text
stringlengths
8
5.77M
Q: Multibinding in Silverlight using VB.Net I am trying to implement multibinding in Silverlight using VB.Net. I have found a very good reference for an implementation in C# here. I spent some time trying to use various converters to migrate it into VB.Net but I still didn't get it working properly. So.. I'm looking for some references that exemplify how MultiBinding can be done in VB.Net. Also an example using Silverlight 5 beta would be fine (I read in a post right here on Stack Overflow that it supports multibinding). A: I've translated that sample into VB.NET for Silverlight, which can be downloaded from here. For posterity, the code is listed below. Keep in mind that both are still under any license terms specified by the original author. Core Code BindingUtil.vb Imports System.Collections.Generic Imports System.Net Imports System.Windows Imports System.Windows.Controls Imports System.Windows.Documents Imports System.Windows.Ink Imports System.Windows.Input Imports System.Windows.Media Imports System.Windows.Media.Animation Imports System.Windows.Shapes Imports System.Windows.Data Imports System.ComponentModel Namespace SLMultiBinding ''' <summary> ''' Provides a mechanism for attaching a MultiBinding to an element ''' </summary> Public Class BindingUtil #Region "DataContextPiggyBack attached property" ''' <summary> ''' DataContextPiggyBack Attached Dependency Property, used as a mechanism for exposing ''' DataContext changed events ''' </summary> Public Shared ReadOnly DataContextPiggyBackProperty As DependencyProperty = DependencyProperty.RegisterAttached("DataContextPiggyBack", GetType(Object), GetType(BindingUtil), New PropertyMetadata(Nothing, New PropertyChangedCallback(AddressOf OnDataContextPiggyBackChanged))) Public Shared Function GetDataContextPiggyBack(d As DependencyObject) As Object Return DirectCast(d.GetValue(DataContextPiggyBackProperty), Object) End Function Public Shared Sub SetDataContextPiggyBack(d As DependencyObject, value As Object) d.SetValue(DataContextPiggyBackProperty, value) End Sub ''' <summary> ''' Handles changes to the DataContextPiggyBack property. ''' </summary> Private Shared Sub OnDataContextPiggyBackChanged(d As DependencyObject, e As DependencyPropertyChangedEventArgs) Dim targetElement As FrameworkElement = TryCast(d, FrameworkElement) ' whenever the targeElement DataContext is changed, copy the updated property ' value to our MultiBinding. Dim relay As MultiBindings = GetMultiBindings(targetElement) relay.SetDataContext(targetElement.DataContext) End Sub #End Region #Region "MultiBindings attached property" Public Shared Function GetMultiBindings(obj As DependencyObject) As MultiBindings Return DirectCast(obj.GetValue(MultiBindingsProperty), MultiBindings) End Function Public Shared Sub SetMultiBindings(obj As DependencyObject, value As MultiBindings) obj.SetValue(MultiBindingsProperty, value) End Sub Public Shared ReadOnly MultiBindingsProperty As DependencyProperty = DependencyProperty.RegisterAttached("MultiBindings", GetType(MultiBindings), GetType(BindingUtil), New PropertyMetadata(Nothing, AddressOf OnMultiBindingsChanged)) ''' <summary> ''' Invoked when the MultiBinding property is set on a framework element ''' </summary> Private Shared Sub OnMultiBindingsChanged(depObj As DependencyObject, e As DependencyPropertyChangedEventArgs) Dim targetElement As FrameworkElement = TryCast(depObj, FrameworkElement) ' bind the target elements DataContext, to our DataContextPiggyBack property ' this allows us to get property changed events when the targetElement ' DataContext changes targetElement.SetBinding(DataContextPiggyBackProperty, New Binding()) Dim bindings As MultiBindings = GetMultiBindings(targetElement) bindings.Initialize(targetElement) End Sub #End Region End Class End Namespace IMultiValueConverter.vb Imports System.Net Imports System.Windows Imports System.Windows.Controls Imports System.Windows.Documents Imports System.Windows.Ink Imports System.Windows.Input Imports System.Windows.Media Imports System.Windows.Media.Animation Imports System.Windows.Shapes Imports System.Globalization Namespace SLMultiBinding ''' <summary> ''' see: http://msdn.microsoft.com/en-us/library/system.windows.data.imultivalueconverter.aspx ''' </summary> Public Interface IMultiValueConverter Function Convert(values As Object(), targetType As Type, parameter As Object, culture As CultureInfo) As Object Function ConvertBack(value As Object, targetTypes As Type(), parameter As Object, culture As CultureInfo) As Object() End Interface End Namespace MultiBinding.vb Imports System.Diagnostics Imports System.Windows Imports System.Windows.Controls Imports System.Windows.Data Imports System.Collections.ObjectModel Imports System.Windows.Markup Imports System.ComponentModel Imports System.Collections.Generic Imports System.Globalization Namespace SLMultiBinding ''' <summary> ''' Implements MultiBinding by creating a BindingSlave instance for each of the Bindings. ''' PropertyChanged events for the BindingSlae.Value property are handled, and the IMultiValueConveter ''' is used to compute the converted value. ''' </summary> <ContentProperty("Bindings")> _ Public Class MultiBinding Inherits Panel Implements INotifyPropertyChanged ''' <summary> ''' Indicates whether the converted value property is currently being updated ''' as a result of one of the BindingSlave.Value properties changing ''' </summary> Private _updatingConvertedValue As Boolean #Region "ConvertedValue dependency property" Public Shared ReadOnly ConvertedValueProperty As DependencyProperty = DependencyProperty.Register("ConvertedValue", GetType(Object), GetType(MultiBinding), New PropertyMetadata(Nothing, AddressOf OnConvertedValuePropertyChanged)) ''' <summary> ''' This dependency property is set to the resulting output of the ''' associated Converter. ''' </summary> Public Property ConvertedValue() As Object Get Return GetValue(ConvertedValueProperty) End Get Set(value As Object) SetValue(ConvertedValueProperty, value) End Set End Property Private Shared Sub OnConvertedValuePropertyChanged(depObj As DependencyObject, e As DependencyPropertyChangedEventArgs) Dim relay As MultiBinding = TryCast(depObj, MultiBinding) Debug.Assert(relay IsNot Nothing) relay.OnConvertedValuePropertyChanged() End Sub ''' <summary> ''' Handles propety changes for the ConvertedValue property ''' </summary> Private Sub OnConvertedValuePropertyChanged() OnPropertyChanged("ConvertedValue") ' if the value is being updated, but not due to one of the multibindings ' then the target property has changed. If Not _updatingConvertedValue Then ' convert back Dim convertedValues As Object() = Converter.ConvertBack(ConvertedValue, Nothing, ConverterParameter, CultureInfo.InvariantCulture) ' update all the binding slaves If Children.Count = convertedValues.Length Then For index As Integer = 0 To convertedValues.Length - 1 DirectCast(Children(index), BindingSlave).Value = convertedValues(index) Next End If End If End Sub #End Region #Region "CLR properties" ''' <summary> ''' The BindingMode ''' </summary> Public Property Mode() As BindingMode Get Return m_Mode End Get Set(value As BindingMode) m_Mode = value End Set End Property Private m_Mode As BindingMode ''' <summary> ''' The target property on the element which this MultiBinding is assocaited with. ''' </summary> Public Property TargetProperty() As String Get Return m_TargetProperty End Get Set(value As String) m_TargetProperty = value End Set End Property Private m_TargetProperty As String ''' <summary> ''' The Converter which is invoked to compute the result of the multiple bindings ''' </summary> Public Property Converter() As IMultiValueConverter Get Return m_Converter End Get Set(value As IMultiValueConverter) m_Converter = value End Set End Property Private m_Converter As IMultiValueConverter ''' <summary> ''' The configuration parameter supplied to the converter ''' </summary> Public Property ConverterParameter() As Object Get Return m_ConverterParameter End Get Set(value As Object) m_ConverterParameter = value End Set End Property Private m_ConverterParameter As Object ''' <summary> ''' The bindings, the result of which are supplied to the converter. ''' </summary> Public Property Bindings() As BindingCollection Get Return m_Bindings End Get Set(value As BindingCollection) m_Bindings = value End Set End Property Private m_Bindings As BindingCollection #End Region Public Sub New() Bindings = New BindingCollection() End Sub ''' <summary> ''' Invoked when any of the BindingSlave's Value property changes. ''' </summary> Private Sub SlavePropertyChanged(sender As Object, e As PropertyChangedEventArgs) UpdateConvertedValue() End Sub ''' <summary> ''' Uses the Converter to update the ConvertedValue in order to reflect ''' the current state of the bindings. ''' </summary> Private Sub UpdateConvertedValue() Dim values As New List(Of Object)() For Each slave As BindingSlave In Children values.Add(slave.Value) Next _updatingConvertedValue = True ConvertedValue = Converter.Convert(values.ToArray(), GetType(Object), ConverterParameter, CultureInfo.CurrentCulture) _updatingConvertedValue = False End Sub ''' <summary> ''' Creates a BindingSlave for each Binding and binds the Value ''' accordingly. ''' </summary> Friend Sub Initialise(targetElement As FrameworkElement) Children.Clear() For Each binding As Binding In Bindings Dim slave As BindingSlave ' create a binding slave instance If Not String.IsNullOrEmpty(binding.ElementName) Then ' create an element name binding slave, this slave will resolve the ' binding source reference and construct a suitable binding. slave = New ElementNameBindingSlave(targetElement, binding) Else slave = New BindingSlave() slave.SetBinding(BindingSlave.ValueProperty, binding) End If AddHandler slave.PropertyChanged, AddressOf SlavePropertyChanged Children.Add(slave) Next End Sub #Region "INotifyPropertyChanged Members" Public Event PropertyChanged As PropertyChangedEventHandler Implements INotifyPropertyChanged.PropertyChanged Protected Sub OnPropertyChanged(name As String) RaiseEvent PropertyChanged(Me, New PropertyChangedEventArgs(name)) End Sub #End Region End Class ''' <summary> ''' A simple element with a single Value property, used as a 'slave' ''' for a Binding. ''' </summary> Public Class BindingSlave Inherits FrameworkElement Implements INotifyPropertyChanged #Region "Value" Public Shared ReadOnly ValueProperty As DependencyProperty = DependencyProperty.Register("Value", GetType(Object), GetType(BindingSlave), New PropertyMetadata(Nothing, AddressOf OnValueChanged)) Public Property Value() As Object Get Return GetValue(ValueProperty) End Get Set(value As Object) SetValue(ValueProperty, value) End Set End Property Private Shared Sub OnValueChanged(depObj As DependencyObject, e As DependencyPropertyChangedEventArgs) Dim slave As BindingSlave = TryCast(depObj, BindingSlave) Debug.Assert(slave IsNot Nothing) slave.OnPropertyChanged("Value") End Sub #End Region #Region "INotifyPropertyChanged Members" Public Event PropertyChanged As PropertyChangedEventHandler Implements INotifyPropertyChanged.PropertyChanged Protected Sub OnPropertyChanged(name As String) RaiseEvent PropertyChanged(Me, New PropertyChangedEventArgs(name)) End Sub #End Region End Class ''' <summary> ''' A binding slave that performs 'ElementName' binding. ''' </summary> Public Class ElementNameBindingSlave Inherits BindingSlave Private _multiBindingTarget As FrameworkElement ''' <summary> ''' The source element named in the ElementName binding ''' </summary> Private _elementNameSource As FrameworkElement Private _binding As Binding Public Sub New(target As FrameworkElement, binding As Binding) _multiBindingTarget = target _binding = binding ' try to locate the named element ResolveElementNameBinding() AddHandler _multiBindingTarget.LayoutUpdated, AddressOf MultiBindingTarget_LayoutUpdated End Sub ''' <summary> ''' Try to locate the named element. If the element can be located, create the required ''' binding. ''' </summary> Private Sub ResolveElementNameBinding() _elementNameSource = TryCast(_multiBindingTarget.FindName(_binding.ElementName), FrameworkElement) If _elementNameSource IsNot Nothing Then SetBinding(BindingSlave.ValueProperty, New Binding() With { _ .Source = _elementNameSource, _ .Path = _binding.Path, _ .Converter = _binding.Converter, _ .ConverterParameter = _binding.ConverterParameter _ }) End If End Sub Private Sub MultiBindingTarget_LayoutUpdated(sender As Object, e As EventArgs) ' try to locate the named element ResolveElementNameBinding() End Sub End Class Friend Delegate Sub BindingCollectionChangedCallback() Public Class BindingCollection Inherits Collection(Of BindingBase) ' Fields ' TODO: Private ReadOnly _collectionChangedCallback As BindingCollectionChangedCallback Protected Overrides Sub ClearItems() MyBase.ClearItems() OnBindingCollectionChanged() End Sub Protected Overrides Sub InsertItem(index As Integer, item As BindingBase) If item Is Nothing Then Throw New ArgumentNullException("item") End If ValidateItem(item) MyBase.InsertItem(index, item) OnBindingCollectionChanged() End Sub Private Sub OnBindingCollectionChanged() ' TODO: RaiseEvent _collectionChangedCallback() End Sub Protected Overrides Sub RemoveItem(index As Integer) MyBase.RemoveItem(index) OnBindingCollectionChanged() End Sub Protected Overrides Sub SetItem(index As Integer, item As BindingBase) If item Is Nothing Then Throw New ArgumentNullException("item") End If ValidateItem(item) MyBase.SetItem(index, item) OnBindingCollectionChanged() End Sub Private Shared Sub ValidateItem(binding As BindingBase) If Not (TypeOf binding Is Binding) Then Throw New NotSupportedException("BindingCollectionContainsNonBinding") End If End Sub End Class End Namespace MultiBindings.vb Imports System.Collections.ObjectModel Imports System.Linq Imports System.Reflection Imports System.Windows Imports System.Windows.Data Imports System.Windows.Markup Namespace SLMultiBinding ''' <summary> ''' Manages the construction of multiple MultiBinding instances ''' </summary> <ContentProperty("Bindings")> _ Public Class MultiBindings Inherits FrameworkElement Private _targetElement As FrameworkElement ''' <summary> ''' Gets / sets the collection of MultiBindings ''' </summary> Public Property Bindings() As ObservableCollection(Of MultiBinding) Get Return m_Bindings End Get Set(value As ObservableCollection(Of MultiBinding)) m_Bindings = Value End Set End Property Private m_Bindings As ObservableCollection(Of MultiBinding) Public Sub New() Bindings = New ObservableCollection(Of MultiBinding)() End Sub ''' <summary> ''' Sets the DataContext of each of the MultiBinding instances ''' </summary> Public Sub SetDataContext(dataContext As Object) For Each relay As MultiBinding In Bindings relay.DataContext = dataContext Next End Sub ''' <summary> ''' Initialises each of the MultiBindings, and binds their ConvertedValue ''' to the given target property. ''' </summary> Public Sub Initialize(targetElement As FrameworkElement) _targetElement = targetElement Const DpFlags As BindingFlags = BindingFlags.[Public] Or BindingFlags.[Static] Or BindingFlags.FlattenHierarchy For Each relay As MultiBinding In Bindings relay.Initialise(targetElement) ' find the target dependency property Dim targetType As Type = Nothing Dim targetProperty As String = Nothing ' assume it is an attached property if the dot syntax is used. If relay.TargetProperty.Contains(".") Then ' split to find the type and property name Dim parts As String() = relay.TargetProperty.Split("."c) targetType = Type.[GetType]("System.Windows.Controls." & parts(0) & ", System.Windows, Version=2.0.5.0, Culture=neutral, PublicKeyToken=7cec85d7bea7798e") targetProperty = parts(1) Else targetType = targetElement.[GetType]() targetProperty = relay.TargetProperty End If Dim sourceFields As FieldInfo() = targetType.GetFields(DpFlags) Dim targetDependencyPropertyField As FieldInfo = sourceFields.First(Function(i) i.Name = targetProperty & "Property") Dim targetDependencyProperty As DependencyProperty = TryCast(targetDependencyPropertyField.GetValue(Nothing), DependencyProperty) ' bind the ConvertedValue of our MultiBinding instance to the target property ' of our targetElement Dim binding As New Binding("ConvertedValue") With { _ .Source = relay, _ .Mode = relay.Mode _ } targetElement.SetBinding(targetDependencyProperty, Binding) Next End Sub End Class End Namespace Sample TitleConverter.vb Imports System.Net Imports System.Windows Imports System.Windows.Controls Imports System.Windows.Data Imports System.Windows.Documents Imports System.Windows.Ink Imports System.Windows.Input Imports System.Windows.Media Imports System.Windows.Media.Animation Imports System.Windows.Shapes Namespace SLMultiBinding Public Class TitleConverter Implements IMultiValueConverter #Region "IMultiValueConverter Members" Public Function Convert(values As Object(), targetType As Type, parameter As Object, culture As System.Globalization.CultureInfo) As Object Implements IMultiValueConverter.Convert Dim forename As String = TryCast(values(0), String) Dim surname As String = TryCast(values(1), String) Return String.Format("{0}, {1}", surname, forename) End Function Public Function ConvertBack(value As Object, targetTypes As Type(), parameter As Object, culture As System.Globalization.CultureInfo) As Object() Implements IMultiValueConverter.ConvertBack Dim source As String = TryCast(value, String) Dim pos = source.IndexOf(", ") Dim forename As String = source.Substring(pos + 2) Dim surname As String = source.Substring(0, pos) Return New Object() {forename, surname} End Function #End Region End Class End Namespace
79 U.S. 379 (____) 12 Wall. 379 KNOX v. EXCHANGE BANK. Supreme Court of United States. *380 Mr. Claughton, for the defendant in error. *382 Mr. Justice MILLER delivered the opinion of the court. In the case of Herndon v. Howard, it was decided that the proper course when a party to a writ of error had been declared bankrupt and an assignee duly appointed, was for the assignee in bankruptcy to make application to reinstate it and to be substituted for the bankrupt as plaintiff in error. The application, here, being made during the term, while the matter is still within our control, we see no objection to the substitution asked for, if the case is one which ought to be reinstated. The motion on which the writ of error was dismissed last spring was based on the allegation that no question is found in the record which would give this court jurisdiction to review the judgment of the State court. As it would be useless to set aside the order of dismissal merely to try that question again, on which the parties were fully heard, we must now inquire if that objection is well taken. It is now argued by the plaintiff in error that the original provision in the charter of the bank making its notes receivable for debts due to it was a contract; and that the obligation of that contract has been impaired. We have decided in the case of Furman v. Nichol, that such a law does constitute a contract, which attaches to the notes in the bands of any one to whom they may come, and we agree that if the *383 trustee of the bank is to be considered as occupying, for the purposes of this suit, the place of the bank, that the judgment of the Court of Appeals was erroneous. But we are not authorized by the Judiciary Act to review the judgments of the State courts, because their judgments refuse to give effect to valid contracts, or because those judgments, in their effect, impair the obligation of contracts. If we did, every case decided in a State court could be brought here, when the party setting up a contract alleged that the court had taken a different view of its obligation to that which he held. As this court said in Railroad Company v. Rock,[*] it must be the constitution, or statute, of the State which impairs the obligation of a contract, or the case does not come within our jurisdiction. What statute of Virginia is supposed to affect unfavorably the contract under which these notes were issued? It is rather insinuated than fully declared, that the court gave such effect to the act of February, 1866, under which the bank made its assignment. But nothing in the record shows that the court based its judgment on any such proposition. Nor is there anything in that statute which by any possibility can be said to impair the force given to those notes by the charter of the bank. The latter statute merely authorized, in general terms, the insolvent banks to make assignments of all their effects for the benefit of all their creditors. This is a right which they probably had before. But whether they did or not the statute contains no expression from which the intent to affect the value of the notes of the bank as payment for its debts can be inferred. In the case of Nichol v. Furman the State of Tennessee passed a law by which the notes of the bank receivable by its charter for taxes were no longer to be so received; and this court held that this latter statute impaired the obligation of the contract found in the charter. But there it was the statute which worked the injury and it was the judgment of *384 the State court holding the statute valid which gave this court jurisdiction. So in the case of Bridge Proprietors v. Hoboken Company. The legislature of New Jersey had passed a law authorizing the company to erect a railroad bridge at a certain point where the complainants alleged that they had an exclusive privilege for bridging the stream under a statute passed many years before. If the first statute gave this exclusive right it was clear that the second statute impaired that right, and so impaired the obligation of the contract. This we held to be a proper subject of inquiry by this court. But in the present case there can be no pretence that the statute which authorized the assignment by the bank impaired the obligation of the contract to receive its notes for its debts, nor does the right or claim of the trustee to refuse the notes in payment rest on this statute, or on any construction given to it by the court. We are of opinion that nothing in the record before us shows jurisdiction in this court, and the motion to reinstate is, for this reason, OVERRULED. NOTE. At the same time with the preceding case was adjudged another, in which the principle established by the first case is illustrated in somewhat different circumstances. It was the case of NOTES [*] 4 Wallace, 181; see also Railroad Company v. McClure, 10 Wallace, 511.
[Rapidly progressing forms of pulmonary tuberculosis in adolescents]. Examination of 23 adolescents with rapidly progressive pulmonary tuberculosis (RPPT) discovered severe bilateral lesions in 47.8%, caverns in 91.3%, M. tuberculosis in 86.9% of the examinees. 75% of the adolescents were resistant to antituberculous treatment. RPPT in adolescents is represented mainly by infiltration pulmonary tuberculosis (78.3%), caseous pneumonia and disseminated pulmonary tuberculosis (21.7%). RPPT develops because of late diagnosis and infection with drug-resistant M. tuberculosis.
Rage 2 is perhaps the biggest game Avalanche Studios is working on right now. Developed in collaboration with id Software, this post-apocalyptic open world sequel adds a lot of new features, such as the Nanotrite powers. In an interview published on GamesTM (issue 206), the developers described this addition as instrumental to deliver a 'Wasteland Superhero' experience. Just Cause 4 Packs More Than Four Times the Scope and ‘Far Deeper’ Mechanics Than Predecessors Loke Wallmo (Senior Game Designer at Avalanche): We’ve played around with this idea quite a bit. I think the Nanotrite powers in particular give the player increased dynamics, increased movement and a way to fight without the weapons. You will do the majority of your fighting with weapons, of course. But the Nanotrite powers add a lot to the mix; they help improve crowd control, movement, physicality and playfulness. It took us a long while to get that right, but I think – as you’ve seen today after playing it, hopefully – that you’ll feel like they really work very well together. Tim Willits (Studio Director at id): It’s all about getting you into the action a little bit faster. Because Rage 2 has such a big open world you can approach combat situations from anywhere and in any way that you want to. For example, we reward you for using abilities – it charges your Overdrive, you get different drops – it’s one of the many ways we get you into the action and keep you there. On the visuals front, ever since the marketing campaign began fans noticed that it was much more colorful than the first game. Here's what the developers said about that. Tim Willits (Studio Director at id): A lot of that actually came from, first, the desire to push it far from Rage. And then looking at what the Apex technology could do for us with the jungles and the forests and the swamps and the overgrown cities. And that brought to us light and colour with the vegetation. That led us to have more colourful characters, and people have evolved and let us have more colourful buildings and skies. And now we have a marketing campaign. So it’s really helped establish a unique identity in this world that’s sometimes crowded with brown games. Loke Wallmo (Senior Game Designer at Avalanche): You can’t just add colour to anything. So it’s a part of the identity of Rage, as well. It’s supposed to be fun, crazy, over-the-top, so it works really well with what we’re trying to do with the gameplay, with the characters, with the factions. It made a lot of sense to make everything as colourful as we could. Lastly, Avalanche is well known for its expertise in crafting satisfying vehicles to drive and fight with (Mad Max in particular comes to mind), but Rage 2 won't focus too much on those. Loke Wallmo (Senior Game Designer at Avalanche): It is different in the sense that the gameplay is focusing on more guns on the vehicles, more explosions and gadgets and more over-the-top stuff like that. So it does create a different starting point for where you want to go with the vehicles. But we’re not really focusing on the vehicles that much. You will have one major combat vehicle that is engineered for fighting out in the wasteland, but you can drive anything with wheels. And some other stuff, as well. It’s definitely up to you how you want to approach getting around the world and what you wanna do. And those main vehicles that you have are upgradable, you can customise the weapons and loadouts a bit. Rage 2 is due Spring 2019 on PC, PlayStation 4 and Xbox One. While you wait, be sure to check out the Gamescom 2018 hands-on preview posted by Chris in early September.
NEW DELHI: The postmortem of 6 bodies in the mysterious death case of 11 members of a family in Burari in Delhi has revealed that they died due to hanging. As per the police sources, 'ligature hanging' has been cited as the reason behind the deaths. It also states that no signs of struggle were found. Meanwhile, the family members have given their consent to donate the eyes of the deceased. "The first thing we did was to donate their eyes that could provide eyesight to 22 people, considering the family was religious and always wanted to help others. We gave the approval letter yesterday," Navneet Batra, friend of the family said. Eleven members of a family were found dead under mysterious circumstances in Burari area in Delhi on Sunday. The family of the deceased have demanded an investigation by the Central Bureau of Investigation (CBI). While the Delhi Police has hinted at the possibility of some spiritual or mystical practice by those who were found dead, the family has denied any possibility of suicide. Following the initial investigation into the case, the police said, “during the search of the house, certain hand-written notes have been found which point towards observance of some definite spiritual/mystical practices by the whole family.” “Coincidentally, these notes have a strong similarity with the manner in which the mouths, eyes etc of the deceased were tied and taped. The same is being investigated further to establish its links with the deaths,” a police official told news agency ANI. Meanwhile, Adityanath Sisodia, a relative of the deceased, told Zee News that he had attended an event with the family members on June 17 and they all seemed fine, without any indication of stress. He further said that he also had a conversation with them on the telephone on Saturday and everything appeared to be normal. The case has been transferred to the crime branch for further investigation. "Case has been transferred to us (crime branch) and we've inspected the site. Hand-written letters that have been recovered suggest spiritual angle to the deaths. Further investigation will reveal more," said Alok Kumar, Joint Commissioner Police (Crime). While 10 bodies were found hanging from the roof in the courtyard of the house, the body of Narayana, a 75-year-old woman, was found on the floor. The bodies were blindfolded and gagged. Of the victims, there were two brothers identified as Bhupinder and Lalit Singh. While the former ran a grocery store, the latter was a carpenter. Both operated their businesses from their family home.
Reduction of left ventricular size following oxygen inhalation in patients with coronary artery disease as measured by biplane coronary cineangiograms. Left ventricular size is one of the major determinants of myocardial oxygen consumption, therefore if oxygen inhalation reduces myocardial oxygen demand, such might be beneficial in the treatment of acute myocardial infarction. Routine diagnostic biplane left coronary cineangiograms were obtained during air or oxygen breathing in 11 patients with old myocardial infarction or angina pectoris. Coordinates of the points on the left coronary artery were measured and throughout one cardiac cycle frame by frame. The spatial distance (segment length: L) between any two of these points was calculated. Segment length at R wave on the electrocardiogram (LECG R) and minimum value (Lmin) for each segment were calculated. Arterial pO2 was elevated by oxygen breathing from 91 +/- 4 (+/- SE) to 427 +/- 18 mmHg. Left ventricular segment length was significantly reduced by oxygen breathing: LECG R being reduced following oxygen breathing from 62.3 +/- 3.0 to 60.6 +/- 3.0 mm (a decrease of 3.3 +/- 0.8%) and Lmin also being reduced from 55.9 +/- 2.8 to 54.4 +/- 2.8 mm (a decrease of 3.1 +/- 1.0%). These figures indicate that left ventricular size was reduced. Reduction in left ventricular size through oxygen inhalation, by reducing myocardial oxygen demand, should therefore be beneficial in coronary artery disease.
CS6140 12F: Machine Learning Created: Tue 04 Sep 2012 Last modified: The scientific discipline of Machine Learning is concerned with algorithmic paradigms and techniques that allow machines to learn from experience. Given the vast quantities of data that are collected in the modern world, Machine Learning has become increasingly important in order to utilize the knowledge inherent in this data. In this graduate course, we will examine, in depth, a variety of techniques used in machine learning and data mining and also examines issues associated with their application. Topics include algorithms for supervised learning including decision trees, artificial neural networks, probabilistic methods, boosting, and support vector machines; and unsupervised learning including clustering and principal components analysis. Also covers computational learning theory and other methods for analyzing and measuring the performance of learning algorithms. The course is largely self-contained. This document, and all documents on this website, may be modified from time to time; be sure to reload documents on occasion and check the "last modified" date against any printed version you may have.
Debt – for someone it is a heavy burden, but for someone a way to earn. What category of fast track debt relief reviews? What categories of fast track debt relief reviews are there? Debt can be of several categories: The most common category of debt is when you owe. Far fewer such subjects to whom they should. And units of such subjects who earn on debt. fast track debt relief reviews can also be of several categories. What to do with fast track debt relief reviews? If the subject is a debtor: fast track debt relief reviews need to give. Make a schedule and monthly give a comfortable amount. Do it every month and soon there will be nothing left of the debt. If the subject should? You need to get your money back and never lend it again. fast track debt relief reviews and profit. Also, using debt, you can earn money. Here are some examples: ⬤ right to debt can be bought with a huge discount and then claim it, ⬤ a debt you can buy an asset that will bring more income than the payment on debt, ⬤ debt can be taken at a small percentage and give it at a higher percentage, ⬤ other options. fast track debt relief reviews must move from one category to another category.
Titans RB Lendale White lost nearly 30 pounds during th... Titans RB Lendale White lost nearly 30 pounds during the offseason. Some people were concerned that the weight loss would affect his ability to live up to his 'smash' nickname, but White proved critics wrong in the second quarter, forcing his way in to the end zone to give the Titans a 14-0 lead.
Microcirculatory disturbances during the early phase following experimental spinal cord trauma in the rat. The early (primary) lesion of the microvasculature and neurons in the gray matter of the rat become mainfest within 0-3 min, long before the development of secondary ischemic-anoxic changes. The central hemorrhagic necrosis of the gray matter, induced by the impact injury, seems to depend primarily on theseverity of trauma. However, since the lesion is limited to the gray matter of one or two segments, these primary changes are not responsible for the irreversible transverse lesion. Additionally, the experimental cord injury in the rat demonstrates that secondary vascular changes (i.e., the pathological permeability of vessels in the white matter) produce a progressive edema that spreads into the necrotic zone and leads to definite transverse lesion. Not least of all, the increased pressure of the spinal tissue may promote the self-destructive process leading to irreversible damage to white matter.
Q: LINQ GroupBy string PagePath I have a list of entries List<StatisticsData> public class StatisticsData { public Guid Id { get; set; } public string PagePath { get; set; } public DateTime Date { get; set; } } Sample values: 94F0F2FF-D251-46AA-8AF4-E1CE14A70DFF | osahori.com.pr | 2020-02-18 1697C57B-BD10-43A2-B0F8-EDDFD289AB9B | osahori.com.pr/clientes | 2020-02-18 E91C049A-2F63-4B2E-87BD-B41284332614 | osahori.com.pr/faco-seu-orcamento | 2020-02-18 E91C049A-2F63-4B2E-87BD-B41284332614 | tc.onsiege.com/ | 2020-02-18 BF596A54-C9FF-4FE4-8881-3C1BBCA6C3A6 | tc.onsiege.com/home | 2020-02-18 5D32AF13-B7F9-40BB-927C-C07C5AC994FF | www.ubertaxi.com.br | 2020-02-18 17B5925F-8EFD-4DE1-BC56-4CB1241D0EF1 | www.ubertaxi.com.br/clients | 2020-02-18 ... In result I need groups for the same context of PagePath, e.g: First group: 94F0F2FF-D251-46AA-8AF4-E1CE14A70DFF | osahori.com.pr | 2020-02-18 1697C57B-BD10-43A2-B0F8-EDDFD289AB9B | osahori.com.pr/clientes | 2020-02-18 E91C049A-2F63-4B2E-87BD-B41284332614 | osahori.com.pr/faco-seu-orcamento | 2020-02-18 Second group: E91C049A-2F63-4B2E-87BD-B41284332614 | tc.onsiege.com/ | 2020-02-18 BF596A54-C9FF-4FE4-8881-3C1BBCA6C3A6 | tc.onsiege.com/home | 2020-02-18 Third: 5D32AF13-B7F9-40BB-927C-C07C5AC994FF | www.ubertaxi.com.br | 2020-02-18 17B5925F-8EFD-4DE1-BC56-4CB1241D0EF1 | www.ubertaxi.com.br/clients | 2020-02-18 Etc. Is it possible to do with LINQ? A: Demo on dotnet fiddle You can GroupBy the exact path only, like osahori.com.pr, tc.onsiege.com by using Subtring like below. Note that: Check the case PagePath has no "/". var result = list.GroupBy(p => { var indexOf = p.PagePath.IndexOf('/'); return indexOf > 0 ? p.PagePath.Substring(0, indexOf) : p.PagePath; }); foreach(var item in result) { Console.WriteLine("Group: " + item.Key); foreach(var item2 in item.ToList()) { Console.WriteLine(item2.Id + "|" + item2.PagePath + "|" + item2.Date); } } Output Group: osahori.com.pr 94F0F2FF-D251-46AA-8AF4-E1CE14A70DFF|osahori.com.pr|2/18/2020 12:00:00 AM 1697C57B-BD10-43A2-B0F8-EDDFD289AB9B|osahori.com.pr/clientes|1/1/0001 12:00:00 AM E91C049A-2F63-4B2E-87BD-B41284332614|osahori.com.pr/faco-seu-orcamento|1/1/0001 12:00:00 AM Group: tc.onsiege.com E91C049A-2F63-4B2E-87BD-B41284332614|tc.onsiege.com/|2/18/2020 12:00:00 AM BF596A54-C9FF-4FE4-8881-3C1BBCA6C3A6|tc.onsiege.com/home|2/18/2020 12:00:00 AM Group: www.ubertaxi.com.br 5D32AF13-B7F9-40BB-927C-C07C5AC994FF|www.ubertaxi.com.br|2/18/2020 12:00:00 AM 17B5925F-8EFD-4DE1-BC56-4CB1241D0EF1|www.ubertaxi.com.br/clients|1/1/0001 12:00:00 AM
// // Generated by class-dump 3.5 (64 bit). // // class-dump is Copyright (C) 1997-1998, 2000-2001, 2004-2013 by Steve Nygard. // #import "CDStructures.h" @class DVTDispatchLock, DVTObservingToken, NSArray, NSFileManager, NSMutableArray, NSSet; @interface IDEArchiveManager : NSObject { DVTDispatchLock *_archiveManagerLock; NSFileManager *_fileManager; NSMutableArray *_archives; _Bool _hasScanned; DVTObservingToken *_distributionArchivesLocationObservingToken; } + (void)initialize; + (id)sharedArchiveManager; @property(readonly) NSSet *supportedFileDataTypeIdentifiers; - (BOOL)installArchiveAtPath:(id)arg1 revealInstalledArchive:(BOOL)arg2 error:(id *)arg3; - (BOOL)installArchiveAtPath:(id)arg1 revealInstalledArchive:(BOOL)arg2; - (id)_installedArchiveAtPath:(id)arg1; - (void)deleteArchives:(id)arg1; - (void)deleteArchive:(id)arg1; @property(copy) NSArray *archives; // @dynamic archives; - (void)_populateArchivesIfNeeded; - (void)_refreshArchives; - (id)_allPotentialArchivePathsWithin:(id)arg1; - (void)_checkPathForArchive:(id)arg1 andAddToArray:(id)arg2; - (BOOL)_couldBeArchivePath:(id)arg1; - (void)_revealArchiveAtPath:(id)arg1; - (void)archiveInstalledProductsDirectoryWithPath:(id)arg1 auxiliaryFilesDirectoryPath:(id)arg2 schemeName:(id)arg3 archiveName:(id)arg4 platform:(id)arg5 revealNewArchive:(BOOL)arg6 workspace:(id)arg7 completionBlock:(dispatch_block_t)arg8; - (id)init; // Remaining properties @property(readonly) NSMutableArray *mutableArchives; // @dynamic mutableArchives; @end
//==-- proto_to_cxx.h - Protobuf-C++ conversion ----------------------------==// // // The LLVM Compiler Infrastructure // // This file is distributed under the University of Illinois Open Source // License. See LICENSE.TXT for details. // //===----------------------------------------------------------------------===// // // Defines functions for converting between protobufs and C++. // //===----------------------------------------------------------------------===// #include <cstdint> #include <cstddef> #include <string> namespace clang_fuzzer { class Function; std::string FunctionToString(const Function &input); std::string ProtoToCxx(const uint8_t *data, size_t size); }
Molecular mechanisms of cellular proliferation in acute myelogenous leukemia by leptin. Leptin acts as a growth factor in normal cells as well as in various types of cancer cells. We investigated the effects of leptin on human acute myelogenous leukemia (AML) cells. Leptin stimulated the proliferation of HEL cells through the phosphorylation of STAT3 and ERK1/2. The blocking of STAT3 phosphorylation with the specific inhibitor, AG490, significantly reduced leptin-induced ERK1/2 phosphorylation and cellular proliferation, whereas the blocking of ERK1/2 activation by the specific ERK1/2 inhibitor, PD98059, did not affect the STAT3 phosphorylation or leptin-induced proliferation in HEL cells. Furthermore, knockdown of leptin receptor (OB-R) expression with stealth RNA interference (RNAi) reduced the leptin-induced proliferation of HEL cells and also significantly attenuated leptin-induced STAT3 and ERK1/2 activation. These results suggest that leptin promotes AML cell growth by activating STAT3 and MAPK, although not directly dependent on ERK.
Introduction {#S1} ============ While AIDS-associated *Pneumocystis jirovecii* pneumonia (Pjp) and cryptococcosis have declined in developed countries due to widespread use of highly active antiretroviral treatment ([@B24]; [@B55]; [@B65]), the overall burden of invasive fungal diseases (IFDs), especially candidemia and invasive aspergillosis has increased worldwide ([@B60]; [@B50]; [@B62]; [@B79]; [@B59]; [@B8]). IFDs alone cause about 1.6 million deaths/year ([@B12]). The rise in incidence of IFDs is largely due to an increase in at-risk populations, especially immunocompromised individuals, such as recipients of solid organs or hematopoietic stem cell transplants, and patients with underlying chronic diseases ([@B40]; [@B12]; [@B3]; [@B11]; [@B68]). It is paramount that the management of invasive mycoses must be improved through advancements in prevention, diagnosis, treatment and surveillance ([@B22]; [@B38]; [@B17]). The majority of the current fungal diagnostic techniques are inadequate for the identification of all pathogenic fungi, which is a pre-requisite for timely initiation of appropriate antifungal therapy ([@B68]; [@B33]; [@B17]). Culture-based identification techniques rely on morphological and phenotypic characteristics, are often inaccurate, and lack in most cases species-specific features. Phenotypic traits also fail to differentiate between closely related species or species complexes with near-identical morphological characteristics but distinguishable genetic traits, such as the casual agents of many mold infections, including aspergillosis and scedosporiosis ([@B76]). Further, not all pathogenic fungi grow under laboratory conditions. Morphology based diagnostics are also time-consuming (7--14 days), highly laborious, and heavily dependent on the level of mycological expertise of the microscopist, making them unsuitable for rapid and reliable diagnosis ([@B33]). Serological tests or fungal biomarkers, such as the *Aspergillus* antigen test or the *Cryptococcus* lateral flow assay (CrAg^®^ LFA, IMMY, Norman, OK, United States), are available, but they are designed to identify specific pathogens ([@B15]; [@B68]; [@B13]). To overcome the limitations of standard phenotypic diagnosis and identification methods, culture- and "expert-free" methods capable of identifying fungi directly from biological specimens are needed. Sequence-based identification has proven to be more accurate than conventional methods in diagnostic clinical mycology ([@B16]; [@B4]). Among the applied molecular techniques, DNA barcoding is one of the most promising and efficient methods, as it enables rapid identification of species and recognition of cryptic species across all fungal genera. As such, DNA barcoding has recently been established as the gold standard identification technique for fungal species and has been proven to be more accurate than conventional identification techniques ([@B16]; [@B4]). Barcodes are standardized, easily amplified, universal short DNA sequences (500--800 bp), which are divergent at the species level enabling rapid identification by comparison with a validated reference sequence collection. To ensure consistency of identification, barcodes should be unique to a single species, and stable within each species ([@B32]). Additionally, interspecies variation must exceed the intraspecies variation, generating a "break" in the distribution of distances, which is referred to as the "barcoding gap" ([@B51]). DNA barcoding and its associated references databases \[BOLD ([@B32]), UNITE ([@B39]), RefSeq at Genbank ([@B70]), and the "ISHAM Barcoding Database" ([@B52])\], plays a central role in the identification landscape, as it is the basis for all future methods, either culture dependent or culture independent ([Figure 1](#F1){ref-type="fig"}). ![Current and potentially available techniques for fungal ID, showing the central role of the reference DNA barcode database and the pros and cons of all techniques. Crossed boxes indicate missing databases. DNA barcoded reference strains are fundamental to build up a spectral library.](fmicb-10-01647-g001){#F1} After numerous candidate genetic loci were evaluated, with varying success rates, the internal transcribed spacer (ITS) region was established as the primary fungal DNA barcode by [@B69]. The ITS region is composed of two non-coding and variable regions, ITS1 and ITS2, flanking the highly conserved 5.8S gene. They are located between the 18S \[small subunit (SSU)\] and 28S \[large subunit (LSU)\] genes in the nrDNA repeat ([@B80]). The advantage of the ITS region is, that it can be easily amplified from most fungal taxa, using universal primers, with the most commonly used ones being the ITS1, ITS2, ITS3, ITS4, and ITS5 ([@B80]). Fungal-specific primers were also designed to avoid cross reactivity with plant or animal DNA, such as SR6R and LR1 ([@B78]), V9D, V9G, and LS266 ([@B27]), IT2 ([@B6]), ITS1F ([@B26]) and NL4b ([@B57]; [Figure 2](#F2){ref-type="fig"} and [Table 1](#T1){ref-type="table"}). To provide quality controlled reference primary fungal DNA barcode sequences the International Society for Human and Animal Mycology (ISHAM) "ITS DNA barcode database" was established in 2015 ([@B34]). The primary fungal DNA barcode region identifies up to 75% of the estimated ∼700 pathogenic fungal species ([@B21]). ![Schematic structure of the primary (ITS) and secondary (*TEF1α*) fungal DNA barcode regions indicating universal primers for their amplification.](fmicb-10-01647-g002){#F2} ###### Universal and fungal specific primers for the dual DNAbarcoding scheme. **Barcode** **Primer name** **Sequence** **References** ------------------- ----------------- ------------------------------------ ---------------- Primary barcode ITS1 5′ TCCGTAGGTGAACCTGCGG 3′ [@B80] ITS2 5′ GCTGCGTTCTTCATCGATGC 3′ [@B80] ITS3 5′ GCATCGATGAAGAACGCAGC 3′ [@B80] ITS4 5′ TCCTCCGCTTATTGATATGC 3′ [@B80] ITS5 5′ GGAAGTAAAAGTCGTAACAAGG 3′ [@B80] ITS1F 5′ CTTGGTCATTTAGAGGAAGTAA 3′ [@B26] IT2 5′ CCTCCGCTTATTGATATGCTTAGG 3′ [@B6] SR6R 5′ AAGTATAAGTCGTAACAAGG 3′ [@B78] LR1 5′ GGTTGGTTTCTTTCCT 3′ [@B78] V9D 5′ TTAAGTCCCTGCCCTTTGTA 3′ [@B27] V9G 5′ TACGTCCCTGCCCTTTGTA 3′ [@B27] LS266 5′ GCATTCCCAAACAACTCGACTC 3′ [@B27] NL4b 5′ GGATTCTCACCCTCTATGAC 3′ [@B57] Secondary barcode EF1-1002F 5′ TTCATCAAGAACATGAT 3′ [@B74] EF1-1018F 5′ GAYTTCATCAAGAACATGAT 3′ [@B74] EF1-1620R 5′ GACGTTGAADCCRACRTTGTC 3′ [@B74] EF1-1688R 5′ GCTATCATCACAATGGACGTTCTTGGAG 3′ [@B74] EF1-983F 5′ GCYCCYGGHCAYCGTGAYTTYAT 3′ [@B66] EF1-1567R 5′ ACHGTRCCRATACCACCRATCTT 3′ [@B66] To address the shortcomings of the ITS region and hence close this identification gap, a secondary barcode was proposed in 2015 ([@B74]). The *translational elongation factor 1α* (*TEF1α*) was selected due to its high species discrimination across fungal taxa and the ability to design universal primers, such as EF1-1018F (Al33F)/EF1-1620R (Al33R), EF1-1002F (Al34F)/EF1-1688R (Al34R) ([@B74]), or EF1-983F/EF1-1567R ([@B66]; [Figure 2](#F2){ref-type="fig"} and [Table 1](#T1){ref-type="table"}). To accommodate the secondary fungal DNA barcode a dedicated database that would eventually include all medically relevant fungal species was established to complement the ISHAM-ITS database, which contains only quality-controlled *TEF1α* sequences obtained from taxonomically verified fungal cultures ([@B52]). Both databases have been combined within the "ISHAM Barcoding Database",^[1](#footnote1){ref-type="fn"}^ which was launched in November 2017 at the 7th International DNA barcoding conference at the Kruger National Park in South Africa. The combined dual barcode database provides the medical and veterinary community with quality-controlled primary and secondary fungal DNA barcodes reference sequences. This database is publicly available, and its quality-controlled sequences are shared with other major databases, including RefSeq within GenBank ([@B9]) and UNITE ([@B39]). To date, the clinical utility and accuracy of the dual DNA barcoding system for identification of pathogenic fungi has not been assessed. This study aimed to increase the number of reference secondary barcode sequences for pathogenic fungal species and to compare the accuracy and resolution of the primary and secondary fungal DNA barcodes separately or in combination, focusing on fungi causing invasive fungal infections. Materials and Methods {#S2} ===================== Cultures {#S2.SS1} -------- To generate quality controlled *TEF1α* sequences 270 strains, representing 90 human/animal pathogenic fungal species, were used (see [Supplementary Table 1](#SM1){ref-type="supplementary-material"}). DNA Extraction {#S2.SS2} -------------- DNA was isolated and purified from cultures using either previously described manual method ([@B25]) or the Quick-DNA Fungal/Bacterial Kit (D6007, Zymo Research) according to the manufacturer's instructions. DNA Barcode Generation {#S2.SS3} ---------------------- The secondary fungal DNA barcoding region (*TEF1α*) was amplified using the primers described by [@B74], including: EF1-1018F (Al33F) (5′ GAYTTCATCAAGAACATGAT 3′) and EF1-1620R (Al33R) (5′ GACGTTGAADCCRACRTTGTC 3′) being used together and EF1-1002F (Al34F) (5′ TTC ATCAAGAACATGAT 3′) and EF1-1688R (Al34R) (5′ CTATCATCACAATGG ACGTTCTTGGAG 3′) being used together ([@B74]). The primer set Al33F-Al33R was first used to amplify the *TEF1α* region. If amplification was unsuccessful then it was repeated using the second primer set Al34F-Al34R. Both primer pairs used the following PCR amplification protocol: 5 min initial denaturing at 94°C, followed by 40 of 50 s at 94°C, 50 s annealing at 48°C, 50 s at 72°C and 7 min final extension at 72°C ([@B74]). Amplification success was visualized through gel electrophoresis in a 1.5% agarose gel containing ethidium bromide (EtBr) with ultra-violet illumination. Successfully amplified PCR products were sent for commercial sequencing, e.g., Macrogen Inc., South Korea in both forward and reverse directions. Bidirectional sequenced were assembled and edited using Sequencher^®^ ver. 5.3. (Gene Codes Corporation, Ann Arbor, MI, United States). Sequences were manually checked to resolve ambiguous bases on the forward and reverse trace files considering the PHRED scores received. DNA Barcode Analysis {#S2.SS4} -------------------- The sequences for each taxon were aligned with the program CLUSTALW ([@B77]) part of the software MEGA ver. 7 ([@B47]). Resulting alignments were checked visually and edited when needed. The intraspecies diversity was estimated by calculating the average nucleotide diversity (π) within species, where there were sequences available from more than three strains. The proportion of nucleotide differences in all haplotypes in the sample was derived using the software DnaSP ver. 5.10.01 ([@B48]). Individual analysis of the primary and secondary barcoding regions was performed through barcoding gap analysis. Additionally, analysis was performed on the combined barcoding regions. Taxonomic groups were selected for analysis if represented by three or more species, and if those species were represented by three or more strains. Furthermore, taxonomic groups were required to include at least one species that has been demonstrated to cause invasive fungal infections. Only strains with both primary and secondary barcodes in the database where included in the analysis. When available, more specific taxonomic groups such as clades were selected over genera. Sequences for each genus were aligned and cut to equal length using CLUSTALW as present in MEGA ver. 7 ([@B47]; [@B42]). Genetic distances between each strain were calculated using the Kimura 2-parameter model (K2P) and the intraspecies and interspecies genetic distances were compared ([@B37]). Intra- and interspecies genetic distances were graphed against frequency and analyzed for barcoding gaps. Barcoding gaps were defined by the presence of a distinct difference between the largest intraspecies genetic distance and smallest interspecies genetic distance ([@B34]), i.e., there was no common x value between the intra- and interspecies groups. The introduction of the secondary fungal DNA barcode was accessed for each genus on the basis that there would be an improvement in DNA barcoding if the secondary barcode generated a barcoding gap when the primary barcode did not, or if the overlap between the intra- and interspecies genetic distances was reduced. Results {#S3} ======= The study produced 270 new quality controlled secondary fungal barcode sequences, covering 90 pathogenic fungal species ([Supplementary Table 1](#SM1){ref-type="supplementary-material"}). Overall, the PCR success rate was high within the 270 *TEF1* sequences. 220 secondary barcodes were generated using the Al33F--Al33R primer pair and 50 were amplified with the Al34F--Al34R primer pair. There was no trend in amplification success in different fungal species. However, the Al34F--Al34R primer set was required to amplify all strains of *Aspergillus niger*, *Candida albicans*, *Candida dubliniensis*, *Kluyveromyes marxianus*, and *Pichia kudriavzevii*. There was unsuccessful amplification with both primer sets for some strains of *Cladosporium* spp., *Rhodotorula* spp., and *Trichosporon* spp. All sequences were submitted to the ISHAM Barcoding Database (see footnote 1). The length of the ITS and partial *TEF1α* sequences in the database ranges 285--791 and 534--1002 bp, respectively. The analysis of the nucleotide diversity (π) of 43 fungal species with more than three strains in the ISHAM barcoding database showed that the *TEF1α* region is less diverse than the ITS region in most species ([Figure 3](#F3){ref-type="fig"}). The intraspecies variation of *TEF1α* was for most species below 1.5%, confirming the secondary barcode as a more discriminator marker. According to the selection criteria four different taxonomic groups were selected as proof of principle for the dual barcoding system. These included the two genera, *Diutina* and *Scedosporium*, and the two taxonomic clades, *Lodderomyces* and *Pichia*. The *Diutina* genus was selected for analysis despite one of the species, *Diutina rugosa*, being represented by only two strains as this genus is newly established that causes rare disease ([Table 2](#T2){ref-type="table"}). The species and number of strains included in these analyses are outlined in [Table 2](#T2){ref-type="table"}. ![Intraspecies variation for species, which are represented by more than three strains, in the internal transcribed spacer (ITS) (blue bars) primary fungal DNA barcode compared with the *translation elongation factor 1α* (*TEF1α*) (gray bars) secondary fungal DNA barcode.](fmicb-10-01647-g003){#F3} ###### Number of fungal strains with primary and secondarybarcodes present in the ISHAM Barcoding Databaseanalyzed in this study. **Taxonomic group** **Species/Species complex** **Number of strains** ---------------------- ----------------------------- ----------------------- *Diutina* *Diutina catenulata* 11 *Diutina mesorugosa* 9 *Diutina rugosa* 2 *Lodderomyces* clade *Candida albicans* 13 *Candida dubliniensis* 12 *Candida metapsilosis* 7 *Candida orthopsilosis* 11 *Candida parapsilosis* 26 *Candida tropicalis* 16 *Pichia* clade *Candida inconspicua* 4 *Pichia kudriavzevii* 15 *Pichia norvegensis* 10 *Scedosporium* *Scedosporium apiospermum* 6 *Scedosporium aurantiacum* 13 *Scedosporium boydii* 4 *Diutina* Species {#S3.SS1} ----------------- Barcoding gap analysis of the genus *Diutina* demonstrated no overlap between the intraspecies and interspecies genetic distances with either the primary or secondary fungal DNA barcodes ([Figure 4](#F4){ref-type="fig"}). There was similarly no overlapping region for the barcoding gap analysis of the combination of the primary and secondary barcodes ([Figure 4](#F4){ref-type="fig"}). As such, both fungal barcodes and the combination of the barcodes generated appropriate barcoding gaps. ![Barcoding gap analyses for fungal taxa including causative agents of invasive fungal disease with intraspecies (gray) and interspecies (blue) genetic distances calculated using the Kimura 2-parameter model. **(A)** *Diutina* genus (*Diutina catenulata, Diutina mesorugosa*, and *Diutina rugosa*). **(B)** *Lodderomyces-*clade (*Candida albicans*, *Candida dublinsiensis, Candida metapsilosis, Candida orthopsilosis, Candida parapsilosis*, and *Candida tropicalis*). **(C)** *Pichia-*clade (*Candida inconspicua, Pichia kudriavzevii*, and *Pichia norvegensis*). **(D)** *Scedosporium* genus (*Scedosporium apiospermum, Scedosporium aurantiacum*, and *Scedosporium boydii*).](fmicb-10-01647-g004){#F4} The *Lodderomyces* Clade {#S3.SS2} ------------------------ For the *Lodderomyces* clade, the intraspecies and interspecies genetic distances, generated by the primary fungal barcode produced an overlapping region thereby indicating that there was no barcoding gap ([Figure 4](#F4){ref-type="fig"}). The barcoding gap analysis for the secondary DNA barcode (*TEF1α*) demonstrated no overlap in the intraspecies and interspecies genetic distances for *Lodderomyces* thus showing a clear barcoding gap ([Figure 4](#F4){ref-type="fig"}). The *Lodderomyces* clade analysis using the combination of both the ITS and *TEF1α* regions resulted in the generation of a barcoding gap being generated ([Figure 4](#F4){ref-type="fig"}). The *Pichia* Clade {#S3.SS3} ------------------ Barcoding gap analysis of the *Pichia* clade did not reveal any overlapping regions in the genetic distances for either the ITS or *TEF1α* regions ([Figure 4](#F4){ref-type="fig"}). As there were no overlapping regions this demonstrated that there are barcoding gaps for both the primary and secondary barcode. These results were similar when both barcoding regions were combined as there was a barcoding gap produced ([Figure 4](#F4){ref-type="fig"}). *Scedosporium* Species {#S3.SS4} ---------------------- Barcoding gap analysis of the primary fungal DNA barcode showed an overlapping region ([Figure 4](#F4){ref-type="fig"}). For the secondary barcode, the barcoding gap analysis revealed that there was no overlap between the intraspecies and interspecies genetic distances and so a barcoding gap was present ([Figure 4](#F4){ref-type="fig"}). The barcoding gap analysis of the combination of both barcodes, produced a barcoding gap as there was no overlap between the intraspecies and interspecies genetic distances ([Figure 4](#F4){ref-type="fig"}). Discussion {#S4} ========== ISHAM Barcoding Database Expansion {#S4.SS1} ---------------------------------- Accurate and rapid routine diagnostic tools are essential to reduce the burden of fungal disease. DNA barcoding requires reliable quality-controlled reference sequences for its implementation. As such, fungal DNA Barcoding databases need to have high taxonomic coverage and reliable sequences to ensure users can accurately match sample sequences to the correct reference sequences. Additionally, the more sequences from different strains for each species are represented, the higher is the accuracy of the identification, as this reflects more realistically the existing species variation. In this study, we generated 270 secondary barcodes, which could be amplified reliably using either the primer set Al33F--Al33R or the primer set Al34f--A134R ([Figure 2](#F2){ref-type="fig"}), with a few exceptions where no amplifications where obtained for some strains of *Cladosporium* spp.*, Rhodotorula* spp., or *Trichosporon* spp. In those cases, modification of the amplification conditions, such as touchdown PCR, may be appropriate. As a result of this study the ISHAM Barcoding Database contains, as of the May 10, 2019, 4091 primary (ITS) and 868 secondary barcode (*TEF1α*) sequences covering 640 and 129 pathogenic fungal species, respectively. From those 2681 ITS and 613 *TEF1α* sequences representing 252 species cause invasive fungal diseases. There are an estimated 700 pathogenic fungal species, with the majority rarely causing infections. As such, the taxonomic coverage of ITS sequences within the "ISHAM Barcoding Database" is close to covering all pathogenic fungal species, whilst the *TEF1α* sequences cover less than one fifth. In addition, 59 species are currently only represented by one *TEF1α* sequence, which limits identification due to underrepresented intraspecies variation. As the "ISHAM Barcoding Database" has only been recently expanded to include *TEF1α* sequences, it is expected that as more *TEF1α* sequences are submitted, these issues will be resolved. Currently the "ISHAM Barcoding Database" has enabled pragmatic implementation of the dual barcode scheme for the identification of pathogenic fungi. Comparison of the Primary and Secondary Barcodes {#S4.SS2} ------------------------------------------------ Since the establishment of the secondary fungal DNA barcode the improvement of the identification accuracy for pathogenic fungi has not been assessed. In this study, we compared for the first time the primary and secondary fungal DNA barcodes via barcoding gap analysis based on intraspecies and interspecies genetic distance values as calculated using the K2P model ([@B37]). In addition, the combination of both barcodes was tested and compared to the individual barcodes. ### *Diutina* Species (Previously Belonging to the Genus *Candida*) {#S4.SS2.SSS1} The genus *Diutina* was established only recently. This group of fungal species was previously part of the genus *Candida* ([@B44]; [@B36]). *Diutina* species are uncommon agents of disease, but are associated with nosocomial infections, with fatality rates of up to 70% ([@B58]). *Diutina catenulata* and *Diutina rugosa* are well known causes of fungemia in immunocompromised patients and the seriously ill ([@B63]; [@B53]; [@B7]; [@B30]). *D. rugosa* is notable for its increasing resistance against multiple antifungal agents worldwide, thereby increasing the need for early detection and identification to enable timely initiation of effective treatment ([@B61]). An exception was made for the genus *Diutina* to be included into this analysis, as *D. rugosa* is only represented by two strains in the analysis ([Table 2](#T2){ref-type="table"}). The inclusion of the species was important as *Diutina mesorugosa* and *D. rugosa* have been proposed as synonyms with the variability of ITS sequences used as supporting evidence ([@B54]). Barcoding gap analysis indicates that these species can be clearly identified as separate species. The *Diutina* species are representative of the 75% of pathogenic fungi that are accurately identified by the primary barcode ([@B33]). The secondary barcode and the combination of both barcodes equally identified these species ([Figure 4](#F4){ref-type="fig"}), demonstrating the same level of resolution as the primary barcode ([@B74]). ### The *Lodderomyces* Clade {#S4.SS2.SSS2} The *Lodderomyces* clade contains 21 *Candida* species, including some of the major pathogenic fungal species ([@B44]). This clade contains three of the five most common pathogenic *Candida* species: *Candida albicans*, *Candida dubliniensis*, and *Candida parapsilosis* ([@B72]). These species cause a wide spectrum of diseases, from cutaneous infections to fatal disseminated septicemia ([@B76]). *Candida* species are predominantly commensals in the body and as such these infections largely target immunocompromised patients and are commonly the cause of nosocomial outbreaks ([@B12]). *Candida* is a polyphyletic genus with a highly complex taxonomic history ([@B44]). In the latest edition of The Yeasts A Taxonomic Study, 314 different *Candida* species were described excluding species with anamorph-teleomorph linkages ([@B44]). The genus *Candida* was initially intended to include undifferentiated yeasts that cannot be identified by phenotype ([@B10]). As such there is little stability in the genus with some species being linked to others as anamorphs and the introduction of newly found species. With the advanced use of genomics in taxonomic studies the composition of species and the *Lodderomyces* clade are expected to change. The barcoding gap analysis of the primary barcode was unable to generate a barcoding gap and so was unable to accurately identify all species of the clade ([Figure 4](#F4){ref-type="fig"}). Upon closer inspection, the lack of a barcoding gap was due to the close relationships between *Candida orthopsilosis* and *Candida parapsilosis*, which form part of the *Candida parapsilosis* species complex. This species complex was previously representing a single species, *Candida parapsilosis*, with three subgroups that were then revised to be separate species based on various molecular techniques, including sequencing of the ITS region. The barcoding gap analysis of this study, however, did not reflect this differentiation and so ITS was unable to identify these different species. Barcoding gap analysis of the secondary barcode did produce a barcoding gap and thereby demonstrated that *TEF1α* could accurately identify all species of the Lodderomyces clade ([Figure 4](#F4){ref-type="fig"}). As such, the introduction of the dual barcoding scheme resulted in an accurate identification of these pathogenic fungal species. ### The *Pichia* Clade {#S4.SS2.SSS3} The *Pichia* clade is composed of 20 species. In our study, *Candida inconspicua* was also included in the analysis, as it is thought to be the anamorph for *Pichia cactophila* ([@B43]; [@B45], [@B44]). *Pichia kudriavzevii* and *Pichia norvegensis* are predominantly linked to nosocomial pathogens and may cause outbreaks of infections ([@B56]). *Candida inconspicua* has also been found in clinical samples whilst the other species of the *Pichia* clade have not yet been found to be medically relevant ([@B44]; [@B29]). These species also cause invasive infections in patients with a highly compromised immune systems, and are often found under previous names in the literature ([@B44]; [@B29]; [@B71]; [@B67]; [@B23]). Similarly, to the genus *Diutina*, barcoding gap analysis of the *Pichia* clade revealed barcoding gaps for the primary barcode, secondary barcode and the combination of both barcodes ([Figure 4](#F4){ref-type="fig"}), resulting in an accurate identification of all species of the *Pichia* clade. ### *Scedosporium* Species {#S4.SS2.SSS4} Fungi belonging to the genus *Scedosporium* cause a wide variety of diseases from localized infections to invasive diseases ([@B19]). *Scedosporium* species mainly cause infections in patients with a compromised immune systems largely due to underlying illnesses such as solid organ transplantation, cystic fibrosis, leukemia and bone marrow transplantation ([@B75]; [@B2]; [@B41]; [@B81]; [@B35]). *Scedosporium* spp. can also cause infection in immunocompetent patients ([@B14]; [@B1]; [@B20]). The taxonomy of the genus *Scedosporium* is complex and has changed multiple times over the last decade. Previously, the nomenclature of the genus ruled *Scedosporium* to be the anamorph name whilst *Pseudallescheria* and *Petriella* were the teleomorph names ([@B64]; [@B19]; [@B49]). The two major clinical species were *Scedosporium prolificans* and *Scedosporium apiospermum* and its teleomorph form, *Pseudallescheria boydii* ([@B19]). Multilocus sequencing, morphological analysis and physiological testing later demonstrated that *S. apiospermum* and *P. boydii* are separate species and not anamorphs teleomorph pairs ([@B28]). In 2011, the new nomenclature rules dictating "one fugus = one name" led to the fact that *Scedosporium* took precedence over *Pseudallescheria* as the genus name ([@B31]; [@B46]). The composition of the genus was also changed with *S. prolificans* being removed from the genus and renamed to *Lomentospora prolificans* ([@B46]). The separation between *S. apiospermum* and *S. boydii* was reinforced, however, it was noted that there was no clinical difference between the species, as such all species are referred to the *S. apiospermum* species complex ([@B46]). In this study, there was no barcoding gap present for the primary barcode indicating that *Scedosporium* species cannot be accurately identified using this region alone ([Figure 4](#F4){ref-type="fig"}). The predominant reason for the overlap in intraspecies and interspecies genetic distances was the high similarity between *S. apiospermum* and *S. boydii*. This was reflective of the nomenclature history as these species were previously thought to be an anamorph -- teleomorph pair. Barcoding gap analysis of the secondary barcoding region introduced a barcoding gap and hence allowed for the accurate identification of all *Scedosporium* species ([Figure 4](#F4){ref-type="fig"}). As the separation of *S. apiospermum* and *S. boydii* was established via multilocus sequence analysis, it is reassuring that *TEF1α* can resolve all *Scedosporium* species to the same degree ([@B28]). With the introduction of the dual barcoding scheme, all *Scedosporium* species can now be accurately identified. Assessment of the Dual Barcoding Scheme {#S4.SS3} --------------------------------------- Meaningful implementation of the dual DNA barcoding scheme depends on demonstration of an improvement in the identification accuracy of fungal species causing infections when adding the secondary barcode, *TEF1α*. To demonstrate this the two fungal barcodes were analyzed separately and in combination from selected species, which had sequences from both barcodes being in the "ISHAM Barcoding Database," using barcoding gap analysis through the generation of genetic distances by the K2P model ([@B37]). Although K2P has been used in all DNA barcoding studies since its introduction by [@B32], the accuracy of this model has been questioned ([@B37]; [@B32]). In the selection of ITS region as the primary fungal DNA barcode, the uncorrected p-distances were used for barcoding gap analysis whereas in the case of the secondary fungal DNA barcode (*TEF1α*) analysis the K2P method was applied ([@B69]; [@B74]). The K2P region was selected to generate barcoding gaps over uncorrected p-distances as K2P has been found to generate larger barcoding gaps for most data sets ([@B73]). Additionally, in datasets where uncorrected p-distances were preferred, the performance of K2P was found to be similar ([@B73]). More complicated models have been applied in some studies in an attempt to improve the accuracy of the K2P model, however, the differences were minimal, prompting us to use K2P in our study ([@B18]; [@B5]). Comparison of the number of pathogenic fungal species and strains represented in the "ISHAM Barcoding Database" highlighted the deficit in the number of *TEF1α* reference sequences. Therefore, the value of this study is limited as only strains with both barcodes available were used for the analysis. More species represented by more sequences would give a more exact assessment about the value and resolution power of the dual barcoding concept. DNA barcode gab analysis showed that two of the groups (*Diutina* and *Pichia*) tested were accurately identified using the primary barcode and the secondary barcode on its own, demonstrating that both barcodes had similar resolution. For the remaining two groups (*Lodderomyces* and *Scedosporium*) the primary barcode was not able to produce barcoding gaps whilst the secondary did, demonstrating that the secondary barcode had a higher resolution power. In addition, the combination of both barcodes increased the discriminatory power enabling a more accurate identification. These results indicate, that the application of the dual barcoding system drastically improves species identification in cases where a single barcoding system is unable to do so. Implementation of the Dual Barcoding Scheme {#S4.SS4} ------------------------------------------- We envisage that the proposed dual barcoding scheme can be applied in the routine diagnostic setting in a stepwise procedure. After a clinical specimen is obtained, the unknown fungal isolate is first assessed based on its morphologic and/or biochemical characteristics. Then those unknown fungal isolates which lack obvious morphological characteristics or result in unclear biochemical profiles should be subjected to DNA isolation and primary fungal DNA barcoding (ITS1/2 region). If the obtained sequence shows less than 98.5% identity to a given ITS reference sequence in the database, the secondary fungal DNA barcode (*TEF1α*) should be obtained to achieve a final species identification ([Figure 5](#F5){ref-type="fig"}). ![Workflow of DNA barcoding based fungal ID (Steps 1 and 2 can be done in parallel to speed up the process).](fmicb-10-01647-g005){#F5} The dual fungal DNA barcoding scheme is an efficient diagnostic tool for the identification of agents of invasive mycoses and can be confidently implemented into routine diagnostics. Its implementation along with the expansion of the "ISHAM Barcoding Database" will lead to a paradigm shift in fungal disease diagnostics, enabling a highly accurate identification of the agents of fungal disease. The timely initiation of appropriate therapy will improve patient outcomes through the reduction in morbidity and mortality, prevent the use of unnecessary or inappropriate antifungal drugs, minimizing drug toxicity and resistance development and greatly reduce the associated health care cost. Call for Data Submission {#S5} ======================== To achieve a 100% coverage of all pathogenic fungi and reflect the intraspecies variation for both the primary and secondary fungal DNA barcode we call for the submission of quality-controlled reference sequences of the ITS region and the *TEF1α* for inclusion into the "ISHAM Barcode Database." Please contact the curators of the database WM at <wieland.meyer@sydney.edu.au> and LI at <laszlo.irinyi@sydney.edu.au>. Data Availability {#S7} ================= The primary and secondary fungal barcodes generated and analyzed for this study are available in the ISHAM Barcoding Database (<http://its.mycologylab.org/>). Author Contributions {#S8} ==================== WM, SC, and TS conceived the study. WM coordinated the study and supervised the molecular and data analysis. All members of the ISHAM working group for "Barcoding of Medical Fungi" performed the sample collections. MH and LI conducted the sample processing, all molecular studies, and data analysis. MH, LI, and WM performed the data interpretation. All authors wrote and corrected the manuscript. Conflict of Interest Statement {#conf1} ============================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. **Funding.** This study was supported by the National Health and Medical Research Council of Australia (NH & MRC) grant (\#APP1121936) to WM, SC, and TS, and Western Sydney Local Health District Research and Education Network Research Grant Scheme to WM, TS, SC, and LI. TS is a Sydney Medical School Foundation Fellow. The authors thank all members of the ISHAM working group for "Barcoding of Medical Fungi" for the contribution of strains and barcode sequences. <http://its.mycologylab.org/> Supplementary Material {#S11} ====================== The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fmicb.2019.01647/full#supplementary-material> ###### Click here for additional data file. [^1]: Edited by: Saad J. Taj-Aldeen, Hamad Medical Corporation, Qatar [^2]: Reviewed by: Zheng Wang, Yale University, United States; Huzefa A. Raja, The University of North Carolina at Greensboro, United States [^3]: This article was submitted to Fungi and Their Interactions, a section of the journal Frontiers in Microbiology
The Morning Briefing: Derp State Coup, Race Hoax? and Much, Much More Good Friday morning. The president delivers remarks on the national security and the humanitarian crisis on our southern border The president receives his intelligence briefing President Trump and the first lady depart Washington, D.C., en route to Mar-a-Lago HOT DAMN: McCabe admits DERP STATERS tried to jettison Trump Just wow, right? I mean some of us have suspected this all along. Yesterday we finally learned what sorts of insurance policies were cooked up by FBI agent “Andy’s Office” McCabe. Andy has a book coming out and it’s important to remember that he was fired for lying to the FBI and is currently under criminal investigation. I hope this monster rots in jail. So “Andy’s office” told Scott Pelley of “60 Minutes” that he and some of his derp staters wanted to nullify the duly elected President Trump via the 25th amendment and claim Trump was unable to fulfill his duties as president because RUSSIA. Of course, this amendment is for a president who is IN A COMA or literally incapacitated, but this is the logic coming from the agenda-driven dummies now populating the FBI and DOJ. Their big concern is the fake Trump-RUSSIA story, and McCabe was worried that Trump had RUSSIAN help to win the election. Firing self-righteous yak James Comey was just evidence Trump had been co-opted by the RUSKIES. Sane people recognize that Trump can fire anyone he wants in the Executive Branch and that this move is in no way evidence of something illicit. But again, we have a bunch of sore loser, leftist dummies who are desperate to get rid of a president who has policy differences with the embedded political industry. EEEK! Trump knows RUSSIANS! Yeah, Trump did business is RUSSIA, he knows RUSSIANS. Sheesh. As of today, the number of people indicted or pleading to treasonous collusion with RUSSIA is ZERO. After two years, not a single person has been busted for anything related to RUSSIA or working with RUSSIA to steal the election for Trump. This is not looking good. I am skeptical of any and all racial incidents these days. So many groups have an interest in creating racial strife that the likelihood these incidents turn out to be a hoax is pretty high — like with those poor Covington boys. So this Jussie Smollet story did not sit right with me out of the gate. I used to live in Chicago. The city is not what I would call a MAGA-friendly city. The idea that some MAGA people were openly displaying their MAGA-ness while wandering around in subzero temperatures at 2 a.m. when they recognized an actor from the show “Empire” (is that a MAGA show?) and happened to have bleach and a noose…yeah…I don’t believe this. So it appears this story is falling apart and it looks like it may have been a publicity stunt for Smollet as his character was scheduled to be written off the show. BREAKING: Multiple soucres tell @ABC7Chicago Eyewitness News Jussie Smollet and the 2 men who are being questioned by police staged the attack – allegedly because his character was being written out of the show Empire. It looks like Trump will have to call a state emergency to get some more funding for a wall on the southern border and the Dems will sue. Experts are still combing through the bill to find all the poison pills. Legal scholars say it is unclear how such a step would play out, but they agree a court test would likely focus on whether an emergency actually exists on the southern border and on the limits of presidential power over taxpayer funds. Trump is unhappy with a bipartisan border security bill that is going through Congress to avert another government shutdown, because it contains only a fraction of the funds he demanded for his promised border wall. The White House said Trump would sign the bill but declare a national emergency to try to obtain funds for the wall. That will likely trigger a long legal fight possibly stretching into Trump’s 2020 re-election bid, and embolden critics who already accuse him of authoritarian tendencies and unpredictable swerves in policy-making. The establishment is pretending that the president has never used his emergency powers. We will see how this plays out today and in the future. Jeremy Levin speaks to reporters on Friday, Feb. 15, 1985, in Damascus, Syria before leaving for Frankfurt to meet his wife. Levin escaped from kidnappers who abducted him nearly a year ago on his way to work as Beirut bureau chief for Cable News Network. (AP Photo)
Artist's description: The figures in contexts night remain alone with themselves, in a search for his own identity.A deep sense of emptiness is generated, and the desire to let go, free at last from the thoughts in a dark space that welcomes you as a mother's womb. Artist's description: The figures in contexts night remain alone with themselves, in a search for his own identity.A deep sense of emptiness is generated, and the desire to let go, free at last from the thoughts in a dark space that welcomes you as a mother's womb.
Xanthogranulomatous pyelonephritis in an adolescent. Xanthogranulomatous pyelonephritis is a chronic, inflammatory disease of the kidney rarely found in the pediatric population. We report the case of a 16-year-old boy with fever, microscopic hematuria, and an enlarging cystic renal mass on ultrasonography. The patient had no evidence of renal stones and no known risk factors, other than a recent tattoo performed with unsterile equipment. Because the differential diagnoses included Wilms tumor, he underwent open exploration and nephrectomy. The histopathologic findings were consistent with xanthogranulomatous pyelonephritis, and cultures grew methicillin-resistant Staphylococcus aureus. The etiology was believed to be bacterial seeding from the unsterile tattoo.
(E)- and (Z)-1,2,4-triazolylchromanone oxime ethers as conformationally constrained antifungals. A series of 1,2,4-triazolylchromanone oxime ethers were synthesized and tested for in vitro antifungal activity. Many of these derivatives exhibit high activity against Candida albicans, Saccharomyces cerevisiae, Aspergillus niger and Microsporum gypseum.
Climate debate tests clean coal power Text Size They’ve put the black rock on billboards in swing states and splashed it on full-page ads in Roll Call and yes, POLITICO. They sponsored presidential debates on CNN, and their “clean coal” boosters were a fixture on the campaign trail. They’ve rolled out a series of TV spots from the firm that promised that what happens in Vegas will stay in Vegas. As Butch Cassidy might say, “Who are those guys?” They’re the American Coalition for Clean Coal Electricity, a collection of 48 mining, rail, manufacturing and power-generating companies with an annual budget of more than $45 million — almost three times larger than the coal industry’s old lobbying and public relations groups combined. ACCCE (pronounced “Ace”) is just celebrating its first birthday, but it has already become a juggernaut shaping the terms of the climate change debate on Capitol Hill — even while weathering a high-profile assault by critics who accuse it of peddling hot air. ACCCE’s impact will be on display starting Tuesday as House Energy and Commerce Committee hearings start on a draft climate bill penned by panel Chairman Henry Waxman (D-Calif.) and Energy and the Environment Subcommittee Chairman Ed Markey (D-Mass.). Just a year ago, Waxman and Markey backed a moratorium on new coal-fired electricity plants. But their new draft would allow new coal plants through 2015, if they are retrofitted to cut carbon dioxide output 40 percent to 60 percent within another decade. The technology to do that does not yet exist, but the new measure would set up a $1 billion-a-year clean coal research fund to help. Roots For ACCCE, there’s little doubt the new legislation represents significant progress — progress with roots that go back at least five years to a strategy hatched by two genial Kentucky natives with ties to moderate Democrats. One of them, Steve Miller, had been a campaign manager for former Democratic Kentucky Gov. Brereton Jones before taking the helm of an earlier coal industry public relations effort, the Center for Energy and Economic Development. The other, Joe Lucas, worked at a Kentucky state mining agency and the federal Mine Safety and Health Administration, and then handled coal-related communications for Clinton-era Energy Secretary Hazel O’Leary. Ten years ago, Lucas became the spokesman for another coal industry group — Americans for Balanced Energy Choices — that was working with Miller’s. For more info By 2004, though, Miller and Lucas sensed a changing landscape transformed by concern over global warming. A memo from Miller to Irl Engelhardt, then chief of mining giant Peabody Energy, spelled out a new approach. “On climate change, like other issues, you must be for something rather than against everything.” In addition, Lucas said recently, “it was clear that a much larger budget was necessary.” In 2007, he and Miller told the firms behind previous efforts that the election year of 2008 and beyond would require a more aggressive effort. Not only did Democratic presidential candidates support action on global warming, Republican front-runner John McCain had long championed the issue as well. And international negotiations kicking off in late 2009 would put pressure on the United States to lead on climate policy. Readers' Comments (25) In a logical world where it is recognized that the US has plenty of coal our energy policy would be coal based. But no. No coal, no oil, no nuclear and we just dreamed up a new tax called "Cap 'N Trade". We should not have to apologize for heating our homes or driving our cars. "Climate Change" is a bunch of bull used to expand the tax base. Like I said, we have coal, let's use it. jackieaxe, do you know anyone in western pa, or in ohio or any other places they're mining coal or natural gas? it's a highly destructive and toxic practice. it keeps you warm, but it poisons the wells of entire townships. it collapses homes. it destroys wildlife and their habitat. it renders the soil useless for growing food. you do realize that without those things I listed above, you can forget about staying warm..you'll be cold and dead. Can some PROVE to me that GW exists before we start taxing the hell out of business and putting them out of business? Sometimes I think this is what the environazis want. They had to start calling it Climate change because the earth is NOT warming. This debate will come down too who in the Republican and democrat party still believe in America. An America that was developed on the backs of the hard working coal miners; the hard working oil drillers; the hardworking loggers and the hard working ranchers and farmers. This debate will depend on if the politicians are so in love with "environmentalists", who have no idea what hard work is all about. They only know what their anti everything professors have put in their little skulls. Coal is from OUR Earth; it is here to be used until the environmentalists understand that nuclear energy is also a clean source of fuel. As it stands right now coal and oil are about the only things we can sell the world thats going to help us pay off these huge budget deficits. So we better get drilling and mining or we're all going to be in big trouble. The environmentalists would have us all riding bikes and lighting our homes with candles. If global warming is real I sure wish it would reach the Northeast, its freezing up here. where's your Yankee Ingenuity, Scott? why do you think so low of the American people's ability to innovate? No coal.....no oil.....no nuclear.....no hydro, just where is the power going to come from paw? I work in the electric utility industry and I can tell you wind is not the answer and solar technology hasn't progressed at all. Yankee ingenuity is great but where is it and what are we suppose to use while waiting for the next "big thing"? Health hazzards are a part of life paw. If I lived in a coal producing community I think I would drink bottled water and feed my babies formula just to be safe. We need jobs created in this country and people that do them know the risks involved. Smoking causes cancer but millions of people still do it. Its all about choices. Its a free country, or at least it use to be. I guess it's just the hole we've dug for ourselves. with the current model, we can't earn livings without reasonably convenient transportation. unfortunately, our current energy needs are so great, we're forced to sacrifice a part of the main system that sustains us all: our ecosystem. There is no such thing as clean coal, as in so-called clean-coal tech has not advanced one iota since the propaganda campaign began. This is about protecting entrenched corporate interests and nothing more--something so-called libertarians are often perfectly willing participants in. How much liberty will there be from a warming planet? Of course most libertarians seem to take the big cop out and deny the science of global warming. Conveniently. No coal.....no oil.....no nuclear.....no hydro, just where is the power going to come from paw? I work in the electric utility industry and I can tell you wind is not the answer and solar technology hasn't progressed at all. Yankee ingenuity is great but where is it and what are we suppose to use while waiting for the next "big thing"? Well if you work in the industy then you should know the only thing "Clean Coal" is the word clean Stripmining ruins the land , sludge ponds ruin the aquifers and coal fired power plants blech filth into to the sky. There is no such thing as clean coal, as in so-called clean-coal tech has not advanced one iota since the propaganda campaign began. This is about protecting entrenched corporate interests and nothing more--something so-called libertarians are often perfectly willing participants in. How much liberty will there be from a warming planet? Of course most libertarians seem to take the big cop out and deny the science of global warming. Conveniently. The real agenda is to repeal environment regulations and cripple the EPA After all if global warming is a myth we don't need the EPA or regulations to protect the environment. I happen to like clean air, water land We as a nation have done a great deal in the last 30 or 40 years to address pollution in all areas. Do we really want to undo all of that? I personally like being able to fish in Americas lakes and waterways this wasn't the case all that long ago. LA thanks to those horrible CA emission standards has clearer air in 2008 than it did in 1988 How much liberty will there be from a warming planet? Of course most libertarians seem to take the big cop out and deny the science of global warming. Conveniently. What's your energy plan? I don't want to dismantle the EPA but I think reason needs to enter the argument at some point. I don't want to pay an additional $3,000 a year to heat my home and drive my car through the NEW "cap 'n trade" tax. We have plenty of coal. If there's a way to utilize it, it should be our first choice. Drilling for oil doesn't look to pretty either. We could utilize nuclear but there's a vast culture of opposition to nuclear. Oil comes from terrorist nations. There is no such thing as clean coal. Even if we develop the technology to capture carbon we still need to mine the coal. What is clean about mountain top removal or coal sludge? Answer--nothing. http://images.google.com/image...http://images.google.com/image... Also, of note, more people are employed in the wind energy industry than the coal industry. http://greenwombat.blogs.fortu... The burning of coal also has significant health ramifications according to the American Lung Associations. http://lungaction.org/reports/... If politicians in washington cave to clean coal pressure, its a win for industry lobbyists and a loss for the vast majority of Americans. Call your representatives and tell them to actively oppose any clean coal funding or measures. jackieaxe, do you know anyone in western pa, or in ohio or any other places they're mining coal or natural gas? it's a highly destructive and toxic practice. it keeps you warm, but it poisons the wells of entire townships. it collapses homes. it destroys wildlife and their habitat. it renders the soil useless for growing food. you do realize that without those things I listed above, you can forget about staying warm..you'll be cold and dead What's your energy plan? I don't want to dismantle the EPA but I think reason needs to enter the argument at some point. I don't want to pay an additional $3,000 a year to heat my home and drive my car through the NEW "cap 'n trade" tax. We have plenty of coal. If there's a way to utilize it, it should be our first choice. Drilling for oil doesn't look to pretty either. We could utilize nuclear but there's a vast culture of opposition to nuclear. Oil comes from terrorist nations. You really don't get it coal is filthy no ifs ands or buts Alternatives exist such as localized power generation and conservation exist. This might be boring as ditch water but something as simple as everyone changing to energy conserving light bulbs
Ultrafast nonlinear optical studies of silicon nanowaveguides. Results of a self-consistent ultrafast study of nonlinear optical properties of silicon nanowaveguides using heterodyne pump-probe technique are reported. The two-photon absorption coefficient and free-carrier absorption effective cross-section were determined to be 0.68cm/GW, and 1.9x10(-17) cm2, respectively and the Kerr coefficient and free-carrier-induced refractive index change 0.32x10(-13) cm2/W, and -5.5x10(-21) cm3, respectively. The effects of the proton bombardment on the linear loss and the carrier lifetime of the devices were also studied. Carrier lifetime reduction from 330ps to 33ps with a linear loss of only 14.8dB/cm was achieved using a proton bombardment level of 10(15)/cm2.
TVR Cultural TVR Cultural () was the cultural channel of Romania's government-funded television network Televiziunea Română.It provided cultural news, documentaries about the arts, as well as various shows, musicals and theatrical pieces. It was closed in martie 2017. History TVR Cultural began transmission in 2002. It was built after the model of the Franco-German TV channel Arte, and other European channels, that promote programming in the areas of culture and the arts. Stop broadcasting Due to the financial crisis in which Romanian Television is immersed, Claudiu Saftoiu, president of TVR, decided to stop broadcasting in the summer of 2012. There is growing criticism of this decision, which comes at a time when other public broadcasters in the Central and Eastern Europe, including Poland’s Telewizja Polska and the Czech Republic’s Česká televize, "are planning to add to their channel portfolios" . See also Arte Mezzo TVP Kultura References External links TVR Cultural ID - Soprano & Tatoo TVR Cultural Cultural Category:Television channels and stations established in 2002 Category:Television channels and stations disestablished in 2012 Category:2002 establishments in Romania Category:2012 disestablishments in Romania Category:Defunct television channels in Romania
Woman who killed neighbour’s cat in microwave is jailed for six months Mother of three Gina Robins, who killed a friend’s kitten in a microwave, has been jailed for six months. Gina Robins who has been sentenced to six months in prison for putting a neighbour’s kitten in a microwave (Picture: SWNS) Robins was told the offence was so serious that only a custodial sentence was appropriate. The 31-year-old, who has no previous convictions, was also banned from keeping animals for ten years. ‘We have seen little remorse for the death of the kitten or the trauma caused to your former friend,’ she was told by bench chairman Liz Clyne at Torquay magistrates’ court. The revenge attack happened at the home of cat-owner Sarah Knutton, who had reported Robins’s abusive partner to police, a trial heard last month. Robins put the ten-week-old pet in the microwave after using it to warm food for her 18-month-old son, Oliver. Miss Knutton then said she heard a noise ‘like a crisp packet being popped’ followed by a loud ‘screeching’. Robins, of Torquay, Devon, later sent a text message ending their friendship and claiming the killing last February was ‘karma’. She denied animal cruelty and claimed the microwave was accidentally turned on by another cat after the kitten got inside. But magistrates found her evidence ‘far-fetched’ and ‘inconsistent’.
Match Preview: Basingstoke Town v Dorchester Town Sat 6th Oct Whilst smaller teams such as Horsham and Moneyfields will be welcoming it’s FA Cup opponents this Saturday in the next round of the FA Cup, our own FA Cup run is over and done with yet again before October, so we return to the league this weekend and welcome Dorchester Town another team dumped out of the cup, by our last Saturday’s opponents Tiverton 2–0. Dorchester Town sit just two places above the relegation zone in 18th place with 8pts from 8 games so far this season. With just two wins, two draws and 4 losses and -9 goal difference, The Magpies may well be happy to come to the Camrose, not just because Stoke have gone off the boil recently and are leaking goals like the Titanic, but also their performances on their brand new installed 3G pitch, appear not to have suited the team from Dorset as they had hoped. Having lost at home to Met Police (our opponents, Saturday week) 0-1, a weak 2-2 draw against Kings Langley, then a late winner against local team Hartley Wintney 2-1, they were then humbled 0-3 at home to Hendon last Saturday. Mind you there away isn’t that much better with a 2-4 win at Wimborne in the middle of hammerings at Salisbury 3-0 and local rivals Weymouth 5-0. Their 8th point was a 2-2 draw at Beaconsfield Town. As for our recent record against the Magpies, well it isn’t that great, in fact it is pretty awful almost shocking. In the past two seasons we have played them 4 times in the league and are yet to beat them. Last season we were held 1-1 at the Camrose, whilst losing 1-0 at the Avenue Stadium. We have also played them the past two seasons in the FA Trophy, which in 2016-17 was our only recent win when for those who attended the game in Dorchester, saw an amazing game where we somehow run out winners 0-3 on a day when it could have been 8-8. We played them in 2017-18 season but were knocked out 2-1. So, as we enter this Saturday’s game, Basingstoke now sit in 7th spot and are desperate to re-start it’s league season. As for our squad, it is unlikely that Sam Deadfield whatever his injury turns out to be, is unlikely to play this weekend, whilst Dan Bayliss re-aggravated an ankle injury, but it is expected that he will be in the line-up come Saturday. I will update when I can. Jack McKnight without doubt has been a revelation since winning a starting role and is the other real goal-scoring threat from midfield. Dean Stow has secured the penalty taking role for the season. Whatever, line-up Jason Bristow decides to go with, we need to win the midfield battle, so would assume Charlie Kennedy & Dan Collier will be the first names on the teamsheet. So along with McKnight, that’s 3 of your midfield set. Is it time to start with two-up front, I have always been a firm believer of that and would like to see Argent supported by the aerial influence of Callum Bunting from the start. If we go with that, we will have to go with one winger, which likely means pushing Akers to the bench. As for the defence, we have conceded goals from the near post in recent weeks and think we need to counteract this Saturday (and every other match too). Dorchester have always proved to be a dogged team to play and will no doubt be the same this Saturday, but let’s hope for a performance that can get the crowd cheering and an early goal or two would help.
Q: Scrape Dynamic Data from Website Using C# HTMLAGILITYPACK I am scraping data using HTMLAGILITY Pack, but the page doesn't load properly. I need that my code should wait until the page is fully loaded. There is some kind of work around to use browser in form, but I don't need to use that in form. Here is the Link I need to scrap and following is my code. HtmlWeb web = new HtmlWeb(); ServicePointManager.SecurityProtocol = SecurityProtocolType.Tls12; HtmlAgilityPack.HtmlDocument doc = web.Load(website); var goldTypes = doc.DocumentNode.SelectNodes("//h2[@class='gold-box-title']").ToList(); var goldPrices = doc.DocumentNode.SelectNodes("//span[@class='gold-box-price--sale'").ToList(); for (int i = 0; i < 2; i++) { string goldPrice = goldPrices[i].InnerText; string goldType = goldTypes[i].InnerText; } A: You were correct, all the data is available in structured json in the ":buyable" attribute of the "buyable-gold" elements. I did a quick test and this should be what you want. This will give you a list of structured objects with the data you need. HtmlWeb web = new HtmlWeb(); ServicePointManager.SecurityProtocol = SecurityProtocolType.Tls12; HtmlAgilityPack.HtmlDocument doc = web.Load("https://www.ezrsgold.com/buy-runescape-gold"); var buyGoldNodes = doc.DocumentNode.SelectNodes("//buyable-gold"); var buyableJsonList = buyGoldNodes.Select(x => HttpUtility.HtmlDecode(x.Attributes[":buyable"].Value)).ToList(); var buyables = buyableJsons.Select(x => JsonConvert.DeserializeObject<Buyable>(x)).ToList(); Then your Buyable class would look something like this. public class Buyable { public int id { get; set; } public string sku { get; set; } public int game_id { get; set; } public string title { get; set; } public int min_qty { get; set; } public int max_qty { get; set; } public string base_price { get; set; } public string sale_price { get; set; } public Bulk_Price[] bulk_price { get; set; } public string delivery_time { get; set; } public string description { get; set; } public object sort_order { get; set; } public string created_at { get; set; } public string updated_at { get; set; } public string price { get; set; } public bool on_sale { get; set; } public int discount_from { get; set; } } public class Bulk_Price { public string qty { get; set; } public string price { get; set; } }
The death toll for U.S. service members in Afghanistan rose Friday after a fatal helicopter crash. The helicopter reportedly hit a tree while delivering troops to the Kharwar district for a night raid. The collision forced the crew to make an emergency landing, during which one crew member was killed. The six others injured in the crash are receiving medical treatment, according to Stars and Stripes, which cites local sources. The Taliban claimed to have shot down the helicopter and killed dozens of Americans. “We can confirm the crash was not the result of enemy action,” NATO’s Resolute Support Mission said in a statement. “We have full accountability for all personnel and the crash site has been secured.” An investigation into the incident is already underway. “We are deeply saddened by the loss of our comrade,” Gen. John Nicholson, commander of Resolute Support, said in a statement. “On behalf of all Resolute Support, our heartfelt sympathies go out to the families and friends of our fallen comrade and those injured in this unfortunate event.” A dozen U.S. service members have died in Afghanistan this year. More than 2,000 Americans have given their lives in service of their country since the U.S. began waging war in Afghanistan 16 years ago. The latest fatal incident comes amid a build-up of troops in the region to eradicate radical Islamic terrorism. Follow Ryan on Twitter Send tips to ryan@ dailycallernewsfoundation.org. Content created by The Daily Caller News Foundation is available without charge to any eligible news publisher that can provide a large audience. For licensing opportunities of our original content, please contact licensing@dailycallernewsfoundation.org.
The cables, such as insulated strands or solid conductors made of copper or steel, that are worked on the cable processing device are usually provided in drums, on reels or as bundles and are conveyed by means of a cable conveying device to the processing station. A cable processing device is disclosed in EP 1 447 888 A1, for example. EP 1 447 888 A1 discloses a cable processing device comprising a stripping unit and two crimping stations as processing stations. The cable is guided to the processing stations by means of a cable conveying device formed as a belt drive, said cable conveying device being configured as a cable feed for moving the cable along a machine longitudinal axis of the cable processing device. When the cable supply, for example a cable reel, runs out, a new cable must be removed from a new cable reel and supplied to the processing stations. For cable preparation, it may also be necessary to work other cables, for example cables of another color. For this purpose, it is known to use a cable processing device comprising a cable changer. Cable changers for the selective supply of cables to the processing stations typically comprise two guide units for guiding and holding one cable each. Owing to the second guide unit, in which a second cable is guided and held, a more rapid cable change is possible. The second or additional guide unit makes it possible to prepare a second cable during operation or while the cable processing device is operating. This can prevent an interruption in production, for example due to an emptying cable drum, in that a new drum is provided and the corresponding cable is already accommodated in the second guide unit. The changeover time can be shortened and two different cables can be worked alternately as necessary. A cable changer of this kind has been disclosed in EP 1 879 199 A2, for example. In the case of this cable changer, the guide units are cylindrical. For the cable change, one rotational movement must be carried out, which leads to a complicated mechanical construction. The drum must be lowered together with the two guide units including a rotary bearing for the drum, in order to bring the cable into the operating region of the cable conveying device. A further disadvantage is that the cables may cross and touch each other. A cable processing device comprising guide units that are also cylindrical has been disclosed in DE 41 05 631 A1. In order to change a cable to another, a selective rotational movement must be carried out, in which all of the guide units are rotated with each other. A further cable processing device comprising a cable changer of the type mentioned at the outset is disclosed in EP 1 213 800 B1. This cable changer may accommodate a large number of cables that are optionally supplied, by means of the cable conveying device, to the processing stations in order for the cable ends to be processed. The cable changer comprises a plurality of guide units that are arranged linearly one above the other. The guide units are arranged in a vertical frame in this case. The frame can be moved up and down in the vertical direction. The cables arranged on top of each other in the cable changer may have different cross sections, colors, insulations and/or conductor properties. Depending on the cable to be worked, the frame is moved up or down until the relevant cable guide comprising the desired cable is in the correct position on the machine longitudinal axis in the cable conveying device. The cable processing device comprising this cable changer is characterized by high variability and the cable changer can be used in sequence processing and in particular for housing assembly; however, the machine is expensive and complex and leads to relatively high initial costs. In this system, it is also impossible or at least nearly impossible to introduce new cables into the cable changer during operation.
NEW YORK — Deron Williams had a tough decision to make. A two-time Olympian and three-time All-Star, Williams was one of the league’s most sought-after free agents this offseason. Heavily recruited by his hometown Dallas Mavericks and his current team, formerly known as the New Jersey Nets, the point guard chose to stay with the Nets and signed a contract for five years and $98.7 million. Then again, this season’s Nets aren’t exactly the same team that acquired Williams from the Utah Jazz back in February of 2011. The Nets have left the Garden State for the Empire State and are now the Brooklyn Nets. They have new uniforms with a classic black-and-white design and a logo that references Brooklyn’s 1950s-style subway signs. They also have a new arena, the Barclays Center. After opening Sept. 21 with a series of concerts by Nets minority owner Jay-Z, the first basketball game there was Monday’s preseason contest between the Nets and the Wizards. “It’s going to be the best arena in the NBA, hands down,” Williams said. “People are excited about a team coming here.” It won’t be an easy task to supplant Madison Square Garden as the premier sports arena in New York, or make a dent in the Knicks’ fan base, but the Brooklyn Nets are hoping to do just that with their arena and by putting an exciting product on the floor. The Nets were unsuccessful in landing former Orlando Magic center Dwight Howard, who originally asked for a trade to Brooklyn before signing with the Los Angeles Lakers, but they were successful in getting six-time All-Star swingman Joe Johnson. The tandem of Johnson and Williams will give the Nets one of the most potent backcourts in the NBA. They are also planning to go head-to-head with the Knicks in the battle for celebrity fans, thanks in part to Jay-Z and his wife, Beyonce, who will court the entertainment crowd. The Nets also are also the subject of this season’s NBA TV reality show, The Association, which will follow the team all season. A side note for Wizards fans is the addition of Andray Blatche to the Nets’ roster. Washington released the polarizing forward/center in July using the amnesty provision. Blatche chose the Nets over the defending champion Miami Heat after what he called a “sales pitch” from Nets coach Avery Johnson. “The conversation I had with Avery was more what I needed from him,” Blatche said in an interview with the New York Daily News. “It was about putting together a personal plan for me. I felt that would help me get to where I needed to be.” As for his time with the Wizards and the way his career in D.C. ended, Blatche says he’s put it behind him. “To be honest with you, I’ve forgotten about Washington,” Blatche said. “It’s old. It happened. I took it. Now I’m moving on. I can’t do over the past.” The Wizards and Nets will meet four times, each hoping to avoid another appearance in the draft lottery. The Wizards have missed the playoffs the past four seasons, the Nets the past five. Nets majority owner Mikhail Prokhorov made the bold promise to put a championship team on the court within five years after buying the team in 2010. “It’s easy to make a strong team, but it’s very difficult to make a championship team,” Prokhorov said when Barclays Center opened last month. “So we are on the right way, and I’m expecting our championship within three years now.”
LA MANSION steakhouse inside Mexico’s lower house of Congress has become the headquarters of a lobbying effort the likes of which congressmen say they have never seen before. There is so much wining and dining that one lawmaker, proposing a bill on October 15th to regulate the lobbyists, claimed he was talking to a half-empty floor because his colleagues were too busy being schmoozed at La Mansion. The lobbyists work mainly for soft-drinks companies such as Coca-Cola, PepsiCo and their respective Mexican bottlers Femsa and Cultiba. Their focus is a proposal currently under debate in Congress to slap an excise tax of one peso (about eight American cents) on to the price of a litre of fizzy drinks. Though the industry has faced down consumer activists in the past in Coca-Cola’s biggest market by volume outside the United States, this initiative comes directly from President Enrique Peña Nieto. The lobbyists may have blundered in their attempt to kill it. The government’s argument is simple. Mexicans consume too many fizzy drinks (on average 40% more per person than people in the United States). The habit has helped make the country one of the most obese in the world, and obesity is a killer: Mexico’s mortality rates from diabetes are staggeringly high. The government proposed the “sin tax” to discourage soft-drinks consumption. The industry’s reaction has been apoplectic. In full-page ads in national newspapers it has argued that the tax is regressive and “satanises” soft drinks, which it claims do not cause obesity. With a hint of xenophobia, the lobbyists call it the “Bloomberg tax”, because New York’s mayor, Michael Bloomberg, has also sought to tax fizzy drinks. Bethany Gomez of Euromonitor International, a consultancy, says the industry is right to be worried. More than half the fizzy drinks sold in Mexico are in bottles of two litres or more, which is where the extra pesos would be most noticeable. A switch to smaller sizes would hit volumes. What is more, the tax may set a precedent. “Coca-Cola seems to be worried that whatever happens here could spread to the rest of Latin America,” says Javier Treviño, a ruling-party lawmaker. The lobbyists have made some missteps, congressmen say. They have created enemies in other industries by proposing that the tax be charged on sugar content, not just on soft drinks. That angers companies like Nestlé, which makes sugary snacks, as well as Mexico’s politically connected sugar-cane producers. They have also been too overt in their lobbying, in a political system that is used to more subtle forms of collusion between lawmakers and business. One of Femsa’s main lobbyists, a former ruling-party bigwig, is said to have had a blazing row with the current head of the party in the lower house, who resented being bossed around. So the soft-drinks lobbyists’ tactics may have backfired. As The Economist went to press there was still no final agreement on the soft-drinks tax—but congressmen appeared ready to approve the one-peso levy—as well as extending another tax to junk food.
Daimler Chrysler Ins. Co. v Keller (2018 NY Slip Op 05999) Daimler Chrysler Ins. Co. v Keller 2018 NY Slip Op 05999 Decided on September 12, 2018 Appellate Division, Second Department Published by New York State Law Reporting Bureau pursuant to Judiciary Law § 431. This opinion is uncorrected and subject to revision before publication in the Official Reports. Decided on September 12, 2018 SUPREME COURT OF THE STATE OF NEW YORK Appellate Division, Second Judicial Department ALAN D. SCHEINKMAN, P.J. REINALDO E. RIVERA CHERYL E. CHAMBERS HECTOR D. LASALLE, JJ. 2016-01154 (Index No. 20328/09) [*1]Daimler Chrysler Insurance Company, etc., appellant, vElliot Keller, et al., defendants, RLI Insurance Company, respondent. Gordon & Haffner, LLP, Harrison, NY (David Gordon of counsel), for appellant. Kenney Shelton Liptak Nowak, LLP, Buffalo, NY (Elsa J. Schmidt of counsel), for respondent. DECISION & ORDER In a subrogation action to recover insurance benefits, the plaintiff appeals from an order of the Supreme Court, Kings County (Francois A. Rivera, J.), dated October 30, 2015. The order granted the motion of the defendant RLI Insurance Company for summary judgment dismissing the complaint insofar as asserted against it, and denied the plaintiff's cross motion for summary judgment on the complaint. ORDERED that the order is affirmed, with costs. On June 26, 2002, Elliot Keller was involved in a motor vehicle accident with Ojie Ferguson. At the time of the accident, Elliot was driving a vehicle he and Susan Keller (hereinafter together the Kellers) had leased from Chrysler Financial Company (hereinafter CFC). The Kellers were insured under a primary policy with Travelers Insurance Company (hereinafter Travelers), and Elliot had an umbrella policy with RLI Insurance Company (hereinafter RLI). In 2003, Ferguson commenced an action against the Kellers and CFC. The Kellers first notified RLI of the accident and the lawsuit in August 2006, and RLI issued a disclaimer letter on September 5, 2006, denying coverage to all defendants for "late notice of suit." The Ferguson action was settled in 2007, with Daimler Chrysler Insurance Company (hereinafter DCIC) paying $250,000 toward the settlement on behalf of its insured, CFC, and Travelers paying $250,000. Thereafter, DCIC commenced this action, as subrogee of CFC, against the Kellers, and subsequently moved, inter alia, to amend the complaint to add RLI as a defendant. Upon receipt of the motion, RLI issued a disclaimer letter to DCIC on June 3, 2010. After RLI was added as a defendant, it moved for summary judgment dismissing the complaint insofar as asserted against it based on CFC's failure to provide timely notice of the occurrence, claim, and underlying suit. DCIC cross-moved for summary judgment on the complaint. The Supreme Court granted RLI's motion on the basis that CFC did not qualify as an insured under the RLI policy, a ground not raised by either party, and denied DCIC's cross motion. DCIC appeals and we affirm, albeit for reasons different from those stated by the Supreme Court. The Supreme Court erred in essentially searching the record and granting relief based upon arguments that were not raised (see Rosenblatt v St. George Health & Racquetball Assoc., LLC, 119 AD3d 45, 52-53; Quizhpe v Luvin Constr., 70 AD3d 912, 914). "A motion for summary judgment on one claim or defense does not provide a basis for searching the record and granting summary judgment on an unrelated claim or defense'" (Baseball Off. of Commr. v Marsh & McLennan, 295 AD2d 73, 82, quoting Sadkin v Raskin & Rappoport, 271 AD2d 272, 273; see Rosenblatt v St. George Health & Racquetball Assoc., LLC, 119 AD3d at 53; Quizhpe v Luvin Constr., 70 AD3d at 914). Contrary to the court's determination, in its motion, RLI did not assert that CFC was not an additional insured, but rather asserted that, even assuming CFC could prove it qualified as an insured under the policy, it failed to satisfy the notice requirements of the policy. The parties had no opportunity to address the issue of CFC's status as an insured (see Frank M. Flower & Sons, Inc. v North Oyster Bay Baymen's Assn., Inc., 150 AD3d 965, 966; Matter of Meighan v Ponte, 144 AD3d 917, 918; Mew Equity, LLC v Sutton Land Servs., LLC, 144 AD3d 874, 877). In the interest of judicial economy, we deem it appropriate, under the circumstances of this case, to address RLI's motion on the merits, rather than remitting the matter to the Supreme Court to do so (see Rosenblatt v St. George Health & Racquetball Assoc., LLC, 119 AD3d at 56). We note that the issue has been fully briefed by the plaintiff and RLI. RLI established, prima facie, its entitlement to judgment as a matter of law dismissing the complaint insofar as asserted against it based upon CFC's failure to provide timely notice of the occurrence and suit. "The insured's failure to satisfy the notice requirement constitutes a failure to comply with a condition precedent which, as a matter of law, vitiates the contract'" (Great Canal Realty Corp. v Seneca Ins. Co., Inc., 5 NY3d 742, 743, quoting Argo Corp. v Greater N.Y. Mut. Ins. Co., 4 NY3d 332, 339; see Sputnik Rest. Corp. v United Natl. Ins. Co., 62 AD3d 689, 689). This rule applies to excess carriers as well as primary carriers (see American Home Assur. Co. v International. Ins. Co., 90 NY2d 433, 443). "[A] justifiable lack of knowledge of insurance coverage may excuse a delay in reporting an occurrence" (Winstead v Uniondale Union Free School Dist., 201 AD2d 721, 723; see Albano-Plotkin v Travelers Ins. Co., 101 AD3d 657, 658). To establish a valid excuse due to the insured's alleged ignorance of insurance coverage, the insured has the burden of proving "a justifiable lack of knowledge of insurance coverage" and "reasonably diligent efforts to ascertain whether coverage existed" upon receiving information "which would have prompted any person of ordinary prudence to consult either an attorney or an insurance broker" (Winstead v Uniondale Union Free School Dist., 201 AD2d at 723; see Albano-Plotkin v Travelers Ins. Co., 101 AD3d at 658). Here, in support of its motion, RLI submitted evidence that counsel for the Kellers and CFC in the underlying action performed an investigation and learned the detailed information regarding the umbrella policy in March 2005. Such knowledge is imputed to CFC (see Center v Hampton Affiliates, 66 NY2d 782, 784). As such, RLI established that RLI was given no notice of the accident or lawsuit until August 2006, and CFC did not provide notice until RLI was served with DCIC's motion to amend the complaint in June 2010. In opposition, DCIC failed to raise a triable issue of fact (see McGovern-Barbash Assoc., LLC v Everest Nat. Ins. Co., 79 AD3d 981, 984; 120 Whitehall Realty Assoc., LLC v Hermitage Ins. Co., 40 AD3d 719, 721). DCIC concedes that CFC had knowledge of the umbrella policy as of the time it received RLI's September 5, 2006, disclaimer letter, yet offered no explanation as to why CFC did not provide notice until service of DCIC's motion to amend the complaint to name RLI as a defendant on or about June 1, 2010 (see Ortiz v Fage USA Corp., 105 AD3d 720, 721; Sputnik Rest. Corp. v United Nat. Ins. Co., 62 AD3d at 689). Contrary to DCIC's contention, RLI did not waive its right to deny coverage to CFC based on its disclaimer letter dated September 5, 2006, since that disclaimer denied coverage based on late notice of suit of all the defendants, not just the named insureds (see General Acc. Ins. Group v Cirucci, 46 NY2d 862, 864). Accordingly, we agree with the Supreme Court's determination granting RLI's motion for summary judgment, albeit for reasons different from those stated by the court. SCHEINKMAN, P.J., RIVERA, CHAMBERS and LASALLE, JJ., concur. ENTER: Aprilanne Agostino Clerk of the Court
Bulbophyllum aristilabre Bulbophyllum aristilabre is a species of orchid in the genus Bulbophyllum. References The Bulbophyllum-Checklist The Internet Orchid Species Photo Encyclopedia aristilabre
Doxorubicin-induced Cardiotoxicity and Cardioprotective Agents: Classic and New Players in the Game. Doxorubicin (DOX) is a cytostatic antibiotic from the class of anthracyclines widely used in chemotherapeutic cancer treatments. Despite the efficiency against several types of cancer, the use of DOX remains limited due to the side effects, especially cardiotoxicity. Among the DOX administration strategies, there are the "classic players" such as nanoparticles and polymers, which are capable of DOX delivery directly to interesting neoplastic regions. On the other hand, the "new players" such as phytochemicals and probiotics emerged with the proposal to react with DOX free radicals, reducing the oxidative stress, inflammatory and apoptotic process. Thus, this review aims to report the studies involving these classics and new players along the years that focus on improved administration and reduction of DOX-induced cardiotoxicity.
Two weeks ago, Washingtonians gathered to celebrate the 100th birthday of The New Republic, the magazine that helped shape Woodrow Wilson’s views on democracy and torpedo Bill Clinton’s health plan. On Thursday, the venerable Washington institution announced it is shifting its headquarters to New York, amid a shakeup that saw the resignation of its highest editors and promised to redefine the identity of a century-old institution that once served as liberalism’s leading voice. Franklin Foer, the top editor, sent a memo to staff in the afternoon announcing that he would be quitting due to differences of vision with the magazine’s owner, Chris Hughes, a 31-year-old Facebook co-founder who bought the magazine in 2012 and now aspires to reposition it as a “digital media company.” The move came, sources said, after Foer discovered that Hughes had already hired his replacement, Gabriel Snyder, a Bloomberg Media editor who formerly ran The Atlantic Wire blog. In an impromptu address at the magazine’s office in Washington, Leon Wieseltier also told staff that he would be quitting after 31 years as literary editor. His time at TNR, he said through tears, was “the best thing I’ve done in my little life.” ( Also on POLITICO: After shake-up, New Republic staffers resign en masse) On Friday, the majority of The New Republic’s masthead resigned en masse to protest the decision. Nine of the magazine’s 12 senior editors submitted letters of resignation to Hughes and chief executive Guy Vidra, as did two executive editors, the digital media editor, the legislative affairs editor, and two arts editors. At least 20 of the magazine’s contributing editors also requested that their names be removed from the magazine’s masthead. The New Republic will continue to maintain a D.C. office, but be based primarily in New York. It will also cut its publication frequency in half, publishing just 10 print issues a year. Vidra announced those changes in a memo to staff following Foer’s resignation. Through its history, The New Republic has been a vehicle for progressive thinking, while priding itself on a willingness to challenge liberal orthodoxy, from the left or right. In its early decades, it provided intellectual fuel for the emergence of the United States as an international force. And in recent decades, particularly after the 9/11 attacks, it continued to urge a robust foreign policy, even endorsing the 2003 invasion of Iraq. Whether it can, or even wants to, maintain a similar posture as it plots a radically different future was a matter of speculation among the magazine’s many illustrious readers and alumni. ( Also on POLITICO: Candy Crowley out at CNN) Hughes, Foer and Wieseltier all did not respond to requests for interviews and comment on Thursday. The New Republic’s spokesperson, Annie Augustine, also did not respond to requests for interviews with Hughes, Vidra and Snyder. Franklin Foer, left, and Leon Wieseltier announced they would be quitting. | Getty In his memo, Vidra wrote that TNR would be making “significant investments in creating a more effective and efficient newsroom as well as improved products across all platforms.” “Given the frequency reduction, we will also be making some changes to staff structure,” Vidra wrote. “This is not a decision we make lightly, but we believe this restructuring is critical to the long-term success of the company.” The shakeup has been in the works for months. When Hughes bought TNR in 2012, at the age of 28, he had aspired to restore respectability and influence to the financially crippled magazine. He reinstated Foer, who had served as editor from 2006 to 2010, and gave Wieseltier his backing. From the get-go, The New Republic struggled to make a mark on Washington and Hughes struggled to generate ad revenue. By 2014, Hughes was thinking of ways to restructure the magazine for digital growth, even at the expense of its legacy. In September, he hired Vidra, the former general manager of Yahoo News, to serve as TNR’s first-ever chief executive. ( Also on POLITICO: House sends Obama message with immigration vote) Vidra’s vision for TNR was radically different than that of Foer and Wieseltier. In meetings with staff, he spoke of the magazine as though it were a Silicon Valley startup, sources said. He talked about “disruption” and said he wanted to “break shit.” He referred to himself as a “wartime CEO.” At one point, he proposed giving every employee shares in the company, suggesting that he had plans to make it public. Sources said that Vidra also showed little regard for Foer or his writers. In a meeting held in November, he made it clear to staff that he found the magazine boring and had stopped reading longform articles. Three weeks later, at the magazine’s 100-year anniversary gala — a star-studded, black-tie affair featuring speeches from former President Bill Clinton and Supreme Court Justice Ruth Bader Ginsburg — Vidra mispronounced Foer’s name while introducing him to the audience. (He pronounced “Foer” as “Foyer.”) In a turnaround that stunned staffers and contributors, Hughes decided to stake TNR’s future on Vidra’s vision rather than Foer’s. In an interview with The New York Times last month, Hughes said he no longer even thinks about TNR as a magazine. “Today, I don’t call it a magazine at all. I think we’re a digital media company.” Both Foer and Wieseltier were aware of the changes taking place, even if Hughes and Vidra didn’t always tell them. Hughes, sources said, was terribly conflict averse. Foer found out that Gabriel Snyder had been tapped to replace him only after hearing that the Bloomberg Media editor was making attempts to hire people for TNR in New York. Foer then approached Hughes to ask if Snyder had indeed been hired to replace him, and Hughes came clean. Foer and Wieseltier then moved to resign. Chris Hughes, left, bought the magazine in 2012 and now aspires to reposition it as a “digital media company.” | AP Photo ( Also on POLITICO: This week's Cartoon Carousel) Hughes and Vidra’s changes and their handling of the transition have rankled many current and former staffers and contributors. “I was under the impression when Chris Hughes took over that he understood the importance of and wanted to preserve long-form journalism,” Robert Kagan, a contributing editor at the magazine, told POLITICO. “That’s certainly what he told me when I met with him.” Kagan told POLITICO that he would be resigning as a contributing editor. The New Yorker’s Ryan Lizza also requested, via Twitter, that his name be removed from the list of contributing editors. Jonathan Chait of New York magazine has also asked that his name be removed. On Thursday night, staffers gathered at Nopa, a Washington bar, to lament the change. “We won’t be excited to go to work without Frank there,” one told POLITICO. Others described themselves as “pissed” and “devastated.” Late Thursday, Vidra sent another email to TNR staff assuring them that the D.C. office would not be dissolving. “We are going to be sending an invite to our all-hands meeting tomorrow momentarily and are planning on holding the meeting at 10 a.m.,” Vidra wrote. “I will be in DC in person to help answer questions. I also want to take this opportunity to clarify something from my earlier note. While I discussed our move to a new, expanded office in New York, by no means does that mean that we are shuttering DC, nor are we asking employees to relocate. We are committed to supporting the DC staff and the vital work you do every day.” Still, the center of operations is moving to New York, and the widely held belief now is that Hughes plans to use TNR to chase clicks and web traffic, a la BuzzFeed, while sacrificing its reputable brand as a political and literary magazine. “Assuming Chris really does plan to dumb it down in the name of clicks, what’s maddening is the way he has betrayed the premise on which he bought it. It’s like buying a historic Victorian mansion with the promise of preserving it — and then carving it into condos two years later,” one former longtime TNR staffer told POLITICO. “I hope Chris realizes how much intellectual firepower he’s losing here — and how hard it is to fake intellectual substance,” the former staffer said. “It makes no sense to publish clickbait under the TNR name (again, if that’s really his plan), you might as well just build a new thing from scratch.” On Twitter, the Washington media establishment responded with equal shock and disgust. “Awful to hear @FranklinFoer and Leon Wieseltier are out at @tnr. There are no better journalists out there,” Peter Baker, the New York Times’ chief White House correspondent, wrote. “Time to cancel the subscription.” “Frank Foer and Leon Wieseltier are supremely talented and will be fine,” wrote The Atlantic’s Jeffrey Goldberg. “It’s The New Republic that’s in desperate trouble.” Hadas Gold contributed to this report. Correction: This post has been updated to correct the spelling of Kagan’s name. Follow @politico CORRECTION: Corrected by: Jennifer Shutt @ 12/04/2014 09:42 PM Correction: An earlier version of this story misidentified Robert Kagan.
"If you look at successful people, nine times out of ten they will tell you stories of tremendous struggle. If you've got a different kind of brain and, I submit, that most interesting people do, that's great. Never lose sight of those strengths, those talents, because that is what's going to take you to great places." Lemon Tree is a family owned speech therapy center dedicated to helping children and teens with language–based learning differences. The center was created to help identify and treat those students who feel an overwhelming sense of frustration with learning and often times, slip through the cracks. If not properly identified and understood, learning differences can have devastating effects on a child’s educational, social, and emotional well-being. Lemon Tree offers positive solutions and support to students who, although bright, are not responding to traditional education and intervention. Lemon Tree specializes in the ability to zero in on the root cause of children’s learning difficulty and intervene with the right treatment that effectively retrains their underlying weakness. Our goal is to empower students to identify their innate strengths as learners and reach their intended educational potential. HOW DO WE DO IT? THE BREAKDOWN: ✤ First, we identify and target the underlying deficit. Identifying and understanding the underlying deficit is of paramount importance to the success of your child’s educational progress. If the underlying deficit is not properly identified or understood, your resources can quickly be drained with little or no results. Furthermore, the negative impact of yet another frustrating, non-productive learning experience for your child will only add insult to injury to his emotional well-being. ✤ Then we intervene with the right treatment strategies. The domino effect. With the underlying deficit properly identified, we can intervene with the right treatment strategies. Hence, our mantra: work smarter, not harder. If your child is not responding to traditional education, repetition and trying harder is certainly not the solution. Your child learns differently. You have to intervene differently. With the right treatment strategies and approaches, your child’s processing pathways can be retrained to make reading, writing, and language more efficient. THE OUTCOME: Improved learning efficiency, restored self-confidence and more time for your child to enjoy being a kid.
Friday, January 23, 2009 Cookbook Week: The Vegan Table The Menu: Sweet and Spicy Pumpkin Soup alongside olive oil-brushed, toasted ciabatta and a healthy helping of fresh salad greens. If I do say so myself, our vegan table was lookin' and tastin' pretty snazzy, thanks to Ms. Colleen's immaculate culinary creation. Crunchy bread dipped in a smooth pumpkin-purée, seasoned with a medley of sweet and savory spices made a perfect pair. Yum. The Goods: With half of the VN staff out at the WIPP Women's Leadership Conference, the office is feeling a wee bit empty this afternoon, which made us extra excited to fill up with this hearty meal inspired by Collen Patrick-Goudreau's soon-to-be-available cookbook. Yes, from the author of the celebrated The Joy of Vegan Baking comes a second and equally magnificent roster of recipes. With more than 200 to choose from, Ms. Colleen did an excellent job. Her version of this autumn-inspired soup made for a perfect cookbook week finale. Although MIA here in the VN kitchen, she was kind enough to whip up this batch of made-from-scratch soup and have it hand-delivered. Thanks, Colleen!
Lower number and thinner myelin of large myelinated fibers in human cervical compression radiculopathy. The authors conducted a morphometric investigation of the histopathological alterations in myelinated fibers (MFs) of the nerve roots of C-6, which showed macroscopic indentation, presumably due to cervical spondylotic radiculopathy. In six cadavers, designated as the radiculopathy group, in which the nerve roots of C-6 showed indentation due to compression on one side (indented side) and the remaining nerve roots (normal side) showed a normal appearance macroscopically, morphometric findings of the nerve roots and the MFs on both the indented and normal sides were evaluated and subjected to blind comparison. Seven cadavers with normal-appearing C-6 nerve roots served as controls. In the control group, there were no differences in the morphometric parameters: that is, total transverse fascicular area, total number of small and large MFs, and relationship between myelin thickness and the radius of the axon between the right and left sides in either the ventral or dorsal roots. There was no evidence found of axonal degeneration, ongoing demyelination, or loss of MFs in either the ventral or dorsal roots in the radiculopathy group on the indented side. However, there were significantly lower numbers of large MFs per root and significantly thinner myelin sheaths relative to axon size on the indented side compared with those on the normal side in both the ventral and dorsal roots. These findings are characteristic alterations of the MFs produced by chronic low-grade compression.
How Detecting Neurotransmitter Imbalance Can Help You to Feel Better Detecting Neurotransmitter Imbalance: Neurotransmitters, chemicals in our brains that work as messengers between brain cells, are responsible for most of what goes on in our bodies. They regulate our behavior, our emotions, our ability to learn, and the way we sleep. When these chemicals are not present in the proper balance, it can affect everything from our energy levels to our ability to focus to how we feel. Studies have shown that neurotransmitters have a tremendous influence on our mood, and insufficient levels of certain neurotransmitters have been identified in patients with emotional disorders and mental illness. What, exactly, are neurotransmitters, and how do they work? Our brain contains specialized nerve cells, called neurons, which are responsible for receiving information, processing it, and transmitting it to other cells. Neurons are not in direct contact with one another; in order for neurons to pass messages to each other, they rely on highly specialized chemicals called neurotransmitters. How Detecting Neurotransmitter Imbalance Can Help You to Feel Better: Neurotransmitters are made out of amino acids, which come from proteins. Neurotransmitters are made out of amino acids, which come from proteins – you will see why this is important further on. The neurotransmitters essentially bridge the “gaps” (called synapses) between neurons to relay their messages. When these neurotransmitters exist at insufficient levels, important information may not be passed along correctly. Some of the important neurotransmitters that affect our moods are described here. Acetylcholine -regulates voluntary movement, sleep, memory, and learning. Too much acetylcholine is present with depression, and too little is present in patients with dementia. Dopamine – helps to regulate learning, focus and movement. Excessive levels of dopamine are present in patients with schizophrenia; too little dopamine is associated with depression, as well as the tremors exhibited by patients with Parkinson’s disease. Norepinephrine (noradrenalin) – helps to regulate appetite and alertness; low levels are found in patients with depression, while excessive norepinephrine has been found in patients with schizophrenia. What causes neurotransmitter imbalance? Neurotransmitter imbalance can be caused by high levels of stress. Diet also plays an important part in maintaining neurotransmitter levels. The formation of neurotransmitters requires sufficient levels of dietary protein, in addition to certain vitamins and minerals. Medications, drugs and alcohol, hormone imbalances, genetics, and heavy metal toxicity can all play a role in neurotransmitter depletion, as well. Neurotransmitter Testing Typically, treatment for any of the disorders described here involves medication, which is prescribed to treat the symptoms without any real evidence of what is causing the condition. In many cases, several different medications are tried before coming across one that works. Neurotransmitter testing provides a simple tool for determining the precise cause of the symptoms by pinpointing exactly which neurotransmitters are in imbalance. Neurotransmitter testing enables medical professionals to guide treatment toward the cause of the condition, rather than tossing medications at it until one of them finally works. In many cases, therapeutic drugs may not be necessary at all. Changes in dietary and lifestyle habits and the use of natural remedies and neurotransmitter supplements can correct neurotransmitter imbalances without the use of prescription medications that may have negative side effects. Testing for neurotransmitter imbalances consists of taking a simple blood or urine sample. Neurotransmitter tests are covered by most insurance plans, making them easily affordable. By identifying the neurotransmitter imbalance that is causing your health issues, you can ensure that you are receiving the proper treatment and that you will begin to feel better as soon as possible.
Q: Ruby code memory leak in loop Below code is having memory leak. It's running under ruby 2.1.1. I am not able to find the actual leak. q = Queue.new("test") while true do m = q.dequeue body = JSON.parse(m.body) user_id = body["Records"][0] user = V2::User.find(user_id) post = V2::Post.find(post_id) end After few hours of run I added GC.start but its not solving the problem q = Queue.new("test") while true do m = q.dequeue body = JSON.parse(m.body) user_id = body["Records"][0] user = V2::User.find(user_id) post = V2::Post.find(post_id) GC.start end I don't know how to find the actual memory leak. A: Try removing the lines from the bottom up, and seeing if the memory leak persists. It's possible that the Memory leak is coming from the find method, or possibly the JSON.parse (extremely unlikely), or the custom Queue data structure. If the memory leak is still there after removing all of the lines, it is likely coming from the worker itself and/or the program running the workers. q = Queue.new("test") while true do m = q.dequeue # Finally remove this and stub the while true with a sleep or something body = JSON.parse(m.body) # Then remove these two lines user_id = body["Records"][0] user = V2::User.find(user_id) # Remove the bottom two lines first post = V2::Post.find(post_id) end
Objective morality I am sure that any atheist who has even skirted the theism/atheism debate has encountered what I will term here the “objective morality” argument. The argument has a couple of versions but the common thread is that morality that is subjective is of little or no value. There must be a moral law or moral law giver, an ultimate authority who invests morality with an unchanging solidity that subjective morality lacks. Theists view subjective morality as being akin to whim, being open to change at will. This sentiment is usually summed up in the inevitable Dostoevsky quote from his book The Brothers Karamazov “If God does not exist, everything is permitted.” The view of the theists that morality has its basis in objective reality or is at least divorced from human whim presents some very interesting questions and objections. Christians often use this argument for instance while dutifully ignoring the changing morality from the old testament to the new. One question of interest is; “Why, if morality is objective does it seem to focus solely on humans?” I think it is fair to say that every moral question that is posed and every moral law presented has to do with human action. I don’t believe anyone has every criticized a lion for killing a gazelle; “How immoral!!” While it makes perfect sense that a morality invented by humans focuses solely on humans, it doesn’t follow that the same should apply to an objective morality. If killing is wrong, then it is wrong, it makes no sense that it be dependant on species. Perhaps all lions are immoral, objectively speaking! The most interesting question to me though must be “Does morality source with God, or is moral law truly objective?” If moral law is truly objective then God himself is subject to it. His murder of every living thing (bar a few lucky pairs and a presumably incestuous family) must be deemed immoral as it breaks the “thou shalt not murder” law. His orders of genocide don’t look too good by any light either. This would render God less than morally perfect and so I doubt the idea would find much traction in the theistic community. My guess is, though I have never posed the question to a theist, is that most theists would be in favor of morality sourcing with God rather than being something truly objective which even God must be subject to. Incidentally, if any theists disagrees I would love to hear your thoughts on the subject. If morality originates with God then it is subjective to God. This presents some problems of its own. Most obviously, any moral “laws” that God would invent are entirely arbitrary. For example, God merely chooses to make moral issues of what people do with their genitals. There is nothing objectively wrong with adultery or homosexuality or any of the other practices that God deems immoral as morality in this case is a subjective invention by God. He may have chosen to make the wearing of blue shoes a high moral crime. If the theist’s argument is to be accepted, the theist themselves must accept that anything God chooses to make moral/immoral would be automatically so. Were God to command all his worshippers to immediate bugger the nearest child in order to gain their salvation, that act would immediately become a righteous act and the price of being “saved” The bible seems to show a changing morality too, something with violates many of God’s supposed properties, most notably his unchanging nature and all-goodness. More importantly though, it shows just how subjective and subject-to-change even the perfect morality of God is. In conjunction with the objective morality argument is the idea that everyone has a moral sense implanted in them by God. This is the theist’s way of explaining how non-theists often act in good moral conscience. It presents some problems of its own though. Why is there ever disagreement about what is moral if we all already know what is moral and what is not? If God has magically informed us, there should be complete agreement. We would all “feel” the same way about every moral question. It also raises a question about free will. How free are we really if we come with pre-installed ideas about what is good and what is bad. Presumably the freedom comes in the liberty to do “bad” things. I wonder how often murders find murder morally objectionable but just go ahead and do it anyway as an exercise in free will. Sociopaths simply don’t feel that many of the things we find “bad” are bad. They lack all empathy with the victims of such actions. They simply don’t get it. This all fits perfectly with an evolutionary explanation of our moral sense, both biological evolution and the evolution of societies. Modern society simply could not exist if most people did not adhere to what we might call common morality most of the time. Biological reproduction is not perfect, in some cases the faculties most of us take for granted don’t work properly. Sociopaths for instance have a compromised sense of empathy with other people. Well either that or God forgot to include their moral sense! There is a great irony though in the way in which most, if not all, Christians cherry pick the bible’s perfect morality. I doubt many Christian fathers these days would consider charging his daughter’s rapist 50 shekels and set up a marriage. Rather than embrace all the moral teachings in the bible, Christians pick and choose the moral teachings they agree with and quietly ignore the rest. Jesus even said that the old laws where to be upheld but I don’t see even devout Christians out stoning disrespectful children. What is ironic in this, is that Christians are applying the same subjective morality that the rest of live by in order to decide which parts of the bible are “good” and which are “bad” (though I doubt they see it that way) In essence they apply their subjective moral views to a text in order to determine what it says the objective morality is. While society at large may once have supported the idea of executing adulterers, modern societies (western democracies at least) no longer do. Rather than point to some Islamic countries where such practices still go on and say “That’s what we should be doing, just like it says in the bible” Christians instead find these practices just as barbaric as non-theists do. They must also confront the problem that God is apparently unchanging. If that is so, then what was moral is moral and always will be moral. Aside from the host of contradictions this raises between the Old and New Testaments, it also means that it is still moral to kill someone for working on the Sabbath. By not executing your friend for putting in a little overtime you are guilty of immorality. All of the evidence from human behavior, both the general and the exceptional and all the evidence provided by changing societal attitudes to moral issues seem to fit perfectly with a subjective, evolved morality. Replies to This Discussion Very well written. You might have read it already, but I think Marc Hauser's "Moral Minds: How Nature Designed a Universal Sense of Right and Wrong" is a must-read if you're interested in the evolutionary origin of our moral sense. I wrote this in an effort to help Objectivists understand that rights are not "natural" in the usual sense of the term; rights are human institutions, created for a purpose. Rights come from peace treaties. Rand made the distinction between "objective", "subjective", and "intrinsic" theories of ethics, but most Objectivists have failed to understand the distinction, and carry on as if rights were intrinsic. -JBH ----------------------------- August 21, 1998. Defining five terms. Rand used the term "objective" differently than most philosophers. Some definitions, from Webster's Collegiate Dictionary, 10th edition. OBJECTIVE: ... in the realm of sensible experience, independent of individual thought and perceptible by all observers; having reality independent of the mind.... perceptible to persons other than the affected individual... OBJECTIVISM: an ethical theory that moral good is objectively real or that moral precepts are objectively valid. SUBJECTIVE: ... belonging to reality as perceived rather than as independent of mind;... conditioned by personal mental characteristics or states... arising out of or identified by means of one's perception of one's own states and processes.. SUBJECTIVISM: a doctrine that the supreme good is the realization of a subjective experience or feeling... a doctrine that individual feeling is the ultimate criterion of the good and the right. ABSOLUTE: characteristic of a ruler or authority completely free of constitutional or other restraints... having no restriction, exception, or qualification... being self-sufficient and free of external references or relationships... RELATIVE: a thing having a relation or connection with or necessary dependence on another thing... not absolute or independent... RELATIVISM: (a) a theory that knowledge is relative to the limited nature of the mind and the conditions of knowing... (b) a view that ethical truths depend on the individuals and groups holding them. Notice that the two meanings of "relativism" differ in important ways. The scientific method of seeking knowledge admits that its conclusions are relative to, dependent on, the (objective) evidence gathered so far, and may be changed by new evidence. In ethics, "relativism" commonly refers to a particular view, "cultural relativism", that ethics are a matter of (subjective) majority opinion. These are two different uses of the word, which must be kept distinct. "Objective" and "absolute" are not the same, "subjective" and "relative" are not the same. Objective things can be relative, subjective opinions can be held absolutely. (The fifth term I want to define is INTRINSIC; see below.) Notice also that "objectivism", as defined by the dictionary i.e. by mainstream usage, has two alternative meanings- that moral good is objectively real OR that moral precepts are objectively valid. The point of this essay is that Rand did NOT lump these two together. Where mainstream philosophers made a twofold distinction between "objective" and "subjective" ethics, Rand made a threefold distinction between "intrinsic", "objective", and "subjective". She said that the good is objective, but she meant something different by it. The primary text where she speaks of this is in the essay "What is Capitalism?", reprinted in CAPITALISM: THE UNKNOWN IDEAL, pages 21-25. (All quotes below are from that text.) Her presentation there must be read keeping in mind that she believed she had solved the "is-ought" problem pointed out by Hume. Particular phrases and sentences can be quoted to support an "intrinsicist" view; I don't think she made the distinction entirely clear. I shall be quoting selectively also. BEGIN QUOTES: The intrinsic theory holds that the good is inherent in certain things or actions as such, regardless of their context or consequences... it is a theory that divorces the concept of 'good' from beneficiaries, and the concept of 'value' from valuer and purpose- claiming that the good is good in, by, and of itself. The intrinsic theory holds that the good resides in some sort of reality, independent of man's consciousness... The objective theory holds that the good is neither an attribute of 'things in themselves' nor of man's emotional states, but an evaluation of the facts of reality by man's consciousness... The objective theory holds that the good is an aspect of reality in relation to man... Fundamental... is the question: Of value to whom and for what? An objective theory does not permit... the separation of 'value' from 'purpose'.... Since values are to be discovered by man's mind, men must be free to ... judge them, and to choose, be it material goods or ideas... Since values are established contextually, every man must judge for himself, in the context of his own knowledge, goals, and interests. END QUOTES from that source. One more, from PHILOSOPHY: WHO NEEDS IT, "From the Horse's Mouth": "Material objects as such have neither value nor disvalue; they acquire value-significance only in regard to a living being- particularly, in regard to serving or hindering man's goals." So: Looking again at the definitions from the dictionary, when a mainstream philosopher says (or hears a claim) that "moral good is objectively real", they understand it to be a claim that the good is "in the realm of sensible experience, independent of individual thought and perceptible by all observers; having reality independent of the mind...." In other words, what they meant by "objective", Rand would call "intrinsic". What she meant by "objective", they had no ready word for. This difference in terminology can be dramatic, and can lead to serious misunderstanding. For example, the Australian philosopher John L. Mackie wrote a book, ETHICS: INVENTING RIGHT AND WRONG. His first sentence is "There are no objective values." Most Objectivists would quit reading at that point, but if you read the first half of the book, you find that what he is arguing is that there are no intrinsic values, in Rand's terminology. If you read the second half of the book, you find that he is an Aristotelean. Mainstream terminology sets up a false dichotomy; Rand carved out a third alternative. Mainstream philosophers would say that an "objective" good would necessarily be ABSOLUTE, by the definition given above: "having no restriction, exception, or qualification... being self-sufficient and free of external references or relationships..."; Rand would say that things have value because people value them, that everything "good" is good TO somebody FOR something, and that "goodness" is RELATIVE to an individuals' goals. Further, because she says that every individual must choose their own goals, by mainstream terminology, her theory of the good would be SUBJECTIVE: "belonging to reality as perceived rather than as independent of mind... conditioned by personal mental characteristics or states... arising out of or identified by means of one's perception of one's own states and processes..." By the SECOND of the two dictionary definitions of "objectivism", that "moral precepts are objectively valid", then Rand's ethical system would be objective by mainstream terminology. Rand's system, as I understand it, consists entirely, repeat, entirely, of hypothetical oughts: "If you want X, then you ought to do Y." Further, since the goal of her system is objectively measurable, her system is a set of claims about causal relationships that are objectively true or false. It is for this reason that I explain what I understand to be Rand's view by saying that "Ethics is engineering. It is NOT a science, in that it is not discovering a unique "correct" ethical system that exists in nature independently of human choice. Likewise ethics is not art, in that it is not simply an expression of our emotions and ideals. Engineering has elements of both science and art, but it is distinct from each." I believe this way of explaining it makes the distinction she intended, between intrinsic, objective, and subjective, without the confusions caused by nonstandard terminology. It seems to me that, if you choose not to look to God for a moral standard, then you need to look to nature. Nature is "red in tooth and claw": it has but one imperative: SURVIVE. As nature's prime directive, survival is the only natural basis I can think of for an objective moral standard. Perhaps you can come up with some other basis. I don't believe most humans can accept morality based on survival: we like to think we are above predator-versus-prey. Nature is so cold and uncaring. I think that's one of the reasons we invented God and religion. But without an objective standard, ANY morality is necessarily subjective. Which leads us back to survival as our only objective moral standard. But we're not beasts -- survival isn't just a matter of kill-or-be-killed. Because of our intelligence and all it represents, survival becomes much more complicated when dealing with humans. So, for the sake of discussion, let's use survival as a moral standard: survival of individuals and of our species. How would that work? How would that guide our actions? The first thing that leaps to my mind is killing. Death is the opposite of survival. Nature insists on death for survival: does that mean killing is not immoral? One might think that killing could be good in the case of overpopulation but wouldn't birth control be a better option? Religion causes a lot of deaths. Perhaps religion has evolved as a natural mechanism to weed out the simple-minded among us. If you think it is, then shouldn't we promote religion? But wouldn't it be faster just to kill all the religious folks? Outlaw religions? Reason with them? Humor them? Join them? I don't know. There's a big difference between having an objective moral standard and applying it. In the end, any objective moral standard must be interpreted and applied. That's a subjective process. Perhaps there can be no truly objective moral standard . . . I'm replying to myself because I've been corrected (elsewhere) about my misplaced emphasis on survival as an objective moral standard. Instead, it's cooperation that should be the standard. Survival is merely the reason for cooperation. So what do you think? Is there a better candidate for an objective moral standard than is cooperation? I'm dubious of any claim to objectivity where morality is concerned but cooperation seems like a very good candidate. I personally find the idea of an objective moral standard to be a absurd concept. As you say, whenever you try to approach the idea of an objective morality, you inevitably run into subjective considerations. .
Saturday, 30 June 2012 My last 2011/12 post is the one where I detail all the teams I saw over the season and look at how they did. Where are they now? Are they even still there? Those questions you’ve never asked and many more are answered here as all 67 teams I saw are rated or slated. What’s that you ask? Just where did Hatfield Peverel finish in the Essex & Suffolk Border League this season? Read on below… AFC Hornchurch (Final position: Isthmian Premier Division: 2nd) –> Managed to get over missing out on the league title to Billericay Town by winning the play-offs. A 2-1 extra-time win over Lowestoft Town means Blue Square South football for the Urchins next season. AFC Wimbledon (League 2: 16th) –> Decent first season back in the Football League for The Dons. Lost form during the middle which could have got them into trouble but finished well. Aldershot Town (League 2: 11th) –> A disappointing season overall for the Shots as they missed out on the play-off places by 6 points. Partially covered by the League Cup run where they reached the 4th Round before losing 3-0 to Man Utd. Amersham Town (Spartan South Midlands League 1st Division: 20th) –> Poor again from the village club as they finished towards the bottom of league. They did finish 8 points clear of Sun Postal Sports but 121 goals conceded tells a story. Arsenal (Premiership: 3rd) –> Recovered after their dreadful start to pick up some form and beat Spurs and Newcastle to 3rd place. Still no trophy yet though… Ashford Town (Middx) (Evo-Stik Southern Division 1 Central: 9th) –> Poor start to the season cost them dear as they finished 10 points off the play-offs. Aston Villa (Premiership: 16th) –> Negative and downright shite for most of the season, relegation would have been fitting. Unsurprisingly Alex McLeish was sacked and now Paul Lambert has the task of making Aston Villa play positive football again. Barking (Essex Senior League: 5th) –> Will always be remembered by me for being ground #100 and this season they were well away from the Top 2, but well away from being towards the bottom of the league also. Bethnal Green United (Essex Senior League: 9th) –> Reasonable season in the league by finishing in midtable. Also reached the FA Vase 5th Round but lost to eventual winners Dunston UTS. Blackburn Rovers Youth (Premier Academy League Group C: 1st) –> Just pipped Manchester City Youth to the Group C win but lost in the Academy Final to Fulham and the FA Youth Cup Final. Boreham Wood (Blue Square South: 8th) –> Good end of the season run to finish 8th. 10 points off the play-offs. Bradford City (League 2: 18th) –> Still no progress for Bradford, slumped at the bottom end of the Football League. 6 points off relegation this time out, Phil Parkinson is a man under pressure to deliver next season. Bradworthy (North Devon League Premier: 6th) –> While 6th is a decent league finish, only a goal difference of +11 compared to 5th place Torridgeside’s +34 shows where they need to improve. Bristol City Youth (Premier Academy League Group B: 10th) –> Really must do better. Buckingham Athletic (Spartan South Midlands League 1st Division: 18th) –> Not great from Buckingham as they struggled for most of the season. Charlton Athletic (League 1: 1st) –> Once Chris Powell’s side went top of League 1, there was no stopping them as they romped home with 101 points and only 5 defeats all season. Chelsea (Premiership: 6th) –> What an eventful season for the Blues. The AVB project didn’t work as he was punted in early 2012. Legend Di Matteo took over and while they finished a disappointing 6th, the club won the FA Cup and the holy grail of the Champions League. Chelsea Youth (Premier Academy League Group A: 7th) –> Disappointing in the Academy League as they were not challenging near the top. They did win their 4th FA Youth Cup title though with a 4-1 aggregate win over Blackburn Rovers Youth however. Chorley (Evo-Stik Northern Premier League Premier: 3rd) –> Another excellent season from Chorley where they almost achieved consecutive promotions but lost in the play-off Semi-Finals to FC United of Manchester 2-0. Croydon FC (Combined Counties League Premier: 16th) –> 10 points clear of relegation but a lot of points away from making an impact at the top. Dagenham & Redbridge (League 2: 19th) –> Their dreadful relegation form from 2010/11 continued into this season but their late season form saved them as they were 6 points off relegation. Dolton (North Devon Premier: 11th) –> Were well away from relegation as they finished 14 points clear but will need a bit more to push forward into the top half. Dunston UTS (Northern League 1st Division: 3rd) –> Just missed out on a Top 2 finish and a promotion place to the Evo-Stik Northern Premier League. The FA Vase win however, will more than make up for it. Ebbsfleet United (Blue Square Premier: 14th) –> Good first season back in the BSP, finishing 13 points away from relegation. Can they now push on? Exeter Civil Service (Southwest Peninsula League Division 1 East: 13th) –> Seem to be going backwards, albeit slowly. One position down on last season but one point more. Exeter City (League 1: 23rd) --> “Devon’s biggest club”™ were a shambles all season at the back and were promptly relegated back to their level in League 2. Fisher FC (Kent League: 10th) –> Starting to settle down on and off the field after a few years of turmoil. Next step for them will be getting their own ground. Fleet Town (Evo-Stik Southern Division 1 Central: 21st) –> Dreadful season for the Fleet as they finished in the relegation zone. Yet, due to Bedfont Town pulling out of the league, they were reprieved so live to fight another day. Fulham (Premiership: 9th) –> Excellent end of season form to finish in the top half of the league. Fulham Youth (Premier Academy League Group A: 1st) –> Won their group and retained the Academy League with a 2-0 win over Blackburn Rovers Youth in the Academy Final too. Gresley (Midland Football Alliance: 1st) –> Kept their nerve to win the League by 2 points over Westfields. They will be playing Evo-Stik Northern Premier League football next season. Hatfield Peverel (Essex & Suffolk Border League Premier: 8th) –> Finished right bang in the middle of the table due to too many draws over the season. Still a decent base to start their 1st season at their new home however. Heaton Stannington (Northern Alliance Premier: 1st) –> Kept their good form going right until the end of the season as they took the title by 3 points over Hebburn Reyrolle. Hendon FC (Isthmian Premier Division: 7th) –> Good effort from The Greens as they finished only 3 points behind the play-offs. Lost in the FA Cup 4th Qualifying Round with a 5-1 away defeat at Luton Town. Hillingdon Borough (Spartan South Midlands League Premier: 10th) –> Pretty much in midtable obscurity as they were nowhere near the top, nor the bottom. Kentish Town (Spartan South Midlands League 1st Division: 19th) –> Struggled on the pitch the season and with the loss of the Copthall Stadium to Saracens, they may struggle of the pitch too. Not sure where they are playing next season? Livingston (Scottish Division 1: 5th) –> Reasonable start back at Level 2 for Livi, John Hughes will need to get them higher in 2012/13 however. And still no news on this new ground? Macclesfield Town (League 2: 24th) –> Only 39 goals scored tells its own sorry story. Relegated back to the non-league where they may struggle again. Manchester United (Premiership: 2nd) –> Were a 95th minute goal away from winning yet another league title. Surprisingly it was their loss of form late on that cost them with defeats to Wigan and Man City being the most crucial. Millwall (Championship: 16th) –> Disappointing league season as they floated around the bottom of midtable throughout and went out of the League Cup in the 3rd Round after a 5-0 away defeat to Wolves. Morecambe (League 2: 15th) –> After a fantastic start where we all dreamt of promotion, injuries hit a small squad and cost them as they could not regain the form from Aug-Sep. After last season though, this is an improvement – hopefully it’s continued into next season. Nantwich Town (Evo-Stik Northern Premier League Premier: 10th) –> Lost form towards the end of the season as they finished 15 points off the play-offs. Even had a point deducted for fielding an ineligible player. Newcastle United (Premiership: 5th) –> A brilliant season under Pardew means the Toon Army can enjoy some European tours next season. Odense BK (Danish Superliga: 10th) –> A poor season and were very nearly relegated from the top flight. Only 6 points clear of Lyngby Boldklub. Oldham Athletic (League 1: 17th) –> Non-existent end of season nearly pulled them into relegation trouble but they finished 11 points clear. Ottery St Mary (Southwest Peninsula League Division 1 East: 17th) –> Looked a beaten club when I saw them so no surprise they only picked up 1 win all season and finished bottom. They sadly pulled out of the SWP League at the end of the season too so will try to regroup in the Devon & Exeter League 3rd Division. Oxford United Youth (Football League Youth Alliance South West: 6th) –> Missed out on the end of season play-offs by 7 points. Also lost in the FA Youth Cup 3rd Round with a 2-1 home defeat to Bolton. Oxhey Jets (Spartan South Midlands League Premier: 17th) –> Recent improvement over recent seasons in terms of league position but not in points. Stuck in the mire? Percy Main Amateurs (Northern Alliance Premier: 10th) –> Comfortable in the end for PMA as they finished 17 points clear of the bottom two. Queens Park Rangers (Premiership: 17th) –> Still unsure how they stayed up as QPR were dreadful for large chunks of the season. They also have Stoke City to thank as Bolton failed to beat them, meaning they went down instead. Raith Rovers (Scottish Division 1: 7th) –> Stayed out of the relegation play-off fight by 6 points to play again in D1. Will be interesting next season how they cope with John McGlynn’s departure to Hearts. Redbridge (Isthmian League Division 1 North: 6th) –> An excellent season for the Motormen as they finished just outside the play-offs and had that FA Cup run to the 2nd Round before Crawley Town beat them 5-0. Seems strange then that the Chairman and Manager left in the close season. A state of flux? Shrewsbury Town (League 2: 2nd) –> Graham Turner’s men hit form at the right time and more importantly kept it up to secure promotion to League 1. Sidmouth Town (Southwest Peninsula League Division 1 East: 14th) –> An acceptable first season at Level 11 that started well and then tailed off too early. 75 goals conceded highlights an area they need to improve. Staveley Miners Welfare (Northern Counties East League Premier: 5th) –> Finished well behind league winners Retford United, however they are making progress in the ground improvements. Sutton United (Blue Square South: 4th) –> An excellent season back at this level to finish in the play-offs and have a good FA Cup run. We’ll see if they can repeat that this coming season. Three Bridges (Sussex County League 1st Division: 1st) –> Kept their nerve to win the Sussex County League title by 3 points from Lancing. Their reward is Isthmian League football next season. Tooting & Mitcham United (Isthmian Premier Division: 21st) –> Dreadful season and in the end they finished 20 points from safety. Will need to regroup and fast before they sink even further next season. Can look forward to their derby vs Dulwich Hamlet though. Tring Athletic (Spartan South Midlands League Premier: 6th) –> Decent from Tring this time and they’ll want to push on now to challenge for promotion next time out. Truro City (Blue Square South: 14th) –> Dominated all season (and continued into the summer too) by HMRC court orders and administration threats but on the pitch, they adapted well to their first season at this level. Welling United (Blue Square South: 3rd) –> Unsurprisingly lost in the play-off final 1-0 to Dartford meaning they’ll have to do it all again this season. West Auckland Town (Northern League 1st Division: 2nd) –> The nearly men of the season. Just missed out on the Northern League title as Sunderland RCA beat them to it by 2 points and lost in the FA Vase Final too. Wodson Park (Spartan South Midlands League 1st Division: 16th) –> Floated around the lower ends of the league all season. Yeovil Town (League 1: 17th) –> Looked to be heading down with Exeter until Gary Johnson came in as boss and Terry Skiverton was moved aside. In the end this was an inspired move as they finished 11 points and 4 places away from the drop. And that is it! 2011/12 now officially over for me. The prep has already started for 2012/13 too so I’m looking forward to getting back out there and watching some more great/good/average/tinpot/dreadful football. The final pics are some snapshots of games I was at this season. None are my own, thanks to those who took them. Tuesday, 19 June 2012 In terms of mileage, this was easily the daddy of all seasons for me so far. With 38 games of football (as well as 2 games of rugby league and half a day of field hockey), I also got in a fair few minutes of sporting action. As always, some of this action was brilliant while some of it was tinpot with lots in between. Got some unexpected grounds in this season (if you asked me where Three Bridges was in August 2011, I would have looked at you in confusion!) which was always a bonus. I also finally made good my promise on bringing more sports to The Travelling Fan! Hopefully it’s again onwards and upwards – but a quick look at the season gone by including the TTF awards. Best Game: Gresley 1-1 Three Bridges (A.E.T) – A brilliant FA Vase tie that had 120 minutes of action and drama. Played in the windy backdrop of the Derbyshire hills, Three Bridges nearly pulled off a shock but a draw was the right result on the day. The return game in Sussex was nearly as good, but this first game just pipped it. Worst Game: Hatfield Peverel 0-0 Rowhedge – If this game was still being played today then both teams still wouldn’t have scored. A dreadful game that was only slightly liven up by a late red card for a professional foul. Has put me off this league slightly, but will no doubt forget my lesson next season. Best Team: Newcastle United – They had a brilliant season in the Premiership and deservedly finished in a European spot. I saw them hammer Man Utd 3-0 and they looked a class apart in that game. Easily the best team (relative to the level they play at) I saw this season. Worst Team: Hillingdon Borough – Had a few candidates for this award (Kentish Town, Bristol City Youth, Macclesfield Town and Ottery St Mary) but Hillingdon Borough win this purely for their keystone cops defending vs Tring Athletic. A shame as they were a lovely club and even came 10th out of 22 in their league. Can only judge what I see though and against Tring they were hopeless. Best Player: I have no idea why or how Carl Derewenko has ended up at Amersham Town but his goal scoring power was sensational. Continued it through the season too. Too good to be playing at Level 10. Best Ground (Professional): Last season it was Sunderland and this season it’s Newcastle’s St James Park. Clearly some top grounds in the NE. A fantastic venue that I would be happy to go back to at some point in the future. Best Ground (Non-League): Tooting & Mitcham Utd’s Imperial Fields is a cracking venue. Large terracing behind each goal, a massive main stand overlooking the pitch and an excellent clubhouse. I’ll be back – at some point. Worst Ground: Really wasn’t a fan of Ashford Town’s Robert Parker Stadium. In the middle of nowhere, there wasn’t much to distinguish from other bland grounds. The piss poor weather when I went didn’t help but I didn’t enjoy the ground. Most Picturesque Ground: Amersham Town is in a lovely setting. Out in the Buckinghamshire hills with an old building that is falling down to boot too. Fully recommended for a visit. Biggest Dump: Croydon town centre is an… interesting place. 2nd place goes to Aldershot or as my travel companion called it, Aldershite. (Original, I know) Best Programme: Not many outstanding programmes I came across this season but Dunston UTS only charged 50p for theirs and it was a good effort. Top stuff. Worst Programme: Aldershot Town’s was naff. Most Football League programmes aren’t the best but this wasn’t good and certainly not worth £3. Best Bar: Really liked Tooting & Mitcham’s digs. Modern clubhouse with some history of the club around the walls. Was a decent London price for a pint too – on to a winner. Best Food: Welling United’s bacon and sausage baguette was actually magical. I can’t big this up enough, my tastebuds came after eating it. Funniest Moment: Shrewsbury taking the lead at Arsenal was absolutely brilliant. Would have actually peed my pants laughing if I wasn’t sat in with the Arsenal fans. Best Punch Up: Does Three Bridges vs Gresley count? It had abuse, red cards and the police were called without a single punch being thrown it appeared. Hardest Place to Find: With the advent of Google Maps and me finally properly planning new trips, getting lost is a rarity if it even happened this season. Hillingdon Borough and Ashford Town (Middx) will need pre-planning. Don’t expect to find these grounds “on the cuff”. Friendliest Club: Kentish Town and Ottery St Mary were a delight to speak to on my travels this season. Most Miserable Club: Croydon FC weren’t exactly all smiles when I saw them. Best Supporters: Fisher FC. Were dreadful on the pitch when I saw them but the hardcore crew of their fans turned up with flags and songs and created the atmosphere. Worst Supporters: Bradford City. Never seen a group of fans turn so quickly against their team when things started to go slightly wrong. You aren’t Barcelona, you’re in League 2. Deal with it. Best Song: While it may be a twist on a Man Ure song – “This is what it means to Hibees! This is what it means to small! This is what it feels like when your team wins NOTHING AT ALL! NOTHING AT ALL!” Best Goal: Billy Knott had never scored a professional goal when he hit his 30 yard volley towards goal vs Macclesfield Town. In it went and AFC Wimbledon went onto win. Unsaveable. Special mention to Livi’s 3rd vs Raith Rovers, a brilliant counter attack from a Raith corner. Most Attractive Female Employee(s): All of them were beautiful this season. I could feel it in their hearts. Special Merit Award: All non-league players. As without you, I’d have to spend most Saturdays shopping or doing something equally as shit. This was easily the season when Hearts really pushed me away from them. Sacking a club legend is one thing (possibly deserved – I disagree). Yet, to continue to completely mismanage the club financially means I certainly will not be attending Tynecastle or buying any Hearts stuff until Romanov goes. It should have looked better this summer after amazingly qualifying for Europe and winning the Scottish Cup. But another hero in Paulo Sergio left, when the club thanked him for the work he had done this season by giving him a paycut. Unbelievable. So going into this season with no team, no manager and no pre-season. I can take the despair, its the hope I can’t stand. From a club who don’t seem to give a shit about their supporters to one that does, I spent a lot of time with Morecambe this season and fully enjoyed it. Since my support went to them after a trip to Christie Park in my freshers week – I did 3 away games with the Shrimps this season and each were extremely different. It’s a shame the early season promotion charge faded but I’ll be there with them (on occasions) next season. Thanks to everyone who looked in this season and here’s to another great 12 months at TTF! I blame my friend Pete Macmillan. He convinced me to join the rugby league team at uni (a sport I knew nothing about) and then after enjoying playing it (despite being crap) convinced me to pick a team out of a hat to support in the Super League and Co-Op Championship. That team pulled out (for the Super League side) was the medium size side of the Wakefield Wildcats. I was going to take this seriously, I’ve followed the club (from afar) since then and have always intended to go up to the Yorkshire city that I have no connection to. That day had come. Wakefield is the main settlement and administrative centre of the City of Wakefield, a metropolitan district of West Yorkshire, located by the River Calder. Tools and later iron implements have been found at Lee Moor and Lupset in the Wakefield area showing evidence of human activity since prehistoric times. This part of Yorkshire was home to the Brigantes until the Roman occupation in 43 AD. Wakefield was probably settled by the Angles in the 5th or 6th century and after 876AD the area was controlled by the Vikings who founded hamlets or thorpes around Wakefield. The settlement was recorded as Wachfeld in the Domesday Book of 1086, and covered a much greater area than present day Wakefield, much of which was described as "waste". At the time of the Civil War, Wakefield was a Royalist stronghold however in 1643 the town was taken by the Parliamentarians. In medieval times Wakefield became an inland port and centre for the woollen and tanning trades but by the start of 19th century Wakefield was a wealthy market town and inland port trading in wool and corn which became one of the biggest in the country. When cloth dealing declined, wool spinning mills using steam power were built by the river as well as a glass works, several breweries, soapworks, brickyards and of course mining to give the town a diverse economy. West Riding Pauper Lunatic Asylum was built just outside the town in 1816. During the 19th century, the Wakefield Asylum played a central role in the development of British psychiatry, with Henry Maudsley and James Crichton-Browne amongst its medical staff. While Wakefield does have a football team (albeit playing in nearby Ossett now) this really is a rugby league city. Trinity Wildcats were founded in 1873 and were one of the original 22 clubs the formed the Northern Rugby Football Union in 1895, making them one of the oldest clubs in the world. Founded by a group of men from the Holy Trinity Church in 1873. Early matches were played at Heath Common (1873), Manor Field (1875–76) and Elm Street (1877) before the club moved to Belle Vue in 1879. One of the initial forces in the game, Trinity won the Northern Union Challenge Cup for the first time in 1909, beating Hull 17-0 at Headingley. The corresponding 1914 final saw the result reversed, with Hull winning 6-0, and proved to be an accurate guide to the teams pre-war endeavours, as Trinity lost four Yorkshire Cups in the 1930s with a side that included club stalwart Jonathon Parkin. The post war years for Wakefield were the most successful as during the 50s, the club won the Yorkshire Cup twice as well as the Yorkshire League before the real glory days in the 60s when the Challenge Cup was won 3 times as well as the Championship which was finally won in 1967 and then again in 1968. When the summer era of Rugby League came in with the birth of the Super League in 1996, Wakefield along with Castleford and Featherstone were down to merge to form a new team called Calder. While Wakefield voted for this, the other two didn’t and Wakey missed out on the SL by finishing below 10th spot in 1995. (13th) They won promotion to SL for the 1999 season and started off ok, although they did end up in relegation battles in 2001 and 2005. 2006 also saw a relegation battle as John Kear came in but they missed the drop due to the “Battle of Belle Vue” game where Wakey beat Cas 29-17 to send the Tigers down. Recent times have been hard as the ridiculous licence system came in. Administration hit in 2011 and it looked like relegation would happen too as it was expected Wakefield would lose their licence but Crusaders pulled out and Wakefield lived again in the SL. Belle Vue is a ground that splits opinion. Home of Wakefield since 1879, it does show its age and is one of the reasons why Wakefield have been close to losing their SL license twice. Two sides of the ground have terracing with the West Stand being uncovered and running down the side of the pitch. The North Stand is also a terrace but now has the added bonus of a roof which was much needed for the miserable weather this game was played under. The East Stand is the only seated stand which looks like it may provide a decent view of the action as well as being an old structure that fits in well with the rest of the ground. The South side holds the corporate boxes which looks like a block of flats lumped at the back of the ground as well as the clubhouse in the corner of the ground. While Belle Vue has its critics, I love the ground as it is proper old school. Is it unsafe? No. Unfit for purpose? No. Fans of the plastic fantastic corporate hell need to take a good look at their soulless ground before lambasting this one. Belle Vue’s days look sadly numbered though as Wakefield are awaiting the outcome of the planning referral for their Haymarket development which is due on June 19th. A positive outcome to that should see Trinity play there around 2014. On the pitch, Wakefield are improving slightly since the debacle I watched at the Twickenham Stoop back in March. After a few defeats (and a win over Salford), a win over Castleford at Magic Weekend has seemed to kick-start Wakefield’s season and were coming into this game against the Broncos in much more confident mood. The Broncos were the complete opposite however as since that 36-0 win, they had lost all 7 games (to Catalan x2, Leeds, Hull KR, Bradford and Hull) and were floating around the bottom of the table with tinpot Widnes. Not many (if any) away fans seemed to have made the trip which could have possibly meant, I was the only person to travel from London for this. Even with the poor weather, just under 6,000 were here and there was a decent atmosphere as the game kicked off. Watching from the dry of the North Stand, I was a little concerned at how Wakefield would start as within 5 minutes of the London game we were already a converted try and penalty down. A better start was needed and Broncos kept giving away penalties early on for staying too long in the tackle. One of those penalties was converted on 5 minutes though as Ali Lauitiiti put Vince Mellars through for the opening try. Sykes converted a penalty to make it 6-0 before Tim Smith split a static away defence to put Dean Collis over and it was 12-0 with only 20 minutes gone. The standout try came around the 30 minute mark when Lauitiiti received the ball around the 10 metre mark. He smashed his way through four defenders before going over to give Wakefield an 18-0 lead at HT. It was looking very good! Broncos did come out for the 2nd half and put Wakefield under a wee bit of pressure but the defensive line held firm before Broncos had a man in the sin bin. Michael Robinson crudely stopping a quick restart and deservedly went off. It got worse for Broncos as attacking with a man advantage Wakefield scored their 4th try when Danny Kirmond went over. At 22-0 it looked easy but Broncos took advantage of some slack defending for the first time from Wakefield as Scott Wheeldon scored with Shane Rodney converting. If it looked like Broncos would start a late surge a needless penalty conceded from them allowed Sykes to kick another two points over and end the belief that Broncos could come back. Sykes had a kicking rate of 4 from 6 which in the conditions was a decent rate. While the rain continued to hammer it down and the wind got stronger, Wakefield played out the majority of the last few minutes with the ball in hand but could not add anymore to score. A fairly comfortable win in the end. Wakefield’s excellent form continued into their next game as a stunning 20 point come back saw them beat Hull 32-30. Broncos unsurprisingly beat Championship side Widnes 28-24 to move off the bottom of the table to make the fight around the bottom interesting for the next couple of months. While the conditions were terrible and it wasn’t the most exciting game of rugby league I fully enjoyed my first visit to Wakefield and I will certainly be back for a few times before the Wildcats move to their (hopeful) new ground at Haymarket in a couple of years. Despite the fact I have no connection with Wakefield, I love the fact I’m a Wildcat. Mr Macmillan, thank you. Tuesday, 5 June 2012 The 14th European Championship is nearly upon us and with that comes piss poor and incorrect predictions. As this blog is one for jumping upon any bandwagon, here are mine for the tournie. Usual rules apply. Read, go to bookies, bet on opposite. Win some money. GROUP A POLAND – The hosts do have a chance to make the QFs I feel. With a decent goalkeeper in Szczesny and a solid midfield, they should have enough to see off Czech Rep and Greece. With Dortmund pair Lewandowski & Blaszczykowski, Poland have a strikeforce that can trouble any defence and, importantly, coming off the back of an excellent season in the Bundesliga. A weakness could be (up till now) the lack of killer instinct as 11 goals in their last 10 games shows they rarely hammer teams. The new Greece? RUSSIA – Four years ago, the side led by Guus Hiddink reached the semi-finals. That won’t happen this time. They plodded along to get here and current manager Dick Advocaat isn’t universally popular. Especially with the decision to normally overlook striker Aleksandr Kerzhakov in favour of Pavlyuchenko or Pogrebnyak. If however Arshavin rolls back the years and Alan Dzagoev continues his excellent form, Russia should challenge the Poles to win this group. But will they beat anyone in Group B? Doubtful. CZECH REP – If you can only qualify through a 92nd minute non-penalty against Scotland (yes I’m still bitter) then you have problems. Scraping through the play-offs, the Czechs arrive with a team that is partly about to retire and partly not even ready. The impressive Under 21 side from last year (you know, the team that knocked out England) have only had 2 players called up to the squad (Tomas Pekhart and Marek Suchy) which suggests they are not ready, yet. Their one positive is that in my eyes they have the best defence in the group. With Cech, (if he plays like his Chelsea 2005-2007 days) Tomas Sivok and Roman Hubnik, they won’t concede many, but will they score any? GREECE – Younger football fans who can’t remember 2004 may think that the tournament was a wind-up. Watching Greece at Euro 2008 and WC 2010 was a painful one as a side afraid to attack and have no ideas were easily eliminated. “Lord” Otto has now gone and replaced by Fernando Santos, but the tactics are the same. It isn’t pretty, but in qualifying it’s effective. Conceding only 5 goals in 10 games they should be ok at the back and even defeated a dark horse in Croatia to win their group. You have to wonder where the goals will come from though as Samaras even struggled in the SPL again. If the “Greek Messi” Ioannis Fetfatzidis gets a chance, he (and Greece) could shine, otherwise it’s another early exit. THE GROUP – The first round of games (Russia vs Czech Rep and Poland vs Greece) will be the key. I expect Russia and Poland to win those so when they meet in Round 2, they could still probably draw against each other and cruise through. I’ve gone with Poland to win the Group based on home advantage but neither side are getting past the Group B qualifiers. 1st – POLAND, 2nd – RUSSIA, 3rd – Czech Rep, 4th – Greece GROUP B HOLLAND – The Orange boys are back and look a pretty good bet to reach the final once again. Put into the “weaker” side of the draw, a team that battered their group in qualifying (bar a last match defeat to Sweden – they were already through) should be right there. With Klaas-Jan Huntelaar they have the top scorer in qualifying and the man who almost single handily hauled Schalke back into a respectable position in the Bundesliga. (Top scorer with 29 goals) Even if he doesn’t show up, attacking riches of Sneijder, Robben, Van der Vaart and Van Persie will trouble any defence. The trouble is their defence. Jonny Heitinga and Joris Mathijsen doesn’t get the heart racing. Back home, Dutch media also think they will fail to make it out the group stages quoting Germany and Portugal as the stronger teams. GERMANY - “Dies ist unsere Zeit.” The rest of Europe expects, as do Germany itself. They have arguably got stronger since the World Cup as the likes of Badstuber, Ozil and Muller have gotten older and wiser. Add in new talents such as Mario Gotze and Marco Reus – this is probably the best squad Germany will have for some time. Their weakness is the defence (except Phillip Lahm) but if they can keep the ball in the opposition half the creativity, skill and just sheer German efficiency will see them past their opponents. PORTUGAL – Once again Portugal have to qualify through the play-off lottery as once again they ended Bosnia’s dream of qualifying for a major tournament for the first time. Portugal in my eyes are a one man team. Mr C Ronaldo. Mark him out of the game (which Bayern players already have good experience of) and you’ll probably beat Portugal. The rest of the squad are just not good enough to make the final stages and to exacerbate matters, key players seem to have lost form going into the tournament. Some really poor results recently have affected the side with defeat to Turkey and a 0-0 draw against Macedonia. More needs to happen from other players. But can they deliver it? DENMARK – Before I started researching Denmark and their squad, I had them bottom of the group on 0 points. Now I have researched them, I think a 3rd place finish is on the cards. A tournament too early perhaps with some talented youngsters on the way. World Cup 2014 should see Nicolai Jorgensen and Rasmus Falk light up the Danish team. For this set of players, relying on Nicklas Bendtner for goals is always a risk but Christian Eriksen and Dennis Rommedahl can cause problems. Any of these key players get injured however, the Danish lack of depth would mean 3rd place may not even be achievable, THE GROUP – Despite the problems the Dutch media expect them to face in this group, I can see them winning this on goal difference after a draw against the Germans in game 2. With wins against Portugal and Denmark, I think Holland will score more as the Germans start slowly with some narrow wins. Denmark will avoid the wooden spoon. 1st – HOLLAND, 2nd – GERMANY, 3rd – Denmark, 4th - Portugal GROUP C SPAIN – I’m very big on reoccurrences. No team has ever retained the European Championships and I can’t see Spain breaking that record this time. The Semi-Finals should be fairly easy to get to. Win a weak group and beat 2nd place in a weaker group before facing the might of Group B. The problem this time out with Spain is that teams know how to play against that time of game (look at the teams Barcelona failed to break down this season). With David Villa out of the tournament and Torres failing to hit a barn door, it seems the task of scoring their goals will be up to Pedro (2 international goals) and Fernando Llorente (7 international goals – although one was vs Scotland). The squad is strong with some class as Xavi, David Silva and Juan Mata can offer something very different. But is it the strongest squad in the tournament? ITALY – It’s funny how long 2 weeks is in football. Had I wrote this two weeks ago, I would have discussed that Italy have taken a gamble with Antonio Cassano leading the line after missing most of the season with cardiac problems. Also Mario Balotelli can have the potential to explode or cause utter mayhem to opposition defenders. Yet now the Italian team has been rocked in yet another match fixing crisis and have even discussed pulling out of the tournament. Defender Domenico Criscito would have started at left back after an excellent season with Zenit St Petersburg but has pulled out due to these match fixing allegations. The squad now look disinterested and “warmed-up” for the tournament with a woeful 3-0 defeat to Russia. The saving grace is that manager Cesare Prandelli can appear to motivate the squad and they could squeeze through. CROATIA – The eternal darkhorses can cause a couple more shocks again but have been dealt a massive blow in the loss of Ivica Olic with a thigh injury which was suffered during the 1-1 draw with Norway. It’s now up to Eduardo and Nikica Jelavic to score the goals but Croatia will miss Olic’s energy and workrate. With Modric and Kranjcar they have a midfield that is extremely creative and can take them into the QFs. Their weakness is in defence however as Greece proved how vulnerable they can be during qualification. Weak to crosses and slow (Simunic vs Torres would be brutal) as soon as they come up against a half decent strike force, Croatia will be eliminated. IRELAND – Probably sounds extremely patronising but Ireland have done well just to get here. Built on the back of excellent organisation under Trapattoni, Ireland appear to be the new Greece as their safety first approach means not many goals at either end in their games. Defensively sound as proven by keeping clean sheets against bigger sides such as Russia and Italy. They need to be excellent at the back though as their midfield is paper light with St Ledger, Andrews and Whelan nowhere near the class needed to compete at the top international level. Kevin Doyle had an average season with Wolves while Robbie Keane only managed 2 games all season at LA Galaxy. A lot of defence awaits. THE GROUP – Despite Spain’s deficiencies, they should easily win the group with 7 or 9 points. The race for 2nd is very interesting but I have Croatia to snatch it by taking 3 points from their first game vs Ireland and sneaking through then. Maybe Italy should have pulled out the tournament. 1st – SPAIN, 2nd – CROATIA, 3rd – Italy, 4th – Ireland GROUP D FRANCE – The French have come a long way since the 2010 shambles (which I called!) when they were eliminated at the group stage. They should qualify from this group as the backbone of the team is now settled. Hugo Lloris, Yann M’Vila, Adil Rami and Karim Benzema will all be in the French team for years and can all contribute something too. Another important aspect to France as the depth on the bench as Mathieu Valbuena and Jeremy Menez can be impact subs. The weakness is that this tournament may have come too soon. Blanc can work his magic for World Cup 2014 where they will be one of the favourites, but they should make the SFs at least here. ENGLAND – For the first time in my lifetime, the English media have already waved the white flag for this tournament. This however shows how pathetic the English (and British to a certain extent) media are as this England team are not all bad. They should get through this group and reach the QFs where they will get dumped out by the holders. England do have pace in Ashley Young, Walcott and Oxlade-Chamberlain to get at defences (especially the older ones, like Ukraine) and cause problems. The main concern is Roy Hodgson hasn’t had long to get his ideas across as well as alienating players such as Rio Ferdinand. (Will he even be missed? No.) Young players can have this tournament for experience before a better (but unsuccessful) tilt at World Cup 2014. UKRAINE – The other hosts have the harder group compared to Poland and will most likely be crashing out early. Relying on Shevchenko, Tymoshchuk and Rotan for goals and creative spark despite all being over 30 shows a team that is stale. They have also not played competitive football for some time, playing against the tinpot sides as “warm up” for France and England. A 3-2 defeat to Austria also shows this team lack the ability of others and should be heading for an early exit. 3 points most likely against Sweden however. SWEDEN – Imagine Sweden being Portugal-Lite. With Ibrahimovic playing the role of C.Ronaldo, the rest of the team watch as he tries to make the magic happen. A slight exaggeration but should be close to the truth. A team in transition under Erik Hamren are starting to attack more (appealing to Ibra) and get other “key” players such as Elmander, Kallstrom and Larsson into the game. Add in up and coming talents such as Rasmus Elm and Ola Toivonen and it’s not all bad. But can they overcome any of these 3 teams in the group? I think not. THE GROUP – France and England in the Top 2 with France nicking it. Probably through a narrow win in the first game against each other. Should England need a result in their final game against the hosts then 2nd and 3rd place could change hands but I think England should hold on to their QF place. Can’t see Sweden doing anything, but I’ve been wrong before, lots of times. 1st – FRANCE, 2nd – ENGLAND, 3rd – Ukraine, 4th – Sweden QUARTER FINALS Poland vs Germany Holland vs Russia Spain vs England France vs Croatia The four group winners (bar Poland) should have enough to get through to the Semis. Poland despite having a home crowd behind them should be beaten by Germany’s blitzkrieg tactics as Die Mannschaft should now be getting into full force. Holland won’t suffer the same result at Euro 2008 as they’ll beat Russia, Spain should pass their way past England while France will show Croatia’s defensive deficiencies up. SEMI FINALS Germany vs Spain Holland vs France Spain’s run as Euro Champs will end as Germany will win a narrow game (elfmeters?) to fully show their credentials as favourites. Holland vs France is a tougher game, but I’ve gone with Holland as they have the experience of getting to a final while France still have shown signs they can self-implode. FINAL GERMANY vs Holland It’s the repeat of the Euro ‘88 semi and the World Cup ‘74 final. I’ve gone with Germany to win it as they have shown signs in the last two tournaments of going all the way and should finally win a tournament with a team that will get better too. I can see this being an even tighter game than the group stage encounter but the different elements of the German team along with their German efficiency will see them win their 4th Euro Champ title.
[ { "date": "2019-01-01 00:00:00", "start": "2018-12-31T14:00:00.000Z", "end": "2019-01-01T14:00:00.000Z", "name": "New Year's Day", "type": "public", "rule": "01-01 and if sunday then next monday if saturday then previous friday", "_weekday": "Tue" }, { "date": "2019-01-21 00:00:00", "start": "2019-01-20T14:00:00.000Z", "end": "2019-01-21T14:00:00.000Z", "name": "Martin Luther King Jr. Day", "type": "public", "rule": "3rd monday in January", "_weekday": "Mon" }, { "date": "2019-02-14 00:00:00", "start": "2019-02-13T14:00:00.000Z", "end": "2019-02-14T14:00:00.000Z", "name": "Valentine's Day", "type": "observance", "rule": "02-14", "_weekday": "Thu" }, { "date": "2019-03-04 00:00:00", "start": "2019-03-03T14:00:00.000Z", "end": "2019-03-04T14:00:00.000Z", "name": "Guam History and Chamorro Heritage Day", "type": "public", "rule": "1st monday in March", "_weekday": "Mon" }, { "date": "2019-04-15 00:00:00", "start": "2019-04-14T14:00:00.000Z", "end": "2019-04-15T14:00:00.000Z", "name": "Tax Day", "type": "observance", "rule": "04-15 if friday then next monday if saturday,sunday then next tuesday", "_weekday": "Mon" }, { "date": "2019-04-19 00:00:00", "start": "2019-04-18T14:00:00.000Z", "end": "2019-04-19T14:00:00.000Z", "name": "Good Friday", "type": "observance", "rule": "easter -2", "_weekday": "Fri" }, { "date": "2019-04-21 00:00:00", "start": "2019-04-20T14:00:00.000Z", "end": "2019-04-21T14:00:00.000Z", "name": "Easter Sunday", "type": "observance", "rule": "easter", "_weekday": "Sun" }, { "date": "2019-04-24 00:00:00", "start": "2019-04-23T14:00:00.000Z", "end": "2019-04-24T14:00:00.000Z", "name": "Administrative Professionals Day", "type": "observance", "rule": "wednesday before 04-28", "_weekday": "Wed" }, { "date": "2019-05-12 00:00:00", "start": "2019-05-11T14:00:00.000Z", "end": "2019-05-12T14:00:00.000Z", "name": "Mother's Day", "type": "observance", "rule": "2nd sunday in May", "_weekday": "Sun" }, { "date": "2019-05-27 00:00:00", "start": "2019-05-26T14:00:00.000Z", "end": "2019-05-27T14:00:00.000Z", "name": "Memorial Day", "type": "public", "rule": "monday before 06-01", "_weekday": "Mon" }, { "date": "2019-06-16 00:00:00", "start": "2019-06-15T14:00:00.000Z", "end": "2019-06-16T14:00:00.000Z", "name": "Father's Day", "type": "observance", "rule": "3rd sunday in June", "_weekday": "Sun" }, { "date": "2019-07-04 00:00:00", "start": "2019-07-03T14:00:00.000Z", "end": "2019-07-04T14:00:00.000Z", "name": "Independence Day", "type": "public", "rule": "07-04 and if sunday then next monday if saturday then previous friday", "_weekday": "Thu" }, { "date": "2019-07-22 00:00:00", "start": "2019-07-21T14:00:00.000Z", "end": "2019-07-22T14:00:00.000Z", "name": "Liberation Day", "type": "public", "rule": "07-21 if sunday then next monday", "_weekday": "Mon" }, { "date": "2019-09-02 00:00:00", "start": "2019-09-01T14:00:00.000Z", "end": "2019-09-02T14:00:00.000Z", "name": "Labor Day", "type": "public", "rule": "monday in September", "_weekday": "Mon" }, { "date": "2019-10-14 00:00:00", "start": "2019-10-13T14:00:00.000Z", "end": "2019-10-14T14:00:00.000Z", "name": "Columbus Day", "type": "public", "rule": "2nd monday in October", "_weekday": "Mon" }, { "date": "2019-10-31 18:00:00", "start": "2019-10-31T08:00:00.000Z", "end": "2019-10-31T14:00:00.000Z", "name": "Halloween", "type": "observance", "rule": "10-31 18:00", "_weekday": "Thu" }, { "date": "2019-11-02 00:00:00", "start": "2019-11-01T14:00:00.000Z", "end": "2019-11-02T14:00:00.000Z", "name": "All Souls' Day", "type": "public", "rule": "11-02", "_weekday": "Sat" }, { "date": "2019-11-11 00:00:00", "start": "2019-11-10T14:00:00.000Z", "end": "2019-11-11T14:00:00.000Z", "name": "Veterans Day", "type": "public", "rule": "11-11", "_weekday": "Mon" }, { "date": "2019-11-28 00:00:00", "start": "2019-11-27T14:00:00.000Z", "end": "2019-11-28T14:00:00.000Z", "name": "Thanksgiving Day", "type": "public", "rule": "4th thursday in November", "_weekday": "Thu" }, { "date": "2019-11-29 00:00:00", "start": "2019-11-28T14:00:00.000Z", "end": "2019-11-29T14:00:00.000Z", "name": "Day after Thanksgiving Day", "type": "observance", "rule": "friday after 4th thursday in November", "_weekday": "Fri" }, { "date": "2019-12-09 00:00:00", "start": "2019-12-08T14:00:00.000Z", "end": "2019-12-09T14:00:00.000Z", "name": "Our Lady of Camarin Day", "type": "public", "rule": "12-08 if sunday then next monday", "_weekday": "Mon" }, { "date": "2019-12-24 00:00:00", "start": "2019-12-23T14:00:00.000Z", "end": "2019-12-24T14:00:00.000Z", "name": "Christmas Eve", "type": "optional", "rule": "12-24", "_weekday": "Tue" }, { "date": "2019-12-25 00:00:00", "start": "2019-12-24T14:00:00.000Z", "end": "2019-12-25T14:00:00.000Z", "name": "Christmas Day", "type": "public", "rule": "12-25 and if sunday then next monday if saturday then previous friday", "_weekday": "Wed" }, { "date": "2019-12-31 00:00:00", "start": "2019-12-30T14:00:00.000Z", "end": "2019-12-31T14:00:00.000Z", "name": "New Year's Eve", "type": "observance", "rule": "12-31", "_weekday": "Tue" } ]
ABUJA — National Chairman of All Progressives Congress, APC, Chief John Oyegun yesterday revealed that he resisted several external efforts to truncate the just concluded presidential election of the party in Lagos. According to him, his belief that the best aspirant would emerge as the presidential candidate of the party through a transparent process paid off having entrusted the task on credible hands. Oyegun spoke during the presentation of the report of the national convention committee which was chaired by the immediate past governor of Ekiti state, Dr. Kayode Fayemi. He said: “I am not at all surprised at the very outstanding job that you and your team have accomplished. “The success of the convention has propelled the party. We are proponent of change and it was necessary that one of our major activity should convey to the world what we mean by change. “So many efforts were made to get me to call the aspirants together and arm twist them into stepping down for each other and I resisted it and said, no, we are going to organise a transparent convention so that whoever win will have no excuse in the world. “I entrusted that mission to you and your team. You have organised what will go into history in this nation, in our political space and beyond as clearly the freest and fairest presidential primary that has ever been witnessed in this nation. On behalf of the party, I congratulate you for what you have done for the party which is incalculable.
// Copyright (C) 2002 Charless C. Fowlkes <fowlkes@eecs.berkeley.edu> // Copyright (C) 2002 David R. Martin <dmartin@eecs.berkeley.edu> // // This program is free software; you can redistribute it and/or // modify it under the terms of the GNU General Public License as // published by the Free Software Foundation; either version 2 of the // License, or (at your option) any later version. // // This program is distributed in the hope that it will be useful, but // WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU // General Public License for more details. // // You should have received a copy of the GNU General Public License // along with this program; if not, write to the Free Software // Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA // 02111-1307, USA, or see http://www.gnu.org/copyleft/gpl.html. #include <assert.h> #include <limits.h> #include <float.h> #include <math.h> #include <stdlib.h> #include <iostream> #include <stdio.h> #include <ctype.h> #include <memory.h> #include "image.hh" #include "array.hh" #include "ic.hh" namespace Group { // // given a pb image and window radius, computes a support map for each // pixel out to the given radius. // void computeSupport(const DualLattice& boundaries, const int wr, const float thresh, SupportMap& support) { support.resize(boundaries.width,boundaries.height); Util::Array1D<PointIC> adj; int count = 0; //Util::Message::startBlock(boundaries.width,"computing support"); for (int x = 0; x < boundaries.width; x++) { //Util::Message::stepBlock(); for (int y = 0; y < boundaries.height; y++) { interveningContour(boundaries,thresh,x,y,wr,adj,count); Util::Array1D<PointIC> map(count); for (int i = 0; i < count; i++) { map(i) = adj(i); const int ix = map(i).x; const int iy = map(i).y; assert(ix >= 0); assert(ix < boundaries.width); assert(iy >= 0); assert(iy < boundaries.height); } support(x,y) = map; } } //Util::Message::endBlock(); } // // Walk the bresenham line from (x0,y0) to (x2,y2) ignoring any points outside // a circular window of radius wr. // (x1,y1) and (x3,y3) should be on either side of (x2,y2) // // For each line, stop if the max-accumulated pb is > thresh. // // Append any points on the line (for which the line is the best approximant // and distance from x0 is less than wr) to scanlines array. // // points is preallocated scratch space. // scanCount and scanLines store the results // void ic_walk (const DualLattice& boundaries, const float thresh, const int x0, const int y0, const int x1, const int y1, const int x2, const int y2, const int x3, const int y3, const int wr, Util::Array1D <PointIC> &points, Util::Array1D <int>&scanCount, Util::Array2D <PointIC> &scanLines) { const int width = boundaries.width; const int height = boundaries.height; // the predicate that uses long longs will overflow if the image // is too large assert (2*wr+1 < 1000); // make sure points array is big enough assert ((int) points.size () >= 4*wr+2); // make sure scan arrays are the right size assert ((int)scanCount.size() == 2*wr+1); assert ((int)scanLines.size(0) == 2*wr+1); assert ((int)scanLines.size(1) == 2*wr+1); //sanity check the points assert (x0 >= 0 && x0 < width); assert (y0 >= 0 && y0 < height); assert (x1 >= 0 && x1 < width); assert (y1 >= 0 && y1 < height); assert (x2 >= 0 && x2 < width); assert (y2 >= 0 && y2 < height); assert (x3 >= 0 && x3 < width); assert (y3 >= 0 && y3 < height); // make sure points are all distinct assert (x0 != x1 || y0 != y1); assert (x0 != x2 || y0 != y2); assert (x0 != x3 || y0 != y3); assert (x1 != x2 || y1 != y2); assert (x1 != x3 || y1 != y3); assert (x2 != x3 || y2 != y3); //constants used in testing whether this is //the best path const long long dx1 = x1 - x0; const long long dy1 = y1 - y0; const long long dx2 = x2 - x0; const long long dy2 = y2 - y0; const long long dx3 = x3 - x0; const long long dy3 = y3 - y0; const long long dot11 = dx1 * dx1 + dy1 * dy1; const long long dot22 = dx2 * dx2 + dy2 * dy2; const long long dot33 = dx3 * dx3 + dy3 * dy3; // compute dx,dy for the bresenham line const int dx = x2 - x0; const int dy = y2 - y0; const int adx = abs (dx); const int ady = abs (dy); // figure out what octant we're in for the bresenham algorithm; // octant i covers pi/4 * [i,i+1) int octant = -1; if (dx > 0 && dy >= 0) { // quadrant 0 octant = (adx > ady) ? 0 : 1; } else if (dx <= 0 && dy > 0) { // quadrant 1 octant = (adx < ady) ? 2 : 3; } else if (dy <= 0 && dx < 0) { // quadrant 2 octant = (adx > ady) ? 4 : 5; } else if (dx >= 0 && dy < 0) { // quadrant 3 octant = (adx < ady) ? 6 : 7; } else { assert (0); } // t is our bresenham counter int t = 0; switch (octant) { case 0: t = -adx; break; case 1: t = -ady; break; case 2: t = -ady; break; case 3: t = -adx; break; case 4: t = -adx; break; case 5: t = -ady; break; case 6: t = -ady; break; case 7: t = -adx; break; default: assert (0); } // maxpb contains the max-accumulation of pb from (x0,y0) to (x,y) // on the bresenham line. float maxpb = 0.0f; // (xi,yi) is our current location on the bresenham line int xi = x0; int yi = y0; // accumulate the points in the order we find them int count = 0; int oldx = xi; int oldy = yi; //walk the line while (xi != x2 || yi != y2) { // step one pixel on the bresenham line switch (octant) { case 0: xi++; t += (ady << 1); if (t > 0) { yi++; t -= (adx << 1); } break; case 1: yi++; t += (adx << 1); if (t > 0) { xi++; t -= (ady << 1); } break; case 2: yi++; t += (adx << 1); if (t > 0) { xi--; t -= (ady << 1); } break; case 3: xi--; t += (ady << 1); if (t > 0) { yi++; t -= (adx << 1); } break; case 4: xi--; t += (ady << 1); if (t > 0) { yi--; t -= (adx << 1); } break; case 5: yi--; t += (adx << 1); if (t > 0) { xi--; t -= (ady << 1); } break; case 6: yi--; t += (adx << 1); if (t > 0) { xi++; t -= (ady << 1); } break; case 7: xi++; t += (ady << 1); if (t > 0) { yi--; t -= (adx << 1); } break; default: assert (0); } // Figure out if the bresenham line from (x0,y0) to (x2,y2) is the // best approximant we will see for the line from (x0,y0) to (xi,yi). // We need: // T(i,2) < T(i,1) && T(i,2) <= T(i,3) // Where T(a,b) is the angle between the two lines (x0,y0)-(xa,ya) // and (x0,y0)-(xb,yb). // We can compute an exact integer predicate; let C be the square // of the cosine of T: // C(i,2) > C(i,1) && C(i,2) >= C(i,3) // Use the identity: // cos(t) = a.b/|a||b| // Square and cross-multiply to get rid of the divides and square // roots. // Note that we first check to see if T(i,2) == 0, in which case // the line is a perfect approximant. const long long dxi = xi - x0; const long long dyi = yi - y0; const long long dotii = dxi * dxi + dyi * dyi; const long long doti1 = dxi * dx1 + dyi * dy1; const long long doti2 = dxi * dx2 + dyi * dy2; const long long doti3 = dxi * dx3 + dyi * dy3; const bool good = (doti2*doti2 == dotii*dot22) || (dot11*doti2*doti2 > dot22*doti1*doti1 && dot33*doti2*doti2 >= dot22*doti3*doti3); // otherwise accumulate the pb value if we've crossed an edge float intersected = 0.0f; if (oldx == xi) { if (yi > oldy) { intersected = boundaries.H(xi,yi); } else if (yi < oldy) { intersected = boundaries.H(oldx,oldy); } } else if (oldy == yi) { if (xi > oldx) { intersected = boundaries.V(xi,yi); } else if (xi < oldx) { intersected = boundaries.V(oldx,oldy); } } else { if ((xi > oldx) && (yi > oldy)) //down to right { intersected = std::max(boundaries.H(oldx,yi),intersected); intersected = std::max(boundaries.H(xi,yi),intersected); intersected = std::max(boundaries.V(xi,oldy),intersected); intersected = std::max(boundaries.V(xi,yi),intersected); } else if ((xi > oldx) && (yi < oldy)) //up to right { intersected = std::max(boundaries.H(oldx,oldy),intersected); intersected = std::max(boundaries.H(xi,oldy),intersected); intersected = std::max(boundaries.V(xi,oldy),intersected); intersected = std::max(boundaries.V(xi,yi),intersected); } else if ((xi < oldx) && (yi > oldy)) //down to left { intersected = std::max(boundaries.H(oldx,yi),intersected); intersected = std::max(boundaries.H(xi,yi),intersected); intersected = std::max(boundaries.V(oldx,oldy),intersected); intersected = std::max(boundaries.V(oldx,yi),intersected); } else if ((xi < oldx) && (yi < oldy)) //up to left { intersected = std::max(boundaries.H(oldx,oldy),intersected); intersected = std::max(boundaries.H(xi,oldy),intersected); intersected = std::max(boundaries.V(oldx,oldy),intersected); intersected = std::max(boundaries.V(oldx,yi),intersected); } } maxpb = std::max(maxpb,intersected); oldx = xi; oldy = yi; // if the approximation is not good, then skip this point if (!good) { continue; } // if the accumulated pb is too high, then stop if (maxpb > thresh) { break; } // record this connection PointIC p; p.x = xi; p.y = yi; p.sim = 1.0f - maxpb; points(count) = p; count++; } // add our list of points to scanLines; we have to reverse // the order in octants 2,3,4,5 switch (octant) { case 0: case 1: case 6: case 7: for (int i = 0; i < count; i++) { const int yind = points(i).y - y0 + wr; scanLines(yind,scanCount(yind)++) = points (i); } break; case 2: case 3: case 4: case 5: for (int i = count - 1; i >= 0; i--) { const int yind = points(i).y - y0 + wr; scanLines(yind,scanCount(yind)++) = points (i); } break; default: assert (0); } } // // given a pb image, a pixel (x0,y0), and a pb threshold, compute the intervening-contour // weight to all pixels inside a given box of radius "wr" subject to the threshold "thresh". // pb is max-accumulated along bresenham lines. the result is stored in scanline order as // a list of points and their pb value. // void interveningContour(const DualLattice& boundaries, const float thresh, const int x0, const int y0, const int wr, Util::Array1D<PointIC> &adj, int &count) { const int width = boundaries.width; const int height = boundaries.height; // make sure (x0,y0) is valid assert (x0 >= 0 && x0 < width); assert (y0 >= 0 && y0 < height); // make sure adj array is big enough adj.resize((2*wr+1)*(2*wr+1)); // allocate space for lists of pixels; this operation is O(1) // since the space need not be initialized. Util::Array2D <PointIC>scanLines(2*wr+1,2*wr+1); // we need to keep track of the length of the scan lines Util::Array1D <int>scanCount(2*wr+1); scanCount.init(0); // scratch space for ic_walk() function Util::Array1D<PointIC> scratch(4*wr+2); // the rectangle of interest, a square with edge of length // 2*wr+1 clipped to the image dimensions const int rxa = std::max(0,x0-wr); const int rya = std::max(0,y0-wr); const int rxb = std::min(x0+wr,width-1); const int ryb = std::min(y0+wr,height-1); // walk around the boundary, collecting points in the scanline array // first walk around the rectangle boundary clockwise for theta = [pi,0] //std::cerr << "[" << x0 << "," << y0 << "] "; //std::cerr << "(" << rxa << "," << rya << ")-(" << rxb << "," << ryb << ")" << std::endl; if (x0 > rxa) // left { if ((y0 > 0) && (y0 < ryb)) { ic_walk(boundaries, thresh, x0,y0, rxa,y0-1, rxa,y0, rxa,y0+1, wr, scratch,scanCount,scanLines); } for (int y = y0-1; y > rya; y--) { ic_walk(boundaries, thresh, x0,y0, rxa,y-1, rxa,y, rxa,y+1, wr, scratch,scanCount,scanLines); } } if (x0 > rxa+1 || y0 > rya+1 || ((x0 > rxa) && (y0 > rya)) ) // top-left { ic_walk(boundaries, thresh, x0,y0, rxa,rya+1, rxa,rya, rxa+1,rya, wr, scratch, scanCount, scanLines); } if ( ((x0 == rxa) && (y0 == rya+1)) || ((x0 == rxa+1) && (y0 == rya)) ) { PointIC pnt; pnt.x = rxa; pnt.y = rya; pnt.sim = 1.0f; const int yind = pnt.y - y0 + wr; scanLines(yind,scanCount(yind)++) = pnt; } if (y0 > rya) // top { for (int x = rxa+1; x < rxb; x++) { ic_walk(boundaries, thresh, x0,y0, x-1,rya, x,rya, x+1,rya, wr, scratch, scanCount, scanLines); } } if ((y0 > rya+1) || (x0 < rxb-1) || ((y0 > rya) && (x0 < rxb)) ) // top-right { ic_walk(boundaries, thresh, x0,y0, rxb-1,rya, rxb,rya, rxb,rya+1, wr, scratch, scanCount, scanLines); } if ( ((x0 == rxb-1) && (y0 == rya)) || ((x0 == rxb) && (y0 == rya+1)) ) { PointIC pnt; pnt.x = rxb; pnt.y = rya; pnt.sim = 1.0f; const int yind = pnt.y - y0 + wr; scanLines(yind,scanCount(yind)++) = pnt; } if (x0 < rxb) // right { for (int y = rya+1; y < y0; y++) { ic_walk(boundaries, thresh, x0,y0, rxb,y-1, rxb,y, rxb,y+1, wr, scratch, scanCount, scanLines); } } // now counterclockwise for theta = (pi,0) if (x0 > rxa) // left { for (int y = y0+1; y < ryb; y++) { ic_walk(boundaries, thresh, x0,y0, rxa,y-1, rxa,y, rxa,y+1, wr, scratch, scanCount, scanLines); } } if ((x0 > rxa+1) || (y0 < ryb-1) || ((x0 > rxa) && (y0 < ryb))) // bottom-left { ic_walk(boundaries, thresh, x0,y0, rxa,ryb-1, rxa,ryb, rxa+1,ryb, wr, scratch, scanCount, scanLines); } if ( ((x0 == rxa) && (y0 == ryb-1)) || ((x0 == rxa+1) && (y0 == ryb)) ) { PointIC pnt; pnt.x = rxa; pnt.y = ryb; pnt.sim = 1.0f; const int yind = pnt.y - y0 + wr; scanLines(yind,scanCount(yind)++) = pnt; } if (y0 < ryb) // bottom { for (int x = rxa+1; x < rxb; x++) { ic_walk(boundaries, thresh, x0,y0, x-1,ryb, x,ryb, x+1,ryb, wr, scratch, scanCount, scanLines); } } if ((y0 < ryb-1) || (x0 < rxb-1) || ((y0 < ryb) && (x0 < rxb))) // bottom-right { ic_walk(boundaries, thresh, x0,y0, rxb-1,ryb, rxb,ryb, rxb,ryb-1, wr, scratch, scanCount, scanLines); } if ( ((x0 == rxb-1) && (y0 == ryb)) || ((x0 == rxb) && (y0 == ryb-1)) ) { PointIC pnt; pnt.x = rxb; pnt.y = ryb; pnt.sim = 1.0f; const int yind = pnt.y - y0 + wr; scanLines(yind,scanCount(yind)++) = pnt; } if (x0 < rxb) // right { for (int y = ryb-1; y > y0; y--) { ic_walk(boundaries, thresh, x0,y0, rxb,y-1, rxb,y, rxb,y+1, wr, scratch, scanCount, scanLines); } if ((y0 > 0) && (y0 < ryb)) { ic_walk(boundaries, thresh, x0,y0, rxb,y0-1, rxb,y0, rxb,y0+1, wr, scratch, scanCount, scanLines); } } for (int y = 0; y < 2*wr+1; y++) { int len = scanCount(y); assert (len >= 0 && len <= 2*wr+1); if (y + y0 - wr < 0) { assert(len == 0); } // check that pixels are in the right row for (int i = 0; i < len; i++) { assert(scanLines(y,i).y == y+y0-wr); } // check that pixels in each row are in increasing order for (int i = 0; i < len-1; i++) { assert(scanLines(y,i).x < scanLines(y,i+1).x); } } // construct the adjacency list count = 0; for (int y = 0; y < 2*wr+1; y++) { int len = scanCount(y); for (int i = 0; i < len; i++) { adj(count++) = scanLines(y,i); } } } // compute the max over lattice energies on a straightline // path connecting p1 and p2 /* void interveningContour (const DualLattice& boundaries, const int x1, const int y1, const int x2, const int y2, float& icsim) { float maxpb = 0; const int width = boundaries.pb.size(0); const int height = boundaries.pb.size(1); const int dx = x2 - x1; const int dy = y2 - y1; const int steps = std::max (abs (dx), abs (dy)); if (steps == 0) { return; } const float xincr = (float) dx / (float) steps; const float yincr = (float) dy / (float) steps; float x = x1; float y = y1; float olddist = boundaries.dist(x1,y1); for (int k = 0; k < steps; k++) { x += xincr; y += yincr; const int xi = (int) rint (x); const int yi = (int) rint (y); float newdist = boundaries.dist(xi,yi); if ( ((olddist >= 0) && (newdist < 0)) || ((olddist <= 0) && (newdist > 0)) ) { maxpb = std::max(maxpb, boundaries.pb(xi,yi)); } olddist = newdist; } icsim = 1-maxpb; } */ } //namespace Group
<?php /** * sysPass * * @author nuxsmin * @link https://syspass.org * @copyright 2012-2018, Rubén Domínguez nuxsmin@$syspass.org * * This file is part of sysPass. * * sysPass is free software: you can redistribute it and/or modify * it under the terms of the GNU General Public License as published by * the Free Software Foundation, either version 3 of the License, or * (at your option) any later version. * * sysPass is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with sysPass. If not, see <http://www.gnu.org/licenses/>. */ namespace SP\Tests\SP\Services\UserGroup; use DI\DependencyException; use DI\NotFoundException; use SP\Core\Context\ContextException; use SP\Core\Exceptions\ConstraintException; use SP\Core\Exceptions\QueryException; use SP\Core\Exceptions\SPException; use SP\DataModel\UserToUserGroupData; use SP\Repositories\NoSuchItemException; use SP\Services\UserGroup\UserToUserGroupService; use SP\Storage\Database\DatabaseConnectionData; use SP\Tests\DatabaseTestCase; use function SP\Tests\setupContext; /** * Class UserToUserGroupServiceTest * * @package SP\Tests\SP\Services\UserGroup */ class UserToUserGroupServiceTest extends DatabaseTestCase { /** * @var UserToUserGroupService */ private static $service; /** * @throws NotFoundException * @throws ContextException * @throws DependencyException * @throws SPException */ public static function setUpBeforeClass() { $dic = setupContext(); self::$dataset = 'syspass_userGroup.xml'; // Datos de conexión a la BBDD self::$databaseConnectionData = $dic->get(DatabaseConnectionData::class); // Inicializar el servicio self::$service = $dic->get(UserToUserGroupService::class); } /** * @throws ConstraintException * @throws QueryException */ public function testCheckUserInGroup() { $this->assertTrue(self::$service->checkUserInGroup(1, 2)); $this->assertTrue(self::$service->checkUserInGroup(2, 3)); $this->assertFalse(self::$service->checkUserInGroup(3, 3)); } /** * @throws ConstraintException * @throws QueryException */ public function testGetGroupsForUser() { $data = self::$service->getGroupsForUser(3); $this->assertCount(1, $data); $this->assertEquals(2, $data[0]->userGroupId); $data = self::$service->getGroupsForUser(2); $this->assertCount(2, $data); $this->assertEquals(1, $data[0]->userGroupId); $this->assertEquals(3, $data[1]->userGroupId); $data = self::$service->getGroupsForUser(10); $this->assertCount(0, $data); } /** * @throws ConstraintException * @throws QueryException */ public function testAdd() { $data = [3, 4]; self::$service->add(1, $data); $this->assertEquals([2, 3, 4], self::$service->getUsersByGroupId(1)); $this->expectException(ConstraintException::class); self::$service->add(10, $data); } /** * @throws ConstraintException * @throws QueryException */ public function testAddDuplicated() { $data = [2, 3, 4]; $this->expectException(ConstraintException::class); self::$service->add(1, $data); } /** * @throws ConstraintException * @throws QueryException */ public function testUpdate() { $data = [3, 4]; self::$service->update(1, $data); $this->assertEquals($data, self::$service->getUsersByGroupId(1)); $this->expectException(ConstraintException::class); self::$service->update(10, $data); } /** * @throws ConstraintException * @throws QueryException * @throws NoSuchItemException */ public function testGetById() { $data = self::$service->getById(2); $this->assertCount(2, $data); $this->assertInstanceOf(UserToUserGroupData::class, $data[0]); $this->assertEquals(2, $data[0]->getUserGroupId()); $this->assertEquals(1, $data[0]->getUserId()); $this->assertEquals(2, $data[1]->getUserGroupId()); $this->assertEquals(3, $data[1]->getUserId()); $data = self::$service->getById(3); $this->assertCount(1, $data); $this->assertEquals(3, $data[0]->getUserGroupId()); $this->assertEquals(2, $data[0]->getUserId()); $this->expectException(NoSuchItemException::class); self::$service->getById(10); } /** * @throws ConstraintException * @throws QueryException */ public function testGetUsersByGroupId() { $data = self::$service->getUsersByGroupId(2); $this->assertCount(2, $data); $this->assertEquals([1, 3], $data); } }
"I'm the most popular Republican ever" 7 new steel plants Praised for reuniting families "Bob Mueller is totally conflicted" President Donald Trump's raucous and freewheeling campaign rallies are fertile ground for misinformation. He held two of them this week, and he's got another in Ohio on Saturday.And he's not the only one out there pushing false narratives.Spotted in the crowd on Tuesday were dozens of followers of the "QAnon" conspiracy theory. You can read more about that here , but I'll sum it up quickly: Adherents peddle bizarre claims being pushed by an anonymous internet troll called "Q," who tells his followers Trump's mission in the White House is to unravel a pedophilic "deep state" run by former government officials.Welcome to Fact Check Friday.There is no doubt the president can draw a raucous crowd, but the most popular Republican ever? More so than Honest Abe?Here's Trump at a campaign rally in Tampa, Florida, Tuesday night: "They just came out with a poll, did you hear? The most popular person in the history of the Republican party is Trump! Can you believe this? [Cheers and applause] ... So I said: 'Does that include Honest Abe Lincoln? He was pretty good, right?'"Of course, there was no polling when Lincoln was president.But when we look at polls about other presidents, Trump's claim doesn't hold up. In fact, so far, he's tied with President Richard Nixon at second to last when you look at the highest poll numbers of each post-World War II president.Trump's highest approval rating to date among Republicans had him at 90 percent. Respectable. But Presidents Reagan, Bush 41 and 43, Nixon and Eisenhower all did better than that at some point during their tenures. Trump does beat President Ford's all-time best approval rating of 80 percent.Speaking at a campaign rally Thursday, in the heart of American steel country in Wilkes-Barre, Pennsylvania, President Trump claimed: "U.S. Steel is opening up seven plants."He upped the number from Tuesday when he told a crowd in Tampa the steel company was building six new mills."U.S. Steel just announced that they are building six new steel mills. And that number is soon going to be lifted, but I'm not allowed to say that so I won't."We're left to suppose he got permission to make the announcement. But when we called U.S. Steel, the company said it wouldn't confirm Trump's claim. Meghan Cox, a spokeswoman for U.S. steel, said all major announcements are made public and posted on its website.In June, U.S. Steel announced it would restart blast furnace "A" at Granite City Works this fall due to "increased demand for steel manufactured in the United States." The company says the restart will add 300 new jobs on top of 500 new jobs added after it opened blast furnace "B" in March.There was no mention of seven new steel plants. The White House did not respond to ABC's request for clarification.The president took to Twitter this week to let his followers know a federal judge had given his government "great credit" for reuniting children with their families after they were separated at the border."A highly respected federal judge today stated that the "Trump Administration gets great credit" for reuniting illegal families. Thank you, and please look at the previous administration's record - not good!"Judge Dana Sabraw did say "the government deserves great credit" for reuniting most families, but keep in mind the only reason they were in court was to reverse the Trump's policy of separating families.Plus, in that same proceeding, Judge Sabraw said "the government is at fault for losing several hundred parents in the process," referencing the deportation of hundreds of parents without their children.Also this: Cmdr. Jonathan White, a senior Health and Human Services official tasked with managing the detention and reunification of these immigrant children, testified to Congress this week that he'd warned the administration in advance that children would suffer under this policy."We raised a number of concerns ... about any policy that would result in family separations due to our concerns for the best interest of the child," White told the Senate Judiciary Committee. "Separation of children from their parents entails significant risk of harm to children," White said.Most important, the problem isn't solved. Hundreds of children remain separated from their parents. Here's Judge Sabrow in Friday's hearing: "The reality is that for every parent who is not located, there will be a permanently orphaned child, and that is 100% the responsibility of the administration."President Trump called for his attorney general, Jeff Sessions, to "stop" the Russia investigation this week. One reason, he says, is that special Robert Mueller has "conflicts of interest."The problem is, he hasn't offered any evidence to support that claim.For the purposes of a fact check, it's not possible to disprove the unknown, but consider these known facts:Trump tweeted, "Is Robert Mueller ever going to release his conflicts of interest with respect to President Trump, including the fact that we had a very nasty & contentious business relationship, I turned him down to head the FBI (one day before appointment as S.C.) & Comey is his close friend.."First, in the same sentence in which Trump claims he had a "nasty and contentious business relationship" with Mueller, he also claims to have interviewed him to head the FBI. Why would he have interviewed Mueller for that job if he knew that he had conflicts?Plus, would Mueller even want that job again? He'd already run the FBI for 12 years. And he was even asked to stay on an extra two years past the designated 10-year term, which ended in 2013.Second, Trump has never said what the alleged "business" problem was. However, the New York Times reported in January that Trump has cited a private dispute Mueller had over dues at Trump's golf club in Sterling, Virginia.Third, and finally, on June 28, 2018, Trump's own deputy attorney general, Rod Rosenstein, the person who appointed Mueller, testified to Congress that he was "not aware of any disqualifying conflict of interest."Trump's claim is ruled highly suspect. But, if the president more clearly states his view of the alleged conflict, we will update this post.
pay some homage to the other series.I think the main problem with the series is the relative shortness as there was honestly so much more the creator could have done with the theme in question. On the other hand the creator may not have wanted the series to become a “monster of the week” series just so the readers could in fact find out the fate in relation to the “white akuma”, and whether or not the world ends up being saved from the wheels of fate. Instead we get a short piece that focuses more on the psychological element as well as inter relations between the characters. The story also falls into many cliches as well that may have brought it down had the writer made said series longer.The characters are ultra important when it comes to this particular series. This short series is after all about how people interact with each other, and how people act towards others in prejudicial ways because of fear. Sometimes fear is justified, but in other times said fear is not. This is a theme that is explored along with how those acting in prejudicial manners and those being prejudiced act towards each other, and why conflict does occur in real life.The art work for this particular piece is also nice. The artist takes the time to fill every frame with important information in regards to the story line, nor is there any confusing action poses that a person can't read the movements of. Luca's design embodies the persona people would expect of someone labeled a demon, while his sister is the personification of pure innocence. The artist went out of his way to personify these attributes to each, and for good reason.Ultimatly I enjoyed this short series a lot. Not only was it short, but I could feel empathy towards the characters. I enjoyed the plot twists for the stories. I also liked making the connections to “Naruto” and comparing the two on a critical level. While it is true that the two are their own pieces of work I think a person can also appreciate “Shuumatsu no Laughter” even more with a knowledge of Naruto. Or one could have it soured if one is to much of a fangirl/fanboy.
Spontaneous oscillation of the systemic arterial pressure during cardiopulmonary bypass in man. The effects of some drugs used during the operation. Despite the fact that the blood flow maintained during cardiopulmonary bypass is rather steady in the extracorporeal pump output, the arterial pressure under high-dose fentanyl anaesthesia quite often shows sinusoidal oscillations. In the present study the duration of an oscillatory cycle was on average 17.6 +/- 3.6 s, its amplitude 7.3 +/- 1.6 mm Hg and mean systemic arterial pressure 75 +/- 12 mm Hg. The oscillation is affected by the drugs used under bypass conditions. In our series of clinical observations the blood pressure oscillation disappeared under the influence of chlorpromazine, phentolamine, droperidol, and enflurane, and it disappeared or at least was distinctly attenuated under fentanyl, thiopental, diazepam, sodium nitroprusside, nitroglycerin, acebutolol, and potassium chloride. Pancuronium, atropine and furosemide appeared to be practically ineffective. In spite of the fact that the drugs used affected several sites of the sympathetic efferent chain, the disappearance and attenuation of the oscillation were associated with a simultaneous decrease of blood pressure. Hence, it is suggested that the occurrence of the oscillations requires some level of peripheral vascular tone.
[Meta-analysis on autogenous fat injection for unilateral vocal cord paralysis]. This study conduct a qualitative synthesis and quantitative meta-analysis of VFAFI, aimed to study whether it is a useful treatment for UVCP. Electronic databases PubMed, YZ365. COM, WANFANG DATA, CMJD, CHKD,CNKI were searched using relevant keywords. Reported treatment outcomes were clustered into three categories,i. e. subjective, perceptual,acoustic,aerodynamic,and stroboscopic. Meta-analyses were performed on studies with numerical results using random effects model. Five articles were identified with a total of 404 patients. All the studies reported significant improvements or decrease after VFAFI in each category of outcome measurements. Meta-analysis demonstrated a significant increase or decrease in all categories. Adverse effects include slight inflammatory reponse can resolve spontaneously within 1 month. The recurrence rate after VFAFI was high due to the self absorption. NNE and Jitter of post-operation is lower than pre-operation,there is no significantly change between the control group and experimental group; F0, Shimmer and MPT of post-operation is higher than pre-operation, there is no significantly change between the control group and experimental group. The invasiveness and morbidity of VFAFI are low and the side effects are self-limited. Meta-analyses demonstrated significant improvements or decreased from both objective and subjective measurements. Further controlled studies with longer follow-up periods and more person were included may evaluate the effectiveness of VFAFI more reliably.
Belmar School District The Belmar School District is a community public school district that serves students in pre-kindergarten through eighth grade from Belmar, in Monmouth County, New Jersey, United States. The district also serves students from Lake Como who attend as part of a sending/receiving relationship. The school was constructed in 1909 and has had additions built in 1929, 1949, 1969 and 1993. There are 61 certified staff members, including the district's administrators, teachers, nurses and child study team personnel, with an additional 12 paraprofessionals. The single school is two schools in one, a primary school for grades preschool through fifth and a middle school organization plan for grades six through eight. As of the 2017-18 school year, the district and its one school had an enrollment of 525 students and 54.4 classroom teachers (on an FTE basis), for a student–teacher ratio of 9.7:1. The district is classified by the New Jersey Department of Education as being in District Factor Group "DE", the fifth-highest of eight groupings. District Factor Groups organize districts statewide to allow comparison by common socioeconomic characteristics of the local districts. From lowest socioeconomic status to highest, the categories are A, B, CD, DE, FG, GH, I and J. Students in ninth through twelfth grade are assigned based on sending/receiving relationships to either Manasquan High School or Asbury Park High School. Manasquan High School also serves students from Avon-by-the-Sea, Brielle, Lake Como, Sea Girt, Spring Lake, Spring Lake Heights who attended Manasquan High School as part of sending/receiving relationships with their respective districts. As of the 2017-18 school year, Manasquan High School had an enrollment of 945 students and 71.4 classroom teachers (on an FTE basis), for a student–teacher ratio of 13.2:1, while Asbury Park High School had an enrollment of 415 students and 43.5 classroom teachers (on an FTE basis), for a student–teacher ratio of 9.5:1. Students may also attend Red Bank Regional High School, Marine Academy of Science and Technology, Academy of Allied Health & Science, High Technology High School, Communications High School or Biotechnology High School. Another option is Academy Charter High School, located in Lake Como, which serves residents of Allenhurst, Asbury Park, Avon-by-the-Sea, Belmar, Bradley Beach, Deal, Interlaken and Lake Como, and accepts students on a lottery basis. School Belmar Elementary School served an enrollment of 517 students as of the 2017-18 school year. Sarah Wilton, Principal Administration Core members of the district's administration are: David Hallman, Superintendent Michael Bardsley, Business Administrator / Board Secretary The district's board of education has nine members who set policy and oversee the fiscal and educational operation of the district through its administration. As a Type II school district, the board's trustees are elected directly by voters to serve three-year terms of office on a staggered basis, with three seats up for election each year held (since 2012) as part of the November general election. Lake Como is also represented with a member of the Board of Education. References External links Belmar School District School Data for the Belmar School District, National Center for Education Statistics Belmar Elementary School Weather Station Category:Belmar, New Jersey Category:Lake Como, New Jersey Category:New Jersey District Factor Group DE Category:School districts in Monmouth County, New Jersey
Immature human DCs efficiently translocate endocytosed antigens into the cytosol for proteasomal processing. Cross-presentation of endocytosed antigen is essential for induction of CD8 effector T cell responses and a hallmark of dendritic cells (DCs). The mode of antigen processing in this context is controversial and some models imply translocation of the antigen from the endosomes into the cytosol. To test this hypothesis we made use of the pro-apoptotic properties of cytochrome c when in the cytosol, and confirmed that it indeed triggered apoptosis of human immature DCs but only at high concentrations. Proteasome inhibitors reduced the required concentration of cytochrome c thousand-fold, indicating that protein translocated into the cytosol is rapidly degraded by proteasomes. Mature DCs were also susceptible to cytochrome c-triggered apoptosis at high concentrations but proteasome inhibitors did not increase their sensitivity. Other cross-presenting cells such as B cells and monocytes were not sensitive to cytochrome c at all, indicating that they do not shuttle internalized antigen into the cytosol. Thus, processing of internalized antigens seems to follow different pathways depending on cell type and, in case of DCs, maturation state. Immature DCs appear to have a unique capacity to shuttle external antigen into the cytosol for proteasomal processing, which could explain their efficiency in antigen cross-presentation.
Here's the latest - The Short Term West Services desk bought power from Sierra Pacific Holding Co. for 4/29 and 4/30. Then, Bob Ellery, our contact there, called the Real Time desk and said they had lost a unit and needed to buy some of the power back from us. The deals are in our system as follows: 594854 EPMI buys Sierra Pac. NP-15 4/29 - 45 mw round-the-clock 4/30 - 40 mw round-the-clock $218 off peak $328 on peak 595714 Short Term West Hourly sells Automated Power Exchange (Sierra's scheduling coordinator) NP-15 4/29 - 19 mw round-the-clock $228 (Total Value = $103,968) Because Sierra's buy-back was in the Real Time market, we sold to their SC, not Sierra itself. Also, confirm letters don't go out on hour-ahead trades, which could be why you're running into some confusion. Let me know if this helps, and I'll continue to look for a deal flowing on 4/30. The Real Time group told me there was one, but it's only for the first 6 hours, not the whole day. I'll get back to you soon. Kate Mark Confer 05/02/2001 07:20 AM To: Kate Symes/PDX/ECT@ECT cc: Subject: Any Update Kate, what is the latest regarding Sierra Pacific Industries and the buy backs for the 29th & 30th in the amount of $103,968 for each day? Let me know if I can obtain more information for you. The payment terms are net 5 days after receipt of invoice, which they faxed to me on April 30th. Again, thanks for all your help regarding this and all the EES items. Mark
The evolutionary dynamics of adaptive virginity, sex-allocation, and altruistic helping in haplodiploid animals. In haplodiploids, females can produce sons from unfertilized eggs without mating. However, virgin reproduction is usually considered to be a result of a failure to mate, rather than an adaptation. Here, we build an analytical model for evolution of virgin reproduction, sex-allocation, and altruistic female helping in haplodiploid taxa. We show that when mating is costly (e.g., when mating increases predation risk), virginity can evolve as an adaptive female reproductive strategy. Furthermore, adaptive virginity results in strongly divergent sex-ratios in mated and virgin queen nests ("split sex ratios"), which promotes the evolution of altruistic helping by daughters in mated queen nests. However, when helpers evolve to be efficient and increase nest production significantly, virgin reproduction is selected against. Our results suggest that adaptive virginity could have been an important stepping stone on the pathway to eusociality in haplodiploids. We further show that virginity can be an adaptive reproductive strategy also in primitively social haplodiploids if workers bias the sex ratio toward females. By remaining virgin, queens are free to produce sons, the more valuable sex in a female-biased population. Our work brings a new dimension to the studies linking reproductive strategies with social evolution.
Tim Robberts via Getty Images A double exposure of two business men shaking hands with a view of the City of London and of a green fields landscape. The ideal of a democracy such as ours is that we elect governments to enact laws in the general public interest. We may not each like every single law that is passed, but overall the laws passed should be in our general good interest. There may even be laws that cause us inconvenience from time to time, but we accept them for the greater good. Take the laws that allow us to be pulled over, with no evidence to suggest we are guilty of anything, to see if we have been drinking while driving. Ride Checks are a minor inconvenience we all accept to help keep our roads safe. As citizens, we accept that some laws might cost us something or inconvenience us in some way, but we agree to them because that's the price of living in a civilized society. This is why I have a real problem with people or corporations who think there should be no laws passed that impinge on them and their selfish needs -- but that's exactly what the corporate world is trying to push onto the rest of us with the latest generation of so-called free trade deals, including the Trans-Pacific Partnership. Where once trade deals dealt with bringing down tariffs to allow for the freer flow of goods between countries, today's trade deals put much more emphasis on "non-tariff barriers" such as laws and regulations within the countries involved in a trade deal -- and grant extraordinary powers to corporations to sue governments that pass laws that hurt their profits. The idea is to ensure consistent regulations among countries in a trade deal so that one country can't use its laws and regulations to restrict trade. The reality is that corporations use the trade deals to restrict duly elected governments from passing laws that are in the interest of their own citizens. The TPP -- a proposed new deal between Australia, Brunei Darussalam, Canada, Chile, Japan, Malaysia, Mexico, New Zealand, Peru, Singapore, the United States of America and Vietnam -- is the latest in this new generation of trade deals. Its Investor-State Dispute Settlement (ISDS) system would give corporations the right to sue governments if they pass laws that restrict their ability to generate a profit, even if those laws are in the public interest. There are no reciprocal rights in the deal, however, that would allow for corporations to be sued under the TPP's toothless labour rights chapter. In certain cases, the deal would prevent governments from enacting new regulations on an industry, once regulations have been relaxed. This ratcheting effect means our laws can only move in one direction toward greater deregulation, without regard to any future societal needs or demands. Canada is already the most sued nation under this system of extra-judicial tribunals. So why would we want to sign a new deal that could see us sued even more, just for passing laws that our citizens want? It makes no sense. Governments are elected to pass laws that are in the public interest, on issues such as labour rights, protecting the environment, establishing minimum health and safety standards, to safeguard our cultural industries, and more. No trade deal should ever be ratified that limits this very basic responsibility of government. And yet that's what the TPP and other recent trade deals with an ISDS system would do. As if that weren't enough, the TPP would hurt many of our key industries, from dairy to auto, raise drug prices due to its patent law requirements, provide multinational firms an unlimited flow of temporary workers into Canada through inter-corporate arrangements, and more. All this despite recent studies that predict the TPP will have a negative effect on Canada's economy -- or, at best, have little to no impact at all. No wonder Nobel Prize winning economist Joseph Stiglitz called the Trans-Pacific Partnership "the worst trade deal ever." And, no wonder the deal was negotiated in secret by the Harper government. Unifor is urging Members of Parliament to not ratify the TPP in its current form. Canada's approach to global trade and investment must serve to enhance our collective economic and social development, and must be guided by progressive, fair trade principles.
A product of Seton Hall Preparatory School in West Orange, N.J, Sterling Gibbs returned home to Seton Hall in the 2013-2014 season as their starting point guard after spending his freshman year at Texas. Gibbs gained national attention when the redshirt sophomore hit a step-back jumper at the buzzer to give the Pirates a stunning 64-63 win over the #3/3 Villanova Wildcats in the Quarterfinals of the Big East Tournament. Key stats: 32 GP, 13.2 REB/G, 41% FG. Learn more about Sterling Gibbs here!
Q: Proving that the solution set of $ax+by+cz=0$ and $dx+ey+fz=0$ is a line in $\mathbb{R}^3$ I have a question here which says: "The solution set of: $$ax+by+cz=0$$ $$dx+ey+fz=0$$ is a line in $\mathbb{R^3}$" I am supposed to show that this is true or false. If it's true, I have to explain why and if it's false, I have to explain why it's false. I don't think it's true. We COULD have a line if the planes intersected but if $a,b,c$ are scalar multiples of $d,e,f$, then we would just have the same plane since there are infinitely many solutions. Is that the right should process or did I mess up my reasoning? A: When absolutely nothing is provided about $a,b,c,d,e,f$ then for one you may even just take say all of them to be equal to zero, and then the system of solutions is the whole of $\mathbb R^3$, which is not a line. Of course, a plane is also obtainable : it is obtained exactly when the ratios $d:a,e:b,f:c$ are the same (else, the planes would not be parallel and hence would intersect at a line passing through zero). Then, the equations $ax+by+cz = 0$ and $dx+ey+fz = 0$ describe the same plane. This is clearly seen for example with $a,b,c,d,e,f$ all equal to $1$, or say $a,b,c=1$, $d,e,f = 2$. So, obviously the statement given can be false. Note , however, that a solution must exist. This is because of the rank-nullity theorem, applied on the linear transformation $(x,y,z) \to (ax+by+cz,dx+ey+fz)$. This is a map from $\mathbb R^3$ to $\mathbb R^2$. It has rank atmost $2$, therefore nullity at least one i.e. the null space has at least one line.
Hypnospace Outlaw Hypnospace Outlaw is a simulation video game developed by Tendershoot and published by No More Robots for Microsoft Windows, macOS, and Linux. Set in an alternate-history 1999, the game takes place inside a parody of the early Internet called Hypnospace. The player assumes the role of an "Enforcer" for the company Merchantsoft—creator of Hypnospace—and seeks to police illegal content, copyright violations, viruses, and cyberbullying by users on the service. In the process, the player engages in detective work and puzzle-solving. The game released on March 12, 2019. Development and reception Hypnospace Outlaw was designed by Jay Tholen, creator of the earlier game Dropsy. The new game was funded via a successful Kickstarter campaign, and was a finalist for the Independent Game Festival's 2019 Seumas McNally Grand Prize and "Excellence in Audio". Upon its release in March 2019, it received "generally positive reviews" from critics, according to review aggregator website Metacritic. The game was nominated for the Tin Pan Alley Award for Best Music in a Game, the Statue of Liberty Award for Best World, and the Herman Melville Award for Best Writing at the New York Game Awards; and for "Game, Simulation" at the NAVGTR Awards. References External links Category:2019 video games Category:Internet-based works Category:Kickstarter-funded video games Category:Linux games Category:MacOS games Category:Point-and-click adventure games Category:Video games developed in the United States Category:Windows games Category:Video games set in 1999
<?xml version="1.0" encoding="UTF-8"?> <!-- /** * Copyright © Magento, Inc. All rights reserved. * See COPYING.txt for license details. */ --> <sections xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:noNamespaceSchemaLocation="urn:magento:mftf:Page/etc/SectionObject.xsd"> <section name="AdminNewsletterConfigPageSubscriptionOptionsSection"> <element name="allowGuestSubscription" type="checkbox" selector="input[name='groups[subscription][fields][allow_guest_subscribe][inherit]']" timeout="30"/> <element name="guestSubscription" type="select" selector="#newsletter_subscription_allow_guest_subscribe" timeout="30"/> </section> </sections>
Archive for February, 2015 February 13, 2015 The bottom is in. You have read it here first, but the S&P 500 has just bottomed at 2092. We pride ourselves on being rich, on being successful investors, on being handsome gentlemen, and on being contrarians. As the best there are at what we do, we took stock of the current stock market and considered what would be the most contrarian position possible. Simple: the position that the S&P 500 will never go lower than it is today. Its all time high will be its prospective low. Here is a clear chart for all you visual-learning, millennial types, who probably struggled to get through the text above: Recommendation:“It should be clear from the first element that the process has to begin with investors who are unusually perceptive. Unconventional, iconoclastic or early. That’s why successful investors are said to spend a lot of their time being lonely.” – Howard Marks Howard, do they have to be so lonely? We say screw that noise. Let’s make this whole thing a party. That is why we are sharing our bottom with all of you. As I have typed this post, the market has soared 2 more points to 2094. I am not saying that our call is 100% correct — I am typing it. The bottom is in, my friends, so invest with confidence. If you have access to imprudent amounts of leverage, now is the time to use all of it. Long or Short? At Long or Short Capital LLC, we leverage our superior intellect and extensive investing experience to recommend explicit Long or Short positions and related abstract trades, which may or may not be possible with real world financial derivatives. We use science to improve the lives of the rich.More About LoS
Obesity status of middle school students in Xiangtan and its relationship with Internet addiction. To investigate the state of middle school students' obesity in Xiangtan, China and to study the influence of Internet addiction on obesity. 1,150 junior and senior middle school students in Xiangtan, China. The research subjects were select randomly for the study. The height and body weight of human body were measured and the obesity state was judged according to BMI value and the Working Group on Obesity in China (WGOC) standard. The questionnaire for the survey of middle school students' basic situation was designed and a survey of the respondents' personal information and the contributory factors to obesity was conducted. The Middle School Students' Internet Addiction Diagnosis Scale was adopted for measuring and judging the Internet addiction of the research subjects. (1) The total detection rate of obesity was 23.57%. (2) The overall detection rate of Internet addiction was 21.23%. (3) The detection rate of obesity in middle school students with Internet addiction (32.92%) was significantly higher than that without Internet addiction (21.06%). Logistic regression showed that Internet addiction was an independent risk factor of obesity. Internet addiction is related to obesity of middle school students.
For data storage (e.g., cache, main memory, long term storage, etc.), there is typically a trade-off between quality of service and error correction. Quality of service refers to a level of precision with which a computer system (e.g., storage system) processes data. Error correction refers to processes a hardware system performs in order to correct errors in data. As the quality of service (e.g., precision of data) increases, the amount of error-correction that a hardware device (e.g., memory device) must perform typically goes up. Conversely, as less quality of service is needed, the amount of error-correction that a hardware device must perform typically goes down. A computer system may be configured to compute with full data-correctness-guarantees (e.g., high-precision). Computing with full data-correctness-guarantees refers to maintaining all, or substantially all, bits of the data. However, computing full data-correctness-guarantees, on a full-time basis, is often not practical for many computing operations. Hardware (e.g., a memory device) typically provides strong guarantees for error correction. Software typically relies completely on hardware to maintain full data error-correction guarantees. Such complete reliance on hardware is demanding on the hardware. The demand can lead to memory devices that operate more slowly. Perhaps worse, the memory devices may also experience shorter life spans. For example, precise flash memory operation may cause quicker wear out due to the need for a larger number of write iterations. When the hardware cannot maintain the error-correction guarantees, the hardware issues a fatal error. Then, neither the hardware nor the software can proceed with normal computing operations. Full data-correctness-guarantees (e.g., high-precision operations with an effort to maintain the precision of all bits of data), which are often required by hardware, are not always needed for software applications. Some software applications can tolerate errors in some of their data structures, such as, for example, picture data, audio data, video data, and/or most other data that a user decides to store. A computer can process these types of data with approximate precision and, at the same time, maintain virtually no perceptible difference in the user experience during the processing of the data. In one example, approximate storage refers to a computer system storing data in memory, and later the memory device returning approximately the data that was stored in that memory. Approximate precision is the precision with which the memory device returns approximately the data that was stored in the memory. Approximate precision is a precision level at which the memory device does not guarantee full data-correctness for one or more variables of data. For example, the memory device does not guarantee all bits of the data are correct.
322 F.Supp.2d 406 (2004) RIJ PHARMACEUTICAL CORP., Plaintiff, v. IVAX PHARMACEUTICALS, INC., Defendant. No. 02 CIV.4301 CM. United States District Court, S.D. New York. June 14, 2004. *407 Jerold C. Feuerstein, Kriss & Feit, P.C., New York City, for Plaintiff. James E. Cecchi, Carella, Byrne, Bain, Gilfillan, Cecchi, Stewart & Olstein, Roseland, NJ, for Defendant. MEMORANDUM DECISION AND ORDER MCMAHON, District Judge. Plaintiff RIJ Pharmaceutical Corp. ("RIJ") brings this action against Defendant Ivax Pharmaceuticals, Inc. ("Ivax") alleging breach of contract for the sale of goods. Defendant has filed counterclaims alleging the same. Defendant now moves for partial summary judgment on its counterclaims, and partial dismissal of Plaintiff's claims. Plaintiff cross-moves for summary judgment on all its claims, and dismissal of all of Defendant's counterclaims. For the following reasons, Defendant's motion is denied in part, and granted in part. Plaintiff's motion is denied in its entirety. FACTS The Parties RIJ is a pharmaceutical manufacturer of over-the-counter generic pharmaceutical products for private labels. A significant part of its business is the sale of generic over-the-counter pharmaceuticals for private labels. Thus, RIJ manufactures a line of generic products, bottles the product under the name of the distributor and *408 ships the goods to the distributor for sale. Ivax, known prior to February 7, 2001 as Zenith Goldline Pharmaceuticals, Inc. ("Goldline"), manufactures and distributes both over-the-counter and prescription generic pharmaceutical products. Since 1986, Ivax has outsourced to RIJ the manufacture of certain over-the-counter products, including antacid, cough/cold and laxative products, which would then be sold under one or more of Ivax's trade names, or otherwise sold or distributed by Ivax. There was no underlying contract between RIJ and Ivax. Instead, the parties would typically negotiate price on a product-by-product basis, and Ivax would order the products from RIJ as needed by submitting purchase orders. In 1999, Ivax began allowing RIJ to bid on multiple products at once. (Brij Gupta Dep., p. 41:8-14 to 43:18). In September 2000, Ivax conducted a routine audit of RIJ's facilities in Middletown, New York (the "September 2000 Audit"). The purpose of the audit was to ensure the products produced by RIJ to be sold under Ivax's trade names or otherwise sold or distributed by Ivax were being produced in accordance with Ivax's standards, as well as to ensure that RIJ complied in all respects with applicable FDA regulations. Ivax asserts that the audit uncovered numerous deficiencies in RIJ's facilities and manufacturing processes, including bacterial contamination. Ivax subsequently brought these deficiencies to the attention of RIJ. (Counterclaim, ¶¶ 14-15). The Instant Complaint On June 1, 2002, RIJ brought a complaint against Ivax seeking compensation for various actions taken by Ivax during the course of its relationship with RIJ. Specifically, RIJ has alleged that Ivax is liable for (1) unpaid product deliveries to Ivax; (2) inventory for a month's worth of future orders which RIJ contends that it maintained pursuant to an agreement between the parties; and (3) product orders which Ivax cancelled. The October 2000 Purchase Orders Beginning on or about October 17, 2000, Ivax submitted a series of purchase orders totaling $112,533.76 (the "First Group of Purchase Orders") to RIJ for various pharmaceutical products. The purchase orders were made in accordance with a bid award dated March 16, 2000. (Complaint, ¶ 5). Most of the orders were for a product called Genfiber Powder, the generic equivalent of Metamucil laxative, which accounted for $98,567.68 of the total purchase price. The remaining orders were for Losopan, the generic equivalent of Riopan antacid, and totaled $13,290.16. Upon the completion of their manufacture, RIJ shipped the pharmaceutical products requested in the First Group of Purchase Orders to Ivax. Ivax received the products, along with invoices (the "Invoices") from RIJ requesting payment. The Excess Inventory Agreement During November or December of 2000, Ivax began to increase its orders of Genfiber beyond the amount that RIJ typically shipped each month (approximately 40,000 bottles of regular and 15,000 bottles of orange-flavored Genfiber). RIJ alleges that because the lead time needed to fill the orders was approximately eight weeks, the parties agreed that RIJ would manufacture and hold one month of Genfiber in its inventory in order to prevent a sudden shortfall (Gupta Dep., p. 89:8-14; pp. 110:22-111 to 111:25; pp. 116:7-20.) Dr. Brij Gupta ("Gupta"), RIJ's President, testified that he believes that the agreement was confirmed in writing between his sales representative, Bi-Costal *409 Pharmaceutical Corp. ("Bi-Costal") and Ivax. (Gupta Dep., p. 89:55 to p. 90:6.) RIJ, however, has not produced the agreement. In reliance on this agreement, RIJ claims to have expended $100,710 on raw materials, caps and bottles, which were specially manufactured for Ivax or Goldfine, an affiliate of Ivax. (Plf.'s 56.1 Statement of Facts, at ¶ 5.)[1] Bi-Costal's representative, Brett Barczak ("Barczak"), tells a different story. At his deposition, Barczak testified that there was a "floor stock" program existing between Ivax and RIJ in 1997, when he began working for Bi-Costal. (Brett Barczak Dep., pp. 35:3-36:6.) Under this "floor stock" program, RIJ was to keep one month's worth of inventory on all products, and three months inventory of "key products" to fill orders on a more timely basis. (Barczak Dep., pp. 33:11 to 14; pp. 67:19 to 68:60.) The purported "floor stock" agreement was never reduced to writing. (Id., pp. 70:18 to 71:3.) There was no agreement whatsoever as to what would happen with any leftover inventory if a product or the relationship were terminated. (Id., pp. 68:20 to 69:19.) Barczak testified that it is ordinary practice in the industry for a customer, such as Ivax, to purchase any leftover inventory if a product were discontinued, but if such an agreement existed, it would ordinarily be memorialized in a purchase order or some other writing. (Id., pp. 69:10 to 72:4.) Ivax denies asking RIJ to manufacture or agree to purchase from RIJ an additional one-month of inventory of Genfiber, and claims that no writing memorializing a "floor stock" program or other similar agreement was ever produced by RIJ. In that connection, Sandra Dalling, Ivax's buyer responsible for RIJ accounts, testified at her deposition that Ivax has never made a request, from RIJ or any other supplier, that a supplier keep inventory on hand for future orders unless the request was confirmed by a purchase order. (Sandra Dalling Dep., pp. 19:11 to 20:3.) Cancelled Orders RIJ also alleges that Ivax is responsible for seven cancelled product orders totaling $80,411.44. On January 18, 2001, Ivax representative Sandra Darling ("Darling") sent a fax to Dr. Gupta cancelling three of the purchase orders, nos. 52993, 52995 and 53864. Dr. Gupta confirmed the cancellations by signing, dating and returning the fax to Darling on January 24, 2001. (Decl. of Lindsey H. Taylor, Exh. D.) The remaining orders were cancelled when Ivax terminated the relationship between the parties on May 8, 2001. (Id. Exh. E.) As of the time that those purchase orders were cancelled, all were overdue. (Id. Exh. F.) At his deposition, Gupta testified that RIJ was "making no claim" for the order cancelled by the January 18 fax because RIJ was able to sell those products to other customers. (Gupta Dep., pp. 118:24 to 120:19.) The total amount of those purchase orders (52993, 52995 and 53864) is $24,098.32. As to the remaining four cancelled orders, Gupta testified that all of the products RIJ manufactures are suitable for sale to any of its customers that sell the same product, e.g., the generic Mylanta made for one customer would be suitable for sale to another customer distributing generic Mylanta. (Id., pp. 38:10 to 39:12.) Gupta further testified that he believed many of the products manufactured for Ivax's cancelled orders were sold to other customers. The only reason RIJ would *410 not be able to sell those products is if they were "slow movers." (Id., pp. 162:24 to 170:4.) He further testified that RIJ had kept records of which products were sold to customers, which were still being held in inventory and which had been destroyed because they expired before they could be sold. (Gupta Dep., pp. 38:10 to 39:12; pp. 162:24 to 170:4; p.. 176:12-15; pp. 100:17 to 101:7.) Ivax made several requests to RIJ for documentation relating to the sales of the products to third parties to which RIJ failed to respond. As a result of these transactions, RIJ now seeks to recover damages for (1) the cost of the Genfieber and Losopan products, for which Ivax has not paid; (2) the cost of one month's worth of inventory of regular Genfiber and orange-flavored Genfiber that Ivax allegedly agreed to purchase; and (3) the cost of the cancelled purchase orders. Ivax's Counterclaims On August 16, 2002, Ivax interposed a counterclaim for breach of implied and express warranties against RIJ seeking to hold it liable for (1) certain pharmaceutical products RIJ shipped to Ivax, which Ivax contends were defective; (2) expenses associated with the recall of the allegedly defective products; and (3) consequential damages resulting from the defective and recalled pharmaceutical products. On January 11, 2001, Ivax received a complaint from a hospital pharmacist that a bottle of liquid Genaton antacid had an unusual smell. The product was returned to Ivax for testing, and the testing revealed that the product was contaminated with bacteria. The bacteria was the same kind of bacteria that Ivax's September 2000 Audit had discovered in RIJ's facilities previously. Following the complaint, Ivax suspended all then-pending orders of liquid pharmaceutical products manufactured by RIJ. (Counterclaim, ¶¶ 17-18). In subsequent months, Ivax received additional complaints regarding contaminated Genaton and premature product degradation.[2] On March 26, 2001, following the new complaints, Dr. Gupta sent a letter to J.C. Torres at Ivax stating, "RIJ Pharmaceutical Corp. has initiated a voluntary recall of Goldline Brand GENATON ANTACID Lot Numbers 01012, Exp. 10/02 and 01011, Exp. 10/02 contained in white plastic 12 Fl. Oz. Bottles. This recall is to the retail level." (Reply Dec. of Counsel, Exh. A)(emphasis added).[3] Dr. Gupta's March 26, 2001 letter goes on to include instructions to Ivax as to how to proceed with the recall. Those instructions include the statement, "Notify all customers, to the retail level of the recall, and make arrangements for return of the product from them." (Id.) (Emphasis added). (Aff. of Brij Gupta in Opp. to Mem. for Summ. J., dated May 22, 2003, at ¶ 2). Shortly afterwards, Ivax recalled the two lots of Genaton liquid "at the retail level," in accordance with Dr. Gupta's instructions. (Counterclaim, ¶¶ 19-20).[4] *411 In September 2000, and from December 2000 through March 2001, RIJ delivered to Ivax $74,506 worth of Aluminum Hydroxide Gel (# XXXXX-XXXX-XX), Genaton (# XXXXX-XXXX-XX), Losopan (# XXXXX-XXXX-XX) and Losopan Plus (# XXXXX-XXXX-XX).[5] Because the goods in question are over-the-counter pharmaceuticals, they are subject to regulations implemented by the Food & Drug Administration (the "FDA"), as well as other Federal and state agencies which are designed to protect the consuming public. The Food, Drug and Cosmetic Act (the "FDCA") prohibits "The introduction or delivery for introduction into interstate commerce of any food, drug, device, or cosmetic that is adulterated or misbranded," 21 U.S.C.A. § 331(a). The FDCA further provides that "A drug or device shall be deemed misbranded," unless its labels include the established name of each inactive ingredient listed in alphabetical order on the outside container of the retail package and, if determined to be appropriate by the Secretary, on the immediate container, as prescribed in regulation promulgated by the Secretary, except that nothing in this subclause shall be deemed to require that any trade secret be divulged, and except that the requirements of this subclause with respect to alphabetical order shall apply only to non-prescription drugs that are not also cosmetics and that this subclause shall not apply to nonprescription drugs not intended for human use. 21 U.S.C. § 352(e)(1)(A)(iii). In addition, on March 17, 1999, the FDA published a final rule establishing a standardized format and standardized content requirements for the labeling of over-the-counter (OTC) drug products (the "Drug Facts regulations"). The final rule became effective on April 17, 2001. On September 1, 1988, and on June 3, 1992, RIJ executed in favor of Ivax certain guarantees, providing in relevant part The undersigned, RIJ Pharmaceutical Corporation, hereby guarantees that no ... drug ... constituting or being part of any shipment or any delivery, now or hereafter made to you by [RIJ], will at the time of such shipment or delivery be adulterated or misbranded within the meaning of the Federal Food, Drug and Cosmetic Act ... nor will such ... drug ... be an article which may not, under the provisions of Sections 404 and 505 of said Act, be introduced into interstate commerce. The guarantee shall be a continuing guarantee and shall be binding upon the undersigned with respect to all .. drugs ... hereafter shipped or delivered to you by the undersigned, or in transit, before the receipt by you of written notice of revocation thereof. (Decl. of Counsel in Opp. to Plf.'s Motion for Summ. J., Exhs. E & F). On March 11, 1997, RIJ executed a Continuing Guarantee and Indemnification (the "Continuing Guarantee") in favor of Ivax. The Continuing Guarantee was substantially similar to the prior guarantees, but added a provision for third-party liability and the statement that "The Products shipped to Purchaser will at the time of shipment be in compliance with all applicable *412 laws, standards, practices and regulations." (Id., Exh. G). On April 4, 2001, Ivax requested from RIJ a Return Goods Authorization for the $74,506 shipments of Aluminum Hydroxide Gel, Genaton, Losopan and Losopan Plus on the basis that the labels for the shipped products failed to comply with existing federal law and FDA regulations and thereby violated the guarantees made by RIJ with respect to those shipments. RIJ refused to accept return of the shipments on the grounds that it has a longstanding policy not to accept returns of private label merchandise. On May 9, 2001, Ivax's Purchasing Manager, Linda Camacho, sent a letter to Dr. Gupta discontinuing Ivax's business relationship with RIJ. The letter stated that the decision to cease doing business with Ivax was based on (1) the 2000 Audit; (2) the regulatory compliance issues; (3) quality issues; (4) the recall; and (5) consumer complaints (about the products Ivax purchased from RIJ and resold). The letter also requested two Return Authorizations for excess inventory and for all returns resulting from the recall. (Decl. of Counsel in Opp. to Plf.'s Mem. for Summ. J., Exh. K). The Instant Motions On May 2, 2003, RIJ moved and Ivax cross-moved for summary judgment. RIJ's motion seeks a money judgment of $112,553.76 on all of its claims, the dismissal of Ivax's counterclaim for the return of goods and reimbursement in the sum of $78,682, and dismissal of Ivax's counterclaim for consequential damages and lost profits. Ivax's motion seeks dismissal of RIJ's excess inventory claim, dismissal of a portion of RIJ's demand for payment for Ivax's cancelled orders, and summary judgment on its own claim for reimbursement for recall expenses. DISCUSSION Standard for Summary Judgment Summary judgment may be granted only if there is no genuine issue as to any material fact and the moving party is entitled to judgment as a matter of law. See Fed.R.Civ.P. 56(c); Celotex Corp. v. Catrett, 477 U.S. 317, 322-23, 106 S.Ct. 2548, 91 L.Ed.2d 265 (1986). Under New York law, to establish a claim for breach of contract a plaintiff must plead and prove the following elements: (i) the existence of a contract; (ii) breach by the other party; and (iii) damages suffered as a result of the breach. See First Investors Corp. v. Liberty Mut. Ins. Corp., 152 F.3d 162 (2d Cir.1998). Summary judgment is appropriate in a breach of contract action where the language of the contract is unambiguous, and reasonable persons could not differ as to its meaning. See Fulton Cogeneration Assoc. v. Niagara Mohawk Power Corp., 84 F.3d 91, 98 (2d Cir.1996). Contract language is unambiguous when it has "`a definite and precise meaning, unattended by danger of misconception in the purport of the [contract] itself, and concerning which there is no reasonable basis for a difference of opinion.'" Hunt Ltd. v. Lifschultz Fast Freight, Inc., 889 F.2d 1274, 1277 (2d Cir.1989) (quoting Breed v. Ins. Co. of North America, 46 N.Y.2d 351, 413 N.Y.S.2d 352, 385 N.E.2d 1280 (1978)). THE CROSS MOTIONS FOR SUMMARY JUDGMENT ON THE COUNTERCLAIMS ARE DENIED I. Purchase and Sale of Goods A. Rejection of Goods On April 4, 2001, Ivax requested that RIJ authorize the return of $74,506 in over-the-counter pharmaceutical products shipped by RIJ to Ivax between October 2000 and March 2001 on the basis that the *413 product labels failed to comply with applicable federal drug laws and FDA regulations and were therefore in violation of implied and express warranties given by RIJ to Ivax. RIJ now seeks to dismiss Ivax's counterclaim for these returned goods, arguing that Ivax was not entitled to reject the pharmaceutical shipment because (1) the goods were not defective and, (2) even if they were defective, Ivax did not reject or revoke its acceptance of them within a reasonable time. Ivax supports its contention that the goods were defective by reciting a number of alleged labeling deficiencies, including a failure to list the products' inactive ingredients in alphabetical order in violation of 21 U.S.C. § 352(e) and a failure to meet the formatting requirements of the FDA's Drug Facts regulations. Although Ivax admits that the FDA did not require companies to be in full compliance with the Drug Facts regulations until April 16, 2001 (shortly after the final batch of allegedly non-conforming goods were delivered), Ivax maintains that standard practice in the pharmaceuticals industry is to begin compliance with new FDA regulations upon publication and that the purpose for the delay between the publication date and effective date is to allow for a "cure period." (Decl. of Jennine Gary, ¶ 7). RIJ contends that no such industry standard applies to the Drug Facts regulations. The question of the existence of the industry standard is material to the reasonable expectations of Ivax with respect to RIJ's delivery of conforming pharmaceutical labels, and therefore presents an issue of fact for this Court, thereby precluding summary judgment for RIJ.[6] The timeliness of Ivax's rejection or revocation of acceptance of the allegedly non-conforming goods is also a factual issue. Under Section 2-602(1) of the New York Uniform Commercial Code, "a buyer is given a reasonable time to inspect goods upon their receipt and to reject them by seasonable notification if they are found to be non-conforming." Sherkate Sahami Khass Rapol v. Henry R. Jahn & Son, Inc., 701 F.2d 1049, 1051 (2d Cir.1983). A buyer who "fails to make an effective rejection," accepts the goods. N.Y. U.C.C. § 2-606(1)(b). Nevertheless, a buyer who has already accepted goods may still revoke his acceptance "within a reasonable time after the buyer discovers or should have discovered the ground" for revocation if the "nonconformity substantially impairs" the value of the good. N.Y. U.C.C. § 2-608. A "reasonable time" depends upon the "nature, purpose and circumstances" of the action at issue, and therefore to be treated flexibly. NY UCC § 1-204(2); First Security Mortgage Co. v. Goldmark Plastics Compounds, 862 F.Supp. 918, 933 (E.D.N.Y.1994). Absent exceptional circumstances, whether an action has been taken within a "reasonable time" is a question of fact. Sherkate Sahami Khass Rapol, 701 F.2d at 1051. Here, RIJ argues that the three-month lag between Ivax's receipt of the majority of the allegedly non-conforming products (January 2001) and its rejection of those products (April 2001) was unreasonable. Ivax attributes the delay to the size and nature of Ivax's business, which it claims *414 did not permit immediate inspections. RIJ counters that Ivax's inspection controls are inadequate.[7] The Second Circuit has noted that exceptional circumstances exist justifying a judicial determination of "reasonable time" where a buyer with actual or constructive knowledge of a product's defect either repeatedly uses the product or continues to make payments on the product and waits six or more months before attempting to reject it. Sherkate Sahami Khass Rapol, 701 F.2d at 1051-52. The facts of this case hardly rise to the level of inexcusable delay necessary to invoke those exceptions. The timeliness of Ivax's rejection of the generic over-the-counter pharmaceuticals shipped by RIJ or its revocation of acceptance is therefore a question for the jury. B. Breach of Warranty Ivax next contends that RIJ breached several express guarantees by shipping the mislabeled bottles. This claim also survives summary judgment. The clear language of the guarantees promises only that none of the shipped products would be mislabeled "at the time of such shipment or delivery." Having acknowledged that the Drug Facts regulations did not become effective until after the final batch of pharmaceutical products were delivered, Ivax cannot now claim RIJ's violation of the Drug Facts regulation as the basis of its violation of the express guarantee. Nevertheless, Section 21 U.S.C. § 352(e) was enacted in 1997, well before RIJ shipped the products currently under dispute. And Ivax has conceded that the bottle labels did not list the inactive ingredients. Thus, RIJ is not entitled to summary judgment on Ivax's breach of warranty counterclaim. II. Consequential Damages RIJ also moves to dismiss Ivax's counterclaim for consequential damages and lost profits on the grounds that those damages are overly speculative. Under the U.C.C., consequential damages resulting from the seller's breach include "any loss resulting from general or particular requirements and needs of which the seller at the time of contracting had reason to know and which could not reasonably be prevented by cover or otherwise." N.Y. U.C.C. § 2-715(2)(a). "In the case of sale of wares to one in the business of reselling them, resale is one of the requirements of which the seller has reason to know within the meaning of subsection (2)(a)." N.Y.U.C.C. § 2-715(2)(a), cmt. 2. Ivax claims that the following damages were a reasonably foreseeable consequence of RIJ's breach of warranty: (1) Ivax's lost profits during the time that it was attempting to obtain alternative suppliers for the products previously purchased by RIJ; (2) damages for Ivax's lost market share for Genaton and Aluminum Hydroxide resulting from those products being off the market; (3) damages for Ivax's lost market share for Losopan and Losopan Plus resulting from Ivax not being able to reintroduce those products because they were off the market. "Under New York law, consequential damages for a breach of contract or warranty claim can include loss of goodwill, including the loss of customers, future profits, and harm to business reputation." *415 Hangzhou Silk Import and Export Corp. v. P.C.B. Intern. Industries, No. 00 CIV. 6344(RLC), 2002 WL 2031591, *7 (S.D.N.Y. Sept. 5, 2002) (citing Toltec Fabrics, Inc. v. August Inc., 29 F.3d 778, 780 (2d Cir.1994)). "[C]onsequential damages for lost profits are recoverable where the buyer is a reseller or a broker." Canusa Corp. v. A & R Lobosco, Inc., 986 F.Supp. 723, 732 (E.D.N.Y.1997) (citations omitted). However, "a calculation and award of lost profits may not be based on speculation." Coastal Aviation, Inc. v. Commander Aircraft Co., 937 F.Supp. 1051, 1063 (S.D.N.Y.1996) (citing Texpor Traders, Inc. v. Trust Co. Bank, 720 F.Supp. 1100, 1114 (S.D.N.Y.1989)). Instead, a plaintiff seeking to recover lost profits for breach of warranty must meet the following criteria: First, it must be demonstrated with certainty that such damages have been caused by the breach and, second, the alleged loss must be capable of proof with reasonable certainty. In other words, the damages may not be merely speculative, possible or imaginary, but must be reasonably certain and directly traceable to the breach, not remote or the result of other intervening causes.... In addition, there must be a showing that the particular damages were fairly within the contemplation of the parties to the contract at the time it was made. Coastal Aviation, Inc., 937 F.Supp. at 1064 (citing Kenford Co. v. County of Erie, 67 N.Y.2d 257, 502 N.Y.S.2d 131, 132, 493 N.E.2d 234, 234-35 (1986) (per curiam)). Viewing the evidence in a light most favorable to Ivax, I must determine whether Ivax has presented enough evidence to prove to a trier of fact with reasonable certainty that it lost goodwill or future profits, that the amount of that loss was within the reasonable contemplation of both parties, and that any such loss was directly traceable to RIJ's breach of warranty. I find that it has. Ivax has presented evidence from which a trier of fact may reasonably infer that it sustained some amount of lost profits and that it lost market share for Genaton, Aluminum Hydroxide, Losopan and Losopan Plus as a result of Defendant's breach of warranty. (See Deposition of Aldo Perez, p. 25:16-40:7). Although Ivax bases it claim largely on past market conditions, such claims are cognizable under New York law. Larsen v. A.C. Carpenter, Inc., 620 F.Supp. 1084, 1134 (E.D.N.Y.1985) (consignee in shipping contract was entitled to recover purchase price and incidental and consequential damages, including lost profits, subject to 30 percent reduction for mitigation, based on estimates generated from past market conditions). In addition, Dr. Gupta testified that he knew that Ivax was in the business of reselling the products it ordered from RIJ, (Gupta Dep., p. 84), and therefore, under § 2-715, RIJ had reason to know of RIJ's consequential damages. Ivax, however, has not met its burden of demonstrating with certainty how much of its lost market was caused by RIJ's breach. In fact, the deposition testimony of Aldo Perez, Ivax's Director of Financial Planning and Analysis, offered by Ivax as "objective evidence" of the amount of those losses, suggests that any number of factors could have accounted for Ivax's loss of market share for the relevant pharmaceutical products: Q: Is the theory that the suspension and/or discontinuance, actually here the suspension of the product is what caused the decrease in the monthly demand? A: Yes. Q: Is there any basis for making that assumption? *416 A: When you say — what do you mean by that? Q: I mean that you have a mathematical computation which shows that there is obviously a decrease in monthly demand. A: Right. Q: So the sole basis of that figure, which is $44,577.28, is just based upon the decrease of the monthly demand of the product? A: That is correct. Q: But you didn't take into account, did you analyze any factors which caused the decrease in monthly demand? A: The assumption that being off the market for that time period effected the demand. That's the assumption. Q: What causes you to make that assumption? Could it be other factors? A: I don't know. (Opp. Dec. of Counsel, Ex. K). As to lost profits, neither party has alleged that the "arrangement" between Ivax and RIJ represents a sales agreement for the continuing purchase of pharmaceutical products beyond those reflected in the existing purchase orders (and potentially in the separately alleged "floor stock" agreement). Therefore, Ivax's lost profits claim for the period during which it sought to obtain a new supplier is limited to such profits as would have been obtained from the existing orders, but not potential future orders. Texpor Traders, Inc., 720 F.Supp. at 1114 (lost profits based on potential customers orders not recoverable). III. Recall Expenses Finally, Ivax seeks summary judgment on its claim for reimbursement for expenses incurred in connection with the Genaton recall. Defendant's recall expense totaled $45,394.00. (Deposition of Aldo Perez, pp. 15:2 to 23:8.) RIJ now suggests that "the recall of Genaton was done at the retail level [rather than the wholesale level], which was beyond the necessary recall under the circumstances." (Plaintiff's Response to Defendant's Statement of Facts, at ¶ 3.) However, because RIJ has agreed to reimburse Ivax for any costs associated with the recall, (id.), the issue of whether RIJ failed to mitigate its retail expenses is mooted. Moreover, Dr. Gupta's letter of March 26, 2001 to J.C. Torres makes clear that it was he, not Ivax, that was responsible for directing the recall at the retail level. Ivax is therefore entitled to summary judgment against RIJ for $45,394 in recall expenses. THE CROSS-MOTIONS FOR SUMMARY JUDGMENT ON THE CLAIMS IN THE COMPLAINT ARE GRANTED IN PART AND DENIED IN PART I. RIJ's Affirmative Claim for Goods Sold and Delivered RIJ moves for summary judgment on its affirmative claim for $112,533.76 in goods that were sold and delivered, but not paid for, to Ivax. RIJ's claim for goods sold and delivered is comprised of a $98,567.68 claim for Genfiber, and a $13,966.09 claim for Losopan. The unpaid Losopan shipments to Ivax bear an invoice date of March 19, 2001. (Aff. of Gupta, Exh. E). Because Ivax notified RIJ that the Losopan shipments (and other shipments) were nonconforming on March 20, 2001, and requested a return authorization on April 4, 2001, RIJ's rejection of the Losopan orders was timely. Nevertheless, as discussed above, the issue of whether the Losopan shipments were in fact non-conforming is a question of fact. Therefore, RIJ's motion for summary judgment in its favor is denied to that extent. *417 Ivax has not denied its liability for the Genfiber shipments. Therefore, RIJ is entitled to prevail on its motion for summary judgment regarding those shipments totaling $98,567.68. However, Ivax asks that this Court not order judgment on the Genfiber claim at this time, on the grounds that its counterclaims "more than offset" the $98,567.68 it owes to RIJ. I agree with Ivax. Where multiple claims or counterclaims are involved in an action and a court has finally resolved only some of the claims, "the court may direct the entry of a final judgment as to one or more but fewer than all of the claims or parties only upon an express determination that there is no just reason for delay and upon an express direction for the entry of judgment." Fed.R.Civ.P. 54(b); Ginett v. Computer Task Group, Inc., 962 F.2d 1085, 1091 (2d Cir.1992). "A Rule 54(b) certification of final judgment on any claim would be inappropriate only if such claim is `inherently inseparable' or `inextricably interrelated' to remaining claims." EMI Music Marketing v. Avatar Records, Inc., 317 F.Supp.2d 412, 423 (S.D.N.Y.2004) (quoting Ginett, 962 F.2d at 1096). Clearly, the claims and counterclaims in this case qualify as "inextricably interrelated." They arise out of the same underlying set of facts, and require an interpretation of the duties and obligations of the parties pursuant their long-standing business relationship. Given the possibility of offsets resulting from Ivax's counterclaims, I deny RIJ's request to enter judgment at this time against Ivax as to RIJ's Genfiber shipments. II. RIJ's Claim That Ivax is Obligated to Buy Excess Inventory Ivax moves to dismiss RIJ's claim that Ivax is obligated to buy inventory purchased by RIJ pursuant to a purported agreement between the parties. The motion is denied. Section 2-201(1) of the New York Uniform Commercial Code governs contracts for the sale of goods over $500. It requires "some writing sufficient to indicate that a contract for sale has been made between the parties and signed by the party against whom enforcement is sought." N.Y. U.C.C. § 2-201(1). Generally, the writing must (1) evidence a contract for the sale of goods, (2) be signed, and (3) specify a quantity. Id. § 2-201 cmt. 1. The writing need not contain all the material terms, but it must "afford a basis for believing that the offered oral evidence rests on a real transaction." Id. Also, the adequacy of a writing for statute of frauds purposes "must be determined from the documents themselves, as a matter of law." Hilord Chem. Corp. v. Ricoh Elec., Inc., 875 F.2d 32, 36-37 (2d Cir.1989) (internal citation omitted). An exception to the writing requirement exists where "the goods are to be specially manufactured for the buyer and are not suitable for sale to others in the ordinary course of the seller's business." N.Y. U.C.C § 2-201(3). "Unsalability under this section must be based on the characteristics of special manufacture, rather than on such tests as lost market opportunities or a seller's unrelated inability to dispose of the goods." Arthur Blum Signs, Inc. v. Transportation Displays Inc., 273 A.D.2d 46, 47-48, 709 N.Y.S.2d 49, 51 (1st Dep't.2000). Here, RIJ claims that there was an agreement between Ivax and RIJ to manufacture and hold in inventory one month's supply of regular and orange-flavored Genfiber. Ivax denies that any such agreement existed. According to RIJ, the cost of producing these goods, together with their containers, was $100,710 (with the bottles accounting for $42,991.33) — well *418 over the $500 threshold for the Statute of Frauds. Although RIJ had the opportunity to produce documentary evidence of the agreement during discovery, it has not done so. Instead, RIJ claims that the excess inventory was specially manufactured for Ivax. But RIJ has not shown that the "raw materials" used for Genfiber are not suitable for sale to others. Indeed, Gupta testified that the surplus inventory of raw materials not only could have been sold to others, but that some of it in fact had been sold to others. (Gupta Dep., p. 176:12-15; pp. 100:17 to 101:7.) Therefore, the "raw materials" were not specially manufactured, Norminjil Sportswear Corp. v. T G & Y Stores Co., Inc., 644 F.Supp. 1, (S.D.N.Y.1985) (merchandise not within "specially manufactured" exception where discovery revealed that merchandise had been resold), and the only remaining issue is whether the silk-screened bottles could be considered specially manufactured. Ivax points to Webcor Packaging Corp. v. Autozone, 158 F.3d 354, 356-57 (6th Cir.1998) in support of its claim that the silk-screen bottles were not specially manufactured for Ivax. In Webcor, Webcor argued that packages it printed containing Autozone's logo were specially manufactured goods, and that Autozone was therefore responsible for its inventory of packing which would have been sold to Autozone's suppliers for packaging auto parts. The court found that the packages were not specially manufactured for Autozone — in part because "The essential goods to be received by Autozone under the arrangements existing at the time of the alleged oral agreement were finished brake parts, not empty "Duralast" cartons." Webcor, 158 F.3d at 360. Webcor is distinguishable. Here, Plaintiff's testimony supports the notion that the silk-screened bottles were an essential part of the agreement. According to Plaintiff, Ivax specifically contracted for the silk-screen bottles. (Gupta Dep., p. 86:9-16.) In addition, the need for the excess inventory agreement was a direct result of the eight week lead time needed to process a Genfiber order. The silk-screening process accounted for six of those eight weeks. (Gupta Dep., pp. 87:10 to 88:18.) Thus, assuming that a "floor stock" or similar agreement did exist, there is evidence that an essential purpose of the contract was for specially manufactured bottles, as much as it was a contract for Genfiber. Moreover, New York law compels a different outcome here than in Webcor. In Meyer Bros. Drug Co. v. McKinney et al., 137 A.D. 541, 121 N.Y.S. 845 (3d Dep't 1910), aff'd, 203 N.Y. 533, 96 N.E. 1122 (1911), a manufacturing chemist contracted with retailers to purchase various items, which were to be packed ready for retail in specifically designed packages and bottles, and branded or labeled with defendant's name. The court found that because the defendants had contracted for the specially manufactured goods (i.e. the fully assembled product, including the bottles and labels), the contract did not fall within the Statute of Frauds. Meyer Bros., 121 N.Y.S. at 848. Assuming that RIJ and Ivax did in fact have a "floor stock" agreement, therefore, Meyer Bros. requires me to find that the Genfiber bottles and labels constitute specially manufactured goods sufficient to take the agreement out of the Statute of Frauds.[8] Ivax will thus be entitled *419 to present parol evidence of the "floor stock" agreement at trial. III. RIJ's Claim For Cancelled Orders Ivax also seeks dismissal of RIJ's claims that it must reimburse RIJ for certain purchase order cancellations. RIJ has relinquished claims for three purchase orders — Nos. 52993, 52995 and 53864 (totaling $24,098.32). Those claims are therefore dismissed. As for the remaining four cancelled orders, Gupta testified that RIJ retained records detailing the products allegedly contained in the purchase orders cancelled by Ivax which were actually sold to third parties. Despite repeated requests by Ivax, RIJ has not produced any of these records (nor has it even attempted to address its failure to produce those documents in its opposition papers). It is well settled that where a party fails to provide relevant information within its control concerning the subject matter of the litigation, the Court may infer that the information, if disclosed, would be harmful to the party who fails to provide it. E.g. Chambers v. Capital Cities/ABC, 159 F.R.D. 441, 445 (S.D.N.Y.1995); Weeks v. ARA Services, 869 F.Supp. 194, 195 (S.D.N.Y.1994); Intercommunity Relations Council v. U.S. D.H.H.S., 859 F.Supp. 81, 83 (S.D.N.Y.1994); cf. Gray v. Great American Recreation Ass'n, Inc., 970 F.2d 1081, 1082 (2d Cir.1992) ("The non-appearance of a litigant at trial or his failure to testify as to facts material to his case and as to which he has especially full knowledge creates an inference that he refrained from appearing or testifying because the truth, if made to appear, would not aid his contention"). Here, Dr. Gupta's failure to provide Ivax with the relevant records generates the reasonable inference from the evidence that RIJ's records would reflect that it had mitigated its damages by reselling the products for the cancelled orders. Gupta has admitted that at least some of the goods were sold and the only thing which would have prevented a resale is market conditions. The extent to which RIJ was able to sell these goods is solely within RIJ's knowledge. The records reflecting those sales are similarly within RIJ's possession. Because RIJ has admittedly sold some of those goods and failed to produce any records regarding those sales, it is reasonable for me to infer that RIJ was able to resell those goods so as to eliminate most, if not all, damages for the cancelled orders which it might otherwise be able to recover from Ivax. As a result, RIJ is given one final chance — within 10 days of the date of this order — to produce those records. If it does not, its claims resulting from Ivax's cancelled orders will be dismissed in their entirety. CONCLUSION RIJ's motion for summary judgment is DENIED in its entirety. Ivax's motion for summary judgment is DENIED as to RIJ's claim for excess inventory and the cancelled orders. However, RIJ has 10 days from the date of this order to produce documents detailing any sales to third parties of the products allegedly contained in the purchase orders which were cancelled by Ivax, or it claim for those cancelled orders will be dismissed. Ivax's motion is GRANTED in the amount of $45, 394 as to its affirmative claim for recall expenses. This constitutes the decision and order of the Court. NOTES [1] RIJ alleges that Ivax requested a certain style of bottle, which had Goldline's label "silk-screened" on it (i.e. directly printed on the bottle). The bottles cost $42,991.33 in total. (Plf.'s Resp. to Def.'s Statement of Facts, at ¶ 2.) [2] RIJ also claims to have received approximately seven different complaints about Genfiber powder. (Counterclaim, ¶ 23). [3] A recall at the wholesale level means a recall of all products in the chain of distribution as far along as wholesalers. For example, in a recall at the wholesale level, all products in the hands of distributors and wholesalers, but not in the hands of retailers or consumers, would be returned. In a recall to the "retail level," all products in the hands of distributors, wholesalers and retailers, but not consumers, would be returned. (Def. Reply Mem. at 4 n. 1.) [4] In the event of a recall, Ivax is obligated to mail notices to all buyers of the non-compliant product, to arrange for and accept the return of the non-compliant product, and to provide either a replacement product or a refund or a credit for the cost of the non-compliant product. (Counterclaim, ¶ 13). [5] The specific contents and dates of the purchase orders at issue are as follows: (1) 20,343 16 oz. bottles of Aluminum Hydroxide Gel on September 7 and September 13, 2000 ($38,869.37); (2) 4,298 12 oz. bottles of Losopan Plus on December 14, 2000 ($5,914.48); (3) 3,552 12 oz. bottles of Genaton on February 28, 2001 ($5,274.72); (4) 9,293 12 oz. bottles of Genaton suspension on March 1, 2001 ($13,800); and (5) 6,867 12 oz. bottles of Losopan suspension on March 22, 2001 ($8,158.00). [6] RIJ does not address Ivax's claim that the shipped product's inactive ingredients were not listed in alphabetical order on the container labels as mandated by 21 U.S.C. § 352(e). However, at his deposition, Dr. Gupta testified that Ivax had agreed to provide RIJ with graphics and the format for new conforming labels, but then failed to send them. Ivax counters that it was RIJ's responsibility to revise its labels. Again, disputed issues of material fact prevent me from deciding whether Ivax's actions indicated an acceptance of the nonconforming labels. [7] In arguing that Ivax had notice of the label's non-conformity upon receipt of the goods, RIJ essentially claims that Ivax did not exercise due diligence. Under the U.C.C., "An organization exercises due diligence if it maintains reasonable routines for communicating significant information to the person conducting the transaction..." N.Y.U.C.C. § 1-201(27). On this record, I cannot say that Ivax's procedures for detecting and communicating product defects were insufficient as a matter of law. [8] Ivax also contends that RIJ has not shown $42,991.33 in damages. While Ivax is correct that the invoices attached to RIJ's papers are not consistent with a damage award of that amount, that is not an issue for this motion. Ivax will have ample opportunity to argue for reduced damages at trial.
Kayseri place s around the foot of Erciyes Mountain which has steppe climate, which is one of the middle anatolian cities. Through the history, it exposed plenty of outbreak sickness. Moreover, because of the deficiency of sewerage system arised the sickness of malaria at summer time. Thus, Kayseri natives moved to Ali mount and Erciyes Mountain because of having more plenty of air than town center. Through a summer season, They lived on there, where called 'Bağ' means vineyard. The moving of almost whole city, brings a lot of culture materials into life. Employing of grape growing was very famous occupation. There were different 33 sorts of grape.On this study we observed in order of words, idioms, concepts and traditions about grape and vineyard.
Welcome to UD RESEARCH This exciting magazine showcases the discoveries, inventions and excellence of UD's faculty, staff and students. Our latest issue showcases our research efforts on sea level rise, a serious issue for Delaware, the flattest state in the U.S. News Briefs /// Family dynamics undergoa world of change Bahira Sherif Trask, professor of human development and family studies Change is a constant in life, even when it comes to “family dynamics”— the interrelationships between family members , according to Bahira Sherif Trask, professor of human development and family studies. But today, the process is even more accelerated, says Trask, who shared examples from research around the world at the first TEDxWilmington conference, held this past August in Wilmington, Del. Consider this: Fifteen years ago, in a small town in northern Mexico, the men and women had traditional roles—the men worked in the fields and the women oversaw meals, child care and domestic chores. Ten years ago, a factory opened outside of the town, and the women began to travel an hour and a half to the factory, work 10-hour days and return home. There, they continue to handle all the domestic chores, raising the question about improvements in their quality of life. As women join the workforce, countries around the world are experiencing higher rates of divorce—even where divorce has a stigma attached to it, such as Ghana, Korea and Nigeria. Women who have financial independence are much more likely today to initiate divorce if they are not happy. In the U.S., 42 percent of children are now born outside of marriage. However, researchers are finding that, compared to the 1960s, both men and women are spending more time with their children, even though many more women work outside of the home. So, are these changes good or bad? Trask doesn’t pass judgment, but rather explores the impact these types of shifts have on the economy, families and relationships. “We are in the midst of an incredible social transformation,” the UD expert explains. “It’s a radical and permanent transformation, and it’s happening very quickly. It’s accelerated now. What I’m trying to do is raise awareness, so we can put in place programs and policies that will help individuals and families with these new phenomena.” Originating in 1984 as a conference bringing together people from technology, entertainment and design (from which its name is derived), TED is a nonprofit “devoted to ideas worth spreading.” TED events feature short presentations on a wide range of subjects to educate and spark meaningful discussions.
VITO-1, a novel vestigial related protein is predominantly expressed in the skeletal muscle lineage. In order to identify novel genes expressed in skeletal muscle we performed a subtractive hybridization for genes expressed in human skeletal muscle but not in other tissues. We identified a novel scalloped interaction domain (SID) containing protein in humans and in the mouse, which we named VITO-1. Highest homology of VITO-1 was found with the Drosophila vestigial and the human TONDU proteins in the SID (54 and 40%, respectively). Using whole-mount hybridzation and Northern blot analysis, we showed that VITO-1 is expressed in the somitic myotome from E8.75 mouse embryos onwards and later on in skeletal muscle but not in the heart. Additional expression domains during development were detected in the pharyngeal pouches and clefts starting at E8.0 as well as in the cranial pharynx and in Rathkes pouch. By Northern blot analysis, we found VITO-1 to be up-regulated in C2C12 myotubes although some expression can be detected in proliferating C2C12 myoblasts. No expression was spotted in other adult mouse tissues. Likewise, expression of human Vito-1 during fetal and adult human development was found exclusively in skeletal muscle preferentially in fast skeletal muscles. These data suggest a role of VITO-1 for the development of skeletal muscles and of pharyngeal clefts/Rathkes' pouch derived structures.
Jamie Hendry Jamie Hendry (born 24 July 1985) is a British theatre executive and West End producer. Education Hendry attended St Paul's School (London) before graduating from Warwick University in 2006. Career Hendry set up Jamie Hendry Productions in 2008 after working as an assistant producer in the West End and on Broadway. The hits he has produced include the Olivier Award-winning Legally Blonde: The Musical, Let It Be and La Cage aux Folles (2008 West End revival) In 2010, he was nominated for The Independent and The Hospital Club 100 most influential people in the creative industries. In 2011, Hendry announced he was developing a new musical adaptation of The Wind in the Willows with book by Julian Fellowes and music & lyrics by George Stiles & Anthony Drewe and in February 2014 announced that the production had raised £1Million via online crowdfunding. This was London Theatre's most ambitious crowdfunding raise to date. The production went on to open at the London Palladium in 2017 and was also screened in cinemas across the UK. In 2014 and again in 2017, Hendry was ranked among the top 100 influential power brokers in the British theatre industry. In 2019, Hendry launched the New English Shakespeare Company, an international touring company, with a production of Much Ado About Nothing at the Dubai Opera in September 2019. Hendry is a member of the Society of London Theatre. Theatre Credits Film Credits Awards Laurence Olivier Awards 2009 Best Musical Revival La Cage aux Folles (2008 London revival) 2010 Best New Musical – Spring Awakening 2011 Best New Musical – Legally Blonde: The Musical Critics' Circle Theatre Awards 2008 The Peter Hepple Award for Best Musical – La Cage aux Folles (2008 London revival) 2009 The Peter Hepple Award for Best Musical – Spring Awakening Whatsonstage Theatregoer's Choice Awards 2009 The Nick Hern's Books Best New Play – Under the Blue Sky 2011 Best New Musical – Legally Blonde: The Musical References External links Jamie Hendry Productions Category:British theatre managers and producers Category:Living people Category:1985 births Category:People educated at St Paul's School, London
A 39 year old man presents with a swelling in his neck that has been progressively enlarging over the last few months.What clinical tests would you perform to assess him?The swelling moves upwards when the tongue is protruded.What is the likely cause, and how common is this condition?Describe the embryological origin of the thyroid and its significance in this case. ![](umj0084-0215-f1){#d36e113} A representative image from his CT scan is shown below. ![](umj0084-0215-f2){#d36e117} ![](umj0084-0215-f3){#d36e179} 1. With regard to skin cancer, what does this image represent? 2. What is the clinical significance of this region? 3. Explain Mohs' micrographic surgery ![](umj0084-0215-f4){#d36e249} 1. What abnormality is shown on the CT image above? 2. What procedure can this be a complication of? 3. What is the German term that links this radiological sign with the photograph on the right? A patient with chronic lymphocytic leukaemia attends for routine clinical review. Venous blood is sent for analysis and the laboratory phone urgently with the results shown in panel A. A further blood sample is collected using an alternative blood bottle, and the results in panel B are returned. ![](umj0084-0215-f5){#d36e312} The patient is not on potassium supplements or drugs linked with hyperkalaemia. An ECG is normal. He is not given any treatment, but two further blood samples are sent to the laboratory urgently and the results in panel C and D are returned.How would you explain the change in the potassium result?What conditions predispose to this phenomenon?How should an accurate potassium concentration be obtained in these circumstances? ![](umj0084-0215-f6){#d36e385} 1. Abnormalities of the thyroid gland or thyroglossal duct can cause swelling in this midline location. Thyroid swellings move on swallowing, while thyroglossal cysts tend to move when the tongue is protruded. 2. A thyroglossal cyst is a common painless midline neck swelling. Approximately 7% of people have remnants of the thyroglossal duct^[@CIT0001]^. It is the commonest cause of midline neck swellings in children, accounting for 70% of congenital neck abnormalities; 76% of cases present before the age of 6 years^[@CIT0001]^. 3. Derived from endoderm, the thyroid primordium descends in the midline of the neck from the base of the tongue and courses anterior to the hyoid bone to an infrahyoid position anterior to the thyrohyoid membrane, thyroid cartilage, and trachea^[@CIT0002]^. The inferior portion of the thyroglossal duct differentiates into the pyramidal lobe of the thyroid gland^[@CIT0002]^. As such, thyroglossal duct cysts are found below the hyoid bone in 85% of cases, but can lie anywhere between the foramen caecum and the suprasternal notch^[@CIT0001]^. Due to its attachment to the tongue, protrusion of the tongue will raise a thyroglossal cyst superiorly. This classical sign is virtually pathognomonic of thyroglossal duct cysts. ```{=html} <!-- --> ``` 1. The image depicts the H-zone which is an anatomical region of the face that includes the temple, ear, eyelids, nose and lips. 2. The H-zone is considered a high-risk site for basal cell carcinoma, the commonest human cancer. Tumours that arise in this region often have a greater extent of invasion than is initially appreciated by clinicians, and therefore attempts at routine primary excision are less likely to be successful. These regions also tend to be cosmetically sensitive. 3. Mohs' micrographic surgery is a technique that is used to treat high-risk cutaneous basal cell carcinoma. The method was developed by Frederic Edward Mohs in 1938 at the University of Wisconsin. The technique involves initially removing the tumour with a minimal amount of surrounding healthy tissue. Detailed microscopic examination (by a histopathologist or suitably trained clinician) of the surgical margins of the carefully orientated excised specimen is then carried out whilst the patient is still at clinic. If the margins are clear then surgery is complete. If the margins are positive then small amounts of further tissue are removed in the relevant area(s) until clear margins are finally obtained. Recurrence rates are lower using this technique compared with standard excision, and a better cosmetic result is more likely. However, this technique is labour intensive and is therefore quite costly. ![](umj0084-0215-f7){#d36e601} 1. A stack of radio-opaque stones is visible in the distal left ureter. 2. This can be a complication of Electronic Shock Wave Lithotripsy (ESWL), a common treatment for renal calculi. ESWL is a non-invasive method that utilises auditory waves to break up a calculus with minimal collateral damage. Steinstrasse may also occur spontaneously due to multiple ureteric stones. 3. This sign is known as "Steinstrasse", a term derived from the German for "stone street." Steinstrasse is a common complication of ESWL, with a reported incidence of as high as 8%. The risk is related to the size of the original stone and its anatomical site. It is caused when fragments of a broken calculus become lodged in the ureter causing obstruction and hydronephrosis. Patients normally present with pain and discomfort, or in more severe cases, obstructive pyelonephritis and urosepsis. Treatment can be either conservative, further ESWL or surgical (with procedures such as percutaneous nephrolithotomy, ureteroscopy or open surgery), depending on severity and anatomical position. In order to minimise the risk of developing Steinstrasse after ESWL, patients are encouraged to increase fluid intake and be physically active. Adequate follow-up post-ESWL allows Steinstrasse to be identified and treated early. ```{=html} <!-- --> ``` 1. This is a case of pseudohyperkalaemia, i.e. the true serum potassium concentration is normal despite an apparently elevated level reported by the laboratory. In this case, the man\'s fragile leukaemic cells have released potassium in those samples delivered to the laboratory using the pneumatic tube system (samples A and B), presumably due to vibration and pressure changes. For samples delivered to the laboratory by the hospital porters (C and D), the potassium concentration is normal. 2. Pseudohyperkalaemia can occur with: haemolysis, delayed processing of blood, very high white cell or platelet counts, potassium contamination and abnormal red blood cells. In leukaemia, the disease sub-type, degree of leucocytosis, type of blood tube and manner of transport to the laboratory may all be factors^[@CIT0003]^. 3. If pseudohyperkalaemia is suspected, blood should be collected carefully into both clotted and lithium heparin tubes, and transported to the laboratory manually as soon as possible. Alternatively, a point of care device might be available (e.g. a blood gas analyser with a potassium facility).
May 28, 2015 JUDGMENT The Fourteenth Court of Appeals GRACE INSTRUMENT INDUSTRIES, LLC, Appellant NO. 14-15-00269-CV V. MELDEN SCHMIDT AND OFI TESTING EQUIPMENT, INC., Appellee ________________________________ Today the Court heard appellee's motion to dismiss the appeal from the judgment signed by the court below on March 2, 2015. Having considered the motion and found it meritorious, we order the appeal DISMISSED. We further order that all costs incurred by reason of this appeal be paid by appellant, Grace Instrument Industries, LLC. We further order this decision certified below for observance.
--- abstract: 'We consider the large-$D$ limit of Einstein gravity. It is observed that a consistent leading large-$D$ graph limit exists, and that it is built up by a subclass of planar diagrams. The graphs in the effective field theory extension of Einstein gravity are investigated in the same context, and it is seen that an effective field theory extension of the basic Einstein-Hilbert theory will not upset the latter leading large-$D$ graph limit, [*i.e.*]{}, the same subclass of planar diagrams will dominate at large-$D$ in the effective field theory. The effective field theory description of large-$D$ quantum gravity limit will be renormalizable, and the resulting theory will thus be completely well defined up to the Planck scale at $\sim 10^{19}$ GeV. The $\left(\frac1D\right)$ expansion in gravity is compared to the successful $\left(\frac1N\right)$ expansion in gauge theory (the planar diagram limit), and dissimilarities and parallels of the two expansions are discussed. We consider the expansion of the effective field theory terms and we make some remarks on explicit calculations of $n$-point functions.' author: - 'N. E. J. Bjerrum-Bohr' title: Quantum gravity at a large number of dimensions --- Introduction ============ A traditional belief is that an adequate description of quantum gravity is necessarily complicated, and that we are very far from a satisfying explanation of its true physical content. This might be correct, however progress on the problems in quantum gravity are being made, and gravitational interactions are today better understood than previously. The fate of gravity in the limit of Planckian scale energies is still unknown. At the physical transition to such energies $\sim 10^{19}$ GeV, fundamental issues are believed to arise. They concern the validity of the conceptual picture of space and time geometry. A completely new understanding of physics might be the consequence. String theory or the so called $M$-theory are candidates for such theories in high energy physics. Einstein’s theory of general relativity on the other hand presents us with an excellent classical model for the interactions of matter and space-time in the low energy regime of physics. Astronomical observations support the theoretical predictions, and there are no experimental reasons for a disbelief in the physical foundations of general relativity. The fact that general relativity is not a quantum theory is however intriguing. A fundamental description of nature should either be completely classical or quantum mechanical from a theoretical point of view, and so far experiments support quantum mechanics as the correct basis for interpreting physical measurements. It would be nice to unify Einstein’s theory in the classical low energy limit with a full quantum field theoretic description in the high energy limit. This seems not to be immediately possible, attempts of making a quantum field theoretic description of general relativity have normally proven to be incomplete in regard to the question of renormalizability of the fundamental action for the theory. The basic four-dimensional Einstein-Hilbert action: $${\cal L}_{\rm EH} = \int d^4x{\sqrt {-g}}\Big(\frac{2R}{\kappa^2} + {\cal L}_{\text{matter}}\Big),$$ is not renormalizable in the sense that the counter-terms which appear in the renormalized action, [*e.g.*]{}, ($\sim R^2$), ($\sim R_{\mu\nu}R^{\mu\nu}$) and ($\sim R^3),\ \ldots$ cannot be absorbed in the original action [@Veltman; @NON; @matter]. In the above equation ($\kappa^2$) is defined as ($32\pi G_D$), where ($G_D$) is the $D$-dimensional Newton constant. The disappointing conclusion is usually that a field theoretical treatment of gravity is not possible, and that one should avoid attempting such a description. Effective field theory presents a solution to the renormalization problem of gravity. It initially originates from an idea put forward by Weinberg [@Weinberg]. Including all possible invariants into the action, [*i.e.*]{}, replacing the basic $D$-dimensional Einstein-Hilbert action with: $${\cal L}_{\rm effective\ EH} = \int d^Dx{\sqrt {-g}}\bigg(\Big(\frac{2R}{\kappa^2}+c_1R^2+c_2R^{\mu\nu}R_{\mu\nu}+\ldots\Big)+{\cal L}_{\text{eff. matter}}\bigg),$$ solves the issue of renormalizability. No counter terms can be generated in a covariant renormalization scheme, which are not already present in the action. The effective field theory approach will always lead to consistent renormalizable theories in any dimension, [*e.g.*]{}, for ($D=4$), ($D=10$) or even ($D=127$). It is important to note that in regard to its renormalizability, an effective field theory in the large-$D$ limit of gravity is just as well defined as the planar diagram large-$N$ limit, in e.g., a $(D=4)$ Yang-Mills theory. A Yang-Mills theory, at ($D > 4$), will also need to be treated by means of effective field theory in order to be renormalizable. What we give up in the effective field treatment of gravity or in any other theory, is the finite number of terms in the action. The Einstein action is replaced with an action which has an infinite number of coupling constants. These have to be renormalized at each loop order. The coupling constants of the effective expansion of the action, [*i.e.*]{}, ($c_1, c_2, \ldots$), will have to be determined by experiment and are running, [*i.e.*]{}, they will depend on the energy scale. However, the advantage of the effective approach is quite clear. Quantum gravity is an effectively renormalizable theory up to the energies at the Planck scale! The effective field theory description of general relativity has directly shown its worth by explicit calculations of quantum corrections to the metric and to the Newtonian potential of large masses. This work was pioneered by Donoghue, refs. [@Donoghue:dn; @B1; @B2], and as an effective field theory combined with QED, refs. [@DB; @QED]. The conceptual picture of Einstein gravity is not affected by the effective field theory treatment of the gravitational interactions. The equations of motion will of course be slightly changed by the presence of higher derivative terms in the action, however the contributions coming from such terms can at normal energies be shown to be negligible [@Stelle; @Simon:ic]. Effective field theory thus provides us with a very solid framework in the study of gravitational interactions and quantum effects at normal energies, and solves some of the essential problems in building field theoretical quantum gravity models. An intriguing paper by Strominger [@Strominger:1981jg] deals with the perspectives of basic Einstein gravity at an infinite number of dimensions. The basic idea is to let the spatial dimension be a parameter in which one is allowed to expand the theory. Each graph of the theory is then associated with a dimensional factor. Formally one can expand every Greens function of the theory as a series in $\left(\frac1D\right)$ and the gravitational coupling constant ($\kappa$): $$G = \sum_{i,j}(\kappa)^i\left(\frac1D\right)^j {\cal G}_{i,j}.$$ The contributions with highest dimensional dependence will be the leading ones in the large-$D$ limit. Concentrating on these graphs only simplifies the theory and makes explicit calculations easier. In the effective field theory we expect an expansion of the theory of the type: $$G = \sum_{i,j,k}(\kappa)^i\left(\frac1D\right)^j ({\cal E})^{2k}{\cal G}_{i,j,k},$$ where (${\cal E}$) represents a parameter for the effective expansion of the theory in terms of the energy, [*i.e.*]{}, each derivative acting on a massless field will correspond to a factor of (${\cal E}$). The basic Einstein-Hilbert scale will correspond to the (${\cal E}^2\sim \partial^2 g$) contribution, while higher order effective contributions will be of order (${\cal E}^4\sim\partial^4 g$), (${\cal E}^6\sim \partial^6 g$), $\ldots$ etc. The idea of making a large-$D$ expansion in gravity is somewhat similar to the large-$N$ Yang-Mills planar diagram limit considered by ’t Hooft [@tHooft]. In large-$N$ gauge theories, one expands in the internal symmetry index ($N$) of the gauge group, [*e.g.*]{}, $SU(N)$ or $SO(N)$. The physical interpretations of the two expansions are of course completely dissimilar, [*e.g.*]{}, the number of dimensions in a theory cannot really be compared to the internal symmetry index of a gauge theory. A comparison of the Yang Mills large-$N$ limit (the planar diagram limit), and the large-$D$ expansion in gravity is however still interesting to perform, and as an example of a similarity between the two expansions the leading graphs in the large-$D$ limit in gravity consists of a subset of planar diagrams. Higher dimensional models for gravity are well known from string and supergravity theories. The mysterious $M$-theory has to exist in an 11-dimensional space-time. So there are many good reasons to believe that on fundamental scales, we might experience additional space-time dimensions. Additional dimensions could be treated as free or as compactified below the Planck scale, as in the case of a Kaluza-Klein mechanism. One application of the large-$D$ expansion in gravity could be to approximate Greens functions at finite dimension, [*e.g.*]{}, ($D=4$). The successful and various uses of the planar diagram limit in Yang-Mills theory might suggest other possible scenarios for the applicability of the large-$D$ expansion in gravity. For example, is effective quantum gravity renormalizable in its leading large-$D$ limit, [*i.e.*]{}, is it renormalizable in the same way as some non-renormalizable theories are renormalizable in their planar diagram limit? It could also be, that quantum gravity at large-$D$ is a completely different theory, than Einstein gravity. A planar diagram limit is essentially a string theory at large distances, [*i.e.*]{}, could gravity at large-$D$ be interpreted as a large distance truncated string limit? We will here combine the successful effective field theory approach which holds in any dimension, with the expansion of gravity in the large-$D$ limit. The treatment will be mostly conceptual, but we will also address some of the phenomenological issues of this theory. The structure of the paper will be as follows. First we will discuss the basic quantization of the Einstein-Hilbert action, and then we will go on with the large-$D$ behavior of gravity, [*i.e.*]{}, we will show how to derive a consistent limit for the leading graphs. The effective extension of the theory will be taken up in the large-$D$ framework, and we will especially focus on the implications of the effective extension of the theory in the large-$D$ limit. The $D$-dimensional space-time integrals will then be briefly looked upon, and we will make a conceptual comparison of the large-$D$ in gravity and the large-$N$ limit in gauge theory. Here we will point out some similarities and some dissimilarities of the two theories. We will also discuss some issues in the original paper by Strominger, ref. [@Strominger:1981jg]. We will work in units: $(\hbar=c=1)$, and metric: ${\rm diag}(\eta_{\mu\nu})=(1,-1,-1,-1,\dots,-1)$, [*i.e.*]{}, with $(D-1)$ minus signs. Review of the large-$D$ limit of Einstein gravity ================================================= In this section we will review the main idea. To begin we will formally describe how to quantize a gravitational theory. As is well known the $D$-dimensional Einstein-Hilbert Lagrangian has the form: $${\cal L} = \int d^Dx \sqrt{-g}\Big(\frac{2R}{\kappa^2}\Big).$$ If we neglect the renormalization problems of this action, it is possible to make a formal quantization using the path integral approach. Introducing a gauge breaking term in the action will fix the gauge, and because gravity is a non-abelian theory we have to introduce a proper Faddeev-Popov ghost action as well. The action for the quantized theory will consequently be: $${\cal L} = \int d^Dx \sqrt{-g}\Big(\frac{2R}{\kappa^2}+{\cal L}_{\rm gauge\ fixing}+ {\cal L}_{\rm ghosts}\Big),$$ where (${\cal L}_{\rm gauge\ fixing}$) is the gauge fixing term, and (${\cal L}_{\rm ghosts}$) is the ghost contribution. In order to generate vertex rules for this theory an expansion of the action has to be carried out, and vertex rules have to be extracted from the gauge fixed action. The vertices will depend on the gauge choice and on how we define the gravitational field. It is conventional to define: $$g_{\mu\nu} \equiv \eta_{\mu\nu}+\kappa h_{\mu\nu},$$ and work in harmonic gauge: ($\partial^\lambda h_{\mu\lambda} = \frac12\partial_\mu h^\lambda_\lambda$). For this gauge choice the vertex rules for the 3- and 4-point Einstein vertices can be found in [@Dewitt; @Sannan]. Yet another possibility is to use the background field method, here we define: $$g_{\mu\nu} \equiv \tilde g_{\mu\nu}+\kappa h_{\mu\nu},$$ and expand the quantum fluctuation: ($h_{\mu\nu}$) around an external source, the background field: ($\tilde g_{\mu\nu} \equiv \eta_{\mu\nu} + \kappa H_{\mu\nu}$). In the background field approach we have to differ between vertices with internal lines (quantum lines: $\sim h_{\mu\nu}$) and external lines (external sources: $\sim H_{\mu\nu}$). There are no real problems in using either method; it is mostly a matter of notation and conventions. Here we will concentrate our efforts on the conventional approach. In many loop calculations the background field method is the easiest to employ. See ref. [@Donoghue:dn; @B1; @B2; @NON] for additional details about, [*e.g.*]{}, the vertex rules in the background field method. Another possibility is to define: $$\tilde g^{\mu\nu} \equiv \sqrt{-g}g^{\mu\nu} = \eta^{\mu\nu} + \kappa h^{\mu\nu},$$ this field definition makes a transformation of the Einstein-Hilbert action into the following form: $$\begin{split} {\cal L} &= \int d^D x \frac{1}{2\kappa^2}(\tilde g^{\rho\sigma}\tilde g_{\lambda\alpha}\tilde g_{\kappa\tau}\tilde g^{\alpha\kappa}_{\ \ \ , \rho}\tilde g^{\lambda\tau}_{\ \ \ , \sigma} -\frac1{(D-2)}\tilde g^{\rho\sigma}\tilde g_{\alpha\kappa}\tilde g^{\lambda\tau}\tilde g^{\lambda\tau}_{\ \ \ , \sigma} -2\tilde g_{\alpha\tau}\tilde g^{\alpha\kappa}_{\ \ \ , \rho}\tilde g^{\rho\tau}_{\ \ \ , \kappa}), \end{split}$$ in, ($D=4$), this form of the Einstein-Hilbert action is known as the Goldberg action [@Capper:pv]. In this description of the Einstein-Hilbert action its dimensional dependence is more obvious. It is however more cumbersome to work with in the course of practical large-$D$ considerations. In the standard expansion of the action the propagator for gravitons take the form: $$D_{\alpha\beta,\gamma\delta}(k) = -\frac{i}{2}\frac{\Big[\eta_{\alpha\gamma}\eta_{\beta\delta} +\eta_{\alpha\delta}\eta_{\beta\gamma}-\frac{2}{D-2} \eta_{\alpha\beta}\eta_{\gamma\delta}\Big]}{k^2-i\epsilon}.$$ The 3- and 4-point vertices for the standard expansion of the Einstein-Hilbert action can be found in [@Dewitt; @Sannan] and has the following form: $$\begin{split} V^{(3)}_{\mu\alpha,\nu\beta,\sigma\gamma}(k_1,k_2,k_3) &= \kappa\,{\rm sym} \Big[ -\frac12P_3(k_1\cdot k_2\,\eta_{\mu\alpha}\eta_{\nu\beta}\eta_{\sigma\gamma}) -\frac12P_6(k_{1\nu}k_{1\beta}\eta_{\mu\alpha}\eta_{\sigma\gamma}) + \frac12P_3(k_1\cdot k_2\,\eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\sigma\gamma})\\& +P_6(k_1\cdot k_2\,\eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}) +2P_3(k_{1\nu}k_{1\gamma}\eta_{\mu\alpha}\eta_{\beta\sigma}) -P_3(k_{1\beta}k_{2\mu}\eta_{\alpha\nu}\eta_{\sigma\gamma}) +P_3(k_{1\sigma}k_{2\gamma}\eta_{\mu\nu}\eta_{\alpha\beta})\\& +P_6(k_{1\sigma}k_{1\gamma}\eta_{\mu\nu}\eta_{\alpha\beta}) +2P_6(k_{1\nu}k_{2\gamma}\eta_{\beta\mu}\eta_{\alpha\sigma}) +2P_3(k_{1\nu}k_{2\mu}\eta_{\beta\sigma}\eta_{\gamma\alpha}) -2P_3(k_1\cdot k_2\,\eta_{\alpha\nu}\eta_{\beta\sigma}\eta_{\gamma\mu})\Big], \end{split}$$ and $$\begin{split} V^{(4)}_{\mu\alpha,\nu\beta,\sigma\gamma,\rho\lambda}(k_1,k_2,k_3,k_4)&=\kappa^2\,{\rm sym}\Big[ -\frac14P_6(k_1\cdot k_2\,\eta_{\mu\alpha}\eta_{\nu\beta}\eta_{\sigma\gamma}\eta_{\rho\lambda}) -\frac14P_{12}(k_{1\nu}k_{1\beta}\eta_{\mu\alpha}\eta_{\sigma\gamma}\eta_{\rho\lambda}) -\frac12P_6(k_{1\nu}k_{2\mu}\eta_{\alpha\beta}\eta_{\sigma\gamma}\eta_{\rho\lambda})\\& +\frac14P_6(k_1\cdot k_2\, \eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\sigma\gamma}\eta_{\rho\lambda}) +\frac12P_6(k_1\cdot k_2\, \eta_{\mu\alpha}\eta_{\nu\beta}\eta_{\sigma\rho}\eta_{\gamma\lambda}) +\frac12P_{12}(k_{1\nu}k_{1\beta}\eta_{\mu\alpha}\eta_{\sigma\rho}\eta_{\gamma\lambda})\\& +P_6(k_{1\nu}k_{2\mu}\eta_{\alpha\beta}\eta_{\sigma\rho}\eta_{\gamma\lambda}) -\frac12P_6(k_1\cdot k_2\,\eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\sigma\rho}\eta_{\gamma\lambda}) +\frac12P_{24}(k_1\cdot k_2\,\eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}\eta_{\rho\lambda}) \\&+\frac12P_{24}(k_{1\nu}k_{1\beta}\eta_{\mu\sigma}\eta_{\alpha\gamma}\eta_{\rho\lambda} +\frac12P_{12}(k_{1\sigma}k_{2\gamma}\eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\rho\lambda}) +P_{24}(k_{1\nu}k_{2\sigma}\eta_{\beta\mu}\eta_{\alpha\gamma}\eta_{\rho\lambda})\\& -P_{12}(k_1\cdot k_2\,\eta_{\alpha\nu}\eta_{\beta\sigma}\eta_{\gamma\mu}\eta_{\rho\lambda}) +P_{12}(k_{1\nu}k_{2\mu}\eta_{\beta\sigma}\eta_{\gamma\alpha}\eta_{\rho\lambda}) +P_{12}(k_{1\nu}k_{1\sigma}\eta_{\beta\gamma}\eta_{\mu\alpha}\eta_{\rho\lambda}) \\&-P_{24}(k_1\cdot k_2\,\eta_{\mu\alpha}\eta_{\beta\sigma}\eta_{\gamma\rho}\eta_{\lambda\nu}) -2P_{12}(k_{1\nu}k_{1\beta}\eta_{\alpha\sigma}\eta_{\gamma\rho}\eta_{\lambda\mu}) -2P_{12}(k_{1\sigma}k_{2\gamma}\eta_{\alpha\rho}\eta_{\lambda\nu}\eta_{\beta\mu})\\& -2P_{24}(k_{1\nu}k_{2\sigma}\eta_{\beta\rho}\eta_{\lambda\mu}\eta_{\alpha\gamma}) -2P_{12}(k_{1\sigma}k_{2\rho}\eta_{\gamma\nu}\eta_{\beta\mu}\eta_{\alpha\lambda}) +2P_{6}(k_1\cdot k_2\,\eta_{\alpha\sigma}\eta_{\gamma\nu}\eta_{\beta\rho}\eta_{\lambda\mu})\\& -2P_{12}(k_{1\nu}k_{1\sigma}\eta_{\mu\alpha}\eta_{\beta\rho}\eta_{\lambda\gamma}) -P_{12}(k_1\cdot k_2\,\eta_{\mu\sigma}\eta_{\alpha\gamma}\eta_{\nu\rho}\eta_{\beta\lambda}) -2P_{12}(k_{1\nu}k_{1\sigma}\eta_{\beta\gamma}\eta_{\mu\rho}\eta_{\alpha\lambda}\\& -P_{12}(k_{1\sigma}k_{2\rho}\eta_{\gamma\lambda}\eta_{\mu\nu}\eta_{\alpha\beta}) -2P_{24}(k_{1\nu}k_{2\sigma}\eta_{\beta\mu}\eta_{\alpha\rho}\eta_{\lambda\gamma}) -2P_{12}(k_{1\nu}k_{2\mu}\eta_{\beta\sigma}\eta_{\gamma\rho}\eta_{\lambda\alpha})\\& +4P_{6}(k_1\cdot k_2\,\eta_{\alpha\nu}\eta_{\beta\sigma}\eta_{\gamma\rho}\eta_{\lambda\mu}) \Big], \end{split}$$ in the above two expressions, ’${\rm sym}$’, means that each pair of indices: ($\mu\alpha$), ($\nu\beta$), $\ldots$ will have to be symmetrized. The momenta factors: ($k_1$, $k_2$, $\ldots$) are associated with the index pairs: ($\mu\alpha$, $\nu\beta$, $\ldots$) correspondingly. The symbol: ($P_{\#}$) means that a $\#$-permutation of indices and corresponding momenta has to carried out for this particular term. As seen the algebraic structures of the 3- and 4-point vertices are already rather involved and complicated. 5-point vertices will not be considered explicitly in this paper. The explicit prefactors of the terms in the vertices will not be essential in this treatment. The various algebraic structures which constitutes the vertices will be more important. Different algebraic terms in the vertex factors will generate dissimilar traces in the final diagrams. It is useful to adapt an index line notation for the vertex structure similar to that used in large-$N$ gauge theory. In this notation we can represent the different algebraic terms of the 3-point vertex (see figure \[3vert\]). ---------------------------------------------------------------------------- ---------------------------------------------------------------------------- ---------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------- $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.1.ps}}\right)_{\rm [$\sim {\rm sym}[-\frac12P_3(k_1\cdot $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.2.ps}}\right)_{\rm $\sim {\rm sym}[ \frac12P_3(k_1\cdot k_2 3A}$ k_2\eta_{\mu\alpha}\eta_{\nu\beta}\eta_{\sigma\gamma})],$]{} 3B}$ \eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\sigma\gamma})+P_6(k_1\cdot k_2 \eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.3.ps}}\right)_{\rm $\sim {\rm sym}[ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.4.ps}}\right)_{\rm $\sim {\rm sym}[ 3C}$ P_3(k_{1\sigma}k_{2\gamma}\eta_{\mu\nu}\eta_{\alpha\beta})],$ 3D}$ 2P_6(k_{1\nu}k_{2\gamma}\eta_{\beta\mu}\eta_{\alpha\sigma})+2P_3(k_{1\nu}k_{2\mu}\eta_{\beta\sigma}\eta_{\gamma\alpha})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.5.ps}}\right)_{\rm $\sim{\rm sym}[ -2P_3(k_1\cdot $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.6.ps}}\right)_{\rm $\sim {\rm 3E}$ k_2\eta_{\alpha\nu}\eta_{\beta\sigma}\eta_{\gamma\mu})],$ 3F}$ sym}[2P_3(k_{1\nu}k_{1\gamma}\eta_{\mu\alpha}\eta_{\beta\sigma}) -P_3(k_{1\beta}k_{2\mu}\eta_{\alpha\nu}\eta_{\sigma\gamma}) ],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig1.7.ps}}\right)_{\rm $\sim {\rm 3G}$ sym}[-\frac12P_6(k_{1\nu}k_{1\beta}\eta_{\mu\alpha}\eta_{\sigma\gamma})].$ ---------------------------------------------------------------------------- ---------------------------------------------------------------------------- ---------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------- For the 4-point vertex we can use a similar diagrammatic notation (see figure \[4-point\]). ----------------------------------------------------------------------------- --------------------------------------------------------------------------------------------- $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.1.ps}}\right)_{\rm $\sim {\rm sym} [-\frac14P_6(k_1\cdot k_2 4A}$ \eta_{\mu\alpha}\eta_{\nu\beta}\eta_{\sigma\gamma}\eta_{\rho\lambda})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.2.ps}}\right)_{\rm $\sim {\rm sym} 4B}$ [-\frac14P_{12}(k_{1\nu}k_{1\beta}\eta_{\mu\alpha}\eta_{\sigma\gamma}\eta_{\rho\lambda})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.3.ps}}\right)_{\rm $\sim {\rm sym} 4C}$ [-\frac12P_6(k_{1\nu}k_{2\mu}\eta_{\alpha\beta}\eta_{\sigma\gamma}\eta_{\rho\lambda})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.4.ps}}\right)_{\rm $\sim {\rm sym} [\frac14P_6(k_1\cdot k_2 4D}$ \eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\sigma\gamma}\eta_{\rho\lambda}) +\frac12P_6(k_1\cdot k_2 \eta_{\mu\alpha}\eta_{\nu\beta}\eta_{\sigma\rho}\eta_{\gamma\lambda}) +\frac12P_{24}(k_1\cdot k_2 \eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}\eta_{\rho\lambda})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.5.ps}}\right)_{\rm $\sim {\rm sym} 4E}$ [\frac12P_{12}(k_{1\nu}k_{1\beta}\eta_{\mu\alpha}\eta_{\sigma\rho}\eta_{\gamma\lambda}) +\frac12P_{24}(k_{1\nu}k_{1\beta}\eta_{\mu\sigma}\eta_{\alpha\gamma}\eta_{\rho\lambda}) +\frac12P_{12}(k_{1\sigma}k_{2\gamma}\eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\rho\lambda})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.6.ps}}\right)_{\rm $\sim {\rm sym} 4F}$ [-2P_{12}(k_{1\nu}k_{1\beta}\eta_{\alpha\sigma}\eta_{\gamma\rho}\eta_{\lambda\mu}) -2P_{12}(k_{1\sigma}k_{2\gamma}\eta_{\alpha\rho}\eta_{\lambda\nu}\eta_{\beta\mu})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.7.ps}}\right)_{\rm $\sim {\rm sym} [2P_6(k_1\cdot k_2 4G}$ \eta_{\alpha\sigma}\eta_{\gamma\nu}\eta_{\beta\rho}\eta_{\lambda\mu}) +4P_6(k_1\cdot k_2 \eta_{\alpha\nu}\eta_{\beta\sigma}\eta_{\gamma\rho}\eta_{\lambda\mu})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.8.ps}}\right)_{\rm $\sim {\rm sym} [-P_{12}(k_1\cdot k_2 4H}$ \eta_{\alpha\nu}\eta_{\beta\sigma}\eta_{\gamma\mu}\eta_{\rho\lambda}) -P_{24}(k_1\cdot k_2 \eta_{\mu\alpha}\eta_{\beta\sigma}\eta_{\gamma\rho}\eta_{\lambda\nu})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.9.ps}}\right)_{\rm $\sim {\rm sym} 4I}$ [-2P_{24}(k_{1\nu}k_{2\sigma}\eta_{\beta\rho}\eta_{\lambda\mu}\eta_{\alpha\gamma}) -2P_{12}(k_{1\sigma}k_{2\rho}\eta_{\gamma\nu}\eta_{\beta\mu}\eta_{\alpha\lambda}) -2P_{12}(k_{1\sigma}k_{2\rho}\eta_{\gamma\lambda}\eta_{\mu\nu}\eta_{\alpha\beta}) $ $-2P_{24}(k_{1\nu}k_{2\sigma}\eta_{\beta\mu}\eta_{\alpha\rho}\eta_{\lambda\gamma}) -2P_{12}(k_{1\nu}k_{2\mu}\eta_{\beta\sigma}\eta_{\gamma\rho}\eta_{\lambda\alpha})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.10.ps}}\right)_{\rm $\sim {\rm sym} [-\frac12P_6(k_1\cdot k_2 4J}$ \eta_{\mu\nu}\eta_{\alpha\beta}\eta_{\sigma\rho}\eta_{\gamma\lambda}) -P_{12}(k_1\cdot k_2 \eta_{\mu\sigma}\eta_{\alpha\gamma}\eta_{\nu\rho}\eta_{\beta\lambda})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.11.ps}}\right)_{\rm $\sim {\rm sym} 4K}$ [P_{24}(k_{1\nu}k_{2\sigma}\eta_{\beta\mu}\eta_{\alpha\gamma}\eta_{\rho\lambda}) +P_{12}(k_{1\nu}k_{2\mu}\eta_{\beta\sigma}\eta_{\gamma\alpha}\eta_{\rho\lambda}) -2P_{12}(k_{1\nu}k_{1\sigma}\eta_{\mu\alpha}\eta_{\beta\rho}\eta_{\lambda\gamma})],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig2.12.ps}}\right)_{\rm $\sim {\rm sym} 4L}$ [P_6(k_{1\nu}k_{2\mu}\eta_{\alpha\beta}\eta_{\sigma\rho}\eta_{\gamma\lambda} -2P_{12}(k_{1\nu}k_{1\sigma}\eta_{\beta\gamma}\eta_{\mu\rho}\eta_{\alpha\lambda}) -P_{12}(k_{1\sigma}k_{2\rho}\eta_{\gamma\lambda}\eta_{\mu\nu}\eta_{\alpha\beta})].$ ----------------------------------------------------------------------------- --------------------------------------------------------------------------------------------- There are only two sources of factors of dimension in a diagram. A dimension factor can arise either from the algebraic contractions in that particular diagram or from the space-time integrals. No other possibilities exists. In order to arrive at the large-$D$ limit in gravity both sources of dimension factors have to be considered and the leading contributions will have to be derived in a systematic way. Comparing to the case of the large-$N$ planar diagram expansion, only the algebraic structure of the diagrams has to be considered. The symmetry index: ($N$) of the gauge group does not go into the evaluation of the integrals. Concerns with the $D$-dimensional integrals only arises in gravity. This is a great difference between the two expansions. A dimension factor will arise whenever there is a trace over a tensor index in a diagram, [*e.g.*]{}, ($\eta_{\mu\alpha}\eta^{\alpha\mu},\ \eta_{\mu\alpha}\eta^{\alpha\beta} \eta_{\beta\gamma}\eta^{\gamma\mu},\ \ldots \sim D$). The diagrams with the most traces will dominate the large-$D$ limit in gravity. Traces of momentum lines will never generate a factor of ($D$). It is easy to be assured that some diagrams naturally will generate more traces than other diagrams. The key result of ref. [@Strominger:1981jg] is that only a particular class of diagrams will constitute the large-$D$ limit, and that only certain contributions from these diagrams will be important there. The large-$D$ limit of gravity will correspond to a truncation of the Einstein theory of gravity, where in fact only a subpart, namely the leading contributions of the graphs will dominate. We will use the conventional expansion of the gravitational field, and we will not separate conformal and traceless parts of the metric tensor. To justify this we begin by looking on how traces occur from contractions of the propagator.\ We can graphically write the propagator in the way shown in figure \[prop\]. ![A graphical representation of the graviton propagator, where a full line corresponds to a contraction of two indices.\[prop\]](fig3.ps){height="0.5cm"} The only way we can generate index loops is through a propagator. We can graphically represent a propagator contraction of two indices in a particular amplitude in the following way (see figure \[figprop1\]). Essentially (disregarding symmetrizations of indices etc) only the following contractions of indices in the conventional graviton propagator can occur in an given amplitude, we can contract, [*e.g.*]{}, ($\alpha$ and $\beta$) or both ($\alpha$ and $\beta$) and ($\gamma$ and $\delta$). The results of such contractions are shown below and also graphically depicted in figure \[figprop2\]. $$\begin{split} \frac12[\eta_{\alpha\gamma}\eta_{\beta\delta}+\eta_{\alpha\delta}\eta_{\beta\gamma}-\frac{2}{D-2}\eta_{\alpha\beta}\eta_{\gamma\delta}\Big]\eta^{\alpha\beta} = \eta_{\gamma\delta} -\frac{D}{D-2}\eta_{\gamma\delta} \\ \frac12[\eta_{\alpha\gamma}\eta_{\beta\delta}+\eta_{\alpha\delta}\eta_{\beta\gamma}-\frac{2}{D-2}\eta_{\alpha\beta}\eta_{\gamma\delta}\Big]\eta^{\alpha\beta}\eta^{\gamma\delta} =-\frac{2D}{D-2} \end{split}$$ We can can also contract, [*e.g.*]{}, ($\alpha$ and $\gamma$) or both ($\alpha$ and $\gamma$) and ($\beta$ and $\delta$) again the results are shown below and depicted graphically in figure \[figprop3\]. $$\begin{split} \frac12[\eta_{\alpha\gamma}\eta_{\beta\delta}+\eta_{\alpha\delta}\eta_{\beta\gamma}-\frac{2}{D-2}\eta_{\alpha\beta}\eta_{\gamma\delta}\Big]\eta^{\alpha\gamma} = \frac12\eta_{\beta\delta}D+\eta_{\beta\delta}\left(\frac12+\frac{1}{D-2}\right)\\ \frac12[\eta_{\alpha\gamma}\eta_{\beta\delta}+\eta_{\alpha\delta}\eta_{\beta\gamma}-\frac{2}{D-2}\eta_{\alpha\beta}\eta_{\gamma\delta}\Big]\eta^{\alpha\gamma}\eta^{\beta\delta} = D^2 - \frac{D}{D-2}\end{split}$$ As it is seen, only the $(\eta_{\alpha\gamma}\eta_{\beta\delta}+\eta_{\alpha\delta}\eta_{\beta\gamma})$ part of the propagator will have the possibility to contribute with a positive power of ($D$). Whenever the $\left(\frac{\eta_{\mu\nu}\eta_{\alpha\beta}}{D-2}\right)$ term in the propagator is in play, [*e.g.*]{}, what remains is something that goes as $\left(\sim \frac{D}{D-2}\right)$ and which consequently will have no support to the large-$D$ leading loop contributions. We have seen that different index structures go into the same vertex factor. Below (see figure \[dif3\]), we depict the same 2-loop diagram, but for different index structures of the external 3-point vertex factor (i.e., (3C) and (3E)) for the external lines. Different types of trace structures will hence occur in the same loop diagram. Every diagram will consist of a sum of contributions with a varying number of traces. It is seen that the graphical depiction of the index structure in the vertex factor is a very useful tool in determining the trace structure of various diagrams. The following type of two-point diagram (see figure \[1-loop\]) build from the (3B) or (3C) parts of the 3-point vertex will generate a contribution which carries a maximal number of traces compared to the number of vertices in the diagram. The other parts of the 3-point vertex factor, [*e.g.*]{}, the (3A) or (3E) parts respectively will not generate a leading contribution in the large-$D$ limit, however such contributions will go into the non-leading contributions of the theory (see figure \[1-loop2\]). The diagram built from the (3A) index structure will, [*e.g.*]{}, not carry a leading contribution due to our previous considerations regarding contractions of the indices in the propagator (see figure \[figprop2\]). It is crucial that we obtain a consistent limit for the graphs, when we take ($D \rightarrow \infty$). In order to cancel the factor of ($D^2$) from the above type of diagrams, [*i.e.*]{}, to put it on equal footing in powers of ($D$) as the simple propagator diagram, it is seen that we need to rescale $\left(\kappa \rightarrow \frac{\kappa}{D}\right)$. In the large-$D$ limit $\left(\frac{\kappa}{D}\right)$ will define the ’new’ redefined gravitational coupling. A finite limit for the 2-point function will be obtained by this choice, i.e, the leading $D$-contributions will not diverge, when the limit ($D\rightarrow \infty$) is imposed. By this choice all leading $n$-point diagrams will be well defined and go as $\left(\sim \left(\frac{\kappa}{D}\right)^{(n-2)}\right)$ in a $\left(\frac1D\right)$ expansion. Each external line will carry a gravitational coupling  [^1]. However, it is important to note that our rescaling of $(\kappa)$ is solely determined by the requirement of creating a finite consistent large-$D$ limit, where all $n$-point tree diagrams and their loop corrections are on an equal footing. The above rescaling seems to be the obvious to do from the viewpoint of creating a physical consistent theory. However, we note that other limits for the graphs are in fact possible by other redefinitions of $(\kappa)$ but such rescalings will, [*e.g.*]{}, scale away the loop corrections to the tree diagrams, thus such rescalings must be seen as rather unphysical from the viewpoint of traditional quantum field theory. For any loop with two propagators the maximal number of traces are obviously two. However, we do not know which diagrams will generate the maximal number of powers of $D$ in total. Some diagrams will have more traces than others, however because of the rescaling of $(\kappa)$ they might not carry a leading contribution after all. For example, if we look at the two graphs depicted in figure \[other\], they will in fact go as $\left(D^3 \times \frac{\kappa^4}{D^4}\times D^3 \sim \frac{1}{D}\right)$ and $\left(D^5 \times \frac{\kappa^8}{D^8}\times D^5 \sim \frac{1}{D^3}\right)$ respectively and thus not be leading contributions. In order to arrive at the result of ref. [@Strominger:1981jg], we have to consider the rescaling of $(\kappa)$ which will generate negative powers of $(D)$ as well. Let us now discuss the main result of ref. [@Strominger:1981jg]. Let ($P_{\rm \max}$) be the maximal power of ($D$) associated with a graph. Next we can look at the function ($\Pi$): $$\Pi = 2L - \sum_{m = 3}^\infty(m-2)V_m.$$ Here ($L$) is the number of loops in a given diagram, and ($V_m$) counts the number of $m$-point vertices. It is obviously true that ($P_{\rm max}$) must be less than or equal to ($\Pi$). The above function counts the maximal number of positive factors of ($D$) occurring for a given graph. The first part of the expression simply counts the maximal number of traces ($\sim D^2$) from a loop, the part which is subtracted counts the powers of ($\kappa$ $\sim \frac1D$) arising from the rescaling of ($\kappa$). Next, we employ the two well-known formulas for the topology of diagrams: $$L = I - V + 1,$$ $$\sum_{m=3}^\infty m V_m = 2I + E,$$ where ($I$) is the number of internal lines, $\left(V = \sum_{m=3}^\infty V_m\right)$ is total number of vertices and ($E$) is the number of external lines. Putting these three formulas together one arrives at: $$P_{\rm max} \leq 2 - E - 2\sum_{m=3}^\infty V_m.$$ Hence, the maximal power of ($D$) is obtained in the case of graphs with a minimal number of external lines, and two traces per diagram loop. In order to generate the maximum of two traces per loop, separated loops are necessary, because whenever a propagator index line is shared in a diagram we will not generate a maximal number of traces. Considering only separated bubble graphs, thus the following type of $n$-point (see figure \[bubble\]) diagrams will be preferred in the large-$D$ limit: Vertices, which generate unnecessary additional powers of $\left(\frac1D\right)$, are suppressed in the large-$D$ limit; multi-loop contributions with a minimal number of vertex lines will dominate over diagrams with more vertex lines. That is, in figure \[multi\] the first diagram will dominate over the second one. Thus, separated bubble diagrams will contribute to the large-$D$ limit in quantum gravity. The 2-point bubble diagram limit is shown in figure \[bubble2\]. Another type of diagrams which can make leading contributions, is the diagrams depicted in figure \[4-vertex\]. These contributions are of a type where a propagator directly combines different legs in a vertex factor with a double trace loop. Because of the index structure (4J) in the 4-point vertex such contributions are possible. These types of diagrams will have the same dimensional dependence: $\left(\frac{\kappa^4}{D^4}\times D^4\sim 1\right)$, as the 2-loop separated bubble diagrams. It is claimed in [@Strominger:1981jg], that such diagrams will be non-leading. We have however found no evidence of this in our investigations of the large-$D$ limit. Higher order vertices with more external legs can generate multi-loop contributions of the vertex-loop type, [*e.g.*]{}, a 6-point vertex can in principle generate a 3-loop contribution to the 3-point function, a 8-point vertex a 4-loop contribution the the 4-point function etc (see figure \[6-point\]). The 2-point large-$D$ limit will hence consist of the sum of the propagator and all types of leading 2-point diagrams which one considered above, [*i.e.*]{}, bubble diagrams and vertex-loops diagrams and combinations of the two types of diagrams. Ghost insertions will be suppressed in the large-$D$ limit, because such diagrams will not carry two traces, however they will go into the theory at non-leading order. The general $n$-point function will consist of diagrams built from separated bubbles or vertex-loop diagrams. We have devoted appendix \[app2\] to a study of the generic $n$-point functions. The large-$D$ limit and the effective field theory extension of gravity ======================================================================= So far we have avoided the renormalization difficulties of Einstein gravity. In order to obtain a effective renormalizable theory up to the Planck scale we will have to introduce the effective field theory description. The most general effective Lagrangian of a $D$-dimensional gravitational theory has the form: $${\cal L} = \int d^Dx \sqrt{-g}\bigg(\Big(\frac{2}{\kappa^2}R+ c_1R^2+c_2R_{\mu\nu}R^{\mu\nu}+\ldots\Big)+{\cal L}_{\rm eff.\ matter}\bigg),$$ where ($R^\alpha_{\ \mu\nu\beta}$) is the curvature tensor ($g = -{\rm det}(g_{\mu\nu})$) and the gravitational coupling is defined as before, [*i.e.*]{}, ($\kappa^2 = 32\pi G_D$). The matter Lagrangian includes in principle everything which couples to a gravitational field [@matter], [*i.e.*]{}, any effective or higher derivative couplings of gravity to bosonic and or fermionic matter. In this paper we will however solely look at pure gravitational interactions. The effective Lagrangian for the theory is then reduced to invariants built from the Riemann tensors: $${\cal L} = \int d^Dx \sqrt{-g}\Big(\frac{2R}{\kappa^2}+c_1R^2+ c_2R_{\mu\nu}R^{\mu\nu}+\ldots\Big).$$ In an effective field theory higher derivative couplings of the fields are allowed for, while the underlying physical symmetries of the theory are kept manifestly intact. In gravity the general action of the theory has to be covariant with respect to the external gravitational fields. The renormalization problems of traditional Einstein gravity are trivially solved by the effective field theory approach. The effective treatment of gravity includes all possible invariants and hence all divergences occurring in the loop diagrams can be absorbed in a renormalized effective action. The effective expansion of the theory will be an expansion of the Lagrangian in powers of momentum, and the minimal powers of momentum will dominate the effective field theory at low energy scales. In gravity this means that the ($R \sim ({\rm momentum})^2$) term will be dominant at normal energies, [*i.e.*]{}, gravity as an effective field theory at normal energies will essentially still be general relativity. At higher energy scales the higher derivative terms ($R^2 \sim ({\rm momentum})^4) ,\ \ldots, (\ R^3\sim ({\rm momentum})^6) \ldots$, corresponding to higher powers of momentum will mix in and become increasingly important. The large-$D$ limit in Einstein gravity is arrived at by expanding the theory in ($D$) and subsequently taking ($D\rightarrow \infty$). This can be done in its effective extension too. Treating gravity as an effective theory and deriving the large-$D$ limit results in a double expansion of the theory, [*i.e.*]{}, we expand the theory both in powers of momentum and in powers of $\left(\frac1D\right)$. In order to understand the large-$D$ limit in the case of gravity as an effective field theory, we have to examine the vertex structure for the additional effective field theory terms. Clearly any vertex contribution from, [*e.g.*]{}, the effective field theory terms, ($R^2$), and, ($R_{\mu\nu}^2$), will have four momentum factors and hence new index structures are possible for the effective vertices. We find the following vertex structure for the ($R^2$) and the ($R_{\mu\nu}^2$) terms of the effective action (see figure \[efft\] and appendix \[app1\]). ------------------ ------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------- $V_3^{\rm eff}=$ $\kappa^3\left(\parbox{1cm} $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.2.ps}}\right)^{\rm $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.3.ps}}\right)^{\rm $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.4.ps}}\right)^{\rm $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.5.ps}}\right)^{\rm eff}_{\rm 3E}$+ {\includegraphics[height=0.8cm]{fig16.1.ps}}\right)^{\rm eff}_{\rm eff}_{\rm 3B}$+ eff}_{\rm 3C}$+ eff}_{\rm 3D}$+ 3A}$+ $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.6.ps}}\right)^{\rm $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.7.ps}}\right)^{\rm $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.8.ps}}\right)^{\rm $\kappa^3\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.9.ps}}\right)^{\rm eff}_{\rm 3F}$+ eff}_{\rm 3G}$+ eff}_{\rm 3H}$+ eff}_{\rm 3I}$. ------------------ ------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------- We are particularly interested in the terms which will give leading trace contributions. For the (3B)$^{\rm eff}$ and (3C)$^{\rm eff}$ index structures of we have shown some explicit results (see figure \[3B3C\]). ----------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------- $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig17.1.ps}}\right)^{\rm $\sim {\rm eff}_{\rm 3B}$ sym}[-P_3\left(\eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[3c_1k_1^2(k_2\cdot k_3)+c_2(\frac12(k_1\cdot k_2)(k_1\cdot k_3)-\frac14k_2^2k_3^2)]\right)$ $-P_6\left(\eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[2c_1k_1^2k_3^2+c_2(\frac12(k_1\cdot k_3)^2-\frac14k_2^2(k_1\cdot k_3))]\right)],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig17.2.ps}}\right)^{\rm $\sim {\rm eff}_{\rm 3C}$ sym}[-P_3\left(k_{1\mu}k_{1\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[3c_1k_2\cdot k_3]\right) -2P_6\left(k_{1\mu}k_{1\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_1 k_3^2]\right) +\frac12P_6\left(k_{1\mu}k_{2\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1\cdot k_3]\right) $ +$P_6\left(k_{1\mu}k_{3\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1\cdot k_3]\right) -\frac12P_3\left(k_{2\mu}k_{3\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1^2]\right) -\frac12P_6\left(k_{3\mu}k_{3\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1^2]\right)$ $ -\frac12P_6\left(k_{1\beta}k_{3\nu}\eta_{\mu\sigma}\eta_{\alpha\gamma}[c_2k_2^2]\right) -\frac12P_6\left(k_{3\beta}k_{3\nu}\eta_{\mu\sigma}\eta_{\alpha\gamma}[c_2k_2^2]\right)].$ ----------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------- It is seen that also in the effective theory there are terms which will generate double trace structures. Hence an effective 1-loop bubble diagram with two traces is possible. Such diagrams will go as $\left(\frac{\kappa^4}{D^4}c_1\times D^2 \sim \frac{c_1}{D^2}\right)$. In order to arrive at the same limit for the effective tree diagrams as the tree diagrams in Einstein gravity we need to rescale ($c_1$) and ($c_2$) by ($D^2$) i.e., ($c_1 \rightarrow c_1D^2$) and ($c_2 \rightarrow c_2D^2$). Thereby every $n$-point function involving the effective vertices will go into the $n$-point functions of Einstein gravity. In fact this will hold for any ($c_i$) provided that the index structures giving double traces also exists for the higher order effective terms. Other rescalings of the ($c_i$)’s are possible. But such other rescalings will give a different tree limit for the effective theory at large-$D$. The effective tree-level graphs will be thus be scaled away from the Einstein tree graph limit. The above rescaling with ($c_i \rightarrow c_iD^2$) corresponds to the maximal rescaling possible. Any rescaling with, [*e.g.*]{}, ($c_i \rightarrow c_iD^n$, $n > 2$) will not be possible, if we still want to obtain a finite limit for the loop graphs at ($D \rightarrow \infty$). A rescaling with $(D^2)$ will give maximal support to the effective terms at large-$D$. The effective terms in the action are needed in order to renormalize infinities from the loop diagrams away. The renormalization of the effective field theory can be carried out at any particular ($D$). Of course the exact cancellation of pole terms from the loops will depend on the integrals, and the algebra will change with the dimension, but one can take this into account for any particular order of $(D=D_p)$ by an explicit calculation of the counter terms at dimension ($D_p$) followed by an adjustment of the coefficients in the effective action. The exact renormalization will in this way take place order by order in $\left(\frac1D\right)$. For any rescaling of the $(c_i)$’s it is thus always possible carry out a renormalization of the theory. Depending on how the rescaling of the coefficients $(c_i)$ are done, there will be different large-$D$ limits for the effective field theory extension of the theory. The effective field theory treatment does in fact not change the large-$D$ of gravity as much as one could expect. The effective enlargement of gravity does not introduce new exciting leading diagrams. Most parts of our analysis of the large-$D$ limit depends only on the index structure for the various vertices, and the new index structures provided by the effective field theory terms only add new momentum lines, which do not give additional traces over index loops. Therefore the effective extension of Einstein gravity is not a very radical change of its large-$D$ limit. In the effective extension of gravity the action is trivially renormalizable up to a cut-off scale at ($M_{\rm Planck}$) and the large-$D$ expansion just as well defined as an large-$N$ expansion of a renormalizable planar expansion of a Yang-Mills action. As a subject for further investigations, it might be useful to employ more general considerations about the index structures. Seemingly all possible types of index-structures are present in the effective field theory extension of gravity in the conventional approach. As only certain index structures go into the leading large-$D$ limit, the ’interesting’ index structures can be classified at any given loop order. In fact one could consider loop amplitudes with only ’interesting’ index structures present. Such applications might useful in very complicated quantum gravity calculations, where only the leading large-$D$ behavior is interesting. A comparison of the index structures present in other field expansions and the conventional expansion might also be a working area for further investigations. Every index structure in the conventional expansion of the field can be build up from the following types of index structures, see figure \[indexs\]. Thus, it is not possible to consider any index structures in a 3- or 4-point vertex, which cannot be decomposed into some product of the above types of index contractions. It might be possible to extend this to something useful in the analysis of the large-$D$ limit, [*e.g.*]{}, a simpler description of the large-$D$ diagrammatic truncation of the theory. This is another interesting working area for further research. Considerations about the space-time integrals ============================================= The space-time integrals pose certain fundamental restrictions to our analysis of the large-$D$ limit in gravity. So far we have considered only the algebraic trace structures of the $n$-point diagrams. This analysis lead us to a consistent large-$D$ limit of gravity, where we saw that only bubble and vertex-loop diagrams will carry the leading contributions in $\left(\frac1D\right)$. In a large-$N$ limit of a gauge theory this would have been adequate, however the space-time dimension is much more that just a symmetry index for the gauge group, and has a deeper significance for the physical theory than just that of a symmetry index. Space-time integrations in a $D$-dimensional world will contribute extra dimensional dependencies to the graphs, and it thus has to be investigated if the $D$-dimensional integrals could upset the algebraic large-$D$ limit. The issue about the $D$-dimensional integrals is not resolved in ref. [@Strominger:1981jg], only explicit examples are discussed and some conjectures about the contributions from certain integrals in the graphs at large-$D$ are stated. It is clear that in the case of the 1-loop separated integrals the dimensional dependence will go as $\left(\sim \Gamma(\frac{D-1}{2})\right)$. Such a dimensional dependence can always be rescaled into an additional redefinition of $(\kappa)$, [*i.e.*]{}, we can redefine $\left(\kappa\rightarrow \frac{\kappa}{\sqrt{C}}\right)$ where $\left(C \sim \Gamma(\frac{D-1}{2})\right)$. The dimensional dependence from both bubble graphs and vertex-loop graphs will be possible to scale away in this manner. Graphs which have a nested structure, [*i.e.*]{}, which have shared propagator lines, will be however be suppressed in $(D)$ compared to the separated loop diagrams. Thus the rescaling of $(\kappa)$ will make the dimensional dependence of such diagrams even worse. In the lack of rigorously proven mathematical statements, it is hard to be completely certain. But it is seen, that in the large-$D$ limit the dimensional dependencies from the integrations in $D$-dimensions will favor the same graphs as the algebraic graphs limit. The effective extension of the gravitational action does not pose any problems in these considerations, concerning the dimensional dependencies of the integrals and the extra rescalings of $(\kappa)$. The conjectures made for the Einstein-Hilbert types of leading loop diagrams hold equally well in the effective field theory case. A rescaling of the effective coupling constants have of course to be considered in light of the additional rescaling of ($\kappa$). We will have ($c_i\rightarrow Cc_i$) in this case. Nested loop diagrams, which algebraically will be down in $\left(\frac1D\right)$ compared to the leading graphs, will also be down in $\left(\frac1D\right)$ in the case of an effective field theory. To directly resolve the complications posed by the space-time integrals, in principle all classes of integrals going into the $n$-point functions of gravity have to be investigated. Such an investigation would indeed be a very ambitious task and it is outside the scope of this investigation. However, as a point for further investigations, this would be an interesting place to begin a more rigorous mathematical justification of the large-$D$ limit. To avoid any complications with extra factors of ($D$) arising from the evaluation of the integrals, one possibility is to treat the extra dimensions in the theory as compactified Kaluza-Klein space-time dimensions. The extra dimensions are then only excited above the Planck scale. The space-time integration will then only have to be preformed over a finite number of space-time dimensions, [*e.g.*]{}, the traditional first four. In such a theory the large-$D$ behavior is solely determined by the algebraic traces in the graphs and the integrals cannot not contribute with any additional factors of ($D$) to the graphs. Having a cutoff of the theory at the Planck scale is fully consistent with effective treatment of the gravitational action. The effective field theory description is anyway only valid up until the Planck scale, so an effective action having a Planckian Kaluza-Klein cutoff of the momentum integrations, is a possibility. Comparison of the large-$N$ limit and the large-$D$ limit ========================================================= The large-$N$ limit of a gauge theory and the large-$D$ limit in gravity has some similarities and some dissimilarities which we will look upon here. The large-$N$ limit in a gauge theory is the limit where the symmetry indices of the gauge theory can go to infinity. The idea behind the gravity large-$D$ limit is to do the same, where in this case ($D$) will play the role of ($N$), we thus treat the spatial dimension ($D$) as if it is only a symmetry index for the theory, [*i.e.*]{}, a physical parameter, in which we are allowed to make an expansion. As it was shown by ’t Hooft in ref. [@tHooft] the large-$N$ limit in a gauge theory will be a planar diagram limit, consisting of all diagrams which can be pictured in a plane. The leading diagrams will be of the type depicted in figure \[planar\]. ![A particular planar diagram in the large-$N$ limit. A $(\times)$ symbolizes an external source, the full lines are index lines, an full internal index loop gives a factor of ($N$).\[planar\]](fig19.ps){height="4cm"} The arguments for this diagrammatic limit follow similar arguments to those we applied in the large-$D$ limit of gravity. However the index loops in the gauge theory are index loops of the internal symmetry group, and for each type of vertex there will only be one index structure. Below we show the particular index structure for a 3-point vertex in a gauge theory. ![The index structure for the 3-point in vertex in a gauge theory.](fig20.ps){height="2.5cm"} This index structure is also present in the gravity case, [*i.e.*]{}, in the (3E) index structure, but various other index structure are present too, [*e.g.*]{}, (3A), (3B), $\ldots$, and each index structure will generically give dissimilar traces, [*i.e.*]{}, dissimilar factors of ($D$) for the loops. In gravity only certain diagrams in the large-$D$ limit carry leading contributions, but only particular parts of the graph’s amplitudes will survive when ($D\rightarrow\infty$) because of the different index structures in the vertex factor. The gravity large-$D$ limit is hence more like a truncated graph limit, where only some parts of the graph amplitude will be important, [*i.e.*]{}, every leading graph will also carry contributions which are non-leading. In the Yang-Mills large-$N$ limit the planar graph’s amplitudes will be equally important as a whole. No truncation of the graph’s amplitudes occur. Thus, in a Yang-Mills theory the large-$N$ amplitude is found by summing the full set of planar graphs. This is a major dissimilarity between the two expansions The leading diagram limits in the two expansions are not identical either. The leading graphs in gravity at large-$D$ are given by the diagrams which have a possibility for having a closed double trace structure, hence the bubble and vertex-loop diagrams are favored in the large-$D$ limit. The diagrams contributing to the gravity large-$D$ limit will thus only be a subset of the full planar diagram limit. Other expansions of the fields ============================== In gravity it is a well-known fact that different definitions of the fields will lead to different results for otherwise similar diagrams. Only the full amplitudes will be gauge invariant and identical for different expansions of the gravitational field. Therefore comparing the large-$D$ diagrammatical expansion for dissimilar definitions of the gravitational field, diagram for diagram, will have no meaning. The analysis of the large-$D$ limit carried out in this paper is based on the conventional definition of the gravitational field, and the large-$D$ diagrammatic expansion should hence be discussed in this light. Other field choices may be considered too, and their diagrammatic limits should be investigated as well. It may be worth some efforts and additional investigations to see, if the diagrammatic large-$D$ limit considered here is an unique limit for every definition of the field, [*i.e.*]{}, to see if the same diagrammatic limit always will occur for any definition of the gravitational field. A scenario for further investigations of this, could e.g., be to look upon if the field expansions can be dressed in such a way that we reach a less complicated diagrammatic expansion at large-$D$, at the cost of having a more complicated expansion of the Lagrangian. For example, it could be that vertex-loop corrections are suppressed for some definitions of the gravitational field, but that more complicated trace structures and cancellations between diagrams occurs in the calculations. In the case of the Goldberg definition of the gravitational field the vertex index structure is less complicated [@Strominger:1981jg], however the trace contractions of diagrams appears to much more complicated than in the conventional method. It should be investigated more carefully if the Goldberg definition of the field may be easier to employ in calculations. Indeed the diagrammatical limit considered by [@Strominger:1981jg] is easier, but it is not clear if results from two different expansions of the gravitational field are used to derive this. Further investigations should sheet more light on the large-$D$ limit, and on how a field redefinition may or may not change its large-$D$ diagrammatic expansion. Furthermore one can consider the background field method in the context of the large-$D$ limit as well. This is another working area for further investigations. The background field method is very efficient in complicated calculations and it may be useful to employ it in the large-$D$ analysis of gravity as well. No problems in using background field methods together with a large-$D$ quantum gravity expansion seems to be present. Discussion ========== In this paper we have discussed the large-$D$ limit of effective quantum gravity. In the large-$D$ limit, a particular subset of planar diagrams will carry all leading $\left(\frac1D\right)$ contributions to the $n$-point functions. The large-$D$ limit for any given $n$-point function will consist of the full tree $n$-point amplitude, together with a set of loop corrections which will consist of the leading bubble and vertex-loop graphs we have considered. The effective treatment of the gravitational action insures that a renormalization of the action is possible and that none of the $n$-point renormalized amplitudes will carry uncancelled divergent pole terms. An effective renormalization of the theory can be preformed at any particular dimensionality. The leading $\left(\frac1D\right)$ contributions to the theory will be algebraically less complex than the graphs in the full amplitude. Calculating only the $\left(\frac1D\right)$ leading contributions simplifies explicit calculations of graphs in the large-$D$ limit. The large-$D$ limit we have found is completely well defined as long as we do not extend the space-time integrations to the full $D$-dimensional space-time. That is, we will always have a consistent large-$D$ theory as long as the integrations only gain support in a finite dimensional space-time and the remaining extra dimensions in the space-time is left as compactified, [*e.g.*]{}, below the Planck scale. We hence have a renormalizable, definite and consistent large-$D$ limit for effective quantum gravity – good below the Planck scale! No solution to the problem of extending the space-time integrals to a full $D$-dimensional space-time has been presented in this paper, however it is clear that the effective treatment of gravity do not impose any additional problems in such investigations. The considerations about the $D$-dimensional integrals discussed in ref. [@Strominger:1981jg] hold equally well in a effective field theory, however as well as we will have to make an additional rescaling of ($\kappa$) in order to account for the extra dimensional dependence coming from the $D$-dimensional integrals, we will have make an extra rescaling of the coefficients ($c_i$) in the effective Lagrangian too. Our large-$D$ graph limit is not in agreement with the large-$D$ limit of ref. [@Strominger:1981jg], the bubble graph are present in both limits, but vertex-loops are not allowed and claimed to be down in $\left(\frac1D\right)$ the latter. We do not agree on this point, and believe that this might be a consequence of comparing similar diagrams with different field definitions. It is a well-known fact in gravity that dissimilar field definitions lead to different results for the individual diagrams. Full amplitudes are of course unaffected by any particular definition of the field, but results for similar diagrams with different field choices cannot be immediately compared. Possible extensions of the large-$D$ considerations discussed here would be to allow for external matter in the Lagrangian. This might present some new interesting aspects in the analysis, and would relate the theory more directly to external physical observables, [*e.g.*]{}, scattering amplitudes, and corrections to the Newton potential at large-$D$ or to geometrical objects such as a space-time metric. The investigations carried out in [@B1; @B2] could be discussed from a large-$D$ point of view. Investigations in quantum gravitational cosmology may also present an interesting work area for applications of the large-$D$ limit, e.g. quantum gravity large-$D$ big bang models etc. The analysis of the large-$D$ limit in quantum gravity have prevailed that using the physical dimension as an expansion parameter for the theory, is not as uncomplicated as expanding a Yang-Mills theory at large-$N$. The physical dimension goes into so many aspects of the theory, [*e.g.*]{}, the integrals, the physical interpretations etc, that it is far more complicated to understand a large-$D$ expansion in gravity than a large-$N$ expansion in a Yang-Mills theory. In some sense it is hard to tell what the large-$D$ limit of gravity really physically relates to, [*i.e.*]{}, what describes a gravitational theory with infinitely many spatial dimensions? One way to look at the large-$D$ limit in gravity, might be to see the large-$D$ as a physical phase transition of the theory at the Planck scale. This suggests that the large-$D$ expansion of gravity should be seen as a very high energy scale limit for a gravitational theory. Large-$N$ expansions of gauge theories [@tHooft] have many interesting calculational and fundamental applications in, [*e.g.*]{}, string theory, high energy, nuclear and condensed matter physics. A planar diagram limit for a gauge theory will be a string theory at large distance, this can be implemented in relating different physical limits of gauge theory and fundamental strings. In explicit calculations, large-$N$ considerations have many important applications, [*e.g.*]{}, in the approximation of QCD amplitudes from planar diagram considerations or in the theory of phase-transitions in condensed matter physics, [*e.g.*]{}, in theories of superconductivity, where the number of particles will play the role of ($N$). High energy physics and string theory are not the only places where large symmetry investigations can be employed to obtain useful information. As a calculational tool large-$D$ considerations can be imposed in quantum mechanics to obtain useful information about eigenvalues and wave-functions of arbitrary quantum mechanical potentials with a extremely high precision [@Bjerrum-Bohr:qr]. Practical applications of the large-$D$ limit in explicit calculations of $n$-point functions could be the scope for further investigations as well as certain limits of string theory might be related to the large-$D$ limit in quantum gravity. The planar large-$D$ limit found in our investigation might resemble that of a truncated string limit at large distances? Investigations of the (Kawai-Lewellen-Tye [@KLT]) open/closed string, gauge theory/gravity relations could also be interesting to preform in the context of a large-$D$ expansion. (See e.g., [@Bern3; @Bern:2002kj; @BjerrumBohr:2003af; @Bjerrum-Bohr:2003vy] for resent work on this subject. See also  [@Deser:1998jz; @Deser:2000xz]) Such questions are outside the scope of this investigation, however knowing the huge importance of large-$N$ considerations in modern physics, large-$D$ considerations of gravity might pose very interesting tasks for further research. I would like to thank Poul Henrik Damgaard for suggesting this investigation and for interesting discussions and advise. Effective 3- and 4-point vertices {#app1} ================================= The effective Lagrangian takes the form: $${\cal L} = \int d^Dx \sqrt{-g}\Big(\frac{2R}{\kappa^2}+c_1R^2+c_2R_{\mu\nu}R^{\mu\nu}+\ldots\Big).$$ In order to find the effective vertex factors we need to expand $(\sqrt{-g}R^2)$ and $(\sqrt{-g}R_{\mu\nu}^2)$. We are working in the conventional expansion of the field, so we define: $$g_{\mu\nu} \equiv \eta_{\mu\nu}+\kappa h_{\mu\nu}.$$ To second order we find the following expansion for ($\sqrt{-g}$): $$\sqrt{-g} = \exp\left(\frac12\log (\eta_{\mu\nu}+\kappa h_{\mu\nu})\right) = \left(1+\frac\kappa2h_\alpha^\alpha-\frac{\kappa^2}4h_\alpha^\beta h^\alpha_\beta+\frac{\kappa^2}8(h_\alpha^\alpha)^2\ldots\right).$$ To first order in ($\kappa$) we have the following expansion for ($R$): $$\begin{split} R^{(1)}=\kappa\left[\partial_{\alpha}\partial^{\alpha}h_\beta^\beta-\partial^\alpha\partial^\beta h_{\alpha\beta}\right], \end{split}$$ and to second order in ($\kappa^2$) we find: $$\begin{split} R^{(2)}&=\kappa^2\Big[-\frac12\partial_\alpha\left[h_\mu^\beta\partial^\alpha h_\beta^\mu\right]+\frac12\partial_\beta\left[h_\nu^\beta(2\partial_\alpha h^{\nu\alpha} - \partial_\nu h_\alpha^\alpha)\right]+\frac14\left[\partial_\alpha h_\beta^\nu + \partial_\beta h_\alpha^\nu - \partial^\nu h_{\beta\alpha}\right]\left[\partial^\alpha h_\nu^\beta + \partial_\nu h^{\beta\alpha}-\partial^\beta h_\nu^\alpha\right]\\ &-\frac14\left[2\partial_\alpha h^{\nu\alpha}-\partial^\nu h_\alpha^\alpha\right]\partial_\nu h_\beta^\beta -\frac12h^{\nu\alpha}\partial_\nu\partial_\alpha h^\beta_\beta + \frac12h_\alpha^\nu\partial_\beta\left[\partial^\alpha h_\nu^\beta+\partial_\nu h^{\beta\alpha} - \partial^\beta h_\nu^\alpha\right]\Big] \end{split}$$ In the same way we find for ($R_{\mu\nu}$): $$\begin{split} R^{(1)}_{\nu\alpha} = \frac{\kappa}2 \left[\partial_\nu\partial_\alpha h_\beta^\beta- \partial_\beta\partial_\alpha h_\nu^\beta- \partial_\beta\partial_\nu h_\alpha^\beta + \partial^2 h_{\nu\alpha}\right], \end{split}$$ and $$\begin{split} R^{(2)}_{\nu\alpha} &=\kappa^2\Big[ -\frac12\partial_\alpha\left[h^{\beta\lambda}\partial_\nu h_{\lambda\beta}\right] + \frac12\partial_\beta\left[h^{\beta\lambda}(\partial_\nu h_{\lambda\alpha}+\partial_\alpha h_{\nu\lambda} - \partial_\lambda h_{\nu\alpha})\right]\\ &+\frac14\left[\partial_\beta h_\nu^\lambda + \partial_\nu h_\beta^\lambda - \partial^\lambda h_{\nu\beta}\right]\left[\partial^\lambda h^\beta_\alpha + \partial_\alpha h^{\beta}_\lambda-\partial^\beta h_{\nu\alpha}\right] -\frac14\left[\partial_\alpha h_\nu^\lambda + \partial_\nu h_\alpha^\lambda - \partial^\lambda_{\alpha\nu}\right]\partial_\lambda h^\beta_\beta\Big]. \end{split}$$ From these equations we can expand to find ($R^2$) and ($R^2_{\mu\nu}$). Formally we can write: $$\begin{split} \sqrt{-g}R^2 &= \frac12h_\alpha^\alpha R^{(1)}R^{(1)} + 2 R^{(1)}R^{(2)}\\ &=\frac{\kappa^3}2 h_\gamma^\gamma \Big[\partial_{\alpha}\partial^{\alpha}h_\beta^\beta-\partial^\alpha\partial^\beta h_{\alpha\beta}\Big] \Big[\partial_{\sigma}\partial^{\sigma}h_\rho^\rho-\partial^\sigma\partial^\rho h_{\sigma\rho}\Big] + 2\kappa^3\Big[\partial_{\sigma}\partial^{\sigma}h_\rho^\rho-\partial^\sigma\partial^\rho h_{\sigma\rho}\Big]\bigg[-\frac12\partial_\alpha\left[h_\mu^\beta\partial^\alpha h_\beta^\mu\right]\\&+\frac12\partial_\beta\left[h_\nu^\beta(2\partial_\alpha h^{\nu\alpha} - \partial_\nu h_\alpha^\alpha)\right]+\frac14\left[\partial_\alpha h_\beta^\nu + \partial_\beta h_\alpha^\nu - \partial^\nu h_{\beta\alpha}\right]\left[\partial^\alpha h_\nu^\beta + \partial_\nu h^{\beta\alpha}-\partial^\beta h_\nu^\alpha\right]\\ &-\frac14\left[2\partial_\alpha h^{\nu\alpha}-\partial^\nu h_\alpha^\alpha\right]\partial_\nu h_\beta^\beta -\frac12h^{\nu\alpha}\partial_\nu\partial_\alpha h^\beta_\beta + \frac12h_\alpha^\nu\partial_\beta\left[\partial^\alpha h_\nu^\beta+\partial_\nu h^{\beta\alpha} - \partial^\beta h_\nu^\alpha\right] \bigg], \end{split}$$ and $$\begin{split} \sqrt{-g}R^2_{\mu\nu} &= \frac12h_\gamma^\gamma R_{\mu\nu}^{(1)}R^{(1) \mu\nu} - 2h^{\alpha\beta}R_{\mu\alpha}^{(1)}R^{(1) \mu}_\beta+ 2 R_{\mu\nu}^{(1)}R^{(2) \mu\nu} \\ &=\frac{\kappa^3}8 h_\gamma^\gamma \Big[\partial_\nu\partial_\alpha h_\beta^\beta- \partial_\beta\partial_\alpha h_\nu^\beta- \partial_\beta\partial_\nu h_\alpha^\beta + \partial^2 h_{\nu\alpha}\Big] \Big[\partial^\nu\partial^\alpha h_\rho^\rho- \partial_\rho\partial^\alpha h^{\nu\rho}- \partial_\rho\partial^\nu h^{\alpha\rho} + \partial^2 h^{\nu\alpha}\Big]\\ & -\frac{\kappa^3}2h^{\rho\sigma} \Big[\partial_\mu\partial_\sigma h_\gamma^\gamma- \partial_\gamma\partial_\sigma h_\mu^\gamma- \partial_\gamma\partial_\mu h_\sigma^\gamma + \partial^2 h_{\mu\sigma}\Big] \Big[\partial^\mu\partial_\rho h_\beta^\beta- \partial_\beta\partial_\rho h^{\mu\beta}- \partial_\beta\partial^\mu h_\rho^\beta + \partial^2 h^{\mu}_{\rho}\Big] \\&+\kappa^3 \Big[\partial_\nu\partial_\alpha h_\gamma^\gamma- \partial_\gamma\partial_\alpha h_\nu^\gamma- \partial_\gamma\partial_\nu h_\alpha^\gamma + \partial^2 h_{\nu\alpha}\Big] \Big[ -\frac12\partial^\alpha\left[h^{\beta\lambda}\partial^\nu h_{\lambda\beta}\right] + \frac12\partial_\beta\left[h^{\beta\lambda}(\partial^\nu h_{\lambda}^{\alpha}+\partial^\alpha h^{\nu}_{\lambda} - \partial_\lambda h^{\nu\alpha})\right]\\ &+\frac14\Big[\partial_\beta h^{\nu\lambda} + \partial^\nu h_\beta^\lambda - \partial^\lambda h^{\nu}_{\beta}\Big]\left[\partial_\lambda h^{\beta\alpha} + \partial^\alpha h^{\beta}_\lambda-\partial^\beta h^{\alpha}_\lambda\right] -\frac14\left[\partial^\alpha h^{\nu\lambda} + \partial^{\nu} h^{\alpha\lambda} - \partial^\lambda h^{\alpha\nu}\right]\partial_\lambda h^\beta_\beta\Big]. \end{split}$$ Contracting only on terms which go into the $(3B)^{\rm eff}$ and $(3C)^{\rm eff}$ index structures, and putting ($\kappa = 1$) for simplicity, we have found for the ($R^2$) contribution: $$(R^2)_{(3B)^{\rm eff}} = \partial^2 h^\rho_\rho\Big (-\frac32 \partial_\alpha h^\beta_\mu\partial^\alpha h_\beta^\mu-2h_\beta^\mu \partial^2 h^\beta_\mu\Big),$$ and $$(R^2)_{(3C)^{\rm eff}} = -\partial^\sigma\partial^\rho h_{\sigma\rho}\Big (-\frac32 \partial_\alpha h^\beta_\mu\partial^\alpha h_\beta^\mu-2h_\beta^\mu \partial^2 h^\beta_\mu\Big),$$ For the ($R^2_{\mu\nu}$) contribution we have found: $$(R^2_{\mu\nu})_{(3B)^{\rm eff}} = \frac18h_\gamma^\gamma \partial^2 h_{\nu\alpha}\partial^2 h^{\nu\alpha}-\frac14\partial_\lambda\partial_\beta h_\gamma^\gamma \partial^\beta h^{\nu\alpha}\partial^\lambda h_{\nu\alpha}-\frac12\partial_\lambda\partial_\beta h_\gamma^\gamma h^{\nu\alpha}\partial^\beta\partial^\lambda h_{\nu\alpha} +\frac14 \partial_\lambda h_\gamma^\gamma \partial^2 h_{\nu\alpha} \partial^\lambda h^{\nu\alpha},$$ and $$\begin{split} (R^2_{\mu\nu})_{(3C)^{\rm eff}} &= \frac12\partial_\lambda\partial_\beta h^\lambda_\sigma \partial^\sigma h^{\nu\alpha} \partial^\beta h_{\nu\alpha} +\partial_\lambda\partial_\beta h_\sigma^\lambda h^{\nu\alpha}\partial^\sigma\partial^\beta h_{\nu\alpha} -\frac14\partial^2h_{\lambda\beta}\partial^\lambda h^{\nu\alpha} \partial^\beta h_{\nu\alpha} -\frac12 \partial^2 h_{\lambda\beta} h^{\nu\alpha} \partial^\lambda\partial^\beta h_{\nu\alpha}\\ & -\frac12\partial_\beta h^{\beta\lambda}\partial^2 h_{\nu\alpha} \partial_\lambda h^{\nu\alpha} -\frac12h^{\beta\lambda}\partial^2 h_{\nu\alpha} \partial_\lambda \partial_\beta h^{\nu\alpha}. \end{split}$$ This leads to the following results for the (3B) and (3C) terms: ----------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------- $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.2.ps}}\right)^{\rm $\sim {\rm eff}_{\rm 3B}$ sym}[-P_3\left(\eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[3c_1k_1^2(k_2\cdot k_3)+c_2(\frac12(k_1\cdot k_2)(k_1\cdot k_3)-\frac14k_2^2k_3^2)]\right)$ $-P_6\left(\eta_{\mu\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[2c_1k_1^2k_3^2+c_2(\frac12(k_1\cdot k_3)^2-\frac14k_2^2(k_1\cdot k_3))]\right)],$ $\left(\parbox{1cm}{\includegraphics[height=0.8cm]{fig16.3.ps}}\right)^{\rm $\sim {\rm eff}_{\rm 3C}$ sym}[-P_3\left(k_{1\mu}k_{1\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[3c_1k_2\cdot k_3]\right) -2P_6\left(k_{1\mu}k_{1\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_1 k_3^2]\right) +\frac12P_6\left(k_{1\mu}k_{2\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1\cdot k_3]\right) $ +$P_6\left(k_{1\mu}k_{3\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1\cdot k_3]\right) -\frac12P_3\left(k_{2\mu}k_{3\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1^2]\right) -\frac12P_6\left(k_{3\mu}k_{3\alpha}\eta_{\nu\sigma}\eta_{\beta\gamma}[c_2k_1^2]\right)$ $ -\frac12P_6\left(k_{1\beta}k_{3\nu}\eta_{\mu\sigma}\eta_{\alpha\gamma}[c_2k_2^2]\right) -\frac12P_6\left(k_{3\beta}k_{3\nu}\eta_{\mu\sigma}\eta_{\alpha\gamma}[c_2k_2^2]\right)].$ ----------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------- Using the same procedure, we can find expression for non-leading effective contributions, however this will have no implications for the loop contributions. We have only calculated 3-point effective vertex index structures in this appendix, 4-point index structures are tractable too by the same methods, but the algebra gets much more complicated in this case. Comments on general $n$-point functions {#app2} ======================================= In the large-$D$ limit only certain graphs will give leading contributions to the $n$-point functions. The diagrams favored in the large-$D$ will have a simpler structure than the full $n$-point graphs. Calculations which would be too complicated to do in a full graph limit, might be tractable in the large-$D$ regime. The $n$-point contributions in the large-$D$ limit are possible to employ in approximations of $n$-point functions at any finite dimension, exactly as the $n$-point planar diagrams in gauge theories can be used, [*e.g.*]{}, at ($N=3$), to approximate $n$-point functions. Knowing the full $n$-point limit is hence very useful in the course of practical approximations of generic $n$-point functions at finite ($D$). This appendix will be devoted to the study of what is needed in order calculate $n$-point functions in the large-$D$ limit. In the large-$D$ limit the leading 1-loop $n$-point diagrams will be of the type, as displayed in figure \[n-point\]. ![The leading 1-loop $n$-point diagram, the index structure for the external lines is not decided, they can have the momentum structure, (i.e., as in (3C)), or they can be of the contracted type, (i.e., as in (3B)). External lines can of course also originate from 4-point vertex or a higher vertex index structure such as, e.g., the index structures (4D) or (4E). This possibility will however not affect the arguments in this appendix, so we will leave this as a technical issue to be dealt with in explicit calculations of $n$-point functions.\[n-point\]](fig21.ps){height="1.2cm"} The completely generic $n$-point 1-loop correction will have the diagrammatic expression, as shown in figure \[n-point3\]. ![A diagrammatic expression for the generic $n$-point 1-loop correction.\[n-point3\]](fig22.ps){height="4cm"} More generically the large-$D$, $N$-loop corrections to the $n$-point function will consist of combinations of leading bubble and vertex-loop contributions, such as shown in figure \[larged\]. For the bubble contributions it is seen that all loops are completely separated. Therefore everything is known once the 1-loop contributions are calculated. That is, in order to derive the full $n$-point sole bubble contribution it is seen that if we know all $j$-point tree graphs, as well as all $i$-point 1-loop graphs (where, $i,j \leq n$) are known, the derivation the full bubble contribution is a matter of contractions of diagrams and combinatorics. For the vertex-loop combinations the structure of the contributions are a bit more complicated to analyze. The loops will in this case be connected through the vertices, not via propagators, and the integrals can therefore be joined together by contractions of the their loop momenta. However, this does in fact not matter; we can still do the diagrams if we know all integrals which occurs in the generic 1-loop $n$-point function. The integrals in the vertex-loop diagrams will namely be of completely the same type as the bubble diagram integrals. There will be no shared propagator lines which will combine the denominators of the integrals. The algebraic contractions of indices will however be more complicated to do for vertex-loop diagrams than for sole bubble loop diagrams. Multiple index contractions from products of various integrals will have to be carried out in order to do these types of diagrams. Computer algebraic manipulations can be employed to do the algebra in the diagrams, so we will not focus on that here. The real problem lays in the mathematical problem calculating generic $n$-point integrals. In the Einstein-Hilbert case, where each vertex can add only two powers of momentum, we see that problem of this diagram is about doing integrals such as: $$\begin{split} I_n^{(\mu_1\nu_1\mu_2\nu_2\cdots\mu_n\nu_n)}= \int d^D l \frac{l^{\mu_1}l^{\nu_1}l^{\mu_2}l^{\nu_2}\cdots l^{\mu_n}l^{\nu_n}}{l^2 (l+p_1)^2(l+p_1+p_2)^2\cdots(l+p_1+p_2+\ldots p_n)^2}, \end{split}$$ $$\begin{split} I_n^{(\nu_1\mu_2\nu_2\cdots\mu_n\nu_n)}= \int d^D l \frac{l^{\nu_1}l^{\mu_2}l^{\nu_2}\cdots l^{\mu_n}l^{\nu_n}}{l^2 (l+p_1)^2(l+p_1+p_2)^2\cdots(l+p_1+p_2+\ldots p_n)^2}, \end{split}$$ $$\vdots$$ $$\begin{split} I_n= \int d^D l \frac{1}{l^2 (l+p_1)^2(l+p_1+p_2)^2\cdots(l+p_1+p_2+\ldots p_n)^2}, \end{split}$$ Because the graviton is a massless particle such integrals will be rather badly defined. The denominators in the integrals are close to zero, and this makes the integrals divergent. One way to deal with these integrals is to use the following parametrization of the propagator: $$1/q^2 = \int^\infty_0 dx \exp (-x q^2), {\rm for} \ \ \ q^2>0,$$ and define the momentum integral over a complex $(2w)$-dimensional Euclidian space-time. Thus, what is left to do is gaussian integrals in a $(2w)$-dimensional complex space-time. Methods to do such types of integrals are investigated in [@Capper:vb; @Leibbrandt:1975dj; @Capper:pv; @Capper:dp]. The results for: ($I_2$), ($I_2^{(\mu)}$), ($I_2^{(\mu\nu)}$) and ($I_3$) are in fact explicitly stated there. It is outside our scope to actually delve into technicalities about explicit mathematical manipulations of integrals, but it should be clear that mathematical methods to deal with the 1-loop $n$-point integral types exist and that this could an working area for further research. Effective field theory will add more derivatives to the loops, thus the nominator will carry additional momentum contributions. Additional integrals will hence have to be carried out in order to do explicit diagrams in an effective field theory framework. [99]{} G. ’t Hooft and M. J. Veltman, Annales Poincare Phys. Theor. A [**20**]{} (1974) 69. M. H. Goroff and A. Sagnotti, Nucl. Phys. B [**266**]{} (1986) 709; A. E. van de Ven, Nucl. Phys. B [**378**]{} (1992) 309. S. Deser and P. van Nieuwenhuizen, Phys. Rev. D [**10**]{} (1974) 401; S. Deser and P. van Nieuwenhuizen, Phys. Rev. D [**10**]{} (1974) 411; S. Deser, H. S. Tsao and P. van Nieuwenhuizen, Phys. Rev. D [**10**]{} (1974) 3337. S. Weinberg, PhysicaA [**96**]{} (1979) 327. J. F. Donoghue, Phys. Rev. D [**50**]{} (1994) 3874 \[arXiv:gr-qc/9405057\]. N. E. J. Bjerrum-Bohr, J. F. Donoghue and B. R. Holstein, Phys. Rev. D [**68**]{}, 084005 (2003) \[arXiv:hep-th/0211071\]. N. E. J. Bjerrum-Bohr, J. F. Donoghue and B. R. Holstein, Phys. Rev. D [**67**]{}, 084033 (2003) \[arXiv:hep-th/0211072\]. J. F. Donoghue, B. R. Holstein, B. Garbrecht and T. Konstandin, Phys. Lett. B [**529**]{}, 132 (2002) \[arXiv:hep-th/0112237\]. N. E. J. Bjerrum-Bohr, Phys. Rev. D [**66**]{} (2002) 084023 \[arXiv:hep-th/0206236\]. K. S. Stelle, Gen. Rel. Grav.  [**9**]{} (1978) 353. J. Z. Simon, Phys. Rev. D [**41**]{} (1990) 3720. A. Strominger, Phys. Rev. D [**24**]{}, 3082 (1981). G. ’t Hooft, Nucl. Phys. B [**72**]{}, 461 (1974). S. Sannan, Phys. Rev. D [**34**]{}, 1749 (1986). D. M. Capper, G. Leibbrandt and M. Ramon Medrano, Phys. Rev. D [**8**]{} (1973) 4320. N. E. J. Bjerrum-Bohr, J. Math. Phys.  [**41**]{} (2000) 2515 \[arXiv:quant-ph/0302107\]. H. Kawai, D. C. Lewellen and S. H. Tye, Nucl. Phys. B [**269**]{} (1986) 1. Z. Bern and A. K. Grant, Phys. Lett. B [**457**]{} (1999) 23 \[arXiv:hep-th/9904026\]. Z. Bern, Living Rev. Rel.  [**5**]{}, 5 (2002) \[arXiv:gr-qc/0206071\]. N. E. J. Bjerrum-Bohr, Phys. Lett. B [**560**]{}, 98 (2003) \[arXiv:hep-th/0302131\]. N. E. J. Bjerrum Bohr, Nucl. Phys. B [**673**]{}, 41 (2003) \[arXiv:hep-th/0305062\]. S. Deser and D. Seminara, Phys. Rev. Lett.  [**82**]{}, 2435 (1999) \[arXiv:hep-th/9812136\]. S. Deser and D. Seminara, Phys. Rev. D [**62**]{}, 084010 (2000) \[arXiv:hep-th/0002241\]. D. M. Capper and M. R. Medrano, Phys. Rev. D [**9**]{} (1974) 1641. G. Leibbrandt, Rev. Mod. Phys.  [**47**]{}, 849 (1975). D. M. Capper and G. Leibbrandt, J. Math. Phys.  [**15**]{}, 795 (1974). [^1]:
Leopard print Lamborghinis and diabolical Diablos: Inside the fast and furious world of Japan's Yakuza mafia He is a self-professed associate of Japan’s notorious Yakuza who admits that his business interests are somewhat dubious. So Morohoshi-san might have been expected to select the most low-profile vehicle money could buy. Instead, the 'businessman', from K abukicho, Tokyo's 'entertainment district' bought himself a flashing neon Lamborghini Diablo. He is the star of a new mini documentary Underground Hero: Love to Hate Me about the lives of the infamous Yakuza - the so called Japanese mafia - and their associates. This is the modified Lamborghini Diablo driven by Morohoshi-san, from Kabukicho, Tokyo's 'entertainment district' is one of the stars of a new mini documentary about the chosen ride for associates of the infamous Yakuza mafia Given that his business, by his own admission, lies firmly in a 'grey area', this Japanese 'gangster' might have been best advised to pick a car with a low profile. Instead he has chosen a Lamborghini Diablo, modified in a particularly indiscreet neon fashion In the film the businessman is seen driving in a variety of showy modified Lamborghini Tokyo-based videographer, Luke Huxham, came up with the idea for the documentary, produced by Maiham Media , he said, after seeing 'questionable looking people driving around in supercars'. He said: 'You can't really just walk up to these guys and ask them to be in your film. 'You don't walk into Kabukichou after midnight and start trying to film people with tattoos all over their bodies unless you want to have your nose broken. 'You need to know someone that has a good relationship with the people in these underground cultures and ask them to invite you in for as long as you're allowed to stay which is usually not very long.' He struck up a rapport with Lamborghini fanatic Morohoshi-san, and tailed him with a camera as he mixed with Japanese bike gangs the Bosozoku, brightly coloured flashing Lamborghinis and the Yakuza. Tokyo-based videographer, Luke Huxham, came up with the idea for the documentary , he said, after seeing 'questionable looking people driving around in supercars' He said making the documentary was a difficult. 'You don't just Kabukichou after midnight and start trying to film people with tattoos all over their bodies unless you want to have your nose broken' he said The Yakuza is a collective term given to Japan's organised crime syndicates. It is estimated that the Yakuza has over 100,000 members spread across the country in different gangs, but together they make the largest organised crime group in the world. The gangs, along with Osaka street racers and Kanto area Bosozoku (motorcycle and moped gangs in Japan) are well known for their love of modifying their cars to make them appear lower, wider and more impressive looking. It is not known whether Morohoshi-san is truly affiliated with the Yakuza, but he admits his business is in a 'grey area'. Film-maker Mr Huxham adds of his new acquaintance: 'Style is personal, fun is universal. 'That’s what you need to embrace before watching this film. Morohoshi-san is living between the lines, somewhere in that grey section. 'Mixing with the undesirables and modifying his Lamborghini in ways most of us would never dream of doing. His style is unique and questionable but one things for sure, he’s too busy having fun to care what you think. Morohoshi- san's 'style is unique and questionable but he's too busy having fun to care what you think' according to Mr Huxham 'And that’s truly what makes him a cool character.' Just last month police seized a 'glow-in-the-dark' supercar from a London street after its wealthy Qatari owner was stopped for not having a licence or the correct insurance. The £350,000 Lamborghini Aventador - with a paint job that made it look like something out of the sci-fi film Tron - was impounded near Harrod's in Knightsbridge. It is understood its owner is 24-year-old Nasser Al-Thani, a member of Qatar's ruling family. Police stopped the car on Brompton Street and had it towed away after Mr Al-Thani failed to produce a licence or the correct insurance.
Coeliac disease: changing views on gluten-sensitive enteropathy. The continuing flow of scientific development in coeliac disease in the past decade points to the need for the formulation of a new concept of pathophysiology and clinical approach to the coeliac condition. Immunogenetic studies have shown a correlation of the disease to the HLA region on the short arm of chromosome 6; immunological research has led to the concept of a T-cell-driven immunologic response of the small intestine, with the identification of highly sensitive and specific antibodies; and our understanding of the histopathology of coeliac disease has changed dramatically, initiated by the proposition of a spectrum of gluten-sensitive enteropathy by Marsh in 1992. Clinical studies report a significant change in patient characteristics and epidemiology. The incidence of the disease has shifted to a majority of adult coeliacs, and it may present with less severe symptoms of malabsorption. Screening studies suggest an overall prevalence of up to 1 in 200-300. Update on histopathology concentrating on the work of our research group. We specifically describe the work of our group in Arnhem concerning the identification and validation of the spectrum of intestinal histopathology in gluten-sensitive enteropathy, i.e. lymphocytic enteritis (Marsh I lesion), lymphocytic enteritis with crypt hyperplasia (Marsh II lesion), and villous atrophy, subdivided into partial villous atrophy (Marsh IIIA), subtotal villous atrophy (Marsh IIIB) and total villous atrophy (Marsh IIIC). Special attention is given to a subgroup of 'refractory coeliacs', including the identification of (pre-)malignant aberrant T cells in the intestinal mucosa of these patients. New data on immunogenetics, epidemiology, histopathology and patient characteristics point to a significant change of view on coeliac disease.
Energy-minimization bias: compensating for intrinsic influence of energy-minimization mechanisms. Anecdotal and scientific evidence suggest humans tend to undershoot targets in rapid movements. We investigated whether this undershoot bias derives from energy minimization mechanisms. Participants performed 200 trials of two tasks: (1) a simple slider push to a target, and (2) a modified version of (1), designed so overshooting was less energy consuming than undershooting. Results support that the undershoot bias found in (1), as well as the overshoot bias found in (2), results from an energy minimization mechanism. Energy minimization might be inherent to biological systems. Movement biases were un desirable for maximal performance. Nonetheless, participants presented biases despite financial incentives to perform maximally. Participants did, however, appear sensitive to systematic errors produced by the attraction to less energy costly responses. We suggest that the motor system is constrained such that maximal performance trades off with energetic optimality although humans are able to learn and compensate for the energy minimization biases.
Q: Pseudo to SQL? All Records where FirstName & LastName Is duplicated but City is different? I need to find all records that the FIRSTNAME is a duplicate and the LASTNAME is a duplicate but the city is different for the records where the names are duplicate. So my data looks like this: FirstName LastName CustomerFileLocation City ---------------------------------------------------------------------- Joe Smith c:\file1\File1.txt Dallas Joe Jones c:\File2\File1.txt New York Joe Smith c:\File3\File1.txt New Mexico City Harry Smith c:\File4\File1.txt Boca Raton Joe Smith c:\File3\File1.txt Dallas Michael Smith c:\File1\File1.txt Dallas I want the query to return Joe Smith c:\file1\File1.txt Dallas Joe Smith c:\File3\File1.txt New Mexico City I wrote the following to find the matching FirstName and LastName. But I am not sure how to say "and City doesn't match" SELECT dbo.TblFileCache.FirstName, dbo.TblFileCache.LastName, dbo.TblFileCache.ClaimFilePath, dbo.TblFileCache.Skip FROM dbo.TblFileCache INNER JOIN (SELECT FirstName, LastName, COUNT(*) AS CountOf FROM dbo.TblFileCache AS tblFileCache_1 GROUP BY FirstName, LastName HAVING (COUNT(*) > 1)) AS dt ON dbo.TblFileCache.FirstName = dt.FirstName AND dbo.TblFileCache.LastName = dt.LastName WHERE (dbo.TblFileCache.Skip = 0) ORDER BY dbo.TblFileCache.FirstName, dbo.TblFileCache.LastName A: To get all the rows in your original data where one set of user names has multiple cities, you can use window functions: select t.* from (select t.*, min(city) over (partition by FirstName, LastName) as mincity, max(city) over (partition by FirstName, LastName) as maxcity from dbo.TblFileCache t ) t where mincity <> maxcity; If you want one row per city, you can do an aggregation on top of this: select FirstName, LastName, min(CustomerFileLocation) as CustomerFileLocation, city from (select t.*, min(city) over (partition by FirstName, LastName) as mincity, max(city) over (partition by FirstName, LastName) as maxcity from dbo.TblFileCache t ) t where mincity <> maxcity group by FirstName, LastName, City;
Background {#Sec1} ========== The mixed lineage leukemia (MLL) family of histone lysine methyltransferases consists of several proteins including MLL1-5, SET1a, and SET1b. MLL1 and MLL2 are related to Drosophila Trithorax (Trx), MLL3 and MLL4 related to Drosophila Trithorax related (Trr), and SET1A and SET1B are related to dSet1 \[[@CR1]\]. MLL proteins are capable of introducing mono-, di-, and trimethylation of histone H3 at lysine K4. Each methylation state of H3K4 is associated with a distinguished chromatin state, for example, H3K4 monomethylation is majorly located at enhancer elements and H3K4 trimethylation is associated with the promoters of the active genes. Recent work has demonstrated that MLL3/MLL4 function as major H3K4 monomethyltransferases at enhancers \[[@CR2],[@CR3]\]. MLL proteins function as large complexes that include tryptophan-aspartate repeat protein-5 (WDR5), retinoblastoma-binding protein-5 (RBP5), and absent small homeotic-2-like (ASH2L) as core complex members, which are indispensable for the complete methyltransferases activity, plus variable additional factors \[[@CR4]-[@CR7]\]. The MLL3 (KMT2C) protein is 4,911 amino acids long, and it contains 8 plant homeodomain (PHD) and a suppressor of variegation, enhancer of zeste, trithorax (SET) domain which contains the catalytic center. Knockout of MLL3 in mice led to stunted growth, reduced cell proliferation, and lower fertility \[[@CR8]\]. In general, cancer is caused by mutations and epigenetic alterations. These effects overlap when epigenetic factors are mutated, for example, EZH2, DNMT3A, or TET2, which are frequently affected \[[@CR9],[@CR10]\]. MLL3 is considered as tumor suppressor gene because it is often deleted in myeloid leukemia patients \[[@CR11]\], and the targeted inactivation of MLL3 in mice leads to epithelial tumor formation \[[@CR12]\]. Correspondingly, recent studies reported reduced MLL3 expression in many breast tumors \[[@CR13],[@CR14]\], and low expression of MLL3 was correlated with the poor survival rate in the gastric cancer patients as well \[[@CR15]\]. In addition, MLL3 is also recurrently mutated in several cancers including glioblastoma, melanoma, pancreatic, and breast cancers, and overall is one of the most frequently mutated PKMTs in cancers \[[@CR11],[@CR16],[@CR17]\]. Ongoing sequencing studies uncovered a large number of somatic mutations in cancer tissues, but it is difficult to discriminate relevant driver mutations from irrelevant so-called passenger mutations \[[@CR18]\]. One approach in this direction is to study the effect of the mutations and investigate if critical properties of the protein are affected, as done here with three mutations reported to occur in the catalytic SET domain of MLL3. Two of them led to massive changes of the enzymatic properties *in vitro* and in cells - N4848S abolished the catalytic activity and Y4884C changed the product pattern of the enzyme leading to increased generation of H3K4me2 and me3, while the MLL3 wild-type only deposits H3K4 monomethylation. Our data indicate that somatic mutations in the SET domain of MLL3 alter its catalytic properties indicating that the mutations might contribute to carcinogenesis in a distinct mutation-specific manner. Results {#Sec2} ======= Somatic mutations in the SET domain of MLL3 affect its catalytic activity {#Sec3} ------------------------------------------------------------------------- Using the COSMIC database \[[@CR19]\], we searched for missense mutations in the SET domain of MLL3 (4,771 to 4,911) and selected three mutations (S4757C, N4848S, and Y4884C) based on their proximity to the peptide or AdoMet binding sites of the enzyme (Figure [1](#Fig1){ref-type="fig"}). The mutations were found in cancers of the lung (S4757C), endometrium, central nervous system (N4848S), and large intestine (Y4884C). The SET domain of human MLL3 and the respective mutations were cloned, and the proteins expressed and purified with good yield (Additional file [1](#MOESM1){ref-type="media"}: Figure S1A). The methylation activity of the MLL3 variants was tested with and without complex members (WDR5, RBP5, and ASH2L) using recombinant H3 protein as substrate and radioactively labeled AdoMet. The reaction mixture was separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the transfer of radiolabeled methyl groups to the H3 protein was analyzed by autoradiography. The results showed that the S4757C and Y4884C MLL3 variants exhibit methyltransferase activity but N4848S is inactive. Similar to wild-type MLL3, the two active variants (S4757C and Y4884C) showed stronger methyltransferase activity in the presence of the complex members (Figure [2](#Fig2){ref-type="fig"}A). The methylation activity of the S4757C variant was in par with wild-type MLL3, and the activity of Y4884C was fourfold reduced (Figure [2](#Fig2){ref-type="fig"}B). We have analyzed the secondary structure composition of the proteins by circular dichroism spectroscopy indicating that the mutant proteins are correctly folded (Additional file [1](#MOESM1){ref-type="media"}: Figure S1B).Figure 1**Structure of the MLL1-SET domain bound to the H3 peptide and cofactor product S-adenosyl-L-homocysteine (AdoHcy) (pdb code 2W5Y).** Note that an MLL3 structure currently is not available. **(A)** The protein is shown as blue ribbon, and the peptide is shown in orange in the stick model with the target nitrogen atom colored white. The residues corresponding to Asn4848 and Tyr4884 are displayed in red and green, respectively, the corresponding alignment of MLL1 and MLL3 is shown in Additional file [1](#MOESM1){ref-type="media"}: Figure S4. **(B)** Details of the MLL1-SET structure showing that N3906 (corresponding to N4848) is involved in an H-bond to AdoMet (shown in stick model with coloring by atom type). **(C)** Details of the MLL1-SET structures showing the hydrophobic and aromatic pocket of MLL1 surrounding the target nitrogen atom which consists of Y3942 (corresponding to Y4884, shown in green) and Y4800, I4847, and Y4885 (all designations refer to MLL3, residues shown in blue).Figure 2**Activity of MLL3 protein variants.** Recombinant histone H3 protein was methylated with radioactively labeled AdoMet by MLL3-SET wild-type and MLL3-SET mutant proteins either alone or in the presence of complex member proteins. **(A)** Example of an autoradiographic image of the SDS polyacrylamide gel. The methylation signal of H3 is indicated. **(B)** Quantitative analysis of the averages of duplicate experiments. The error bars indicate the standard error of the mean. Substrate specificity of MLL3 variants with peptide substrates {#Sec4} -------------------------------------------------------------- To investigate the substrate specificity and product pattern of the MLL3 protein variants, SPOT peptide arrays were synthesized with H3 tail (1 to 15) peptides, which contain either unmethylated H3K4 or different methylated forms of K4. The K4A variant was used as negative control. Peptide arrays were methylated with the MLL3 protein variants in the presence of complex members using radioactively labeled AdoMet (Figure [3](#Fig3){ref-type="fig"}). Consistent with the results of the protein methylation assay, the N4848S variant was inactive and both Y4884C and S4757C were active. However, we observed a change in the substrate specificity of the Y4884C variant when compared with wild-type MLL3. Wild-type MLL3 prefers the unmethylated H3K4 peptide as a substrate and no methylation signal was detected with the methylated forms of H3K4 and on the H3K4A, indicating that it could only introduce a single methyl group on H3K4, which is in agreement with literature data \[[@CR2],[@CR3]\]. Strikingly, Y4884C preferred the H3K4me1 peptide substrate and some methylation activity was even observed on the H3K4me2 substrates illustrating that this variant can transfer up to three methyl groups to the target lysine. At the same time, the variant was less active on the unmethylated H3K4 substrate, indicating a pronounced change in enzymatic properties when compared to the wild-type enzyme.Figure 3**Substrate specificity of MLL3 protein variants.** H3 (1 to 15) peptide arrays containing H3K4 at different methylation states and a K4A peptide were methylated with MLL3-SET wild-type and mutant proteins in the presence of complex members using radioactively labeled AdoMet. **(A)** Example of an autoradiographic image of the methylated peptide SPOT arrays, peptides with the corresponding lysine variants are indicated. **(B)** Quantitative analysis of the average methylation signals of two independent experiments. The methylation data were normalized to the H3K4me0 methylation signal obtained with the individual MLL3-SET variants. The error bars indicate the standard error of the mean. To further confirm the change in substrate methylation state preference and product pattern of the Y4884C mutant, unmethylated and monomethylated H3K4 peptides were incubated in solution with MLL3 wild-type and the variants in the presence of unlabeled AdoMet. The samples were collected at the defined time intervals, and the methylation was analyzed by mass spectrometry. Wild-type MLL3 showed fast monomethylation of the H3K4me0 peptide, followed by weak dimethylation after long incubation times (Figure [4](#Fig4){ref-type="fig"}A, upper panel). No methylation was detectable with the H3K4me1 peptide even after the long incubation times (Figure [4](#Fig4){ref-type="fig"}B, upper panel) which suggests that the MLL3 wild-type protein is inactive on the H3K4me1 peptide and it is majorly a H3K4 monomethyltransferase. The weak dimethylation of the H3K4me0 peptide likely is due to a processive methylation of bound peptide after the first methylation cycle. In contrast, the Y4884C variant exhibited only weak activity on the H3K4me0 peptide (Figure [4](#Fig4){ref-type="fig"}A, lower panel). However, this did not result in an accumulation of monomethylated products indicating that they were rapidly converted into the di- and trimethylated state. Strikingly, Y4884C showed strong methylation activity on the H3K4me1 peptide resulting in the generation of dimethylated and later trimethylated products (Figure [4](#Fig4){ref-type="fig"}B, lower panel).Figure 4**Substrate specificity and product pattern of MLL3 protein variants.** H3K4 unmethylated (H3; 1 to 19) and monomethylated H3 (1 to 17) peptides were methylated by MLL3-SET wild-type and MLL3-SET Y4884C mutant protein in the presence of complex members using unlabeled AdoMet. The samples were collected at different time points, and methylation was analyzed by mass spectrometry using the relative areas of the corresponding unmethylated and methylated peaks. **(A)** Matrix-assisted laser desorption/ionization (MALDI) spectra of the methylation of the H3K4me0 peptide with MLL3 wild-type (upper panel) and Y4884C (lower panel). The masses of the corresponding peptides are 2,423.4 Da (H3K4me0), 2,437.4 Da (H3K4me1), 2,451.4 Da (H3K4me2), and 2,465.4 Da (H3K4me3). **(B)** MALDI spectra of the methylation of the H3K4me1 peptide with MLL3 wild-type (upper panel) and Y4884C (lower panel). The masses of the corresponding peptides are 2,181.2 Da (H3K4me1), 2,195.2 Da (H3K4me2), and 2,209.2 Da (H3K4me3). The methylation data were fitted by numerical integration and least squares fit to a non-processive kinetic model. The H3K4me0 data show that MLL3 wild-type has a high preference for H3K4me0 and conversion rate of me1 to higher methylated forms is almost zero (Figure [5](#Fig5){ref-type="fig"} and Additional file [1](#MOESM1){ref-type="media"}: Figure S2). In contrast with the H3K4me0 substrate, the Y4884C mutant showed highest activity on the monomethylated substrate. This conclusion was supported by the methylation of the H3K4me1 substrate which was rapid with the Y4884C variant. The S4757C variant showed similar preferences and activities as the wild-type (data not shown). These results indicate that the Y4884C variant has an altered substrate specificity and product pattern and unlike the other two active variants, Y4884C is a unique H3K4 variant of MLL3 with di- and trimethyltransferase activity.Figure 5**Summary of the analysis of the results of the peptide methylation experiments.** Panels **(A)** and **(B)** show the average rate constants of MLL3-SET wild-type and MLL3-SET Y4884C variant for the methylation of H3K4me0 **(A)** and H3K4me1 **(B)** substrates determined at a peptide concentration of 10 μM. Error bars indicate the standard error of mean of two independent experiments. Data in panel **(A)** were normalized to *k* ~1~ of MLL3-SET, and data in panel **(B)** were normalized to *k* ~2~ of Y4884C. Panel **(C)** shows the *v* ~max~/*K* ~*M*~ values for methylation of the un- (me0), mono- (me1), or dimethylated (me2) peptide substrates by MLL3-SET and Y4884C. These values were determined from methylation kinetics carried using 5, 10, 20, and 40 μM of peptide (Additional file [1](#MOESM1){ref-type="media"}: Figure S5). Next, we determined the rates of peptide methylation of MLL3 and the Y4884C variant using un-, mono-, and dimethylated peptide substrates at variable peptide concentrations of up to 40 μM and fitted the initial rates to the Michaelis-Menten model. While the resulting *K*~*M*~ values were too high to allow a reliable fitting of the individual *K*~*M*~ and *v*~max~ values, the *v*~max~/*K*~*M*~ values, which represent the most valuable parameter to compare enzyme activities, were well defined (Figure [5](#Fig5){ref-type="fig"}C). These experiments confirmed that wild-type MLL3 is more active than Y4884C on the unmethylated peptide substrate, but it has almost no activity on mono- or dimethylated substrates. In contrast, the Y4884C variant prefers the monomethylated substrate and it can also methylate the dimethylated substrate. Substrate specificity of MLL3 variants with protein substrates {#Sec5} -------------------------------------------------------------- Next, we aimed to test the substrate specificity and product pattern of wild-type MLL3 and the Y4884C at the protein level. Recombinant H3 protein was methylated using the same concentrations of MLL3 wild-type and Y4884C variant with and without complex member proteins in the presence of unlabeled AdoMet. The reaction mixtures were separated on SDS-PAGE, and the methylation was detected with an H3K4me3 antibody. The results show a strong trimethylation signal for the Y4884C but only a very faint signal with the MLL3 wild-type in the presence of complex patterns (Figure [6](#Fig6){ref-type="fig"}A). No methylation signal was detected with both the variants in the absence of complex members. This result indicated that the trimethylation activity of the Y4884C variant is strongly increased also with protein substrates. The activity of the S4757C variant was similar to the wild-type in this assay as well (Additional file [1](#MOESM1){ref-type="media"}: Figure S3).Figure 6**Product specificity of MLL3-SET wild-type and Y4884C at protein level. (A)** Methylation of recombinant histone H3 protein by MLL3-SET wild-type and Y4884C alone and in the presence of complex members using unlabeled AdoMet as cofactor. After methylation, the proteins were separated by SDS-PAGE, blotted and the methylation was detected using an H3K4 trimethylated antibody (upper panel). The lower panel shows the Ponceau S-stained image of the blot. The bar diagram shows the average methylation signal from two independent experiments. The error bars indicate the standard error of the mean. **(B)** Global histone H3K4me3 methylation analysis from HEK293 cells. The cells were transfected with different MLL3 variant plasmids, histones were isolated, and H3K4me3 methylation was probed by Western blot. The upper image shows the H3K4me3 signal and a Ponceau S stain as loading control. The bar diagram shows the quantification from three experiments. The error bars display the standard error of the mean. The signal obtained from the MLL3 was set to 1, and the other signals were normalized accordingly. To study the effect of the MLL3 variants on global H3K4 trimethylation levels in cells, we transiently expressed the MLL3 wild-type SET domain and each of the variants in HEK293 cells. Histone proteins were purified from these cells, and global H3K4me3 levels were determined with the H3K4me3 antibody. As shown in Figure [6](#Fig6){ref-type="fig"}B, the expression of the Y4884C mutant protein resulted in a considerable increase of cellular H3K4me3 levels when compared with the histone proteins isolated from the cells transfected with the other MLL3-SET variants, which is in agreement with the *in vitro* result that Y4884C has a trimethylation activity. Although H3K4me3 levels from the cells expressing the other variants (MLL3 wild-type, S4757C, N4848S) were little higher than those of untransfected cells, these differences were not significant. We conclude that the Y4884C somatic cancer mutant of MLL3 exhibits different enzymatic properties than the wild-type protein and it functions as H3K4 trimethyltransferase both *in vitro* and in cells. Discussion {#Sec6} ========== It has recently been reported that the somatic mutations in the SET domain of PKMTs, for example, in EZH2 and NSD2, lead to carcinogenesis by altering the global chromatin methylation levels (review \[[@CR17]\]). We show here that the N4848S and Y4884C somatic mutations of MLL3 have remarkable and specific effects on the catalytic properties of the enzyme, because the N4848S exchange renders MLL3 inactive and the Y4884C exchange converts MLL3 from a monomethyltransferase to a di- and trimethyltransferase. These pronounced changes of the catalytic properties of both variants strongly suggest that the mutations have a direct role in carcinogenesis. The lack of effects of the S4757C exchange does not exclude that other properties not covered by our assay may be altered. Alternatively, it may indicate that this is a passenger mutation, which has no role in carcinogenesis. The loss of methyltransferase activity due to the N4848S mutation is not surprising from a structural point of view, as this residue is located in a catalytically important NHXC motif which is highly conserved in PKMTs \[[@CR20],[@CR21]\]. N4848 in MLL3 is directly located in the AdoMet binding pocket of MLL3 (Figure [1](#Fig1){ref-type="fig"}) and the exchange of asparagine to serine affects a hydrogen bond between the cofactor and the protein, which could explain the loss of activity. This result is in agreement with a tumor suppressor role of MLL3, because many cancers were reported to have either reduced expression of MLL3 or inactive truncated proteins due to frame shift mutations. The change in substrate preferences and product pattern of the Y4884C mutant can be explained as well, because Y4884 is part of an aromatic active site pocket of MLL3 (Figure [1](#Fig1){ref-type="fig"}) and mutations of the aromatic pocket residues have been shown to alter the product pattern of PKMTs \[[@CR20],[@CR22]\]. The MLL3 Y4884C mutant resembles in its properties the enhancer of zeste homolog 2 (EZH2) mutations at Y641, which is the most frequently mutated residue in this enzyme \[[@CR23]\]. EZH2-Y641 mutated proteins show different substrate preference and higher H3K27 trimethylation activity than the EZH2 wild-type both *in vitro* and in the tumor cell lines \[[@CR24]-[@CR26]\]. By this, they strongly influence the expression of polycomb repressive complex 2 (PRC2) target genes \[[@CR27]\], and EZH2 inhibitors have been successfully used in tumors with these mutations \[[@CR27],[@CR28]\]. The MLL3 Y4884C variant could lead to similar changes of the global chromatin regulation. Conclusions {#Sec7} =========== We report here the effect of somatic mutations in the catalytic domain of MLL3. Our data show that mutations in the SET domain of MLL3 may lead to tumorigenesis through two converse mechanisms. The N4848S mutation leads to a loss of the catalytic activity of MLL3, which resembles the effect of other loss of function mutations in MLL3, like frame shifts or loss of expression. Such mutations may lead to the loss of H3K4 methylation at target genes and inhibit the expression of tumor suppressor genes. The Y4884C mutation leads to a change in the substrate specificity and product pattern of MLL3. This may result in the deposition of aberrant H3K4 trimethylation at enhancers leading to their conversion to promoters and the expression of oncogenes similarly as observed after knockdown of the Kdm5c H3K4me3 demethylase \[[@CR29]\]. Hence, MLL3 inhibitors are promising therapeutic options for cancers containing Y4884C mutations, but they might even be harmful in cancers with N4848S mutations. These data illustrate that individual cancer mutations even in one protein need to be functionally studied in order to develop and apply individual treatments. Methods {#Sec8} ======= Cloning, expression, and purification of proteins and protein variants {#Sec9} ---------------------------------------------------------------------- MLL3-SET domain (4,734 to 4,911, Uniprot identifier-Q8NEZ4-1) was amplified from the cDNA prepared from HEK293 cells and cloned into pGEX-6p2 vector as GST fusion protein. For mammalian expression, coding sequence of MLL3-SET domain was similarly amplified and cloned into pEYFP-C1 vector (Clontech, Palo Alto, CA, USA). The corresponding mutations in the MLL3-SET domain were generated using megaprimer PCR protocol. For expression, *Escherichia coli* BL21-DE3 codon plus (Novagen, Madison, WI, USA) carrying the corresponding plasmid were grown at 37°C until they reached 0.6 to 0.8 OD~600~. Cells were then shifted to 20°C for 10 min and induced overnight with IPTG (1 mM). The cells were harvested by centrifugation (5,000 *g*). Protein purification was conducted as described before \[[@CR30]\]. For eukaryotic expression, the MLL3-SET domain and corresponding mutant plasmids were transfected in HEK293 cells using FuGENE HD (Promega, Madison, WI, USA). The cells were harvested 3 days after transfection. Histones were isolated by the acid extraction method as described previously \[[@CR31]\]. The WDR5, RBP5, and ASH2L proteins were expressed and purified as described \[[@CR32]\]. Peptide methylation assays {#Sec10} -------------------------- Peptide arrays on cellulose membranes were synthesized using SPOT method and methylated as described \[[@CR33]\]. Peptides used for the in solution experiments were commercially purchased from Intavis AG (Köln, Germany). Peptide arrays were washed for 5 min in the methylation buffer (50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 5 mM MgCl~2~, and 3 mM DTT). The arrays were then incubated for 60 min at room temperature in methylation buffer containing 50 nM MLL3-SET variants and 0.76 μM radioactively labeled AdoMet (PerkinElmer, Waltham, MA, USA) and treated as described previously \[[@CR30],[@CR34]\]. In solution peptide, methylation was performed by incubating the respective peptide in the methylation buffer (50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 5 mM MgCl~2~, and 3 mM DTT) supplemented with 50 nM of MLL3-SET variant protein and unlabeled AdoMet (1 mM). If not otherwise indicated, 10 μM peptide was used. The reaction was carried out at 25°C temperature. Samples were collected from the reaction tube at indicated time points, and the reactions were stopped by diluting 1 μl of the reaction mixture 9 μl 0.1% TFA, and the methylation level of the peptides were analyzed by mass spectrometry as described \[[@CR35]\]. Histone protein methylation assays {#Sec11} ---------------------------------- The H3 protein was incubated with MLL3-SET in methylation buffer in the presence of either radioactively labeled or unlabeled AdoMet for 3 h at 25°C. The reactions were stopped by heating the samples in the SDS loading buffer at 95°C for 5 min. Then, the proteins were separated on a 16% SDS-PAGE. The methylation signal was detected by autoradiography in the samples methylated with radioactive AdoMet cofactor. For the samples methylated with the unlabeled AdoMet, the methylation signal was detected by Western blot with a modification-specific antibody (Active motif, Cat. \# 39159, Lot. \# 15808002, which binds to H3K4me3 with very good specificity \[[@CR36]\]). Circular dichroism analysis {#Sec12} --------------------------- Circular dichroism (CD) measurements were performed using a J-815 circular dichroism spectrophotometer (JASCO Corporation, Tokyo, Japan). MLL3-SET wild-type or the mutant variant proteins (20 μM) were diluted in a buffer containing 10 mM Tris pH 7.5 and 200 mM KCl, and the spectra were collected at room temperature using a 0.1-mm cuvette in a wavelength range between 195 and 240 nm. For each sample, at least 60 scans were collected and averaged. The spectra of mutant proteins were scaled to the wild-type protein to normalize concentration differences and allow better comparison. Additional file {#Sec13} =============== Additional file 1: Figure S1.Protein expression and quality. **Figure S2**. Fit of the methylation data shown in Figure [4](#Fig4){ref-type="fig"} to a stepwise methylation model of the corresponding substrate peptide. **Figure S3**. *In vitro* methylation of recombinant H3 protein by MLL3-SET wild-type and S4757C. **Figure S4**. Alignment of the amino acid sequences of MLL1 and MLL3. Figure S5. Rate *vs.* c (peptide) plots obtained from the peptide methylation experiments. **Competing interests** The authors declare that they have no competing interests. **Authors' contributions** SW, SK, IK, and AJ devised the study and planed the experiments. SW, SK, and IK performed all the experiments. SW, SK, and AJ analyzed the data and interpreted the results. SW, SK, and AJ prepared the manuscript. All authors read and approved the final manuscript. This study was partially supported by the DFG (JE 252/7). We gratefully acknowledge provision of expression construct for WDR5, RBP5, and ASH2L by J.-F. Couture (Ottawa, Canada).
Felix Jones (rugby union) Felix Jones (born 5 August 1987) is an Irish former rugby union player and current coach. He played primarily as a fullback, but could also play on the wing. In October 2015, Jones was forced to retire from all rugby due to a neck injury. He moved into coaching after retiring from playing, and is currently a European-based coaching consultant with the South African national team, whose head coach and director of rugby are Jones' former Munster coaching colleagues Jacques Nienaber and Rassie Erasmus respectively. Education and early career Jones played mini-rugby for Seapoint and continued to play for the club right up to the take-off of his professional career. He was a member of Seapoint's All Ireland Junior Cup win in 2007. He attended St. Andrew's College in Dublin, where he played for the schools Junior and Senior Cup teams. Professional career Leinster Jones played for Leinster in the Under-19 team (2 caps), the Under-20 team (4 caps) and the Leinster A team (13 caps) before making his Leinster first XV debut against Connacht in February 2008. Munster He made his Munster debut against Glasgow Warriors in September 2009 and played 6 games before injuring his neck against Connacht in December 2009. Jones made his comeback against Aironi in September 2010, and played 3 games before injuring his knee against Ospreys in the same month. He was out until March 2011. He made his European debut for Munster against Brive in April 2011. Jones was part of the Munster team that won the 2010–11 Magners League. Jones made his comeback from the injury that ruled him out of the 2011 Rugby World Cup on 10 February 2012, playing 80 minutes for Shannon in their AIL game against Young Munster. He made his comeback for Munster in a Pro12 fixture against Treviso on 18 February 2012. Jones made his Heineken Cup debut in the quarter-final against Ulster on 8 April 2012. He missed Munster's league play-off semi-final against Ospreys on 11 May 2012 when he picked up a shoulder injury in training. The shoulder injury ruled him out for at least 4 months, as it required surgery. Jones returned from the injury on 13 October 2012, playing a full 80 minutes for Munster A. He then came off the bench in Munster's second round Heineken Cup tie against Edinburgh on 21 October 2012. Jones underwent successful knee surgery in late January 2013, and is expected to be back in action for Munster by March 2013. He signed a two-year contract extension with Munster in February 2013. Jones captained Munster in their 21–10 win against Treviso on 12 September 2014. Ireland An injury to Luke Fitzgerald gave Jones a call-up to the Ireland Under-20 team which went on to achieve a Grand Slam in the 2007 Six Nations Under 20s Championship, with Jones scoring two tries in the opening fixture against Wales. In total, Jones earnt 5 caps for the Ireland Under-20 team. He has represented Ireland A three times and was a member of the squad which won the Churchill Cup in 2009. Jones was selected in Ireland's squad for the 2011 Rugby World Cup warm-ups in August. He earned his first cap as a substitute in the game against Scotland on 6 August 2011. His second cap came against France on 13 August 2011, again as a substitute. His first start for Ireland came against France on 20 August. However, an ankle ligament injury sustained in an awkward fall against France dashed Jones's hopes of playing at the 2011 Rugby World Cup in New Zealand, as the injury ruled him out for the duration of the tournament. Jones was named in the Ireland squad for the 2013 Ireland tour to North America on 19 May 2013. He came off the bench against the USA on 8 June 2013. Jones started in Ireland's 14–40 victory against Canada on 15 June 2013. He was called up as injury-cover to Ireland's squad for the 2013 Guinness Series on 19 November 2013. Jones started for Ireland Wolfhounds in their friendly against England Saxons on 25 January 2014. On 27 January 2014, Jones was named in Ireland's 34-man squad for the opening two fixtures of the 2014 Six Nations Championship. Jones was named in the Ireland squad for their 2014 Tour to Argentina on 19 May 2014. He started the first test against Argentina on 7 June 2014. He was named in the Ireland squad for the 2014 Guinness Series on 21 October 2014. Jones came off the bench during the 29–15 win against South Africa on 8 November 2014. He started against Georgia on 16 November 2014, scoring two tries in the 49–7 win. Jones came on in the 26–23 win against Australia on 22 November 2014. Jones captained Ireland Wolfhounds in their game against England Saxons on 30 January 2015. He was named in the Ireland squad for the opening rounds of the 2015 Six Nations Championship on 1 February 2015. He came off the bench against Italy on 7 February 2015. Jones came off the bench in the 19–9 win against England on 1 March 2015. England's failure to score enough points against France meant Ireland won the 2015 Six Nations Championship, the first time Ireland have won back-to-back championships since 1948–49. Jones was nominated for the IRUPA Medal For Excellence 2015 in April 2015. Jones was named in the 45-man training squad for the 2015 Rugby World Cup on 24 June 2015. He started in the first World Cup warm-up against Wales on 8 August 2015, scoring a try in the 21-35 win for Ireland. Jones came off the bench in the warm-up game against Wales on 29 August 2015. Coaching Jones joined the Munster coaching team ahead of the 2016–17 season as a technical coach. After helping Munster reach the semi finals of the 2016–17 European Rugby Champions Cup and the 2017 Pro12 Grand Final, he signed a two-year contract extension with the province which saw his role expand to backs and attack coach. As well as coaching with Munster, Jones also assisted Ireland head coach Joe Schmidt with the national teams tour of Japan in June 2017. He left Munster's coaching staff in June 2019. Ahead of the 2019 Rugby World Cup, Jones joined the South African national team as a defence consultant. South Africa's head coach is Rassie Erasmus, who was director of rugby at Munster when Jones began his coaching career with the province. Honors Munster Pro14: Winner (1): 2010–11 Ireland Six Nations Championship: Winner (1): 2015 South Africa Rugby World Cup: Winner (1): 2019 References External links Leinster Profile Munster Profile Pro14 Profile Ireland Profile Category:1987 births Category:Living people Category:People educated at St. Andrew's College, Dublin Category:Rugby union players from County Dublin Category:Irish rugby union players Category:Leinster Rugby players Category:Munster Rugby players Category:Shannon RFC players Category:Irish rugby union coaches Category:Munster Rugby non-playing staff Category:Ireland Wolfhounds international rugby union players Category:Ireland international rugby union players Category:Ireland international rugby sevens players Category:Rugby union fullbacks Category:Rugby union wings
Distal clavicle fractures represent 20% of all clavicle fractures.[@bib1] Neer classified these fractures based on the location of the fracture line relative to the coracoclavicular (CC) ligaments and acromioclavicular (AC) joint.[@bib2] Neer type I and type III fractures are stable fractures that are generally treated nonoperatively.[@bib3] Neer type II and V fractures are unstable, and treatment remains controversial.[@bib3], [@bib4] Various treatment options have been described, including open reduction and internal fixation with hook plate fixation, tension band wiring, screw fixation, and distal locking plates. Many of these techniques are associated with a high perioperative complication rate. Most of these complications are related to painful or prominent hardware, resulting in reoperation rates as high as 43%.[@bib5] We describe a novel surgical technique that allows indirect fixation of distal clavicle fractures and reconstruction of the CC ligaments without the use of prominent hardware. Our early clinical results have resulted in excellent union rates and functional outcomes while minimizing hardware-related complications. Patient Positioning {#sec1} =================== After the administration of a regional interscalene block and the induction of general anesthesia, the patient is positioned in a modified beach-chair position with the head of the bed elevated to 60° to 70°. The index extremity is prepped and draped under sterile conditions, with the arm resting free across the body. Surgical Exposure {#sec2} ================= The surgical technique using a cadaveric model is shown in [Video 1](#appsec1){ref-type="sec"}. A 4-cm incision is made perpendicular to the long axis of the clavicle approximately 2 to 3 cm medial to the acromioclavicular (AC) joint. The deltotrapezial fascia is carefully incised in line with the clavicle to facilitate later closure over the implants ([Fig 1](#fig1){ref-type="fig"}). The fracture hematoma is thoroughly evacuated, and all interposed soft tissue and periosteum are removed. The medial and lateral soft tissues adjacent to the coracoid are bluntly dissected to facilitate later passage of the sutures and graft around the coracoid.Fig 1Patient positioned in modified beach chair position. A 4-cm incision is made perpendicular to the long axis of the right clavicle approximately 2 cm medial to the acromioclavicular (AC) joint. The deltotrapezial fascia is carefully incised in line with the clavicle, exposing the fracture site. The soft tissues medial and lateral to the coracoid should be bluntly dissected to allow for uncomplicated passage of graft and sutures. The asterisk indicates the coracoid, and the arrow illustrates the lateral part of distal clavicle fracture. (I, inferior; L, lateral; M, medial; S, superior.) Graft Preparation {#sec3} ================= Depending on surgeon preference, a semitendinosus autograft or allograft may be used for this procedure. We prefer to use a 7 × 240-mm semitendinosus allograft. The graft doubled over should be approximately 100 to 120 mm, depending on the size of the patient. The ends of the graft are tapered and whip-stitched using a no. 2 nonabsorbable suture. The graft is tapered so that both ends will pass easily through a 6-mm tunnel. The sutures should extend at least 40 mm from the end of the graft, which allows the interference screw to obtain purchase on the sutured portion of the graft during final fixation. Suture Passage Around Coracoid {#sec4} ============================== A coracoid passer is then placed around the coracoid in either medial to lateral or lateral to medial direction, and a strong passing suture (FiberStick; Arthrex, Naples, FL) is shuttled through the instrument and passed under the coracoid ([Fig 2](#fig2){ref-type="fig"}). We prefer to use a flexible obturator (Arthrex) to clear any soft tissue around the coracoid; however, this step may be substituted with careful blunt dissection around the coracoid. Two different-colored suture tapes (FiberTape; Arthrex) and a passing suture are then shuttled around the coracoid using the obturator as a shuttle. The shuttle suture is used to pass the prepped allograft around the coracoid. At this point, both the sutures and the graft should be around the coracoid process.Fig 2A coracoid passer is then placed around the coracoid in an either medial to lateral direction (as seen in the photograph) or a lateral to medial direction, and a strong passing suture is shuttled through the instrument and passed under the coracoid (asterisk). The white arrow identifies the fracture. The patient is positioned in a modified beach-chair position, with the surgical side on the right. (L, lateral; M, medial.) Clavicle Preparation {#sec5} ==================== Attention is then turned to preparing the clavicle. A 2.4-mm drill is used to create the first drill hole for the FiberTapes. This drill hole is located on the medial fracture fragment, as close to the fracture site as possible, while still preserving 5 mm of bone laterally to prevent iatrogenic fracture through this drill hole. A second tunnel for the graft is created with a 6.0-mm cannulated reamer that is placed over a 2.4-mm guidewire. This tunnel is placed in the center of the clavicle and at least 15 mm medial to the first tunnel to ensure an adequate bone bridge. The superior cortical edges should be rasped to remove any sharp edges from the entrance of the tunnel. A passing suture is placed in the 2.4-mm tunnel and the FiberTape sutures are shuttled through the tunnel. It is important to pass the FiberTape sutures prior to passing the graft, so that the sutures lie posterior to the graft. Both ends of the graft are then passed through the 6.0-mm tunnel using a shuttle suture ([Fig 3](#fig3){ref-type="fig"}).Fig 3The construct just before final fixation. Two sutures and a semitendinosus allograft are passed around the inferior aspect of the coracoid. The sutures are passed through a 2.4-mm drill hole in the clavicle while both ends of the graft are passed through a 6-mm tunnel in the clavicle. The patient is positioned in a modified beach-chair position, with the surgical side on the right. The large arrow shows the medial clavicle fracture fragment, and the small arrow, the graft, which is passed around the coracoid and through the medial drill tunnel in the clavicle. (L, lateral; M, medial.) Fracture Reduction Using Sutures and Cortical Button {#sec6} ==================================================== Attention is now turned to reducing and fixing the fracture. The 4 limbs of the FiberTape sutures are passed through a cortical button (Dog Bone Button; Arthrex). We prefer the orientation seen in [Figure 4](#fig4){ref-type="fig"} as it matches the normal contour of the clavicle and provides the most effective compression. The sutures should then be tied down over the cortical button, reducing the medial fragment to the lateral fragment. An assistant may be needed to assist in maintaining the reduction while the sutures are tied.Fig 4The 4 limbs of FiberTape sutures are passed through a cortical button (Dog Bone Button, Arthrex) (arrow) and then tied over the button, reducing the medial fragment (asterisk) to the lateral fragment. The graft is then tensioned and spread while the surgeon inserts the interference screw, fixating the graft within the 6-mm tunnel. The patient is positioned in a modified beach-chair position, with the surgical side on the right. (I, inferior; L, lateral; M, medial; S, superior.) An assistant then tensions and spreads the graft while the surgeon inserts the interference screw fixing the graft within the 6-mm tunnel. We typically use a 5.5 × 10-mm PEEK interference screw (Arthrex). After the graft is fixed within the tunnel, the free ends of the graft are amputated ([Fig 5](#fig5){ref-type="fig"}). A free needle is then used to pass the free ends of the FiberTape sutures through the anterior deltotrapezial fascia in a horizontal mattress fashion. These sutures are then tied, repairing the deltotrapezial fascia to the clavicle and burying the knot stacks to minimize the risk of soft tissue irritation. The incision is closed in a standard fashion.Fig 5This image shows the final construct in a right clavicle, with a cortical button laterally (white arrow) and an interference screw medially (black arrow). The deltotrapezial fascia has been repaired to the clavicle (white asterisk) using the free ends of the FiberTape sutures, in turn burying the knot stacks to minimize hardware-related complications. The patient is positioned in a modified beach-chair position. (I, inferior; L, lateral; M, medial; S, superior.) Rehabilitation {#sec7} ============== Postoperatively, the patient is placed into a sling to minimize the tension on the repair for 4 to 6 weeks. Supine passive range of motion of the shoulder is initiated immediately postoperatively. At 4 to 6 weeks, the patient may begin active and active assisted range of motion exercises. Strengthening may begin at 8 weeks. Full return to activity and sport begins around 4 months. Discussion {#sec8} ========== Nonoperative treatment of unstable distal clavicle fractures has led to poor outcomes, with nonunion rates approaching 50%.[@bib3] Although many operative techniques have been described to address these unstable fractures, currently no gold standard exists. Techniques include locked and nonlocked plates, coracoclavicular screws, tension band wiring, Kirschner wires, and hook plates. Some authors have advocated the addition of suture anchor fixation for coracoclavicular fixation in addition to superior locking plate fixation in these fractures.[@bib6], [@bib7], [@bib8] Rieser et al.[@bib9] compared the use of a distal-third locking plate to acromioclavicular TightRope (Arthrex) and found that a combined construct of locking plate and TightRope was better than either construct alone. Although more robust fixation is necessary to treat the unstable fracture pattern, this has often come with the downside of hardware irritation or pin migration, acromion fracture, or arthrosis of the acromioclavicular joint. On the contrary, lower profile fixation has resulted in failure of fixation and nonunion, often resulting in a second surgical procedure.[@bib10], [@bib11], [@bib12] We have described a surgical technique for fixing displaced distal clavicle fractures using a combination of cortical button fixation and coracoclavicular ligament reconstruction. The cortical button reduces the medial fracture fragment to the lateral fragment and provides stable fixation for fracture healing. The CC ligament reconstruction provides a second point of fixation to stabilize the construct while also re-creating the normal ligamentous attachments between the coracoid and the clavicle. Surgical pearls and pitfalls of this technique are described in [Table 1](#tbl1){ref-type="table"}.Table 1Pearls and PitfallsPearlsPitfallsCarefully incise deltotrapezial fascia in line with the clavicle to facilitate later closure over implantsWithout 40 mm whip-stitched on either end of the allograft, there is a risk of screw injuring the graft on insertionPrepare graft using a minimum of 7 × 240 mm with sutures whip-stitched approximately 40 mm on either end to facilitate interference fixation with screwFailure to provide adequate bony bridge (\>15 mm) between drill holes risks iatrogenic fractureUse of flexible obturator around the coracoid allows for easier passage of sutures and graft and less soft tissue interpositionInadequate tension while tying sutures over cortical button risks malreduction of clavicleThe 2.4-mm drill tunnel for suture tapes should be at least 15 mm from the distal edge of the medial clavicle fragment to prevent iatrogenic fractureShuttle the suture tapes through the clavicle before passing the graft so that they lie posterior to the graftPass free ends of the suture tapes through the anterior deltotrapezial fascia and tie over the top to bury the knots and avoid fascial irritationThe superior cortical edges of the graft tunnel should be rasped to remove any sharp edges to prevent damaging the graft during screw insertion There are several advantages of this technique ([Table 2](#tbl2){ref-type="table"}). The use of low-profile implants avoids the risk of hardware irritation and the need for subsequent surgery. By burying the suture knots below the deltotrapezial fascia, the risk of knot irritation is minimized. The use of TightRope fixation has been described to indirectly restore the coracoclavicular relationship; however, this technique requires drilling through the coracoid, which risks coracoid fracture and loss of reduction.[@bib12], [@bib13], [@bib14] This technique does not require drilling through the coracoid and thus has no risk of coracoid fracture. By indirectly reducing the medial fracture fragment with the FiberTape sutures around the coracoid, there is also no need for obtaining purchase in the lateral fracture fragment, which is often difficult, particularly in comminuted fractures. Lastly, the use of an allograft reconstruction restores the native CC ligaments and provides a biological construct that provides a secondary restraint to superior displacement. Some of the limitations of this technique include its technically demanding nature in addition to the risk of iatrogenic clavicle fracture while drilling tunnels through the clavicle. Overall, this is a successful and reproducible technique for managing distal clavicle fractures and should be considered when managing comminuted distal clavicle fractures.Table 2Advantages and DisadvantagesAdvantagesDisadvantagesFixation technique that is applicable to all distal clavicle fracture patternsTechnically demandingTechnique can be used even in the setting of severe comminution of the lateral fracture fragmentPossible iatrogenic fracture risk when drilling bone tunnels through the clavicleLow-profile hardware minimizes the risk of hardware irritationPotential for neurovascular injury when passing sutures and graft around coracoidIndirect reduction technique provides stability and stable construct without the need for obtaining fixation in the distal fragmentAllograft restores native CC ligaments to restore anatomy and provide stabilityBiomechanical stability stronger than locking plate aloneAvoids complications of coracoid fracture with techniques that provide CC stability using TightRope or screw fixationNo mandatory need for a second surgical procedure to remove hardware like other devices (i.e., hook plate) Supplementary Data {#appsec1} ================== Video 1The patient is positioned in a modified beach chair position with the right upper extremity prepped into the field. An incision is made perpendicular to the long axis of the clavicle. Adequate visualization is then obtained by evacuating the hematoma, and the fracture fragments are identified and cleared of all soft tissue. While a semitendinosus allograft is being prepared on the back table, the soft tissue around the coracoid is bluntly dissected. Two suture tapes (FiberTape) and the allograft are passed around the inferior aspect of the coracoid process. A 2.4-mm drill hole is drilled bicortically \>15 mm from the distal end of the medial clavicle fracture fragment. A second drill tunnel is made 15 mm medial to the prior tunnel with a 6.0-mm cannulated drill seated over a guidewire. The edges are rasped to avoid sharp edges. The FiberTape sutures are shuttled through the 2.4-mm drill tunnel while the graft is passed through the medial tunnel. The sutures should be passed prior to the graft so that they lie posterior to the graft. The 4 limbs of the FiberTape sutures are tied over a cortical button (Dog Bone) while the assistant reduces the medial fracture fragment to the lateral fragment. The graft is then tensioned and spread by an assistant while a 5.5 × 10-mm interference screw is seated into the medial drill tunnel. The free ends of the graft are amputated. The free ends of the FiberTape sutures are then loaded on a free needle and passed through the anterior deltotrapezial fascia to bury the knot. The deltotrapezial fascia is then closed over the implants and the wound is closed in a layered fashion.ICMJE author disclosure forms The authors report the following potential conflicts of interest or sources of funding: G.P.Y. is a paid consultant for Arthrex. Full ICMJE author disclosure forms are available for this article online, as [supplementary material](#appsec1){ref-type="sec"}.
Austerity measures in Greece, imposed following a bailout by the international community, have led to devastating social and health consequences for the country’s population, according to a report in yesterday’s Lancet. Greece’s health crisis: from austerity to denialism, a paper by Cambridge University sociologist Alexander Kentikelenis and colleagues, shows how rising demand for healthcare as a result of the cuts has coincided with a drop in the provision of services, leading to substantial unmet medical need. In 2010 the Greek government agreed to an austerity package overseen by the European Union, the European Central Bank and the International Monetary Fund, known collectively as the Troika. Since then, Greece has had the largest cutbacks to the health sector seen across Europe, as the bailout package capped public expenditure at 6% of GDP. The country’s public spending on health is now less than any of the other pre-2004 EU members. “The data reveals that the Greek welfare state has failed to protect people at the time they needed support the most. A rapidly growing number of Greeks are losing access to healthcare as a result of budget cuts and unemployment,” said Kentikelenis. The authors of the paper acknowledge that Greece’s healthcare system was in need of reorganisation well before its economic plight came to the world’s attention. However, they take the government to task for its denial that the health of the population has been affected as a result of the slashing of budgets. At a time of increasing health need and falling incomes, Greece’s bailout agreement stipulated shifting the cost of healthcare to patients. The Greek government introduced new charges for visits to outpatient clinics and higher costs for medicines. The authors’ analysis of the latest available data from the EU Statistics on Income and Living Conditions revealed a 47% rise in people who felt they did not receive medically necessary healthcare. This increase was linked to a rising inability to afford care and the costs of travel to access health services, according to the authors. Rapidly increasing unemployment since 2009 meant a growing number of people no longer had any form of health cover. “Those without insurance would have been eligible for a basic package of health services after means testing, but the criteria for means testing have not been updated to take account of the new social reality,” said Kentikelenis. “To respond to unmet need, social clinics staffed by volunteer doctors have sprung up in urban centres. Before the crisis such services mostly targeted immigrant populations, but now as many as half the patients are Greek nationals.” The health problems are particularly pronounced among Greece’s most vulnerable groups who include the poor, the unemployed, the elderly, pregnant women and children, and those with mental health problems. The paper describes the situation faced by these groups as a “public health tragedy”. There has been a 120% increase in the use of mental health services at a time of funding cuts of 20% in 2010-2011 and a further 55% in 2011-2012. Suicides and the incidence of major depression have rapidly risen. Austerity measures have also been linked to increased incidence of infectious disease. Following cuts to outreach programmes, including the distribution of syringes and condoms to injection-drug users, in the first year of austerity, a rapid rise of HIV infections was observed: from 15 in 2009 to 484 in 2012. The incidence of tuberculosis among drug users more than doubled in 2013. Kentikelenis and co-authors point to the experiences of other countries – notably, Iceland and Finland – in surviving financial crises. They argue that, by ring-fencing health and social budgets, and concentrating austerity measures elsewhere, governments can offset the harmful effect of crises on the health of their populations. “Although the Greek healthcare system had serious inefficiencies before the crisis, the scale and speed of imposed change have constrained the capacity of the public health system to respond to the needs of the population at a time of heightened demand,” Kentikelenis said. The paper Greece’s health crisis: from austerity to denialism by Alexander Kentikelenis (University of Cambridge), Marina Karanikolos (London School of Hygiene and Tropical Medicine), Aaaron Reeves (University of Oxford), Martin McKee (London School of Hygiene and Tropical Medicine) and David Stuckler (University of Oxford) was published by the Lancet on 21 February 2014. For more information about this story contact Alexandra Buxton, Office of Communications, University of Cambridge, amb206@admin.cam.ac.uk 01223 761673 Inset image: Greeks protest austerity cuts
OK Tito&;I was unable to redeem that particular code again but I redeemed one just like it from last week. Same type of code but different game and this is what I got. Deposit $20 to redeem your winnings. To me&;That is a deposit code because as soon as you hit discard the winnings are gone. The same thing happened this morning with your code. That&’s a wonderful place to successful game and fun. It is great that there is such a blog with lots of such occasions that everyone will find something suitable for themselves. Enjoy the game here!
'Dark Knight' in cruise control Empty "The Dark Knight" proved again over the weekend that it is a major force overseas, finishing with a mighty $34.7 million from 7,754 screens in 62 markets to lift its foreign gross to $382.1 million, more than double the take for any previous Batman entry. The Warner Bros. release maintained its hold on first place and — without serious immediate competition — is expected to stay on top for a few more weeks. With the market slowing down as the summer comes to a close, the big movies of the busy season are making final rounds before getting ready for their DVD release. Universal's musical hit "Mamma Mia!" raised its weekend voice by $12.8 million for a cume of $234.1 million, while the same studio's "The Mummy: Tomb of the Dragon Emperor" reached an offshore gross of $220 million as it registered $12.5 million from 6,000 playdates in 50 countries. Sony's "You Don't Mess With the Zohan," muscling its way into major overseas markets, brought in $10.4 million from 1,985 screens in 30 territories to raise its gross to $56.4 million, while Disney/Pixar's "WALL-E" kept up its pace as a major contender with a weekend take of $8.5 million from 3,193 screens in 29 markets for a gross to date of $162.2 million. Germany brought the Caped Crusader to new heights, welcoming the Warner Bros./DC Comics franchise at No. 1 with $9.9 million (including previews) from 955 screens. It took in a 59% share of the top five films in the territory and exceeded the entire boxoffice take of "Batman Begins" by 17%, Warners said. In second-weekend "Dark Knight" holds, France ranked No. 1 again with $4.7 million nationwide from 820 screens for a market cume of $16.7 million; Spain slipped to No. 2 with $1.9 million for a market total of $11.7 million; and Russia held on to the No. 1 spot with $1.7 million for a market score of $6.6 million. Five weeks in the U.K. has delivered $86.1 million; four in Australia, $40 million; five in Mexico, $24.8 million; four in Brazil, $19.3 million; and three in Korea, $18.6 million. "Mamma Mia!" had another great weekend in the U.K., according to Universal Pictures International, holding at No. 2 in its seventh weekend and taking in $3.4 million from 501 dates for a market tally of $98.6 million. Meanwhile, "The Mummy" has brought in $12.9 million from Japan; $13.6 million from Germany; and $10.1 million from France. The film is scheduled to open in China, Australia, New Zealand and Italy in September. "Zohan" opened at No. 1, Spain ($3.4 million from 334 screens) for the biggest Adam Sandler opening ever in the market. It was 65% better than his previous best, "Click," and knocked "Dark Knight" out of the No. 1 spot, Sony said. "WALL-E," which still has 50% of the international market to go, has taken in $20.2 million from France in four weeks, $12.1 million from Spain in three and $6.9 million from Korea, also in three. This weekend's openings include India and Denmark. Among recent newcomers, Ben Stiller's "Tropic Thunder" burst forth with $5 million from eight markets, opening No. 1 in Australia with $2.7 million from 224 screens. Fox's "Taken" took in $3.1 million from 1,069 screens in four markets for a cume of $10.4 million, and "Mirrors" reflected $1.8 million from 426 screens in 14 territories.
SAN FRANCISCO, California, USA -- Wednesday, January 27, 2010 -- As Steve Jobs and Apple prepared to announce their new tablet device, activists opposed to Digital Restrictions Management (DRM) from the group Defective by Design were on hand to draw the media's attention to the increasing restrictions that Apple is placing on general purpose computers. The group set up "Apple Restriction Zones" along the approaches to the Yerba Buena Center for the Arts in San Francisco, informing journalists of the rights they would have to give up to Apple before proceeding inside. DRM is used by Apple to restrict users' freedom in a variety of ways, including blocking installation of software that comes from anywhere except the official Application Store, and regulating every use of movies downloaded from iTunes. Apple furthermore claims that circumventing these restrictions is a criminal offense, even for purposes that are permitted by copyright law. Organizing the protest, Free Software Foundation (FSF) operations manager John Sullivan said, "Our Defective by Design campaign has a successful history of targeting Apple over its DRM policies. We organized actions and protests targeting iTunes music DRM outside Apple stores, and under the pressure Steve Jobs dropped DRM on music. We're here today to send the same message about the other restrictions Apple is imposing on software, ebooks, and movies. If Jobs and Apple are actually committed to creativity, freedom, and individuality, they should prove it by eliminating the restrictions that make creativity and freedom illegal." The group is asking citizens to sign a petition calling on Steve Jobs to remove DRM from Apple devices. The petition can be found at http://www.defectivebydesign.org/ipad "Attention needs to be paid to the computing infrastructure our society is becoming dependent upon. This past year, we have seen how human rights and democracy protesters can have the technology they use turned against them by the corporations who supply the products and services they rely on. Your computer should be yours to control. By imposing such restrictions on users, Steve Jobs is building a legacy that endangers our freedom for his profits," said FSF executive director Peter Brown. Other critics of DRM have asserted that Apple is not responsible, and it is the publishers insisting on the restrictions. However, on the iPhone and its new tablet, Apple does not provide publishers any way to opt out of the restrictions -- even free software and free culture authors who want to give legal permission for users to share their works. "This is a huge step backward in the history of computing," said FSF's Holmes Wilson, "If the first personal computers required permission from the manufacturer for each new program or new feature, the history of computing would be as dismally totalitarian as the milieu in Apple's famous superbowl ad." About the Free Software Foundation The Free Software Foundation, founded in 1985, is dedicated to promoting computer users' right to use, study, copy, modify, and redistribute computer programs. The FSF promotes the development and use of free (as in freedom) software -- particularly the GNU operating system and its GNU/Linux variants -- and free documentation for free software. The FSF also helps to spread awareness of the ethical and political issues of freedom in the use of software, and its Web sites, located at fsf.org and gnu.org, are an important source of information about GNU/Linux. Donations to support the FSF's work can be made at http://donate.fsf.org. Its headquarters are in Boston, MA, USA. Media Contacts John Sullivan Free Software Foundation +1 (617) 542 5942 campaigns@fsf.org Translations
# # (C) Copyright 2006 # Wolfgang Denk, DENX Software Engineering, wd@denx.de. # # SPDX-License-Identifier: GPL-2.0+ # # # AMCC 440SPe Evaluation (Katmai) board # PLATFORM_CPPFLAGS += -DCONFIG_440=1 ifeq ($(debug),1) PLATFORM_CPPFLAGS += -DDEBUG endif ifeq ($(dbcr),1) PLATFORM_CPPFLAGS += -DCONFIG_SYS_INIT_DBCR=0x8cff0000 endif
Q: how is "Exchange hashpartitioning" working in spark I have a dataset which I want to write sorted into parquet files for getting benefit of requesting these files afterwards over Spark including Predicate Pushdown. Currently I used repartition by column and the number of partitions to move the data to the particular partition. The column is identifying the corresponding partition (beginning from 0 to (fixed) n). The result is that scala/spark is generating an unexpected result and creating less partitions (some of them are empty). Maybe a Hash Collision? For solving the problem I tried to find out the reason and tried to find workarounds. I found one workaround by transforming the dataframe to rdd and use partitionBy with HashPartitioner. Surprising for me: I got the expected results. But converting a dataframe to an RDD is not a solution for me, because it takes too much resources. I have tested this environment on SPARK 2.0 on cloudera CDH 5.9.3 SPARK 2.3.1 on emr-5.17.0 Here is my tests with outputs. Please use Spark-shell to run them scala> import org.apache.spark.HashPartitioner import org.apache.spark.HashPartitioner scala> val mydataindex = Array(0,1, 2, 3,4) mydataindex: Array[Int] = Array(0, 1, 2, 3, 4) scala> val mydata = sc.parallelize(for { | x <- mydataindex | y <- Array(123,456,789) | } yield (x, y), 100) mydata: org.apache.spark.rdd.RDD[(Int, Int)] = ParallelCollectionRDD[0] at parallelize at <console>:27 scala> val rddMyData = mydata.partitionBy(new HashPartitioner(5)) rddMyData: org.apache.spark.rdd.RDD[(Int, Int)] = ShuffledRDD[1] at partitionBy at <console>:26 scala> val rddMyDataPartitions = rddMyData.mapPartitionsWithIndex{ | (index, iterator) => { | val myList = iterator.toList | myList.map(x => x + " -> " + index).iterator | } | } rddMyDataPartitions: org.apache.spark.rdd.RDD[String] = MapPartitionsRDD[2] at mapPartitionsWithIndex at <console>:26 scala> | // this is expected: scala> rddMyDataPartitions.take(100) res1: Array[String] = Array((0,123) -> 0, (0,456) -> 0, (0,789) -> 0, (1,123) -> 1, (1,456) -> 1, (1,789) -> 1, (2,123) -> 2, (2,456) -> 2, (2,789) -> 2, (3,456) -> 3, (3,789) -> 3, (3,123) -> 3, (4,789) -> 4, (4,123) -> 4, (4,456) -> 4) scala> val dfMyData = mydata.toDF() dfMyData: org.apache.spark.sql.DataFrame = [_1: int, _2: int] scala> val dfMyDataRepartitioned = dfMyData.repartition(5,col("_1")) dfMyDataRepartitioned: org.apache.spark.sql.Dataset[org.apache.spark.sql.Row] = [_1: int, _2: int] scala> dfMyDataRepartitioned.explain(false) == Physical Plan == Exchange hashpartitioning(_1#3, 5) +- *(1) SerializeFromObject [assertnotnull(input[0, scala.Tuple2, true])._1 AS _1#3, assertnotnull(input[0, scala.Tuple2, true])._2 AS _2#4] +- Scan ExternalRDDScan[obj#2] scala> val dfMyDataRepartitionedPartition = dfMyDataRepartitioned.withColumn("partition_id", spark_partition_id()).groupBy("partition_id").count() dfMyDataRepartitionedPartition: org.apache.spark.sql.DataFrame = [partition_id: int, count: bigint] scala> // this is unexpected, because 1 partition has more indexes scala> dfMyDataRepartitionedPartition.show() +------------+-----+ |partition_id|count| +------------+-----+ | 1| 6| | 3| 3| | 4| 3| | 2| 3| +------------+-----+ I first throught that HashPartitioner is been used in the method of repartitioning a dataframe, but this doesn't seem to be the case, becaue it is working on RDDs. Could anyone guide me how this "Exchange hashpartitioning" (see explain output above) is working? 2019-01-16 12:20: This is not a duplicate of How does HashPartitioner work? because I am interested in the Hashing Algorithm of repartition by column (+ number partitions) on a Integer column. The general HashPartitioner is working as expected as you can see in the source code. A: There is nothing unexpected here. As explained in How does HashPartitioner work? Spark uses hash(key) modulo number of partitions and non-uniform distribution, especially on small datasets is not unexepected. Difference between Dataset and RDD is expected as well, as both use different hashing functions (ditto). Finally The result is that scala/spark is generating an unexpected result and creating less partitions is not a correct observation. Number of partitions created is exactly the requested scala> dfMyDataRepartitioned.rdd.getNumPartitions res8: Int = 5 but the empty ones won't be visible in the aggregation, because there are no corresponding values.
Back painted glass panels can be made with a metal backing (for magnets), and they wipe clean turning the surface into the ultimate command station! If you or your family have a busy schedule, then you need a command station in your home. You may be thinking, “what is a command station?” A command station is an area in your home for your calendar, to-do lists, shopping lists, and important contact numbers all in one place. It should be somewhere that you will pass by often (kitchens are ideal). Get creative and use different coloured magnets to represent different people in the house, or have them indicate whose turn it is to do certain chores. The possibilities are endless with a home command station, you just need the right resources. Where should you put it? Your placement of your command station depends who it’s for. If it’s a personal organisation tool, then back-painted glass makes a great addition to a home office. If it’s for you and your roommates, the kitchen will ensure it’s noticed every day. If it’s a way to organise your children’s lunches and backpacks, then putting one close to an entranceway will ensure you don’t forget anything. Only you can know what’s best for your home’s chaotic dynamics — what other spaces can you think of to put back-painted glass? Before you set up your back-painted glass, you should think even more about the customisation. At House of Mirrors, we love to be influenced by our customers’ creativity. An example of this could be to separating the glass into different coloured sections to represent different tasks or members of your family. Or perhaps you want a versatile and simplistic area that you can clear when you have company over. The great thing about back-painted glass is that it disappears whenever you want it to. Unlike a whiteboard, this organisational tool can transform into a blank wall with a simple wipe of a cloth.
A new technique of branched stent graft treatment for ruptured thoracoabdominal aortic aneurysms. Endovascular repair of thoracoabdominal aortic aneurysms (TAAAs) using a branched stent graft is a technically challenging procedure. A 64-year-old man with multiple medical problems, including severe renal impairment, is presented with a ruptured type IV TAAA. He underwent emergency repair using an off-the-shelf branched stent graft and carbon dioxide as the exclusive contrast agent.
use v6; use Test; plan 14; =begin pod Tests for lexical classes delcared with 'my class' =end pod # L<S12/Classes> # A few basic tests. eval-lives-ok 'my class A {}', 'my class parses OK'; eval-lives-ok '{ my class B {} }; { my class B {} }', 'declare classes with the same name in two scopes.'; eval-lives-ok '{ my class B {}; B.new; }', 'can instantiate lexical class'; throws-like '{ my class B {}; B.new; }; B.new', X::Undeclared::Symbols, 'scope is correctly restricted'; { my class WeissBier { has $.name; method describe() { 'outstanding flavour' } } my $pint = WeissBier.new(name => 'Erdinger'); ok $pint ~~ WeissBier, 'can smart-match against lexical class'; is $pint.name, 'Erdinger', 'attribute in lexical class works'; is $pint.describe, 'outstanding flavour', 'method call on lexical class works'; is WeissBier.gist, '(WeissBier)', 'lexical type object stringifies correct'; my class LessThanAmazingWeissBier is WeissBier { method describe() { 'tastes like sweetcorn' } } ok LessThanAmazingWeissBier ~~ WeissBier, 'inehritance between lexical classes works'; my $ltapint = LessThanAmazingWeissBier.new(name => 'Baltika 7'); ok $ltapint ~~ LessThanAmazingWeissBier, 'can smart-match class that inherits'; ok $ltapint ~~ WeissBier, 'can smart-match against parent class too'; is $ltapint.describe, 'tastes like sweetcorn', 'can call overridden method'; is $ltapint.name, 'Baltika 7', 'can call inherited method that accesses inherited attribute'; } # https://github.com/Raku/old-issue-tracker/issues/1311 { class Forest { class Frog { method speak { "ribbit ribbit" } }; has Frog $.frog; method new() { my Frog $frog .= new; self.bless(:$frog); }; } is Forest.new.frog.speak, 'ribbit ribbit', 'can construct objects of inner class in outer constructor'; } # vim: expandtab shiftwidth=4
1. Introduction {#section0005} =============== The adenoviruses (Ads) comprise a large family of double-stranded DNA viruses found in amphibians, avians and mammals, which have a nonenveloped icosahedral capsid structure [@bib1], [@bib2], [@bib3], [@bib4]. Ad vectors have been developed for gene therapy purposes with the aim of treating inherited or acquired diseases [@bib5]. However, the high immunogenicity of E1-deleted Ad recombinants excluded their successful use for sustained gene therapy and led to their development as vaccine carriers [@bib6]. Ad vaccines have been shown to induce the highest B- and CD8^+^ T-cell responses in experimental animals, including rodents [@bib7], [@bib8], canines [@bib9], and primates [@bib10], [@bib11], [@bib12] and have been tested in human clinical trials for antigens of HIV-1 [@bib13]. Ad vectors are being evaluated in additional clinical trials using DNA vaccine priming regimens followed by Ad vector booster immunizations [@bib14]. The Ad vectors used for the treatment of many diseases are predominantly derived from human serotype Ad2 (hAd2) and Ad5 (hAd5) although several issues still hamper this gene delivery system. These include the inability to transduce certain target cell populations, an acute Ad mediated toxicity *in vivo*, and most importantly the high prevalence of hAd5 vector neutralizing antibodies (VNAs) within the human population which decrease gene transfer efficiency or blunt vaccine potency. In fact, subgroup C (which includes hAd2 and hAd5) adenoviral infection is endemic in the human population and consequently, the majority of humans seroconvert within the first 5 years of life as the result of natural infections. In the United States, depending on the age of the study population and the sensitivity of the assay, 40--60% of humans carry readily detectable VNAs to hAd5 virus [@bib8]. Seroprevalence rates to hAd5 virus are markedly higher in human populations from developing countries [@bib8]. In animal models, including non-human primates (NHPs), VNAs generated upon pre-exposure to hAd5 virus have been shown previously to strongly impair the B- and T-cell responses to the transgene product of a vaccine based on an E1-deleted Ad of the same serotype [@bib15], [@bib16], [@bib17]. A similar impairment was observed in human volunteers in a clinical trial with a hAd5 vaccine to HIV-1 [@bib18]. In order to overcome these problems, different strategies are being pursued. These include immunosuppression [@bib19], [@bib20], artificial envelopment with lipid bilayers [@bib21], use of different human Ad serotypes [@bib22], [@bib23], retargeting of human vectors by masking the adenoviral fiber knob to ablate binding to the coxsackievirus adenovirus receptor (CAR) [@bib24], targeting specific cell receptor by genetic modification of hAd fiber [@bib25], [@bib26] and vector encapsulation into microparticles [@bib27]. Vectors based on human non-subgroup C adenovirus have been previously reported [@bib22]. Among them, hAd35 has been proposed as an alternative to hAd5 for vaccine delivery because of its low seroprevalence: comparison of hAd5- and hAd35-based vectors in mice and non-human primates showed a lower immunological potency of the latter vector [@bib28], [@bib29]. Similarly, two other vectors based on the rare serotypes hAd24 and hAd34 induced lower CMI than hAd5 in non-human primates [@bib30]. Additionally, use of non-human Ads as vectors to elude hAd immunity has been proposed (reviewed in [@bib31]). Several non-human Ads are naturally non-pathogenic to humans and have been well characterized and unlike human Ads, it is expected that immunity to non-human adenoviruses will not be prevalent in the human population. It has been shown that pre-existing humoral immunity in humans did not cross-neutralize ovine [@bib32], chimpanzee [@bib33], [@bib34], [@bib35], [@bib36], canine [@bib37], [@bib38] or porcine Ads [@bib39]. These strategies are particularly relevant for the use of Ad vectors as cancer vaccines. In fact, one of the major obstacles to achieving a tumor-specific immune response is that of overcoming central and/or peripheral T cell tolerance against TAAs and inducing CTLs that could effectively eradicate disseminated tumor metastases and subsequently maintain a long lasting immunological memory, preventing tumor recurrence [@bib40]. Ad have been shown to be efficacious vaccine vectors able to break immune tolerance to target antigens in human TAA transgenic mice [@bib41], [@bib42], [@bib43], [@bib44] as well as in non-human primates [@bib45]. Increasingly, combinations of Ad vectors with heterologous modalities of immunization, such as *in vivo* electroporation of plasmid DNA (DNA-EP) induce superior immune responses compared to single modality vaccines [@bib41], [@bib45], [@bib46]. In this study, we describe the use of an E1--E3 deleted recombinant Ad vector obtained from a novel Chimpanzee adenovirus type 3 (ChAd3) belonging to subgroup C adenoviruses (Colloca et al., in preparation), for the development of cancer vaccines directed against two model TAAs: carcinoembryonic antigen (CEA) and HER-2/*neu*, recognized as optimal targets for therapeutic intervention. CEA is an oncofetal membrane antigen, member of the immunoglobulin gene superfamily that is expressed in normal gastrointestinal tissue and is overexpressed by a high percentage of human colon, pancreatic, breast, and lung adenocarcinomas [@bib47]. HER-2/*neu* oncoprotein is a tyrosine kinase receptor overexpressed in several human tumors and associated with poor prognosis [@bib48], [@bib49]. Here, we show that ChAd3-based vaccines are able to induce an immune response comparable to hAd5 serotype-based vectors, break tolerance to tumor antigens, overcome Ad5 pre-existing immunity and achieve anti-tumor effects. Our findings may have significant impact on the development of Ad-based cancer vaccines. 2. Materials and methods {#section0010} ======================== 2.1. Chimpanzee adenovirus 3 {#section0015} ---------------------------- Isolation, expansion and cloning of ChAd3 is described elsewhere (Colloca et al., in preparation). Briefly, ChAd3 was isolated from chimpanzee stool specimens and expanded on 293 and A549 cells. ChAd3 belongs to subgroup C Ads and has a viral genome of 37,741 bp, homologous to Ad5 with a E3 region of 4400 bp. ChAd3 has low seroprevalence in human sera (8% and 33% with a titer \>200 for ChAd3 and hAd5, respectively) and a capability of insertion of 9000 bp deleting the region E1--E3 (Colloca et al., in preparation). 2.2. Plasmid constructs and adenovirus vectors {#section0020} ---------------------------------------------- Plasmid pV1J/CEA and hAd5/CEA carry CEA codon optimized cDNA and have been previously described [@bib44]. Generation of hAd5/*neu*.ECD.TM has been described elsewhere [@bib50]. For ChAd3 vectors, shuttle plasmids containing codon optimized human CEA and rat *neu* ECD.TM cDNAs [@bib44], [@bib50] driven by hCMV promoter were generated and the expression cassette was inserted by homologous recombination in ChAd3 backbone, E1--E3 deleted (Colloca et al., in preparation). Briefly, CEA and rat *neu* ECD.TM expression cassettes were excised from polyMRK-CEAopt and polyMRK-rat *neu* ECD.TM with SspI/AscI and were recombined to SnaBI linearized pChAd3-EGFP to replace the EGFP expressing cassette through homology of hCMV and bGH polyA, using BJ5183 *E. coli* cells. The resulting plasmids pChAd3-CEA and pChAd3_rat*neu*ECD.TM were cut with PmeI, to release the adenovirus ITRs and transfected in Per.C6 cells (human retinoblastoma cell line), which provide E1 of hAd5 virus. Viruses were expanded through serial passages on Per.C6 cells, purified by CsCl gradient centrifugation and the viral particle concentration was determined by spectrophotometry. *In vitro* and *in vivo* CEA transgene expression was tested by ELISA (Direct Elisa CEA Kit, DBC-Diagnostics Biochem Canada Inc.). Rat *neu*\_ECD.TM expression was verified by FACS. The amount of transducing particles of hAd5 or ChAd3 preparations were determined by limiting dilution on Per.C6 cells. 2.3. Peptides {#section0025} ------------- Lyophilized peptides were purchased from Bio-Synthesis (Lewisville, TX) and resuspended in DMSO at 40 mg/ml. Pools of CEA peptides of 15 aa overlapping by 11 residues were assembled as previously described [@bib44]. Particularly, in this study we utilized CEA pool D (53 peptides, each at 0.769 mg/ml in DMSO), encompassing the protein from residue 481 to 703. Peptides and pools were stored at −80 °C. 2.4. Mice and immunizations {#section0030} --------------------------- C57BL/6 mice transgenic for human CEA (CEA.Tg, H-2^b^) were kindly provided by Dr Primus (Vanderbilt University). Female BALB/c mice (H-2^d^) transgenic for the transforming *neu*T oncogene (*neuT* ^+^/*neuT* ^−^) under the transcriptional control of the MMTV promoter [@bib51] and transgene negative (*neuT* ^−^/*neuT* ^−^) were bred under specific pathogen-free conditions by Charles River Breeding Laboratories (Calco, Italy) and were kindly provided by Dr G. Forni (University of Torino, Italy). For all experiments, mice were anaesthesized with Isoflurane (Schering Plough, New Augusta, USA) and immunized by injecting the indicated vp of hAd5 or ChAd3 vectors in quadriceps muscle. CEA.Tg mice were vaccinated with DNA by injecting a total amount of 50 μg of pV1J-CEA-LTB plasmid DNA into one quadriceps muscle (50 μg in 50 μl of physiological solution) followed by electroporation (EP) as previously described [@bib44]. At the end of the treatment period and before necropsy, mice were euthanized by compressed CO~2~ gas in cylinder as indicated in the American Veterinary Medical Association (AVMA) Panel on Euthanasia and according to the guidelines described in [@bib52]. The experiments were conducted according to EU Directive EC86/609 on the protection of animals used for experimental and other scientific purposes, which was ratified by Italian Legislation with DL no. 116/92 on 19 February, 1992 2.5. Antibodies detection and titration {#section0035} --------------------------------------- Sera for antibody titration were obtained by retro-orbital bleeding. ELISA assays were performed using highly purified CEA protein or rat*neu*ECD-hFc as previously described [@bib44], [@bib50]. Anti-CEA and anti-rat HER-2/*neu* titers were calculated by plotting serum dilution vs. optical density values and the Michaelis--Menten curve was fitted to the data using Kaleidagraph (v3.5, Synergy Software). 2.6. Cytokine intracellular staining {#section0040} ------------------------------------ The detection of peripheral immune response was measured as previously described [@bib53]. Briefly, PBMCs were resuspended in 0.6 ml RPMI, 10% FCS and incubated at 37 °C for 12--16 h with the pool D of CEA peptides or rat *neu* 15.3 (TYVPANASL, identified in a previous study [@bib43] at 5 μg/ml final concentration of each peptide) and brefeldin A (1 μg/ml; BD Pharmingen). Staphylococcus enterotoxin B (SEB) at 10 μg/ml and DMSO were used as positive and background control. Cells were then washed and stained with surface antibodies. After washing, cells were fixed, permeabilized and incubated with the IFNγ-FITC antibodies (BD Pharmingen), fixed with formaldehyde 1% in PBS and analyzed on a FACS-Calibur flow cytometer, using CellQuest software (Becton Dickinson). 2.7. Pre-immunity to hAd5 and neutralization studies {#section0045} ---------------------------------------------------- Mice received one or two injections of a E1-deleted hAd5 vector (H14, Q-Biogene--Montreal, hereafter referred to as hAd5wt) and 2--4 weeks later neutralizing antibody titer vs. hAd5 was determined as previously described [@bib54]. Briefly, 2 × 10^6^ to 1.5 × 10^7^ viral particles of hAd5 expressing secreted alkaline phosphatase (hAd5-SEAP) were diluted in 100 μl of complete cell medium and added to an equal volume of mouse serum diluted in complete medium. Each serum sample was tested at various dilutions. Samples were pre-incubated for 1 h at 37 °C and then added to 293 cells seeded into 96 wells (3 × 10^4^ cells/well). The inoculum was then removed and cells re-fed with fresh medium. 24 h later, 50 μl of medium was removed and SEAP activity was measured by a chemiluminescent assay (Phospha-Light System™, Applied Biosystems, Bedford, MA) according to manufacturer instructions. The neutralization titer is defined as the dilution of serum giving a 50% reduction of the SEAP activity observed in the positive control with the virus alone. 2.8. Statistics {#section0050} --------------- Student\'s *t*-test or Log-Rank test were performed where indicated. *p* value \< 0.05 were considered significant. 3. Results {#section0055} ========== 3.1. Construction of ChAd3 vectors {#section0060} ---------------------------------- E1--E3 deleted, replication-defective ChAd3 vectors containing codon optimized CEA sequence and rat *neu* ECD.TM cDNAs were constructed by homologous recombination. As shown in [Fig. 1](#fig1){ref-type="fig"} , the transgenes were cloned in a cassette driven by the human CMV promoter (hCMV) and with a bovine growth hormone (bGH) polyadenylation signal at the 3′-end. Vectors were rescued and expanded in Per.C6 cells. The vp/pfu ratio, a parameter that determines the relative infectivity level of different Ad viruses and preparations, was similar to hAd5 preparations (from 20 to 35).Fig. 1Schematic representation of the vectors. CEA and rat *neu* ECD.TM expression cassettes were inserted by homologous recombination in E1--E3 deleted hAd5 and ChAd3 vectors as indicated. 3.2. hAd5 and ChAd3 express similar levels of CEA {#section0065} ------------------------------------------------- To verify the capability of ChAd3 to infect human cells and express the antigen of interest, HeLa cells were infected at different ratio vp:cell with ChAd3-CEA and hAd5-CEA. CEA is a GPI-anchored protein, normally shed in biological fluids and for this reason is easily detectable [@bib55]. Forty-eight hours later, the supernatant of the infected cells was collected and CEA protein was quantified by ELISA. As shown in [Fig. 2](#fig2){ref-type="fig"}A ChAd3-CEA was able to infect cells and protein secretion levels were comparable with those of hAd5-CEA infected cells.Fig. 2ChAd3 and hAd5 show comparable expression of CEA *in vitro* and *in vivo*. (A) HeLa cells were infected at the indicated ratio vp/cell. 48 h later secreted CEA was measured in the supernatant by ELISA. Grey diamonds and white square symbols show average CEA expression mediated by hAd5-CEA and ChAd3-CEA, respectively. (B) CEA.Tg mice were injected i.m. with the indicated amount (vp) of either hAd5 or ChAd3. Three days later, mice were bled and circulating CEA levels were measured by ELISA. Grey dots indicate the geometric mean of the group. We next assessed the infectivity of the vectors and CEA expression *in vivo*. Groups of CEA.Tg were injected intramuscularly with three doses (10^10^, 10^9^ and 10^8^ vp/mouse) of either of the two adenoviral vectors. Three days later, CEA expression was measured in the serum and we found that levels of the secreted protein by ChAd3-CEA were roughly 3--4-fold lower than with hAd5-CEA vector ([Fig. 2](#fig2){ref-type="fig"}B). 3.3. Immunogenicity of ChAd3 and hAd5 is comparable {#section0070} --------------------------------------------------- To assess whether ChAd3 was capable of breaking the immunologic tolerance to CEA in CEA.Tg mice and to measure the kinetics of the immune response, PBMCs were analyzed at different time points by intracellular staining (ICS) for the frequency of CEA-specific IFNγ producing CD8^+^ cells, 2 weeks after a single treatment of mice with 10^10^ vp of either hAd5-CEA of ChAd3-CEA vaccines. Both vectors were able to elicit a significant immune response that reached a peak level between 14 and 21 days post-injection ([Fig. 3](#fig3){ref-type="fig"}A) and decreased to basal level 75--100 days after the treatment, with apparently slower kinetics than those observed with ChAd3-CEA vector.Fig. 3Characterization of the immunogenic properties of ChAd3-CEA. (A) Kinetics of the immune response. Groups of 6--8 CEA.Tg mice were immunized with 1 × 10^10^ vp of either hAd5-CEA or ChAd3-CEA vector. At the indicated time point, mice were bled and PBMCs were stimulated with a pool of peptides covering the C-term of CEA (pool D) and analyzed by intracellular staining for IFNγ. Group average with standard deviations (error bar) is shown. (B) Vaccine potency of ChAd3-CEA. Groups of 6 CEA.Tg mice were vaccinated with the indicated vp of either hAd5-CEA or ChAd3-CEA vector. Thirty days after the injection, PBMCs were analyzed for CEA-specific response by intracellular staining for IFNγ. Histograms and error bars show group average and standard deviations, respectively. (C) hAd5 and ChAd3 vector mixed modality. Groups of 6 CEA.Tg mice were immunized either with 10^8^ vp of hAd5-CEA or ChAd3-CEA vector or mock injected. Thirty days later, mice were boosted with the indicated vector and 2 weeks later, PBMCs were analyzed for CEA-specific response by intracellular staining for IFNγ. White circles indicate the immune response measured per single animal; gray dots represent the group geometric mean. Mice with responses above 0.1% CD8^+^/IFNγ^+^ (dashed line) are considered responders. Student\'s *t*-test, *p* = 0.05 for hAd5/hAd5 vs. hAd5/ChAd3 or ChAd3/ChAd3 groups. To better characterize the immunogenic potential of ChAd3 with respect to hAd5, we immunized CEA.Tg mice with escalating doses of each virus. One month after the injection, ChAd3 elicited higher responses, especially at the lower dose (10^8^ vp, [Fig. 3](#fig3){ref-type="fig"}B). To measure the effect of heterologous vs. homologous Ad-based vaccination, CEA.Tg mice were vaccinated 1 month apart with different combinations (hAd5/hAd5; ChAd3/ChAd3; hAd5/ChAd3) at low doses (10^8^ vp/mouse) that did not induce measurable NVAs. As shown in [Fig. 3](#fig3){ref-type="fig"}C, hAd5 prime/boost vaccination induced a apparently low immune response (geomean: 0.2% CEA-specific CD8^+^IFNγ^+^ PBMCs; 4/6 responder mice) compared to ChAd3/ChAd3 and hAd5/ChAd3 regimens (geomean: 0.8% and 0.9%, respectively; 100% responders). Taken together, these data show that ChAd3 has similar potency compared to hAd5 in eliciting CEA-specific immune response. 3.4. ChAd3 vaccine overcomes hAd5 pre-existing immunity {#section0075} ------------------------------------------------------- The impact of pre-existing immunity to hAd5 was tested in mice previously exposed to high dose wild type hAd5 (1 × 10^10^ vp). One month later, all animals developed high titer NVAs (titer ≈1/1000 to 1/2000) and were treated with one injection of hAd5 or ChAd3-CEA expressing vectors (see scheme in [Fig. 4](#fig4){ref-type="fig"}A). CEA-specific T cell immune response was unaffected in animals vaccinated with ChAd3-CEA (see [Fig. 3](#fig3){ref-type="fig"}, [Fig. 4](#fig4){ref-type="fig"} for reference) but completely abolished in mice receiving the hAd5-CEA treatment. The effect of anti-hAd5 immunity in the "recall" phase was also evaluated following previous treatments with DNA-EP. CEA.Tg mice with pre-existing immunity received 4 weekly DNA-EP treatments, 2 weeks later were injected with the Ad vectors and the immune response was measured thereafter. As shown in [Fig. 4](#fig4){ref-type="fig"}B, anti-hAd5 antibodies completely blunted the "priming" and "boosting" capability of regimens containing hAd5. In contrast, poor or no reduction was observed in mice that received ChAd3 vector. Similarly, the duration of the response in DNA-EP/ChAd3-CEA treated animals was not affected by pre-existing immunity ([Fig. 4](#fig4){ref-type="fig"}C). These data indicate that antibodies against hAd5 are unable to impair ChAd3 immunization potency both in a homologous and heterologous vaccination setting.Fig. 4ChAd3-CEA vaccine overcomes hAd5 immunity. (A) Top scheme. Groups of CEA.Tg mice were pre-injected with 10^10^ vp of wild type hAd5 and immunized either with hAd5-CEA or ChAd3-CEA (10^10^ vp). The average (±SD) anti-hAd5 titer of the group is shown. Two weeks later, the immune response against CEA was measured by intracellular staining for IFNγ⋅ (B) Pre-exposure to wt hAd5 does not impair ChAd3 vaccine potency. Groups of 10 CEA.Tg mice received 4 weekly DNA-EP with pV1J-CEA or left untreated (mock). Two weeks after, animals were injected with 10^9^ vp of either of the two vectors and the immune response against CEA was measured 14 days later by intracellular staining for IFNγ. (C) Kinetics of immune response. Treated mice were bled at the indicated time points and PBMCs were analyzed by intracellular staining for IFNγ. Mice with a CEA-specific response \>0.1% CD8^+^/IFNγ^+^ were considered responders. 3.5. ChAd3 vaccine confers anti-tumor effects in BALB/NeuT mice with anti-hAd5 immunity {#section0080} --------------------------------------------------------------------------------------- To further extend our observations to another TAA/mouse model, we utilized the BALB/NeuT mice. This is one of the most suitable models for vaccine evaluation since female mice develop autochthonous, spontaneous and synchronous breast cancer in each of their 10 mammary glands [@bib51] and the anti-tumor response is highly correlated with the immune response against rat *neu* [@bib50]. Two weekly injections of hAd5\_*neu*.ECD.TM at week 8 and 9 were sufficient to induce a strong *neu*-specific CD8^+^ T-cell response (mean ≈1%) as measured by IFNγ intracellular staining at week 11. This response persisted at significant levels (CD8^+^/IFNγ^+^  \> 0.1%) for at least another 3 weeks (week 14, see [Fig. 5](#fig5){ref-type="fig"}A). At both time points, at least 80% of the mice responded to the vaccination. Two similarly spaced weekly injections of ChAd3\_*neu*.ECD.TM induced a slightly lower T-cell response than hAd5\_*neu*.ECD.TM injections. In this case, about 80% of the mice responded at the first time point and 60% persisted at the second. PBMCs collected from saline treated mice (controls) did not show any IFNγ producing T cells (data not shown).Fig. 5ChAd3-\_*neu*.ECD.TM immunogenic properties and anti-tumor effects. (A) T-cell responses. Groups of 10 BALB/NeuT mice were vaccinated at the 8th and 9th week of age. The immune response against rat *neu* 15.3 epitope was analyzed at week 11 and 14. Open circles indicate the response of individual mice, filled circle denotes the group mean. A mouse with T-cell reactivity of at least 0.1% was considered a responder. Student\'s *t*-test at week 11, *p* \< 0.05 for hAd5wt+hAd5 vs. hAd5 alone or hAd5wt+ChAd3 or ChAd3 alone. (B) Antibody titer. Anti-rat HER-2/*neu* titers were determined as described in materials and methods. At least 10 mice were included in each group. Open circles indicate the response of individual mice, filled circle denotes the group mean. Student\'s *t*-test, *p* \< 0.0003 for hAd5wt+hAd5 vs. hAd5 alone or hAd5wt+ChAd3 or ChAd3 alone. (C) Anti-tumor effect. Mice were immunized as described in the text and tumor development followed from week 15 onwards. At least 10 mice were included in each group. Percentage of tumor-free mice is shown. Group symbols are shown in graph legend. Log-Rank test, hAd5wt+ChAd3-ECD.TM vs. hAd5wt+hAd5-ECD.TM: *p* = 6.27 × 10^−06^. To determine whether neutralizing antibodies to hAd5 cross-reacted with ChAd3 in this mouse model, groups of mice were immunized as previously described with two injections of either hAd5\_*neu*.ECD.TM or ChAd3\_*neu*.ECD.TM. Two weeks prior to the vaccination, mice were injected with 10^10^ particles of wild type hAd5 to induce neutralizing antibodies. Following administration of the vaccine, the T-cell response was analyzed. Mice that received hAd5 wild type prior to hAd5\_*neu*.ECD.TM showed no detectable *neu*-specific T cell response by IFNγ intracellular staining ([Fig. 5](#fig5){ref-type="fig"}A). The mean response dropped from 1% to undetectable, suggesting that the vector had been neutralized by pre-existing anti-hAd5 humoral responses. In contrast, no such significant drop in immunogenicity was observed in the ChAd3\_*neu*.ECD.TM immunized mice. 50--70% of the mice were responders at both time points. Similar results were obtained for antibody response against rat HER2-*neu*, also strongly affected by pre-exposure to wt hAd5. Finally, to assess if ChAd3 vaccine could confer therapeutic anticancer effects, tumors were palpated from week 15 onwards. Two hAd5 injections resulted in 80% of the mice remaining tumor free until week 42 ([Fig. 5](#fig5){ref-type="fig"}C). Similarly, data obtained with two ChAd3 injections showed that 70% of the mice were tumor free for up to 42 weeks. Control mice developed 10 tumors by week 25. The groups that received a pre-immunization of wt hAd5 were also evaluated. The presence of neutralizing antibodies drastically reduced the efficacy of hAd5\_*neu*.ECD.TM. By week 30, none of the mice were tumor free. On the other hand, pre-existing immunity to hAd5 did not have any impact on the anti-tumor effect of ChAd3\_*neu*ECD.TM immunization, as 60% mice were tumor free with or without pre-exposure to hAd5. These data confirmed that anti-hAd5 humoral immunity do not cross-react with ChAd3 and therefore, the new vector is an effective substitute for hAd5 in mice. 4. Discussion {#section0085} ============= Cancer immune therapy and its translation to the clinic are strictly dependent on efficient vaccine technology, delivery systems and evaluation in appropriate pre-clinical models. CEA.Tg mice express CEA with a tissue distribution similar to that of humans [@bib56] and provide a particularly relevant model to critically verify the potential efficacy of a human CEA-based vaccine [@bib57]. Similarly, BALB/NeuT mice allow assessment of active cancer immunotherapy against HER-2/*neu*. Here, overexpression of the activated (V664E) form of the rat HER-2/*neu* oncogene under the control of the mouse mammary tumor virus promoter, leads to the progressive development of invasive mammary adenocarcinoma in all ten mammary glands [@bib51]. We have shown that DNA-EP technology and particularly hAd5 carrier, along with codon usage optimization [@bib44] and antigen engineering [@bib41], [@bib42], lead to breakage of immune tolerance and hamper cancer progression in these models [@bib43], [@bib50]. The exceptional immunogenicity of replication-defective hAd5 vectors is probably due to a number of properties: (i) the high levels of transgene expression driven in most vectors by the potent cytomegalovirus promoter, (ii) the activation of the innate immune system, (iii) the transduction of immature dendritic cells driving their maturation into antigen-presenting cells, and (iv) a sufficiently long duration of antigen presentation due to lack of apoptosis induction of the transduced cells. However, pre-existing anti-adenovirus immunity and, in particular, neutralizing antibodies which reduce cell uptake of the adenoviral vectors can significantly dampen vaccine responses and represent a major limitation to the successful use of common serotypes of adenovirus. To circumvent the impairment of vaccine efficacy by pre-existing neutralizing antibodies, we developed vaccine vectors based on Ads that had been isolated from chimpanzees. One of these, ChAd3 has close sequence homology with the hAd5 virus and thus belongs to subgroup C of the *Adenovirideae* (Colloca et al., in preparation). In this study, we show that ChAd3-CEA and hAd5-CEA have similar infectivity potency *in vitro* and *in vivo* ([Fig. 2](#fig2){ref-type="fig"}). The primary receptor responsible for attachment of all Ad serotypes, except those from group B that use CD46 [@bib22], is the CAR [@bib58]. Recent studies have shown that Ad can also use other receptors, such as the major histocompatibility complex I (MHCI) and heparin sulfate glycosaminoglycans [@bib59]. Gene transfer efficacy mediated by hAd5 and ChAd3 has been investigated in a large panel of human primary cells of different tissue origin and found to be similar (Colloca et al., in preparation). This suggested that both vectors utilize the same entry mechanisms, at least in *in vitro* cultured cells. However, expression of CEA was apparently lower in ChAd3-CEA i.m. injected mice ([Fig. 2](#fig2){ref-type="fig"}B), suggesting that this vector may have different properties and/or tropism in transducing mouse tissues compared to hAd5 [@bib60], [@bib61]. Importantly, ChAd3-CEA was able to break tolerance in CEA.Tg mice inducing a potent antigen-specific CD8^+^ response with kinetics comparable to that of hAd5-CEA ([Fig. 3](#fig3){ref-type="fig"}A and B), thus indicating that this vector could infect the cells instrumental for antigen expression and induction of the immune response via direct or indirect presentation of the antigen. ChAd3\_*neu* ECD.TM showed similar immunogenic properties in BALB/NeuT mice ([Fig. 5](#fig5){ref-type="fig"}A and B). ChAd3-CEA vector also showed good efficacy in boosting hAd5-CEA elicited immune response in a heterologous type of vaccination ([Fig. 3](#fig3){ref-type="fig"}C). This feature is important, since regimens consisting of rare serotype Ad vectors combined to hAd5 have recently proven able to elicit augmented magnitude, breadth and polyfunctionality of cellular immune responses and superior protective efficacy as compared with the homologous hAd5 regimen against HIV-1 [@bib62]. The ChAd3 vector was developed to overcome pre-existing serotype-specific neutralizing antibodies to hAd5, shown to interfere with the efficacy of the homologous vaccine carrier. This limitation could only in part be circumvented by increasing the vaccine dose, which may result in severe vector-mediated toxicity. Indeed, cross-neutralization of the ChAd3-mediated immune response did not occur in animals with high titer hAd5 pre-existing immunity ([Fig. 4](#fig4){ref-type="fig"}, [Fig. 5](#fig5){ref-type="fig"}) and equally the Ad boosting effect as a consequence of DNA-EP priming was not impaired ([Fig. 4](#fig4){ref-type="fig"}B and C). Finally, we showed that ChAd3\_*neu* ECD.TM had an anti-tumor effect comparable to the corresponding hAd5 vector, and most important of all, that ChAd3 vaccine efficacy was not blunted by the presence of hAd5 neutralizing antibodies ([Fig. 5](#fig5){ref-type="fig"}C) and was associated to the measured HER-2/*neu*-specific immune response. Recently, Chimpanzee Ad vectors such as AdC7, AdC68 and AdC1 have proven particularly effective tools as vaccines against a variety of viral antigens and diseases, such as influenza caused by H5N1 strains [@bib63], human immunodeficiency virus type 1 in NHPs [@bib33], rabies virus [@bib36] and severe acute respiratory syndrome mediated by SARS-Coronavirus [@bib35]. Of note, in these models the organism recognizes the antigen as an exogenous protein and consequently the elicited immune response is generally strong and effective against the target pathogen. On the other hand, choosing appropriate preclinical models in which TAAs are recognized as self-protein is imperative to better predict the possible outcome of a cancer vaccine in human patients. Here we report for the first time that novel chimp Ad vectors, such as ChAd3, can be employed as potent cancer vaccine tools and may prove particularly useful as vaccine vectors for populations in the developing world with high levels of pre-existing anti-hAd5 immunity. Additionally, ChAd3 vectors could be utilized together with hAd5, other common hAd vectors and DNA-EP in heterologous prime-boost regimens. We thank IRBM-LAR personnel for excellent technical support in conducting animal experiments. We also are grateful to Janet Clench for editorial assistance and Manuela Emili for graphics. *Conflict of interest statement:* No competing financial interests exist.
Pursuant to Ind. Appellate Rule 65(D), this Memorandum Decision shall not be regarded as precedent or cited before any court except for the purpose of establishing the defense of res judicata, collateral estoppel, or the law of the case. ATTORNEY FOR APPELLANT: ATTORNEYS FOR APPELLEE: JEFFREY G. RAFF GREGORY F. ZOELLER Deputy Public Defender Attorney General of Indiana Fort Wayne, Indiana RICHARD C. WEBSTER Deputy Attorney General FILED Indianapolis, Indiana May 17 2012, 9:27 am IN THE COURT OF APPEALS OF INDIANA CLERK of the supreme court, court of appeals and tax court JOHN F. FYOCK, ) ) Appellant-Defendant, ) ) vs. ) No. 02A03-1109-CR-00421 ) STATE OF INDIANA, ) ) Appellee-Plaintiff. ) APPEAL FROM THE ALLEN SUPERIOR COURT The Honorable Wendy W. Davis, Judge Cause No. 02D05-1010-FB-184 May 17, 2012 MEMORANDUM DECISION - NOT FOR PUBLICATION KIRSCH, Judge John F. Fyock was convicted of four counts of dealing in a schedule I, II or III controlled substance,1 each as a Class B Felony. He was sentenced to twenty years each for Counts I, II, and IV and ten years for Count III with all sentences to run concurrently. He appeals and raises the following restated issues: I. Whether the evidence was insufficient to support his conviction. II. Whether the sentence was inappropriate in light of the nature of his offenses and the character of the offender. We affirm. FACTS AND PROCEDURAL HISTORY Douglas Holliday (“Holliday”) was a confidential informant making drug purchases for the Fort Wayne Police Department (“FWPD”). Holliday knew Fyock and had previously purchased narcotics from him. On September 17, 2010, the FWPD arranged a controlled buy of narcotics between Holliday and Fyock. That day, Fyock sold heroin and methadone to Holliday for $75. On September 23, 2010, the FWPD arranged another controlled buy between Holliday and Fyock. Fyock sold heroin and methadone to Holliday for $100. The State charged Fyock with four counts of dealing in a schedule I, II, or III controlled substance. Holliday testified regarding the drug transactions, and the jury found Fyock guilty of all counts. At Fyock’s sentencing hearing, the trial court found that Fyock sold Holliday the narcotics while he was on parole and that Fyock’s criminal history contained seven prior misdemeanor convictions, thirteen prior felony convictions, one 1 See Ind. Code § 35-48-4-2. 2 revocation of misdemeanor probation, one revocation of felony probation, and three parole violations. No mitigating factors were found. The trial court sentenced Fyock to the maximum of twenty years each for Counts I, II, and IV, and to ten years for Count III and ordered that the sentences be served concurrently, for an aggregate sentence of twenty years. Fyock now appeals. DISCUSSION AND DECISION I. Evidence Supporting Convictions When reviewing a claim of sufficiency of the evidence, “we do not reweigh the evidence or judge the credibility of the witnesses.” Hundley v. State, 951 N.E.2d 575, 579 (Ind. Ct. App. 2011). We consider only whether “the probative evidence and reasonable inferences drawn from the evidence could have allowed a reasonable trier of fact to find the defendant guilty beyond a reasonable doubt.” McHenry v. State, 820 N.E.2d 124, 126 (Ind. 2005) (citation omitted). Fyock claims that the evidence is insufficient to support his convictions because Holliday was not a credible witness. Holliday was a drug user and had much to gain as a confidential informant for the FWPD. Fyock’s argument asks this court to reweigh the evidence and the credibility of Holliday, which we cannot do. Hundley, 951 N.E.2d at 579. It is the function of the jury to “resolve conflicts in testimony and to determine the weight of the evidence and the credibility of the witnesses.” Maxwell v. State, 731 N.E.2d 459, 462 (Ind. Ct. App. 2000). The jury may believe or disbelieve witnesses as it sees fit. Mishler v. State, 894 N.E.2d 1095, 1102 3 (Ind. Ct. App. 2008). Holliday testified at trial regarding the drug transactions. The jury determined beyond a reasonable doubt from the evidence presented to them at trial that Fyock committed the crimes with which he was charged. We will not disturb the jury’s decision. II. Sentencing “This court has authority to revise a sentence ‘if, after due consideration of the trial court’s decision, the Court finds that the sentence is inappropriate in light of the nature of the offense and the character of the offender.’” Spitler v. State, 908 N.E.2d 694, 696 (Ind. Ct. App. 2009) (quoting Ind. Appellate Rule 7(B)), trans. denied. “Although Indiana Appellate Rule 7(B) does not require us to be ‘extremely’ deferential to a trial court’s sentencing decision, we still must give due consideration to that decision.” Patterson v. State, 909 N.E.2d 1058, 1062-63 (Ind. Ct. App. 2009) (quoting Rutherford v. State, 866 N.E.2d 867, 873 (Ind. Ct. App. 2007)). We understand and recognize the unique perspective a trial court brings to its sentencing decisions. Id. at 1063. The defendant bears the burden of persuading this court that his sentence is inappropriate. Id. Fyock argues that the nature of the offense does not justify the maximum sentence of twenty years for three of his four convictions because Holliday and Fyock were both drug users and the transactions between them involved a small sum of money. Fyock’s arguments provide unpersuasive mitigating factors for revising his sentence in light of the nature of the offense. Fyock engaged in the sale of heroin and methadone for profit and did so while he was on parole. Additionally, Fyock has conceded that his criminal history precludes a 4 sentence revision based on the character of the offender. Appellant’s Br. at 7. Fyock’s seven prior misdemeanor convictions and thirteen prior felony convictions, among many other infractions, weigh heavily against revision of his sentence. Fyock has not met his burden, and we therefore conclude that his sentence was not inappropriate in light of the nature of the offense and character of the offender. Affirmed. BAKER, J., and BROWN, J., concur. 5
Review of the use of MRI in soft tissue lesions. The MR images of 34 patients with soft tissue lesions were retrospectively evaluated to assess the accuracy of the technique in distinguishing benign from malignant lesions, and to assess the usefulness of various criteria in making this distinction. The overall sensitivity for the detection of malignancy was 75% with a specificity of 94%. Size of lesion was found to be a good criterion in predicting malignancy, lesion margin and signal intensity were less useful. The tissue type was determined in a few instances where signal characteristics were typical, notably lipomas and neural tumours, but this was not reliable and in most lesions the tissue of origin cannot be determined on MR imaging and biopsy is necessary.
EURUSD Remains Under Bearish Pressure Euro traded down against the US Dollar during the past two sessions, and looks poised for more declines. There was a bullish trend line formed on the hourly chart of the EURUSD pair earlier, which was broken by the Euro sellers recently. France Consumer Price Index released by INSEE posted an increase of 0.8% in March 2016, more than the forecast of 0.7%. Spanish Consumer Price Index on the other hand registered a decline of 0.8% in March 2016. Technical Analysis The Euro continued to face selling pressure during the past couple of sessions, and as a result it fell below the 1.1340 level against the US Dollar. There was a bullish trend line formed on the hourly chart of the EURUSD pair earlier, which was broken by the bears. The recent break in the EURUSD pair looks real, as the pair traded below the 100 and 200 hourly simple moving average. Selling rallies can be considered in the near term as the pair may test the 1.1300 support area. France and Spanish CPI Today, the France Consumer Price Index, measuring the price movements by the comparison between the retail prices of a representative shopping basket of goods and services was released by INSEE. The market was expecting an increase of 0.7% in the CPI, but the result was better. The French CPI rose 0.8% in March 2016. Moreover, the Spanish Consumer Price Index was also released, which registered a decline of 0.8% in March 2016. In terms of the monthly change, there was a rise of 0.6%, which was in line with the market forecast. There was hardly anything encouraging for the Euro bulls, which is the reason why we may see more losses in EURUSD in the short term. Information and opinions contained on this page are for educational purposes only and do not constitute trading recommendations. Trading OTC Forex on margin carries a high level of risk, and may not be suitable for all investors. The high degree of leverage can work against you as well as for you. Before deciding to invest in foreign exchange or futures you should carefully consider your investment objectives, level of experience, and risk appetite. The possibility exists that you could sustain a loss of some or all of your initial investment and therefore you should not invest money that you cannot afford to lose. You should be aware of all the risks associated with foreign exchange and futures trading, and seek advice from an independent financial advisor if you have any doubts.
Q: Biased bootstrap: is it okay to center the CI around the observed statistic? This is similar to Bootstrap: estimate is outside of confidence interval I have some data that represents counts of genotypes in a population. I want to estimate genetic diversity using Shannon's index and also generate a confidence interval using bootstrapping. I've noticed, however, that the estimate via bootstrapping tends to be extremely biased and results in a confidence interval that lies outside of my observed statistic. Below is an example. # Shannon's index H <- function(x){ x <- x/sum(x) x <- -x * log(x, exp(1)) return(sum(x, na.rm = TRUE)) } # The version for bootstrapping H.boot <- function(x, i){ H(tabulate(x[i])) } Data generation set.seed(5000) X <- rmultinom(1, 100, prob = rep(1, 50))[, 1] Calculation H(X) ## [1] 3.67948 xi <- rep(1:length(X), X) H.boot(xi) ## [1] 3.67948 library("boot") types <- c("norm", "perc", "basic") (boot.out <- boot::boot(xi, statistic = H.boot, R = 1000L)) ## ## CASE RESAMPLING BOOTSTRAP FOR CENSORED DATA ## ## ## Call: ## boot::boot(data = xi, statistic = H.boot, R = 1000) ## ## ## Bootstrap Statistics : ## original bias std. error ## t1* 3.67948 -0.2456241 0.06363903 Generating the CIs with bias-correction boot.ci(boot.out, type = types) ## BOOTSTRAP CONFIDENCE INTERVAL CALCULATIONS ## Based on 1000 bootstrap replicates ## ## CALL : ## boot.ci(boot.out = boot.out, type = types) ## ## Intervals : ## Level Normal Basic Percentile ## 95% ( 3.800, 4.050 ) ( 3.810, 4.051 ) ( 3.308, 3.549 ) ## Calculations and Intervals on Original Scale Assuming that the variance of t can be used for the variance of t0. norm.ci(t0 = boot.out$t0, var.t0 = var(boot.out$t[, 1]))[-1] ## [1] 3.55475 3.80421 Would it be correct to report the CI centered around t0? Is there a better way to generate the bootstrap? A: In the setup given by the OP the parameter of interest is the Shannon entropy $$\theta(\mathbf{p}) = - \sum_{i = 1}^{50} p_i \log p_i,$$ which is a function of the probability vector $\mathbf{p} \in \mathbb{R}^{50}$. The estimator based on $n$ samples ($n = 100$ in the simulation) is the plug-in estimator $$\hat{\theta}_n = \theta(\hat{\mathbf{p}}_n) = - \sum_{i=1}^{50} \hat{p}_{n,i} \log \hat{p}_{n,i}.$$ The samples were generated using the uniform distribution for which the Shannon entropy is $\log(50) = 3.912.$ Since the Shannon entropy is maximized in the uniform distribution, the plug-in estimator must be downward biased. A simulation shows that $\mathrm{bias}(\hat{\theta}_{100}) \simeq -0.28$ whereas $\mathrm{bias}(\hat{\theta}_{500}) \simeq -0.05$. The plug-in estimator is consistent, but the $\Delta$-method does not apply for $\mathbf{p}$ being the uniform distribution, because the derivative of the Shannon entropy is 0. Thus for this particular choice of $\mathbf{p}$, confidence intervals based on asymptotic arguments are not obvious. The percentile interval is based on the distribution of $\theta(\mathbf{p}_n^*)$ where $\mathbf{p}_n^*$ is the estimator obtained from sampling $n$ observations from $\hat{\mathbf{p}}_n$. Specifically, it is the interval from the 2.5% quantile to the 97.5% quantile for the distribution of $\theta(\mathbf{p}_n^*)$. As the OP's bootstrap simulation shows, $\theta(\mathbf{p}_n^*)$ is clearly also downward biased as an estimator of $\theta(\hat{\mathbf{p}}_n)$, which results in the percentile interval being completely wrong. For the basic (and normal) interval, the roles of the quantiles are interchanged. This implies that the interval does seem to be reasonable (it covers 3.912), though intervals extending beyond 3.912 are not logically meaningful. Moreover, I don't know if the basic interval will have the correct coverage. Its justification is based on the following approximate distributional identity: $$\theta(\mathbf{p}_n^*) - \theta(\hat{\mathbf{p}}_n) \overset{\mathcal{D}}{\simeq} \theta(\hat{\mathbf{p}}_n) - \theta(\mathbf{p}),$$ which might be questionable for (relatively) small $n$ like $n = 100$. The OP's last suggestion of a standard error based interval $\theta(\hat{\mathbf{p}}_n) \pm 1.96\hat{\mathrm{se}}_n$ will not work either because of the large bias. It might work for a bias-corrected estimator, but then you first of all need correct standard errors for the bias-corrected estimator. I would consider a likelihood interval based of the profile log-likelihood for $\theta(\mathbf{p})$. I'm afraid that I don't know any simple way to compute the profile log-likelihood for this example except that you need to maximize the log-likelihood over $\mathbf{p}$ for different fixed values of $\theta(\mathbf{p})$. A: As the answer by @NRH points out, the problem is not that the bootstrapping gave a biased result. It's that the simple "plug in" estimate of the Shannon entropy, based on data from a sample, is biased downward from the true population value. This problem was recognized in the 1950s, within a few years of the definition of this index. This paper discusses the underlying issues, with references to associated literature. The problem arises from the nonlinear relation of the individual probabilities to this entropy measure. In this case, the observed genotype fraction for gene i in sample n, $\hat{p}_{n,i}$, is an unbiased estimator of the true probability, $p_{n,i}$. But when that observed value is applied to the "plug in" formula for entropy over M genes: $$\hat{\theta}_n = \theta(\hat{\mathbf{p}}_n) = - \sum_{i=1}^{M} \hat{p}_{n,i} \log \hat{p}_{n,i}.$$ the non-linear relation means that the resulting value is a biased under-estimate of the true genetic diversity. The bias depends on the number of genes, $M$ and the number of observations, $N$. To first order, the plug-in estimate will be lower than the true entropy by an amount $(M -1)/2N$. Higher order corrections are evaluated in the paper linked above. There are packages in R that deal with this issue. The simboot package in particular has a function estShannonf that makes these bias corrections, and a function sbdiv for calculating confidence intervals. It will be better to use such established open-source tools for your analysis rather than try to start over from scratch.
U.S. Mayors Vow Not to Give in to Ransom Demands Ransomware attacks have been increasing since late December 2018 and attacks have been reported with increasing frequency as 2019 has progressed. Ransomware may have fallen out of favor with cybercriminals in 2018, but it is once again a firm favorite as it was in 2016 and 2017. In recent months there has been an extensive ransomware campaign targeting local government offices, cities, and municipalities. These attacks have caused massive disruption, and many have resulted in ransoms being paid. In the past few days alone, three ransomware attacks have been reported that have seen more than $1,200,000 in ransoms paid. Riviera Beach in Florida paid a ransom of $600,000 for the keys to unlock its encrypted files and Lake City in Florida paid around $460,000. Most recently, La Porte County in Indiana paid a ransom demand of $130,000. These are just three of many. According to the United States Conference of Mayors, in the past 6 years, more than 170 city, county, or state government systems have been taken out of action as a result of ransomware attacks and there have been 22 attacks so far in 2019. Cybercriminals will continue to conduct attacks as long as it is profitable to do so. When ransoms are paid, it simply encourages further attacks. The United States Conference of Mayors has decided to take a stand. The organization represents more than 1,400 majors across the United States and has vowed that in the event of attack, ransom demands will not be paid. That is a necessary step to take to de-incentivize attacks but it could potentially be very costly. In 2018, the City of Atlanta was attacked with ransomware and refused to pay the $50,000 ransom demand. The city has ended up spending tens of millions of dollars on recovery. The high cost of recovery without paying the ransom could prove too much for small cities, which is why several have been advised by their insurers to pay the ransoms. In such cases, help is required from the federal government. The majors have urged Congress to pass the State Cyber Resiliency Act, which would give state and local governments the support needed to help them implement their cyber resiliency plans What is also needed is greater investment in cybersecurity defenses. Attacks are being conducted because there are security holes that can be easily exploited. Until those holes are plugged, the attacks will continue. TitanHQ can help plug those holes and thwart ransomware attacks by blocking the main attack vectors. SpamTitan is a powerful email security solution that blocks email-threats at source and keeps inboxes threat free. WebTitan protects users while online and blocks malicious websites and malware downloads. With both of these powerful, but low-cost solutions in place, you will be well protected against ransomware attacks.
Gabriela Manufacturing must decide whether to insource or outsource a new toxic-free miracle carpet cleaner that works with its Miracle Carpet Cleaning Machine. If it decides to insource the product, the process would incur $300,000 of annual fixed costs and $1.50 per unit of variable costs. If it is outsourced, a supplier has o What is the definition of strategy? How would you compare and contrast business strategy and business tactics? In what type of business circumstances would you apply each of the three models: IBDM, a decision model, and a typical strategy model? Explain. Identify two retailers in the same industry that have two different target markets such as Walmart and Target, Amazon.com and Oriental Trading, Sears and Nordstroms, Gander Mountain and Hallmark Visit both retailers. Write a paper critiquing merchandise presentation techniques at each store. Discuss issues regard lighting, si The concepts are: -Financial Crisis -Managing Risk -Central Banks -Debt Markets -Moral Hazard -The International Financial system Select one of these concepts and find a related article at the New York Times: http://www.nytimes.com/ . Try clicking on "Business" on the left to see the business/financial relate Case 1 Read the following fictitious case and answer the questions that follow: Insurance fraud is the second most prevalent crime in the United States (income tax fraud is the first). It is one of the fastest growing crime categories during economic downturns. This spells good news for TLS Service Bureau, Inc. The compan Both Starwood Hotels (Sheraton, W-hotels, and The Westin are some of their brands), and Marriott own hotels and resorts in Venezuela. From the perspective of political risk, should these firms sell their properties in Venezuela? And, if a firm (for example: Starwood Hotels) decides to sell its properties in Venezuela, should o 700- to 1,050-word paper in which you analyze the individual values and the organization's values as reflected by the organization's plans and actions. Include the following in your paper: Only this: Analyze the degree of alignment between the organization's stated values and the organization's actual plans and actions. 1.) What is strategic management? What role does strategic management play in the hospitality industry? How could a hospitality organization use strategic management to increase profitability? 2.) What is guest recovery? Why is it important to a hospitality organization? What guest recovery strategies can a hospitality orga See the attached file. Drawing from the attached, discuss the relationship between your organization's skills and staff characteristics. The following questions need to be answered: 1. What is the organization's chief skill (core competency)? 2. What are its key staff characteristics and how do they operate? ? Considering the elements of microeconomics, create a list of three (3) best practices that would benefit any small business or start-up. Explain your rationale. ? Chapter 3 discusses three (3) types of economic systems: capitalism, planned economies (socialism and communism), and mixed market economies. Create and describe A strong behaviorist approach to learning focuses on discrete tasks that are built up until they become a complex behavior. A strong constructivist (situated learning) approach focuses on creating environments for interaction that call out the experiences and guide integration of experiences into a complex social interaction tha Examining the various aspects of the vendor and buyer relationship. Discuss what you feel is important for creating and maintaining productive vendor relationships from a buyer perspective. Discuss how this is different from the vendor's perspective. Examine the risks and rewards involved with exclusive vendor relationships. For Talk about "Whole Foods" http://www.wholefoodsmarket.com/ List the retailer's primary vendors and describe their relationship. Consider product, logistics, and support services; do not focus solely on merchandise See attached file. Part I Please see the attached for a review of the IPhone. What other messaging would be successful for the specific brand and why? Part II Please see the attached for a review of the Body Bugg. What other new media tools could be added to the messaging strategy for the brand? Please include at In recognition of current market trends, Steve Jobs claimed that he wanted to transform the company by making the Mac the hub of the consumers' digital lifestyle. Despite Apple Computer's recent successes, the company is facing an ever-changing competitive environment on multiple fronts. 1. What are the key strategic challen See attached case file for C&C Grocery. 1. Using a discussion of the types of effectiveness approaches, describe the current and proposed structure of C&C Grocery. Explain in detail. 2. Which of Porter's Competitive Strategies and Miles/Snow's Strategy Typology describe the role of consultant? Be Specific... 3. Which of t Like others you have viewed in this YouTube series, Meg Wheatley is an outstanding organizational consultant. Among her major accomplishments include work on Action Learning with the US Army. View the two clips that feature Meg discussing engagement and conversation. Of the ten principles Meg speaks of which ones are most sig Utilizing the chart on p. 209 in The Performance Consultant's Field Book identify the key measures that are used in your client organization for measuring results. Is your client focusing on the correct measurements to achieve the organizational goal? Discuss your findings ? What is design? How is design important to an organization? What would happen if design-principled problem solving was applied to your organization? Explain. ? What are the elements of design strategy? Why would different countries use different design strategies? In your opinion, are foreign design strategies more or less There is no exact definition of a developed economy, but rather there is a sliding scale. Most sources agree that the G8 countries are the major economies in the world. This group of countries together comprises over two thirds of the world's economic output (U.S. Department of State's Bureau of International Information Program What are the challenges Elizabeth faced in meeting her capacity needs and what she should have considered before moving into the larger facility? What is wrong with the proposal made by the team of the business students and why. Explain how the business would be different if Elizabeth accepts the proposal made by the student 1. Select and submit two appropriate templates and the PowerPoint layout screens from Advanced Presentations by Design(Textbook) that you are considering for your proposal. 2. Submit the approximate cost of your proposal/services. Take into consideration your time, materials, resources, travel, etc. For salary information: Peter Drucker is revered as the Father of Modern Management but his influence goes beyond the field of management. View the 'Peter Drucker Says' interview and share your comments and insights on his wisdom. http://www.youtube.com/watch?v=DbM7gU6Y5LA. (4:29) 1. Credibility and influence are vital components for success as a performance consultant as well as successful completion of any consulting project. Use the "Client Capabilities and Commitment" Assessment on p. 97 - 98 in the Field Book. Upon completing the Client Assessment, utilize the If-Then Chart on p. 99 to write a repo View the clip on about Caterpillar- Running Learning Like a Business (2:37) http://www.youtube.com/watch?v=WdZcV3SxCzM&feature=related Comment on Dave Vance's (former President of Caterpillar University) view of performance consulting. What parts of his discussion point out the strategic influence a performance consu Write a clear strategic plans stretching over the next 3 to 5 years that will help Walmart improve. These improvements should be clear business accomplishments. These include profits, revenue, and market share and company image. 1.Create a name and business logo for your consulting practice that will differentiate your consulting practice from others. 2.After careful thought, present two topics for the Final Project 3.Provide your target audience, the client issue or problem, your objective and the desired outcome for consideration. Read this story: Anonymous (2011), Old Navy Campaign Targets Men. Advertising Age June 18. Imagine you have been hired as a consultant to the VP of marketing for Old Navy. The VP wants to get an objective opinion from someone outside the company who is familiar with current marketing basics. Assignment: (1) Write a memo Internet Marketing at first glance may sound like a fairly short and specific topic. In fact, there are many different areas. This book will focus on value, both from a business and consumer perspective. We will begin with a discussion of customer va... READ MORE » ... READ MORE »
All Orangery/Loggia Originally a feature of stately homes, the Orangery has now evolved into a private, luxurious living space. While large windows and a glass roof are still their main features, Orangeries are subtly different from conservatories in that they generally have more brickwork to ensure they blend into your home in an elegant way. An Orangery from Budget represents the pinnacle of traditional elegance. Blending classic craftsmanship with the benefits of modern materials and techniques, we deliver a living environment with quality and longevity. Each design has high levels of security and energy efficiency built in, no need to worry about drafts and leaks. And of course, the latest high security features come as standard. Orangery: The height of sophistication All the styles in our Orangery collection use the very latest building materials and construction techniques to create an elegant addition to your home. Fascias and elegant pilasters are blended with the latest glass technology and high levels of security and energy efficiency. And of course with Budget, our experience and professionalism means your peace of mind. Either visit our showroom or book an appointment for one of our consultants to give you a no-obligation quotation. THE HEIGHT OF SOPHISTICATION All the styles in our Orangery collection use the very latest building materials and construction techniques to create an elegant addition to your home. Authentic period features such as fascias and elegant pilasters are blended with modern benefits such as the latest glass technology, high levels of security and energy efficiency. And of course with Budget, our experience and professionalism means your peace of mind. Visit our showroom or book an appointment for one of our consultants to give you a no-obligation quotation.
% Generated by roxygen2: do not edit by hand % Please edit documentation in R/plot-acf_diagnostics.R \name{plot_acf_diagnostics} \alias{plot_acf_diagnostics} \title{Visualize the ACF, PACF, and CCFs for One or More Time Series} \usage{ plot_acf_diagnostics( .data, .date_var, .value, .ccf_vars = NULL, .lags = 1000, .show_ccf_vars_only = FALSE, .show_white_noise_bars = FALSE, .facet_ncol = 1, .facet_scales = "fixed", .line_color = "#2c3e50", .line_size = 0.5, .line_alpha = 1, .point_color = "#2c3e50", .point_size = 1, .point_alpha = 1, .x_intercept = NULL, .x_intercept_color = "#E31A1C", .hline_color = "#2c3e50", .white_noise_line_type = 2, .white_noise_line_color = "#A6CEE3", .title = "Lag Diagnostics", .x_lab = "Lag", .y_lab = "Correlation", .interactive = TRUE, .plotly_slider = FALSE ) } \arguments{ \item{.data}{A data frame or tibble with numeric features (values) in descending chronological order} \item{.date_var}{A column containing either date or date-time values} \item{.value}{A numeric column with a value to have ACF and PACF calculations performed.} \item{.ccf_vars}{Additional features to perform Lag Cross Correlations (CCFs) versus the \code{.value}. Useful for evaluating external lagged regressors.} \item{.lags}{A sequence of one or more lags to evaluate.} \item{.show_ccf_vars_only}{Hides the ACF and PACF plots so you can focus on only CCFs.} \item{.show_white_noise_bars}{Shows the white noise significance bounds.} \item{.facet_ncol}{Facets: Number of facet columns. Has no effect if using \code{grouped_df}.} \item{.facet_scales}{Facets: Options include "fixed", "free", "free_y", "free_x"} \item{.line_color}{Line color. Use keyword: "scale_color" to change the color by the facet.} \item{.line_size}{Line size} \item{.line_alpha}{Line opacity. Adjust the transparency of the line. Range: (0, 1)} \item{.point_color}{Point color. Use keyword: "scale_color" to change the color by the facet.} \item{.point_size}{Point size} \item{.point_alpha}{Opacity. Adjust the transparency of the points. Range: (0, 1)} \item{.x_intercept}{Numeric lag. Adds a vertical line.} \item{.x_intercept_color}{Color for the x-intercept line.} \item{.hline_color}{Color for the y-intercept = 0 line.} \item{.white_noise_line_type}{Line type for white noise bars. Set to 2 for "dashed" by default.} \item{.white_noise_line_color}{Line color for white noise bars. Set to \code{tidyquant::palette_light()} "steel blue" by default.} \item{.title}{Title for the plot} \item{.x_lab}{X-axis label for the plot} \item{.y_lab}{Y-axis label for the plot} \item{.interactive}{Returns either a static (\code{ggplot2}) visualization or an interactive (\code{plotly}) visualization} \item{.plotly_slider}{If TRUE, returns a plotly x-axis range slider.} } \value{ A static \code{ggplot2} plot or an interactive \code{plotly} plot } \description{ Returns the \strong{ACF and PACF of a target} and optionally \strong{CCF's of one or more lagged predictors} in interactive \code{plotly} plots. Scales to multiple time series with \code{group_by()}. } \details{ \strong{Simplified ACF, PACF, & CCF} We are often interested in all 3 of these functions. Why not get all 3+ at once? Now you can. \itemize{ \item \strong{ACF} - Autocorrelation between a target variable and lagged versions of itself \item \strong{PACF} - Partial Autocorrelation removes the dependence of lags on other lags highlighting key seasonalities. \item \strong{CCF} - Shows how lagged predictors can be used for prediction of a target variable. } \strong{Lag Specification} Lags (\code{.lags}) can either be specified as: \itemize{ \item A time-based phrase indicating a duraction (e.g. \verb{2 months}) \item A maximum lag (e.g. \code{.lags = 28}) \item A sequence of lags (e.g. \code{.lags = 7:28}) } \strong{Scales to Multiple Time Series with Groups} The \code{plot_acf_diagnostics()} works with \code{grouped_df}'s, meaning you can group your time series by one or more categorical columns with \code{dplyr::group_by()} and then apply \code{plot_acf_diagnostics()} to return group-wise lag diagnostics. \strong{Special Note on Groups} Unlike other plotting utilities, the \code{.facet_vars} arguments is NOT included. Use \code{dplyr::group_by()} for processing multiple time series groups. \strong{Calculating the White Noise Significance Bars} The formula for the significance bars is \code{+2/sqrt(T)} and \code{-2/sqrt(T)} where \code{T} is the length of the time series. For a white noise time series, 95\% of the data points should fall within this range. Those that don't may be significant autocorrelations. } \examples{ library(tidyverse) library(timetk) # Apply Transformations # - Differencing transformation to identify ARIMA & SARIMA Orders m4_hourly \%>\% group_by(id) \%>\% plot_acf_diagnostics( date, value, # ACF & PACF .lags = "7 days", # 7-Days of hourly lags .interactive = FALSE ) # Apply Transformations # - Differencing transformation to identify ARIMA & SARIMA Orders m4_hourly \%>\% group_by(id) \%>\% plot_acf_diagnostics( date, diff_vec(value, lag = 1), # Difference the value column .lags = 0:(24*7), # 7-Days of hourly lags .interactive = FALSE ) + ggtitle("ACF Diagnostics", subtitle = "1st Difference") # CCFs Too! walmart_sales_weekly \%>\% select(id, Date, Weekly_Sales, Temperature, Fuel_Price) \%>\% group_by(id) \%>\% plot_acf_diagnostics( Date, Weekly_Sales, # ACF & PACF .ccf_vars = c(Temperature, Fuel_Price), # CCFs .lags = "3 months", # 3 months of weekly lags .interactive = FALSE ) } \seealso{ \itemize{ \item \strong{Visualizing ACF, PACF, & CCF:} \code{\link[=plot_acf_diagnostics]{plot_acf_diagnostics()}} \item \strong{Visualizing Seasonality:} \code{\link[=plot_seasonal_diagnostics]{plot_seasonal_diagnostics()}} \item \strong{Visualizing Time Series:} \code{\link[=plot_time_series]{plot_time_series()}} } }
The Board of Directors wishes to announce that the Company, as part of a group of Malaysian Companies comprising Putera Capital Berhad ("PCB" or "the Company"), KUB Power Sdn Bhd ("KUBP"), Nexus Star Holdings Sdn Bhd ("NSHSB") and Realmild (M) Sdn Bhd ("RMSB") had on 28 May 2004 entered into a Memorandum of Agreement ("MOA") in Beijing, The People's Republic of China with China National Electric Equipment Corporation ("CNEEC") (collectively hereinafter referred to as "The Parties"). The purpose of the MOA is to jointly prepare a Technical and Financial Proposal to secure the Upgrading and Reinforcement of Tenaga Nasional Berhad ("TNB")'s current Transmission Lines and Substations and the Constuction and Completion of new High Voltage Transmission Lines and Substations, including the 500kV/275kV/132kV High Voltage Transmission Line and its associated Substations in Peninsular Malaysia (hereinafter called the "Missing Link" Project or "MLP") which is to be implemented and completed in line with TNB's 2003-2010 Electricity Demand Forecast. The Parties shall provide combined packages of Foreign (China) and Malaysian Private Sector Engine of Growth by financing for the foreign portions through China Export Credit and for the local portions through Malaysian Capital Market Funding and/or Public Private Partnership ("PPP"), Private Finance Initiative ("PFI") or Build Lease Operate and Transfer ("BLOT") Scheme, whichever is acceptable to the Malaysian Government and TNB. The MLP shall be undertaken on Privatisation Basis with the Scope of Works includes, inter alia:- 1. 455km of 500kV double circuit normal overhead transmission lines from Bukit Tarek to Yong Peng. 2. 170km of 500kV double circuit normal overhead transmission lines from Kuala Lumpur East to Paka. 3. 2 new 500kV Substations at Bentong and Lenggeng. 4. Upgrade of Yong Peng North, Yong Peng East, Permas Jaya, Bukit Batu, Olak Lampit, Junjung, Gurun and Kuala Lumpur East Substations to 500kV, as well as upgrade of Kg Awah and Paka Substation to 500kV. 5. Close the Loop between Salak South and Sentul Raya Substations with a 275kV double circuit normal overhead line. The estimated cost corresponding to the Scope of Works is USD1 (One) Billion, subject to confirmation upon completion of System Study covering technical, financial, legal, environmental and survey study by the Parties and acceptance of them by TNB. The Ministry of Energy, Water and Communications, Malaysia shall assist the Parties to procure TNB to enter into a MOA exclusively with the Parties and to co-operate with the Parties in providing all related data and information pertaining to the Scope of Works of the "Missing Link" Project. The costs and expenses incurred in the preparation of the System Study and the Proposal will be borne by CNEEC. If the Proposal is accepted by TNB, CNEEC shall be appointed as the Engineering, Procurement, Construction and Commissioning ("EPC") Contractor. If the Proposal is not accepted by TNB on ground of non-viability, NSHSB shall be responsible to reimburse the costs and expenses incurred by CNEEC in the preparation of the System Study and the Proposal.
Firmenname Desired Style: clean, professional, and relatively simple, but not boring Accepted File Formats: Vector Formats (.eps, .pdf or .ai) Blue Valley Insurance Agency needs a new logo to go along with a new website design. The in-progress website design is viewable at http://bvia.banyantheory.com. The main logo color should be approximately the same gray-blue that was used for the company's existing logo, available at http://www.bvia.com/Logo.jpg. Another acceptable color to use (if the original gray-blue is too designer unfriendly) is #4A5A78. Other like blues will be considered, but should be similar in order to stay consistent with the company's existing stationery. The website design will be updated to reflect the final logo color scheme, so please do not use the site design as a color reference. Please do, however, refer to it to make sure the logo fits the design. Note that the logo on the demo site is just a placeholder, and neither it nor the company's existing logo should influence the new logo design. The new logo should portray a clean, professional image of the company. It should have a transparent background, and it should be arranged in such a way that it is wide and short so as to fit in the same space as the placeholder logo. The exact dimensions of the placeholder is 356x61, but this is not a hard limit. Only the words "Blue Valley Insurance" are required. The word "Agency" is optional, and "Inc." is also acceptable if it fits nicely within the logo. The owner expressed interest in dropping "Agency" and "Inc." from the new logo, but in general prefers whatever best fits the design. The logo should be in vector format. Specifically, it must be able to be opened with Adobe Illustrator CS3. Please do not contact Blue Valley Insurance directly. This contest is being held on its behalf, by Banyan Theory, LLC (http://www.banyantheory.com).
THIS IS THE EXTREME LIFE CHANGER SHOW!MY NAME IS SONNY CARDONA AND THIS IS A SHOW ABOUT WHAT'S HAPPENING IN THE WORLD TODAY!!HOW THE SATANIC NEW WORLD ORDER IS TAKING OVER YOUR LIVES!!! LOG ONTO EXTREMELIFECHANGER.COM
‘Big Little Lies’ Viewers React to Nail-Biting, Blood-Soaked Finale Suffice it to say, the the final episode of Big Little Lies— HBO's latest miniseries that explored wealth, abuse and death in small-town California — left audiences positively shook. Last night (April 2), David E. Kelley's seven-part drama revealed the truth behind the season's two biggest mysteries: Who was killed at the Audrey Hepburn/Elvis Presley party, and who was behind the gruesome death? Across an hour-long episode, audiences finally got their answers and *SPOILERRRR* the perp was more unexpected than Adam Scott's cringeworthy karaoke set. In "You Get What You Need," Celeste's (Nicole Kidman) and Perry's (Alexander Skarsgard) domestic turmoil came to a head when Celeste finally resolved to leave her husband following a particularly gruesome fight in which he nearly knocked her unconscious. Perry confronted Celeste at the party and swore up and down he would change his ways (he routinely beat and degraded Celeste), and when he got the sense that Celeste would remain unmoved, and that she wouldn't consider staying with him, he lunged. In a scene spilling over with mania, Perry attacked Celeste and her friends Madeline (Reese Witherspoon) and Jane (Shailene Woodley), who swooped in to defend Celeste. Even the ladies' sworn enemy Renata (Laura Dern) put up her dukes to stop the maddened Perry. But even though the battle amounted to four-against-one, the ladies' couldn't stop Perry. Until one of them did. Out of the clear blue, Bonnie (Zoe Kravitz), the young, crunchy stepmother to Madeline's teenage daughter, sprinted to the site of the skirmish and, with a decisive shove, knocked Perry backwards down a flight of stairs and tumbling toward his bloody death. On Twitter, fans seemed equal parts relieved and shocked that Perry's death was the one the show had been forecasting all season. Secondarily, the shock that avowed pacifist Bonnie delivered the final blow was real among viewers. Still, they seemed strangely satisfied. Did you catch the Big Little Lies finale? What did you think? Share your thoughts in the comments.
The Count of Saint Elmo The Count of Saint Elmo (Italian: Il Conte di Sant'Elmo) is a 1950 historical adventure film directed by Guido Brignone and starring Massimo Serato, Anna Maria Ferrero and Tino Buazzelli. It was shot at the Titanus Studios in Rome. The film's sets were designed by the art director Ottavio Scotti. Plot On the way to perform at the opera in Naples, a famous singer is accosted by an outlaw leader who then proceeds to let her go with robbing anything. Later she believes she recognises the man as the Count of Sant'Elmo, although he indignantly denies this. She later discovers that he is in fact the leader of band of Carbonari fighting for Italian unification, battling the local chief of police Baron Cassano. Cast Massimo Serato as Count of Sant'Elmo Anna Maria Ferrero as Laura Cassano Tino Buazzelli as Baron Annibale Cassano Nelly Corradi as Bianca Barbieri Tina Lattanzi as Donna Clelia Carlo Croccolo as Alberico Alfredo Varelli as Don Paolo Pier Luigi Costantini as Forino Renato Malavasi as Anselmo Luigi Pavese as Security Officer Filippo Scelzo as Mancini Franco Pesce References Bibliography Chiti, Roberto & Poppi, Roberto. Dizionario del cinema italiano: Dal 1945 al 1959. Gremese Editore, 1991. External links Category:1950 films Category:1950s historical films Category:Italian films Category:Italian historical films Category:Italian black-and-white films Category:Italian-language films Category:1950s drama films Category:Films directed by Guido Brignone Category:Films set in Sicily Category:Films set in the 1860s
Текст песни группы Rolling Stones -"Might As Well Get Juiced" If you really want to rip up your mind If you want to take the lid off your life If you want to reach down in the sump To last dregs off the camel"s back hump And the wolves are howling right at your door And the vultures want to tear off some more Your flesh is burning right off your bones Your children kick you out of your home If you really want to tear up your mind If you really want to get yourself blind Might as well get juiced Might as well get juiced Hey mama What"s this crazy game of sevens, eights and nines I can"t keep up with you baby I"m gonna give you such a piece of my mind When I get around to it "Cause honey I"m abused Might as well get juiced If you really want to melt down your mind Crank it up to straight double time If you really want to have you some fun Spit right down on everyone If you"ve got the strength to scream out "Hell Why?" The wheels of life are passing you by You might as well get juiced Might as well get juiced Some people like to get high on love
Boston, MA - Boston Bruins General Manager Peter Chiarelli announced today, April 13, that the club has signed forward Carl Soderberg to a three-year, one-way contract through the 2014-15 season. The NHL approved the Standard Player Contract of Soderberg for registration today at 5:00 p.m. Soderberg’s salary is worth an annual cap figure of one million dollars. Soderberg will join the club Wednesday, April 17, and will be eligible for the remainder of the NHL regular season and Stanley Cup Playoffs. Chiarelli issued the following statement in regards to Soderberg: “We are fortunate to get a player like Carl at this stage of the season. I would like to thank the President of the Linkoping hockey club, Mike Helber and their GM, Johan Hemlin, in playing a significant part in allowing Carl to play for the Boston Bruins. Carl is a big strong two way center who can also play wing. We look forward to him joining our team this week.” In 54 games with Linkoping HC (Swedish Elite League) this year, Soderberg has registered 31 goals and 29 assists for 60 points with a +18 rating. The 27-year-old forward is ranked 1st the SEL in goals (31), second in points (60), seventh in assists (29) and 12th in plus/minus rating (+18). Linköping HC and Soderberg were eliminated from the Swedish Elite League Playoffs on Friday, April 5 with the final series score of 4-1. In 2011-12, Soderberg was second on Linköping HC in points (35) and assists (21), and was tied for second in goals (14). In two seasons with Linkoping HC, Soderberg has skated in 96 games, notching 45 goals, 50 assists for 95 points with a +24 rating. Prior to joining Linköping HC, the 27-year-old forward skated in 219 games with the Malmo Redhawks (Sweden 1st Division) from 2005-2010 tallying 80-159=239 totals with a combined +69 rating. The 6’3’’ 218-pound native of Malmo, Sweden was drafted by the St. Louis Blues in the second round (49th overall) the 2004 NHL Entry Draft. The Bruins acquired Soderberg from the Blues on July 23, 2007 in exchange for goaltender Hannu Toivonen.