text stringlengths 8 5.77M |
|---|
NVP-BEZ235, dual phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor, prominently enhances radiosensitivity of prostate cancer cell line PC-3.
Aberrant activation of phosphatidylinositol 3-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) pathway may account for development of radioadaptation and is not rare in prostate cancer. Neither PI3K nor mTOR blockade could completely inhibit the pathway owing to paradoxical feedback, so we anticipate dual PI3K/mTOR blockade by NVP-BEZ235 to radiosensitize prostate cancer cells. We investigated into the radiosensitizing effect of NVP-BEZ235 on PC-3 cells, which are devoid of androgen receptors. Clonogenic survival and MTT assays were performed, and to pursue underlying cellular changes flow cytometric analysis of cell cycle and apoptosis as well as western blot were carried out. Exposure to NVP-BEZ235 and irradiation caused a greater degree of survival inhibition than ionizing radiation (IR) or BEZ235 alone. Dual PI3K/mTOR blockade along with IR induced a G2/M arrest and enhanced proapoptotic effect. NVP-BEZ235 radiosensitized PC-3 cells through counteracting constitutive as well as IR-triggered activation of Akt/mTOR signaling. Our study demonstrated that the dual PI3K/mTOR inhibitor NVP-BEZ235 prominently improved the radiosensitivity of PC-3 cells. It sensitized tumor cells to irradiation via interruption of cell cycle progression and augmentation of cell apoptosis, which was due to its constraint on constitutive and IR-elicited PI3K/Akt/mTOR signaling activation. |
Green synthesis and electrophoretic deposition of Ag nanoparticles on SiO₂/Si(100).
Plasmonic substrates were prepared by electrophoretic deposition of Ag nanoparticles on SiO2/Si(100). The Ag nanoparticles were obtained using [Ag(NH3)2](+) as the Ag precursor and d-glucose as the reducing agent. Under optimized conditions, this simple and green synthesis method furnished a suspension of Ag nanoparticles with a narrow dimensional dispersion (centered around 27 nm) and a negative z-potential, suitable for electrophoretic deposition. Samples were chemically, optically and morphologically characterized by photoemission and UV-vis spectroscopy and electron microscopy, and tested as substrates for surface enhanced Raman spectroscopy. Despite being a very simple procedure, good enhancement factors were measured thanks to the formation of hot spots, formed by sandwiching the analyte (benzenethiol) between sequentially deposited Ag nanoparticles. |
Motorsport Marques: Honda
17.7K
Views
Honda has proven itself time and again that it knows how to do things right in motorsport.
Competition in international motorsport hasn't historically been quite as high a priority for Japanese brands as it is for those from other countries. It’s certainly not difficult to name examples to the contrary - Subaru and Mitsubishi in WRC or Mazda winning Le Mans in 1991 - but there is no Japanese equivalent to, say, Ferrari. Just the same, Honda’s level of involvement in motorsports has been much greater than other Japanese companies, and deserves more than just an honorable mention.
Honda’s automotive racing efforts began in earnest in 1964, when it entered Formula 1 as a constructor. At this point, Honda had only been building road cars for a few years, but already being the world’s largest motorcycle manufacturer, it wasn't totally new to the world of building vehicles. But Honda was one of the only constructors to build both its own engine and chassis, something only Ferrari and BRM had done before, and the practice continues to be quite rare. But despite this commitment, Honda wasn’t especially successful in F1 during the Sixties, and would leave in 1968.
Honda would stay active in Formula 2 for some time, and would eventually return to F1 in 1983 as an engine supplier. This would finally pay off in 1987, when Nelson Piquet would pilot a Honda-powered Williams car to the world championship. Honda switched teams after this, and with McLaren, powered five more championship cars. These included all three of the cars used by Ayrton Senna to win the championship. Honda stayed on as an engine supplier for some time, and although Honda-powered cars won races, there wasn’t another championship to be had after the ’87-’91 streak.
But Honda did come very close recently. Honda returned to F1 as a constructor in 2006, racing only a few years before deciding to withdraw as a result of the global financial crisis. The team was sold to Ross Brawn and became Brawn GP for the 2009 season. Brawn used the Honda-designed chassis, but a Mercedes engine was substituted for the original. It could be speculated upon endlessly whether a Honda engine would have produced the same result, but it was in the Brawn car that Jensen Button won the 2009 World Championship.
Honda isn’t the only Japanese company to enjoy success in F1. Infiniti's partnership with Red Bull uses engines from its sister-company Renault, while Toyota's foray into grand prix racing failed to materialize into success. Just the same, it is really with the smaller cars where Honda has the greater success in racing. This first took the form of CART engines, starting in 1994, with Honda-powered cars enjoying a championship-winning streak that lasted from 1996 to 2001. Honda would switch to IndyCar in 2004, and after Honda cars won two championships in a row, Honda became the sole engine supplier to IndyCar in 2006.
For the running of the 2006 Indianapolis 500, every car was run with a Honda engine, and it became the first running of the race in history to not have a single engine problem. Honda is no longer the only engine supplier, but its small engines are still absolutely world-class. Honda’s motorcycles have been at the forefront of two-wheeled racing much longer than its cars on four, both on the road and on the track. Its first foray into motorcycle racing was the 1959 Isle of Man TT, and from there it has evolved into one of the most successful brands in GP racing.
Of course, this follows the theme that Honda really does best in racing that involves smaller engines. But just because it isn't always as high-profile, that doesn't mean that Honda isn't winning races. It is a hugely important manufacturer in its given areas of competition, and that is no easy feat. |
Many computer-related applications incorporate some level of security to restrict user access. For example, in many applications, it is often necessary that a user of a computer provide a password to log on to a computer and corresponding network. The use of a password provided by a user affords at least some level of protection against intruders that would otherwise tamper with a computer and its contents.
Although the use of a password can be advantageously incorporated in many applications, there are sometimes drawbacks associated with their use. For instance, a user can forget a password if it is not used for an extended period of time. In some cases, a user can forget his or her password after returning from a long vacation.
To make matters worse, some systems require a user to change the password on a periodic basis for heightened security. This only adds to the difficulty of keeping track of a password at any given time. Even if a password is written on a piece of paper for later reference, the paper can be easily lost or destroyed, thwarting its purpose.
A password is also easily replicated to the extent that it can be transferred from one person to another by word of mouth. Thus, if a hacker breaks into a computer system and retrieves a user's password, this key is easily passed on to other vandals who can then tamper with a computer system and its contents. Moreover, a user that is assigned a password can misplace his or her trust in a friend who carelessly reveals a password to others even though it was intended to be kept secret.
These potential drawbacks are particularly disturbing since a corporation's most valuable asset is quite often information accessible by a user logging onto a password-protected computer. |
In vivo linear microcracks of human femoral cortical bone remain parallel to osteons during aging.
Previous studies have examined the density of microdamage within the cortex of long bones mostly from the viewpoint that is perpendicular to the long axis of the bone. The goal of the present work is to conduct a systematic characterization of the microcracks from a viewpoint that is parallel to the long axis of a load-bearing bone, the femur, so as to gain a better understanding of the size, shape and orientation of the microdamage. Longitudinal cross sections were taken at the mid-diaphysis of femurs from 13 male donors (23-85 years old) after being stained with basic fuchsin. The number of cracks, their lengths and orientation with respect to osteons were characterized using brightfield and UV-epifluorescent imaging. The mean crack density was 0.1118+/-0.0417 mm(-2) in the longitudinal plane and it significantly increased with age. The median crack length along the longitudinal plane did not change with age. The crack length in the posterior quadrant was significantly lower than anterior, medial and lateral quadrants. Less than 3% of the cracks were longer than 1 mm, indicating the presence of 'in vivo macroscopic' cracks in bone tissue. It was observed that the 99% of the cracks had angles that were less than 25 degrees with the osteons (median angle of 4.2 degrees with an interquartile range of 5.8 degrees ), indicating that the majority in vivo linear microcracks are parallel to osteons. This parallelism did not differ between quadrants nor changed with age. The remarkably stagnant crack length and crack orientation across decades of aging suggest that either physiological loading profile leading to these in vivo microcracks are not changing notably with age, or, microcrack and osteonal orientations may be relatively insensitive to age-related changes in locomotion. In conclusion, in vivo linear microcracks of the femoral mid-shaft grow in planes parallel to osteons and their lengths do not increase with age. |
“It’s not enough to say that socialism is the solution. In the 21st century, fighting capitalist ecocide must be at the heart of our vision, our program and our activity.”
by Ian Angus
Ian Angus is editor of Climate & Capitalism. This is the text of his talk at the Socialism 2013 conference in Chicago, June 29, 2013. It has been lightly edited for publication.
UPDATE: Video of this talk is now online
I’ll start with two quotations.
The first is the opening sentence of Chris Williams’ excellent book, Ecology and Socialism.
“There is a giant death sentence hanging over much of our world.”
If you’ve read Chris’s book, you know that is not an exaggeration: There is a giant death sentence hanging over much of our world, and only a mass revolutionary movement can stop the execution.
My second quotation is the slogan that has appeared on the masthead of Climate & Capitalism for seven years. We borrowed and paraphrased a famous statement by Rosa Luxemburg:
“Ecosocialism or barbarism: There is no third way.”
Today, I want to make two arguments that are implicit in Chris’s sentence and in Climate & Capitalism’s slogan.
My first argument will be that the environmental crisis we face today is not a simple extension of capitalism’s centuries-old war with nature. In the last half of the 20th century, what Marx and Engels called the “metabolic rift” became qualitatively wider, qualitatively more serious.
My second argument will be that because the metabolic rift has become a global ecological abyss, socialists today must be ecosocialists. Not because the word itself is particularly wonderful, but because in our time the fight against environmental destruction is central to the fight against capitalism.
It’s not enough to say that socialism is the solution. In the 21st century, fighting capitalist ecocide must be at the heart of our vision, our program and our activity.
A century ago, the founders of the Communist International had to deal with a new phenomenon – imperialism – and had to make the fight against imperialism central to their work or be doomed to irrelevance. To make that change very clear to everyone, they rewrote one of the most time-honored of all revolutionary slogans: The changed “Workers of all countries unite!” to say “Workers of all countries and all oppressed peoples, Unite!”
As I’m sure you know, revolutionaries are often pretty conservative people. Inevitably, some comrades objected to that change. Lenin himself replied:
“Of course, the modification is wrong from the standpoint of the Communist Manifesto, but then the Communist Manifesto was written under entirely different conditions.”
The Bolsheviks knew that a truly revolutionary program must respond to reality. When reality changes, our program must change too.
Today we are in a comparable situation. We face a global environmental crisis that is qualitatively more serious than anything socialists 50 years ago could have imagined. We must adjust our thinking and our actions to respond to that reality.
We need to take the beginning points that ecosocialism offers today, and to build on them using the method of Marxism, using the best scientific work of our time, and using the lessons we learn in struggles for change. We must apply our new understanding in a wide variety of places and circumstances.
So please consider this the beginning of a discussion, not a final declaration!
From The Closing Circle to the Great Acceleration
The idea that humanity’s relationship with the biosphere changed qualitatively during the 20th century isn’t new, although it has not been widely discussed until recently.
To my knowledge the first person to argue it explicitly was the radical biologist and ecologist Barry Commoner. His analysis of the environmental crisis, published 40 years ago, stands up very well today.
In the 1960s and 1970s, when the modern environmental movement was being born, most environmentalists held that environmental problems were a result of a permanent conflict between humans and nature, so the only way to stop pollution and environmental degradation was to reduce the number of people.
That view is still very common today. The defenders of that view frequently point to past societies that cut down all their trees, exhausted their farmlands, or otherwise undermined the natural basis of their existence.
Barry Commoner didn’t deny that human activity damaged or even destroyed ecosystems in the past. But in classic his 1971 book The Closing Circle, he argued that the modern environmental crisis is qualitatively different.
In the second half of the 20th Century environmental destruction went from gradual to rapid, from short-term to long-term and often permanent, and from local to global.
In Commoner’s words, “most pollution problems made their first appearance, or became very much worse, in the years following World War II.” It was then, he said, that “the fabric of the ecosphere begin to unravel.”
The unravelling, he showed, was closely associated the spectacular expansion of the petroleum and petrochemical industries, which produced immense volumes of products and wastes that nature could not recycle, and at the same time stimulated a huge expansion in the amount of energy used in production and transportation.
Much of his book was devoted to documenting that transformation, and showing that it could not possibly be explained by population growth. He argued, very convincingly, that the worldwide deployment of destructive technologies and products was driven by capitalism’s inherent need to grow.
The new technologies were adopted because they were more profitable – but they only more profitable because corporations didn’t have to pay for the environmental damage they caused.
“The environmental crisis,” Commoner wrote, “reveals serious incompatibilities between the private enterprise system and the ecological base on which it depends.”
Sadly, Barry Commoner lost the battle of ideas in the green movement. The advocates of population control became dominant in the environmental movement and in mainstream ecology.
Even more sadly, the socialist left did not take up Commoner’s arguments. His most important book, The Closing Circle, has long been out of print.
But today, although he isn’t getting credit, Barry Commoner’s view that there was a radical environmental turning point after World War II is gaining widespread acceptance.
In 2000, the Nobel Prize winning chemist Paul Crutzen made a convincing case that the Industrial Revolution marked the beginning of a new geological epoch, a time when humans and human society are the dominant force shaping our planet. He proposed to name this epoch the Anthropocene – the New Human epoch. That proposal has not been officially adopted yet, but it has won wide support in scientific circles.
More recently, Crutzen joined with ecologist Will Steffen and historian John McNeill to make a further proposal, to divide the Anthropocene into two eras – the Industrial Era, from 1800 to 1945, and the Great Acceleration, from 1945 to the present.
After World War II, they write, “the most rapid and pervasive shift in the human-environment relationship began.” On almost every possible measure, “the human enterprise suddenly accelerated.”
They’ve published graphs showing increases in water use, greenhouse gas emissions, paper consumption, motor vehicles, urban population, and more, since 1950. Some show no activity at all before 1950, others show slow increases prior to 1950 — all show a sudden shift into high gear after 1950. The graphs suddenly go almost straight up.
In short, scientists today are rediscovering and documenting the radical environmental transition that Barry Commoner described over 40 years ago. We can only hope that they will eventually adopt his radical social conclusions, as well.
Interlocking crises
With the Great Acceleration, capitalism’s assault on the biosphere entered a new phase, one defined by, as John Bellamy Foster says, “a qualitative transformation in the level of human destructiveness.”
As a result, we face what is usually called the global environmental crisis. A few months ago, Monthly Review justly suggested we call it a Planetary Emergency.
The emergency comprises an interlocked set of crises in the fundamental natural processes that have made Earth habitable for millions of years.
In 2009, a group of 28 internationally renowned scientists associated with the Stockholm Resilience Center identified and quantified nine planetary boundaries that define what they call a “safe operating space for humanity.” Crossing any one of those thresholds, they wrote, could have “deleterious or even disastrous consequences for humans.”
In fact, we have already crossed three of them, and we are getting close to the red line on four more. Seven of the nine critical planetary boundaries are close to or in the danger zone.
Climate change is the best-known and most critical case. The Stockholm study says that once the level of carbon dioxide in the atmosphere passes 350 parts per million, the climate system becomes increasingly unstable and catastrophic tipping points become possible.
As you probably know, the level is now at 400 parts per million, so that boundary has been passed, and we are now solidly in the climate danger zone.
We are also over the red line for interference with the nitrogen cycle, which results primarily from overuse of artificial fertilizers, and for loss of biodiversity caused by the highest rate of species extinctions in tens of millions of years.
The crisis is now
There is a tendency in discussing these environmental crises, to say that catastrophes will happen if we don’t act soon, in 10 or 20 years. In a sense that is true, but it is misleading.
In reality, catastrophic change has already begun.
According to the Global Humanitarian Forum, a think tank headed by former UN Secretary General Kofi Annan, there are already 300,000 deaths every year that would not have happened without climate change.
Nearly half of those deaths are children aged five years or younger, dying in agony from diarrhea or malaria, diseases whose frequency and intensity has been massively increased by global warming.
Think about that. Every 210 seconds, a small child dies because greenhouse gas emissions are out of control.
No society that permits that to happen deserves to be called civilized. No society that causes it to happen deserves to continue.
Another study shows that in 2012, over 30 million people were forced out of their homes by climate- and weather-related disasters. By way of comparison, in 1945, after six years of total war, there were about 40 million refugees in Europe. Now, three-quarters as many are displaced by climate disasters in one-sixth of the time.
But temporary displacements caused by storms and floods are only a small part of environmental refugee story. The United Nations estimates that one-third of the people who live in urban slums in Africa are there because advancing deserts and failing farms have made their traditional homes uninhabitable. In Asia, in Bangladesh alone, over 400,000 people move into the capital city, Dhaka every year. Most are environmental refugees.
And this is only the beginning. I don’t intend this talk to be a list of disaster stories, but it could well be. The point is that a global environmental crisis is already here. It is already killing and displacing millions of people. It requires action now.
The planetary emergency is already upon us. If we delay, it will get much worse.
A four degree world
International agreements say that the global average temperature increase should be less than 2 degrees Celsius over the pre-industrial level, to avoid disastrous climate change. Many scientists say the limit should be lower.
But if current trends continue, there is no chance of staying below 2 degrees, and there is a strong possibility that the increase will be twice that level.
Recently the World Bank warned that even if all countries meet their commitments to reduce greenhouse gas emissions, the world is likely to warm by more than 3°C. If they don’t, global warming could exceed 4°C as early as the 2060s.
The World Bank report has a provocative title: Turn Down the Heat: Why a 4°C Warmer World Must Be Avoided. In it the World Bank’s president writes:
“The 4°C scenarios are devastating: the inundation of coastal cities; increasing risks for food production potentially leading to higher malnutrition rates; many dry regions becoming dryer, wet regions wetter; unprecedented heat waves in many regions, especially in the tropics; substantially exacerbated water scarcity in many regions; increased frequency of high-intensity tropical cyclones; and irreversible loss of biodiversity, including coral reef systems.
“And most importantly, a 4°C world is so different from the current one that it comes with high uncertainty and new risks that threaten our ability to anticipate and plan for future adaptation needs.”
And just last month the International Energy Agency said that even if current promises are kept, “the long-term average temperature increase is more likely to be between 3.6 °C and 5.3 °C … with most of the increase occurring this century.”
But no one expects the worst polluters to keep their promises. Emissions aren’t slowing down, they are speeding up, and the world is speeding into climate hell.
What’s worse, the climate crisis is only part of the story – even if by some miracle, emissions were cut to zero tomorrow, six other planetary boundaries would still be in danger.
What humanity faces in this century is not just deterioration of the conditions of life in one area or even one country.
The metabolic rift is now global, and there is now a very real possibility that it will throw all of humanity into a new dark age, that all our dreams of a better world will be replaced by unending nightmares.
Socialists and the crisis: theory but not practice?
I think most socialists and socialist groups would agree with what I’ve said so far, at least in general terms. Capitalism is destroying the earth, socialism is the solution.
And yet, when I compare the socialist literature on the environmental crisis with the actual socialist response in action, I am struck by the gap between theory and practice.
I have a shelf full of books that offer Marxist perspectives of environmental crises, especially of global warming. All show clearly that capitalism is the cause, and all say socialism is the solution. But very few of them, almost none, offer concrete proposals for actually making the necessary change.
It’s as though Marx wrote: “The philosophers have interpreted the world in various ways … and that’s good enough.”
As Nick Davenport wrote recently in an article we published in Climate & Capitalism, socialists have tended to treat the environmental crisis as a stick to beat capitalism with, as another proof that capitalism must go, but not as an arena of the class struggle to which we must be fully committed.
There have been some significant exceptions. The Socialist Alliance in Australia for example, defines itself as ecosocialist, and has played an important role in building environmental movements there. There are other examples in Europe. Closer to home, I have been impressed by the growing involvement of members of the International Socialist Organization in the fight against capitalist ecocide across the U.S., and I see that the Solidarity is discussing ecosocialism in its current pre-convention period.
But in general, environmental action has not been treated as a strategic priority by organized socialist groups in the Global North.
That needs to change. In the 21st century, socialists must be ecosocialists. To stop capitalist ecocide, we need both the scientific insights of modern ecology and the revolutionary social analysis that only Marxism provides.
That’s why I am very excited about the recent formation of System Change Not Climate Change – the Ecosocialist Contingent, and about the reports I’ve heard this weekend on the growing activity of ISO members. I hope we are seeing a turn in the North American socialist left towards environmental activism, and towards ecosocialism.
What does ‘being ecosocialist’ mean?
The word “ecosocialism” isn’t copyrighted. Just like the word “socialism,” it means different things to different people. I can only present my own perspective, and I won’t be at all surprised if some ecosocialists disagree with what I have say.
For me, ecosocialism is not a new theory or brand of socialism — it is socialism with Marx’s important insights on ecology restored, socialism committed to the fight against ecological destruction.
Ecosocialism is not a separate organization, it is a movement to win existing red and green groups and individuals to an ecosocialist perspective.
It is socialism that recognizes, in John Bellamy Foster’s words, that “there can be no true ecological revolution that is not socialist; no true socialist revolution that is not ecological.”
And it is socialism that is actively engaged in peoples’ struggles against capitalism’s assaults.
Increasingly, the planetary emergency is directly affecting the lives of working people, farmers, indigenous communities, and all of the oppressed. As capitalism continues its relentless drive to expand no matter what damage it causes, we will see – we are already seeing — increasing resistance.
Many of these struggles will focus on narrow issues, and many of the participants will have huge illusions about what can be done within the system. That’s inevitable.
The worst mistake socialists can make in such circumstances – unfortunately it’s a mistake that many socialists do make – is to stand on the sidelines because a given campaign isn’t radical enough, or because it doesn’t fit someone’s preconceptions of what a movement ought to look like.
We need to remember Marx’s great insight that people in large numbers don’t change themselves and then change the world – they change themselves by changing the world.
As Rosa Luxemburg wrote, class-consciousness and organization aren’t created by simply by pamphlets and leaflets, but “by the living political school, by the fight and in the fight.”
In Rebuilding the Left, the Chilean Marxist Marta Harnecker puts it this way:
“Being radical is not a matter of advancing the most radical slogans, or of carrying out the most radical actions….
“Being radical lies rather in creating spaces where broad sectors can come together and struggle. For as human beings we grow and transform ourselves in the struggle.
“Understanding that we are many and are fighting for the same objectives is what makes us strong and radicalizes us.”
Only through and in struggles for change can we reach and win the many people who today find it easier to imagine the end of the world than the end of capitalism.
We need to be patient – as another famous Marxist said, we must “patiently explain.” Contrary to the liberals who think we should place our faith in Democratic politicians, and contrary to the advocates of guerrilla attacks on infrastructure, there really is no shortcut to “creating spaces where broad sectors can come together and struggle.”
But we also need to be prepared for unexpectedly rapid shifts. Let’s learn from Turkey, where a mass movement against the regime exploded from what at first seemed to be a very modest environmental protest, a fight to save a park.
The fight for Gezi Park and Taksim Square is not an isolated case. In our time, when the Great Acceleration is pushing us to the edge, and when capitalism’s ability to maneuver on even small environmental problems is severely limited, we will see more and more such conflicts.
That’s especially true in the Global South, where catastrophic environmental change is a present reality, and where the fight to save the environment and the fight against imperialism are visibly and inextricably linked. But it’s also true here in the belly of the beast.
Lenin famously wrote that revolutionaries must not restrict themselves to a narrow, economic understanding of class struggle. He said we must be tribunes of the people, responding to “every manifestation of tyranny and oppression, no matter where it appears, no matter what stratum or class of the people.”
In our time, revolutionaries cannot be tribunes of the people unless we are also tribunes of the environment. We must respond, to the best of our ability, to every manifestation of capitalist environmental destruction.
That’s why I like the word ecosocialism. Not because we need a new kind of socialism, but because the word signals loud and clear that we don’t view environmental destruction as just another stick to bash capitalism with.
It is also why I prefer to spell ecosocialism as one word, without a hyphen. Because the “eco” part is not an add-on. It is – and must be — integral to socialism in the 21st century.
We are ecosocialists because the environmental crisis isn’t just a talking point – it’s a planetary emergency that revolutionaries must confront as a top priority.
We need to initiate and join struggles for immediate environmental aims. We need to participate, not as sideline critics, but as activists, builders and leaders.
The world we want
And at the same time, we need to find the best ways to “patiently explain” how those struggles relate to the larger fight to save the world from capitalist ecocide. In our book, Too Many People?, Simon Butler and I expressed the goal of that larger fight this way:
“In every country, we need governments that break with the existing order, that are answerable only to working people, farmers, the poor, indigenous communities, and immigrants — in a word, to the victims of ecocidal capitalism, not its beneficiaries and representatives.”
Such governments will have two fundamental and indivisible characteristics.
First, they will be committed to grassroots democracy, to radical egalitarianism, and to social justice. They will be based on collective ownership of the means of production, and they will work actively to eliminate exploitation, profit and accumulation as the driving forces of our economy.
Second, they will base their decisions and actions on the best ecological principles, giving top priority to stopping anti-environmental practices, to restoring damaged ecosystems, and to re-establishing agriculture and industry on ecologically sound principles.
We suggest some of the first environmental measures such governments might take. Our suggestions include:
rapidly phasing out fossil fuels and biofuels, replacing them with clean energy sources;
actively supporting farmers to convert to ecological agriculture; defending local food production and distribution;
introducing free and efficient public transport networks;
restructuring existing extraction, production, and distribution systems to eliminate waste, planned obsolescence, pollution, and manipulative advertising, and providing full retraining to all affected workers and communities;
retrofitting existing homes and buildings for energy efficiency;
closing down all military operations at home and elsewhere; transforming the armed forces into voluntary teams charged with restoring ecosystems and assisting the victims of environmental disasters.
Our suggestions aren’t carved in stone, and I’m sure you can think of many other essential changes.
Those are transitional measures, steps towards what Fred Magdoff has called “a truly ecological civilization — one that exists in harmony with natural systems.”
Magdoff lists eight characteristics that an ecological civilization would have. It would:
stop growing when basic human needs are satisfied;
not entice people to consume more and more;
protect natural life support systems and respect the limits to natural resources, taking into account needs of future generations;
make decisions based on long-term societal/ecological needs, while not neglecting short-term needs of people;
run as much as possible on current (including recent past) energy instead of fossil fuels;
foster human characteristics and a culture of cooperation, sharing, reciprocity, and responsibility to neighbors and community;
make possible the full development of human potential, and;
promote truly democratic political and economic decision making for local, regional, and multiregional needs.
As Fred Magdoff says, a society with those characteristics would be “the opposite of capitalism in essentially all respects.”
Today, we must be ecosocialists
Such a profound transformation will not “just happen.” In fact, it will not happen at all unless ecology has a central place in socialist theory, in the socialist program, and in the activity of the socialist movement.
There was a time when you could make a case that environmental destruction, though serious, was no more critical than any of capitalism’s other crimes.
That time is long past.
Capitalism has driven us to a crisis point in the relationship between humanity and the rest of nature – if business as usual continues, major ecological collapse isn’t just possible but probable, and that will put civilization at risk.
There is a giant death sentence hanging over much of our world, and capitalism is the executioner.
That’s why Climate & Capitalism rewrote Rosa Luxemburg’s famous warning, to say that humanity must choose between ecosocialism and barbarism.
And that’s also why, in the 21st century, socialists must be ecosocialists, and humanity needs an ecosocialist revolution. |
Q:
Can't load Facebook comments when loading content dynamically using Ajax/jQuery
I am having issues getting Facebook comments to load after adding them to a webpage using ajax.
Javascript Code:
$().ready(function() {
$(document).delegate(".image a", "click", function() {
$("#dynamic-image").load($(this).attr("href"), {ajaxload:1}, function() {
$("#dynamic-image").css("display","block");
$('#dynamic-image').lightbox_me({
zIndex: 999,
centered: false,
modalCSS: {top: '10px'},
overlayCSS: {background: 'black', opacity: .9},
onLoad: function() {
$("#dynamic-image").css("display","block");
FB.XFBML.parse(document.getElementById('ajax-fb-comments'));
},
onClose: function() {
$("#dynamic-image").css("display","none");
}
});
});
return false;
});
});
HTML5 Facebook comments code:
<div class="fb-comments" data-href="<? echo the_permalink(); ?>" data-width="627" data-num-posts="10" data-colorscheme="light" id="ajax-fb-comments"></div>
I have tried using both XFBML and HTML5 Facebook comment code and neither worked. I have used FB.XFBML.parse() before, I have it working fine with dynamically loaded like buttons however its having issues with the Facebook comments, they just don't load and there are no Javascript errors.
A:
I got this to work.
All I had to do was use "FB.XFBML.parse()" and target the div that was around the fb comment tags.
|
The estimated $8 billion a year generated worldwide by the trafficking of humans are the tainted profits of “a most egregious form of slavery,” according to Kent Hill, a senior health official with the U.S. Agency for International Development (USAID). |
Distribution of Candida species in women with vulvovaginal symptoms and their association with different ages and contraceptive methods.
The aim of this study was to determine the frequency and distribution of Candida spp. within different age groups and different contraceptive methods users in women with vulvovaginal symptoms. The study included 569 female outpatients who had visited the Education and Research Hospital of Mustafa Kemal University, Turkey, between Jaunary 2004 and June 2005. Among 569 women with symptoms of vulvovaginitis, 240 (42.2%) were positive for Candida spp., of which 106 (44.2%) were C. albicans and 134 (55.8%) were non-albicans spp. The age group 26-30 y had the highest frequency of Candida spp. (23.7%). Candida spp. were isolated from 44.2% of contraceptive method users, and 37.9% of non-contraceptive users (p>0.05). The isolation rate of C. albicans was higher among oral-contraceptive users (57.5%) than IUCD users (38.5%), coitus interruptus (48.5%) and condom users (42.8%). These results indicate that factors associated with age and contraceptive method used may influence the occurrence and distribution of Candida spp. in women with vulvovaginal symptoms. |
Thursday, July 20, 2017
Let's Learn Sinhalese in English 4
Now let’s learn
how to express something that is going to happen in the future (that
is, construction of the future tense sentences). There are mainly
four ways. We will consider all forms (like negative statement,
questions, etc) of the same sentence.
There is nothing to
learn anew in the first method. Actually, you can use the same
present time sentence you have been learning so far here. Usually you
use an adverb (like tomorrow) that denotes future with that too (it’s
not required though).
Stephanie heta e:ka kiyanava: . (Stephanie will tell it
tomorrow.)
Api anidhdha: yanava: . (We will go day after tomorrow.)
Egollo e:ka karanava: . (They will do it.)
The negative
statement form is just the same negative statement that you have
already learned.
There is another
popular way of expressing something in future (the second method). In
that sentence pattern, you just change the ending of “-nava:”
verb. To construct this future tense verb, you first remove the
“-nava:” part, and you append “-a:vi”.
Balanava: →
Balanava: + a:vi → Bala:vi (will look)
Karanava: →
Kararanava: + a:vi → Kara:vi (will do)
Now you can make
future tense sentences as follows.
Shane ya:vi. (Shane will go.)
Ayda bath uya:vi. (Ayda will cook rice.)
Gasa kapa:vi. (The tree will be cut.)
However, this form
of future tense is not used with a subject of I or We (first person
pronouns). If you use this form of verb with I or We, that would be a
future time sentence of course, but additionally that sentence will
mean an indefinite expression (uncertain whether or not the action
will be done). In short, such a sentence is expressed in English with
the helping verbs of “may, might”.
Man ya:vi. (I may go. / I will probably go.)
Api e:ka kara:vi. (We may do it. / We will probably do it.)
Surprisingly, if you
want to express an indefinite future tense (just as discussed in the
previous paragraph) with any subject (in addition to I and We), we
use this same sentence. So, this sentence pattern has two meanings
with any noun/subject other than I, We – one is “normal future
tense”, and the other is “indefinite future tense”.
Eya: ya:vi. (He will probably go. / He may go.)
Natalie e:vi. (Natalie may come. / Natalie will probably
come.)
Oya: e:ka kiya:vi. (You may tell it. / You will probably tell
it.)
The negative
statement of this second kind of future tense pattern is as same as
the normal negative statement you already know.
Shane yanne naehae. (Shane will not go.)
(remember this same sentence has the meaning of “Shane does not
go” and “Shane is not going”; take the correct
meaning based on the context)
Ayda bath uyanne naehae. (Ayda will not cook rice.)
(also, “Ayda does not cook rice” and “Ayda is not
cooking rice”)
To form the positive
question, you just add “-dha” at the end of the verb of
the positive statement as follows. This question form also applies to
the indefinite future tense.
Shane ya:vidha? (Will Shane go? Or May Shane go?)
Ayda bath uya:vidha? (Will Ayda cook rice? Or May Ayda cook
rice?)
There is another popular way to construct the negative
question. It is formed like this. First assume that “-nava:” verb
form is there; now remove “va:” from that "assumed" verb. After that, you
put “ekak naehae” at the end. This also applies to the
indefinite future tense. See how it is done below.
The third method is
exclusive for the subject of I or We (first person pronouns). It is
similar to English “shall” sentences. Here, the “-nava:”
ending of the verb is changed to “-nnam”.
Mama yanava: . → Mama yannam. (I shall go.)
Api e:ka kohomahari karannam. (We shall do it somehow or
other.)
The negative
statement of this type of sentence is as same as normal negative
statement.
Mama yanne naehae. (I shall not go.)
Api e:ka karanne naehae. (We shall not do it.)
This is how we
construct the positive question. You remove “m” from the verb
(let’s call this verb participle “nna verb” from this
moment on), and append “dha”. Actually, this is how we make
request in Sinhala too.
Karannam →
Karannam + dha = karannadha
Mama yannadha? (Shall I go?)
Api e:ka karannadha? (Shall we do it?)
Last let’s make
the negative question. First remove “m” from the verb like we did
earlier (that is, make the “nna verb”), and put “epa:dha”
after that.
Karannam →
Karannam epa:dha = karanna epa:dha
Mama yanna epa:dha? (Shall I not go?)
Api e:ka karanna epa:dha? (Shall we not do it?)
The fourth method of
making a future tense is similar to “be going to” sentence
pattern in English. Here, we use the “nna verb” and after that we
put “yanne” or “yanava:”.
Mama potha kiyavanna yanne/yanava: .
(I am going to read the book.)
Eya: nidiyanna yanava:/yanne.
(She/He is going to sleep.)
If you substitute
“inne” or “innava:” for “yanne” or
“yanava:” in the above sentence pattern, then you change the
meaning from “be going to” to “be planning to” or “be
about to”. It also gives kind of future meaning.
Mama potha kiyavanna inne/innava: .
(I am planning to read the book. / I am about to read the book.)
Eya: nidyanna inne/innava: .
(He/She is planning to sleep.)
Let’s make
commands in Sinhala now. It’s very easy. Always the command is
directed to the person in your presence (that is, “you”).
It’s the same as in English. Follow the normal Sinhala sentence
order. Here, the doer is “oya:” (singular) or
“o:gollo/o:gollan, oya:la:” (plural) subject. You can omit
it if you like (as in English). There is a small change in the verb
ending; you just put the “nna verb” instead of the normal “-nava:
verb” form.
Oya: yanna.
(You go.)
Yanna.
(Go.)
Oya: bath ho’mdin kanna.
(You eat rice well.)
Bath kanna.
(Eat rice.)
Ogollo loku potha kiyavanna.
(You (plural) read the big book.)
Potha kiyavanna.
(Read the book.)
To give a command
not to do something, you just put “epa:” after verb, or
before the subject (if existing), or after the subject (whether or
not it exists).
Oya: yanna epa: .
Epa: oya: yanna.
Oya: epa: yanna.
(You don’t go.)
Yanna epa: .
Epa: yanna.
(Don’t go.)
Oya: bath kanna epa: .
Epa: oya: bath kanna.
Oya epa: bath kanna.
(You don’t eat rice.)
Bath kanna epa: .
Epa: bath kanna.
(Don’t eat rice.)
Ogollan potha kiyavanna epa: .
Epa: ogollan potha kiyavanna.
Ogollan epa: potha kiyavanna.
(You don’t read the book.)
Potha kiyavanna epa: .
Epa: potha kiyavanna.
(Don’t read the book.)
If you want to make
the command more polite, you can put “karuna:karala”
(please) at the beginning or the end of the command.
Karuna:karala oya: yanna.
Oya: yanna karuna:karala.
(You go please.)
Karuna:karala yanna
Yanna karuna:karala.
(Go please.)
Karuna:karala oya: yanna epa: . / Oya: yanna epa: karuna:karala.
Karuna:karala epa: oya: yanna. / Epa: oya: yanna karuna:karala.
Karuna:karala oya: epa: yanna. / Oya: epa: yanna karuna:karala.
(You don’t go please.)
Karuna:karala yanna epa: . / Yanna epa: karuna:karala.
Karuna:karala epa: yanna. / Epa: yanna karuna:karala.
(Don’t go please.)
If you like, you can
substitute “please” for “karuna:karala” too. For
example,
Please oya: yanna. / Oya: yanna please.
(Please go.)
Please yanna epa: . / Yanna epa: please.
(Please don’t go.)
You can make the
command milder. And it probably can be considered as a plead now
(instead of a command). For that, you append “-ko” to the
“nna verb”. You may include “please” or “karuna:karala”
to make it “much milder”. There is no negative form of this.
Oya: yannako.
Yannako oya:
Yannako.
(Go. Will you?)
You can also make
the command stronger/stringent. You specially use this form of
command when you are mad at somebody (or scolding somebody or in a
quarrel, etc). You never use this form of command at your parents,
older relatives, teachers, honorable people, etc. It’s harsh. To
make this harsh command, you put a verb made as follows (you remove
the “nava:” from the “nava: verb” form, and append “pan”
to it). No negative form of this exists.
Karanava: →
Karanava: + pan = Karapan
Potha liyapan.
(Read the book.)
Surprisingly, this
same command form is used among friends too. Then it has no
harsh meaning, but instead it gets a friendly meaning. Only in this "friendly"
situation, you may add “please” or “karuna:karala” to this "-pan" type
command. |
From June 26-30, 2019, 34 prospective Native American pre-law applicants from across Indian Country attended the Native American Pipeline to Law Initiative at UC Berkeley in Berkeley, C.A. During this five-day intensive program, students heard from law school admissions professionals, law professors, law students, and more about applying to and attending law school. This year, we were fortunate enough for Olympian Billy Mills (Oglala Lakota) to surprise us!
The Pipeline’s mission is to provide serious preparation for Native law applicants, as well as to connect applicants to the invaluable resources and support they need from professionals. The program even includes an introduction to and support for taking the LSAT. Former participants of this program have gone on to complete PLSI and law school.
The Pipeline to Law Initiative will be held again during the summer of 2020. If you’re interested in providing financial support to this program or have more questions, please contact Kate Rosier. |
College gender gap widens: 57% are women By Mary Beth Marklein, USA TODAY In May, the Minnesota Office of Higher Education posted the inevitable culmination of a trend: Last year for the first time, women earned more than half the degrees granted statewide in every category, be it associate, bachelor, master, doctoral or professional. Women currently make up 57% of all college students. By Alison Redlich, The Burlington Free Press Cause for celebration — or for concern? Before you answer, consider the perspective of Jim McCorkell, founder of Admission Possible, a St. Paul program to help low-income high school kids prepare for college. Last year, 30% of the students were boys. This fall, that has inched up to 34%, but only because "we actually did a little affirmative action," McCorkell says. "If we had a tie (between a male and a female applicant), we gave it to a boy." As women march forward, more boys seem to be falling by the wayside, McCorkell says. Not only do national statistics forecast a continued decline in the percentage of males on college campuses, but the drops are seen in all races, income groups and fields of study, says policy analyst Thomas Mortenson, publisher of the influential Postsecondary Education Opportunity newsletter in Oskaloosa, Iowa. Since 1995, he has been tracking — and sounding the alarm about — the dwindling presence of men in colleges. College administrators shy away from the term "affirmative action," a murky concept rooted in redressing historic inequities and loaded with legal implications. Yet the imbalances do trouble some admissions officials. (Related: Colleges remain cautious) So just as they might consider race or geographical diversity in building freshman classes, they similarly look for gender parity. There are more men than women ages 18-24 in the USA — 15 million vs. 14.2 million, according to a Census Bureau estimate last year. But nationally, the male/female ratio on campus today is 43/57, a reversal from the late 1960s and well beyond the nearly even splits of the mid-1970s. The trends have developed in plain view — not ignored exactly, but typically accompanied by some version of the question: Isn't this a sign of women's progress? Today, though, the blue-collar jobs that once attracted male high school graduates are drying up. More boys are dropping out of high school and out of college. And as the gender gap widens, concern about the educational aspirations of young men appears to be gaining traction, albeit cautiously. But even as evidence of a problem — a crisis, some say — mounts, "there's a complacency about this topic," McCorkell says. There has been no outcry, for example, on the scale of a highly publicized 1992 report by the American Association of University Women, How Schools Short-Change Girls, which compiled reams of research on gender inequities. That study "really ... got people to focus on girls ... (but) there is no big network that protects the needs of boys," says family therapist Michael Gurian, author of the just-published The Minds of Boys: Saving Our Sons from Falling Behind in School and Life, which argues that elementary and secondary schools aren't meeting the developmental needs of boys. The minefields ahead And the needs of boys and girls are different, says Kimberly Tsaousis, a college-prep adviser who works mostly with low-income minorities at Cleveland High School in Seattle. "Girls are way more likely to just pay attention" during advising sessions, she says. "It's almost less cool" for boys to show interest in college. Talk of gender is fraught with social, legal and political minefields. Witness the outcry after Harvard President Lawrence Summers remarked in January that women might be underrepresented in sciences because of innate differences in abilities. For one thing, female inequities persist. There's still a pay gap. According to the Census Bureau, women on average earned 77 cents to each dollar paid to male counterparts in 2004. So it's perhaps no surprise that most educators exploring the issue have an eye toward equilibrium. Maine's Department of Education, for example, created a task force to look closely at boys' poor academic performance and found a ratio of 154 women for every 100 men in the state's colleges and universities in 2000, the greatest gap of any state. But the final report, to be released this fall, will recommend strategies to promote gender-equitable education. "We very quickly decided ... we wanted to make sure we did not neglect" girls even while exploring obstacles facing boys, says deputy commissioner Patrick Phillips. The University of Washington recently started a college-prep program for boys, but administrator Thomas J. Calhoun Jr. notes the university also supports girls-only programs, including one aimed at increasing women in engineering. And though President Bush in his State of the Union address singled out boys when he unveiled a$150 million initiative, led by Laura Bush, to dissuade kids from joining gangs, a conference hosted by the first lady Oct. 27 is called "Helping America's Youth." Federal laws pose additional challenges. Under No Child Left Behind, for example, schools must track data by race and gender, which helps educators pinpoint vulnerable populations. Yet because of potential conflicts with federal laws created to ensure gender and racial equity, educators "can't target resources to where they see the need," says Deborah Wilds of the Bill and Melinda Gates Foundation, which finances college scholarships for underrepresented kids. "You know that the kids least likely to graduate are a particular gender or ethnic background, but then you have to walk a fine line in how you serve them." 'Value in. .. equal numbers' Most of those tracking the issue agree that getting males into the college pipeline is best addressed in elementary and secondary schools. Even so, the disparities on campuses worry some admissions officials, particularly at liberal arts colleges where gaps are widest. "We think there's value in having equal numbers," says Jim Bock, admissions dean at Pennsylvania's Swarthmore College. Last year, the school admitted more women than men, but it admitted a greater percentage of the male applicants than female. The student body's male/female breakdown is about 48/52. In interviews, several college administrators, including Bock, said they would not admit a male over a better qualified female. But they do try to build a diverse class — an idea that echoes the Supreme Court's 2003 ruling on race-based affirmative action. That ruling struck down a University of Michigan formula that gave extra points to minorities because of their race. But the justices also ruled that schools could consider race as one of many factors because achieving diversity on college campuses is an important goal. In 2000, a federal judge told the University of Georgia to stop awarding bonus points to males (and minorities) in admissions. A study this year of admissions processes at 13 liberal arts schools, most with a predominantly female applicant pool, found that gender was "not a significant determinant" in admissions decisions. When a gender preference for men emerged, it occurred at historically female campuses where the share of female applicants had reached 55% or more, authors Sandy Baum and Eban Goodstein say. The authors neither advocate nor oppose affirmative action, but as men grow shorter in supply, "we should be talking about whether it's reasonable to give preferences to men," says Baum, a Skidmore College professor. UCLA higher education professor Linda Sax says such a discussion should address what effect, if any, the gender composition of a college has on men and women. To find out, she examined data from more than 17,000 students at 204 four-year colleges. Preliminary results show that on campuses that were predominantly female, both men and women got higher grades. Predominantly female campuses also led to a "significant increase" in men's commitment to promoting racial understanding and led males to more liberal views on abortion, homosexuality and other social issues, her research found. "What we're talking about here is the impact of women's attitudes and values," Sax says. For his part, author Gurian says one reason colleges may fail to attract more men is precisely because they are more geared to female learning styles and interests. Colleges that want to compete for the dwindling pool of men should emphasize male interests, such as sports, he says, and offer more male role models. But meaningful change must take place well before the college years, says Gurian, who acknowledges a personal interest in the subject: He has two daughters. "We all know a boy that's struggling," he says. "If we create a generation of men who aren't getting an education, that's bad for women." HOW MALE REPRESENTATION BREAKS DOWN BY RACE AND INCOME About 9.9 million women (57.4%) and 7.4 million men (42.6%) were enrolled in colleges eligible for federal student aid in 2003-04. The percentage of undergrads (18-24) who are male, by race and income: Low-income (Less than $30,000) Middle-income ($30,000 to $69,999) Upper Income ($70,000 or more) 1995-96 1999-00 2003-04 1995-96 1999-00 2003-04 1995-96 1999-00 2003-04 White 46 42 42 50 46 43 52 48 49 Black 32 36 36 48 42 42 41 48 48 Hispanic 43 43 39 46 51 42 50 52 49 Asian 53 51 47 57 48 50 52 54 51 All 44 42 40 50 47 44 51 48 49 Data: U.S. Department of Education, National Center for Education Statistics, National Postsecondary Student Aid Studies, 1995-96, 1999-2000, 2003-04 Income ranges adjusted for inflation to 1995-96 dollars; Source: ACE Center for Policy Analysis Contributing: Anthony DeBarros, Breanne Gilpatrick and Susan O'Brian |
<?xml version="1.0" encoding="utf-8" ?>
<ContentPage xmlns="http://xamarin.com/schemas/2014/forms"
xmlns:x="http://schemas.microsoft.com/winfx/2009/xaml"
xmlns:esri="clr-namespace:Esri.ArcGISRuntime.Toolkit.Xamarin.Forms;assembly=Esri.ArcGISRuntime.Toolkit.Xamarin.Forms"
x:Class="Toolkit.Samples.Forms.Samples.SymbolEditorSample">
<ContentPage.Content>
<Grid >
<Grid.RowDefinitions>
<RowDefinition Height="Auto" />
<RowDefinition />
</Grid.RowDefinitions>
<StackLayout Margin="20">
<Label Text="Size" />
<Slider Maximum="100" Minimum="5" Value="{Binding Symbol.Size, Source={x:Reference symbolDisplay}, Mode=TwoWay}" />
<Label Text="Style" />
<Picker ItemsSource="{Binding SimpleMarkerSymbolStyles}" SelectedItem="{Binding Symbol.Style, Source={x:Reference symbolDisplay}, Mode=TwoWay}"/>
<Label Text="Angle" />
<Slider Minimum="0" Maximum="360" Value="{Binding Symbol.Angle, Source={x:Reference symbolDisplay}, Mode=TwoWay}" />
</StackLayout>
<Frame BorderColor="LightGray" Grid.Row="1" Margin="20" HorizontalOptions="Center" VerticalOptions="Center" Padding="0" CornerRadius="0">
<esri:SymbolDisplay x:Name="symbolDisplay" Symbol="{Binding Symbol}" />
</Frame>
</Grid>
</ContentPage.Content>
</ContentPage> |
/***************************************************************************
*
Copyright 2013 CertiVox UK Ltd. *
*
This file is part of CertiVox MIRACL Crypto SDK. *
*
The CertiVox MIRACL Crypto SDK provides developers with an *
extensive and efficient set of cryptographic functions. *
For further information about its features and functionalities please *
refer to http://www.certivox.com *
*
* The CertiVox MIRACL Crypto SDK is free software: you can *
redistribute it and/or modify it under the terms of the *
GNU Affero General Public License as published by the *
Free Software Foundation, either version 3 of the License, *
or (at your option) any later version. *
*
* The CertiVox MIRACL Crypto SDK is distributed in the hope *
that it will be useful, but WITHOUT ANY WARRANTY; without even the *
implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. *
See the GNU Affero General Public License for more details. *
*
* You should have received a copy of the GNU Affero General Public *
License along with CertiVox MIRACL Crypto SDK. *
If not, see <http://www.gnu.org/licenses/>. *
*
You can be released from the requirements of the license by purchasing *
a commercial license. Buying such a license is mandatory as soon as you *
develop commercial activities involving the CertiVox MIRACL Crypto SDK *
without disclosing the source code of your own applications, or shipping *
the CertiVox MIRACL Crypto SDK with a closed source product. *
*
***************************************************************************/
/* ECDH/ECIES/ECDSA Functions - see main program below */
/* Note that in production code miracl COMBA mechanism should be invoked for 2-3 times speed up */
/* Use this mirdef.h for 32-bit processor - note no assembly required
#define MR_LITTLE_ENDIAN
#define MIRACL 32
#define mr_utype int
#define mr_dltype long long
#define mr_unsign64 unsigned long long
#define MR_IBITS 32
#define MR_LBITS 32
#define mr_unsign32 unsigned int
#define MR_ALWAYS_BINARY
#define MR_STATIC 8
#define MR_GENERIC_MT
#define MR_STRIPPED_DOWN
#define MR_NOSUPPORT_COMPRESSION
#define MR_SIMPLE_BASE
#define MR_SIMPLE_IO
#define MR_NOASM
#define MAXBASE ((mr_small)1<<(MIRACL-1))
#define MR_BITSINCHAR 8
*/
/* Use this mirdef.h for 64-bit processor
#define MR_LITTLE_ENDIAN
#define MIRACL 64
#define mr_utype long long
#define mr_unsign64 unsigned long long
#define MR_IBITS 32
#define MR_LBITS 32
#define mr_unsign32 unsigned int
#define MR_ALWAYS_BINARY
#define MR_STATIC 4
#define MR_GENERIC_MT
#define MR_STRIPPED_DOWN
#define MR_NOSUPPORT_COMPRESSION
#define MR_SIMPLE_BASE
#define MR_SIMPLE_IO
#define MAXBASE ((mr_small)1<<(MIRACL-1))
#define MR_BITSINCHAR 8
*/
/* Link to these files
mrcore.c
mrarth0.c
mrarth1.c
mrarth2.c
mrio1.c
mrgcd.c
mrxgcd.c
mrarth3.c
mrbits.c
mrmonty.c
mrcurve.c
mraes.c
mrshs256.c
mrstrong.c
For 64-bit build using Microsoft compiler mrmuldv.w64 must be included as well
For 64-bit build using Linux and Intel chips, mrmuldv.g64 must be included as well
To use COMBA speed-up, for 32-bit build add
#define MR_COMBA 8
#define MR_GENERALISED_MERSENNE
#define MR_SPECIAL
For 64-bit build add
#define MR_COMBA 4
#define MR_GENERALISED_MERSENNE
#define MR_SPECIAL
to mirdef.h
Also create mrcomba.c using MEX utility, and add mrcomba.c in build
*/
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include <time.h>
#include "ecdh.h"
/* Elliptic Curve parameters - NIST P256 Curve */
#if MIRACL==64
const mr_small ecrom[]={
0xffffffffffffffff,0xffffffff,0x0,0xffffffff00000001,
0x3bce3c3e27d2604b,0x651d06b0cc53b0f6,0xb3ebbd55769886bc,0x5ac635d8aa3a93e7,
0xf3b9cac2fc632551,0xbce6faada7179e84,0xffffffffffffffff,0xffffffff00000000,
0xf4a13945d898c296,0x77037d812deb33a0,0xf8bce6e563a440f2,0x6b17d1f2e12c4247,
0xcbb6406837bf51f5,0x2bce33576b315ece,0x8ee7eb4a7c0f9e16,0x4fe342e2fe1a7f9b};
#endif
#if MIRACL==32
const mr_small ecrom[]={
0xffffffff,0xffffffff,0xffffffff,0x0,0x0,0x0,0x1,0xffffffff,
0x27d2604b,0x3bce3c3e,0xcc53b0f6,0x651d06b0,0x769886bc,0xb3ebbd55,0xaa3a93e7,0x5ac635d8,
0xfc632551,0xf3b9cac2,0xa7179e84,0xbce6faad,0xffffffff,0xffffffff,0x0,0xffffffff,
0xd898c296,0xf4a13945,0x2deb33a0,0x77037d81,0x63a440f2,0xf8bce6e5,0xe12c4247,0x6b17d1f2,
0x37bf51f5,0xcbb64068,0x6b315ece,0x2bce3357,0x7c0f9e16,0x8ee7eb4a,0xfe1a7f9b,0x4fe342e2};
#endif
static void hash(octet *p,int n,octet *x,octet *y,octet *w)
{
int i,hlen,c[4];
HASHFUNC sha;
char hh[HASH_BYTES];
hlen=HASH_BYTES;
SHS_INIT(&sha);
if (p!=NULL)
for (i=0;i<p->len;i++) SHS_PROCESS(&sha,p->val[i]);
if (n>0)
{
c[0]=(n>>24)&0xff;
c[1]=(n>>16)&0xff;
c[2]=(n>>8)&0xff;
c[3]=(n)&0xff;
for (i=0;i<4;i++) SHS_PROCESS(&sha,c[i]);
}
if (x!=NULL)
for (i=0;i<x->len;i++) SHS_PROCESS(&sha,x->val[i]);
if (y!=NULL)
for (i=0;i<y->len;i++) SHS_PROCESS(&sha,y->val[i]);
SHS_HASH(&sha,hh);
OCTET_EMPTY(w);
OCTET_JOIN_BYTES(hh,hlen,w);
for (i=0;i<hlen;i++) hh[i]=0;
}
/* Hash octet p to octet w */
void HASH(octet *p,octet *w)
{
hash(p,-1,NULL,NULL,w);
}
/* Initialise a Cryptographically Strong Random Number Generator from
an octet of raw random data */
void CREATE_CSPRNG(csprng *RNG,octet *RAW)
{
strong_init(RNG,RAW->len,RAW->val,0L);
}
void KILL_CSPRNG(csprng *RNG)
{
strong_kill(RNG);
}
BOOL HMAC(octet *m,octet *k,int olen,octet *tag)
{
/* Input is from an octet m *
* olen is requested output length in bytes. k is the key *
* The output is the calculated tag */
int i,hlen,b;
char h[HASH_BYTES],k0[HASH_BLOCK];
octet H={0,sizeof(h),h};
octet K0={0,sizeof(k0),k0};
hlen=HASH_BYTES; b=HASH_BLOCK;
if (olen<4 || olen>hlen) return FALSE;
if (k->len > b) hash(k,-1,NULL,NULL,&K0);
else OCTET_COPY(k,&K0);
OCTET_JOIN_BYTE(0,b-K0.len,&K0);
OCTET_XOR_BYTE(0x36,&K0);
hash(&K0,-1,m,NULL,&H);
OCTET_XOR_BYTE(0x6a,&K0); /* 0x6a = 0x36 ^ 0x5c */
hash(&K0,-1,&H,NULL,&H);
OCTET_EMPTY(tag);
OCTET_JOIN_BYTES(H.val,olen,tag);
return TRUE;
}
/* Key Derivation Functions */
/* Input octet z */
/* Output key of length olen */
void KDF1(octet *z,int olen,octet *key)
{
char h[HASH_BYTES];
octet H={0,sizeof(h),h};
int counter,cthreshold;
int hlen=HASH_BYTES;
OCTET_EMPTY(key);
cthreshold=MR_ROUNDUP(olen,hlen);
for (counter=0;counter<cthreshold;counter++)
{
hash(z,counter,NULL,NULL,&H);
if (key->len+hlen>olen) OCTET_JOIN_BYTES(H.val,olen%hlen,key);
else OCTET_JOIN_OCTET(&H,key);
}
}
void KDF2(octet *z,octet *p,int olen,octet *key)
{
/* NOTE: the parameter olen is the length of the output k in bytes */
char h[HASH_BYTES];
octet H={0,sizeof(h),h};
int counter,cthreshold;
int hlen=HASH_BYTES;
OCTET_EMPTY(key);
cthreshold=MR_ROUNDUP(olen,hlen);
for (counter=1;counter<=cthreshold;counter++)
{
hash(z,counter,p,NULL,&H);
if (key->len+hlen>olen) OCTET_JOIN_BYTES(H.val,olen%hlen,key);
else OCTET_JOIN_OCTET(&H,key);
}
}
/* Password based Key Derivation Function */
/* Input password p, salt s, and repeat count */
/* Output key of length olen */
void PBKDF2(octet *p,octet *s,int rep,int olen,octet *key)
{
int i,j,len,d=MR_ROUNDUP(olen,HASH_BYTES);
char f[EFS],u[EFS];
octet F={0,sizeof(f),f};
octet U={0,sizeof(u),u};
OCTET_EMPTY(key);
for (i=1;i<=d;i++)
{
len=s->len;
OCTET_JOIN_LONG(i,4,s);
HMAC(s,p,EFS,&F);
s->len=len;
OCTET_COPY(&F,&U);
for (j=2;j<=rep;j++)
{
HMAC(&U,p,EFS,&U);
OCTET_XOR(&U,&F);
}
OCTET_JOIN_OCTET(&F,key);
}
OCTET_CHOP(key,olen,NULL);
}
/* AES encryption/decryption */
void AES_CBC_IV0_ENCRYPT(octet *k,octet *m,octet *c)
{ /* AES CBC encryption, with Null IV and key k */
/* Input is from an octet string m, output is to an octet string c */
/* Input is padded as necessary to make up a full final block */
aes a;
BOOL fin;
int i,j,ipt,opt,ch;
char buff[16];
int padlen;
OCTET_CLEAR(c);
if (m->len==0) return;
if (!aes_init(&a,MR_CBC,k->len,k->val,NULL)) return;
ipt=opt=0;
fin=FALSE;
forever
{
for (i=0;i<16;i++)
{
if (ipt<m->len) buff[i]=m->val[ipt++];
else {fin=TRUE; break;}
}
if (fin) break;
aes_encrypt(&a,buff);
for (i=0;i<16;i++)
if (opt<c->max) c->val[opt++]=buff[i];
}
/* last block, filled up to i-th index */
padlen=16-i;
for (j=i;j<16;j++) buff[j]=padlen;
aes_encrypt(&a,buff);
for (i=0;i<16;i++)
if (opt<c->max) c->val[opt++]=buff[i];
aes_end(&a);
c->len=opt;
}
/* returns TRUE if all consistent, else returns FALSE */
BOOL AES_CBC_IV0_DECRYPT(octet *k,octet *c,octet *m)
{ /* padding is removed */
aes a;
int i,ipt,opt,ch;
char buff[16];
BOOL fin,bad;
int padlen;
ipt=opt=0;
OCTET_CLEAR(m);
if (c->len==0) return TRUE;
ch=c->val[ipt++];
if (!aes_init(&a,MR_CBC,k->len,k->val,NULL)) return FALSE;
fin=FALSE;
forever
{
for (i=0;i<16;i++)
{
buff[i]=ch;
if (ipt>=c->len) {fin=TRUE; break;}
else ch=c->val[ipt++];
}
aes_decrypt(&a,buff);
if (fin) break;
for (i=0;i<16;i++)
if (opt<m->max) m->val[opt++]=buff[i];
}
aes_end(&a);
bad=FALSE;
padlen=buff[15];
if (i!=15 || padlen<1 || padlen>16) bad=TRUE;
if (padlen>=2 && padlen<=16)
for (i=16-padlen;i<16;i++) if (buff[i]!=padlen) bad=TRUE;
if (!bad) for (i=0;i<16-padlen;i++)
if (opt<m->max) m->val[opt++]=buff[i];
m->len=opt;
if (bad) return FALSE;
return TRUE;
}
/*** EC GF(p) primitives - support functions ***/
/* destroy the EC GF(p) domain structure */
void ECP_DOMAIN_KILL(ecp_domain *DOM)
{
int i;
for (i=0;i<EFS;i++)
{
DOM->Q[i]=0;
DOM->A[i]=0;
DOM->B[i]=0;
DOM->Gx[i]=0;
DOM->Gy[i]=0;
}
for (i=0;i<EGS;i++)
DOM->R[i]=0;
}
/* Initialise the EC GF(p) domain structure
* It is assumed that the EC domain details are obtained from ROM
*/
int ECP_DOMAIN_INIT(ecp_domain *DOM,const void *rom)
{ /* get domain details from ROM */
FILE *fp;
#ifdef MR_GENERIC_AND_STATIC
miracl instance;
miracl *mr_mip=mirsys(&instance,2*EFS,16);
#else
miracl *mr_mip=mirsys(2*EFS,16);
#endif
BOOL fileinput=TRUE;
big q,r,gx,gy,a,b;
int words,promptr,err,res=0;
#ifndef MR_STATIC
char *mem=(char *)memalloc(_MIPP_ 6);
#else
char mem[MR_BIG_RESERVE(6)];
memset(mem,0,MR_BIG_RESERVE(6));
#endif
DOM->nibbles=2*EFS;
words=MR_ROUNDUP(EFS*8,MIRACL);
if (mr_mip==NULL || mem==NULL) res= ECDH_OUT_OF_MEMORY;
mr_mip->ERCON=TRUE;
if (res==0)
{
q=mirvar_mem(_MIPP_ mem, 0);
a=mirvar_mem(_MIPP_ mem, 1);
b=mirvar_mem(_MIPP_ mem, 2);
r=mirvar_mem(_MIPP_ mem, 3);
gx=mirvar_mem(_MIPP_ mem, 4);
gy=mirvar_mem(_MIPP_ mem, 5);
promptr=0;
init_big_from_rom(q,words,(const mr_small *)rom,words*5,&promptr); /* Read in prime modulus q from ROM */
init_big_from_rom(b,words,(const mr_small *)rom,words*5,&promptr); /* Read in curve parameter b from ROM */
init_big_from_rom(r,words,(const mr_small *)rom,words*5,&promptr); /* Read in curve parameter r from ROM */
init_big_from_rom(gx,words,(const mr_small *)rom,words*5,&promptr); /* Read in curve parameter gx from ROM */
init_big_from_rom(gy,words,(const mr_small *)rom,words*5,&promptr); /* Read in curve parameter gy from ROM */
convert(_MIPP_ -3,a);
add(_MIPP_ q,a,a);
big_to_bytes(_MIPP_ EFS,q,DOM->Q,TRUE);
big_to_bytes(_MIPP_ EFS,a,DOM->A,TRUE);
big_to_bytes(_MIPP_ EFS,b,DOM->B,TRUE);
big_to_bytes(_MIPP_ EGS,r,DOM->R,TRUE);
big_to_bytes(_MIPP_ EFS,gx,DOM->Gx,TRUE);
big_to_bytes(_MIPP_ EFS,gy,DOM->Gy,TRUE);
}
#ifndef MR_STATIC
memkill(_MIPP_ mem,6);
#else
memset(mem,0,MR_BIG_RESERVE(6));
#endif
err=mr_mip->ERNUM;
mirexit(_MIPPO_ );
if (err==MR_ERR_OUT_OF_MEMORY) return ECDH_OUT_OF_MEMORY;
if (err==MR_ERR_DIV_BY_ZERO) return ECDH_DIV_BY_ZERO;
if (err!=0) return -(1000+err);
return res;
}
/* Calculate a public/private EC GF(p) key pair. W=S.g mod EC(p),
* where S is the secret key and W is the public key
* If RNG is NULL then the private key is provided externally in S
* otherwise it is generated randomly internally */
int ECP_KEY_PAIR_GENERATE(ecp_domain *DOM,csprng *RNG,octet* S,octet *W)
{
#ifdef MR_GENERIC_AND_STATIC
miracl instance;
miracl *mr_mip=mirsys(&instance,DOM->nibbles,16);
#else
miracl *mr_mip=mirsys(DOM->nibbles,16);
#endif
big q,a,b,r,gx,gy,s,wx,wy;
epoint *G,*WP;
int err,res=0;
#ifndef MR_STATIC
char *mem=(char *)memalloc(_MIPP_ 9);
char *mem1=(char *)ecp_memalloc(_MIPP_ 2);
#else
char mem[MR_BIG_RESERVE(9)];
char mem1[MR_ECP_RESERVE(2)];
memset(mem,0,MR_BIG_RESERVE(9));
memset(mem1,0,MR_ECP_RESERVE(2));
#endif
if (mr_mip==NULL || mem==NULL || mem1==NULL) res= ECDH_OUT_OF_MEMORY;
mr_mip->ERCON=TRUE;
if (res==0)
{
q=mirvar_mem(_MIPP_ mem, 0);
a=mirvar_mem(_MIPP_ mem, 1);
b=mirvar_mem(_MIPP_ mem, 2);
r=mirvar_mem(_MIPP_ mem, 3);
gx=mirvar_mem(_MIPP_ mem, 4);
gy=mirvar_mem(_MIPP_ mem, 5);
s=mirvar_mem(_MIPP_ mem, 6);
wx=mirvar_mem(_MIPP_ mem, 7);
wy=mirvar_mem(_MIPP_ mem, 8);
bytes_to_big(_MIPP_ EFS,DOM->Q,q);
bytes_to_big(_MIPP_ EFS,DOM->A,a);
bytes_to_big(_MIPP_ EFS,DOM->B,b);
bytes_to_big(_MIPP_ EGS,DOM->R,r);
bytes_to_big(_MIPP_ EFS,DOM->Gx,gx);
bytes_to_big(_MIPP_ EFS,DOM->Gy,gy);
ecurve_init(_MIPP_ a,b,q,MR_PROJECTIVE);
G=epoint_init_mem(_MIPP_ mem1,0);
WP=epoint_init_mem(_MIPP_ mem1,1);
epoint_set(_MIPP_ gx,gy,0,G);
if (RNG!=NULL)
strong_bigrand(_MIPP_ RNG,r,s);
else
{
bytes_to_big(_MIPP_ S->len,S->val,s);
divide(_MIPP_ s,r,r);
}
ecurve_mult(_MIPP_ s,G,WP);
epoint_get(_MIPP_ WP,wx,wy);
if (RNG!=NULL) S->len=big_to_bytes(_MIPP_ 0,s,S->val,FALSE);
W->len=2*EFS+1; W->val[0]=4;
big_to_bytes(_MIPP_ EFS,wx,&(W->val[1]),TRUE);
big_to_bytes(_MIPP_ EFS,wy,&(W->val[EFS+1]),TRUE);
}
#ifndef MR_STATIC
memkill(_MIPP_ mem,9);
ecp_memkill(_MIPP_ mem1,2);
#else
memset(mem,0,MR_BIG_RESERVE(9));
memset(mem1,0,MR_ECP_RESERVE(2));
#endif
err=mr_mip->ERNUM;
mirexit(_MIPPO_ );
if (err==MR_ERR_OUT_OF_MEMORY) return ECDH_OUT_OF_MEMORY;
if (err==MR_ERR_DIV_BY_ZERO) return ECDH_DIV_BY_ZERO;
if (err!=0) return -(1000+err);
return res;
}
/* validate an EC GF(p) public key. Set full=TRUE for fuller,
* but more time-consuming test */
int ECP_PUBLIC_KEY_VALIDATE(ecp_domain *DOM,BOOL full,octet *W)
{
#ifdef MR_GENERIC_AND_STATIC
miracl instance;
miracl *mr_mip=mirsys(&instance,DOM->nibbles,16);
#else
miracl *mr_mip=mirsys(DOM->nibbles,16);
#endif
big q,a,b,r,wx,wy;
epoint *WP;
BOOL valid;
int err,res=0;
#ifndef MR_STATIC
char *mem=(char *)memalloc(_MIPP_ 6);
char *mem1=(char *)ecp_memalloc(_MIPP_ 1);
#else
char mem[MR_BIG_RESERVE(6)];
char mem1[MR_ECP_RESERVE(1)];
memset(mem,0,MR_BIG_RESERVE(6));
memset(mem1,0,MR_ECP_RESERVE(1));
#endif
if (mr_mip==NULL || mem==NULL || mem1==NULL) res= ECDH_OUT_OF_MEMORY;
mr_mip->ERCON=TRUE;
if (res==0)
{
q=mirvar_mem(_MIPP_ mem, 0);
a=mirvar_mem(_MIPP_ mem, 1);
b=mirvar_mem(_MIPP_ mem, 2);
r=mirvar_mem(_MIPP_ mem, 3);
wx=mirvar_mem(_MIPP_ mem, 4);
wy=mirvar_mem(_MIPP_ mem, 5);
bytes_to_big(_MIPP_ EFS,DOM->Q,q);
bytes_to_big(_MIPP_ EFS,DOM->A,a);
bytes_to_big(_MIPP_ EFS,DOM->B,b);
bytes_to_big(_MIPP_ EGS,DOM->R,r);
bytes_to_big(_MIPP_ EFS,&(W->val[1]),wx);
bytes_to_big(_MIPP_ EFS,&(W->val[EFS+1]),wy);
if (mr_compare(wx,q)>=0 || mr_compare (wy,q)>=0) res=ECDH_INVALID_PUBLIC_KEY;
}
if (res==0)
{
ecurve_init(_MIPP_ a,b,q,MR_PROJECTIVE);
WP=epoint_init_mem(_MIPP_ mem1,0);
valid=epoint_set(_MIPP_ wx,wy,0,WP);
if (!valid || WP->marker==MR_EPOINT_INFINITY) res=ECDH_INVALID_PUBLIC_KEY;
if (res==0 && full)
{
ecurve_mult(_MIPP_ r,WP,WP);
if (WP->marker!=MR_EPOINT_INFINITY) res=ECDH_INVALID_PUBLIC_KEY;
}
}
#ifndef MR_STATIC
memkill(_MIPP_ mem,6);
ecp_memkill(_MIPP_ mem1,1);
#else
memset(mem,0,MR_BIG_RESERVE(6));
memset(mem1,0,MR_ECP_RESERVE(1));
#endif
err=mr_mip->ERNUM;
mirexit(_MIPPO_ );
if (err==MR_ERR_OUT_OF_MEMORY) return ECDH_OUT_OF_MEMORY;
if (err==MR_ERR_DIV_BY_ZERO) return ECDH_DIV_BY_ZERO;
if (err!=0) return -(1000+err);
return res;
}
/*** P1363 EC GF(p) primitives ***/
/* See P1363 documentation for specification */
int ECPSVDP_DH(ecp_domain *DOM,octet *S,octet *WD,octet *Z)
{
#ifdef MR_GENERIC_AND_STATIC
miracl instance;
miracl *mr_mip=mirsys(&instance,DOM->nibbles,16);
#else
miracl *mr_mip=mirsys(DOM->nibbles,16);
#endif
big q,a,b,s,wx,wy,z;
BOOL valid;
epoint *W;
int err,res=0;
#ifndef MR_STATIC
char *mem=(char *)memalloc(_MIPP_ 7);
char *mem1=(char *)ecp_memalloc(_MIPP_ 1);
#else
char mem[MR_BIG_RESERVE(7)];
char mem1[MR_ECP_RESERVE(1)];
memset(mem,0,MR_BIG_RESERVE(7));
memset(mem1,0,MR_ECP_RESERVE(1));
#endif
if (mr_mip==NULL || mem==NULL || mem1==NULL) res= ECDH_OUT_OF_MEMORY;
mr_mip->ERCON=TRUE;
if (res==0)
{
q=mirvar_mem(_MIPP_ mem, 0);
a=mirvar_mem(_MIPP_ mem, 1);
b=mirvar_mem(_MIPP_ mem, 2);
s=mirvar_mem(_MIPP_ mem, 3);
wx=mirvar_mem(_MIPP_ mem, 4);
wy=mirvar_mem(_MIPP_ mem, 5);
z=mirvar_mem(_MIPP_ mem, 6);
bytes_to_big(_MIPP_ EFS,DOM->Q,q);
bytes_to_big(_MIPP_ EFS,DOM->A,a);
bytes_to_big(_MIPP_ EFS,DOM->B,b);
bytes_to_big(_MIPP_ S->len,S->val,s);
ecurve_init(_MIPP_ a,b,q,MR_PROJECTIVE);
W=epoint_init_mem(_MIPP_ mem1,0);
bytes_to_big(_MIPP_ EFS,&(WD->val[1]),wx);
bytes_to_big(_MIPP_ EFS,&(WD->val[EFS+1]),wy);
valid=epoint_set(_MIPP_ wx,wy,0,W);
if (!valid) res=ECDH_ERROR;
}
if (res==0)
{
ecurve_mult(_MIPP_ s,W,W);
if (W->marker==MR_EPOINT_INFINITY) res=ECDH_ERROR;
else
{
epoint_get(_MIPP_ W,z,z);
Z->len=big_to_bytes(_MIPP_ EFS,z,Z->val,TRUE);
}
}
#ifndef MR_STATIC
memkill(_MIPP_ mem,7);
ecp_memkill(_MIPP_ mem1,1);
#else
memset(mem,0,MR_BIG_RESERVE(7));
memset(mem1,0,MR_ECP_RESERVE(1));
#endif
err=mr_mip->ERNUM;
mirexit(_MIPPO_ );
if (err==MR_ERR_OUT_OF_MEMORY) return ECDH_OUT_OF_MEMORY;
if (err==MR_ERR_DIV_BY_ZERO) return ECDH_DIV_BY_ZERO;
if (err!=0) return -(1000+err);
return res;
}
/* Sign octet F using private key S. Signature in C and D. Must supply RNG */
int ECPSP_DSA(ecp_domain *DOM,csprng *RNG,octet *S,octet *F,octet *C,octet *D)
{
char h[HASH_BYTES];
octet H={0,sizeof(h),h};
#ifdef MR_GENERIC_AND_STATIC
miracl instance;
miracl *mr_mip=mirsys(&instance,DOM->nibbles,16);
#else
miracl *mr_mip=mirsys(DOM->nibbles,16);
#endif
big q,a,b,gx,gy,r,s,f,c,d,u,vx;
epoint *G,*V;
int err,res=0;
#ifndef MR_STATIC
char *mem=(char *)memalloc(_MIPP_ 12);
char *mem1=(char *)ecp_memalloc(_MIPP_ 2);
#else
char mem[MR_BIG_RESERVE(12)];
char mem1[MR_ECP_RESERVE(2)];
memset(mem,0,MR_BIG_RESERVE(12));
memset(mem1,0,MR_ECP_RESERVE(2));
#endif
if (mr_mip==NULL || mem==NULL || mem1==NULL) res= ECDH_OUT_OF_MEMORY;
mr_mip->ERCON=TRUE;
hash(F,-1,NULL,NULL,&H); /* hash message */
if (res==0)
{
q=mirvar_mem(_MIPP_ mem, 0);
a=mirvar_mem(_MIPP_ mem, 1);
b=mirvar_mem(_MIPP_ mem, 2);
gx=mirvar_mem(_MIPP_ mem, 3);
gy=mirvar_mem(_MIPP_ mem, 4);
r=mirvar_mem(_MIPP_ mem, 5);
s=mirvar_mem(_MIPP_ mem, 6);
f=mirvar_mem(_MIPP_ mem, 7);
c=mirvar_mem(_MIPP_ mem, 8);
d=mirvar_mem(_MIPP_ mem, 9);
u=mirvar_mem(_MIPP_ mem, 10);
vx=mirvar_mem(_MIPP_ mem,11);
bytes_to_big(_MIPP_ EFS,DOM->Q,q);
bytes_to_big(_MIPP_ EGS,DOM->R,r);
bytes_to_big(_MIPP_ EFS,DOM->Gx,gx);
bytes_to_big(_MIPP_ EFS,DOM->Gy,gy);
bytes_to_big(_MIPP_ EFS,DOM->A,a);
bytes_to_big(_MIPP_ EFS,DOM->B,b);
bytes_to_big(_MIPP_ S->len,S->val,s);
bytes_to_big(_MIPP_ H.len,H.val,f);
ecurve_init(_MIPP_ a,b,q,MR_PROJECTIVE);
G=epoint_init_mem(_MIPP_ mem1,0);
V=epoint_init_mem(_MIPP_ mem1,1);
epoint_set(_MIPP_ gx,gy,0,G);
do {
if (mr_mip->ERNUM) break;
strong_bigrand(_MIPP_ RNG,r,u);
ecurve_mult(_MIPP_ u,G,V);
epoint_get(_MIPP_ V,vx,vx);
copy(vx,c);
divide(_MIPP_ c,r,r);
if (size(c)==0) continue;
xgcd(_MIPP_ u,r,u,u,u);
mad(_MIPP_ s,c,f,r,r,d);
mad(_MIPP_ u,d,u,r,r,d);
} while (size(d)==0);
if (res==0)
{
C->len=big_to_bytes(_MIPP_ EGS,c,C->val,TRUE);
D->len=big_to_bytes(_MIPP_ EGS,d,D->val,TRUE);
}
}
#ifndef MR_STATIC
memkill(_MIPP_ mem,12);
ecp_memkill(_MIPP_ mem1,2);
#else
memset(mem,0,MR_BIG_RESERVE(12));
memset(mem1,0,MR_ECP_RESERVE(2));
#endif
err=mr_mip->ERNUM;
mirexit(_MIPPO_ );
if (err==MR_ERR_OUT_OF_MEMORY) return ECDH_OUT_OF_MEMORY;
if (err==MR_ERR_DIV_BY_ZERO) return ECDH_DIV_BY_ZERO;
if (err!=0) return -(1000+err);
return res;
}
/* Verify Signature (C, D) on F using public key W */
int ECPVP_DSA(ecp_domain *DOM,octet *W,octet *F, octet *C,octet *D)
{
char h[HASH_BYTES];
octet H={0,sizeof(h),h};
#ifdef MR_GENERIC_AND_STATIC
miracl instance;
miracl *mr_mip=mirsys(&instance,DOM->nibbles,16);
#else
miracl *mr_mip=mirsys(DOM->nibbles,16);
#endif
big q,r,a,b,gx,gy,wx,wy,f,c,d,h2;
int bit,err,res=0;
epoint *G,*WP,*P;
BOOL compressed,valid;
#ifndef MR_STATIC
char *mem=(char *)memalloc(_MIPP_ 12);
char *mem1=(char *)ecp_memalloc(_MIPP_ 3);
#else
char mem[MR_BIG_RESERVE(12)];
char mem1[MR_ECP_RESERVE(3)];
memset(mem,0,MR_BIG_RESERVE(12));
memset(mem1,0,MR_ECP_RESERVE(3));
#endif
if (mr_mip==NULL || mem==NULL || mem1==NULL) res= ECDH_OUT_OF_MEMORY;
mr_mip->ERCON=TRUE;
hash(F,-1,NULL,NULL,&H); /* hash message */
if (res==0)
{
q=mirvar_mem(_MIPP_ mem, 0);
a=mirvar_mem(_MIPP_ mem, 1);
b=mirvar_mem(_MIPP_ mem, 2);
gx=mirvar_mem(_MIPP_ mem, 3);
gy=mirvar_mem(_MIPP_ mem, 4);
r=mirvar_mem(_MIPP_ mem, 5);
wx=mirvar_mem(_MIPP_ mem, 6);
wy=mirvar_mem(_MIPP_ mem, 7);
f=mirvar_mem(_MIPP_ mem, 8);
c=mirvar_mem(_MIPP_ mem, 9);
d=mirvar_mem(_MIPP_ mem, 10);
h2=mirvar_mem(_MIPP_ mem,11);
bytes_to_big(_MIPP_ EFS,DOM->Q,q);
bytes_to_big(_MIPP_ EGS,DOM->R,r);
bytes_to_big(_MIPP_ EFS,DOM->Gx,gx);
bytes_to_big(_MIPP_ EFS,DOM->Gy,gy);
bytes_to_big(_MIPP_ EFS,DOM->A,a);
bytes_to_big(_MIPP_ EFS,DOM->B,b);
bytes_to_big(_MIPP_ C->len,C->val,c);
bytes_to_big(_MIPP_ D->len,D->val,d);
bytes_to_big(_MIPP_ H.len,H.val,f);
if (size(c)<1 || mr_compare(c,r)>=0 || size(d)<1 || mr_compare(d,r)>=0)
res=ECDH_INVALID;
}
if (res==0)
{
xgcd(_MIPP_ d,r,d,d,d);
mad(_MIPP_ f,d,f,r,r,f);
mad(_MIPP_ c,d,c,r,r,h2);
ecurve_init(_MIPP_ a,b,q,MR_PROJECTIVE);
G=epoint_init_mem(_MIPP_ mem1,0);
WP=epoint_init_mem(_MIPP_ mem1,1);
P=epoint_init_mem(_MIPP_ mem1,2);
epoint_set(_MIPP_ gx,gy,0,G);
bytes_to_big(_MIPP_ EFS,&(W->val[1]),wx);
bytes_to_big(_MIPP_ EFS,&(W->val[EFS+1]),wy);
valid=epoint_set(_MIPP_ wx,wy,0,WP);
if (!valid) res=ECDH_ERROR;
else
{
ecurve_mult2(_MIPP_ f,G,h2,WP,P);
if (P->marker==MR_EPOINT_INFINITY) res=ECDH_INVALID;
else
{
epoint_get(_MIPP_ P,d,d);
divide(_MIPP_ d,r,r);
if (mr_compare(d,c)!=0) res=ECDH_INVALID;
}
}
}
#ifndef MR_STATIC
memkill(_MIPP_ mem,12);
ecp_memkill(_MIPP_ mem1,3);
#else
memset(mem,0,MR_BIG_RESERVE(12));
memset(mem1,0,MR_ECP_RESERVE(3));
#endif
err=mr_mip->ERNUM;
mirexit(_MIPPO_ );
if (err==MR_ERR_OUT_OF_MEMORY) return ECDH_OUT_OF_MEMORY;
if (err==MR_ERR_DIV_BY_ZERO) return ECDH_DIV_BY_ZERO;
if (err!=0) return -(1000+err);
return res;
}
void ECP_ECIES_ENCRYPT(ecp_domain *DOM,octet *P1,octet *P2,csprng *RNG,octet *W,octet *M,int tlen,octet *V,octet *C,octet *T)
{ /* Inputs: Input params, random number generator, his public key, the message to be encrypted and the MAC length */
/* Outputs: my one-time public key, the ciphertext and the MAC tag */
int i,len;
char z[EFS],vz[3*EFS+2],k[32],k1[16],k2[16],l2[8],u[EFS];
octet Z={0,sizeof(z),z};
octet VZ={0,sizeof(vz),vz};
octet K={0,sizeof(k),k};
octet K1={0,sizeof(k1),k1};
octet K2={0,sizeof(k2),k2};
octet L2={0,sizeof(l2),l2};
octet U={0,sizeof(u),u};
if (ECP_KEY_PAIR_GENERATE(DOM,RNG,&U,V)!=0) return; /* one time key pair */
if (ECPSVDP_DH(DOM,&U,W,&Z)!=0) return;
OCTET_COPY(V,&VZ);
OCTET_JOIN_OCTET(&Z,&VZ);
KDF2(&VZ,P1,EFS,&K);
/* split key into AES encryption key and MAC key */
K1.len=K2.len=16;
for (i=0;i<16;i++) {K1.val[i]=K.val[i]; K2.val[i]=K.val[16+i];}
AES_CBC_IV0_ENCRYPT(&K1,M,C);
OCTET_JOIN_LONG((long)P2->len,8,&L2);
len=C->len;
OCTET_JOIN_OCTET(P2,C);
OCTET_JOIN_OCTET(&L2,C);
HMAC(C,&K2,tlen,T);
C->len=len;
}
/* ECIES Decryption */
BOOL ECP_ECIES_DECRYPT(ecp_domain *DOM,octet *P1,octet *P2,octet *V,octet *C,octet *T,octet *U,octet *M)
{ /* Inputs: Input params, ciphertext triple V,C,T and recipients private key */
/* Output: recovered plaintext M */
int i,len;
char z[EFS],vz[3*EFS+2],k[32],k1[16],k2[16],l2[8],tag[32];
octet Z={0,sizeof(z),z};
octet VZ={0,sizeof(vz),vz};
octet K={0,sizeof(k),k};
octet K1={0,sizeof(k1),k1};
octet K2={0,sizeof(k2),k2};
octet L2={0,sizeof(l2),l2};
octet TAG={0,sizeof(tag),tag};
if (ECPSVDP_DH(DOM,U,V,&Z)!=0) return FALSE;
OCTET_COPY(V,&VZ);
OCTET_JOIN_OCTET(&Z,&VZ);
KDF2(&VZ,P1,EFS,&K);
/* split key into AES decryption key and MAC key */
K1.len=K2.len=16;
for (i=0;i<16;i++) {K1.val[i]=K.val[i]; K2.val[i]=K.val[16+i];}
if (!AES_CBC_IV0_DECRYPT(&K1,C,M)) return FALSE;
OCTET_JOIN_LONG((long)P2->len,8,&L2);
len=C->len;
OCTET_JOIN_OCTET(P2,C);
OCTET_JOIN_OCTET(&L2,C);
HMAC(C,&K2,T->len,&TAG);
C->len=len;
if (!OCTET_COMPARE(T,&TAG)) return FALSE;
return TRUE;
}
|
Introduction
============
Bacterial diseases represent some recalcitrance and difficulties to manage the pest problems affecting commercial vegetable production. Spraying with antibiotics and pesticides, usually suggested controlling bacterial diseases, have never been satisfactory. Antibiotics and synthetic pesticides are forbidden in many countries because of their exerting a negative impact such as high and acute toxicity, long degradation periods and accumulation in the food chain. Therefore, losses from bacterial diseases can be substantial all over the world. Plant diseases caused by bacteria are factors in several plant family members (Aktar et al., 2009\[[@R1]\]). In addition; bacterial diseases caused by pathovars of *Xanthomonas* also result in a decreased yield of harvest. Pathovars of *Xanthomonas* are reported to have developed resistance to several antibiotics such as kanamycin, ampicillin, penicillin, and streptomycin (Rodriguez et al., 1997\[[@R18]\]). This seriously hinders the management of diseases of crops and agricultural products (Satish et al., 1999\[[@R19]\]). Besides, control of the disease is difficult, often requiring expensive and complex integrated pest management (IPM), including the use of contamination-free seeds, sanitization practices, and the use of chemicals (Araujo et al., 2003\[[@R2]\]). Naturally occurring biologically active plant products such as plant-based essential oils and organic extracts, pure compounds could be a source of new eco-friendly pesticides to serve as templates for new and more effective compounds in controlling plant pathogenic microorganisms. Furthermore, bio-pesticides have been suggested as effective substitutes for chemical pesticides (Gan-Mor and Matthews, 2003\[[@R9]\]).
*Poncirus trifoliata*Rafin (Rutaceae), also known as trifoliate orange, is a close relative to the *Citrus*trees. It is a decidious or semi-decidious shrub, a native of China and Korea, and is also known as the Korean bitter orange. Traditionally, trifoliata oranges (*P. trifoliata*) have been widely used in folk medicine as a remedy for gastritis, dysentery, inflammation, digestive ulcers, etc. A scientific investigation into the health-maintaining properties of trifoliate orange fruit has revealed its anti-inflammatory, antibacterial and anti-anaphylactic activities (Kim et al., 1999\[[@R11]\]). In Korea, fruit extracts of *P. trifoliate* are used in some over-the-counter drugs for the treatment of a variety of gastrointestinal (GI) disorders (Lee et al., 2005\[[@R13]\]). Another researcher reported that poncirus fruit is a potent antileukaemic agent by promoting apoptosis of cancer cells (Yi et al., 2005\[[@R23]\]). Several compounds such as poncirin, coumarins, auraptine, hesperidin and naringin have been identified from poncirus fruits (Avula et al., 2005\[[@R3]\]). Previously, we reported the chemical compositions of seed essential oil of *Poncirus trifoliata* Rafin by GC-MS and evaluated antibacterial potential of the oil and organic seed extracts of *P. trifoliata* Rafin against foodborne pathogens (Rahman et al., 2009\[[@R16]\]). Further, we have previously reported on the isolation, characterization and anti-listerial potential of naturally occurring limonin and imperatorin from *P. trifoliata* seed (Rahman et al., 2012\[[@R17]\]). However, there is no report available in the literature on antibacterial properties especially on *Xanthomonas* spp. including morphological changes using volatile essential oil, isolated natural compounds of *P. trifoliata*seeds.
Considering the deleterious effects of synthetic antibiotics and pesticides on life supporting systems, there is an urgent need to search for alternative approaches for the management of plant pathogenic microorganisms. Therefore, to find out the environmentally friendly alternatives to chemical pesticides we investigated the role of secondary metabolites (essential oil and compounds limonin and imperatorin) of *P. trifoliata*as an antibacterial potential on *Xanthomonas* spp. *in vitro.*
Materials and Methods
=====================
Micro-organisms
---------------
In this study, the used organisms were *Xanthomonas campestris*pv.*compestris* KC94-17-XCC, *Xanthomonas campestris*pv.*vesicatoria* YK93-4-XCV, *Xanthomonas oryzae*pv.*oryzae* KX019-XCO and *Xanthomonas* sp. SK12. These organisms were collected from Korean Agricultural Culture Collection (KACC), Suwon, Republic of Korea. Active cultures for experimental use were prepared by transferring a loopful of cells from stock cultures to flasks and inoculated in Luria-Bertani (LB) broth medium at 28 °C for 24 h. Cultures of each bacterial strain were maintained on LB agar medium at 4 °C.
In vitro antibacterial activity assay
-------------------------------------
The antibacterial test was carried out by agar disc diffusion method using 100 μl of standardized inoculum suspension containing 10^7^ CFU/ml of bacteria (Murray et al., 1995\[[@R14]\]). The seed essential oil was diluted 1:5 (v/v) with methanol and appropriate amounts (5, 10 or 15 μl) were spotted onto the filter paper discs (6 mm diameter) and placed on the inoculated agar. Negative controls were prepared using the same solvent (MeOH) employed to dissolve the oil. Standard reference antibiotic, streptomycin (20 μg/disc, from Sigma-Aldrich Co., USA), was used as positive control for the tested bacteria. The plates were then sealed with parafilm and incubated at 28 °C for 24 h. Antibacterial activity was evaluated by measuring the diameter of the zones of inhibition against the tested bacteria. Each assay in this experiment was replicated three times.
Determination of minimum inhibitory concentration (MIC)
-------------------------------------------------------
Minimum inhibitory concentrations (MICs) of seed essential oil and compounds limonin and imperatorin were tested by a two-fold serial dilution method (Chandrasekaran and Venkatesalu, 2004\[[@R7]\]). The test samples of oil and pue compounds (limonin and imperatorin) were dissolved in methanol and dimethyl sulfoxide (DMSO), respectively and incorporated into LB broth medium to obtain a concentration of 1,000 μg/ml and serially diluted to achieve 500, 250, 125, 62.5, 31.25, 15.62, 7.81 and 3.9 μg/ml, respectively. The final concentration of solvent in the culture medium was maintained at 0.5 % (v/v). A 10 μl standardized suspension of each tested organism (10^7^ CFU/ml approximately) was transferred to each tube. The control tubes contained only bacterial suspension, were incubated at 28 °C for 24 h. The lowest concentration of the test samples, which did not show any growth of tested organism after macroscopic evaluation, was determined as MICs, which were expressed in μg/ml.
Scanning electron microscopic (SEM) analysis on Xanthomonas spp.
----------------------------------------------------------------
To determine the antibacterial efficacy of the compounds limonin and imperatorin on the morphological changes, SEM studies were performed on *Xanthomonas* sp. SK12 treated with MIC concentrations of these compounds. Controls were prepared without samples. Further, to observe the morphological changes, the method of SEM was modified from Kockro method (Kockro et al., 2000\[[@R12]\]). The bacterial samples were washed gently with 50 mM phosphate buffer solution (pH 7.2), fixed with 2.5 g/100 ml glutaraldehyde and 1 g/100 ml osmic acid solution. The specimen was dehydrated using sequential exposure per ethanol concentrations ranging from 30-100 %. The ethanol was replaced by tertiary butyl alcohol. After dehydration, the specimen was dried with CO~2~. Finally, the specimen was sputter-coated with gold in an ion coater for 2 min, followed by microscopic examinations (S-4300; Hitachi).
Statistical analysis
--------------------
The data obtained for antibacterial activity of seed essential oil and isolated compounds were statistically analyzed and mean values were calculated. A Student\'s *t*-test was computed for the statistical significance of the results at *p*\< 0.05.
Results
=======
In vitro antibacterial effect of seed essential oil of P. trifoliata against phytopathogenic Xanthomonas spp.
-------------------------------------------------------------------------------------------------------------
Seed essential oil also showed potent *in vitro* inhibitory effect against plant pathogenic bacteria of *Xanthomonas*spp. At the concentrations of 5, 10 and 15 μl/disc of 1:5 (v/v) dilution of seed essential oil with methanol, the oil exhibited a potent inhibitory effect against all four strains of *Xanthomonas*spp. such as *X. campestris* pv. *compestris* KC94-17-XCC, *X. campestris* pv. *vesicatoria* YK93-4-XCV, *X. oryzae* pv. *oryzae* KX019-XCO and *Xanthomonas*sp. SK12 as a diameter of inhibition zones of 13.1\~20.0, 14.0\~22.1, 16.2\~21.0 and 15.2\~21.2 mm, respectively along with their MIC values ranging from 62.5 to 125 μg/ml (Table 1[(Tab. 1)](#T1){ref-type="fig"}).
In vitro antibacterial activities of limonin and imperatorin against Xanthomonas spp.
-------------------------------------------------------------------------------------
Limonin and imperatorin exhibited potent antibacterial activity against phytopathogenic bacteria of *Xanthomonas*spp. (MIC value: 15.62\~62.5 μg/ml) as shown in Table 2. Bacterium *Xanthomonas*spp. SK12 was found to be the most sensitive organisms toward limonin and imperatorin (MIC: 15.62 μg/ml for each), while *X. campestris* pv. *vesicatoria* YK93-4-XCV was the most sensitive to imperatorin (MIC: 15.62 μg/ml) (Table 2[(Tab. 2)](#T2){ref-type="fig"}).
Scanning electron microscopic (SEM) studies on Xanthomonas sp. SK12 using compounds limonin and imperatorin
-----------------------------------------------------------------------------------------------------------
On the basis of lower MIC values (15.62 μg/ml) of both limonin and imperatorin on *X.*spp. SK12, the effect of these compounds (MIC) on the morphology of this bacterium was observed by scanning electron microscopy (SEM) and the results showed the detrimental effect of these compounds on the cell morphology of *X.*sp. SK12 (Figure 1[(Fig. 1)](#F1){ref-type="fig"}). Control cells in the absence of limonin and imperatorin showed a regular, smooth surface as shown in Figure 1 (A1-B1)[(Fig. 1)](#F1){ref-type="fig"}. In contrast, cells inoculated with limonin and imperatorin at MIC value (15.62 μg/ml) revealed severe detrimental effect on the morphology of cell membranes, showing disruption, pore formation and analysis of the membranes integrity, as shown in Figure 1 (A2-A3 & B2-B3)[(Fig. 1)](#F1){ref-type="fig"}.
Discussion
==========
The increasing social and economic implications caused by plant pathogenic bacteria means there is a constant striving to produce safer foods (crops, vegetables and fruits) and to develop new antibacterial agents. In general, plant-derived essential oils are considered as non-phytotoxic compounds and potentially effective against pathogenic bacteria (Vasinauskiene et al., 2006\[[@R22]\]; Basim and Basim, 2003\[[@R4]\]). In recent years, the use of antimicrobial compounds such as essential oils extracts and natural compounds are one of the first choices after outbreaks of bacterial plant diseases. Besides, interest has been generated in the development of safer antibacterial agents to control plant pathogenic bacteria in agriculture which also include essential oils and extracts (Deena and Thoppil, 2000\[[@R8]\]).
Essential oils, which are odorous and volatile products of plant secondary metabolism, have wide applications to control pathogenic bacteria (Ozturk and Ercisli, 2007\[[@R15]\]). Various publications have documented the antimicrobial activities of essential oils and plant extracts (Saxena et al., 2012\[[@R20]\]; Shafia et al., 2002\[[@R21]\]; Bougatsos et al., 2004\[[@R5]\]; Jirovetz et al., 2006\[[@R10]\]). Mono- and sesqueterpenes, which are phenolic in nature, have potential antimicrobial activities. It seems reasonable to assume that their antimicrobial mode of action might be related to the phenolic compounds present (Cakir et al., 2004\[[@R6]\]). Most of the studies on the mechanism of phenolic compounds have focused on their effects on cellular membranes. Actually, phenolic compounds not only attack cell walls and cell membranes, thereby affecting their permeability and release of intracellular constituents (e.g. ribose, Na glutamate) but also interfere with membrane functions (electron transport, nutrient uptake, protein, nucleic acid synthesis and enzyme activity). Thus, active phenolic compounds present in the oil of *P. trifoliata* might have several invasive targets which could lead to the inhibition of plant pathogenic bacteria.
In our study, it has become clear that seed essential oil strongly inhibited *in vitro* the growth of *Xanthomonas*spp. Bacterial leaf blight caused by *X. oryzae* pv. *oryzae* has been reported the most serious disease of rice in South East Asia, particularly since the widespread cultivation of dwarf high-yielding cultivars (Zhou et al., 2013\[[@R24]\]).
Compounds limonin and imperatorin also showed a great potential of antibacterial activity against plant pathogenic bacteria of *Xanthomonas*spp. In this study, *Xanthomonas*sp. SK12 was found to be the most sensitive organism to both limonin and imperatorin. SEM study also revealed the detrimental effect of limonin and imperatorin on the cell morphology of the tested organism such as *Xanthomonas* sp. SK12. The results of this study would be worthy as an important bio-control approach to inhibit such severe plant pathogenic bacteria.
Notes
=====
Prof. Md. Atiqur Rahman and Prof. Sun Chul Kang (Phone: +82-53-850-6553; FAX: +82-53-850-6559, eMail: sckang\@daegu.ac.kr) contributed equally as corresponding authors.
{#T1}
{#T2}
{#F1}
|
Q:
Hot to submit a form that was loaded in modal?
After loading a form into modal-body into twitter bootstrap, how do I submit this form using modal primary button?
I don't want to set #id because this primary button have to submit every form loaded.
A:
I will go using a selector like $('#idofmodal .modal-body form').submit()
Obviously you must change this selector according to your markup (or post the markup here so I can change it according to it)
Hope this helps
|
Playful and boisterous Marietta gives a fun filled and very intimate insight into herself and her toned, slim, all natural COVERTOCOVER.INFOl and seductive Marietta shows off her cute and erotic side in this shoot. Undressing on the bed she leaves all but her hat on as she stretches and flexes into many exposing and suggestive positions; and with legs spread she slips her fingers around her wet.
Playful and boisterous Marietta gives a fun filled and very intimate insight into herself and her toned, slim, all natural COVERTOCOVER.INFOl and seductive Marietta shows off her cute and erotic side in this shoot. Undressing on the bed she leaves all but her hat on as she stretches and flexes into many exposing and suggestive positions; and with legs spread she slips her fingers around her wet.
Marietta is an out-of-this-world beauty, so it makes sense that cult director Doris Wishman cast her for the sexy sci-fi romp, Nude on the Moon (). The dark-haired lusty titan was made for the role, with huge hooters and a propensity for getting naked/5(3).
Playful and boisterous Marietta gives a fun filled and very intimate insight into herself and her toned, slim, all natural COVERTOCOVER.INFOl and seductive Marietta shows off her cute and erotic side in this shoot. Undressing on the bed she leaves all but her hat on as she stretches and flexes into many exposing and suggestive positions; and with legs spread she slips her fingers around her wet. |
In trauma and many operative cases it is customary to insert a catheter into the bladder very early on to drain the bladder, detect some forms of internal damage, and monitor urinary output, and potentially provides passage for insertion of other instruments. Temperature measurements can be readily made by way of the catheter duct with electronic sensors now available. Internal pressure, intra-abdominal, may need to be monitored in many cases and here also electronic related sensors provide means to monitor pressure by way of the catheter access. The mucosa lining the genito-urinary and gastrointestinal tracts has vascular features that facilitate blood oxygen level determinations. The usual practice involves the use of a light source and a light sensitive sensor, attached to available body areas, that indicates oxygen level in the blood by it's light response characteristics. Externally applied, these systems sometimes become dislodged. Modern light sources and sensors suggest the use of the catheter structure as convenient access for oximeter functions. The vessels of the mucosa pulse with the heartbeat and provide a convenient pulse rate detector with readily available adaptation of the electronic signal processor activity related to the blood oxygen sensor.
The development of miniature sensors and closely related signal carriers invited and was attended by an increase in the number of data gathering functions considered necessary. The apparatus grew smaller but the number increased. The work area became cluttered. Connections of monitoring devices to external instrumentation became more tedious and invited errors. The loss of monitor information at critical points was, and is, dangerous.
There is a need to combine a number of medical data gathering intrusive devices into the envelope of one of those devices deemed necessary so that the effect of only one intrusion is borne by the patient and patient care area. Further, when time is assumed to be vital, the use of a single catheter, capable of a plurality of functions, is of value in terms of time economy and certainty of correct connections. In addition, the security of device placement and the acquisition of reliable data, being critical, is significantly advanced by the combination of these modalities.
It is therefore an object of this invention to provide via the catheter apparatus a combination of data gathering functions in one catheter envelope.
It is yet another object of this invention to provide a urethral catheter with a built in temperature measuring capability, a built in pressure measuring capability, a built in blood oxygen measuring capability and a built in pulse rate measuring ability, with a balloon near the insertion end of the catheter for anchoring the assembly within the urinary bladder, thus assuring the correct and stable placement of the various monitoring devices.
These and other objects, advantages, and features of this invention will be apparent to those skilled in the art from a consideration of this specification, including the attached claims and appended drawings. |
If I wanted other authorities for Jarndyce and Jarndyce, I could rain them on these pages, to the shame of—a parsimonious public.
But as it is wholesome that the parsimonious public should know what has been doing, and still is doing, in this connexion, I mention here that everything set forth in these pages concerning the Court of Chancery is substantially true, and within the truth.
There had been, he admitted, a trivial blemish or so in its rate of progress, but this was exaggerated and had been entirely owing to the "parsimony of the public," which guilty public, it appeared, had been until lately bent in the most determined manner on by no means enlarging the number of Chancery judges appointed—I believe by Richard the Second, but any other king will do as well. |
"We appreciate Keith's contributions to our hockey club during his time with the Blue Jackets. This is a great opportunity for him and we wish him the best," said Blue Jackets' general manager Jarmo Kekalainen.
Before joining the Blue Jackets for the 2012-13 season, he had served as an assistant coach with the Toronto Maple Leafs, he has also served an assistant coach with the New York Rangers and the Philadelphia Flyers. |
Effects of chronic hypoxia on fetal coronary responses.
This review examines the effect of high altitude and/or chronic hypoxia on cardiac mechanisms that influence perfusion of the fetal heart (e.g., tissue metabolism, coronary vessel growth, and coronary blood flow and vessel responsiveness). In response to intrauterine hypoxia, the fetal heart may either reduce its energy demand or increase its substrate and oxygen delivery as a means of sustaining cardiac function. Cardiac glycolysis predominates as a metabolic pathway of ATP synthesis in the fetal heart under both normoxic and hypoxic conditions. During prolonged oxygen insufficiency, normal cardiac function is sustained by anaerobic glycolysis relying primarily on high levels of stored glycogen in the heart. Chronic hypoxia increases coronary vessel growth and myocardial vascularization in fetal hearts, although the response may depend on the presence of ventricular hypertrophy. Recent studies demonstrate that high altitude hypoxia increases both resting fetal coronary flow and coronary flow reserve as an adaptive response toward increasing oxygen delivery. Hypoxia may also directly effect local vascular smooth muscle mechanisms, resulting in altered coronary artery reactivity to circulating vasoactive substances and contributing to enhanced perfusion. Further study is needed to understand the relative importance of each of these cardiac adaptations in contributing to fetal survival. It is likely that differences in fetal coronary responses to intrauterine hypoxia are highly dependent on the gestational age and relative maturity of the animal species. |
Q:
Using login info to scrape a website with python
I'm trying to scrape articles off a news website, to which I have a subscription, using lxml.
I am logged into the website on every browser on my computer (not that this matters?), but whenever I try to get any text from specific articles, using the following:
page = requests.get("http://www.SomeWebsite.com/blah/blah/blah.html")
tree = html.fromstring(page.text)
article = tree.xpath('//div/p/text()')
I get the following response:
['You have viewed your allowance of free articles. If you wish to view more, click the button below.']
Any ideas or suggestions on how to get around this?
Disclaimer: I'm new to python and web scraping
EDIT: Solution posted below using Selenium library
A:
So the website I was trying to scrape was rejecting all post requests I would send it (I tried Python, R, and PHP) and I found that I could only load the news articles with an actual browser.
Thanks to @duhaime, I used Selenium to accomplish this. Here is my code:
import selenium
from selenium import webdriver
# I used Firefox, but you could use Chrome or IE
browser = webdriver.Firefox()
browser.get('http://www.SomeWebsite.com/login')
# I needed to stop the script here to actually login.
# I tried to use an existing profile w/ my username & password but the website
# rejected my profile info and locked me out of the account
browser.get('http://www.SomeWebsite.com/blah/blah/blah.html')
element = browser.find_element_by_id("TheElementYouNeed").text
# This downloads all the text from the article at this particle 'id' element
Docs for Selenium bindings: http://selenium-python.readthedocs.org/en/latest/installation.html#introduction
|
Trevor Linden sparks the fighting in hockey debate, a Jake Gardiner type deal in Justin Schultz' future, Flames and Jets goaltending, Nail Yakupov talking the talk, and more in this week's roundup
In the roundup we go around the Nation Network and give you some of the best articles of the last couple weeks. Every once in a while it's good to know what other teams are doing, or maybe you find an interesting article you wouldn't have found otherwise.
Baertschi - Drafted 3 years ago, 51 GP in NHL
M. Reinhart - Drafted 4 years ago, 19 GP in NHL
Bennett - Completely unfounded claim that he will certainly be playing more than 9 games next season.
Got any better examples of players the Flames have "thrown in" to the NHL? I'll give you Monahan, but many of our fans believe that was a mistake. I don't hear many Oil fans lamenting over Eberle, Hall, RNH, or Yakupov getting dispatched too soon.
The only thing similar between the rebuilds of these 2 teams is that yes, they have both obtained some first round draft picks and finished poorly in the standings in the process. You ask if we will make the playoffs in year 4 of our rebuild? Maybe, maybe not. But I bet you we won't be finishing bottom 4 in the NHL either (unlike... hmmm... there has to be an example...)
Kovalchuk, Nash, Fleury, Ovechkin, Crosby, Johnson, Kane, Stamkos, Tavares, Hall, Nugent-Hopkins, Yakupov, Mackinnon all 1st overall picks. All went into the NHL right off the bat. You can't tell me the Flames would do anything different then any other team albeit the Oilers just sucked way worse and that's on management. No Oilers fan will disagree with you there.
Funny that you say "I bet you we won't be finishing bottom 4 in the NHL by year 4 of the rebuild" .... You sound like an Oilers fan cause we said the exact same thing.
Wrong again. Every year since the start of your rebuild you have been saying "this is the year... this is the year..."
We are starting year 2 of our rebuild and you don't hear anyone saying "this is the year..."
I just said we won't be finishing in last. But we'll give you enough of our dust to munch on when the time comes and you guys are still reeling in top 3 draft picks each year saying "this is the year..."
Wrong again. Every year since the start of your rebuild you have been saying "this is the year... this is the year..."
We are starting year 2 of our rebuild and you don't hear anyone saying "this is the year..."
I just said we won't be finishing in last. But we'll give you enough of our dust to munch on when the time comes and you guys are still reeling in top 3 draft picks each year saying "this is the year..."
Except that I have heard plenty of them say it. But hey at this point of the argument I think we can both agree that we love our teams. I wish nothing but the best of luck to Flames I honestly do. Like I've previously stated I just want to see any Canadian team if not all of them do well. It's getting old that we argue about which team sucks more. It will be nice when there comes a day when our teams are at the top of the standings and we argue about which team had the better season/playoff run.
Do Oilers fans troll Canuck pages or flame pages and write immature things about their teams? I hope not, I certainly don't. Thats the difference between Edmonton fans and flames/canucks fans, we have class. Are Edmontonians better people than Calgarians or Vancouverites? It is a possibility.
The nice thing about being an Oilers fan is that we have loads of talent and are trending upwards. VAN and CGY are hurting teams with not much to look forward to in the future, so by all means if it makes you feel good to write negative comments, continue to do so. It only epitomizes what the rest of the country already thinks about Flames/Canucks fans and just makes you look pathetic.
Cheers
Oilers are "TRENDING UPWARD"????
omg please.... seriously... can you back that up in any measurable statistical way??? this would be priceless...
And I love how Flames fans for some reason feel like they are a lot better then the Oilers despite the fact they have missed the playoffs 6 years and counting.
I don't see the Flames making the playoffs for a few more seasons, and I see the Oilers making a push this season finally and passing on the torch to Calgary for being the leading team missing the playoffs.
as a flames fan, i would be happy to see the Oilers move up to the 20-25 range in he standings.
it just is sick how the oilers have hogged all the high drafts for years, and seems intent on another top 3 pick again!
I think the NHL needs to implement a new rule, which could appropriately be called the "oiler rule", that weighs the lottery in a way that doeznt allow one team to get 5 first overalls in a row...
Flames nation, unfortunately, brings with it one of the oddest people; he runs multiple accounts, uses others' names to commment, and with multiple accounts going simultaneously actually argues with himself...
there isnt much we can do about him, so we just have to live with it.
it is still embarassing when we at FN have the rest of the world exposed to our weird guy.
this is very typical, par for the course stuff for him.
^you know what's sad? it's when people hijack other peoples names, then have the hijacker turn around and claim the original is the imposter, then go and claim that FN "brings with it one of the oddest people", right Jeff?
Oh yeah, and welcome back to the gutters, Vancouver fans. Just try not to light our cars on fire, Ok?
Well we're a sensitive lot, prone to violence and skullduggery. It's a demonic style but we expect a winner. Our need for validation outweighs our common sense. It's who we are and it'll probably never change.
^you know what's sad? it's when people hijack other peoples names, then have the hijacker turn around and claim the original is the imposter, then go and claim that FN "brings with it one of the oddest people", right Jeff? |
According to Simon Johnson the 2020 campaign platform for Democratic candidates has to veer away from Trump's trickle-down economics. This cutting taxes for the rich will not spur growth in the long term. Worse it will just entrench inequality further. American voters need to know that it is wrong to continue “some version of the Reagan regime, which is likely to deliver consistently mediocre growth and extreme income inequality.”
While the author underscores the urgency to tackle economic inequality, he knows too well that the “oligarchy” that Ronald Reagan had created will resist any tax increase and fight it tooth and nail. The 2017 overhaul of the federal tax law was Trump’s legislative achievement. In retrospect Reagan was totally wrong about his fiscal policy being a boon to the economy. On the contrary it had contributed to the biggest budget deficits in US history. As a result to Trump's tax cut, last month the budget deficit rose by 2% to $209 billion. In the 2019 budget year, the US ran up a deficit of $984 billion, the most in seven years. For 2020 it will hit $1 trillion and will stay above this figure for the next decade.
The idea that cutting taxes for the rich was a good way to both raise revenue for the government and create jobs for the unemployed has not just been discredited by the IMF, even George H W Bush called it “voodoo economics” in 1980. Thanks in part to the chaotic manner in which Trump's bill was rushed through Congress in 2017, tax cut had enabled multinational corporations to dodge paying hundreds of billions of dollars, by claiming their profits were earned outside the US. As the IRS is underfunded and understaffed, it currently fails to collect nearly 15% of total tax liabilities – primarily to the benefit of those with high incomes.
What the author finds worrying is that “as rich people accumulated more wealth, both in personal terms and through the companies they controlled, they plowed some of this money into boosting their own political influence, with a view to increasing their wealth still further.” During his 2016 campaign, Trump vowed to “drain the swamp” in Washington. But since he took office, his focus has been protecting his own personal interests, pursuing policies to enrich his family and fellow plutocrats.
Ronald Reagan was blamed for the 2008 economic crisis. The late president was responsible for deregulation in the financial sector and, in particular, loosening restrictions on mortgage lending to people with lower down payments. In the wake of one of the worst financial crises in history, governments in the US and Europe moved to adjust financial regulation.
The Dodd-Frank Act, officially called the Dodd-Frank Wall Street Reform and Consumer Protection Act, was signed into law by President Obama in 2010 in response to the crisis that became known as the Great Recession. Dodd-Frank put regulations on the financial industry and created programmes to stop mortgage companies and lenders from taking advantage of consumers. In February 2017 Trump moved to chisel away at Obama’s legacy on financial regulation, announcing steps to revisit the rules.
There is a saying: History does not always repeat itself, but it often rhymes. The author points out that the “US has, of course, faced a situation like this once before – at the end of the nineteenth century. The response then was a range of reforms spread out over decades, including antitrust legislation and legal rulings against the strongest corporate interests on the planet, direct election of the US Senate, and enactment of the federal income tax (in the face of a hostile Supreme Court). Expanding social insurance – ultimately including government-run social security – and strengthening financial-market regulation in the 1930s was part of the same broad response. The system that emerged served the US well, until it was steadily dismantled following the election of Ronald Reagan in 1980.”
As Trump’s 2017 overhaul of federal tax law has inflicted much harm on the country’s budget, the next Democratic president will have no choice but to repeal Trump’s tax cut and Jobs Act. |
Don't worry, the L.A. map only shows rail. The main problem is that it doesn't show enough. By 2020 (the last year shown in the video) phase 2 of the Expo line should be complete, making the light blue line longer. There should also be a green line extension to LAX and an additional light rail line paralleling the green line. IF L.A. manages to accelerate the rail part of measure R (which seems likely) then there will several more rail extensions than the video predicts
Thank you anyway. While I have assignments in Carleton University to work on that I really should be starting, I've been, of late, working on a map of the Barcelona Metro. A new circumferential metro line, Line 9, is being built, and I'd like to include it. The first segment of the first phase to La Sagrera (and a new high speed rail station) opens next month. The rest of the line will open in 2014. I also include trams, as you will notice. :)
As I've said before, subways aren't really that great because there is a strong disincentive to travelling underground. Trams and light rail are much better for this, so I would want to make subways long hops (at least 5km) and ideally, join them at surface level with trams. I'm imagining a sort of rollercoaster ride with surface transfers with trams.
I'm transitioning my writing over to my other site which was previously called The Direct Transfer. People seemed to be confused by the differences in brand between The Overhead Wire and The Direct Transfer so I made a change and combined the two as The Overhead Wire.
This page will continue to be here and will still be updated sparingly as it has over the last few years, however new original analysis and writing will be featured at TheOverheadWire.com in addition to the news archive and The Overhead Wire Daily email. |
The?black garlic?and name fermentation black garlic is born with fresh garlic, with the skin in the fermenting box in 60 to 90 days after fermentation made of food, the black garlic of trace element content is higher, taste sweet and sour, without garlic smell. As anti-oxidation, acidification effect, especially suitable for the three tenors crowd, and cancer patients.
Introduction
The black garlic and garlic, a black fermented black garlic, is to use fresh raw garlic, with skin wet high temperature in the fermenting box fermentation in 60 ~ 90 day, make its natural fermented make food, it raw garlic in the reserved original ingredients, and on the basis of raw garlic to of antioxidation, improve the acidification efficacy several times, and a lot of raw garlic itself into a human proteins necessary for every day of the 18 kinds of amino acids, and then quickly absorbed by human body, to enhance human immunity, restore the human body fatigue, keep the human body health played the role of positive role, and taste sweet and sour, after food without garlic taste, fire is readily availability of health food. We know that garlic itself is very good health food, and the role of the black garlic is amazing. To diabetes, high blood pressure, high blood fat, cancer have very significant control efficacy.
The black garlic has a very high nutritional £¦#118alue, inspection agency detect the report shows: fresh garlic every 100 g contains moisture content 63.8 g, 7.2 g sugar, protein 5.2 g and 10.2 g fat, calcium 10 mg, p 12.5 mg, iron 1.3 mg, vitamin B10.29 mg, vitamin B20.06 mg, Nick acid 0.8 mg, vitamin C and mg, in addition, it also contains magnesium and other trace elements and so on, these are the human body essential nutrients. And the black garlic every 100 g contains moisture content 43.6 g, heat 1100 KJ, 41.4 g sugar, protein 10.4 g and 5.1 g fat, calcium and magnesium 52 mg, mg, iron 2.1 mg, sodium, potassium, 36 mg 930 mg, zinc 1.4 mg vitamin B610.726 mg, vitamin B20.126 mg, nicotinic acid 10.048 mg, etc, can see from this, the black garlic than garlic water, fat and other significantly reduce, trace elements have significantly improved, and the sugar, protein, vitamin and so on, at least for garlic of more than two times, therefore, the black garlic has the rich, even can improve human body essential nutrients to function.
Function
So the black garlic can be eliminate fatigue, improve physical strength, solve constipation, protect liver, improve activity, promote sleep and prostate DuoZhong function. Prevent cancer ¡¡£¦#168;£¦#168; ¡¡£¦#168;£¦#168; strengthen control blood sugar organs of special effects food is the best of the best garlic anticancer from ancient Egypt since, garlic is because is nourishing and strengthening and relieve fatigue and effects of the food is thought of, in 1990 the United States national cancer institute publication "Designer Foods Program" in garlic for prevention of cancer the most effective and is listed in the 48 common cancer is the head of the food. At the same time, it can reduce the cholesterol in the blood of the redundant and sugar, also can adjust the gastric bowel peristalsis. The smell of garlic garlic consists mainly of allicin, allicin and vitamin B1 phase formed by the combination of called the garlic thiamin components have relieve fatigue, promote the decomposition of the efficacy of sugar, control blood sugar up; At the same time in the fine grain garlic is called the organic sulfide can activate cells, and can help vitamin B1 will sugar into energy, has the fatigue lifted, enhance physical strength and curative effect. In addition, which is called the inorganic selenium nutrients has powerful eliminate various kinds of life habit the root of the disease-the role of reactive oxygen species. Will allicin heating 25-100 ¡æ to create called garlic ene (Spanish ajoene) of sulfur compounds (has the characteristics of oil will melt) composition, and its control blood sugar and sugar into energy effect more. Modern medical research proves, garlic set 100 DuoZhong medicinal and health care component in a body, including sulfur volatiles 43 species, vulcanization and sulfonic acid (such as garlic meat) ester 13, amino acids nine and peptide eight, glucoside of 12, of 11 kinds of enzymes. In addition, garlic is unique, the composition of garlic, when it enters the blood becomes allicin when, this kind of allicin even diluted 100000 times can still in the instant kill typhoid bacillus, dysentery bacillus, influenza virus, etc. Allicin and vitamin B1 combination can produce garlic thiamin, eliminate fatigue, enhance physical with the surprise effect. Garlic contains the creatine anhydride is involved in muscle activity indispensable ingredients, the generation of semen have a role, can make the sperm quantity growth, the so-called eat garlic energetic refers to the people. Garlic is also can promote the metabolism, lower cholesterol and triglyceride content, and have lower blood pressure, fall blood sugar role, subject to high blood pressure, high blood fat, arteriosclerosis and diabetes have certain curative effect. Garlic for external use can promote skin blood circulation, remove skin aging cutin layer, soften the skin and enhance its flexibility, still can prevent insolation, prevent melanin deposition, to splash whitening. Research at home and abroad in recent years that garlic can block of nitrosamines carcinogens in the body to the synthesis, so far, the cancer prevention effect in 40 DuoZhong vegetables, fruits, press the pyramids arranged, garlic is located in the tower. In 100 DuoZhong garlic ingredients, including dozens of composition have independent cancer-fighting properties.
Taste sweet and sour no stimulation
The black garlic, no peculiar smell of garlic, but sending out can remind appetite of rich smell. In order to keep a lot of water of garlic, all the production process keeps the wet state, it is the appearance of the fruit. This is because the long time of fermentation and ripe garlic to the protein content in are broken down into amino acid, carbohydrate is broken down to fructose, and complete reserve with garlic, garlic.?
So the black garlic sweet smell, delicious, also can be used as a dessert or dessert to eat. Through the analysis of test results prove food, as a delicious ingredients of the amino acid content, the black garlic than ordinary garlic has increased 2.5 times. The black garlic eat to mouth like jelly after are soft, and after food eaten raw garlic, no peculiar smell of, also won't produce undesirable stimulation to intestines and stomach.?
Through the fermentation, garlic medicinal effect more enhanced
After fermentation and ripe black garlic with the far superior to the ordinary garlic on health care effect. Especially the powerful adjust blood circulation effect and antioxidant power. Although these effects ordinary garlic also can achieve, but the black garlic in the fermented mature process, strengthening the original in the composition of the inherent power based on the new components and produces, its health effects become more powerful.?
The sterilization, construction to prevent the wall
The black garlic contains allicin has antibacterial effect, it to dozens of popular virus and DuoZhong pathogenic organisms have exterminate action. On the composition of the antiseptic effect is mainly allicin, still have a kind of white oil sex liquid "vulcanization propylene" [(CH2CH2 H2) 2 S]. This kind of allicin even diluted 100000 times can still in the instant kill typhoid bacillus, dysentery bacillus, influenza virus, etc. The black garlic of volatile compounds, leaching solution and allicin in test tubes, DuoZhong pathogenic bacteria to significantly inhibit or kill role. These of sulfur compounds to the corrupt fungi also has the very strong inhibition and exterminate action, and its function is equivalent or better than chemical preservatives strength benzoic acid, the sorbic acid, is now find natural plant in one of the strongest antiseptic.?
Anti-aging, antioxidant neng force is common of 39 times garlic
Antioxidant ability
The human body is the essence of the aging by oxidation, black garlic and the super antioxidant function is its ability to produce extremely good effect more disease of the main reason, also can cause the body to produce the multi-function weakened disease very good health care treatment effect.?
Enhance the immune function
Experiments show that the black garlic fat soluble volatile oil can significantly improve the macrophage phagocytosis function, strengthen the function of the immune system. Allicin has activated by sugar of lipid membrane function, can improve its permeability, making the cell metabolism strengthen, improve the energy, the machine body immunity dint then strengthen. Lysine, serine have improve immune function, vitamin C can also enhance human immunity. The black garlic contains zinc participate in hormone synthesis, improve human immunity.?
Powerful regulate blood sugar level
The black garlic can affect the liver glycogen synthesis, reduce the blood sugar level and increase the plasma insulin levels. One of the allicin can make a normal blood glucose levels drop, the black garlic also contained S-methyl cysteine sulfone follows and S-allyl base cysteine sulfone follows, this contains sulfide can restrain G-6-P enzyme NADPH, prevent insulin damage, have fall blood sugar role. The black garlic in the ErLiuHuaWu also allyl have this effect. The black garlic contain alkaloids, also has the lower blood sugar composition, increasing the function of insulin, the more important is it normal blood sugar leels of no effect. Glycine reduce blood glucose levels, prevention and cure diabetes. Isoleucine have promote insulin secretion, adjust the function of blood sugar.?
Researchers in the animal experiment with 25 g black garlic juice feed for glucose tolerance test rabbit, measure the largest black garlic group blood glucose down £¦#118alue is 12.4%-1.2%, distilled water control group were 1.8%-0.5%, explain the black garlic to control blood sugar have obvious effect. And they give by four oxygen pyrimidine diabetes rats caused by the mouth absorb the black garlic extract, also showed a black garlic has fall blood sugar role, intake, 2 h blood sugar concentration after its reduced by 17.9% ~ 26.2%. The black garlic regulate blood sugar ability is not simple control, but in the protection of insulin, the initiative will convert sugar can energy, that people with diabetes have the ability of ordinary people like sugar, not oral glucose-lowering drugs, to decide the black garlic than a hypoglycemic products than effect.
This section production methods
With fresh raw garlic, with skin wet high temperature in the fermenting box natural fermentation in 60 to 90 days become namely.?
Someone in the family make, the method is as follows: the clean with the skin fresh garlic in household electric cooker, transferred to heat preservation condition placed 10 ~ 15 days or so.
Editor this period of black garlic applicable people
1, anemia, iron, the calcium. 2, cardiovascular and cerebrovascular diseases as. 3, high blood pressure, high cholesterol, high blood fat, high blood sugar of. 4, hepatitis and liver cirrhosis, liver cancer, the high index. 5, and cancer. 6, alzheimer's disease, Parkinson's disease, etc. 7, stroke, ear stroke, etc. 8, kidney empty, frail, easy tired, spirit who are suffering. 9, the prostate gland disease. 10, diabetes patients. 11, easy to catch a cold one. 12 for the period, the suffering symptoms. 13, want to keep young energetic person. 14 and low immunity crowd, enhance immunity. 15, do the office for a long time, do not exercise the crowd. 16, in the healthy crowd. 17, constipation, the diarrhea
Editor this section should be eating black garlic matters needing attention
It is the flourishing, suggested that Japanese a grain can. Leukaemia and related blood coagulation adverse symptoms, one proposed food. |
Q:
R - y axis limit/range for hexbin plot
I am attempting limit the range of a saved plot in R. I am able to do so in a normal plot like so without any set range:
library(hexbin)
library(lattice)
data <- read.table("textfile.txt", as.is=TRUE);
xpts <- data[,1];
ypts <- data[,2];
jpeg('plot.jpg', width = 1000, height = 1000);
plot(xpts, ypts);
dev.off();
I then get the following image:
I then set my own y-axis limit from 0 to 10 using ylim in the plot function:
library(hexbin)
library(lattice)
data <- read.table("textfile.txt", as.is=TRUE);
xpts <- data[,1];
ypts <- data[,2];
jpeg('plot.jpg', width = 1000, height = 1000);
plot(xpts, ypts, ylim=c(0,10));
dev.off();
I then get the following image:
I have to make a hexbin plot. It works great without a range limit, like so:
library(hexbin)
library(lattice)
data <- read.table("textfile.txt", as.is=TRUE);
xpts <- data[,1];
ypts <- data[,2];
bin <- hexbin(x=xpts, y=ypts);
jpeg('hexplot.jpg', width = 1000, height = 1000);
plot(bin);
dev.off();
and I get the following image:
Then, when I try to set a similar ylim on the hexbin, I get errors. I've tried ybnds as it's something that others have tried, but I don't know how to set the range. I have something like this:
library(hexbin)
library(lattice)
data <- read.table("textfile.txt", as.is=TRUE);
xpts <- data[,1];
ypts <- data[,2];
bin <- hexbin(x=xpts, y=ypts, ybnds=c(0,10));
jpeg('hexplot.jpg', width = 1000, height = 1000);
plot(bin);
dev.off();
I get the following error:
Error in hexbin(x = xpts, y = ypts, ybnds = c(0, 10)) :
'ybnds' must encompass range(y)
Execution halted
I have also tried ylim, but it seems I can't use it for hexbin. It would be great if someone would help me out - truly appreciated.
A:
Try restricting the data input:
data <- read.table("textfile.txt", as.is=TRUE);
xpts <- data[,1][ data[,2] <= 10 & data[,2]>=0]
ypts <- data[,2][ data[,2] <= 10 & data[,2]>=0]
(You don't need terminating semi-colons at the end of lines.)
|
Pathological study of archival lung tissues from five fatal cases of avian H5N1 influenza in Vietnam.
Highly pathogenic avian H5N1 influenza virus (H5N1) infection in humans causes acute respiratory distress syndrome, leading to multiple organ failure. Five fatal cases of H5N1 infection in Vietnam were analyzed pathologically to reveal virus distribution, and local proinflammatory cytokine and chemokine expression profiles in formalin-fixed, paraffin-embedded lung tissues. Our main histopathological findings showed diffuse alveolar damage in the lungs. The infiltration of myeloperoxidase-positive and/or CD68 (clone KP-1)-positive neutrophils and monocytes/macrophages was remarkable in the alveolar septa and alveolar spaces. Immunohistochemistry revealed that H5N1 mainly infected alveolar epithelial cells and monocytes/macrophages in lungs. H5N1 replication was confirmed by detecting H5N1 mRNA in epithelial cells using in situ hybridization. Quantitation of H5N1 RNA using quantitative reverse transcription PCR assays revealed that the level of H5N1 RNA was increased in cases during early phases of the disease. We quantified the expression of tumor necrosis factor-alpha (TNF-α), interleukin (IL)-6, IL-8, regulated on activation normal T-cell expressed and secreted (commonly known as RANTES), and interferon-gamma-inducible protein of 10 kDa (IP-10) in formalin-fixed, paraffin-embedded lung sections. Their expression levels correlated with H5N1 RNA copy numbers detected in the same lung region. Double immunofluorescence staining revealed that TNF-α, IL-6, IL-8 and IP-10 were expressed in epithelial cells and/or monocytes/macrophages. In particular, IL-6 was also expressed in endothelial cells. The dissemination of H5N1 beyond respiratory organs was not confirmed in two cases examined in this study. |
Background {#Sec1}
==========
Progressive and irreversible airflow obstruction are characteristics of chronic obstructive pulmonary disease (COPD), which are caused by chronic inflammation of airways \[[@CR1]\]. COPD is a major cause of morbidity and mortality worldwide and is projected to become the third leading cause of death by 2030 \[[@CR2]\]. The major therapeutic goal of COPD treatment is to prevent acute exacerbations. However, available treatments for acute exacerbations of COPD (AECOPD) are currently not very effective \[[@CR3]\]. Bacterial infections of the lower respiratory tract are believed to play a major role in the pathogenesis of AECOPD. Generally, nontypeable *Haemophilus influenzae*, *Streptococcus pneumoniae*, and to a lesser extent, *Moraxella catarrhalis* are the most frequent species isolated by microbiological culture during COPD exacerbations \[[@CR4]\]. These organisms can often be found colonizing the airways of COPD patients between exacerbations \[[@CR5]\]. Since many of these bacteria persist in the airways of COPD patients, their presence may promote chronic inflammatory states that drives COPD pathogenesis. However, information on the quantitative analysis of bacterial burden in the lower respiratory tract in stable COPD and AECOPD patients are quite limited. Previous studies frequently analyzed bacteria in the respiratory tract of patients by traditional microbiological culture techniques. However, the current microbiological gold standard has a number of limitations, particularly the lack of sensitivity and time-consuming culture; which significantly impacts the treatment and management of patients, and limits our understanding of the development and progression of COPD \[[@CR4]\]. Furthermore, bacterial cultures can lead to false-negative results, especially during concurrent antibiotic treatment. A challenge in COPD diagnostics is to distinguish disease-causing strains from colonizing strains. It has been shown that for *Streptococcus pneumoniae* \[[@CR6]\], the load of many types of bacteria in the respiratory tract is probably greater during infection than during carriage; and therefore, quantitative methods would most likely improve diagnostic quality.
In recent years, real-time quantitative PCR (RT-qPCR) has emerged as a valuable tool for the quantitative and rapid detection of various biological specimens in body fluids \[[@CR7], [@CR8]\]. Guma *et al*. developed a RT-qPCR method using primers and a TaqMan probe complementary to sequences in the omp P6 gene for rapid detection of *Haemophilus influenzeae*, and their study concluded that P6 RT-qPCR is both sensitive and specific for identifying *Haemophilus influenzeae* in respiratory secretions \[[@CR9]\]. In another study, the prevelance of *Moraxella catarrhalis* was detected by RT-qPCR using primers and probes targeting the copB gene, which provided a sensitive and reliable means of rapidly detecting and quantifying *Moraxella catarrhalis* during lower respiratory tract infections; and this may be applied to other clinical samples \[[@CR10]\]. In addition, some other common pathogenic bacteria in respiratory tract infections such as *Klebsiella pneumoniae* \[[@CR11]\], *Staphylococcus aureus* \[[@CR12]\], *Streptococcus pneumoniae* \[[@CR13]\], and *Pseudomonos aeruginosa* \[[@CR14]\] were detected by RT-qPCR, targeting bacteria-specific genes. These methods present sensitive and reliable means of rapidly detecting and quantifying microorganisms. The load of common bacteria in the respiratory tract of patients with COPD or lower respiratory tract infection was analyzed by RT-qPCR or multiplex PCR in sputum samples \[[@CR4], [@CR15]\]^.^ In another study, the spectrum of potentially pathogenic microorganisms in sputum of COPD patients was determined by PCR-denaturing gradient gel electrophoresis (DGGE) \[[@CR16]\]. However, most of these previous studies focused on the respiratory tract microbiome of COPD patients in the stable stage \[[@CR17]\], and only few studies compared common bacteria between the stable stage and acute exacerbations of COPD. Furthermore, most of the studied samples were sputum or bronchoalveolar lavage fluid (BALF) samples, in which contamination by pathogens colonizing the upper respiratory tract are difficult to avoid. Therefore, proper collection of samples from the lower respiratory tract is a key for the precise quantitative analysis of pathogens. The usefulness of a protected specimen brush (PSB) for diagnosing respiratory infections has been reported earlier \[[@CR18]--[@CR20]\]. The tip of the sampling brush or PSB is covered by a sheath to avoid contamination by organisms in the upper tract while the brush is being inserted or pulled out \[[@CR21]\]. Thus, PSB or protected BALF from bronchoscopy appears as the best choice for sample collection from the lower respiratory tract in COPD patients.
In this present study, we describe the application of RT-qPCR in tageting specific bacterial pathogen genes for the simultaneous and direct detection and quantification of a range of the most common pathogens in the lower respiratory tract including Staphylococcus aureus, Klebsiella pneumoniae, Streptococcus pneumoniae, Pseudomonos aeruginosa, Haemophilus influenzeae, and Moraxella catarrhalis in PSB and BALF samples obtained from stable COPD and AECOPD patients. Moreover, we explored the relationship among bacterial burden, inflammtory response such as neurotophil count and cytokine levels of IL-1β, IL-6 and IL-8 in BALF, and the forced expiratory volume in one second (FEV1) % predicted, forced vital capacity (FVC) % predicted, and FEV1/FVC lung function values in COPD patients. Our study is the first to describe common bacteria in the lower respiratory tract by RT-qPCR analysis using PSB and protected BALF samples, and compare the change of bacterial load between the stable stage and acute exacerbations of COPD. These results may provide guidance for the effective and timely antibiotic treatment of AECOPD patients.
Materials and Methods {#Sec2}
=====================
Study subjects {#Sec3}
--------------
Sixty-six COPD patients (GOLD stage II-III, COPD group) and 33 healthy subjects (HS group) with normal pulmonary function (non-smokers) were enrolled in this case--control study, which was carried out at the Department of Respiratory Diseases, Affiliated Yinzhou Hospital, College of Medicine, Ningbo University, China. COPD was diagnosed according to the patient's history of tobacco smoking, symptoms, and post-bronchodilator pulmonary function tests with FEV1/FVC lower than 70 %, according to Global Initiative for Chronic Obstructive Lung Disease (GOLD) guidelines \[[@CR22]\]. All patients were clinically assessed including chest radiography, temperature recording and blood gas analysis (as needed) to exclude other causes of breathlessness. Moreover, patients in the COPD group were further divided into two subgroups according to disease stage: stable COPD group and AECOPD group. The stable COPD group consisted of 34 patients who were evaluated as clinically stable and underwent an exacerbation-free period of six weeks. Patients in the stable COPD and HS groups were examined by bronchoscopy to exclude other lung lesions. The AECOPD group consisted of 32 patients who were identified according to the Anthonisen criteria \[[@CR23]\] and the consensus definition for COPD exacerbations \[[@CR24]\]. Patients in the AECOPD group were diagnosed according to pulmonary function and underwent mechanical ventilation via tracheal tubing to treat type-II respiratory failure. Bronchoscope examinations were guided by a tracheal tube. All subjects enrolled in this study underwent routine blood examination. Patients that presented with pneumonia, neuromuscular diseases, thoracic deformities, restrictive lung diseases, pulmonary vascular disease, as well as patients who underwent lung resection, were excluded from this study. Two hours after tracheal tube intubation and before antibiotic treatment, lower respiratory tract samples were collected by a protected specimen brush (PSB) and protected bronchoalveolar lavage (BAL) during bronchoscopy. This study protocol was authorized by the ethics and research committee of the Affiliated Yinzhou Hospital, College of Medicine, Ningbo University, China. Signed informed consent was obtained from all subjects.
Collection of PSB and BALF samples from patients {#Sec4}
------------------------------------------------
PSB samples were collected with a sheath brush (Olympus BC-5 CE, Olympus Imaging, Center Valley, PA, USA) with a distal occlusion composed of polyethylene glycerol through a flexible bronchoscope (Olympus, BF-260). The brush was pushed out of the sheath, cut with ethanol-disinfected scissors, and placed in an Eppendorf tube containing 1.5 ml of saline solution. A part of the PSB samples (0.5 ml) were used for standard bacterial cultures and remaining samples were prepared for total DNA extraction. Simultaneously with PSB sample collection, BAL specimens were obtained by lavaging the airway with approximately 50 ml of 0.9 % NaCl solution through the bronchoscope; and approximately 60 % lavage return volume was collected. Total BALF cells were counted from a 0.05 ml aliquot, 0.5 ml of BALF samples were used for bacterial cultures, and 1 ml of BALF samples were taken for total DNA extraction. Remaining fluid samples were centrifuged (1,000 g for 10 min) at 4 °C, and the supernatant was stored at −80 °C for subsequent cytokine analysis by ELISA. The remaining cell pellets were resuspended with 0.9 % NaCl solution, and a differential cell count was performed using cytospin and Wright-Giemsa staining.
Bacterial cultures {#Sec5}
------------------
PSB and BALF samples were inoculated into Eosin methylene blue agar, Brucella agar, blood agar, and chocolate agar media (Biomérieux, Marcy l\'Etoile. France); and incubated for 24--48 h at 37 °C. Colony identification was performed using the Vitek 2 Compact full automatic identification system (Biomérieux, France). For PSB and BALF cultures, after 24 h of incubation, bacterial colonies with growth of ≥10^3^ and ≥10^5^, respectively, were considered as pathogenic.
Cytokine ELISA {#Sec6}
--------------
IL-1β, IL-6, IL-8, IL-10 and TNF-α cytokine concentrations in BALF supernatants were measured by standardized sandwich ELISA (eBioscience, San Diego, CA, USA) according to manufacturer's protocols.
Preparation of bacterial DNA from PSB and BALF samples {#Sec7}
------------------------------------------------------
PSB or BALF samples (1 ml) were centrifuged at 11,000 g for five minutes. Aliquots of 0.2 ml of the pellet were used in order to obtain a 5-fold concentration of the samples. DNA was prepared using a Qiagen DNA Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. DNA was stored at −20 °C before amplification by RT-qPCR. In each experiment, a negative control that contained all reagents except the PSB sample was included.
RT- qPCR of PSB and BALF samples {#Sec8}
--------------------------------
Primers and TaqMan probes for the specific amplification of *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae* and *Moraxella catarrhalis* were synthesized by Sangon Biotech Co., Ltd. (Shanghai, P.R. China). Primer sequences and assay performance are summarized in Table [1](#Tab1){ref-type="table"}. DNA amplification and detection were performed with a TaqMan 7500 Fast system (Applied Biosystems, Foster City, CA, USA). The reaction mixture (20 μl) used in the PCR assay was as follows: 10 μl of TaqMan Universal PCR Mastermix (Applied Biosystems), 2 μl of extracted DNA, 0.5 μl of specific primers (final concentration was 0.6 μmol/l), and probes (final concentration was 0.3 μmol/l). PCR cycling conditions applied for khe, cps, omp P6, and copB gene assays were as follows: heating at 94 °C for four minutes, followed by 40 cycles of 94 °C for 30 s and 60 °C for one minute. PCR cycling conditions applied for egc and gyrB gene assays were as follows: heating at 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for one minute. Optimized conditions of the RT-qPCR assay are summarized in Table [2](#Tab2){ref-type="table"}. Fluorescence was measured after each cycle, and each assay was carried out in duplicate. Two negative RT-qPCR controls were run on each sample plate, and the median cycle of quantification (Cq) value from each duplicate was used for analysis.Table 1RT-qPCR primers and assay performance summaryOrganismTarget genePrimer/Probe sequencesAssay linearityRef.*Staphylococcus aureusegc*F:5′-CTTCATATGTGTTAAGTCTTGCAGCTT-3′R^2^ = 0.995\[[@CR12]\]R:5′-TTCACTCGCTTTATTCAATTGTTCTG-3′Slope = −3.91P: 5′-6-FAM -ATGTTAAATGGCAATCCT-TAMRA -3′Efficiency = 1.04*Klebsiella pneumoniaekhe*F: 5′-GATGAAACGACCTGATTGCATTC-3′R^2^ = 0.997\[[@CR11]\]R: 5′-CCGGGCTGTCGGGATAAG-3′Slope = −3.60P:5′-6-FAM-CGCGAACTGGAAGGGCCCG-TAMRA-3′Efficiency = 1.07*Streptococcus pneumoniaecps*F: 5′-GCTGTTTTAGCAGATAGTGAGATCGA-3′R^2^ = 0.995\[[@CR13]\]R: 5′-TCCCAGTCGGTGCTGTCA-3′Slope = −3.11P: 5′-6-FAM-AATGTTACGCAACTGACGAG-TAMRA -3′Efficiency = 1.12*Pseudomonos aeruginosagyrB*F: 5′-GGCGTGGGTGTGGAAGTC-3′R^2^ = 0.995\[[@CR14]\]R: 5′-TGGTGGCGATCTTGAACTTCTT-3′Slope = −3.55P: 5′-6-FAM-TGCAGTGGAACGACA-TAMRA-3′Efficiency = 0.96*Haemophilus influenzeaeomp P6*F:5′-CCAGCTGCTAAAGTATTAGTAGAAG-3′R^2^ = 0.997\[[@CR9]\]R: 5′-TTCACCGTAAGATACTGTGCC-3′Slope = −4.22P: 5′-6-FAM -CAGATGCAGTTGAAGGTTATTTAG-Efficiency = 0.95TAMRA-3′*Moraxella catarrhaliscopB*F: 5′-GTGAGTGCCGCTTTACAACC-3′R^2^ = 0.998\[[@CR10]\]R: 5′-TGTATCGCCTGCCAAGACAA-3′Slope = −3.66P:5′-6-FAM-TGCTTTTGCAGCTGTTAGCCAGCCTAA-Efficiency = 0.91TAMRA-3′Table 2Optimized conditions for egc, khe, cps, gyrB, omp P6 and copB RT-qPCR assayReactionFinal concentrationComponents*egckhecpsgyrBomp P6copB*TaqMan Universal PCR Mastermix1×1×1×1×1×1×Primer0.6 μmol/L0.6 μmol/L0.6 μmol/L0.6 μmol/L0.6 μmol/L0.6 μmol/LProbe0.3 μmol/L0.3 μmol/L0.3 μmol/L0.3 μmol/L0.3 μmol/L0.3 μmol/LTotal volume20 μl20 μl20 μl20 μl20 μl20 μlMelt95 °C, 10 min94 °C, 4 min94 °C, 4 min95 °C, 10 min94 °C, 4 min94 °C, 4 minDenaturation95 °C, 15 s94 °C, 30 s94 °C, 30 s95 °C, 15 s94 °C, 30 s94 °C, 30 sAnnealing/Extension60 °C, 60 s60 °C, 60 s60 °C, 60 s60 °C, 60 s60 °C, 60 s60 °C, 60 sCycles454040454040PCR Product Size82 base pairs77 base pairs67 base pairs190 base pairs156 base pairs71base pairsTable 3Demographic and clinical characteristics of patients in the HS, stable COPD and AECOPD groupsHSStable COPD patientsAECOPD patients(*n* = 33)(*n* = 34)(*n* = 32)Age (years)65 ± 867 ± 769 ± 6Gender (M/F)20/1328/627/5BMI (kg/m^2^)23.1 ± 5.124.2 ± 4.923.8 ± 3.9Tobacco (pack/year)-44.2 ± 25.643.7 ± 27.8FEV1 (L)3.3 ± 0.31.3 ± 0.1^\*\*^1.2 ± 0.2^\*\*^FEV1 % predicted103.6 ± 7.353.4 ± 8.8^\*\*^51.4 ± 9.0^\*\*^FVC (L)4.0 ± 0.22.9 ± 0.2^\*^2.7 ± 0.2^\*^FVC % predicted102.7 ± 6.781.4 ± 9.3^\*\*^79.9 ± 7.4^\*\*^FEV1/FVC (%)82.3 ± 6.143.8 ± 4.4^\*\*^44.1 ± 7.1^\*\*^WBC (x10^9^/L)5.6 ± 1.26.1 ± 1.711.4 ± 5.1^\*\*\#\#^Neutrophils (%)64.6 ± 6.768.7 ± 7.6^\*^85.4 ± 6.1^\*\*\#\#^CRP (mg/L)6.7 ± 2.416.1 ± 6.7^\*\*^85.2 ± 30.4^\*\*\#\#^All data are expressed as means ± SEM, except gender. ^\*^ *P* \< 0.05 and ^\*\*^ *P* \< 0.01 *vs*. the HS group; ^\#^ *P* \< 0.05 and ^\#\#^ *P* \< 0.01 *vs*. the stable COPD group; FEV1, Forced expiratory volume in one second; FVC, forced vital capacity; CRP, C-reactive protein; HS, Healthy subjects. The spirometry data in AECOPD patients reflect the baseline data in the stable stageTable 4Microbiological culture results of PSB and BALF samples obtained from patients in the HS, stable COPD and AECOPD groups*n* (%)HSStable COPD patientsAECOPD patients(*n* = 33)(*n* = 34)(*n* = 32)PSBBALFPSBBALFPSBBALF*No isolated or Normal flora*29 (87.9)29 (87.9)20 (58.8)15 (44.1)9 (28.1)8 (25.0)*Staphylococcus aureus*1 (3.0)1 (3.0)2 (5.9)4 (11.8)3 (9.4)3 (9.4)*Klebsiella pneumoniae*1 (3.0)1 (3.0)1 (2.9)3 (8.8)4 (12.5)4 (12.5)*Streptococcus pneumoniae*2 (6.0)2 (6.0)4 (11.8)5 (14.7)3 (9.4)4 (12.5)*Pseudomonos aeruginosa*002 (5.9)2 (2.9)4 (12.5)5 (15.6)*Haemophilus influenzeae*002 (5.9)3 (8.8)6 (18.8)5 (15.6)*Moraxella catarrhalis*001 (2.9)2 (2.9)2 (6.3)2 (6.3)*Others* ^a^001 (2.9)2 (2.9)1 (3.1)1 (3.1)^a^Other isolated bacteria including *Acinetobacter baumanii*, *Escherichia coli*, and *Streptococcus hemolyticus*. HS, Healthy subjects
Quantification of microorganism load in PSB and BALF samples {#Sec9}
------------------------------------------------------------
To quantify the number of bacterial cells in PSB and protected BALF samples, six ATCC standard strains were used as positive controls. *Staphylococcus aureus* (ATCC 25923) and *Pseudomonos aeruginosa* (ATCC 27853) were provided by the Clinical Laboratory, First Hospital, Ningbo City, China. *Klebsiella pneumoniae* (ATCC 700603), *Streptococcus pneumoniae* (ATCC 49619), *Haemophilus influenzeae* (ATCC 49247), and *Moraxella catarrhalis* (ATCC 25238) were purchased from Bioplus Biotech Co., Ltd. (Shanghai, China). A dense suspension of bacteria grown on agar plates was inoculated in phosphate-buffered saline, representing a bacterial concentration of approximately 10^8^ CFU/ml. A 10-fold serial dilution scheme ranging between 10^8^ and 10^3^ CFU/ml was prepared. To correlate cycle threshold (CT) values measured by RT-qPCR with the number of bacterial cells present in each sample, aliquots (100 ml) of each dilution of bacterial suspension were plated out in triplicate onto agar plates. Agar plates were incubated overnight at 37 °C, and colonies were counted in order to calculate the number of CFU per dilution tube. DNA extraction was performed from a sample (5 ml) of each dilution tube and was analyzed concomitantly by RT-qPCR. Each positive control was carried out in triplicate, mean CT values were calculated and plotted against the base 10 logarithm of CFU per ml, and a standard curve was generated. The load of microorganisms in PSB and BALF samples was determined using a standard equation.
Statistical analysis {#Sec10}
--------------------
All data were expressed as means ± SEM. Differences between groups were examined for statistical significance by one-way analysis of variance (ANOVA) using SPSS 11.0 software (SPSS Inc., Chicago, USA). The correlation among bacterial burden, inflammatory mediators such as neutrophil cell count and cytokine levels, and pulmonary function such as FEV1 % predicted, FVC % predicted, and FEV1/FVC were calculated using *Pearson*'s correlation coefficient. *P* values \<0.05 denoted that the difference was statistically significant.
Results {#Sec11}
=======
Demographic and clinical features and pulmonary function of COPD patients and healthy subjects (HS) {#Sec12}
---------------------------------------------------------------------------------------------------
Demographic and clinical features, spirometric findings, and routine blood examination results of patients in the HS, stable COPD and AECOPD groups are shown in Table [3](#Tab3){ref-type="table"}. Age, gender, and BMI did not differ among the three groups. Spirometry, FVC, FVC % predicted, FEV1, and FEV1 % predicted significantly decreased in patients in the stable COPD group compared with patients in the HS group (*P* \< 0.05). However, the percentage of neutrophils and C-reactive protein (CRP) levels were significantly higher in patients in the stable COPD and AECOPD groups compared with patients in the HS group (*P* \< 0.05), and between patients in the stable COPD and AECOPD groups (*P* \< 0.01). White blood cell count significantly increased in patients in the AECOPD group compared with patients in the stable COPD and HS groups (*P* \< 0.01). However, there was no significant difference between patients in the stable COPD and HS groups (*P* \> 0.05).
Microbiological cultures from PSB and BALF samples obtained from COPD patients and HS {#Sec13}
-------------------------------------------------------------------------------------
PSB and BALF samples were obtained through a flexible bronchoscope to analyze bacteria in the lower respiratory tract of COPD patients and HS. Microbiological cultures revealed that 29 HS (87.9 %) had no isolated or normal non-pathogenic bacterial flora in PSB and BALF samples (Table [4](#Tab4){ref-type="table"}). In 20 (58.8 %) and 15 COPD patients (44.1 %), no isolated or normal airway bacterial flora was detected in PSB and BALF samples, respectively. In nine (28.1 %) and eight (25.0 %) AECOPD patients, no isolated or normal airway bacterial flora was detected in PSB and BALF samples, respectively. The following pathogenic bacteria were identified in cultures of the remaining patients: *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis*. Other isolated bacteria included *Acihetobacter baumanii*, *Escherichia coli*, and *Streptococcus hemolyticus* (Table [4](#Tab4){ref-type="table"}).
RT-qPCR analysis of bacteria in PSB and BALF samples obtained from COPD patients and HS {#Sec14}
---------------------------------------------------------------------------------------
Total bacterial DNA in PSB and BALF samples were extracted for quantification of bacterial content by RT-qPCR analysis. Six bacterial strains were analyzed using corresponding standard strains as positive controls (Table [5](#Tab5){ref-type="table"}). *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* were recovered from PSB samples in 68.8 %, 46.9 %, 42.8 %, 62.5 %, 78.1 % and 50.0 % of patients in the AECOPD group, respectively; and in 47.1 %, 29.4 %, 58.8 %, 44.1 %, 52.9 % and 64.7 % of patients in the stable COPD group, respectively; compared with 9.1 %, 15.2 %, 30.3 %, 6.1 %, 15.2 % and 12.1 % of HS, respectively (*P* \< 0.01). Detected rates of the six strains in BALF samples demonstrated the same diversification trend as those revealed in PSB samples. There was no significant difference in detection rates for the six bacterial strains in BALF samples compared with PSB samples (Table [5](#Tab5){ref-type="table"}).Table 5RT-qPCR analysis of PSB and BALF samples obtained from patients in the HS, stable COPD and AECOPD groups***n*** (%)HSStable COPD patientsAECOPD patients(*n* = 33)(*n* = 34)(*n* = 32)PSBBALFPSBBALFPSBBALF*Staphylococcus aureus*3 (9.1)2 (6.1)16 (47.1)17 (50.0)22 (68.8)20 (62.5)*Klebsiella pneumoniae*5 (15.2)6 (18.2)10 (29.4)9 (26.5)15 (46.9)16 (50.0)*Streptococcus pneumoniae*10 (30.3)8 (24.2)20 (58.8)18 (52.9)14 (42.8)17 (53.1)*Pseudomonos aeruginosa*2 (6.1)2 (6.1)15 (44.1)17 (50.0)20 (62.5)23 (71.9)*Haemophilus influenzeae*5 (15.2)6 (18.2)18 (52.9)20 (58.8)25 (78.1)24 (75.0)*Moraxella catarrhalis*4 (12.1)4 (12.1)22 (64.7)20 (58.8)16 (50.0)15 (46.9)HS, Healthy subjects
Furthermore, to compare the pathogen detection rate between microbiological culture and RT-qPCR, mean detection rates of the six pathogens by RT-qPCR analysis and conventional microbiological culture from PSB and BALF samples in all subjects were calculated and analyzed. Mean detection rates of *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* by RT-qPCR analysis were 40.6 ± 36.79 %, 31.03 ± 14.5 %, 43.68 ± 13.87 %, 32.62 ± 30.78 %, 49.7 ± 27.28 % and 40.77 ± 23.08 %, respectively; which were significantly higher compared with 7.08 ± 3.68 % (*P* = 0.008), 7.14 ± 4.74 % (*P* = 0.001), 10.07 ± 3.58 % (*P* = 0.0002), 6.15 ± 6.57 % (*P* = 0.022), 8.18 ± 7.84 % (*P* = 0.0018), and 3.07 ± 2.82 % (*P* = 0.0037), respectively, as detected by conventional culture methods.
Quantification of microorganism load in PSB and BALF samples obtained from COPD patients and HS {#Sec15}
-----------------------------------------------------------------------------------------------
To quantify the number of bacterial cells in PSB and protected BALF samples obtained from patients in the three groups, six ATCC standard strains (*Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis*) were used as positive controls to correlate CFU with the CT values measured by RT-qPCR. CT values revealed a linear correlation with the 10-log of CFU per ml of bacteria. Therefore, the load of pathogens in PSB and BALF samples were calculated according to a standard curve equation (Fig. [1](#Fig1){ref-type="fig"}). A significant increase in the load of *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* in PSB samples obtained from AECOPD patients were detected, as compared with PSB samples obtained from stable COPD patients (Fig. [2a](#Fig2){ref-type="fig"}, *P* \< 0.01 or *P* \< 0.05). The load of *Klebsiella pneumoniae* and *Haemophilus influenzea* in PSB samples obtained from AECOPD patients significantly increased compared with PSB samples obtained from the HS group (*P* \< 0.01). However, there was no significant difference in the load of *Streptococcus pneumoniae* between patients in the COPD and HS groups (*P* \> 0.05).Fig. 1Standard curves for *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* assays. Mean threshold cycle (CT) value ± SEM of three replicates (three per run) for each reaction is shown in relation to the log of CFU calculated per 20 μl of reaction mixture. Relative correlation coefficient (*R* ^*2*^) and linear regression equations are reported in the legendFig. 2Bacterial load in PSB and BALF samples obtained from COPD patients and healthy subjects. The burden of *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* in PSB samples (**a**), and of *Klebsiella pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* in BALF samples (**b**) obtained from AECOPD patients compared with stable COPD patients. All data are expressed as means ± SEM. ^\*^ *P* \< 0.05 and ^\*\*^ *P* \< 0.01 *vs*. the HS group; ^\#^ *P* \< 0.05 and ^\#\#^ *P* \< 0.01 *vs*. the stable COPD group
There was a significant increase in the load of *Klebsiella pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* in BALF samples obtained from AECOPD patients compared with BALF samples obtained from stable COPD patients (Fig. [2b](#Fig2){ref-type="fig"}, *P* \< 0.01 or *P* \< 0.05). Moreover, the load of *Haemophilus influenzea* in BALF samples obtained from AECOPD patients significantly increased, compared with BALF samples obtained from patients in the HS group (*P* \< 0.05). However, there was no significant difference in the load of *Staphylococcus aureus* and *Streptococcus pneumoniae* between patients in the COPD and HS groups (*P* \> 0.05).
Total and differential cell counts in BALF samples obtained from COPD patients and HS {#Sec16}
-------------------------------------------------------------------------------------
To assess the degree of lung inflammation in COPD patients, BALF samples were collected; then, total and differential cell counts were analyzed. The total number of alveolar inflammatory cells dramatically increased in AECOPD patients compared with stable COPD patients and HS, and in stable COPD patients compared with HS (*P* \< 0.01, Fig. [3a](#Fig3){ref-type="fig"}).Fig. 3Infiltration of inflammatory cells in airways of COPD patients. The number of total inflammatory cells including neutrophils, lymphocytes, and macrophages in BALF samples obtained from patients in the HS, stable COPD and AECOPD groups were determined (**a**). The percentage of each cell type from total cells (**b**). Data are expressed as means ± SEM (*n* = 20 per group). ^\*^ *P* \< 0.05 and ^\*\*^ *P* \< 0.01 *vs*. the HS group; ^\#^ *P* \< 0.05 and ^\#\#^ *P* \< 0.01 *vs*. the stable COPD group
The differential cell count of BALF revealed a significant increase in all inflammatory cells in the alveolar space in AECOPD patients compared with stable COPD patients and HS (Fig. [3b](#Fig3){ref-type="fig"}). The highest increment was observed in the neutrophil population (*P* \< 0.01), but the number of lymphocytes and macrophages also significantly increased in AECOPD patients (*P* \< 0.01). However, the percentage of macrophages in the total cell population significantly decreased (*P* \< 0.01). The percentage of lymphocytes in stable COPD and AECOPD patients significantly increased compared with HS (*P* \< 0.01, Fig. [3b](#Fig3){ref-type="fig"}).
Cytokine levels in BALF supernatants obtained from COPD patients and HS {#Sec17}
-----------------------------------------------------------------------
In order to determine changes in pro-inflammatory cytokines, BALF supernatants obtained from COPD patients and HS were collected. IL-1β, IL-6, IL-8, IL-10 and TNF-α were measured by ELISA. Levels of IL-1β, IL-6, IL-8, IL-10 and TNF-α in BALF supernatants were significantly higher in stable COPD and AECOPD patients compared with HS (Table [6](#Tab6){ref-type="table"}, *P* \< 0.01). Moreover, significant differences were observed between stable COPD and AECOPD patients for all cytokines (*P* \< 0.01).Table 6Cytokine levels in BALF supernatants obtained from patients in the HS, stable COPD and AECOPD groupsCytokines (pg/ml)HSStable COPD patientsAECOPD patients(*n* = 33)(*n* = 34)(*n* = 32)IL-1β0.15 ± 0.050.21 ± 0.07^\*\*^0.58 ± 0.13^\*\*\#\#^IL-60.64 ± 0.151.05 ± 0.21^\*\*^2.07 ± 0.22^\*\*\#\#^IL-86.81 ± 1.599.50 ± 1.3^\*\*^31.39 ± 6.02^\*\*\#\#^IL-100.10 ± 0.060.18 ± 0.06^\*\*^0.30 ± 0.10^\*\*\#\#^TNF-α0.02 ± 0.010.05 ± 0.01^\*\*^0.27 ± 0.11^\*\*\#\#^All data are expressed as means ± SEM. ^\*^ *P* \< 0.05 and ^\*\*^ *P* \< 0.01 *vs*. the HS group; ^\#^ *P* \< 0.05 and ^\#\#^ *P* \< 0.01 *vs*. the stable COPD group. HS, Healthy subjects
Correlation between bacterial burden, inflammatory index, and pulmonary function of COPD patients and HS {#Sec18}
--------------------------------------------------------------------------------------------------------
Using *Pearson*'*s* correlation coefficient, positive correlations were detected between the load of *Klebsiella pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae* and *Moraxella catarrhalis*, and inflammatory mediators such as the percentage of neutrophils and concentration of cytokines such as IL-1β, IL-6 and IL-8 in BALF supernatants (Table [7](#Tab7){ref-type="table"}). Moreover, *Pearson*'*s* correlation coefficients between the load of *Staphylococcus aureus*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae* and *Moraxella catarrhalis*, and TNF-α concentrations in BALF supernatants revealed a positive and statistically significant correlation (*P* \< 0.01). However, no significant correlation between the load of *Streptococcus pneumoniae* and inflammatory mediators was detected (*P* \> 0.05).Table 7Correlation analysis of bacterial burden and inflammatory index in BALF samples*Staphylococcus aureusKlebsiella pneumoniaeStreptococcus pneumoniaePseudomonos aeruginosaHaemophilus influenzeaeMoraxella catarrhalis*(log CFU/ml)(log CFU/ml)(log CFU/ml)(log CFU/ml)(log CFU/ml)(log CFU/ml)*rprprprprprp*Neutrophil (%)0.1750.2520.4580.0020.0710.6410.4970.0030.564\<0.010.551\<0.01IL-1β (pg/ml)−0.0820.5110.3270.0100.0860.4790.4520.0010.682\<0.010.503\<0.01IL-6 (pg/ml)0.0680.5890.3170.0120.0820.5000.4130.0040.663\<0.010.549\<0.01IL-8 (pg/ml)0.1650.1870.3140.0130.0440.7200.3410.0180.694\<0.010.587\<0.01IL-10 (pg/ml)−0.0420.7380.2010.1180.1100.3640.2050.1630.451\<0.010.3760.003TNF- α (pg/ml)0.2660.0310.2490.0510.1210.3160.3200.0270.703\<0.010.493\<0.01
The correlation between the load of the six pathogens and the FEV1 % predicted, FVC % predicted and FEV1/FVC values were analyzed to assess the relationship between bacterial burden and pulmonary function in the study subjects. *Pearson*'*s* correlation coefficients between the load of *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae* and *Moraxella catarrhalis* in PSB samples and the FEV1 % predicted, FVC % predicted, and FEV1/FVC values revealed a negative statistically significant correlation (*P* \< 0.01, Table [8](#Tab8){ref-type="table"}).Table 8Correlation analysis of bacterial burden in PSB samples and pulmonary function*Staphylococcus aureusKlebsiella pneumoniaeStreptococcus pneumoniaePseudomonos aeruginosaHaemophilus influenzeaeMoraxella catarrhalis*(log CFU/ml)(log CFU/ml)(log CFU/ml)(log CFU/ml)(log CFU/ml)(log CFU/ml)*rprprprprprp*FEV1 % predicted−0.674\<0.01−0.865\<0.01−0.543\<0.01−0.664\<0.01−0.849\<0.01−0.813\<0.01FVC % predicted−0.597\<0.01−0.756\<0.01−0.419\<0.01−0.586\<0.01−0.728\<0.01−0.675\<0.01FEV1/FVC−0.660\<0.01−0.833\<0.01−0.532\<0.01−0.639\<0.01−0.814\<0.01−0.776\<0.01
Discussion {#Sec19}
==========
Several innate immune mechanisms are involved in maintaining the sterility of a healthy human airway. However, immune mechanisms are disrupted by smoking or other hazardous substances; resulting in the persistence of microbial pathogens in the lower airway of COPD patients \[[@CR25]\], which is called "colonization" by some researchers. Previous studies have proven that bacterial colonization is associated with greater levels of airway inflammation measured in sputum \[[@CR26]--[@CR28]\] and has been implicated as the cause of most exacerbations in COPD \[[@CR29]--[@CR31]\]^.^ Acute exacerbations are associated with a more rapid decline in lung function and an impaired quality of life, which are both major causes of morbidity and mortality in COPD \[[@CR22]\]. However, the pathogens involved, the number of pathogens that change, and the mechanism on how these infections alter lower airway inflammation remains unclear.
Bacterial colonization and airway inflammation in COPD patients have been previously demonstrated in studies. However, these studies have been limited to sampling the central tracheobronchial tree and/or detecting the pathogen by traditional cultures \[[@CR26]--[@CR28]\]. In this present study, the load of pathogenic bacteria strain *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae* and *Moraxella catarrhali* were detected in PSB and BALF samples obtained from COPD patients and HS by RT-q-PCR assays, targeting specific pathogen genes. Moreover, cell count in BALF and pro-inflammatory cytokine concentrations in BALF supernatants were analyzed. Significantly higher levels of *Klebsiella pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis* were identified in both PSB and BALF samples obtained from stable COPD and AECOPD patients. Additionally, a significantly higher number of total cells and percentage of neutrophils in BALF, together with higher levels of IL-1 β, IL-6, IL-8, IL-10 and TNF-α in BALF supernatants, were detected in stable COPD and AECOPD patients. More importantly, pathogen loads in BALF samples were positively correlated with the percentage of neutrophils and levels of pro-inflammatory cytokines in BALF. Pathogen loads in PSB samples were negatively correlated with FEV1 % predicted, FVC % predicted, and FEV1/FVC values. Thus, the increase of pathogens in the lower respiratory tract likely contributed to the inflammatory response in the airways, leading to recurrent AECOPD and pulmonary function decline.
Obtaining samples from the lower respiratory tract without being contaminated by the upper airway flora is a crucial factor in accurately determining the prevalence of bacteria in the lower respiratory tract. Previous studies have found higher rates of bacterial isolates in sputum than in samples collected by bronchoscopy in stable COPD patients \[[@CR32]--[@CR34]\]. This is likely due to the high contamination rate of sputum with the upper respiratory tract flora. Therefore, bronchoscopy with PSB appears as the best method to avoid upper airway contamination. For the same reason, protected BALF samples are appropriate for contamination-free pathogen analysis. Our results did not reveal significant differences in rates of the six analyzed pathogens between PSB and BALF samples among the three study groups. However, significantly higher rates of these six pathogens were found in PSB and BALF samples obtained from COPD patients compared with samples obtained from HS, and no significant differences between stable COPD and AECOPD patients were detected. These data confirms bacterial colonization in the lower respiratory tract of COPD patients, regardless of the patient's status (stable or acute exacerbation of COPD). Nevertheless, persistent symptoms and recurrent exacerbations were seen in ex-smokers with moderate to severe COPD, suggesting that persistent inflammation resulting from bacterial infections has clinical consequences. Thus, the number of bacteria in the airway is a key factor for the development of AECOPD in stable COPD pateints.
Previous studies have demonstrated bacterial load changes in airways of COPD patients using conventional methods \[[@CR26]--[@CR29]\]. However, conventional methods such as microbiological cultures are time-consuming and may give false-negative results, especially during ongoing antibiotic treatments. Non-culture based methods such as RT-qPCR are sensitive, specific and provide fast results; and are valuable tools for the early diagnosis and effective therapy of COPD. Erb-Downward *et al*. identified a core pulmonary bacterial microbiome that includes *Pseudomonas*, *Streptococcus*, *Prevotella*, *Fusobacterium*, *Haemophilus*, *Veillonella*, and *Porphyromonas* by massively parallel pyrosequencing of bacterial 16S amplicons \[[@CR35]\]^.^ In another study, the composition of the lung microbiome was determined using 454 pyrosequencing of 16S rDNA in BALF; and found that the main phyla in all samples were *Actinobacteria*, *Firmicutes*, and *Proteobacteria* \[[@CR17]\]. However, analysis of microbiomes by 16S rDNA or 16 s rRNA focuses in building a picture of the complete microbial community in an environment, making a cluster analysis and studying the evolution history of microbiomes. Nevertheless, it is important to identify common bacterial species in the lower respiratory tract of COPD patients for guidance in clinical antibiotic therapy and analysis of inflammatory response. In this present study, RT-qPCR analysis revealed significantly higher detection rates for *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Streptococcus pneumoniae*, *Pseudomonos aeruginosa*, *Haemophilus influenzeae*, and *Moraxella catarrhalis*, compared to conventional microbiological culture in all subjects. These results reflect the higher sensitivity and specificity of RT-qPCR, as a fast pathogen detection method.
Pathogens such as *Streptococcus pneumoniae*, *Haemophilus influenzae*, and *Moraxella catarrhalis* are associated with approximately 50 % of COPD exacerbations, as demonstrated by traditional microbiological culture. These organisms can often be found colonizing the respiratory airways of COPD patients between exacerbations \[[@CR5]\], and are consistent with our culture results. However, bacteria in COPD varies with disease severity, as *Pseudomonas aeruginosa* is more commonly detected in patients with severe COPD in both stable \[[@CR36], [@CR37]\] and acute exacerbations \[[@CR38]--[@CR40]\]. Microbiome analysis by 16S rDNA or 16 s rRNA also revealed that *Haemophilus* species were strongly associated with the presence of COPD \[[@CR41]\], while *Pseudomonas* species were more commonly observed in subjects with moderate or severe COPD \[[@CR35]\]. Patients in our present study presented with moderate and severe COPD (GOLD stage II-III), and the load of *Klebsiella pneumoniae*, *Haemophilus influenzeae*, *Moraxella catarrhalis* and *Pseudomonos aeruginosa* in PSB and BALF samples obtained from COPD patients significantly increased compared with samples obtained from HS, as detected by RT-qPCR; suggesting that bacterial species quantitatively analyzed by RT-qPCR are consistent with bacterial species cultured in previous studies. Moreover, the load of *Klebsiella pneumoniae*, *Haemophilus influenzeae*, *Moraxella catarrhalis* and *Pseudomonos aeruginosa* in AECOPD patients also significantly increased compared with stable COPD patients; which suggest that this increase of bacterial load in the lower respiratory tract may contribute to acute exacerbation in COPD. A previous study has indicated the colonization of *Streptococcus pneumoniae* in AECOPD patients \[[@CR42]\]. In this present study, there was no significant increase of *Streptococcus pneumoniae* in PSB and BALF samples from AECOPD patients, compared with stable COPD patients and HS. However, our study results had no discrepancy with previous studies, because high loads of *Streptococcus pneumoniae* were found in both stable COPD patients and HS; which is consistent with a previous study \[[@CR35]\]. Our results by RT-qPCR indicated that *Streptococcus pneumoniae* was present in all study subjects, although previous studies did not detect a high load of *Streptococcus pneumoniae* in these subjects by using conventional culture methods.
In the contrary, diagnosing lower respiratory tract infections caused by *Streptococcus peumoniae*, *Haemophilus influenzae*, and *Moraxella catarrhalis* by PCR has been limited to distinguishing colonization from infections. This may depend on the analysis that combined the load of the above pathogens with symptoms and inflammatory mediators such as C-reactive protein, the number of neutrophils, and some pro-inflammatory cytokines. Exacerbations are typically associated with increased neutrophilic airway inflammation \[[@CR43], [@CR44]\]. Pro-inflammatory cytokines such as TNF-α, IL-1 β and IL-6 are increased in COPD and appear to amplify inflammation \[[@CR45]\]. In this present study, there was a significant increase in the number of neutrophils in BALF, and in the levels of pro-inflammatory cytokines IL-1 β, IL-6, IL-8, IL-10 and TNF-α in BALF supernatants obtained from AECOPD patients, compared with stable COPD patients and HS; and there was a positive correlation between the load of *Klebsiella pneumoniae*, *Haemophilus influenzeae*, *Moraxella catarrhalis* and *Pseudomonos aeruginosa*, and most inflammatory mediators. These data indicate that the increase in the load of common pathogens in the lower respiratory tract of COPD patients may contribute to the increase in pro-inflammatory response as acute exacerbations occur, resulting in disease progression and gradual decline in lung function. Indeed, there was a negative correlation between the load of the six pathogens and the FEV1 % predicted, FVC % predicted and FEV1/FVC values, which revealed that increased loads of common pathogens led to the decline of lung functions in COPD patients. However, in this present study, there was no quantitative data regarding changes in the above bacteria in the lower respiratory tract of mild COPD patients (GOLD stage I). Thus, the association between the load of these six bacteria and the degree of airflow obstruction in COPD patients was limited, requiring a more in-depth study in the future.
Conclusions {#Sec20}
===========
In summary, our data indicate that significantly higher loads of *Klebsiella pneumoniae*, *Haemophilus influenzeae*, *Moraxella catarrhalis*, and *Pseudomonos aeruginosa* exist in PSB and BALF samples obtained from AECOPD patients, compared with stable COPD patients and HS, as revealed by RT-qPCR. Higher loads were correlated with increased inflammatory response in the lower respiratory tract, and were associated with disease progression and decline in lung function in COPD patients. Our study may provide a new standard for the quantitative measurement of common bacteria in the lower respiratory tract of moderate and severe COPD patients, and provide some guidance in determining the most appropriate antibiotic therapy for AECOPD patients. Limitations of this study include small sample size, lack of healthy smokers and mild COPD patients, as well as the relationship between bacterial load and immune barrier of the lower respiratory tract in COPD patients. Therefore, further studies with a larger patient population are warranted to address these issues.
COPD
: Chronic obstructive pulmonary disease
RT-qPCR
: Real-time quantitative PCR
PSB
: Protected specimen brush
BALF
: Bronchoalveolar lavage fluid
IL
: Interleukin
ELISA
: Enzyme-linked immunosorbent assay
DGGE
: Denaturing gradient gel electrophoresis
GOLD
: Global initiative for chronic obstructive lung disease
HS
: Healthy Subjects
FEV1
: Forced expiratory volume in one second
FVC
: Forced vital capacity
TNF
: Tumor neurosis factor
CT
: Cycle threshold
CRP
: C-reactive protein
**Competing interests**
The authors declare that they have no competing interests.
**Authors\' contributions**
Wang HY carried out the clinical study, participated in the RT-qPCR analysis and drafted the manuscript. Gu X carried out the ELISA measurement. YW participated in the conventional culture and RT-qPCR analysis. Xu T and Fu ZM participated in the clinical samples collection. Peng WD participated in the design of the study and performed the statistical analysis. WY conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
The work described in this article was supported by the Nature Scientific Fund of Ningbo City (Grant No. 2013A610237) and the Fund of Appropriate Technology Conversion Program, Zhejiang Province, P. R. China (Grant No.201339656). We thank Medjaden Bioscience Limited for assisting in the preparation of this manuscript.
|
What is the Trans-Pacific Partnership (TPP)?
The Canadian Parliment. The TPP deal, which is currently being negotiated in secret, involves 12 countries, affecting 800 million residents and will involve 40% of the world’s economy with a combined GDP of $20 Trillion dollars.
The Trans-Pacific Partnership (TPP) may soon be an acronym as recognizable as NAFTA — but this free trade venture could have much more economic strength and impact than its North American predecessor.
As Canada sets its sights on joining the club, many are asking what exactly our country would be getting, and giving up, to secure a potentially game-changing multilateral agreement.
What is the Trans-Pacific Partnership?
The Trans-Pacific Partnership is a free trade deal aimed at further expanding the flow of goods, services and capital across borders.
Its four founding members — New Zealand, Chile, Singapore and Brunei – may not be the usual suspects when it comes to high-powered global economic deals, but the trade-hungry countries turned heads when they signed off on the TPP’s precursor, the Trans-Pacific Strategic Economic Partnership Agreement in 2005.
They pledged, among other things, to “enlarge the framework of relations among the Parties through liberalizing trade and investment and encouraging further and deeper cooperation to create a strategic partnership within the Asia-Pacific region.”
‘This is a further example of our determination to diversify our exports and to create jobs, growth and long-term prosperity for Canadian families.’—Prime Minister Stephen Harper
The quartet faced relatively few obstacles in their quest to set up the transnational deal, and the efforts soon caught the attention of five other nations: the United States, Australia, Peru, Vietnam and Malaysia, who joined in 2008.
The nine partners currently have a combined GDP of more than $17 trillion.
Canada and Mexico are now being considered for membership, subject to the approval of the nine countries already involved — including their long-time trading partner, the U.S.
Although negotiations involving Canada haven’t begun in earnest, the federal government has already signaled its eagerness to get on with the process.
“This is a further example of our determination to diversify our exports and to create jobs, growth and long-term prosperity for Canadian families,” said Prime Minister Stephen Harper from the G20 Summit in Mexico on June 19.
Where did it come from?
The TPP has its roots in the notoriously incremental dealings of the Asia-Pacific Economic Co-operation forum (APEC), a 21-member collective that seeks to promote free trade within and beyond the Asia-Pacific region.
Canada was among APEC’s founding members, capitalizing on its Pacific Ocean coastline and its interest in freer trade. In 1989, it joined the forum, which included Japan, Indonesia, Australia, Brunei, South Korea, Malaysia, New Zealand, the Philippines, Singapore, Thailand and the U.S.
Throughout the 1990s, nine other members — including Chile and Vietnam — also joined APEC. It is from this forum that TPP’s founding members would eventually springboard to expedite many of APEC’s goals.
Early on, one of the TPP’s stated objectives was to “support the wider liberalization process in APEC consistent with its goals of free and open trade and investment” by establishing a free trade area.
The Trans-Pacific Partnership already includes nine pacific countries — including Vietnam, Australia, New Zealand at the U.S. — with a combined GDP of over $17 trillion. If Canada and Mexico successfully join, that number would rise to over $20 trillion. (CBC)
What’s in it for Canada?
The federal government has been vocal about its plans to diversify trade. It is pursuing trade deals with India and has a foothold in China and Japan. So far, however, Canada does not have a bona fide free trade deal in increasingly attractive Asia.
Admission to the TPP would mean access to a bundle of growing economies.
P.O.V.
So far, the CBC community has mixed feelings about the Trans-Pacific Partnership.
“We’d be crazy not to at least explore this option.” – Linda’s View
“Canada is better off holding out for a far better deal (on our terms) as the world’s insatiable thirst for our resources exceeds our ability to supply.” – William Hebert
Add to this the possibility that Japan could join the TPP, despite mounting protests in that country, and the economic and political traction of the group increases.
In fact, the TPP could become the world’s largest free-trade zone – one that is well formed, but also flexible enough to accommodate a growing membership.
With Canada and Mexico entering the talks, the countries involved represent 658 million people and a gross domestic product of $20.5 trillion, according to a release from the Prime Minister’s Office.
The TPP already includes some of Canada’s major trading partners, notably the U.S., and could soon include Mexico — which increases the pressure to protect Canada’s economic position in North America.
Ottawa argues that TPP membership would be a boon to the integrated supply chain on the continent, and that a missed opportunity to join would have dire consequences.
CBC News national affairs editor Chris Hall notes that, if Canada is shut out of the group, national products could become relatively more expensive, and therefore less appealing. Canada would also have to deal with the group’s tariffs.
On the flip side, a best-case scenario for ordinary Canadians would include new jobs and lower prices on everything from cheese to manufactured goods if TPP membership bolsters both import and export trade.
Indeed, the possibilities presented by membership are enormous, but so too are the potential risks.
What are the risks?
The major concerns surround what Canada will have to give up to join the TPP, and whether or not the costs will outweigh the benefits. The government has not released a cost-benefit study as it did during past negotiations with Europe and India.
Many are uncomfortable with the bargaining chips already on the table, especially control over Canada’s marketing boards and the national supply of eggs, chickens and milk.
It’s an important point for some members — especially the U.S. and New Zealand — and some have speculated that Canada’s supply management system, which controls domestic poultry and dairy prices, trade restrictions and high tariffs on imports, will have to ease up before the country can enter the TPP.
Unfinished Business
John Weekes, Canada’s former chief negotiator for the North American Free Trade Agreement (NAFTA), told CBC News in 2011 that the U.S. will likely use the TPP to try to resolve a range of bilateral trade issues with Canada.
For instance, he said, NAFTA never dealt with Canadian foreign ownership rules that have kept American companies out of this country’s lucrative telecommunications market — a fact, many argue, that has also been to the detriment of consumers here.
How the U.S. will leverage its spot in the TPP remains to be seen, but the results could have implications across all sectors of the economy — including the banking sector.
Gerald Keddy, the parliamentary secretary to the trade minister, insisted that Canada’s marketing boards will be protected.
“Let’s be clear, we’ve signed free trade agreements with nine countries around the world and we’ve been able to look after supply side management in every single one of those,” he said.
From the outside looking in, however, the details of a potential deal remain imprecise. It isn’t even clear what the cost of admission was for other members.
“What did they give up, if they gave up anything?” asked Liberal trade critic Wayne Easter, who is not convinced of the merits of the TPP. “We need a net benefit for the country.”
Another concern is that, as a late comer, Canada will have to accept several agreements made by the current TPP partners before it is allowed to come to the table — which will happen no sooner than the fall.
By then 12 rounds of negotiations will have taken place without Canadian input, according to the Canadian Press.
This reality hasn’t fazed the prime minister, who says the negotiations are still at “fairly preliminary phases” and that Canada won’t try to undo what has been done.
“There is an accession process, so we don’t disrupt the negotiations,” he said.
Harper was vague about the specific terms of Canada’s entry into the TPP talks.
“As in any negotiation, nothing is agreed to until everything is agreed to by all parties.”
What are critics saying?
The TPP has no shortage of critics around the world.
At home, many are questioning the assertion that Canada will steer clear of major and unprecedented compromises, arguing that the federal government has already worked hard to be considered a candidate.
‘It’s really a trade agreement for the one per cent and their corporate interests.’—Maude Barlow, the Council of Canadians
“It’s very, very clear that Canada had to make some significant concessions … in order to get into these negotiations,” said Don Davies, the NDP trade critic.
“We’ve been given a seat at the table, but we’ve had our ability to negotiate significantly impaired,” he added.
Citizens’ organizations and public advocacy groups who oppose the deal are gearing up for a fight that could be as intense and bitter as the one that lead up to NAFTA’s implementation in 1994.
“It’s really a trade agreement for the one per cent and their corporate interests,” said Maude Barlow, the National Chairperson of the Council of Canadians, which opposed and continues to criticize NAFTA. |
The French health ministry has said the deaths of up to 3,000 people in recent weeks could be attributed to the European heat wave.
The announcement came as the government extended throughout the country an emergency hospital plan originally introduced in the Paris region to deal with the medical crisis.
The move was ordered by Prime Minister Jean-Pierre Raffarin, who cut short his holiday to head a crisis meeting of his cabinet in Paris.
The "Plan Blanc", which is normally reserved for epidemics, disasters or terrorist attacks, provides for the recall of doctors from holiday and making available extra staff, hospital beds and temporary mortuaries.
Last summer the situation was catastrophic and this year it is worse, we were not at all prepared - the hospital system is failing
Correspondents say the measure is an attempt by the government to show it is not taking the problem lightly, after sharp criticism from the socialist opposition and health professionals.
The fatality figures were the first to be given by the government, which previously said that there was no accurate way of measuring deaths from the heat.
The ministry said its estimates were based on reports of deaths received from hospitals and mortuaries whose figures for this week were 37% higher than for the same period last year. The figure for Paris was more than 50% higher.
Temporary mortuaries have been set up
The heat eased slightly on Thursday, with temperatures in Paris reaching around 30C compared with more than 40C earlier in the week.
And forecasters predicted relief across western Europe, with the UK, Germany and Spain also looking forward to cooler, fresher weather in the coming days.
The extreme heat has set records on the continent, leading to dozens of deaths from heat stroke and devastating forest fires in countries on the western Mediterranean.
Firefighters are continuing to battle blazes in Portugal, where the popular tourist region, the Algarve, remains under serious threat.
Army call
French officials say comprehensive nationwide casualty figures will be released next week, based on a survey of private and public medical institutions including retirement homes.
But the BBC's Alan Little in Paris says the health ministry's announcement is a humiliating turnaround for a government whose response to the crisis has been perceived as too slow.
Most ministers have been out of Paris for the traditional August holiday.
Health Minister Jean-Francois Mattei told French radio the government "carried out the responses that were needed".
Most of the victims are old people, prompting comments in the press to the effect that the real scandal was their loneliness and isolation - many families leave behind their elderly relatives as they go on holiday.
However, Dr Muriel Chaillet of the St Antoine hospital in Paris told BBC News Online that the situation could be blamed partly on an aging population but partly on the state of the health service.
"Last summer the situation was catastrophic and this year it is worse; we were not at all prepared. The hospital system is failing," she said.
"These figures panic me, but they do not surprise me; they correspond to the situation." |
Q:
Repeat the task using while loop until user clicks on “No” button?
Public Class Form2
Dim ss As Boolean
Private Sub Button1_Click(sender As Object, e As EventArgs) Handles Button1.Click
Dim i, z As Integer
ss = False
Butn_no.Focus()
While ss = False
Application.DoEvents()
i = Val(InputBox("enter 1st number", "program#3"
))
z = Val(InputBox("enter 2nd number", "program#3"))
If z = 0 Or i = 0 Then
MsgBox("one of the given number is empty try again or not integer", vbCritical, "error")
Else
If z = i * i Then
MsgBox("second number is the sqaure of first number", vbInformation, "program#3")
Else
MsgBox("second number is not the square of first" & vbNewLine & " first number = " & i.ToString & " 2nd number = " & z.ToString, MsgBoxStyle.OkCancel, "program#3")
End If
End If
End While
End Sub
Private Sub Button2_Click(sender As Object, e As EventArgs) Handles Butn_no.Click
ss = True
End Sub
End Class
This is working but next time when while executed I am unable to click on button 2 due to input box which is showing at the top, with this same method I stopped the loop which is appending text in textbox in my earlier program. I just want to stop loop execution on button pressed if anyone?
A:
Val returns a double and you have declared i as an integer. Same problem with z. Val is an old VB6 method. .Net has new methods to replace it. I used Integer.TryParse. If an non integer is entered it will not update the output variable which will remain 0. If the input is a valid Integer, i and z will be assigned the new value.
The Continue While takes the execution back to the top of the While.
Put your exit question in the loop. You can use Return to exit the Sub.
Private Sub Button1_Click(sender As Object, e As EventArgs) Handles Button1.Click
Dim i, z As Integer
While True
Integer.TryParse(InputBox("enter 1st number", "program#3"), i)
Integer.TryParse(InputBox("enter 2nd number", "program#3"), z)
If z = 0 Or i = 0 Then
MsgBox("one of the given number is empty try again or not integer", vbCritical, "error")
Continue While
Else
If z = i * i Then
MsgBox("second number is the sqaure of first number", vbInformation, "program#3")
Else
MsgBox("second number is not the square of first" & vbNewLine & " first number = " & i.ToString & " 2nd number = " & z.ToString, MsgBoxStyle.OkCancel, "program#3")
End If
End If
Dim Answer = DialogResult.Yes
If Answer = MessageBox.Show("Do you want to quit?", "Quit?", MessageBoxButtons.YesNo) Then
Return
End If
End While
End Sub
|
Q:
Using Apache POI can I stop users copying formatting?
I have made an excel sheet which is generated by Java. The cells can only accept certain values, depending on data validation done against lists on a separate sheet.
This all works great, but if a user copies some values from another cell and pastes it into the cell it avoids validation... is there any way to prevent this?
A:
You can do this by setting data format for that cell.
style = wb.createCellStyle();
style.setDataFormat(wb.createDataFormat().getFormat("0.000%"));
which will percentage value.
For documentation goto:
Apache HSSF Doc
|
tl;dr: Applications for our fall batch are open. Etsy is sponsoring the batch and providing $5k grants for female students (we’re open to more sponsors). We’re starting a Hacker School Residency program, where awesome programmers come work closely with our students for one or two week stints. Peter Seibel will be the first resident. You can nominate residents.
What if?
Hacker School exists largely because we like to ask, “What if?” What if we ran a writer’s retreat for programmers? What if there were no grades, teachers, or formal curriculum? What if you could always feel comfortable saying, “I don’t understand?” What if we made social rules explicit?
What if Hacker School were half women?
Last batch, we partnered with Etsy to get equal numbers of men and women in Hacker School. We had no idea if that was feasible, since in our three previous batches we had had exactly one woman.
We were blown away by the response we got: Over 650 women applied, and we ended up with many more qualified women requesting financial assistance than we anticipated. Thankfully, 37signals and Yammer stepped up to provide additional grants for women.
The result? Twenty three of the 51 students in our current batch are female, and Hacker School is much better for it.
One thing we’ve heard repeatedly from women in Hacker School is that they love that here they’re “programmers” and not “female programmers.” A student told me last week that it feels like Hacker School has always been half women. It’s no longer a “what if.”
We’re thrilled to announce today that Etsy will be hosting our fall batch and sponsoring an additional 10 grants. Etsy has been an absolute pleasure to work with, and it’s hard to imagine how they could have been any more thoughtful, tasteful, or respectful. They’ve been an ideal partner.
We want to make this batch bigger and better than our last, and we’re currently in talks with several other companies interested in sponsoring Hacker School and providing grants. If you’re interested in working with us as well, please let us know.
Another “what if”
Some of the best moments at Hacker School have come after talks by guest speakers. David Nolen spoke one Saturday about ClojureScript. The Q&A after his talk turned into a mini workshop with a handful of students, which turned into David staying and sharing his expertise and enthusiasm for nearly eight hours. He came back a few weeks later and walked a group of students through the internals of the ClojureScript compiler until almost 11pm. That led to half a dozen Hacker Schoolers signing Clojure contributor agreements and adding support for code reflection to the ClojureScript REPL.
My cofounder Dave recently asked another “what if”: What if the world’s best programmers did two week residencies at Hacker School? As usual, we don’t know the answer (which is why it’s a question worth asking), but we suspect it will be good.
Admittedly, this sounds far-fetched. Why should the best programmers in the world take two weeks off from their jobs to come work with us? But Hacker School itself initially sounded improbable. Who would quit their jobs and dedicate themselves to becoming better programmers for three months, and where would we find space to do it – full-time, for free – in one of the most expensive real estate markets in the world?
It no longer seems improbable that people would leave their jobs to do Hacker School. In fact, dozens of people now have, and many have done much more. Well over half of our current batch moved to New York solely for Hacker School, and more than 20% of our current batch moved countries to do it. (And somehow we’ve managed to beg, borrow, or steal space for five batches.) While Hacker School may have sounded improbable when we started, it clearly wasn’t impossible.
So today we’re announcing our Hacker School Residency. The idea is simple: Great programmers come work with us, full-time, on open source projects.
We’re delighted to say that Peter Seibel, author of Coders at Work and Practical Common Lisp (and programmer at Etsy), has generously agreed to be our first resident. Peter spoke at Hacker School earlier this summer and blew us away with his thoughtful advice for becoming a better programmer and genuine engagement with students.
We’re looking for more Hacker School Residents now. We’re looking for people who are at the top of their field, love what they do, and are genuinely nice human beings. If you’d like to nominate someone, including yourself (especially if your name is Peter Norvig), please send us a nomination. If you think it’d be impossible to take an extra week or two off work, ask yourself: “What if?” Maybe we can find a way to make it happen.
Always an experiment
A student asked me recently how I thought Hacker School was going. It was a surprisingly hard question to answer. On the one hand, I’m unabashedly proud of what we’ve accomplished in just over a year. On the other hand, we’re chronically dissatisfied with Hacker School: There are a thousand ways we think we could do better, and we’re far from where we want to be.
To be clear, we’re not a bootcamp or a training program, we’re something different: The place where programming is important, where people come to focus, learn from each other, and do great work. We’re an ongoing experiment, and we think we can keep getting better, so long as we’re always willing to ask, “what if?”
Curious? Read about Hacker School and apply to our fall batch. |
Serum uric acid as a marker of microvascular damage in systemic sclerosis patients.
Microvascular damage of skin and internal organs is a hallmark of systemic sclerosis (SSc). Serum uric acid (UA) represents a marker of inflammation and endothelial dysfunction. The aims of this study were to evaluate the correlation between serum UA and intrarenal arterial stiffness evaluated by Doppler ultrasound in SSc patients with normal renal function. We also evaluated the correlation between serum UA and other clinical variables of the disease. Forty-five SSc patients underwent clinical assessment, Doppler ultrasound of intrarenal arteries with evaluation of resistive index (RI), pulsatile index (PI), and systolic/diastolic ratio (S/D), echocardiography with systolic pulmonary artery pressure (PAPs), baseline pulmonary function tests, and nailfold videocapillaroscopy (NVC). In all patients serum UA was measured. The serum UA showed a significant positive correlation with sCr (r=0.33, p<0.0001) and PAPs (r=0.38, p<0.01) >and negative correlation with CKD-EPI (r=-0.35, p<0.01). The mean value of serum UA increased with severity of NVC damage. Using this cut-off value of 4.7mg/dl, the mean value of Doppler indices of intrarenal stiffness is significantly different (p<0.05) in SSc patients with low normal or high normal serum UA. Serum UA concentration is higher in patients with high microvascular damage than in patients with low microvascular damage. These preliminary data must be confirmed in large prospective studies. |
Q:
How to get a substring between two strings in PHP?
I need a function that returns the substring between two words (or two characters).
I'm wondering whether there is a php function that achieves that. I do not want to think about regex (well, I could do one but really don't think it's the best way to go). Thinking of strpos and substr functions.
Here's an example:
$string = "foo I wanna a cake foo";
We call the function: $substring = getInnerSubstring($string,"foo");
It returns: " I wanna a cake ".
Thanks in advance.
Update:
Well, till now, I can just get a substring beteen two words in just one string, do you permit to let me go a bit farther and ask if I can extend the use of getInnerSubstring($str,$delim) to get any strings that are between delim value, example:
$string =" foo I like php foo, but foo I also like asp foo, foo I feel hero foo";
I get an array like {"I like php", "I also like asp", "I feel hero"}.
A:
If the strings are different (ie: [foo] & [/foo]), take a look at this post from Justin Cook.
I copy his code below:
function get_string_between($string, $start, $end){
$string = ' ' . $string;
$ini = strpos($string, $start);
if ($ini == 0) return '';
$ini += strlen($start);
$len = strpos($string, $end, $ini) - $ini;
return substr($string, $ini, $len);
}
$fullstring = 'this is my [tag]dog[/tag]';
$parsed = get_string_between($fullstring, '[tag]', '[/tag]');
echo $parsed; // (result = dog)
A:
Regular expressions is the way to go:
$str = 'before-str-after';
if (preg_match('/before-(.*?)-after/', $str, $match) == 1) {
echo $match[1];
}
onlinePhp
A:
function getBetween($string, $start = "", $end = ""){
if (strpos($string, $start)) { // required if $start not exist in $string
$startCharCount = strpos($string, $start) + strlen($start);
$firstSubStr = substr($string, $startCharCount, strlen($string));
$endCharCount = strpos($firstSubStr, $end);
if ($endCharCount == 0) {
$endCharCount = strlen($firstSubStr);
}
return substr($firstSubStr, 0, $endCharCount);
} else {
return '';
}
}
Sample use:
echo getBetween("abc","a","c"); // returns: 'b'
echo getBetween("hello","h","o"); // returns: 'ell'
echo getBetween("World","a","r"); // returns: ''
|
1.2k Shares 1.2k
0
0
I asked my daughter Tali if she would like to spend Memorial Day this year doing something significant. She is thirteen and even though there are two more weeks of school, Memorial Day weekend marks the beginning of summer. So the weekend is always spent doing fun things, being outdoors with friends, and rarely if ever doing anything that signifies what Memorial Day is about.
“What kind of thing? Are you giving a lecture somewhere?”
“Yes and no,” I replied, “come read this.”
I let her read a message I received from Ronald Kukal, who was the first class petty officer on the USS Liberty, a US navy ship that was attacked and destroyed by the Israeli military on June 8, 1967. Ron is one of the Liberty survivors.
Tali read the message carefully, then looked at me and said:
“Dad, we have to go to this!”
“This” was a Memorial Day in event Maricopa, Arizona in the heart of the Arizona desert, commemorating the USS Liberty.
The USS Liberty is the most decorated ship in the US Navy for a single action, though it was not engaged in battle, in fact being an intelligence gathering ship, it had no battle capabilities and was only armed with 4 fifty caliber machine guns to ward off unwanted boarders. The crew were awarded, collectively, one Medal of Honor, two Navy Crosses, eleven Silver Stars, twenty Bronze Stars (with “V” on it for valor), nine Navy Commendation Medals, and two hundred and four Purple Hearts. The ship was also awarded the Presidential Unit Citation. But all the survivors were ordered never to speak of what they had experienced. It took many years and a great deal of suffering before the survivors reached the point where they felt they could no longer keep in inside and had to speak up.
On the morning of June 8, 1967, in the midst of a war that Israel had initiated just a few days earlier - and was clearly winning - against Egypt, Syria and Jordan - the USS Liberty was about 17 miles off the Gaza coast, in international waters. For several hours throughout that day Israeli air force reconnaissance planes had been flying over the Liberty, in what seemed like attempts to identify it. The crew felt no threat – quite the opposite, Israel was a US ally. During one recorded debriefing a naval observer from the reconnaissance flight arrived at Israeli air force HQ and sat down with the air-naval liaison officer there. The two officers consulted Janes’ Fighting Ships and learned that the ship they saw earlier in the day was the USS Liberty, a United States Navy technical research ship. [1]
Then, at 1400 hours, (2:00 PM local time) without any warning, Israeli fighter jets launched an attack on USS Liberty. The aircraft made repeated firing passes, attacking with rockets and internal cannons. After the first group of fighter jets had exhausted their ammunition, subsequent flights of Israeli fighter jets continued to attack with rockets, cannon fire, and even napalm. The use of napalm is significant because it is made of a toxic, flammable combination of gel and petroleum that sticks to the skin and causes severe burns. Eight men died as a result of the air attack and the shrapnel and shock of exploding rockets had wounded 75 men.
After the Israeli jets completed their attacks, Israeli torpedo boats began firing torpedoes, killing 26 more men. Survivors reported that the Israeli torpedo boat crews swept the decks of USS Liberty with continuous machine gun fire, targeting communications equipment and any crewmembers that ventured above decks. Survivor Glen Oliphant said, “I personally recall very clearly from my position outside the wardroom -- that the torpedo boats then circled the ship for a long time firing at close range at anything that moved. Men trying to aid their wounded shipmates on deck were fired upon. Men fighting fires were fired upon and I recall seeing their fire hoses punctured by machinegun fire. This went on for several minutes. At one point the boatmen concentrated their fire near the waterline amidships, presumably hoping to blow up the boilers to hasten our demise.”
Although communication systems were severely damaged the crew somehow managed to get a distress signal to the Sixth Fleet command which then sent out aircraft to defend the Liberty. Shortly after the Sixth Fleet command transmitted an authorization for the rescue aircraft to destroy the attackers, the Israeli torpedo boats halted their attack. At the same time, the Israeli military notified the US Naval Attaché in Tel Aviv that Israeli forces had mistakenly attacked a United States Navy ship, and apologized. The commander of the Sixth Fleet received an order from Washington, DC to turn the rescue planes around. According to several sources the commander questioned the order which was then reiterated to him by President Johnson himself.
Israeli sources claim that Israeli helicopters flew over the Liberty after the attack and offered assistance but their offer was turned down. Several of the survivors mentioned that at one point after the attack an Israeli combat helicopter flew over with civilians which included the US Naval Attaché. A bag with a message for the captain was dropped from the hovering helicopter, which read: “Do you have any casualties?” At this point the ship was barely afloat, bullet ridden, with gaping holes as a result of the torpedo attacks and the blood and body parts of the dead and the wounded were everywhere. Two thirds of the crew had become casualties. According to the survivors, the Captain looked up at the chopper and gave them the finger. The ship and survivors were left to float in the Mediterranean, miraculously not capsizing, for 17 long hours before help arrived to rescue the survivors and take care of the wounded.
Ronald Kukal was first class Petty Officer on the Liberty, this is how he described to me the very moments after the torpedo attack, “I could hear shrapnel flying over my head, and little did I know that shrapnel was killing almost all my men down there.” Ron was also put in charge of body recovery and identification. This took place several days after the attack, which meant that the bodies, many of them in pieces, had been in the water for days. His very words to me were, “I went about the dismal job of picking up the pieces of a very complicated jigsaw puzzle. Can't put it any other way. Most of my shipmates couldn't stand the smell. I smelled nothing.” For many years the survivors were forced to remain silent and the US government and the press said little about the attack.
In his message to me, a message that convinced my daughter to join me on this long road trip from San Diego to Maricopa, rather than stay in town and spend the weekend with friends, he writes:
“The men who survived the Liberty are slowly making their way out of this world, so to speak. This meeting in Maricopa is sort of a last effort on our part to keep the memory of the ship alive […] what our government is hoping for and always has, is the death of all of us, and then the matter will be over […] I don’t know how we have held together but we have. There is no hatred in this group, and really there never has been, we have only wanted justice. I doubt if we will get it.”
Read part II here: "The day Israel attacked America"
Endnote
1. http://www.ussliberty.org/report/report.htm
|
Pawnbrokers in Hong Kong are offering cash-strapped customers loans in exchange for their designer handbags.
Expensive arm candy often retains its retail value so companies feel safe using them as collateral for debts. Cash-poor clients - whose money is tied up in savings or the stock market - are generally allowed to borrow 80 per cent of their bag's value.
Customers are expected to pay back their loan within four months with four per cent added monthly interest. Once the debt is cleared they are given their handbag back.
Designer arm candy, such as Chanel and Louis Vuitton, often retains its retail value so companies feel safe using the bags as collateral on loans
The Wall Street Journal reports that the Yes Lady Finance Co., one of the companies that offers the scheme, will approve a loan within half an hour - as long the handbag is Gucci, Chanel, Hermès or Louis Vuitton.
Those with special edition or vintage versions of the 'big four' designers will even get better loan leverage.And it's not just women - one in five customers are men.
RELATED ARTICLES
Share this article
All bags are rigorously checked for authenticity by second-hand designer goods expert Milan Station Holdings Ltd, which works closely with the company.
While most pawnbrokers take homes and cars, in Hong Kong handbags are also seen as a safer investment
An Hermes Birkin, which can cost up to £100,000 and is carried by Kim Kardashian and Victoria Beckham, was handed over in return for a £13,170 loan
According to The Wall Street Journal, 'almost all' of Yes Lady's customers, which translates to 'Rich Woman' in Cantonese, pay their loans back in full within
the four months and are reunited with their designer accessories.
It has been reported that a Hermès Birkin, which can cost up to £100,000 and is carried by Kim Kardashian and Victoria Beckham, was handed over in return for a £13,170 loan. |
Synthesis of polyamidoamine dendrimers having poly(ethylene glycol) grafts and their ability to encapsulate anticancer drugs.
Polyamidoamine dendrimers having poly(ethylene glycol) grafts were designed as a novel drug carrier which possesses an interior for the encapsulation of drugs and a biocompatible surface. Poly(ethylene glycol) monomethyl ether with the average molecular weight of 550 or 2000 was combined to essentially every chain end of the dendrimer of the third or fourth generation via urethane bond. The poly(ethylene glycol)-attached dendrimers encapsulating anticancer drugs, adriamycin and methotrexate, were prepared by extraction with chloroform from mixtures of the poly(ethylene glycol)-attached dendrimers and varying amounts of the drugs. Their ability to encapsulate these drugs increased with increasing dendrimer generation and chain length of poly(ethylene glycol) grafts. Among the poly(ethylene glycol)-attached dendrimers prepared, the highest ability was achieved by the dendrimer of the fourth generation having the poly(ethylene glycol) grafts with the average molecular weight of 2000, which could retain 6.5 adriamycin molecules or 26 methotrexate molecules/dendrimer molecule. The methotrexate-loaded poly(ethylene glycol)-attached dendrimers released the drug slowly in an aqueous solution of low ionic strength. However, in isotonic solutions, methotrexate and adriamycin were readily released from the poly(ethylene glycol)-attached dendrimers. |
Q:
How can I install pycrypto on a 64-bit Windows 7 machine?
I tried installing PyCrypto using pip, but it complained about needing vcvarsall.bat. I installed Visual Studio 2008, but now I get ValueError: [u'path'] when I try to install it from pip.
I tried downloading a pre-built binary from Voidspace, but they only have 32-bit versions, and it doesn't seem to install correctly on my machine (it says it succeeded, but running python and trying import Crypto gives me an ImportError: No module named Crypto).
What do I need to do?
A:
Voidspace now has prebuilt 64bit binaries:
eg. The 64bit binary for python 2.7
|
1920 United States presidential election in Georgia
The 1920 United States presidential election in Georgia took place on November 2, 1920, as part of the wider United States Presidential election. Voters chose 14 representatives, or electors, to the Electoral College, who voted for president and vice president.
Background
With the exception of a handful of historically Unionist North Georgia counties – chiefly Fannin but also to a lesser extent Pickens, Gilmer and Towns – Georgia since the 1880s had been a 1-party state dominated by the Democratic Party. Disfranchisement of almost all African-Americans and most poor whites had made the Republican Party virtually nonexistent outside of local governments in those few hill counties, and the national Democratic Party served as the guardian of white supremacy against a Republican Party historically associated with memories of Reconstruction. The only competitive elections were Democratic primaries, which state laws restricted to whites on the grounds of the Democratic Party being legally a private club.
Vote
The Cox/Roosevelt ticket easily carried the state of Georgia on election day.
Results
References
Notes
Georgia
1920
Category:1920 Georgia (U.S. state) elections |
Two-thirds of the way around the planet, and still going.
Further Reading
Early Monday morning, Solar Impulse 2 left John F. Kennedy Airport in New York on its attempt to cross the Atlantic as part of its 'round-the-world flight. The solar-powered craft is expected to take four days to make its way to Seville, Spain. This leg features Bertrand Piccard at the controls after fellow pilot André Borschberg brought the craft into New York.
As of noon Eastern Standard Time, the craft was eight percent of the way through its journey, which will take it northeast along the US and Canadian coasts to Newfoundland, after which it will turn southeast to head more directly to Spain. After starting the flight on battery power, the craft has largely recharged its batteries as it continues to climb above a kilometer in altitude. |
Various novel glucocorticoids are disclosed, inter alia also the active compound ciclesonide, in DE-A 41 29 535. The combination of selected glucocorticoids with specific β2-sympathomimetics is described in various patent applications (e.g. EP 0 416 950, EP 0 416 951, WO93/11773 or DE-A 19541689). WO01/89492 relates to a stable powder formulation comprising formoterol, a glucocorticosteroid and a carrier or diluent for use in the treatment of respiratory diseases. |
---
abstract: 'Precise estimation of the probabilistic structure of natural images plays an essential role in image compression. Despite the recent remarkable success of end-to-end optimized image compression, the latent codes are usually assumed to be fully statistically factorized in order to simplify entropy modeling. However, this assumption generally does not hold true and may hinder compression performance. Here we present context-based convolutional networks (CCNs) for efficient and effective entropy modeling. In particular, a 3D zigzag scanning order and a 3D code dividing technique are introduced to define proper coding contexts for parallel entropy decoding, both of which boil down to place translation-invariant binary masks on convolution filters of CCNs. We demonstrate the promise of CCNs for entropy modeling in both lossless and lossy image compression. For the former, we directly apply a CCN to the binarized representation of an image to compute the Bernoulli distribution of each code for entropy estimation. For the latter, the categorical distribution of each code is represented by a discretized mixture of Gaussian distributions, whose parameters are estimated by three CCNs. We then jointly optimize the CCN-based entropy model along with analysis and synthesis transforms for rate-distortion performance. Experiments on the Kodak and Tecnick datasets show that our methods powered by the proposed CCNs generally achieve comparable compression performance to the state-of-the-art while being much faster.'
author:
- 'Mu Li, Kede Ma, , Jane You, , David Zhang, , and Wangmeng Zuo, '
bibliography:
- 'IEEEabrv.bib'
- './egbib.bib'
title: 'Efficient and Effective Context-Based Convolutional Entropy Modeling for Image Compression'
---
[Shell : Bare Demo of IEEEtran.cls for IEEE Journals]{}
Context-based convolutional networks, entropy modeling, image compression.
Introduction
============
Data compression has played a significant role in engineering for centuries [@wiki:morse_code]. Compression can be either lossless or lossy. Lossless compression allows perfect data reconstruction from compressed bitstreams with the goal of assigning shorter codewords to more “probable” codes. Typical examples include Huffman coding [@huffman1952method], arithmetic coding [@witten1987arithmetic], and range coding [@martin1979range]. Lossy compression discards “unimportant” information of the input data, and the definition of importance is application-dependent. For example, if the data (such as images and videos) are meant to be consumed by the human visual system, importance should be measured in accordance with human perception, discarding features that are perceptually redundant, while keeping those that are most visually noticeable. In lossy compression, one must face the rate-distortion trade-off, where the rate is computed by the entropy of the discrete codes [@Shannon1948] and the distortion is measured by a signal fidelity metric. A prevailing scheme in the context of lossy image compression is transform coding, which consists of three operations - transformation, quantization, and entropy coding. Transforms map an image to a latent code representation, which is better-suited for exploiting aspects of human perception. Early transforms [@ahmed_1974_dct] are linear, invertible, and fixed for all bit rates; errors arise only from quantization. Recent transforms take the form of deep neural networks (DNNs) [@balle2016end], aiming for nonlinear and more compressible representations. DNN-based transforms are mostly non-invertible, which may, however, encourage discarding perceptually unimportant image features during transformation. This gives us an opportunity to learn different transforms at different bit rates for optimal rate-distortion performance. Entropy coding is responsible for losslessly compressing the quantized codes into bitstreams for storage and transmission.
In either lossless or lossy image compression, a discrete probability distribution of the latent codes shared by the encoder and the decoder ([*i*.*e*.]{}, the entropy model) is essential in determining the compression performance. According to the Shannon’s source coding theorem [@Shannon1948], given a vector of code intensities $\bm y =\{y_0,\ldots,y_M\}$, the optimal code length of $\bm y$ should be $\lceil-\log_{2}P(\bm y)\rceil$, where binary symbols are assumed to construct the codebook. Without further constraints, it is intractable to estimate $P(\bm y)$ in high-dimensional spaces, a problem commonly known as the curse of dimensionality. For this reason, most entropy coding schemes assume $\bm y$ is fully statistically factorized with the same marginal distribution, leading to a code length of $\lceil-\sum_{i=0}^{M}\log_{2}P(y_i)\rceil$. Alternatively, the chain rule in probability theory offers a more accurate approximation $$\begin{aligned}
P(\bm y) \approx \prod_{i=0}^{M}P(y_i|\mathrm{PTX}(y_i,\bm y)),\end{aligned}$$ where $\mathrm{PTX}(y_i,\bm y)\subset\lbrace y_0,\ldots, y_{i-1}\rbrace$ represents the partial context of $y_i$ coded before it in $\bm y$. A representative example is the context-based adaptive binary arithmetic coding (CABAC) [@marpe2003context] in H.264/AVC, which considers the two nearest codes as partial context, and obtains noticeable improvements over previous image/video compression standards. As the size of $\mathrm{PTX}(y_i,\bm y)$ becomes large, it is difficult to estimate this conditional probability by constructing histograms. Recent methods such as PixelRNN [@oord2016pixel] and PixelCNN [@oord2016conditional] take advantage of DNNs in modeling long range relations to increase the size of partial context, but are computationally intensive.
In this work, we present context-based convolutional networks (CCNs) for effective and efficient entropy modeling. Given $\bm y$, we specify a 3D zigzag coding order such that the most relevant codes of $y_i$ can be included in its context. Parallel computation during entropy encoding is straightforward as the context of each code is known and readily available. However, this is not always the case during entropy decoding. The partial context of $y_i$ should first be decoded sequentially for the estimation of $P(y_i|\mathrm{PTX}(y_i,\bm y))$, which is prohibitively slow. To address this issue, we introduce a 3D code dividing technique, which partitions $\bm y$ into multiple groups in compliance with the proposed coding order. The codes within each group are assumed to be conditionally independent given their respective contexts, and therefore can be decoded in parallel. In the context of CCNs, this amounts to applying properly designed translation-invariant binary masks to convolutional filters.
To validate the proposed CCNs, we combine them with arithmetic coding [@witten1987arithmetic] for entropy modeling. For lossless image compression, we convert the input grayscale image to eight binary planes and train a CCN to predict the Bernoulli distribution of $y_i$ by optimizing the entropy loss in information theory [@cover2006elements]. For lossy image compression, we parameterize the categorical distribution of $y_i$ with a discretized mixture of Gaussian (MoG) distributions, whose parameters ([*i*.*e*.]{}, mixture weights, means, and variances) are estimated by three CCNs. The CCN-based entropy model is jointly optimized with analysis and synthesis transforms ([*i*.*e*.]{}, mappings between raw pixel space and latent code space) over a database of training images, trading off the rate and the distortion. Experiments on the Kodak and Tecnick datasets show that our methods for lossless and lossy image compression perform favorably against image compression standards and DNN-based methods, especially at low bit rates.
Related Work
============
In this section, we provide a brief overview of entropy models and lossy image compression methods based on DNNs. For traditional image compression techniques, we refer interested readers to [@sudhakar2005image; @wallace1992jpeg; @skodras2001jpeg].
DNN-Based Entropy Modeling
--------------------------
The first and the most important step in entropy modeling is to estimate the probability $P(\bm y)$. For most image compression techniques, $\bm y$ is assumed to be statistically independent, whose entropy can be easily computed through the marginal distributions [@balle2016end; @theis2017lossy; @agustsson2017soft; @rippel2017real]. Arguably speaking, natural images undergoing a highly nonlinear analysis transform still exhibit strong statistical redundancies [@balle2018variational]. This suggests that incorporating context into probability estimation has great potentials in improving the performance of entropy coding.
DNN-based context modeling for natural languages and images has attracted considerable attention in the past decade. In natural language processing, recurrent neural networks (RNN) [@mikolov2010recurrent], and long short-term memory (LSTM) [@sundermeyer2012lstm] are two popular tools to model long-range dependencies. In image processing, PixelRNN [@oord2016pixel] and PixelCNN [@oord2016conditional] are among the first attempts to exploit long-range pixel dependencies for image generation. The above-mentioned methods are computationally inefficient, requiring one forward propagation to generate (or estimate the probability of) a single pixel. To speed up PixelCNN, Reed [*et al*.]{} [@reed2017multi] proposed Multiscale PixelCNN, which is able to sample a twice larger intermediate image conditioning on the initial image. This process may be iterated to generate the final high-resolution result. When viewing Multiscale PixelCNN as an entropy model, we must losslessly compress and send the initial image as side information to the decoder for entropy decoding.
Only recently have DNNs for context-based entropy modeling become an active research topic. Ball[é]{} [*et al*.]{} [@balle2018variational] introduced a scale prior, which stores a variance parameter for each $y_i$ as side information. Richer side information generally leads to more accurate entropy modeling. However, this type of information should also be quantized, compressed and considered as part of the codes, and it is difficult to trade off the bits saved by the improved entropy model and the bits introduced by storing this side information. Li [*et al*.]{} [@li2017learning] extracted a small code block for each $y_i$ as its context, and adopted a simple DNN for entropy modeling. The method suffers from heavy computational complexity similar to PixelRNN [@oord2016pixel]. Li [*et al*.]{} [@li2018efficient] and Mentzer [*et al*.]{} [@mentzer2018conditional1] implemented parallel entropy encoding with masked DNNs. However, sequential entropy decoding has to be performed due to the context dependence, which remains painfully slow. In contrast, our CCN-based entropy model permits parallel entropy encoding and decoding, making it more attractive for practical applications.
DNN-Based Lossy Image Compression
---------------------------------
A major problem in end-to-end lossy image compression is that the gradients of the quantization function are zeros almost everywhere, making gradient descent-based optimization ineffective. Different strategies have been proposed to alleviate the zero-gradient problem resulting from quantization. From a signal processing perspective, the quantizer can be approximated by additive i.i.d. uniform noise, which has the same width as the quantization bin [@gray1998quantization]. A desired property of this approximation is that the resulting density is a continuous relaxation of the probability mass function of $\bm y$ [@balle2016end]. Another line of research introduced continuous functions (without the zero-gradient problem) to approximate the quantization function. The step quantizer is used in the forward pass, while its continuous proxy is used in the backward pass. Toderici [*et al*.]{} [@toderici2015variable] learned an RNN to compress small-size images in a progressive manner. They later tested their models on large-size images [@toderici2016full]. Johnston [*et al*.]{} [@johnston2017improved] exploited adaptive bit allocations and perceptual losses to boost the compression performance especially in terms of MS-SSIM [@wang2003multiscale].
The joint optimization of rate-distortion performance is another crucial issue in DNN-based image compression. The methods in [@toderici2015variable; @toderici2016full; @johnston2017improved] treat entropy coding as a post-processing step. Ball[é]{} [*et al*.]{} [@balle2016end] explicitly formulated DNN-based image compression under the framework of rate-distortion optimization. Assuming $\bm y$ is statistically factorized, they learned piece-wise linear density functions to compute differential entropy as an approximation to discrete entropy. In a subsequent work [@balle2018variational], each $y_i$ is assumed to follow zero-mean Gaussian with its own variance separately predicted using side information. Minnen [*et al*.]{} [@minnen2018joint] combined the autoregressive and hierarchical priors, leading to improved rate-distortion performance. Theis [*et al*.]{} [@theis2017lossy] introduced a continuous upper bound of the discrete entropy with a Gaussian scale mixture. Rippel [*et al*.]{} [@rippel2017real] described pyramid-based analysis and synthesis transforms with adaptive code length regularization for real-time image compression. An adversarial loss [@goodfellow2014generative] is incorporated to generate visually realistic results at low bit rates [@rippel2017real].
CCNs for Entropy Modeling
=========================
In this section, we present in detail the construction of CCNs for entropy modeling. We work with a fully convolutional network, consisting of $T$ layers of convolutions followed by point-wise nonlinear activation functions, and assume the standard raster coding order (see Fig. \[fig:conv\]). In order to perform efficient context-based entropy coding, two assumptions are made on the network architecture:
- For a code block $\bm y\in\mathbb{Q}^{M\times H\times W}$, where $M$, $H$, and $W$ denote the dimensions along channel, height, and width directions, respectively, the corresponding output of the $t$-th convolution layer $\bm v^{(t)}$ has a size of ${M\times H\times W\times N_t}$, where $N_t$ denotes the number of feature blocks to represent $\bm y$.
- Let $\mathrm{CTX}( y_i(p,q),\bm y)$ be the set of codes encoded before $y_i(p,q)$ ([*i*.*e*.]{}, full context), and $\mathrm{SS}( v^{(t)}_{i,j}(p,q))$ be the set of codes in the receptive field of $v^{(t)}_{i,j}(p,q)$ that contributes to its computation ([*i*.*e*.]{}, support set), respectively. Then, $\mathrm{SS}(v^{(t)}_{i,j}(p,q))\subset \mathrm{CTX}( y_{i}(p,q), \bm y)$.
Assumption I establishes a one-to-many correspondence between the input code block $\bm y$ and the output feature representation $\bm v^{(T)}$. In other words, the feature $ v^{(t)}_{i,j}(p,q)$ in $i$-th channel and $j$-th feature block at spatial location $(p,q)$ is uniquely associated with $y_{i}(p,q)$. Assumption II ensures that the computation of $v^{(t)}_i(p,q)$ depends only on a subset of $\mathrm{CTX}(y_i(p,q),\bm y)$. Together, the two assumptions guarantee the legitimacy of context-based entropy modeling in fully convolutional networks, which can be achieved by placing translation-invariant binary masks to convolution filters.
We start with the case of a 2D code block, where $\bm y\in \mathbb{Q}^{H\times W}$, and define masked convolution at the $t$-th layer as $$v^{(t)}_i(p,q) = \sum_{j=1}^{N_t} \left( u^{(t)}_j \ast\left( m^{(t)} \odot w^{(t)}_{i,j}\right) \right)(p,q)+b_i^{(t)},
\label{eq:conv2d}$$ [ where $\ast$ and $\odot$ denote 2D convolution and Hadamard product, respectively. $\bm w^{(t)}_{ij}$ is a 2D convolution filter, $\bm m^{(t)}$ is the corresponding 2D binary mask, and $b_i^{(t)}$ is the bias. ]{} According to Assumption I, the input $\bm u^{(t)}_i$ and the output $\bm v^{(t)}_i$ are of the same size as $\bm y$. The input code block $\bm y$ corresponds to $\bm u^{(0)}_0$.
![Illustration of 2D masked convolution in the input layer of the proposed CCN for entropy modeling. A raster coding order (left to right, top to bottom) and a convolution kernel size of $5\times 5$ are assumed here. The orange and blue dashed regions indicate the full context of the orange and blue codes, respectively. In the right panel, we highlight the support sets of the two codes in corresponding colors, which share the same mask.[]{data-label="fig:conv"}](conv.pdf){width="0.76\linewidth"}
{width="100.00000%"}
{width="1.0\linewidth"}
{width="1.0\linewidth"}
For the input layer of a fully convolutional network, the codes to produce $v^{(0)}_{i}(p,q)$ is $\Omega_{p,q}=\{y(p+\mu,q+\nu)\}$, where $(\mu,\nu)\in\Psi$ is the set of local indices centered at $(0,0)$. We choose $$\begin{aligned}
\mathrm{SS}(v^{(0)}_{i}(p,q))=\mathrm{CTX}(y(p,q),\Omega_{p,q})\subset \mathrm{CTX}(y(p,q),\bm y),\end{aligned}$$ which can be achieved by setting $$\begin{aligned}
m^{(0)}{(\mu,\nu)} = \begin{cases}
1, &\mbox{if } \Omega_{p,q}(\mu,\nu) \in\mathrm{CTX}(y(p,q),\bm y) \\
0, &\mbox{otherwise}.
\end{cases}
\label{eq:mask_input}\end{aligned}$$ Fig. \[fig:conv\] illustrates the concepts of full context $\mathrm{CTX}(y(p,q), \bm y)$, support set $\mathrm{SS}(v^{(0)}(p,q))$, and translation-invariant mask $\mathbf m^{(0)}$, respectively. At the $t$-th layer, if we let $\bm m^{(t)} = \bm m^{(0)}$, for a code $y(p+\mu,q+\nu)\in \mathrm{CTX}(y(p,q), \bm y)$, we have $$\begin{aligned}
\mathrm{SS}(u^{(t)}_j(p+\mu,q+\nu))\subset& {\mathrm{CTX}}(y(p+\mu,q+\nu),\bm y)\nonumber\\
\subset& {\mathrm{CTX}}(y(p,q),\bm y),\end{aligned}$$ where the first line follows by induction and the second line follows from the definition of context. That is, as long as $y(p+\mu,q+\nu)$ is in the context of $y(p,q)$, we are able to compute $v^{(t)}_i{(p,q)}$ from $u^{(t)}_j(p+\mu,q+\nu)$ without violating Assumption II. In addition, $u^{(t)}_j(p,q)$ for $t>0$ is also generated from ${\mathrm{CTX}}(y{(p,q)},\bm y)$, and can be used to compute $v^{(t)}_i{(p,q)}$. Therefore, we may modify the mask at the $t$-th layer $$\begin{aligned}
\mathbf{m}^{(t)}{(\mu,\nu)} = \begin{cases}
\mathbf{m}^{(0)}(\mu,\nu), &\mbox{if } (\mu,\nu)\ne(0,0)\\
1, &\mbox{otherwise}.
\end{cases}
\label{eq:mask_hidden}\end{aligned}$$
![Illustration of masked codes with $M=6$, $r=2$, and a filter size of $3\times 3$. Blue dots represent codes activated by the mask and red dots indicate the opposite. The only difference lies in the green diagonal plane. (a) Input layer. (b) Hidden layer.[]{data-label="fig:3d_mask"}](figs/k1.pdf){width="100.00000%"}
![Illustration of masked codes with $M=6$, $r=2$, and a filter size of $3\times 3$. Blue dots represent codes activated by the mask and red dots indicate the opposite. The only difference lies in the green diagonal plane. (a) Input layer. (b) Hidden layer.[]{data-label="fig:3d_mask"}](figs/k2.pdf){width="100.00000%"}
(500,200) (0,0)[{width="100.00000%"}]{} (250,90) (120,-5) (380,-5) (30,16) (118,50) (90,16) (260,50) (372,50) (478,50) (9,32) (86,32) (142,36) (146,28) (208,32) (290,36) (285,28) (356,32) (412,36) (416,28) (475,36) (470,28) (290,65)
Proposed Strategies for Parallel Entropy Decoding
-------------------------------------------------
With the translation-invariant masks designed in Eqn. (\[eq:mask\_input\]) and Eqn. (\[eq:mask\_hidden\]), the proposed CCN can efficiently encode $\bm y$ in parallel. However, it remains difficult to parallelize the computation in entropy decoding. As shown in Fig. \[fig:context\] (a) and (b), the two nearby codes in the same row (highlighted in orange and blue, respectively) cannot be decoded simultaneously because the orange code is in the support set (or context) of the blue code given the raster coding order. To speed up entropy decoding, we may further remove dependencies between codes at the risk of model accuracy. Specifically, we partition $\bm y$ into $K$ groups, namely, ${\mathrm{GP}}_0(\bm y),\ldots, {\mathrm{GP}}_{K-1}(\bm y)$, and assume the codes within the same group are statistically independent. This results in a partial context $\mathrm{PTX}(y(p,q),\bm y)=\{{\mathrm{GP}}_0(\bm y),\ldots,{\mathrm{GP}}_{k-1}(\bm y)\}$ for $y(p,q)\in {\mathrm{GP}}_{k}(\bm y)$. In other words, all codes in the $k$-th group share the same partial context, and can be decoded in parallel. Note that code dividing schemes are largely constrained by pre-specified coding orders. For example, if we use a raster coding order, it is straightforward to divide $\bm y$ by row. In this case, $y(p,q-1)$ ($p$ and $q$ index vertical and horizontal directions, respectively), which is extremely important in predicting the probability of $y(p,q)$ according to CABAC [@marpe2003context], has been excluded from its partial context. To make a good trade-off between modeling efficiency and accuracy, we switch to a zigzag coding order as shown in Fig. \[fig:context\] (d), where ${\mathrm{GP}}_k(\bm y)=\{y(p,q)| p+q=k\}$ and $\mathrm{PTX}(y(p,q),\bm y)=\{y(p',q')|p'+q'< k\}$. As such, we retain the most relevant codes in the partial context for better entropy modeling (see Fig. \[fig:lossless\_cmp2\] for quantitative results). Accordingly, the mask at the $t$-th layer becomes $$\begin{aligned}
m^{(t)}{(\mu,\nu)} = \begin{cases}
m^{(0)}(\mu,\nu), &\mbox{if } \mu+\nu\ne 0\\
1, &\mbox{otherwise}.
\end{cases}
\label{eq:mask_hidden_slope}\end{aligned}$$
Now, we extend our discussion to a 3D code block, where $\bm y\in \mathbb{Q}^{M\times H \times W}$. Fig. \[fig:3d\] (a) shows the proposed 3D zigzag coding order and 3D code dividing technique. Specifically, $\bm y$ is divided into $K=M+H+W-2$ groups in the shape of diagonal planes, where the $k$-th group is specified by ${\mathrm{GP}}_k(\bm y)=\{y_r(p,q)|r+p+q=k\}$. The partial context of $y_r(p,q)\in{\mathrm{GP}}_k(\bm y)$ is defined as $\mathrm{PTX}(y_r(p,q),\bm y)=\{y_{r'}(p', q')|r'+p'+q'<k\}$. We then write masked convolution in the 3D case as $$\begin{aligned}
v^{(t)}_{i,r}(p,q) = \sum_{j=1}^{N_t} \sum_{s=1}^{M}\left( u^{(t)}_{j,s} \ast\left( m^{(t)}_{r,s} \odot w^{(t)}_{i,j,r,s}\right) \right)(p,q)+b_{i,r}^{(t)},\end{aligned}$$ where $\{i,j\}$ and $\{r,s\}$ are indices for the feature block and the channel, respectively. For the 2D case, each layer shares the same mask ($M=1$). When extending to 3D code blocks, each channel in a layer shares a mask, and there are a total of $M$ 3D masks. For the input layer, the codes to produce $v^{(0)}_{i,r}(p,q)$ is $\Omega_{p,q}=\{y_s{(p+\mu,q+\nu)}\}_{(\mu,\nu)\in\Psi, 0\le s< M}$, based on which we define the mask as $$\begin{aligned}
m^{(0)}_{r,s}{(\mu,\nu)} = \begin{cases}
1, &\mbox{if } \Omega_{p,q}(\mu,\nu) \in\mathrm{PTX}({y_r(p,q),\bm y})\\
0, &\mbox{otherwise}.
\end{cases}
\label{eq:3dmask_input}\end{aligned}$$ For the $t$-th layer, we modify the mask to include the current diagonal plane $$\begin{aligned}
m^{(t)}_{r,s}(\mu,\nu) = \begin{cases}
m^{(0)}_{r,s}(\mu,\nu), &\mbox{if } s+\mu+\nu\ne r\\
1, &\mbox{otherwise},
\end{cases}
\label{eq:mask_input_3d}\end{aligned}$$ as shown in Fig. \[fig:3d\_mask\].
Analysis of the Degree of Parallelism {#sec:dop}
-------------------------------------
[ We analyze the degree of parallelism (DOP) of the proposed CCN, which is defined as the number of operations that can be or are being simultaneously executed by a computer. For entropy encoding, all codes can be estimated in parallel, leading to a DOP of $MHW$. The proposed CCN divides the code block into $K=M+H+W-2$ groups and allows the codes within each group to be processed in parallel. Ideally, the DOP should be the group size (*i.e.*, the number of codes in the group). However, different groups have different sizes in the shape of irregular diagonal planes. Here, the average group size is adopted as a rough indication of DOP, $$\begin{aligned}
\mathrm{DOP}=\frac{1}{K}\sum_{k=0}^{K-1} Z_k=\frac{MHW}{M+H+W-2},\end{aligned}$$ where $Z_k$ denotes the number of codes in the $k$-th group. It is clear that DOP is a function of height, width, and channel of the code block.]{}
CCN-Based Entropy Models for Lossless Image Compression
=======================================================
In this section, we combine our CCN-based entropy model with the arithmetic coding algorithm for lossless image compression.
(500,180) (0,0)[{width="100.00000%"}]{} (16,100) (213,146) (236,120) (262,86) (505,85) (187,105) (187,70) (236,50)
As a starting point, we binarize the grayscale image $\bm x\in \mathbb{R}^{H\times W}$ to obtain a 3D code block $$\begin{aligned}
y_{r}(p,q) = \left\lfloor \frac{x(p,q)}{2^{7-r}} \right\rfloor {\rm mod}\ 2, \quad r=0,1,\ldots,7,\end{aligned}$$ where we index the most significant bit-plane with $r=0$. Our CCN takes $\bm y$ as input and produces a feature block $\bm v$ (the superscript $(T)$ is omitted for notation convenience) of the same size to compute the mean estimates of Bernoulli distributions $P(y_r(p,q)|\mathrm{SS}(v_r(p,q)))$. Fig. \[fig:lossless\_frame\] shows the network architecture, which has eleven masked convolution layers with parametric ReLU nonlinearities in between. The last convolution responses undergo a sigmoid nonlinearity to constrain their range between $[0,1]$. We make four residual connections as suggested in [@he2016deep] to accelerate training. We will experiment with two hyper-parameters in CCN: the convolution filter size for all layers $S$ and the number of feature blocks in hidden layers $N$.
To optimize the network parameters collectively denoted by $\bm \theta$, we adopt the expected code length as the empirical loss $$\begin{aligned}
\ell(\bm \theta) = \mathbb{E}_{\bm y}&\Big[-\sum_{r,p,q} \big({\mathbbm 1}(y_r(p,q)=1)\log_2( v_{r}(p,q))\nonumber\\
&- \mathbbm{1}(y_r(p,q)=0)\log_2(1- v_{r}(p,q)) \big)\Big],
\label{eq:lossless_entropy}\end{aligned}$$ where $\mathbbm{1}(\cdot)$ is an indicator function and the expectation may be approximated by averaging over a mini-batch of training images. Finally, we implement our own arithmetic coding method with the learned CCN-based entropy model to compress $\bm y$ to bitstreams, and report performance using actual bit rates.
CCN-Based Entropy Models for Lossy Image Compression
====================================================
In lossy image compression, our objective is to minimize a weighted sum of rate and distortion, $\ell_r + \lambda \ell_d$, where $\lambda$ governs the trade-off between the two terms. As illustrated in Fig. \[fig:lossy\_framework\], the proposed compression method has four components: an analysis transform $g_a$, a quantizer $g_d$, a CCN-based entropy model, and a synthesis transform $g_s$. The analysis transform $g_a$ takes a color image $\bm x$ as input and produces the latent code representation $\bm z$, which is further quantized to generate the discrete code block $\bm y$. $g_a$ consists of three convolutions, each of which is followed by down-sampling with a factor of two. A dense block [@huang2017densely] comprised of seven convolutions is employed after each down-sampling. After the last dense block, we add another convolution layer with $M$ filters to produce $\bm z$. Empirically, the parameter $M$ sets the upper bound of the bit rate that a general DNN-based compression method can achieve. The parameters of $g_a$ constitute the parameter vector $\bm \phi$ to be optimized. The synthesis transform $g_s$ has a mirror structure of the analysis transform. Particularly, the depth-to-space reshaping [@toderici2016full; @shi_2016_real] is adopted to up-sample the feature maps. The last convolution layer with three filters is responsible for producing the compressed image in RGB space. The parameters of $g_s$ constitute the parameter vector $\bm \psi$ to be optimized.
For the quantizer $g_d$, we parameterize its quantization centers for the $r$-th channel by $\{\omega_{r,0},\ldots,\omega_{r,L-1}\}$, where $L$ is the number of quantization centers and $\omega_{r,0}\le\ldots\le\omega_{r,L-1}$. The monotonicity of $\bm \omega$ can be enforced by a simple re-parameterization based on cumulative functions. Given a fixed set of $\bm \omega$, we perform quantization by mapping $z_r(p,q)$ to its nearest center that minimizes the quantization error $$\begin{aligned}
y_r(p,q) = g_d(z_r(p,q))= \operatorname*{argmin}_{\{ \omega_{r,l}\}}\Vert z_{r}(p,q) - \omega_{r,l} \Vert^2_2.
\label{eq:mapping}\end{aligned}$$ $g_d$ has zero gradients almost everywhere, which hinders training via back-propagation. Taking inspirations from binarized neural networks [@courbariaux2016binarized; @zhou2016dorefa; @rastegari2016xnor], we make use of an identify mapping $\hat{g}_d(y_r(p,q)) = y_r(p,q)$ as a continuous proxy to the step quantization function. During training, we use $g_d$ and $\hat{g}_d$ in the forward and backward passes, respectively.
The quantization centers $\bm \omega$ should be optimized by minimizing the mean squared error (MSE), $$\begin{aligned}
\ell(\bm \omega)=\frac{1}{MHW} \sum_{r,p,q}\Vert z_{r}(p,q)-
y_{r}(p,q))\Vert^2_2,
\label{eq:loss_quant}\end{aligned}$$ which is essentially a $k$-means clustering problem, and can be solved efficiently by the Lloyd’s algorithm [@lloyd1982least]. Specifically, we initialize $\bm \omega$ using uniform quantization, which appears to work well in all experiments. To make parameter learning of the entire model smoother, we adjust $\bm \omega$ using stochastic gradient descent instead of a closed-form update.
Without prior knowledge of the categorical distributions of the quantized codes ${\bm y}$, we choose to work with discretized MoG distributions, whose parameters are predicted by the proposed CCNs. We write the differentiable MoG distribution with $C$ components as $$\begin{aligned}
y_r(p,q) \sim \sum_{i=0}^{C-1}\pi_i\mathcal{N}(y_r(p,q);\mu_i, \sigma^2_i),
\label{eq:mog}\end{aligned}$$ where $\pi_i$, $\mu_i$ and $\delta^2_i$ are the mixture weight, mean, and variance of the $i$-th component, respectively. Then, [the probability of $y_r(p,q)$ is calculated as the integral over the quantization bin $\Delta$ that the code lies in]{} $$\begin{aligned}
P(y_{r}{(p,q)})=\int_{\Delta}\sum_{i=0}^{C-1}\pi_i\mathcal{N}(\xi; \mu_i, \sigma_i^2)d\xi.
\label{eq:prob}\end{aligned}$$ [For example, suppose $y_r(p,q)=\omega_{r,l}$, then $\Delta=[(\omega_{r,l-1}+\omega_{r,l})/2,(\omega_{r,l}+\omega_{r,l+1})/2]$, where we define $\omega_{r,-1} = -\infty$ and $\omega_{r,L} = \infty$, respectively.]{}
Next, we describe the proposed entropy model in lossy image compression, which is comprised of three CCNs with the same structure, as shown in Fig. \[fig:lossy\_framework\]. Each CCN consists of nine masked convolutions with three residual connections to produce $C$ feature blocks, matching the number of components in MoG. They separately output mixture weights, means and variances to build the discretized MoG distributions. The network parameters of our CCNs constitute the parameter vector $\bm \theta$ to be optimized.
![Bit rates (in terms of bpp) of different DNN-based entropy models for lossless image compression on the Kodak dataset. SIN($M$) refers to a side information network that allocates $M$ output channels to represent side information. The orange and gray bars represent the bit rates resulting from the image and the side information, respectively.[]{data-label="fig:lossless_performance"}](lossless_cmp){width="1.0\linewidth"}
Finally, we are able to write the empirical rate-distortion objective for the parameters $\{\bm \phi, \bm \psi, \bm \theta\}$ as $$\begin{aligned}
\ell(\bm \phi, \bm \psi, \bm \theta)= \mathbb{E}_{\bm x}\Bigg[&-\sum_{i} \log_2 P_{y_i}\bigg(g_d\Big(g_a(\bm x;\bm \phi)\Big);\bm\theta\bigg) \nonumber\\
&+ \lambda \ell_d\bigg(g_s\Big(g_d\big(g_a(\bm x;\bm \phi)\big);\bm \psi\Big),\bm x\bigg)\Bigg].
\label{eq:loss}\end{aligned}$$ $\ell_d$ is the distortion term, which is more preferable to be assessed in perceptual space. In this paper, we optimize and evaluate our lossy image compression methods using the standard MSE and a perceptual metric MS-SSIM [@wang2003multiscale]. Similar to lossless image compression, we combine the optimized entropy model with arithmetic coding and report the actual bit rates.
Experiments {#sec:exp}
===========
In this section, we test the proposed CCN-based entropy models in lossless and lossy image compression by comparing to state-of-the-art image coding standards and recent deep image compression algorithms. We first collect $10,000$ high-quality and high-definition images from Flickr, and down-sample them to further reduce possibly visible artifacts. We crop $1,280,000$ grayscale patches of size $128\times128$ and $640,000$ color patches of size $3\times256\times256$ as the training sets for lossless and lossy image compression, respectively. We test our models on two independent datasets - Kodak and Tecnick [@asuni2013testimages], which are widely used to benchmark image compression performance. The Caffe implementations along with the pre-trained models are made available at <https://github.com/limuhit/CCN>.
Lossless Image Compression {#sec:lossless_exp}
--------------------------
We train our CCN-based entropy models using the Adam stochastic optimization package [@kingma2014adam] by minimizing the objective in Eqn. (\[eq:lossless\_entropy\]). We start with a learning rate of $10^{-4}$, and subsequently lower it by a factor of $10$ when the loss plateaus, until $10^{-6}$. The (actual) bit rate in terms of bits per pixel (bpp) is used to quantify the compression performance, which is defined as the ratio between the total amount of bits used to code the image and the number of pixels in the image. A smaller bpp indicates better performance. For example, an uncompressed grayscale image has eight bpp.
We first compare the proposed CCNs with masked convolutional networks (MCNs) [@mentzer2018conditional1; @li2018efficient], Multiscale PixelCNN [@reed2017multi], and side information networks (SINs) [@balle2018variational] for entropy modeling. As a special case of CCNs, MCNs specify the raster coding order without using any code dividing technique (see Fig. \[fig:context\]). We implement our own version of MCN that inherits the network architecture from CCN with $N=16$ (number of feature blocks) and $S =5$ (filter size). [ Multiscale PixelCNN [@reed2017multi] is originally designed for image generation. Here we slightly modify it for entropy modeling. Specifically. we approximate the iterative process of Multiscale PixelCNN with a single network by mapping the initial grayscale image directly to the probability distributions of the original image. The network includes an up-sampling convolution layer followed by five residual blocks. We test various configurations of Multiscale PixelCNN, and choose to down-sample the original image by a factor of 4 as initialization, which delivers the best overall compression performance. ]{} SINs summarize the side information of ${\bm y}$ with a separate DNN, which is beneficial in probability estimation. [ We adopt a DNN-based autoencoder including three stride convolutions and two residual connections to generate the side information]{}, which is further quantized and compressed with arithmetic coding for performance evaluation. We test five variants of SINs with different amount of side information by changing the number of output channels $M$. All competing models are trained on the same dataset described at the beginning of Section \[sec:exp\].
We also introduce a light-weight version of our method, which we name CCN$_\mathrm{light}$, by making the network architecture lighter (with $N=4$ and $S=3$) and by dividing the input image into non-overlapping patches for parallel processing. [ We split the image into a total of $R\times R$ smaller patches with the size of $\frac{H}{R}\times\frac{W}{R}$. The DOP now becomes $\frac{MHW}{M+H/R+W/R-2}$, which further speeds up the original CCN by about $R$ times. ]{}
![Bit rates of CCN in comparison with lossless image compression standards on the Kodak and Tecnick datasets.[]{data-label="fig:lossless_cmp3"}](lossless_cmp3){width="1.0\linewidth"}
[cccccc]{} &SIN&MCN&
------------
Multiscale
PixelCNN
------------
: Running time in seconds and model complexity of different DNN-based entropy models on the Kodak dataset[]{data-label="tab:lossless_time"}
& CCN&$\mbox{CCN}_\mathrm{light}$\
Encoding time& 0.155& 0.323& 0.400 & 0.323 & 0.074\
Decoding time& 0.155& 3079.68& 0.400 & 35.28 & 0.984\
------------------
\# of parameters
($\times 10^6)$
------------------
: Running time in seconds and model complexity of different DNN-based entropy models on the Kodak dataset[]{data-label="tab:lossless_time"}
& $6.70$& $3.89$&$3.67$&$3.89$&$0.10$\
--------------------
\# of FLOPs
($\times 10^{12})$
--------------------
: Running time in seconds and model complexity of different DNN-based entropy models on the Kodak dataset[]{data-label="tab:lossless_time"}
& $0.58$& $2.78$&$2.87$&$2.78$&$0.07$\
Fig. \[fig:lossless\_performance\] shows the bit rates of the competing methods on the Kodak dataset. The proposed CCN matches the best performing model MCN, which suggests that with the proposed zigzag coding order and code dividing technique, CCN includes the most important codes as the partial context of the current code being processed. The bit rates of SINs come from two parts - the image itself and the side information. It is clear from the figure that increasing the amount of side information leads to bit savings of the image, at the cost of additional bits introduced to code the side information. In general, it is difficult to determine the right amount of side information for optimal compression performance. Multiscale PixelCNN can also be regarded as a special case of SINs, whose side information is a small image without further processing, leading to the worst performance.
We also compare CCN with the widely used lossless image compression standards, including TIFF, GIF, PNG, JPEG-LS, JPEG2000-LS, and BPG. All test results are generated by MATLAB2017. From Fig. \[fig:lossless\_cmp3\], we find that CCN (along with its light-weight version CCN$_\mathrm{light}$) overwhelms all competing methods on the Kodak/Tecnick dataset, achieving more than $5.9\%/6.2\%$ bit savings compared to the best lossless image compression standard, JPEG2000-LS.
![Ablation study of CCN on the Kodak and Tecnick datasets. CCN($N$,$S$) denotes the CCN with $N$ feature blocks and $S\times S$ filter size. CCN$_\mathrm{raster}$ represents the CCN with the raster coding order and the corresponding code dividing technique (see Fig. \[fig:context\]).[]{data-label="fig:lossless_cmp2"}](lossless_cmp2.pdf){width="1.0\linewidth"}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/1.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/2.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/3.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/4.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/5.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/6.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/7.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
(50,50) (4,4)[![Visualization of the learned continuous MoG distributions of representative codes before discretization. It is clear that most of them are multimodal, and therefore cannot be well fitted using a single Gaussian.[]{data-label="fig:mog"}](./dist/8.png "fig:"){width="0.92\linewidth"}]{} (0,20) (30,0)[[[$y$]{}]{}]{}
The running time of the competing DNN-based entropy models is tested on an NVIDIA TITAN Xp machine, whose results on the Kodak dataset are listed in Table \[tab:lossless\_time\]. For encoding, CCN$_\mathrm{light}$ enjoys the fastest speed, followed by Multiscale PixelCNN and SIN (the best performing variant). Despite similar encoding time, they have substantially different decoding complexities. Multiscale PixelCNN has the fastest decoder, followed by SIN. Due to the sequential decoding nature, MCN is the slowest, taking nearly one hour to decode a grayscale image of size $752\times496$. Our CCN achieves a significant improvement upon MCN with the proposed code dividing technique, while maintaining nearly the same bit rates. Moreover, CCN$_\mathrm{light}$ speeds up CCN more than $30$ times, striking a good balance between model efficiency and model accuracy. [ We also report the model complexity of the competing models in terms of the number of parameters and floating point operations (FLOPs) in Table \[tab:lossless\_time\]. Except for the CCN$_\mathrm{light}$, all the competing models have comparable complexity.]{}
We conduct thorough ablation experiments to analyze the impact of individual components of CCN to final compression performance. Fig. \[fig:lossless\_cmp2\] shows the bit rates of CCNs with three different numbers of feature blocks ($N\in\{4,8,16\}$) and two filter sizes ($S\in\{3,5\}$). When the filter size and the network depth are fixed, adding more feature blocks effectively increases model capability and thus boosts the compression performance. Similarly, using a larger filter size with fixed network depth and feature block number increases the partial context, leading to better entropy modeling. Moreover, we replace the proposed zigzag coding order in CCN with the raster coding order, whose model is denoted by CCN$_\mathrm{raster}$. From Fig. \[fig:lossless\_cmp2\], we observe that the performance of CCN$_\mathrm{raster}$ drops significantly, only comparable to the CCN with four feature blocks. This verifies the advantages of the proposed coding order.
Lossy Image Compression
-----------------------
In lossy image compression, the analysis transform $g_a$, the non-uniform quantizer $g_d$, the CCN-based entropy model, and the synthesis transform $g_s$ are jointly optimized for rate-distortion performance. In the early stages of training, the probability $P({\bm y})$ often changes rapidly, which makes it difficult to keep track of, and may cause instability in learning the entropy model. We find that this issue can be alleviated by a simple warmup strategy. Specifically, $g_a$ and $g_s$ are trained using the distortion term $\ell_d$ only for the first epoch. We then fix $g_a$ and train the CCN-based entropy model until it reasonably fits the current distribution of the codes. After that, we end-to-end optimize the entire method for the remaining epochs. We use Adam with a learning rate of $10^{-5}$ and gradually lower it by a factor of $10$, until $10^{-7}$. The number of quantization centers is $L=8$, and the number of Gaussian components in MoG is $C=3$. [ Fig. \[fig:mog\] shows the learned continuous distributions of representative codes, which are typically multimodal, and therefore cannot be well fitted by unimodal distributions (*e.g.*, Gaussian).]{} The optimization is performed separately for each $\lambda$ and for each distortion measure. We optimize twelve models for six bit rates and two distortion metrics (MSE and MS-SSIM). MSE is converted to peak signal-to-noise ratio (PSNR) for quantitative analysis.
![Rate-distortion curves of several variants of the proposed lossy image compression method on the Kodak dataset. []{data-label="fig:cmp"}](cmp_psnr){width="0.85\linewidth"}
[ We also evaluate the effect of several components, [*i*.*e*.]{}, the transforms, entropy model, and joint optimization, of the proposed lossy image compression method. All the variants of our method are optimized for MSE distortion and tested on the Kodak dataset. The compression performance of these methods is shown in Fig. \[fig:cmp\]. In terms of the transforms, we replace each dense block of our method with three residual blocks. To keep the same network depth, the first residual block consists of three convolution layers, while the last two residual blocks have two convolution layers. Our method performs better than this variant, especially at higher bit rates. As for the entropy model, we replace the proposed CCN with CCN$_\mathrm{raster}$. Similar to the results in lossless image compression, our method with the zigzag coding order outperforms this variant with the raster coding order. Moreover, we investigate the effect of joint optimization of the transforms and the entropy model. A baseline method is introduced, which first optimizes the transforms for MSE ($\lambda=\infty$), and then trains the CCN-based entropy model by fixing the learned transforms. The baseline method performs worse than the jointly optimized one by 1 dB. Similar trends can be observed for the variants with residual blocks. ]{}
![Rate-distortion curves of different compression methods on the Kodak dataset. (a) PSNR. (b) MS-SSIM.[]{data-label="fig:kodak"}](psnr){width="1.0\linewidth"}
![Rate-distortion curves of different compression methods on the Kodak dataset. (a) PSNR. (b) MS-SSIM.[]{data-label="fig:kodak"}](ms-ssim){width="1.0\linewidth"}
![Rate-distortion curves of different compression methods on the Tecnick dataset. (a) PSNR. (b) MS-SSIM.[]{data-label="fig:tecnick"}](tec_psnr){width="1.0\linewidth"}
![Rate-distortion curves of different compression methods on the Tecnick dataset. (a) PSNR. (b) MS-SSIM.[]{data-label="fig:tecnick"}](tec_ms_ssim){width="1.0\linewidth"}
{width="1.0\linewidth"}
{width="1.0\linewidth"}
We compare our methods with existing image coding standards and recent DNN-based compression models. These include JPEG [@wallace1992jpeg], JPEG2000 [@skodras2001jpeg], BPG [@bellard2016bpg], Agustsson17 [@agustsson2017soft], Theis17 [@theis2017lossy], Toderici17 [@toderici2016full], Rippel17 [@rippel2017real], Mentzer18 [@mentzer2018conditional1], Johnston17 [@johnston2017improved], Ballé17 [@balle2016end], and Li18 [@li2017learning]. Both JPEG (with 4:2:0 chroma subsampling) and JPEG2000 are based on the optimized implementations in MATLAB2017. For BPG, we adopt the latest version from its official website with the default setting. When it comes to DNN-based models for lossy image compression, the implementations are generally not available. Therefore, we copy the results from their respective papers.
{width="1.0\linewidth"}
{width="1.0\linewidth"}
Fig. \[fig:kodak\] shows the rate-distortion curves on the Kodak dataset. We find that our method optimized for MSE outperforms all competing methods at low bit rates ($<0.5$ bpp), except for BPG. When optimized for MS-SSIM, our method performs on par with Rippel17 and is much better than the rest. Fig. \[fig:tecnick\] shows the rate-distortion curves on the Tecnick dataset, where we observe similar trends for both PSNR and MS-SSIM. An interesting observation is that when we continue increasing the bit rate, PSNR/MS-SSIM starts to plateau, which may be due to the limited model capability. Without any constraint on rate ($\lambda = \infty$) and quantization ($L=\infty$), our method optimized for MSE only reaches $38.2$ dB on the Kodak dataset, which can be treated as an empirical upper-bound for our network structure. Preliminary results from [@balle2018variational] indicate that increasing the depth and width of the network leads to performance improvements at high bit rates.
We visually compare the compressed images by our method against Ball[é]{}17, Li18, JPEG2K, and BPG. Fig. \[fig:visual\_kodak\] and Fig. \[fig:visual\_tec\] show sample compressed results on the Kodak and Tecnick datasets, respectively. JPEG2K and BPG exhibit artifacts (such as blocking, ringing, blurring, and aliasing) that are common to all handcrafted transform coding methods, reflecting the underlying linear basis functions. Ball[é]{}17 is effective at suppressing ringing artifacts at the cost of over-smoothing fine structures. Li18 allocates more bits to preserve large-scale strong edges, while tends to eliminate small-scale localized features ([*e*.*g*.]{}, edges, contours, and textures). In contrast, our method generates compressed images with more faithful details and less visible distortions.
We report the running time of our method at six bit rates on the Kodak dataset using the same machine. It takes $0.024$ second to generate ${\bm y}$ and $0.032$ second to reconstruct the image. The entropy coding time is listed in Table \[tab:time\_lossy\], where we see that more time is needed to encode and decode images at higher bit rates. This is because, [ in our experiments, we use a larger $M$ at higher bit rates as a way of preserving more perceptually meaningful information. This corresponds to more convolution operations and longer processing time. ]{} With the help of the proposed code dividing technique, our method performs entropy decoding in around one second for images of size $752\times496$. [ We also note that the entropy coding time for lossy image compression is much faster than that of lossless image compression for two main reasons. First, in lossless compression, the size of the code block to CCN for entropy coding is $8 \times H \times W$. In lossy compression, the input image is first transformed to the code block with the size of $M\times\left(H/8\right)\times\left(W/8\right)$ ($M\le32$). With a smaller code block size, the lossy CCN is expected to be faster than the lossless CCN. Moreover, $N$ and $S$ also highly affect the speed. For the CCN in lossless compression, we set $N=16$ and $S=5$, whereas for the CCN in lossy compression, we set $N=3$ and $S=5$, leading to the faster speed. ]{}
Average bpp 0.100 0.209 0.362 0.512 0.671 0.794
------------- ------- ------- ------- ------- ------- -------
Encoding 0.013 0.025 0.044 0.066 0.085 0.103
Decoding 0.116 0.227 0.457 0.735 1.150 1.232
: Running time in seconds of our CCN-based entropy model at six bit rates on the Kodak dataset
\[tab:time\_lossy\]
Conclusion and Discussion
=========================
We have introduced CCNs for context-based entropy modeling. Parallel entropy encoding and decoding are achieved with the proposed coding order and code dividing technique, which can be efficiently implemented using masked convolutions. We tested the CCN-based entropy model (combined with arithmetic coding) in both lossless and lossy image compression. For the lossless case, our method achieves the best compression performance, which we believe arises from the more accurate estimation of the Bernoulli distributions of the binary codes. For the lossy case, our method offers improvements both visually and in terms of rate-distortion performance over image compression standards and recent DNN-based models.
The application scope of the proposed CCN is far beyond building the entropy model in image compression. As a general probability model, CCN appears promising for a number of image processing applications. For example, we may use CCN to learn a probability model $P(\bm x)$ for natural images, and use it as a prior in Bayesian inference to solve various vision tasks such as image restoration [@zhang2017beyond; @portilla2003image], image quality assessment [@Wang2006; @ma2018], and image generation[@oord2016pixel; @chen2018neural].
Acknowledgment {#acknowledgment .unnumbered}
==============
This work was supported in part by Shenzhen Research Institute of Big Data and Shenzhen Institute of Artificial Intelligence and Robotics for Society. The authors would like to thank the NVIDIA Corporation for donating a TITAN Xp GPU used in this research.
\[[{width="1in" height="1.25in"}]{}\][Mu Li]{} received the B.C.S. degree in Computer Science and Technology from Harbin Institute of Technology, Harbin, China, in 2015. He is the owner of the Hong Kong PhD Fellowship and is currently working toward the Ph.D. degree in Department of Computing from the Hong Kong Polytechnic University, Hong Kong, China. His research interests include deep learning and image processing.
[Kede Ma]{} (S’13-M’18) received the B.E. degree from the University of Science and Technology of China, Hefei, China, in 2012, and the M.S. and Ph.D. degrees in electrical and computer engineering from the University of Waterloo, Waterloo, ON, Canada, in 2014 and 2017, respectively. He was a Research Associate with the Howard Hughes Medical Institute and New York University, New York, NY, USA, in 2018. He is currently an Assistant Professor with the Department of Computer Science, City University of Hong Kong. His research interests include perceptual image processing, computational vision, and computational photography.
\[[{width="1in" height="1.25in"}]{}\][Wangmeng Zuo]{}(M’09-SM’14) received the Ph.D. degree in computer application technology from the Harbin Institute of Technology, Harbin, China, in 2007. From 2004 to 2006, he was a Research Assistant with the Department of Computing, The Hong Kong Polytechnic University, Hong Kong. From 2009 to 2010, he was a Visiting Professor with Microsoft Research Asia. He is currently a Professor with the School of Computer Science and Technology, Harbin Institute of Technology. He has published over 60 papers in top-tier academic journals and conferences. His current research interests include image enhancement and restoration, weakly supervised learning, visual tracking, and image classification. He has served as a Tutorial Organizer in ECCV 2016, an Associate Editor of the IET Biometrics, and the Guest Editor of Neurocomputing, Pattern Recognition, the IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS FOR VIDEO TECHNOLOGY, and the IEEE TRANSACTIONS ON NEURAL NETWORKS AND LEARNING SYSTEMS.
\[[{width="1in" height="1.25in"}]{}\][Jane You]{} received the B.Eng. degree in electronics engineering from Xi’an Jiaotong University, Xi’an, China, in 1986, and the Ph.D. degree in computer science from La Trobe University, Melbourne, VIC, Australia, in 1992. She was a Lecturer with the University of South Australia, Adelaide SA, Australia, and a Senior Lecturer with Griffith University, Nathan, QLD, Australia, from 1993 to 2002. She is currently a Full Professor with The Hong Kong Polytechnic University, Hong Kong. Her current research interests include image processing, pattern recognition, medical imaging, biometrics computing, multimedia systems, and data mining.
\[[{width="1in" height="1.25in"}]{}\][David Zhang]{} received the Graduation degree in computer science from Peking University, Beijing, China, the M.Sc. degree in computer science in 1982, and the Ph.D. degree in 1985 from the Harbin Institute of Technology (HIT), Harbin, China. In 1994, he received the second Ph.D. degree in electrical and computer engineering from the University of Waterloo, Waterloo, Ontario, Canada. From 1986 to 1988, he was a Postdoctoral Fellow with Tsinghua University and then an Associate Professor at the Academia Sinica, Beijing. He is currently a Chair Professor at the Hong Kong Polytechnic University and the Chinese University of Hong Kong (Shenzhen). He also serves as a Visiting Chair Professor at Tsinghua University, Beijing, and an Adjunct Professor at Peking University, Shanghai Jiao Tong University, Shanghai, China, HIT, and the University of Waterloo. His research interests are medical biometrics and pattern recognition.
|
Q:
Confusion about 'memoryless' meaning
I am reading the book "Multiple input describng functions and nonlinear system design" written by A.Gelb and W.E.Vander Velde.
At some point it says:
Single-valued characteristics are termed memoryless; multivalued characteristics are said to possess memory.
I am a bit confused about the meaning of the 'memoryless' term. I thought that memoryless meant a function that depends only on the value at that time instant and not at previous instants of time.
What am I missing?
A:
The definition as you quoted it is only correct for static nonlinearities. The output of a static nonlinearity only depends on the input function directly, and not on its integral or derivatives. Otherwise, the nonlinearity is called dynamic (i.e. having memory). A static nonlinearity can also have memory if it is multi-valued, i.e. if there is more than one possible output value for a given input value (e.g. a system with hysteresis). Finally, a static nonlinearity is indeed memoryless if it is single-valued, i.e. if its output is uniquely defined by its input value:
$$y(t) = F(x(t))$$
where $y=F(x)$ is an injective function (i.e. each $x$ is mapped to only one value $y$).
So in sum you have
dynamic nonlinearity: has memory
static nonlinearity
multi-valued: has memory
single-valued: memoryless
|
1. Field of the Invention
The present invention relates to an optical conversion assembly to convert exchangeable objective lenses of a camera into a monocular optical device such as a telescope, a microscope or a viewer.
2. Description of the Prior Art
The interchangeable lenses that are utilized on high quality still cameras such as 35 mm cameras and movie cameras have developed to a state wherein they have excellent resolving powers from the vicinity of the optical axis of the field of view to the outer circumference. These lenses are frequently coated to prevent reflection losses across a broad wavelength spectrum. The lenses provide highly accurate color reproduction with a minimum of reflection between the lens surfaces and minimum internal reflection in the lens barrel to eliminate any optical flare and ghost images. In many cases, the commercial cost of these wide angle, telephoto, and zoom lenses far exceeds the cost of the camera bodies.
Frequently, both amateur and professional photographers carry a number of exchangeable lenses with their camera to be prepared for various types of shots requiring the different lenses. These lenses can represent a substantial investment and to date have generally found no other substantial application other than being mounted on the camera. There is thus a need in the prior art to permit alternative utilization of these interchangeable lenses outside of the camera photography field.
Cited of general interest for its disclosure of a prism system in a telescope in U.S. Pat. No. 4,030,808. |
Eaton Cutler-Hammer XRU1S24 OptoCoupler Terminal Block Relay 24V DC
The new XR Series OptoCoupler Terminal Block Relays can be used in all applications and consist of a pluggable miniature OptoCoupler and a basic terminal block. The XR Series utilizes screw or spring-cage technology, as well as offers quick system wiring, superior safety features, clear labeling and a high level of modularity. |
Pages
Saturday, December 15, 2012
SpiceJet to Start Flights Connecting Delhi and Riyadh
Flyers looking for a connection between India’s thriving capital, Delhi and Saudi Arabia's capital Riyadh will now be able to grab cheap travel deals with SpiceJet.
Revealed by various online media sources, India’s popular no frills carrier, SpiceJet is now offering tickets deals on its newest daily direct flights services on Delhi- Riyadh route from January 4, 2013.
The airline is expected to deploy its sleek 189-seater Boeing 737 NG aircraft to offer tickets for its new flights between India’s capital and the largest city of Saudi Arabia. The development is sure to tempt increasingly higher number of budget passengers who are often to be seen in a look out for cheap flights tickets on the route.
Besides Riyadh, the airline is also offering tickets on direct flights connecting India and Guangzhou in China with effect from February 8, 2013. Including these two services, the airline sells tickets for seven international destinations in its network from India. Presently, the carrier operates only to Kathmandu, Colombo, Kabul, Dubai and Male.
In a recent development, the airline had announced its plans to launch new services on three new international routes, Kochi-Male, Kochi-Dubai and Ahmadabad-Dubai. Out of which, the airline has already launched its flights connecting South India’s city of Kochi to Male and Dubai on November 29 and December 10, 2012, respectively. It is all geared to kick start its new route connecting Ahmadabad and Dubai from December 19, 2012.News Reference |
Q:
Configurable product isn't displaying in categories?
I have an issue where items are not displaying in there categories, sale for example, and I am wondering if it has anything to do with the configurable product quantity which is zero, although the simple products it contains have quantities?
ss-2018-24 contains the following:
ss-2018-24-s (qty 1)
ss-2018-24-m (qty 2)
ss-2018-24-l (qty 2)
ss-2018-24 inventory has the following settings:
Manage Stock - Yes (use config settings: tick)
Enable Qty Increments - No (use config settings: tick)
Enable Qty Increments - Yes
Is the fact that the configurable product has a quantity of zero, the reason the product isn't displaying under the sale category, even though it's assigned?
Some help would be really appreciated.
A:
YES. It has everything to do with the configurable product quantity being set to zero while also configured to manage stock.
By default, Manage Stock is turned off for a configurable product, because the inventory is managed through each associated product. This means that you should not set manage stock to yes for the configurable product itself; only the associated simple products.
Your items are not showing up in the catalog because you have a quantity of 0 configured for a product that you are managing stock on. This results in the product not being displayed, because you have indicated there are 0 of them.
Magento Documentation: https://docs.magento.com/m1/ee/user_guide/catalog/inventory-configurable-product.html
|
A company in Zhengzhou, China’s Henan Province, has caused outrage online after some of its employees were spotted crawling on their hand and knees around a local lake because they couldn’t meet their sales targets!
The shocking corporal punishment was publicised by various local media outlets. According to the reports, at least a dozen people were seen dragging themselves on all fours on a wooden path along the lake. Their clothes were worn out and some of them were bleeding with bruises and scrapes.
When questioned about their unusual behavior, one of them told the reporter that they were being punished by their employer for their poor performance at work. One member of staff was stationed at the lake to make sure everyone finished their prescribed number of laps.
The incident took place last Friday, and photographs of the crawling sales staff were soon posted on Weibo, China’s largest social media website. Thousands of users spoke out against the inhumane treatment of the poor employees. “How can this company ever get stronger with such kind of a policy?” one user questioned. “For starters, the employees wouldn’t follow it with their whole hearts.”
“Where’s the trade union? Where’s the dignity and where’s the bottom line?” another asked.
Many found it strange that the employees complied with the management’s orders instead of refusing to crawl. “The punishment is total humiliation. But I don’t understand these employees. Why crawl just because someone else told you to do so?” a user wrote.
“I think these people can only do what their bosses order them to, because they are afraid of losing their jobs,” another reasoned. “Hope there is a proper solution for them to enjoy some dignity, while not costing them their jobs.”
Ordering employees to crawl on all fours in public is not exactly unheard of in China. Two years ago,the boss of a cosmetics company from Chongqing had his staff crawl in a busy square to test their resistance to pressure.
Source: CCTV |
Attack Force (film)
Attack Force is a 2006 American science fiction thriller action film directed by Michael Keusch, and also written and produced by Steven Seagal, who also stars in the film. The film co-stars Lisa Lovbrand and David Kennedy. The film was released on direct-to-DVD in the United States on December 5, 2006.
Plot
Marshall Lawson (Steven Seagal) is the commander of an elite U.S. military unit. During an overseas assignment in Paris, Lawson loses all three of his men in a seemingly random attack on their hotel room. He takes it upon himself to investigate the attack, with the help of his girlfriend Tia (Lisa Lovbrand) and his friend Dwayne (David Kennedy). Marshall uncovers CTX, a covert military drug so secret that an arm of the military headed by a man named Werner (Danny Webb) wants Marshall eliminated. Tia turns out to be one of the two military scientists who developed CTX.
Reina (Evelyne Armela O'Bami), the hooker who slaughtered Marshall's team, was under the influence of CTX. The drug gives its users superhuman strength and agility, but also irrevocably drives them to violence. The other co-inventor of CTX is Aroon (Adam Croasdell), now a Paris night club owner. Aroon has plans to release the CTX into the Paris' water supply, which would turn the city's residents into deranged killers. Marshall, Tia, and Dwayne must stop Aroon and Werner before that happens.
Cast
Steven Seagal as Marshall Lawson
Lisa Lovbrand as Tia
David Kennedy as Dwayne
Danny Webb as Werner
Gabi Burlacu as Tia's agent
Matthew Chambers as Seth
Vlad Coada as Tia's Agent #3
Adam Croasdell as Aroon
Mark Dymond as Phil
Florian Ghimpu as Tourist
Vlad Iacob as Tia's Agent
Ileana Lazariuc as Queen
Sayed Najem as Hitman Guard
Daniel Pisica as Lead Team Soldier
Production
Filming took place at Castel Film Studios in Bucharest, Romania from January 7 to March 8, 2006.
When the film was first announced under the name Harvester, the plot description described a significantly different scenario than the one in the finished film; the villains were described as aliens with actress Ileana Lazariuc listed as "alien queen." In an email exchange between Seagalogy author Vern and co-writer Joe Halpin prior to the release of Attack Force, Halpin confirmed that although the movie had been written with a sci-fi element, it had been shot in two ways: one explained the villain's actions as the work of European mobsters, and the other explained them as the work of aliens. Asked if the alien plot elements would be present in the final cut, Halpin answered "Who knows," explaining that the producers and Seagal would come to an agreement in post-production. In the finished film, the villains are explained to be gangsters, and no reference is made to any extraterrestrial origin.
Critics and fans have speculated that leaving the nature of the story unresolved during principal photography led to the pervasive use of other actors overdubbing dialogue (particularly Seagal's) that occurs in the finished film. Seagal's 2005 film Submerged appears to have undergone a similar post-production process.
Reception
The film was not very well received; as of February 2014 it had a 20% "rotten" audience rating on film review aggregator Rotten Tomatoes (it was not screened for critics). David Nusair of Reel Film Reviews called it, "flat-out unwatchable," and "egregiously shoddy," claiming, "even the most ardent Seagal fan would be hard-pressed to sit through this monstrosity of a production in just one sitting." Seagalogy author Vern noted "[Seagal] does a bare minimum, the lowest amount he can get away with and still seem like the star. Not much fighting, not always appearing (or speaking) in his own scenes, no speeches," but goes on to note, "...I don’t agree that it’s his worst," comparing it favorably to Seagal's previous film (also directed by Michael Keusch), 2006's Shadow Man.
Several reviewers complained about the perceived slapdash nature of the film, in particular the extensive use of an obvious voice double overdubbing much of the dialogue from Seagal.
References
External links
Category:2006 films
Category:2006 direct-to-video films
Category:2000s action thriller films
Category:American action thriller films
Category:American films
Category:Direct-to-video action films
Category:English-language films
Category:American films about revenge
Category:Films shot in Bucharest
Category:Sony Pictures direct-to-video films |
Review: The mariachi-flavored 'Pulling Strings' a fun little number
"Pulling Strings"
Pantelion Films
Jaime Camil stars in "Pulling Strings."
Jaime Camil stars in "Pulling Strings." (Pantelion Films)
Mark Olsen
Hot on the heels of the surprise success of "Instructions Not Included," which quickly became the all-time highest-grossing Spanish language film in the U.S., comes another movie aimed at the same audience. "Pulling Strings," also being released by "Instructions" distributor Pantelion Films, looks to do potential crossover audiences one better with a story that allows the language to be split between Spanish and English. Serving mostly as a strong calling card for star Jaime Camil, the film has an appealingly loose, slightly ramshackle charm.
The story is set in Mexico City, where Alejandro (Camil) has seen his career as a mariachi singer falter since having to focus more on raising his daughter after losing his wife. He applies for a visa so he and the little one can visit her grandparents across the border but is denied by Rachel (Laura Ramsey), a young U.S. Embassy worker who is about to be transferred to London.
When a chance encounter brings them together again and Rachel loses her boss' diplomatic laptop, Alejandro sees a chance to win her over and gain his visa. It's a flimsy, even nonsensical, premise that nevertheless throws the action in motion so that adventure, romance and a bit of singing can ensue.
The film was directed by Pitipol Ybarra from a script with four credited writers, and in this crosscultural experiment, the least convincing part, oddly, is the portrayal of the crossing of cultures. Ramsey's character understands some Spanish, while wisecracking friend and coworker Carol (Aurora Papile) seems to speak almost none. (Let's hope the actual U.S. foreign service staff in Mexico City does better in that regard.)
This is largely to allow Alejandro's buddy Canicas (Omar Chaparro) to crack wise about the girls in Spanish without them fully understanding him. As wacky sidekicks, Chaparro and Papile have a charged, goofball chemistry that nearly draws away from the main story.
Having Camil's character as a leader of a mariachi band is really a saving grace for the movie, as the occasional breaks for songs allow the film to exist as if in the heightened reality of a movie musical. In the face of Camil's full-on charm offensive, Ramsey comes across as wooden and uncertain. Playing Rachel's mother, Stockard Channing steals every scene she's in because, well, she's Stockard Channing. (About all that need be said of Tom Arnold's performance as a bumbling Embassy administrator is that he is not Stockard Channing.)
Regardless of how it matches up to the box-office numbers of "Instructions," the mariachi-flavored romantic comedy of "Pulling Strings" makes for a fun little number. |
(-8)/3*9/6. Sort -3, o, s, -2 in descending order.
o, -2, -3, s
Let h(j) = j**2 - 1162*j - 5833. Let l be h(-5). Put 4, l, -1862, -1 in decreasing order.
4, l, -1, -1862
Suppose 17*v + 21*v = -39 + 495. Sort 1, -4, 5, v in descending order.
v, 5, 1, -4
Suppose 196 = 22*t - 71*t. Sort 31, t, -168 in decreasing order.
31, t, -168
Let j(q) = -40*q - 14. Let y(t) = 79*t + 29. Let f(a) = 11*j(a) + 6*y(a). Let n be f(-3). Let b = n + 78. Put b, 4, -1 in decreasing order.
4, -1, b
Suppose 6 = 2*p + 3*l, 46*l = -4*p + 41*l + 12. Put 1, -3, p, 12 in increasing order.
-3, 1, p, 12
Let t be (3 + 33/(-9))/((-263)/(-789)). Put -7, t, -26, 5 in increasing order.
-26, -7, t, 5
Let f be (-10)/(-45) + 232/(-72). Let u = -1.435 - -5.435. Sort -62, u, f.
-62, f, u
Suppose 0 = 2*n - 3*v - 6 + 2, -3*n - 7 = 2*v. Suppose o - d + 0*d - 6 = 0, d + 10 = 3*o. Let k = -46 - -44. Put n, o, -6, k in descending order.
o, n, k, -6
Let a(m) = 2*m**2 + 79*m + 157. Let o be a(-2). Put 1, o, -34 in decreasing order.
o, 1, -34
Let j = 26407 + -26408. Put 2/51, 3/4, 3, j in descending order.
3, 3/4, 2/51, j
Let g = -4557.18 + 4557. Sort -2, g, -0.3, -10 in decreasing order.
g, -0.3, -2, -10
Let w(r) = r + 6. Let t be w(-11). Suppose 3*h + 0*h + 8 = 2*i, -12 = 4*h - 3*i. Suppose -o + h*o = -2*a + 7, 2*a - 3 = 5*o. Put o, t, -1 in descending order.
o, -1, t
Let d(t) = 6*t**3 + 31*t**2 + 32*t + 18. Let y be d(-4). Sort -2, y, -3, -132 in descending order.
y, -2, -3, -132
Let j be ((-6)/(-4))/(2 + 5/(-10)). Let q be j + (-34)/(-8) - (-80)/(-20). Sort -4, -4.8, q in increasing order.
-4.8, -4, q
Let v = -11 + 15. Suppose -21265 + 21115 = -15*x. Sort v, 5, x in ascending order.
v, 5, x
Let i(o) = -3*o**3 - 109*o**2 + 74*o - 4. Let z be i(-37). Let x be (12/(-54)*-6)/((-22)/(-3)). Let h = -3 - -8. Put x, h, z, -2/9 in ascending order.
z, -2/9, x, h
Suppose p - 4*t + 393 = 0, -3*p + 5*t = 925 + 240. Put -3, -5, p in descending order.
-3, -5, p
Suppose 5*b + 2*j - 2231 = -871, -3*b + 842 = -4*j. Let s = 272 - b. Let f(z) = z**2 - 10*z + 12. Let o be f(9). Sort 5, s, o in decreasing order.
5, o, s
Suppose 0 = 11*w + 63 - 52. Let p be ((-8)/4 + 4)*(w - -2). Put 3, p, 1/6 in descending order.
3, p, 1/6
Suppose -4*x + 4*a = x - 22, 0 = 3*x + 3*a + 3. Let w be 4/(-14) - (-1413)/1197 - 144/(-1368). Put w, x, 5, -1 in increasing order.
-1, w, x, 5
Let r = -868.3 - -842.3. Put r, 9, -1/6 in ascending order.
r, -1/6, 9
Let m(s) = -17*s**2 + 273*s - 15. Let b be m(16). Put -359, -1, 3, b in decreasing order.
3, b, -1, -359
Suppose 0 = -4*p - 6 - 170. Suppose 8 - 20 = 3*f. Let y be f/22 + (-184)/p. Sort y, 5, -1, 0.
-1, 0, y, 5
Suppose -121*h + 70610 = -11981 - 11426. Sort h, -4, -5 in increasing order.
-5, -4, h
Let r(g) = g**3 - 3*g**2 + 4*g - 4. Let i be r(5). Let u be (-3)/((-2)/i*3). Let c be ((-11)/u)/((-2)/18). Put c, 1, -8, 0 in ascending order.
-8, 0, 1, c
Let c = 5 - 13. Let m(k) = -k**2 - 7*k + 3. Let x be m(c). Let j = 4.404 - 0.404. Sort 5, j, 2/9, x.
x, 2/9, j, 5
Let m(k) = 33*k - 4. Let g be m(2). Let r be -5 + (-3 - -3) + 4 + 67. Let d = r - g. Sort -4, 1, d, 5 in descending order.
5, d, 1, -4
Let n be 21 + 197/(-10) + 4/(-5). Put n, 0.02, -0.029 in descending order.
n, 0.02, -0.029
Let s = -17650 + 17653. Sort s, -5, 9/10, 1.8 in decreasing order.
s, 1.8, 9/10, -5
Suppose 0 = 5*q - 3*r + 15, 10*q - 2*r = 12*q + 6. Sort q, 38, 0.
q, 0, 38
Let s = -15551 + 15538. Sort s, -33.1, 4 in ascending order.
-33.1, s, 4
Let o(i) = 4*i + 41. Let s be o(-11). Let c(l) be the second derivative of l**4/12 + l**3 - 9*l**2 + 24*l. Let v be c(-8). Put v, 2, s, 5 in decreasing order.
5, 2, v, s
Let n = -0.4725 + 191.3725. Let t = n + -191. Let p = 3/65 + -86/455. Sort 2, p, t.
p, t, 2
Let z(c) = c**3 - 10*c**2 + 19*c + 34. Let q be z(6). Sort -3, 9, 7, q, 3.
-3, 3, q, 7, 9
Let h be 3 + (-136)/20 + 3. Let g = 41.321 + 0.179. Let o = -42 + g. Put -1/5, 4, o, h in descending order.
4, -1/5, o, h
Let b = 5.9 + -50.9. Let m = -76 - b. Let a = -27 - m. Put -0.11, a, -2 in descending order.
a, -0.11, -2
Let k = 9/41 + 206/369. Put -1, -0.2, k, 1.7 in descending order.
1.7, k, -0.2, -1
Suppose 24*b - 305 - 2455 = 0. Let g(x) = -x**3 + 12*x**2 + 26*x + 28. Let y be g(14). Sort b, y, 4.
y, 4, b
Let r be (-7 + (-165)/30)*(-4)/10. Put r, -383, 3, 1 in ascending order.
-383, 1, 3, r
Let i = 19.8 - 0.3. Let x = -19 + i. Sort 2, x, 1 in decreasing order.
2, 1, x
Let t = 14403 + -14402.6. Sort t, 5, 1/3, -1, -11 in ascending order.
-11, -1, 1/3, t, 5
Let y(v) = -v**3 + 24*v**2 - 79*v - 23. Let g be y(20). Put 5, -2, -11, g in increasing order.
-11, g, -2, 5
Let a(f) = f**2 - 55*f + 156. Let t be a(3). Let d = 14 + 27. Sort 3, t, d in descending order.
d, 3, t
Suppose -21 = -3*c - 6. Suppose -c*a = 4*h - 16, -4*h - 9 - 11 = -4*a. Let w be (-9)/h*4/(-12). Put -7, w, 3 in ascending order.
-7, w, 3
Suppose -6*d - 53 - 61 = -0*d. Put 1/2, 2, 12/5, d, -0.3 in descending order.
12/5, 2, 1/2, -0.3, d
Let i be -4 + 13 + (3 - 3) + -4. Suppose -3*z - 5 + 2 = 3*g, -11 = -i*g + 3*z. Let m = 20 + -20. Put m, g, -2, 12 in descending order.
12, g, m, -2
Let l = -212 + 221. Suppose l*y + 96 = -15*y. Sort -3, -2, -8, y in ascending order.
-8, y, -3, -2
Let a = -439 + 436.15. Let s = a + -2.15. Put 5, -111, s in decreasing order.
5, s, -111
Let x = -316 - 35. Let l = 350.7 + x. Sort -2, -1/3, -22, l in ascending order.
-22, -2, -1/3, l
Suppose 223*g - 245*g + 110 = 0. Sort g, 2, 1363 in decreasing order.
1363, g, 2
Let z be 1/(4/3)*(13 - 1). Suppose -21*d - z = -24*d. Put d, -7, 2 in decreasing order.
d, 2, -7
Let v be 11 - 17/((-408)/(-324)). Sort -1, v, -0.1.
v, -1, -0.1
Let a = 2357 - 2354. Sort a, -3, 0.3, 27 in descending order.
27, a, 0.3, -3
Suppose 2*m = -4*r + 5*m + 10, 0 = r - 3*m + 2. Suppose 4*w = -3 - 1. Sort w, 3, 2, r in ascending order.
w, 2, 3, r
Suppose -11*v = 57 - 24. Suppose 0 = 5*c - 5*k - 15, -3*c - 4*k + 15 = 2*c. Put 1, c, v in increasing order.
v, 1, c
Let m = -86 - -84. Let z = -567 + 572. Suppose -3*c - 1 = 8. Sort c, m, 2, z.
c, m, 2, z
Let j = -139550/3 + 46518. Let x = 1/7 + -2/7. Sort 43, j, x, 4.
x, j, 4, 43
Suppose 0*s = 4*s + 192. Let o = s - -43. Suppose -4*p - h + 4 + 9 = 0, 3*h = -2*p + 19. Put -2/13, p, o in descending order.
p, -2/13, o
Let c be (-6)/(-8) + 111/(-36) + 3. Let z = 805.95 + -806. Sort z, -1, c.
-1, z, c
Let j be (4/(-10))/((-2)/20). Let d be (-130)/132 - (-12)/(-66). Sort -4/5, j, d.
d, -4/5, j
Let v = 2 - 3. Let b be 4/8 - (-38)/76. Sort v, 2, b, -5 in decreasing order.
2, b, v, -5
Suppose 0*p + 40 = 2*p. Let b be -24 + (96/24 - -25). Sort p, b, 4, -2 in decreasing order.
p, b, 4, -2
Let r be ((-6)/15)/(2/(-20)). Let t be (0 - -1) + 1/(4/140). Suppose t*j = 38*j. Sort r, -1, j in decreasing order.
r, j, -1
Suppose -38*u + 32*u = 24. Let j be ((-90)/(-20))/((-2)/u). Sort 2, 1, j, -5.
-5, 1, 2, j
Suppose 2*w - 223 = -3*x, -2*x + 293 = 3*w - 29. Sort 1, w, -0.1, 4/9.
-0.1, 4/9, 1, w
Let i = 0.2957 + -0.7957. Sort i, 0.2, -0.2, -13, 1 in increasing order.
-13, i, -0.2, 0.2, 1
Let q be ((-12)/(-7))/(-2*1). Let o = -24.97 - -23.7. Let b = o - -1.37. Sort 1, -0.3, q, b in ascending order.
q, -0.3, b, 1
Let p = -1606.949 + 1607. Sort p, 3, 0, 1/2 in descending order.
3, 1/2, p, 0
Let g = -43 - -39. Let j be 102/10*25/10. Let i = j + -25. Sort g, -1/2, i in decreasing order.
i, -1/2, g
Let s = -1265 + 1264.09. Sort s, -1/2, -0.1 in descending order.
-0.1, -1/2, s
Let z = -60.04 + 40.04. Sort 0.3, -2, -2/3, z, -2/7 in descending order.
0.3, -2/7, -2/3, -2, z
Let n = -28.8 + 32.8. Let v = 3.8 - n. Sort 0.3, -0.04, v in decreasing order.
0.3, -0.04, v
Let p be (-5 + 5)/(0 - -2). Let w be -2 - (1560/(-785) - p). Let x = -344/2355 - w. Sort -3, x, -7 in increasing order.
-7, -3, x
Let i(j) = 62*j**2 + 124*j + 1. Let b be i(-2). Put -30, b, -2, 2 in increasing order.
-30, -2, b, 2
Let a = 108 - 107.59. Let d = 21 - 21.31. Let x = d + a. Sort 1/2, x, 4.
x, 1/2, 4
Let d = 19 - -2. Let i(h) = -6 - 10*h - h**2 - d*h - 9 + 18*h. Let s be i(-12). Put s, -4, 3 in descending order.
3, s, -4
Suppose -3*h + p - 1 - 5 = 0, -3*p = 0. Let i be (-1*(-2)/h)/((-20)/(-1120)). Put i, -2, 5 in decreasing order.
5, -2, i
Let b = -18179 - -18178. Sort 3, b, 2.173 in descending order.
3, 2.173, b
Let m(b) = 9*b |
Reversal of seven-year old visual field defect with extracranial-intracranial arterial anastomosis.
A variety of neurologic deficits has been reversed following extracranial-intracranial arterial anastomoses. We are presenting an unusual case of complete resolution of a documented seven-year-old defect in the right homonymous visual fields following anastomosis of the superficial temporal artery and the angular branch of the middle cerebral artery. |
News Ticker
NBA – The defending NBA Champion Golden State Warriors host the visiting Cleveland Cavaliers in their first meeting this season, on Christmas Day Specials at Oracle Arena in Oakland. The Warriors ranked 2nd best in the West Standings with 26 wins and 7 losses, while the Cavaliers is sitting 3rd in the East Standings with 24 wins and 9 losses.
Both teams are currently playing good basketball this season, The Warriors have an 11 – game winning streak before the Denver Nuggets snapped it prior to this game while the Cavaliers had their own winning streak to 13 – game winning streak tying the franchise record and won 19 of their last 21 games after a slow start this season.
Early in the game the Cleveland Cavaliers are mostly in control of the game posting their biggest lead of 7 points, outscoring the home team 24 – 20 at the end of the 1st quarter. As expected LeBron James and Kevin Durant to lead their team where both players scored 9 points.
In the 2nd quarter, the Warriors take their first lead of the game 42 – 39 after a made 3’s by Kevin Durant with 3:02 to go, the lead was up to 5 points after a 7 – 0 run by the Warriors but the visiting team manage to cut the lead in just 2 points at the half. The Warriors outscored the Cavaliers 22 – 16 in the 2nd quarter to finish the half leading by 2 points 46 – 44.
Durant leads all scorers with 14 points, 6 rebounds, 1 assists and 2 blocks for the home team while Kevin Love leads the Cavs with 11 points and 11 rebounds and LeBron James just healed with 10 points in 4 out of 10 shooing.
In the 3rd quarter Kevin Love is keeping the Cavaliers alive against the Warriors while his team mates LeBron James is struggling throughout the day. Love scored 26 points and 17 rebounds in 3 quarters to keep the Cavaliers hang on down by just 4 points at the end of the 3rd 71 – 67, Warriors by 4 pts. Durant leads the Warriors in the after 3 quarters with 20 points.
In the 4th quarter, The Warriors are enjoying the biggest lead of the game with 9 points 90 – 81 with under 5 minutes to go in the quarter, but the Cavaliers roars back with an 11 – 2 run to tie the game 92 all with under 2 minutes to go. The Warriors regain the lead after a made 3’s by Klay Thompson 95 – 92, the Cavs had their chance, but LeBron James made some crucial turnovers in the end game that caused to their 10th loss of the season.
James finished the game with 20 points, 6 rebounds and 6 assist while Kevin Love has game high of 31 points and 18 rebounds for the Warriors Kevin Durant scores 25 points, 7 rebounds and 5 blocks and some key defensive stop to LeBron James while Klay Thompson added 24 points scoring the last 7 points of the Warriors.
Meanwhile Stephen Curry did not play in the game to miss his 9th straight game due to ankle injury. |
European Spreadwatch Alert As Italian Bank Borrowings From ECB Rise To New Record
It may not be a big rise, but the €1 billion increase in Italian bank borrowings from the ECB, from €270 billion to €271 billion in Apirl as just reported by the Bank of Italy, is still a record, and not one Italy should be proud of. The Spanish bank update is pending and will be out in a few days, although if the recent about face by Rajoy, admitting the Spanish banks are about to be nationalized, which today is no longer sending the markets higher, is an indication, it won't be a vast improvement. Sure enough, the fact that the market's attention is once again drawn to an indicator of the PIIGS financial sector insolvency is not good for sovereign spreads and at last check everyone was wider, core and periphery together, as Spain was+5.3 bps, Italy +3.8 bps, Netherlands +0.3 bps, and France 1.8 bps. Even the futures are shocking not green on more bad news.
OT: Tyler, any thoughts on Netanyahu's consolidation of power with the Likud and Kadima Parties joining forces? Seems to me the path to war with Iran is clearer than ever: oil prices plummet, consolidation of power, Obama re-election, war
All the talk this morning with the talking heads is that Austerity was VOTED OUT......yeah it was...but now what...who is going to pay for the new government largess????? Has anyone figured that out???? NOT...for countries with no cash...no growth prospects..no commodities...nothing to sell....how are they going to increase their government spending.....unless they print......or default.....
In the Comex yesterday..there was no movement in either the silver or gold markets...nada..nothing from the customer or the dealer....very wierd....but the price is dropping....and the EU is falling apart...but people are running to the US 10 year and the German 10 Years.....wierd number 25
Italy si broke, it only survives by taking more debts to refund the matured ones.55 italians workers and entrepreneurs have commited suicides in the past 6 months.The expenses sheet of the State is always and endlessly growing while the revenue of the State is dwindling due to deflation .Our exports are too expensive because of the stupid exchange rate - which actually is a peg of 1,3 $ for 1 Euro- .The ECB just take care of price stability (obedient to the german monetarist agenda ) and not of growth and employement so it keeps the prime rate at 1% instead f 0,25% in the USA.Italy will soon run for the emergency exit like Greece, like Portugal, like Spain, and France will join too despite all their self-inflated ego and gallic pride about being equal to Germany; this is the ultimate lie to blow off since France high GNP is mainly due to consumption and debt unlike Germany where exports and saving are the normal practice.So expect in six months from now a new Euro crisis when the CDS will rise on the FRIGS and the spread with German bunds will widen.US $ should then be at 1,25 for a Euro
Good points. The picture in Italy grows more bleak by the day. I travel there so see it first hand. Suicides on the news while Monti expresses less humanity than a corpse. He seems completely out of touch. The bad part is that, between the super nanny state and too much Mama, it is difficult to find a pair of balls anywhere. The suicides tell the story. People seem scared and in denial, and I hear from acquaintances that drug use is getting worse.
Italian money is sucked by the ton into a giant hole of corruption. Monti, of course, also has no cajones and so only tries to squeeze more from the taxpayers and old people. Zero effort to stop political corruption or organized crime. One recent move was to force pensioners to open bank accounts, which of course subjects them to fees, risk, etc. Hard to see how this can end well.
News could have been worse = + 10 on the ES.
In retrospect the MSM will refer to it as complacency I imagine.
It mirrors the rest of our economy - price is almost flat but what you're buying is shit.
SSDD - bring it, you ponzi cock-suckers. |
LOS ANGELES - March 13, 2018 - ( Newswire.com
Samera Entertainment, who manage Australian director John V. Soto, are delighted to announce that his Sci-Fi movie about parallel worlds, “Alpha Gateway” starring Jacqueline McKenzie (“Deep Blue Sea”, “The 4400”) and Myles Pollard (“Drift”, “Looking for Grace”) has received Official Selection for the London International Festival of Science Fiction and Fantastic Film (London Sci-Fi).
The London Sci-Fi Film Festival, now in its 17th year, is recognized as one of the U.K.’s premiere genre festivals, with guest judges in the past including Guillermo Del Toro, John Landis, Michel Gondry, Joe Dante and Benedict Cumberbatch. The festival runs over seven days in May and has been attended by over 87,000 festival goers.
The Australian director of “Alpha Gateway”, John V. Soto, commented, “I’m super proud to have my film selected for such an amazing Sci-Fi festival and can’t wait to meet U.K. festival goers and be part of the celebration.”
“Alpha Gateway” (aka “The Gateway” in Australia) has previously had a successful festival run across the U.S. including the oldest genre festival in the U.S., the Boston Sci-Fi Festival in Somerville, Massachusetts, FilmQuest 2017 in Provo, Utah, and the filmmakers festival, Austin Revolution in Texas. At the Austin festival, the Sci-Fi movie won a number of awards including Best Feature and Best Visual Effects with John winning Best Director.
In addition to the festival news, the film is currently ranked in the Top Ten most popular 2018 Sci-Fi movies on IMDB. The film, which is having its Australian theatrical release May 3, through The Backlot Films, has been released by Gravitas Ventures on over forty VOD and Cable platforms across the U.S. and Canada.
Gravitas Ventures acquired the movie late 2017 and are managing the North American release. The director of acquisitions at Gravitas Ventures, Josh Spector, commented, “‘Alpha Gateway’ is the kind of smart science fiction film that genre and independent filmgoers alike love and we are thrilled to be bringing John’s film to North American audiences in the first quarter of 2018.”
John V. Soto commented, “It’s very exciting for an Aussie to have their film released in the U.S. and Canada. My amazing cast and crew worked really hard on this movie and I’m hopeful the film will be enjoyed by audiences.”
Reviews to date of the film have been good; Rotten Tomatoes critic, Simon Foster, from Screen Space, noted, “A compelling turn from a committed leading lady and a twisty premise skilfully executed will ensure ‘The Gateway’ finds avid fans amongst sci-fi types seeking thoughtful, discussion-starting cinema.” Daniel Yocom from Utah Geek: “Wonderful acting brings each of the characters to life. A solid story maintaining a theme to give it cohesion from beginning to end.”
For press inquiries please contact Sharry Flaherty as follows:
Email: sameraentertainment@gmail.com
Press Release Service by Newswire.com Original Source: Australian Film 'Alpha Gateway' Selected for the London Sci-Fi Festival |
1. Introduction {#sec1}
===============
High-throughput in vitro ADME (absorption, distribution, metabolism and excretion) screening (HT-ADME) has been widely adopted as an essential part of lead optimization for synthetic molecules (small molecules and more recently peptides) since around the year 2000 \[[@bib1], [@bib2], [@bib3]\]. HT-ADME screening usually consists of in vitro assay suites that assess compound properties (or liabilities) such as metabolism \[[@bib4],[@bib5]\], permeability \[[@bib6], [@bib7], [@bib8]\], drug-drug-interactions \[[@bib9], [@bib10], [@bib11]\], physicochemical properties \[[@bib12],[@bib13]\] and also toxicities \[[@bib14],[@bib15]\]. Several key technologies, including automated liquid handling \[[@bib16]\], high speed liquid chromatography--tandem mass spectrometry (LC-MS/MS) for sample analysis \[[@bib17],[@bib18]\], and software and automation tools \[[@bib19], [@bib20], [@bib21]\], have together enabled these in vitro assays to be performed in high-density plate format (96, 384 or even 1536-well plates \[[@bib22]\]) with the throughput and capacity required for early phases of drug discovery. It has been proven with industry-wide data that addressing ADME properties early in the discovery process helps significantly reduce attrition rates of drug candidates due to pharmacokinetic properties later in development \[[@bib23]\]. There have been a number of comprehensive reviews covering the history and common practices of HT-ADME screening and sample analysis \[[@bib17],[@bib24], [@bib25], [@bib26], [@bib27], [@bib28]\].
Due to its critical role in drug discovery, the last decade (2010--2019) saw a number of significant developments in HT-ADME screening. First of all, the conduct of ADME screening has been "industrialized" through the development of software and automation that has facilitated assay incubation, sample analysis, data review and reporting. While in vitro ADME screening used to be conducted almost exclusively at big pharmaceutical companies, these mostly off-the-shelf tools have really "industrialized" ADME screening, empowering labs of different sizes, operating models (centralized, distributed, outsourced, etc.) and geographic locations to perform these screening assays with high efficiency. Secondly, cutting edge liquid handling and analysis technologies continued to be incorporated into ADME screening to further improve speed, quality and cost-effectiveness. Thirdly, the ADME screening assay portfolio continued to expand, especially in areas such as drug-transporter interactions, early soft spot identification, and ADME screening of peptide drug candidates. And lastly, the data generated by ADME screening assays have been widely used to develop in silico models with machine learning approaches to predict ADME properties. In this review we cover the recent developments and the state-of-the-art in these aforementioned areas; in addition we also offer a perspective on emerging sciences and technologies for next decade in the field of ADME screening.
2. The "industrialization" of ADME screening {#sec2}
============================================
At the time of its inception in the late 1990's, in vitro ADME screening was almost exclusively performed at large pharmaceutical companies, where the significant size of the discovery portfolio ensured enough assay demand, therefore justifying the substantial investment required in infrastructure and expertise development \[[@bib24],[@bib29], [@bib30], [@bib31]\]. There were no existing commercially-available solutions to HT-ADME automation and sample analysis at the time; therefore, many companies developed their own customized solutions. The assay automation of that era tended to be stand-alone, workstation-based, with limited integration of various components \[[@bib29],[@bib32]\]. Similarly, various custom solutions were developed for automated LC-MS/MS method development, sample analysis and data review \[[@bib33], [@bib34], [@bib35], [@bib36]\]. While these highly innovative solutions laid the foundation for the field of HT-ADME screening as we know today, they required a high level of expertise in automation and bioanalysis to develop and maintain. The proprietary nature of these solutions also prevented them from being used in any other companies. As a result, HT-ADME screening was very much a "luxury" enjoyed by drug discovery organizations in only a handful of the largest pharmaceutical companies at the time.
From 2010 to 2019, with the importance of ADME screening in drug discovery well understood, and also thanks to the maturation of the underlying technologies, vendors started to commercialize products based on these previously proprietary tools specifically designed for HT-ADME screening.
2.1. Assay automation {#sec2.1}
---------------------
In assay automation, multiple vendors including Tecan, Hamilton, PerkinElmer and many others, now offer complete, off-the-shelf solutions for ADME screening assays \[[@bib4],[@bib16],[@bib37]\]. These solutions are typically based on a core platform of liquid handling, with additional accessories such as plate stores, shakers, incubators, filtration devices, centrifuges and sealers to perform tasks necessary for various HT-ADME assays. Several other vendors, including HighRes Biosolutions \[[@bib38]\] and Agilent \[[@bib39]\], offer fully integrated automation systems consisting of all of the aforementioned components, as well as one (or more) robotic arm(s) and corresponding software schedulers, for fully automated, truly walk-away assay operation. Multiple plates and multiple assays can be scheduled and conducted on the same system, thus realizing the most operation efficiency.
2.2. LC-MS/MS bioanalysis {#sec2.2}
-------------------------
LC-MS/MS with step or ballistic gradient LC, coupled with selected reaction monitoring (SRM) on triple-quadrupole mass spectrometers, has been the method of choice for HT-ADME sample analysis \[[@bib40]\]. As pointed out by our previous review, the key challenges there are the large number of compounds requiring MS/MS optimization, the large sample number requiring analysis, and the large amount of data to process and review \[[@bib17]\]. To address the requirement of SRM MS/MS conditions, automated optimization through flow injection analysis (FIA) is usually the solution \[[@bib41]\]. To speed up the LC-MS/MS sample analysis, several approaches have been developed. The first is multiplexed LC-MS/MS, where multiple independent LC systems (channels) are connected through a switching valve to a single mass spectrometer; staggered injections are then made in synchronization with the switching valve, so that at any given time only the elution window from a single channel goes into the mass spectrometer. Either a 2x (for a 2-channel system) or a 4x (for a 4-channel system) speed improvement is possible with the multiplexing approach \[[@bib13],[@bib42]\]. Another commonly used approach is direct online solid phase extraction -- mass spectrometry (online SPE-MS), often also called "trap and elute", where small SPE cartridges packed with quite large particles (∼50 μm) are used to perform essentially a desalting step for the sample first, and the analytes are then eluted with 100% organic solvent directly into the mass spectrometer \[[@bib9],[@bib43],[@bib44]\]. The online SPE-MS approach offers a higher speed (5--10 s/sample) than the multiplexed LC-MS approach (30--60 s/sample), but obviously affords less chromatographic separation. Therefore, online SPE-MS is typically used for probe-based assays (i.e., Cytochrome P450 inhibition), where a single analyte and its stable isotopically labeled internal standard are analyzed for a large number of samples. On the other hand, multiplexed LC-MS/MS is commonly used in assays where many different compounds, all with different physicochemical properties, need to be analyzed from a single assay batch (i.e., from metabolic stability or permeability assays).
Recently, similar to automation solutions, several vendors now offer complete hardware and software packages for the LC-MS/MS sample analysis of HT-ADME assay samples using these aforementioned approaches. For example, Thermo offers the QuickQuan™ package where MS/MS optimization, method generation and sample analysis can be fully automated on their triple-quadrupole instruments \[[@bib5],[@bib45],[@bib46]\]. Optionally, QuickQuan can be further integrated with the Thermo multiplexed frontend LC system (Aria) to achieve an analysis time as fast as 15 s/sample with gradient elution, which is desirable for the large number of samples encountered in HT-ADME screening \[[@bib42],[@bib47]\].
Another vendor, Sciex, offers a highly integrated solution for HT-ADME analysis named DiscoveryQuant™. Originally based on a proprietary solution developed at Pfizer \[[@bib48]\], DiscoveryQuant™ underwent multiple iterations of development as a collaboration project between Sciex and multiple partners in the biopharma industry, and has now evolved into the most widely adopted software tool for HT-ADME bioanalysis \[[@bib21],[@bib49],[@bib50]\]. The automated SRM MS/MS optimization routine in DiscoveryQuant™ has two unique and very useful features. First, it uses only a single loop injection (∼1 min) with nested MS(/MS) scans to perform optimization of precursor ion, product ion, de-clustering voltage and collision energy, which has greatly simplified the optimization process and increased the optimization speed. Secondly, DiscoveryQuant™ has a powerful database feature where all optimized conditions from one instrument can be uploaded to a centralized database that allows sharing among many different Sciex instruments across the hall, or even across the globe, as illustrated in [Fig. 1](#fig1){ref-type="fig"}. A closely-related product, LeadScape™, not only incorporates all DiscoveryQuant™ features, but also controls the Apricot Designs Dual Arm (ADDA) \[[@bib51]\] or LeadScape-1 (LS-1) \[[@bib52]\] multiplexed autosampler for high-speed online-SPE or gradient LC separation in front of Sciex mass spectrometers. The online SPE-MS approach can achieve an analysis speed as fast as 5 s/sample, whereas the gradient LC mode can have a speed of approximately 15 s on the ADDA/LS-1 platform. Once the data are acquired, DiscoveryQuant™/LeadScape™ also has a data review module to perform automatic peak integration. Additional data review tools, including MultiQuant™ by Sciex and Gubbs Mass Spec Utility (GMSU) by Gubbs Inc, have also been widely used to process LC-MS/MS data from HT-ADME samples.Fig. 1Centralized SRM database allows sharing of MS/MS conditions across multiple sites and instrument platforms using DiscoveryQuant™. SRM: selected reaction monitoring. Instrument pictures are used with permission from Sciex.Fig. 1
Taken together, these off-the-shelf and scalable solutions greatly enabled HT-ADME workflows in labs in biopharmaceutical companies of various sizes \[[@bib9],[@bib43],[@bib53], [@bib54], [@bib55]\], in contract research organizations (CRO's) \[[@bib56]\] and in academic research centers \[[@bib57],[@bib58]\]. Therefore, HT-ADME screening has evolved from a workflow done by only a few large pharmaceutical companies in the 2000's to a standard practice anywhere where drug discovery research is conducted during the last decade.
3. Cutting-edge technologies in HT-ADME screening {#sec3}
=================================================
In parallel to the industrialization of routine HT-ADME screening, novel and cutting-edge technologies have also continued to be tested and implemented in the field during the last decade thanks to the innovative culture of the existing HT-ADME community of practitioners. In this section, we review some of the technologies that have been adopted or are currently being evaluated in the HT-ADME screening laboratory.
3.1. Liquid handling {#sec3.1}
--------------------
Liquid handling of sub-μL volumes has become a truly enabling technology for all screening communities (lead discovery, HT-ADME, etc.) in drug discovery. Low volume dispensing is critical in limiting the percentage of organic solvent (0.5% or lower) in the assay mixture, and the ability to accurately and reproducibly dispense nanoliter volumes can pave the way to assay miniaturization by reducing total incubation volume (and therefore reagent consumption). There are many technologies capable of nanoliter dispensing, with two enjoying the most success to date.
The mosquito® line of liquid handlers by SPT Labtech uses disposable, miniaturized positive displacement pipette tips to accurately transfer volumes as low as 25--50 nL. Since it uses a positive displacement approach for pipetting, a mosquito® liquid handler can easily transfer different liquid types, without resorting to re-calibration based on viscosity. Successful applications of mosquito® liquid handlers for low volume dispensing in HT-ADME assays have been reported \[[@bib59]\].
Another highly successful nanoliter transfer approach uses sound waves to acoustically separate nanoliter-sized droplets from liquid meniscus in the source plate and eject them to the destination plate. Highly accurate, reproducible and rapid transfer of liquid volumes as low as 2.5 nL can be achieved in only several minutes for a 384-well plate \[[@bib60]\]. First adopted in the high-throughput screening \[[@bib61]\] and compound management \[[@bib62]\] environment, acoustic transfer technologies have now been applied extensively in HT-ADME screening assays, especially those requiring serial dilutions for IC~50~ determination \[[@bib25]\]. One caveat of the acoustic transfer approach is the need for calibration for each liquid type since different sound energy levels need to be applied for liquids with different properties (surface tension, viscosity, etc.). Two vendors currently offer acoustic dispensers: Echo by Labcyte®, and ATS® by EDC Biosystems. A comparison of the two low-volume transfer approaches is presented in [Table 1](#tbl1){ref-type="table"}.Table 1Comparison of the two low-volume liquid handlers.Table 1ParametersPositive displacementAcoustic transferTransfer range25 nL to 1.2 μL2.5 nL to 5 μLSample contactContactContactlessTransfer speedMinutes per 384-well plateMinutes per 384-well plateConsumablesSpecial tipsSpecial platesSample typeAny liquidsAqueous, DMSO
3.2. High-throughput sample analysis approaches {#sec3.2}
-----------------------------------------------
Sample analysis is another area where emerging technologies have been continuously evaluated and implemented. As mentioned previously, LC-MS/MS is still the workhorse in HT-ADME bioanalysis. However, it has been very difficult to break the 1 s/sample barrier for any chromatography and autosampler-based systems, despite the development of online SPE \[[@bib44],[@bib63]\] and multiplexed LC systems \[[@bib46]\]. To achieve even higher throughput, direct MS analysis from samples deposited onto solid support using various ionization methods has been attempted. These ionization methods include matrix assisted laser desorption ionization (MALDI) \[[@bib64]\], laser diode thermal desorption (LDTD) \[[@bib65]\], direct analysis in real time (DART) \[[@bib66]\], coated blade spray \[[@bib67]\], and dip-and-go inductive nanoelectrospray \[[@bib68]\] amongst others. As pointed out in a previous review \[[@bib17]\], although many of these ionization methods can achieve (or potentially achieve) a very high speed of analysis (several samples per second), they require an additional liquid handling step to transfer liquid assay samples into a solid support, which adds cost and complexity in automation. This disadvantage can be mitigated by using the aforementioned nanoliter transfer technologies for sample transfer \[[@bib69]\], with several examples of HT-ADME applications reported in the literature \[[@bib70]\]. Another disadvantage of these direct ionization approaches is the moderate to severe ionization suppression effect observed \[[@bib71]\] (since there is no chromatographic separation), and the resulting generally lower data quality when compared to LC-MS-based approach.
A very innovative approach combining acoustic ejection and direct ionization for high-throughput mass spectrometry (HTMS) analysis has been recently developed by a group from AstraZeneca \[[@bib72],[@bib73]\]. Dubbed acoustic mist ionization mass spectrometry, this approach uses a modified Echo acoustic dispenser to eject a "mist" of picoliter-sized droplets through a heated transfer tube directly into the mass spectrometer. Ionization is accomplished by a high voltage applied to the well top. The direct, contactless and high-speed (\<1s/sample) features of this technology make it a highly attractive HTMS option for various screening areas and the group has published several papers describing its use in lead discovery. The biggest challenge of the acoustic mist ionization methodology is its data quality. This is due to (1) the difficulty in maintaining reproducibility in the mist generation (since regular acoustic dispensers operate by ejecting discrete, well-controlled nL droplets); and (2) the suppression effect exerted by the sample matrix. As a result, a CV of ∼30% has been reported for repeated analysis, which is considered somewhat to be high for ADME applications.
A more recent development in direct acoustic mass spectrometry has made significant progress in addressing these challenges. Developed by Sciex, their acoustic ejection mass spectrometer (AEMS) uses a simple yet elegant interface called open port interface (OPI) to capture the droplets and transport them with a stream of carrier solvent (typically methanol) into a conventional electrospray ionization source \[[@bib74], [@bib75], [@bib76]\]. [Fig. 2](#fig2){ref-type="fig"} shows the schematic of an AEMS system \[[@bib76]\]. AEMS with OPI enjoys the similar sub-second/sample speed and direct analysis features to those of the AMI-MS approach. In addition, it has been demonstrated that AEMS can generate highly reproducible results from assay samples thanks to the low variability of acoustic ejection of nL-sized droplets and, more importantly, the mitigation of ionization suppression by the significant dilution (∼1000x) of the droplets by the carrier solvent. As a result, a typical CV of 3%--5% without the use of internal standards has been reported using AEMS for HTS and HT-ADME assay samples \[[@bib74]\]. Obviously, the dilution effect does negatively affect the detection limit of the analytes. However, the low nM lower limit of quantitation (LLOQ) typically reported with AEMS should be sufficient to meet the requirements of most in vitro assays. Therefore, with its balance of high speed and high data quality, AEMS is poised to become the detection method of choice for label-free, biochemical or cell-based assays including those used in HT-ADME screening. A comparison of the several high-throughput MS-based readout methods for HT-ADME assays is presented in [Table 2](#tbl2){ref-type="table"}.Fig. 2Schematic of the acoustic ejection mass spectrometer (AEMS) system. Reprinted with permission from Refs. \[[@bib76]\], Copyright (2020) American Chemical Society.Fig. 2Table 2Comparison of high-throughput MS analysis approaches. SPE: solid phase extraction; LDI: laser desorption ionization; AMI: acoustic mist ionization; AE: acoustic ejection.Table 2ParametersLC-MS/MSSPE-MS/MSLDI-MSAMI-MSAE-MSSpeed per well60s10 s1 s1 s1 sIn situ sample clean upYesYesNoNoYesData variabilityLowLowHighHighLowSample format96/38496/38496/384384384/1536Sample volume\>40 μL\>40 μL\<1 μL\<1 μL\<1 μLDirect analysisYesYesNoYesYes
3.3. High resolution mass spectrometry {#sec3.3}
--------------------------------------
In addition to the speed increase on the triple-quadrupole MS platform mentioned above, another emerging trend in HT-ADME bioanalysis is the use of high-resolution accurate mass (HRAM) capability of time-of-flight or Orbitrap mass spectrometers for sample analysis. Quantitative sample analysis of HT-ADME samples has been demonstrated with HRAM, typically by using the sample pooling approach to reduce sample numbers and take full advantage of the high resolving power of the mass spectrometer \[[@bib77]\]. More importantly, a number of quantitative/qualitative workflows have been introduced to perform metabolic soft spot analysis concurrently with metabolic stability sample analysis \[[@bib78],[@bib79]\].
4. Expansion of HT-ADME screening assay portfolio {#sec4}
=================================================
4.1. Transporter assays {#sec4.1}
-----------------------
The assay portfolio of in vitro HT-ADME screening has continued to expand during the last decade and here we highlight some of the recently deployed assays in the field. Drug-drug-interactions and toxicity due to transporter involvement have been increasingly recognized as an important potential liability of drug candidates. As a result, inhibition assays for hepatobiliary and renal transporters (in addition to the existing intestinal transporters) have become an integral part of the drug-drug interaction (DDI) portfolio of many HT-ADME screening labs \[[@bib10],[@bib11]\]. Some of the most commonly studied transporters in HT-ADME include hepatobiliary transporters such as organic anion-transporting polypeptide 1B1 (OATP1B1), organic anion-transporting polypeptide 1B3 (OATP1B3), sodium (Na^+^) taurocholate cotransporting polypeptide (NTCP), bile salt export pump (BSEP) \[[@bib80]\], renal transporters such as organic anion transporter 1 (OAT1), organic anion transporter 3 (OAT3), organic cation transporter 1 (OCT1), organic cation transporter 2 (OCT2), multidrug and toxin extrusion protein 1 transporter (MATE1), multidrug and toxin extrusion protein 2K transporter (MATE2K) \[[@bib10]\], and intestinal transporters such as P-glycoprotein (P-gp) and breast cancer resistance protein (BCRP) \[[@bib81]\]. Most of the transporter screening assays are conducted in inhibition mode by assessing the potential of a drug candidate to act as a "perpetrator" by inhibiting the activity of a given transporter. If necessary, substrate assays can be used to assess whether a drug candidate is likely to become a "victim" of a transporter-mediated DDI \[[@bib82]\].
4.2. HT-ADME assays for peptide drug candidates {#sec4.2}
-----------------------------------------------
Another growing area in HT-ADME screening is the characterization of peptide drug candidates. Since its inception, HT-ADME has been mostly used to assess the properties and liabilities of small molecule drug candidates. Recently, peptides have emerged as an attractive drug modality since they can combine target affinities similar to those of biologics with physicochemical properties closer to those of small molecules. Most peptide drugs are dosed by injection due to their poor proteolytic stability, low membrane permeability and low oral bioavailability \[[@bib83]\]. A number of synthetic strategies \[[@bib84], [@bib85], [@bib86]\] have been attempted to address these challenges for orally-dosed peptide drug candidates and, correspondingly, new or modified HT-ADME assays have been developed to facilitate the lead optimization in oral peptide drug discovery. For example, permeability assays such as colon adenocarcinoma cell line (Caco-2) or parallel artificial membrane permeability assay (PAMPA) have both been used to assess the permeability of peptides \[[@bib84],[@bib87]\]. However, due to the non-specific binding typically exhibited by peptides and the generally very low permeability values, they tend to generate null results in these assays. Therefore, assay conditions have been modified to address these challenges. Also, additional assays such as chromatography-based experimental polar surface area (EPSA) have been developed specifically to assess the permeability of peptides \[[@bib88]\].
4.3. High-throughput soft spot identification assays {#sec4.3}
----------------------------------------------------
The in vitro metabolic soft spot assay is another recent addition to the HT-ADME assay portfolio \[[@bib89]\]. Unlike most HT-ADME assays with numbers as end points (IC~50~, permeability values, percent bound, etc.), the metabolic soft spot assay provides structural information about the sites of metabolism (SOM), or "soft spots" of discovery compounds. Historically a very low throughput assay conducted only for a handful of lead compounds, metabolic soft spot assays have recently become quite common in HT-ADME. This is due to technological developments in two areas: first, the availability of high-performance, high-resolution mass spectrometers with generic data acquisition methods \[[@bib90],[@bib91]\]; and, second, the development of software tools to perform automated structural elucidation in batch mode \[[@bib92],[@bib93]\]. Equipped with the SOM information from the soft spot assay, discovery projects can now address metabolic instability synthetically for both small molecules and peptides in a more targeted way than before.
5. Future perspective {#sec5}
=====================
Thanks to the evolving sciences and enabling technologies, we anticipate more exciting developments in the field of HT-ADME in next decade. From an assay portfolio standpoint, emerging areas of ADME sciences will inevitably find their way into HT-ADME screening. Examples of these include new, more physiologically relevant in vitro microphysiological systems (MPS) such as 3D tissue cultures and organ(s)-on-a-chip \[[@bib94], [@bib95], [@bib96], [@bib97], [@bib98]\], for better in vitro in vivo translation (IVIVT). Another trend in ADME is the use of endogenous probes (essentially biomarkers) for transporter DDI studies in vivo, which has the potential advantages of reducing pill burden and obtaining transporter DDI information from a regular phase I study \[[@bib99], [@bib100], [@bib101], [@bib102], [@bib103], [@bib104]\]. Once the endogenous probes are validated, it is foreseeable that the corresponding in vitro HT assays can be implemented in a screening mode as well. Yet another example is HT-ADME screening of new drug modalities. In addition to small molecules and peptides, the field is poised to enter early ADME screening of new modalities including protein degraders \[[@bib105], [@bib106], [@bib107]\], antisense oligonucleotides (ASO's) \[[@bib108], [@bib109], [@bib110]\], antibody drug conjugates (ADC's) \[[@bib111], [@bib112], [@bib113], [@bib114]\] and biologics \[[@bib115], [@bib116], [@bib117]\]. Although the ADME science of these modalities is still currently developing, we expect more and more HT-ADME format assays will become online to support discovery efforts along with the evolving science.
With the long history of HT-ADME operation in many companies and the resulting wealth of ADME data that can be "mined", developing in silico models to predict ADME properties has long been recognized as the logical next step for HT-ADME screening \[[@bib118],[@bib119]\]. While many ADME predictive models reported in the literature use a training set of only several hundred compounds, a large pharmaceutical company's HT-ADME dataset could contain assay results from several hundred thousand compounds. These datasets can serve as the ideal training sets for model development due to its large size, and also the fact that they are a much better representation of the chemical space occupied by the compound collection of the particular company. Computational chemistry approaches aimed at developing quantitative structure-activity relationship (QSAR) models have long been applied to ADME properties \[[@bib120],[@bib121]\]. More recently, various machine learning (ML) methods have been applied to develop models for clearance, permeability and DDI potentials \[[@bib122], [@bib123], [@bib124], [@bib125], [@bib126]\]. With the recent rapid development in machine learning methodologies, and the large size of the HT-ADME datasets available to use as training sets, it is expected that even better predictive ADME models can be developed in the future to guide efforts such as hit triaging from lead discovery screens and in the design-make-test cycles of lead optimization in drug discovery \[[@bib127]\].
Conflicts of interest
=====================
The author declares that there are no conflicts of interest.
Appendix A. Supplementary data {#appsec1}
==============================
The following is the Supplementary data to this article:Multimedia component 1Multimedia component 1
The author would like to thank all colleagues in Lead Profiling (LP) and Separation and Analysis Technology Team (SATT) of Bristol-Myers Squibb Co..
Peer review under responsibility of Xi\'an Jiaotong University.
Supplementary data to this article can be found online at <https://doi.org/10.1016/j.jpha.2020.05.004>.
|
This information was originally posted on our forum by LDD. Please understand that LDD and NYFirearms.com or its staff are not firearms experts, law enforcement, lawyers, legal experts or anything of the sort so this information should not be taken as legal advice. The observations regarding date stamps on magazines described in this post are just that, observations based on examining several magazines and are not intended to be taken as absolute fact. As always, please consult a qualified legal expert if you are unsure of any laws or regulations.
Magazine Varieties:
If you are looking for a really durable, bomb-proof magazine, then I’d point you to the Chartered Industries (CI) and Imperial Defense (ID) steel 30 round magazines. These are NATO standard dimensions, but the ID mags were intended for the Brit’s SA-80s. IIRC Singapore uses a mix of rifles that include M16 pattern and their own domestic bullpups. Both fit in properly spec’d US AR15s without modification.
Chartered Industries Mags:
Parkerized grey bodies
Floorplates
Followers
The downside of the CI and grey ID mags is the prebans shipped with blue followers that were complete crap. They were shaped like our green/orange followers, but made out of a plastic that has the consistency of a gummy bear (they would bow inside the mag body: bow in front = follower hangup; bow in back = bolt doesn’t lock back on the last round).
I replace these blue followers with Magpul followers as a matter of conscience, before I sell them (they are that bad). The CI mags may require you to grind a little of the MP followers away before they will fit (front baseplate retention tabs on CI mags are oversized compared to USGI mags). MP followers fit the Imperial Defense mags without modification.
Imperial Defense Magazines (subcategories: Black and Grey):
Did some more research on these, including contacting some folks that used the black magazines for wildcat builds during the ban. I knew the grey ones were preban because I bought a batch during the ban (at “preban” prices too). Personally, I never encountered the black ones till after the ban but have since spoken with builders, who, as I said, used the black 30 round mags for wildcat AR builds.
About
NYFirearms.com was founded in 2008 by Mike Centola and Jeff Wiedrick as a response to a lack of discussion forums for New York State firearms owners. Originally the intent was solely for a discussion forum, but it quickly developed into an extremely informative blog-based site, incorporating firearms news, reviews, and events.
Categories
Most Recent Posts
If you are a N.Y.S. gun owner, ANY kind of gun, that includes you “I’m only a shotgun hunter and don’t care about AR15’s or handguns”, you will be subject to a bunch of new gun restrictions including HAVING to purchase insurance if you own any gun, If Cuomo gets re-elected. Do something for once […]
Our friends over at Allstar Tactical have come out with a new options for your “assault rifles” in New York. They have introduced the “SAFEMOD” which permanently locks your magazine in place for your AR15-type rifle. Read the description from their website below: Introducing our in-house designed SAFEMOD™ mag button. This mag button will modify […]
Subscribe to Blog via Email
Enter your email address to subscribe to this blog and receive notifications of new posts by email. |
#!/usr/bin/expect
set remoteHost [lrange $argv 0 0]
set password [lrange $argv 1 1]
spawn scp /root/.ssh/id_rsa.pub $remoteHost:/
expect {
"(yes/no)? " {
send "yes\r"
exp_continue
}
"password:" {
send "${password}\r"
}
}
interact {
timeout 60 { send " "}
}
spawn ssh $remoteHost "cd /; cat id_rsa.pub >> /root/.ssh/authorized_keys"
expect {
"password:" {
send "${password}\r"
}
}
interact {
timeout 60 { send " "}
}
exit
|
Kustom Kulture does not sell smoking accessories that are to be used or resold for illegal purposes. |
The player exposure requirements are different for skaters and goaltenders. While the required one defenseman and two forwards must be under contract for 2017-18 (in addition to games played thresholds), the goaltender can be under contract for 2017-18 or a restricted free agent.
To prevent teams from simply exposing RFA-status goaltenders that they have no intention of retaining in the first place, an additional expansion clause requires the team to tender a qualifying offer on the RFA goalie prior to submitting their protected list.
If the Sabres want to expose Lehner as part of the player exposure requirements, they have to tender a qualifying offer of $2.225M to him prior to submitting their list on June 17, 2017. |
Q:
SQL Server XML Querying with specific value
I have a XML as below in one of the table column of type xml
<fields>
<field>
<name>SourceFileName</name>
<value>ABCD</value>
</field>
<field>
<name>Template</name>
<value>XYZ</value>
</field>
</fields>
I need to query the XML to get the value for a specific text in field/name node
i used the below SQL but it doesn't return any data for the second one
SELECT *
FROM xmltable
WHERE XMLText.value('(/fields/field/name)**[1]**' ,'varchar(max)') LIKE
'Template'
SELECT *
FROM xmltable
WHERE XMLText.value('(/fields/field/name)**[1]**' ,'varchar(max)') LIKE
'SourceFileName'
whereas the below returns data
SELECT *
FROM xmltable
WHERE XMLText.value('(/fields/field/name)**[2]**' ,'varchar(max)') LIKE
'Template'
Can somebody help, how do i write a generic query to return data based on the name passed?
A:
If you want to handle multiple XML elements, you need to use the .nodes() XQuery function.
Try something like this:
SELECT
Name = XC.value('(name)[1]', 'varchar(50)'),
[Value] = XC.value('(value)[1]', 'varchar(25)')
FROM
dbo.XmlTable
CROSS APPLY
XmlText.nodes('/fields/field') AS XT(XC)
The .nodes() call will create a "pseudo" table XT with a single column XC that contains the XML fragment that is matched by that XPath expression - in your case, you get two rows, each representing one of the <field> elements.
You can now "reach into" those XML fragments and extract the data you need using the .value() calls - and you get the name and value for both <field> elements this way:
|
We noticed that you're using an unsupported browser. The TripAdvisor website may not display properly.We support the following browsers:Windows: Internet Explorer, Mozilla Firefox, Google Chrome. Mac: Safari.
We stopped on St Pat’s Day prior to a show at Gennesee Theater. Service was fast and friendly. They pour a good drink. The pizza is some of the best I have ever eaten. Thin crust.
Bartender even provided a green beer for St Pat’s....More
Showed up to pick up Pizza and was not greeted but ignored by a girl staring at her cell phone for several minutes. Another man was unfriendly as well. Service and respect are very important as important as quality of food. We will never order...More
I don't know if they are under new ownership, but this pizza is not the same, but the price is still high! I paid $27 for a pizza, and it was not the same. I always get sausage and onions. The smell would stay in...More
Quonset has the best pizza in Waukegan. My husband and I order from there every Friday. It's costly, but worth it. I had one bad experience, where the crust was completely burned, but they sent a replacement pizza right away.
I have a theory that typically a person's favorite pizza is their favorite pizza from when they were a kid. Well, this is mine. It has been around for 50ish years. They just started taking credit cards several years ago. Pizza is awesome! Crust is...More
My wife and I took my mother to Quonset Pizza for her birthday. She's in a wheelchair, but the experience was still pretty good. It was kind of difficult getting her in and out of the place but we were able to find a table...More |
UNITED NATIONS (Reuters) - U.N. Secretary-General Antonio Guterres has chosen former Chilean President Michelle Bachelet to be the world body’s new human rights chief, the United Nations said on Wednesday.
Chilean president Michelle Bachelet shows her ballot during the presidential election in Santiago, Chile December 17, 2017. REUTERS/Carlos Vera
The 193-member U.N. General Assembly is due to meet on Friday to approve Bachelet’s appointment. She would replace Jordan’s outspoken Zeid Ra’ad al-Hussein, who is stepping down at the end of the month after a four-year term in the Geneva-based job.
Ambassadors chairing different regional groups at the United Nations were told of the decision on Tuesday by U.N. Deputy Secretary-General Amina Mohammed, several diplomats, speaking on condition of anonymity, told Reuters earlier on Wednesday.
U.N. spokesman Farhan Haq said in a statement that Guterres formally notified the General Assembly on Wednesday.
Bachelet, a victim of torture under the dictatorship of Augusto Pinochet, was conservative Chile’s first female leader.
The pediatrician-turned-politician first served as president of Chile from 2006 to 2010. Her amiable style, welfare policies and steady economic growth in one of the region’s most developed countries made her popular.
Bachelet then led U.N. Women, a body for gender equality and the empowerment of women, between 2010 and 2013, before returning to Chile where she again served as president from 2014 to 2018, pushing for a more radical tax-and-spend agenda, as well as broader abortion rights and gay marriage.
Zeid told reporters in New York earlier this month that he did not seek a second term because he did not believe he would have the support of key world powers, including the United States, China and Russia.
Zeid has been strongly critical of some of U.S. President Donald Trump’s policies and his attacks on the media.
“Someone said to me ‘just come out swinging’ and that’s what I did,” Zeid said of advice he was given when he started the job in 2014. “Silence does not earn you any respect.”
“We do not bring shame on governments, they shame themselves,” he said.
Zeid said the pressure of the human rights job was intense. After a tough week last year, his wife recommended he watch feel-good reality television show “The Great British Bake Off” to take his mind off human rights abuses.
“This man pulls out a soufflé just before the competition ends and the thing collapses,” he said. “I burst into tears and I couldn’t stop.” |
Multnomah County prosecutors have decided not to pursue charges against the owner of the Mr. Formal tuxedo chain after the driver of a pickup truck accused him of pointing a pistol during a January road-rage incident.
Chuck Sparks, chief deputy district attorney, said Tuesday that his office isn’t pursuing charges against Edwin Honeycutt III because the driver of the pickup truck didn’t wish to go forward with a prosecution.
According to a police report released Tuesday, Timothy James Short, 49, told Portland police that he’d be satisfied if Honeycutt lost his concealed weapons permit. According to court papers Honeycutt filed last week, the Multnomah County Sheriff’s Office revoked his permit because of the incident.
Short called police at about 1:30 p.m. on Jan. 3 to report that the driver of a silver Landrover -- later identified as 59-year-old Honeycutt -- was following his GMC pickup closely and driving recklessly, the police report says. Short said after he stopped at a red light at Southeast McLoughlin and Holgate boulevards, Honeycutt pulled up next to him.
Short claims he waved a white tissue “as a sign of truce,” according to the report. But Honeycutt rolled down his window and pointed a semi-automatic handgun with -- the laser sight activated -- at him. Short said Honeycutt said, “This is what I do!”
Short claims he said he was “calling the cops,” and that spurred Honeycutt to drive off.
Honeycutt owns one of the largest apparel-based chains in the Portland area. He founded Mr. Formal 38 years ago, and its website lists 23 locations in Oregon, Washington, California and Idaho.
Based on Honeycutt’s license plate, it didn’t take three police officers long to track him down at the Mr. Formal location at 1205 S.E. Grand Ave., where Honeycutt told his side of the story. Honeycutt said he noticed the GMC pickup driving recklessly on Interstate 5, and he worried the driver was going to “kill someone,” according to the report. He said he tried to call 911 and then the non-emergency number but couldn’t get through to a dispatcher.
Honeycutt told police that the pickup, which was occupied by the driver and two other men, pulled up beside him at a stoplight. Honeycutt said the driver, Short, waved a white cloth and said something about “tears.” Honeycutt said he didn’t know what the driver meant by this gesture, but all three of the pickup’s occupants looked rough, so he stopped following.
Officer Paul Park wrote in his report that he asked Honeycutt when he thought it would be OK to display a handgun, and Honeycutt responded by saying he never “brandished” a handgun at Short. Honeycutt then showed the officer where he kept the gun in his Land Rover.
“I asked Honeycutt how Short could have described the handgun with such accuracy, down to the laser sight, had Honeycutt not brandished the weapon,” the officer wrote. “Honeycutt conceded that he had held the firearm on his leg during the incident, but did not point it at Short.”
In court papers demanding the return of his handgun last week, Honeycutt stated that he was the victim of road-rage inflicted by the occupants of the pickup. Honeycutt wrote that the young men were “yelling at me and taunting me,” and he worried they might assault him. So he says he removed his Ruger .380 automatic pistol from its case and placed “it beside me on the front console next to my seat in my car.”
It’s unclear if Honeycutt -- who has no criminal history -- will get his gun back. It’s up to the Portland Police Bureau to release the gun back to Honeycutt, now that the District Attorney’s Office no longer needs it as evidence.
Honeycutt has said he plans to apply for a new concealed weapons permit. |
Cation-pi binding of an alkali metal ion by pendant alpha,alpha-dimethylbenzyl groups within a dinuclear iron(III) structural unit.
We report here on the cation-pi binding of potassium ions by benzyl groups in a coordination complex. The results demonstrate the cation-binding power of the benzyl group and consequently the potential for aromatic groups to interact with alkali metal ions even in aqueous media. |
Related literature {#sec1}
==================
For background to Schiff bases, see: Casas *et al.* (2000[@bb2]). For a related structure, see: Li & Jian (2010[@bb3]).
Experimental {#sec2}
============
{#sec2.1}
### Crystal data {#sec2.1.1}
C~10~H~13~N~3~OS*M* *~r~* = 223.29Orthorhombic,*a* = 13.397 (3) Å*b* = 9.1271 (18) Å*c* = 18.799 (4) Å*V* = 2298.6 (8) Å^3^*Z* = 8Mo *K*α radiationμ = 0.26 mm^−1^*T* = 293 K0.25 × 0.22 × 0.18 mm
### Data collection {#sec2.1.2}
Bruker SMART CCD area-detector diffractometer20742 measured reflections2627 independent reflections1746 reflections with *I* \> 2σ(*I*)*R* ~int~ = 0.061
### Refinement {#sec2.1.3}
*R*\[*F* ^2^ \> 2σ(*F* ^2^)\] = 0.040*wR*(*F* ^2^) = 0.146*S* = 0.942627 reflections136 parametersH-atom parameters constrainedΔρ~max~ = 0.17 e Å^−3^Δρ~min~ = −0.29 e Å^−3^
{#d5e384}
Data collection: *SMART* (Bruker, 1997[@bb1]); cell refinement: *SAINT* (Bruker, 1997[@bb1]); data reduction: *SAINT*; program(s) used to solve structure: *SHELXS97* (Sheldrick, 2008[@bb4]); program(s) used to refine structure: *SHELXL97* (Sheldrick, 2008[@bb4]); molecular graphics: *SHELXTL* (Sheldrick, 2008[@bb4]); software used to prepare material for publication: *SHELXTL*.
Supplementary Material
======================
Crystal structure: contains datablocks global, I. DOI: [10.1107/S1600536810038882/hb5659sup1.cif](http://dx.doi.org/10.1107/S1600536810038882/hb5659sup1.cif)
Structure factors: contains datablocks I. DOI: [10.1107/S1600536810038882/hb5659Isup2.hkl](http://dx.doi.org/10.1107/S1600536810038882/hb5659Isup2.hkl)
Additional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?hb5659&file=hb5659sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?hb5659sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?hb5659&checkcif=yes)
Supplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [HB5659](http://scripts.iucr.org/cgi-bin/sendsup?hb5659)).
Comment
=======
Schiff-base have attracted much attention because they can be utilized as effective ligands to be coordination compounds in coordination chemistry. (Casas *et al.*, 2000). As part of our research for new Schiff-base compounds we synthesized the title compound (I), and describe its structure here. In the molecule structure, the dihedral angle between the benzene ring and the thiourea unit is \[8.64 (7)°\].
Bond lengths and angles agree with those observed in related compounds (Li & Jian, 2010).
Experimental {#experimental}
============
A mixture of 4-methylthiosemicarbazide (0.1 mol) and 4-methoxybenzaldehyde (0.1 mol) was stirred in refluxing ethanol (30 mL) for 2 h to afford the title compound (0.090 mol, yield 90%). Colourless bars of (I) were obtained by recrystallization from ethanol at room temperature.
Refinement {#refinement}
==========
H atoms were fixed geometrically and allowed to ride on their attached atoms, with C---H distances=0.97 Å, and with *U*~iso~=1.2--1.5*U*~eq~.
Figures
=======
{#Fap1}
Crystal data {#tablewrapcrystaldatalong}
============
----------------------- ---------------------------------------
C~10~H~13~N~3~OS *D*~x~ = 1.290 Mg m^−3^
*M~r~* = 223.29 Mo *K*α radiation, λ = 0.71073 Å
Orthorhombic, *Pbca* Cell parameters from 2650 reflections
*a* = 13.397 (3) Å θ = 3.2--27.2°
*b* = 9.1271 (18) Å µ = 0.26 mm^−1^
*c* = 18.799 (4) Å *T* = 293 K
*V* = 2298.6 (8) Å^3^ Bar, colorless
*Z* = 8 0.25 × 0.22 × 0.18 mm
*F*(000) = 944
----------------------- ---------------------------------------
Data collection {#tablewrapdatacollectionlong}
===============
----------------------------------------------- --------------------------------------
Bruker SMART CCD area-detector diffractometer 1746 reflections with *I* \> 2σ(*I*)
Radiation source: fine-focus sealed tube *R*~int~ = 0.061
graphite θ~max~ = 27.5°, θ~min~ = 3.0°
phi and ω scans *h* = −17→17
20742 measured reflections *k* = −11→11
2627 independent reflections *l* = −24→24
----------------------------------------------- --------------------------------------
Refinement {#tablewraprefinementdatalong}
==========
------------------------------------- ----------------------------------------------------------------------------------
Refinement on *F*^2^ Primary atom site location: structure-invariant direct methods
Least-squares matrix: full Secondary atom site location: difference Fourier map
*R*\[*F*^2^ \> 2σ(*F*^2^)\] = 0.040 Hydrogen site location: inferred from neighbouring sites
*wR*(*F*^2^) = 0.146 H-atom parameters constrained
*S* = 0.94 *w* = 1/\[σ^2^(*F*~o~^2^) + (0.1*P*)^2^\] where *P* = (*F*~o~^2^ + 2*F*~c~^2^)/3
2627 reflections (Δ/σ)~max~ = 0.001
136 parameters Δρ~max~ = 0.17 e Å^−3^
0 restraints Δρ~min~ = −0.29 e Å^−3^
------------------------------------- ----------------------------------------------------------------------------------
Special details {#specialdetails}
===============
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Geometry. All e.s.d.\'s (except the e.s.d. in the dihedral angle between two l.s. planes) are estimated using the full covariance matrix. The cell e.s.d.\'s are taken into account individually in the estimation of e.s.d.\'s in distances, angles and torsion angles; correlations between e.s.d.\'s in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell e.s.d.\'s is used for estimating e.s.d.\'s involving l.s. planes.
Refinement. Refinement of *F*^2^ against ALL reflections. The weighted *R*-factor *wR* and goodness of fit *S* are based on *F*^2^, conventional *R*-factors *R* are based on *F*, with *F* set to zero for negative *F*^2^. The threshold expression of *F*^2^ \> σ(*F*^2^) is used only for calculating *R*-factors(gt) *etc*. and is not relevant to the choice of reflections for refinement. *R*-factors based on *F*^2^ are statistically about twice as large as those based on *F*, and *R*- factors based on ALL data will be even larger.
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords}
==================================================================================================
------ -------------- -------------- -------------- -------------------- --
*x* *y* *z* *U*~iso~\*/*U*~eq~
S1 0.89733 (4) 1.04305 (5) 0.58910 (3) 0.0579 (2)
C7 0.89674 (13) 0.2105 (2) 0.33447 (9) 0.0442 (4)
N3 0.88845 (12) 0.66880 (17) 0.48831 (8) 0.0467 (4)
C4 0.92228 (14) 0.4806 (2) 0.40190 (10) 0.0456 (4)
O1 0.88816 (11) 0.08431 (16) 0.29666 (7) 0.0577 (4)
N2 0.91161 (12) 0.80887 (17) 0.50939 (9) 0.0509 (4)
H2A 0.9558 0.8577 0.4862 0.061\*
C8 0.85569 (15) 0.2343 (2) 0.40146 (9) 0.0483 (5)
H8A 0.8197 0.1606 0.4240 0.058\*
C2 0.86618 (14) 0.8710 (2) 0.56577 (10) 0.0450 (4)
N1 0.79800 (13) 0.79216 (17) 0.59919 (8) 0.0567 (5)
H1A 0.7848 0.7061 0.5831 0.068\*
C9 0.86880 (15) 0.3681 (2) 0.43415 (10) 0.0484 (5)
H9A 0.8412 0.3836 0.4789 0.058\*
C3 0.93581 (15) 0.6236 (2) 0.43363 (10) 0.0505 (5)
H3B 0.9819 0.6866 0.4129 0.061\*
C5 0.96339 (16) 0.4532 (2) 0.33528 (10) 0.0550 (5)
H5A 1.0006 0.5259 0.3130 0.066\*
C10 0.83329 (19) −0.0329 (2) 0.32630 (13) 0.0661 (6)
H10A 0.8337 −0.1143 0.2940 0.099\*
H10B 0.7657 −0.0023 0.3345 0.099\*
H10C 0.8631 −0.0619 0.3706 0.099\*
C6 0.95017 (17) 0.3214 (2) 0.30188 (10) 0.0584 (5)
H6A 0.9773 0.3063 0.2569 0.070\*
C1 0.7442 (2) 0.8428 (3) 0.66153 (12) 0.0832 (8)
H1B 0.6985 0.7681 0.6769 0.125\*
H1C 0.7077 0.9301 0.6499 0.125\*
H1D 0.7907 0.8636 0.6990 0.125\*
------ -------------- -------------- -------------- -------------------- --
Atomic displacement parameters (Å^2^) {#tablewrapadps}
=====================================
----- ------------- ------------- ------------- -------------- ------------- --------------
*U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^
S1 0.0564 (4) 0.0466 (3) 0.0707 (4) −0.0056 (2) 0.0113 (2) −0.0107 (2)
C7 0.0415 (9) 0.0505 (10) 0.0405 (9) −0.0008 (7) 0.0004 (7) −0.0047 (8)
N3 0.0450 (9) 0.0478 (9) 0.0473 (8) −0.0012 (7) 0.0014 (7) −0.0062 (7)
C4 0.0398 (10) 0.0524 (10) 0.0446 (10) −0.0010 (8) 0.0011 (8) −0.0025 (8)
O1 0.0616 (9) 0.0578 (8) 0.0537 (8) −0.0079 (6) 0.0076 (6) −0.0105 (7)
N2 0.0492 (10) 0.0480 (9) 0.0557 (9) −0.0070 (7) 0.0083 (7) −0.0079 (7)
C8 0.0510 (11) 0.0498 (10) 0.0441 (10) −0.0016 (9) 0.0055 (8) 0.0060 (8)
C2 0.0393 (9) 0.0470 (10) 0.0488 (10) 0.0024 (8) −0.0009 (8) −0.0009 (8)
N1 0.0623 (11) 0.0511 (9) 0.0568 (10) −0.0110 (8) 0.0156 (8) −0.0102 (8)
C9 0.0512 (11) 0.0553 (11) 0.0386 (9) 0.0006 (9) 0.0067 (8) 0.0011 (8)
C3 0.0456 (11) 0.0534 (11) 0.0524 (11) −0.0051 (9) 0.0023 (9) −0.0020 (9)
C5 0.0572 (12) 0.0587 (12) 0.0492 (10) −0.0129 (9) 0.0156 (9) −0.0027 (9)
C10 0.0698 (16) 0.0533 (12) 0.0751 (14) −0.0098 (10) 0.0038 (12) −0.0050 (10)
C6 0.0602 (13) 0.0689 (13) 0.0462 (10) −0.0105 (10) 0.0168 (9) −0.0102 (9)
C1 0.099 (2) 0.0764 (14) 0.0739 (14) −0.0251 (14) 0.0394 (15) −0.0209 (13)
----- ------------- ------------- ------------- -------------- ------------- --------------
Geometric parameters (Å, °) {#tablewrapgeomlong}
===========================
--------------- ------------- ------------------- -------------
S1---C2 1.683 (2) C2---N1 1.322 (2)
C7---O1 1.358 (2) N1---C1 1.451 (3)
C7---C6 1.383 (3) N1---H1A 0.8600
C7---C8 1.391 (3) C9---H9A 0.9300
N3---C3 1.277 (2) C3---H3B 0.9300
N3---N2 1.374 (2) C5---C6 1.368 (3)
C4---C5 1.391 (3) C5---H5A 0.9300
C4---C9 1.391 (3) C10---H10A 0.9600
C4---C3 1.446 (3) C10---H10B 0.9600
O1---C10 1.413 (2) C10---H10C 0.9600
N2---C2 1.347 (2) C6---H6A 0.9300
N2---H2A 0.8600 C1---H1B 0.9600
C8---C9 1.378 (3) C1---H1C 0.9600
C8---H8A 0.9300 C1---H1D 0.9600
O1---C7---C6 115.63 (16) C4---C9---H9A 119.2
O1---C7---C8 124.96 (17) N3---C3---C4 124.16 (18)
C6---C7---C8 119.40 (17) N3---C3---H3B 117.9
C3---N3---N2 114.88 (16) C4---C3---H3B 117.9
C5---C4---C9 117.63 (17) C6---C5---C4 121.34 (17)
C5---C4---C3 118.95 (17) C6---C5---H5A 119.3
C9---C4---C3 123.42 (17) C4---C5---H5A 119.3
C7---O1---C10 118.68 (15) O1---C10---H10A 109.5
C2---N2---N3 121.08 (16) O1---C10---H10B 109.5
C2---N2---H2A 119.5 H10A---C10---H10B 109.5
N3---N2---H2A 119.5 O1---C10---H10C 109.5
C9---C8---C7 119.47 (18) H10A---C10---H10C 109.5
C9---C8---H8A 120.3 H10B---C10---H10C 109.5
C7---C8---H8A 120.3 C5---C6---C7 120.48 (17)
N1---C2---N2 117.22 (17) C5---C6---H6A 119.8
N1---C2---S1 123.74 (15) C7---C6---H6A 119.8
N2---C2---S1 119.04 (15) N1---C1---H1B 109.5
C2---N1---C1 123.65 (17) N1---C1---H1C 109.5
C2---N1---H1A 118.2 H1B---C1---H1C 109.5
C1---N1---H1A 118.2 N1---C1---H1D 109.5
C8---C9---C4 121.67 (17) H1B---C1---H1D 109.5
C8---C9---H9A 119.2 H1C---C1---H1D 109.5
--------------- ------------- ------------------- -------------
Hydrogen-bond geometry (Å, °) {#tablewraphbondslong}
=============================
------------------- --------- --------- ------------- ---------------
*D*---H···*A* *D*---H H···*A* *D*···*A* *D*---H···*A*
N1---H1A···N3 0.86 2.28 2.661 (2) 107
N1---H1A···S1^i^ 0.86 2.86 3.4718 (18) 130
N2---H2A···S1^ii^ 0.86 2.59 3.4359 (17) 169
------------------- --------- --------- ------------- ---------------
Symmetry codes: (i) −*x*+3/2, *y*−1/2, *z*; (ii) −*x*+2, −*y*+2, −*z*+1.
###### Hydrogen-bond geometry (Å, °)
*D*---H⋯*A* *D*---H H⋯*A* *D*⋯*A* *D*---H⋯*A*
------------------- --------- ------- ------------- -------------
N1---H1*A*⋯N3 0.86 2.28 2.661 (2) 107
N1---H1*A*⋯S1^i^ 0.86 2.86 3.4718 (18) 130
N2---H2*A*⋯S1^ii^ 0.86 2.59 3.4359 (17) 169
Symmetry codes: (i) ; (ii) .
|
Installing AutoRest version: v2
AutoRest installed successfully.
Commencing code generation
Generating CSharp code
Executing AutoRest command
cmd.exe /c autorest.cmd https://github.com/Azure/azure-rest-api-specs/blob/master/specification/containerregistry/resource-manager/readme.md --csharp --version=v2 --reflect-api-versions --csharp-sdks-folder=C:\dev\azure-sdk-for-net\sdk
2020-07-27 22:48:04 UTC
Azure-rest-api-specs repository information
GitHub fork: Azure
Branch: master
Commit: 3903ebec90f50617c36911b25d499a7ae867b740
AutoRest information
Requested version: v2
Bootstrapper version: autorest@2.0.4413
|
Maybe the easiest (dare we say "most spirited"?) way to get rid of all that pesky candy: turn it into something that will get you tipsy. And if you weren’t planning on throwing a Halloween party this year, you might want to reconsider. This concoction isn’t something you’re going to casually sip on a mellow Wednesday night in. RECIPE: Combine 1 cup fruit candy (Jolly Ranchers, Gummi Bears, Butterscotch, Starburst, and Twizzlers all work) with 2 cups vodka in a large glass jar or resealable container. Let sit at least 24 hours for hard candy like Jolly Ranchers, and at least 48 for softer candy like Gummi Bears and Starburst), shaking occasionally to dissolve. Not that the color matters here, because let’s be honest, you’re drinking melted candy, but keep like colors together for the prettiest results. (When we were testing this, some of us were perfectly content to drink this out of little cups filled with lots of ice. But go ahead, make punch, use them for JELL-O shots, get wild. It’s Halloween!)
Hungry?
Loading Comments...
It’s almost Halloween, which means candy season. Whether you’re planning for Trick-or-Treaters or not, it’s pretty hard to walk into your local drug store and not come out with an embarrassingly large bag of Reese’s Peanut Butter Cups (undisputed king of Halloween candy*) or something equally delicious and spooky.
So, on one hand: Yay! So much candy! On the other hand: Eek! What do I do with all this candy? If you’re sick of eating it the old-fashioned way (at night, in bed, probably with Netflix) and are looking for some new ways to enjoy those individually wrapped packets of joy, here are some things you can make with all the “leftovers” to mix it up and blow minds.
Maybe the easiest (dare we say "most spirited"?) way to get rid of all that pesky candy: turn it into something that will get you tipsy. And if you weren’t planning on throwing a Halloween party this year, you might want to reconsider. This concoction isn’t something you’re going to casually sip on a mellow Wednesday night in. RECIPE: Combine 1 cup fruit candy (Jolly Ranchers, Gummi Bears, Butterscotch, Starburst, and Twizzlers all work) with 2 cups vodka in a large glass jar or resealable container. Let sit at least 24 hours for hard candy like Jolly Ranchers, and at least 48 for softer candy like Gummi Bears and Starburst), shaking occasionally to dissolve. Not that the color matters here, because let’s be honest, you’re drinking melted candy, but keep like colors together for the prettiest results. (When we were testing this, some of us were perfectly content to drink this out of little cups filled with lots of ice. But go ahead, make punch, use them for JELL-O shots, get wild. It’s Halloween!) |
Racists Vandalize LeBron James’s Los Angeles Home
The NBA superstar was not home at the time of the incident.
Racists spray painted the n-word on the front gate of LeBron James’s Los Angeles home Wednesday in the upscale community of Brentwood, a day before he was set to play in his seventh straight N.B.A. finals, reports TMZ.
James’s Cleveland Cavaliers will face the Golden State Warriors for the third consecutive season, notes The New York Times:
Over the last several seasons, James, the N.B.A.’s most recognizable superstar, has been unafraid to voice his political opinions, decrying police killings of African-American men and endorsing Hillary Clinton for president. His willingness to speak his mind has set him apart from stars of previous eras, including Michael Jordan, with whom he is often compared.
In 2015, Variety reported that James had purchased a $21 million home in the Brentwood neighborhood of Los Angeles. The basketball superstar has demonstrated his interest in a second career as a Hollywood player; the production company he co-founded, SpringHill Entertainment, signed a deal with Warner Brothers Entertainment in 2015 and James played himself in the movie “Trainwreck” that year. |
{
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stderr",
"output_type": "stream",
"text": [
"Using TensorFlow backend.\n"
]
}
],
"source": [
"import numpy as np\n",
"import gym\n",
"from keras.models import Sequential\n",
"from keras.layers import Dense, Activation, Flatten\n",
"from keras.optimizers import Adam\n",
"from rl.agents import SARSAAgent\n",
"from rl.policy import EpsGreedyQPolicy"
]
},
{
"cell_type": "code",
"execution_count": 2,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"\u001b[33mWARN: gym.spaces.Box autodetected dtype as <class 'numpy.float32'>. Please provide explicit dtype.\u001b[0m\n"
]
}
],
"source": [
"# load the environment\n",
"env = gym.make('CartPole-v1')"
]
},
{
"cell_type": "code",
"execution_count": 3,
"metadata": {
"collapsed": false
},
"outputs": [],
"source": [
"# set seed \n",
"seed_val = 456\n",
"env.seed(seed_val)\n",
"np.random.seed(seed_val)"
]
},
{
"cell_type": "code",
"execution_count": 4,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"states = env.observation_space.shape[0]\n",
"actions = env.action_space.n"
]
},
{
"cell_type": "code",
"execution_count": 5,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"# define agent\n",
"def agent(states, actions):\n",
" \"\"\"Simple Deep Neural Network.\"\"\"\n",
" model = Sequential()\n",
" model.add(Flatten(input_shape=(1,states)))\n",
" model.add(Dense(16))\n",
" model.add(Activation('relu'))\n",
" model.add(Dense(16))\n",
" model.add(Activation('relu'))\n",
" model.add(Dense(16))\n",
" model.add(Activation('relu'))\n",
" model.add(Dense(actions))\n",
" model.add(Activation('linear'))\n",
" return model\n",
"\n",
"model = agent(states, actions)"
]
},
{
"cell_type": "code",
"execution_count": 6,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Training for 50000 steps ...\n",
"Interval 1 (0 steps performed)\n",
"10000/10000 [==============================] - 95s 10ms/step - reward: 1.0000\n",
"319 episodes - episode_reward: 30.984 [8.000, 500.000] - loss: 7.445 - mean_squared_error: 552.109 - mean_q: 29.475\n",
"\n",
"Interval 2 (10000 steps performed)\n",
"10000/10000 [==============================] - 93s 9ms/step - reward: 1.0000\n",
"122 episodes - episode_reward: 82.467 [9.000, 435.000] - loss: 6.987 - mean_squared_error: 831.830 - mean_q: 39.221\n",
"\n",
"Interval 3 (20000 steps performed)\n",
"10000/10000 [==============================] - 89s 9ms/step - reward: 1.0000\n",
"81 episodes - episode_reward: 122.617 [14.000, 500.000] - loss: 10.447 - mean_squared_error: 1416.096 - mean_q: 52.411\n",
"\n",
"Interval 4 (30000 steps performed)\n",
"10000/10000 [==============================] - 95s 9ms/step - reward: 1.0000\n",
"75 episodes - episode_reward: 133.933 [15.000, 500.000] - loss: 6.933 - mean_squared_error: 1527.035 - mean_q: 54.172\n",
"\n",
"Interval 5 (40000 steps performed)\n",
"10000/10000 [==============================] - 99s 10ms/step - reward: 1.0000\n",
"done, took 470.141 seconds\n"
]
},
{
"data": {
"text/plain": [
"<keras.callbacks.History at 0x120d44dd8>"
]
},
"execution_count": 6,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"# Define the policy\n",
"policy = EpsGreedyQPolicy()\n",
"\n",
"# Define SARSA agent by feeding it the policy and the model\n",
"sarsa = SARSAAgent(model=model, nb_actions=actions, nb_steps_warmup=10, policy=policy)\n",
"\n",
"# compile sarsa with mean squared error loss\n",
"sarsa.compile('adam', metrics=['mse'])\n",
"\n",
"# train the agent for 50000 steps\n",
"sarsa.fit(env, nb_steps=50000, visualize=False, verbose=1)"
]
},
{
"cell_type": "code",
"execution_count": 7,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Testing for 100 episodes ...\n",
"Episode 1: reward: 350.000, steps: 350\n",
"Episode 2: reward: 383.000, steps: 383\n",
"Episode 3: reward: 316.000, steps: 316\n",
"Episode 4: reward: 371.000, steps: 371\n",
"Episode 5: reward: 356.000, steps: 356\n",
"Episode 6: reward: 399.000, steps: 399\n",
"Episode 7: reward: 317.000, steps: 317\n",
"Episode 8: reward: 370.000, steps: 370\n",
"Episode 9: reward: 364.000, steps: 364\n",
"Episode 10: reward: 432.000, steps: 432\n",
"Episode 11: reward: 331.000, steps: 331\n",
"Episode 12: reward: 387.000, steps: 387\n",
"Episode 13: reward: 361.000, steps: 361\n",
"Episode 14: reward: 365.000, steps: 365\n",
"Episode 15: reward: 350.000, steps: 350\n",
"Episode 16: reward: 375.000, steps: 375\n",
"Episode 17: reward: 396.000, steps: 396\n",
"Episode 18: reward: 372.000, steps: 372\n",
"Episode 19: reward: 386.000, steps: 386\n",
"Episode 20: reward: 388.000, steps: 388\n",
"Episode 21: reward: 326.000, steps: 326\n",
"Episode 22: reward: 336.000, steps: 336\n",
"Episode 23: reward: 413.000, steps: 413\n",
"Episode 24: reward: 387.000, steps: 387\n",
"Episode 25: reward: 356.000, steps: 356\n",
"Episode 26: reward: 374.000, steps: 374\n",
"Episode 27: reward: 354.000, steps: 354\n",
"Episode 28: reward: 328.000, steps: 328\n",
"Episode 29: reward: 381.000, steps: 381\n",
"Episode 30: reward: 308.000, steps: 308\n",
"Episode 31: reward: 348.000, steps: 348\n",
"Episode 32: reward: 367.000, steps: 367\n",
"Episode 33: reward: 343.000, steps: 343\n",
"Episode 34: reward: 387.000, steps: 387\n",
"Episode 35: reward: 327.000, steps: 327\n",
"Episode 36: reward: 378.000, steps: 378\n",
"Episode 37: reward: 339.000, steps: 339\n",
"Episode 38: reward: 383.000, steps: 383\n",
"Episode 39: reward: 367.000, steps: 367\n",
"Episode 40: reward: 333.000, steps: 333\n",
"Episode 41: reward: 352.000, steps: 352\n",
"Episode 42: reward: 340.000, steps: 340\n",
"Episode 43: reward: 365.000, steps: 365\n",
"Episode 44: reward: 357.000, steps: 357\n",
"Episode 45: reward: 363.000, steps: 363\n",
"Episode 46: reward: 368.000, steps: 368\n",
"Episode 47: reward: 385.000, steps: 385\n",
"Episode 48: reward: 353.000, steps: 353\n",
"Episode 49: reward: 342.000, steps: 342\n",
"Episode 50: reward: 340.000, steps: 340\n",
"Episode 51: reward: 412.000, steps: 412\n",
"Episode 52: reward: 366.000, steps: 366\n",
"Episode 53: reward: 362.000, steps: 362\n",
"Episode 54: reward: 339.000, steps: 339\n",
"Episode 55: reward: 306.000, steps: 306\n",
"Episode 56: reward: 391.000, steps: 391\n",
"Episode 57: reward: 396.000, steps: 396\n",
"Episode 58: reward: 371.000, steps: 371\n",
"Episode 59: reward: 348.000, steps: 348\n",
"Episode 60: reward: 387.000, steps: 387\n",
"Episode 61: reward: 392.000, steps: 392\n",
"Episode 62: reward: 394.000, steps: 394\n",
"Episode 63: reward: 387.000, steps: 387\n",
"Episode 64: reward: 388.000, steps: 388\n",
"Episode 65: reward: 376.000, steps: 376\n",
"Episode 66: reward: 385.000, steps: 385\n",
"Episode 67: reward: 342.000, steps: 342\n",
"Episode 68: reward: 382.000, steps: 382\n",
"Episode 69: reward: 418.000, steps: 418\n",
"Episode 70: reward: 351.000, steps: 351\n",
"Episode 71: reward: 354.000, steps: 354\n",
"Episode 72: reward: 355.000, steps: 355\n",
"Episode 73: reward: 355.000, steps: 355\n",
"Episode 74: reward: 390.000, steps: 390\n",
"Episode 75: reward: 384.000, steps: 384\n",
"Episode 76: reward: 344.000, steps: 344\n",
"Episode 77: reward: 384.000, steps: 384\n",
"Episode 78: reward: 338.000, steps: 338\n",
"Episode 79: reward: 375.000, steps: 375\n",
"Episode 80: reward: 380.000, steps: 380\n",
"Episode 81: reward: 353.000, steps: 353\n",
"Episode 82: reward: 381.000, steps: 381\n",
"Episode 83: reward: 350.000, steps: 350\n",
"Episode 84: reward: 329.000, steps: 329\n",
"Episode 85: reward: 319.000, steps: 319\n",
"Episode 86: reward: 370.000, steps: 370\n",
"Episode 87: reward: 390.000, steps: 390\n",
"Episode 88: reward: 382.000, steps: 382\n",
"Episode 89: reward: 395.000, steps: 395\n",
"Episode 90: reward: 334.000, steps: 334\n",
"Episode 91: reward: 392.000, steps: 392\n",
"Episode 92: reward: 393.000, steps: 393\n",
"Episode 93: reward: 359.000, steps: 359\n",
"Episode 94: reward: 370.000, steps: 370\n",
"Episode 95: reward: 363.000, steps: 363\n",
"Episode 96: reward: 349.000, steps: 349\n",
"Episode 97: reward: 338.000, steps: 338\n",
"Episode 98: reward: 387.000, steps: 387\n",
"Episode 99: reward: 367.000, steps: 367\n",
"Episode 100: reward: 425.000, steps: 425\n",
"Average score over 100 test games: 365.67\n"
]
}
],
"source": [
"# Evaluate the agent on 100 new episodes.\n",
"scores = sarsa.test(env, nb_episodes=100, visualize=False)\n",
"\n",
"print('Average score over 100 test games: {}'.format(np.mean(scores.history['episode_reward'])))"
]
},
{
"cell_type": "code",
"execution_count": null,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": []
}
],
"metadata": {
"anaconda-cloud": {},
"kernelspec": {
"display_name": "Python [default]",
"language": "python",
"name": "python3"
},
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.5.4"
}
},
"nbformat": 4,
"nbformat_minor": 2
}
|
PROGRAM DESCRIPTION: XL tape heads have been supplied by Telex for the past 10
years and are still supplied as original equipment on our premium models.. These long
wearing heads have the unique ability to be re-manufactured to like-new condition, even
after they have been badly worn. This is accomplished by removing the four tiny screws
from the back of the head and separating the front portion of the head. A new front
section is installed using specialized alignment equipment. Often, it is not necessary to
totally replace the front of the heads. They can be restored to original specifications by
lapping and polishing to remove scratches and slight wear grooves. For either process the
worn head must be returned directly to the head manufacturer. Refinished Heads: The surface of the heads will be lapped and polished.
Upon completion, the head will meet all electrical and magnetic specifications of a new
head and will contain more than 50% of the original wear depth. A small dot will be
drilled in the front section so it can be distinguished from re-manufactured heads. See
Figure #1. Re-manufactured Heads: New front section installed., guarantying the same
wear depth and specifications as a new head..
RETURN PROCEDURE: Return the XL heads requiring service to the following
address. If possible, please list the quantity and part numbers of each head. The heads
will be refinished if the wear depth permits and re-manufactured if the wear depth is too
deep. You will be charged accordingly and heads will be returned COD unless previous
arrangements are made. Note: Exact prices are available, on request, after the heads have
been inspected. Note : If you want all heads to be re-manufactured (not refinished),
please request this service.
Note: Electro Magnetic Components (EMC) is the
manufacturer of XL heads. Tellus is their representative. Each is an independent company.
Although we recommend their work, Telex is not responsible for the action of either
company.
Table #1: XL Head Part Numbers
The following heads qualify for the head rebuilding program:
55800-000*
55801-000
55801-001
55802-000*
55802-002
55803-000*
55805-000*
55807-000
55813-000
55813-001
55814-000
55814-001
55815-000
55815-001
*These heads can be refinished but cannot be re-manufactured.
NOTE: Heads which have broken pins or open channels do not qualify for the
head rebuilding program.
New heads should be ordered directly from Telex if replacement is
necessary
NOTES:
This program supersedes Service Bulletin #114 and all other head refinishing programs
offered by Telex. This change is made to increase the speed and flexibility of the XL head
rebuilding program.
Electro Magnetic Components (EMC) and Tellus Company, Ltd. are the only authorized
refinishing or re-manufacturing agents for XL heads. New heads are not available through
either of these companies.
New heads are available only from Telex, authorized Telex dealers or authorized Telex
service stations.
Heads which have been resurfaced by companies other than EMC or Tellus may not qualify
for the rebuilding program described. |
Background
==========
Secretory phospholipases A~2~ are widely distributed as toxic components of snake venoms. A number of snake species express endogenous snake blood phospholipase A~2~ inhibitors (sbPLIs). This kind of molecules was first described in venomous snakes with the primary function of self-protection against an eventual presence of snake venom PLA~2~ (svPLA~2~) in their own blood stream \[[@B1], [@B2]\]. According to the presence of known domains from mammal proteins - C-type lectin-like, tandem leucine-rich repeats (LRRs), or three-finger motifs - sbPLIs were grouped into alpha (α), beta (β) or gamma (γ) structural classes, respectively \[[@B3]\]. Comparable inhibitors were later identified in a number of non-venomous species \[[@B4], [@B5], [@B6], [@B7], [@B8], [@B9]\]. Whether venomous or not, some snake species express sbPLIs belonging to up to three different structural classes simultaneously \[[@B3], [@B7], [@B10], [@B11]\].
SbγPLIs are the most widely distributed inhibitors among elapid and viperid species from the Old and New World \[[@B12], [@B13], [@B14]\]. Concerning non-venomous snakes, as far as we know, until now sbγPLIs were solely purified from Asian species \[[@B4], [@B5], [@B6], [@B7], [@B8], [@B9]\]. With that in mind, we investigated the presence of this kind of inhibitor in *Boa constrictor* - a non-venomous tropical snake - popularly known as *jiboia*. We identified a functional sbγPLI, cloned the encoding gene from liver tissue and structurally characterized the deduced protein. The sbγPLI was named BcNF by analogy with CNF (*Crotalus* neutralizing factor), a prototype of this class of inhibitors previously isolated from the South American rattlesnake, *Crotalus durissus terrificus* \[[@B15], [@B16]\].
Methods
=======
*Boa constrictor* blood plasma and liver tissue collection
----------------------------------------------------------
Heparinized blood plasma and liver tissue fragments were collected from a *Boa constrictor* specimen captured in the municipality of Contagem (19º55\'54\" S, 44º03\'13\" W), in the Brazilian state of Minas Gerais. The specimen was kept in captivity in the Serpentarium of Ezequiel Dias Foundation until death by natural causes. The whole blood was collected immediately after the animal death, centrifuged for plasma separation and clarified using a 0.22-µm microfilter. The total protein content was estimated by spectrophotometry readings at 280 nm. One optical density unit was considered to be equivalent to 1 mg/mL of protein. Liver fragments were collected in DEPC-treated tubes and quickly frozen in liquid nitrogen. Whenever applicable, blood plasma and tissue liver from *C. d. terrificus* specimens were used as reference.
Fractionation of *B. constrictor* blood plasma
----------------------------------------------
Five hundred microliters of *B. constrictor* blood plasma were diluted to 10 mL with 25 mM Tris-HCl, 0.1 M NaCl pH 8.7 (buffer A) and dialyzed against the same buffer to ensure ionic equilibrium. After centrifugation to remove any insoluble material, the supernatant was loaded into an anion exchange column (Hitrap QFF 1mL, GE HealthCare). Protein elution was performed with a linear gradient of 25 mM Tris-HCl, pH 8.7, containing 2.0 M NaCl (buffer B), under a flow rate of 1 mL/min. Fractions with inhibitory activity (1 mL each) were pooled, 4-fold diluted with a saturated ammonium sulfate (SAS) solution and loaded into hydrophobic interaction columns connected in series \[four columns HiTrap Phenyl FF 5 mL (low sub) column, GE HealthCare\]. Elution was performed with a decreasing salt gradient under a flow of 5 mL/min. Total protein concentration was estimated by optical density readings of the eluted fractions at 280 nm.
Inhibition of PLA~2~ activity
-----------------------------
The crude venom of *C. d. terrificus* was used as a source of PLA~2~. Increasing volumes of snake blood plasma with known protein concentration were preincubated with a fixed concentration (50 μg/mL) of *C. d. terrificus* venom for 30 min at 37°C. The same procedure was applied to purified fractions, after dialysis against 25 mM ammonium formats, pH 6.5, whenever necessary. Residual PLA~2~ activity was evaluated by measuring the clearing halos (in mm) of hydrolysis in agar gels with incorporated hen egg yolk suspension \[[@B17]\]. Negative (PBS) and positive (no blood plasma) controls were run in parallel. Inhibition curves were constructed by plotting the halo diameter against protein concentration in logarithm scale. Data were analyzed by linear regression using least squares method in the Graph Prism 6.0 for Mac OS X (GraphPad software Inc., California). Curve limits were calculated with 95% of confidence level. Specific activities were represented by curve slopes and expressed by mean ± S.D. Whenever applicable, regression line slopes were statistically compared in pairs.
SDS-PAGE and western blotting
-----------------------------
*B. constrictor* blood plasma and purified BcNF were analyzed by SDS-PAGE in a 15% homogeneous or in an 8-25% gradient Phast® gel (Phast System®, GE HealthCare). Western blotting was revealed with rabbit anti-CNF IgG (0.5 mg/mL), followed by commercial anti-rabbit IgG-peroxidase antibody (A0545, Sigma) at a 1:5000 dilution. The color reaction was developed with DAB (3,3\' diaminobenzidine tetrahydrochloride) in the presence of H~2~O~2~.
RNA extraction and cDNA synthesis
---------------------------------
Total RNA was isolated from about 50 mg of *B. constrictor* liver tissue using Trizol® (Invitrogen, USA) following the manufacturer's instructions. RNA integrity was analyzed by gel electrophoresis in a 0.8% agarose gel using TBE (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0) as running buffer. RNA bands were visualized under UV light, after staining with ethidium bromide. After cDNA synthesis using 2 to 5 (g of total RNA and oligo(dT)12-18 primer (First-Strand Synthesis kit, Invitrogen, USA), polymerase chain reactions were carried out with specific oligonucleotides based on the primary structure of CNF \[[@B15]\]: 3'CGCTCATGTGACTTTTGTCAC5' (sense, amino-terminus), 3'TCAGAGGCTTGCCAATCTGATG5' (antisense, carboxy-terminus). A housekeeping gene (β?actin) was PCR-amplified in parallel, in the presence of adequate oligonucleotides.
Fresh PCR products were cloned into the pGEM-T vector (Promega, USA) following the manufacturer's instructions. Insert-containing clones were isolated after PCR screening of transformed NM522 *E. coli.* Negative control contained no DNA. Amplified products were analyzed by electrophoresis in 1.0 % agarose gels in TBE buffer, in the presence of ethidium bromide. DNA from three positive clones were completely sequenced by the dideoxy chain termination method \[[@B18]\] on an automated ABI Prism 310 Genetic Analyzer (Perkin Elmer Applied Biosystems, USA) with the Big Dye Terminator Cycle Sequencing Ready Reaction (Perkin Elmer Applied Biosystems, USA). M13 forward and M13 reverse oligonucleotides were used as primers.
The cycling conditions were 3 min at 94°C, 35 cycles of 30 sec at 94°C, 30 sec at 55°C and 1 min at 72°C, followed by an extension period of 5 min at 72°C in a TC412 thermocycler (Techne).
Primary/secondary structure predictions and multiple alignment
--------------------------------------------------------------
Three complete reads in both directions were assembled and aligned against each other. The consensus sequence was used to deduce the primary structure and main basic properties of BcNF. The secondary structure was predicted using the Chou Fasman algorithm. Multiple sequencing alignments with primary structures of other sbγPLIs were performed using the ClustalW algorithm and a Gonnet's similarity matrix was subsequently generated. Inclusion criterium for sbγPLIs was the access to chemically determined or deduced primary structures in public data bases. For species with two or more sequence deposits due to isoforms, calculated consensus was taken as representative of the inhibitor. Signal peptides were removed, whenever necessary. The sbγPLIs from the following snake species were aligned: *Bothrops alternatus* (ABV91326/7), *Bothrops erythromelas* (ABV91328/9), *Bothrops jararaca* (ABV91330/1), *Bothrops jararacussu* (ABV91332/3), *Bothrops moojeni* (ABV91332/5), *Bothrops neuwiedi* (ABV91336/7), *Crotalus durissus terrificus* (AAA19162), *Elaphe climacophora* (BAH47550), *Elaphe quadrivirgata* (BAA83078), *Gloydius brevicaudus* (formerly *Agkistrodon blomhofii siniticus*) (BAA86970), *Lachesis muta* (AAR04437/8), *Malayopython reticulatus* (formerly *Python reticulatus*) (AAF73945), *Notechis scutatus* (CAB56615/6/7), *Oxyuranus microlepidotus* (AAF23784), *Oxyuranus scutellatus* (AAF23781), *Protobothrops flavoviridis* (formerly *Trimeresurus flavoviridis*) (BAA24502)*, Protobothrops elegans* (BAJ14719/20/21), *Pseudonaja textilis* (AAF23783), *Sinonatrix annularis* (JN975878)*.* All the procedures were performed using the MacVector 16.0.10 software (Mac Vector Inc., USA) with default parameters.
Results
=======
Identification and purification of BcNF from *B. constrictor* blood plasma
--------------------------------------------------------------------------
First, the blood plasma of *B. constrictor* was tested for inhibition of *C. d. terrificus* venom PLA~2~ ([Fig. 1](#f1){ref-type="fig"}). Inhibition was observed, although to a lesser extent when compared to *C. d. terrificus* blood plasma (positive control). Specific activities for PLA~2~ inhibition were: -1.112 ± 0.1075 and -2.307 ± 0.1498 for *B. constrictor* and *C. d. terrificus* blood plasma, respectively. These activities were statistically different (*p* \< 0.0001). PLA~2~ inhibition activity was significantly lower for *B. constrictor* blood plasma.
Figure 1Inhibition curves of PLA~2~ activity of *C. d. terrificus* venom by the blood plasma of *Boa constrictor* (white dots). The blood plasma of *C. d. terrificus* was used as reference (black dots). Curve equations: y = (-1.112 ± 0.1075)x + (17.22 ± 0.3193) for *B. constrictor* and y = (-2.307 ± 0.1498)x + (17.45 ± 0.4478) for *C. d. terrificus*, with determination coefficient (R^2^) of 0.9145 and 0.9546, respectively. The 95% confidence intervals of the best fit curves are indicated by dashed lines.
Following, we investigated whether the observed inhibition could be due to the presence of a sbγPLIs. Western blotting revealed the presence of a CNF-like molecule in the blood plasma of *B. constrictor*. Two main protein bands were recognized by anti-CNF antibodies ([Fig. 2](#f2){ref-type="fig"}), with apparent molecular masses roughly corresponding to glycosylated (ng) and non-glycosylated (ng-) monomers. A fainter band was present with mol. mass of possible dimers (2ng/2ng-). The result indicated the presence of a sbγPLIs, named BcNF, in the blood plasma of *B. constrictor*.
Figure 2(A) SDS-PAGE 15% after staining with Coomassie Blue and (B) Western blotting revealed with anti-CNF IgG. Lanes: MM - molecular marker (in kDa) (SeeBlue Plus 2 Pre-stained Protein Standard, Invitrogen); 1 - CNF (20 µg); 2 - *C. d. terrificus* blood plasma (80 µg); 3 - *B. constrictor* blood plasma (80 µg). The arrows indicate non-glycosylated monomer (ng-), glycosylated monomer (ng) and possible dimers (2ng/2ng-).
BcNF was isolated from *B. constrictor* blood plasma using two chromatographic steps: an ionic exchange followed by a hydrophobic interaction. The eluted fractions were assayed for PLA~2~ inhibition ([Fig. 3](#f3){ref-type="fig"}). Fractions from the second purification step presenting inhibitory activity were combined and submitted to electrophoresis and Western blotting using anti-CNF IgG. A CNF-like molecule (BcNF) was mostly eluted with 100% of ultrapure water ([Fig. 4](#f4){ref-type="fig"}). BcNF and CNF (positive control) at varying concentrations were assayed for PLA~2~ inhibition ([Fig. 5](#f5){ref-type="fig"}). Calculated specific activities were -1.344 ± 0.1705 and -4.797 ± 0.3434 for BcNF and CNF, respectively. These activities were statistically different (*p* \< 0.0001). BcNF inhibited PLA~2~ at a significant lesser extent compared to CNF.
Figure 3Purification of BcNF from *B. constrictor* blood plasma. **(A)** Anion-exchange and **(B)** hydrophobic interaction chromatograms. Elution gradients are indicated by dotted lines. PLA~2~ inhibitor-containing fractions are indicated by horizontal bars.
Figure 4(A) SDS-PAGE in 8-25% gel after silver staining and (B) Western blotting developed with anti-CNF IgG. PC: positive control (CNF). Lanes are numbered on top according to percentages of eluent B (ultrapure water) in the hydrophobic interaction chromatography.
Figure 5Inhibition curves of PLA~2~ activity of *C. d. terrificus* venom by BcNF isolated from *B. constrictor* blood plasma (white dots). CNF from *C. d. terrificus* snakes was used as positive control for PLA~2~ inhibition (black dots). Curve equations: y = (-1.344 ± 0.1705)x + (13.50 ± 0.4235) for BcNF, and y = (-4.797 ± 0.3434)x + (19.13 ± 0.4478) for CNF, with determination coefficient (R^2^) of 0.8860 and 0.9606, respectively. The 95% confidence intervals of the best fit curves are indicated by dashed lines.
BcNF cloning from *B. constrictor* liver tissue
-----------------------------------------------
The integrity of extracted RNA from *B. constrictor* liver tissue was confirmed by the unique presence of characteristic bands corresponding to 18S and 28S ribosomal RNAs (data not shown). After RT-PCR in the presence of specific primers for CNF, an amplicon of about 545 bp confirmed the encoding of a CNF-like protein in the liver tissue of *B. constrictor* ([Fig. 6](#f6){ref-type="fig"}). The DNA fragment was cloned, purified and sequenced for further analysis.
Figure 6Electrophoresis of RT-PCR products after amplification of liver tissue with specific primers for CNF (left side) or β-actin (right side). M: molecular marker 1 kb DNA ladder (Gibco-BRL). Lanes 1 and 4: *B. constrictor* liver; lanes 2 and 6: *C. d. terrificus* liver (reference); lanes 3 and 7: negative control (no DNA); lane 5: no reverse transcriptase in the reaction.
Deduced primary structure and chemical properties predictions of BcNF
---------------------------------------------------------------------
The deduced primary sequence of mature BcNF was compared to that of CNF. Both proteins are composed of 181 amino acids, including 16 conserved cysteines and a single putative N-linked carbohydrate site at Asn^157^. Fourteen amino acid substitutions were noted in BcNF when compared to CNF, one of them (R^93^/K^93^) within a segment proposed before for sbγPLIs interaction with PLA~2~ ([Fig. 7](#f7){ref-type="fig"}). Basic properties of BcNF and CNF are summarized in [Table 1](#t1){ref-type="table"}.
Figure 7Alignment of the deduced primary structure of BcNF (sbγPLI from *B. constrictor*) and CNF (sbγPLI from *C. d. terrificus*). Identical amino acids are in grey background. Amino acid substitutions are in white background. The decapentapeptide Q^84^PFPGLPLSRPNGYY^98^ is indicated by a continuous black arrow above the numbering line.
Table 1Comparison of basic properties of BcNF (sbγPLI from *B. constrictor*) and CNF (sbγPLI from *C. d. terrificus*)PropertyBcNFCNFMolecular mass (Da)20074.5720058.69Isoelectric point (pI)5.515.55Composing amino acidsTotal (no.)181181Chemical character (%)Non-polar30.430.9Polar43.042.4Acidic13.213.3Basic13.313.3
Amino acid substitutions, in general, lead to a decrease in the number of α-helixes from three in CNF to one in BcNF, besides a displacement of beta sheets in the predicted secondary structures of the proteins ([Fig. 8](#f8){ref-type="fig"}).
Figure 8Secondary structure predicted for BcNF (top) compared to CNF (bottom). The differences are indicated by arrows on top of BcNF structure, using the same color as in the structural diagram.
Multiple sequence alignment of BcNF and other sbγPLIs
-----------------------------------------------------
The deduced primary sequence of BcNF was multiply aligned with sbγPLIs from venomous and nonvenomous snakes from Asia, Australia and Latin America (available as [Additional file 1](#suppl1){ref-type="supplementary-material"}). A similarity matrix was generated (available as [Additional file 2](#suppl2){ref-type="supplementary-material"}) and the identity scores (ISs) were graphically represented ([Fig. 9](#f9){ref-type="fig"}). For BcNF and sbγPLIs from Latin American pit vipers, most ISs were within the last decile (90-100%). ISs above 80% were obtained for Asian viperid snakes. On the other hand, when BcNF was compared to sbγPLIs from non-venomous species from Asia, the ISs were below 70%. ISs below 70% were also obtained for Elapidae snakes.
Figure 9Graphical representation of the identity scores (ISs) obtained in Gonnet's similarity matrix after multiple alignment of the deduced primary structure of BcNF with known sbγPLIs. Black/white circle: Colubridae, white triangle: Elapidae, white circle: Viperidae, black rectangle: Pythonidae.
Discussion
==========
*Boa* is a Neotropical genus of snakes that occurs almost continuously from southern South America through to northern Mexico \[[@B19]\]. Historically recognized as monotypic, recent data based on the distinct morphological traits, color patterns exhibited by these snakes and the wide diversity of ecosystems they inhabit, collectively suggest that the genus contains multiple species \[[@B20]\]. In Brazil, *B. constrictor* (*sensu lato*) can be found all over the country, except in the extreme south \[[@B21]\]. It is an aglyphous species, devoid of venom or Duvernoy's glands. Similarly to other henophidian snakes (boas, pythons and their kin), *B. constrictor* uses constriction to subdue and kill a wide range of prey - including lizards, birds and mammals - through an interesting modulated process mediated by the victim's heartbeat \[[@B22]\]. Apparently, there is no need of an inhibitor for self-protection against toxic svPLA~2~.
The detection of sbPLIs in non-venomous snake species is not a novelty. The first sbγPLIs was isolated from *E. quadrivirgata* \[[@B6]\]. The finding was later attributed to feeding habits of the species on venomous snakes \[[@B7]\]. However, another sbγPLI - named PIP for phospholipase A~2~ inhibitor from *Python* - was soon described in the non-venomous and non-ophiophagus species *Malayopython reticulatus* (formerly *Python reticulatus*) \[[@B8]\]. Since then, a number of sbγPLIs were detected in colubrid from Asia: *Dinodon rufozanatum* \[[@B5]\], *Elaphe carinata* \[[@B5]\], *E. climacophora* \[[@B7]\], *E. rufodorsata* \[[@B5]\], *E. teniura*, *Macropisthodon rudis* \[[@B9]\], *Synonatrix annularis* \[[@B4]\], and *Zaocys dhumnades* \[[@B5]\], in addition to xenodermatid *Achalinus rufescens* \[[@B5]\]. A structurally-related PIP homolog was also described in the non-venomous rock python (*P. sebae*) from Africa, although with poor PLA~2~ inhibition activity \[[@B23]\]. Regarding non-venomous snakes living in the American continent, studies are lacking on any sbPLI.
*B. constrictor* inhibition of PLA~2~ was lower than that of *C. d terrificus* blood plasma. Similarly, BcNF was less active than CNF. Our results are in accordance with those described for *E. climacophora* and *E. quadrivirgata.* Respective sbγPLIs were detected at higher amounts in the former, and justified by the ophiophagous habits of the species \[[@B7]\]. It is important to note that, in addition to sbγPLIs, those Elaphe species express sbα? and sbβPLIs simultaneously in the circulating blood. We used antibodies developed against CNF to search for sbγPLI in *B. constrictor*. The detection of inhibitors from other structural classes is a possibility that cannot be discarded.
BcNF is highly similar to CNF, with 14 substitutions in a total of 181 amino acids and an IS of about 90%. The molecular masses of the non-glycosylated monomers, calculated from amino acid compositions, are very close ([Table 1](#t1){ref-type="table"}). Band migrations in gel electrophoresis also indicated similar apparent molecular masses for monomers and oligomers ([Fig. 7](#f7){ref-type="fig"}). Like CNF, BcNF is composed by a mixture of non-glycosylated (20 kDa) and glycosylated (22-24 kDa) monomers. For CNF, which is the main subject of study in our lab, the proportion between non-glycosylated and glycosylated varies according to the preparation. The sample loaded in SDS-PAGE ([Fig. 2](#f2){ref-type="fig"}) was mostly non-glycosylated. However, it has been shown that the carbohydrate moiety is not essential for PLA~2~ inhibition by CNF \[[@B24]\]. The same might be true for BcNF. The tendency for oligomerization might be a shared property, too. In fact, the 16^th^, 113^th^, 132^nd^ and 166^th^ tyrosinyl residues, which were previously suggested to form the interface between monomers in the oligomerization of CNF, are maintained at the same positions in BcNF. These residues might be involved in the oligomerization of the latter also. BcNF was only tested against svPLA~2~ from *C. d. terrificus* venom, but the possibility of inhibition of other svPLA~2~ cannot be discarded. The decapentapeptide Q^84^PFPGLPLSRPNGYY^98^, which was previously proposed to be the best consensus motif possibly involved in the sbγPLIs interaction with PLA~2s~ is maintained in BcNF. The only amino acid replacement was conservative (R^93^/K^93^).
Interestingly, BcNF appeared more closely related to sbγPLIs from Latin American pit vipers, and from Asian pit vipers to a lesser extent, than to those from non-venomous snakes from Asia described so far.
Conclusion
==========
A functional sbγPLI (BcNF) was described, for the first time, in the blood plasma of *B. constrictor,* a non-venomous species from America. BcNF displayed higher primary identity with sbγPLIs from pit vipers than with sbγPLIs from non-venomous species from Asia. Even with a growing number of sbγPLI identifications in the last years, the physiological role played by these proteins in non-venomous snake species remains to be clarified.
Abbreviations
-------------
IS: identity score; LRRs: tandem leucine-rich repeats; SAS: saturated ammonium sulfate; sbPLI: snake blood phospholipase A~2~ inhibitor; svPLA~2~: snake venom phospholipase A~2~.
The authors would like to thank A. C. Valentim, L. A. Melo, R. M. Lima, P. S. Almeida for the technical support and the undergraduate students V. L. R Perché and M. P. Romualdo for their contribution.
**Availability of data and materials:** All data extracted and or analyzed during this study are included in this published article.
**Funding:** C. L. Fortes-Dias is a productivity fellow from the State of Minas Gerais Research Foundation (FAPEMIG), a Brazilian funding agency.
**Ethics approval:** Not applicable.
**Consent for publication:** Not applicable.
The following online material is available for this article:
Additional file 1.Multiple alignment of sbγPLIs.Click here for additional data file.
Additional file 2.Gonnet's similarity matrix obtained after multiple sequence alignment of sbγPLI from data bases, except for *B. constrictor.*Click here for additional data file.
[^1]: **Competing interests:** The authors declare that they have no competing interests.
[^2]: **Authors\' contributions:** CLFD contributed to the study conception and design, data interpretation, article drafting and writing. DHFM, RPB, GSS (undergraduate students) were responsible for data acquisition and interpretation, the literature review and article drafting. PLO was a contributor in data acquisition and interpretation, and article drafting. All authors read and approved the final manuscript.
|
filter by Category
"I've been listening to the Catholic Answers Live podcast for about a year now. Today I heard Patrick Coffin say you were reaching all nations, and I felt I had to confirm it! I love your show and I learn every day. Thank you very much!”
When I go surfing on the Internet, I have a wide range of web sites I visit—including strange sites maintained by eccentrics at both ends of the Catholic spectrum. I do this because I have found that you can find the most interesting things in the craziest places. For example, the other day I was browsing through a sedevacantist site.
In the midst of headlines that warned of impending doom on all fronts of the Church, I found a link to an English translation of an essay written in the...
In recent weeks, I have been seeing alarms raised by faithful Catholics over controversy in the Church. Most recently the Catholic news outlets have been reporting that Cardinal Walter Kasper gave a speech on the family in February to the consistory called by Pope Francis. Among other things, the Cardinal speculated on the conditions under which the Church could offer the sacraments of...
In my last blog post I examined the first of the four notes or marks of the Church—namely, unity. Today I would like to briefly examine the second defining mark or quality of the Church: holiness.
For many, the Catholic Church’s claim of holiness is quite provocative. After all, how can the Catholic Church possibly claim to be holy when her membership is made up of sinners? How can she claim to be...
This time of year wedding invitations start showing up in mailboxes and Catholics begin facing difficult decisions about whether or not to attend the weddings of lapsed Catholics. At Catholic Answers, we hear from the relatives and friends of fallen-away Catholics who are planning their weddings outside the Church. What is a serious Catholic to do?
The law of the Church
When any Catholic—even a lapsed one—gets married, he must have a Catholic wedding ceremony... |
Aug 28 Outdoor Advertising Abundance in Romania
Arriving in Bucharest I was surprised to find outdoor advertising everywhere – sophisticated with videos, electronics, and 3D spectaculars. Here are examples, the Air France jet above a subway entrance, a Ted bus shelter, and a slice of a busy intersection. |
OS052. Preeclampsia candidate genes differentially methylated in maternal leukocyte DNA.
Altered gene expression in biomarkers associated with preeclampsia/ eclampsia (PE) could be explained in part by epigenetic phenomena such as variable methylation We sought to characterize the methylation profiles of candidate genes known to be associated with the preeclampsia phenotype in maternal leukocyte DNA in preeclamptic cases and normotensive controls at the time of delivery. Methylation profiles of maternal leukocyte DNA were evaluated in 14 PE cases and 14 normotensive controls. Subjects were nulliparous, non-smokers, age and BMI matched. Genomic DNA was run on a commercially available beadchip human methylation assay. Mean methylation at sites in genes from a well-defined preeclampsia gene set present on our platform were compared using a t-test. QC confirmed high correlation of replicates and detection p values >95%. Of the 39 genes in the "preeclampsia gene set", 34 were present on our platform with 73 CpG sites. Seven out of 34 tested in this gene set had differential methylation with p value <0.05. Two genes were found to be less methylated in PE which may result in more expression. AGT (-3%;p= 0.027), angiotensin, is a potent vasoconstrictor with exaggerated effect in PE. DDAH1 (-6%;p=0.031) is involved in nitric oxide generation, via asymmetric dimethylarginine (ADMA), levels of which are known to be altered in PE. Five genes were more methylated and therefore may correlate with reduced transcription. CALCA (+4%;p=0.001) forms calcitonin-gene related peptide, a potent vasodilator decreased in the PE . F5 (+1%;p=0.016), coagulation Factor V, is a target of activated protein C, and increased resistance related to genetic variants (Factor V Leiden) or pregnancy have been associated with PE. MTHFR (+3%;p=0.041) regulates homocysteine; high levels are associated with a 20X increase in risk for PE. POMC (+4%;p=0.014) produces beta endorphin and through ACTH stimulates aldosterone, both decreased in PE. PTGS2 (+3%;p=0.03) is part of the COX 2 prostaglandin pathway involved in inflammation. Differential methylation of these 7 genes may affect transcription and explain known alterations in gene product associated with PE. |
Baiyi Zhuan
The Baiyi Zhuan () is a description of the Dai polity of Mong Mao in 1396 written by two envoys, Qian Guxun and Li Sicong, sent by the Ming court in China to resolve conflicts between the Ava Kingdom in Burma and Mong Mao, also known as Luchuan-Pingmian. The description includes the history, geography, political and social organization, customs, music, food, and products of the region (Sun Laichen, 1997). Ming Shilu describes the work:
References
Jiang Yingliang (1980) Baiyi zhuan jiaozhu [Annotated version of the Baiyi zhuan], Kunming: Yunnan Renmin Chubanshe.
Sun Laichen (1997) Chinese Historical Sources on Burma: A Bibliography of Primary and Secondary Works," The Journal of Burma Studies, Volume 2: Special Issue, 1997, pp. 1-116.
Wade, Geoff (1996) "The Bai Yi Zhuan: A Chinese Account of Tai Society in the 14th Century," 14th Conference of the International Association of Historians of Asia (IAHA), Chulalongkorn University, Bangkok, Thailand. (Includes translation of (Jiangliang, 1980), a copy can be found at the Thailand Information Center at Chulalongkorn Central Library).
Category:Chinese history texts
Category:14th-century history books
Category:History of Myanmar
Category:Ming dynasty
Category:Tai history |
"¶ ELECTRONIC MUSIC ¶" "GEORGIA This turkey looks like the mafia got a hold of it." "JUDY It's how the Amish do it." "I saw it on YouTube." "GEORGIA The Amish post on YouTube?" "That is crazy." "JUDY I know, times have changed [LAUGHTER]." "Wait, this is, this is hell." "I, I never gave my mother enough credit for doing this production year after year." "I guess I was already drinking by the time everything was done." "It was like this magical, mystical meal appeared [LAUGHTER]." "And Bill always did the cooking, so" "GEORGIA Yeah, that" " Thanksgiving is fun for everyone but the chef." "True that." "ZOE Mom has been brining the turkey for a week." "It's gonna be more like Passover than Thanksgiving." "LILY Oh, what'd you say?" "I just can't believe that our mother, a woman who's consistently flummoxed by the microwave and who has never made a piece of unburnt toast, is cooking for 15." "Do you remember that one time when she made that big pie with that huge dome." "And then dad tapped on it and the whole thing collapsed." "[LAUGHTER]" "Oh, it was so tragic." "No, it was funny." "I like his new girlfriend." "She's cool." "But it's like mega awkward when she treats me like we're besties." "Totes, that's so off." "And she's always posting on my Facebook and liking things." "[LAUGHTER] Why don't you block her?" "It would make things kind of weird." "GEORGIA I do not trust those instructional videos." "I followed one once and seriously almost blinded myself trying to apply liquid eye liner." "JUDY Are you kidding?" "GEORGIA Bad idea." "JUDY That's terrible" "Oh look, there's my wayward husband." "Why did you guys drive separately?" "He had to drop something off on his way over here." "For work, on Thanksgiving?" "Who knows where he goes or what he does." "ZOE I wonder why she's unfriended me?" "LILLY Well you live far away." "She doesn't even know you yet." "I guess it's better that way." "Mom would be crazy jealous." "She already puts me in the middle enough as it is." "Wait, so mom can see what's on my Facebook?" "Yeah, she's got like this secret account." "She's like the J. Edgar Hoover of social media." "[LAUGHTER] I'll show you." "GEORGIA Really?" "An hour." "RICK No, no, no, it's not been an hour." "Look, I had to park like a mile away." "That's - - there's trees in this neighborhood, everywhere." "Your obsession with sap is unnerving." "Hey, hey, hey, hey." "Happy Thanksgiving." "[BIRD CHIRPING NOISE]" "GEORGIA What is that weird sound?" "Uh, I don't know, I downloaded some new ring tones," "That's probably what it is." "It sounds like a dying sparrow." "I'll set it to silent." "Will you set it to off?" "Okay, happy now?" "I'm gonna go help with the buffet table, want to help me?" "Sounds exciting." "I'm gonna make a cocktail instead." "Hey Kimmy." "KIMMY Oh, hey Rick." "RICK Hey can you believe the, uh, Vuelta, Contador and Froome battling it out?" "It should be the tour, right?" "KIMMY Right." "GEORGIA Sounds like you guys are having fun." "Kimmy, he's on restriction, no cell phone for Rick." "No cell phone for Rick." "KIMMY (OS) Got it." "GEORGIA (OS) No cell phone" "I will keep an eye on him for Rick" "KIMMY (OS) So Rick, uh, are, are you going to the Giro in Italy or?" "Yeah, yeah, I'll be in Italy for the Giro." "KIMMY Wow." "I'll miss the tour in France, though, but I'm gonna go to the" "Vuelta in Spain for sure." "KIMMY Wow." "RICK Yeah." "[INDISTINCT CHATTER ON PORCH]" "DYLAN Oops." "JESSE So I'm, I'm chatting with this guy on Bottom Feeder for like three weeks and then he just disappears." "DYLAN Bottom Feeder's bull shit." "People just want to chat and chat and chat and chat and chat." "It's a bottomless chat feeder." "JESSE Okay yes, but I just felt rejected, you know." "DYLAN It's not real rejection." "It's more of a pseudo rejection." "We just had so much in common." "We both loved" "Miles Davis, Dry Rieslings and spontaneous swimming and then poof he just disappears." "I know that this sounds horrible." "But" "I, I sort of hope that something awful happened to him, or maybe he died." "Because otherwise he just never wrote back to me." "DYLAN Maybe he just met someone else" "JESSE Then why wouldn't he just say that?" "I mean is there no decorum left in the world?" "No manners?" "DYLAN Was he younger?" "JESSE A little, 18 years." "DYLAN Well the kids are used to that kind of interaction, it's normal to them." "It's all just virtual." "JESSE You're so much better at this than I am." "Oh my god," "I'm such a bad gay." "DYLAN I've only actually gone through with it a few times." "JESSE Right." "When is the last time that you actually met someone in person?" "DYLAN Some drug addict came over, started cutting coke on my Noguchi table." "JESSE Oh my god, poor Noguchi." "DYLAN Then he put his head on my chest and said the sound of my beating heart made him hard." "JESSE Yeah, I would take a serial killer blow job at this point." "Oh, Gold Unicorn?" "JUDY Hi, mom." "I left you a message on your voice mail on your cell but it's full." "I, I tried the house." "It's not working." "[LAUGHTER] I don't know why it's not working." "Yes, everything is under control." "I have mister turkey right here." "I brined it, yes, it's very briny." "All briny." "550." "I don't know, whatever." "Okay." "No, no, no, uh," "I, I don't need your help." "I don't. this year I am Sacajawea." "I know that she wasn't at the first Thanksgiving." "I was just making a little bit of a joke." "Okay, I will text her and, and make sure she does." "Okay, just, just get over here, I love you." "Okay, bye." "[Doorbell rings]" "JUDY Happy Thanksgiving." "SHANE Hello." "Oh, three horny mules." "Is that local?" "Uh, 98 points on, uh, Wine Enthusiast." "Oh." "Fabulous, thank you." "This is very nice." "Oh well thank you for noticing that." "Yes it's, uh, difficult to miss." "Kind of like your work." "Oh, I would have loved to have shared your work with my readers." "My former readers." "And speaking of work, is everyone okay with me doing the blog interviews and-?" "Oh yes, absolutely." "You know, I saw your show at Red Art three years ago." "And I thought it would have been amazing to be a part of one of your projects." "And here you are." "Well I hope it meets your expectations." "I'm sure it will." "Thanksgiving is a, it's a pretty foreign concept in Britain." "In England we just Christmas and Boxing Day so." "Box it " " I nev - - what is Boxing Day anyway?" "Oh, no one knows." "[LAUGHTER] you don't even know." "And, and I, and I want to remind you that this is the first time that I have attempted the entire Thanksgiving feast." "Oh well this is my first time trying to eat one." "So I'm just very grateful you invited me, you know, thank you." "I don't know where I would have, uh, ended up." "Well I'm so glad it's here." "Um, I'm gonna go back in to my work station." "Okay." "'Cause it's chaos in there." "And, um," "Rick is mixing drinks there at the bar." "RICK Yo." "JUDY (OS) And that's Kimmy SHANE (OS) Hello." "JUDY It's Shane, so." "SHANE Hi." "KIMMY Welcome, Shane." "JUDY See you in a minute." "SHANE Okay" "LILY (OS) So then he sends me this Snapchat of his erect ding-dong." "ZOE Classy." "LILY Like that's supposed to turn me on?" "ZOE [LAUGHTER] I wish I could say that I believe it gets different but apparently all penises have the same IQ." "College guys do that?" "Yeah, I have an entire collection of" "Valedictorian dicks." "No, I mean I like penises." "I'm all about penises, but so up close it's just way too natural history museum." "And no one needs to see balls close up." "Mm-hmm." "This poor guy texts me pictures of everything." "I mean its- he's such an over texter." "It's really annoying." "What does he over text about?" "ZOE:" "Fire hydrants, um, public parks, urban decay." "He sent me pictures of him winking, but it just like looks weird." "Hmm, what about you?" "I know you're having adventures." "Do you like anyone other than Snapchat boy?" "Mm, there's like this one guy." "Hmm?" "Yeah, he's a club promoter, so he's like in the scene." "Mm, he sounds fast." "Yeah, he's a little fast." "But I kind of like fast." "I think." "DYLAN (OS) Your sister couldn't have lost her job at a worse time." "JESSE (OS) I know, when it rains it pours." "And I haven't been on Linked In lately but the job market for art critics does not seem like it's exactly on fire." "Has she dated anyone since the divorce?" "JESSE:" "I mean she's on Date Me but I don't know, I think she she might just be on there for the validation." "You know, just to be liked and found attractive from her picture." "Well I know that feeling." "Even if ugly guys or fatties like me it still makes me happy." "Like, you know, this guy put himself out there for me, I'll always have options." "Yeah, no, having options is, is great." "But sometimes too many options is a problem." "Yeah." "SHANE (OS) Thanks." "RICK(OS) Cheers." "KIMMY Oh, Thank you." "RICK (OS) Of course." "So, uh, what's your field of reportage?" "KIMMY (OS) Oh, sports." "Really, I wouldn't have thought that." "Yeah, I guess you probably thought, uh, math meets." "or, uh, chess tournaments." "Maybe some classical music." "SHANE I just think it's a little bit unusual." "KIMMY (OS) I guess." "Do you have, uh, a sport that's your specialty?" "KIMMY (OS) it's LA, so basketball." "It's all about basketball." "Yeah, when you guys win there are riots." "It's terrifying." "KIMMY It's crazy." "I guess you're a friend of Judy's in the art world?" "Are you a dealer?" "[LAUGHTER], No, no, no, I'm a, I'm a multi-media artist." "I organize, uh, location-based group happenings." "I'm interested in how people interact in unusual, strange and heightened situations." "KIMMY Oh, Oh- uh, oh hey Rick, um, we haven't talked about the tour yet." "RICK:" "We'll do that over turkey." "You're busy." "KIMMY(OS) Okay, save me a seat?" "What were you saying?" "RICK Hey, hey, hey, Jesse, you little bitch." "JESSE [LAUGHTER] Rick." "Uh, Dylan, this is Rick." "He's married to my sister's friend Georgia and, uh, Rick this is my friend Dylan." "RICK Hey, Dylan." "DYLAN Nice to meet you." "DYLAN Happy Thanksgiving." "RICK Happy turkey day, gobble, gobble, and all that." "SHANE (OS) Well for example recently my team picked out, uh, this drunken American guy in a bar." "And then we all went in and pretended it was his birthday." "And, uh, eventually he started joining in even though it wasn't his birthday." "And then we uploaded the whole thing onto YouTube." "KIMMY So it wasn't his birthday, you just messed around with some innocent stranger?" "SHANE:" "Yeah, that's right [LAUGHTER]." "In, in a way." "But it was a, it was a jocular kind of messing." "KIMMY Hmm." "SHANE And there was, you know, some touching moments." "There was some real pathos." "JESSE(OS) So how's work?" "RICK It's pretty good I guess." "It is what it is." "Gets a little mundane, a little repetitive, a lot of the same issues come up." "DYLAN Like what kind of issues, what do you do?" "RICK Oh I work for Google." "DYLAN Really?" "That's awesome." "Google's like so now." "What do you do there?" "RICK Well I don't actually work for the big G, I work for a law firm that deals with, uh, first amendment copyright issues surrounding the Internet." "KIMMY Are you working on anything now?" "SHANE Yeah, I'm actually gonna upload this Thanksgiving to my blog." "KIMMY This dinner?" "SHANE Yeah, I thought it would be charming." "So you're gonna add comments and cutesy little pictures and things like that?" "Yeah." "Pictures," "SHANE and videos, image macros, gifts, vines, and interviews." "Actually," "I" " I'd love to ask you some questions if you are up for it?" "KIMMY Oh no." "I'm not used to being interviewed." "SHANE Uh, well I mean I can understand how you might not like the tables turned on yourself." "KIMMY Oh no it, it's not about the tables being turned, I mean." "SHANE Well there you go, and you might enjoy being on the answer side of the situation for once." "KIMMY Okay [LAUGHTER]." "Let's give it a shot for what you call art." "SHANE Okay, great." "KIMMY Okay great." "RICK (OS) Well I mean I guess there's a case where a guy has been posting pictures of his girlfriend, his ex-girlfriend, nude pictures." "And Google's named in the suit because he's using Google ads on his blog." "DYLAN Why would anyone do something so creepy?" "RICK That's a good question." "No telling what people do when they're pissed off." "JESSE Hashtag karma." "SHANE (OS) Kimmy's keen insight on all forms of sports are known to the legions of fans in, uh, this great city." "Uh, so Kimmy," "I want you to throw that keen eye on yourself." "Uh, what does, what does Thanksgiving mean to you?" "KIMMY Uh, you know, Thanksgiving's always been one of my favorite holidays since I was a little girl." "My parents were immigrants and, uh, this was the one American tradition that they celebrated." "My dad, uh, was very reserved and always focused on work." "But when it came to Thanksgiving he would drop his work and he would join the family and he was the life of the party." "KIMMY Um, and my mom just loved to cook." "She would cook up a storm." "And, uh, there'd be everything, you know, turkey and stuffing and mashed potatoes." "She would separate the white meat from the dark meat." "I mean it was an art." "There was corn, kimchee" "[LAUGHTER]." "There was always kimchee." "RICK (OS) So Dylan, what do you do?" "DYLAN I'm a high-end dog washer." "JESSE He is the pup pamperer to the stars." "RICK I did not know there was a, a high end to the business." "DYLAN There's an entire ecosystem of doggie care in Los Angeles." "RICK Yeah, I mean I've seen the vans that drive around." "But that's not--?" "DYLAN No, most of my clients have an extra bathroom dedicated to canine cleaning." "My dogs are the one percent." "RICK:" "Hmm." "How long have you been doing this?" "DYLAN Almost 15 years." "RICK Wow." "Jesse you are, uh, you're in the dog world, yeah?" "JESSE Uh, well, you know, rescue." "Like I save them, he soaks them, you know, I'm gonna go for reinforcements." "JESSE You good?" "DYLAN Good." "RICK No we're good." "KIMMY With the world being so overstimulated I feel like" "Thanksgiving is a time to really just disconnect from all that and, um, really reconnect with what's important." "SHANE Does your work normally make you feel connected?" "You're a sports journalist." "I mean you interact with people all day." "KIMMY Well you would think that." "But it, it, uh, somehow has the opposite effect." "How so?" "KIMMY I get all these online comments about my articles." "Um, from anonymous icons and names." "And they're really aggressive, just really violent." "You know, and, uh, what's worse some of them are actually totally racist and sexist." "You wouldn't believe some of the ugly things people have to say." "They're just complete strangers, they don't even know who I am." "JUDY Uh, gorgeous." "Okay." "Now, I will make a tent, okay." "If you say so." "JUDY Hey, KATE Hey, So..." "JUDY Look at my tent." "KATE I guess you skipped that class at Barnard, huh?" "JUDY I guess I did." "KATE So what's that smoky smell?" "JUDY Uh, it's the oven." "I haven't used it in years." "KATE Nice, so turkey cordon dust and spider webs." "Very local ingredients." "JUDY Mm-hmm." "KATE Alice Waters would be proud." "JUDY Listen, I am proud of this bird." "Look at this turkey." "Is that a good-looking turkey?" "Huh?" "Handsome." "Cary Grant of turkeys." "KATE I take you more for the, uh, takeout turkey type." "JUDY Did you bring the cranberry sauce?" "KATE Yes I did." "What, I can't compete with Whole Foods." "JUDY Kate." "KATE What?" "JUDY You said you were gonna make cranberry sauce." "KATE No, I didn't." "I haven't used my kitchen since Bush won." "JUDY No, you did, you said you were gonna make it." "And I have the evidence right here." "And I quote I will wrangle up the cranberry sauce." "KATE Exactly." "I wrangled up the cranberry sauce." "Come on, you know I don't cook." "JUDY I wanted it to be homemade." "I wanted it to be beautiful and perfect" "KATE Nobody eats it anyway." "It's just decoration." "Now give your sister a hug, come on." "JUDY Oh no." "KATE Come On." "JUDY Hey look it, wish bones." "KATE Yeah." "JUDY Mine's bigger." "KATE Mine has a diamond." "KIMMY Well yeah, I guess it's better that they take it out on me than their wives." "SHANE Yeah, I've heard about that in America." "Yours is a sort of brutish nation" "KIMMY Sorry, can we hold for a second." "Jesse?" "KIMMY Hi." "JESSE Hi." "JESSE Hi." "KIMMY So nice to see you." "JESSE Nice to see you." "KIMM Oh." "Uh, this is Shane." "He's a friend of your sister's." "He's uh- an artist from Britain." "SHANE Hey Jesse." "JESSE Nice to meet you, how-- uh, Britain." "SHANE Yeah." "JESSE Um, I, I love, uh, I love BBC America and also nationalized healthcare." "SHANE Yeah, don't forget Big Ben." "JESSE What's going on here, in this, looks like sex, lies and videotapes." "KIMMY Maybe two out of three." "SHANE Yeah if you have a loose definition of videotape." "I'm actually interviewing Americans about Thanksgiving." "KIMMY Yeah, come sit with us." "JESSE Oh no, no." "I'm, I'm, I'm too shy." "KIMMY What?" "SHANE No, no, come on, I'll, uh, I'll loosen you up." "KATE I thought uh- stuffing was just spiced, soggy bread." "JUDY No, it is, um, what is it called?" "Aunt Marjoram's fall bounty stuffing." "It's from Vintage Eats dot com." "Ooh." "Vintage, one of my favorite euphemisms." "Vintage." "[LAUGHTER] Okay well if you don't" "JUDY like that then I have the uh, vegan tofu stuffing from" "Lizzy Emerald's website." "KATE Wow." "Two novelty stuffings, you're such a show off" "[JUDY CLICKS HER TONGUE]" "Hey." "ZOE Well hi Auntie K." "LILY We're just- ZOE Hey mom." "JUDY Hi girlies." "LILY We're just gonna get some sodas." "KATE So how's the ivy league, huh?" "Is it worth the 50k?" "ZOE Oh, I'm on scholarship, you know that. [LAUGHTER]" "KATE So what's a scholarship buy you this year?" "ZOE I am taking two classes this semester." "LILY Oh eeh." "ZOE Comparative literature and advanced French theory." "KATE You are your mother's daughter." "JUDY And I am the proudest mother in the whole wide world." "JUDY Love you, best girls in the whole wide world." "JUDY Ooh, look it, it's my own Susan Sontag." "ZOE Oh mom." "JUDY Come on, everybody needs a hero." "ZOE Okay, I will be by the pool reading." "LILY Yeah, I'm gonna go to my room." "JUDY Okay bye." "LILY Bye." "JUDY I'll let you know when the appetizers get here." "LILY All right, thanks mama." "JUDY Oh, I did good on those girls." "KATE You know they only love you because you feed them?" "CAR GPS Input not recognized." "GINA Why are you doing this to me." "Turn right and then make a U turn." "GINA I'm getting confused again." "CAR GPS Five hundred feet." "GINA What?" "CAR GPS U turn now." "GINA No back." "CAR GPS Call voice mail." "GINA Back." "GINA Call Judy." "CAR GPS Your input was not understood." "Phone options are call, hang up," "(GPS) Entry and back." "No, no no." "no no no!" "Call Doctor Brandhog Back, back call Judy." "KATE It's always weird when the parents ask me out." "'Cause it's like are they flattering me or are they bribing me?" "JUDY Is that even allowed?" "KATE You know, I've been single so long, it doesn't even matter." "I just roll with whatever rolls by." "When you're in my position you have to have a take what you can get attitude." "You'll see." "JUDY Yeah, I'm not really that into dating just yet" "KATE Well you better hurry up, because the dating pool is draining fast." "So get going." "And it takes a long time to meet people, so you need to set the ground work." "JUDY You know what, okay I, I got to admit it, okay." "Maybe I have set a little ground work." "I have been, uh, dabbling in the online thing, Date Me dot com." "Date Me dot com?" "Yeah..." "KATE Is the garage sale at seven p.m. of online dating." "JUDY No, don't tell me that." "Yeah." "I think some of those guys seems nice." "KATE Yeah, if you like liars, phonies, scam artists." "I mean Pony Play?" "You heard about that yet?" "Yes." "Kate." "JUDY That is, you're being paranoid." "KATE No, I am not." "I was obsessed with it for a while." "And trust me I have more stories than Scheherazade." "SHANE Kimmy was telling me that Thanksgiving is an opportunity for her to reconnect with, with connection." "Do you feel the same way?" "What makes you feel disconnected?" "JESSE Uh, disconnect." "Um - -." "Okay, um," "I" " I have a very intense relationship with my email." "And ironically that makes me feel disconnected." "SHANE Okay." "Tell me about your email dysfunction?" "JESSE Just, um, well mostly I just, I just check my email over and over and over again." "Where even I think it's crazy" "Because nothing is coming in." "But then something does come in." "And even if it's like spam or an ad or whatever," "I just feel - - validated." "KATE Why can't we all just become lesbians?" "And buy a winery in Napa?" "[LAUGHTER]" "JUDY Wine?" "KATE Yes." "And we'll grow biodynamic grapes and, and make Grenache and we'll convert a barn into an art studio." "JUDY Oh that sounds delish." "Uh, you may be right about the whole lesbian thing." "Because I never felt more popular than when I was up for head curator at the O'Keefe Institute." "KATE See?" "The only problem is all lesbians are married now." "JUDY Mm-hmm." "KATE I mean truly there's" "The good ones." "[LAUGHS] no such thing..." "KATE There is no such thing as a good old lesbian." "I mean who's single." "JUDY Yeah." "KATE Unless she's a nun." "JESSE And I try to put these restrictions on it." "Like, um, you can only download once every four hours." "Or just some arbitrary number." "But then work calls, some freelance gig and they need it right away." "So." "SHANE Mm-hmm." "And, uh, you know, because your work is connected to your email." "JESSE Yeah, yeah, I'm like sitting in front of my computer all day." "So it's like, it's like I'm tempted every single second of the day." "I don't even know what I'm looking for or waiting for or hoping is gonna come in. because the truth is nothing important or interesting is coming in." "JUDY I am optimistic about my opportunities." "KATE Well you should be, 'cause you always had better luck with men than I did." "JUDY What are you talking about?" "You had tons of boyfriends." "KATE Yeah but they weren't like your boyfriends." "They weren't like James." "JUDY James." "Holy shit [LAUGHTER], where did you pull that from?" "JESSE Yeah but it makes me so upset when something personal ends up in my spam folder." "Although, sometimes I'll just, I'll just like approve spam just so that I get more mail." "I Mean not, not spam exactly, more just like ads." "And things like that, things that, you know, other people might not want to receive." "I just can't help it, I just like it." "I really like it." "I like having all this stuff in my inbox." "I am sort of pro spam." "KATE I had such a crush on him." "JUDY You did?" "KATE But you won't believe what happened to him." "JUDY God, don't tell me." "Did he die?" "KATE No worse." "He's bald." "Completely bald." "JUDY Oh well that is far worse than death." "KATE Yeah, a bald eagle, a, a billiard ball, bald." "JUDY How do you know that he's bald?" "KATE Google images." "Yeah, I was cyberstalking him." "JUDY Okay, you're a little tiny bit sick [LAUGHTER]." "God." "Oh James." "He had such a thick head of hair." "I can't believe it, he's bald." "Oh and he was such a stallion." "KATE Now he's a bald stallion." "It sounds like a movie, The Bald Stallion." "JUDY I believe the movie was the Black Stallion." "KATE The bald black stallion." "That reminds me of a one-night stand I had in Algiers." "JUDY What?" "KATE You don't know everything about me." "SHANE What would you imagine life would be like if you stopped receiving emails?" "JESSE I think that would be death." "If people stopped trying to reach me that would be like a death of sorts." "SHANE So would you say your life's value is dependent on, on the attention of others?" "JESSE Hmm, that's [LAUGHTER]" "Uh." "I suddenly feel like I have said too much." "Want me to talk about Thanksgiving?" "God, I hate cranberry sauce, it's- it tastes like medicine." "SHANE No I, I much prefer hearing about your, uh, junky-esque all-consuming need for, for email love." "JUDY Jesse, mom's here." "What?" "SHANE It makes you," "SHANE It makes you, sounds like a..." "Shit!" "JESSE Sorry go ahead." "SHANE Like a walking Radiohead album." "JESSE I'm a creep." "JUDY Why didn't you park in the driveway?" "[LAUGHTER]" "GINA Well I thought maybe you wanted that parking space for a guest." "JUDY Well what are you not a guest?" "[LAUGHTER]" "JUDY Hey." "GINA Hi." "JUDY Where's your car?" "GINA Oh it's way down there." "JUDY What?" "You walked in the heels?" "GINA Don't talk about the car, okay." "Because I hate that car." "I am so angry with that car right now." "JUDY What happened?" "GINA The navigation system." "It turned me around again." "JUDY Oh god you know those things are always unreliable." "Do you" "Do you think you should be driving?" "GINA I drive just fine." "I shouldn't be listening to that ridiculous contraption in there." "JUDY I could have had one of the girls pick you up." "What is that?" "It's some homemade cranberry sauce." "I know, you told me, but, uh, you know, you don't have to use it." "JUDY No, no, no." "You don't understand- [LAUGHTER" "You saved the day." "What?" "I did?" "How did you know?" "Oh, she got canned." "Canned." "[LAUGHTER]" "GINA That's my daughter all right, she's been half-assing it since she was a toddler." "JUDY She's great" "BERT Hey, is this Julie's house?" "JUDY Judy." "Ju-- it's, uh, I'm Judy." "JUDY This, this is my house." "Judy" "Right, I'm Bert, a friend of Shane's." "JUDY Oh that's right, I'm sorry." "He did- he told me you were coming." "BERT Yeah." "I'm here." "JUDY Yes, you are." "Yeah, so is dinner served?" "JUDY Not - - not quite yet." "I, I'm, I'm working on it though." "Maybe uh- 90 minutes?" "I don't know." "You have to be some place?" "Oh. okay" "Well, no, I" " I wouldn't have been so early." "I was at the gym." "I could have finished my workout." "GINA Oh I gotta lose ten pounds in a week." "Ten pounds." "In a week, yeah." "GINA [LAUGHTER] You're gonna disappear." "JUDY Shh." "BERT Why would you say disap" " I'm not gonna disappear." "Why would you say that?" "GINA No, no, no." "I just" "JUDY I don't think that she meant GINA: you really gonna..." "I mean you, look just fine." "BERT Not gonna disappear- No, it's for a show." "I, I'm doing a, a show." "I'm sure Shane told you about it?" "JUDY Oh right, right, right." "You are the actor." "BERT I am the actor, yes." "GINA Right." "BERT I'm playing an English boxer." "With a left hook, from Leeds." "BERT Yeah, yeah." "That's how I met Shane." "I'm studying the accent." "JUDY Mm-hmm." "BERT A friend introduced us" "JUDY Well sounds like you have quite an ear." "That's terrific." "BERT Everybody says that, yeah." "JUDY Good for you." "Uh, by the way this is, uh, Bert, this is my mother, Gina." "BERT Oh, yo." "GINA Yeah, yo." "JUDY Okay why don't we, uh, come in." "BERT Did you make some stuffing?" "JESSE Oh." "KIMMY:" "Oh it's your mom." "JUDY:" "Well got to get back in the kitchen" "JESSE One at seven." "ALL Hi!" "GINA Baby, oh." "BERT Hey man." "SHANE Hey buddy." "CHATTER IN BACKGROUND [INAUDIBLE]" "JUDY Well keep making me look good, little brother." "SHANE We didn't really finish." "GINA (OS) So what's going on in here?" "JUDY Oh. uh, you know what, I'll explain it all to you inside." "Oh Let's get this in the fridge." "Okay." "Okay?" "I'm gonna help." "BERT Do you guys have a bathroom?" "JUDY Uh- yes we do have a bathroom [LAUGHS] It's right down there." "GINA(OS) Darling." "KATE (OS) Hey Mom." "GINA You." "KATE Hi." "JESSE Yes, two minutes." "JUDY You might want to come and join us." "JUDY Okay." "JESSE Two minutes." "GINA Whoa, you have been very busy in here." "JUDY I know it, it, it looks like a mess but there is actually a method to my madness." "My pie crusts are gonna be silky smooth and I have two stuffings." "Count them, two, that are about to go in." "And mister turkey is in here getting all golden brown." "And oh by the way mom saved the day, she made homemade cranberry sauce." "[GRUNTS] I'm a boxer from Leeds. [GRUNTS]" "Yeah. [GRUNTS] I'll mess you up." "[GRUTNS] Yeah." "Oh good." "JESSE (OS) It sounds weird but it makes me feel like I'm in control or like" "I'm, I'm like this guy with a purpose." "Oh, you know what, um, actually I have to- I'm, it, it's like a work thing." "SHANE We have uh- a treasure trove of material we can come back to later if we need to." "JESSE Oh great, yeah, yeah, yeah, just pick me up any time." "Or we'll pick it up any time." "SHANE Yeah, if I, if I need to get a hold of you." "JESSE Yeah, email." "Email as we've talked." "Yeah." "That's great, Ok." "SHANE Yeah" "BERT Fuck." "Fuck, what is your face doing there, buddy?" "No too fat." "Jesus Christ, you need a fucking nose job, what is- ?" "KATE Happy day, mom, happy day." "Thanks." "JESSE Hi, I didn't know you were here." "Hey" "The baby boy." "I know I didn't say hi properly." "Wow." "GINA Well, um, do you want me to do some dishes?" "You'll have a little bit more work space." "JUDY No, I don't want you to do any dishes." "I don't want you to do anything at all." "Jesse." "Yes." "I snuck a little bite of your pared rum and it was kind of fantastic" "JESSE Of course it was." "Although I do have to say it was between that and an apple pan dowdy." "JUDY Oh I can't imagine you making anything called a pan dowdy." "Maybe a brown Betty." "JESSE Ooh, I love me a brown Betty." "I actually, somewhat unsurprisingly, know a drag queen named Brown Betty." "JUDY Of course you do." "JESSE Of course I do." "KATE What are you guys talking about?" "JUDY We are talking about cakes and pies and tarts." "JESSE Pastries and for..." "KATE Who are you?" "What have you done with my family?" "[INDISTINCT]" "JUDY No, no, no, no, no, no, no, no." "No, no, mom," "I told you I don't want you doing that." "I don't want you doing that." "Go have a drink you guys." "Have fun." "Spirits!" "Now you're talking." "Come on mom." "GINA You have the ingredients?" "JUDY Of course I do." "Thanksgiving is about the two Toms" "ALL TOGETHER Tom Turkey and Tom Collins." "That's right." "That's my kids." "Come on, let me make you one." "GINA Yeah, I almost got lost." "JESSE I'm gonna catch up with you guys in two seconds." "KATE What?" "JESSE Oh my god what is the huge, giant emergency?" "DYLAN I turned on Bottom Feeder, Rick's on it, shirtless." "JESSE What?" "DYLAN It said the guy was eight feet away." "JESSE Well how, how, how do you know it's him?" "DYLAN It looked like a torso that could belong to him." "And it said his tribe is discreet." "JESSE Was that English hipster on there?" "You know, I've always had that Bowie thing." "DYLAN No, next closest guy is a thousand and 32 feet away, 78 years old and likes P and P and NSA." "JESSE Fuck, I mean did you message the torso?" "DYLAN I'm thinking about it." "He's hot, and smart." "JESSE No, no, because what about Georgia?" "I mean she gave up so much for him, her entire career." "DYLAN Who's Georgia?" "JESSE [MUMBLING] That's Georgia." "That Georgia" "DYLAN Oh she's really pretty." "If I liked girls I'd be all over that." "JESSE You and Rick really do have a lot in common, apparently." "GEORGIA Hi boys, why don't you come in here and keep me company?" "JESSE Oh my god." "Just act really casual." "Oh." "GINA I just use it to tune out, because I just want to be told what to do. 'Cause I don't like thinking when I'm driving." "KATE Probably not what the GPS people had in mind." "GINA It's so depressing to get lost, Kate." "It worries me." "That my mind is going." "KATE That's how I am every single day, and I'm not even menopausal, much." "GINA It wouldn't bother me either if people didn't just come flying at me like that." "They just whizz on by like crazy people." "It can make your head spin." "It makes mine spin." "KATE You should see the kids at school." "I mean they are so speeded up by the internet And they're all on Adderall so it cracks them out even more." "You know, they can't even read a short story." "We've completely given up on novels." "GEORGIA Hi." "JESSE Hey, oh those are so pretty." "GEORGIA Oh thank you, I figured I'd do something with my unused creative talents." "JESSE Um, I'm sorry, uh, this is my friend Dylan." "GEORGIA Hi, Dylan." "I saw you guys conspiring over there." "What's going on?" "Whose boyfriend ran off with somebody else, huh?" "What's going on?" "Tell me." "JESSE No, no secrets." "DYLAN No gay secrets." "JESSE No." "GEORGIA Okay well that's a bummer, I wanted some gossip." "Uh, Jesse?" "JESSE Yeah." "GEORGIA How are you?" "JESSE Fine." "I mean, you know, fine." "Good." "Just work, email, work, email, work, email." "Cheating at paleo, email." "Same old, same old." "KATE Getting kids to read books was always a chore." "So it's easier just to have given up on it completely." "GINA Now that is sad." "What's gonna happen to books?" "KATE:" "I mean even the word book has a negative connotation to it now." "You know we're thinking of assigning graphic novels?" "Comic books, to fool them." "Sort of a literary bait and switch for these dark times." "GINA Oh." "If you ask me," "I think we're raising a society of nincompoops." "KATE Strong thumbed nincompoops." "GINA What do you suppose he's doing over there?" "KATE Case in point." "JESSE (OS) What about you?" "GEORGIA Fine too, not working." "Distracted husband." "Expiring biological clock." "JESSE Yeah, I, I" " I mean I thought things were going really well for you." "Judy always brags about how great you're doing..." "GEORGIA You know what, I, I got caught up in the LA lifestyle." "I stopped taking gigs, I started doing Pilates, my career is going nowhere." "But I have a seriously strong core." "GINA What about you?" "How are you, sweetheart?" "Are you happy?" "Huh?" "Yeah." "I'm so happy to see you." "KATE Oh well, I'm, I'm as well as can be expected, mom." "GINA Oh I'm so happy to hear that." "KATE Yeah." "But Judy, Judy's having a hard time with this divorce." "GINA That man was a millstone around her neck." "But he sure made beautiful babies." "[LAUGHTER]." "[clink]" "KATE I'd give anything for a millstone." "GINA Oh stop it." "You've had so many opportunities." "You've always been a free spirit." "Always." "That's what you are." "A free spirit." "It's such a nice Yeah." "way of saying free on a Friday night." "DYLAN How, how did you meet Judy?" "GEORGIA She reviewed a show of mine back when I was doing fine art a hundred years ago." "They were New York City gal pals." "Yeah." "How 'Sex in The City'" "Oh Samantha, Really." "guilty as charged." "[LAUGHTER]" "DYLAN And then you moved to LA and settled down?" "Why?" "GEORGIA Oh you know, the reason, it's always the same reason, a guy." "JESSE Yeah but I mean Rick is like, he's kind of a good reason." "I mean you like being married to Rick?" "GEORGIA Yes." "Um, marriage is a process of self-discovery." "DAVID Can you hold it steady please?" "PETRA Mm-hmm." "This will take just a nanosecond." "DAVID No, I, I can't fix it unless you hold it." "PETRA Mm-hmm." "DAVID Ah, wait, you know bending down like this hurts my back." "PETRA Well my readers need to know about this." "It's my responsibility." "DAVID:" "Are you using your ethnic avatar or your white one this time?" "PETRA [LAUGHTER] Honey Girl 21 is for Hayneedle only." "I'm white everywhere else." "You know that." "DAVID How could I forget that?" "PETRA Can I read it to you?" "DAVID Do I have a choice?" "Ah, you know what, maybe it's not bending down" " Maybe it's just you." "PETRA Ignoring that. "Mommy monster here." "Just pulling up to T-day dinner and the new cart turns out to be a T-urd." "See the pics below." "Now on to Yelp to collapse this cart out of business." [LAUGHTER] What do you think?" "It's kind of funny, right" "DAVID Oh that's great, you're like the Ralph Nader of Amazon." "Can you help me?" "PETRA Ralph Nader of Amazon." "Oh, I like that." "Yeah, just a second, I got to post this on Yelp now." "DAVID Jesus, honey, we're already late." "Your guacamole's gonna turn brown." "PETRA The guac can wait." "This can't." "ZOE Where was I. Oh I love this part. "At the bottom of her heart, however, she was waiting for something to happen." "Like shipwrecked sailors she turned despairing eyes upon the solitude of her life." "Seeking a far off, some white sail in the mists of the horizon."" "¶ MYSTICAL WESTERN FILM MUSIC ¶" "SHANE And its got that real feel." "KATE It's the oil." "The olive oil." "KATE It makes- looks like an oil." "GINA Oh." "SHANE What's that?" "KATE Oh well this is a triple martini." "No one talks about it, but the pilgrims were plastered." "SHANE Uh- the pilgrims and the Indians that's the thing." "Oh, sorry." "I'm Shane." "KATE Oh." "SHANE I'm friends with Judy." "Uh-huh, I'm Kate, Judy's sister." "GINA Hello." "KATE And this is our mom, Gina." "Hello." "SHANE Ah, the queen mother, nice to meet you." "SHANE Happy turkey leg as they say." "GINA Thanks." "Shane, huh?" "Now that is a real solid name." "Did you ever see the movie?" "The old movie called Shane?" "SHANE No." "GINA It was one of my favorites when I was a little girl." "SHANE I've heard of it, but I've not seen it." "It's something about a, uh, heroic dog, isn't it?" "GINA No, it, uh, how could you not see a movie that has your name?" "SHANE:" "It's just not very, uh, popular in England, I don't think." "GINA Did you ever see it, honey?" "Oh come on, it's an old American classic." "Oh, it's wonderful." "You'd both love it, I know." "You should see it." "KATE Done." "First thing on the to-do list, right?" "Because we have so much time." "I mean who has time for anything." "It takes a lot of time to see an entire movie." "SHANE What about TV?" "KATE I used to TiVo Guiding Light, but they cancelled that." "So I watch webisodes, YouTube videos, you know, like a minute, two maybe." "Who has time for anything longer?" "Seriously, I'm," "I'm busy online doing other stuff." "SHANE Doing what?" "KATE I do a little, uh, online dating here and there." "GINA I heard on The Today Show that a lot of mature women are having great success meeting men." "Mom." "GINA On the web." "Mature is 35, I'm old." "GINA You're not old." "You're just seasoned, baby." "KATE I'm the seasons, I'm many, many seasons." "SHANE No, you are a very enticing woman." "KATE Oh." "GINA You know, they say there are a lot of older men in the web as well." "Aren't they looking for girlfriends, hmm?" "KATE Why are you asking him?" "I'm on there, day and night, all right." "There are no men." "I think every man has his filter set for under 50." "And every man worth dating under 30." "The same 12 men keep popping up over and over again." "And they're really old," "I mean they are really old Methuselahs, okay?" "And so then I have to lie about my age." "And I do not think about it as lying, because I have to level the playing field." "I mean these men don't know who I am." "They don't know what a vibrant 50-year-old woman I am." "And I'm a giver." "GINA That's right." "KATE I'm a giver." "You want to date a taker, date a 20 year old, okay." "But I'm a giver." "GINA Yes you are." "KATE The male brain is compartmentalized, right." "So it can only focus on one thing at a time." "And they can never see the big picture." "That's science, Shane." "But men are vain, they're vain, they're vain motherfuckers, I'm telling you." "I mean they just sit there and they think that young woman are gonna fall all over the potbellied, silver-haired" "[LAUGHTER] Yeah." "daddies." "KATE I mean do you ever see a guy over 50 doing a sit-up?" "Never." "[LAUGHTER]" "KATE Never." "Do you ever see them in spinning class?" "GINA Mm-mm." "KATE No,never." "KATE Hey, Rick, you go to Soul Cycle lately?" "Pilates?" "We're having a conversation, come here." "RICK I, actually I'm just kind of waiting for a call" "I'm, I'm gonna make the call right now." "Okay." "KATE Alright" " Yeah." "Excuse me." "Well he's not over 50, but you know what I mean." "That's the point." "The whole thing is just such a joke." "It really is a joke" "GINA (OS) Is something wrong, sweetheart?" "KATE Hey, it's this cheap vodka that makes me combative." "My sister and her CVS booze." "SHANE I love it." "It's very Liz Taylor circa, well, circa anytime" "I suppose." "[LAUGHTER]" "KATE So what's your story?" "SHANE In terms of what?" "KATE Love." "SHANE We don't talk about love in Britain." "I love the queen, that's all you're gonna get out of me." "GINA That's nice." "KATE All right, well." "GINA Is, is the queen single?" "SHANE:" "No, she's married to Prince Phillip." "KATE Of course she's married to a prince, 'cause she's a greedy bitch." "SHANE Yeah." "We love her anyway though." "And I always think a queen should be a little bit greedy, you know." "KIMMY Some guy just tweeted asking if I'm enjoying my eel and teriyaki turkey." "Who are these people?" "Gun show 87." "Give me a break." "Everything okay?" "JUDY No, everything is not okay." "My phone has chosen to abandon me in my hour of need." "It says no access to the Internet." "KIMMY Okay, did you restart it?" "JUDY Yes, Kimmy, I restarted it." "KIMMY Hey, easy." "Um, did you check the settings?" "'Cause sometimes the settings I don't know- I don't know are off." "And you reset it?" "from settings" "Well just okay, I just" "It, it's just supposed to work." "Okay, let me check." "JUDY Okay, okay 'cause it, it's an emergency." "All the recipes for" "Thanksgiving are bookmarked on there [LAUGHTER]." "It's coming back on." "JUDY No, I know it comes on." "It's just I can't get online." "KIMMY Okay don't worry I'll get you back online." "JUDY Okay please, please." "If you don't it's gonna be the worst" "Thanksgiving since the great salmonella gravy scare of 1996." "KIMMY We- go get it." "I will get you back online." "Okay." "Okay." "Okay." "Okay." "I'm going this way." "I'm going that way." "JUDY Stir that broth, it's for the vegan turkey stuffing." "KIMMY Okay I got it." "Go." "Okay." "Thank you Kimmy." "KIMMY Yes." "Go, Go." "[PHONE RINGS]" "KIMMY Hello?" "You did what?" "No, sorry I, I can't hear you." "Hang on," "I'm going to go outside." "You're breaking up." "DAVID Look like you just- no, it's not" " Hi." "PETRA Hey." "Hi." "So good to see you honey." "Hey Judy, sorry we're late." "JUDY It's after three." "[LAUGHTER]" "PETRA I know, I was working." "Sorry." "DAVID Yeah, not blogging." "JUDY Yeah." "Hey Jennifer." "JENNIFER Hey." "Look how cute, she's so big. [LAUGHTER]." "PETRA I know, she is." "JUDY I have a crisis." "PETRA Oh, oh, what happened?" "Well I, I can't get online on my phone." "DAVID What?" "Hey." "and I..." "JUDY ...bookmarked all the recipes and if we don't get back on, appetizers is all we're having." "Honey that's not gonna happen." "I know that I'm late, but I'm here now to help." "okay" "David, set up the cheese platter." "Oh, I'm not mad at a cheese platter." "Oh and take her somewhere and park her." "Park her?" "PETRA I, You, you know what I mean." "God, I mean I'm just Jewish men are so sensitive." "JUDY Oh you stop it, it's not that he's Jewish." "PETRA He's stupid." "See you at dinner." "Come on, sweetie." "Oh, okay." "Hello." "Come on, baby, I might need you to pick up the front." "PETRA What are we looking at first?" "JUDY Tofu stuffing from Lizzie Emerald's website." "PETRA Ooh, you like Lizzie Emerald?" "Well she's supposed to be a total bitch." "JUDY How do you know something like that?" "PETRA Who's a bitch dot com." "JUDY There is a website called who's a bitch dot com?" "PETRA How do you not know that?" "JUDY I don't know- 'cause I'm not" "PETRA Well I'm" "JUDY Shi- my broth." "Ooh, oh" "PETRA Oh no." "Do you need that?" "JUDY Yes I need it, it's for the stuffing." "Oh shit." "Shit!" "PETRA Honey, I told you, you" "JUDY Oh!" "PETRA Oh see I- you should have done potluck." "I'm just." "Potluck?" "No." "Yes." "JUDY I wanted a homemade, beautiful Vintage Thanksgiving." "You know what I mean, like." "Making things by hand." "Nobody, nobody makes things anymore." "It's all attach and send." "And download." "Oh" "Wow, is that supposed to be happening?" "Wow. 550 seems really high." "No, no, no, no no." "Please." "JUDY Well there's no temperature consensus online and" "PETRA Oh." "JUDY And I surveyed like a dozen recipes." "Shit." "Ah." "Oh..." "Oh no." "Oh dear." "PETRA Oh no, no, no, no." "There's no use crying over burnt turkey." "Hey." "It's like turkey jerky." "JUDY No fuck turkey jerky." "I wanted juicy turkey." "PETRA Yeah well." "I wanted better fucking homes and gardens magazine turkey." "I wanted turkey to make Martha Stewart wet." "You know, I shouldn't have relied on this fucking thing." "Well you're never there when I need you." "Why are you never there when I need you?" "[KNOCKING ON DOOR]" "LILY Come in." "JESSE Hello, my gorgeous niece." "LILY Hi." "When did you get here?" "JESSE You hiding out?" "LILLY This is the commotion free zone." "JESSE Hurricane Thanksgiving, it's like a goddamn category seven out there." "LILY Yeah." "JESSE You have the right idea." "What are you now, like 40?" "LILY Sixteen." "But my ID says 18." "JESSE You little criminal." "I bet the boys are going crazy over you." "Do you have a boyfriend?" "LILLY There's a guy I'm seeing, but no one would approve, so." "Mmm- It's nothing." "JESSE I know the feeling." "Remember when I dated that Scientologist?" "LILY Oh, it's not that bad He's just older." "JESSE Okay yeah but how much older?" "Like do I need to kick his ass or-?" "LILLY No Uncle Jesse, I can kick his ass myself." "JESSE Fine, but if you need me to kung-fu chop one of your dates you just text me." "Okay." "Okay." "LILLY Hey, what about you?" "You seeing anyone special?" "JESSE I can't really seem to meet anyone." "LILLY Come on." "LILY There are tons of gay guys out there [LAUGHTER]." "No, I'm serious, this is like the best time in history to be gay." "Uh-uh." "You should get on Bottom Feeder." "Wait, how do you know about Bottom Feeder?" "I, I love BF." "Why do you have a gay dating app?" "Duh, 'cause it lets me rate hot guys." "Here, let's see." "I can't believe you know about this app." "Everyone does, it's like legendary." "Oh let me see your account." "I'll help you" "No." "No, [BARF SOUND] 100 percent no." "Please." "No, what the hell is wrong with you?" "No, maybe later, but just" "Yes." "So wait" "I" " I don't understand." "Like what, what do you even use for a profile pic?" "Oh I use the torso of Antonio Sabato Junior." "Of course." "You want to see?" "Yeah, seriously he's hot." "Oh my gosh, what?" "I have like zero bars." "JESSE Hmm." "I usually have at least two." "You broke it." "No I didn't." "You broke your phone." "¶ EERIE MUSIC ¶" "BERT (whispering) Oh." "Come on." "GEORGIA Hey, come over here." "I thought we agreed no phones on the holiday." "RICK Yeah, I know." "But, uh, I don't know these people that well." "They're your friends." "So what am I supposed to do?" "GEORGIA What are you talking about?" "You've got Kimmy, she's your sports buddy." "You love Kimmy." "RICK Yes, yes, I, I love Kimmy, she's great and she's so much fun to talk to about sports." "And that lasts five to ten minutes." "And then what am I supposed to do?" "GEORGIA [CLEARS THROAT] Rick, we made an agreement." "RICK Okay." "Okay?" "Okay." "Okay." "I'm sorry, the phone is in my pocket." "Okay." "Now." "So what's up?" "GEORGIA Will you please make me a mojito?" "RICK That's it?" "That's, that's why you called me over here, so I could be your manservant and make you drinks?" "GEORGIA [LAUGHS] You know I love the way you make them." "RICK Oh boy," "Oh." "Yeah, okay." "I guess I'll make a mojito." "You know what, don't trouble yourself." "You know what, why don't you make me a mojito." "Yeah." "I mean" "I'm at your friend's house, I'm here for you." "I'm being a good boy." "Why should I put on a display?" "I mean it's the holidays, I should be able to be myself, yes?" "Yes, and why does being yourself always mean being by yourself?" "Okay that conversation." "No, stop it." "Will you just, Georgia, I will make you your drink." "Now you have to stop nagging me." "I just thought that my husband would want to spend five minutes with me on Thanksgiving." "You know what I mean?" "Muddle a little mint, engage with some people." "Forget it." "Georgia." "Come here." "You really take that give right out of Thanksgiving." "Just so you know." "Good to know." "You okay playing your game, honey?" "Yeah, daddy." "DAVID Okay." "KATE Fox playing break-up songs and he's taking bar stools..." "[INAUDIBLE] cigarette smoke and name tags." "PETRA All right, are those boiled?" "JUDY Did you just see me take them off the stove?" "PETRA I don't know if they're done yet." "JUDY They're boiling hot." "Okay." "Yeah, but I didn't peel them." "PETRA Oh." "JUDY Because I wasn't sure if you were supposed to peel them first." "PETRA Oh no, no, no, no." "Peeling sounds like so much work." "Or peel them" "And besides, no, but the..." "And now they're hot so I don't skin has like amino acid and fiber know if I can get" "Gets you nice and regular Thanksgiving is not about amino acids and fiber and keeping regular." "It should be about keeping regular." "It's not." "It's about creamy, white perfection" "Excuse me, creamy white perfection?" "What if I want chunky black?" "That's yummy." "Well when you do" "Thanksgiving you can do chunky black." "No, see I'm not gonna do Thanksgiving for this very reason." "I mean look" "Holy shit." "I totally forgot." "What?" "A cookbook." "I have one Oh." "actual book with pages and here it is right- oh, holy shit." "What?" "Classic French cooking." "Oh honey the word Thanksgiving's not even in the French vocabulary." "No, no, no, no, no, no, it's okay." "PETRA:" "Well" "We're gonna change it up. we are gonna have a thanksgiving with a, with a European flair." "PETRA Okay but there is no mashed potatoes in" "What's the word for- French cooking they gratine them or- or gratan them potato." "Well then, we will gratine them." "Whatever." "I mean- Okay." "They're gone." "JUDY Come on!" "viva la France." "PETRA No you're right, you're absolutely right." "JUDY How do you say potato in French?" "PETRA Potato?" "Pomme, pomme." "JUDY I think it's a pomme frites." "Yeah, we are gonna have a Parisian Thanksgiving." "KATE He was so wound up." "SHANE Yeah, it's just Bert's way of coping with life as a rarely employed Los Angeles actor." "KATE Oh great." "GINA If you ask me that's a very sad way to live." "He's always on a leash, paranoid he's gonna miss something." "SHANE Mm, there are worse ways to make a living." "KATE Yeah, try public school teaching when the Republicans are in charge." "GINA Hey." "KATE Except for the great communicator." "GINA Right." "I was a substitute school teacher." "Thirty years." "I went home for the day, my work was over." "SHANE The constancy of the iPhone age must be, uh, very different from your generation, hmm?" "GINA Oh my generation." "Are you implying my generation is so far from yours?" "SHANE I didn't mean it in a negative way." "KATE You never say generation to a woman." "GINA I was just trying to get your goat." "KATE Mom's still quick as a wit." "Better mind the gap." "GINA About most things." "Not everything." "SHANE Uh I think the mind blossoms with age." "You know, uh, the insight from a lifetime of experience must be invaluable?" "GINA Yes." "Although some 70 year olds are just as clueless as 20 years olds." "So uh, so how is your online love life." "Excuse Me?" "KATE Oh." "KATE If this trumps mine I'm switching to a quadruple martini." "How's your love life, mom?" "GINA I, uh, I really haven't signed up yet." "SHANE Why not?" "GINA 'Cause I don't like the Internet [LAUGHTER]." "I don't trust it." "It's better for younger people I think." "SHANE How so?" "Do you mind if I record this?" "GINA Record?" "Why?" "SHANE Well it's, uh, it's for a little project." "You can approve it before I post it, I promise." "KATE Oh, better get that in writing mom." "GINA Does Judy know about this?" "SHANE Uh, she's totally on board." "GINA Okay." "SHANE Okay?" "SHANE So?" "How is the Internet from your perspective?" "GINA Well I do try to keep up with everything." "I, I want to be savvy about the Internet, about all this new technology coming around." "But it is so much and it, it's, it's too fast." "It comes flying at you, it makes my head spin [LAUGHTER]." "I, I am afraid I am one click away from somebody having all of my information." "I was watching 20/20." "You, you ever see that?" "Mm-hmm." ""20/20"." "GINA And they said that if anybody ever gets your information, you, your life is never the same." "They ruin your credit." "And even the credit guys, they cannot fix it." "So" " I'm not for that." "Besides it's very isolating." "You know, to sit there for hours all by yourself." "Trying to figure things out." "I like people." "I," "I like to talk." "I, I like to go to the store." "This probably doesn't make much sense to you, being younger- how old are you?" "SHANE Thirty." "KATE Oh lord." "GINA God." "KATE I was probably at a Bangles concert when you were born." "GINA You grew up with computers, didn't you?" "SHANE I have." "GINA Well how would you like it if you spent your whole life and all of a sudden a computer comes along and it's in charge of everything." "SHANE But do you feel things have got better as a whole?" "GINA One hundred percent worse." "ZOE (OS) "She listened to every sound, sprang up with a start, wondered that it did not come." "And then at sunset, always more saddened, she longed for the morrow." "KIMMY Me love you long time." "[INAUDIBLE PHONE CONVERSATION NOISES]" "This is supposed to be sports." "[INAUDIBLE PHONE CONVERSATION NOISES]" "No, I, I understand I'm not supposed to take" "Okay." "Hello?" "Hello?" "Fuck." "DYLAN Hey man." "RICK Hey." "DYLAN You know where the John is?" "I got to drain the lizard." "RICK (OS) Yeah I think the, uh, I think the main bathroom is on the other end of the house." "This everything here seems to be connected to a bedroom." "So." "DYLAN Yeah, thanks." "Haven't I seen you before?" "RICK No" " I don't think so." "DYLAN Maybe it wasn't in person or your, your whole person." "RICK I'm sorry what's that?" "DYLAN Maybe we met in the cyberspace?" "RICK I don't think so, I- are you in one of my fantasy football leagues?" "DYLAN No [LAUGHS] I'm pretty sure it was a different district of the cyber hood." "RICK Well I'm pretty sure that I don't know what you're talking about then, dude." "DYLAN Dude." "Most smart married men turn off their Bottom Feeder before going to a Thanksgiving dinner." "Eight feet away is so dumb." "RICK Like I said I'm not sure I know what you're talking about." "Tell" " I'm telling you," "I don't care." "Do not care." "Not going to say anything." "RICK Fucking phone, man." "I turn the goddamn app off it comes back on." "I turn it off, it comes on again." "Fucking headache." "DYLAN I've always wanted to be someone's mistress." "KIMMY (OS) ....says maybe it's time for a little iPhone espionage." "GEORGIA Yeah, I already did that." "KIMMY Ah." "DAVID Hey." "I believe you ordered one ice cold mojito." "GEORGIA That is so sweet." "Thank you." "DAVID Oh, how's it going out here?" "KIMMY Meltdown at work." "And the cell phones are dead." "The rapture has begun." "DAVID No, don't worry, I'm sure they will get the phones working again." "GEORGIA Mm, for the sake of my marriage I kind of hope they don't." "DAVID What's that mean?" "KIMMY Rick is a phone junky." "He's on his phone all day and all night." "DAVID You know, I have my own strange addict." "Yeah, it's my wife." "She, uh, she's like a human Pinterest board." "GEORGIA What does that mean?" "DAVID Uh, Petra, she just reviews everything under the sun and over the sun." "I mean she, she'll review a gas station if she doesn't like the gas pump or, or write four-page blog entries on what her favorite varieties of flavored lip gloss are." "You know, and she gets so fired up when people like her reviews or comment on her analysis or, or re-tweet her tweets." "It's like she's having a fucking orgasm." "GEORGIA Oh." "DAVID You know, she's posting or vining or tumbler-ing or insta-ing or whatever." "I don't know." "GEORGIA Maybe we should start a support group." "Step one." "DAVID Step one, Rick should throw his phone in the middle of the ocean if it would make you happy." "BERT Work." "You will work." "You will listen to me, I am your master, you will work, work." "Be a good phone." "Be good." "Okay stay very still, be good, that's it." "That's it, be good." "ZOE (OS) Hey." "Hey." "BERT Hey." "ZOE I think I recognize you." "Aren't you that Yeah." "guy from, um?" "Yep." "Yep, I am that guy, yeah." "I used to love that show when I was a kid." "BERT Oh this is not working." "I have to send a selfie to my agent right now." "I have to look aggressive." "ZOE Are you a friend of my mom's?" "BERT I've been on other shows since you were a little kid, just so you know." "ZOE I didn't mean anything by that." "I" "BERT I did not disappear." "I did not disappear." "ZOE Are you okay?" "[BERT CRYING] ¶ ETHEREAL MUSIC ¶" "BERT The phone isn't working." "ZOE Do you want to borrow my phone?" "BERT No, fuck, work, would you please, would you please work, would you please work for me?" "Would you please, someone be here, please." "Please god help." "DAVID It's hard to find time to listen." "Petra and I have been together for 12 years and I, I feel like I have to squeeze in alone time with a crowbar." "The records just stack up." "GEORGIA My first boyfriend and I would lie there for hours listening to records." "Lots of James Taylor, Joni Mitchell." "DAVID Mm, tuning into the music, watching the records go round and round for hours." "I'd love to do that again." "DAVID Petra listens to one song and she wants to review the entire album online." "DAVID It kind of ruins the magic." "GEORGIA It's kind of like when I take Rick to a gallery show." "He shoots a photo of a picture on the wall without even looking at it." "It's like he wants to preserve a memory that hasn't even happened yet." "Yeah, how about those people who record the entire concert" "Oh!" "on their phone." "Are they even listening?" "Agreed!" "So not what a concert is about." "Agreed." "Anyway, now they're using their phones as lighters." "Yes, totally, it's so lame" "I'm gonna see if Judy needs rescuing." "Uh, do you want to hang out here for a bit?" "Yeah, sure." "I'm no use in the kitchen anyway." "I'll uh, let your spouses know you're out here." "Ah no need, I'm sure Petra's busy cooking." "GEORGIA And Rick's busy texting." "GINA (OS) Ah!" "ZOE (OS) Hi!" "GINA My girl." "SHANE Right." "ZOE I'm so happy to see you." "GINA Oh, I'm so happy to see you." "Come on, sit down." "ZOE Okay." "Wait, does anyone know the whack job outside?" "He's acting like he's on bad hallucinogens." "SHANE That's my friend Bert, I invited him." "He may well have swallowed his spray tan again." "GINA (OS) He's on drugs too?" "[LAUGHTER]" "At Thanksgiving?" "SHANE No, it's just that his drama teacher tries to get him to stay in character for days at a time." "Last month it was a Smurf." "It's a grim business, I'll go check he's okay." "It's nice to see you again." "ZOE Nice to see you." "What were you talking about with Mom's latest art pet?" "GINA He's doing research for his new grog." "ZOE Oh Grammy it's not grog, it's blog" "GINA Well good." "Because when I hear the word grog" "I get thirsty." "I think there's really a lot to say about your generation." "And all of this technology." "ZOE You sound like such a grandma right now." "My generation, and grogs?" "GINA Okay smarty pants." "What do you think about all this?" "Huh?" "ZOE You want to know a secret?" "Of course." "ZOE It is the older people that take the Internet too seriously." "It is moms who get in posting fights on Facebook." "I mean my generation, we know how to shut off our phones." "We know better than anyone else the difference between real communication and cyber communication." "Like I have no problem not responding to a text because" "I know it's not the end of the world." "And I expect people that I text to feel the same way." "GINA Hmm." "ZOE I just don't think it's our generation's fault if stupid people take their phones too seriously." "They have an off button just like we do." "There's a guy and he won't stop texting me." "And he's just doing it for himself." "I mean he's addicted to the validation of me texting him back." "But it has nothing to do with me." "I know that." "I don't think he does, which actually gives me all the power" "GINA [LAUGHING] Yes." "I think that my generation knows what to do when it all becomes too much." "We ignore it." "Well You just got to recognize it for what it is, you know, it's a tool." "It's just a tool." "It's like a scale or a blender." "KATE The day my scale texts me is the day I shoot myself." "[KITCHEN NOISES" "SHANE Here we are in the nerve center" "JUDY Oh of the house, the kitchen." "Where we find our hostess." "JUDY Shane out out, out, out." "Oh, what's wrong, what's wrong with this?" "What's wrong with it?" "The- this is not what my kitchen looks like" "This is not what I look like." "Mess is part of the creative process." "I once took a tour of Damien Hirst's studio." "The effluvium was very, very similar." "What do we have in here?" "JUDY Ah, no peaking." "Oh." "That is the turkey" "Oh okay it's a lit- it's a little black." "Is it a cajun turkey?" "Uh, the- it's meant to be Amish." "Let's put some suspenders on it then." "Perhaps a little hat." "And what do we have here?" "Really?" "[SHANE LAUGHS]" "This- potatoes" "Oh- okay." "Um, so this will be mashed potatoes." "And, um, I boiled them and I, I wasn't sure about the skin so I am improvising." "SHANE Oh okay well a little bit of that and the, and the black meat, you'd have a very passable shepherd's pie." "Oh god, you're right about that." "There's a bit of irony" "Because I am serving Britain's national dish on" "American Thanksgiving, to a Brit." "[LAUGHTER]" "PETRA Who's this, what's that?" "JUDY Oh, oh sorry I thought I told you." "This is Shane." "And he's a, a conceptual artist." "And he's blogging about our Thanksgiving." "Blog?" "I wouldn't say I was a conceptual artist." "SHANE It's more, uh, reality television meets, uh, Dada." "PETRA Dada?" "Mama, dada, what - - [LAUGHTER] I know you were speaking English." "Maybe the beginning part." "PETRA (OS) Is he speaking English?" "JUDY (OS) Oh come on, he's speaking with an accent, it's still English." "SHANE What, uh, what, what are you doing here?" "PETRA Ah." "Replacement stuffing." "SHANE You don't stuff it in the turkey?" "PETRA Uh, well some people do." "Most don't." "SHANE Uh, god, you- thi- this holiday is full of misnomers." "I'm still unclear on why you persist on using the term Indian." "JUDY Oh well that's a funny thing because Columbus, he was headed for India." "and he got Uh, whoa, Excuse me." "Excuse me." "I didn't give you permission to film me." "SHANE Oh I'm sorry, I uh" "JUDY I" "PETRA I'm sure you did and maybe she did too, but really you shouldn't have." "SHANE Oh, uh, it's all right, I'll, I'll sw- - switch it off now." "And, uh, please my, my" " I apologize." "JUDY Oh, No, no, no." "That's on me, I'm sorry." "Petra, I told him that it would be okay." "For this blogger to film this blogger?" "Oh my god, I didn't even really think about it like that." "I no- um" " I..." "It's not really the same thing." "I'm gonna go find my friend Bert." "So, uh." "Oh." "SHANE Good luck with it, Judy, very nice to meet you, uh" "PETRA JUDY TOGETHER Petra." "SHANE Petra." "That's right." "Okay Yeah" "Right, okay." "Shane." "Who is that limey poser?" "[LAUGHING] I think he's kind of adorable." "PETRA He's not adorable." "He's a remnant of my past art life." "PETRA Well if that is your art life, I'm glad it's in your past." "¶ EERIE MUSIC ¶ [TAPPING ON PHONE]" "[PHONE DINGING]" "RICK No, we have to stop, we have to stop." "We can't do this." "Why?" "That was pretty good." "We just, we, I want to, and we're going to." "I just" "It's Thanksgiving, my wife is right down the hall." "Okay well maybe we can message each other on Bottom Feeder?" "RICK That's a very good idea." "I'll send you a unicorn right now." "If I can get the goddamn thing to work." "This phone, uh, no- It won't load." "DYLAN All this talk of unicorns and loads is making me hungry" "RICK Uh" " This thing is not working." "GINA Okay." "KATE I don't want any, mom." "GINA There you go." "Are you sure you should be drinking all that" "On an empty stomach?" "KATE It's better this way." "GINA I don't like watching you get drunk like this honey." "KATE Then don't." "GINA You know, it was never like this when Adam was around" "KATE Twelve years, what a waste." "GINA How is he?" "Do you know?" "KATE Well he seems really happy on Facebook." "Oh my gosh he just seems so happy with his wife and his daughter" "GINA I'm sorry." "KATE But thanks for asking." "GINA I'm, uh" " I know how hard that must be for you." "It's not exactly like I had a that must be for you." "great role model for marital bliss." "GINA I don't want to get into that, Kate." "KATE (OS) I know you don't." "You just left me to clean up all your messes." "GINA (OS) That is quite enough." "Thank you." "I'm gonna go out and and see Zoe." "See if she's learned anything." "Wherever she's learning it." "KATE She's such a little showoff, that Zoe." "But she will learn." "Boys don't make passes at girls who make passes." "PETRA Oh god." "Mm." "JUDY What?" "What's wrong now?" "PETRA Mm, it's, mm-mm." "I mean you really can taste that this is straight out of a box." "JUDY ...well did you follow the instructions?" "You mean add water to contents of box and stir?" "Yeah, I did that." "JUDY (OS) Okay you know what, that is not helping." "PETRA(OS) Oh" " Jesus!" "A little snarky, to tell you the truth." "I thought that out of the box foods were just supposed to work." "PETRA Honey, nothing ever just works." "That's why you're supposed to research and read reviews before you buy." "JUDY Okay, well who has time to do that?" "PETRA With the Internet it takes no time." "You know, most people don't remember this, but not so long ago there was very little we could do when something didn't work." "And now, you know, if there's something that's not working or there's a manufacturer's problem I now have a place where I can go to complain." "Like my voice is actually being heard." "I feel like my entire life I've been collecting information and, and, and observations and, and thoughts and, you know, I've - - god, I've just wanted to let it all out." "You know?" "I feel like my whole life's experience has led to something." "And people have learned that I know something, and they care that" "I know something." "I mean, you know, every time somebody likes one of my reviews, I feel like I've made an impact in the world." "That I've mattered." "That I've helped someone." "I don't know." "I know it sounds silly." "But some people do community service, some people do art, and some people post." "¶ SLOW TINKLING PIANO MUSIC ¶" "GEORGIA Someone like Cartier-Bresson, the reason his images are so wonderful is because you could feel him being engaged in the life he was photographing." "He, he said something once like photography is nothing, it's life that I'm interested in." "And I just feel like it's the opposite of that now." "I mean people just snap and post without even looking at what they're shooting half the time." "SHANE Hello guys, uh, so, uh, tempers are flaring a little bit." "So if you could get any footage, uh, near the windows, that would be great." "Just sort of make sure you stay out of sight." "And, uh, yeah things are going well and I'll speak to you later." "Okay." "RICK Just- put my picture up there so I, I can hear it from other guys that I'm attractive." "That they can let me know what they feel." "My wife, she, sh- she doesn't say it, she doesn't" "She's not turned on by me maybe, I don't know, maybe she is." "I just don't, I don't feel it." "I, uh- does that make any sense?" "I don't know, I" " I- don't hook up with guys there." "I don't, I have, but I- [STUTTERING]" "I don't." "That's not me." "I mean I'm, I'm s " " I'm straight." "Okay, I'm gonna, I want to give you my number." "But you're gonna have to be discreet." "Please." "DYLAN You know the problem with apps like Bottom Feeder is that they just, they just impede the natural progress of the inevitable." "You sinner boys need more time." "JESSIE (OS) Rap, sat " " Saturday," "LILLY(OS):" "Ah." "JESSIE (OS):" "eight points for that word." "LILLY (OS):" "Ah!" "JESSE (OS):" "Because I am smart" "JESSE (OS):" "and you are not." "JESSE (OS):" "Because I am amazing at Boggle." "LILY Okay yeah, yeah, you're bomb at Boggle." "JESSE Yes, I am." "Thank you." "KATE Wow, I forgot the sound of joy." "Uncle Jesse's just showing off." "Yeah, we figured with the cell phones out we would go retro with a board game." "KATE Ooh, how subversive." "Before you know it we'll be talking to each other." "LILY How are things in the kitchen of mayhem?" "KATE Well, you know, that Petra is in there quote helping her." "JESSE Okay well Petra's a ball buster." "She'll make sure that poor dead turkey flies." "LILLY Well hey, do you want to play another round with us?" "KATE Oh wow, yeah." "God, I loved board games." "Then I did this Monopoly speed dating thing." "Oh, don't ever do it." "LILLY Fun-." "We're just counting up the scores from the last round." "LILLY Yeah, I know." "KATE Wow, aw, I forgot." "All these little pieces, it's so- and the sand timer." "LILLY Well mom's had this game for forever." "I guess we kind of grew out of it." "We used to play all the time." "JESSE With your dad?" "LILLY Yeah." "He loves board games." "KATE Games in general." "JESSE Kate, enough." "LILLY (OS) Hmm, uh, what kind of games did you play when you guys were little?" "JESSE Oh well, hmm, my big sisters used to like to dress me up." "LILLY Really?" "KATE Yeah, we put pink bows in his hair." "JESSE Pink bows." "KATE 'Cause he was always gay." "JESSE Always." "And then Mom would play those little, these like little folk songs and we would dance." "'Cause she had this, um, what was the, it was like a little guitar?" "KATE(OS) Ukulele." "JESSE The ukulele." "JESSE (OS) right." "And, and she knew maybe three chords." "But she could play a thousand songs with these three chords." "Like, uh " "KATE (OS) Camp town races." "Doo-da, doo-da." "JESSE Doo-da." "KATE And, um, the Clementine, my darling Clementine." "JESSE Oh." "Are those like hippy songs?" "No, they are old, fun- LILLY (OS) Oww!" "campfire songs." "LILLY Wait, what's a campfire?" "I'm kidding, I'm sorry." "JESSE Kate." "KATE Oh yeah, shaky, shaky, shaky..." "BERT (OS" " OUTSIDE) You can do it." "You can do it, come on." "Oh, come on you little fuckhead." "Work." "Work, please work." "BERT'S SUPER EGO (OS) Bert, [UNINTELLIGIBLE]" "BERT:" "Just fuck, what the?" "Who, who are you?" "How do you know my real name?" "BERT'S SUPER EGO You are having another of your episodes." "A moment of psychosis brought on by traumatic phone withdrawal." "BERT What?" "BERT'S SUPER EGO This is your superego speaking." "The part of your own mind that is self-critical." "BERT Oh." "I always knew I had an ego." "I assumed it was super." "BERT'S SUPER EGO You must begin an important change." "[ECHOING] Change, change, change, change." "SUPER EGO One that begins with a search." "BERT Okay wait- what, what, what search?" "BERT'S SUPER EGO For tranquility." "For silence." "And most of all for meaning." "BERT Meaning what?" "GINA (OS) Well it's great looking at you out here." "ZOE Hey, Granny." "GINA I'm not disturbing you am I?" "ZOE No, no, not at all." "Please sit down." "GINA Okay." "ZOE How's auntie Kate?" "GINA She's drunk again." "ZOE That must be hard for you to watch." "GINA Mm." "I suppose I should be used to it after all these years." "But although the last time I really thought it was the last time." "SHANE Hey guys, I'm trying to find my friend Bert." "You haven't seen him, have you?" "DYLAN He probably took one look at that torched turkey and he headed straight for Denny's." "Torched Turkey sounds like an indie band." "RICK Speaking of missing persons I'm gonna go look for my wife." "DYLAN Yeah, you do that, Rick." "RICK See you, Dylan." "DYLAN How'd your interview with, uh, Jesse go?" "SHANE Yeah, no, he's, he's, uh, he's an interesting guy." "He kind of he wants to live in a world of email." "You know, like, uh, Tron but more banal." "DYLAN Want another interview per chance?" "SHANE Yeah, I need to locate my friend Bert." "There are rumors that he's, uh, he's acting like himself." "DYLAN Well we can do it fast." "And, uh, I might be too fat and stuffed after dinner to have my picture taken, so." "SHANE Okay." "Sure, yeah, if, if you don't mind, uh, doing a, a fast one." "DYLAN Famous for fast ones." "It's an American thing." "SHANE:" "Okay." "Like, uh, fast food?" "ZOE I wish that something or someone would come along and she could find some happiness." "GINA Mm-hmm." "Sometimes I worry that it's all my fault." "ZOE No, no, Granny." "Of course it's not." "It's like me worrying about" "Mom's divorce." "There's only so much you can do." "GINA You have taken such good care of her." "ZOE I have had to learn to set boundaries." "GINA Believe me it's better that way." "But when it's your child, it's so hard." "Look at all of mine." "They're all unhappy." "ZOE Well unhappiness is just part of the human condition." "It's like what I'm reading about in French class." "So much of life is about waiting for something to happen." "And the sadness when it doesn't happen." "DAVID Petra and I tried to have a rule where we turned off our phone one day a week." "Technology free day." "Ironically it was supposed to help us connect." "GEORGIA How did that go?" "DAVID I kept catching her little cheats as she'd call them." "But, um, they weren't little cheats to me." "SHANE When I started I, I wanted people to talk about their past and, and how they give thanks for their so-called blessings." "But all anyone seems to want to talk about is technology." "So what comes to mind when, when turkey and technology and, and family merge?" "DYLAN Um, okay wow, that's intense." "Um, I" " I was a latch key kid." "Um, I was, you know, I'd come home every day and just be alone for four or five hours." "And so I'd just rely on myself." "Find ways to keep myself entertained." "To not, uh, feel lonely." "I guess the phone reminds me of that." "SHANE Do you call the phone mommy or daddy?" "DYLAN Well I guess it, it's a little bit of both." "I have these," "I have these strange ideas of the future sometimes." "Um, like someday when we're born we'll be handed a phone and it becomes our, our nanny, our teacher, our friend and companion." "SHANE Well I suppose little children are everywhere with their phones now." "DYLAN Totally." "SHANE Do you think that's a bad development?" "To have people brought up by phone nannies, as you suggest?" "DYLAN I don't." "There's some piss poor parenting out there." "But a phone, a phone can watch over you, make sure you don't get lost." "It can make sure you get fed on time." "It can teach you new things." "SHANE But doesn't that take away a, a human element?" "I mean studies have shown there are, that a bottle isn't the same as the nipple, for example." "DYLAN If a phone can teach you how to play a chord, what's the need for a music teacher?" "If, if a phone can inspire me to workout, what's the need for a coach?" "SHANE Yeah surely there's, there's something missing?" "I mean" " All these jobs, they're not just mechanical." "Or, well maybe they are" "¶ EERIE TINKLING MUSIC ¶" "PETRA Don't worry about David and Jennifer, they, they'll just be fine." "In fact I should probably look on them." "Oh hey Kimmy." "KIMMY Hi." "PETRA So, uh, have you seen David?" "Wh- why, why do you suddenly look like that?" "What?" "Where is he?" "KIMMY He's chatting with Georgia." "PETRA With Georgia and Rick?" "KIMMY Just Georgia." "Don't shoot the messenger." "PETRA Why do I get the feeling that I should suddenly look for my husband?" "So what exactly are they talking about?" "KIMMY Living life online." "Apparently Rick isn't- paying enough attention to Georgia." "PETRA Oh that's classic." "And I'm sure David was complaining about me in the same way." "You know, I know how and what that man thinks at all times." "JUDY Well you do pay a lot of attention to your online life." "PETRA No I don't." "JUDY Petra." "PETRA What?" "No, uh, excuse me." "I just believe that my online persona is more influential and more creative and more, you know, maybe more vibrant than my actual persona." "JUDY But it's not real." "PETRA Well I beg to differ." "I think there's very little difference between real life and online life." "It's all life." "We're living it, right now." "JUDY Yeah, no actually what you're talking about is actually more typing than it is living." "PETRA Same diff." "Wow." "Whatever, look, um, I think that this situation here is beyond salvation." "So I'm gonna gather up my little team and head for a reservation." "LILLY (OS) Okay, Gutty is not a word." "JESSE (OS) It is, I'm telling you." "It means to have a large gut." "LILLY No way." "KATE I don't buy it." "KATE No." "JESSE Listen." "JESSE Listen, I call people, myself mostly, gutty, all the time." "LILLY You're insane." "JESSE:" "I'm not." "I'm not, I'm telling you, I'm not." "LILLY All right." "Shit." "I'm still not getting any bars." "This is getting really freaky, how are we gonna figure it out?" "KATE Have you heard of something called a dictionary?" "LILLY I mean yeah, I've, I've got that app." "KATE Well the app was based on a real thing." "And I'm sure there's one in the house." "LILLY I've never seen one." "Mom just Kindles everything." "JESSE Are, are you seriously telling me that there's not a dictionary in this entire house?" "LILLY No, I mean don't get on my case about it." "I'm only 16." "KATE I don't believe this." "Little miss art critic doesn't have a dictionary in this house?" "That's really, really sad." "LILLY Why is it sad?" "JESSE I, I don't know, I just feel like every house ought to have a dictionary, even if nobody uses it." "LILLY Why?" "KATE Because it's a part of the infrastructure of a home." "You have the roof, you have the front door, you have cable, and you have a dictionary." "JUDY Maybe I should start a blog." "Judy's failed life dot com." "And this will be the inaugural entry." "KIMMY Your life is not a failure, okay." "You've got really nice kids." "You've got a cozy house." "Your career is about to break through again." "I mean you've got a bright mind and a really warm heart." "You've got it all as far as I'm concerned." "JUDY Well then how come I'm not happy?" "KIMMY Well I'm gonna sound like an ancient Chinese proverb, but the best we can do is be content." "You know, happiness only comes in brief, brilliant flashes." "It's been a long fucking time since I've had one of those." "KIMMY They seem to be happening less and less for everyone I know." "JUDY Will you help me?" "I mean I've got all those people to feed and I don't know, we can find takeout or something." "KIMMY I mean how, how do we even know what's open?" "I can't call or, or search." "JUDY Well how did we search in the old days?" "KIMMY I don't remember." "JUDY I remember." "We used to go to Korea Town and we would go and we would find a restaurant that we had never been to before." "And we would just walk in, the sign wouldn't even be in English." "And we would ask for the most popular thing." "on the menu and it be- became sort of a tradition, you know." "It was like a family bonding ritual." "KIMMY And you don't do it anymore?" "JUDY Never." "Not since the divorce." "I mean we tried to do it a couple times, the girls and I, and Zoe would find a bad review online..." "But then we'd, you know, we wouldn't go." "If it's one thing the Internet is good for, it's convincing you not to do something." "KIMMY I used to go to all those Korean places when I was growing up." "It feels like a really long time since I've been down there." "In Korea, we have a Thanksgiving called Chuseok." "You visit the tomb of your ancestors, offer them food and drinks." "DAVID(OS) Doesn't it seem, I don't know..." "KIMMY Nobody really seems to do it anymore." "DAVID (OS) Really quiet?" "GEORGIA Mm-hmm." "KIMMY(OS) It's like all the ancient traditions are being lost." "DAVID How long do you think we've been out here?" "GEORGIA I don't know." "My phone's black." "DAVID Is your battery dead?" "It won't start." "DAVID Here, use my phone." "Mine's dark also." "GEORGIA Maybe it's an omen." "DAVID An omen." "GEORGIA Mm-hmm." "You want to go for a walk?" "DAVID Yes." "Yes, I do." "PETRA David?" "Huh, well." "Hello?" "David?" "KIMMY It feels so strange not to have a specific destination." "JUDY We may not have a destination, but we have a mission." "KIMMY Yes." "JUDY We will not go hungry on Thanksgiving" "[LAUGHTER]" "JUDY Here we go." "LILLY:" "There's like this weird nostalgia for inconvenience." "I mean listen, were paper letters and paper newspapers so much better?" "Or like having to wake up at six a.m. to go wait in line to buy a concert ticket?" "Oh it's so great." "Come on." "Life is so much better now." "You guys really had it hard." "JESSE Look, I'm not saying that I don't like those conveniences." "I just" "KATE No, it's true, something is lost." "JESSE Yeah." "LILLY No, but so much is gained." "KATE No, but I'm not sure it's worth it." "JESSE I mean I feel it too." "Like something has been lost." "LILLY Uh" " Your silly." "I- What is lost?" "What is it?" "KATE I don't know, it's hard to explain." "I mean I" " I'm just curious." "I'm not trying to be difficult." "JESSE Okay, maybe it's like- it's like the pleasure of something was directly related to the inconvenience." "KATE There were little victories that came from trying to figure something out and feeling needed." "Like the dictionary needed us." "Maps, newspapers, needed us." "Stores needed us." "You know, I mean you could only find the word when you participated with the dictionary." "It was your knowledge of the alphabet and the time and the care that you took to look through it." "And, you know, dealing with all these pages that were so thin and you go too far this way." "And then this way." "And then where is the" " - and then there it is." "There it is." "You know." "I mean it took something." "It meant something." "It meant something to find a word and look it up." "And now it's just click." "Just a click and it's all the same clicking with the same amount of non-effort." "A click to make a reservation, click to pay your bills, click to buy something." "I mean we've totally convenienced our self out of being needed." "JESSE And the worst part is, is we have taken the most sacred thing in the world, and that's finding love, finding a relationship and we have reduced it into a one-click game." "This device is, it's trapped us inside." "I never go out anymore." "I miss going out." "I miss the random shit that would happen when I would go out." "LILLY I don't get it, why don't you just go out?" "KATE Oh my god, look." "JESSE What?" "JUDY Right here." "JESSE Gout." "KATE No, go out." "It's a sign." "LILLY Hello, I just said that." "Go out." "KATE I know and there it is." "Go out." "We need to go out." "JESSE This, this is my new mantra." "Go out." "KATE We need to go out." "JESSE Let's go out." "We're going out." "KATE Yeah, let's go out." "Come on, you coming?" "LILLY No, you guys are weird." "JESSE We're going out." "KATE I am so excited." "JESSE We're gonna go out." "KATE We don't know what we're gonna do, we're just gonna see." "LILLY Yeah." "JESSE We're going out." "LILLY We're just gonna go out." "LILLY Okay you're going out of your minds maybe." "KATE See what happens, life." "Life happens out." "JESSE What are we gonna do?" "KATE We're gonna buy,- buy a CD" "JESSE We're gonna buy a 20 cent CD for twenty - twenty two dollars." "KATE We're gonna wait in line for something." "JESSE We could get a dictionary." "KATE We could get a dictionary" " Just go." "BERT'S SUPER EGO You are not living to your full potential." "BERT I'm not." "SUPER EGO You spend too much time taking selfies and looking at yourself." "BERT Is that a good or a bad thing?" "'Cause people are always telling me that I have a good look." "BERT'S SUPER EGO A good look is meaningless." "What is important is inside yourself." "BERT When you say inside, inside myself, like, like inside myself?" "What?" "What's in there?" "BERT'S SUPER EGO Much more than your selfie would suggest." "Don't you want to find out how much more?" "BERT Okay." "How do I do that?" "BERT'S SUPER EGO:" "Your true self will be found with quiet reflection." "Go forth now, dear Bertram, in quiet reflection." "JESSE It's sort of beautiful out." "KATE Yeah, it's still light." "Where are we going?" "Oh look." "JESSE What, really?" "KATE Yeah." "JESSE Shut up." "You are not." "Look." "KATE I am so." "Out with the blackberry." "Come on." "We're really going out." "JESSE Don't you shame my blackberry." "KATE Now what?" "JESSE I don't know, I'm naked and scared." "Am I fat?" "Gutty." "KATE (OS) You're not gutty." "JESSE Cell phone's... [INAUDIBLE]" "KATE Such a cheat." "So not right." "Poor Lilly." "BERT (OS) My selfie is not myself." "ASSISTANT 1 No it's, it's good, they can't see me." "BERT (OS) My selfie is not myself." "PETRA (OS) David?" "David?" "Damn it, where is he?" "Oh, have you seen your wife?" "RICK I'm not exactly sure where she is." "PETRA Well I heard she was flirting with David." "RICK That's great, thanks for the information." "Why don't you mind your own business?" "PETRA What are you doing out here anyway, are you, are you getting reception?" "Is reception back?" "All right well I'm, I'm not getting anything here." "Just" "RICK I'm sorry that's my phone." "PETRA I know I just - - this is a real emergency." "If I can just this one thing I mean you didn't fucking ask me." "I understand but I just You just take my- take a person's need one second." "phone alright- give me my" "Excuse me?" "Don't touch me Give me my fucking phone." "RICK Are you kidding me?" "You're stark raving mad." "Oh well fuck you." "You just fucking smashed my phone." "You shouldn't grab it." "Yes Fuck me?" "I shouldn't grab you?" "You grabbed my fucking phone." "How about that?" "Now your phone is in the water." "PETRA What is wrong with you?" "RICK What's wrong with me?" "PETRA What- that is my life's work." "RICK That's pathetic." "Your phone is your life's work?" "Shouldn't your husband, your daughter, your family be your life's work?" "PETRA E" " Excuse me." "Do not talk about my family, especially not my daughter." "Where is, where is Jennifer?" "RICK Go on, go find her." "PETRA Jennifer?" "PETRA Jennifer?" "Baby?" "Go on." "Go" "RICK Mom of the year." "Get the hell out of here." "PETRA Honey." "Jennifer?" "Ah." "Oh, Oh shit. [CRYING]" "PETRA Jennifer?" "ZOE Oh, what happened in here?" "GINA Thanksgiving got the best of her." "ZOE Where is she?" "GINA I think she probably wants to be alone." "ZOE Oh, I'm not sure if this is funny or tragic." "I'm sure" "I could figure it out if it weren't for the hunger pangs." "LILLY Oh my God what the fuck!" "GINA Lilly!" "LILLY Oh I'm sorry, granny." "ZOE What are we gonna do?" "This is a disaster." "GINA Mm, well I have an admission to make." "I knew something like this could possibly happen, so I made a backup thanksgiving dinner." "And it's in my fridge right now at the house." "ZOE Seriously Granny?" "GINA Yeah." "GINA Okay." "CAR GPS Welcome to your navigation system." "My name is Ethyl." "GINA Okay ethyl." "CAR GPS How may I help you?" "GINA Hit it girl." "DYLAN (OS) Yes, I know." "I know that everything I use my phone for" " sex, love, uh, companionship are just stand-ins for the, for the real thing." "I, I know that, I know a phone can't love you." "can't nurture you." "SHANE Why would you want it to?" "DYLAN Because it's easier than working things out with real people." "SHANE [LAUGHING] Yes." "I suppose you're quite right." "DYLAN I got to go." "SHANE You suddenly in a rush?" "DYLAN I don't, I don't even know what I'm doing here." "I should be with my own family on Thanksgiving." "SHANE Well, you gonna make it?" "This is like one of those old" "Rosalind Russell movies." "DYLAN I hope so." "CAR GPS Prepare to detour in 500 feet." "GINA See what you did?" "CAR GPS Detour now." "GINA What did I do?" "CAR GPS Detour now." "GINA I've already been down that road, Ethyl." "CAR GPS Action not recognized." "Resuming previous route." "GINA Oh, okay." "CAR GPS Continue for three miles." "GINA Here we are." "CAR GPS Then turn right." "GPS Continue straight then make a U-Turn." "GINA Ah." "CAR GPS Continue for three miles." "Then turn right." "Oh god now I need gas." "Then you will arrive at your destination." "See what you did?" "Approaching Dusky Glen road." "What?" "I'm going myself." "GPS I'm sorry but no satellites can be located." "GINA Turn you off." "CAR GPS Welcome to your navigation system, how may I help you?" "SHANE Okay ladies, you want to come out and we'll do the final shot." "So it was a tumultuous, uh, Thanksgiving," "With some unexpectedly thought-provoking dialogue." "Um, now I don't like my art to have lessons." "I like, I like them just to be dollops of human foibles and triumphs." "So I would like to end with a question." "And, uh, that is the next time you pick up your device, I'd like you to ask yourself what is it I'm searching for?" "And is this the way to find it?" "Um, okay, well that's it." "I'd just like to thank all the new Twitter followers." "You know, you guys are the faceless fans that make it worthwhile." "And, uh, we'll see you again next time." "ASSISTANT 2 How'd it go?" "SHANE Practically perfect in every way." "ASSISTANT 2 I can't believe that thing actually worked." "Where did you get it?" "SHANE Amazon, 35 dollars." "They're quite popular, actually." "At some point I can imagine everyone having a phone jammer in their homes." "ASSISTANT 1 I doubt it." "ASSISTANT 2 Yeah, I don't see that happening either." "SHANE Well, mark my words, the future is not in the search but the silence my friends." "Now come on." "¶ DIGITAL MUSIC ¶" "[Sounds of the wild...." "Coyotes, birds... night.]" |
Renal biopsy: methods and interpretation.
Renal biopsy most often is indicated in the management of dogs and cats with glomerular disease or acute renal failure. Renal biopsy can readily be performed in dogs and cats via either percutaneous or surgical methods. Care should be taken to ensure that proper technique is used. When proper technique is employed and patient factors are properly addressed, renal biopsy is a relatively safe procedure that minimally affects renal function. Patients should be monitored during the post biopsy period for severe hemorrhage, the most common complication. Accurate diagnosis of glomerular disease, and therefore, accurate treatment planning,requires that the biopsy specimens not only be evaluated by light microscopy using special stains but by electron and immunofluorescent microscopy. |
Reviews Pazo de Castrelos
Pazo de Castrelos
Pazo de Castrelos can be described as a huge wooded park comprising of a house which functions as a museum at present. A formal ‘box garden’ lies behind this house. It’s flanked by terrace wall as well as a ‘rose walk’. Boulevards of plane trees and magnolias go on to traverse romantic garden wherein a ‘tulip tree’ can be grown.
1
Maybe you might also be interested in:
Mirador de la Guia is located at the distance of 1 Km on the north-eastern side of Vigo. This is the site from which fine views pertaining to ‘ria’ and ‘offshore islands’ can be enjoyed. It’s worth visiting at... |
Bypassing of local hospitals by rural Medicare beneficiaries.
Several previous studies of hospital utilization by nonelderly rural residents suggest that local rural hospitals have been increasingly bypassed, often for care in urban hospitals. This resulted in lost volume for rural hospitals, detracting from their financial viability. It is not clear to what extent elderly rural residents also bypass local hospitals and whether this reflects regionalization of treatment for some conditions or avoidance of local hospitals assumed to provide inadequate care. This study examines hospital use by aged rural Delaware Medicare beneficiaries living in a ZIP code area that has a local hospital during Fiscal Year (FY) 1987 (N = 670). Most of these Medicare beneficiaries were hospitalized locally. Those beneficiaries who bypassed local rural hospitals usually did so because cardiovascular surgical procedures were required and were often only performed in large urban teaching hospitals. Beneficiaries using nonlocal hospitals were similar to users of local hospitals with respect to age and sex and traveled an average of nearly 42 miles for treatment. "Bypassing" here appears to be due primarily to regional specialization of care rather than abandonment of local rural hospitals by rural residents. |
This invention relates to a clamping device for dental handpieces.
More particularly, the invention is concerned with dental handpieces having an elongated handpiece sleeve in which a drive shaft is rotatably mounted. The drive shaft drives a tooth treatment tool e.g. a drill. The drive shaft has at one end an opening or hollow portion at its output side to receive the tool shank. The drive shaft at its output side is provided with several depressions distributed over the circumferential wall of the cavity of the end portion, of decreasing depth as viewed in radial section. These depressions are provided for the external suspension of roll bodies which form a roll clamping lock retaining the tool during rotation of the driving shaft. The internal suspension of the roll bodies are formed by openings in a bushing which surrounds the tool shank and is formed in the manner of a roll or antifriction body cage. The openings permit application of or abutment of the roll bodies against the tool shank. The bushing is provided with a pre-clamping element to retain the inserted tool prior to the starting of the rotation of the driving shaft.
In principle, the roll bodies of such self-locking roll clamping locks may be balls. Expediently, however, the roll bodies consist of needles or rollers. The depressions serve for the external suspension for the roll bodies and are designed as axial grooves; and the openings which provide for the internal suspension are axial slots. The depth of the depressions varies in an arcuate fashion, particularly as seen in radial section, and expediently decreases uniformly from the lowest point toward both sides so that the roll bodies occupy their clamping position relative to the tool shank independently of the direction of rotation of the driving shaft when the latter starts up. As a result of a non-uniform decrease of the depth of the depressions a freewheeling can be obtaining in one of the two directions of rotation of the driving shaft. The number of roll bodies or roll elements is generally more than two, preferably three.
The terms used "axial" and "radial" refer to the axes of the driving shaft or respectively to the handpiece sleeve.
A clamping device having the aforesaid features is known from German Pat. No. 811,250. In this known prior art clamping device, a pre-clamping element forming part of a bushing is used to retain or hold the tool prior to the starting of the rotation of the drive shaft. For this purpose, springs are placed around the bushing and act on the roll bodies which consist of needles centrically, i.e. radially inward. A similar arrangement with such springs is disclosed in German Pat. No. 592,225. Upon starting of the drive shaft, the springs constitute a counter-force which act on the roll bodies; the entire control is based upon the proper dimensioning of the springs, and this is usually quite difficult. Accordingly, depending on the dimensioning of the springs, the roll bodies either occupy their clamping position or are prevented from doing so. If the spring force is too weak, the roll bodies are permited to occupy the clamping position, but the roll bodies are prevented from moving out of the clamping position because of the now additionally generated clamping force of the springs. The correct dimensioning of the springs is therefore difficult.
A clamping device similar to the aforementioned type, but without a bushing having a pre-clamping element which surrounds the tool shank, i.e. arranged in the cavity of the driving shaft, is disclosed in German Pat. No. 905,528. In this known clamping device, the pre-clamping element consists of a separate arrangement. In this arrangement, three clamping balls are disposed around the tool shank which are provided in openings in the driving shaft and are arranged in the manner of a ball bearing cage so that they can be applied internally against the tool shank and externally against the conical inner wall of a clamping sleeve in clamped position under the action of a clamping spring and mounted on the driving shaft. By means of an outer grip, the clamping sleeve can be displaced on the driving shaft counter to the action of the clamping spring axially into the release position. In this known clamping device, inwardly pressing the clamping balls may cause damage and deformations on the tool shank which will make repeated use of the tool and its extraction from the clamping device doubtful.
Moreover, all mentioned known clamping devices have the following disadvantages: When a strong load is applied to the tooth treatment tool, i.e. at increased torque, the roll bodies may be wedged between the driving shaft and tool shank so strongly that at decreased torque or standstill of the driving shaft the roll bodies will no longer be able to become released from their clamping position. As a result, the tool cannot be extracted from the clamping device and hence from the handpiece. If, in order to prevent this, the depressions distributed over the inner circumferential wall of the hollow end portion of the driving shaft were formed with a depth decreasing more as seen in radial section, then, difficulties would arise under decreased load at too great a decrease of the depth, the clamping force of the roll bodies would, during the decrease of the load of the tool, i.e. at reduction of the torque, diminish while the driving shaft is still running; or respectively, the roll bodies would release from their clamping position, so that the tool would start to vibrate and become released from the clamping device, and this may lead to dangerous injuries.
It is a principal object underlying the invention to provide a clamping device of the above-mentioned kind to avoid springs difficult to dimension and clamping balls which cause damage to the tool shank, while assurance is given that on the one hand a sufficient clamping action is always exerted by the roll bodies onto the tool shank during the period the driving shaft is running, and that on the other hand the tool can freely be extracted from the clamping device when the driving shaft is stopped and stands still. |
Are we having fun yet? Brits come 18th in UN's first World Happiness rankings... behind Costa Rica, Israel and UAE
The UK has been placed behind the likes of Costa Rica, Israel and the United Arab Emirates in a global league table of happiness.
Despite being one of the richest nations in the world, the UK has been ranked as only the 18th happiest in an authoritative United Nations report, behind much poorer countries.
Britain was placed six places behind Costa Rica – a country where average income levels are less than one quarter of those in the UK.
Nobody happier: Nyhavn in Copenhagen, Denmark, where citizens are the happiest in the world, the report found
The relatively high level of family breakdown in the UK is one reason why we may have been pushed down the list.
The table was topped by wealthy Scandinavian nations – with Denmark, Finland and Norway ranked as the three happiest respectively.
Impoverished and war-ravaged nations in Africa, including Sierra Leone and Togo, came at the bottom of the table.
But despite a general link between a country’s wealth and its mood, the author of the World Happiness Report said the two factors were not inherently linked.
Not happy: Women shop at a market in Tsevie, Togo, Africa. Togo is the least happy nation in the world, behind a long list of other countries in sub-Saharan Africa
Jeffrey Sachs, a development economist from New York’s Columbia University, said happiness could be achieved independently of a country’s economic performance, arguing: ‘The U.S. has had a three-time increase of gross national product per capita since 1960, but the happiness needle hasn’t budged.’
WHO ARE THE WORLD'S HAPPIEST?
1. Denmark 2. Finland 3. Norway 4. Netherlands 5. Canada 6. Switzerland 7. Sweden
8. New Zealand 9. Australia 10. Ireland 11. USA 12. Costa Rica 13. Austria 14. Israel 15. Belgium 16. Luxembourg 17. United Arab Emirates
18. United Kingdom 19. Venezuela
20. Iceland
Other factors such as social relations and general health were deemed more important.
The report incorporated several British studies which had found that marriage and self-employment were key factors leading to an increase in levels of happiness in the UK.
Mr Sachs said ‘affluence has created its own set of afflictions’.
He added that economic development led to problems such as eating disorders, obesity, diabetes and tobacco-related illnesses. The academic also said economic development led to addiction to shopping, television and gambling.
He warned that there were wider social issues associated with economic growth, including ‘the loss of community, the decline of social trust, and the rising anxiety levels associated with the vagaries of the modern globalised economy’.
The table was created by the UN, which compiled worldwide survey responses from 2005 until mid-2011 to determine the happiness level of 156 different countries.
The idea of a national happiness score in order to determine policy has been used in Britain.
Last year a controversial £2million survey ordered by David Cameron concluded that three quarters of the population rated themselves as ‘seven out of ten’ on a wellbeing scale.
Critics of the survey argued that it was costly and unnecessary.
|
Q:
Directly computing the ideal of a variety
Let $k$ be an algebraically closed field, let $f \in k[x,y]$ be an irreducible polynomial, and let $C = V(f)$ be the variety it defines. Show directly (without using the Nullstellensatz) that $I(C) = (f)$.
The fact that $(f) \subset I(C)$ is clear, but I'm not sure how to show the other inclusion. I know that I need to show that for $g \in I(C)$, $g = hf$ for some $h \in k[x,y]$.
So, write $g = qf + r$ where all letters are polynomials. It will be enough to show $r = 0$. Since $g(x) = 0$ for all $x \in V(f)$, we see that $r(x) \in I(C)$. I'm not sure how to show that $r$ is identically zero though.
A:
I hope someone will post a nicer answer. But for now here is a slightly crude idea.
Suppose $g \in I(C)$, but $g \notin (f)$. In particular $g$ and $f$ have no common factor in $k[x,y]$—this is where we use irreducibility of $f$. (If $f$ and $g$ had a common factor, that common factor would have to be $f$, and we'd have $f \mid g$.) Consider $f, g \in k[x][y]$, i.e., as polynomials in $y$ with coefficients in $k[x]$. We have $k[x][y] \subset k(x)[y]$, which is a Euclidean domain since $k(x)$ is a field. And $g$ and $f$ still have no common factor in $k(x)[y]$, since if $p(x,y)/q(x)$ were a common factor of $g$ and $f$, then $p$ would be a common factor of $g$ and $f$ in $k[x,y]$.
So, in $k(x)[y]$, $(f,g)=1$. That means there are $p,q \in k(x)[y]$ such that $pf+qg=1$. Then clearing denominators, $p'f+q'g=d$, where $p',q' \in k[x,y]$ and $d \in k[x]$, and $d \neq 0$. Every point of $I(C)$ is a vanishing point of $f$ and $g$, hence also of $d$. So $I(C)$ is contained in the union of finitely many "vertical" lines, namely $V(D)$ (one line for each root of $d$).
Finally we use the closedness of $k$. First of all, for each $a \in k$, the vertical line $x=a$ must intersect $I(C)$, since the univariate polynomial $f(a,y)$ has roots in $k$. Second, $k$ is infinite; there are infinitely many "vertical" lines. This shows that $I(C)$ is not contained in any finite union of vertical lines. Contradiction.
Well, having written all that, I will say that it should be possible to simplify things if you can use resultants. The polynomial $d$ is a resultant of $f$ and $g$; you have to show that the resultant is not identically zero, which should not be too hard I think... (We got $d \neq 0$ because it is a common denominator for $p$ and $q$.)
|
<html xmlns="http://www.w3.org/1999/xhtml" xmlns:math="http://www.w3.org/1998/Math/MathML">
<head>
<script>
function boom()
{
var mtd1 = document.getElementById("mtd1");
var mtd2 = document.getElementById("mtd2");
var newSpan = document.createElementNS("http://www.w3.org/1999/xhtml", "span");
mtd1.appendChild(newSpan);
mtd1.removeAttribute("columnspan");
mtd2.setAttribute("columnspan", 0);
}
</script>
</head>
<body onload="boom();">
<math:mtd id="mtd1" columnspan="5" /><math:mtd id="mtd2" />
</body>
</html>
|
Bulletin of the World Health Organization
Menu
Global HIV/AIDS target will not be achieved by WHO alone, says WHO HIV/AIDS Director
1 June 2004
The global target of providing 3 million people in developing countries with antiretroviral treatment by 2005 — "3 by 5" — is still achievable but its ultimate success depends on how much political will, money and resolve the world is willing to invest, said Dr Jim Yong Kim in a special interview in the July issue of the Bulletin of the World Health Organization (2004;82(6):474-476) .
"WHO has chosen to hold itself accountable to the "3 by 5" target because we feel it is the most concrete, transforming and appropriate goal around which to organize our activities at this point in the epidemic," said Kim. "Whether or not the world can achieve "3 by 5" will depend on many other actors. In proclaiming our [WHO's] commitment to the target, we are saying that we will do everything in our power to help countries reach their aspirations in treating their HIV-positive citizens."
WHO's primary role in combating the global AIDS pandemic has been to develop the public health approach that, according to Kim, is essential for the successful and sustainable expansion of HIV treatment in developing countries: "In order to quickly and equitably roll out HIV treatment in resource-poor settings, we could not take a one doctor, one patient approach." Until recently, the only way HIV could be treated was in a hospital-based, first-world type approach where physicians were the only ones able to administer HIV/AIDS treatment but this approach fails in poor countries, explained Kim.
WHO's decision to focus on HIV/AIDS rather than any other global health problem reflects in part a growing recognition by the world's leaders of the gravity of an epidemic which in many countries, is wiping out the segment of the population essential for its social and economic survival. This is reflected in the fact that much of the new money invested in health has been flagged for HIV/AIDS, said Kim.
Although more funds than ever before have been pledged for AIDS relief in developing countries — over US$ 20 billion so far, in 2003 only 400 000 of the six million people requiring antiretroviral treatment were actually receiving it. Over 90% of those needing antiretroviral treatment live in developing, mainly sub-Saharan, countries.
"The world has voted — presidents and prime ministers have voted — to put their money into the fight against HIV/AIDS. For WHO to turn its back on HIV/AIDS would be tantamount to a dereliction of duty," said Kim who see WHO's key role now to be at the country level, helping to ensure that the funds are spent efficiently on the ground.
WHO has also been able to use its unique position to address the gap in drug quality assurance faced by many developing countries able to import cheaper generic drugs under a trade and intellectual property agreement developed at the World Trade Organization. Using its pre-qualification system, WHO has been able to act in a global drug regulatory capacity and evaluate the quality of imported drugs for use in those countries which may not have good drug regulatory authorities themselves. The pre-qualification system uses the expertise of drug regulators from countries like Switzerland, Canada, Australia and France and from 16 other countries.
During the interview, WHO's HIV/AIDS strategy under the spotlight, Kim also addressed some of the ethical issues surrounding the "3 by 5" strategy such as the difficult decision faced by many countries scaling up treatment of who to treat first as well as how those same countries will face up to the challenge of protecting patient confidentiality.
Key issues that still need to be addressed, said Kim, include the possible emergence of HIV resistance and the role of supervised therapy in preventing this, the cost of second-line drug regimens and a potential price rise in first-line regimens following 2005 when countries become TRIPS [trade-related aspects of intellectual property rights] compliant.
Discussing whether "3 by 5" is achievable is not as important as identifying the obstacles to achieving it and developing ways of overcoming them, said Kim.
"Right now, we are doing everything we can to help bring all the players together because the whole world needs to rally around this incredible challenge, if we are going to reach "3 by 5."
For further information please contact Ms Samantha Bolton, Communications Officer, HIV/AIDS Department, WHO, Tel: +41 22 791 1970, email: boltons@who.int. All WHO Press Releases, Facts Sheets and Features can be obtained on the WHO home page http://www.who.int. |
Nicholas Coni describes *Medicine and warfare: Spain, 1936--1939* as "the only book, ... even in Spanish or Catalan, that tries to present an impartial and reasonably comprehensive portrait of the medical, surgical, and nursing implications" of the Spanish Civil War (p. xix). In spite of the vast literature covering many aspects of the Spanish hostilities, and the importance of that conflict in shaping European expectations about the medical consequences of modern warfare, this claim is fair. There has been little attempt to account systematically for the medical practices of either Nationalists or Republicans and the challenges to which they responded. It is the major strength of *Medicine and warfare* to have filled this gap.
Yet, as Coni admits, his task was both "ambitious and daunting", and his 266-page tome is a slim volume for a bold project. The range of the twelve chapters indicates how slim: 'Nursing', 'Blood transfusion', 'International Brigades' and 'Famine and disease', all feature. Their organization into discrete, free-standing units leaves little opportunity for narrative and does not help to impart a sense of how medical knowledge developed under the particular conditions of "Spain, 1936--1939". Instead, Coni concentrates on names, injuries, dates and places. This happens especially in the chapter on 'Wound care', where 'Types of wound', 'Severe facial injuries', and 'Other measures in use for casualties' are listed without additional comment, followed by short commentaries on burns, frostbite, and wounds of the head, abdomen, chest, eyes, ears, and vessels. This style is typical of several chapters in *Medicine and warfare*, and unfortunately makes impossible a sustained analysis of the complex relations between those two terms.
Coni privileges current understandings of medical concepts and practices. In a discussion of the innovative and controversial use of stored blood by the Republican haematologist, Federico Durán Jordá, he paraphrases the received account of the Barcelona Blood Transfusion Service before endorsing the latter-day consensus that opposition to blood storage was little more than "prejudice" (pp. 75--7). Yet it might have been more interesting to consider how the conditions of warfare prompted reliance upon a technology whose status remained suspect in several countries long after the closure of Spanish hostilities in 1939. Elsewhere, Coni defines "shock" in present-day terms, rather than as a concept that evolved and mutated through the novel experiences and innovations of wartime medicine. So it is unsurprising that his central conclusion is a variant on a familiar, but contentious, aphorism: "medical science flourished during the Spanish Civil War" (p. 1).
But Coni, who makes no large historical claims, has accomplished what he set out to do and described the "medical implications" of the Spanish conflict in a rich compendium of facts. The separate chapter of 'Biographical notes' provides especially helpful information on some of the major medical innovators of the period, while the bibliography is a trove of relevant sources. A further advantage is the clarity of Coni\'s consistently accessible writing; methodological choices and limits on content are also made clear from the outset. Though readers should not expect the evocative prose and deeply contextualized analyses that characterize the best histories of the Spanish Civil War, this original effort to map uncharted territory will prove invaluable to anyone wishing to continue research in the area.
|
Interlaboratory study of the bioluminescence inhibition tests for rapid wastewater toxicity assessment.
Several toxicity procedures are currently being used for the wastewater toxicity assessment. We have undertaken an interlaboratory comparison of the use of different bioluminescence inhibition toxicity tests based on Vibrio fischeri, in order to evaluate their reproducibility for the rapid wastewater toxicity assessment. Twenty-two laboratories took part in this study organized by the Institut Català de Tecnologia (ICT) and the Consejo Superior de Investigaciones Cientificas (CSIC). During the exercise, six series of six samples were analyzed along 5 months. Every batch of samples was composed by three real samples and three standard solutions. The real samples were: an untreated effluent of a paper industry, a sample from a first settlement of a wastewater treatment plant (WWTP) and the final effluent of the WWTP. The goals of the interlaboratory study were to evaluate the repeatability (r) and reproducibility (R) when different laboratories conduct the test, the influence of different matrix samples, the variability between different tests based on the same principle: the bioluminescence inhibition of V. fischeri, but involving different commercial devices and to determine the rate at which participating laboratories successfully completed tests initiated. The maximum number of outlier values was corresponding to a non-treated effluent from a paper industry. This also was the most complex and toxic sample analyzed. An increase on the non-convergent values obtained for the participants was observed at higher matrix complexity and at lower toxicity level. In comparison with other editions of this interlaboratory study the matrixes of real samples analyzed were more complex, nevertheless the final variability coefficient for the exercise was nearby to the average value for the past editions. Due to the high complexity of some samples involved in this intercalibration the stability of real samples were also followed during the test. On the other hand, no relation was found between final results and the different devices, as show the cluster analysis. |
Nord-Troms District Court
Nord-Troms District Court () is a district court located in the city of Tromsø in Troms county, Norway. The court serves the part of the county located north of the Malangen fjord, plus the territory of Svalbard. This includes the municipalities of Tromsø, Karlsøy, Balsfjord, Storfjord, Gáivuotna – Kåfjord, Nordreisa, Skjervøy and Kvænangen (and Svalbard). The court is subordinate to the Hålogaland Court of Appeal. The court is led by the chief judge () Unni Sandbukt. This court employs a chief judge and nine other judges.
The court is a court of first instance. Its judicial duties are mainly to settle criminal cases and to resolve civil litigation as well as bankruptcy. The administration and registration tasks of the court include death registration, issuing certain certificates, performing duties of a notary public, and officiating civil wedding ceremonies. Cases from this court are heard by a combination of professional judges and lay judges. Cases from this district court may be appealed to the Hålogaland Court of Appeal.
History
Starting around 1600, Troms county was divided into two district courts: Senja and Tromsø District Counrt, which were merged in 1755 into one court. When Tromsø became a kjøpstad in 1794, it was supposed to have its own court, although that didn't actually happen until 1838. In 1855, the district court was divided back to the historical Senja and Tromsø courts. In 1917, the Tromsø district court was divided into two: Malangen District Court and Lyngen District Court. In 1985, a new Tromsø District Court was established by the merger of Tromsø City Court and the Malangen District Court. In 1990, the Nord-Troms District Court was created when the Tromsø District Court was merged with the Lyngen District Court. Originally, it was called the , but in 2002, all courts of first instance in Norway changed their name , thus its present name is .
References
Category:District courts of Norway
Category:Organisations based in Tromsø
Category:Politics of Svalbard |
/*
* COPYRIGHT: See COPYING in the top level directory
* PROJECT: ReactOS kernel
* FILE: drivers/fs/vfat/volume.c
* PURPOSE: VFAT Filesystem
* PROGRAMMER: Jason Filby (jasonfilby@yahoo.com)
* Herve Poussineau (reactos@poussine.freesurf.fr)
*/
/* INCLUDES *****************************************************************/
#include "vfat.h"
#define NDEBUG
#include <debug.h>
/* FUNCTIONS ****************************************************************/
static
NTSTATUS
FsdGetFsVolumeInformation(
PDEVICE_OBJECT DeviceObject,
PFILE_FS_VOLUME_INFORMATION FsVolumeInfo,
PULONG BufferLength)
{
PDEVICE_EXTENSION DeviceExt;
DPRINT("FsdGetFsVolumeInformation()\n");
DPRINT("FsVolumeInfo = %p\n", FsVolumeInfo);
DPRINT("BufferLength %lu\n", *BufferLength);
DPRINT("Required length %lu\n", (sizeof(FILE_FS_VOLUME_INFORMATION) + DeviceObject->Vpb->VolumeLabelLength));
DPRINT("LabelLength %hu\n", DeviceObject->Vpb->VolumeLabelLength);
DPRINT("Label %*.S\n", DeviceObject->Vpb->VolumeLabelLength / sizeof(WCHAR), DeviceObject->Vpb->VolumeLabel);
if (*BufferLength < sizeof(FILE_FS_VOLUME_INFORMATION))
return STATUS_INFO_LENGTH_MISMATCH;
if (*BufferLength < (sizeof(FILE_FS_VOLUME_INFORMATION) + DeviceObject->Vpb->VolumeLabelLength))
return STATUS_BUFFER_OVERFLOW;
DeviceExt = DeviceObject->DeviceExtension;
/* valid entries */
FsVolumeInfo->VolumeSerialNumber = DeviceObject->Vpb->SerialNumber;
FsVolumeInfo->VolumeLabelLength = DeviceObject->Vpb->VolumeLabelLength;
RtlCopyMemory(FsVolumeInfo->VolumeLabel, DeviceObject->Vpb->VolumeLabel, FsVolumeInfo->VolumeLabelLength);
if (DeviceExt->VolumeFcb->Flags & FCB_IS_FATX_ENTRY)
{
FsdDosDateTimeToSystemTime(DeviceExt,
DeviceExt->VolumeFcb->entry.FatX.CreationDate,
DeviceExt->VolumeFcb->entry.FatX.CreationTime,
&FsVolumeInfo->VolumeCreationTime);
}
else
{
FsdDosDateTimeToSystemTime(DeviceExt,
DeviceExt->VolumeFcb->entry.Fat.CreationDate,
DeviceExt->VolumeFcb->entry.Fat.CreationTime,
&FsVolumeInfo->VolumeCreationTime);
}
FsVolumeInfo->SupportsObjects = FALSE;
DPRINT("Finished FsdGetFsVolumeInformation()\n");
*BufferLength -= (sizeof(FILE_FS_VOLUME_INFORMATION) + DeviceObject->Vpb->VolumeLabelLength);
DPRINT("BufferLength %lu\n", *BufferLength);
return STATUS_SUCCESS;
}
static
NTSTATUS
FsdGetFsAttributeInformation(
PDEVICE_EXTENSION DeviceExt,
PFILE_FS_ATTRIBUTE_INFORMATION FsAttributeInfo,
PULONG BufferLength)
{
PCWSTR pName; ULONG Length;
DPRINT("FsdGetFsAttributeInformation()\n");
DPRINT("FsAttributeInfo = %p\n", FsAttributeInfo);
DPRINT("BufferLength %lu\n", *BufferLength);
if (*BufferLength < sizeof (FILE_FS_ATTRIBUTE_INFORMATION))
return STATUS_INFO_LENGTH_MISMATCH;
if (DeviceExt->FatInfo.FatType == FAT32)
{
Length = 10;
pName = L"FAT32";
}
else
{
Length = 6;
pName = L"FAT";
}
DPRINT("Required length %lu\n", (sizeof(FILE_FS_ATTRIBUTE_INFORMATION) + Length));
if (*BufferLength < (sizeof(FILE_FS_ATTRIBUTE_INFORMATION) + Length))
return STATUS_BUFFER_OVERFLOW;
FsAttributeInfo->FileSystemAttributes =
FILE_CASE_PRESERVED_NAMES | FILE_UNICODE_ON_DISK;
FsAttributeInfo->MaximumComponentNameLength = 255;
FsAttributeInfo->FileSystemNameLength = Length;
RtlCopyMemory(FsAttributeInfo->FileSystemName, pName, Length);
DPRINT("Finished FsdGetFsAttributeInformation()\n");
*BufferLength -= (sizeof(FILE_FS_ATTRIBUTE_INFORMATION) + Length);
DPRINT("BufferLength %lu\n", *BufferLength);
return STATUS_SUCCESS;
}
static
NTSTATUS
FsdGetFsSizeInformation(
PDEVICE_OBJECT DeviceObject,
PFILE_FS_SIZE_INFORMATION FsSizeInfo,
PULONG BufferLength)
{
PDEVICE_EXTENSION DeviceExt;
NTSTATUS Status;
DPRINT("FsdGetFsSizeInformation()\n");
DPRINT("FsSizeInfo = %p\n", FsSizeInfo);
if (*BufferLength < sizeof(FILE_FS_SIZE_INFORMATION))
return STATUS_BUFFER_OVERFLOW;
DeviceExt = DeviceObject->DeviceExtension;
Status = CountAvailableClusters(DeviceExt, &FsSizeInfo->AvailableAllocationUnits);
FsSizeInfo->TotalAllocationUnits.QuadPart = DeviceExt->FatInfo.NumberOfClusters;
FsSizeInfo->SectorsPerAllocationUnit = DeviceExt->FatInfo.SectorsPerCluster;
FsSizeInfo->BytesPerSector = DeviceExt->FatInfo.BytesPerSector;
DPRINT("Finished FsdGetFsSizeInformation()\n");
if (NT_SUCCESS(Status))
*BufferLength -= sizeof(FILE_FS_SIZE_INFORMATION);
return Status;
}
static
NTSTATUS
FsdGetFsDeviceInformation(
PDEVICE_OBJECT DeviceObject,
PFILE_FS_DEVICE_INFORMATION FsDeviceInfo,
PULONG BufferLength)
{
DPRINT("FsdGetFsDeviceInformation()\n");
DPRINT("FsDeviceInfo = %p\n", FsDeviceInfo);
DPRINT("BufferLength %lu\n", *BufferLength);
DPRINT("Required length %lu\n", sizeof(FILE_FS_DEVICE_INFORMATION));
if (*BufferLength < sizeof(FILE_FS_DEVICE_INFORMATION))
return STATUS_BUFFER_OVERFLOW;
FsDeviceInfo->DeviceType = FILE_DEVICE_DISK;
FsDeviceInfo->Characteristics = DeviceObject->Characteristics;
DPRINT("FsdGetFsDeviceInformation() finished.\n");
*BufferLength -= sizeof(FILE_FS_DEVICE_INFORMATION);
DPRINT("BufferLength %lu\n", *BufferLength);
return STATUS_SUCCESS;
}
static
NTSTATUS
FsdSetFsLabelInformation(
PDEVICE_OBJECT DeviceObject,
PFILE_FS_LABEL_INFORMATION FsLabelInfo)
{
PDEVICE_EXTENSION DeviceExt;
PVOID Context = NULL;
ULONG DirIndex = 0;
PDIR_ENTRY Entry;
PVFATFCB pRootFcb;
LARGE_INTEGER FileOffset;
BOOLEAN LabelFound = FALSE;
DIR_ENTRY VolumeLabelDirEntry;
ULONG VolumeLabelDirIndex;
ULONG LabelLen;
NTSTATUS Status = STATUS_UNSUCCESSFUL;
OEM_STRING StringO;
UNICODE_STRING StringW;
CHAR cString[43];
ULONG SizeDirEntry;
ULONG EntriesPerPage;
DPRINT("FsdSetFsLabelInformation()\n");
DeviceExt = (PDEVICE_EXTENSION)DeviceObject->DeviceExtension;
if (sizeof(DeviceObject->Vpb->VolumeLabel) < FsLabelInfo->VolumeLabelLength)
{
return STATUS_NAME_TOO_LONG;
}
if (DeviceExt->Flags & VCB_IS_FATX)
{
if (FsLabelInfo->VolumeLabelLength / sizeof(WCHAR) > 42)
return STATUS_NAME_TOO_LONG;
SizeDirEntry = sizeof(FATX_DIR_ENTRY);
EntriesPerPage = FATX_ENTRIES_PER_PAGE;
}
else
{
if (FsLabelInfo->VolumeLabelLength / sizeof(WCHAR) > 11)
return STATUS_NAME_TOO_LONG;
SizeDirEntry = sizeof(FAT_DIR_ENTRY);
EntriesPerPage = FAT_ENTRIES_PER_PAGE;
}
/* Create Volume label dir entry */
LabelLen = FsLabelInfo->VolumeLabelLength / sizeof(WCHAR);
RtlZeroMemory(&VolumeLabelDirEntry, SizeDirEntry);
StringW.Buffer = FsLabelInfo->VolumeLabel;
StringW.Length = StringW.MaximumLength = (USHORT)FsLabelInfo->VolumeLabelLength;
StringO.Buffer = cString;
StringO.Length = 0;
StringO.MaximumLength = 42;
Status = RtlUnicodeStringToOemString(&StringO, &StringW, FALSE);
if (!NT_SUCCESS(Status))
return Status;
if (DeviceExt->Flags & VCB_IS_FATX)
{
RtlCopyMemory(VolumeLabelDirEntry.FatX.Filename, cString, LabelLen);
memset(&VolumeLabelDirEntry.FatX.Filename[LabelLen], ' ', 42 - LabelLen);
VolumeLabelDirEntry.FatX.Attrib = _A_VOLID;
}
else
{
RtlCopyMemory(VolumeLabelDirEntry.Fat.Filename, cString, max(sizeof(VolumeLabelDirEntry.Fat.Filename), LabelLen));
if (LabelLen > sizeof(VolumeLabelDirEntry.Fat.Filename))
{
memset(VolumeLabelDirEntry.Fat.Ext, ' ', sizeof(VolumeLabelDirEntry.Fat.Ext));
RtlCopyMemory(VolumeLabelDirEntry.Fat.Ext, cString + sizeof(VolumeLabelDirEntry.Fat.Filename), LabelLen - sizeof(VolumeLabelDirEntry.Fat.Filename));
}
else
{
memset(&VolumeLabelDirEntry.Fat.Filename[LabelLen], ' ', sizeof(VolumeLabelDirEntry.Fat.Filename) - LabelLen);
}
VolumeLabelDirEntry.Fat.Attrib = _A_VOLID;
}
pRootFcb = vfatOpenRootFCB(DeviceExt);
/* Search existing volume entry on disk */
FileOffset.QuadPart = 0;
if (CcPinRead(pRootFcb->FileObject, &FileOffset, SizeDirEntry, TRUE, &Context, (PVOID*)&Entry))
{
while (TRUE)
{
if (ENTRY_VOLUME(DeviceExt, Entry))
{
/* Update entry */
LabelFound = TRUE;
RtlCopyMemory(Entry, &VolumeLabelDirEntry, SizeDirEntry);
CcSetDirtyPinnedData(Context, NULL);
Status = STATUS_SUCCESS;
break;
}
if (ENTRY_END(DeviceExt, Entry))
{
break;
}
DirIndex++;
Entry = (PDIR_ENTRY)((ULONG_PTR)Entry + SizeDirEntry);
if ((DirIndex % EntriesPerPage) == 0)
{
CcUnpinData(Context);
FileOffset.u.LowPart += PAGE_SIZE;
if (!CcPinRead(pRootFcb->FileObject, &FileOffset, SizeDirEntry, TRUE, &Context, (PVOID*)&Entry))
{
Context = NULL;
break;
}
}
}
if (Context)
{
CcUnpinData(Context);
}
}
if (!LabelFound)
{
/* Add new entry for label */
if (!vfatFindDirSpace(DeviceExt, pRootFcb, 1, &VolumeLabelDirIndex))
Status = STATUS_DISK_FULL;
else
{
FileOffset.u.HighPart = 0;
FileOffset.u.LowPart = VolumeLabelDirIndex * SizeDirEntry;
if (!CcPinRead(pRootFcb->FileObject, &FileOffset, SizeDirEntry,
TRUE, &Context, (PVOID*)&Entry))
{
Status = STATUS_UNSUCCESSFUL;
}
else
{
RtlCopyMemory(Entry, &VolumeLabelDirEntry, SizeDirEntry);
CcSetDirtyPinnedData(Context, NULL);
CcUnpinData(Context);
Status = STATUS_SUCCESS;
}
}
}
vfatReleaseFCB(DeviceExt, pRootFcb);
if (!NT_SUCCESS(Status))
{
return Status;
}
/* Update volume label in memory */
DeviceObject->Vpb->VolumeLabelLength = (USHORT)FsLabelInfo->VolumeLabelLength;
RtlCopyMemory(DeviceObject->Vpb->VolumeLabel, FsLabelInfo->VolumeLabel, DeviceObject->Vpb->VolumeLabelLength);
return Status;
}
/*
* FUNCTION: Retrieve the specified volume information
*/
NTSTATUS
VfatQueryVolumeInformation(
PVFAT_IRP_CONTEXT IrpContext)
{
FS_INFORMATION_CLASS FsInformationClass;
NTSTATUS RC = STATUS_SUCCESS;
PVOID SystemBuffer;
ULONG BufferLength;
/* PRECONDITION */
ASSERT(IrpContext);
DPRINT("VfatQueryVolumeInformation(IrpContext %p)\n", IrpContext);
if (!ExAcquireResourceSharedLite(&((PDEVICE_EXTENSION)IrpContext->DeviceObject->DeviceExtension)->DirResource,
(BOOLEAN)(IrpContext->Flags & IRPCONTEXT_CANWAIT)))
{
return VfatQueueRequest(IrpContext);
}
/* INITIALIZATION */
FsInformationClass = IrpContext->Stack->Parameters.QueryVolume.FsInformationClass;
BufferLength = IrpContext->Stack->Parameters.QueryVolume.Length;
SystemBuffer = IrpContext->Irp->AssociatedIrp.SystemBuffer;
DPRINT("FsInformationClass %d\n", FsInformationClass);
DPRINT("SystemBuffer %p\n", SystemBuffer);
switch (FsInformationClass)
{
case FileFsVolumeInformation:
RC = FsdGetFsVolumeInformation(IrpContext->DeviceObject,
SystemBuffer,
&BufferLength);
break;
case FileFsAttributeInformation:
RC = FsdGetFsAttributeInformation(IrpContext->DeviceObject->DeviceExtension,
SystemBuffer,
&BufferLength);
break;
case FileFsSizeInformation:
RC = FsdGetFsSizeInformation(IrpContext->DeviceObject,
SystemBuffer,
&BufferLength);
break;
case FileFsDeviceInformation:
RC = FsdGetFsDeviceInformation(IrpContext->DeviceObject,
SystemBuffer,
&BufferLength);
break;
default:
RC = STATUS_NOT_SUPPORTED;
}
ExReleaseResourceLite(&((PDEVICE_EXTENSION)IrpContext->DeviceObject->DeviceExtension)->DirResource);
IrpContext->Irp->IoStatus.Status = RC;
if (NT_SUCCESS(RC))
IrpContext->Irp->IoStatus.Information =
IrpContext->Stack->Parameters.QueryVolume.Length - BufferLength;
else
IrpContext->Irp->IoStatus.Information = 0;
IoCompleteRequest(IrpContext->Irp, IO_NO_INCREMENT);
VfatFreeIrpContext(IrpContext);
return RC;
}
/*
* FUNCTION: Set the specified volume information
*/
NTSTATUS
VfatSetVolumeInformation(
PVFAT_IRP_CONTEXT IrpContext)
{
FS_INFORMATION_CLASS FsInformationClass;
NTSTATUS Status = STATUS_SUCCESS;
PVOID SystemBuffer;
ULONG BufferLength;
PIO_STACK_LOCATION Stack = IrpContext->Stack;
/* PRECONDITION */
ASSERT(IrpContext);
DPRINT("VfatSetVolumeInformation(IrpContext %p)\n", IrpContext);
if (!ExAcquireResourceExclusiveLite(&((PDEVICE_EXTENSION)IrpContext->DeviceObject->DeviceExtension)->DirResource,
(BOOLEAN)(IrpContext->Flags & IRPCONTEXT_CANWAIT)))
{
return VfatQueueRequest(IrpContext);
}
FsInformationClass = Stack->Parameters.SetVolume.FsInformationClass;
BufferLength = Stack->Parameters.SetVolume.Length;
SystemBuffer = IrpContext->Irp->AssociatedIrp.SystemBuffer;
DPRINT("FsInformationClass %d\n", FsInformationClass);
DPRINT("BufferLength %u\n", BufferLength);
DPRINT("SystemBuffer %p\n", SystemBuffer);
switch (FsInformationClass)
{
case FileFsLabelInformation:
Status = FsdSetFsLabelInformation(IrpContext->DeviceObject,
SystemBuffer);
break;
default:
Status = STATUS_NOT_SUPPORTED;
}
ExReleaseResourceLite(&((PDEVICE_EXTENSION)IrpContext->DeviceObject->DeviceExtension)->DirResource);
IrpContext->Irp->IoStatus.Status = Status;
IrpContext->Irp->IoStatus.Information = 0;
IoCompleteRequest(IrpContext->Irp, IO_NO_INCREMENT);
VfatFreeIrpContext(IrpContext);
return Status;
}
/* EOF */
|
# SimpleAggregateFunction {#data-type-simpleaggregatefunction}
`SimpleAggregateFunction(name, types_of_arguments…)` data type stores current value of the aggregate function, and does not store its full state as [`AggregateFunction`](../../sql-reference/data-types/aggregatefunction.md) does. This optimization can be applied to functions for which the following property holds: the result of applying a function `f` to a row set `S1 UNION ALL S2` can be obtained by applying `f` to parts of the row set separately, and then again applying `f` to the results: `f(S1 UNION ALL S2) = f(f(S1) UNION ALL f(S2))`. This property guarantees that partial aggregation results are enough to compute the combined one, so we don’t have to store and process any extra data.
The following aggregate functions are supported:
- [`any`](../../sql-reference/aggregate-functions/reference/any.md#agg_function-any)
- [`anyLast`](../../sql-reference/aggregate-functions/reference/anylast.md#anylastx)
- [`min`](../../sql-reference/aggregate-functions/reference/min.md#agg_function-min)
- [`max`](../../sql-reference/aggregate-functions/reference/max.md#agg_function-max)
- [`sum`](../../sql-reference/aggregate-functions/reference/sum.md#agg_function-sum)
- [`sumWithOverflow`](../../sql-reference/aggregate-functions/reference/sumwithoverflow.md#sumwithoverflowx)
- [`groupBitAnd`](../../sql-reference/aggregate-functions/reference/groupbitand.md#groupbitand)
- [`groupBitOr`](../../sql-reference/aggregate-functions/reference/groupbitor.md#groupbitor)
- [`groupBitXor`](../../sql-reference/aggregate-functions/reference/groupbitxor.md#groupbitxor)
- [`groupArrayArray`](../../sql-reference/aggregate-functions/reference/grouparray.md#agg_function-grouparray)
- [`groupUniqArrayArray`](../../sql-reference/aggregate-functions/reference/groupuniqarray.md)
- [`sumMap`](../../sql-reference/aggregate-functions/reference/summap.md#agg_functions-summap)
- [`minMap`](../../sql-reference/aggregate-functions/reference/minmap.md#agg_functions-minmap)
- [`maxMap`](../../sql-reference/aggregate-functions/reference/maxmap.md#agg_functions-maxmap)
Values of the `SimpleAggregateFunction(func, Type)` look and stored the same way as `Type`, so you do not need to apply functions with `-Merge`/`-State` suffixes. `SimpleAggregateFunction` has better performance than `AggregateFunction` with same aggregation function.
**Parameters**
- Name of the aggregate function.
- Types of the aggregate function arguments.
**Example**
``` sql
CREATE TABLE t
(
column1 SimpleAggregateFunction(sum, UInt64),
column2 SimpleAggregateFunction(any, String)
) ENGINE = ...
```
[Original article](https://clickhouse.tech/docs/en/data_types/simpleaggregatefunction/) <!--hide-->
|
Navigated minimally invasive facet fusion during percutaneous lumbar pedicle screw insertion: Technical note.
Minimally invasive surgery (MIS), or percutaneous, lumbar pedicle screw placement is commonly done, but the percutaneous nature of this makes posterior arthrodesis extremely difficult. Many times, surgeons will simply forego posterior arthrodesis, place posterior pedicle screws, and rely only on the interbody area for arthrodesis. We describe our technique of adding facet arthrodesis via the same corridor through which the pedicle screw is inserted with minimal addition of time or steps. We demonstrate our technique of how we use navigation and tubular retractors to perform posterior facet arthrodesis during percutaneous pedicle screw placement. We illustrate this technique with a case of a patient with scoliosis, intraoperative photos, and an illustrative video. We also show an intraoperative computed tomography image to help visualize the arthrodesis surfaces. With this technique, we show how there are a few additional steps that are not very time consuming to add posterior arthrodesis. MIS facet fusion can be performed in a relatively straightforward manner during percutaneous pedicle fixation without significant addition of intraoperative time or steps. It is possible to add posterior arthrodesis to percutaneous lumbar pedicle screw fusion with few added steps and minimal addition of time using navigation and MIS tubular retractors. |
Q:
Start another activity (by Intent) on half screen
Is it possible to start an activity (ie. Calculator) from within my main activity but in such a way that it only takes a part of the screen and not the whole screen?
A:
I don't think you can do that before honeycomb fragments.
But nothing prevents you from taking your calculator apart, and make it a reusable view.
|
Randy Merkley
(403) 992-0622
(403) 992-0622
8820 Blackfoot Trail SE, Suite 115, Calgary, AB T2J 3J1
A Better Way to Buy and Sell Real Estate
Thank you for visiting randymerkley.remax.ca! I look forward to hearing from you soon! Contact me any time, or visit my social media sites listed below for upcoming listings and market information. Email: randymerkley@shaw.ca Cell: 403.992.0622
Request More Info
RE/MAX FIRST
Our
home buying and selling experiences with Randy began couple years ago
with the sale & purchase of a home. All went very smoothly and
Randy's knowledge base of the area, diligence, and attention to detail
made those transactions worry free. Going forward for any such
transactions, Randy will be our first choice to get us into the next
house of our dreams and to sell our existing home once again. Randy was
somehow able to always be one step ahead and ultimately see us through
another sale and purchase. When the process seemed daunting, Randy was
the eternal optimist and reassured us that everything would work out. He
also sold our home within days of listing. From market analysis,
contract negotiations, and doing literally whatever it took to get both
deals done, Randy was outstanding in terms of his ability to make it
happen !! We felt like family and like we were his only client. Highly
recommend this agent and friend for your next real estate transaction.
He is truly one of the preferred realtor in NW Calgary !!
Abrar----We
have recently used Randy Merkley for a purchase and sale and he is by
far the best real estate agent we have ever been involved with. Randy is
very patient as we ultimately took over 2 years to make up our minds
and find the right house, he continued to work with us patiently and
was always very responsive and understanding. Exceptional communication
skills, he got to know us and a sense of what we were looking for and
worked hard to find it. He was so responsive and helpful. From start to
finish he went above and beyond in all areas and really helped us
through every part of the process. Definitely one of the best in the
business!Aaron & Michelle----Purchasing
our 1st home was a great experience & smooth process with Randy. He
worked tirelessly to find the right home to fit our needs in our top
choice communities. We would not hesitate to recommend Randy in the
future. Thank you! Jae & Sloane----My
husband and I had a wonderful experience working with Randy while
purchasing our first house in Canada. He was very patient and helpful.
Since we were new immigrants, we were told that it could be better to
work with a realtor from our home country. However, we decided to work
with Randy because of his wonderful personality and no regret at all."Neda & Kambiz ----
I
worked with Randy for over a year looking at dozens of properties to
find one that fit my needs. Randy was always professional and I always
felt that he had my best interests in mind. When we finally found a
property that worked, Randy was very honest in negotiations and made
sure the deal went through without any issues. It was a pleasure to
work with Randy and I will use him again in the future! Carey Taylor----We
just wanted to thank you for your outstanding work, support and
patience in the sale of our home in Panarama Hills, at a time we knew we
were taking a chance when the economy and house sales were not strong
and to sellers were not selling at asking price, you kept working hard
for us and were extremely patient, you have given us fair and
invaluable advise when it came to staging our house as well as keeping
us on track as far as the pricing and when and if to lower and right
down to the final negotiation with the other realtor/buyer, you knew
what we wanted and you helped us get there and we really had fun doing
so. We could not have asked for a better realtor…from start to finish,
your service was outstanding and should I do it again, I would use you
and your expertise and I will definitely refer you to anyone who is in
need of an awesome Realtor. Thank you again for all your efforts we
greatly appreciate all your support from start to finish. Simply put it
was an Amazing Experience!!
Darren and Landra
----We
have just completed our third transaction with Randy. He has been
prompt, professional, and available whenever we needed anything in both
our sale and purchase even though we are in Cochrane. The most
important thing to us is that we can trust Randy as he values his
integrity in work and family. He has gone out of his way to do what was
necessary to keep things on track for us such as delivering documents
or arranging cleaners during the busy time of packing and moving. We
will be using Randy again for our real estate needs in the future and
recommend others to do the same!Josh & Carmen
----Randy helped us with the sale of our home and was able to negotiate the final number to be well over the list price. When
it came time to purchase, we were looking for something very specific.
Randy was incredibly helpful and patient in finding us a great property
which we were able to purchase under value.Through the process we have gotten to know Randy as a friend and would highly recommend him.
Greg & Cindy----Over
the last years we have had the chance to do business with Randy as a
realtor and we can say he has been very helpful as he always find us a
property that matches our interests. We can say that Randy excels at
communication , he is a good negotiator and that he has a very good eye
for detail.First
he helped us to sell our house in Tuscany where we got multiple offers,
then he helped us to find a good investment property in the community
of Nolan Hill and he also helped us to find the perfect house for
ourselves in the amazing community of Riviera in Cochrane.Wahib & Veronica ----Working
with Randy was great! He was dedicated to our needs, highly accessible
whenever we needed him, and knowledgable about the buying and selling
process. We have recommended him to our friends and would definitely use
him again.Elia & Jeff----
Randy
walked us through the purchase of our first property and showed extreme
professionalism in doing so. Randy made himself very available and
worked above and beyond the call of duty, showing countless properties
to ensure we found the right home. You will not be disappointed with
Randy Merkley.Colby & Addie |
78 Cal.App.3d 788 (1978)
144 Cal. Rptr. 535
In re BUDDY EARL WRIGHT on Habeas Corpus.
Docket No. 9647.
Court of Appeals of California, Fourth District, Division Two.
March 16, 1978.
*791 COUNSEL
Raymond C. Youngquist and Roger S. Hanson for Petitioner.
Evelle J. Younger, Attorney General, Jack R. Winkler, Chief Assistant Attorney General, Daniel J. Kremer, Assistant Attorney General, Jay M. Bloom and Karl J. Phaler, Deputy Attorneys General, for Respondent.
OPINION
KAUFMAN, J.
In 1973 a jury convicted petitioner of kidnaping (Pen. Code, § 207) and rape by threat of force (Pen. Code, § 261, subd. 3) and found he was armed with and used a firearm in connection with each offense. The judgment of conviction was affirmed on appeal by this court *792 in an unpublished opinion (4 Crim. 6056). Petitioner, who is presently confined in state prison seeks habeas corpus on grounds of newly discovered evidence and false testimony by the principal prosecution witness.
On December 17, 1976, petitioner filed an application for writ of habeas corpus in Kern County Superior Court. That petition was subsequently transferred to and filed in the Superior Court of San Bernardino County. Following an extensive evidentiary hearing, the San Bernardino Superior Court denied the petition for habeas corpus. Thereafter petitioner filed the instant petition for habeas corpus directly in the California Supreme Court. That court ordered the Director of the Department of Corrections to show cause before this court why the relief prayed for should not be granted.
The Evidence at Trial
The case for the prosecution can be summarized as follows. On May 2, 1972, Mary R. resided at her mother's house in Ontario. At 11:30 p.m. enroute from her mother's house to her place of employment she stopped at the Circle K Market to purchase something to eat during her lunch break. After making her purchase, she returned to her unlocked car. As she was putting the key into the ignition, petitioner jumped into the car on the passenger side, pointed a gun at her face, and ordered her to turn the car radio off and to pull out of the parking lot.
Petitioner gave her various directions and, while proceeding past the Armory at John Galvin Park, petitioner ordered her to turn in the driveway and to park. Petitioner told Mary, "I want a little," got out on the passenger side, and told her to get out the same side.
Petitioner put the gun into his pocket and took Mary to the bushes against the wall of the Armory. He ordered her to take her clothes off and had intercourse with her. Petitioner then told her to get dressed, and they returned to the car. In her hurry to "get out of there and get away," Mary left her bra behind.
Petitioner directed Mary to drive on various streets and had her stop the car and let him out on Del Norte Avenue. Mary immediately went to her mother's house and reported the incident to her mother. Her father immediately notified the police.
*793 A description of petitioner was broadcasted over the police radio. Shortly after midnight on May 3, a man resembling the description broadcasted was seen by a patrolling police officer in a Chevrolet El Camino parked in the vicinity of the Holiday Inn. The man drove to the Holiday Inn parking lot and entered a room. The officer called for assistance. As he and other officers approached the motel room the man, later identified as petitioner, emerged. The officers told petitioner that they were investigating a possible rape, and one of the officers asked petitioner where he had been. Petitioner replied that he had been to the Circle K Market. The officers then advised petitioner of his Miranda rights and petitioner indicated that he understood them and wanted to clear up the matter.
Petitioner told the officers that he had been drinking at the Holiday Inn bar for about a half hour, that he had gone to the Circle K Market at about 12:17 a.m. and stayed about 20 minutes, and that on the way back to the motel his car had stalled. He denied that he had been with a woman that night. He stated that he did not have a gun.
Investigating officers found a brassiere in the bushes next to the wall of the Armory. On the morning of May 3, a student on the way to school found a .45 automatic wrapped in a towel on the sidewalk next to a field near the Holiday Inn. An examination of Mary R. disclosed scratches on the right thigh, on the back at the bra level, and on the right buttock. A vaginal smear revealed the presence of semen.
The defense was that Mary R. solicited and agreed to an act of prostitution, consented to intercourse and accused petitioner of rape because he failed to pay her the amount agreed upon. Petitioner testified he was the owner of a business engaged in highway construction; on May 2, 1972, he had come from his home in Visalia to Riverside to discuss some $27,000 owed him by the Sansone Company; he checked into the Holiday Inn at approximately 5 p.m. on May 2, 1972; he drank in the Holiday Inn bar from approximately 8 p.m. to 11 p.m.; he attempted to get something to eat at the Holiday Inn but learned it was too late; he drove to the Circle K Market to get something to eat; after he completed his purchase, he was approached by a young man outside the market who asked, "How would you like to have some of that," referring to a young woman inside the market whom petitioner identified as Mary R.; the young man indicated petitioner would have to discuss the financial arrangements with her; Mary R. emerged from the store, engaged petitioner in conversation and invited him into her automobile; after *794 some haggling she agreed to have intercourse with him for $20; petitioner agreed to pay her $10 before and $10 after the act; since he had some doubts what he might be getting involved in, he went back to his vehicle to get his brother's .45 caliber automatic he had in the glove compartment; he put the automatic in his jacket pocket but never pointed it at Mary; after having intercourse Mary became enraged when she discovered that petitioner could not pay her the additional $10 and told him, "I will show you." As he was driving his vehicle back to the Holiday Inn, petitioner was concerned that Mary might try to make trouble for him and became nervous when he saw police cars. He wrapped the .45 automatic in a towel and threw it out the door of his vehicle.
During the People's case in chief, on direct examination Mary R. testified that on the date of the rape she was married but was living apart from her husband and had a boyfriend. She denied that petitioner ever negotiated with her for an act of prostitution; she denied petitioner discussed giving her any money; and she denied that he gave her any money.
On cross-examination she testified she had lived in an apartment at 2644 Angela in Pomona and that that residence was shared by a number of other persons including Pam Lane Wallace, Betty Lou, Douglas Seibert, Richard Kilgore (nicknamed Hammy) and Frank DeMarte. She testified Larry Reynolds moved into that apartment when she moved out. She testified she had not had sexual relations with a man not her husband other than Frank DeMarte. She denied having sexual relations with Douglas Seibert or Larry Reynolds. She denied engaging in an act of sexual intercourse with anybody on an occasion when she went to the Colorado River around Easter of 1972.
Although the court restricted petitioner's cross-examination of Mary on the subject of her use of seconal, she did admit frequent use of seconal and amphetamines and indicated their use could produce symptoms of anger or short temper.
During trial, at a hearing outside the presence of the jury on petitioner's renewed Ballard motion to compel a psychiatric examination of Mary R., Mary denied having sexual relations with Jim Newlin and denied staying overnight at his apartment on Canoga Street in Montclair.
*795 The Evidentiary Hearing
In support of his petition for habeas corpus in the superior court, petitioner filed several declarations executed by Douglas Seibert including one dated January 9, 1975, and another dated November 13, 1975. In the latter declaration Seibert stated: "I first met Mary ... in March or April, 1972 when she was with her brother-in-law, Larry Reynolds. Larry and Mary had been out eating pills (reds) and Larry asked me if I would like to `party' with them. He said that if I gave Mary Twenty ($20.00) Dollars she would go to a motel and party with me all I wanted. I agreed and four of us (Larry took a girl named Shelly) went to the Motel Six on Holt Avenue in Pomona. I paid Mary Twenty ($20.00) Dollars and paid for the motel room. We spent the night there and I had sexual intercourse with Mary. Because Mary was a sexually aggresive [sic] person she preferred engaging in intercourse while on top. She made it clear that she was doing this only because I paid her the money....
"About a week or two after this, Mary, myself, Frank DeMarte, Richard Killgore [sic], and Pam Wallace all moved into an apartment on Artesia, near County Road in Southern Pomona. I got to know Mary well during this time. Her husband, Larry's brother, had been busted with Larry's wife and he was doing time in Nevada. Mary, her husband, Lary [sic] and his wife had all traded off, that is, partied together. During this time Mary was sleeping with Frank DeMarte and a lot of other people. Whenever she needed money, especially to buy reds, she would go out and sell herself to get the money.
"Once Mary, myself, Pam Wallace and a friend, Tom Burton, went to the Colorado River over the Easter vacation. Mary sold herself to get money for reds. We spent about three days there, but Mary didn't have enough reds with her. We had driven down there in Burton's car, but he left after the first day and came back to Pomona. We needed money to get home and Mary needed money for more reds. She asked me to pimp for her. I asked several guys in the area, but they said they didn't need to pay for it. Mary said she would do it herself. She went out and after awhile came back with the money. She generally preferred to have someone pimp for her to make sure that it was okay, but she would do it herself if it looked alright.
"On another occasion, Larry, his wife, Mary and myself went to Las Vegas and we ran out of money. Mary asked me to pimp for her with *796 some of the guys at the crap table. I told her that you couldn't do that at these clubs and that you could get in a lot of trouble. But she was all loaded on reds, so she went off by herself and came back in about an hour or an hour and a half with One Hundred ($100.00) Dollars. This was sometime around the first of 1972, about March or April.
"Mary had a very heavy habit with reds. She used about fifty to one hundred a day when she had them available. I have seen her go into convulsions when she could not get them. When she was not on `downers' she was a real `bitch' and very wild. I have seen her use cocaine on one occasion.
"Mary liked sex and would give it away if she didn't need money for reds. If she did need money, she would insist on getting paid for it. After having sexual intercourse, she was `crazy' and it was difficult to tell how she would act.
"On the night of May 2, 1972, I was at Apartment `A', Jim Newland's [sic], on Canoga Street and Mary came by. She said that she had a chance to get a jar of reds at work and needed money. A jar would be about one thousand reds and would cost about Eighty ($80.00) to One Hundred ($100.00) Dollars. She asked me to go down to the store with her and pimp for her so she could get some money. I was sick that night and told her I didn't want anything to do with it. The apartment was about a half block from the Seven-Eleven store [sic]. She came by at about 6:00 P.M. Later, I talked to Larry Reynolds and he told me that she had told him to find somebody at the store and set up a deal for her. Larry said that he did it; he said that he asked this guy at the store if he would like to have this chick going into the store, and the guy said that it looked okay. Larry said that he saw the guy leave her car to go back to his own car and that when he started to get back into Mary's car, he saw him drop his gun. When he saw that, Larry took off because he didn't know what was going on...."
Several times during the course of the hearing the presiding judge made it clear that the reason he had granted the evidentiary hearing was Seibert's statements to the effect that Mary R. had prostituted herself on various occasions, that she had asked Seibert to pimp for her on the night of the rape and that Larry Reynolds had told Seibert that in fact he had solicited petitioner for Mary on the night of May 2, 1972. He indicated that these were the matters on which he was most interested in hearing testimony.
*797 At the evidentiary hearing Douglas Seibert was sworn as a witness. Initially, he was asked whether his declarations of January 9 and November 13, 1975 were true and correct. He stated that Larry Reynolds and his wife had not accompanied Mary R. and Seibert to Las Vegas, but that otherwise both declarations were true and correct.
On specific interrogation he affirmed that he and Mary and Larry Reynolds and a girl named Shelly went to Motel 6 in March or April 1972. He testified the parties switched sexual partners all night and that he had sexual intercourse with both women. With respect to his payment of $20 to Mary, he testified that this payment occurred "later on in the night"; that when the parties first went into the motel room he was paired with Shelly and Larry Reynolds was paired with Mary; and that, subsequently, he said to Mary: "Here, Mary, I'll give you 20 bucks if you'll go with me." He testified the room was a single room with two beds.
Seibert did move into an apartment with Mary, Frank DeMarte, Richard Kilgore and Pam Wallace. He testified he had sexual relations with Mary at the apartment even during the time she was going with DeMarte. However, he never observed her in an act of sexual intercourse with another man and he never saw her receive money in exchange for sexual favors.
Although he affirmed the episode at the Colorado River in which Mary left and returned with money, he did not testify that he solicited an act of prostitution for her. On the contrary, he testified that he never offered her sexual favors for sale.
He reaffirmed as correct his declaration statements about the episode in Las Vegas where Mary went off by herself and came back with $100.
With respect to Mary's use of drugs, Seibert denied stating he had seen Mary take 50 to 100 pills on several occasions. He testified that the most pills he saw Mary take at one time was five and that sometimes he saw her take from fifteen to twenty pills a day. When asked his opinion as to whether or not Mary would sell herself to get pills, his answer was: "Her character at that time probably wasn't any different than any of ours. You know, everybody was into the red trip, and that's all it was."
With respect to his declaration statement that on the night of May 2, 1972 (the night of the rape) Mary asked him to pimp for her so she could *798 get some money to buy a "jar of reds" at work, Seibert testified that he did not know whether or not the conversation took place the same day as the rape. He reaffirmed, however, that he did have a conversation with Mary in which she wanted to buy a jar of reds and wanted him to "go down to the store" with her.
In respect to the declaration statement to the effect that Larry Reynolds had admitted pimping for Mary the night of the rape, Seibert testified that it was Larry Reynolds who told him about the rape and that: "He did state that he had asked someone if they wanted this girl; that she looked nice; and that he was real vague about it, though."
Seibert testified that he left the State of California about two to three months after the end of April 1972 because of a problem involving the revocation of his probation and that he remained out of the state until sometime after petitioner's trial.
Larry Reynolds, Mary's former brother-in-law, also testified at the evidentiary hearing. He denied having been present at the Circle K Market on the night of the rape, denied having introduced Mary to petitioner and denied ever having seen petitioner. He denied having seen petitioner drop a gun outside the Circle K Market and denied ever having told Douglas Seibert he had. In fact he had no recollection of ever discussing any of these matters with Seibert. He said it was possible he had once gone with Mary to the Circle K Market at night prior to her going to work for the purpose of buying some beer or groceries, and, if so, that probably was in 1971. He further denied having pimped for Mary in April or May of 1972 or at any other time. He also denied that Mary had ever asked him to do so.
Reynolds did state that he, Seibert, Mary and another woman named Shelly went to a motel in Pomona on one occasion. So far as he knew, Seibert did not pay money to Mary in return for sexual favors. So far as he knew, Mary had never committed an act of prostitution.
He did live in an apartment on Angela Street which was shared by Mary, Seibert, DeMarte, Kilgore and Pam Wallace. He had sexual relations with Mary on one or two occasions. He never saw Mary engage in sex with any other individual, but he believed Mary had had sexual relations with Frank DeMarte and Douglas Seibert. He had gonorrhea at about the time he had sexual relations with Mary, and he believed Seibert and DeMarte also had gonorrhea about the time they were living *799 in the Angela Street apartment. He believed Mary also had gonorrhea and had gone to Dr. Hederman for treatment. Mary had stayed overnight on occasion at Jim Newlin's apartment and Reynolds believed she had had sexual relations with Newlin to whom she was now married. Although Reynolds believed Mary would willingly engage in sexual relations with the person with whom she was currently going, she would only have intercourse with the person she was keeping company with at that time. He denied Mary "switched off" or had sequential intercourse with groups of men.
Reynolds testified that although Mary used pills, she was steadily employed and seemed to have sufficient money. Although she contributed to the purchase of pills, she was not the main source of the money for their purchase. Mary had told Reynolds that she was able to purchase pills at work. The most he had seen Mary take was two to five pills at one time. He had never heard of Mary prostituting herself for money or for pills.
In response to questions by the court, Reynolds testified he did not leave the area after the date of the rape, that at the time of trial he was living in Pomona and that all his life he had lived in either Pomona or Ontario.
Dr. Arthur Hederman, M.D., testified that in April 1972 he treated Mary R. for gonorrhea. Mary was last treated on April 28, 1972. At about that same time he also treated Douglas Seibert for gonorrhea. Also admitted into evidence were records of the Los Angeles County Health Department showing that Mary R. was being treated for venereal disease from November 1971 until April 1972.
Testimony of a representative of Motel 6 fixed the date of the Motel 6 incident involving Douglas Seibert, Larry Reynolds, Mary R. and Shelly as March 14, 1972.
The judge presiding at the evidentiary hearing did not make formal findings. However, his comments during and at the close of the evidentiary hearing reveal his factual determinations.
"The thing that impressed me [about the petition and its accompanying declarations and affidavits] was not the fact that we may have had a promiscuous young woman or that somebody was overindulging in drugs but rather that there had been a deliberate solicitation of prostitution by *800 the alleged victim with her pimp and that this was corroborated apparently from the declaration of Seibert. He put Larry Reynolds right on the scene consistent with Mr. Wright's testimony. He corroborated Mr. Wright's testimony right down the line in all crucial and material points; even to the fact of having Lary [sic] Reynolds tell him about it; even to seeing Mary before on that very night and having indications of her intent and her need for drugs; to having Mr. Reynolds not only tell him about the solicitation and the pointing out of the alleged victim but also the gun. All of these things are very persuasive to me, and in that type of a situation, had I remained convinced of that, I certainly would grant your petition." (Italics added.)
"Based upon the evidence that I've heard and the transcripts, the argument of counsel, and the witnesses that have been before me ... I can say that I believe either that the complaining witness committed perjury or at least there's a strong probability that she committed perjury, that she had indeed had sexual relations with men other than her husband and Frank DeMarte, and further that such evidence would be of assistance to the defense, that it was material, and that it has some probative value...." (Italics added.)
"Certainly I believed that the victim, together with Seibert and Reynolds, at one point shared that Motel 6. I certainly believe that there was sex within there...."
"The only act of prostitution, however, that was revealed in the evidence presented before this court on this occasion was the one time outside of the inferences of she didn't have money; she's gone; she comes back with money, which is not the best inference in the world. It was Mr. Seibert's testimony that, hey, four of us went to the motel, and I started out with Shelley, and we balled all night, in effect, and later on I had to give Mary $20 in order to get sex with her. And I must have expressed my incredulous reaction at the time. I did not believe him. I think he flatly committed perjury himself on the point. That knocked out completely your prostitution, the one act of concrete prostitution. It knocked out completely the thing that really impressed me at the time of the reading of the affidavits." (Italics added.)
Thus the judge found Mary R. had given perjured testimony at trial but that it related only to her denial of having sexual intercourse with men other than her husband and Frank DeMarte. He concluded there was no reasonable probability a different result would have been had at *801 trial had the true facts been shown and the false testimony was not "substantially material or probative on the issue of guilt or punishment" as required by Penal Code section 1473, subdivision (b)(1).
Effect of Superior Court's Factual Determinations
(1) At the outset we must determine what effect is to be given the factual determinations of the superior court. Where an appellate court on an application for habeas corpus has appointed a referee to conduct an evidentiary hearing the rules are well settled: the appellate court is not bound by the factual determinations of the referee but, rather, independently evaluates the evidence and makes its own factual determinations; the factual determinations of the referee are entitled to great weight, however, when supported by the record, particularly with respect to questions of or depending upon the credibility of witnesses the referee heard and observed. (In re Rosoto, 10 Cal.3d 939, 946 [112 Cal. Rptr. 641, 519 P.2d 1065]; In re Branch, 70 Cal.2d 200, 203, fn. 1, 211 [74 Cal. Rptr. 238, 449 P.2d 174]; In re Imbler, 60 Cal.2d 554, 562 [35 Cal. Rptr. 293, 387 P.2d 6].) Where, as here, an application for habeas corpus has been denied in the superior court after an evidentiary hearing and a new application for habeas corpus is thereafter made to an appellate court based upon the transcript of the evidentiary hearing in the superior court, the procedure to be followed appears to be open to some question. (See In re Hochberg, 2 Cal.3d 870, 874, fn. 2 [87 Cal. Rptr. 681, 471 P.2d 1] [independent appraisal of the evidence], citing In re Smiley, 66 Cal.2d 606, 611 [58 Cal. Rptr. 579, 427 P.2d 179], et passim; but cf. In re Podesto, 15 Cal.3d 921, 937 [127 Cal. Rptr. 97, 544 P.2d 1297] [trial court's determination on application for bail on appeal will not be upset except for abuse of discretion].)
In our view, for all practical purposes the successive-writ situation is essentially the same as where the appellate court has made a reference. When a reference is made by a Court of Appeal, the referee appointed is customarily a judge of the superior court and, of course, the opportunity to hear and observe the witnesses is the same whether the judge is acting as a referee appointed by the appellate court or as a judge of the superior court. We hold, therefore, that the rules applicable to an appellate court's review of its referee's factual determinations obtain also in a case where the superior court has denied habeas corpus after an evidentiary hearing and a petition for habeas corpus is thereafter presented to an appellate court based upon the transcript of the evidentiary hearing conducted in *802 the superior court. (See In re Hochberg, supra, 2 Cal.3d at p. 874, fn. 2; In re Smiley, supra, 66 Cal.2d at p. 611, et passim.)
Independently evaluating the evidence presented at the evidentiary hearing, and giving due consideration to the fact that the judge of the superior court heard and observed the witnesses and we did not, we find the judge's determinations of fact concerning or depending upon credibility of witnesses fully justified, and we agree with and adopt them. As shall appear, however, we do not entirely agree with all of the judge's evaluations and characterizations of the significance of the false testimony.
Newly Discovered Evidence
(2) Petitioner does not sufficiently distinguish the ground of newly discovered evidence from the ground of perjured testimony. His arguments often admix the two. While, of course, the discovery of perjured testimony will almost necessarily involve the discovery of new evidence, these constitute distinct grounds for habeas corpus relief, are subject to different legal standards and must be considered separately. (See, e.g., In re Imbler, supra, 60 Cal.2d at pp. 560-567, 569-570.)
(3) To warrant habeas corpus relief new evidence must be such as to undermine the entire structure of the case upon which the prosecution was based; it must point unerringly to the petitioner's innocence and must be conclusive; it is not sufficient that the new evidence conflicts with that presented at the trial and would have presented a more difficult question for the trier of fact. (In re Weber, 11 Cal.3d 703, 724 [114 Cal. Rptr. 429, 523 P.2d 229]; In re Branch, supra, 70 Cal.2d at pp. 213-215; In re Imbler, supra, 60 Cal.2d at pp. 569-570; In re Lindley, 29 Cal.2d 709, 724 [177 P.2d 918].) Concomitantly, the new evidence must be credible and convincing. (See In re Weber, supra, 11 Cal.3d at pp. 723-725; In re Branch, supra, 70 Cal.2d at pp. 214-215; In re Imbler, supra.)
Petitioner's contention that the foregoing rules were changed or abrogated by In re Ferguson, 5 Cal.3d 525 [96 Cal. Rptr. 594, 487 P.2d 1234], is not meritorious. Although, of course, new evidence had been discovered by the defendant in Ferguson, that case involved what the court found to be a suppression by the prosecuting attorney of material evidence favorable to the defendant. The standards there discussed and announced relate to the duty of the prosecutor to disclose to an accused *803 favorable material evidence known or which should have been known to the prosecutor. The rules governing habeas corpus relief on the ground of newly discovered evidence were in no way implicated or questioned. Indeed, in In re Weber, three years after the Ferguson decision, the latter rules were rearticulated and applied. (11 Cal.3d at p. 724.)
Similarly without merit is the contention found in the traverse that the rules laid down in Lindley, Imbler, Branch and Weber were abrogated by the 1975 amendment to Penal Code section 1473 dealing with habeas corpus relief on the ground of false evidence. This contention is born of petitioner's failure to distinguish between the grounds of perjured testimony and newly discovered evidence. The rule that to be sufficient for habeas corpus relief, the new evidence must undermine the entire structure of the prosecution's case applied only to newly discovered evidence; it never applied to perjured testimony. (See In re Imbler, supra, 60 Cal.2d at pp. 560, 569; In re Lindley, supra, 29 Cal.2d at pp. 722, 724.) The 1975 amendment to Penal Code section 1473, which we hereinafter discuss in detail, dealt only with habeas corpus relief on the ground of false evidence. It did not change the law relating to the ground of newly discovered evidence.
The most significant portions of the asserted newly discovered evidence was with ample justification disbelieved by the judge presiding at the evidentiary hearing. The only evidence that Mary R. had previously engaged in an act or acts of prostitution came from Douglas Seibert. While the judge believed that sexual intercourse took place at the Motel 6, he did not believe that Seibert paid Mary $20 for her sexual favors on that occasion and, in fact, felt that Seibert perjured himself in so testifying. He felt Seibert's testimony to the effect that the parties switched sexual partners all night but that the payment of $20 to Mary did not occur until "later on in the night" was rather incredible. We agree. Moreover, Seibert's testimony concerning this episode was at odds with his declaration statement in several material respects. In the declaration Seibert implied he paid Mary $20 before having sexual relations with her, stated she made it clear she had intercourse with him only because of payment, and indicated he was introduced to Mary for the first time that same night by Larry Reynolds who took the girl named Shelly to the motel. His testimony indicated he had met Mary on prior occasions, that Larry Reynolds was originally paired with Mary and, of course, that he did not pay the $20 until "later on in the night." Similarly, Seibert's declaration statements to the effect that Mary would sell herself for money or reds were contradicted by his testimony at the *804 evidentiary hearing that he never saw her receive money in exchange for sexual favors and never observed her in an act of sexual intercourse with another man and by his evasive, nonresponsive answer to the question whether it was his opinion that Mary would sell herself to get pills. As the judge observed, the testimony concerning the Colorado River and Las Vegas incidents in which Mary assertedly left and returned with money, even if believed, constituted exceedingly weak evidence of prostitution. Moreover, with respect to the Las Vegas incident, Seibert testified he did not offer Mary's sexual favors for sale and, in fact, never had, contradicting his declaration statement that he did.
It is also clear from the judge's comments that he did not believe Seibert's story that Mary had asked him to pimp for her on the night of the rape so she could get money to buy pills and that Larry Reynolds had subsequently told him he had pimped for her at the store that night and had seen the man drop his gun. Again, the judge's disbelief was fully justified. While Seibert's declaration statements were definite and detailed, his testimony at the evidentiary hearing concerning these two conversations was vague and indefinite (e.g., she wanted him to "go down to the store" with her; "[h]e did state that he had asked someone if they wanted this girl ... he was real vague about it though"). In his declaration, Seibert states the conversation with Mary definitely took place on the night of May 2, 1972, a critical fact. At the evidentiary hearing, however, he testified he did not know whether the conversation took place on the night of the rape. In addition, of course, Larry Reynolds testified unequivocably that he was not with Mary at the Circle K Market on the night of the rape, that he had never solicited an act of prostitution for Mary and that he had never before seen petitioner. He further denied having told Seibert he saw a man drop a gun and had no recollection of ever discussing this matter with Seibert. The judge, of course, saw and heard these witnesses and was in the best position to determine which of them was telling the truth.
The remaining asserted newly discovered evidence is: (1) Mary had a considerable seconal habit, taking 2 to 5 pills at a time and up to 20 pills a day; (2) Mary said on one or more occasions that she sometimes bought pills at work; (3) Larry Reynolds admitted it was possible he had once gone with Mary to the Circle K Market at night prior to her going to work, probably in 1971, for the purpose of buying some beer or groceries; (4) in addition to having had sexual intercourse with Frank DeMarte, which she admitted, Mary had had sexual intercourse with Douglas Seibert, Larry Reynolds and Jim Newlin and in connection with *805 that fact (a) Mary stayed overnight at the apartment of Jim Newlin on Canoga Street and (b) Larry Reynolds lived in the Angela Street apartment with Mary and the group prior to the time Mary moved out; (5) at about the time of the rape Mary, DeMarte, Seibert and Reynolds all had gonorrhea.
Except as to the number of pills she was taking, the fact that Mary had a considerable seconal habit is not new evidence. She testified at trial she frequently used seconal and mentioned some of the effects of such use. Since the rape occurred May 2, 1972, the possibility that Reynolds may have gone to the Circle K Market with Mary some night in 1971 before she went to work is either completely irrelevant or so lacking in probative value as to necessitate no further comment. The importance petitioner attaches to the fact that Mary said she sometimes bought pills at work is unwarranted. That she was on her way to work when the rape occurred and was able to buy pills at work, without more, does not give rise to an inference she prostituted herself for the purpose of buying pills at work on the night in question. As previously observed, the presiding judge did not credit Seibert's statement relating a conversation between Mary and him on the night of the rape in which she indicated she needed money to buy a jar of reds. In this connection, we note that Reynolds testified at the evidentiary hearing that, although Mary used pills, she was steadily employed and seemed to have sufficient money. At trial, Mary testified without contradiction that she had money, that she had just been paid the day of the rape.
(4) Petitioner relies most heavily on the new evidence that Mary had sexual relations with Seibert, Reynolds and Newlin at about the same time.[1] He asserts that this evidence clearly substantiates his claim that Mary prostituted herself. On the contrary, this evidence is barely material, if material at all, has no probative value whatever on the issue of prostitution and, indeed, would not even be admissible evidence in a new trial.
The fact that Mary had consensual sexual relations with four male acquaintances over a relatively short span of time simply does not give rise to a natural or logical inference that she was a prostitute or that she committed an act of prostitution with a total stranger on the night of May 2, 1972. Neither does the fact Mary, Seibert, Reynolds and DeMarte all *806 had gonorrhea at about the same time. The only inference to which the latter fact gives rise is that each of those persons had prior sexual intercourse with a person who had the disease. In view of its limited probative value and obvious prejudicial effect, it is questionable whether the evidence of venereal disease would have been admitted at trial even if it had been known and offered. (See Evid. Code, § 352.)
Moreover, this evidence would not be admissible in a new trial. Contrary to the rule that prevailed at the time of trial, under Evidence Code section 1103 as amended in 1974 (Stats. 1974, ch. 569, § 2, p. 1388), unless first introduced by the prosecution, evidence of the complaining witness' sexual conduct other than with the defendant is not admissible to prove consent in a prosecution for rape. (Evid. Code, § 1103, subd. (2)(a); see People v. Blackburn, 56 Cal. App.3d 685, 690 [128 Cal. Rptr. 864].) Thus, were petitioner afforded a new trial he would not be permitted to introduce the new evidence credited by the judge at the evidentiary hearing that Mary had sexual intercourse with Reynolds, Newlin and Seibert. In a new trial he could not even show Mary had sexual relations with Frank DeMarte. Nor would he be permitted to show Mary, DeMarte, Seibert and Reynolds all had gonorrhea.[2]
Petitioner's contention this evidence would be admissible under an exception prescribed by subdivision (2)(c) of Evidence Code section 1103 is not meritorious. That subdivision provides that, if the prosecutor introduces evidence relating to the sexual conduct of the complaining witness, the defendant may cross-examine with respect to such evidence and offer relevant evidence "limited specifically to the rebuttal of such evidence introduced by the prosecutor...." It is true the prosecution in its case in chief elicited testimony from Mary that she was married, that she was separated from her husband and had a boyfriend, that petitioner did not negotiate with her for an act of prostitution and that petitioner neither discussed giving her any money nor gave her any money. The last two items related exclusively to Mary's conduct with petitioner. The other questions asked and facts elicited related to Mary's marital status and social arrangements. They were not sufficiently related to Mary's sexual conduct to open up the subject of her sexual conduct with men other than petitioner to cross-examination and rebuttal evidence under *807 subdivision (2)(c). Moreover, the fact that she had consensual sexual relations with a number of male acquaintances and that she and several of them had gonorrhea would not tend logically or naturally to discredit or rebut any fact elicited by the prosecution in the examination alluded to.[3]
Whether, considered separately or in combination, it cannot be said that petitioner's credible new evidence undermines the entire structure of the case upon which the prosecution was based nor that it points unerringly and conclusively to petitioner's innocence. At most, it conflicts with the evidence presented at trial and would have presented a more difficult question for the trier of fact. Habeas corpus relief on the ground of newly discovered evidence is therefore not warranted. (In re Weber, supra, 11 Cal.3d at p. 724; In re Branch, supra, 70 Cal.2d at pp. 213-215; In re Imbler, supra, 60 Cal.2d at pp. 569-570; In re Lindley, supra, 29 Cal.2d at p. 724.)
Perjured Testimony False Evidence
Prior to the 1975 amendment to Penal Code section 1473, the rule was clear that to obtain habeas corpus relief on the ground of perjured testimony, the petitioner was required to establish by a preponderance of the evidence: (1) that perjured testimony was adduced at his trial, (2) that this was known to a representative of the state, and (3) that the perjured testimony may have affected the outcome of the trial. (In re Imbler, supra, 60 Cal.2d at p. 560; Napue v. Illinois, 360 U.S. 264, 269, 272 [3 L.Ed.2d 1217, 1221, 1223, 79 S.Ct. 1173]; see Witkin, Cal. Criminal Procedure (1975 supp.) § 804, p. 866.)
In 1975 (Stats. 1975, ch. 1047, § 2) Penal Code section 1473 dealing with habeas corpus relief was amended to provide in pertinent part:
"(b) A writ of habeas corpus may be prosecuted for, but not limited to, the following reasons:
"(1) False evidence that is substantially material or probative on the issue of guilt or punishment was introduced against a person at any hearing or trial relating to his incarceration; ...
*808 ".... .... .... .... ...
"(c) Any allegation that the prosecution knew or should have known of the false nature of the evidence referred to in subdivision (b) is immaterial to the prosecution of a writ of habeas corpus brought pursuant to subdivision (b)." (Italics added.)
Although the judge found Mary R. had given perjured testimony at trial, he concluded the perjured testimony was not "substantially material or probative on the issue of guilt or punishment" as required by Penal Code section 1473, subdivision (b)(1) and that there was no reasonable probability a different result would have obtained at trial in the absence of the perjured testimony. Petitioner contends these conclusions resulted from the application of erroneous standards and are wrong.[4] We, of course, are not bound by the judge's conclusions nor by the standards employed by him.
The contentions of the parties raise the question to what extent the preexisting law pertaining to habeas corpus relief on the ground of perjured testimony was changed by the 1975 amendment to Penal Code section 1473 and, in particular, whether a petitioner seeking relief under the amended statute is still required to show the false evidence may have affected the outcome of his trial and what is meant by the statutory language "[f]alse evidence that is substantially material or probative on the issue of guilt or punishment." (5a) Exercising our independent judgment, we have concluded: the judge's finding that Mary R. gave false testimony at trial in certain particulars is correct; the requirement under the preexisting law that the petitioner show the false evidence may have affected the outcome of his trial was not eliminated or changed by the 1975 amendment to Penal Code section 1473 and is still required for relief under the amended statute: "[f]alse evidence that is substantially material or probative on the issue of guilt or punishment" means false evidence of such significance that it may have affected the outcome of *809 the trial; and petitioner has not made the requisite showing that the false testimony here disclosed may have affected the outcome of his trial.
Little need be said in support of our conclusion that Mary R.'s testimony denying sexual relations with men other than her husband and Frank DeMarte was false. The People do not contend the judge's conclusion that this testimony was false[5] was unjustified and, although some of the testimony credited by the judge might constitute inadmissible opinion evidence upon proper objection, we think this finding justified and adopt it.
Petitioner places great reliance on the presiding judge's statement that the evidence Mary R. had sexual relations with Seibert, Reynolds and Newlin in addition to DeMarte, "would be of assistance to the defense, that it was material, and that it has some probative value...." He contends that, this being so, he is entitled to habeas corpus relief under Penal Code section 1473, subdivision (b)(1) without more. As will appear in subsequent discussion, we have reservations about these evaluations of the judge. However, the point to be made at this juncture is that petitioner is mistaken if his contention is that he is entitled to habeas corpus relief under the amended statute upon showing no more than false testimony relevant to a material issue and that the true facts would have been helpful to the defense. Under the well-settled law prior to the 1975 amendment, it was incumbent upon the petitioner to show the perjured testimony was such that it may have affected the outcome of the trial. (In re Imbler, supra, 60 Cal.2d at p. 560; Napue v. Illinois, supra, 360 U.S. at p. 272 [3 L.Ed.2d at p. 1223].) There is no indication the 1975 amendment to Penal Code section 1473 was intended to eliminate this requirement. Indeed, the indications are to the contrary.
*810 The bill eventually enacted as the 1975 amendment to Penal Code section 1473 was Assembly Bill No. 48 (1975-1976 Reg. Sess.). As amended in the Assembly, May 1, 1975, the materiality requirement contained in the bill read: "False evidence that is material or probative on the issue of guilt or punishment...." There was no express requirement of substantiality. In that same version of the bill there appeared a proposed subdivision (d) to Penal Code section 1473 which read: "Before the court may deny relief for a writ of habeas corpus prosecuted pursuant to subdivision (b), the court must find beyond a reasonable doubt the false evidence or its use to have been harmless." In the analysis of the May 1 version of Assembly Bill No. 48 prepared for use of the Senate Committee on Judiciary it was said the proposed subdivision (d) would clearly constitute "a liberalization of existing law" but that it would be consistent with the recent decision in People v. Ruthford, 14 Cal.3d 399 [121 Cal. Rptr. 261, 534 P.2d 1341] (May 1975). It was pointed out, however, that Ruthford involved prosecutorial suppression of evidence whereas the bill dealt with habeas corpus relief for false evidence even though introduced at trial totally without prosecutorial fault. Thus, the propriety of enacting the bill's provision incorporating the "harmless beyond a reasonable doubt" standard was brought into question. The analysis further pointed out that in Ruthford it was held that, even where prosecutorial suppression of evidence had occurred, the materiality showing required for relief was not simply that the suppressed evidence was "material" but that it was "substantially material." It was noted that, inappropriately perhaps, the bill's requirement of "material or probative" required a lesser showing for relief than that required where prosecutorial suppression of evidence had occurred.[6] The *811 bill was subsequently amended to insert "substantially" before "material or probative" and to delete the proposed subdivision (d) incorporating the "harmless beyond a reasonable doubt" standard.[7] As so amended Assembly Bill No. 48 was enacted as chapter 1047 of the 1975 Statutes in September 1975.
The Attorney General urges the Legislature's rejection of the "harmless beyond a reasonable doubt" standard clearly indicates its intention not to modify or eliminate the requirement of the preexisting law that the petitioner show the false evidence might have affected the outcome of the trial. We are not certain the intention of the Legislature in this regard is thus rendered completely clear, but we agree the conclusion urged by the Attorney General is indicated, particularly in view of the statement in the Senate Committee on Judiciary's analysis that enactment of the "harmless beyond a reasonable doubt" provision would clearly constitute "a liberalization of existing law." The only part of the existing law that could have been liberalized by enactment of the "harmless beyond a reasonable doubt" provision was the requirement found in both In re Imbler and Napue v. Illinois, that the petitioner show the false evidence may have affected the outcome of the trial. If the Legislature believed, as it was informed, that enactment of the "harmless beyond a reasonable doubt" provision would change the preexisting rule, it follows it must also have believed and intended that its deletion of that provision would leave the preexisting rule intact.[8]
*812 That this was the intention of the Legislature is also supported by the amendment inserting the word "substantially" in front of the words "material or probative." In view of the statements in the Senate Committee on Judiciary's analysis (see fn. 6, ante [pars. foll. No. 7]), it is clear that this change was intended to increase the materiality showing required to make it at least as great as the materiality showing required in the suppression of evidence cases. The California suppression of evidence case most informative on the problem of materiality is In re Ferguson, supra, 5 Cal.3d at pages 533-535. After a two-page discussion of materiality and an analysis of the suppressed evidence there involved, the court concluded that had the defense known of the evidence suppressed, "it is reasonably probable that it could have obtained a different verdict." (5 Cal.3d at p. 535.)[9] We think there is no substantive difference between "may have affected the outcome of the trial" and "reasonably probable that it could have obtained a different verdict."
The Ferguson materiality formulation takes on added significance when it is seen that the statutory language "substantially material" may *813 be traced to that case. It is clear from the statements in the Senate Committee on Judiciary's analysis (see fn. 6, ante [pars. foll. No. 7]), and the ensuing amendment of Assembly Bill No. 48 that the word "substantially" was inserted in front of the words "material or probative" on the basis of People v. Ruthford, supra, which had then only recently been decided. The expressions "substantial material evidence," "material substantial evidence" and "substantial materiality" are found throughout the Ruthford opinion. (14 Cal.3d at pp. 406, 408, 409.) The first use of any such expression is found in the statement: "In Ferguson we imposed a stricter duty upon prosecutors by requiring them to disclose substantial material evidence favorable to the accused without request. Furthermore, Brady and Ferguson indicate that either intentional or negligent prosecutorial suppression of substantial material evidence favorable to the accused denies to the defendant a fair trial and requires reversal." (14 Cal.3d at pp. 405-406 [citing Brady v. Maryland, 373 U.S. 83 [10 L.Ed.2d 215, 83 S.Ct. 1194] and In re Ferguson, supra 5 Cal.3d 525].) The expression "substantial material evidence" is not found in Brady.[10] However, it does appear in Ferguson: "Although a request for production of evidence may be a factor to consider in determining a charge of suppression of evidence, we have recognized that `in some circumstances the prosecution must, without request, disclose substantial material evidence favorable to the accused.'" (5 Cal.3d at p. 532; italics added.)[11] On the following page the Ferguson court quoted from a concession of the Attorney General referring to evidence that is "`substantial, material, and favorable to the defense.'" (5 Cal.3d at p. 533.) There immediately follows the previously mentioned two-page discussion and evaluation of the materiality of the evidence found to be suppressed (5 Cal.3d at pp. 533-535) terminating with the previously quoted conclusion of the court that had the defense known of the suppressed evidence, "it is reasonably probable that it could have obtained a different verdict." Thus, it is clear that in the view of the *814 Ferguson court, "substantial material evidence" meant evidence of such significance that with reasonable probability it could have affected the outcome of the trial. (See also 5 Cal.3d at p. 533 ["... other defense evidence which might have caused a different verdict."].) As we have already observed, we perceive no substantive difference between the formulations "reasonably probable that it could have obtained a different verdict" and "may have affected the outcome of the trial." Accordingly, we conclude the statutory language "[f]alse evidence that is substantially material or probative on the issue of guilt or punishment" means false evidence of such significance that it may have affected the outcome of the trial.
The question remains whether petitioner has made the requisite showing. In considering that question it is essential to have clearly in mind what the false evidence was. Here again, petitioner fails to distinguish sufficiently between false evidence and newly discovered evidence. He refers not only to the evidence that Mary R. had sexual intercourse with three men other than Frank DeMarte, which she denied at trial, but also the evidence that Mary and several of the men had gonorrhea and that Mary was able to purchase pills at work. At trial no question was asked Mary concerning anybody's having gonorrhea or her ability to purchase pills at work.[12] There was no false testimony at trial relating to these matters. The evidence subsequently developed by petitioner constitutes newly discovered evidence and has been fully considered under that head.[13]
*815 The only false evidence was Mary's testimony that other than with Frank DeMarte she had not had sexual relations with any man not her husband, that she had not had sexual intercourse with Larry Reynolds, Douglas Seibert or Jim Newlin and, in that connection, that she had not stayed overnight at the apartment of Jim Newlin and, possibly, that Larry Reynolds did not move into the Angela Street apartment until she moved out.
Petitioner's contention that this false testimony was of such significance that it may have affected the outcome of his trial is based largely on the fundamental misconception that it is probative on the issue of prostitution. He repeatedly asserts that the evidence Mary had sexual intercourse with these men substantiates his defense that what occurred was not rape but an act of prostitution. As we have previously explained, however, the fact that Mary had consensual sexual intercourse with three male acquaintances in addition to Frank DeMarte over a relatively brief span of time simply does not give rise to an inference that she was a prostitute or that she committed an act of prostitution on the night of May 2, 1972. Indeed, as we have seen, this evidence would not even be admissible as substantive evidence in a new trial. (Evid. Code, § 1103, subd. (2)(a).) We conclude, therefore, that on a substantive basis this evidence was not such as may have affected the outcome of petitioner's trial.
Petitioner is correct, however, that introduction of evidence that Mary had sexual intercourse with Reynolds, Newlin and Seibert, that she had stayed overnight at Newlin's apartment and that Reynolds moved into the Angela Street apartment prior to Mary's moving out would have borne on Mary's credibility. (6a) And we have no doubt that in appropriate circumstances false testimony bearing on the credibility of a key prosecution witness may constitute "[f]alse evidence that is substantially material or probative on the issue of guilt or punishment" within the meaning of Penal Code section 1473, subdivision (b)(1).[14] (See In re *816 Imbler, supra, 60 Cal.2d at pp. 564-565; cf. Giglio v. United States, supra, 405 U.S. at p. 154 [31 L.Ed.2d at p. 108]; Napue v. Illinois, supra, 360 U.S. at pp. 269, 270 [3 L.Ed.2d at p. 1221]; People v. Ruthford, supra, 14 Cal.3d at pp. 407-408.) (5b) The question is, therefore, whether it is reasonably probable the evidence that Mary had sexual intercourse with Reynolds, Newlin and Seibert, that she had in fact stayed overnight at Newlin's apartment, and that Reynolds moved into the Angela Street apartment before she moved out could have had such an effect on Mary's credibility as to produce a verdict of not guilty. We believe not.
Petitioner characterizes the trial as nothing more than a contest of credibility between Mary and him. Certainly it must be said Mary was a key prosecution witness and the question of credibility was vital, but petitioner's characterization of the trial is not entirely accurate. There was rather strong circumstantial evidence of petitioner's guilt. The fact that petitioner was armed with a .45 automatic at the time of the alleged act of prostitution did not help his cause. His explanation for having the gun with him, that he had some doubts what he might be getting involved in, was somewhat less than convincing, particularly in light of his attempt to dispose of the weapon by throwing it out the door of his vehicle when he saw police cars. The false statements he originally made to the police that he did not have a gun and had not been with a woman that night did not help him. Nor was his case strengthened by the fact the act of sexual intercourse claimed to be an act of prostitution took place in the bushes against the wall of the armory when nearby petitioner had an unoccupied hotel room.[15]
In addition, the jury was well aware that Mary was no paragon of virtue. She admitted that while still married she had had sexual relations with Frank DeMarte and that she frequently used seconal and amphetamines. There was much evidence concerning her group living arrangement. The judge that presided at the evidentiary hearing opined that it would not have come as any great shock to the jury that Mary had sexual relations with three male acquaintances other than DeMarte, and we agree.[16]
*817 (6b) Petitioner incorrectly contends that in testing the false evidence for substantial materiality, "a reviewing court need not look to what other evidence of untainted nature might be available to arguably support the conviction...." On the contrary, in assessing whether the false testimony was of such significance it may have affected the outcome of the trial, it is necessary to consider all of the evidence and circumstances in the case. "In considering the materiality of the evidence, we must look to the entire record because materiality can only be determined in the light of the circumstances. Thus we must consider not only the other evidence of guilt but also any other defense evidence which might have caused a different verdict." (In re Ferguson, supra, 5 Cal.3d at p. 533; see also People v. Ruthford, supra, 14 Cal.3d at p. 410.)
We think it not impertinent to observe also that were petitioner granted a new trial, unless the prosecution first elicited evidence of Mary's sexual conduct, which seems unlikely, petitioner's evidence that Mary had sexual intercourse with these men would not be admissible for impeachment purposes. Unless its probative value would be outweighed by its prejudicial effect, evidence of a complaining witness' sexual conduct may be admissible in a rape case to impeach the complaining witness under certain circumstances and by following a statutorily prescribed procedure. (Evid. Code, §§ 780, 782, 1103, subd. (2)(d); see People v. Blackburn, supra, 56 Cal. App.3d at p. 691.) However, before the statutory provisions have any possible application, there must be testimony by the complaining witness that would be impeached by evidence of her sexual conduct. (See People v. Blackburn, supra, 56 Cal. App.3d at p. 693.) As we have seen, the fact that Mary had sexual intercourse with three male acquaintances in addition to DeMarte is not probative on the issue of prostitution and would not tend to discredit Mary's testimony that she did not commit an act of prostitution on the night of May 2. It could not therefore be introduced for impeachment of that testimony. Since, as we have explained, petitioner would be precluded by Evidence Code section 1103, subdivision (2)(a) from questioning Mary about her sexual conduct other than with defendant for substantive purposes and since it is most unlikely the prosecution would adduce evidence of Mary's sexual conduct, it is almost a certainty there would be no testimony that this new evidence would tend to impeach.
*818 Petitioner urges the false testimony shown here is as substantially material as the false testimony in Imbler and the evidence suppressed in Ferguson. In attempting to determine whether the false evidence was such as may have affected the outcome of the trial, it is not greatly helpful to attempt to compare the false evidence or suppressed evidence in different cases, for, as previously indicated, that determination depends upon an evaluation of the facts, circumstances and all the evidence in each case. In any event, petitioner's argument is not persuasive.
In Imbler, the petitioner had been convicted of first degree murder and sentenced to death. He asserted that Costello, one of several witnesses who at trial identified him as the perpetrator, gave perjured testimony in identifying him, in admitting only one felony conviction when in fact he had suffered two and, in an attempt to bolster his credibility, in testifying that following his release from state mental hospitals to which he had been committed, he had received degrees from the University of California and the University of Southern California. On the basis of the evidence at a reference hearing, the court found Costello's trial testimony that he had received two college degrees after being released from the state mental hospitals was false. It determined that Costello's identification testimony was not perjured, though at the reference hearing he testified he could not identify petitioner as the perpetrator of the crime. With respect to the false testimony about receiving college degrees, the court acknowledged that false testimony affecting a witness' credibility might require that the conviction be overturned "if it might have affected the outcome of the trial." (60 Cal.2d at pp. 564-565.) But it did not attempt to determine whether the false testimony might have affected the outcome of the trial. It held that petitioner "failed to prove knowledge of these falsehoods by representatives of the state" as was then required. (60 Cal.2d at p. 565.) Accordingly, the petitioner was denied relief. Obviously, Imbler does not aid petitioner. The court did not reach the question whether the false evidence might have affected the outcome of the trial, and relief was denied in that case.
Ferguson, as we have previously pointed out, involved what the court found to be prosecutorial suppression of evidence. The petitioner in that case had been convicted of kidnaping Mr. and Mrs. Miller and of six sexual offenses against Mrs. Miller, including rape and oral copulation. He claimed that as he was driving he was flagged down by Mr. Miller, that he picked the Millers up, that Mr. Miller offered Mrs. Miller to him *819 for the four or five dollars he had and that after a brief discussion between Mr. and Mrs. Miller, Mrs. Miller agreed to go with him, whereupon Mr. Miller left petitioner's car and petitioner and Mrs. Miller drove to an orange grove where several sexual acts occurred. Although Mrs. Miller was permitted to testify at trial, it was shown she could not read or write, did not know her address, did not know in which year or which state she was born, did not know what it meant to swear to tell the truth and did not know what an oath was. The evidence suppressed was Mr. Miller's arrest record which would have shown 37 entries including a felony conviction and commitments to state hospitals as a sex degenerate and a psychotic. Indicating that Mr. Miller's felony conviction would have been admissible to impeach his credibility and that much of the other information contained in the arrest record would have constituted admissible evidence under Evidence Code section 1103 as it then read[17] and would have been highly probative on the issue of guilt, the court concluded that had the defense known of the suppressed evidence, it was reasonably probable it could have obtained a different verdict. By contrast, in the case at bench, as we have several times pointed out, the fact that Mary had consensual sexual relations with three of her male acquaintances in addition to DeMarte is not probative on the crucial issue of prostitution, would not seriously have impaired the credibility of her trial testimony and, in a new trial, would not even be admissible evidence.
Finally, petitioner contends that had Mary testified truthfully at the renewed Ballard motion and admitted she had sexual relations not only with DeMarte but also with Reynolds, Newlin and Seibert, the trial court might have granted petitioner's motion for a psychiatric examination of Mary and, thus, her false testimony may have affected the outcome of his trial. Of course, neither petitioner nor we have any way of knowing or even guessing what such a psychiatric examination would have disclosed or what testimony the examiner might have given. It is entirely possible that petitioner would not have been helped in the least. In any event, even assuming a different ruling on the Ballard motion would satisfy the "substantially material" requirement, we find it inconceivable the evidence that Mary had sexual intercourse not only with DeMarte but also with Reynolds, Newlin and Seibert might have changed the ruling on the Ballard motion.
*820 Petitioner asserts the judge presiding at the evidentiary hearing acknowledged the ruling on the Ballard motion might have been different. If he did, we do not agree with him. However, we do not so read the record. Counsel for petitioner asserted, "the Court might have ruled otherwise had the testimony been honest at the time, your Honor." The judge responded dubiously: "Well, they [sic] might have."
Prior to the renewed Ballard motion hearing, Mary had already testified about having sexual relations with Frank DeMarte and about her group living arrangement. At the hearing on the renewed motion, she testified she took seconal and would get "loaded" on it mostly on weekends. She testified that at the time of the rape she had been taking "reds" approximately two years but had stopped using them at the end of the summer of 1972. She felt they affected her moods, her outlook on life and caused her depression and anger. Pamela Lane Wallace was one of several additional witnesses at the hearing on the renewed Ballard motion. She testified she was one of the group living in the apartment, that she had seen Mary take seconal frequently and that she and Mary used to get "loaded" together. While they were living at the apartment, approximately 15 people a day would come by and many of them would get "loaded" and sleep there. She described it as a "flophouse." With respect to Mary's reputation for chastity, she testified that Douglas Seibert had said: "Mary's loving sure is good"; Sid Langerman had said: "Yes, I went to bed with her"; and Richard Kilgore told her that "he had been to bed with Mary."
At the conclusion of the hearing on the renewed motion, the trial judge stated: "... I watched with particular interest the development of any evidence that might indicate to the Court some psychological problem on the part of the complaining witness. [¶] The Court certainly doesn't condone her mode of living over the past year or so and I certainly don't approve of the mores of her particular society. [¶] On the other hand, I have not observed anything that would cause me to suspicion [sic] that there is some type of mental defect or deficiency that would prevent her from relating to the best of her ability the events involved in this case."
As the trial court correctly indicated, the question presented by the renewed Ballard motion was whether it appeared Mary had an emotional or mental condition that might affect her credibility. (Ballard v. Superior Court, 64 Cal.2d 159, 174-175 [49 Cal. Rptr. 302, 410 P.2d 838, 18 A.L.R.3d 1416]; People v. Russel, 69 Cal.2d 187, 195 [70 Cal. Rptr. 210, *821 443 P.2d 794].) He found no such emotional or mental condition and, accordingly, denied the motion for psychiatric examination. The testimony of Pamela Wallace included hearsay statements indicating Mary had had sexual relations with a number of men other than Frank DeMarte. The comments of the court indicate it understood the testimony but that it was not concerned with Mary's "mode of living over the past year or so" or "the mores of her particular society" but, rather, whether she had some emotional or mental condition that might affect her credibility. Finding none, it denied petitioner's motion. In view of the evidence given at the hearing on the renewed motion and the court's comments, there is no reasonable possibility, much less probability, the ruling would have been different had Mary admitted having sexual relations with Reynolds, Newlin and Seibert.
We conclude the false testimony proved by petitioner was not of such significance that it may have affected the outcome of his trial and, thus, that it was not "substantially material or probative" within the meaning of Penal Code section 1473, subdivision (b)(1).
The petition for habeas corpus is denied.
Gardner, P.J., and Tamura, J., concurred.
A petition for a rehearing was denied April 4, 1978, and petitioner's application for a hearing by the Supreme Court was denied May 25, 1978. Mosk, J., was of the opinion that the application should be granted.
NOTES
[1] Petitioner asserts as a fact that Mary infected the men with gonorrhea, but the evidence is simply that they all had the disease at about the same time. The conclusion that Mary infected the men is wholly unwarranted.
[2] As we have observed, evidence that Mary had gonorrhea is not relevant to prove she prostituted herself. The only inference logically and naturally flowing from that fact is that she had sexual intercourse with a person who had the disease. Accordingly, that evidence would be inadmissible under Evidence Code section 1103, subdivision (2)(a) and the evidence the men had gonorrhea would be rendered irrelevant to any material issue in the case.
[3] The exception relied on by petitioner was also added by the 1974 amendment. (1974 Stats., ch. 569, § 2, p. 1388.) Being mindful thereof it is not likely in a new trial that a knowledgeable prosecutor would risk asking even the innocuous questions whether Mary was married, separated or had a boyfriend.
[4] Petitioner's assertion the judge applied the "must undermine the entire structure of the prosecution's case" standard to the false testimony problem is not justified by the record. The judge was greatly concerned with the meaning of "substantially material" as used in Penal Code section 1473, subdivision (b)(1) and whether there was "a reasonable probability that the trier of the fact[s] would have arrived at a different decision." Petitioner also criticizes the judge's use of the expression "would have arrived at a different decision" and urges that if any such standard is applicable, the formulation should be "could have arrived at a different decision." Although from a practical standpoint we think there is little difference, the use of the word "could" might have been more appropriate than "would." (See In re Ferguson, supra, 5 Cal.3d at p. 535.)
[5] The judge referred to the false testimony as "perjured." We do not know whether he intended to use that word in a technical, legal sense or a popular sense, but we shall refer to the testimony in question as false testimony rather than perjured testimony. To obtain a conviction for perjury, the prosecution is required to prove a number of technical elements with which we need not here be concerned. One is a materiality requirement that "`the testimony given could have probably influenced the tribunal before which the cause was being tried....'" (See In re Imbler, supra, 60 Cal.2d at pp. 564-565, fn. 2, and cases there cited.) We think there is little if any difference between the materiality requirement "could have probably influenced the tribunal before which the cause was being tried" and the materiality requirement that the false testimony "may have affected the outcome of the trial." In view of our conclusion that the false testimony is not such as "may have affected the outcome of the trial," we doubt the propriety of characterizing the false testimony as "perjured" in a technical, legal sense. Under Penal Code section 1473, subdivision (b)(1), however, it is not required that perjury be proved. A showing of "false evidence" is sufficient. Additionally, it is no longer necessary to show a representative of the state knew the testimony was false. (Pen. Code, § 1473, subd. (c).)
[6] The analysis reads in pertinent part:
"5.... .... .... .... .... .
"To the extent that this bill removes the apparent condition that the prosecutor knew or should have known that testimony was perjured before the defendant may have relief from his conviction, it appears to be a needed reform.
".... .... .... .... .... .
"6. This bill would prohibit the denial of a petition for habeas corpus where false evidence was shown, unless it were proved beyond a reasonable doubt that the error was harmless.
"This provision, while it clearly is a liberalization of existing law, is consistent with a recent trend in California case law. In People v. Ruthford (May, 1975) Crim. 18431, the California Supreme Court held that, where the prosecution had suppressed substantial material evidence bearing on the credibility of a key witness, the defendant was entitled to relief unless the suppression was harmless `beyond a reasonable doubt.'
"This holding was based on the conclusion that the suppression of such evidence constitutes a denial of due process, and thus that the Chapman rule, requiring a reasonable doubt standard for the proof of harmless error in such cases, should apply.
"The key distinction between this case and the federal decisions preceeding [sic] it, on the one hand, and this bill, on the other, is that the former all involve prosecutorial misconduct, while, under the bill, the reasonable doubt standard would apply whether or not use of false evidence by the prosecution had been knowing, negligent, inadvertent, or totally without fault.
"7. This bill would require only that the false evidence have been `material or probative,' to support a petition for habeas corpus. The Ruthford case, discussed above at Comment 6, required the defendant, where the prosecution has suppressed evidence, to show that the evidence was `substantially material.'
"This bill, therefore, requires a lesser showing by the defendant despite the absence of prosecutorial misconduct, than the Ruthford case required where prosecutorial misconduct is present." (Original italics.)
[7] The amendment also substituted a new subdivision (d): "Nothing in this section shall be construed as limiting the grounds for which a writ of habeas corpus may be prosecuted or as precluding the use of any other remedies." This provision is not material to the decision at hand.
[8] Whether the statement in the analysis about "a liberalization of the existing law" was in fact correct is of no great consequence; it is what the Legislature was informed and presumably believed that is significant. However, as shall subsequently appear, the requirement that the false evidence be such as may have affected the outcome of the trial is a materiality requirement, whereas the "harmless beyond a reasonable doubt" standard is generally said to be applicable to the problem of prejudice. (See, e.g., People v. Ruthford, supra, 14 Cal.3d at p. 408.) Although the concepts of materiality and prejudice are obviously related and may be overlapping, it may be theoretically possible that both are applicable. For example, it might be concluded that the petitioner must show substantial materiality (the false evidence was such as may have affected the outcome of the trial) but that relief would nevertheless be denied upon a showing by the People of a lack of prejudice (the false evidence was harmless beyond a reasonable doubt). This appears to be the applicable procedure in California in suppression of evidence cases. The court in People v. Ruthford, supra, 14 Cal.3d at page 409, stated: "The defendant must make a showing of substantial materiality and even after this showing is made reversal is not required if the prosecution establishes the failure to disclose was harmless beyond a reasonable doubt." Our conclusion that the false testimony in the case at bench was not shown to be such as may have affected the outcome of the trial, renders unnecessary our consideration of whether relief might also be denied in an appropriate case upon a showing the false evidence was harmless beyond a reasonable doubt. A court faced with that question, of course, would have to deal with the fact that the provision incorporating that standard in the May 1, 1975, version of Assembly Bill No. 48 was subsequently deleted.
[9] In Ruthford, the quoted formulation was discussed, along with similar formulations from Giglio v. United States, 405 U.S. 150, 154 [31 L.Ed.2d 104, 108, 92 S.Ct. 763] ["could ... in any reasonable likelihood have affected the judgment of the jury"] and Napue v. Illinois, supra, 360 U.S. at page 272 [3 L.Ed.2d at page 1223] ["may have had an effect on the outcome of the trial"] as being tests for prejudice. (14 Cal.3d at p. 408.) It is clear these formulations in fact relate to materiality. The formulation in Ferguson is the conclusion of a two-page discussion of materiality in which prejudice is not once mentioned. (5 Cal.3d at pp. 533-535.) The formulation in Giglio was expressly identified by the court as a test for materiality. (405 U.S. at p. 154 [31 L.Ed.2d at p. 108]; see also the materiality formulation used in perjury prosecutions discussed in In re Imbler, supra, 60 Cal.2d at pp. 564-565, fn. 2 ["`could have probably influenced the tribunal before which the cause was being tried'"].) In any event, Ruthford did not purport to overrule any part of Ferguson and, as noted (see fn. 8, ante), expressly retained a requirement of "substantial materiality" which, as will appear, it borrowed from Ferguson.
[10] In Brady the court expressed its holding as follows: "We now hold that the suppression by the prosecution of evidence favorable to an accused upon request violates due process where the evidence is material either to guilt or to punishment, irrespective of the good faith or bad faith of the prosecution." (373 U.S. at p. 87 [10 L.Ed.2d at p. 218].)
[11] For the quoted proposition Ferguson cites In re Lessard, 62 Cal.2d 497, 509 [42 Cal. Rptr. 583, 399 P.2d 39]. Lessard did use the expression "substantial material evidence" on both pages 509 and 510. The expression "substantial materiality" was also used at page 510. Curiously enough, Lessard appears to have borrowed the expression "substantial material evidence" from the court's discussion of the suppression of evidence in In re Imbler, supra, 60 Cal.2d at page 569. (62 Cal.2d at p. 509.) Imbler cited no authority for its use of the expression, and we have been unable to trace its source further.
[12] Petitioner's reference to this evidence as having been concealed or suppressed by Mary is unwarranted by the record.
[13] Petitioner asserts he discovered the evidence relating to venereal disease and Mary's ability to purchase pills at work during his investigation of the false testimony concerning her sexual relations with other men. He then cites In re Ferguson, supra, 5 Cal.3d at page 533 for the proposition that, where prosecutorial suppression of evidence has occurred, consideration is given not only to the evidence which was actually suppressed but also to evidence discovered as the result of disclosure of the suppressed evidence. The point is without consequence, for we have given full consideration to this evidence under the head of newly discovered evidence. As we there indicated, the evidence that Mary had said on one or more occasions that she had purchased pills at work is of only slight probative value, if any, and the evidence that she and several of her male acquaintances had gonorrhea at the same time is barely material, if material at all, and completely without probative value on the crucial issue of prostitution.
We observe, however, that the situation in the case at bench is not essentially the same at that in Ferguson. Here, petitioner was not precluded from discovering the evidence relating to venereal disease and Mary's purchase of pills at work by the fact that Mary gave false testimony at trial. Larry Reynolds from whom came much of the information about the venereal disease and all of the evidence relating to Mary's ability to purchase pills at work had not left the area and was living in Pomona at the time of trial. Petitioner's attorney knew of his existence and of his connection with the case as is evidenced by the fact he asked Mary at trial if she had not had sexual relations with Larry Reynolds. Indeed, it appears the fact that Mary had had sexual relations with Seibert and Newlin came as no surprise, for Mary was specifically asked by defense counsel at trial if she had not had sexual relations with these two individuals and hearsay evidence was introduced at the Ballard motion hearing indicating she had had sexual relations with a number of men other than her husband Frank DeMarte. (See discussion, infra.)
[14] We think it probable the statutory language "on the issue of guilt or punishment" had its source in the language of the court in Brady v. Maryland, supra, 373 U.S. at page 87 [10 L.Ed.2d at page 218], "is material either to guilt or to punishment...." (See fn. 10, ante.) In Brady the suppressed evidence related to the issue of punishment, but the holding of Brady is applied also to evidence bearing on the credibility of a key prosecution witness. (Giglio v. United States, supra, 405 U.S. at pp. 153-154 [31 L.Ed.2d at p. 108].)
[15] At trial petitioner explained this fact by testifying he suggested that Mary and he go to the hotel room but that Mary declined saying she did not have time.
[16] In fact, the district attorney at trial argued to the jury: "Even if I were to say that she is much worse than she is, if I were to condemn her entirely as a person that is running around from flower to flower, man to man, giving each one of them venereal disease as she goes, that still would not make her a prostitute in the context of the attack on her character that Mr. Youngquist [defense counsel] has put before you."
[17] Ferguson was decided in 1971 prior to the 1974 amendment of Evidence Code section 1103 making the complaining witness' sexual conduct generally inadmissible in a prosecution for rape.
|
The NFL is, to be polite, discerning about what kind of brain research it endorses in the ongoing study of chronic traumatic encephalopathy (CTE). So far, it seems to favor better helmets (which are bullshit) and better sideline procedures (the chief of which, the King-Devick test, might not be bullshit). It also likes to fund studies and appear proactive on the issue, which brings us to its latest venture: donating to an international study that posits, shockingly, that football isn’t actually all that dangerous, all things considered.
The NFL will match $600,000 in privately raised research funding for a new collaborative study between English, American, and Australian brain scientists that will study players across sports, beginning in January 2016. The leading scientist is Michael Turner, medical director of the International Concussion and Head Injury Research Foundation (ICHIRF). Turner, whose previous job was as head of the British Horseracing Authority, thinks the media is getting out ahead of itself on concussion science:
“The media hype is way ahead of the science,” he told Reuters at the NFL’s second annual professional sports concussion conference in London. “Normally what happens is we painstakingly move forward and we produce the science at the end of it and public and media interest starts to pick up. With this it has been quite the opposite.”
Broadly, this is true. Concussion science has slowed to the point that the postmortem CTE check has more ceremonial than functional value. But the “media hype” has been in service of forcing action by the NFL. Without rhetoric that at times outstrips the state of science as governed by rules of evidence, there would be no reason for the NFL to do a damn thing. Which, to Turner, might be just fine (emphasis mine):
By my estimation and from information we have got from various charities involved in racing, they don’t seem to be coming to a great deal of problems, having lots of concussions.
Turner is either buying into the NFL’s bullshit self-reporting on the number of concussions experienced by players here, or else he’s making a whale of a fine distinction. The latter seems less likely when set against Turner’s explanation of what does cause depression and altered cognitive states in former NFLers:
“Also when athletes retire they are at a very critical period in their lives. Prior to that they were well-known they might have been famous and earning quite a lot of money and suddenly, they have very little status, nobody knows who they are, they don’t have somewhere to go to work and I think that transition can be badly handled by lots of sports.”
He goes on:
“You never hear that discussion among professional athletes or student athletes when they have finished competing and what we find out is that people who have pre-injury had mood disorders or depression do worse than those who don’t.”
So yes, he’s right about the fact that not every concussion victim will develop mental problems. (For example, 87 of the 91 former players autopsied showed signs of CTE, but the sample is massively self-selected.) But to just toss what observation has been done down the shitter is, uhm, not exactly prudent. Damage to regions of the brain associated with CTE puts people at risk for depression—and there’s ample evidence that the tau clusters that denote CTE are present there, even if we don’t know exactly how those mutated clusters affect function.
Furthermore, chronic pain is a major factor in the development of clinical depression and NFL players tend to leave the league with lingering injuries. Maybe, if Turner wants to make sweeping judgments about why players are sad after they retire because they’re not famous anymore, he should look at their physical conditions too. The ways that NFL football (and other contact sports) affects players in later life are complex, and very far from being fully understood.
Which is all to say that Turner’s suggestions here, in his capacity as a scientist, are at best reckless. As the head of an NFL-sanctioned study, one empowered to take part in the future of concussion science, they border on negligence. And as the shithead just a few breaths removed from griping about discussion of CTE racing far ahead of the Real Science, they’re a very funny thing indeed.
Contact the author at patrick@deadspin.com or @patrickredford. |
Local drug delivery using coated stents: new developments and future perspectives.
Percutaneous coronary intervention has been hampered by restenosis since its inception. Many research projects including the use of various devices and systemic drug administration have shown disappointing results. The clinical data reported from trials with sirolimus- and paclitaxel- eluting stents have been very promising, such that stents with the capability of drug elution are currently attracting the medical community for the prevention of restenosis. Based on the mechanism of action of the drugs released from the stent and the target of the restenotic process, there may be 4 therapeutic objectives: anti-inflammatory, anti-proliferative, anti-migratory, and pro-endothelial healing. There are many candidate agents for drug-eluting stents, however, it now becomes clear that not all drug-eluting stents are equally effective. This article describe candidate agents which have been tested or currently under investigation, and summarize the latest information. |
Epidermal growth factor-nanoparticle conjugates change the activity from anti-apoptotic to pro-apoptotic at membrane rafts.
The proliferation epidermal growth factor (EGF) is known to acquire contradictory apoptotic activities upon conjugation with gold nanoparticles (GNPs) through hitherto unknown mechanisms. Here, we identified an essential role of membrane rafts in the drastic activity switching of EGF-GNPs through the following intracellular signaling. (1) In contrast to the rapid diffusion of activated EGF receptor after the soluble EGF stimulation, the receptor is confined within membrane rafts upon binding to the EGF-GNPs. (2) This initial receptor confinements switch its endocytosis process from normal clathrin-mediated endocytosis to caveolin-mediated one, changing the phosphorylation dynamics of essential downstream kinases, i.e., extracellular signal-regulated kinase and AKT. Importantly, the destruction of membrane rafts by β-cyclodextrin reversed this trafficking and signaling, restoring EGF-GNPs to lost anti-apoptotic property. These results reveal the importance of GNP-mediated signal condensation at membrane rafts in conferring the unique apoptotic activity on EGF-nanoparticle conjugates. STATEMENT OF SIGNIFICANCE: Epidermal growth factor (EGF) is a small secretory protein that induces cell proliferation upon binding to its receptor existed on cellular plasma membranes. One interesting feature of the protein in the nanobiology field is, its acquisition of apoptosis-inducing (cellular suicide) activity rather than proliferative one upon conjugation to gold nanoparticles through hitherto unknown mechanisms. Here, we identified the involvement of membrane rafts, plasma membrane nanodomains enriched with cholesterol, in the apoptosis processes by changing the receptor trafficking and downstream signal transduction pathways. Moreover, the destruction of lipid rafts restored the EGF-nanoparticle conjugates with lost anti-apoptotic activity. These finding highlight potential applications of EGF-nanoparticle conjugates to cancer therapy, as the EGF receptor are highly expressed in cancer cells. |
In the marketplace Anxiety Can Hypnotherapy Help Treat?
Hypnotherapy has enjoyed rapid growth over the last times. As it grows in popularity, hypnotherapy is much simpler to access than ever and has been applied to wide range of topics. In this particular article good take a tour of earth of hypnotherapy and operate is previously make flip. We’ll look in the definition of hypnotherapy the actual to expect after you compromise into your hypnotherapist’s comfy couch.
According to Webster’s Dictionary hypnotherapy is psychotherapy that facilitates suggestion, reeducation, or analysis by hypnosis. Hypnosis is looked as a trance state observed as a extreme suggestibility, relaxation and heightened creativeness.
The aim of hypnotherapy is actually help you obtain more of the items you want, either stopping behaviours, like smoking cessation or weight loss, or starting behaviours like grow to be or stress management. A hypnotherapy session will trigger you to rethink, review and customize way information is stored inside your brain.
A typical hypnotherapy session will gently lull you into an altered state of consciousness. This altered associated with consciousness sounds like being drowsy, or zoned out money-back guarantee feeling will last for the space of the session – usually a session or 90mins. You even now awake but you are so happily involved in what the hypnotherapist says that devote more awareness of the story and less to your immediate views.
This story typically has several parts:
a beginning, called an induction assist you you settle and start to focus your attention, a bridge or deepener, this be beneficial you relax even further, the middle, this a good imaginative story about a sequence of events that changes means you see or experience a behavior, and an end, this refocuses you on your immediate surroundings and returns in order to definitely a normal wide awake state.
The information that makes up the middle part of your story is different from topic to topic. For instance, for are having hypnotherapy for smoking cessation the story might actually cover how fresh, clean air feels good in your lungs, or how a person first were children you breathed fresh air with enthusiasm and felt satisfied. By simply session is related to public speaking skills craze might actually cover how easy it end up being speak with friends at caf and the you speak in public often without any hesitation or fear. The suggestions embedded through a hypnotherapy story lead of which you rethink and change the way information is stored inside your brain. What once was seen as positive and necessary could be seen as outdated and unhelpful, what was seen as frightening and impossible can be seen as effortless and thrilling.
With every new connection comes the for different behavior, lots of people make enough connections through one session to begin new behaviours straight off of. Other people discover gradual change over the weeks following their session or will need more than one session of hypnotherapy to start to make the changes which want.
Overall, hypnotherapy is highly regarded with its wide application and the impressive results it will offer. The common uses of hypnotherapy are smoking cessation and weight loss, so confident a couple of hypnotherapists may guarantee success or your back.
When you begin hypnotherapy you can expect a therapy session to provide you with almost to sleep and to target your attention with a tale full of suggestions. Whenever relax head makes different connections these new connections can bring new behaviours and capabilitys. The real good thing about a hypnotherapy session could be felt previously days or weeks the canadian government used session all of which will literally give you a for you to rethink the person you are and how you do your best. The application of hypnotherapy is continually evolving and will continue to shape how you think about what we have the capability of. Prone to want alter your behaviours, hypnotherapy can be a remarkably relaxing way to do so. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.