2.06270467138684, -2.69371704122351,
-3.39752962974103, -2.79058398623315, -1.88626286232714, -0.533955600453168,
-0.97824730140724, -1.37053771648418, -1.13688762431077, -1.88227290793777,
-2.14091563086876, -2.10724079988486, -1.79817740124181, -1.9442932843616,
-1.42949422687975, -0.640152824848764, -1.77268445706376, -1.95686501819604,
-2.42185920234213, -3.01162459369206, -3.84233898907454, -2.06259210365912,
-1.57532579991299, -0.932251575230005, 0.567866447619805, -0.449575844190766,
-0.00793789186021199, -0.225542828394328, -0.879008180331891,
-1.75905082499834, -2.37517021026615, -1.40390927300627, -1.2869983219346,
-0.673358865361563, -1.19145622736426, -1.70597578076354, -1.46466379339722,
-2.34231564185925, -2.70766382106899, -2.0471523805615, -1.07825724394511,
-1.35374439980713, -1.47839892574532, -1.98454271799149, -2.07892765668713,
-1.6258259673048, -2.42872797803205, -2.75403099552901, -1.31390929027705,
-1.0594520200397, -1.77448163097283, -1.30410900707983, -1.71177421755171,
-0.666102296949653, -2.60837260705187, -3.01673768786414, -2.9799051334756,
-2.21342473631687, -2.0768199047563, -2.42830461829911, -1.67249366961103,
-1.19215540000306, -0.219106310425489, 0.167345321484568, -1.44859501568703,
-1.22942122194241, -1.19350667650019, -2.12134429933562, -2.42666987839949,
-1.63982228889148, -1.40097261907959, -1.30882557258132, -1.66972342270571,
-2.94988472542088, -3.03405084721607, -2.83374425950197, -2.32844816218273,
-1.17230311661113, -0.519482200881806, -1.03687055069583, -1.34015070179041,
-0.82161072527743, -1.26523104107172, -1.79669602484615, -0.975608431969761,
-1.24032961819845, -1.73905815647346, -0.746469012501182, -0.855673852265682,
-1.5231836395444, -1.208740827206, -2.26391603583977, -0.384480891926527,
0.0240512919417141, -1.63622091877234, -1.37464184564359, -0.674337139909683,
-1.09591950079923, -1.84796282429124, -1.53083159759717, -0.930163918326661,
-0.957707487025251, -2.37878875954481, -1.87642166610379, -0.584833127230498,
-1.94135909882617, -1.84968579206153, -1.16635635431868, 0.663496483009796,
-0.333791352259063, -1.79027689174655, -1.8796998750572, -0.95131357533916,
0.0247744618797308, -1.07002856240912, -1.05340056259412, -0.0652965217990213,
-0.454604621199402, -1.77486345347113, -1.93701252432069, -1.6669663624418,
-1.57662775975655, -1.81208911194467, -3.34004830007481, -3.97330026655328,
-2.7997132325212, -1.95133916532286, -1.11694264555734, -1.75870118144175,
-1.94510454994949, -1.33944009973253, -1.44209563328927, -2.18246630534056,
-2.1390032571009, -0.500449806673684, 0.237324270204318, 0.391023355878773,
-1.25307644536456, -2.65137935384083, -2.47310582973807, -0.817486317951799,
-0.836015364859875, -0.140540703939186, -0.274267788625716, -2.1212036393433,
-2.24295005865069, -2.33244321697468, -1.28477361423492, -0.946364699619165,
-0.198766594585164, -1.57119018747419, -1.70504970201139, -0.349665044617594,
0.44031384314883, -0.581638732875443, -1.24313282337179, -2.76694485055846,
-2.61107659974337, -2.51783510617666, -1.73443500720912, -0.576593061067915,
-0.454670330857992, -1.12650078691592, 0.208041265839061, 0.304522196972248,
0.769523213878526, -0.763907210044676, -2.60230337391043, -2.58938522335379,
-1.58853099772171, -2.71200043443646, -2.26908268937152, -2.43710039468792,
-2.5921360168797, -2.42463447020587, -1.91169346396546, -0.884817068625473,
-0.905545525223572, -0.944747552261632, -0.888101261469542, -0.92663315744545,
-1.39127733852728, -1.75770116292591, -1.21652416221617, -0.70413302456883,
-1.53121060577524, -1.13670995470789, -1.792538679974, -2.18739628157264,
-1.05035330533726, -1.40908788621614, -2.63714876591057, -1.52703345104819,
-1.09575786720196, -2.01554646926787, -1.86837633111059, -1.10928567690879,
-0.755905237306467, -2.35529038692601, -2.41227854964742, -2.26499989905866,
-1.88108927200827, -2.27671573960257, -1.17137731804445, -1.25387708537618,
-1.79132818837952, -1.91585801169278, -1.2083528751976, -2.6973272429283,
-2.30159212504339, -1.37225978461472, -1.22641918951942, -1.14998657469656,
-1.91462536504542, -2.58110667694924, -2.21240868149499, -1.21485327266641,
-1.05329602413547, -1.98891444850726, -0.816649442002191, -1.47624233998839,
-2.547851740644, -1.71992792647289, -2.23376974391051, -1.50256182034184,
0.110458462125322, -0.571362271922269, -1.08838852282835, -0.346566018686358,
-1.07886032702333, -1.34424756087822, -2.62280840358298, -3.46872978031949,
-3.08210641119665, -2.76961593913676, -0.278374792391845, -0.231047508381238,
0.201350394967859, -1.87832000403754, -1.17450085145542, 0.0437968629512635,
-1.07739072494609, -1.44133742506231, -1.81268027566804, -1.60297210629812,
-2.55830192873211, -1.37426303039471, -0.427769898792018, -1.65620255448748,
-2.00810793721822, -2.2231376042671, -1.72151572417748, -0.767528009297744,
-2.22594145181704, -1.76681342399245, -2.16247396334965, -3.10943134729207,
-3.12788143676695, -2.06114117412454, -2.02772269414388, -0.490797753942777,
0.0191398142031444, -0.122061180921285, -2.24373412691591, -1.60070939102935,
-1.52313112156526, -1.87417112305029, 0.14830840647187, 0.384036127394766,
-0.635589545704953, 0.776943729701688, -0.745074841239663, -1.9819891031497,
-2.21411428813555, -2.80697365806496, -2.61945772478834, -2.87396368090653,
-1.4292174781551, -1.59089797149409, -1.53061505813716, -0.624285561340901,
-1.11237891110957, -1.59190449842568, -0.997605944930856, -0.731484083418439,
-1.03263083374676, -2.39554908407873, -2.28344056338024, -2.83798282305084,
-2.53457285510107, -1.5091879102634, -1.82980352763119, -0.477697549156539,
-0.537057607244476, -1.52703748102683, -1.65202935409648, -1.57785707440583,
-0.520098434120803, -0.634267182677926, -1.45199202981028, -0.587449192786686,
0.0436134884611019, 0.775703771607352, -0.0344770720179866, -0.305957411809007,
-1.51871684052896, -0.23929292204807, 0.507313977907364, -1.19402510827189,
-1.6881969628593, -2.49301419045729, -3.68925156134533, -2.50834733919984,
-2.70103196106648, -3.20323478742396, -2.71054065377485, -2.70283323253263,
-2.31268849753436, -2.03858604155539, -3.52605848326393, -3.32983829036574,
-1.69386709880127, -1.72702749281163, -2.18344985693944, -1.93183331366501,
-2.27280312989715, -1.75267001277833, -2.13552869281595, -2.22326055014134,
-1.5646500634889, -0.477212574997211, -1.04606425646592, -1.72732707856613,
-0.306409473407863, -0.291172407372425, -1.69643085253659, -1.53388281631529,
-1.4847562897374, -0.231676577249991, 0.683686484228289, -2.22986899358907,
-2.39357226191258, -1.08641852181437, -1.44772980907595, -2.42003635821825,
-3.36343404223207, -1.66469682063851, -0.936921341713554, -0.770837590437537,
-1.44011325470376, -2.38581827381022, -2.24387242341659, -1.09479756892535,
-0.585679522689718, -3.15776554455376, -3.3504387145297, -3.85050145974314,
-2.73742996843145, -1.26481100003101, -0.586327348511175, -0.301022333316516,
0.382963829609949, -0.940752599222307, -1.40409976128884, -1.41030428176165,
-1.47968852104057, -0.970764652822862, -1.59946269113962, -1.01621540510661,
-0.674270454739185, -1.50601161466169, -2.50549821018769, -2.95514685938458,
-2.36479166814888, -2.929770030953, -4.22685969857512, -3.28734528504654,
-1.71720047156523, -1.36742360621395, 0.216030620779819, 0.873142145843642,
-0.91536665257239, -0.882174769660838, -0.566615022243749, -1.23623820340677,
-1.35103433974715, -0.913623747355958, -1.8547707119913, -2.74710315064137,
-2.99164990153256, -2.6262533946843, -2.98576625884216, -1.34134350294935,
-0.398737584076197, -1.38833526675134, -2.35215388329089, -2.1111226423622,
-1.24928971520029, -1.42838998289804, -1.64889357200332, -0.117900759469514,
-1.08178217563972, -1.89332039526171, -1.37326420681656, -0.938370301358816,
0.707268997655034, -0.0917940600029805, 0.00156960042304632,
-1.25863024869003, -3.28392994302527, -3.45317201671376, -1.09306105025091,
-1.62069951290284, -1.73365700752734, -0.959059192922422, -0.929981075790063,
-1.82425313739511, -0.944823705331196, -0.792356928138649, -0.113238743893339,
-0.188617596376064, -1.51270471510983, -1.47176725657192, -1.32311756651367,
0.150687451930682, 0.346020204758549, -0.424954322361968, -1.68311323362719,
-1.43732439089844, -2.51973831405086, -2.02334803552041, -1.50422192068282,
-1.79739940234656, -1.22345497955869, -1.6345934474853, -2.36925143192057,
-2.09020932039071, -2.07106934339007, -1.33790403757331, -1.54829030126535,
-1.67951605259984, -1.91640362248343, -1.58928461876473, -1.53406082840166,
-2.55881864547849, -1.60473840015266, -1.15126465635604, -3.3334302728334,
-3.12065580830519, -2.03458442462486, -2.51242952289264, -1.50993603998054,
-2.80039249205062, -2.19669085032213, -3.34794089903742, -1.95129262603717,
0.158565935511058, -0.960800968306626, 0.0636812298576908, 0.627941365491542,
-1.08153504896365, -1.2808341966217, -2.3272873658968, -2.96830593766482,
-1.40229357077333, -1.47582460437233, 0.0262384297265514, 0.530283727891271,
0.841989509773471, 0.534238220883459, -2.23000872077701, -2.48514702039838,
-1.85030146435564, -0.508911021923605, -1.95668208152067, -2.06667589326077,
-1.51071490868722, -1.7755678209994, -1.42499479386321, -0.828296226617648,
-1.00746871304948, -2.84108260570653, -1.41017904714401, -0.174835995852969,
-1.67093453558692, -2.5297532532187, -1.56342526172122, -1.90175219318546,
-1.83215529740851, -1.71799979742914, -1.50822526005679, -1.45740108875251,
-1.18413347581155, -2.43514002830363, -2.1112746699385, -1.868545063728,
-2.28150795232839, -2.62992240221754, -3.2572121179441, -1.09672363184963,
-1.84729995057288, -2.83509444882647, -0.664072715240358, -1.66112205486141,
-2.69515220981894, -2.20696462011618, -1.48675575460525, -0.889945992712771,
-0.671167407121379, -0.541001246468613, -1.35504321102633, -2.16044116805195,
-1.47318771485685, -0.786312624188787, -2.59564555871072, -1.92758887458541,
-1.52170034473965, -1.43471234766882, -1.9914095922544, -2.45985002499409,
-2.36587339194324, -2.5529671995102, -2.17730252951278, -1.62756657998052,
-0.633937317269117, -1.64138837231172, -2.0983005477339, -2.41328682275294,
-1.12637420978016, -1.11942634017374, -0.333181465946743, -0.431308981181578,
-1.15275479568612, -1.61294107083646, -1.9725828515837, -0.332149981650716,
0.0972702648386988, -1.06160492644686, -1.12803387538018, -1.41212976427327,
-1.74807481388466, -2.20548799890943, -1.83700343378685, -1.2054696780513,
-1.08179647346385, -1.13898637343242, -1.78263406666364, -3.0796799304336,
-2.84206261897666, -2.94164063910405, -3.05943715692501, -2.74392367663931,
-3.23765465005884, -4.64578220210004, -1.61595927671636, 0.145922796602685,
-0.0186444418952099, -0.444784773473916, -1.39453239952663, -1.48526963241243,
-2.25290542847072, -0.951897494558719, -0.580849967633917, -0.00285063799370056,
0.0967696694381435, -1.19377808037953, -1.83230714353186, -2.18383908901353,
-0.564474914155695, -0.466447347009625, -0.816389849473332, -0.524738021108616,
-1.13741129947836, -0.898432212137843, -0.812950313573276, 0.339597257109049,
0.264787633375406, -0.787698423242615, -0.466549147977476, -1.07334532991923,
-2.22144763015513, -2.47709394799171, -1.28583324657829, -1.61068373093191,
-0.78895134736817, -1.25954769713066, -2.81953545342762, -2.71204021019316,
-2.76719065646022, -2.3064575643105, -1.41583745498713, -0.363080212647397,
-0.969488869091008, -2.28860719860112, -2.50179853730199, -1.87761027365425,
-3.00658070028941, -3.02572371030441)
|
Site Navigation
Site Mobile Navigation
Teaching the Penn State Scandal
Gene J. Puskar/Associated PressThe university president, Graham B. Spanier, left, and Coach Joe Paterno. Both men’s tenure at Penn State came to an end Wednesday night. Go to related article »
November 16 | Updated
Are you talking about the Penn State news this week in your classroom or at home with your children? Let us know how you’re handling it. Here are some ideas for discussion, writing or further research.
Understanding the Basics
A good place to start to quickly understand the story and its implications is the Times Topics page, Penn State (Sex Abuse Scandal 2011), which features a short overview of the events, along with links to all articles, opinion pieces and multimedia on the topic.
The overview, as currently posted (it may change as events develop) ends with this paragraph:
Law enforcement officials have said that Paterno had met his legal obligation in alerting his superiors at the university when he learned of the allegation against Sandusky, but they suggested he might well have failed a moral test for what to do when confronted with such a disturbing allegation involving a child not even in his teens. No one at the university alerted the police or pursued the matter to determine the well-being of the child involved.
Essential Questions about Leadership, Decision-Making and Morality
To raise the question of Coach Joe Paterno’s role, and the moral role of any leader, we published a Student Opinion question this week: “Do Leaders Have Moral Obligations?” As of now 166 students have written in, including one who noted that our question coincidentally echoed one he had just answered for the essay part of the SAT last Saturday.
When we read this, we alerted our colleagues at The Choice, a Times blog about demystifying the college process. They contacted the College Board to find out exactly what the essay question asked. In “SAT Essay Question Proves Prescient,” Jacques Steinberg writes:
Every so often, the essay questions on the SAT exam have the ripped-from-the-headlines feel of an episode of “Law and Order,” as when the test-makers asked students in the spring if they considered reality television to be “authentic.”
But to some students who took the exam last Saturday morning, it seemed as if those who devise the essay prompts for the SAT were almost anticipating what would later become the big news of the day, and the days that followed: the arrest on Saturday of a former assistant football coach at Pennsylvania State University on charges of sexually abusing young boys on campus, and the apparent failure of administrators (including the head football coach, Joe Paterno) to report to the authorities suspicions of abuse raised years earlier.
“All communities and groups have reliable rules of right and wrong in the form of laws, values, and social standards,” the essay prompt began, according to a transcript later made available to The Choice blog by the College Board, which oversees the SAT. “It is therefore generally assumed that most people know the difference between right and wrong and that they usually know the right thing to do. This view is simplistic, however. People often find themselves in complex situations for which no rule provides adequate guidance and the right course of action is unclear.”
The test-takers were then asked to answer a question — “Is it often difficult for people to determine what is the right thing to do?” — and directed to use “examples taken from your reading, studies, experience, or observations.”
Using our Student Opinion question or the SAT essay prompt reprinted above, reflect not just on this one case, but also on how these questions about morality, decision-making and leadership can apply to a variety of stories in the news, works of literature, and events in history. How do these questions resonate in your own life? Who are some famous fictional characters, historical leaders or current figures who have faced hard decisions and done what they considered the “right” thing, even if it was difficult? Who are some famous figures who did not? What lessons can you draw from reading about several such people?
Reacting to the Reactions
How did some Penn State students react after officials announced they had fired Coach Paterno? What do you think of their response? And does the depiction Penn State students jibe with other depictions of young people in current news stories like Occupy Wall Street?
How is the college itself, a place where there is a whole course devoted to Coach Paterno, using this news as a “teachable moment” in classes like “Ethics in Sports” and elsewhere? How did one professor use the video of student reactions in class the next day? How do you think you would have responded if you were a Penn State student this week?
Paterno was still practicing for the game against Nebraska on Saturday, and supportive students were rallying at his house. This is what Israel calls “the delusion that the ability to win football games indicates anything at all about your character or intelligence other than that you can win football games.”
And in his Op-Ed column “The Institutional Pass,” Joe Nocera argues that the fact of Paterno’s Catholic faith “is part of what makes his actions — or, more accurately, his inaction — so inexplicable.” He concludes, “For 46 years, Joe Paterno averted his eyes to the daily injustices, large and small, that his players suffered.”
What do you think? What might the fact that no coach in football has achieved the longevity and success that he has at Penn State say — or not say — about him as a person? How might his role as an “acknowledged Great Man” have affected him over time? Does Paterno’s successful coaching career and status as something of a legend make his apparent inaction in this case excusable or inexcusable? Why? As far as you can tell, what was Paterno’s role in the power structures at Penn State and beyond? What kind of culture seems to have existed among the football and athletic department staff?
Analyzing the Role of College Sports
Do you agree with him that serious academic, recruiting, concussion and now sexual abuse problems are often swept under the rug to maintain a successful college football program? To what extent is the college sports system broken? Are athletes – and, it seems, coaches – who apparently break the law sometimes given a free pass on campus? Why?
Take a critical look at the college football industry by reading this article and some of the other reports and pieces it links to, including Taylor Branch’s recent piece in The Atlantic on college sports in general. What are some of the problems these writers identify? What complications are there? What solutions have been proposed? Do you think anything will change as a result of this scandal or any others? Why or why not?
Learning More About Sexual Abuse
The longest, most exhaustively researched article I ever wrote for a newspaper or magazine was about a child molester who had sexually abused a little boy living down the street. The abuse went on for more than two years, beginning when the boy was 10.
This molester had a job. A house. A wife. Two kids of his own. And he gained access to his victim not through brute force but through patience, play and gifts: help with his homework, computer games, a new bike. To neighborhood observers, including the victim’s parents, the molester’s attentiveness passed for kindness, at least for a while. A molester’s behavior very often does.
Localizing Aspects of the Penn State Story
How can other schools apply the lessons of the Penn State scandal to their own institutions? What elements of the story resonate at any school, even one not touched by like sexual abuse? What other problems, like bullying, does it remind students of? What aspects of their own learning culture are they reminded of when they consider this story?
The Bystander Effect
In a much-e-mailed Op-Ed piece, “Let’s All Feel Superior,” columnist David Brooks writes about the “outraged reaction of a zillion commentators over the past week, whose indignation is based on the assumption that if they had been in Joe Paterno’s shoes, or assistant coach Mike McQueary’s shoes, they would have behaved better.”
Unfortunately, he reminds us, history tells a different story: whether during the Holocaust, the Rwandan genocide, Abu Ghraib or the street beatings that happen in American neighborhoods, so many of us do not intervene while witnessing ongoing crimes that psychologists have a name for it: the Bystander Effect.
Read Mr. Brooks piece and think about how it applies to you. When have you been guilty of “bystander behavior”? Why?
Related: In 2010, The Learning Network published this series of lesson ideas in conjunction with the Roman Catholic Church sex abuse scandal in Ireland.
Think from Sandusky’s perspective about what he was “taught” by the responses from Penn State and the nonprofit he founded, Second Mile:
In 1998, he was caught having a shower with a young boy; it was reported to Chile Protective Services, and it was found *nothing untoward happened.* All charges were dropped. What was Sandusky taught here? Even if I’m reported to authorities, nothing happens. I bet I can get away with more.
In 2000, he is witnessed raping a boy in the shower at Penn State by a janitor. Janitor tells his boss, who tells him to report it (boss doesn’t report it). Janitor doesn’t report it. Sandusky might have known he was witnessed and not reported. Lesson to Sandusky: I can be witnessed raping children in a semi-public place and no one will do anything.
In 2002, he was witnessed raping a 10 year old in a public place (shower). He and the 10 year old *both saw* that they were witnessed. It was reported to the highest levels at Penn State, and apparently reported to Second Mile (where he arranged to have access to foster kids who were already abuse victims and likely to be extremely easy targets for his predation). Consequences to Sandusky? *His keys to the locker room at Penn State were taken away.* *He was told not to bring kids on campus–something everyone states was unenforceable.* *The cops were never even called.* Lesson to Sandusky? You tell me. Perhaps: the President of the University doesn’t really mind that I am raping children on university grounds.
Since 1977 and until 2010, Sandusky was allowed access to vulnerable kids through the nonprofit he founded, Second Mile, even after they were notified at least twice of his inappropriate behavior. Even after Sandusky’s raping of a child was officially reported to police in 2008, he got to spend another two full years with Second Mile.
What message was sent by so many different people, at so many levels– ranging from janitors to the President of the university, and from staff and leaders of a nonprofit to Child Protective Services itself–was sent to Sandusky?
This tragic story arrived coincidentally with my sociology classes examining the notion of the iron law of oligarchy, where an organization’s (and in this case, Paterno himself) power is concentrated in the hands of fewer and fewer people. Former Penn State player and current ESPN commentator Matt Millen said as much himself in an interview (//goo.gl/VmcMu), claiming that no one on the PSU campus was as powerful as Joe Paterno, save for the President. Yet, in examining the PSU administrative chart, football and athletics are nowhere represented. Tragic story, but relevant in the classroom.
I was so aghast at the students’ reaction to the Paterno firing, and I couldn’t help but contrast what they did with the noble behavior of the young people at Occupy Wall St. I think these Penn State students should think before they act and I wonder what they would feel like if it had been their own brother or nephew who had been sodomized by this sick man, and how that child is going to fee for the rest of his life. Misplaced, blind loyalty which results in violent behavior is a really, really frightening thing to witness.
We watch current events and I prepared the kids prior to watching. I tried to be careful in my words with my middle school students. I explained Jerry Sandusky is being accused of doing inappropriate things to a number of young boys.
I also tried to tie this in with our school effort to stop bullying. We discussed how other children would not have been abused if someone had spoken up and put an end to it. Sometimes our students are afraid to report incidents because they might be embarrassed or think they are a “snitch”. I thought it made sense to them that there is a need for others to speak up when we see others being mistreated.
I can’t believe that an assistant coach has to go on leave, while a long-time head coach, who failed to step up when children are being abused is supported. Shame on Penn State. I’ve always admired the program. Now I’m sickened.
By pure coincidence, I had begun the week with my 11-year-old son with a frank and open “sex ed” discussion (I am not a squeamish mom).
By mid-week the Penn State issue fully exploded, so it seemed necessary to me to put the two things together.
I explained about the issues involved (complex for a adult, so think of a kid!), which inevitably involved how kids get assaulted and how and why they don’t tell; because I think the mechanics of child sex assault are complex and need to explained more fully to kids than they are.
This is difficult for parents, since explanations involve discussions of things that you feel as a parent are beyond them and that injure their innocence. YET (!), if you don’t explain the mechanics (both physical and psychological) of what pedophiles actually do, then how will a kid know what’s wrong in a situation with a clever, manipulative and controlling figure of trust and authority?
[To wit, one Sandusky victim interviewed on CNN still hadn’t realized that Sandusky’s repeated hand on his thigh in the car had been a violation! And of course the more serious violations had been kept secret by who-knows-how-many boys…]
So we had discussions that were tough for me as a parent. Certainly my sons have been given all the standard talks, but this was more substantial than I’d ever given previously.
Thanks for the great teaching resources!
I appreciate writers like yourself using the horrific events that transpired at Penn State to bring awareness to the unspoken epidemic of child abuse and molestation! I am 57 year old and sustained physical, emotional and sexual abuse by people who were thought of as pillars in my community! In ultimately led to being raped at 13! I tried to tell someone and that person told me it was my fault and I should pray on it! I was terrified for years! I never told anyone for years, not even my husband of 32 years until 4 years ago! I have suffered with depression, feelings of inadequacies and fear! I have so many nightmares that I am afraid to go to sleep! I started seeing a counselor 1 1/2 years ago and have been diagnosed with PTSD! I have lived the terror of my abuse since I was 6. I hope the episodes at Penn State start a conversation and culture where people start opening their eye to this hidden epidemic. I hope it makes it easier for victims to come forward! I beg the media not to let the topic die when the dust of this scandal settles! We as a country canNEVER become complacent about this topic. Don’t let this be the sensational story of the day forgotten when the next big story comes along! Too many lives are at stake! The scars from abuse and molestation never fade. We victims try to cope, but always live looking over our shoulders with fear!
PC
I teach medical students at Drexel University and we spent some time in a small group session of first year students discussing this Thursday. The culture of medicine has many similarities to that of sports – teamwork where everyones’ performance is crucial, the leadership is often extremely intimidating and powerful and mistakes are humiliating – and fatal in our case. Medicine can foster the same “culture of complicity” where those lower on the team feel unable to approach leaders with mistakes or concerns out of fear. A doctor who engenders fear and avoidance in nurses and residents can be skilled and brilliant but a danger to patient care if underlings feel the need to hide mistakes or minimize problems.
Senior attendings need to defend people even when they are wrong so mistakes don’t compound themselves. One example could be if a second-year resident is concerned that the ureter may have been nicked during a routine hysterectomy but feels afraid to tell the attending. The culture has to be for the attending to be open and understanding, stop what is being done and go back to run the ureter and make sure it is patent, all as a matter of routine. The resident should be praised for bringing up the concern, not berated. That a student coach and janitorial staff were afraid to come forward with what they saw speaks volumes to the culture and autocracy at Penn State. I try to tell my students to be approachable by all members of the healthcare team – everyone from the unit clerk to the fellow should be able to come to you with a concern and not fear retribution.
With respect Tim I believe you have totally missed the real story and the media is not either willing, or is clouded by Joe Paterno’s impeccable reputation, to connect the dots to come to a full realization of the horror of what we are likely looking at here. The 2002 shower incident has by far garnered the most attention but I believe that the 1998 incident, which led to a lengthy police report detailing Sandusky admitting to showering naked with a young boy and likely touching and fondeling him, and the decisions made by Paterno and Penn State President Graham Spanier is by far the most important event in this scandal.
I believe that the most likely scenario following the completion of that report was that the DA and Chief of Penn State police met with Paterno and Spanier to discuss with them how they wanted this report to be released. Paterno was the most important and powerful man at Penn Stae and there is no way anything having to do with his football program would move forward without his knowledge and consent. It is unfathomable that a man who knew within 5 minutes that one of his players spit on the sidewalk downtown would not be a part of how this report moved forward. And this is where the light needs to be shed on this investigation.
Someone in that room decided that they didn’t want this report to be released, someone said “make that report disappear.” There is enough evidence in that report for the case to go to the grand jury 100 out of 100
times, but it didn’t go. Why not? Maybe they didn’t want the Penn State Football brand to be stained, maybe Paterno who had his strongest team in a decade-and maybe his last chance at a national championship-didn’t fell like he could do it without his genious defensive coordinator. Is that so hard to believe about this man as more and more of the details of this scandal come to light? Whatever the reason, they made a decision to bury that report and once they made that decision their future was inextricably tied to Sandusky’s.
Why? Because by covering up that incident and making that report “disappear” they made themselves complicit to and accomplices to any criminal acts committed by Sandusky in the future. Think about it, if the 2002 incident had been reported to the police the 1998 incident would have been brought back into light and answers would have been sought as to why that report had been buried. All those involved would be criminally complicit in the rape.
I believe this is the only scenario that makes any sense-do we really believe that Paterno’s only crime was that he didn’t do enough? Let’s look at the 2002 incident, Mike McQueary reports the incident to Paterno-okay-then we are led to believe that Joe Paterno, the king of all things Penn State, simply called his athletic director Tim Curley, a man who answered to Paterno not the other way around, told him what happened and left it at that. Does that seem likely? Or is it more likely that Paterno met with Curley and Spanier and said basically we need to bury this or we are all going down. Which is the more likely scenario knowing what we are all coming to know about this man and this program-not what we thought we knew.
Does it seem strange to anyone that Mike McQueary has kept silent about this? Forget that he didn’t go the police, he didn’t tell his friends? At the bar on Saturday night when someone brought up Sandusky, no “let me tell you something about that disgusting…” Would you tell anyone? Maybe someone sat this Graduate Asst. coach down and said something like “tell me Mike does Penn State football mean anything to you? It’s the most important thing in the world to you isn’t it and you wouldn’t do anything to hurt it, would you? You’ve got a big future here you know…” Oh yea, since that incident McQueary has risen from GA to Penn State’s national recruiting director and receiver’s coach-he is looked at as Paterno’s right hand man. Hmmm…
Let’s turn on the lights and see that the emperor has no clothes. Joe Paterno is not guilty of doing to little, of looking the other way, he is an accomplice to the sexual abuse, rape, and sodomy of countless young boys. Those of you who are defending Joe Paterno are good people, you are defending him because we all thought he was a man whose values were a beacon for us all. I understand that but we were wrong.
Paterno a scapegoat? He knew for years what Sandusky was capable of repeating with another victim. I read the grand jury report. Paterno turned his cheek. He deserves more than losing his coaching position. All the victims…are the fault of campus police? WHHATT? All of this is the fault of a sick man who used his position to manipulate and the fault of so many adults that did nothing or did something just to cover their butt. Anyone with knowledge of the abuse should do something and more until EVERY child is safe. Children depend on adults for safety. How can these adults sleep at night knowing that a young boy was physically and mentally tortured. Yes, our generation is a ME generation where football and ME, MYSELF, and I are more important than protecting an innocent child.
Their hope is that instructors and students can use the questions and links included on the page to help guide discussions of the issues raised by the Penn State sex abuse scandal.
Debbie Hawhee, Heather Adams, Michael J. Faris, and Mark Hlavacik are responsible for this collective act of writing and intervention. They made this in one day! Please share and use in your classrooms or conversations.
Students everywhere need to wonder whether tribalism and “absolute faith” have a place in their schools, and if so, what are the limits.
I’ve written three posts to help educators get at the key issues with their students:
(1) “What creates such a powerful interest in loyalty and stability that it completely over-rides the commitment to the best interests of children?” //speedchange.blogspot.com/2011/11/cultures-of-compliance.html
(2) “he rape of a ten-year-old was not enough for this 26-year-old, steeped in PSU’s concepts of loyalty, to over-ride his faith in a God-like Paterno and get him to pick up his phone. “McQueary locked eyes with the “boy” and Sandusky briefly and then quickly left the room” (says the Grand Jury report). What if he had seen a ten-year-old being stabbed to death? Would he still have walked away, gone home, talked to daddy and JoePa? And what about Paterno himself? What would McQueary have had to tell him to get him to dial 9-1-1? Maybe, “there are eight boys buried under our practice field”? How horrendous a crime would it have had to be for Paterno to move loyalty to Pennsylvania State University into ‘second place’?” //speedchange.blogspot.com/2011/11/teaching-of-tribalism.html (this links to Irish Taoiseach Enda Kenny’s speech on the Cloyne Report, 12 minutes your students should listen to.
(3) “We all need to look at our schools. Where has faith, belief, automaticity, replaced doubt, questioning, and conscious thought? And how can we undo that?” //speedchange.blogspot.com/2011/11/darkness-at-noon-saturday.html
I think that Joe Paterno should not of been fired. I think they should of let him finish the year. He was such a big coach and he made lots of money and could shut people up. Paterno told his superior about what was happening, which was what he supposed to do.
I think if a student is raped in school the teacher should get fined and go to jail. He should have told the authority so he might of kept his job. Paterno did in a way the right thing, but also the wrong by doing it himself.
Leaders such as coach and teachers and authorities play a big enough role in society too know what is wrong from right. The moral of the situation is that what Sandusky did was wrong at all costs, and disgusting too. Even if the situation was not under Paternos authority, when he saw that his boss and people who had higher power than him in the University, he should have taken it in too his own hands and went too the police. Despite that he didn’t go too the police when he heard of the situation many years ago, I don’t think he should have lost his job for it now because the higher authorities should have done something themselves.
Paterno has major athletic achievement and respect from all of Penn State, guaranteed. But, too gain all of that leadership and respect also comes a lot of responsibility. After bringing in millions of dollars too Penn State over the years he was a huge role model too athletes and other workers, and drew in many students too Penn State. Now the reputation of Penn State is bound too be ten times as worse as it would have been then because it has been covered up for so many years. Students won’t feel safe going there anymore if they think things like that can be covered up, and the school has created a bad name for itself now because no one felt it was necessary to speak up years ago. They only made it worse for themselves.
Joe Paterno was the Football coach at Penn State university. He was fired for the recent discovery of the sexual abuse scandal at Penn State. Paterno has a moral obligation to talk to authorities about issues in his program that involve legal issues. However Paterno was not the one committing the act so he should not have been punished as severely punished as he was. Paterno made a mistake by not calling the authorities, but he should not be the one being punished because he did go to someone and the president of the university swept it under the rug.
Paterno brings millions to Penn State every year. However he has a bigger responsibility than winning football games and bringing in money. Paterno’s responsibility is to show the young men he coached how to be good men through football. Paterno set a bad example to his players when he did not tell authorities about Sandusky raping of young men.
I feel that you put what is wrong before the program, yes it is a huge program with a fantastic reputation but these are young kids being raped. I feel that the kids come first and is much more important. If this was documented when it was first spotted there reputation would still be in tack. But since they have been holding this information inside for so long that it is now too late. As for Paterno he did the right thing in telling the presidents what happened. Joe should have noticed that still no action has been done and spoke up. But it is not his responsibility but it shows his morals and that shows allot. Joe has done nothing but great achievement for that school and for him to go out like this is sad. now his reputation is in jeopardy due to the fact the the higher authority did not take action after finding out about the incident. Enough is enough, 40 counts, well that is wrong. you cant let that kind of thing go on. very disappointing in the Penn State program. Skandusk should have been spoken too, fired and sentence to life in prison.
Joe Patterno was a leader of Penn State on and off the feild. He created a name for himself and the school he loved so much. As a leader who impacted the school so much, he had an obligation to correct what was going on at the school, rather than thinking of saving the reputation. Even if a case doesn’t fall under their authority, someone still has the power to stop a situation that shouldn’t be happening.
When it comes down to it, you can have achievements and respect you want, if you mess up once or don’t give information, people will turn on you in a second. With leadership comes high responsibility, and oyu have to be smart with those responsibilities.
yes! leaders do have the responsibility and obligation to take action in cases that do not necessary fall under their specific authority. If you seen actions with your own eyes you must still report them. Paterno is being criticized for something that he thought he left the oppurtuinity to Graham B. Spanier but yet spanier decided to let things be and not report them that has nothing to do with Paterno. Paterno did witness these action taken place but he did aware people so Paterno should have no lead in this.
No it is enough to have major athletic achievements and respect. Even though you should respect each individual under every circumstances i think that leadership does carry a higher responsibility.
In a leader position i feel as though you should have a responsibility and a moral obligation even to whats not under your authority, if something is going horrible wrong you cant just sit back and let it slide, that’s what Joe Paterno did. i give him some credit for telling his higher ups but after that didn’t work why would he not go to the authorities concerning sandusky’s actions, 40 counts is alot of reasons for Paterno to go to the police,i dont blame joe or feel he should have been fired but i do feel like something more should’ve been done. That being said i don’t understand the animosity toward Joe Paterno, he is a football coach, just because he is the face of Penn state doesn’t somehow make him responsible beyond his measures,hes just a person there are many things we don’t know, he didn’t keep it to himself he did tell someone so i feel like him being fired was the correct justice.
Although Joe Paterno reported what he saw to the Penn State president. He did take action but his responsibility shouldn’t have ended there. Yes, he fulfilled his obligation to report any illegal actions on campus but when the Penn State President chose not to take legal action Joe Paterno should have made the moral decision and go to the authorities. Legally, he fulfilled his obligation and therefore no longer hold any responsibility in the eyes of the legal system. In the eyes of morality his responsibility in the matter was not over just because he reported it to who he was supposed to. Everyone who knew about it should have reported it to legal authorities.
I understand, Penn State football is a huge organization. It brings in millions of dollars in revenue. It was so high up on the Totem Pole that it was seen as untouchable. The President felt that if word got out it would be disastrous. But what’s more disastrous the lives of dozens of young boys being ruined for the rest of their life or the reputation of a football team.
I don’t think that he should have gotten fired but he’s not completely innocent in the matter. He held a piece of the responsibility and should have contacted legal authorities.
First i would like to show my concern and sorrows to the helpless young victims who were effected by this horrible scandal. In my opinion as too coach Joe Paterno being fired , Im going to have to agree with the decision because a person with that much respect and power cannot let something so evil and horrible happen right under your nose and not do the CLEARLY right thing. I understand he told his higher enforcers but once he saw that the proper punishments were not being received he should of gone to the law directly. As a man i couldn’t imagine being told that ” someone saw the assistant coach raping a 10 year old boy in the shower”, this major problem should of been dealt with along time ago. Its just a moral obligation that Joe Paterno should of acted upon. His great athletic achievements and mutual respect should of pushed towards the issue being resolved and not swept under the rug for it to come out years after and now resulting in him being fired . Every action has a reaction and in this case the reaction is due to Paternos lack of action.
His friends appear surprised when asked why the prosecutor, Ray Gricar, failed to prosecute Sandusky for sexual assault of a child.
Then Gricar disappears and someone attempts to destroy the hard drive on his laptop computer. The computer at his home shows that someone in his home searched the query “how to wreck a hard drive,” creating the speculation that Gricar himself tried to “wreck” the hard drive of his laptop.
Might there have been child porn on that computer? Might Gricar, fearful that the contents would be discovered, have attempted to destroy his own hard drive? Would threats from those allied with Sandusky that they would disclose the contents of the hard drive have kept Gricar from prosecuting Sandusky?
Wednesday, November 16, 2011new york post comment
Do leaders have responsibility and moral obligation to take action in cases that do not fall under specific authority?
in my opinion i think that under certain situations it is right to take action. in Joe paterno’s case i believe he did the right thing by telling his superiors about the situation.
Is it enough to have major achievements and a great deal of respect?
in Joe paterno’s case he was Penn state football. he shaped the team to what it is today. some people see paterno as a “untouchable” figure in the Penn state sports system. Joe’s leadership was a big piece of this argument. McQueary saw Sandusky committing the crime. McQueary quickly told paterno. After Coach Paterno was notified he quickly went to the school president spaner. in my opinion paterno did the right thing by letting his superiors know what was going on.
Is it wrong to choose protecting an institution’s reputation over intervening to stop wrongdoing of some of its matters? Absolutely! what happened at Penn state was a absolute shame. it really is unbelievable that people would hide such a crude thing. overall in my opinion it is not right to cover up anything to save an institutions reputation. |
Q:
Deploying Django app using passenger
I can get through everything on their wiki - and then I'm lost. http://wiki.dreamhost.com/Django
I have a blank Django template, and whenever I try to change anything I get a 500 internal server error.
I have completely developed my django app locally and just want to host it online - figured it would be easy but am slowly learning that it is not.
I upload my app "videos" to this directory and then put it into the installed apps and ran "python manage.py syncdb", which finds no fixtures (which I Found odd).
From there, it just gets an internal server error.
Here is the error I am getting: http://tweettune.com/ and here is the error log:
[Wed Aug 24 01:49:15 2011] [error] [client 66.212.30.122] Premature end of script headers:
[Wed Aug 24 01:49:15 2011] [error] [client 66.212.30.122] Premature end of script headers: internal_error.html
[Wed Aug 24 08:16:40 2011] [error] [client 99.229.160.94] Premature end of script headers:
[Wed Aug 24 08:16:41 2011] [error] [client 99.229.160.94] Premature end of script headers: internal_error.html
[Wed Aug 24 08:21:38 2011] [error] [client 99.229.160.94] Premature end of script headers:
[Wed Aug 24 08:21:38 2011] [error] [client 99.229.160.94] Premature end of script headers: internal_error.html
[Wed Aug 24 08:27:41 2011] [error] [client 99.229.160.94] Premature end of script headers:
[Wed Aug 24 08:27:41 2011] [error] [client 99.229.160.94] Premature end of script headers: internal_error.html
I've been trying for 6 hours now and can not figure out what I am doing wrong. I suppose I just don't understand how to deploy an application at all - my thought process now is take my locally hosted app and replace all the files in the default django template online. I don't see why this should not work but it's not. I tried the "hello world app" example by using this code in my passenger_wdgi file and it works...
def application(environ, start_response):
start_response('200 OK', [('Content-type', 'text/plain')])
return ["Hello, world!"]
Any direction would be helpful.
EDIT: Here are the contents of my passenger_wsgi.py file which may be helpful (although it is automatically generated by dreamhost...so figured it would be correct).
import sys, os
sys.path.append(os.getcwd())
os.environ['DJANGO_SETTINGS_MODULE'] = "sotd.settings"
import django.core.handlers.wsgi
application = django.core.handlers.wsgi.WSGIHandler()
project_path='/home/tweettune.com/sotd/'
sys.path.insert(1, project_path)
A:
I had the same problem.
The solution was to add the folder of my application in the wsgi_passenger.py
import sys, os
sys.path.append(os.getcwd())
sys.path.append(os.path.join(os.getcwd(), 'include your apps folder here'))
os.environ['DJANGO_SETTINGS_MODULE'] = "cpc.settings"
import django.core.handlers.wsgi
application = django.core.handlers.wsgi.WSGIHandler()
This link was very useful to me:
http://discussion.dreamhost.com/thread-128918.html
A:
If using django>1.7 replace two last line with
from django.core.wsgi import get_wsgi_application
application = get_wsgi_application()
|
Screen time is independently associated with health-related quality of life in overweight and obese adolescents.
Excessive screen time and diminished health-related quality of life (HRQoL) are greater problems for obese than nonobese adolescents, but no research has examined the relationship between these two variables. This study examined the association between screen time and HRQoL in overweight and obese adolescents. A sample of 358 overweight and obese adolescents aged 14-18 years were assessed at baseline between 2005 and 2010 as part of the Canadian Healthy Eating, Aerobic and Resistance Training in Youth (HEARTY) trial. We used the Pediatric Quality of Life (PEDS-QL) and other self-report measures to assess HRQoL and screen time, defined as how long the 261 females and 97 males spent viewing TV, using the computer and playing video games. After adjusting for socio-demographic variables, adiposity, physical activity and diet, screen time duration was associated with reduced overall HRQoL (adjusted r = -0.16, ß = -0.16, p = 0.009) and psychosocial HRQoL (adjusted r = -0.16, ß = -0.18, p = 0.004), but not physical HRQoL. No differences were found between males and females. Screen time was associated with reduced overall and psychosocial HRQoL in overweight and obese adolescents. Future research should determine whether reducing screen time improves overall and psychosocial HRQoL in obese adolescents. |
Draft of Trump's Executive Order on Social Media Companies - cddotdotslash
https://twitter.com/byjacobward/status/1265864271138828289
======
mtmail
Related discussion of the Reuters story
[https://news.ycombinator.com/item?id=23334830](https://news.ycombinator.com/item?id=23334830)
|
Structural and functional characterization of a novel tumor-derived rat galectin-1 having transforming growth factor (TGF) activity: the relationship between intramolecular disulfide bridges and TGF activity.
Previously we demonstrated that overexpression of a beta-galactoside binding protein, galectin-1, caused the transformation of BALB3T3 fibroblast cells [Yamaoka, K., Ohno, S., Kawasaki, H., and Suzuki, K. (1991) Biochem. Biophys. Res. Commun. 179, 272-279]. We have now studied the structure-function relationship between the sugar-binding activity and the mitogenic activity of galectin-1 purified from an avian sarcoma virus-transformed rat NRK cell line, 77N1. The purified galectin-1 (t-galectin-1) had potent mitogenic activity in BALB3T3 cells, but no sugar-binding activity. Treatment of t-galectin-1 with 2-mercaptoethanol decreased its mitogenic activity, but resulted in the appearance of a sugar binding activity. Chemical modification of sulfhydryl groups in purified t-galectin-1 with [14C]-iodoacetamide suggested the presence of intramolecular disulfide bonds. MALDI-TOF mass spectrometric analysis of the native and reduced forms of the tryptic peptides from t-galectin-1 showed that t-galectin-1 has two intramolecular disulfide bonds (Cys2-Cys16 and Cys42-Cys60). These studies suggest that these intramolecular disulfide bonds of t-galectin-1 are essential for its mitogenic activity and that the different activities may be regulated by structural changes caused by intramolecular disulfide bond-breakage. |
Q:
Caching DNS returns SERVFAIL for NS record, but dig +trace disagrees?
This question is similar, but doesn't elaborate on the confusing case of a why a NS record cannot be obtained.
One of our caching DNS environments (RHEL 5.8, BIND 9.3.6-20.P1.el5_8.4) has ceased to return any useful data at all for a zone. Usually this sort of problem ends up being a stale NS or glue record, but in this particular case I can't seem to even get the cache to report a NS record for the zone.
dig @mycache somedomain NS returns SERVFAIL. There are no nameserver records cached at all.
dig +trace shows a healthy delegation path, with the final nameserver returning a response. Manually running the dig query against the final nameserver returns a valid NS record, the corresponding A record exists and agrees with the glue, etc.
What gives? Why is there no NS record for me to obtain from the DNS cache, not even a bad one?
A:
If there's no authoritative answer for a NS record, then there's nothing to cache other than the failure to determine the authority. This is what has been cached, and a server's in-memory information about lame nameservers cannot be obtained by a DNS client. (or rather, this is as close as you're going to get)
Usually you can identify a problem with stale nameserver records by comparing the NS record in cache to what you find on the internet, but in this case there is no authoritative NS record to to cache. Glue records are not authoritative in and of themselves; with no authoritative answer, there is simply no authoritative nameserver.
One of two things is usually happening here:
dig +trace is getting a stale answer for an intermediate nameserver from your local cache, and there really is a problem going on at the moment. I've covered this behavior in another question.
The caching server encountered NXDOMAIN or SERVFAIL when chasing glue records to find an authoritative nameserver, and this event has been cached. Even if the problem has been corrected, or the glue has been pointed somewhere else, the nameserver isn't going to try asking for it again until an internal timer expires. Requesting a cache purge for the zone in question will usually reset it.
The latter case is usually the culprit. If you want to be absolutely sure, it may be possible to dump your nameserver's runtime cache and view the glue in memory. (i.e. BIND's rndc dumpdb) Be advised that this is a very expensive operation unless you can limit the scope of the dump to a single zone, and generally something to be avoided in high load scenarios.
|
A permanent Democratic majority? Hispanic voters played a pivotal role in this election. If current trends continue, they may turn other parts of the country as blue as they just turned New Mexico.
Over the past eight years, as much of the country went firmly into either the red corner or the blue corner, New Mexico remained doggedly purple. In 2000, two of the state's three U.S. representatives were Republicans, as were its governor and one of its senators. But both houses of the state Legislature were run by Democrats, and Al Gore squeaked past George W. Bush in November, with a margin of fewer than 400 votes. Four years later, Democrat Bill Richardson won the governorship, but Bush captured New Mexico's five electoral votes, again by a small margin.
This year New Mexico didn't deliver any mixed messages. On Nov. 4, Democrats dominated at every level. Barack Obama beat John McCain, Tom Udall took an open Senate seat that had been Republican, and Martin Heinrich and Harry Teague took two formerly Republican House seats. And every one of them won in a landslide, with margins of 10 percent or more; Obama prevailed by 15 points, Udall by 22. New Mexico is now bright blue, with Democrats in nearly every elected statewide office, control of the state House and Senate, and an all Democratic congressional delegation.
Advertisement:
What happened? The long-promised Latino realignment may have become reality. Coveted by Karl Rove, courted by George W. Bush, the fastest-growing sector of the American electorate stampeded toward the Democrats this November. New Mexico is only the most striking symbol of a nationwide trend that helped flip as many as seven states and 85 electoral votes into Obama's column. Latinos formed their largest share ever of the national electorate, 9 percent, and their numbers are poised to increase in every election to come. They also voted by their largest margin ever for the Democrats, 67 to 31 percent. If that pattern continues, the GOP is doomed to 40 years of wandering in a desert.
In some of the purple and red states conquered by Obama last week, the degree to which Hispanic votes determined the outcome can be debated. Not in New Mexico. The bluing of New Mexico can be attributed almost solely to a change in the behavior of one demographic bloc. "If you look at the numbers, you'd have to say that it is because of the Latino vote," Cuauhtemoc "Temo" Figueroa, the Obama campaign's Latino vote director, says. "When you talk about New Mexico politics, it's not an afterthought, it's not an addendum, it is the discussion."
In 2004, according to exit polls, Hispanics made up 32 percent of the electorate there, and broke 56-44 for John Kerry over Bush. But Bush, buoyed by the white vote, managed to win by 1 percentage point overall.
By 2008, the Hispanic share of the electorate had increased by a third, to 41 percent, and voters in the demographic were much more Democratic, going 69-30 for Obama over McCain. That change by itself can account for almost all of Obama's advantage in the state, especially since the white vote stayed essentially the same (though whites' share of the electorate was down by 7 percentage points) and the African-American population is small. This shift can also account for most of Udall's margin in his Senate race, and for the Democrats' wins in the two House races. It also means that the Hispanic share of the New Mexico electorate finally approaches the Hispanic share of the state population, which is 42 percent. (And this despite dire warnings from some quarters about widespread vote suppression in New Mexico.)
Experts who spoke to Salon also credited the Hispanic vote with delivering Colorado and Nevada to Obama. Colorado added a Democratic senator and a Democratic representative this cycle, while Nevada added a House seat. In both states, the Latino share of the electorate grew 50 percent or more from 2004 to 2008, from 10 percent to 15 percent in Nevada and from 8 to 13 percent in Colorado. Nevada's Hispanic margins for Obama were especially lopsided, at 76 to 24, according to exit polls.
Fernand Amandi, executive vice president of Bendixen & Associates, a firm known for its polling of Hispanics, says that even Obama's wins in Indiana, North Carolina and Virginia should be credited to this demographic cohort. Figueroa doesn't wholly disagree -- he says that the Hispanic vote was "pivotal" in Indiana and "pivotal and determinative" in Virginia.
But the numbers were most striking in Florida, because of the history and unique nature of Florida's Latino electorate. For years, the state's Hispanic community was dominated by Cuban exiles, the devout Republicans crucial to the GOP's hold on the state's rich trove of electoral votes. This year, for the first time since such things began to be measured in the 1980s, Florida's Hispanics voted for a Democrat for president, and in large numbers too. In 2004, they went for Bush 56-44. This year, the result was almost the exact opposite; Obama took the community's vote, 57-42, and won the state.
Amandi says this change was the "largest swing of any demographic group in the country." He attributes it to the "rise of the non-Cuban Hispanic vote," an influx of people from other countries moving to Florida. (The Obama campaign made a special effort in the Orlando area, the center of the state's Puerto Rican community, a reliably Democratic bloc.) And as the exile generation ages and dies, the Cuban community is becoming less Republican too, Amandi says. Both trends bode poorly for the GOP's prospects in a swing state with 27 electoral votes.
Advertisement:
None of this means that Democrats can take the Hispanic vote for granted. In fact, the party's success this year comes in large part because it began a concerted effort focusing on Hispanics. Simon Rosenberg, the president of the New Democrat Network, which has been studying the changing electorate and especially the impact of the Hispanic vote, says, "Increased turnout happened because Democrats finally woke up to this Hispanic opportunity ... It's really only in the last few years that Democrats woke up to this new reality. If you're a Hispanic voter, particularly in the Southwest or the West, the Democratic Party sort of woke up and started to speak to you."
Figueroa, too, credits the success to organization. "I think we've learned from previous elections and we've learned from this election now that if you spend the resources and you pay attention to the community, you can win," he says. "The West in general is ripe territory for Democrats, and it's an area where you see not only the party structure investing huge amounts of resources in the West but progressive organizations investing a huge amount of time and money."
Assuming Democrats can keep up this momentum, a couple of big prizes await: Arizona and, yes, perhaps even Texas. The experts with whom Salon spoke were all but unanimous in saying that Arizona could be in play very soon, and that Texas could become a battleground within the next eight years and perhaps even by 2010.
"Whether in four years or whether in eight years, I do see potential there in Texas, because of just the sheer magnitude of the numbers, the Hispanic voters," Figueroa says. "But I think what has to happen in Texas is they -- 'they' meaning the party structure -- has to show they can put together an operation that can win. And 2010 would be a great example to show where they're at."
Advertisement:
If that happens, if Democrats can count on Hispanics to deliver the nine states, including those two, where their population is at or exceeds the national average, then the party would have a formidable advantage in every presidential election. Combined, those states represent 212 Electoral College votes. Add the dependably blue Northeast, and the Dems win the White House every time.
But just as Democrats can't take the Latino vote for granted, so can they not depend on the opposition to keep screwing up. For all the abuse heaped on him, Karl Rove saw the Hispanic juggernaut coming and tried to get the GOP ready. Rove had visions of appealing to Hispanics and thereby ensuring a political future for his party. And it almost worked, but then his fellow Republicans went nativist and mucked it all up.
"If the party doesn't embrace the kind of change that is out there in the way that our country's demographics are changing... they're going to relegate themselves to a permanent minority," says Dan Gurley, the Republican National Committee's field director during the 2004 election. "I think Karl Rove is absolutely right when it comes to where the party needs to be with the Hispanic community. I think he totally gets it, and the unfortunate thing is that a lot of people, a lot of the base of the party, don't."
There's an old political cliché: Demography is destiny. The Latino share of the national electorate has increased a full percentage point in each of the last two national elections. It will only increase more quickly in the coming years, since so much of the Hispanic population, 46 million strong, consists of the U.S.-born children of nonvoting immigrants. The country's changing demographics left the GOP with a choice -- prevent Hispanics from forming a reliably Democratic bloc or face what could be decades of minority party status. For the moment, the Republican Party has chosen poorly. Now it's time to face the consequences. |
/*
* delayTest.c:
* Just a little test program I'm using to experiment with
* various timings and latency, etc.
*
* Copyright (c) 2012-2013 Gordon Henderson. <projects@drogon.net>
***********************************************************************
* This file is part of wiringPi:
* https://projects.drogon.net/raspberry-pi/wiringpi/
*
* wiringPi is free software: you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published by
* the Free Software Foundation, either version 3 of the License, or
* (at your option) any later version.
*
* wiringPi is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public License
* along with wiringPi. If not, see <http://www.gnu.org/licenses/>.
***********************************************************************
*/
#include <stdio.h>
#include <unistd.h>
#include <sys/time.h>
#define CYCLES 1000
int main()
{
int x ;
struct timeval t1, t2, t3 ;
int t ;
int max, min ;
int del ;
int underRuns, overRuns, exactRuns, bogusRuns, total ;
int descheds ;
// Baseline test
gettimeofday (&t1, NULL) ;
gettimeofday (&t2, NULL) ;
t = t2.tv_usec - t1.tv_usec ;
printf ("Baseline test: %d\n", t);
for (del = 1 ; del < 200 ; ++del)
{
underRuns = overRuns = exactRuns = total = 0 ;
descheds = 0 ;
max = 0 ;
min = 999 ;
for (x = 0 ; x < CYCLES ; ++x)
{
for (;;) // Repeat this if we get a delay over 999uS
{ // -> High probability Linux has deschedulled us
gettimeofday (&t1, NULL) ;
usleep (del) ;
// delayMicroseconds (del) ;
gettimeofday (&t2, NULL) ;
timersub (&t2, &t1, &t3) ;
t = t3.tv_usec ;
if (t > 999)
{
++descheds ;
continue ;
}
else
break ;
}
if (t == del)
++exactRuns ;
else if (t < del)
++underRuns ;
else if (t > del)
++overRuns ;
if (t > max)
max = t ;
else if (t < min)
min = t ;
total += t ;
}
printf ("Delay: %3d. Min: %3d, Max: %3d, Unders: %3d, Overs: %3d, Exacts: %3d, Average: %3d, Descheds: %2d\n",
del, min, max, underRuns, overRuns, exactRuns, total / CYCLES, descheds) ;
fflush (stdout) ;
usleep (1000) ;
}
return 0 ;
}
|
1. Field of the Invention
This invention relates to a fabrication process of substrate, and more specifically to a method of making multilayer substrate by build-up process.
2. Description of the Related Art
Currently, the methods for use in forming multilayer substrate by build-up process mainly comprise the conformal mask self-limited drilling process and the photo-via process.
FIGS. 1-5 illustrate major steps of fabrication of a multilayer substrate by the conformal mask self-limited drilling process. FIG. 1 shows an interlayer circuit board 100 with two layers of conductor circuits formed thereon. Referring to FIG. 2, two resin coated copper foils 110 are laminated on both sides of the interlayer circuit board 100 by conventional methods such as thermocompression. The resin coated copper foil 110 mainly comprises an insulating resin layer 110a and a copper foil 110b. Referring to FIG. 3, a photoresist layer 120 is formed over the surface of the copper foil 110b laminated on the both sides of the interlayer circuit board 100 using conventional techniques and materials, then imaged and developed. As is well-known, a photomask is used to image only certain area of the photoresist layer 120 which, when developed, are removed to leave predetermined portions of the copper foil 110b exposed. Then the exposed portions of the copper foil 110b are etched so as to form fine holes at predetermined positions thereof. Referring to FIG. 4, the remaining photoresist is removed and laser beams are applied to the insulating resin layer 110a exposed from the fine holes of the copper foil 110b. A plurality of laser pulses are used to remove the exposed resin layer 110a until parts of the conductor circuits of the interlayer circuit board 100 are exposed thereby forming via holes. It is noted that each laser pulse has a energy density per pulse that is greater than the ablation threshold of resin layer 110a and less than the ablation threshold of the copper foil 110b. Subsequently, referring to FIG. 5, a copper layer 130 is plated over the entire surface of the copper foil 110b (including the via holes) for electrically connecting the conductor circuits of the interlayer circuit board 100 to the copper foil 110b. Plating in this step is typically carried out by electroless copper plating. The copper layer 130 establishes electrical connections between the copper foil 110b, the via holes, and the conductor circuits of the interlayer circuit board 100. Finally, an etch resist is formed on the copper layer 130, and then the copper layer 130 is selectively etched to form outer layer circuits (not shown).
FIGS. 6-10 illustrate major steps of fabrication of a multilayer substrate by the photo-via process. As shown in FIG. 6, a photoimagable dielectric (PID) 210 is applied onto the interlayer circuit board 100 by conventional methods. Then, the PID 210 is imaged and developed to form photo vias 210a at predetermined positions thereof (see FIG. 7). After that, a through hole 220 is formed by mechanical drilling or laser drilling (see FIG. 8). Subsequently, referring to FIG. 9, a copper layer 230 is plated over the entire surface of the PID 210 (including the photo vias 210a and through hole 220). Finally, an etch resist is formed on the copper layer 230, and then the copper layer 230 is selectively etched to form outer layer circuits (not shown).
However, the aforementioned build-up methods both use photoimaging and developing techniques to form the blind vias. Due to errors originated in the photoimaging and developing process, it is quite easy to have misregistration problems during via formation.
The present invention therefore seeks to provide a multilayer substrate manufacturing method which overcomes, or at least reduces the above-mentioned problems of the prior art.
It is a primary object of the present invention to provide a process for producing a multilayer substrate wherein the via holes are directly formed by mechanical drilling or laser drilling instead of photoimaging and developing thereby simplifying the whole process and avoiding the misregistration problems due to errors originated in the photoimaging and developing process.
Accordingly, the present invention provides a method of making a multilayer substrate comprising: (a) providing an interlayer circuit board having conductor circuits thereon; (b) forming a dielectric layer on the interlayer circuit board; (c) mechanical drilling (or laser drilling) through the dielectric layer to the conductor circuits at predetermined positions thereof so as to form via holes; (d) electrolessly plating a conductive layer on the surface of the dielectric layer and the via holes; (e) forming an etch resist on the conductive layer, followed by formation of outer conductor circuits on the conductive layer by selectively etching; and (f) removing the etching resist.
Typically, the mechanical drilling (or laser drilling) has better accuracy, so the via holes are formed with better accuracy. Furthermore, since the via holes are formed by drilling instead of photoimaging and developing, the processing steps of the method in accordance with the present invention are minimized thereby significantly improving the production efficiency. |
Christine Lagarde, managing director and chairwoman of the International Monetary Fund (IMF), has encouraged the exploration of a central bank digital currency (CBDC) in the light of decreasing demand for cash and rising preference for digital money.
In a prepared speech for the Singapore Fintech Festival on Wednesday, Lagarde said:
“I believe we should consider the possibility to issue digital currency. There may be a role for the state to supply money to the digital economy.”
Various central banks around the world are “seriously” considering the issuance of digital currency, she said, including Canada, China, Sweden and Uruguay. “They are embracing change and new thinking—as indeed is the IMF.”
Lagarde noted that major cryptocurrencies like bitcoin, ethereum and XRP, are also “vying for a spot in the cashless world, constantly reinventing themselves in the hope of offering more stable value, and quicker, cheaper settlement.”
Continue Reading on CoinDesk
Like this: Like Loading... |
Pahlaj Nihalani, the Central Board of Film Certification (CBFC) chief, is in the news again. This time for imposing strange restrictions on a documentary, An Insignificant Man. Directed by Khushboo Ranka and Vinay Shukla, An Insignificant Man is centred on the formation of an alternate political force, the Aam Aadmi Party (AAP), helmed by activist-whistleblower-turned-politician Arvind Kejriwal. Nihalani has told the filmmakers to obtain the no objection certificates (NOCs) from the prominent politicians featured in the film – Kejriwal, ex-Delhi chief minister Sheila Dikshit, Narendra Modi – and delete six references to the BJP and the Congress. Talking to The Wire, Ranka and Shukla said they oppose the CBFC’s demands, calling them illegal and unethical, remaining determined to fight for their film’s theatrical release.
Excerpts from the interview:
The CBFC has censored many films on frivolous grounds, ranging from profanity and homosexuality to duration of kisses. But An Insignificant Man is a political documentary. Were you apprehensive before approaching the censor board?
Ranka: We were on two extremes. We thought they’ll either outright deny [the certificate] on some strange ground, like they’re prone to, or they’ll grant us the certificate. So we were looking at both the possibilities. We had even spoken to a lot of people. We speak to [documentary filmmaker] Anand Patwardhan quite often and he said, “You won’t have any problem at all.”
But now it’s neither here nor there. They said that, “We’ve passed your film, just get us these things [the NOCs from Kejriwal, Dikshit and Modi], and beep out the Congress and BJP from six places.” We don’t think those NOCs are a justified demand. And secondly, beeping out the name of political parties is strange. Like, why would you ask us that?
It’s like beeping Punjab from Udta Punjab.
Ranka: Yes, and that’s what we’ve been saying. So basically, they laid out impossible demands, which effectively bans the film. And not just impossible, they’re also illegal and unethical. Illegal because the Cinematograph Act doesn’t have any condition for mandatory NOCs. There’s no precedent. There’ve been documentaries which have never been asked for an NOC. Anand Patwardhan has never been asked for an NOC. I spoke to Kamal Swaroop [the director of The Battle of Benaras],and he said he was never asked for an NOC. His film was just banned. So there is no consistency.
It’s also unethical because politicians are in the public domain; they are the most powerful people. So, if anything, they should be subjected to the highest scrutiny. Again, if the censor board had a problem with us misrepresenting facts, presenting fake news or getting into a sub judice matter, then we’d be okay with that. But they don’t have those problems. So essentially they want us to take permissions from politicians who are being critiqued.
You first applied for the certification in February, screening the film for the censor board’s examining committee. What was communicated to you after it?
Shukla: It was pretty Kafkaesque. Usually they see the film and tell you what the problem is: what needs to be cut, what needs to be changed. In our case their discussion went on for an hour after the screening – so much so that they took a break. Then we went in and they told us in a very bureaucratic language that we’ll not speak to you about the film. We said, “Do you have any problems with it? What does this mean?” They replied, “We’ll let you know our problems in a letter.” So we said, “The two of us are here; it’s a forum where filmmakers can represent their concerns and so can you, so before anything, let’s talk about what it is that’s bothering you.” They said, “We just won’t speak to you.” And just as we were moving out, one of the censor board committee members goes, “But, everything aside, it’s a great film.” And then the room falls silent again. So it was quite strange for us, because we weren’t sure what’s happening. Then nearly ten days later, we got a letter from them, which said, “Your film has been referred to the revising committee by the CBFC chief, Mr Nihalani”, and we were asked to pay the application fee, completely bypassing any reasons for why they had referred it to the revising committee.
The letter did not specify a reason?
Shukla: No. The first letter, which said that the film is going to the RC [Revising Committee], didn’t give us any reason. So we thought this is strange. We asked various people what we should do from here on. And everyone said that it’s a protocol to give a reason. So we went and met the various officials at the CBFC office. All of them said, “Yes, we usually give reasons, but in this case we don’t know, you’ll have to speak to Mr Nihalani.” I went to meet with Mr Nihalani in February and I told him, “The process of reapplication is expensive. There are so many partners in the film, people have put their money; everyone wants to know what is happening exactly. So if you could tell us your concerns, it’d be helpful in communicating to everyone.”
And he said, “I’m not obliged to give you any answers or clarifications. You do whatever you want.” Then he called his peon and told him to escort me out. So it seemed completely uncalled for – the way the board behaved. We wrote them a formal letter, asking what Cinematograph Act clauses we’re violating. In reply to that letter they sent us the first letter, which had no reasons.
Finally, we applied for the revising committee screening and were told to get the NOCs, and beep out the names of the Congress and the BJP.
Nihalani’s been criticised for his politically-motivated decisions. The Udta Punjab case is well known. (“I’ve heard Anurag Kashyap has taken money from AAP to show Punjab in bad light,” Nihalani had said then.) In a recent film, Sameer, he wanted the line “Mann ki baat” to be removed, because it’s the name of prime minister’s show. He’s called himself a “proud Modi chamcha”. In such a scenario, what do you make of Nihalani clamping down on a documentary on Kejriwal, the opposition leader?
Ranka: After they saw the film, and this happened during the examining committee screening too, they’d leak the news to the media. So even before we had any official communication from them, it’d get out. In this case also [the revising committee screening], we had started seeing reports and one of them mentioned that he had asked for an NOC from Kejriwal because he thought it’s “potentially damaging” to his reputation. So there’s that.
Also, is it up to him to protect the reputation of people and politicians? And secondly, when it comes to a politically-motivated [censor board], as filmmakers who have made a political film, we’ve consciously stayed away from talking about it, because we don’t want to make it into a polarising this-party-vs-that-party debate. We want people to see the documentary in a critical way. Those who watched the film have had wildly different readings and we’d like it to be that way.
Two more documentaries have been banned under Nihalani’s tenure. The Battle for Banaras, which documented the electoral tussle between Kejriwal and Modi in the 2014 Lok Sabha elections, was denied a censor certificate. (Nihalani called it “pro-Kejriwal in the way it’s been shot”.) Then En Dinon Muzaffarnagar, an investigative piece on the 2013 Muzaffarnagar riots, was embroiled in a censorship battle for nearly two years. Do you think the future of investigative documentaries – especially when they’re political – faces a threat in this country?
Ranka: I understand what you’re saying, but even the past has been like this. You’ve films like Kissa Kursi Ka, you’ve seen Aandhi, even Anand Patwardhan’s documentaries. So the future and the past and the present of [political films] are equally… it’s difficult to make political films, and that’s why there’re so few of them. And that is why the reform has to come from a legal space. All the decisions that Pahlaj Nihalani has made have been overturned by the FCAT [Film Certification Appellate Tribunal], which means they were not legally sound. So basically you’ve this guy who is continuously making whimsical and random decisions, which then the filmmakers have to fight in court.
Shukla: The censor board – in any case, any scenario – should not be acting as the political outpost of any party or politician.
Ranka: Or ideology.
Shukla: Both of us understand your concerns about the rising censorship. But the current didn’t start from this administration; it’s been coming a long way. That’s the reason we don’t see any political films.
Ranka: But I definitely feel things have become more whimsical since Pahlaj Nihalani has come. His decisions are completely random and absurd.
An Insignificant Man chronicles the rise of AAP and Arvind Kejriwal – a story that unfolded in 2013. As we know, that story has markedly changed since. Are you concerned that the delays caused by the censor board will make the documentary dated?
Shukla: We have to delink the idea of documentary from the idea of contemporary news. Our film is a more long-form meditative look at these activists who decide to become politicians and then what happens. Of course, the contemporary reality keeps changing, the stories of people whom you’re documenting keeps changing, but we take great solace in the fact that whenever people see the film, they walk away with more questions and curiosity, and not less.
At the same time, there’s a pressure of getting the film out as soon as possible. No film can exist in its cocoon forever, saying whenever it’ll go out it’s fine. And Mr Nihalani has put us in a difficult position, considering how much time it has taken and how much time it’s going to take from here.
What’s your next course of action? Will you be applying to the FCAT?
Ranka: We’re in the process. And it takes time with the FCAT proceedings. So we’re trying to figure out what we should do in the meantime. A lot of people are saying that we should release it online, which I understand, but it’s almost like saying, “This isn’t worth fighting for, because you can release it online.” That’s a bit myopic. Even if we can release it online, the whole point is that it shouldn’t be so difficult to get a censor certificate. |
Women Louis Vuitton Monogram Vernis Bellevue GM Wine Red M93589
$229.99
Size
18.1*10.2*7.5
Quantity:
Unit(s)
replica monogram vernis sale at cheap price from our online store. the high class of the cases can match with your precious louis vuitton monogram vernis bellevue gm wine red m93589. it is made from house classic material with a delicate design taht shape it more eye-catching.there is no doubt, this louis vuitton monogram vernis bellevue gm wine red m93589 will be the most warmly welcomed accessory.Size:18.1"*10.2"*7.5" |
Q:
Hide source script PowerShell GUI
We can convert a PowerShell script to an executable exe file using the PS2EXE-GUI. We have an exe file now. All is well. The resulting exe file is a .Net assembly containing the Base64 encoded source script. This means that the code is not hidden. It can be easily restored back with the key -Extract:
Script.exe -Extract: 'Script.ps1'
Does this mean that I cannot create a shell where the source code will be completely hidden? Of course we are not talking about assembler. Are there any ways to hide the PowerShell source code in GUI exe file? Thanks
A:
In the end, this would than be a reversible encryption because the script engine requires to interpret it.
And a reversible encryption (based on a symmetric key algoritm) is weak, see also: Is it possible to securely store passwords using reversible encryption?
Quote:
The primary weakness of reversible encryption is simple: if the key is compromised, the encrypted data is compromised, period.
Which means that it is essentially the same as hiding it behind a Base64 encryption.
As soon as the encryption gets popular, it will be hacked, and you will find online decrypters on the web as what happened with the VBScript .vbe encryption.
In other words, if there is anything specific in your script you need to hide (like a password), you should look into other directions, e.g.: run the script under different credentials, prompt for a password, or simply give the user (limited) rights to the concerned application (which you effectively do by supplying the script).
|
S Y N O P S I S
1810 England, the height of the Napoleonic wars. It was thought that humans walked the path of enlightenment leaving monsters and dark things behind. However, those monsters and night stalkers merely hide in the darkness, as a young maid, Bernadette, soon finds out.
@makishal: Yeah, Baten Kaitos was definitely a unique experience, really enjoyable. Voice acting could have used some work in some areas, but I think that a lot of it added to the game, despite being sub-par.
Glad you enjoy the comic and I hope you continue to do so. |
"I didn't waste any more time -- I called her right away, and she put me on the phone with (Dolphins general manager) Jeff Ireland, and he got me on a 2:30 flight, and my sister started helping me (get) as much as I could into a suitcase. For all I know, I was minutes away from missing out on my big chance." |
[Hospital-acquired anemia: Facts, consequences and prevention].
Hospital-acquired anemia is common, especially in the most critically ill patients. It may be associated with poor patient outcomes. It may result from increased blood loss, impaired red cell production or reduced red cell life span. Multiple associated factors may contribute simultaneously or sequentially to the decrease in hemoglobin level. Some of them are related to the underlying disease and others are iatrogenic. Clinicians should be aware of the importance and consequences of iatrogenic anemia caused by diagnostic blood sampling. Strategies and measures to minimize iatrogenic blood loss should be prioritized. They may reduce the risk of developing anemia and then red blood cells transfusion requirement. |
Use of electrical vehicles is becoming increasingly popular due to the environmental benefits of removing pollution caused by fossil fuel burning vehicle engines from the environment, especially in densely populated urban environments. As with most mobile electrical devices, electrical vehicles carry electrical energy storage devices or batteries, which supply power to the vehicle propulsion and other systems. As can be appreciated, the vehicle batteries require recharging after usage.
At present, electric vehicle recharging is accomplished by connecting a recharging connector into a vehicle receptacle manually. The vehicle receptacle is usually located in the same or similar location as a vehicle fuel fill spout. Such locations are protected by doors or lids, much in the same way vehicle fill spouts are protected from environmental elements, dirt and road debris. However, with the advent of automated electric vehicle recharging systems, the vehicle charge receptacles may be located elsewhere in the vehicle, including areas that are commonly inaccessible to users such as beneath the vehicle. |
Cookie Shelter jewelry but accessories contain contemporary Evening Dresses 2012while offering classic designs. Its flippa's sales catalog moments unique and complete affordable ties collection. As a consultant in that jewelry producer, you will certainly enjoy the advantages of working even both at home and achieve success. You are selling and offer the products for the buyers into whatever strategy you believe is lucrative making commissions.
Dessert Lee Jewelry piecies are targeted, fashionable and stylish and most importantly, affordable and should perfectly match all ages group. With the variety of choices open up, women and want to men are able to have limitless lineup of style jewelries. Because jewelry piecies are womens friend, they not really cease to search for whats very first time and whats fad. This is what makes Cookie Lee is the fact that in a hurry to have the ever slashing demands and he tastes of your buyers. There are several brands an cater likewise elegant gems. But quality-wise, Cookie Shelter collection is one of them the most beautiful options.
Included with fashion, these accessories serve to match and complete Prom Dresses 2012perfectly trim any corner and any special occasion. So anyone who would like to stand from the crowd could use them for just class and just attitude into their persona. Regardless of the occasion, there is the ideal rings piece that can suit the requirements. Whether it actually is for festive outdoors, professional functions, marriages, night outs, whatever it's very, there are a lot of available jewelry that will help complement its taste.
Not style , fashion, Cookie Shelter offers good home business opportunity to ladies who wanted to generate, own their own unique business, while not just staying acquainted with the infants. If you are not sure of this but interests you becoming a sales person, this article offer you a basic review of what you get and learning about owning copying jewelry restaurant. If you feel a sales person, you can be used earn 50% of each item that you could sell. This is completely lucrative and because of this , why a lot more are taking thing about this profitable possibility.
Before being an independent rep, you do have to pay original Quinceanera Dresses 2012startup cost and you have got to go for $300 value of products per year, which is responsible for $25 in a blue moon. And next, you sell as many as you want a person can host if they shows as you would like. This greatly depends upon how drastically you are prepared to shell out how darn you are prepared to earn. On average, an run of the mill show has been said to will offer about $400-$500. In this case, your sale is dependent how good anyone else at offering and communication.
In accessory, Cookie Shelter jewelry consultants is also known to earn 50% internal building distributors. This ensures that, the more and more people you're about to recruit, the any more your downline will continually be and the more that you will generate. However, a problem at worth it setup is always that since these products are gave beforehand, many will not to financially begin the facilities. But even if you are a reputable sales distributor and you have large inventories, there is no requirement for a minimum demand for sales or the quantity of recruits to grasp because you have established your organization and is up into your arms to make it grow and of course expand harder.
Get a fresh fashion internal Cookie Shelter jewelry at Home based jewelry on youtube. Discount bills await your body. Browse all the comprehensive rings selections and spend less! |
344 U.S. 178 (1952)
MONTGOMERY BUILDING & CONSTRUCTION TRADES COUNCIL ET AL.
v.
LEDBETTER ERECTION CO., INC.
No. 43.
Supreme Court of United States.
Argued November 13, 1952.
Decided December 8, 1952.
CERTIORARI TO THE SUPREME COURT OF ALABAMA.
Herbert S. Thatcher argued the cause for petitioners. With him on the brief were J. Albert Woll, James A. Glenn, Joseph E. Finley and Earl McBee.
*179 By special leave of Court, Mozart G. Ratner argued the cause for the National Labor Relations Board, as amicus curiae, urging reversal. With him on the brief were Acting Solicitor General Stern, Marvin E. Frankel, George J. Bott, David P. Findling and Bernard Dunau.
Jack Crenshaw argued the cause for respondent. With him on the brief was Files Crenshaw.
Arthur J. Goldberg filed a brief for the Congress of Industrial Organizations, as amicus curiae, supporting petitioners.
MR. JUSTICE MINTON delivered the opinion of the Court.
The respondent filed a bill in equity in the Circuit Court of Montgomery County, Alabama, to enjoin certain picketing activities, wholly peaceful, carried on by the petitioners, labor organizations. Upon the sworn bill and without notice, the court issued forthwith a "Temporary Writ of Injunction." The petitioners appeared and filed an answer and a motion to dissolve the injunction on numerous grounds. Subsequently, the petitioners withdrew their answer and most of the grounds assigned for dissolution of the injunction and filed new grounds therefor. The motion to dissolve was denied, and from this order of the court the petitioners appealed to the Supreme Court of Alabama, which affirmed the order of the trial court. 256 Ala. 678, 57 So. 2d 112, rehearing denied, 256 Ala. 689, 57 So. 2d 121. Certiorari was sought here and granted, 343 U. S. 962.
At the very threshold, we are presented with a question of jurisdiction. This Court may grant certiorari from a judgment or decree of the Supreme Court of Alabama, the highest court in the State, only if the judgment or decree is final. 28 U. S. C. § 1257. Was this a final judgment or decree?
*180 From the earliest days, this Court has refused to accept jurisdiction of interlocutory decrees, such as is involved in this case. In Gibbons v. Ogden, 6 Wheat. 448, the first case presenting this issue to this Court, an injunction had been granted by a Chancery Court of the State of New York. The defendant answered and moved to dissolve the injunction. The court denied the motion to dissolve, and the defendant appealed to the Court for the Trial of Impeachments and Correction of Errors which affirmed. The appeal to this Court was dismissed because there was no final decree in the court of last resort for this Court to review.
The provision of § 1257 that only "Final judgments or decrees rendered by the highest court of a State in which a decision could be had, may be reviewed by the Supreme Court . . ." has been carried in almost identical language since the Judiciary Act of 1789, 1 Stat. 85, § 25.
"This requirement is not one of those technicalities to be easily scorned. It is an important factor in the smooth working of our federal system." Radio Station WOW v. Johnson, 326 U. S. 120, 124.
The distinction between a preliminary or temporary injunction and a final or permanent injunction was elementary in the law of equity. The classical concept was at once recognized and applied in Gibbons v. Ogden, supra. There is no room here for interpretation. The rule remains unchanged.
True, as long as a temporary injunction is in force it may be as effective as a permanent injunction, and for that reason appeals from interlocutory judgments have been authorized by state legislatures and Congress. But such authorization does not give interlocutory judgments the aspect of finality here, even though we may have inadvertently granted certiorari. Baldwin Co. v. Howard Co., 256 U. S. 35, 40.
*181 It is argued that if this is not held to be a final decree or judgment and decided now, it may never be decided, because to await the outcome of the final hearing is to moot the question and to frustrate the picketing. However appealing such argument may be, it does not warrant us in enlarging our jurisdiction. Only Congress may do that. Furthermore, the interlocutory decree could have been readily converted into a final decree, and the appeal could have proceeded without question as to jurisdiction just as effectively and expeditiously as the appeal from the interlocutory injunction was pursued in this case.
Since there was no final judgment of the Supreme Court of Alabama for review, the writ of certiorari must be dismissed as improvidently granted.
It is so ordered.
MR. JUSTICE DOUGLAS, with whom MR. JUSTICE BLACK concurs, dissenting.
The question presented is the power of the state court to issue a temporary injunction in this kind of labor dispute. If petitioners had sought mandamus or another appropriate state writ directed against the judge who issued the temporary injunction, I should have no doubt that it would be a final judgment which we would review. See Bandini Co. v. Superior Court, 284 U. S. 8, 14. Cf. Rescue Army v. Municipal Court, 331 U. S. 549, 565. I see no difference of substance between that case and this. The mischief of temporary injunctions in labor controversies is well known. It is done when the interlocutory order is issued. The damage is often irreparable. The assertion by the state court of power to act in an interlocutory way is final. Whether it has that power may be determined without reference to any future proceedings which may be taken. Unless the rule of finality is to be *182 purely mechanical, which to date it has not been (see Radio Station WOW v. Johnson, 326 U. S. 120, 124), we should determine now whether the National Labor Relations Act permits a state court to interfere with a labor controversy in a way, which though interim in form, irretrievably alters the status of the dispute or in fact settles it.[*]
NOTES
[*] This "practical" rather than "technical" construction is as necessary here as it is in cases involving appeals from "final decisions" in the federal system. See Cohen v. Beneficial Loan Corp., 337 U. S. 541, 545-546.
|
2006-05-30
The Four Wheel Drive Club and the Nuwara-Eliya Motor Sports club organized the anual off road challenge on the 17th of April at Nuwara Eliya. We (me and my brother Sanjaya) missed the last similar event organized by the Land Rover Owners club at Waters Edge, so we were very keenly looking forward to this one. And we also made arrangements to provide a live update of photos over the Internet.
We drove to have a look at the driving range in the late evening of the 16th. Some members of the club were doing final preperations. We had a brief survey of the area with the dim streatlights from across the lake, and returned to my uncle's place where were were staying.
We got to the rally area at around 8 next morning. A long row of "jeeps" were already lined up. The climate was sunny and bright, but the general trend was to rain in the evening. We also met Asantha, our friend in the 4x4 club, who hooked us with Lasantha, the DJ of the event, and we could share the electricity supply with him. Lasantha was very talented at his job, and was always willing to give us a helping hand throughout the event.
I connected the laptop to the Internet through GPRS/IR using the IR drivers in the Linux kernel, irda utilities and GPRS Easy Connect. The connection was not very fast, but satisfactory. The Flickr plugin in KIPI used by Digikam was a very convenient way to upload images.
Sanjaya was taking photos, and I was uploading selectively as they arrived. It was difficult to capture all the interesting things hapenning all over, so he ran from one place to the other, and back again, and so forth. My Canon PowerShot A70 was faulty, so this time we had borrowed a Fuji (don't remember the exact model) from a friend. It was also not an SLR, but had a 10x zoom which was very useful. We had two memory sticks, and could swap them without keeping one of us waiting for the other. By the way Sanjaya's photograph shown here was taken on the next day, as the ones I took during the event was not very clear. :-(
The morning continued to be bright and sunny, and the event progressed merrily. The obstacles were of varying degrees of difficulty, and carried points accordingly. Sanjaya was worried that still photos didn't capture the dramatic effects in clearing them. For example, a Nissan Patrol, which was doing really well, was airborn for a second or so at an unexpected moment, and Sanjaya found himself too late to capture it while in the air. A video, on the other hand, whould have done justice in capturing everything that came to pass.
By early afternoon, the sky started getting darker, and eventually rain set it. The organizers first decided to select the "top 10" from the already finished obstacles and hold a timed event, but later that plan also had to be cancelled. We stopped uploading images and started wondering around to see closely how the competitors were showing off "freely" on the track.
And what a showing off it turned out to be! The attaction was a muddy hole. One after the other, competitors started attempting to clear it in different ways. Some were successful, and some weren't, and the (friendly) reaction of the audience was in compliance with the outcome of each attempt. ;-) Slippery conditions in the middle of rain added another layer of difficulty, but the sheer courage of the competitors was amazing.
By late evening, we remembered that both of us didn't eat nor drink anything for the whole day and hunger and thirst started setting in. So we decided to return home at around 6 in the evening, and had a refreshing meal. After a short nap, we started to drive to Colombo at around 9.
Then we had the last, and the worst, adventure of the day. Our petrol tank was far from empty, but we knew that we can't make it to Colombo with what was left. So we wanted to fuel the Jimny as soon as possible before it becomes a crisis. But the gas stations in Thalawakele, Kotagala and Hatton were all closed, and the matter was alowly becoming a crisis. By about Ginigathhena, we could travel only about 10-20 kilometers more before we start going on the reserve.
So we had to make a decision. We knew that the distance from Ginigathhena to Nawalapitiya was 12km, and we would definitely make it to Gampola from there. But if we can't find petrol in Gampola, then the journey from there to Peradeniya, where Sanjaya was certain that we can find the gas station to be open, was a risky one. But we decided to take the risk. We also first tried to contact some friends in Gampola to find a bit more petrol to reduce the risk, but later decided not to wake them late in the night.
And we were lucky. We could reach Peradeniya, and the gas station was open. And it was around 3 in the morning when we finally reached our lodgings in Colombo.
Images Sanjaya captured during the event are available on my flickr gallery. |
Northern European Bank Nordea Confirms Bitcoin Ban for Employees
As News.Bitcoin.com learned two weeks ago, one of Europe’s largest banks, Nordea, will enact a company-wide policy to effectively ban its employees from owning or trading in cryptocurrency. Citing risks and perhaps looming regulation, the bank decided to act preemptively.
Also read: Whistleblower Details Big Bank’s Plans to Prohibit Employees Owning Bitcoin
Nordea Bank Bans Bitcoin for Employees
Most of the 31,000 Nordea Bank employees by Spring won’t be allowed to own or trade in cryptocurrency, according to a bank-wide policy to be enacted at the end of next month. One of Northern Europe’s largest banks, Nordea has had a tenuous relationship with bitcoin over the last few years. Its present executive team is on record as either being dismissive or openly hostile to decentralized digital currency.
Barely two weeks ago, a company whistleblower reached out to News.Bitcoin.com to explain the bank was indeed considering such a move, upsetting some employees. This week the bank confirmed to mainstream media sources such as Reuters and Bloomberg the policy was indeed being enacted.
Nordea spokeswoman told Reuters by email, “The risks are seen as too high and the protection is insufficient for both the co-workers and the bank.” Employees who hold the currency as of the ban won’t be asked to sell them. The bank is, however, recommending they do exactly that, sell.
The bank explained to Bloomberg, “Given these high risks, and in line with our role in the banking industry to maintain high standards of conduct, Nordea is not supportive of staff investing in cryptocurrencies,” citing the standard worries about volatility and supposed criminal usage.
Clients and Rivals
Nordea was forced to address the issue of advising clients who’re interested in the crypto boom, insisting, “it’s important to emphasize that it is not something we recommend our customers to invest in. Just like every other bank trading platforms, Nordea Investor provides access to trade all securities listed on, for example, Nasdaq,” meaning “self-services customers can purchase cryptocurrency-related products through the platform, but it is important to emphasize that it is not something we recommend.”
Without much fanfare, large Northern European rival, Danske Bank, has done roughly the same sans complete prohibition: “We’re skeptical toward cryptocurrencies and are advising our employees not to trade them, but we don’t impose an actual ban. We’re currently analyzing the situation and time will tell whether there’ll be a formal ban.” As for its clients, “Due to lack of maturity and transparency in the various cryptocurrencies, we have decided not to provide trading of such securities on our various investment platforms,” Danske clarified.
Still, some experts view such seemingly drastic moves as really just banks hedging against inviting regulators to crackdown on the industry. Nordea’s ban, then, could be seen as less a blow to cryptocurrency and more a boon to self governance.
Whatever the case, Nordea’s exact way to monitor its employees was not revealed.
What do you think of bank employees being banned from crypto? Let us know in the comments section below.
Images courtesy of Pixabay, Nordea.
Not up to date on the news? Listen to This Week in Bitcoin, a podcast updated each Friday. |
You Can Now Wear Legos. On Your Face.
Fashion designers Agi & Sam unveiled a unique look over the weekend during the London Collection fashion show when they sent models out with Legos attached to their faces, although it's unclear just how the Legos remained on their mugs.
Take a gander for yourself to see if this a style you think will, ahem, stick. |
Q:
TornadoFX: Label text not updating
One of the issues I'm currently experiencing is that I can't seem to change the text of a Label which is implemented in a dynamically loaded AnchorPane. I assume this might be related to the controller and how JavaFX/TornadoFX works, but I can't seem to find what I'm doing wrong.
The issue itself occurs in this class, and happens in the showSystemDetails() method. What I would expect to happen is that upon pressing the "System Details" button in the sidebar, the labels would update to the required value, but this isn't happening for some reason.
Please feel free to point me to what I'm doing wrong, or provide any constructive criticism. The project is still in full development so a lot of things are still messy/broken.
A:
The reason this isn't working is that you're manually loading a new version of the FMXL file every time you select something in your menu. The FXML file originally loaded by SystemDetailsViewProxy is updated correctly, but that's not the one you're showing on screen anymore.
To see the updated View, make sure you put the root node of the SystemDetailsViewProxy instance back.
You could for example change your DrawerMenuButton enum to contain references to SystemDetailsViewProxy::class instead of those two strings, and use add(viewClass) to add the correct root node to your view when clicking the menu buttons.
Furthermore, you should be using ViewModels and binding instead of manually updating the text property of the labels. You're doing an awful lot of manual/error prone work that the framework can help you with for free.
Your application is not using best practices in several important areas, and you're rolling your own solutions for stuff that the framework already does very well :)
Views are singletons when managed by the framework, but you instantiate them yourself instead of using inject/find. The result is that important life cycle methods are not being called.
I would also suggest looking into type safe builders instead of FXML.
Hope this helps :)
|
Proliferation in Student Debt Driven
By Weakest Borrowers, Fed Finds
Feb. 18, 2014 4:26 p.m. ET
The nation's sharp rise in student debt is being driven largely by Americans with poor credit.
Overall student debt rose 12% to $1.08 trillion in 2013, the Federal Reserve Bank of New York said in a report released Tuesday. Student debt is the second-largest form of household credit, after mortgages. |
- 56*o - 3161. Let b(y) = 12*h(y) + 11*i(y). Differentiate b(a) with respect to a.
-1460*a - 1
Let n(w) = 123*w**2 + 5*w. Let z(c) = 27 + c + c**2 + 33 - 60. Let l(y) = n(y) + 5*z(y). Find the second derivative of l(a) wrt a.
256
Let y(c) be the second derivative of -599*c**4/4 - 3*c**3 + 7*c**2/2 - 691*c. What is the second derivative of y(l) wrt l?
-3594
Let r(t) = t**2 - 2*t + 2. Let u be r(2). Find the third derivative of 2 - 42*y**2 + 78*y**2 + y**3 - 6 - 42*y**u wrt y.
6
What is the third derivative of 13260*m - 4426*m + 7716*m**3 - 4420*m - 4418*m + 8*m**2 + 74 wrt m?
46296
Let f be ((-4)/5)/(82/(-2665)). Find the third derivative of -288*a**2 - 29*a**4 - f*a**4 - 19*a**4 wrt a.
-1776*a
What is the second derivative of 66*n**3 - 413 + 196*n**3 - 5*n + 3*n - 30*n**3 - 2*n**2 - 24*n**3 wrt n?
1248*n - 4
Let t(b) be the first derivative of 1315*b**4/4 - 283*b**3/3 + 1229. Find the third derivative of t(u) wrt u.
7890
Let k = -5120/3 + 1709. Let c(n) be the first derivative of 0*n**3 - 11/2*n**2 + 0*n**4 + k*n**6 + 0*n**5 + 0*n + 13. Find the second derivative of c(s) wrt s.
280*s**3
Let v(d) be the first derivative of -151*d**3/3 - 829*d**2/2 + 1138. What is the second derivative of v(c) wrt c?
-302
Find the second derivative of -1257*y**3 + 1 - 851*y**3 + 10*y + 14 + 572*y**3 wrt y.
-9216*y
Let g be 5*(-10)/(-25) - 0. Suppose 3*j - 2 = g*j. What is the first derivative of 5 - j + 14*r - 3 - 3 wrt r?
14
Differentiate 2129 + 6771*u**2 + 852*u + 698*u - 6769*u**2 with respect to u.
4*u + 1550
Let k be 1/(-1) - -67*(-10)/(-10). Differentiate 11*a + 54*a**2 - 55*a**2 - k + 35*a with respect to a.
-2*a + 46
Let a(y) = 3*y - 17. Let j be 1 + (-3 - (1 - 4)). Let m(u) be the first derivative of -u**2/2 - 19. Let f(t) = j*a(t) - 4*m(t). Differentiate f(o) wrt o.
7
Let j(a) = 17*a - 177. Let t be j(11). Differentiate 11*q**3 - 8*q - 23*q - t*q**3 - 25 - 9 wrt q.
3*q**2 - 31
Let z(o) = -10359*o**2 + 10*o - 16413. Let x(s) = -5181*s**2 + 4*s - 8205. Let y(c) = -5*x(c) + 2*z(c). What is the first derivative of y(g) wrt g?
10374*g
Let g(w) = 10*w + 78. Let r be g(-7). What is the derivative of 145 - r*n + 23*n - 77*n - 28*n wrt n?
-90
Find the second derivative of 1109*z**2 + 1194*z - 9*z**3 - 2195*z**2 - 417*z + 1010*z**2 + 1429*z wrt z.
-54*z - 152
Let u(q) = -773*q + 596. Let t(v) = 7*v - 1. Let g(a) = -6*t(a) + u(a). Find the first derivative of g(n) wrt n.
-815
Let r be (-4)/(-3)*(-6)/(-4). Find the third derivative of -i**3 + 26*i**2 - 7*i**3 + 18*i**r - 43*i**2 wrt i.
-48
Let g = -49 - -60. Let k be (8/7)/(g/77). What is the second derivative of -3*r - 49 - k*r**2 + 49 wrt r?
-16
Let b = -136 - -228. Find the second derivative of 14*v**3 + 12*v**3 - b*v + 14*v wrt v.
156*v
Differentiate 8*w + 26*w - 7375*w**2 - 18*w + 7395*w**2 - 5422 with respect to w.
40*w + 16
Let s(p) = 1292*p**3 + 4102*p**2 + 4*p. Let d(x) = -2584*x**3 - 8201*x**2 - 10*x. Let f(z) = 2*d(z) + 5*s(z). What is the third derivative of f(n) wrt n?
7752
Suppose 7 - 13 = 3*h. Let q be (h/4)/(1 + 35/(-28)). What is the third derivative of -13*d**2 + 27*d**5 + 51*d**q - 4*d**5 wrt d?
1380*d**2
Let v(p) be the second derivative of 3089*p**5/10 - 13*p**3/6 - 36*p**2 + 6*p - 59. What is the second derivative of v(h) wrt h?
37068*h
Let y(x) be the third derivative of -233*x**5/30 + 137*x**4/8 - 90*x**2 - 1. Find the second derivative of y(q) wrt q.
-932
Let s(n) = 6979*n**4 + 2*n**2 - 2*n - 151. Let j(l) = -20936*l**4 - 7*l**2 + 9*l + 455. Let v(u) = 2*j(u) + 7*s(u). Find the second derivative of v(a) wrt a.
83772*a**2
Let z(v) be the first derivative of -17*v**8/14 + 3*v**4/2 + 2*v - 63. Let o(c) be the first derivative of z(c). What is the third derivative of o(q) wrt q?
-8160*q**3
Suppose 29 = 6*m - 19. Differentiate 4*n - 8*n - 8*n - m*n - 12 wrt n.
-20
Let v(c) = 10*c**4 - 18*c**2 + 945. Let k(q) = -19*q**4 + 37*q**2 - 1889. Let o(b) = -6*k(b) - 13*v(b). Differentiate o(l) with respect to l.
-64*l**3 + 24*l
Let c = 10 - 9. Let n(k) = 6*k**3 + k - 2. Let g be n(c). What is the second derivative of -68*v**g + 21*v**5 + 33*v**5 - 13*v wrt v?
-280*v**3
Let n(m) be the first derivative of 1/3*m**3 + 0*m + 0*m**5 + 4*m**2 + 0*m**4 + 51/7*m**7 + 0*m**6 + 42. What is the third derivative of n(i) wrt i?
6120*i**3
Let c(p) = -9310*p**2 - 56*p - 98. Let y(x) = 3102*x**2 + 19*x + 34. Let w(m) = -6*c(m) - 17*y(m). What is the second derivative of w(b) wrt b?
6252
What is the second derivative of -213 + 0*a + 1018*a**2 + 197 - 475 - 145 + 4*a wrt a?
2036
Let f(x) = -x**2 - 15*x - 33. Let j be f(-12). What is the second derivative of -60*z**3 + 49*z - 98*z**j + 100*z**3 wrt z?
-348*z
Let i be (-3)/(-5) + 22/5. Let n(d) = -d**2 + 4*d + 8. Let l be n(i). What is the third derivative of -6*a**3 + 12*a**3 + 7*a**2 + 12*a**l - 4*a**3 wrt a?
84
Let w = -1532 + 1535. Let l(v) be the first derivative of 0*v**4 - 7 - 7/5*v**5 - 11/2*v**2 + 0*v**w + 0*v. What is the second derivative of l(f) wrt f?
-84*f**2
Let c(o) be the second derivative of 0*o**6 + o - 10 + 0*o**5 + 0*o**2 + 35/12*o**4 + 0*o**3 + 32/21*o**7. What is the third derivative of c(g) wrt g?
3840*g**2
Let v(x) be the second derivative of 0 - 92*x + 0*x**6 + 97/21*x**7 + 0*x**5 + 0*x**4 - x**2 - 88/3*x**3. What is the second derivative of v(n) wrt n?
3880*n**3
Let z be 160/3*(2 - -4). Let f = z + -146. What is the second derivative of -6*g + 182*g**3 - f*g**3 + 31*g wrt g?
48*g
Suppose -115*x = -111*x - 4. Find the third derivative of -764*g**5 - 118*g - 706*g**5 + 1533*g**5 + 1 - g**2 - x - 2*g**4 wrt g.
3780*g**2 - 48*g
What is the second derivative of -5311*t**2 + 5487*t**2 + 30*t - 2 - 99*t wrt t?
352
Let h(i) be the second derivative of -25*i**3 + 3/20*i**5 + 3/2*i**4 - 7*i + 6 + 0*i**2. What is the second derivative of h(f) wrt f?
18*f + 36
Let u(t) be the second derivative of 1/6*t**4 + 13*t + 0 + 7/2*t**2 - 5/6*t**3. Let o(w) be the first derivative of u(w). What is the derivative of o(n) wrt n?
4
Let h(u) be the first derivative of -3691*u**5/5 + 3549*u + 681. Find the first derivative of h(i) wrt i.
-14764*i**3
Let m(o) = -8*o - 99. Let b be m(-13). Find the second derivative of 1 - 23*l - 19 - 2*l**3 - 1 + 17*l**b + 20*l wrt l.
340*l**3 - 12*l
Let n(x) be the third derivative of 0 - 3*x**2 + 0*x**4 - 2*x**3 - 1/10*x**5 - 17*x - 3/10*x**6. What is the third derivative of n(g) wrt g?
-216
Let h(a) be the second derivative of 0 - 161*a - 8/15*a**6 - 1/4*a**5 + 0*a**2 + 77/6*a**3 + 1/12*a**4. Find the third derivative of h(g) wrt g.
-384*g - 30
Let u(y) = 3*y**3 - 36*y**2 + 9*y - 29. Let s be u(15). Find the first derivative of -s*i + 1 - 2 + 2053*i - 8 wrt i.
-78
Let o be 6/5*(-20)/8. Let b = 25 + -29. Let s(d) = -8*d**2 - 10. Let x(i) = 9*i**2 + 9. Let v(q) = b*x(q) + o*s(q). What is the first derivative of v(a) wrt a?
-24*a
Let x(v) be the first derivative of v**3 + 0*v**4 + 0*v**2 + 0*v - 100 - 31/3*v**6 + 0*v**5. Find the third derivative of x(b) wrt b.
-3720*b**2
Suppose -2*q + 4*u - u + 9 = 0, -2*u = -2. Find the third derivative of -2 + 61*h**2 + 2 + 72*h**3 - q*h**3 wrt h.
396
Let v(n) be the third derivative of 0*n**3 - 7*n**2 - 5/8*n**4 - 1/60*n**5 + 0*n**6 + 0*n - 1 + 1/210*n**7. What is the second derivative of v(l) wrt l?
12*l**2 - 2
Let f(h) be the first derivative of -13*h**5/5 - 22*h**3/3 - 8656*h - 8658. Differentiate f(x) wrt x.
-52*x**3 - 44*x
Let a(h) be the third derivative of 0*h + 0 + 0*h**6 + 0*h**5 + 0*h**7 + 29/24*h**4 + 0*h**3 + 70*h**2 + 47/336*h**8. Find the second derivative of a(g) wrt g.
940*g**3
Let v(s) = -3*s**2 - 20*s + 16. Let i be v(-7). What is the second derivative of 30*w**5 + 5 - i*w**5 + w**2 - 12*w + 14*w wrt w?
420*w**3 + 2
Find the second derivative of -2322*m**5 - 191*m + 3*m**3 - 535*m + 36*m**3 - 39*m**3 wrt m.
-46440*m**3
Let x(t) = 90350*t**5 + 11703*t**2 - 22. Let b(l) = 12907*l**5 + 1672*l**2 - 3. Let q(p) = -22*b(p) + 3*x(p). Find the third derivative of q(r) wrt r.
-774240*r**2
Suppose -239*u - 20 = -249*u. What is the third derivative of -4*s**5 - 2*s**u + 8*s**4 - 5*s**4 - 4*s**4 - 6 wrt s?
-240*s**2 - 24*s
Suppose 5*y = -0*y - 25, -44 = -3*x + 4*y. Suppose 4*z - w - 16 - 6 = 0, 2*z + w - x = 0. Differentiate 11 - t + 12*t + z*t - 2*t with respect to t.
14
Let l(z) be the sec |
DayZ stand-alone alpha shooting for December DayZ creator Dean Hall has said that the stand-alone alpha will hit this year, likely in December, and that it will be inexpensive. He also made some comments about the competition with fellow zombie-survival title The War Z.
The stand-alone version of DayZ might just barely squeeze into its goal of releasing this year. Creator Dean Hall recently said the alpha will probably hit in December, and on top of that, claimed it will be "cheap."
"It has to be out before the end of the year," he said at the Eurogamer Expo. "Not just because we've committed to it but in order to achieve what we have to do. It has to be. There's no 'we hope it is'; it has to be. And it's going to be cheap. We've decided that we don't need to sell a heap of units in order for us to be OK with where it's going. The more units we sell of it the more ambitious we get, because the project has the better resources."
He said that releasing in December would allow the team to move onto "more ambitious features" in January and February. Hall made some remarks about The War Z, which is set to release this fall. "Maybe they will make a better game - I don't know. Maybe what they're doing is not cool to me, but the way I look at it is what are my options? What could I do? I could stand up here and be very critical of anyone who does a clone copy of the game. What would that actually achieve other than making me look like a dick? It's not going to result in a better game.
"I guess what I'm saying is what I feel isn't important. Maybe that's what leadership is: saying my feelings aren't important here - my feelings are often selfish. I have to be realistic about it and say the responsibility is on me to make a good game. And that's just life." |
Gestational age estimation on United States livebirth certificates: a historical overview.
Gestational age on the birth certificate is the most common source of population-based gestational age data that informs public health policy and practice in the US. Last menstrual period is one of the oldest methods of gestational age estimation and has been on the US Standard Certificate of Live Birth since 1968. The 'clinical estimate of gestation', added to the standard certificate in 1989 to address missing or erroneous last menstrual period data, was replaced by the 'obstetric estimate of gestation' on the 2003 revision, which specifically precludes neonatal assessments. We discuss the strengths and weaknesses of these measures, potential research implications and challenges accompanying the transition to the obstetric estimate. |
Pharmaceutical care practice in patients with chronic kidney disease.
The impact of chronic kidney disease in health is no longer just a patient-physician issue, not only in terms of the increase in the number of patients diagnosed, but also regarding the human and economic cost for health systems. That is why Pharmaceutical Care should include SOPs structured by criteria reached by consensus to conduct Pharmaceutical Care Practice, which will enable to prevent, identify and solve any negative outcomes in patients that are associated with medication. Objectives: To learn about the types of problems related to medications and negative outcomes associated with drugs that can be detected, prevented and solved in patients with chronic kidney disease, through pharmaceutical care practice. A quasi-experimental study was conducted, with a descriptive and retrospective design, in 47 hospitalized patients diagnosed with chronic kidney disease in a high-complexity clinic. Using the DADER methodology, their pharmacological treatments were analyzed, and it was verified whetherthey were necessary, effective and safe, taking into account variables such as the negative outcomes associated with medication, medication-related problems, pharmaceutical interventions, and kidney failure stages. Results: Fifty-one (51) negative outcomes associated with medication were detected during the study; of these, 13.72% were for Necessity, 45.1% for Effectiveness and 41.18% for Safety. A total of 41 pharmaceutical interventions were conducted, 35 were accepted and 6 were not accepted. Of these 6 non-accepted interventions, 3 health problems were not solved, 12 dose re-adjustments were conducted, with cefepime as the drug with the highest number of dose adjustments; most patients were in Stage III and V of CKD, and its main cause was hypertension and Diabetes Mellitus II. The most prevalent NOMs were those for Non-Quantitative Insecurity, therefore these are a highly prevalent problem. This highlights the importance of this public health problem and its major clinical, social and economic impact, associated with Chronic Kidney Disease; therefore, it is necessary to involve all health professionals and patients, to obtain as a result a better use of medications, the prevention of NOMs and a reduction in morbidity associated with pharmacotherapy. |
Kyoto Colors - Urban & Early Modern
Kitayama Street
Kitayama Street, located in the northern part of the city, shows a different side of Kyoto. Unlike mid-city, this area is less crowded with buildings and has a lot of greenery and even scattered vegetable fields. With cafes, restaurants, and boutiques housed in modern architecture dotting the street, the area is good for strolling. Located inside the green wall on the right is the Kyoto Botanical Garden. |
Q:
CPP compile error: included files not found
In my app.cpp file I have the following line: #include "indri/Repository.hpp"
However when I run make (makefile below): I get the following error:
indri/Repository.hpp:22:32: error: indri/Parameters.hpp: No such file or directory
The reason is that the Repository.hpp includes other hpp in the same folder but it uses "indri/*.hpp" instead of just "*.hpp".
What am I missing ?
thanks
## your application name here
APP=myapp
SRC=$(APP).cpp
## extra object files for your app here
OBJ=
prefix = /usr/local
exec_prefix = ${prefix}
libdir = ${exec_prefix}/lib
includedir = ${prefix}/include
INCPATH=-I$(includedir)
LIBPATH=-L$(libdir)
CXXFLAGS=-DPACKAGE_NAME=\"Indri\" -DPACKAGE_TARNAME=\"indri\" -DPACKAGE_VERSION=\"5.0\" -DPACKAGE_STRING=\"Indri\ 5.0\" -DPACKAGE_BUGREPORT=\"project@lemurproject.org\" -DYYTEXT_POINTER=1 -DINDRI_STANDALONE=1 -DHAVE_LIBM=1 -DHAVE_LIBPTHREAD=1 -DHAVE_LIBZ=1 -DHAVE_NAMESPACES= -DISNAN_IN_NAMESPACE_STD= -DSTDC_HEADERS=1 -DHAVE_SYS_TYPES_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_STDLIB_H=1 -DHAVE_STRING_H=1 -DHAVE_MEMORY_H=1 -DHAVE_STRINGS_H=1 -DHAVE_INTTYPES_H=1 -DHAVE_STDINT_H=1 -DHAVE_UNISTD_H=1 -DHAVE_FSEEKO=1 -DHAVE_EXT_ATOMICITY_H=1 -DP_NEEDS_GNU_CXX_NAMESPACE=1 -DHAVE_MKSTEMP=1 -DHAVE_MKSTEMPS=1 -DNDEBUG=1 -g -O3 $(INCPATH)
CPPLDFLAGS = -lindri -lz -lpthread -lm
all:
$(CXX) $(CXXFLAGS) $(SRC) -o $(APP) $(OBJ) $(LIBPATH) $(CPPLDFLAGS)
clean:
rm -f $(APP)
A:
Did you forget to add the current directory?
## your application name here
APP=myapp
SRC=$(APP).cpp
## extra object files for your app here
OBJ=
prefix = /usr/local
exec_prefix = ${prefix}
libdir = ${exec_prefix}/lib
includedir = ${prefix}/include
INCPATH=-I$(includedir) -I. # can you spot the difference?
LIBPATH=-L$(libdir)
CXXFLAGS=-DPACKAGE_NAME=\"Indri\" -DPACKAGE_TARNAME=\"indri\" -DPACKAGE_VERSION=\"5.0\" -DPACKAGE_STRING=\"Indri\ 5.0\" -DPACKAGE_BUGREPORT=\"project@lemurproject.org\" -DYYTEXT_POINTER=1 -DINDRI_STANDALONE=1 -DHAVE_LIBM=1 -DHAVE_LIBPTHREAD=1 -DHAVE_LIBZ=1 -DHAVE_NAMESPACES= -DISNAN_IN_NAMESPACE_STD= -DSTDC_HEADERS=1 -DHAVE_SYS_TYPES_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_STDLIB_H=1 -DHAVE_STRING_H=1 -DHAVE_MEMORY_H=1 -DHAVE_STRINGS_H=1 -DHAVE_INTTYPES_H=1 -DHAVE_STDINT_H=1 -DHAVE_UNISTD_H=1 -DHAVE_FSEEKO=1 -DHAVE_EXT_ATOMICITY_H=1 -DP_NEEDS_GNU_CXX_NAMESPACE=1 -DHAVE_MKSTEMP=1 -DHAVE_MKSTEMPS=1 -DNDEBUG=1 -g -O3 $(INCPATH)
CPPLDFLAGS = -lindri -lz -lpthread -lm
all:
$(CXX) $(CXXFLAGS) $(SRC) -o $(APP) $(OBJ) $(LIBPATH) $(CPPLDFLAGS)
clean:
rm -f $(APP)
|
[The clinical laboratory indices in ancylostomiasis among the population of Kindia Prefecture (Republic of Guinea)].
Clinical and laboratory data have been compared in patients with ankylostomiasis and healthy population of Guinea Republic. An increase in ankylostomiasis morbidity during the humid season has been observed. The clinical pattern of the disease did not differ from that earlier described in literature. Anemia and eosinophilia were the most persistent signs of the disease. The patients with ankylostomiasis revealed an elevated IgM level and a trend towards an increase in 0-lymphocyte population, which is indicative of certain shifts in cellular and humoral immunity. |
Superior rechargeability and efficiency of lithium-oxygen batteries: hierarchical air electrode architecture combined with a soluble catalyst.
The lithium-oxygen battery has the potential to deliver extremely high energy densities; however, the practical use of Li-O2 batteries has been restricted because of their poor cyclability and low energy efficiency. In this work, we report a novel Li-O2 battery with high reversibility and good energy efficiency using a soluble catalyst combined with a hierarchical nanoporous air electrode. Through the porous three-dimensional network of the air electrode, not only lithium ions and oxygen but also soluble catalysts can be rapidly transported, enabling ultra-efficient electrode reactions and significantly enhanced catalytic activity. The novel Li-O2 battery, combining an ideal air electrode and a soluble catalyst, can deliver a high reversible capacity (1000 mAh g(-1) ) up to 900 cycles with reduced polarization (about 0.25 V). |
[Partial kidney resection in renal cell carcinoma].
In 18 patients with renal cell carcinoma in anatomical or functional single kidneys, with limited renal function or bilateral tumors, partial renal resection was absolutely indicated to preserve renal function. In 17 patients with small peripheral tumors and intact contralateral kidney, partial renal resection was performed electively. One patient of each group died during postoperative care. During follow-up, 4 patients with absolute indication for partial renal resection showed progression of the disease. Three developed distant metastases, and in one patient local relapse with infiltration of the inferior cava vein occurred. These 4 patients had had a bilateral synchronous or asynchronous stage pT2 or pT3 renal cell carcinoma and died from the neoplasm within 10-36 months postoperatively. 13 of 18 patients with absolute indication remained tumorfree during a median follow-up period of 57 months. Partial renal resection saved 15 of these 17 patients from dialysis. Sixteen of 17 patients in whom partial renal resection was performed electively remained tumorfree during a median follow-up period of 28 months. The results suggest that, given an absolute indication to prevent dialysis, partial renal resection should be performed whenever technically possible. In patients with small peripherally located tumors and intact contralateral kidney, partial renal resection as an elective procedure must be considered a genuine alternative to radical nephrectomy. |
Q:
Can one be using two nested synchronized blocks in order to lock two cells of an array for atomic operation?
I have a class Repository which allocates resources represented as values of the cells array field. The method moves the resources from one cell to another.
I need to make sure that when we move resources from one cell to another, no other move operations can be performed on the cells in question. That is if a cell (origin cell or destination cell) participates in move operation, we must wait until the current operation completes before we perform another move operation on those cells. There should be no limitation on performing move on different pairs of cells in parallel, for example, move(cells[1], cells[2], 5) and move(cells[4], cells[7], 9) can be performed in parallel.
I thought to use two nested synchronized blocks in order to protect both origin and destination cell. I don't think we need to use wait/notifyAll because we're using synchronized anyway.
Am I on the right track?
This is the code (moveOriginal is the original method and moveSynchronized is the protected one:
public class Repository {
private Integer[] cells;
public Repository(int size, int initialValue) {
cells = new Integer[size];
for(int i = 0; i < size; i++) {
cells[i] = initialValue;
}
}
public void moveOriginal(int from, int to, int amount) {
if(cells[from] >= amount) {
cells[from] = cells[from] - amount;
cells[to] = cells[to] + amount;
}
}
public void moveSynchronized(int from, int to, int amount) {
synchronized(cells[from]) {
synchronized (cells[to]) {
if(cells[from] >= amount) {
cells[from] = cells[from] - amount;
cells[to] = cells[to] + amount;
}
}
}
}
}
A:
There are multiple issues with this approach.
synchronized locks on the value of the cell[x], an Integer, so as soon as you do this
cells[from] = cells[from] - amount;
synchronizing on cells[from] would be locking a different object.
Integer interns objects representing small values. Locking on a shared object like that may lock you out of an entirely wrong cell.
Availability of shared Integer objects goes beyond your thread. Another thread can obtain shared integers on which you synchronize, and lock you out of cells without gaining access to private data structures of your class.
If you want cell-level locking, create an array of objects that would be used specifically for locking the corresponding cells; do not lock on cell values.
A:
No, you can't do that. For this to work you would need to lock on the array itself, preventing parallel operations.
Integer is immutable, meaning cells[to] = cells[to] + amount puts a different object there, instead of modifying the Integer in it. This will cause problems when synchronized(cells[to]) is referring to different objects at different times.
A simplest way to fix this would be to make a Object[] lockArray = new Object[size]; initialized with Objects and synchronize on those. They won't change during your business logic.
In any case you need nested synchronized scopes. What you also need to do is define an order, e.g. always first synchronize on the smaller value. Otherwise you'll get a deadlock when multiple threads try to do something like move(1, 2); move(2, 1); at the same time.
public void moveSynchronized(int from, int to, int amount) {
if(from == to || from < 0 || to < 0 || from > cells.length || to.cells.length)
throw new IllegalArgumentException("Bad values ! " + from + ", " + to);
// Lock1 is always smaller and locked first
int lock1 = from < to ? from : to;
int lock2 = from < to ? to : from;
synchronized(locks[lock1]) {
synchronized (locks[lock2]) {
if(cells[from] >= amount) {
cells[from] = cells[from] - amount;
cells[to] = cells[to] + amount;
}
}
}
}
|
Q:
Issue with SQL ALCHEMY relationship (M:1)
I am having issues with pulling up a user/video in view_state based on relationship.
Using Python 2.7 SQLALCHEMY and CRUD method
Test.py
def test_crud_operations():
api = ConvenienceAPI()
api.create_view_state('module1', 'ack')
api.retrieve_view_state('ack')
api.update_view_state('ack', 'module1')
Code:
#base.py
class View_State(Base):
__tablename__ = 'view_states'
id = Column(Integer, primary_key=True)
timestamp = Column(DateTime, default=datetime.utcnow)
time_update = Column(DateTime, onupdate=datetime.utcnow)
completed = Column(Boolean, default=False) #have to set default
video_id = Column(Integer, ForeignKey('videos.id'))
video = relationship('Video', backref='view_states')
user_id = Column(Integer, ForeignKey('users.id'))
user = relationship('User', backref='view_states')
def __init__(self, video, user):
self.completed = False
self.video = video
self.user = user
def __repr__(self):
return "<View_State(timestamp='%s', time_update='%s', completed='%s', video='%s', user='%s')>" % (self.timestamp, self.time_update, self.completed, self.video, self.user)
#object.py
# View State CRUD
def update_view_state(self, username, videoname):
#update Boolean completed status to 'complete = True'
update_completed = self.session.query(View_State).\
filter(View_State.user.has(User.username == username)).\
filter(View_State.video.has(Video.videoname == videoname)).one()
print 'retrieved from update complete: ', update_completed
if update_completed:
completed = True
temp = update_completed.completed
print 'changed status: ', temp
return update_completed
self.session.commit()
#convenience.py
def update_view_state(self, username, videoname):
user = self.retrieve_user(username=username)
video = self.retrieve_video(videoname)
return super(ConvenienceAPI, self).update_view_state(user, video)
Traceback:
InterfaceError: (sqlite3.InterfaceError) Error binding parameter 0 - probably unsupported type. [SQL: u'SELECT view_states.id AS view_states_id, view_states.timestamp AS view_states_timestamp, view_states.time_update AS view_states_time_update, view_states.completed AS view_states_completed, view_states.video_id AS view_states_video_id, view_states.user_id AS view_states_user_id \nFROM view_states \nWHERE (EXISTS (SELECT 1 \nFROM users \nWHERE users.id = view_states.user_id AND users.username = ?)) AND (EXISTS (SELECT 1 \nFROM videos \nWHERE videos.id = view_states.video_id AND videos.videoname = ?))'] [parameters: (<User(username ='ack', firstname ='A', lastname ='cr', email='a@gmail.org', institution='foo', residency_year='None')>, <Video(videoname='module1', length='8.0', url='https://vimeo.com/138326103')>)]
A:
If you look closely to the traceback message, you are not sending an username but a class as a parameter but try matching it to a string. Which is actually what your program does. you first select user class and video class and pass these classes to update_view_state.
What would happen if you changed this line:
return super(ConvenienceAPI, self).update_view_state(user, video)
to
return super(ConvenienceAPI, self).update_view_state(user.username,
video.videoname)
Or you can change your update_view_state to operate on the relationship instead:
filter(View_State.user.has(user == username)).\
filter(View_State.video.has(video == videoname)).one()
Hannu
|
Featured Post
About Me
I am Professor and Chair of the Department of Political Science and Public Administration at the University of North Carolina at Charlotte. I am also the editor of the academic journal The Latin Americanist.
Tuesday, November 08, 2011
At least the General Accounting Office appears to be sane, since no one else is. It is well documented, and I mean beyond a shadow of a doubt, or even a shadow of that shadow, that high-tech border solutions fail to achieve even a tiny fraction of their goals. They are very expensive, shiny, and PR-happy, yet worthless. I've been writing about this for years--here is one post from earlier this year that links to older posts.
So we know they fail, but U.S. Customs and Border Protection wants to push on anyway in Arizona, perhaps hoping to fail as spectacularly as in Texas. Fortunately, the GAO has just made clear in a report that it does not have enough evidence that it will work. Instead, we get an image of a government agency just trying to do something, without caring at all whether the money spent is a waste. It is indeed pretty scathing.
Specifically, GAO's review of the estimate concluded that the estimate reflected substantial features of best practices, being both comprehensive and accurate, but it did not sufficiently meet other characteristics of a high-quality cost estimate, such as credibility, because it did not identify a level of confidence or quantify the impact of risks. GAO and OMB guidance emphasize that reliable cost estimates are important for program approval and continued receipt of annual funding. In addition, because CBP was unable to determine a level of confidence in its estimate, it will be difficult for CBP to determine what levels of contingency funding may be needed to cover risks associated with implementing new technologies along the remaining Arizona border.
Emphasis mine. Is this really the best we can do? My head is dented from banging it against the wall.
A powerful Republican state Senate leader who championed Arizona's controversial crackdown on illegal immigrants lost his office on Tuesday in a historic recall election, returns showed. Russell Pearce's defeat is a message to the GOP, say some analysts, that jobs and the economy should be a higher priority than illegal immigrants.............
Russell Pearce branded his political opponents as "far left liberals" and labor union activists, and chastised the recall election coming when he has just one year left in his current term.
Lewis, 55, has maintained that residents could not afford to wait until the next election to replace a man who he said has tarnished Arizona's image.
The stage for the recall race was set in July when Brewer, a strong supporter of Pearce, approved the mid-term election challenge after a citizen's group turned in enough signatures to put it on the ballot.
Lewis said the Southwestern state badly needs someone who can tackle immigration and other issues with an approach free of "fear-mongering and political rhetoric," and said Arizona should work with the federal government on a comprehensive immigration solution, not battle the government in court.........
VIDEO : Arizona, Interview with Jerry Lewis after he won the seat in a recall election against Russell Pearce. Russell Pearce supported by Governor Jan Brewer was the Architect Author and Icon of the "Papers Please" Law SB 1070 |
Introduction {#s1}
============
IL-10 is a pleiotropic cytokine that is produced by different cell types, including myeloid cells (dendritic cells, macrophages, eosinophils, neutrophils, and mast cells) and lymphoid cells (NK, B cells, and T cells) with broad anti-inflammatory activity. Macrophages and myeloid dendritic cells express IL-10 upon activation of MyD88 and TRIF-dependent TLR pathways such as TLR3 and TLR4, by stimulation with dsDNA and LPS, respectively ([@B1]). Moreover, tolerogenic dendritic cells (CD11c^low^CD45RB^high^) produce large amounts of IL-10 in response to LPS, which induces T regulatory cell development ([@B2], [@B3]). Natural regulatory cells (nTreg) produce IL-10 in the response to IL-2, which is vital for immune homeostasis ([@B4]).
Structurally, IL-10 belongs to the class II cytokine family, which involves IL-19, IL-20, IL-22, IL-24 (Mda-7), IL-26, and interferons (IFN-α, -β, and -γ) ([@B5]). The IL-10 is a member of helical cytokines as an IL-10 monomer consists of six α-helices (A-F) ([@B6]). Biologically active IL-10 is a non-covalent homodimer, which is described as a three-dimensional (3D) domain swapping protein with a molecular mass of 37 kDa (18.5 kDa for each one) ([@B7]--[@B9]). The IL-10 receptor (IL-10R) is a member of the class II cytokine receptor family and consists of two subunits, IL-10R1 and IL-10R2 ([@B10], [@B11]). IL-10 binds to IL-10R with high affinity; however, it can be species-specific. For example, mouse IL-10 was able to block the binding of human IL-10 to mouse cells but not human cells ([@B12]). Analysis of the protein crystal formed of IL-10 bound to soluble IL-10R1 revealed that the 3D domain-swapped homodimer IL-10, which consists of helices E and F from one chain inserted into the hydrophobic cleft formed by into helices A--D of the other chain, is essential for receptor-binding ([@B13]). IL-10 binding to the IL-10R complex activates a Janus kinase- Signal Transducers and Activation Transcription system (JAK/STAT) signaling pathway. IL-10/IL-10R promotes phosphorylation and activation of the transcription factor STAT3, which is required for the IL-10 immunoregulatory effect ([@B14]).
The anti-inflammatory activity of IL-10 is in part due to the inhibition of the synthesis of pro-inflammatory cytokines such as tumor necrosis factor (TNF) ([@B15]). Furthermore, IL-10 downregulates MHC class II expression and helps to promote wound healing ([@B5], [@B16]). The IL-10 showed to have an immunoregulatory effect during an infection with *Toxoplasma gondii* ([@B17]), *Mycobacterium* spp. ([@B18]), *Herpes simplex virus* ([@B19]), and malaria ([@B20]) by ameliorating the exaggerated T helper 1 and CD8^+^ T cells response including. A defect of IL-10 or the IL-10 receptor has been linked to excessive immune reactions and a disposition to chronic inflammatory disease, such as the early onset of inflammatory bowel disease ([@B21]--[@B23]). Also, changes of the gut microflora could lead to a change in the regulation of the gut-associated immune system, resulting in chronic gut inflammation, which in part could be the result of dysregulated IL-10 expression ([@B21], [@B24]).
Here we report the generation of a new form of IL-10 more suitable for therapeutic intervention, as the natural IL-10 has only a short half-life *in vivo*. The stability of the non-covalent IL-10 dimer strongly depends on physical parameters such as temperature and pH. The IL-10 dimer dissociates to a monomeric form at low protein concentrations or at acidic pHs, as typically found in inflamed tissue. Acidic pH has been found, for instance, in fracture-related hematomas (ranging as low as pH 4.7), in cardiac ischemia (pH 5.7) ([@B25]). Examinations of inflamed skin showed pH values of 5.8--7.2 ([@B25]--[@B27]). It has been demonstrated that \~10 and \~50% of human IL-10 was dissociated (i.e., decayed) when heated to 37 and 55°C, respectively, for 1 h ([@B9]). Moreover, to date, the free IL-10 monomer has not been found in the solution. The IL-10 monomer could not exist in solution due to the presence of significant hydrophobic residues, which are shielded by interaction involved in the dimer form ([@B6]). Therefore, we reasoned that the generation of a stabilized dimer form of IL-10 might be a promising approach to overcome the inherent IL-10 instability and thereby improve its therapeutic potential.
One way to improve the stability of the IL-10 structure has been proposed by generating a stable IL-10 dimer using an internal flexible linker ([@B28]). Expressing the dimer as a single continuous fusion protein in which the monomers are connected by a flexible linkers (Gly-Ser) may offer a stability advantage and improve biological activity ([@B29]). Moreover, Gly-Ser linkers in recombinant proteins could play a general role in overall stability and solubility. A previous study has shown that using a Gly-rich linker to tether the dimeric forms of HIV-1 proteases (HIV-PR) results in a more stable form compared to the natural HIV-PR at pH 7.0 ([@B30]). Moreover, Foss *et al*. showed that using flexible linkers (Gly-rich linker) in transthyretin, the carrier of the thyroid hormone, is more stable than the natural after urea treatment ([@B31]). We now generated a functional IL-10 by linking two monomers using a flexible linker. We examined and compared the biological activity of the stable IL-10 dimer against the natural or non-covalently linked IL-10, both *in vitro and in vivo*. Here, we demonstrate that novel recombinant IL-10 dimer has improved stability and higher biological activity; therefore, it has the potential to be a building block for future IL-10 based immunotherapy treatment regimes.
Methods {#s2}
=======
Plasmid Design and IL-10 Construct
----------------------------------
The eukaryotic expression vector pCEP V19 was used to express the cDNA of natural mouse IL-10 (Nm) and stable mouse IL-10 (STm). The C-terminus of pCEP V19 includes Factor XA (FXA), human serum albumin (HSA), thrombin. oriP: replication origin of Epstein-Barr virus, EBNA-1: Epstein-Barr virus nuclear antigen-1, ampicillin: ampicillin resistance gene (β-lactamase), pUC ori: the bacterial origin of replication, puromycin: puromycin resistance gene, CMV: Promoter of cytomegalovirus, BM40: a signal sequence of protein BM40, 8 His tag: 8 histidine residues, thrombin: thrombin, NheI, Bsu36I, BamHI: restriction sites, mouse IL-10 cDNA, SV40 pA: polyadenylation signal of SV40 Virus. The expression vector was generated and provided to us by Manuel Koch (Institute of Biochemistry II, University of Cologne). The nine amino acids (-G~3~SG~4~S-) and 13 amino acid linker(-G~3~SG~4~-SG~4~-) were generated by inserting the synthetic insert into the second monomer of mouse IL-10. The stable IL-10 cDNA was digested with the BamHI enzyme before ligating the synthetic inserts containing a nine and 13 amino acid linker with 5′ BamHI restriction site and 3′ BglII restriction sites. The confirmation of the correct insert orientation was carried out using NheI and BamHI restriction digestion. The stable human IL-10 (STh), and mutant cDNAs of mouse IL-10 were synthesized (GeneArt Gene Synthesis: Thermofisher). Oligonucleotides were cloned into pMA-RQ, Col E1 origin: the bacterial origin of replication, ampicillin: ampicillin resistance gene (β-lactamase) (Thermofisher), then subcloned into the eukaryotic expression vector pCEP V19.
Transfection of HEK~293~EBNA, IL-10 Expression, and Purification
----------------------------------------------------------------
HEK~293~EBNA (HEK) mammalian cell line was generated from human embryonic kidney cells. The cell line was maintained in Dulbecco\'s modified Eagle\'s medium (DMEM) with 4.5 g/L glucose, 10% fetal bovine serum (FBS) (Life Technologies Ltd), 1% L-Glutamine, and 1% Penicillin-Streptomycin (Pen-Strep) (Sigma). HEK cells carry the Epstein-Barr Virus Nuclear Antigen-1 (EBNA-1) gene and allow for improved protein production since plasmids replicate competently in positive cells. HEK cells were transfected using Lipofectamine 3000 (Invitrogen). HEK cells were first seeded at 1 × 10^6^ cells/well in a 6-well plate. Upon reaching a confluence of \~80--90%, 5 μg of the plasmid DNA was mixed with different volumes of lipofectamine 3000 (3.5 and 7.5 μl) in 125 μl of Opti-MEM™ (Thermofisher), and the mixture was incubated for 15 min at room temperature. Afterward, the lipo-DNA mixture was added dropwise onto the cells. After 24 h, the cells were washed once with PBS, and selection media containing puromycin (Gibco) was added (DMEM, 10% FBS, 1% Pen-Strep, 1% of L-Glutamine, (2 μg/mL) and incubated for 3 days. The cells were then washed with PBS before adding fresh medium minus puromycin. The supernatant was harvested and stored at −20°C until further use. The transfected cell supernatant was loaded at 4°C onto a HisTrap HP column (GE Healthcare). The column was then washed with 10 CV of binding buffer, followed by stepwise elution of the protein with increasing imidazole concentration (50, 100, 250, and 500 mM) in binding buffer. Protein content and purity of each fraction were visualized by Coomassie staining. Positive fractions were pooled and dialyzed at 4°C against PBS.
Animal Models
-------------
Cells derived from mice that were used in the *in vitro* experiments were housed at the University of Manchester Biological Services Facility (BSF) under specific-pathogen-free conditions. They had easy access to food and water on a 12/12-h light cycle. All breeding mice were routinely screened (3 monthly or annually where applicable) according to BSF recommendations. The mouse strains (hTNF.LucBAC and C57BL/6) were bred in this study under a Home Office project license (70/7800) (P8829D3B4) in agreement with the Animal (Scientific Procedures) Act 1986. The C57BL/6 mice were ordered from Charles River (Charles River Laboratories, Inc., Harlow, UK). The *in vivo* experiments were performed at the University of Cologne, Germany, under animal experimental license 24-9168.11-1/2009-22.
Purification of Bone Marrow-Derived Macrophages
-----------------------------------------------
Mouse bone marrow-derived macrophages cells (BMDMs) were isolated, as described previously ([@B32]). Briefly, bone marrow-cells were dissected from femurs and tibiae and plated into a complete media (RPMI 1640 medium (Sigma) supplemented with 10% v/v FBS (Life Technologies Ltd), 100 IU/mL penicillin 100 μg/mL streptomycin (Sigma), 50 ng/mL mouse colony-stimulating factor (MCSF) (Promega), and 50 μM β-mercaptoethanol) (Sigma) at 5 × 10^6^ cells per 90 mm bacterial petri dish (Sterilin, UK) for 4 days. On day 4, 10 mL of complete media was added and incubated for 3 days. Adherent cells were then harvested with 5 mL of PBS supplemented with 5% v/v FBS and 2.5 mM EDTA. For splenocyte isolation, the spleen was homogenized and filtered through nylon mesh filters (70 μM; Becton Dickinson, UK) to generate a single-cell suspension. RBCs were lysed with ammonium chloride potassium (ACK) lysis buffer before the cell pellet was resuspended in DMEM medium supplemented with 10% v/v/FBS, 1% w/v/Penicillin/Streptomycin, 1 mM glutamine and 50 μM β-mercaptoethanol.
Cell-Based Luciferase Reporter Assay
------------------------------------
The cell-based luciferase reporter assay has been previously described ([@B32]). BMDMs were plated in 96 well plates (OptiPlate-96, White Opaque 96-well Microplate; Perkin Elmer, UK) at 1 × 10^5^/well in 0.1 mL medium containing 1 mM luciferin (Promega) and left to rest overnight. Cells were stimulated with LPS (*Salmonella enterica* serovar Minnesota R595; Alexis Biochemicals, UK) (10 ng/mL) alone or in the presence of commercial mouse IL-10 mouse (Protech), natural or stable IL-10 proteins. The anti-IL-10R antibody (clone: 1B1.3a) (Biolegend UK Ltd) was used to validate that the alteration in the luciferase response observed was dependent on the IL-10 receptor\'s engagement with IL-10. Unstimulated cells were used as a negative control. The luciferase activity was measured over time in a CO~2~ Lumistar Omega luminometer (BMG Labtech, UK).
Temperature- and pH-Dependent Stability Study
---------------------------------------------
Stability experiments were performed as previously described ([@B9]), with the biological activity of IL-10 being monitored by luciferase assay. Briefly, 0.1μg/mL of IL-10 sample was incubated at 55°C in time-course (to 30 min). The pre-heated IL-10 sample was added together with LPS on hTNF.LucBAC BMDMs and the luciferase activity was monitored over time. The pH-effect on the biological stability was determined by first pre-incubating a 0.1 μg/mL sample in different pH buffers (sodium citrate pH 2.5, sodium phosphate pH 5.5--6.5 and TRIS-base pH 8.0--10.0) for 24 h at 4°C followed by buffer exchange with PBS using a spin Desalting column (Thermofisher). Protein was diluted to a final concentration in each experiment of 10 ng/mL before testing for biological activity.
Enzyme-Linked Immunosorbent Assay (ELISA) for IL-10
---------------------------------------------------
The recombinant fusion mouse and human IL-10 proteins were detected after purification using Ready Set Go ELISA kits (Cat mIL-10 50-112 eBioscience, UK, Cat hIL-10 88-7106) according to the manufacturer instructions. Briefly, 96-well flat-bottom high-affinity ELISA plates were coated overnight at 4°C with the capture antibody. Plates were washed three times with washing buffer (0.05% Tween 20 PBS) before the addition of blocking buffer to each well with 1X ELISA Diluent (supplied) for 1 h. Standards were prepared and added in 2-fold serial dilutions (4,000--31.25 pg/mL) after washing the plate three times as above. The recombinant protein was diluted 100-fold before serial dilution (1/2) were incubated for 2 h at RT. The detection antibody was added and incubated for 1 h after washing three times with washing buffer as above. Plates were further rewashed three times before incubation with streptavidin-horseradish peroxidase (HRP) for 30 min at RT. Plates were then washed five times with substrate solution, Tetramethylbenzidine (TMB). After incubation for another 15--30 min at RT in the dark, stop solution (2N H~2~SO~4~) was added (25 μl) to each well. Optical density was measured using Versa-Max ELISA Microplate Reader with 450 filter.
Western Blot
------------
Purified IL-10 was detected by western blot using the anti-mouse IL-10 (JES5-2A5) (eBiosciences). For Splenocytes (5 × 10^6^) were either left unstimulated or were stimulated with either Nm or STm for 24 h After 24 h cells were washed three times with cold PBS and lysed in 0.5 mL of RIPA Buffer (Sigma) containing 5 ul of Protease Inhibitor Cocktail (Sigma) and incubated on ice for 5 min. Samples were then centrifuged at 5,000 × g for 5 min, and the supernatants stored at −20°C. A nanodrop machine was used to determine the concentration of the protein (absorbance at 280 nm) for each sample. The total protein concentration was adjusted in all samples with the addition of a RIPA lysis buffer.
Protein samples were loaded onto 4--12% BIS-Tris Gels (Invitrogen) using running buffer MED SDS (Invitrogen). 24 μl of sample and 6 μl of SDS Sample Buffer (4X) (Thermofisher) were mixed and heated at 80°C for 5 min. 10 μl of electrophoresis marker (Sigma) was used to determine the molecular size. The gel was run at 100 V until the tracking dye reached the bottom of the gel. The gel was removed from the gel cassettes and placed in the nitrocellulose membrane (Bio-Rad) and blotted using the Trans-Blot Turbo Transfer System (Bio-Rad). The blot was then incubated with blocking solution (5% w/v milk in TBS-Tween) for 90 min at room temperature; before incubation with a primary antibody: anti-rat IL-10 (JES5-2A5) (eBiosciences), anti-mouse total STAT3 (Cell signaling), and anti-rabbit p-STAT3(Cell signaling) in 1:1000 in 5% w/v milk in TBS-Tween overnight at 4°C. After that, the blots were washed four times with TBS-Tween for 20 min; before incubated with the secondary antibody (horseradish-peroxidase (HRP)-conjugated goat anti-mouse or anti-rabbit (Cell signaling) at 1:2000 in 5% w/v milk in TBS-Tween for 60 min. The signals were developed using a Western Blot Chemiluminescent Substrate (ECL western blotting substrate (Cell signaling).
*In vivo* Experiments
---------------------
Treatment of LPS-induced inflammation of the skin with IL-10: On three consecutive days, 10 μg each of LPS in a volume of 50 μl, with or without varying amounts of Nm or STm, were injected into the flank at the same site. On the 5th day, the tissue surrounding the injection site became removed en bloc and hematoxylin and eosin (H & E) stained. The tissue in 4% formalin was cut to 5 microns thickness using a microtome. After drying the sections onto slides, the deparaffinization and rehydration stages were carried out. The preparations were subsequently stained with Mayer\'s hemalum solution (Sigma) and eosin (Sigma), dehydrated again, and covered with entellan (Merck). When viewed in the light microsphere, the basic cytoplasm, elastin, and collagen appeared red-orange, the nuclei dark blue, and erythrocytes yellow-orange.
Treatment of Endotoxin Shock by IL-10: 100 μl PBS containing 25 μg LPS (serotype 055: B5) was injected retro-orbitally (i.v) in C57BL/6 mice (8--12 weeks) to indicate the optimum time for TNF synthesis after LPS treatment. To test the efficacy of IL-10 in TNF suppression, C57BL/6 mice were pre-treated with different amounts of either PBS, Nm or STm (2 μg each) for 30 min before injecting LPS (10 μg) At the indicated time points (1.5, 3, or 6 h), blood was taken retro-orbitally, and ELISA used to determine the TNF serum concentration. IL-10^−/−^ mice were given 10 μg LPS together with increasing concentrations of Nm or STm being injected intravenously. After 3 h, blood was withdrawn, and the IL 6 serum concentration determined by ELISA.
Statistical Analysis
--------------------
Results were represented as the mean ± standard error of the mean (SEM). Following assessment for normality and equality of variances, statistical inferences on data were performed using one-way, or two-way analysis of variance (ANOVA) followed by unpaired comparisons of treatment means using Dunnett\'s *post-hoc* test (LPS-treated or vs. LPS+IL-10) used in the luciferase inhibition assay and (untreated or vs. treated) used in the stability study. Differences were considered statistically significant when *p* \< 0.05. Luciferase activity represented as area under the curve (AUC) Statistical analyses were performed using GraphPad Prism-7 Software Statistical Package, La Jolla CA; the USA.
Results {#s3}
=======
Generation, Expression, and Purification of a Stable IL-10 Protein Using a Mammalian Expression System
------------------------------------------------------------------------------------------------------
The crystal structure of the IL-10 dimer shows that the C-terminus of one monomer is in close proximity to the *N* terminus of the second monomer due to 3D domain swapping with the antiparallel association. This suggested that a stabilized dimer could be generated by linking these two termini. A new recombinant stable IL-10 was generated by cloning two copies of the same IL-10 cDNA in tandem as a continuous polypeptide in the same orientation separated by 7 amino acids linkers (-G~3~SG~3~-) ([Figure 1A](#F1){ref-type="fig"}). Because glycine-serine linkers do not form α-helices and have no reactive side chains ([@B34]), they are often used for a flexible and neutral connection of protein domains. Importantly, molecular dynamics simulation ([Figure 1B](#F1){ref-type="fig"}) suggested that the linker would not interfere with the secondary structure of the monomers or IL-10 receptor binding site. In this report, we name the natural IL-10 (non-covalently linked) from mouse as Nm and human as Nh; besides, we name the stable IL-10 dimer from the mouse as STm and human as STh.
![Expression and ELISA measurement of natural and stable mouse IL-10. **(A)** The cDNA construct of both natural mouse IL-10 (Nm) and stable mouse IL-10 (STm). The cartoon illustration of the expected protein folding of both Nm and STm versions. **(B)** The ribbon plot of the natural IL-10 homo-dimer with *N* and *C* terminus obtained from the previous study ([@B13]) and the molecular dynamics simulation of stable IL-10. The basis for this simulation is the crystal structure of the hIL-10 dimer ([@B33]) (PDB-ID: 2ILK). After about 2 ns of simulated time, the state of the system shown here was found. The peptide linker (-G3SG3-) is colored red. The molecular simulation of stable IL-10 was carried out by Jan-Philip Gehrcke (Biotechnology Center Dresden). **(C)** Both Nm and STm were stained with Coomassie Blue under reducing condition in SDS-page and **(D)** detected by IL-10 antibody in Western Blot. **(E)** Nm (black line) and STm proteins (blue line) were detected ELISA (1/2 dilutions). All data are representative of triplicate wells, and the bars represent standard error of the mean.](fimmu-11-01794-g0001){#F1}
Both STm and Nm were generated from HEK cells with a His-tagged pCEP V19 expression vector. Recombinant Nm and STm proteins from parental vector-transfected cells were subjected to purification by an N-terminal His-tag purification column and analysis by SDS-PAGE and Western blotting. Under reducing conditions, the Nm migrated as a monomeric band in the region of 23 kDa, while the STm as a stable dimer migrated as a dimer band of \~41 kDa in SDS-PAGE ([Figure 1C](#F1){ref-type="fig"}). This result corresponds to the calculated molecular weights of 18.7 for IL-10 monomers and 37.3 kDa for IL-10 dimers, respectively ([@B35]). Both proteins were also detected using a specific IL-10 antibody (clone: JES5-2A5) in the western blot with different migration profiles due to the monomeric and dimeric forms ([Figure 1D](#F1){ref-type="fig"}). Finally, both STm and Nm were detected by IL-10-ELISA to determine the recombinant IL-10 protein concentrations ([Figure 1E](#F1){ref-type="fig"}) with a commercially sourced IL-10 protein (CmIL-10) (PeproTech) being used as an internal standard.
The Biological Activity of Stabilized Mouse IL-10 Dimer *in vitro*
------------------------------------------------------------------
Different approaches were used to measure the biological activities of the various versions of the IL-10 proteins we generated. First, we determined IL-10 activity by detection of STAT3 phosphorylation in IL-10 treated lymphocytes. To demonstrate proof of concept, spleen cells from wild-type, IL-10^−/−^, and IL-10R1^−/−^ mice were prepared and stimulated with the purified IL-10 proteins (5 ng/mL). Phosphorylated STAT3 (p-STAT3) (75 kDa) was detected by western blot analysis of cell lysates. Both STm and Nm induced p-STAT3 in murine wild-type and IL-10^−/−^ but not in IL-10R1^−/−^ receptor-deficient cells ([Figure 2A](#F2){ref-type="fig"}), demonstrating that the STm IL-10 uses the IL-10R for signaling.
{#F2}
We compared regulatory activities of STm, Nm, and commercial mouse IL-10 (CmIL-10) using BMDMs isolated from the hTNF.LucBAC reporter mouse reports the activation of the human *TNF gene* promoter, as previously described ([@B32]). STm, Nm, and CmIL-10 (all at 10 ng/mL) significantly suppressed the LPS-induced luciferase production by about 60% (*p* \< 0.001 ANOVA) ([Figure 2B](#F2){ref-type="fig"}) Subsequently, we titrated STm and Nm IL-10 and determined half-maximal suppression of luciferase induction (ED~50~) values of 0.04 and 0.17 ng/mL for STm and Nm, respectively ([Figure 2C](#F2){ref-type="fig"}). For validation of this result, we isolated the supernatant of LPS- and IL-10-treated BMDMs after 24 h and measured soluble mouse TNF by ELISA. This alternative readout yielded ED~50~ values in the same range as obtained by quantification by the bioluminescence reporter system ([Figure 2D](#F2){ref-type="fig"}). Thus, STm was 4- to 8-fold more active than natural IL-10. Likewise, Western blot analysis of STAT3 phosphorylation induced by titrating amounts of IL-10 showed about 100-fold higher activity of STm compared to natural mouse IL-10 ([Figure 2E](#F2){ref-type="fig"}). As a further test to quantify the biological activity of STm, we determined concentrations of anti-IL-10 mAb required to inhibit STm-induced STAT3 phosphorylation. While the activity of Nm was almost entirely blocked by pre-incubation with 0.05 mg/ml anti-IL-10 antibody, this antibody concentration did not affect STm activity ([Figure 2F](#F2){ref-type="fig"}).
We believe that the suppression of luciferase is dependent on the IL-10R engagement with IL-10. Therefore, we tested the capability of the IL-10R antibody to block the effect of IL-10 on LPS-BMDMs of h.TNF.LucBAC. Our data showed that the presence of anti-IL-10R1 blocking antibodies completely blocked the biological activity of STm. Our data demonstrate that there is a non-significant change in the luciferase induction of a pre-treated BMDMs with 0.2 μg/mL anti-IL-10 receptors antibody (antiIL-10Ra) compared to the BMDMs treated with LPS only (10 ng/mL) ([Figure 2G](#F2){ref-type="fig"}).
In order to address whether the length of the flexible linker, which may affect solubility, stability, and function of the fusion protein, we generated dimeric IL-10 molecules with different linker lengths -G~3~SG~3~- (STm7), -G~3~SG~4~S- (STm9), and -G~3~SG~4~-SG~4~- (STm13) as described above. Linker length did not impact on the bioactivity of the stable IL-10 as determined by suppression of LPS-induced TNF reporter expression ([Figure 2H](#F2){ref-type="fig"}). Collectively, stable mouse IL-10 shows significantly more potent bioactivity compared to natural mouse IL-10.
Temperature- and pH-Dependent Stability of Stable Mouse IL-10 Protein
---------------------------------------------------------------------
The human IL-10 homodimer was shown to rapidly dissociate into inactive monomers at lower pH and higher temperature ([@B9]). We compared the effect of temperature and pH on the biological activity of STm and Nm. A 30 min incubation at 37°C did not affect the capacity of Nm or STm to suppress LPS-induced luciferase expression ([Figure 3A](#F3){ref-type="fig"}). Nm lost bioactivity already upon 5 min exposure to 55°C, whereas the treatment did not affect STm ([Figure 3B](#F3){ref-type="fig"}, [Figure S1A](#SM1){ref-type="supplementary-material"}). ED~50~ of commercial IL-10 and Nm were significantly reduced by exposure to 55°C for 10 min while STm was not affected by this treatment ([Figures 3C--E](#F3){ref-type="fig"}). Moreover, we investigate the impact of acidic and basic pH on the biological activity of IL-10 protein. Biological activity of both Nm and STm decreased in acidic and alkaline pH compared to neutral pH (pH 7). However, at an acidic pH of 5, STm was significantly more active over a wide concentration range ([Figure 3F](#F3){ref-type="fig"}). We also addressed the effects of freezing and frozen storage on IL-10 bioactivity. Our data indicate that the ED50 of STm IL-10 was 0.041 ng/mL, and ED~50~ Nm was 0.15 ng/mL after storage at −80°C for 6 months ([Figure 3G](#F3){ref-type="fig"}). In summary, we show that stable mouse IL-10 is more resistant to heat and low pH than natural mouse IL-10.
{#F3}
The Effect of the Site-Specific Mutation on Stable Mouse IL-10 Biology
----------------------------------------------------------------------
We predict that the STm bound to IL-10R like Nm (i.e., natural IL-10). To investigate this, we mutated the IL-10R binding site in the STm dimer. The location of the IL-10R binding site was obtained from the previous study on IL-10/IL-10R interaction ([@B13]). For this purpose, we introduced four-point mutations (L23G, R27G, K34G, and Q38G) at the helix A of the second monomer of the STm dimer ([Figure 4A](#F4){ref-type="fig"}). This mutated form of IL-10 named IL-10M2^Mu^. The IL-10 ELISA detected the IL-10M2^Mu^ as validation of the presence of the recombinant protein in culture supernatants of HEK cells ([Figure 4B](#F4){ref-type="fig"}). The luciferase assay, represented as AUC, showed that IL-10M2^Mu^ (10 ng/mL) inhibited the luciferase activity by \~15% (*p* \< 0.5, ANOVA). However, 50 ng/mL of IL-10M2^Mu^ inhibited luciferase activity by \~40% as the Nm and STm (*p* = 0.001, ANOVA) ([Figure 4C](#F4){ref-type="fig"}). This data shows that maximal suppression could be achieved with 5-fold of IL-10M2^Mu^ compared to STm and Nm. This experiment may represent the significance of dimerization in STm to retain the maximum activity by binding to the IL-10R as the natural IL-10.
{#F4}
In previous investigations, we demonstrated that several alanine substitutions in the IL-10^RRCHR^ (i.e., natural IL-10) region have an impact on the structural integrity (α-helical structure) of IL-10 ([Figure 5A](#F5){ref-type="fig"}), with substitution of RRCHR to ARCHA causing the most significant loss of structure ([@B36]). Importantly, we found a correlation between changing the degree of α-helical structure with the reduction in the biological activity of Nm, as presented in ED~50~ and confirmed by the p-STAT3 assay ([Figures 5B,C](#F5){ref-type="fig"}). Based on this data, to further investigate the biological properties and the IL-10R binding of the engineered STm, we assessed the corresponding impact of these substitutions on the biological activity of STm. Our data showed that these mutations affected the biological activity of STm to a different extent compared to Nm, as represented in ED~50~ and confirmed by p-STAT3 assay ([Figures 5D,E](#F5){ref-type="fig"}). Specifically, whereas the ARCHA mutation significantly affected Nm biological activity by \>500 fold, this only led to a 10-fold loss of function in STm. Conversely, the AACHR and RACHR substitutions that did not dramatically modify STm activity led to a similar loss of function in the STm as the ARCHA mutation. Collectively, the inactivation of one monomer of STm led to a weaker binding to IL-10R; moreover, the impact on the biological activity of amino acid substitution at the RRCHR region was higher in Nm than STm.
![The effect of amino acid substitution at the RRCHR region of mouse IL-10 on biological activities. **(A)** The secondary structure of IL-10 mutants by CD spectroscopy adopted from unpublished data ([@B36]). **(B)** The ED50 of natural IL-10 was calculated as flow: Nm^RRCHR^ (un-mutant) (black line) (0.1 ng/mL), Nm^RACHR^ (green line) (0.28 ng/mL), Nm^AACHR^ (blue line) (0.96 ng/mL), and Nm^ARCHA^ (red line) (59.28 ng/mL). **(C)** The activation of cellular signaling (p-STAT3) determines by western blot after lysate from spleen cells of the C57BL/6 mouse treated Nm mutants and un-mutant (control) in dose-response and using the total STAT3 as an internal control. **(D)** The ED50 of stable IL-10 was calculated as flow: STm^RRCHR^ (un-mutant) (black line) (0.36 ng/mL), STm^RACHR^ (green line) (1.6 ng/mL), STm^AACHR^ (blue line) (2.55 ng/mL), and ST^ARCHA^ (red line) (3.02 ng/mL). **(E)** The activation p-STAT3 determines by western blot from spleen cells lysate of the C57BL/6 mouse treated STm mutants and un-mutant (control) in dose-response and using the total STAT3 as an internal control. The data represented as AUC (Area Under the Curve). All data are representative of two independent experiments, with triplicate cultures per experiment (*N* = 2, *n* = 3), and bars represent standard error of the mean.](fimmu-11-01794-g0005){#F5}
Stabilized Mouse IL-10 Dimer Is Biologically Active *in vivo*
-------------------------------------------------------------
While the above data demonstrated the improved biological activity and stability of STm *in vitro*, it was essential also to examine the efficacy of STm *in vivo*. The efficacy of STm compared to Nm under physiological conditions was first examined utilizing a local inflammatory reaction in the skin of mice. The skin consists of a multilayer structure of the epidermis, as well as the bluish coloration of the basophilic epithelial cytoplasm ([Figures 6A,B](#F6){ref-type="fig"}). Subcutaneous injection of LPS causes a dose-dependent inflammatory infiltration of all layers of the skin ([@B37]). Our previous data showed that this reaction is much more severe in IL-10^−/−^ mice, with considerable necrosis of epidermis, dermis, and panniculus carnosus ([@B37]). This result indicates the importance of IL-10 in modulating the inflammatory response to LPS in the skin, validating the model to assess the *in vivo* effectiveness of STm in controlling inflammation. Different concentrations of the IL-10 proteins were injected subcutaneously (under the panniculus carnosus) together with LPS (10 μg) into IL-10^−/−^ mice. On 3 consecutive days, an injection was made in the same place in the flank. On the 5th day, the mice were sacrificed, and the tissue removed from the injection site and examined histologically. This experiment showed that injections of LPS without IL-10 resulted in a massive inflammatory local reaction with massive recruitment of numerous macrophages and neutrophils ([Figures 6C,D](#F6){ref-type="fig"}). Moreover, all layers of the skin in the center of the lesion became necrotic compared to healthy skin. The enlargement view ([Figure 6D](#F6){ref-type="fig"}) showed a necrotic hair follicle and necrotic interfollicular epidermis with condensed nuclei and reddish acidophilic cytoplasm as opposed to the basophilic cytoplasm of healthy keratinocytes. Coadministration of STm along with LPS ([Figure 6E](#F6){ref-type="fig"}) suppressed the inflammatory response in a dose-dependent fashion. In [Figure 6F](#F6){ref-type="fig"}, we summarize the biological activities of STm and Nm in protecting LPS induced inflammation. Both STm and Nm were protective at 2 and 0.2 μg. STm appeared to be more effective than Nm at 0.02 μg, where the biological activity of Nm was waning. At 0.002 μg, both Nm and STm had no protective effect against skin inflammation ([Figure 6F](#F6){ref-type="fig"}). This experiment demonstrated the biological effect of STm *in vivo* but did not allow a quantitative comparison between Nm and STm.
{#F6}
The activity of STm was also tested using an *in vivo* model of LPS-induced systemic inflammation. First, the time course of TNF concentration in serum after retro-orbital (i.v.) LPS injection was determined in establishment experiments. A high serum concentration of TNF \~3.2 ng/mL was measurable 1.5 h after the administration of LPS (25 μg i.v.). This value was reduced by about 75% after 3 h and had returned close to baseline levels 6 h after LPS injection. Injections of PBS or Nm and STm (2 μg each) alone did not result in the measurable release of TNF, which could exclude contamination of these reagents with pyrogens ([Figure 7A](#F7){ref-type="fig"}). In the next experiment, different amounts of STm i.v. were injected 30 min before LPS (25 μg i.v.). Here, the STm proved to be highly effective, in a dose-dependent manner, in the suppression of TNF release. The administration of 2 μg Nm and STm reduced serum TNF concentration by \~70% relative to the control mice receiving only LPS. Both at either 2 or 20 μg, Nm and STm were equally effective at suppressing TNF production ([Figure 7B](#F7){ref-type="fig"}). Apparently, in this assay, the maximum level of TNF suppression was reached at 2 μg IL-10, as the injection of 20 mg IL-10 failed to suppress TNF production further. Experiments with titrations of Nm- and STm, however, showed large fluctuations in TNF serum concentration and therefore did not allow a quantitative comparison of the effects of Nm- and STm (data not shown). Therefore, we investigated the ability of Nm and STm IL-10 to inhibit the production of IL-6, which is another cytokine integral within the acute phase inflammatory immune response. The serum concentration of IL-6 was determined 3 h after injection by ELISA. It was found that over a wide dose range, the STm reduced IL-6 release more effectively than Nm. By non-linear regression, Nm suppressed the IL-6 response with an ED~50~ value of 274.8 ng/mL, whereas STm suppressed IL-6 production with an ED50 of 112 ng/mL. Thus, STm was \~2.5-fold ([Figure 7C](#F7){ref-type="fig"}) more potent than Nm. Altogether, the stable form of IL-10 is biologically active *in vivo*, which controls both the local and systemic inflammatory responses.
{#F7}
The Biological Activity and Stability of Stabilized Human IL-10 Dimer *in vitro*
--------------------------------------------------------------------------------
Our results demonstrated that STm molecules could be generated with potent regulatory activity. Consequently, given the aim of developing an IL-10 based treatment for human disease, we investigated whether it was also possible to create a biologically active and stable version of human IL-10. We first generated and produced a stable human IL-10 using different lengths of the flexible linker ([Figure S2A](#SM1){ref-type="supplementary-material"}). Our data showed that both Nh and STh, with different linker lengths, are biologically active *in vitro* by suppressing LPS-induced luciferase expression in BMDMs from the h.TNF.LucBAC reporter mice ([Figure 8A](#F8){ref-type="fig"}). STh had a 2.5-fold higher biological activity than Nh, as measured by p-STAT3 activation ([Figure 8B](#F8){ref-type="fig"}), which was confirmed by conventional TNF ELISA assay ([Figure S2B](#SM1){ref-type="supplementary-material"}). Like the mouse IL-10, the effect of human IL-10 on luciferase suppression was blocked by using mouse anti-IL-10R1 in a dose-dependent manner. Interestingly, our data demonstrate that increased amounts of anti-IL-10R1 antibody were required to block the effect of STh in suppressing luciferase production than to block the effect of Nh ([Figure 8C](#F8){ref-type="fig"}). This data may indicate the binding of STh to mouse IL-10R is of higher affinity compared to the Nh.
{#F8}
In terms of stability, both STh and Nh were incubated during a time course at 37°C, which showed no significant difference in luciferase inhibition (*p* \> 0.5, ANOVA) ([Figure 8D](#F8){ref-type="fig"}), which indicates the both Nh and STh are biologically active at physiological temperature. However, Nh gradually lost biological activity after 5 min of heat treatment at 55°C, whereas STh maintained biological activity as measured by luciferase assay ([Figure 8E](#F8){ref-type="fig"}) and TNF-ELISA ([Figure S1B](#SM1){ref-type="supplementary-material"}). In a dose-response experiment, we also observed that Nh became less potent after heat treatment (55°C for 10 min) ([Figure 8F](#F8){ref-type="fig"}); however, STh maintained suppressive activity ([Figure 8G](#F8){ref-type="fig"}). The pH-dependent stability study showed that STh behave similarly to Nh, but, the STh was more resistant in pH5 and pH2 ([Figure 8H](#F8){ref-type="fig"}). Overall, these data show that the STh is a biologically active protein *in vitro* with higher stability compared to Nh.
Overall, we generate a stable IL-10 dimer by linking two IL-10 monomers in a head to tail fashion by a flexible linker ([Figure 9](#F9){ref-type="fig"}). We demonstrate that our novel stable IL-10 dimer is more stable in different stress conditions compared to non-covalently linked IL-10 (i.e., natural IL-10). We assume the stable IL-10 dimer folds as natural IL-10. The IL-10 3D domain-swapped dimerization of IL-10 is essential to form the receptor binding site of the cytokine ([@B13]). Our mutational experiment has indirectly proved that stable IL-10 dimer binds and acts by the IL-10 receptor.
{#F9}
Discussion {#s4}
==========
Soon after the cytokine IL-10 was cloned, we generated a mouse mutant deficient for IL-10 and could show that these mice developed inflammatory bowel disease that depended on the microflora ([@B21]). Based on these findings and subsequent preclinical trials, it was shown that while recombinant IL-10 was safe and well-tolerated in healthy individuals ([@B38]), it had limited efficacy in treating inflammatory diseases ([@B39]). In this report, we reach an important milestone for the generation of a recombinant IL-10 with more stable biochemical properties. Syto et al. studied the structural and biological stability of non-covalently linked IL-10 dimer under different conditions. It was observed that incubation of human IL-10 dimer for 1 h at 37 and 55°C resulted in the formation of 2 and 22% monomers, respectively ([@B9]). By the covalent fusion of two IL-10 monomers, we generated a more stable and most likely also more biologically active form of IL-10 both for mouse and human ([Figures 2](#F2){ref-type="fig"}, [8](#F8){ref-type="fig"}). The previous study demonstrates that the covalent fusion of dimeric HIV-1 proteases has been shown to improve protein stability compared to natural dimer ([@B30]). However, the mechanism of this stability enhancement is not clear. Our possible explanation is that linking the C-terminus of one IL-10 monomer to the N-terminus of the second monomer may increase the stability of the IL-10 3D domain-swapped dimer. The IL-10 3D domain-swapped dimer defined as the exchange of the helices E and F (from the first monomer) into the hydrophobic cleft (helices A-D) of the other monomer, which may not be profoundly affected by the different conditions of stress in stable IL-10 compared to the natural IL-10. This study did not define the potential of refolding stable IL-10 to the known active state after different stress-inducing conditions were applied. We could demonstrate that the new IL-10 dimer binds and acts via the IL-10 receptor, shown that it does not act on IL10R1 deficient lymphocytes ([Figure 2A](#F2){ref-type="fig"}), by blocking the biological activity using anti-IL-10 receptor antibodies ([Figure 2F](#F2){ref-type="fig"}) and by introducing point mutations in the covalent linked IL-10 dimer suggested to be involved in IL-10 and IL-10 receptor interaction ([Figure 4](#F4){ref-type="fig"}). A previous study suggested that IL-10 dimer formation is vital to generate the receptor-binding domain that activates IL-10R signaling via side to side interaction ([@B13]). Therefore, it is believed that the correct dimer formation (i.e., 3D domain swapping) in IL-10 is essential to create a receptor-binding domain ([@B13]). This hypothesis has been confirmed by generating a stable monomeric form as a model to bind to IL-10R in 1:1 interaction ([@B40]). The next step along this line is to generate crystal structures for the new IL-10 proteins and to compare these to the known IL-10 structure ([@B33]). Our recombinant stable dimeric IL-10 can now be used as a building block for the development of IL-10 based therapeutic. One of the new features of our stable IL-10 is that we can now prepare asymmetric IL-10 variants as we have control over the complete IL-10 dimer. We can modify each IL-10 molecule in the dimer independently and get 100% variants with a defined order of each of the monomers. This allows in the future more insights into the functional analysis of IL-10 with its receptor and fine-tuning of the biological activity of the stable IL-10 protein.
Using the conditional gene targeting approach, we generated mouse mutants with selective gene inactivation of the IL-10 ([@B41]) and the IL-10R ([@B23]). Using these mutants in many different settings, we have clear evidence that IL-10 is a local acting cytokine, and there is an apparent cell-type specificity at both at the level of the IL-10 producing and at the level of the IL-10 responding cell. For example, in the T-cell specific IL-10 deficient mouse mutant ([@B41]), only T cell-specific responses are dysregulated, while innate responses are unaffected. In contrast, in a macrophage-specific IL-10 receptor-deficient mouse mutant, the T cell responses are unaffected while innate responses are disturbed similarly to IL-10^−/−^ mice. These experiments suggest that the next step toward an IL-10 based therapeutic recombinant protein will be to make an IL-10 protein that can mimic the local acting property of IL-10.This might be achieved by joining our recombinant stable IL-10 to other protein domains that can bind to local regions and/or to specific cell types. Of note, we have generated a fusion protein of IL-10 with an antibody and could see that both the IL-10 activity and the antibody binding property is present in the fusion protein (work in progress). One of the challenging steps in the engineering is to use a form of IL-10 that is less active compared to the natural IL-10 protein in order to allow IL-10 action only when a high local concentration of IL-10 through the local accumulation of the IL-10 protein through the antibody part. Examples of such IL-10 weakening mutations are presented in this report ([Figure 4](#F4){ref-type="fig"}). We presume that we are maybe even able to generate a local acting IL-10 inhibitor, in which one of the two dimers is mutated in a way that the stable IL-10 dimer binds to one of the IL-10 receptor chains and blocking dimerization of the receptor.
In conclusion, the effect of IL-10 in clinical trials is limited due to pleiotropic properties on different cells, and the rapid dissociation of the homodimer at the site of inflammation. Our stable IL-10 protein could be a potential building block for generating a potent and more effective and selective IL-10-based immunotherapy for treating inflammatory diseases and cancers. For instance, a stable IL-10 dimer has already been proposed as a model for generating a target IL-10 immunotherapy because it has a higher biological activity compared to the natural IL-10 monomer ([@B42]) and the IL-10 dimer proposed here would allow constructing such cell-type-specific local acting IL-10.
Data Availability Statement {#s5}
===========================
All datasets generated for this study are included in the article/[Supplementary Material](#s9){ref-type="sec"}.
Ethics Statement {#s6}
================
The animal study was reviewed and approved by Home Office project license (70/7800) (P8829D3B4) in agreement with the Animal (Scientific Procedures) Act 1986 and the *in vivo* experiments were performed at the University of Cologne, Germany, under animal experimental license 24-9168.11-1/2009-22.
Author Contributions {#s7}
====================
FM, SL, AR, and WM: conception, design, and stable IL-10 construction. FM and SL: *in vitro* experiment. SL and AR: *in vivo* experiments. FM, SL, and WM: data acquisition. FM, SL, RJ, and EM: IL-10 expression. FM and SP: luciferase assay. FM, SL, SP, KC, AR, and WM: data analysis and interpretation. FM, KC, and WM: drafting of the article. All co-authors: final approval of the manuscript.
Conflict of Interest {#s8}
====================
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We would like to express our deep and sincere gratitude to Prof. Dr. Mats Paulsson (University of Cologne) for his contribution to this study by providing the mammalian expression vector and cell lines. We also would like to thank Prof. Mike White (University of Manchester) for using the illuminance measuring instrument. We also acknowledge the support and advice from all members in Transgenic Unit core facility (TgU), Faculty of Biology, Medicine and Health, University of Manchester.
**Funding.** The work was supported by a Ph. D. scholarship from Umm Al-Qura University, Saudi Arabia (UMU740) to FM and by the MRC (MR/R010099/1) to KC. MR/R010099/1 was jointly funded by the UK Medical Research Council (MRC) and the UK Department for International Development (DFID) under the MRC/DFID Concordat agreement and is also part of the EDCTP2 program supported by the European Union.
Supplementary Material {#s9}
======================
The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fimmu.2020.01794/full#supplementary-material>
######
Click here for additional data file.
[^1]: Edited by: Fulvio D\'Acquisto, University of Roehampton London, United Kingdom
[^2]: Reviewed by: Krishna Rajarathnam, University of Texas Medical Branch at Galveston, United States; Maria Laura Belladonna, University of Perugia, Italy
[^3]: This article was submitted to Inflammation, a section of the journal Frontiers in Immunology
|
The NYPD says if city transit pervs are convicted of subway crimes twice, it’s enough to get them banned from the MTA for life, The Post has learned.
With subway sex abuse arrests up in the Big Apple so far this year compared to the same period in 2018 — and more than one-third involving suspects already busted for such crimes — the department is trying to ride the recent wave of support for lifetime bans.
Gov. Andrew Cuomo officially came out for the bans last week — and supports a two-strikes-you’re-out ban, a governor’s rep said Tuesday.
“They’re highly recidivist, all of them,’’ NYPD Chief of Detectives Dermot Shea told The Post of the serial sickos. “They get over and over arrested for the same things. They ride the same train lines.
“As soon as our transit cops see them, they know them, and they wind up playing a cat-and-mouse game … and follow these people for hours, unfortunately having to wait and watch them commit another crime. It’s extremely frustrating.’’
While the chief admitted that a lifetime ban “is not easy to enforce,’’ he said, “Sometimes, you gotta roll your sleeves up, go into court and fight for what you think is right.’’
Police brass identified for The Post three slimy straphangers who they say would be among the first targeted by them for potential lifetime bans.
The convicted pervs include 41-year-old Barron Jones of Queens, who has been arrested at least 15 times — including for groping women’s butts and grinding against female straphangers, law enforcement sources said.
Another Queens sicko, Miguel Hermengildo Pacheco, also 41, was accused of grabbing a woman’s bottom as she walked her three kids to school.
One of the pervs, Pedro Sanchez-Rojas, 51, has also allegedly used a camera now twice to film up female subway riders’ skirts.
“These bad actors are indicative of the larger problem of recidivist transit sexual offenders who use the trains solely for a hunting ground — and why we need swift action to protect riders,” said NYPD spokeswoman Devora Kaye.
There have been 624 subway sex-related complaints so far this year in the city compared to 609 for the same period last year, figures show.
There also have been 275 subway sex crime arrests year-to-date compared to 270 for the same time frame in 2018, the stats say. In 95 of the arrests, the perp had already been collared for a subway sex crime, cops said.
Shea said police would enforce lifetime bans hopefully with the help of ankle bracelets that would alert cops if the pervs enter the system.
Besides, “as soon as our transit cops see them, they know them,” Shea said of the perverts.
He said banned offenders would be prosecuted for trespassing, adding that the move to ban serial offenders would likely need state legislative action.
MTA Chairman Pat Foye, hand-picked by Cuomo, has already said he would support such legislation. |
#include "script_component.hpp"
/*
* Author: SilentSpike
* Initalises the `group side` zeus module display
*
* Arguments:
* 0: groupSide controls group <CONTROL>
*
* Return Value:
* None
*
* Example:
* [CONTROL] call ace_zeus_fnc_ui_groupSide
*
* Public: No
*/
#define IDCs [31201,31200,31202,31203]
params ["_control"];
//Generic Init:
private _display = ctrlParent _control;
private _ctrlButtonOK = _display displayCtrl 1; //IDC_OK
private _logic = GETMVAR(BIS_fnc_initCuratorAttributes_target,objNull);
TRACE_1("logicObject",_logic);
_control ctrlRemoveAllEventHandlers "setFocus";
//Validate the module target:
private _unit = effectiveCommander (attachedTo _logic);
private _side = side _unit;
scopeName "Main";
private _fnc_errorAndClose = {
params ["_msg"];
_display closeDisplay 0;
deleteVehicle _logic;
[_msg] call FUNC(showMessage);
breakOut "Main";
};
switch (false) do {
case !(isNull _unit): {
[LSTRING(NothingSelected)] call _fnc_errorAndClose;
};
case (_unit isKindOf "CAManBase"): {
[LSTRING(OnlyInfantry)] call _fnc_errorAndClose;
};
case (alive _unit): {
[LSTRING(OnlyAlive)] call _fnc_errorAndClose;
};
case (_side in [west,east,independent,civilian]): {
[LSTRING(OnlySpecificSide)] call _fnc_errorAndClose;
};
};
//Specific on-load stuff:
private _idcActive = 31200 + ([west,east,independent,civilian] find _side);
SETVAR(_display,oldSide,_idcActive - 31200);
SETVAR(_display,newSide,_idcActive - 31200);
private _fnc_onSelection = {
params [["_activeCtrl", controlNull, [controlNull]]];
private _display = ctrlParent _activeCtrl;
if (isNull _display) exitWith {};
// Update the button scales and colours on selection
{
private _ctrl = _display displayCtrl _x;
private _color = _ctrl getVariable "color";
private _scale = 1;
if (ctrlIDC _activeCtrl == _x) then {
_color set [3,1];
_scale = 1.2
} else {
_color set [3,0.5];
};
_ctrl ctrlSetTextColor _color;
[_ctrl,_scale,0.1] call BIS_fnc_ctrlSetScale;
} forEach IDCs;
// Store selected button index for confirmation
SETVAR(_display,newSide,(ctrlIDC _activeCtrl) - 31200);
};
// Initalize buttons with colour and scale
{
private _ctrl = _display displayCtrl _x;
private _color = [_forEachIndex] call BIS_fnc_sideColor;
_ctrl setVariable ["color", _color];
_ctrl ctrlSetActiveColor _color;
_color set [3,0.5];
if (ctrlIDC _ctrl == _idcActive) then {
[_ctrl,1.2,0] call BIS_fnc_ctrlSetScale;
_color set [3,1];
};
_ctrl ctrlSetTextColor _color;
_ctrl ctrlAddEventHandler ["buttonclick", _fnc_onSelection];
} forEach IDCs;
private _fnc_onUnload = {
private _logic = GETMVAR(BIS_fnc_initCuratorAttributes_target,objnull);
if (isNull _logic) exitWith {};
if (_this select 1 == 2) then {
deleteVehicle _logic;
};
};
private _fnc_onConfirm = {
params ["_ctrlButtonOK"];
private _display = ctrlparent _ctrlButtonOK;
if (isNull _display) exitWith {};
private _logic = GETMVAR(BIS_fnc_initCuratorAttributes_target,objnull);
if (isNull _logic) exitWith {};
private _unit = effectiveCommander (attachedTo _logic);
private _side = [west,east,independent,civilian] select (GETVAR(_display,newSide,GETVAR(_display,oldSide,0)));
[_unit, _side] call FUNC(moduleGroupSide);
deleteVehicle _logic;
};
_display displayAddEventHandler ["unload", _fnc_onUnload];
_ctrlButtonOK ctrlAddEventHandler ["buttonClick", _fnc_onConfirm];
|
# monitor_manager
Quickly manage your monitors.
This script supports: on/off, blank/unblank,
extend, clone, set primary, change output mode,
rotate, reflect, adjust brightness.
# Dependencies
python3, python3-tk, xrandr, fontawesome (fonts-font-awesome package), arandr suggested but not required.
# Usage
Add the following to your i3blocks config:
```
[monitors]
command=$SCRIPT_DIR/monitor_manager
interval=once
#SHOW_ON_OFF=1
#SHOW_NAMES=1
#SHOW_PRIMARY=1
#SHOW_MODE=1
#SHOW_BLANKED=1
#SHOW_DUPLICATE=1
#SHOW_ROTATION=1
#SHOW_REFLECTION=1
#SHOW_BRIGHTNESS=1
#SHOW_BRIGHTNESS_VALUE=0
#SHOW_UP_DOWN=1
#FONT_FAMILY=DejaVu Sans Mono
#FONT_SIZE=11
#CLOSE_TO_BOUNDARY_BUFFER=20
```
|
Originally Posted by TheWatcher
Well, we have already won the series, but our batting order sans Bashar still stays as a big worry. We have two batsmen in the bench who I think should be given a try in this match to see if they can make any difference. So my team is- |
[Roentgen morphology of secondary, metastatic bone tumors (author's transl)].
General and specific roentgen morphologic criteria of secondary metastases are described and characteristic appearances of metastatic disease demonstrated by examples. Early detection of tumor metastases and limitations of different radiologic methods are discussed. Various dynamic ways of development in bone metastasis during the course of malignant disease are described and different biologic growth properties of various tumors documented by different reaction of bone tissue. The high diagnostic value of radiologic follow up examinations for control of therapeutic results is emphasized. This applies for judgement of secondary metastatic as well as for the underlying malignant disease. Analysis of the bone structure of the Tela ossea of macro- and microradiologic films is presented for illustration. |
GR 65
The GR 65 is a long-distance walking route of the Grande Randonnée network that extends from the French Prealps, across south central France, through the Pyrenees.
The French name for this GR route is the Chemin de Saint-Jacques and the Spanish name is the Camino de Santiago, because the GR 65 is an important variant route of the old Christian pilgrimage to Santiago de Compostela, one of several variants of the Way of St. James. In English it is sometimes called The Le Puy Route or by its Latin name Via Podiensis, including its subtrails GR651 and GR652.
The GR 65 is part of the system of European long-distance paths known as E3.
The route starts in Geneva, Switzerland, and continues through France to La Côte-Saint-André (Isère), Le Puy-en-Velay (Haute-Loire), Nasbinals (Lozère), Conques (Aveyron), Figeac (Lot), Moissac (Tarn-et-Garonne), and Aire-sur-l'Adour (Landes), to Roncevalles, Spain.
Category:Camino de Santiago routes
Category:Hiking trails in Europe
Category:Hiking trails in France |
Mooringer (Mainland Frisian, Mooringa), Ferring (Fohr-Amrum), Sölreng (Sylt), Helgoland. Ferring dialect is actively used. Not intelligible to East Frisian Low Saxon [frs] of Germany or Frisian [fry] of the Netherlands except by a few educated bilingual speakers of Frisian. Lexical similarity: 70% between the Mooringer dialect and Standard German [deu], 55% with English [eng], 66% with East Frisian Old Saxon [frs], the Föhr dialect has 69% with Standard German, 62% with English, 68% with Frisian [fry], 73% with East Frisian Low Saxon, 86% with the Mooringer dialect, 91% with the Amrum dialect; the Sylt dialect has 64% with Standard German, 61% with English, 79% with the Mooringer dialect, 85% with the Föhr dialect. |
Efficacy of a new fractional CO2 laser in the treatment of photodamage and acne scarring.
This study evaluates the efficacy and safety of a novel fractional CO(2) laser device for improving facial rhytids, hyperpigmentation, enlarged pores, skin laxity, and acne scarring. Subjects (n= 15) were treated three to five times at 3-week intervals. Biopsy specimens were used to evaluate healing response and neocollagenesis. Clinical improvement was rated on a quartile rating scale from digital photographs. Subject discomfort during treatment was evaluated on a scale of 0 to 5. Fourteen subjects who completed the study achieved good to excellent improvement in overall appearance, with 60% rated excellent. Improvement in photodamage was good to excellent in 92% of subjects, and reduction in rhytids was good to excellent in 85%. A total of 79% of subjects achieved good to excellent improvement in pore sizes and skin laxity. Subject discomfort during treatment was 3.0 +/- 0.7. Erythema persisted for 2-3 days, and subjects resumed normal activities 1-2 days after the procedure. Histological slides after a single treatment showed new collagen formation. The SmartSkin fractional CO(2) system (Cynosure, Inc., Westford, MA, USA) provides significant improvement for the treatment of facial wrinkles, hyperpigmentation, pore size, and skin laxity associated with photodamage. |
+ 270
Find the third derivative of -1465698*j**3 + 1584510*j**2 wrt j.
-8794188
What is the third derivative of -1498563*d**3 - 525106*d**2 wrt d?
-8991378
Differentiate -1665506*d - 822266 with respect to d.
-1665506
Find the second derivative of -564*k**5 + 2*k**4 + 18*k**3 - 11472*k.
-11280*k**3 + 24*k**2 + 108*k
What is the third derivative of 797277*v**4 + 226145*v**2 - 1?
19134648*v
Differentiate 6*i**4*u**2 - 350645*i*u + 3073*u**2 + 564*u with respect to i.
24*i**3*u**2 - 350645*u
Find the second derivative of 96001*j**4 + 4*j - 1115.
1152012*j**2
What is the second derivative of 30*o**2*v**2 + 2192*o**2 - 6623*o*v**2*w**2 + 13*o*v*w**2 wrt v?
60*o**2 - 13246*o*w**2
What is the first derivative of 48219*i**3 + 46727?
144657*i**2
What is the first derivative of h**4 + h**3 + 30478*h - 1456212?
4*h**3 + 3*h**2 + 30478
Find the third derivative of -2*y**4 + 10328*y**3 - 3*y**2 + 58.
-48*y + 61968
Differentiate -2*m*x - 3003*m - 1259853*x - 12 with respect to x.
-2*m - 1259853
What is the third derivative of -9800*g**6 + 4*g**5*w**2 + 36*g**2*w**2 + 25*w**2 wrt g?
-1176000*g**3 + 240*g**2*w**2
Find the third derivative of -m**5 + m**4 - 3721*m**3 - 1496154*m**2 wrt m.
-60*m**2 + 24*m - 22326
Differentiate 7*s**3*t + 65800*s**3 - 13*s*t + 3*t wrt t.
7*s**3 - 13*s + 3
What is the second derivative of -1856766*p**2 - 3989466*p wrt p?
-3713532
What is the second derivative of 713452*g**2*h**2 + 1523*g**2*h - g**2 - 2*g*h + 3*h wrt h?
1426904*g**2
Find the second derivative of w**5 - 17310*w**4 + 81*w + 153.
20*w**3 - 207720*w**2
Find the second derivative of 247*j*k**3 - 5*j*k + 45*k**3 + 7*k + 3669 wrt k.
1482*j*k + 270*k
What is the third derivative of 442431*f**3 - 1933*f**2 + 50*f + 2 wrt f?
2654586
Find the third derivative of 67*h**2*v**3 - 3*h**2*v**2 + 55*h**2 + 7*h*v**2 - 259*v**5 - 20*v wrt v.
402*h**2 - 15540*v**2
Differentiate 18128*i**2*v**2 + 36*i**2 + 5*i*v**3 + 656 wrt v.
36256*i**2*v + 15*i*v**2
What is the third derivative of 378316*m*u**5 - m*u + 7386*m - 2*u**2 + 3*u wrt u?
22698960*m*u**2
What is the second derivative of 54004*j**2*m**2*p**2 - 62*j**2*m + 15*j**2*p**2 - 3*j**2 - 2*j*p wrt m?
108008*j**2*p**2
Find the second derivative of -224367*x**2 + 80*x - 3835 wrt x.
-448734
Find the third derivative of 100629*h**5 - 4596*h**2 - h - 4 wrt h.
6037740*h**2
What is the derivative of 186*i**4 - 66*i**3 + 8*i + 3034996 wrt i?
744*i**3 - 198*i**2 + 8
What is the second derivative of -787789*k**5 + 165*k + 1765 wrt k?
-15755780*k**3
What is the second derivative of -145509*i**2*y + i**2 + 676*i*y - i + 110*y + 1 wrt i?
-291018*y + 2
Find the first derivative of 9*l*n**2*v - 6*l*n*v + 1055117*l*v**2 + l*v + 66*n**2*v**2 wrt n.
18*l*n*v - 6*l*v + 132*n*v**2
Find the third derivative of -3*n**3*v**3*z**2 - 20074*n**3*v*z**2 - 5*n**2*v*z + n*v**3 + n*v*z**2 + 13*n*z wrt n.
-18*v**3*z**2 - 120444*v*z**2
What is the third derivative of 2*l**6*t - 4116*l**5*t**2 - 2*l**2*t**2 + t**2 - 291*t - 2 wrt l?
240*l**3*t - 246960*l**2*t**2
Find the second derivative of -2*j**5 - 2*j**4 - 41143*j**2 + 208411*j wrt j.
-40*j**3 - 24*j**2 - 82286
What is the first derivative of -943572*l**2 + 1409470?
-1887144*l
Find the first derivative of 5*i**3 + 5*i**2 + 71*i - 57534 wrt i.
15*i**2 + 10*i + 71
Find the second derivative of 16316*g**3*r**2 - 3*g**2*r**2 - 198503*g*r**2 wrt g.
97896*g*r**2 - 6*r**2
Differentiate 2846573*o**2 + 1231023 with respect to o.
5693146*o
What is the third derivative of -1189205*w**4 + 15823*w**2 + w + 1 wrt w?
-28540920*w
What is the second derivative of 88*r**2*u**2*w - 2*r**2*w - 10187*r**2 + 8*r*u**2*w - 91*r*u**2 - r*w - 4*u + 1 wrt r?
176*u**2*w - 4*w - 20374
Find the third derivative of -88005*u**3*y + 44*u**2 - 13*y wrt u.
-528030*y
What is the second derivative of -44*f*i**2*m + 262*f*i + 2381*f*m**3 + 2*f*m**2 + f - 10*i**2*m**2 - 2*m**2 + 3*m wrt m?
14286*f*m + 4*f - 20*i**2 - 4
Find the third derivative of -k**4*t**3 - 19935*k**4 + 7*k**2*t**3 - 255*t**3 wrt k.
-24*k*t**3 - 478440*k
Find the third derivative of -746*t**4 - 31*t**3 - 902*t**2 - 430*t wrt t.
-17904*t - 186
Find the third derivative of 11*o**4*r + 18474*o**3*r**2 - 2*o**2*r + o*r**2 - 178*o*r + 17*o - r**2 wrt o.
264*o*r + 110844*r**2
What is the second derivative of 51106*h**2 + 53154*h?
102212
What is the derivative of 335*b**4*c*g + 5*b**4 - 5*b*c - 8*c - 107*g wrt b?
1340*b**3*c*g + 20*b**3 - 5*c
What is the third derivative of 3*a*f**4 + 264*a*f - 1015*a - 363989*f**4 + 2*f**2 wrt f?
72*a*f - 8735736*f
What is the derivative of -483*z**3 + 681*z**2 - 2606539 wrt z?
-1449*z**2 + 1362*z
Find the third derivative of 45348*w**5 + 14*w**2 + 20*w - 1 wrt w.
2720880*w**2
Find the second derivative of 7711*d**2 + 42191*d.
15422
Find the third derivative of -485*s**4 + 920*s**2 - 20*s wrt s.
-11640*s
What is the second derivative of -61652*d**2 - d + 2265 wrt d?
-123304
What is the second derivative of 2*h**5 + 7*h**4 - 59*h**3 - 4*h**2 - 427643*h?
40*h**3 + 84*h**2 - 354*h - 8
What is the third derivative of 724940*r**3 + 32*r**2 - 24713*r?
4349640
Find the second derivative of -8*v**3 + 8309*v**2 + 157662*v.
-48*v + 16618
Find the third derivative of -2*z**6 + 13*z**4 - 299*z**3 + 4*z**2 - 442*z + 1.
-240*z**3 + 312*z - 1794
Find the second derivative of -577264*l**2 + 310938*l.
-1154528
Find the second derivative of -2*r**3 - 472158*r**2 + 510588*r.
-12*r - 944316
Differentiate -6*f**3*n**3 + 8*f**3 + 80*f**2 - 1470*f*n**3 - 1 with respect to n.
-18*f**3*n**2 - 4410*f*n**2
Find the third derivative of -2219634*k**3 + 1535265*k**2 wrt k.
-13317804
Find the second derivative of -2*y*z**4 + 17700*y*z**3 + 41988*y*z - 3*y wrt z.
-24*y*z**2 + 106200*y*z
Differentiate 418706*y + 1145747.
418706
What is the second derivative of 87465*h*u**2 + 7*h*u - 6*h - 4*u + 21 wrt u?
174930*h
What is the second derivative of -302305*c**3 + 2161*c - 43 wrt c?
-1813830*c
What is the first derivative of -188*j**3 + 3*j**2 + 766*j + 2952614 wrt j?
-564*j**2 + 6*j + 766
Find the third derivative of -143*f**3*l**5 + 2*f**3 + 2*f**2*l + 52*f*l**5 + 378*f*l**2 - l**2 wrt l.
-8580*f**3*l**2 + 3120*f*l**2
Find the second derivative of -683811*h**3 + 22955*h - 20.
-4102866*h
What is the third derivative of t**2*z**5 - 58*t**2*z**4 - 79*t**2 + 6*t*z**2 + 7*t + 1 wrt z?
60*t**2*z**2 - 1392*t**2*z
Find the second derivative of -48267*y**3 + 13135*y wrt y.
-289602*y
What is the second derivative of 1137133*w**2 - 3*w + 257619?
2274266
What is the second derivative of 4*b**5*r - 73*b**4 + 64*b**2*r - 161*b + 3*r - 3 wrt b?
80*b**3*r - 876*b**2 + 128*r
What is the third derivative of -i**2*v**4 + 10*i**2*v**2 - 2*i**2*v - i*v**2 + 634*i*v + 6353*v**5 wrt v?
-24*i**2*v + 381180*v**2
Differentiate -725043*u**3 - 773980 with respect to u.
-2175129*u**2
What is the second derivative of -128*a*g**4 + 22*a*g + 42*a - 16*g**4 wrt g?
-1536*a*g**2 - 192*g**2
What is the first derivative of -34*m**2 + 7*m*p**2*y - m*p**2 - m*p + 46*p**2 + 623*y wrt m?
-68*m + 7*p**2*y - p**2 - p
Differentiate 863*k**4 + k + 8105.
3452*k**3 + 1
What is the derivative of -38*c**3 + 1422*c**2 - 138574 wrt c?
-114*c**2 + 2844*c
Find the second derivative of -7599*k**3*s**2 + 3*k**3 + 2640*k**2*s + 34*k*s**3 - k wrt s.
-15198*k**3 + 204*k*s
Find the second derivative of 195466*k**5 - 3*k**4*p**2 + k*p**2 + 4*k - 18962*p**2 wrt k.
3909320*k**3 - 36*k**2*p**2
What is the second derivative of -101*a**4 - 42*a**3*h + a**2*h + a**2 - 6*a*h - 262*a + 10*h wrt a?
-1212*a**2 - 252*a*h + 2*h + 2
Find the second derivative of h**5 + 8724*h**3 - h + 14866 wrt h.
20*h**3 + 52344*h
Find the third derivative of 8566*w**6 - 2*w**5 - 238*w**2 + 2*w wrt w.
1027920*w**3 - 120*w**2
Find the third derivative of 22*v*x**2 - 28*v*z**3 - 158*x**3*z**3 - 3*x**3*z**2 - 7*x*z**2 wrt z.
-168*v - 948*x**3
Find the first derivative of -328*m**4 - 113*m**2 + m - 459801.
-1312*m**3 - 226*m + 1
Differentiate 41*l**2*q**3 - 7677*l**2*q**2 - 2833*l**2 - 85 with respect to q.
123*l**2*q**2 - 15354*l**2*q
What is the second derivative of 101608*d**2 + 397373*d wrt d?
203216
Find the second derivative of -719*m**5 + m**3 - 174*m + 47 wrt m.
-14380*m**3 + 6*m
Find the third derivative of 160*g*u**4 + 6*g*u**3 + 4*g - 3*u**3 + 26*u**2 + 8*u wrt |
We support belief in an intelligent designer—the God of the Bible. This site was also ‘intelligently designed’. But rather than six days, it’s taken thousands of days. Help us design more information for this site. Support this site |
Are men with beards more likely to be sexist? That may depend on where you live. Research published in the Archives of Sexual Behavior in 2015 found a connection between facial hair and negative attitudes about women. But a replication of that study, recently published in the same journal, has failed to find the same results.
The original study, authored by Australian researchers Julian A. Oldmeadow and Barnaby J. Dixson, surveyed 309 men from India and 223 men from the United States. The participants were questioned about their views regarding the opposite sex using the Ambivalent Sexism Inventory, a survey designed to measure sexist attitudes. The participants also were shown nine computer-generated images depicting various types of facial hair (from clean-shaven to full beard) and asked to indicate which matched their own facial hair style.
Oldmeadow and Dixson found that participants with facial hair were more likely to agree with sexist statements such as, “Women seek to gain power by getting control over men.” The researchers said there may be a correlation between facial hair and sexist attitudes because it is a sexually dimorphic trait. Men might grow a beard because it increases their sexual distinction from women. “This hypothetical link between beards and sexism is not suggested to be a conscious one, but more likely mediated by masculine identity,” Oldmeadow and Dixson remarked.
In other words, men with patriarchal views may try to reinforce their “manliness” by growing a beard.
But two researchers from Sweden have disputed that explanation. Kahl Hellmer and T. Johanna Stenson’s new replication study argues that other factors can explain the link found between beards and sexism. They conducted the same study, but used a sample of 312 men from Sweden. The researchers found no link between facial hair and sexism.
The new findings (or lack thereof), Hellmer and Stenson said, suggest that the correlation between beards and sexism is not universal — but is instead entirely cultural. While beards can be a purely aesthetic choice, they can also signal memberships in particular social groups.
“We suggest that facial hair is, to some extent, used by men as a sociocultural symbol that, depending on the cultural environment, signals qualitatively distinct group memberships,” Hellmer and Stenson explained in their study. “Consequently, men in different cultures and traditions cease shaving to pursue different social group memberships, some of which may — or may not — be tied to more traditional or conservative values.”
In a more secular country like Sweden, a beard is more likely to be aesthetic. But in less secular countries like India or the United States, a beard may also indicate membership in a conservative religious group.
Oldmeadow and Dixson said they do not disagree with this assessment. But they don’t believe Hellmer and Stenson’s argument disputes their original hypothesis.
“If the relationship between facial hair and sexism is mediated by cultural groups that promote both conservative values and facial hair, the question remains why do such groups promote facial hair?” they wrote in a reply to the replication study. |
/*
* Copyright (C) 2020 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package com.android.server.locksettings;
import static com.android.internal.widget.LockPatternUtils.StrongAuthTracker.STRONG_AUTH_NOT_REQUIRED;
import static com.android.internal.widget.LockPatternUtils.StrongAuthTracker.STRONG_AUTH_REQUIRED_AFTER_NON_STRONG_BIOMETRICS_TIMEOUT;
import static com.android.server.locksettings.LockSettingsStrongAuth.DEFAULT_NON_STRONG_BIOMETRIC_IDLE_TIMEOUT_MS;
import static com.android.server.locksettings.LockSettingsStrongAuth.DEFAULT_NON_STRONG_BIOMETRIC_TIMEOUT_MS;
import static com.android.server.locksettings.LockSettingsStrongAuth.NON_STRONG_BIOMETRIC_IDLE_TIMEOUT_ALARM_TAG;
import static com.android.server.locksettings.LockSettingsStrongAuth.NON_STRONG_BIOMETRIC_TIMEOUT_ALARM_TAG;
import static com.android.server.locksettings.LockSettingsStrongAuth.STRONG_AUTH_TIMEOUT_ALARM_TAG;
import static junit.framework.Assert.assertEquals;
import static junit.framework.Assert.assertFalse;
import static junit.framework.Assert.assertNotNull;
import static junit.framework.Assert.assertNull;
import static junit.framework.Assert.assertTrue;
import static org.mockito.ArgumentMatchers.any;
import static org.mockito.ArgumentMatchers.eq;
import static org.mockito.Mockito.never;
import static org.mockito.Mockito.verify;
import static org.mockito.Mockito.when;
import android.app.AlarmManager;
import android.app.admin.DevicePolicyManager;
import android.content.Context;
import android.util.Log;
import androidx.test.InstrumentationRegistry;
import androidx.test.filters.SmallTest;
import com.android.server.locksettings.LockSettingsStrongAuth.NonStrongBiometricIdleTimeoutAlarmListener;
import com.android.server.locksettings.LockSettingsStrongAuth.NonStrongBiometricTimeoutAlarmListener;
import com.android.server.locksettings.LockSettingsStrongAuth.StrongAuthTimeoutAlarmListener;
import org.junit.Before;
import org.junit.Test;
import org.mockito.Mock;
import org.mockito.MockitoAnnotations;
@SmallTest
public class LockSettingsStrongAuthTest {
private static final String TAG = LockSettingsStrongAuthTest.class.getSimpleName();
private static final int PRIMARY_USER_ID = 0;
private LockSettingsStrongAuth mStrongAuth;
private final int mDefaultStrongAuthFlags = STRONG_AUTH_NOT_REQUIRED;
private final boolean mDefaultIsNonStrongBiometricAllowed = true;
@Mock
private Context mContext;
@Mock
private LockSettingsStrongAuth.Injector mInjector;
@Mock
private AlarmManager mAlarmManager;
@Mock
private DevicePolicyManager mDPM;
@Before
public void setUp() {
MockitoAnnotations.initMocks(this);
when(mInjector.getAlarmManager(mContext)).thenReturn(mAlarmManager);
when(mInjector.getDefaultStrongAuthFlags(mContext)).thenReturn(mDefaultStrongAuthFlags);
when(mContext.getSystemService(Context.DEVICE_POLICY_SERVICE)).thenReturn(mDPM);
mStrongAuth = new LockSettingsStrongAuth(mContext, mInjector);
}
@Test
public void testScheduleNonStrongBiometricIdleTimeout() {
final long nextAlarmTime = 1000;
when(mInjector.getNextAlarmTimeMs(DEFAULT_NON_STRONG_BIOMETRIC_IDLE_TIMEOUT_MS))
.thenReturn(nextAlarmTime);
mStrongAuth.scheduleNonStrongBiometricIdleTimeout(PRIMARY_USER_ID);
waitForIdle();
NonStrongBiometricIdleTimeoutAlarmListener alarm = mStrongAuth
.mNonStrongBiometricIdleTimeoutAlarmListener.get(PRIMARY_USER_ID);
// verify that a new alarm for idle timeout is added for the user
assertNotNull(alarm);
// verify that the alarm is scheduled
verifyAlarm(nextAlarmTime, NON_STRONG_BIOMETRIC_IDLE_TIMEOUT_ALARM_TAG, alarm);
}
@Test
public void testSetIsNonStrongBiometricAllowed_disallowed() {
mStrongAuth.setIsNonStrongBiometricAllowed(false /* allowed */, PRIMARY_USER_ID);
waitForIdle();
// verify that unlocking with non-strong biometrics is not allowed
assertFalse(mStrongAuth.mIsNonStrongBiometricAllowedForUser
.get(PRIMARY_USER_ID, mDefaultIsNonStrongBiometricAllowed));
}
@Test
public void testReportSuccessfulBiometricUnlock_nonStrongBiometric_fallbackTimeout() {
final long nextAlarmTime = 1000;
when(mInjector.getNextAlarmTimeMs(DEFAULT_NON_STRONG_BIOMETRIC_TIMEOUT_MS))
.thenReturn(nextAlarmTime);
mStrongAuth.reportSuccessfulBiometricUnlock(false /* isStrongBiometric */, PRIMARY_USER_ID);
waitForIdle();
NonStrongBiometricTimeoutAlarmListener alarm =
mStrongAuth.mNonStrongBiometricTimeoutAlarmListener.get(PRIMARY_USER_ID);
// verify that a new alarm for fallback timeout is added for the user
assertNotNull(alarm);
// verify that the alarm is scheduled
verifyAlarm(nextAlarmTime, NON_STRONG_BIOMETRIC_TIMEOUT_ALARM_TAG, alarm);
}
@Test
public void testRequireStrongAuth_nonStrongBiometric_fallbackTimeout() {
mStrongAuth.requireStrongAuth(
STRONG_AUTH_REQUIRED_AFTER_NON_STRONG_BIOMETRICS_TIMEOUT /* strongAuthReason */,
PRIMARY_USER_ID);
waitForIdle();
// verify that the StrongAuthFlags for the user contains the expected flag
final int expectedFlag = STRONG_AUTH_REQUIRED_AFTER_NON_STRONG_BIOMETRICS_TIMEOUT;
verifyStrongAuthFlags(expectedFlag, PRIMARY_USER_ID);
}
@Test
public void testReportSuccessfulBiometricUnlock_nonStrongBiometric_cancelIdleTimeout() {
// lock device and schedule an alarm for non-strong biometric idle timeout
mStrongAuth.scheduleNonStrongBiometricIdleTimeout(PRIMARY_USER_ID);
// unlock with non-strong biometric
mStrongAuth.reportSuccessfulBiometricUnlock(false /* isStrongBiometric */, PRIMARY_USER_ID);
waitForIdle();
// verify that the current alarm for idle timeout is cancelled after a successful unlock
verify(mAlarmManager).cancel(any(NonStrongBiometricIdleTimeoutAlarmListener.class));
}
@Test
public void testReportSuccessfulBiometricUnlock_strongBio_cancelAlarmsAndAllowNonStrongBio() {
setupAlarms(PRIMARY_USER_ID);
mStrongAuth.reportSuccessfulBiometricUnlock(true /* isStrongBiometric */, PRIMARY_USER_ID);
waitForIdle();
// verify that unlocking with strong biometric cancels alarms for fallback and idle timeout
// and re-allow unlocking with non-strong biometric
verifyAlarmsCancelledAndNonStrongBiometricAllowed(PRIMARY_USER_ID);
}
@Test
public void testReportSuccessfulStrongAuthUnlock_schedulePrimaryAuthTimeout() {
final long currentTime = 1000;
final long timeout = 1000;
final long nextAlarmTime = currentTime + timeout;
when(mInjector.getElapsedRealtimeMs()).thenReturn(currentTime);
when(mDPM.getRequiredStrongAuthTimeout(null, PRIMARY_USER_ID)).thenReturn(timeout);
mStrongAuth.reportSuccessfulStrongAuthUnlock(PRIMARY_USER_ID);
waitForIdle();
StrongAuthTimeoutAlarmListener alarm =
mStrongAuth.mStrongAuthTimeoutAlarmListenerForUser.get(PRIMARY_USER_ID);
// verify that a new alarm for primary auth timeout is added for the user
assertNotNull(alarm);
// verify that the alarm is scheduled
verifyAlarm(nextAlarmTime, STRONG_AUTH_TIMEOUT_ALARM_TAG, alarm);
}
@Test
public void testReportSuccessfulStrongAuthUnlock_testRefreshStrongAuthTimeout() {
final long currentTime = 1000;
final long oldTimeout = 5000;
final long nextAlarmTime = currentTime + oldTimeout;
when(mInjector.getElapsedRealtimeMs()).thenReturn(currentTime);
when(mDPM.getRequiredStrongAuthTimeout(null, PRIMARY_USER_ID)).thenReturn(oldTimeout);
mStrongAuth.reportSuccessfulStrongAuthUnlock(PRIMARY_USER_ID);
waitForIdle();
StrongAuthTimeoutAlarmListener alarm =
mStrongAuth.mStrongAuthTimeoutAlarmListenerForUser.get(PRIMARY_USER_ID);
assertEquals(currentTime, alarm.getLatestStrongAuthTime());
verifyAlarm(nextAlarmTime, STRONG_AUTH_TIMEOUT_ALARM_TAG, alarm);
final long newTimeout = 3000;
when(mDPM.getRequiredStrongAuthTimeout(null, PRIMARY_USER_ID)).thenReturn(newTimeout);
mStrongAuth.refreshStrongAuthTimeout(PRIMARY_USER_ID);
waitForIdle();
verify(mAlarmManager).cancel(alarm);
verifyAlarm(currentTime + newTimeout, STRONG_AUTH_TIMEOUT_ALARM_TAG, alarm);
}
@Test
public void testReportSuccessfulStrongAuthUnlock_cancelAlarmsAndAllowNonStrongBio() {
setupAlarms(PRIMARY_USER_ID);
mStrongAuth.reportSuccessfulStrongAuthUnlock(PRIMARY_USER_ID);
waitForIdle();
// verify that unlocking with primary auth (PIN/pattern/password) cancels alarms
// for fallback and idle timeout and re-allow unlocking with non-strong biometric
verifyAlarmsCancelledAndNonStrongBiometricAllowed(PRIMARY_USER_ID);
}
@Test
public void testFallbackTimeout_convenienceBiometric_weakBiometric() {
// assume that unlock with convenience biometric
mStrongAuth.reportSuccessfulBiometricUnlock(false /* isStrongBiometric */, PRIMARY_USER_ID);
// assume that unlock again with weak biometric
mStrongAuth.reportSuccessfulBiometricUnlock(false /* isStrongBiometric */, PRIMARY_USER_ID);
waitForIdle();
// verify that the fallback alarm scheduled when unlocking with convenience biometric is
// not affected when unlocking again with weak biometric
verify(mAlarmManager, never()).cancel(any(NonStrongBiometricTimeoutAlarmListener.class));
assertNotNull(mStrongAuth.mNonStrongBiometricTimeoutAlarmListener.get(PRIMARY_USER_ID));
}
private void verifyAlarm(long when, String tag, AlarmManager.OnAlarmListener alarm) {
verify(mAlarmManager).set(
eq(AlarmManager.ELAPSED_REALTIME),
eq(when),
eq(tag),
eq(alarm),
eq(mStrongAuth.mHandler));
}
private void verifyStrongAuthFlags(int reason, int userId) {
final int flags = mStrongAuth.mStrongAuthForUser.get(userId, mDefaultStrongAuthFlags);
Log.d(TAG, "verifyStrongAuthFlags:"
+ " reason=" + Integer.toHexString(reason)
+ " userId=" + userId
+ " flags=" + Integer.toHexString(flags));
assertTrue(containsFlag(flags, reason));
}
private void setupAlarms(int userId) {
// schedule (a) an alarm for non-strong biometric fallback timeout and (b) an alarm for
// non-strong biometric idle timeout, so later we can verify that unlocking with
// strong biometric or primary auth will cancel those alarms
mStrongAuth.reportSuccessfulBiometricUnlock(false /* isStrongBiometric */, PRIMARY_USER_ID);
mStrongAuth.scheduleNonStrongBiometricIdleTimeout(PRIMARY_USER_ID);
}
private void verifyAlarmsCancelledAndNonStrongBiometricAllowed(int userId) {
// verify that the current alarm for non-strong biometric fallback timeout is cancelled and
// removed
verify(mAlarmManager).cancel(any(NonStrongBiometricTimeoutAlarmListener.class));
assertNull(mStrongAuth.mNonStrongBiometricTimeoutAlarmListener.get(userId));
// verify that the current alarm for non-strong biometric idle timeout is cancelled
verify(mAlarmManager).cancel(any(NonStrongBiometricIdleTimeoutAlarmListener.class));
// verify that unlocking with non-strong biometrics is allowed
assertTrue(mStrongAuth.mIsNonStrongBiometricAllowedForUser
.get(userId, mDefaultIsNonStrongBiometricAllowed));
}
private static boolean containsFlag(int haystack, int needle) {
return (haystack & needle) != 0;
}
private static void waitForIdle() {
InstrumentationRegistry.getInstrumentation().waitForIdleSync();
}
}
|
Todd Carmichael, the co-founder and CEO of La Colombe, says he has a “firm belief that nothing is ever truly finished.” He is, however, content with the recent completion of the company’s 60,000 sq. ft. production facility, one that will support a dramatic increase in the distribution and retail placement of its RTD Draft Latte products.
In a video interview filmed last week at Natural Products Expo West 2017, Carmichael noted that since La Colombe has been in the coffee business for 23 years, “making our own things isn’t something that’s completely foreign to us.” Yet despite the company’s deep experience as a roaster, retailer and, most recently, a producer of RTD beverages, he described the construction of the new plant as “a big pill to swallow.”
“It was a big challenge; it was a lot of work for 120 days,” Carmichael said. “But now that it’s behind us, we have all the freedom in the world.”
The new facility is outfitted with a filler that can produce approximately 60,000 cans in an hour; the company expects utilize that capacity to its fullest as the year progresses. La Colombe’s Draft Lattes are currently available in between 5,000 and 8,000 retail locations and the company is eyeing a total of 30,000 points of distribution by the end of the year, Carmichael said.
Watch this video to hear more from Carmichael, both on La Colombe’s plans to grow the availability of its RTD products and on an expansion of its cafe business, including new locations in Los Angeles and Miami. He also discusses the company’s new product strategy, and how its guiding aim of lifting “the crafted coffee experience from our cafes and [bringing] it out to retailers,” drove the creation and launch of its new Chai and Coconut Milk Mocha Draft Lattes. |
Things you might need to know if you've been arrested for an offense like Drunk Driving. If you are interested, read on. If you're in need of a Minnesota Criminal Defense attorney - CALL or TEXT: (612) 619-0262.
Tuesday, May 10, 2011
DWI Field Sobriety Tests - The One Leg Stand (Explained)
Just like with the the Walk & Turn test, another standard Field Sobriety Test you should prepare yourself for - as you would "study up" before any sort of examination - is the One Leg Stand Test. To do your best on this task, an experienced Minnesota Criminal Defense Attorney is going to tell you that it is important that you understand not only the procedures involved but also what the cops are really looking for when they have your perform this test. Plus, like with the other Drunk Driving tests, this one also makes for a fun party game, no?
One Leg Stand Test (Explained)
As with any of these tests, the officer who has you perform them will most likely will read from a set of instructions much like those offered here - straight from the standard field manner for how to administer such exercises.
First, before having your perform the test, the officer should make sure that you are on a hard, level, non-slippery surface. (Special consideration should also be given to those individuals over a certain age, of a certain weight and/or those who have a physical impairment that would affect their performance.)
As with the Walk & Turn Test, this test also consists of two stages: instruction and performance.
The Instructions
During this stage, you will be the told what to do and and ways to score. In addition, these instructions should not only be explained to you, the officer should also demonstrate the test . Here's what you should be tasked with.
Stand with your feet together and your arms down at the sides, (like this.)
Do not start to perform the test until I tell you to do so.
Do you understand the instructions so far?
When I tell you to start, raise one leg, either leg, with the foot approximately six inches off the ground, keeping your raised foot parallel to the ground."
You must keep both legs straight, arms at your side.
While holding that position, count out loud in the following manner: 'one thousand and one, one thousand and two, one thousand and three, until told to stop.'
Keep your arms at your sides at all times and keep watching the raised foot.
Do you understand?
Go ahead and perform the test.
In addition, you should also be told that if you put your foot down while taking the test, that you should pick it up and continue counting from the point where your foot touched the ground.
The Performance/Scoring
As with any test, you're going to want to know how it's score - so you can do what's necessary to pass, right? Not knowing the criteria - coupled with trying to perform this test at night, with a cop bearing down on you, and traffic whizzing by - is bound to impact even the best test-takers performance. So, try this, before you read ahead, take a stab at the test. Then, after you've read the "teacher's guide" try it again. My guess is, your performance will improve.
During this test, the officer is looking for these behaviors:
Raising your arms in order to gain your balance
Hopping on one-foot
Swaying
Putting your foot down and/or touching the ground
Failing to complete the test
This is what your performance will be graded on. And, believe it or not, two or more of these "signs" can equal a FAIL and give the officer probable cause to arrest you.
What To Do
If your not doing some pre-test studying - but rather you've been arrested for Drunk Driving after failing this silly examination, your next, best step should be to contact an experienced Minnesota DWI Defense Attorney. The One-Leg Stand Test - like nearly all of these tasks - is entirely subjective, and a person could fail it for many reasons other than being intoxicated. An attorney can investigate whether the test was administered properly and what your performance really showed.
But, just as I explained before, in the State of Minnesota taking these tests is completely voluntary. As such, my advice to you is: Don't take these tests - they cannot help you. As a matter of fact, they'll often only hurt one's chances of beating a Drunk Driving charge because the cops tend to pay more attention to every little slip or misstep you make and they often ignore or disregard every correct one - o paint a picture of you as a drunk driver.
Legal Advice Disclaimer
This site seeks to provide information about the law. However, be sure that legal information is not the same as legal advice. Although I do go to some lengths to ensure that what is presented here is true, accurate and useful, before taking any action yourself - I would recommend that you consult with an attorney if you want professional assurance that the infomation posted here (and your interpretation of it) is right for your situation |
Network formation of nanofibrillated cellulose in solution blended poly(methyl methacrylate) composites.
Composites of poly(methyl methacrylate) (PMMA) and nanofibrillated cellulose (NFC) were prepared by solution blending and further processed by injection and compression molding. To improve adhesion at the PMMA/NFC interface, the nanofibrils were covalently grafted with PMMA. Formation of a percolating nanofibril network was observed between 1 and 5 wt.% of NFC by dynamic rotational rheometry in molten state. This observation was further supported by the behavior of glass transition temperature which decreased at low NFC concentrations but recovered above the percolation threshold, indicating a decreased mobility of the matrix polymer. This effect was more pronounced with ungrafted NFC, possibly due to a stronger network. The unmodified NFC induced a minor degradation of the molar mass of PMMA. As thin plates, the composites were transparent at low NFC concentrations but became partially aggregated at the highest NFC concentrations. Despite the continuous NFC network, tensile testing showed no improvement of the mechanical properties. |
Tempi ancor più duri per il rispetto della ricerca scientifica: se verrà confermata la notizia appena diffusa dal Washington Post che il neopresidente Usa Donald Trump intende mettere a capo della commissione sulla "sicurezza dei vaccini e l'integrità scientifica" un noto critico dei vaccini che ancora sostiene, nonostante le evidenze e le ritrattazioni, possano causare l'autismo. Si tratta dell'ambientalista Robert F. Kennedy jr, laureato ad Harvard e d esperto di leggi ambientali, figlio di Bobby (Robert), e nipote del presidente John Kennedy.
Kennedy avrebbe incontrato Trump e poi diffuso la notizia di una sua nomina: il neopresidente Trump è anche lui assai critico nei riguardi dei vaccini e con Kennedy avrebbe parlato di rivedere tutta la legislazione riguardo alla vaccinazione dei bambini. La tesi di Kennedy, che non si sarebbe dichiarato contrario alle vaccinazioni in assoluto, riguarda la sicurezza dei vaccini che secondo lui non sarebbe adeguate. Più volte negli ultimi anni lo stesso Trump si è espresso sulla questione dei vaccini facendo riferimento alla connessione (per lui sicura e accertata) con l'autismo. In più il numero e le dosi di vaccini in tempi così ravvicinati per un bambino sarebbe, secondo Trump, un errore e occorrerebbe diluire queste vaccinazioni in più anni. Cosa che viene contestata dalle autorità scientifiche e associazioni mediche del Paese che considerano sicuri i vaccini e un rischio lasciare senza alcune coperture vaccinali i più piccoli. Sembra si torni indietro.
Tag: Autismo, Kennedy, sicurezza, Trump
Scritto in Vaccini | 3 Commenti » |
Q:
Firebase Auth + FCM
My usecase it to send a push-notification to a user using the Firebase Auth UID to all the devices he is signed-in. Since firebase Auth is managing the user sessions,
Is there a way to directly send a FCM notification just using the uid of the user? Or
Is there a way to fetch the registration ids of all signed-in devices for a given uid?
This looks like standard requirement, for example to update the 'Order Status' to a user. If available this could be pretty powerful, and could greatly simplify direct messaging requirements (e-commerce, chat etc) where the user gets notified on web/android/ios.
If this is not possible, any suggestions on the standard way to acquire/manage the registrations_ids of a given user is appreciated.
Thanks all,
A:
This is not supported out of the box but you can build the mechanism.
You need to maintain a uid specific deviceGroup and all the registration ID per device that belongs to it.
Each time a user signs in with Firebase, you get the device registration ID and the user's ID token and send it to your backend. You verify the ID token and get the uid from it, you then add that registration ID to that user's device group.
Each time a user signs out, you remove their registration ID from the signed out user's device group.
When you want to send a push notification to a specified user, you can send it to the user's device group ID.
This is the simplified version but there are a bunch of edge cases you have to deal with to keep the device group for a user in sync so no notification is sent to a signed out user.
|
Q:
Django smart-select form with bootstrap
I'm using the chained foreign key in django to make a chained dropdown list for country then city etc...
It's working fine, however when I try to add a class to it shows the changes in shape, but it remains empty, when I select the country the city dropdown remains empty, if I remove the class I works again, please help....
A:
I got it
<select class="multisteps-form__input form-control" name="city" required id="id_city" data-chainfield="Country" data-url="/%5Echaining/filter/candidates/City/Country/candidates/Candidate_Address/city" data-value="null" data-auto_choose="true" data-empty_label="--------" name="city" **class**="chained-fk" ></select>
I was adding 2 classes so one was overriding the other.....
Just remove a class and combine them
Correct one...
<select name="city" required id="id_city" data-chainfield="Country" data-url="/%5Echaining/filter/candidates/City/Country/candidates/Candidate_Address/city" data-value="null" data-auto_choose="true" data-empty_label="--------" name="city" class="chained-fk multisteps-form__input form-control" ></select>
|
Big enough to maybe persuade one of Boston's most visible Celtics fans to defect - for a week and a half, at least.
"All I know is that we're both Dominican and we both got each other's back," Horford said.
Horford's scoring numbers were nowhere near the 20.3 points Durant averaged. But he averaged nearly a double-double (10.1 points, 9.7 rebounds) for the Hawks, played wherever coach Mike Woodson put him, even it meant being overmatched, and pushed the Hawks to the playoffs.
"I'm not taking anything away from Durant," Woodson said. "I respect Durant and what he's done this year in our league. He's a great talent. But you can't exclude Al Horford. They should have shared it, I think. If not Al getting it."
Horford took nothing away from Durant. In fact, as soon as he heard the results (which haven't been officially announced), he sent the league's top rookie a message.
"It was a deserved award," Horford said. "I feel like Kevin's been consistent the entire year just like I have. The first thing I did was text him and congratulate him. It's something that's well deserved and I'm happy for him."
Woodson has seen a ton of rookies come through - including Josh Childress, Smith, and Marvin Williams. And it's not that those guys weren't effective. But Horford is a little different.
"I've had so many rookies," Woodson said. "All the rookies I've had have hit a wall during some period of the season. And this young man never hit a wall, which is amazing to me. I mean, he's been a double-double guy. He's anchored our defense, he's helped us get into the playoffs."
That said, the kid's not Superman. But if he did hit a wall, Smith said, he pushed through it.
"He might have been a little fatigued," Smith said. "Everybody gets a little fatigued, but he brushed right through it. He played and we rode him as our center even though he was undersized every night. He didn't make that an issue."
In some ways - namely the way he jawed at Paul Pierce after hitting a jumper at the end of Game 3 - he's added grit to the team that's trickled down.
"He does bring an added toughness to our team and we're riding with it," Smith said.
That moment with Pierce led to the moment between Zaza Pachulia and Kevin Garnett in Game 4, which led to the Hawks developing a sort of cockiness, which is what a young team needs.
"Especially in the playoffs," Horford said. "Tension goes up and it's one of those things where you can't back down. I'm not saying I'm tougher than anyone or I'm whatever, but I tell you what, when it comes down to it, we're going to grind. We're going to war out there."
And even though the award eluded him, he's happier because his team is in the playoffs.
"I've always been about the team," he said. "We have a chance to do something big and that's what I'm focused on right now."
As for that jersey, Ortiz failed to mention that the last time one of his jerseys was in the spotlight, it was for spreading bad luck. Horford paid that incident little mind. |
blog
Fun With Customizing Your Silicone Bracelets - Colors, Patterns, Message, Style!
I was born in a Christian along with like any child I never discussed what I just believed until I concerned 13. Although my family members have never been incredibly religious, even though they did send me to someone Christian school when I lived up in Massachusetts but we didn"t go to church on a regular basis. Then while i was 10, my parents and I moved to Florida and i started for you to church with my grandmother every weekend for the subsequent 3 ages.
If happen to be out on the date for that first time, avoid wearing too many accessories. Hundreds of bling-blings and cool wristbands must be kept for that night. Though it is true that men do not wear jewelry, there are fantastic pieces that you can invest on.
Parachute Men - Is actually the perfect favor for skydiving followers. Fill your favor box with toy parachute men. Such as a picture people and your spouse skydiving is often a nice stroke. Your guests can have so enjoyable playing while using the parachute women and they"ll talk about see the fell every other. Pun completely wanted.
Pre-release marketing. Do you have a product that"s almost ready to launch, to sign up membership site that"s going go live, or a printed book that"s headed for a be made? If so, give your list members the chance buy it at a special price of all time released on the public. Consumers want pertaining to being the first to have got the newest information, so give your list members first shot for your newest related information.
cancer wristbands Dealing with death is tough. Mourning, grief and loss your hardest things in life that vehicle will adventure. For example, a popular scale measures psychological stress from zero to more than 90. The death of a spouse is rated as probably the most stressful - a way of measuring one hundred at the top of the stress continuum.
With each those phrases Debbie released big sighs of relief, and was amazed because when much better she felt, how relaxed she appears to be. We had now unleashed a steady flow of memories, i really followed her lead. She said "I had this recurring dream every evening before they found your pet wwjd wristbands . We"re both together in the water trying to achieve for one another"s hands while he"s calling out to my opinion for help---and no matter how hard I try, I can"t reach his hand. I still encourage them regularly; it will take me days to shake it off".
The tax collector will not look concerning anyone or asked god if might be like someone else,he just inspired to be truly worth gods absolutely love.We all have done things that individuals wish you can easily take right back.We pray that god will forgive what we have done and we then far better about themselves.We know god can forgive us but crucial thing is can we forgive ourselves.We truly cannot be happy with ourselves until we do.
No matter how fashionable you are, chances perform might lose your date if you do not come properly shaven or well groomed. Choosing your associated with fashion is really a personal array. However, you also need to fantastic and presentable. Thus, impressing your hot date is a colossal success you actually get complimented by means you as well as how you can carry yourself.
China launched Algeria"s first communication satellite, Alcomsat-1, into a preset orbit from the Xichang Satellite Launch Center in the southwestern province of Sichuan on Dec 11, 2017. [Photo/Xinhua]
Algeria’s first communications satellite — developed, built and launched by China — began operation this month, according to China Great Wall Industry Corp, the project’s chief contractor.
An in-orbit delivery ceremony for the Alcomsat-1 was held at the Algerian Space Agency’s headquarters in Algiers this month, the company said in a statement.
Alcomsat-1 was launched in December atop a Long March 3B carrier rocket at the Xichang Satellite Launch Center in the southwestern Chinese province of Sichuan.
It is the ninth telecom satellite China has provided to foreign nations and the first space cooperation project between China and Algeria, the statement said.
Alcomsat-1 was designed and manufactured by the China Academy of Space Technology, part of China Aerospace Science and Technology Corp, and is based on the DFH-4 satellite platform.
With a liftoff weight of 5.2 metric tons and a designed life span of 15 years, the satellite will be used for a wide variety of public services such as television broadcasting, emergency communications, remote education and satellite-based signal augmentation, according to Great Wall Industry. |
<?xml version="1.0" ?>
<spirit:component xmlns:altera="http://www.altera.com/XMLSchema/IPXact/extensions" xmlns:spirit="http://www.spiritconsortium.org/XMLSchema/SPIRIT/1685-2009">
<spirit:vendor>Altera Corporation</spirit:vendor>
<spirit:library>pr_region_default_SpatialIP_0</spirit:library>
<spirit:name>SpatialIP_0</spirit:name>
<spirit:version>1.0</spirit:version>
<spirit:busInterfaces>
<spirit:busInterface>
<spirit:name>clock</spirit:name>
<spirit:busType spirit:vendor="altera" spirit:library="altera" spirit:name="clock" spirit:version="17.1"></spirit:busType>
<spirit:slave></spirit:slave>
<spirit:portMaps>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>clk</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>clock</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
</spirit:portMaps>
<spirit:parameters>
<spirit:parameter>
<spirit:name>clockRate</spirit:name>
<spirit:displayName>Clock rate</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="clockRate">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>externallyDriven</spirit:name>
<spirit:displayName>Externally driven</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="externallyDriven">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>ptfSchematicName</spirit:name>
<spirit:displayName>PTF schematic name</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="ptfSchematicName"></spirit:value>
</spirit:parameter>
</spirit:parameters>
</spirit:busInterface>
<spirit:busInterface>
<spirit:name>io_M_AXI_0</spirit:name>
<spirit:busType spirit:vendor="altera" spirit:library="altera" spirit:name="axi4" spirit:version="17.1"></spirit:busType>
<spirit:master></spirit:master>
<spirit:portMaps>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awuser</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWUSER</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awaddr</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWADDR</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awlen</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWLEN</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awsize</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWSIZE</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awburst</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWBURST</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awlock</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWLOCK</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awcache</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWCACHE</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awprot</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWPROT</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awqos</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWQOS</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awvalid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWVALID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>awready</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_AWREADY</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>aruser</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARUSER</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>araddr</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARADDR</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arlen</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARLEN</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arsize</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARSIZE</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arburst</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARBURST</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arlock</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARLOCK</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arcache</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARCACHE</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arprot</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARPROT</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arqos</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARQOS</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arvalid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARVALID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>arready</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_ARREADY</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>wdata</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_WDATA</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>wstrb</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_WSTRB</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>wlast</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_WLAST</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>wvalid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_WVALID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>wready</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_WREADY</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>rid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>ruser</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RUSER</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>rdata</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RDATA</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>rresp</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RRESP</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>rlast</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RLAST</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>rvalid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RVALID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>rready</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_RREADY</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>bid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_BID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>buser</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_BUSER</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>bresp</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_BRESP</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>bvalid</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_BVALID</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>bready</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_M_AXI_0_BREADY</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
</spirit:portMaps>
<spirit:parameters>
<spirit:parameter>
<spirit:name>associatedClock</spirit:name>
<spirit:displayName>Associated clock</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="associatedClock">clock</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>associatedReset</spirit:name>
<spirit:displayName>Associated reset</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="associatedReset">reset</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>trustzoneAware</spirit:name>
<spirit:displayName>TrustZone-aware</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="trustzoneAware">true</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>maximumOutstandingReads</spirit:name>
<spirit:displayName>maximumOutstandingReads</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="maximumOutstandingReads">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>maximumOutstandingWrites</spirit:name>
<spirit:displayName>maximumOutstandingWrites</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="maximumOutstandingWrites">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>maximumOutstandingTransactions</spirit:name>
<spirit:displayName>maximumOutstandingTransactions</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="maximumOutstandingTransactions">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>readIssuingCapability</spirit:name>
<spirit:displayName>Read issuing capability</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="readIssuingCapability">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>writeIssuingCapability</spirit:name>
<spirit:displayName>Write issuing capability</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="writeIssuingCapability">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>combinedIssuingCapability</spirit:name>
<spirit:displayName>Combined issuing capability</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="combinedIssuingCapability">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>issuesINCRBursts</spirit:name>
<spirit:displayName>Issues INCR bursts</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="issuesINCRBursts">true</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>issuesWRAPBursts</spirit:name>
<spirit:displayName>Issues WRAP bursts</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="issuesWRAPBursts">true</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>issuesFIXEDBursts</spirit:name>
<spirit:displayName>Issues FIXED bursts</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="issuesFIXEDBursts">true</spirit:value>
</spirit:parameter>
</spirit:parameters>
</spirit:busInterface>
<spirit:busInterface>
<spirit:name>io_S_AVALON</spirit:name>
<spirit:busType spirit:vendor="altera" spirit:library="altera" spirit:name="avalon" spirit:version="17.1"></spirit:busType>
<spirit:slave></spirit:slave>
<spirit:portMaps>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>address</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_S_AVALON_address</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>readdata</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_S_AVALON_readdata</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>chipselect</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_S_AVALON_chipselect</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>write</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_S_AVALON_write</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>read</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_S_AVALON_read</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>writedata</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>io_S_AVALON_writedata</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
</spirit:portMaps>
<spirit:parameters>
<spirit:parameter>
<spirit:name>addressAlignment</spirit:name>
<spirit:displayName>Slave addressing</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="addressAlignment">DYNAMIC</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>addressGroup</spirit:name>
<spirit:displayName>Address group</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="addressGroup">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>addressSpan</spirit:name>
<spirit:displayName>Address span</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="addressSpan">512</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>addressUnits</spirit:name>
<spirit:displayName>Address units</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="addressUnits">WORDS</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>alwaysBurstMaxBurst</spirit:name>
<spirit:displayName>Always burst maximum burst</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="alwaysBurstMaxBurst">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>associatedClock</spirit:name>
<spirit:displayName>Associated clock</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="associatedClock">clock</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>associatedReset</spirit:name>
<spirit:displayName>Associated reset</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="associatedReset">reset</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>bitsPerSymbol</spirit:name>
<spirit:displayName>Bits per symbol</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="bitsPerSymbol">8</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>bridgedAddressOffset</spirit:name>
<spirit:displayName>Bridged Address Offset</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="bridgedAddressOffset">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>bridgesToMaster</spirit:name>
<spirit:displayName>Bridges to master</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="bridgesToMaster"></spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>burstOnBurstBoundariesOnly</spirit:name>
<spirit:displayName>Burst on burst boundaries only</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="burstOnBurstBoundariesOnly">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>burstcountUnits</spirit:name>
<spirit:displayName>Burstcount units</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="burstcountUnits">WORDS</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>constantBurstBehavior</spirit:name>
<spirit:displayName>Constant burst behavior</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="constantBurstBehavior">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>explicitAddressSpan</spirit:name>
<spirit:displayName>Explicit address span</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="explicitAddressSpan">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>holdTime</spirit:name>
<spirit:displayName>Hold</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="holdTime">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>interleaveBursts</spirit:name>
<spirit:displayName>Interleave bursts</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="interleaveBursts">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>isBigEndian</spirit:name>
<spirit:displayName>Big endian</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="isBigEndian">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>isFlash</spirit:name>
<spirit:displayName>Flash memory</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="isFlash">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>isMemoryDevice</spirit:name>
<spirit:displayName>Memory device</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="isMemoryDevice">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>isNonVolatileStorage</spirit:name>
<spirit:displayName>Non-volatile storage</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="isNonVolatileStorage">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>linewrapBursts</spirit:name>
<spirit:displayName>Linewrap bursts</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="linewrapBursts">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>maximumPendingReadTransactions</spirit:name>
<spirit:displayName>Maximum pending read transactions</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="maximumPendingReadTransactions">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>maximumPendingWriteTransactions</spirit:name>
<spirit:displayName>Maximum pending write transactions</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="maximumPendingWriteTransactions">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>minimumReadLatency</spirit:name>
<spirit:displayName>minimumReadLatency</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="minimumReadLatency">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>minimumResponseLatency</spirit:name>
<spirit:displayName>Minimum response latency</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="minimumResponseLatency">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>minimumUninterruptedRunLength</spirit:name>
<spirit:displayName>Minimum uninterrupted run length</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="minimumUninterruptedRunLength">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>prSafe</spirit:name>
<spirit:displayName>Partial Reconfiguration Safe</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="prSafe">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>printableDevice</spirit:name>
<spirit:displayName>Can receive stdout/stderr</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="printableDevice">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>readLatency</spirit:name>
<spirit:displayName>Read latency</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="readLatency">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>readWaitStates</spirit:name>
<spirit:displayName>Read wait states</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="readWaitStates">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>readWaitTime</spirit:name>
<spirit:displayName>Read wait</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="readWaitTime">1</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>registerIncomingSignals</spirit:name>
<spirit:displayName>Register incoming signals</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="registerIncomingSignals">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>registerOutgoingSignals</spirit:name>
<spirit:displayName>Register outgoing signals</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="registerOutgoingSignals">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>setupTime</spirit:name>
<spirit:displayName>Setup</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="setupTime">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>timingUnits</spirit:name>
<spirit:displayName>Timing units</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="timingUnits">Cycles</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>transparentBridge</spirit:name>
<spirit:displayName>Transparent bridge</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="transparentBridge">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>waitrequestAllowance</spirit:name>
<spirit:displayName>Waitrequest allowance</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="waitrequestAllowance">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>wellBehavedWaitrequest</spirit:name>
<spirit:displayName>Well-behaved waitrequest</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="wellBehavedWaitrequest">false</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>writeLatency</spirit:name>
<spirit:displayName>Write latency</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="writeLatency">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>writeWaitStates</spirit:name>
<spirit:displayName>Write wait states</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="writeWaitStates">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>writeWaitTime</spirit:name>
<spirit:displayName>Write wait</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="writeWaitTime">0</spirit:value>
</spirit:parameter>
</spirit:parameters>
<spirit:vendorExtensions>
<altera:altera_assignments>
<spirit:parameters>
<spirit:parameter>
<spirit:name>embeddedsw.configuration.isFlash</spirit:name>
<spirit:value spirit:format="string" spirit:id="embeddedsw.configuration.isFlash">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>embeddedsw.configuration.isMemoryDevice</spirit:name>
<spirit:value spirit:format="string" spirit:id="embeddedsw.configuration.isMemoryDevice">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>embeddedsw.configuration.isNonVolatileStorage</spirit:name>
<spirit:value spirit:format="string" spirit:id="embeddedsw.configuration.isNonVolatileStorage">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>embeddedsw.configuration.isPrintableDevice</spirit:name>
<spirit:value spirit:format="string" spirit:id="embeddedsw.configuration.isPrintableDevice">0</spirit:value>
</spirit:parameter>
</spirit:parameters>
</altera:altera_assignments>
</spirit:vendorExtensions>
</spirit:busInterface>
<spirit:busInterface>
<spirit:name>reset</spirit:name>
<spirit:busType spirit:vendor="altera" spirit:library="altera" spirit:name="reset" spirit:version="17.1"></spirit:busType>
<spirit:slave></spirit:slave>
<spirit:portMaps>
<spirit:portMap>
<spirit:logicalPort>
<spirit:name>reset</spirit:name>
</spirit:logicalPort>
<spirit:physicalPort>
<spirit:name>reset</spirit:name>
</spirit:physicalPort>
</spirit:portMap>
</spirit:portMaps>
<spirit:parameters>
<spirit:parameter>
<spirit:name>associatedClock</spirit:name>
<spirit:displayName>Associated clock</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="associatedClock">clock</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>synchronousEdges</spirit:name>
<spirit:displayName>Synchronous edges</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="synchronousEdges">DEASSERT</spirit:value>
</spirit:parameter>
</spirit:parameters>
</spirit:busInterface>
</spirit:busInterfaces>
<spirit:model>
<spirit:views>
<spirit:view>
<spirit:name>QUARTUS_SYNTH</spirit:name>
<spirit:envIdentifier>:quartus.altera.com:</spirit:envIdentifier>
<spirit:modelName>Top</spirit:modelName>
<spirit:fileSetRef>
<spirit:localName>QUARTUS_SYNTH</spirit:localName>
</spirit:fileSetRef>
</spirit:view>
</spirit:views>
<spirit:ports>
<spirit:port>
<spirit:name>clock</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>reset</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_S_AVALON_address</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>6</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_S_AVALON_readdata</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_S_AVALON_chipselect</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_S_AVALON_write</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_S_AVALON_read</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_S_AVALON_writedata</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWID</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>5</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWUSER</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWADDR</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWLEN</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>7</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWSIZE</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>2</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWBURST</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>1</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWLOCK</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWCACHE</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>3</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWPROT</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>2</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWQOS</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>3</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWVALID</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_AWREADY</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARID</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>5</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARUSER</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARADDR</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARLEN</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>7</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARSIZE</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>2</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARBURST</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>1</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARLOCK</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARCACHE</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>3</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARPROT</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>2</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARQOS</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>3</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARVALID</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_ARREADY</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_WDATA</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>511</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_WSTRB</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>63</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_WLAST</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_WVALID</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_WREADY</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RID</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>5</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RUSER</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RDATA</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>511</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RRESP</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>1</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RLAST</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RVALID</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_RREADY</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_BID</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>5</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_BUSER</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>31</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_BRESP</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:vector>
<spirit:left>0</spirit:left>
<spirit:right>1</spirit:right>
</spirit:vector>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC_VECTOR</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_BVALID</spirit:name>
<spirit:wire>
<spirit:direction>in</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
<spirit:port>
<spirit:name>io_M_AXI_0_BREADY</spirit:name>
<spirit:wire>
<spirit:direction>out</spirit:direction>
<spirit:wireTypeDefs>
<spirit:wireTypeDef>
<spirit:typeName>STD_LOGIC</spirit:typeName>
<spirit:viewNameRef>QUARTUS_SYNTH</spirit:viewNameRef>
</spirit:wireTypeDef>
</spirit:wireTypeDefs>
</spirit:wire>
</spirit:port>
</spirit:ports>
</spirit:model>
<spirit:vendorExtensions>
<altera:entity_info>
<spirit:vendor>Altera Corporation</spirit:vendor>
<spirit:library>pr_region_default_SpatialIP_0</spirit:library>
<spirit:name>Top</spirit:name>
<spirit:version>1.0</spirit:version>
</altera:entity_info>
<altera:altera_module_parameters>
<spirit:parameters></spirit:parameters>
</altera:altera_module_parameters>
<altera:altera_system_parameters>
<spirit:parameters>
<spirit:parameter>
<spirit:name>device</spirit:name>
<spirit:displayName>Device</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="device">10AS066N3F40E2SG</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>deviceFamily</spirit:name>
<spirit:displayName>Device family</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="deviceFamily">Arria 10</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>deviceSpeedGrade</spirit:name>
<spirit:displayName>Device Speed Grade</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="deviceSpeedGrade">2</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>generationId</spirit:name>
<spirit:displayName>Generation Id</spirit:displayName>
<spirit:value spirit:format="long" spirit:id="generationId">0</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>bonusData</spirit:name>
<spirit:displayName>bonusData</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="bonusData">bonusData
{
}
</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>hideFromIPCatalog</spirit:name>
<spirit:displayName>Hide from IP Catalog</spirit:displayName>
<spirit:value spirit:format="bool" spirit:id="hideFromIPCatalog">true</spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>lockedInterfaceDefinition</spirit:name>
<spirit:displayName>lockedInterfaceDefinition</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="lockedInterfaceDefinition"><![CDATA[<boundaryDefinition>
<interfaces>
<interface>
<name>clock</name>
<type>clock</type>
<isStart>false</isStart>
<ports>
<port>
<name>clock</name>
<role>clk</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
</ports>
<assignments>
<assignmentValueMap/>
</assignments>
<parameters>
<parameterValueMap>
<entry>
<key>clockRate</key>
<value>0</value>
</entry>
<entry>
<key>externallyDriven</key>
<value>false</value>
</entry>
<entry>
<key>ptfSchematicName</key>
</entry>
</parameterValueMap>
</parameters>
</interface>
<interface>
<name>io_M_AXI_0</name>
<type>axi4</type>
<isStart>true</isStart>
<ports>
<port>
<name>io_M_AXI_0_AWID</name>
<role>awid</role>
<direction>Output</direction>
<width>6</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWUSER</name>
<role>awuser</role>
<direction>Output</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWADDR</name>
<role>awaddr</role>
<direction>Output</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWLEN</name>
<role>awlen</role>
<direction>Output</direction>
<width>8</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWSIZE</name>
<role>awsize</role>
<direction>Output</direction>
<width>3</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWBURST</name>
<role>awburst</role>
<direction>Output</direction>
<width>2</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWLOCK</name>
<role>awlock</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWCACHE</name>
<role>awcache</role>
<direction>Output</direction>
<width>4</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWPROT</name>
<role>awprot</role>
<direction>Output</direction>
<width>3</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWQOS</name>
<role>awqos</role>
<direction>Output</direction>
<width>4</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWVALID</name>
<role>awvalid</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_AWREADY</name>
<role>awready</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARID</name>
<role>arid</role>
<direction>Output</direction>
<width>6</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARUSER</name>
<role>aruser</role>
<direction>Output</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARADDR</name>
<role>araddr</role>
<direction>Output</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARLEN</name>
<role>arlen</role>
<direction>Output</direction>
<width>8</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARSIZE</name>
<role>arsize</role>
<direction>Output</direction>
<width>3</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARBURST</name>
<role>arburst</role>
<direction>Output</direction>
<width>2</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARLOCK</name>
<role>arlock</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARCACHE</name>
<role>arcache</role>
<direction>Output</direction>
<width>4</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARPROT</name>
<role>arprot</role>
<direction>Output</direction>
<width>3</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARQOS</name>
<role>arqos</role>
<direction>Output</direction>
<width>4</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARVALID</name>
<role>arvalid</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_ARREADY</name>
<role>arready</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_WDATA</name>
<role>wdata</role>
<direction>Output</direction>
<width>512</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_WSTRB</name>
<role>wstrb</role>
<direction>Output</direction>
<width>64</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_WLAST</name>
<role>wlast</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_WVALID</name>
<role>wvalid</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_WREADY</name>
<role>wready</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RID</name>
<role>rid</role>
<direction>Input</direction>
<width>6</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RUSER</name>
<role>ruser</role>
<direction>Input</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RDATA</name>
<role>rdata</role>
<direction>Input</direction>
<width>512</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RRESP</name>
<role>rresp</role>
<direction>Input</direction>
<width>2</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RLAST</name>
<role>rlast</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RVALID</name>
<role>rvalid</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_RREADY</name>
<role>rready</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_BID</name>
<role>bid</role>
<direction>Input</direction>
<width>6</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_BUSER</name>
<role>buser</role>
<direction>Input</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_BRESP</name>
<role>bresp</role>
<direction>Input</direction>
<width>2</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_M_AXI_0_BVALID</name>
<role>bvalid</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_M_AXI_0_BREADY</name>
<role>bready</role>
<direction>Output</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
</ports>
<assignments>
<assignmentValueMap/>
</assignments>
<parameters>
<parameterValueMap>
<entry>
<key>associatedClock</key>
<value>clock</value>
</entry>
<entry>
<key>associatedReset</key>
<value>reset</value>
</entry>
<entry>
<key>trustzoneAware</key>
<value>true</value>
</entry>
<entry>
<key>maximumOutstandingReads</key>
<value>1</value>
</entry>
<entry>
<key>maximumOutstandingWrites</key>
<value>1</value>
</entry>
<entry>
<key>maximumOutstandingTransactions</key>
<value>1</value>
</entry>
<entry>
<key>readIssuingCapability</key>
<value>1</value>
</entry>
<entry>
<key>writeIssuingCapability</key>
<value>1</value>
</entry>
<entry>
<key>combinedIssuingCapability</key>
<value>1</value>
</entry>
<entry>
<key>issuesINCRBursts</key>
<value>true</value>
</entry>
<entry>
<key>issuesWRAPBursts</key>
<value>true</value>
</entry>
<entry>
<key>issuesFIXEDBursts</key>
<value>true</value>
</entry>
</parameterValueMap>
</parameters>
</interface>
<interface>
<name>io_S_AVALON</name>
<type>avalon</type>
<isStart>false</isStart>
<ports>
<port>
<name>io_S_AVALON_address</name>
<role>address</role>
<direction>Input</direction>
<width>7</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_S_AVALON_readdata</name>
<role>readdata</role>
<direction>Output</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
<port>
<name>io_S_AVALON_chipselect</name>
<role>chipselect</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_S_AVALON_write</name>
<role>write</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_S_AVALON_read</name>
<role>read</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
<port>
<name>io_S_AVALON_writedata</name>
<role>writedata</role>
<direction>Input</direction>
<width>32</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC_VECTOR</vhdlType>
</port>
</ports>
<assignments>
<assignmentValueMap>
<entry>
<key>embeddedsw.configuration.isFlash</key>
<value>0</value>
</entry>
<entry>
<key>embeddedsw.configuration.isMemoryDevice</key>
<value>0</value>
</entry>
<entry>
<key>embeddedsw.configuration.isNonVolatileStorage</key>
<value>0</value>
</entry>
<entry>
<key>embeddedsw.configuration.isPrintableDevice</key>
<value>0</value>
</entry>
</assignmentValueMap>
</assignments>
<parameters>
<parameterValueMap>
<entry>
<key>addressAlignment</key>
<value>DYNAMIC</value>
</entry>
<entry>
<key>addressGroup</key>
<value>0</value>
</entry>
<entry>
<key>addressSpan</key>
<value>512</value>
</entry>
<entry>
<key>addressUnits</key>
<value>WORDS</value>
</entry>
<entry>
<key>alwaysBurstMaxBurst</key>
<value>false</value>
</entry>
<entry>
<key>associatedClock</key>
<value>clock</value>
</entry>
<entry>
<key>associatedReset</key>
<value>reset</value>
</entry>
<entry>
<key>bitsPerSymbol</key>
<value>8</value>
</entry>
<entry>
<key>bridgedAddressOffset</key>
<value>0</value>
</entry>
<entry>
<key>bridgesToMaster</key>
</entry>
<entry>
<key>burstOnBurstBoundariesOnly</key>
<value>false</value>
</entry>
<entry>
<key>burstcountUnits</key>
<value>WORDS</value>
</entry>
<entry>
<key>constantBurstBehavior</key>
<value>false</value>
</entry>
<entry>
<key>explicitAddressSpan</key>
<value>0</value>
</entry>
<entry>
<key>holdTime</key>
<value>0</value>
</entry>
<entry>
<key>interleaveBursts</key>
<value>false</value>
</entry>
<entry>
<key>isBigEndian</key>
<value>false</value>
</entry>
<entry>
<key>isFlash</key>
<value>false</value>
</entry>
<entry>
<key>isMemoryDevice</key>
<value>false</value>
</entry>
<entry>
<key>isNonVolatileStorage</key>
<value>false</value>
</entry>
<entry>
<key>linewrapBursts</key>
<value>false</value>
</entry>
<entry>
<key>maximumPendingReadTransactions</key>
<value>0</value>
</entry>
<entry>
<key>maximumPendingWriteTransactions</key>
<value>0</value>
</entry>
<entry>
<key>minimumReadLatency</key>
<value>1</value>
</entry>
<entry>
<key>minimumResponseLatency</key>
<value>1</value>
</entry>
<entry>
<key>minimumUninterruptedRunLength</key>
<value>1</value>
</entry>
<entry>
<key>prSafe</key>
<value>false</value>
</entry>
<entry>
<key>printableDevice</key>
<value>false</value>
</entry>
<entry>
<key>readLatency</key>
<value>0</value>
</entry>
<entry>
<key>readWaitStates</key>
<value>1</value>
</entry>
<entry>
<key>readWaitTime</key>
<value>1</value>
</entry>
<entry>
<key>registerIncomingSignals</key>
<value>false</value>
</entry>
<entry>
<key>registerOutgoingSignals</key>
<value>false</value>
</entry>
<entry>
<key>setupTime</key>
<value>0</value>
</entry>
<entry>
<key>timingUnits</key>
<value>Cycles</value>
</entry>
<entry>
<key>transparentBridge</key>
<value>false</value>
</entry>
<entry>
<key>waitrequestAllowance</key>
<value>0</value>
</entry>
<entry>
<key>wellBehavedWaitrequest</key>
<value>false</value>
</entry>
<entry>
<key>writeLatency</key>
<value>0</value>
</entry>
<entry>
<key>writeWaitStates</key>
<value>0</value>
</entry>
<entry>
<key>writeWaitTime</key>
<value>0</value>
</entry>
</parameterValueMap>
</parameters>
</interface>
<interface>
<name>reset</name>
<type>reset</type>
<isStart>false</isStart>
<ports>
<port>
<name>reset</name>
<role>reset</role>
<direction>Input</direction>
<width>1</width>
<lowerBound>0</lowerBound>
<vhdlType>STD_LOGIC</vhdlType>
</port>
</ports>
<assignments>
<assignmentValueMap/>
</assignments>
<parameters>
<parameterValueMap>
<entry>
<key>associatedClock</key>
<value>clock</value>
</entry>
<entry>
<key>synchronousEdges</key>
<value>DEASSERT</value>
</entry>
</parameterValueMap>
</parameters>
</interface>
</interfaces>
</boundaryDefinition>]]></spirit:value>
</spirit:parameter>
<spirit:parameter>
<spirit:name>systemInfos</spirit:name>
<spirit:displayName>systemInfos</spirit:displayName>
<spirit:value spirit:format="string" spirit:id="systemInfos"><![CDATA[<systemInfosDefinition>
<connPtSystemInfos>
<entry>
<key>io_S_AVALON</key>
<value>
<connectionPointName>io_S_AVALON</connectionPointName>
<suppliedSystemInfos/>
<consumedSystemInfos>
<entry>
<key>ADDRESS_MAP</key>
<value><address-map><slave name='io_S_AVALON' start='0x0' end='0x200' datawidth='32' /></address-map></value>
</entry>
<entry>
<key>ADDRESS_WIDTH</key>
<value>9</value>
</entry>
<entry>
<key>MAX_SLAVE_DATA_WIDTH</key>
<value>32</value>
</entry>
</consumedSystemInfos>
</value>
</entry>
</connPtSystemInfos>
</systemInfosDefinition>]]></spirit:value>
</spirit:parameter>
</spirit:parameters>
</altera:altera_system_parameters>
<altera:altera_interface_boundary>
<altera:interface_mapping altera:name="clock" altera:internal="SpatialIP_0.clock" altera:type="clock" altera:dir="end">
<altera:port_mapping altera:name="clock" altera:internal="clock"></altera:port_mapping>
</altera:interface_mapping>
<altera:interface_mapping altera:name="io_M_AXI_0" altera:internal="SpatialIP_0.io_M_AXI_0" altera:type="axi4" altera:dir="start">
<altera:port_mapping altera:name="io_M_AXI_0_ARADDR" altera:internal="io_M_AXI_0_ARADDR"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARBURST" altera:internal="io_M_AXI_0_ARBURST"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARCACHE" altera:internal="io_M_AXI_0_ARCACHE"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARID" altera:internal="io_M_AXI_0_ARID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARLEN" altera:internal="io_M_AXI_0_ARLEN"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARLOCK" altera:internal="io_M_AXI_0_ARLOCK"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARPROT" altera:internal="io_M_AXI_0_ARPROT"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARQOS" altera:internal="io_M_AXI_0_ARQOS"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARREADY" altera:internal="io_M_AXI_0_ARREADY"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARSIZE" altera:internal="io_M_AXI_0_ARSIZE"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARUSER" altera:internal="io_M_AXI_0_ARUSER"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_ARVALID" altera:internal="io_M_AXI_0_ARVALID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWADDR" altera:internal="io_M_AXI_0_AWADDR"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWBURST" altera:internal="io_M_AXI_0_AWBURST"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWCACHE" altera:internal="io_M_AXI_0_AWCACHE"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWID" altera:internal="io_M_AXI_0_AWID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWLEN" altera:internal="io_M_AXI_0_AWLEN"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWLOCK" altera:internal="io_M_AXI_0_AWLOCK"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWPROT" altera:internal="io_M_AXI_0_AWPROT"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWQOS" altera:internal="io_M_AXI_0_AWQOS"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWREADY" altera:internal="io_M_AXI_0_AWREADY"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWSIZE" altera:internal="io_M_AXI_0_AWSIZE"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWUSER" altera:internal="io_M_AXI_0_AWUSER"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_AWVALID" altera:internal="io_M_AXI_0_AWVALID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_BID" altera:internal="io_M_AXI_0_BID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_BREADY" altera:internal="io_M_AXI_0_BREADY"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_BRESP" altera:internal="io_M_AXI_0_BRESP"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_BUSER" altera:internal="io_M_AXI_0_BUSER"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_BVALID" altera:internal="io_M_AXI_0_BVALID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RDATA" altera:internal="io_M_AXI_0_RDATA"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RID" altera:internal="io_M_AXI_0_RID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RLAST" altera:internal="io_M_AXI_0_RLAST"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RREADY" altera:internal="io_M_AXI_0_RREADY"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RRESP" altera:internal="io_M_AXI_0_RRESP"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RUSER" altera:internal="io_M_AXI_0_RUSER"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_RVALID" altera:internal="io_M_AXI_0_RVALID"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_WDATA" altera:internal="io_M_AXI_0_WDATA"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_WLAST" altera:internal="io_M_AXI_0_WLAST"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_WREADY" altera:internal="io_M_AXI_0_WREADY"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_WSTRB" altera:internal="io_M_AXI_0_WSTRB"></altera:port_mapping>
<altera:port_mapping altera:name="io_M_AXI_0_WVALID" altera:internal="io_M_AXI_0_WVALID"></altera:port_mapping>
</altera:interface_mapping>
<altera:interface_mapping altera:name="io_S_AVALON" altera:internal="SpatialIP_0.io_S_AVALON" altera:type="avalon" altera:dir="end">
<altera:port_mapping altera:name="io_S_AVALON_address" altera:internal="io_S_AVALON_address"></altera:port_mapping>
<altera:port_mapping altera:name="io_S_AVALON_chipselect" altera:internal="io_S_AVALON_chipselect"></altera:port_mapping>
<altera:port_mapping altera:name="io_S_AVALON_read" altera:internal="io_S_AVALON_read"></altera:port_mapping>
<altera:port_mapping altera:name="io_S_AVALON_readdata" altera:internal="io_S_AVALON_readdata"></altera:port_mapping>
<altera:port_mapping altera:name="io_S_AVALON_write" altera:internal="io_S_AVALON_write"></altera:port_mapping>
<altera:port_mapping altera:name="io_S_AVALON_writedata" altera:internal="io_S_AVALON_writedata"></altera:port_mapping>
</altera:interface_mapping>
<altera:interface_mapping altera:name="reset" altera:internal="SpatialIP_0.reset" altera:type="reset" altera:dir="end">
<altera:port_mapping altera:name="reset" altera:internal="reset"></altera:port_mapping>
</altera:interface_mapping>
</altera:altera_interface_boundary>
<altera:altera_has_warnings>false</altera:altera_has_warnings>
<altera:altera_has_errors>false</altera:altera_has_errors>
</spirit:vendorExtensions>
</spirit:component> |
Renal tubular hypertrophy induced by angiotensin II.
Cellular processes leading to renal tubular hypertrophy may contribute to the development of progressive renal disease. Angiotensin II (ANG II) is a prime agent that has been linked to the progression of renal disease by a host of mechanisms, including the induction of tubular epithelial hypertrophy and stimulation of extracellular matrix biosynthesis. All components of a functional renin-angiotensin system reside within the renal tubule. Epithelial cells exhibit distinct patterns of growth behavior after stimulation with ANG II (namely, hypertrophy of proximal tubule segments and proliferation of more distal segments). The hypertrophic action of ANG II is mediated through high-affinity AT1-receptors, involves activation of pertussis-toxin sensitive G1 proteins, and depends on a decrease in intracellular cAMP. In addition, ANG II induces sequential activation of MAP kinases and S6 kinase, and leads to activation of early immediate genes and the modulation of a series of cyclins and cyclin-dependent kinases. There is also compelling evidence that the ANG II-induced epithelial hypertrophy and the stimulated-synthesis of collagen type IV are mediated by increased transcription and production of TGF-beta. ANG II-mediated inhibition of protein degradation may further increase protein content. The hypertrophic response to ANG II is greater in medium with high glucose concentration. Blockade of the action of ANG II prevents the renal hypertrophy and the tubulointerstitial fibrosis in animal models of chronic renal diseases (independent of changes in systemic or glomerular hemodynamics), in part through interception of ANG II-mediated induction of TGF-beta expression. |
(2:40) RX is about programming with asynchronous data streams. These streams can come from anywhere: user click events, push notifications and GPS updates for example.
(4:45) You can use RX in many places. Even if there’s only one event (e.g. a response from a network request), many events (e.g. user typing in a text field), or an error (such that you get zero data events) — they can all be modelled as asynchronous data streams.
(6:15) RX is a tool that facilitates lots of things, including:
chaining — start operations based on the result of an earlier operation
threading — schedule work and delivery of events on different threads without much effort
composition & data transformation — combine smaller functions together to achieve goals
(8:45) It’s similar to code you’ll see in Kotlin. By default, Kotlin operators work synchronously on finite data sets.
This example in Kotlin demonstrates some standard operators. Each line results in a new collection being created.
Conversely, RX waits until there’s a subscriber, and applies operations on each emission as and when they come (“lazy”).
In Kotlin, you can use asSequence() to transform any Array or Iterable into a Sequence, making the operations “lazy”. Here, the operations will not be applied until a terminal operator (e.g. toList) is called:
Each Sequence operator wraps the output of the previous Sequence operator in a new layer. You can read more about Sequences here.
(13:30) An observable exposes an event stream from some producer of events.
(13:42) Hot vs cold observables. I found this section a little jarring because it was at odds with my understanding of these terms.
There’s more reading from Ben Lesh here.
A cold observable is one which creates (or activates) a sequence of events in its onSubscribe() function. For each observer that subscribes to it, a new stream of events will be sent.
A hot observable is one that wraps around a producer that is created/activated potentially before an observer has subscribed to it. By the time an observer has subscribed, the producer might already have started emitting items or already terminated.
(15:15) Creating observables can be done with factory methods on the Observable class.
Here’s an example which emits the values 5 , 6 , and 7 then finishes:
This is an example of a cold observable. None of the statements inside the block will be executed until a subscriber subscribes. For each subscriber that subscribes, they’ll receive their own stream of 5 , 6 , and 7 events followed by an onComplete() .
(18:29) Observers are an abstraction for a consumer of observable events.
(20:02) The standard observer lifecycle starts with a call to observer.onSubscribe(...) when it calls observable.subscribe(observer) .
From the subscribed state, it can receive multiple calls to observer.onNext(t) which are emissions from the observable, or transition into a terminal state with observer.onError(e) or observer.onComplete() .
(21:05) A simpler way to consume the output of an observable is to use Consumer<T> . This only has one method, fun accept(t: T) which is like Observer.onNext(t: T) .
The IDE will give us a hint that this anonymous class can be converted into a lambda:
Since Kotlin has type inference, we don’t even need to specify that it’s a Consumer<Int> (but be wary of clashing methods — see this post by Victoria Gonda):
Where you have a lambda as the last parameter in a method, you can put the closure outside the parentheses.
If there are no other parameters, then you can get rid of the parentheses:
If there’s only one method in the lambda, and it only has a single parameter, then you can use it as an alias for that parameter:
Nicole Borelli wrote a great post about this shorthand lambda syntax!
(23:48) Operators can be used to create, transform, filter and chain observables. We’ll look at the map() operator. This transforms a stream of one type of item to a stream of another type of item.
This will emit the items 5 , 6 and 7 , transforming each integer into a string (of “hello ” repeated that many times), and then print the three strings:
hello hello hello hello hello
hello hello hello hello hello hello
hello hello hello hello hello hello hello
Written in its expanded form it looks like this:
where these two are the same:
Sometimes it’s easier to break out the lambdas and shorthand as above to help understand long pipelines, especially as you’re getting used to it.
(27:24) The flatMap() operator transforms an item into an observable of (potentially) a different item.
(27:55) Consider you’re building a blogging platform and you want to display a list of all posts from each user.
Matilda has written 3 articles, Jenny 2 and Agatha just 1
You have available to you:
If we used map() , we could transform our stream of User into a stream of List<Article> where each list would be the articles written by a given user:
Marble diagram shows three emissions, Matilda, Agatha and Jenny being transformed into three emissions of type List<Article>
But we don’t want Observable<List<Article>> , we want Observable<Article> .
We can use flatMap() to turn this stream of User into a stream of Article :
Marble diagram shows three emissions, Matilda, Agatha and Jenny being transformed into a single stream of 6 articles
(29:50) So, should you use RX? Well, do you:
like functional programming?
need asynchronous processing of items?
need to compose data from multiple sources?
want to handle errors gracefully?
If you said “yes” to most of these, then “it truly does depend”.
RX might be too complex for your team or for what you’re building, especially if you’re not familiar with it. There’s other options available to you.
On the other hand, it’s very pervasive — it’s available in multiple languages, and many platforms, with lots of examples abound.
(30:50) Recap of operators, observers and observables.
Thanks Annyce!
Thanks also to Toto for helping with the hot/cold definition. |
---
abstract: 'The nonlinear dynamics of a recently derived generalized Lorenz model (Macek and Strumik, Phys. Rev. E 82, 027301, 2010) of magnetoconvection is studied. A bifurcation diagram is constructed as a function of the Rayleigh number where attractors and nonattracting chaotic sets coexist inside a periodic window. The nonattracting chaotic sets, also called chaotic saddles, are responsible for fractal basin boundaries with a fractal dimension near the dimension of the phase space, which causes the presence of very long chaotic transients. It is shown that the chaotic saddles can be used to infer properties of chaotic attractors outside the periodic window, such as their maximum Lyapunov exponent.'
author:
- |
Francis F. Franco\
Department of Physics\
Technological Institute of Aeronautics (ITA)\
São José dos Campos, SP, Brazil, 12228-900\
`francisferreirafranco@gmail.com`\
Erico L. Rempel\
Departmanet of Mathematics\
Technological Institute of Aeronautics (ITA)\
São José dos Campos, SP, Brazil, 12228-900\
`rempel@ita.br`\
title: CHAOTIC SADDLES IN A GENERALIZED LORENZ MODEL OF MAGNETOCONVECTION
---
Introduction
============
The study of simple models of thermal convection based on truncated solutions of hydrodynamic equations has been extremely popular since Lorenz’s original work on deterministic nonperiodic flows [@lorenz1963]. The model was originally derived for the study of two-dimensional Rayleigh-Bénard convection, i.e., thermal convection in a plane layer of fluid heated from below and cooled from above [@chandra]. Since then, sets of Lorenz-like equations have been obtained in different contexts, such as lasers [@haken1975], dynamos [@knobloch1981; @weiss1984], magnetoconvection [@knobloch1992; @macek2010], chemical reactions [@poland1993] etc. In the present paper, we explore the generalized Lorenz model introduced by @macek2010 in the context of magnetoconvection, where the interaction of an electrically conducting fluid with an imposed magnetic field is considered. The model follows Lorenz’s original derivation of three nonlinear ordinary differential equations, adding a fourth equation for the magnetic field fluctuation and it was shown to exhibit hyperchaos [@macek2014; @macek2018]. Although most previous analysis of Lorenz systems (and dynamical systems in general) focus on the asymptotic behaviour, after solutions have converged to an attractor, here we stress the importance of the initial transient dynamics and identify the role of nonattracting chaotic sets.
Nonattracting chaotic sets are subsets of the phase space of a dynamical system where a nonattracting chaotic trajectory can be found, with the corresponding properties of aperiodicity and sensitivity to initial conditions, as measured by a positive Lyapunov exponent [@hsu1988]. Being nonattracting means that neighbouring trajectories will wonder in the vicinity of a chaotic set for a finite time before they diverge from it, eventually converging to some coexisting attractor in the case of dissipative systems. Thus, the outcome is a transient or decaying chaotic behaviour. Usually, there is a special (fractal) set of initial conditions called [*stable manifold*]{} that converges to the nonattracting chaotic set in forward time, and a set that converges to it in reversed time dynamics, the [*unstable manifold*]{} [@hsu1988; @sweet2000]. For that reason, nonattracting chaotic sets are also known as chaotic saddles, as they lie at the intersection of their stable and unstable manifolds, which are smooth surfaces in the phase space. Chaotic saddles are also known as chaotic repellors and are related to dynamical phenomena like chaotic scattering [@macau2002] and fractal basin boundaries [@battelino1988].
Another important role played by chaotic saddles in dynamical systems is in global bifurcations known as crises [@grebogi1982], where chaotic attractors undergo a sudden change in size or structural stability. In a boundary crisis, a chaotic attractor suddenly disappears, leaving a chaotic saddle in its place [@robert2000; @chian2007]; in an interior crisis, a chaotic attractor suddenly enlarges after collision with a chaotic saddle [@szabo1994]; in a merging crisis, two or more chaotic attractors are united to form a larger attractor, where the former attractors are converted to chaotic saddles [@rempel2005]. In all types of crises, chaotic saddles affect the observable dynamics through the appearance of chaotic transients and/or crisis-induced intermittency [@romeiras1987; @rempel2003; @rempel2007]. Due to their close relation to crises, the properties of a chaotic saddle can be used to infer the properties of chaotic attractors generated at crises, such as their Lyapunov exponents and overall topology [@szabo1994; @rempel2005; @tel2015]. In this work, we exemplify this fact in the generalized Lorenz model by comparing the shape of the invariant sets and the value of their maximum Lyapunov exponents for a chaotic saddle and a chaotic attractor in the phase space for different values of the control parameter.
This paper is organized as follows. In section \[sec model\], the generalized Lorenz model of magnetoconvection is described; in section \[sec analysis\], the numerical nonlinear analysis of the model is presented; section \[sec conclusion\] provides the conclusions.
The Generalized Lorenz Model {#sec model}
============================
In this section we summarize the derivation of the generalized Lorenz model of magnetoconvection, which is provided in more details in @macek2018. Consider the two-dimensional motion of a conducting fluid between two horizontal plates separated by a height $h$ in the $z$ direction, with the temperature at the bottom plate kept higher than the temperature at the top plate and an imposed magnetic field in the horizontal direction ($x$). The evolution of the magnetized fluid is governed by the magnetohydrodynamic (MHD) equations
$$\begin{aligned}
\frac{D \textbf{v}}{Dt} &=& - \frac{1}{\rho} \nabla \left(p + \frac{\textbf{B}^2}{2 \mu_{0}} \right) + \frac{\left(
\textbf{B} \cdot \nabla \right) \textbf{B}}{\mu_{0} \rho} + \nu \nabla^2 \textbf{v} + \rho \mathbf{g}, \\
%%%%%
\frac{D \textbf{B}}{Dt} &=& \left( \textbf{B} \cdot \nabla \right) \textbf{v} + \eta \nabla^2 \textbf{B},\\
%%%%%
\frac{D T}{D t}&=& \kappa \nabla^2 T,\\
%%%%%
\nabla \cdot \textbf{B} &=& 0,
\end{aligned}$$
where $\mathbf{v}$ denotes the velocity of the flow, $\rho$ is the mass density, $p$ the pressure, $\textbf{B}$ is the magnetic field, $\mu_{0}$ is the permeability of vacuum, $\nu$ is the kinematic viscosity, $\eta$ the magnetic resistivity, $\kappa$ the thermal conductivity of the fluid, $T$ is the temperature, $\mathbf{g}$ is the constant gravity and $D/Dt \equiv (\partial/ \partial t)+ \mathbf{v} \cdot \mathbf{\nabla}$. Additionally, consider the Boussinesq approximation, where the mass density is considered constant $\rho=\rho_0$, where $\rho_0$ is the density at the lower boundary, except in the buoyancy term ($\rho \mathbf{g}$), where $\rho$ is given by $\rho = \rho_{0}[1 -\beta (T-T_b)]$, where $\beta$ is the constant thermal expansion coefficient and $T_b$ is the temperature at the bottom plate.
By adopting a stream function for the flow velocity, a vector potential for the magnetic field and employing a one-mode Fourier representation, @macek2014 obtained the following generalized Lorenz model $$\begin{aligned}
\dot{x}&=&-\sigma x + \sigma y - \omega_{0} w,\label{model1}\\
\dot{y}&=&-x z + r x -y,\\
\dot{z}&=&x y - b z,\\
\dot{w}&=&\omega_{0} x - \sigma_{m} w,\label{model4}
\end{aligned}$$ where $x$ is the Fourier coefficient related to the stream function, $y$ and $z$ are the coefficients related to the temperature fluctuation and $w$ is the coefficient related to the magnetic vector potential. The overdot denotes derivative with respect to the normalized time $t'=(1+a^2) \kappa (\pi/h)^2t$, where $a$ is a parameter associated with the width $(h/a)$ of the convective rolls at the onset of convection. The other parameters are $b=4/(1+a^2)$, the Prandtl number $\sigma=\nu/\kappa$, the magnetic Prandtl number $\sigma_m=\eta/\kappa$, the normalized Rayleigh number $r=R_a/R_c$, where $R_a=g\beta h^3\delta T/(\nu\kappa)$ and $R_c=(1+a^2)^3(\pi^2/a)^2$, and $\omega_0=\upsilon_{A_0}/\upsilon_0$ is responsible for the strength of the imposed magnetic field, with $\upsilon_0 = 16\pi^2\kappa/(abh\mu_0)$ and $\upsilon_{A_0}=B_0/(\mu_0\rho_0)^{1/2}$ is the Alfvén speed. When $\omega_0=0$ the traditional Lorenz model is obtained.
Nonlinear Dynamics Analysis {#sec analysis}
===========================
Equations (\[model1\])-(\[model4\]) are solved with a fourth-order Runge-Kutta integrator. Just like the original Lorenz system, the generalized model exhibits symmetry under reflection through the $z$ axis, i.e., the system equations are reversible under $x \mapsto -x$, $y\mapsto-y$, $w\mapsto-w$. Figure \[fig symmetry\] illustrates this symmetry, where a periodic attractor (red) and its symmetric counterpart (green) are plotted. Due to this property, the nonlinear evolution of an attractor under changes in control parameters is mimicked by its symmetric attractor, with identical bifurcations taking place simultaneously in different parts of the phase space. We refer to both attractors as $A_1$ and $A_2$.
![Symmetry under reflection through the z axis shown in projection to the x,z plane for periodic attractors A1 (red) and A2 (green) for $\sigma=10$, $b=8/3$, $\sigma_{m}=0.1$, $\omega_{0}=5.95$ and $r=443$.[]{data-label="fig symmetry"}](Fig1.pdf){width="7.0cm"}
We adopt the Poincaré map defined by $x=0$ with $\dot{x}>0$, thus a point is plotted everytime a solution crosses the hyperplane $x=0$ from “left” to “right”. Figure \[fig bifdiag\](a) shows the bifurcation diagram of the generalized Lorenz model for $\sigma=10$, $b=8/3$, $\sigma_m=0.1$ and $\omega_0 = 5.95$, while $r$ is varied between 430 and 480. This set of parameter values was chosen following @macek2014. For each value of $r$, an initial condition is integrated until the orbit converges to an attractor, after which we start plotting the $z$ component of the Poincaré points in red dots. There is a period-2 periodic window starting with a saddle-node bifurcation (SNB) at $r \approx 455.47$. By reducing $r$, the period-2 attractor undergoes a flip bifurcation at $r\approx 442.35$, where its period in the Poincaré map duplicates, going from period-2 to period-4. As the reduced Rayleigh number $r$ is further decreased, a cascade of period-doubling (flip) bifurcations takes place, leading to a small chaotic attractor localized in two narrow bands. The two green lines inside the window represent the evolution of attractor $A_2$ in parallel with $A_1$. The grey dots represent the transient chaotic behaviour displayed by the trajectories before they converge to either $A_1$ or $A_2$ and were found with the sprinkler method [@hsu1988]. The chaotic transients are due to a chaotic saddle surrounding the attractors, and we denote this chaotic saddle by $\Lambda_s$. The window ends in a merging crisis (MC) at $r\approx 437.73$, where $A_1$ and $A_2$ simultaneously collide with the surrounding chaotic saddle and the three sets merge, leading to the formation of a large chaotic attractor. To the left of MC as well as to the right of SNB, the trajectories of $A_1$ and $A_2$ are united in a single large chaotic attractor, except in some narrow periodic windows, where the two attractors split again. Figure \[fig bifdiag\](b) displays the three largest Lyapunov exponents ($\lambda_1 > \lambda_2 > \lambda_3$) of the attracting sets in Fig. \[fig bifdiag\](a) and is a reproduction of Fig. 2 of @macek2014. Note that $\lambda_1$ suddenly drops to negative values at SNB, rises to positive values near MC and then, suddenly jumps to a much higher value at MC. There is an interval for $r>454.7$ where hyperchaos is found, with $\lambda_1>0$ and $\lambda_2>0$, a phenomenon first reported in this system by @macek2014.
![(a) Bifurcation diagram showing the Poincaré points of state variable $y$ as a function of the control parameter $r$, with $\sigma=10$, $b=8/3$, $\sigma_m=0.1$ and $\omega_0 = 5.95$. The gray area represents the chaotic saddle $\Lambda_s$, red dots represent attractor $A_1$ and green dots represent attractor $A_2$; MC denotes merging crisis and SNB denotes saddle-node bifurcation. (b) The three largest Lyapunov exponents, $\lambda_1$, $\lambda_2$ and $\lambda_3$, for the attractors in (a) as a function of $r$.[]{data-label="fig bifdiag"}](Fig2.pdf){width="6.5cm"}
Inside the periodic window, $A_1$ and $A_2$ attract different sets of initial conditions, defined as basins of attraction. The boundary between these basins is highly complex, as illustrated by Fig. \[fig basins\] for $r=453$, where red dots represent initial conditions whose trajectories eventually converge to $A_1$ and green dots represent initial conditions that converge to $A_2$. The complexity is scale invariant, as successive amplifications of a region in the phase space do not simplify the picture, as confirmed by Fig. \[fig basins\_zoom\](a), where a two-dimensional slice of the phase space is shown nearby the period-2 attractors $A_1$ (black squares) and $A_2$ (blue circles). These points represent the Poincaré points of the symmetric attracting trajectories shown in Fig. \[fig symmetry\], but in a different projection $(w \times y)$. Figure \[fig basins\_zoom\](b) shows an enlargement of a region around one of the Poincaré points of $A_1$, where it is clear that the basin only becomes smooth in the close vicinity of the attractor, with an apparently fractal structure otherwise.
![Basins of attraction for attractors $A_1$ (red dots) and $A_2$ (green dots) on the Poincaré map ($x=0$) for $r=453$. The other parameters are as in Fig. \[fig bifdiag\].[]{data-label="fig basins"}](Fig3.pdf){width="8.0cm"}
![(a) A two-dimensional slice $(w \times y)$ of the basins of attraction shown in Fig. \[fig basins\]. Black squares represent the period-2 attractor $A_1$ and blue circles represent the period-2 attractor $A_2$. Red dots converge to $A_1$ and green dots converge to $A_2$. (b) An enlargement of a region in (a), near one of the points of $A_1$.[]{data-label="fig basins_zoom"}](Fig4.pdf){width="7.0cm"}
The fractal dimension of the basin boundary can be estimated with the aid of the uncertainty exponent [@grebogi1983]. Start with a line connecting two points in the phase space, arbitrarily chosen. Then, randomly choose $N_s=10000$ initial conditions on this line and determine to which basin of attraction each of them belongs. Next, displace each initial condition by adding a small perturbation $\varepsilon$. A point is considered uncertain if its perturbation converges to a different attractor. Compute the number of uncertain points $N(\varepsilon)$ for different values of $\varepsilon$ and obtain the fraction of uncertain points as
$$f(\varepsilon)=\frac{N(\varepsilon)}{N_s}.$$
In fractal basin boundaries, the fraction scales as $f \sim \varepsilon^\alpha$, so $\alpha$ is the slope of the linear relation between $\log{(f)}$ and $\log{(\varepsilon)}$. The graph of $\log{(f)} \times \log{(\varepsilon)}$ is shown in Fig. \[fig f\], from which the slope of the linear regression is $\alpha = 6\times10^{-4}\pm4\times10^{-4}$. The dimension of the set of intersecting points of the basin boundary with the 1D line is $d_s = 1 - \alpha$. In the full 3D Poincaré map, the dimension of the basin boundary is $D_s = 3-\alpha = 2.9994$, a value extremely close to the dimension of the phase space.
![Loglog plot of the fraction of uncertain initial conditions $f$ as a function of the uncertainty parameter $\varepsilon$ for $r=453$. The slope of the fitted line is $\alpha = 6\times 10^{-4} \pm 4\times 10^{-4}$.[]{data-label="fig f"}](Fig5.pdf){width="7.5cm"}
The intricacy of the basin boundary and its high fractal dimension result in long chaotic transients before the solutions settle to an attractor. Figure \[fig transient\] shows a solution with a chaotic behaviour up to $t_p \approx 13600$ iterations of the Poincaré map for $r=453$, before the system converges to a period-2 attractor.
![Long chaotic transient before convergence to a period-2 attractor in the Poincaré map for $r=453$.[]{data-label="fig transient"}](Fig6.pdf){width="10.0cm"}
As mentioned before, these chaotic transients are due to the presence of a chaotic saddle in the phase space. Inside the periodic window, this chaotic saddle $\Lambda_s$ is located at the boundary between the basins of attractors $A_1$ and $A_2$, which coincides with the stable manifold of the chaotic saddle [@pentek1995; @tel2015]. In order to find $\Lambda_s$, we first determine the average transient time $\tau$ of initial conditions in the phase space. We define the lifetime of a trajectory as the time it takes to go from its initial condition until the close vicinity of an attractor. For $r=453$, we define a $500 \times 100$ grid of initial conditions in the $(w\times y)$ plane, with the other state variables fixed. Let $N_0$ be the number of initial conditions in the grid and let $N(t)$ be the number of trajectories from those initial conditions that have not converged to any attractor after $t$ iterations of the Poincaré map. These trajectories must be near the chaotic saddle $\Lambda_s$ and, due to its chaotic nature, the probability that the trajectory has not yet escaped from the vicinity of the chaotic saddle on time $t$ decays exponentially with time [@Kantz1985] $$P(t) \sim exp(-\kappa t),$$ for some $t>t_0$, where $\kappa$ is the decay rate. Following @hsu1988 [@lai1995; @sweet2000], we write $P(t) = N(t)/N_0$ and $\kappa = 1/\tau$. $$N(t) \sim N_0\exp(-t/\tau).
\label{eq N}$$ Equation (\[eq N\]) defines a linear dependence between $\log{N(t)}$ and $t$, with $-1/\tau$ as the slope. Thus, the average transient time $\tau$ can be computed by considering the inverse of the slope of the graph of $\log(N(t))\times t$, as shown in Fig. \[fig Nt\]. The estimated value from linear regression is $\tau \approx 1111$.
![Log-linear plot of $N(t)$, the number of orbits that have not converged to an attractor after $t_p$ Poincaré map iterations, as a function of $t_p$ for $r=453$. The other parameters are as in Fig. \[fig bifdiag\]. The slope of the fitted line is $\beta = -9\times 10^{-4} \pm 6.5 \times 10^{-6}$, providing an average transient time of $\tau \approx 1111$ Poincaré map iterations.[]{data-label="fig Nt"}](Fig7.pdf){width="7.5cm"}
We now describe how the sprinkler method is used to find $\Lambda_s$. First, we find on a grid the set of initial conditions with trajectories that are still chaotic after a long time $t_c$. The value of $t_c$ must be large compared to the average lifetime $\tau$, so we choose $t_c=3000$. These initial conditions will first approach $\Lambda_s$ through its stable manifold, stay in its vicinity for some time before they depart along the unstable manifold toward an attractor. Thus, if we iterate all selected initial conditions until $t_m=t_c/2$, their trajectories must be very close to $\Lambda_s$. The set of all those points approximate the chaotic saddle. Figure \[fig cs\](a) depicts the $(y\times w$) components of the chaotic saddle in the beginning of the periodic window, at $r=453$, to the left of SNB in Fig. \[fig bifdiag\](a), when the attractors are periodic. The period-2 attractors are plotted as red ($A_1$) and green ($A_2$) crosses. A comparison with the chaotic attractor to the right of SNB, shown in Figure \[fig bifdiag\](b) for $r=455.48$, reveals that the chaotic saddle is formed by a continuation of many of the recurrent points found in the pre-window chaotic attractor, as discussed in @robert2000.
![(a) Poincaré points of the $(w \times y)$ components of the chaotic saddle inside the periodic window at $r=453$. The other parameters are as in Fig. \[fig bifdiag\]. Red crosses represent attractor $A_1$ and green crosses represent $A_2$. (b) The chaotic attractor at $r=455.48$[]{data-label="fig cs"}](Fig8.pdf){width="7.5cm"}
The Lyapunov exponents of the chaotic saddle $\Lambda_s$ can be approximately computed as the Lyapunov exponents of a long chaotic transient. Figure \[fig lyapcs\] shows the convergence of the first three Lyapunov exponents for a long chaotic transient at $r=453$. We can compare the value $\lambda_1\approx 1.5$ of the chaotic saddle with the maximum Lyapunov exponent of the chaotic attractor just to the right of SNB in Fig. \[fig bifdiag\](b). For $r=455.58$, $\lambda_1\approx 1.51$ for the chaotic attractor, a value very close to the maximum Lyapunov exponent of $\Lambda_s$, confirming the relation of continuation between both sets.
![Convergence of the first three Lyapunov exponents of a long chaotic transient for $r=453$.[]{data-label="fig lyapcs"}](Fig9.pdf){width="7.5cm"}
The maximum Lyapunov exponent $\lambda_1$ of the chaotic saddle can also be estimated from the average lifetime $\tau$ and from $d_s$, the fractal dimension of the set of intersecting points of a one-dimensional line with the stable manifold of the chaotic saddle. For two-dimensional maps, this relation is given by [@hsu1988]
$$\tau = 1/[(1-d_s)\lambda_1].
\label{eq tau}$$
Note that @Kantz1985 had previously derived a more general relation for the decay rate as $\kappa = (1-D_1) \lambda_1$, where $D_1$ is the partial information dimension of the chaotic saddle. For a review of this topic, see the chapter 8 of @Lai2011. For certain higher-dimensional phase spaces, it has been argued that the same relation holds [@lai1995]. Using the previously computed values of $\tau$ and $d_s$ in Eq. (\[eq tau\]) for $r=453$, we obtain
$$\lambda_1=1/[(1-(1-\alpha))1111].
\label{eq l}$$
The error bar in $\alpha=6\times 10^{-4} \pm 4\times 10^{-4}$ is too large for a precise estimation of $\lambda_1$ with Eq. (\[eq l\]). Nonetheless, we observe that using the mean value $\alpha=6\times 10^{-4}$ yields
$$\lambda_1=1/[(1-0.9994)1111] \approx 1.5.
\label{eq l2}$$
The value agrees quite well with the one computed directly from the chaotic transient in Fig. \[fig lyapcs\], confirming that the chaotic transients are due to the chaotic saddle localized on the fractal basin boundary.
Discussion and Conclusions {#sec conclusion}
==========================
Transient chaos is still an overlooked topic in most textbooks and theoretical works on dynamical systems, where the tendency is to focus exclusively on the asymptotic dynamics, after trajectories have converged to an attractor. In practice, however, it is usually not possible to proof that an observed behaviour is asymptotic or not, as experimental results can only confirm a certain behaviour up to a finite time scale, as noted by @tel2015. This has strong implications in areas such as transition to turbulence in pipe flows, where long chaotic transients have been observed and it is difficult to find a critical Reynolds number where the system switches from laminar to persistent turbulence and chaotic saddles play a crucial role [@eckhardt2007]. In this case, the lifetime of the transient chaos follows a supertransient law, i.e., it grows exponentially as a function of the control parameter [@tel2008], a phenomenon also observed in numerical simulations of Keplerian shear flows in the context of accretion disks [@rempel2010; @danilo2018]. For other applications of transient chaos, including intermittency and scattering in leaking systems, see @tel2008, @altmann2013 and @tel2015.
Our results illustrate the importance of transient chaos in dynamical systems in general and in this magnetoconvection model in particular. The existence of very long chaotic transients as seen in Fig. \[fig transient\] can mask the true attractors of the system if the time scales considered are smaller than the average transient time. In the case of the Lorenz system, we stress that the presence of a magnetic field causes an increase in the transient lifetime in the range of parameters studied in this paper. It is also worth pointing that the original Lorenz model displayed multistability, with up to three coexisting basins of attraction reported by @yorke1979, but the basin boundaries are not fractal in those cases [@sprott2017]. We are unaware of the presence of basin boundaries with a fractal dimension close to the dimension of the phase space (as seen in Figs. \[fig basins\] and \[fig basins\_zoom\]) in the original Lorenz system. The high fractal dimension is directly related to the long transients reported above, as indicated by Eq. (\[eq tau\]).
Regarding the non-dimensional control parameters, they were chosen according to the values commonly employed in the original Lorenz model to focus on the impact of the addition of a magnetic field. The new parameters are $\omega_0=5.95$, responsible for the intensity of the background magnetic field, and the magnetic Prandtl number $\sigma_m=0.1$, whose values were chosen following @macek2014. Although it is a low $\sigma_m$, this value is orders of magnitude higher than what is found in the Earth’s liquid outer core ($\sigma_m\sim 10^{-6}$) or in stellar interior ($10^{-4} \leq \sigma_m \leq 10^{-6}$) [@mondal2018]. In fact, considering the relevance of the present work for the study of magnetoconvection, we don’t claim that Macek’s reduced Lorenz model provides realistic simulations of magnetized convection in stellar or Earth’s interior, where this phenomenon is responsible for the dynamo that maintains the magnetic fields [@weiss2014]. However, local and global bifurcations, chaotic saddles and transients similar to the ones displayed by this model have also been observed in more realistic direct numerical simulations of three-dimensional Rayleigh-Bénard convection [@roman2015]. Thus, the analysis of the reduced model can shed light to the understanding of the complexity present in magnetoconvection and guide future nonlinear analyses of more realistic models.
Acknowledgments {#acknowledgments .unnumbered}
===============
This work had the financial support of Brazilian funding agencies CAPES (88887.309065/2018-00), CNPq (304449/2017-2) and FAPESP (2013/26258-4).
[1]{}
Altmann, E. G., Portela, J. S. E., and Tél, T. \[2013\] “Leaking chaotic systems”, [*Reviews of Modern Physics*]{} [**85**]{}, 869–918.
Battelino, P. M., Grebogi, C., Ott, E., and Yorke, J. A. \[1988\] “Multiple coexisting attractors, basin boundaries and basic sets", [*Physica D*]{} [**32**]{}, 296–305.
Chandrasekhar, S. \[1981\] [*Hydrodynamic and hydromagnetic stability*]{} (Dover Publications, New York).
Chertovskih, R., Chimanski, E., and Rempel, E. L. \[2015\] “Route to hyperchaos in Rayleigh–Bénard convection", [*Europhysics Letters*]{} [**112**]{}, 14001.
Chian, A. C.-L., Santana, W. M., Rempel, E. L., Borotto, F. A., Hada, T., and Kamide, Y. \[2007\] “Chaos in driven Alfven systems: unstable periodic orbits and chaotic saddles", [*Nonlinear Processes in Geophysics*]{} [**14**]{}, 17–29.
Eckhardt, B., Schneider, T. M., Hof, B., and Westerweel, J. \[2007\] “Turbulence Transition in Pipe Flow", [*Annual Reviews of Fluid Mechanics*]{} [**39**]{}, 447–468.
Grebogi, C., Ott, E., and Yorke, J. \[1982\] “Chaotic attractors in crisis", [*Physical Review Letters*]{} [**48**]{}, 1507–1510.
Grebogi, C., McDonald, S. W., Ott, E., and Yorke, J. A. \[1983\] “Final state sensitivity: an obstruction to predictability", [*Physics Letters A*]{} [**99**]{}, 415–418.
Grebogi, C., Ott, E., Romeiras, F., and Yorke, J. \[1987\] “Critical exponents for crisis-induced intermittency", [*Physical Review A*]{} [**36**]{}, 5365–5380.
Haken, H. \[1975\] “Analogy between higher instabilities in fluids and lasers", [*Physics Letters A*]{} [**53**]{}, 77–78.
Hsu, G.-H., Ott, E., and Grebogi, C. \[1988\] “Strange saddles and the dimension of their invariant manifolds", [*Physics Letters A*]{} [**127**]{}, 199.
Kantz, H., and Grassberger, P. \[1985\] “Repellers, semi-attractors, and long-lived chaotic transients", [*Physica D*]{} [**17**]{}, 75–76.
Knobloch, E. \[1981\] “Chaos in the segmented disc dynamo", [*Physics Letters A*]{} [**82**]{}, 439–440.
Knobloch, E. \[1992\] “Heteroclinic bifurcations in a simple model of double-diffusive convection", [*Journal of Fluid Mechanics*]{} [**239**]{}, 273–292.
Lai, Y.-C. and Winslow, R. L. \[1994\] “Geometric properties of the chaotic saddle responsible for supertransients in spatiotemporal chaotic systems", [*Physical Review Letters*]{} [**74**]{}, 5208–5211.
Lai, Y.-C., and Tél, T. \[2011\] “Transient Chaos: Complex Dynamics on Finite-Time Scales", Springer - New York.
Lorenz, E. N. \[1963\] “Deterministic nonperiodic flow", [*Journal of the Atmospheric Sciences*]{} [**20**]{}, 130–141.
Macau, E. E. and Caldas, I. L. \[2002\] “Driving trajectories in chaotic scattering", [*Physical Review E*]{} [**65**]{}, 026215.
Macek, M. W. and Strumik, M. \[2010\] “Model for hydromagnetic convection in a magnetized fluid", [*Physical Review E*]{} [**82**]{}, 027301–1–027301–4.
Macek, W. M. \[2018\] “Nonlinear dynamics and complexity in the generalized Lorenz system", [*Nonlinear Dynamics*]{} [**94**]{}, 2957–2968.
Macek, W. M. and Strumik, M. \[2014\] “Hyperchaotic intermittent convection in a magnetized viscous fluid", [*Physical Review Letters*]{} [**112**]{}, 074502.
Mondal, H., Das, A., and Kumar, K. \[2018\] “Onset of oscillatory Rayleigh-Bénard magnetoconvection with rigid horizontal boundaries", [*Physics of Plasmas*]{} [**25**]{}, 012119.
Péntek, A., Toroczkai, S., Tél, T., Grebogi, C., and Yorke, J. A. \[1995\] “Fractal boundaries in open hydrodynamical flows: signature of chaotic saddles", [*Physical Review E*]{} [**51**]{}, 4076–4088.
Poland, D. \[1993\] “Cooperative catalysis and chemical chaos: a chemical model for the Lorenz equations", [*Physica D*]{} [**65**]{}, 86–99.
Rempel, E. L. and Chian, A. C.-L. \[2003\] “High-dimensional chaotic saddles in the Kuramoto-Sivashinsky equation", [*Physics Letters A*]{} [**319**]{}, 104–109.
Rempel, E. L. and Chian, A. C.-L. \[2005\] “Intermittency induced by attractor-merging crisis in the Kuramoto-Sivashinsky equation", [*Physical Review E*]{} [**71**]{}, 016203.
Rempel, E. L., Chian, A. C.-L., and Miranda, R. A. \[2007\] “Chaotic saddles at the onset of intermittent spatiotemporal chaos", [*Physical Review E*]{} [**76**]{}, 056217.
Rempel, E. L., Lesur, G., and Proctor, M. R. E. \[2010\] “Supertransient Magnetohydrodynamic Turbulence in Keplerian Shear Flows", [*Physical Review Letters*]{} [**105**]{}, 044501.
Robert, C. and K. T. Alligood, E. Ott, J. A. Y. \[2000\] “Explosion of chaotic sets", [*Physica D*]{} [**144**]{}, 44–61.
Sweet, D. and Ott, E. \[2000\] “Fractal dimension of higher-dimensional chaotic repellors", [*Physica D*]{} [**139**]{}, 1–27.
Szabó, K. G. and Tél, T. \[1994\] “Transient chaos as the backbone of dynamics on strange attractors beyond crisis", [*Physics Letters A*]{} [**196**]{}, 173–180.
Teixeira, D. M. and Rempel, E. L. \[2018\] “Supertransient magnetohydrodynamic turbulence in Keplerian shear flows: The role of the Hall effect", [*Europhysics Letters*]{} [**124**]{}, 59001.
Tél, T. \[2015\] “The joy of transient chaos", [*Chaos*]{} [**25**]{}, 097619.
Tél, T. and Lai, Y.-C. \[2008\] “Chaotic transients in spatially extended systems", [*Physics Reports*]{} [**460**]{}, 245–275.
Weiss, N. and Proctor, M. R. E. \[2014\] [*Magnetoconvection*]{} (Cambridge University Press, Cambridge).
Weiss, N. O., Cattaneo, F., and Jones, C. A. \[1984\] “Periodic and aperiodic dynamo waves", [*Geophysical and Astrophysical Fluid Dynamics*]{} [**30**]{}, 305–341.
Xiong, A., Sprott, J. C., Lyu, J., and Wang, X. \[2017\] “3D Printing — The Basins of Tristability in the Lorenz System", [*International Journal of Bifurcation and Chaos*]{} [**27**]{}, 1750128.
Yorke, J. A. and Yorke, E. D. \[1979\] “Metastable Chaos: The Transition to Sustained Chaotic Behavior in the Lorenz Model", [*Journal of Statistical Physics*]{} [**21**]{}, 263–277.
|
1. Field of the Invention
The present invention relates to the field of integrated circuits and, more particularly, to semiconductor devices having double lightly doped regions for improved DRAM refresh characteristics and methods for their manufacture.
2. Description of the Related Art
Metal oxide semiconductor (MOS) structures are basic electronic devices used in many integrated circuits. One such structure is the MOS field effect transistor (MOSFET), which is typically formed in a semiconductor substrate by providing a gate structure over the substrate to define a channel region, and by forming source and drain regions on opposing sides of the channel region.
MOSFETs are often used in the formation of memory circuits, including dynamic random access memory (DRAM) circuits. DRAM circuits are composed of an array of individual memory cells, each cell including a capacitor for holding a charge and an access transistor for accessing the charge held in the capacitor.
In a typical DRAM cell using a MOSFET access transistor, after a charge is stored the charge does not remain in the capacitor indefinitely, but instead slowly leaks out of the p-n junction of the access transistor for the cell. This phenomenon is known as xe2x80x9cjunction leakage.xe2x80x9d To avoid losing the cell contents, the charge must be periodically re-stored in the capacitor through a process known as xe2x80x9crefresh.xe2x80x9d Increased junction leakage leads to premature depletion of the capacitor""s stored charge, necessitating more frequent refresh operations. Refresh operations consume device resources and it is therefore desirable to reduce junction leakage as much as possible and thus reduce the frequency of required refresh operations.
Several factors are known to contribute to junction leakage, including (a) the electric field (E) generated at the p-n junction, (b) surface- or bulk-defect-induced recombination/generation current, and (c) gated diode assisted band-to-band tunneling leakage, such as gate-induced drain-leakage (GIDL) current. In particular, factor (a), the electric field (E) generated at the p-n junction, is proportional to the gradient of the doping concentration of either side of the junction. Because junction leakage varies directly with this electric field (i.e. higher E leads to higher junction leakage), it is desirable to control the doping concentration on both sides of the p-n junction. By controlling the doping concentration on both sides of the junction to reduce the gradient of the doping concentration, the p-n junction electric field (E) can be reduced and hence junction leakage.
The gradient of the doping concentration at the p-n junction of a MOSFET in a DRAM array depends on the doping concentration of the channel region and the doping concentration of the ion-implanted regions adjacent the channel serving as source/drain regions for a cell access transistor. For example, in an NMOS transistor, the channel is doped with p-type impurities, the source and drain regions are doped with n-type impurities, and as the boundary between the p-type channel and the n-type drain region is approached, the rate of change in impurity concentration defines the gradient of the doping concentration. An abrupt change in impurity concentration from p-type to n-type doping at the boundary creates a high gradient, high electric field (E) and hence increases junction leakage. A more gradual change from p-type to n-type doping concentration, for example using lightly doped drain (LDD) regions, creates a relatively lower gradient, lower electric field (E) and hence decreases junction leakage.
There are several tradeoffs that must be taken into account when formulating the doping concentrations on either side of the p-n junction. For example, in an NMOS transistor, the p-type doping concentration of the channel should be sufficiently high to turn off the transistor when the gate is off (i.e., low subthreshold leakage). On the other hand, the channel doping concentration should not be so high that a full potential of charge is prevented from being transferred from source to drain when the gate is on.
Likewise, the n-type doping concentration of the source and drain regions should be sufficiently high to obtain satisfactorily low series resistance and threshold voltage. If the n-type doping concentration is too low, transistor current drive may be degraded and a wider depletion width may result, possibly leading to undesirable levels of reverse bias current. On the other hand, if the n-type doping concentration is too high, undesirable junction leakage effects can result as discussed above. Thus, it would be desirable to form the memory array taking the above considerations into account and produce memory cells in which the electric field generated at the p-n junction is reduced for each cell and hence reduce junction leakage.
Another problem associated with the electric field generated at the p-n junction is the xe2x80x9chot carrierxe2x80x9d or xe2x80x9chot electronxe2x80x9d effect wherein energetic charge carriers, typically electrons and/or holes, are accelerated by a strong electric field, such as that created at the p-n junction. Such high strength electric fields accelerate the energetic carriers, known as xe2x80x9chot carriers,xe2x80x9d toward the gate electrode and the underlying gate oxide. These hot carriers are thus injected into the thin dielectric layer of the gate structure and into the adjacent thicker dielectric gate spacer structure, resulting in damage to the gate oxide as well as to the gate spacer structure. Over time, these hot electrons create a permanent charge in the thin dielectric layer and the dielectric spacers, degrading or destroying the performance of the associated MOSFET device. This is typically more of a problem with N-channel MOSFETS (which have electrons as the primary carrier species) than P-channel MOSFETS (which have xe2x80x9cholesxe2x80x9d as the primary carrier species).
The above problems are well known in the art and have resulted in the widely practiced remedy of forming lightly doped drain (LDD) regions between the source/drain regions and the channel region in the semiconductor substrate. This LDD region reduces the gradient of the doping concentration at the boundary (p-n junction) between the source/drain regions and the channel region to thereby lower the strength of the electric field (E) generated at the p-n junction. This reduction in the electric field (E) results in decreased junction leakage and reduces the hot carrier effect.
For example, U.S. Pat. No. 4,366,613 to Ogura et al. (xe2x80x9cOguraxe2x80x9d) discloses the formation of LDD regions in a RAM MOSFET. Referring to FIG. 1, MOSFET device 5 includes a gate structure comprising an access gate conductor 16 and a gate top insulator 20 formed over an oxide layer 18 that is formed on a substrate 12. Insulating spacers 32, 34 are formed on sidewalls of the gate structure. The device also includes source/drain regions 36, 38 and two lightly doped regions 22 and 24, one of which is provided proximate to each of the source/drain regions 36, 38. A channel 15 extends between the LDD regions 22 and 24. By providing the LDD regions 22 and 24, the electric field at the p-n junction between the channel 15 and the source/drain regions 36, 38 is reduced, thereby reducing the junction leakage and the hot carrier effect.
The prior art LDD structure of FIG. 1 can be made by a variety of processes, but is typically made by providing a low-density ion implant of the LDD regions 22, 24 before adding oxide spacers 32, 34 to the gate structure (see U.S. Pat. No. 4,366,613 to Ogura). After the spacers 32, 34 have been added to the gate structure, a higher-density ion implant is made to form the source and drain regions 36, 38. Since the source and drain regions 36, 38 were implanted after the formation of the spacers 32, 34, they are offset further from the channel 15 than the LDD regions 22, 24. The resulting structure exhibits a decreased electric field at the p-n junction.
Although LDD structures have helped advance the state of the art, increasing competition in the semiconductor industry, particularly in the development of DRAM devices and methods, have created a need and desire for greater device performance, especially in the area of lower refresh rates. It would, therefore, be desirable if the problems of junction leakage and hot carrier generation at the p-n junction could be further reduced in a MOSFET access transistor of a memory cell, using conventional processing and manufacturing techniques and at a reasonable cost.
The present invention provides a technique for forming double LDD regions at the p-n junction of a MOSFET access transistor of a memory cell that reliably improves the refresh characteristics of DRAM memory devices without substantially increasing manufacturing costs, with the added benefit of LDD peripheral devices resistant to hot carrier effects.
The above and other features and advantages of the invention are achieved by providing a DRAM memory circuit composed of novel integrated circuit devices, and a novel method of making the devices, including a memory cell with an access transistor with double LDD regions in addition to lightly doped LDD regions in a conventional metal oxide semiconductor field effect transistor (MOSFET), with or without using an additional mask. In the process of making the devices, a semiconductor substrate is provided with a gate structure formed on its surface, thereby defining a channel region in the substrate beneath the gate having a source side and a drain side. Next, lightly doped LDD regions are formed adjacent to the channel region by ion implantation in the substrate. Then, insulating spacers of a first width are formed adjacent to the sidewalls of the gate structure covering at least a portion of each of the LDD regions. Next, the memory array portion of the DRAM circuit is masked and heavily-doped source/drain regions are formed in the unmasked periphery MOSFETs by ion implantation in the substrate. The mask is then removed, and the insulating spacers are etched back to a second width smaller than the first width. Then, double LDD regions are formed by lightly doping the substrate in the memory array and in the periphery MOSFET areas. The structures formed in this method permit reduced channel doping in the memory array, reduced doping concentration gradient near the p-n junction, and hence a reduced electric field at the p-n junctions in both the memory array and peripheral MOSFETS.
The present invention thus provides an improved doping profile at the p-n junction between the channel and the source/drain regions, thereby improving DRAM refresh characteristics by reducing junction leakage. In addition, the hot carrier effect is reduced for periphery MOSFETs. Furthermore, these favorable results were obtained using conventional masking and etching techniques, obviating the need for unconventional processing techniques at a higher cost and failure rate. |
Appearance of tumor necrosis factor-alpha and soluble TNF-receptors I and II in peritoneal effluent of CAPD.
Dialysate and serum concentrations of tumor necrosis factor-alpha (TNF-alpha), soluble TNF-receptor I (sTNFRI) and soluble TNF-receptor II (sTNFRII) were measured during stable and infectious CAPD to determine whether these mediators are released intraperitoneally or derived from the circulation. Dialysate/serum ratios were compared to those of various marker proteins for peritoneal transport and to interleukin-6 (IL-6), which is locally produced. Peritoneal immunoreactive TNF-alpha could be detected in 19 of 20 stable CAPD patients after a night dwell, but only occasionally and in lower concentrations during and after a standard four-hour peritoneal permeability test. Both sTNFRs highly exceeded TNF-alpha dialysate concentrations. In case of peritonitis a median 16-fold increase in dialysate TNF-alpha occurred on the first day, which declined towards control values during a longitudinal follow-up of eight consecutive days. sTNFRI and sTNFRII in dialysate increased three- to fourfold. Their peaks, however, appeared on the second peritonitis day. Bioactive TNF-alpha was only detected when immunoreactive levels exceeded 1000 pg/ml. Serum values of all variables were not altered during infection; sTNFRs exceeded TNF-alpha 300- to 400-fold. During stable CAPD indirect evidence was obtained for transperitoneal transport from plasma to dialysate of TNF-alpha (molecular wt 17 kD), sTNFRI (55 kD) and sTNFRII (75 kD). Dialysate/serum (D/S) ratios were higher, the lower the molecular weight; they were related to D/S ratios of those marker proteins with the nearest molecular weight; D/S ratios were unrelated to the intraperitoneally produced IL-6. Furthermore, the observed D/S ratios were as expected theoretically for their molecular weights.(ABSTRACT TRUNCATED AT 250 WORDS) |
A modified technique for extracting a dislocated lens with perfluorocarbon liquids and viscoelastics.
The authors describe a modified technique for extraction of a dislocated crystalline lens or large and hard lens fragments displaced into the vitreous cavity. An ophthalmic viscosurgical device was used around and on top of the heavy liquid bubble to keep the lens centered and less mobile for easier phacofragmentation or removal by the cutting-suction probe. This technique was used in 10 eyes, including cases of traumatic dislocation and Marfan syndrome, with excellent anatomical results and no complications that could be attributed to the surgical technique. The technique has also been used to retrieve and reposition dislocated intraocular lenses. |
Q:
Samsung Galaxy Tab 2 10.1 rmnet0 interface non existent
I was wondering, why in my Samsung Galaxy 2 tablet I can't see any rmnet0 interface after executing:
adb shell cat /proc/net/xt_qtaguid/stats
Or:
adb shell netcfg
I know this a wifi only device, so, is this maybe the reason behind this?
The device is already connected to internet via my wifi router, I can navigate, see videos, etc etc
But for some reason I only got the wlan0 internal Ip from it, no rmnet0.
Is that a 3G network interface only?
Thanks in advance!
A:
On WiFi, you only have the IP address of your local network, that's completely normal. rmnet interfaces are for mobile data – which would explain why you don't see them on a WiFi only device.
rmnet interfaces are usually associated with cellular connections and usb tethering
from: Android NetworkInterface. What are the meanings of names of NetworkInterface?
|
The Utah Republican Party lost a big legal battle Tuesday in its attempt to overturn a 2014 Utah election law that allows candidates to qualify for the ballot through the caucus-convention system and/or by collecting signatures.
A panel of the 10th Circuit Court of Appeals in Denver upheld the law, called SB54, in a 2-1 decision, saying “states must have flexibility to enact reasonable, common-sense regulations designed to provide order and legitimacy to the electoral process.”
Republicans had argued that the law interfered with the party’s constitutional right of association to select nominees as it chooses — and it preferred to use only the traditional caucus-convention system.
But the court said that SB54 “strikes an appropriate balance between protecting the interests of the state in managing elections” and allowing political parties and individuals “to express their preferences and values in a democratic fashion.”
It concludes, “Not only does this balance not offend our Constitution, it is at its very essence. Accordingly, we affirm” earlier decisions that upheld the new law.
The court majority said the case is not “about who the candidates are, but rather who the deciders are. SB54 was not designed to change the substantive candidates who emerged from the parties, but rather only to ensure that all the party members have some voice in deciding who their party’s representative will be in the general election.”
It added the law’s goal is “to ensure that the will of all [the Republican Party] was not being truncated by an overly restrictive and potentially unrepresentative nominating process.”
Utah Republican Party Chairman Rob Anderson said the party is reviewing the decision and will meet in coming days to decide whether to appeal further. “We want to get through our caucus meetings today first,” he said — noting those meetings coincidentally came on the same day as the decision.
Don Guymon, who is among conservatives on the GOP State Central Committee who have fought to repeal SB54, said the party’s Constitutional Defense Committee will conduct a thorough review to decide what to do next.
“We still have several avenues available to the party including a review by the entire 10th Circuit or going to the Supreme Court,” he said
Other options, he said, include pushing the Legislature to repeal SB54 or doing that by passing the Keep My Voice initiative — which is seeking to qualify for the ballot. “We encourage all Republicans who want to preserve their First Amendment rights to sign the Keep My Voice initiative,” Guymon said.
Lt. Gov. Spencer Cox said he recognizes the court’s decision as current law, and as the state’s “chief elections officer, my duty is to execute the law. As a Republican, I am hopeful that this decision will put to rest the lingering issues and unrest happening within our party, allowing us to move forward together.”
Meanwhile Alex Cragun, executive director of the Utah Democratic Party, questioned what Republicans will do now with a bylaw forced through by ultraconservatives to expel candidates in some races who gather signatures. (Anderson said earlier he is ignoring it as illegal).
But Cragun said, “We can’t help but wonder if the [Utah Republican Party] will bother to enforce its own rules, or continue to demonstrate that it is a lawless, rule-less party. Either way, democracy won big today, and this November, Democrats will too.”
SB54 was a compromise negotiated by the Legislature to preserve the caucus-convention system in the face of a 2014 ballot initiative that would have scrapped it for a direct primary. The resulting law allows both the convention and signature-gathering paths to the primary ballot.
As it turns out, that dual path was a key point in the court’s decision to uphold the law.
The Republican Party had argued the signature-gathering requirements were too burdensome, especially in some legislative districts that are packed with members of one major party with few members of the other. That burden effectively interfered with the party’s right of association with potential candidates, according to the GOP.
“If the signature-gathering path stood alone, we would be inclined to agree,” judges wrote.
Of note, the new Count My Vote initiative — which may appear on the ballot this November — seeks to lower the number of signatures required by law. It would also cement into law the dual pathway to the ballot.
Taylor Morgan, executive director of Count My Vote, said, “We’re pleased the court ruled as we expected. It’s clear that Utahns strongly support the dual pathway to the ballot. That’s why we’re working to give Utahns the final say in how to choose candidates who will appear on the ballot.”
He said his group is close to completing gathering the 113,000 signatures needed to put it on the ballot. “We expect to complete our signature gathering later this month.”
The Republican Party arguments against SB54 convinced one of the three 10th Circuit judges in the case.
Chief Judge Timothy Tymkovich, in a scathing dissent, said the law “attempts to change the substance of the Republican Party under the guise of the state’s authority to regulate electoral procedure.”
He compared it to a California case where the state intentionally tried to reshape the party’s message and favor nominees with “moderate positions.”
Utah’s official reasons for imposing the hybrid nominating system “are vague and even impermissible,” Tymkovich wrote.
Describing SB54 as a “collateral attack on party rules,” he warned, “This case should caution us as to the perils of allowing states to impose procedural changes of this magnitude on unwilling political parties … by force of law.”
Tymkovich was appointed by President George W. Bush. Judge David Ebel, who wrote the opinion for the majority, was a President Ronald Reagan nominee. The third judge, Carlos Lucero, was appointed by President Bill Clinton.
Judges used part of the opinion to chide Marcus Mumford, attorney for the Republican Party, for missed deadlines and failure to comply with court orders.
“If it were to continue in future appeals we might be forced to consider taking action against Mr. Mumford,” they wrote. “He would be well-served to approach his next foray into our courthouse with a keen attention to timeliness and detail.”
The Utah Republican Party had once amassed a $410,000 debt in pursuing the case. It said earlier this year that Dave Bateman, CEO of Entrata software, had agreed to handle the debt by negotiating to lower it and cover the remaining costs. |
Newcastle Knights are interested in taking St Helens and England hooker James Roby to the NRL.
The Knights, coached by former Saints chief Nathan Brown, are keen on boosting their squad after finishing with the wooden spoon last year.
And TotalRL.com understands that Roby is high on their list of targets after another impressive season in Super League and on the international scene.
Roby’s thoughts on a move to Australia are not yet known, but one St Helens source revealed Newcastle have yet to approach them about any of their players. |
Dawid Kurminowski
Dawid Kurminowski (born 24 February 1999) is a Polish footballer who is currently signed with MŠK Žilina as a forward.
Club career
MFK Zemplín Michalovce
Kurminowski made his professional debut for Zemplín Michalovce against DAC Dunajská Streda on 24 February 2018. Kurminowski replaced Sadam Sulley in the second half, when Michalovce were one down. In stoppage time, however, Christián Herc connected to set to score to 2-0 for DAC.
References
External links
MŠK Žilina official club profile
Futbalnet profile
Fortuna Liga profile
Category:1999 births
Category:Living people
Category:Polish footballers
Category:Association football forwards
Category:Lech Poznań players
Category:MFK Zemplín Michalovce players
Category:MŠK Žilina players
Category:Slovak Super Liga players
Category:Expatriate footballers in Slovakia
Category:People from Śrem |
But you are a chosen generation, a royal priesthood, an holy nation, a peculiar people; that you should show forth the praises of him who has called you out of darkness into his marvelous light. (1 Peter 2:9 American KJV)
Accepting this as our calling, we decided to put our shoulder to the plow and not look back. We paid no attention to the circumstances or obstacles that might discourage us. As we considered Denver, a city with approximately 5,000 Brazilians living in it, this wasn't just a desire we felt, but considered it a responsibility to allow ourselves to be used as instruments in the hands of the Lord to proclaim His virtues and greatness.
When we gave birth to our New Generation Christian Community, it was born with lots of goals and purposes in our hearts. But the main one was to make our church available, not just to Brazilians, but to all people who genuinely desire to worship in the name of the Lord Jesus. We want everyone to recognize that we are a “new generation” in Christ Jesus.
We are a church associated with the Mile High Baptist Association. You can learn about what we believe in our Declaration of Faith. Our church services are a true celebration to the Lord. We sing, we honor, and we express our gratitude for everything that He has done. Our teaching of God's Word is not compromised whatsoever by any political system, personal interests, partners, or supporters. We are entirely committed to God and His Holy Word.
Even though we are associated with the Baptist Convention, like any church in the denomination, the New Generation Christian Community is an autonomous church, not subject to, or subordinate to, any specific group, family, or person. So our objective is not to raise denominational flags but to raise up the name of Christ as the head and provider of His Church. In the same way, our church wasn't created for the “Holier than thou” Christians but for everyone who recognizes a need to corporately seek the presence of God as well as to receive spiritual and pastoral assistance. As Jesus said to the Scribes and Pharisees, “It is not the healthy who need a doctor, but the sick. I have not come to call the righteous, but sinners to repentance.” (Luke 5:31-32 NIV) So, come worship the Christ without feeling judged. You are totally welcome and independently accepted by those present in our church services.
When you come to visit, let's leave our differences at the foot of the cross and feel free to worship and celebrate the victory of Christ. We believe, even if you enter unhappy, you will leave feeling joyous. If you come feeling spiritually empty, you will leave full of God and fed by his powerful Holy Word. We are waiting for your precious visit. Make this your church in Colorado. |
and it seemed like they were installed automaticaly, and when I rebooted a system popup recognized the mfc420ca by name and presented a list of other Brother printers to choose as device, but alas my printer was not there. So I tried installing all three from root with
"rpm -ihv --nodeps MFC420CNlpr-1.0.2-1.i386.rpm"
said "allready installed" went to system/printers and still not in list of printers. Tried to print from word processor -- no print.
Googled more and tried the "localhost:631" route and it seemed to install -- still no print.
Its not a USB problem, mouse and key drive work fine.
The printer is both usb and RJ-45, would a network install be easier?
Now I am at a loss as to what to do next. I need my printer so i can print flyers anouncing the date of the comming revoloution. (soon)
P.S. How the heck did Fedora geuss my username and password for my DSL service? As soon as I installed the system I did an imediate update and it connected and downloaded no questions asked. Impressive but spookey. :scratch:
Simon Bridge
05-29-2006 01:37 AM
Select the printer which looks closest to the one you've got.
I take it, it is this one: http://www.brother-usa.com/MFC/mfc_d...=MFC420CN.aspx ... I came close to getting one of these. It's really best thought of as a fax machine with addons to make it look like a printer/scanner. After looking it up I decided to avoid it.
The CUPS driver that (supposedly) works is HL-2070N
I've found the following:http://gentoo-wiki.com/Brother_MFC_420CN_Printer
... mostly gentoo specific instructions but with decent driver notes.
There's supposed to be something called: MFC420CN/CUPS or somesuch for you to use for printing, and another called MFC420CN/SANE for scanning.
seemed to be able to get his brother to work, why can't I? Booooo Hoooooo
Help, before my head gets to shiney, FunkyMonkeyPiE
Simon Bridge
05-29-2006 03:25 AM
Did you install lpd before you installed the cups wrapper?
Make sure, use rpm to remove the driver packages, then install them in the right order. It looks fussy, and if you mess up one step you're toast.
Personally, my opinion is to avoid these products from brother GPL or no. Sell it and buy a real printer. |
1971 Hong Kong municipal election
The 1971 Urban Council election was held on 3 March 1971 for the 5 of the 10 elected seats of the Urban Council of Hong Kong.
10,047 of the 37,797 eligible voters cast their votes, the turnout rate was 26.6%.
Cecilia Yeung Lai Yin of the Club won the seat onto the Urban Council, becoming the first Chinese woman ever elected on this Council.
Outcome
References
Lau, Y.W. (2002). A history of the municipal councils of Hong Kong : 1883-1999 : from the Sanitary Board to the Urban Council and the Regional Council. Leisure and Cultural Service Dept.
Pepper, Suzanne (2008). Keeping Democracy at Bay:Hong Kong and the Challenge of Chinese Political Reform. Rowman & Littlefield.
Category:1971 elections in Asia
Category:1971 in Hong Kong
Urban
Category:March 1971 events in Asia |
EL PASO, Texas (Reuters) - In one of the biggest challenges for his party in Tuesday’s elections, Beto O’Rourke hoped to oust Republican Ted Cruz and become the first Democrat elected to the U.S. Senate from the deeply conservative state of Texas in three decades.
The 46-year-old former punk rocker and three-term U.S. congressman captured the national spotlight and smashed an 18-year-old fundraising record - raising $61.8 million during his campaign, almost twice his rival’s $35.1 million - but significantly trailed Cruz in opinion polls for most of the year. Recent polls showed the race tightening, although Cruz still led.
Their paths to Senate candidacy shared a common root. O’Rourke declared his candidacy in an environment of rising liberal anger following Republican President Donald Trump’s rise to power. Cruz, 47, was first elected to the Senate in 2010 on a wave of fury in the conservative Tea Party movement over Democratic then-President Barack Obama.
The Senate seat is seen as one of Democrats’ few opportunities to pick up one of the two seats they need to gain a majority in the chamber in Tuesday’s elections. Democrats are viewed as having a good chance of taking over the U.S. House of Representatives; if the party also controlled the Senate it could further block Trump’s agenda, notably his ability to appoint more judges to lifetime positions on the Supreme Court.
O’Rourke, of El Paso, has embraced the Democratic Party’s liberal wing, supporting universal healthcare and expressing openness to calls to abolish the U.S. Immigration and Customs Enforcement Agency (ICE).
Cruz, of Houston, feuded with Trump during his unsuccessful 2016 White House run but has since embraced the president’s agenda, backing his tough immigration policies as well as his push for import tariffs aimed at lowering the U.S. trade deficit in goods. Cruz has tried to paint O’Rourke as out of step with the priorities of conservative-leaning Texans.
“There is no race in the country with a starker divide than this U.S. Senate race here in the state of Texas,” Cruz told a cheering crowd at an October campaign rally in Plano.
Slideshow ( 6 images )
O’Rourke has tried to position himself as a more independent voice, saying in a September debate he would be “a senator who will work with the president where we can and stand up to him where we must.”
“We want all of us, Republicans and Democrats, Independents alike to come together and do something great for this country. That’s what I’ve heard from the people of Texas over the last 22 months,” O’Rourke said on Tuesday after casting his vote in El Paso, Texas.
In an October debate, O’Rourke used a taunt from Trump’s presidential campaign, calling his rival “Lyin’ Ted.”
Trump, however, abandoned that nickname, calling Cruz “Beautiful Ted” at an Oct. 22 rally in Houston.
The Democrat also dared to challenge one common orthodoxy in the state, calling for reform of gun laws, including stricter background checks and a ban on assault-style rifles. Cruz criticized O’Rourke for that in a state where guns have long been part of the culture.
Alvaro Mangual, a 40-year-old pharmaceutical sales associate who lives in Houston and is originally from Puerto Rico, said he voted for O’Rourke despite being a registered Republican. He cited immigration as a key issue for this election.
Slideshow ( 6 images )
“Being an immigrant, I want things eased up,” said Mangual. “My wife is from Mexico. The ordeal her family went through with immigration was too much.”
Some political analysts have suggested that O’Rourke’s fundraising success may have drawn donations away from Democratic incumbent senators in other states.
Some 10 such incumbents are up for re-election on Tuesday in states that Trump carried in 2016, and the party can ill afford for any of them to lose if it wants a chance of gaining a Senate majority.
National attention and strong fundraising is no guarantee of success for a Texas Democrat. Former state Senator Wendy Davis leveraged her fame from an ultimately unsuccessful filibuster against a restrictive abortion law into a high-profile 2014 gubernatorial race - which she lost to Republican Greg Abbott.
Texas last elected a Democratic U.S. senator in 1988, when Lloyd Bentsen won his fourth six-year term in office. Bentsen stepped down in 1993 to become Treasury secretary under Democratic President Bill Clinton. Five months later, the Democrat appointed by then-Governor Ann Richards to succeed Bentsen was voted out in a special election. |
Main menu
Category Archives: Gifts
Each bloom has a particular importance joined to it and that is the thing that makes it that blossom, the ideal blossom for a specific month. Here is a short manual for enable you to discover all the required insights about blossoms for various months. Discover them here…
January – Carnations
Which means – Love and Fascination (all in all)
Carnation is the birthday blossom for the period of January. Distinctive shade of carnations holds diverse implications and one can display distinctive hued carnation to a January conceived individual according to the relationship.
February – violet
Which means – Faithfulness and purity
Violet is the birthday blossom for the period of February and diverse shades of violet blooms have distinctive importance. One can pick a particular shaded blossom to present to their dear ones as per the sentiments one needs to impart to the beneficiary. This blossom begins sprouting in the long stretch of February and it quits experiencing childhood in the period of April.
Walk – jonquil (daffodil or the narcissus)
Which means – Friendship and household satisfaction
Jonquil is the birthday blossom for the long stretch of March and the implying that holes up behind is that says, “You are my blessed messenger”. The blossom is accessible in hues including white, yellow and orange and is sprouts in the long stretch of May and February.
April – sweet pea
Which means – Blissful delight or farewell
Sweet pea is the birthday blossom for the long stretch of April and the implying that it holes up behind is that says to the beneficiary, “Thank you for the flawless time”. The April birth blossom is the sweet pea, which implies farewell or merry joy. The sweet pea likewise has a concealed message too which is thank you for a flawless time. These blooms are accessible in various hues.
May – Lily of the valley
Which means – Sweetness and Humility
Lily of the valley is the birthday blossom for the long stretch of May and the concealed message that it passes on to the beneficiary at the less than desirable end is, “You make my life finish”. This blossom is found in white shading.
June – Rose
Which means – Love and Beauty
Rose is the birthday blossom for the long stretch of June and the concealed message is passed on to the beneficiary according to its shading. While a Red Rose says “I Love you”, white Rose stands for, “I am commendable for you”, and also extraordinary roses have diverse significance related with it.
July – larkspur
Which means An Ardent and kind connection
Larkspur is the birthday blossom for the long stretch of July and this bloom is accessible in various hues. The message that it passes on to the beneficiary is as per the shade of the bloom.
August – Gladiolus
Which means – Strong character and earnestness
Gladiolus is the birthday blossom for the long stretch of August and the shrouded importance related with it is “Unexplainable adoration”. The different hues in which these blooms are accessible incorporate Pink, Red, White, Yellow and Orange.
September – Aster
Which means – Wisdom, Love and Faith
Aster is the birthday bloom for the long stretch of September and it exhibits the concealed message that, “Deal with you for me”. The blossom is accessible in various hues that `include Pink, White, Red, Lilac and Mauve.
October – Marigold
Which means – Sympathy and distress
The birthday blossom for the long stretch of October and the message that it subtly passes on to the beneficiary is that, “My considerations are dependably with you”. Marigold blooms are for the most part accessible in two hues, orange and yellow.
November – chrysanthemum
Which means – Cheerfulness and Love
The birthday blossom for the long stretch of November is chrysanthemum and the message that it subtly pass on is “You are a great Friend”. The bloom is accessible in various hues that incorporate yellow, pink, Red, orange, white and Mauve.
December – Narcissus
Which means – Faithfulness, Modesty and regard
Birthday blooms for the period of December are Narcissus and the shrouded message for is, “You are the just a single”. It is accessible in various hues that incorporate yellow, orange and white.
Along these lines, these are the birthday blossom thoughts as indicated by the period of birth. Individuals can blessing blossom as indicated by the month and pass on that extraordinary sentiments of the heart. |
Michelle Lukes
Michelle Lukes is a British actress from London. She trained at the prestigious Bristol Old Vic Theatre School and graduated winning the Newton Blick Award for versatility. Lukes is best known for playing series regular Sgt Julia Richmond in the Cinemax show Strike Back, Lisa Torres in the BBC drama Doctors and Kelly - 087 in Halo 5: Guardians and The Fall of Reach for Netflix. In 2017 Lukes won the Maverick Award at the Action on Film International Film Festival for her contribution to television. Alongside her numerous other film and television appearances, Lukes has taken on stage roles for the Royal National Theatre, Royal Shakespeare Company and the Bristol Old Vic. Michelle is also an accomplished singer, dancer and musician and spent several years in London's West End Theatre performing leading roles in musicals such as Chicago (musical), Cats (musical), Disney's The Lion King (musical), Starlight Express, Fosse and Joseph and the Amazing Technicolor Dreamcoat. In 2004 she was hand-picked to be the on-set Dance Supervisor for Oliver Stone's Alexander, in which she also appeared.
Selected Works
Television
Film
Videogames
Theatre
Awards
In 2017 Michelle Lukes was awarded The Maverick Award at the Action on Film International Film Festival for her work on Strike Back.
References
External links
Category:Living people
Category:English stage actresses
Category:English television actresses
Category:English voice actresses
Category:1984 births |
As far as we know, all cultures from the remotest past to the present believed in a life hereafter. In the last century and a half, however, whether individual identity survives the body has come under debate in the West. Before World War II, proving survival occupied some of the most prominent people of its day, including the English Prime Minister, Arthur Balfour, and several Nobel-Prize winning physicists. Since then, the respectability of this research, the respectability of exploring an issue that weighs on us all, has plummeted dramatically.
Nonetheless, the evidence for survival is mounting daily. Here I can only give you a short summary of what I cover in my book, The Last Frontier. Although the evidence may not yet constitute solid proof according to the standards set by science, the sheer amount of it, the variety of sources, the inner consistency would overwhelmingly stand up in any courtroom, as Victor Zammit, author of A Lawyer Presents the Case for the Afterlife, has pointed out.
As you probably already know, everything that seems to us to be matter is, in fact, almost entirely energy in the form of forces and oscillations. That means there’s not much difference from us and the energy bodies of our discarnate loved ones. We can and do communicate without the use of the physical brain, from one consciousness to another directly by telepathy. For that matter, a few neurobiologists are beginning to admit that the mind, the seat of consciousness, is independent from the brain. This has been demonstrated over and over in clinical experiments on telepathy, precognition and remote viewing, all of which occur outside the brain’s immediate domain. Quantum biology is now looking at highly efficient intelligence in organisms that lack both brains and nervous systems.
Near Death Experience studies have shown definitively that the mind, all that we hold as our identity, can and does operate when separated from the body. There are many documented cases in which people who are clinically dead, whose EEGs and EKGs have flat lined, continue to perceive and think while outside their own bodies. What they see and hear going on in operating rooms, on hospital rooftops and in waiting rooms has been confirmed by attending medical personnel. Yet most physicians involved in this research will still hedge the medically impossible by proposing that the brain is not really dead but continues to function at a level too low to track. What they fail to take into account is that during these experiences the congenitally blind can suddenly see for the first time in their lives and they see, like the normally sighted, with a supernormal accuracy. (For more, see Mindsight: Near-Death and Out-of-Body Experiences in the Blind, by Kenneth Ring and Sharon Cooper.) So far, no one has argued that their visual function was in dormancy only to come awake for those moments or hours out of the body. That a person can see without eyes, perceive without a brain and move around without a body is of enormous significance to the survival issue.
Another avenue for settling the question is reincarnation. The past-life accounts meticulously investigated by Dr. Ian Stevenson, founder of the Division of Perceptual Studies in the Department of Psychiatric Medicine at the University of Virginia, combined with past-life memories furnished by regression therapists represent many thousands of instances in which recall of an earlier life is lucid and demonstrably accurate. Most startling are the many incidences of xenoglossy, in which people spontaneously speak in a foreign language not known to them in their present lives.
The best source for survival research is obviously the dead themselves. Since the beginning of recorded history, individuals with developed mediumistic abilities have served as their spokespeople. Experiments with mediums performed under brutally controlled conditions before and during World War II yielded mind-bending results. Today, Gary Schwartz is successfully continuing that work at the University of Arizona.
As author Dianne Arcangel tells us, surveys estimate that up to 72% of today’s American population has had spontaneous encounters, primarily with deceased relatives. More testimony is collected daily from people who have no previous inclination toward the mystical. Nor are they misfits or dreamers, or prone to hallucinating. Instead they are people who effectively and responsibly operate in the “real world.” Spontaneous encounters are neither expected nor longed for. Nor do they bear the characteristics associated with hallucinations or wish-fulfillment fantasies. What happens during an encounter often takes a person by surprise. And in many cases, the living were not even aware that the appearing deceased had passed. Because of these encounters, lives have been saved, crimes forestalled, lost objects found and futures foretold.
All in all, there is an enormous body of evidence for survival after death. You can read about the problems and possibilities of scientific proof in this website by clicking here on: “Can Science Prove Life After Death?”
If you have already had communication or any other experience with the departed not mediated by a professional, I want to hear about it. I look forward to reading your stories or comments and answering any questions you might have.
Thank you for your amazing and inspiring website. I looked at a couple of sites, and was drawn to yours immediately because of your lovely writing style, your sincerity, intelligence and academic background.
After being an agnostic for many years, and now facing a life crisis in the family, I decided to take a serious look to see if perhaps there is more to existence after all. I want so much to believe in the Afterlife! I felt uplifted and happy these past couple of weeks, reading your blogs and articles. Today I thought to look at the link you gave to Gary Schwartz’s exciting research, which I’ve heard praised elsewhere as great proof too. I read the Wikipedia link and followed the link from there which deals with some controversy about how his experiments were conducted. The article explains in depth why his experiments were flawed in so many ways: http://www.csicop.org/si/show/how_not_to_test_mediums_critiquing_the_afterlife_experiments//
If you read it, you’ll see why other academics were unable to accept Prof. Schwartz’s findings. I must say, I can’t blame them. Poorly conducted experiments sadly take away from the credibility of the whole Afterlife research field. I’m thinking that you didn’t know about this issue with the experiments, as you probably wouldn’t have included the link about Gary Schwartz, but maybe instead have used someone else’s work as an example of proof.
I sincerely hope that you don’t think I’m disrespectful or arrogant. It’s just that I get doubtful and disheartened when wonderful proof turns out to be false hope. I’m scared to delve too deeply into checking any more facts, in case they too turn out to be flawed….
I believe that you are sincere in all you do and am looking forward to reading your book soon.
Veroni, we just friended each other and here you are! In The Last Frontier, I work through the whole issue of proof versus evidence and what constitutes real proof. Very little, I’m afraid. The reason is, however, the lack of research funding and support, nothing else. You should read Dean Radon’s books that explain what psi-researchers are up against, the biases, the expectations and requirements that no other field has to meet. I think I posted an interview with him in which he briefly discusses the problems psi-researchers have to deal with. Even when there is proof, statistically, it is still not accepted.
I’m just curious, you said in one of your blogs that scientists conducted experiments to test the science behind NDE’s and all patients had a positive outcome. However, I heard of many cases where people have had hellish NDE’s – how do you explain that?
Zoe, I don’t know where you read that. If I did write that somewhere, I was referring to a specific test group. I am quite aware that there are hellish NDEs and uncomfortable ones. Furthermore, the profile of the ideal NDE: the tunnel, the being of light, etc., fits very few NDEs, especially cross-culturally. I’m glad you brought this up. The mainstream literature on NDEs too often promotes a very distorted, never analyzed and way too idyllic view of NDEs in general.
I myself have experienced after death communications after the passing of my mother which are olfactory and auditory in nature. The olfactory one was the strong scent of Jasmine which was particularly more citrusy and fresh-smelling than real Jasmine flowers which I experienced in her bedroom 10 days after her passing. After that, I did some research and found out that Dr Anderson, the author for Appointments with Heaven, also had experienced such fragrance throughout his career and life which confirms that such experience is universal irrespective of geographical location or race. For the auditory ones, I have so far heard my mother calling me 7 times already since her passing in December 2013 and it always occurred in the morning at about 10 which woke me up and I could still remember that I was dreaming of something else and not about my mother prior to being awoken by her voice calling me externally into my left ear which seemed to be younger-sounding but without a shadow of a doubt, was definitely hers. I would like to do further research into this at the University of Michigan which offers Metaphysics as such phenomenon has entered into mainstream scientific research. But above all, it is one that I would like to find out for myself if I could truly voluntarily communicate with my mother by myself and the true “spiritual” methodology” for it instead of just leaving it to chance and hoping for it!
Thank you for posting your interesting experiences. Why don’t you look at the bottom of my homepage which features a how-to model for after death communication. There are many ways to approach communicating. The one just mentioned is for personal use between two deeply related people. Others are more professional, such as some that I use regularly in my work. I have had great success is teaching people how to make contact namely because it is natural to us. Good luck. Let me know what happens.
Adrian, that’s a provocative question! You might also ask why are other NDEs so positive! What is remarkable is that whether positive or negative, NDEs seem to have the same effects on people. I don’t think there is one answer to your question. My general take is that NDEs tend to work with deep unconscious material, in the same way as after-death experiences do. There is too a strong relationship between NDEs and Out-of-Body Experiences. Although NDEers claim they are different, I don’t really see that if you read enough of the literature on both. So, given that relationship, OOBEers are rarely able to control where they are going. Frequently they land in “negative” realities, just as we do in dreams. If they are trained, all they do is say “next level” and they are out. If more was known about NDEs, people in negative ones could probably have enough awareness to get them selves out. As it is, we believe that NDEs are something that happen to us, outside of our control. That is not at all the case. In fact, they are highly determined by cultural and personal beliefs. |
Our Services
Our Services
Setting Out Services
The Engineers at Baypoint Surveys have been involved in wide range of small and large scale setting out projects over the last 20 years. This wealth of experience means you can be guaranteed the best quality service at the most competitive prices. Using the latest Trimble S6 robotic total stations our engineers can set out large amounts of data quickly and efficiently. All setting out is carried out in line with our rigorous QA procedure and any positions outside the design tolerance are conveyed to the client prior to construction. All work is covered by our professional indemnity insurance up to a value of £1,000,000, but with our meticulous QA procedure we have never needed to use it.
Setting Out Services
The Engineers at Baypoint Surveys have been involved in wide range of small and large scale setting out projects over the last 20 years. This wealth of experience means you can be guaranteed the best quality service at the most competitive prices. Using the latest Trimble S6 robotic total stations our engineers can set out large amounts of data quickly and efficiently. All setting out is carried out in line with our rigorous QA procedure and any positions outside the design tolerance are conveyed to the client prior to construction. All work is covered by our professional indemnity insurance up to a value of £1,000,000, but with our meticulous QA procedure we have never needed to use it. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.