text stringlengths 8 5.77M |
|---|
HHS adds H5N1 clade 2.2 vaccine to stockpile
Apr 29, 2008 (CIDRAP News) – The US Department of Health and Human Services (HHS) has accepted the first batch of H5N1 avian influenza vaccine based on the H5N1 variant known as clade 2.2, which has spread most widely across Asia, Europe, and Africa.
Sanofi Pasteur announced yesterday that HHS is paying $192.5 million for the vaccine, which is being shipped in bulk form. The number of doses it represents will depend on the final formulation of the vaccine, but the amount could be used to make from 6.4 million to 38.5 million doses or more, the company said.
"This acceptance represents the US government's latest effort to diversify the vaccine stockpile program to include new strains of the H5N1 virus," Sanofi said in a news release. The vaccine is based on H5N1 clade 2.2, the variant that caused the outbreak in bar-headed geese and other birds at China's Quinghai Lake in 2005, the statement said. It was made at Sanofi's plant in Swiftwater, Pa.
Clade 2.2 viruses have sparked outbreaks in more than 60 countries in Africa, Asia, and Europe, with human cases in Azerbaijan, China, Djibouti, Egypt, Iraq, Nigeria, Pakistan, and Turkey, the World Health Organization reported in February.
US officials hope that existing H5N1 vaccines will provide some protection for critical personnel in the early stages of a pandemic, should the H5N1 virus evolve into a pandemic strain. In a pandemic, it is expected to take several months to develop and start producing a vaccine closely matched to the new strain.
Robin Robinson, PhD, director of HHS's Biomedical Advanced Research and Development Agency (BARDA), confirmed that the supply received from Sanofi represents the first clade 2.2 vaccine to be added to the Strategic National Stockpile.
Sanofi called the strain "particularly troubling because it is the first to be identified in an outbreak of migratory birds, which have the potential to spread the virus across continents."
Robinson told CIDRAP News the national stockpile already contains supplies of vaccine based on three other H5N1 variants: clade 1, clade 2.1, and clade 2.3. HHS has sought to diversify the stockpile out of concern that a vaccine based on one strain won't work well against a pandemic virus stemming from a different strain.
The stockpile was begun with a Sanofi vaccine based on a clade 1 virus from Vietnam, he said. In 2006 and 2007 HHS purchased vaccines based on clade 2.1, a strain identified in Indonesia, from Sanofi, GlaxoSmithKline (GSK), and Novartis, he reported. In addition, he said the agency has bought some vaccine from Novartis that's based on clade 2.3, a strain from Anhui province in China.
Robinson said the stockpile currently contains enough H5N1 vaccine to cover about 12 million to 13 million people, assuming two 90-microgram (mcg) doses per person. The vaccines are stored in bulk form, and it may be possible to use smaller doses if various trials of the vaccines with adjuvants (immune-boosting chemicals) are successful, he said.
"This fall we should hit our goal [of having enough vaccine] for 20 million people," Robinson said. "If the adjuvants become a reality we'll be able to have more than that." He reported that Sanofi vaccines make up about two thirds of the stockpile, while the GSK and Novartis vaccines account for about 17% each.
Sanofi's announcement yesterday said the clade 2.2 vaccine supplied to HHS would be good for 6.4 million 90-mcg doses. But if the amount could be reduced to 15 mcg per dose—the amount for each strain in seasonal flu vaccines—the supply would amount to 38.5 million doses.
"If we had a really successful adjuvant, it could be even much higher than the numbers in the press release," Sanofi spokesman Len Lavenda told CIDRAP News. He said the company is working on adjuvants.
Robinson said HHS is supporting the development of adjuvants by GSK, Novartis, and Iomai Inc. Iomai's adjuvant is delivered by a skin patch rather than by being mixed with the vaccine antigen and injected.
The GSK and Novartis adjuvants for H5N1 vaccine "are in a very advanced stage of development in that they are hopefully going to submit licensure applications to the FDA [Food and Drug Administration] later this year," Robinson said. He noted that the adjuvants are not licensed as separate products, but only in combination with a vaccine. If the adjuvanted vaccines are licensed, HHS can consider adding them to the national stockpile, he said.
Robinson also said there are plans for a "mix and match" clinical trial in which Sanofi's vaccine antigen will be combined with adjuvants from GSK and Novartis. The aim will be to see if the adjuvanted vaccines are safe and if they produce immune responses similar to those of the corresponding GSK and Novartis vaccines, he said.
In addition, under an HHS contract, Sanofi will be testing split-virus and whole-virus H5N1 vaccines with two other adjuvants, involving aluminum hydroxide and an oil-and-water emulsion, Robinson said. |
Q:
Are there any "brand" museums in Los Angeles?
Atlanta has the Coca Cola museum, Munich has the BMW museum, in Maranello there is the Ferrari museum. Similarly, are there any "brand" museums in LA or its neighborhoods? I know these museums are quite popular in Europe, but haven't seen anything in LA yet.
A:
Okay, so I've gone through several Wikipedia pages for southern California...
McDonald's Museum (also Juan Pollo) in San Bernardino
Fender Museum of Music and the Arts in Corona (I assume there are some Fender instruments)
Wells Fargo History Museum (Los Angeles and another one in San Diego)
Lawrence Welk Museum in Escondido
Related, if you like cars:
Nethercutt Collection in Sylmar
Petersen Museum in Los Angeles (Wilshire)
plus others
|
Telangana CM K Chandrasekhar Rao
HYDERABAD: In a big jolt to the Congress in Telangana, as many as 12 of its 18 MLAs were recognised as members of the ruling TRS by the assembly Speaker on Thursday hours after they moved him seeking merger of their group.
Capping a day of fast paced political developments, Speaker P Srinivas Reddy acceded to the request of the 12 MLAs considering the fact they constituted two-thirds of the Congress Legislature Party, a requirement for merger under the anti-defection law.
A bulletin from the assembly Thursday night said seats had been alloted to the 12 MLAs along with the members of the Telangana Rastra Samithi Legislature Party in the House.
Unless the merger is reversed, the Congress is set to lose its opposition party status in the assembly as its strength has come down to six.
AIMIM led by Hyderabad Lok Sabha member Asaduddin Owaisi has seven members in the assembly, while the BJP has one. The Telugu Desam Party (TDP) had won two seats in the December polls, that saw the TRS scoring an impressive win, but one of them had also announced his decision to join the ruling party.
The Speaker's decision came after the embattled Congress cried foul, accusing the TRS of purchasing its MLAs and announcing its decision to move the court Friday.
The setback to the Congress in Telangana comes at a time when the party has been on the backfoot in several states following dissidence among its ranks after the drubbing in Lok Sabha elections.
The day unfolded with the MLAs meeting Srinivas Reddy and giving him a representation for merger of their group after Rohith Reddy, representing Tandur constituency, became the 12th Congress legislator to jump the ship.
In what appears to be a calculated move, the Reddy's decision to desert the party came a day after the Congress strength in the assembly came down to 18 following the resignation of state party chief Uttam Kumar Reddy as MLA on his election to the Lok Sabha.
Rohith Reddy's decision boosted the strength of the defectors to the two-third figure, thus insulating them from any possible action under the anti-defection law or the 10th Schedule of the Constitution.
Since early March, as many as 11 Congress MLAs had switched loyalties.
"...the Speaker has taken note that the said 12 members of the Congress Legislature Party who constitute two thirds of its total members in the Telangana Legislative Assembly are deemed to have been merged with the Telangana Rashtra Samithi Legislature Party in Telangana Legislative Assembly in terms of paragraph 4 of the 10th schedule to the Constitution of India.
"Accordingly seats are allotted to them along with members of Telangana Rastra Samithi Legislature Party in the house, the assembly bulletin said.
Earlier in the day, Congress strongly protested against the development and targeted the TRS.
"This is completely illegal. KCR (TRS President and Chief Minister K Chandrasekhar Rao) is cheating the mandate of the people of Telangana," Uttam Kumar Reddy told PTI.
He also held a protest on the Assembly premises along with Congress Legislature Party (CLP) leader M Bhatti Vikramarka and senior party leaders.
Rohith Reddy, earlier in the day, met Rao's son KT Rama Rao and pledged his loyalty to the ruling outfit.
Talking to reporters after petitioning the Speaker, senior legislator Gandra Venkata Ramana Reddy said the 12 MLAs decided to work with the chief minister for the "development of the state."
"We held a special meeting of Congress Legislature Party. All the 12 members support the leadership of chief minister KCR and requested to work with him. We gave a representation to the Speaker and urged him to merge us with the TRS party," Ramana Reddy said.
He claimed the people of the state were with them and supported their move.
The TRS won 88 seats in the assembly polls held in December last year.
Anticipating the move by the TRS, CLP leader M Bhatti Vikramarka, who is the Leader of Opposition, had recently met the Assembly Speaker and urged him to issue a notice to the Congress before taking any action on the merger issue.
"People voted for them ... for Congress. Buying those (Congress) MLAs by KCR is shameful. People of Telangana will not tolerate him for such shameful activities.
"You cannot remove the main opposition party (from the Assembly). You better shift the assembly to your (KCR's) farmhouse," Uttam Kumar Reddy said during the protest.
He alleged Speaker Srinivas Reddy was not available despite repeated attempts to reach him.
"We will fight this out democratically. We have already filed a petition in the High Court (on the defections issue)," he further said.
Assembly marshals took Uttam Kumar Reddy, Vikramarka and several other leaders into preventive custody and handed them over to the police for protesting within the assembly premises.
Separately, police rounded up about 20 Congress workers outside the assembly, a senior police official said.
In the last assembly, TRS managed to lure 12 out of 15 TDP MLAs who won in the 2014 polls.
In the recently held Lok Sabha polls, the Congress won three seats, improving its tally from two in the 2014 polls.
The TRS bagged lower-than-expected nine Lok Sabha seats, while the BJP picked up four.
TRS, however, swept the rural local body polls in Telangana, results of which were declared this week, winning a majority of the mandal and zilla parishad seats. The polls were held last month.
In Video: Telangana: 12 Congress MLAs meet assembly Speaker, demand merger with TRS |
The party also outperformed the governing National Democratic Congress in the parliamentary election by increasing its seats from 122 to 169 to form the majority, while the NDC saw its representation drop from a majority of 148 to 106.
Tasked to find out why the NDC performed poorly, the former Finance Minister Prof. Kwesi Botchwey Committee toured the country meeting the grassroots of the party. |
Q:
Excel - automatically fill down a row with date range matching a specific pattern
Given a specific start date (say Jan, 11th 2012 for example), I want to fill down a row in excel automatically with a date range matching the following pattern for the days (bi-monthly pay period).
1. 11th - 25th
2. 26th - 10th
Of course with actual dates in each cell including the month and year (not simply repeating the two values above). What I'm looking for is a way to put in one or two specific date ranges, such as:
January 11th, 2012 - January 25th, 2012
January 26th, 2012 - February 10th, 2012
And have excel automatically fill down many more cells in the same pattern:
January 11th, 2012 - January 25th, 2012
January 26th, 2012 - February 10th, 2012
February 11th, 2012 - February 25th, 2012
....
December 11th, 2012 - December 25th, 2012
How can I do this?
A:
Format your columns to the date format you prefer. Enter the date of 1/11/2012 into cell A1 and the date of 1/25/2012 in cell B2. Copy the following code into A2;
=DATE(YEAR(B1),MONTH(B1), DAY(B1)+1)
and copy this into B2;
=IF(DAY(B1)=10, DATE(YEAR(B1), MONTH(B1), DAY(25)), DATE(YEAR(B1),MONTH(B1)+1, DAY(10)))
Go ahead and highlight A2 and B2 to drag them down as far as you need.
Should look like this when done;
|
/* This Source Code Form is subject to the terms of the Mozilla Public
* License, v. 2.0. If a copy of the MPL was not distributed with this
* file, You can obtain one at http://mozilla.org/MPL/2.0/. */
/*
* Test various syntax errors.
*/
function script0$init():*
{
// Unknown opcode.
zuul 12 ls "zeeb"
// callproperty insn without enough operands
callproperty parseInt
// This is going to show up in a diagnostic
// for "callproperty" because the input is free-format
pushnull
// callproperty insn with wrong type operands
callproperty parseInt (44.2)
// Too many integer prefixes
10 11 setlocal 1
// pushscope succeeds, but extra_operand is parsed as an insn
pushscope extra_operand
// invalid string arg to debugline
debugline "zerg"
// Last insn in the function is invalid.
foodle
}
function poot()
{
// empty function body -- not allowed
}
// This, on the other hand, is perfectly fine!
|
Q:
Package vs Library
I've just started working with CMake and I noticed that they have both a find_package and a find_library. And this confuses me. Can somebody explain the difference between a package and a library in the world of programming? Or, in the world of CMake?
Appreciate it, guys!
A:
Imagine you want to use zlib in your project, you need to find the header file zlib.h, and the library libz.so (on Linux). You can use the low-level cmake commands find_path and find_library to find them, or you can use find_package(ZLIB). The later command will try to find out all what is necessary to use zlib. It can be extra macro definitions, or dependencies.
Update, more detail about find_package: when the CMake command find_package(SomeThing) is called, as says the documentation, there are two possibility: the module mode (that searches for a file FindSomeThing.cmake), or the config mode (that searches for a file named SomeThingConfig.cmake). For ZLIB, there is a module named FindZLIB, shipped with CMake itself (on my Linux machine that is the file /usr/share/cmake/Modules/FindZLIB.cmake). That module is a CMake script that uses the CMake API to search for ZLIB files in default locations, or ask the user for the location if it cannot be found automatically.
|
Many are speculating that the attack was the result of an argument between Solange and Jay-Z or her witnessing him disrespecting her sister Beyoncé. But after the pair was reportedly seen shopping in a NYC jewelry store, it looks as though any possible issues between the two have subsided. Photo: Reuters
Most fans of Beyoncé and Jay Z already knew who Solange Knowles was well before their much-publicized fight in the elevator at the Standard Hotel in New York City, but after the post-Met Gala altercation on May 5, Solange gained sudden notoriety.
It seemed Solange and Jay Z were fighting over something big to many of those who saw the video TMZ leaked. But apparently it was over something small. "Solange was yelling that anyone who gets close to Jay has to be warned and deal with her as a sister," a source told Us Weekly about Beyoncé’s younger sibling.
The hip-hop royal couple reportedly tried to get Solange to leave the party, which apparently set off the elevator fight. "Jay said something small to her along the lines of, 'You are out of line,'” a different source told the news site. "Solange was being a loudmouth and snapped at Jay trying to calm her down and get her out of there."
The insider added that "there were a few other things" said, but maintained it "isn't the big deal people are making it into." The source continued: "Honestly, the whole fight was over something so small and stupid."
Rumors have been exploding since the altercation, with some asserting that Solange was upset because Jay Z was going to Rihanna’s Met Gala party alone. Beyoncé was also criticized by some after the video showed her remaining stoic in the corner as her little sister tried to attack her husband. But a source told Us Weekly Queen Bey was just “trying to keep the peace.”
"Both Bey and Jay were trying to handle the situation," the source told Us Weekly. "Solange has been that way before, and Jay and Bey just wanted to get her out of there and home before she really caused a ruckus."
In an attempt to prevent the person from committing suicide, Avleen K. Mokha in her Facebook post wrote, "Don't go ahead with this tonight. There's more in life to look forward to beyond tonight. Please be there to see it." |
KATHARINE SCHROEDER PHOTO | Bagpipers march during last week’s Cutchogue St. Patrick’s Day Parade.
St. Patrick’s Day just isn’t the same anymore.
For over a decade the annual celebration of all things Irish — and unfortunately things that have nothing to do Mother Eire (pronounced air-uh, not ear-ree) — meant riding a bus to the Queens-Midtown Tunnel and onto Manhattan’s manic streets for THE parade. The granddaddy of ‘em all, the New York St. Patrick’s Day parade up 5th Avenue in front of hundreds of thousands of people, some of whom are actually not conversing on a cellphone.
That’s the parade any piper worth his salt dreams of. It dates back to 1762 when some homesick Micks and fellow countrymen serving in the British colonial military reconnected to the land of saints and scholars by staging their own March 17 march through lower Manhattan’s narrow streets.
The view from the street is at turns awe-inspiring and terrifying. I played and marched in fair weather and foul, passing St. Patrick’s Cathedral’s imposing Gothic spires, Tiffany’s and other tony shops, the Plaza Hotel and Central Park up to 79th Street. We used to play all the way up to 89th, right to the Guggenheim Museum, but then the city decided it was spending too much on police overtime.
While I think the city looks foolish in its current role as the Sugar Nazi, they heard no complaint from me about loping off those last 10 blocks. Believe me, 30 blocks, much of it uphill, is more than enough.
But I didn’t pipe there last year, nor will I make the march this year. Not sure where I’ll be when this year’s parade steps off on Saturday, on the 16th because the parade is never, ever held on a Sunday, but it’s a safe bet me pipes will remain out in the garage.
The reason is simple. Last year my group, the Peconic Warpipes, fell apart, the victim of internal strife and a lack of interest by many of the senior members. Of course there are other bands out there, including one connected to a Riverhead brewery that rose out of the Warpipes’ ashes, but I have to admit my heart just isn’t in it.
I marched in 10 city parades, in Boston and in dozens of others from the Rockaways to Montauk, but in me sixth decade on this planet the idea of standing in the snow, or rain, waiting for three hours to step off has lost its luster. I am soooooo done with this.
Or so I thought.
That’s not what I was thinking on Saturday as me and the Mrs. watched local dignitaries, Girl Scouts, antique cars, fire trucks, school bands, even a helicopter on a flatbed truck and pipers, of course the pipers, pass us by during Cutchogue’s St. Patrick’s Day parade.
Now I know how a professional athlete must feel when playing days have passed and the view is from the sidelines or the stands. Well, except that I never drew a seven- or eight-figure salary, had multitudes screaming for my autograph, appeared on Letterman or drove a Lamborghini. Other than that, it’s the exact same thing.
The skirl of the pipes grew louder as the bands marched west on Main Road toward the reviewing stand where they stopped, their tartans gleaming in the sunshine of a glorious pre-spring afternoon. They played for the dignitaries and marched off again. That could have been/should have been me up there. Why am I on the outside looking in? Why am I wearing pants? (Knock it off. You know what I mean.)
Then a couple of former bandmates came up to say hi. Great to see ‘em, but boy did it feel awkward.
Soon the horses clip-clopped by, signaling, for obvious reasons, the parade’s end. The crowd dispersed and we walked the short distance home and into the garage. Just before opening the kitchen door I glanced over at the pipes, lying on a cluttered table by the far wall. |
Life's Dominion: An Argument about Abortion, Euthanasia, and Individual Freedom, Ronald Dworkin.
As a teacher of biomedical ethics, I have constantly sought a method to motivate my students to engage in meaningful moral debate on the controversial issues of abortion and euthanasia, without risking a shouting match (as happened on one occasion). The moral views are so personalized and polarized that silence often displaces discourse. Ronald Dworkin's masterful Life's Dominion offers an innovative and insightful way through this impasse by identifying moral commitments shared by persons with different conclusions. His argument begins with "conservative" premises and winds up with "liberal" conclusions. It is a philosophical and constitutional analysis of the meaning of life and death that draws on substantive religious values. In so doing, Dworkin suggests an approach that could alter the adversarial and even violent nature of our cultural debate about the ending of life towards a more dialogic and tolerant, but not indifferent, mode.... |
Q:
Using a Makefile with C
So I have three files:
jarvismarch.c (includes "jarvismarchtools.h")
jarvismarchtools.c
jarvismarchtools.h
I would like to use a makefile to compile the aforementioned files. How would I go about this?
A:
The typical minimal makefile looks like this:
OBJ = jarvismarch.o jarvismarchtools.o
all: $(OBJ)
$(CC) -o jarvismarch $(OBJ)
Taking the comment of asveikau into account and adding a clean target it becomes:
OBJ = jarvismarch.o jarvismarchtools.o
BIN = jarvismarch
CFLAGS = -Wall -pedantic -ansi
all: $(BIN)
$(BIN): $(OBJ)
$(CC) -o @ $(OBJ)
clean:
rm -f $(OBJ) $(BIN)
(Windows users need to use .obj instead of .o)
I strongly recommend against using make. It might be simple at first, but once your project grows I highly recommend a more complete build tool like SCons, CMake or Boost.Build.
|
Why Amazing Race 29 ends as a refreshed—and renewed—show
When the final three teams land on the finish mat during The Amazing Race 29’s finale tonight (CBS, 10 p.m.), they won’t be the last: the venerable series was finally renewed for a 30th season.
That’s great news for a competition that was one of the earliest reality TV shows to place an emphasis on high-quality craft. It’s clearly found enough viewers to justify a renewal, though far fewer of them are watching live thanks to its new timeslot.
And it has also found new life with its latest twist.
Besides some fun and new challenges—in the most recent episodes alone, there was carrying and using bamboo ladders in tight spaces; speed-stacking cups; playing Street Fighter against expert kids; making kimchi; and using bicycles as their only mode of transportation—the show has also delivered a cast that has consistently delivered.
When I watched the first episode of this season, I expected the pairings of strangers to change the dynamic. It didn’t, which was surprising—they just seemed like pairs that’d known each other forever, not people who’d just met.
One reason I gave up TAR was that the editing had become so frustratingly one-note for every team, not even each person. It was the same character beat again and again and again. But something changed this season, and I finally realized what’s different for me is that each person is coming across as a much more complex character.
Casting makes all the difference
At the very least, most of the cast members on The Amazing Race 29 have more than one note that’s being hit by the editing.
For one example, there’s the final-three team of Brooke and Scott. They’re probably the most mismatched team on the entire race, between Brooke’s incessant pessimism, hostility toward others, and constant surrender to whatever obstacle she faces, and Scott’s optimistic excitement and social game.
One moment, they can be screaming at each other in rage; the next Scott will be sarcastically but sincerely encouraging Brooke (“We’re in the Amazing Race. We run.”). Later, we’ll see Brooke offering genuine emotional and human support to Scott, like each of the 712 times he’s had to face his immobilizing fear of heights.
That’s good television, focusing alternately on people’s strengths and weaknesses, and different manifestations of them. I’ve struggled with whether or not to root for “Team Mom and Dad,” Tara and Joey, and I realized that was because I couldn’t quite figure out Joey.
I like that ambiguity. I also like that casting found such a great mix of people that worked so well in various pairings.
Casting people as individuals and letting them create the pairings has rekindled something in the show that has been missing for a while.
The Amazing Race never lost its grand cinematography, which is all the more amazing considering how much of the show is shot by camera operators running alongside the teams; nor its frenetic energy as teams race through remarkable places. But The Amazing Race did lose its way, and is not the show it was in its early years.
Thanks largely to these 22 strangers and the way they were edited, it’s better than it has been in quite some time.
This spring reality show 2019 schedule is a frequently updated list of premieres for broadcast, cable, and streaming reality TV shows, documentary series, game shows, and other prime-time nonfiction TV.
Drag queens give up everything from rights to revenue in order to appear on RuPaul’s Drag Race, and everything from per-episode compensation to Drag Race’s rules are covered in this 51-page participant agreement that contestants sign during the casting process.
reality TV news and reviews, in your inbox
One hand-crafted message sent every Friday. Free. Subscribe now:
discuss this story
about Andy Dehnart
Andy Dehnart’s writing and criticism about television, culture, and media has appeared on NPR and in Vulture, Pacific Standard, The Los Angeles Times, and other publications. He has covered reality television for more than 18 years, and created reality blurred in 2000.
A member of the Television Critics Association who serves on its board of directors, Andy, 41, also directs the journalism program at Stetson University in Florida, where he teaches creative nonfiction and journalism. He has an M.F.A. in nonfiction writing and literature from Bennington College. Learn more about reality blurred and Andy.
stay connected with reality TV
Get advice about what to watch and keep up with the latest in reality television with reality blurred's e-mail newsletter. Just enter your e-mail address:
about reality blurred
reality blurred is your guide to the world of reality TV and unscripted entertainment, with reality show reviews, news, and analysis. It was created in 2000 by Andy Dehnart. He's still writing and publishing it today.
reality blurred is regularly updated with highlights from the world of reality TV: news and analysis; behind-the-scenes reports; interviews with reality TV show cast members and producers; and recaps and reviews of these reality TV shows, including Survivor, Big Brother, The Great British Baking Show, Shark Tank, The Amazing Race, The Bachelor, Project Runway, Dancing with the Stars, Top Chef, and many more. |
Photoelectron imaging and photodissociation of ozonide in O3(-)⋅(O2)n (n = 1-4) clusters.
The photoelectron images of O3 (-) and O3 (-) ⋅ (O2)n (n = 1-4) have been measured using 3.49 eV photon energy. The spectra exhibit several processes, including direct photodetachment and photodissociation with photodetachment of O(-) photofragments. Several spectra also exhibit autodetachment of vibrationally excited O2 (-) photofragments. Comparison of the bare O3 (-) photoelectron spectra to that of the complexes shows that the O3 (-) core is preserved upon clustering with several O2 molecules, though subtle changes in the Franck-Condon profile of the ground state photodetachment transition suggest some charge transfer from O3 (-) to the O2 molecules. The electron affinities of the complexes increase by less than 0.1 eV with each additional O2 molecule, which is comparable to the corresponding binding energy [K. Hiraoka, Chem. Phys. 125, 439-444 (1988)]. The relative intensity of the photofragment O(-) detachment signal to the O3 (-) ⋅ (O2)n direct detachment signal increases with cluster size. O2 (-) autodetachment signal is only observed in the O3 (-), O3 (-) ⋅ (O2)3, and O3 (-) ⋅ (O2)4 spectra, suggesting that the energy of the dissociative state also varies with the number of O2 molecules present in the cluster. |
Q:
How to prevent my 3-year-old boy from climbing on top of me?
We have a 3-year-old boy who spends most of his time at home. Oftentimes, while we are trying to work, or teaching our older kids, the boy will start to climb on top of us. Telling him "Stop" doesn't seem to work. If I carry him and put him back on the floor gently, within a minute he will be climbing on me again. His climbing over us can be annoying, but also cause us to feel quite beat up physically, and exhausted.
What should we do to prevent him from climbing over us, or at least to keep this activity restricted to certain times when we can tolerate it?
I wonder if this is related to another problem we have, which is that sometimes, he will complain, "No one is playing with me, I need someone to play with me." It's not that the older kids are not available, he just seems to want/need his parents to play with him.
A:
I would add to EmandM's excellent answer that 3 is old enough to begin to learn about other people's bodily boundaries, and in general that one does not touch others in a way (or at a time) that is unwanted. You can tell him, "I don't want to play this way right now. Please give me some space!" You can also redirect to a type of touch or a time that IS acceptable. "But I would love a hug" or " We can wrestle after dinner". Keep it friendly but firm when you let him know what the boundary is, and escalate as needed if he then chooses to ignore it.
You may have to enforce your boundaries with whatever disciple technique you commonly use until he begins to get the idea. (I don't mean to suggest anything too harsh, he's just seeking your love and attention-- but he should get the message that doing it in a way that is painful to you, and continuing after you have asked him to stop, is not acceptable in your family).
It is absolutely crucial, in my opinion, for kids to learn that they must respect other peoples' "no" when it comes to physical touch, and that means parents as well. If someone says stop, they should stop right away, and if they tell someone else to stop touching them, they should expect, even demand, the same. It's a cornerstone of successful social interaction as an older child and adult, but a hard lesson at first for a toddler, who may still be coming to terms with the idea that other people have their own needs/wants/feelings.
Overall, he sounds like he's mostly bored and seeks attention and connection. Being home most of the time and entertaining himself while parents give their focused attention to work or older kids is not an easy thing for a little child, even with other kids to play with. He might respond well to being given some 'homework' in the form of puzzles, coloring, etc while you are teaching the others, or to having more one-on-one time with adults.
A:
It sounds like he's looking for your attention, which is normal and natural in a small child. He wants to know that he's loved and wanted by you.
If you are not enjoying this particular attention seeking behaviour, give him attention in a more manageable way. Play games with him, let him help with tasks around the house, do activities with him directly. Give him attention in a positive way that you control and he will seek it less in a way that makes you uncomfortable.
|
Transduction mechanisms in the olfactory and vomeronasal organs of turtles.
It is generally believed that odorants bind to receptor proteins and activate cAMP-dependent channels located in olfactory cilia. In the present paper, we discuss whether or not this mechanism holds for in vivo transduction in the olfactory and vomeronasal organs of a turtle: (1) Elimination of salts from the olfactory epithelium did not affect the responses to odorants; changes in concentration of NaCl or CaCl2 did not affect the olfactory responses. (2) The sensitivity of the vomeronasal system to various general odorants was essentially similar to that of the olfactory system, although the vomeronasal cells have no cilia. Elimination of salts from the surface of the vomeronasal organ, similar to the olfactory system, did not affect responses to odorants. (3) Liposomes having certain lipid compositions responded to odorants with a sensitivity comparable to that in the olfactory system. The liposomes containing phosphatidylserine (PS) exhibited strong responses, especially to fatty acids. (4) Application of PS-containing liposomes to the olfactory epithelium greatly enhanced the responses to fatty acids. The results suggest that the cation channels located at olfactory cilia may not contribute to in vivo olfactory transduction. The results also suggest that lipids in olfactory receptor membranes are important in odor reception. |
One of the reasons behind this trip to South East Asia was to got away from the Middle East for a little bit – As I am sitting in a frozen yogurt cafe in Ho Chi Minh City, I just realised that sometimes you just can’t escape very easily.
I just came out of an exhibit on the history of Vietnam’s communist party. I went because I figured you don’t get to see propaganda by a ruling communist party a lot these days. In the midst of various memorabilia (silver plate from the Libyan Jamahiryya, Cuban stamps, plate from Turkmenistan etc.), posters of all the communist party congresses, photos of party officials being received by various dignitaries and/or at the ceremony for Vietnam’s accession to ASEAN or the WTO, one document from the 1945 liberation struggle from the French really caught my attention. The pamphlet calls for an end to French aggression in exchange for protection of France’s commercial interests in the country. The second last paragraphs is very militant ‘Français! Réfléchissez! Vous avez appris aux événements de Syrie-Liban`. It reminded me of a different Syrian revolution that once was.
The next stop on the tour was the War Remnants Museum. The museum is an impressive and harrowing tour of the impact of the Vietnam war. It has a bright orange room full of pictures of victims of Napalm and other biological weapons, US army tanks and helicopters parked outside and a ‘requiem’ photo exhibition. The ground floor hosts a collection about the various protests that took place all over the world, including in Aleppo, Syria.
A lot of thoughts are now racing in my head on imperialism, military intervention, resistance and post-resistance propaganda (brought to you by the `historic truth` part of the museum). Perhaps the loudest one is a reflection on how humans take part in historic events, motivated in part by my non-heroic and passive experience with the Egyptian revolution. This quote has moved me more than anything else in the museum.
Someone may criticise me, a citizen of a third world country for self-burning in protest, but I strongly believe that those who long for the real peace in Vietnam and all over the world will not consider my death as being in vain |
Effects of food processing on flavonoids and lycopene status in a Mediterranean tomato variety.
This research is focused on the antioxidant properties of dietary components, in particular phenolics and carotenoids and the assessment of the contribution of the combined antioxidants to the total antioxidant activity (TAA) of tomato fruit. The aim of this study was to analyse the effects of processing on the antioxidant properties of tomato. The effects of three different methods of processing fresh tomatoes into tomato sauce were investigated with respect to the antioxidant properties of the fruit. Identification and quantification of the main carotenoids and flavonoids present in tomatoes was achieved by HPLC analysis and the effect on the concentration and availability of these compounds was investigated at different stages of the processing. The processing affected mainly naringenin causing a reduction in the concentration. Conversely, levels of chlorogenic acid were increased suggesting an improvement in availability of this compound to extraction. The concentration of all-trans-lycopene was also increased following processing. Less than 10% isomerisation of all-trans-lycopene to the cis form was detected for all the methods analysed. The effects of processing on the overall antioxidant activity support the theory of a general improvement in availability of individual antioxidants. For both hydrophilic and lipophilic extracts TAA values were increased. |
using System.Web.Mvc;
namespace FormFactory.AspMvc.Wrappers
{
public class FormFactoryViewData : ViewData
{
public FormFactoryViewData(ViewDataDictionary viewData) : base(new FormFactoryModelStateDictionary(viewData.ModelState), viewData.Model)
{
}
}
} |
Q:
Can not get Materialize css dropdown to work with dynamically loaded modal
I have a Rails application running with MaterializeCSS. I am generally using materialize many places in the app including JS objects (like FAB buttons) and it all works fine...except for the dropdown button.
I have this one section of code where I load a modal form on the modal form I have two materializecss components which requires JS: 1) a collapsible list and 2) a dropdown. The collapsible list works fine, but the dropdown does not.
The following code makes it run (or not :-( ). I'm using coffeescript and haml:
this initializes the modal:
modalInit: () ->
$('#photo-modal').modal
dismissible: true
opacity: .5
in_duration: 300
out_duration: 200
starting_top: '4%'
ending_top: '10%'
ready: (modal, trigger) ->
App.PhotoTaginput.refresh()
$('.collapsible').collapsible();
$('.dropdown-button').dropdown();
Note that the collapsible and the dropdown are initialized in the same way!!
I load the modal with this script:
showModal: (element) ->
_this = this
photoId = $(element).parents('.photo-widget').data("photoid")
url = '/photos/' + photoId + '?view=modal'
$('#photo-modal > .modal-content').load url, (result) ->
$('#photo-modal').modal('open');
This fetches some HTML which looks like this:
.row
.image_info#photo_id{:photo_id=>@photo.id, "data-photo_id"=>@photo.id}
.col.l5
.modal-toolbar
%a.waves-effect.waves-light.btn.like{:type => "button", :class=>current_user.voted_for?(@photo) && "red"}
%i.fa.fa-thumbs-o-up
%a.dropdown-button.btn{"data-activates" => "dropdown1", :href => "#"} Drop Me!
%ul#dropdown1.dropdown-content
%li
%a{:href => "#!"} one
%li
%a{:href => "#!"} two
%li.divider
%li
%a{:href => "#!"} three
.col.l12#modal_image
%img.bg.responsive-img{:src => "#{@photo.url('org')}"}
%ul.collapsible.overlay-menu.overlay-menu-show{"data-collapsible"=>"accordion"}
%li
.collapsible-header.overlay-menu-header
%i.material-icons info
info
.overlay-menu-body.collapsible-body
%table
%tbody
%tr
%td Date
%td=@photo.date_taken_formatted
%tr
%td ID
%td=@photo.id
%tr
%td Country
%td=@photo.location.country
%tr
%td Model
%td=@photo.model
%tr
%td Make
%td=@photo.make
It must have something to do with the JS which dynamically should initialize the dropdown. I say this because I can see that the css on the of the dropdown does not change when I press the button. It's kind of wierd though cause it is initialized the same way as the collapsible.
I'm pretty sure that the jquery and materialize libs are loaded correctly. I'm already using both libs in other code sections throughput the application
A:
It turned out to be some HTML beef up.
I had accidentally loaded this part several times times:
%a.dropdown-button.btn{"data-activates" => "dropdown1", :href => "#"} Drop Me!
%ul#dropdown1.dropdown-content
%li
%a{:href => "#!"} one
%li
%a{:href => "#!"} two
%li.divider
%li
%a{:href => "#!"} three
this resulted in several id's of #dropdown1 in the HTML this screwed up the initialisation of the dropdown.
|
112 N.J. Super. 326 (1970)
271 A.2d 27
IN THE MATTER OF THE ADOPTION OF "E".
Superior Court of New Jersey, Essex County Court, Probate Division.
Decided November 2, 1970.
*327 Mr. David M. Beckerman, for plaintiffs adoption applicants.
(Messrs. Beckerman, Franzblau, & Cohen, attorneys).
Mr. Edward Terner, as intervenor, for Children's Aid & Adoption Society.
CAMARATA, J.S.C.
The issue presented for determination is whether adopting parents who do not believe in the existence of a Supreme Being should be permitted to adopt a child 11 month of age.
Plaintiffs, husband and wife, in 1965 applied to the Bureau of Children's Services of the New Jersey Department of Institutions and Agencies seeking to adopt a child. They informed the Bureau that they had no religious affiliation and were not members of any organized church.
Because of plaintiffs' lack of religious affiliation, the Bureau would not consider them as eligible adoptive parents the Bureau relying in part on its Children's Manual, volume 2, 5245-31, entitled "Religious."
At that time the Bureau required each applicant for adoption to designate their religious affiliation and made it mandatory that a religious reference be obtained from a religious leader of the sect to which they belonged.
In February 1966 plaintiffs instituted proceedings in the Appellate Division alleging that this requirement was illegal and in violation of the New Jersey and Federal Constitutions. By stipulation entered October 4, 1966 the suit was dismissed. Thereafter, the regulations of the Bureau of Children's Services were changed. The pertinent part now provides as follows:
5.23 Religion of applicants
Opportunity for religious or spiritual and ethical development of the child should receive full consideration in the selection of adoptive homes. Lack of religious affiliation or of a religious faith, however, should not be a bar to consideration of any applicants for adoption. (2.6, 4.7).
*328 Agencies under religious auspices are free to stipulate requirements consistent with their faith and practice, and that of their clients.
When prospective adoptive parents are identified with a religious faith group, a clergyman of their religious faith may be consulted in order to secure his evaluation of the religious factors.
Couples in which the husband and wife have different religious faiths should not be denied consideration for adoptive placement on this account alone. It is necessary to evaluate in each case what their religious faiths and particularly the difference in religious faith means to them, and how this difference may affect the rearing and development of a child. [Emphasis added]
On July 11, 1967 plaintiffs obtained a male child D, then one month old, from the Children's Aid and Adoption Society of New Jersey. The report of the Society to the court stated that plaintiffs were not religiously affiliated. However, the Society recommended the adoption, and it became final on September 10, 1968.
On June 27, 1969 plaintiffs received from the Children's Aid and Adoption Society another child, E, born on June 19, 1969. E and D are now residing with plaintiffs. The Society in its report to the court stated: "Plaintiffs have no church affiliation however the agency has found them to be people of high moral and ethical standards."
They recommended to the court her adoption.
At E's hearing on August 25, 1970, the court questioned plaintiffs as to their religious affiliations. They testified they had no belief in any religion and did not believe in the existence of a Supreme Being. The court must consider the physical and spiritual welfare of the child. 2 Am Jur.2d, Adoption § 64.
The Declaration of Independence refers to: "Nature's GOD * * * Creator * * * The Supreme Judge of the World * * * Divine Providence."
The founders of our country were most sympathetic to the fundamental belief in the existence of a God.
In Zorach v. Clauson, 343 U.S. 306, 313, 72 S.Ct. 679, 684, 96 L.Ed. 954, 962 (1952), Mr. Justice Douglas speaking *329 for the court said: "We are a religious people whose institutions presuppose a Supreme Being. We guarantee the freedom to worship as one chooses."
Supreme Being has been defined as "A Supreme Being is God." Webster's 7th New Collegiate Dictionary.
God has been defined as "The Supreme Being is the eternal infinite spiritual creator and sovereign of the universe." 38 C.J.S. at 935. See also United States v. Seeger, 380 U.S. 163, 174-185, 85 S.Ct. 850, 858-863, 13 L.Ed.2d 733, 741-748 (1965).
After the hearing the court granted the request of the Children's Aid and Adoption Society to intervene in these proceedings.
Courts should be loath to intervene in matters of religion. Donahue v. Donahue, 142 N.J. Eq. 701 (E. & A. 1948). That case involved a matrimonial action where both parents sought the custody of two children born of the marriage. The father sought to have the children reared in a faith of his selection. See also T. v. H., 102 N.J. Super. 38 (Ch. Div. 1968), affd. on other factual grounds, 110 N.J. Super. 8 (App. Div. 1970). These cases are distinguishable from the instant one. In Donahue, the custody of natural-born children was involved, whereas here it is the placing of a child by adoption into the custody of plaintiffs.
N.J.S.A. 9:3-17 et seq., relating to adoptions, is silent as to any religious requirements of adopting parents. The only guidelines are those set forth in the Bureau of Children's Service requirements, 5.23, supra.
N.J. Const. (1947), Art. I, par. 5, provides:
No person shall be denied the enjoyment of any civil or military right, nor be discriminated against in the exercise of any civil or military right, nor be segregated in the militia or in the public schools, because of religious principles, race, color, ancestry or national origin." [Emphasis added]
Plaintiffs' right to adopt a child is subject to court approval as to whether the best interests of the child would *330 be promoted by permitting the adoption. There is no absolute right of adoption it is a privilege. Brunt v. Watkins, 233 Miss. 307, 101 So.2d 852, 855-856 (Sup. Ct.) (1958); Eggleston v. Landrum, 210 Miss. 645, 50 So.2d 364, 23 A.L.R.2d 696 (Sup. Ct. 1951).
The welfare of the child is the paramount consideration in controlling the discretion of the court. In re Jacques, 48 N.J. Super. 523, 533 (Ch. Div. 1958). This paramount consideration supercedes any right the plaintiffs have in seeking the adoption.
N.J. Const. (1947), Art. I, par. 3, in part provides:
No person shall be deprived of the inestimable privilege of worshiping Almighty God in a manner agreeable to the dictates of his own conscience; nor under any pretense whatever be compelled to attend any place of worship contrary to his faith and judgment; nor shall any person be obligated to pay tithes, taxes, or other rates for buildings or repairing any church or churches, place or places of worship, or for the maintenance of any ministers, or ministry, contrary to what he believes to be right or has deliberately voluntarily engaged to perform. [Emphasis added]
N.J.S.A. 2A:4-2 states:
It is hereby declared to be a principle governing the law of this state that children under the jurisdiction of said court are wards of the state, subject to the discipline and entitled to the protection of the state, which may intervene to safeguard them from neglect or injury and to enforce the legal obligations due to them and from them." [Emphasis added]
E is the court's ward. The court is concerned with the dictates of the child's conscience. The court has the right and duty under either the cited statute or under the doctrine of parens patriae to carry out the constitutional privileges and rights afforded to E, namely, "the inestimable privilege of worshiping Almighty God in a manner agreeable to the dictates of his own conscience."
In Torcaso v. Watkins, 367 U.S. 488, 495, 81 S.Ct. 1680, 1683-1684, 6 L.Ed.2d 982, 987 (1961), Torcaso was appointed to the office of notary public; he was refused a *331 commission to serve because he would not declare his belief in God. The Declaration of Rights of the Maryland Constitution provided that "no religious test ought ever to be required as a qualification for any office of profit or trust in this state, other than a declaration of belief in the existence of God." [Emphasis added] The court held this provision unconstitutional in that it invaded Torcaso's freedom of belief and religion. The court stated that neither a state nor the federal Constitution can constitutionally force a person
To profess a belief or disbelief in any religion * * * [nor] impose requirements which aid all religions as against non-believers and neither can aid those religions based on a belief in the existence of God as against those religions founded on different beliefs. [at 495, 81 S.Ct. at 1683]
Torcaso was of age to make his own decision as to his belief or nonbelief in God.
In the present case E is of tender years. The decision of the child to form a belief or nonbelief in a Supreme Being must await the time when it has the maturity, understanding and independent volition to do so. In Jacques, supra, the court said
* * * It is the instinct of a child to attach itself and cling to those who perform toward it the parental office, and they become endeared to it by ministering to its dependence. [48 N.J. Super. at 533]
The child should have the freedom to worship as she sees fit and not be influenced by parents or exposed to the views of prospective parents who do not believe in a Supreme Being.
The court concludes that the best interests of E will not be promoted by granting the adoption. Accordingly, plaintiffs' application to grant the adoption of Eleanor is denied.
The child is to be returned to the Children's Aid and Adoption Society for further action by it. N.J.S.A. 9:3-27(D).
|
First person account: the Messiah quest.
The article that begins below is the fifth in a series of personal accounts to be published in the Schizophrenia Bulletin. In describing his account, the author commented: "The viewpoint is solely my consciousness. The substance of every statement and the specific words in many statements actually occurred to me. Third person narrative was chosen to convey a sense of my psychological distance from the experience. This distance was essential for accomplishing growth. I have described my emotions and thoughts as exactly as possible, and in sufficient detail for the reader to follow the sequence of change in thought from and content. In spite of certain passages in the text, I had never previously felt fervently about any religion, religious figure, or telepathy, and I had never felt harassed by the Central Intelligence Agency. The experience described followed many extreme stresses--death of a parent, end of a longtime romantic relationship, and a career change. Before these events, my emotional and social adjustment had been good...." Brief comments by two clinicans who saw the author during different phases of the experience described are appended to his account. |
Reducing Risks to Women Linked to Shift Work, Long Work Hours, and Related Workplace Sleep and Fatigue Issues.
In the United States, an estimated 12% to 28% of working women are on shift work schedules, and 12% work more than 48 hours per week. Shift work and long work hours are associated with many health and safety risks, including obesity, injuries, and negative reproductive outcomes. Over time, the worker is at risk for developing a wide range of chronic diseases. These work schedules can also strain personal relationships, owing to fatigue and poor mood from sleep deprivation and reduced quality time to spend with family and friends. Worker errors from fatigue can lead to reduced quality of goods and services, negatively impacting the employer. In addition, mistakes by fatigued workers can have far-reaching negative effects on the community, ranging from medical care errors to motor vehicle crashes and industrial disasters that endanger others. To reduce the many risks that are linked to these demanding work hours, the National Institute for Occupational Safety and Health (NIOSH) conducts research, develops guidance and authoritative recommendations, and translates and disseminates scientific information to protect workers, their families, employers, and the community. The key message to reduce these risks is making sleep a priority in the employer's systems for organizing work and in the worker's personal life. The NIOSH website has freely available online training programs with suggestions for workers and their managers to help them better cope with this workplace hazard. |
One of the two SQL injection vulnerabilities affects applications running on Rails 2.0.0 to 3.2.18 that also use the PostgreSQL database system and query bit string data types. The second vulnerability affects applications running on Rails 4.0.0 to 4.1.2 when using PostgreSQL and querying range data types.
Despite affecting different versions, the two flaws are related and both allow attackers to inject arbitrary SQL code into queries using specially crafted values.
"The only feasible workaround for this issue is to not allow user controlled values to be used in queries with the affected data types," the Rails developers said in a security advisory. "Given the difficulty of ensuring this, upgrading is strongly advised."
For cases where an immediate version upgrade is not possible, the developers also released code patches that can be applied manually.
Ruby on Rails has gained popularity among developers in recent years and is already used by large sites including Hulu, Scribd, Kickstarter and GitHub. This earned the framework inclusion into the Internet Bug Bounty program sponsored by Facebook and Microsoft as "a critical piece of internet infrastructure." |
12-year-old Stephanie from Houston missed her astronaut father. She couldn’t send a message into space—until Hyundai stepped in. Using 11 Genesis cars, drivers wrote her loving message into desert sand. We sat with bated breath, waiting to see if her dad would see it! |
Connected Health Technology for Cardiovascular Disease Prevention and Management.
Advances in computing power and wireless technologies have reshaped our approach to patient monitoring. Medical grade sensors and apps that were once restricted to hospitals and specialized clinic are now widely available. Here, we review the current evidence supporting the use of connected health technologies for the prevention and management of cardiovascular disease in an effort to highlight gaps and future opportunities for innovation. Initial studies in connected health for cardiovascular disease prevention and management focused primarily on activity tracking and blood pressure monitoring but have since expanded to include a full panoply of novel sensors and pioneering smartphone apps with targeted interventions in diet, lipid management and risk assessment, smoking cessation, cardiac rehabilitation, heart failure, and arrhythmias. While outfitting patients with sensors and devices alone is infrequently a lasting solution, monitoring programs that include personalized insights based on patient-level data are more likely to lead to improved outcomes. Advances in this space have been driven by patients and researchers while healthcare systems remain slow to fully integrate and adequately adapt these new technologies into their workflows. Cardiovascular disease prevention and management continue to be key focus areas for clinicians and researchers in the connected health space. Exciting progress has been made though studies continue to suffer from small sample size and limited follow-up. Efforts that combine home patient monitoring, engagement, and personalized feedback are the most promising. Ultimately, combining patient-level ambulatory sensor data, electronic health records, and genomics using machine learning analytics will bring precision medicine closer to reality. |
Comparison of Concanavalin a-Induced Murine Autoimmune Hepatitis Models.
Autoimmune hepatitis (AIH) is a chronic necroinflammatory disease of the liver whose pathogenic mechanisms have not yet been elucidated. Moreover, the current treatment used for the vast majority of AIH patients is largely dependent on immunosuppressant administration and liver transplantation. However, research on the pathogenesis of AIH and effective new treatments for AIH have been hampered by a lack of animal models that accurately reproduce the human condition. AIH models created by concanavalin A (ConA) injections at different times and doses. The levels of ALT, AST, LDH and inflammatory cytokines were examined at various times after 20 mg/kg ConA was administered by ELISA using commercially available kits. Moreover, liver pathological changes were observed by flow cytometry (FCM) and H&E staining. Our experiments demonstrated that the levels of ALT, AST, LDH and several inflammatory cytokines, including TNF-α, IFN-γ, and IL-6, were higher in the 20 mg/kg 12 h ConA group than in the other groups. Importantly, the numbers of activated CD4+ and CD8+ T lymphocytes in the blood, spleen and liver were calculated. These results showed that ConA (20 mg/kg for 12 h)-induced hepatitis was similar to that in clinical AIH patients. Furthermore, we found that the number of MDSCs in the blood was significantly increased in the ConA (20 mg/kg for 12 h) group compared with controls. Our findings indicated that ConA (20 mg/kg for 12 h)-induced hepatitis could be used as an experimental murine model that mirrors most of the pathogenic properties of human type I AIH. This model [ConA (20 mg/kg for 12 h)] provides a valuable tool for studying AIH immunopathogenesis and rapidly assessing novel therapeutic approaches. |
That is how slain Yale University graduate student Annie Le, whose body was discovered on the day she was to be married, was remembered Wednesday night at her fiance's synagogue.
"Instead of celebrating a wedding, we are memorializing a life," said Lauren Widawsky, the younger sister of Jonathan Widawsky, the fiance of Annie Le.
In an hourlong service attended by about 300 people at Temple Beth El, clergy, friends and relatives lamented the loss of Le, 24. She and Widawsky were to be married Sept. 13 by the synagogue's cantor at a nearby catering hall on Long Island.
(AP Photo)
Annie Le Vigil Sept. 14, 2009
That's the day her body was found stuffed behind the wall in the basement of a Yale research building where she worked. Raymond Clark III, a technician who worked in the lab, has been charged with her murder. Police have said they don't know a motive for the slaying.
On Wednesday night, a large portrait of Le smiled out at the congregation, who heard stories about her academic success, sense of humor, ambition, love for shoe shopping and perhaps most importantly, her love for her fiance.
Later, Lauren fought back tears as she spoke directly to Le in the form of a letter. "We all miss you, we love you and you will be in our hearts forever."
Cantor Sandra Sherry noted Le was so looking forward to her wedding and had even made the beaded veil for the ceremony. She said the hundreds who attended the service did so "to support Jonathan, a young man who has had to experience a loss so early in his life."
The couple was to have honeymooned in Greece, she said.
Janet Widawsky recalled her future daughter-in-law cherishing the plans for her upcoming wedding, as well as her life with Jonathan, also 24. She said Le was an animal lover who once rescued a group of abandoned kittens on Long Island and took one of them back by train to her home in New Haven, Conn.
"Annie was a passionate young scientist who wanted to save the world," she said. "A life cut too short."
Le was a doctoral pharmacology student who worked on a team that experimented on mice as part of research into enzymes that could have implications for treatment of cancer, diabetes and muscular dystrophy.
Investigators returned to the campus research building in New Haven on Wednesday to examine potential new evidence, said Officer Joseph Avery, a police spokesman. Authorities do not expect to make more arrests.
A former high school girlfriend of the lab technician who has been charged said Wednesday that Clark was extremely controlling, telling her what clothes she could wear, where she could go and what friends she could have.
Delrocco said Wednesday that Clark would get very angry and "physical" with her, to the point where she was frightened. She declined to elaborate on any physical confrontations.
One of Clark's lawyers, public defender Beth Merkin, declined to comment Wednesday.
An animal lab technician at Yale since 2004, Clark cleaned floors and mouse cages. Some of Clark's co-workers have described him as rigidly enforcing the rules in the lab where research mice were caged.
Le's funeral is set for Saturday in El Dorado Hills, Calif., near her hometown of Placerville. |
Story highlights Occupy Wall Street will hold its first permitted event in New York, group says
The event is dubbed "Honor the Dead, Fight Like Hell For the Living"
Two people were shot near Occupy events in two cities
Occupy Wall Street organizers are planning a Veterans Day rally and concert featuring folksinger Joan Baez in New York City on Friday, as the movement marks its 56th day.
The Foley Square event, dubbed "Honor the Dead, Fight Like Hell for the Living," marks the first time the Occupy Wall Street movement will hold a permitted event in New York, organizers say.
Baez rose to prominence as a folksinger and songwriter in the 1960s, when she was active in protest movements backing peace and human rights.
The Occupy movement started in New York in September as a call to action against unequal wealth distribution. It has spread nationwide and beyond, with major cities continuing with protests despite clashes with the police.
Shootings occurred at Occupy encampments in California and Vermont on Thursday.
JUST WATCHED Powell: leaders must address wealth gap Replay More Videos ... MUST WATCH Powell: leaders must address wealth gap 04:30
JUST WATCHED Riot police vs. Occupy protesters Replay More Videos ... MUST WATCH Riot police vs. Occupy protesters 01:12
JUST WATCHED Safety concerns at Occupy Wall Street Replay More Videos ... MUST WATCH Safety concerns at Occupy Wall Street 02:00
A man was shot and killed in downtown Oakland, where Occupy protesters have been camping for a month, CNN affiliate KTVU reported. The shooting stemmed from an argument near the encampment, police said.
"Tonight's incident underscores the reason why the encampment must end. The risks are too great," Oakland Mayor Jean Quan told the affiliate.
A man was shot and killed Thursday night at an Occupy tent city in Burlington, Vermont, police said.
Witnesses told CNN affiliate WCAX that the man shot himself. Police did not release detailed information on the shooting. |
The Bali Tourism industry is in a crisis state due
to travel advisories which have been issued by a number of countries indicating
that Bali is an unsafe tourism destination. Australia and the United
Kingdom have not imposed travelk bans on Bali. Holland, Switzerland,
Germany and Austraia have lifted their bans. Other major markets, such
as the United States and Japan, have left their bans in for Bali. These
advisories have caused great suffering to the people of Bali and when
viewed from the standpoint of the high state of public order on the island,
are extremely unfair.
In order to address this situation BALI PROMO's Mr.
Luther Barrung has prepared a petition to the President of the United
States, Mr. Bill Clinton, asking his attention in order that the negative
advisory to American's wishing to visit Bali can be withdrawn as soon
as possible.
The subject petition, has the following plea which
we quote in its entirety here:
QUOTE
A PETITION TO THE PRESIDENT OF THE UNITED STATES
OF AMERICA FROM THE PEOPLE OF BALI, INDONESIA
Dear Mr. Clinton:
Your Government has imposed a travel ban on all of
Indonesia, including the island of Bali, declaring our island as unsafe
for visitors from your Country. This has been done despite the fact that
in keeping with the peaceful traditions of Bali-Hindu Culture, our island
has remained free of violent demonstrations and continues to be a safe
holiday destination, even for the citizens who visited us during the social
upheavals in far-away Jakarta several weeks ago.
It is our firm opinion that there exists no practical
or moral basis for the continuance of the travel ban on Bali from your
Government that is causing untold suffering on the more than two million
local people who derive their livliehoods from tourism. Furthermore, the
United States as the world-champion of human rights, has an absolute responsibility
to acknowledge that visitors to the island of Bali are safe from any personal
threat to their security and must, as a result, immediately lift its negative
travel advisory for Bali.
END QUOTE
The above petition is being circulated in English
and Indonesian format by BALI PROMO and is available via facsimile by
making a telephone request to Pak Agung at the Regional Office of Tourism
in Denpasar at 0361 - 225649 or 233474 or Ms. Tusi at 0361 - 286283.
To our readers in Bali, if you have not received
a copy of the petition already, call the above numbers now so one can
be faxed immediately. You are asked to photocopy the form and circulate
the petition to your staffs, guests and banjars and return it to Bali
Promo care of the Department of Tourism on Jalan Raya Puputan before 1700
hours on Wednesday.
The completed petitions will be officially forwarded
to the American Ambassador in Jakarta. |
39687 Round Robin Way
Bethany Beach,
DE
19930
Share this Property!
Description
Escape, relax and unwind on your very own private waterfront deck with amazing pond views. Enjoy the beauty of the swans from from this Bright two bedroom two bath END home conveniently located to all of Sea Colony's amenities. Walking distance to tennis and pools as well as a short stroll to Sea Colony's private 1/2 mile pristine beach. Many improvements throughout this home are included such as an updated HVAC system, pergo flooring throughout, updated kitchen and baths, new blinds, ceiling fans and much more. What a great value for a meticulous home within three blocks of the beach. Great rental investment!
Details
County:Sussex
Community:Sea Colony West
Building:Sea Colony West Vi
Waterfront:Lake/Pond
Waterview:Lake/pond
School District:Indian River
Floors:1
Furnished:Yes
County Tax:$917
Condo Fee:$4,536
HOA Fee:$2,424
Sewer Fee:$286
Description
Escape, relax and unwind on your very own private waterfront deck with amazing pond views. Enjoy the beauty of the swans from from this Bright two bedroom two bath END home conveniently located to all of Sea Colony's amenities. Walking distance to tennis and pools as well as a short stroll to Sea Colony's private 1/2 mile pristine beach. Many improvements throughout this home are included such as an updated HVAC system, pergo flooring throughout, updated kitchen and baths, new blinds, ceiling fans and much more. What a great value for a meticulous home within three blocks of the beach. Great rental investment!
Details
County:Sussex
Community:Sea Colony West
Building:Sea Colony West Vi
Waterfront:Lake/Pond
Waterview:Lake/pond
School District:Indian River
Floors:1
Furnished:Yes
County Tax:$917
Condo Fee:$4,536
HOA Fee:$2,424
Sewer Fee:$286
FREE home evaluation
How Much Is Your Home Worth in Today's Real Estate Market?
FOR SUSSEX COUNTY, DELAWARE PROPERTIES:
Some of the active listings appearing on this site may be listed by other brokers participating in IDX. The information provided by this website is for the personal, non-commercial use of consumers.
Based on information from the Sussex County Association of Realtors. Active listings are updated daily. Last update: ( 05/24/18 05:27:32 am ). Information is deemed reliable but not guaranteed. |
Distributed multi-static active acoustic networks are useful for detecting various underwater objects (targets). Such networks provide the capability to detect, localize, and track targets through the expanded geometric diversity of a distributed field of sources and receivers. However, given the variabilities in acoustic environmental conditions, sensor performance and target behavior, such networks cannot exploit their full potential without management and control methods. Accordingly, it is desirable to provide a control optimization method that may be applied to the ping scheduling task of a multi-static active acoustic network to obtain improved detection, localization and tracking performance. |
Hydrated alkali metal silicates are known fire-proofing materials and are extensively employed in building construction. Under the high temperatures existing during a fire, the water of hydration is driven off causing the composition to puff, expanding by up to 25 to 40 times its original volume. Thus, when combined with fire-stop materials these materials intumesce to provide a layer of insulation against fire and smoke, said layer being full of bubbles and holes from the expansion of the water of hydration. The foaming pressure helps to seal apertures and passages in building structures making these fireproofing materials useful in fire-stops, see U.S. Pat. No. 4,364,210.
Alkali metal silicates can also be incorporated into proofing materials such as asphalt shingles in order to convert these shingles into a fire retardant Class A or B form. Alkali metal silicate particles may be placed in an asphalt layer in between the top layer of asphalt and roofing granules and the substrate of organic felt or fiberglass mat. In the event of a fire on a roof, the intumescent silicate particles expand to form a thermal barrier which retards ignition of the roofing deck.
The formation of alkali metal silicate gels by the addition of such materials as sodium aluminate or boric acid solutions to alkali metal silicates at elevated temperatures is known (see U.S. Pat. No. 4,297,252, Example 3, and U.S. Pat. No. 3,498,807, column 3, lines 42-56).
It is also known that the production of a solid, hydrated alkali metal silicate in which the moisture content is controlled can require carefully controlled drying conditions (see U.S. Pat. No. 3,895,995). Typically, alkali metal silicate suspensions or gels described in the literature are dried or cured at temperatures ranging from 90.degree. to 136.degree. C. and below the boiling point of the suspension or solution.
One difficulty with silicate based materials is their degradation on exposure to water or high relative humidity for extended periods of time. Water is known to leach away the alkali metal oxide from the silicate particles, reducing their ability to intumesce. Various solutions to this problem have been proposed in the past, including a coating which covers alkali metal silicate particles (see U.S. Pat. No. 4,218,502).
it is the object of this invention to provide an alkali metal silicate material which retains its intumescence after long exposure to water in order to ensure that its effectiveness as a fire protection agent will last a long time under outdoor weathering conditions. |
Joel Embiid #21 of the Philadelphia 76ers looks on against the Orlando Magic at Wells Fargo Center (Photo by Mitchell Leff/Getty Images)
BOSTON – Celtics president of basketball operations Danny Ainge has a track record of taking gambles on players with injury risks on draft night. He selected Avery Bradley at No. 19 in 2010 and Jared Sullinger at No. 21 in 2012, despite physical red flags that caused them to slip into the second half of the first round.
Taking flyers on talented players drafted after the lottery is understandable, but Ainge was looking to take a bigger gamble back during the 2014 NBA Draft, according to a new report from Bill Simmons of the Ringer. In the latest edition of his Bill Simmons Podcast, Simmons declared that Ainge was trying to move up to No. 3 overall to select center Joel Embiid, despite the fact he had just undergone surgery for a foot fracture.
“You knew how talented [Embiid] was because he still went third,” Simmons said. “The Celtics were trying to trade [for him]. They had the sixth pick that year, which ended up being Marcus Smart. They were trying to trade the sixth pick and the Brooklyn pick (17th overall) to move to three to take Embiid, even though he was hurt.”
Ainge did not address any trade rumors specifically on draft night, but he confirmed to Toucher and Rich in 2014 that the Celtics would have taken Joel Embiid at No 6, if he had fallen to them.
“Yes, we would have,” Ainge said in June 2014. “He was not red-flagged, meaning ‘Stay away at all costs.’ He was rated a little bit less than (he would have been) with (his injury) risk, but he was a guy that we were looking at, had he fallen.”
The Philadelphia 76ers ultimately turned down Ainge’s reported overtures and took the 7-foot-2 center at No. 3 overall on draft night. Embiid missed his first two pro seasons due to recurring foot issues, but has had an impressive start to his Sixers career last week, averaging 17.3 points and six rebounds in just 21 minutes per game.
That kind of production is making Sixers fans believe he was worth the two-year wait for his season debut. The Celtics won’t be able to get their hands on Embiid anytime soon, but Ainge can rest better knowing his instincts on the 22-year-old big man were spot on.
Brian Robb covers the Celtics for CBS Boston and contributes to NBA.com, among other media outlets. You can follow him on Twitter @CelticsHub. |
SIXTY-EIGHT years of history were wiped out on Friday when the European Commission issued its decision about Cyprus Airways. As had been widely expected, the Commission deemed that part of the funds in excess of €100 million paid to the airline by the state in the form of assistance and through the issue of new capital was in fact a subsidy – €66 million of it had to be paid back. Unable to do so, there was only one choice left to the company – closing down.
Although older than the Cyprus Republic, the national carrier had become a symbol and flagship of the new state when the former was established. Its main shareholder was BEA (British European Airlines), but on independence the Republic took control of the majority stake. By 1991, when British Airways gave up its shares, the state controlled 80 per cent of the shareholding with the rest distributed among individuals. Despite the foreign participation, the national carrier had been run by successive governments and their placemen ever since independence, which is why it has closed down.
In fact the company has followed a very similar path to the state on its way to bankruptcy. It was subject to self-serving decisions by board members, incompetently run by unqualified party-men and sucked dry by the unions with the blessing of the politicians who had turned it into a dumping ground for unemployable party members; there was a time, not too many years ago, when it employed in excess of 2,000 staff on wages and benefits that profitable airlines did not pay. Its payroll, like the state’s, was unsustainable but even after the airline was bailed out by the taxpayer the wage cuts were too small, while the overpaid pilots took the company to court for cutting their princely salaries and won.
There was no troika to impose the painful cuts that could have increased the chances of survival when the airline was bailed out by the taxpayer in 2012. The Christofias government’s action plan at the time included pay rises for the lowest paid of the airline’s workers! By then, it may have already been too late to save the airline after so many years of mismanagement and waste. Tens of millions were lost on ill-advised aircraft purchases, like the Airbus 330, the setting up of Hellas Jet and operation of Eurocypria, not to mention the regular early retirement schemes with ultra-generous compensation packages.
It could not have been any other way at a company that was run by politicians and unions. Business principles were anathema to them as the former tried to maximise votes (and invisible benefits) and the latter the income of their pampered members who were accustomed to wages that were the envy of the rest of working population. The benefits they squeezed out of the company over the years were absurd, but the politicians never said ‘no’ to them. One chairman agreed to annual pay rises of four per cent when the airline was recording millions in annual losses.
And now, the 550 workers that were still employed by the company will join the ranks of the jobless. Some were protesting outside the company HQ on Friday night claiming that the government wanted the company to close down. The truth was that the company was beyond saving. The European Commissioner for Competition said in a statement on Friday: “Cyprus Airways has received large quantities of public money since 2007 but was unable to restructure and become viable without continued state support… injecting additional public money would only have prolonged the struggle without achieving a turn-around.”
Cyprus Airways was doomed because it was never run like a business and the main reason of its existence was to serve the interests of the political party establishment, its directors and its underworked, overpaid employees. Never in its history was there an ethos of customer service or a policy of building customer loyalty, because the paying passengers were always an afterthought. How could it have survived after the introduction of the open skies and the arrival of competition when it could no longer use its monopolistic power to charge high fares and offer poor service.
It never adapted to the competitive environment it found itself in after 2004. The workers were not willing to give up their ‘conquests’, the politicians were happy to carry on wasting the taxpayer’s money so as not to anger the unions and successive boards did nothing, obeying the orders of the government. Such reckless irresponsibility and incompetence could only have ended in bankruptcy.
|
Wholesale Jerseys From China
In addition, to this great benefit, yoga is a fun form of exercise that gives a surprisingly intense workout. But more important, she is the champion of an LPGA major.Interior Design is a fast growing area,lots of North Americans really like their properties andquite a fewhave enough money to invest to modernize to the styles they really want. A straightforward answer in addition with regard to outside heat requirements can be a glowing t shirt heaters.<p><p>As a collection, these memories are an essential attribute of a society, that is definitely, its very own mythology. As with the latest and geeky technology people are more conscious about their lifestyle and modernity. You can do such exercise at your home such as meditation, Cheap NCAA Jerseys , press ups squats and many more. Smoking causes “dry mouth”Smoking impedes the healthy production of saliva in the mouth. This morning I had to get up at 6:30 to go to the bathroom and we weren t getting up until 7:15 and dad patted me on the back when I got back in the room, Lincicome said. Wholesale MLB Jerseys . Gum infections and disease, which are linked closely with tobaccouse, also cause bad breath. 3) Do Exercise :By eating nasty food you get obese or overweight, You eat and sleep, in that process, you get more calories with high fat, to burn those clumsy fat you have to exercise every day. Wholesale Jerseys . They sang country music songs between shots.
Visit my site��http://www.cheapnfljerseysonlineshop.com/ |
At first, thank you very much for providing that invaluable software! We are using it since some days now and are still excited about it. However, we have encountered a weird problem.
The version we use is: FreeCommander XE 2017 Build 740 32-bit public
Our O/S is: Windows 7 Pro x64 English, all patches applied (as per the time of this writing)
The problem:
FC spans multiple Fccontextmenu64 processes. When saying multiple, I am meaning several dozens in the course of a normal working day. These are visible in the systray as well as in the task manager, i.e. they are not just symbols which haven't gone from the systray due to a bug in the graphics driver or such things, but are real processes consuming CPU and memory. Of course, this is a show stopper which would keep us from further using FC if it can't be fixed.
Possible cause for the problem:
We are using FC in a very unusual way. At my workstation, I am using a user account which has administrative privileges (i.e. it belongs to the local "Administrators" group), but which is not the Administrator account itself. I am running one instance of FC normally (i.e. as the normal user of that account), and I am running one additional instance which has been started as Administrator.
In other words: I am starting one instance of FC by double-clicking on its icon (this instance is then running with my normal user privileges), and then I am starting a second instance of FC by running the following command:
We are excited that you did take care of our problem although our working method which is probably the root of the evil is quite exotic.
As an information for you (which might be interesting because probably only a few people have tried it):
The method I have described in my first post works like a charm (besides the Fccontext problem). We have configured the "normal" FC instance to show a white background in the files and folders list, and the "Administrator" instance to show a yellow (or even red) background. Thus, everybody is warned immediately if using the "Administrator" instance.
We are using this to manage files on the server. The "normal" instance (i.e. the normal user) may add files and folders to the server, but is forbidden to change or delete them. The "Administrator" instance (running as Administrator) may also change or delete files on the server (which is necessary only in rare cases). For daily work, the "normal" instance is used. The "Administrator" instance is used only for the special cases. That way, the likelihood that somebody accidentally deletes or changes files on the server is greatly reduced, and ransomware running as the normal user has no chance to alter files on the server; it would have to abuse ("hack") runas.exe or FC to get the administrative privileges on the server to be able to change or delete files there.
The best thing is that you obviously have developed FC in a very clean way, consequently storing the options for each user separately. We have tested this multiple times. The options for the "Administrator" instance and the "normal" instance can be set independently which made the different background colors possible. This is ingenious!
What you need is to use different process for FcContextMenu64.Exe.
In FreeCommander XE 2018 Build 770 you can
- add the following line to the [Form] section of the freecommander.ini
FcContextMenu64Exe=FcContextMenu64adm.exe
Additionally you must create a copy of the file FcContextMenu64.exe with the name FcContextMenu64adm.exe
Make the changes for admin call.
The new version (FreeCommander XE 2018 Build 770 32 bit) did not solve the problem. It changed the behavior, but introduced a new bug. After having installed the new version, and after having followed the additional steps you mentioned very carefully (change the INI file and make a copy of FcContextMenu64.exe), the following is happening now:
As a starting point, I am closing all FC instances and all FcContextMenu64 instances by closing the respective Windows and tray icons and by checking in the task manager that all instances are closed.
Then I am starting the normal instance of FC and the admin instance of FC (the one with the manipulated INI file); I am just starting them and doing no further actions at this point.
From then on, the behavior is weird:
- If I first activate the context menu in the normal instance, one tray icon and one FcContextMenu64 process appears. Again activating the context menu in the normal instance does not make additional icons or processes appear. But when I then try to activate the context menu in the admin instance, this is not possible; the right click is just ignored, no FcContextMenu64adm process appears, and no additional tray icon appears.
In summary, this makes the normal instance usable, but makes the admin instance unusable (because the context menu cannot be used there).
- If I instead first activate the context menu in the admin instance, one FcContextMenu64adm process and one tray icon appears. Again activating the context menu in the admin instance does not make additional icons or processes appear. But now, each time when I activate the context menu in the normal instance, an additional FcContextMenu64 process appears, as well as an additional tray icon. In other words, when having right-clicked five times in the normal instance, I am having five FcContextMenu64 processes and 5 additional icons.
Furthermore, activating the context menu in the admin instance works unreliably (more often fails then works) after having activated the context menu at least one time in the normal instance.
In summary, this makes both instances unusable. The context menu won't show up when right-clicking the admin instance in most cases, and right-clicking in the normal instance will produce a new FcContextMenu64 process and tray icon each time.
I am understanding that this might be difficult to debug. I am not sure if I have expressed myself clearly enough in my initial post. I am not running the admin instance by choosing "Run as Administrator" from the context menu, but by using "runas /user:Administrator ...". This is a big difference.
I am offering to share my desktop with you (preferably using Teamviewer) so that you can exactly see what is happening. If you are interested in debugging the problem that way, please send me a personal message so we can arrange the details.
thanks for your fast reply, and please forgive me that I couldn't do the test yesterday.
The new version of FcContextMenu64 indeed did solve the problem.
I have copied the new version into the program folder, again did copy / rename it as per your instructions, and changed the .ini file for the admin instance as you proposed.
Now, if using the two instances (normal and admin), there are two fccontextmenu64 processes as soon as I have activated the context menu in each instance at least one time (as expected, the task manager shows that one of them belongs to Administrator and one belongs to my normal account), and there are two tray icons. Regardless of how often I activate the context menu in the two instances, and regardless of the order when doing this, and regardless of which instance is started first, no additional processes / tray icons are created. This is exactly how it should be.
I did not notice other problems with the new version of Fccontextmenu64 (but have it used heavily for only an hour so far). However, I think there will be no additional problems. Once again, THANK YOU!
By the way, I personally won't be hurt if FC does not terminate the Fccontextmenu64 process when being closed Actually, I think this shouldn't be a problem for anybody.
Do you plan to include the new version of FcContextMenu64 in the normal download package? |
<?php
/**
* Zend Framework
*
* LICENSE
*
* This source file is subject to the new BSD license that is bundled
* with this package in the file LICENSE.txt.
* It is also available through the world-wide-web at this URL:
* http://framework.zend.com/license/new-bsd
* If you did not receive a copy of the license and are unable to
* obtain it through the world-wide-web, please send an email
* to license@zend.com so we can send you a copy immediately.
*
* @category Zend
* @package Zend_View
* @copyright Copyright (c) 2005-2015 Zend Technologies USA Inc. (http://www.zend.com)
* @license http://framework.zend.com/license/new-bsd New BSD License
* @version $Id$
*/
/**
* Abstract master class for extension.
*/
/**
* Concrete class for handling view scripts.
*
* @category Zend
* @package Zend_View
* @copyright Copyright (c) 2005-2015 Zend Technologies USA Inc. (http://www.zend.com)
* @license http://framework.zend.com/license/new-bsd New BSD License
*
* Convenience methods for build in helpers (@see __call):
*
* @method string baseUrl($file = null)
* @method string currency($value = null, $currency = null)
* @method Zend_View_Helper_Cycle cycle(array $data = array(), $name = Zend_View_Helper_Cycle::DEFAULT_NAME)
* @method Zend_View_Helper_Doctype doctype($doctype = null)
* @method string fieldset($name, $content, $attribs = null)
* @method string form($name, $attribs = null, $content = false)
* @method string formButton($name, $value = null, $attribs = null)
* @method string formCheckbox($name, $value = null, $attribs = null, array $checkedOptions = null)
* @method string formErrors($errors, array $options = null)
* @method string formFile($name, $attribs = null)
* @method string formHidden($name, $value = null, array $attribs = null)
* @method string formImage($name, $value = null, $attribs = null)
* @method string formLabel($name, $value = null, array $attribs = null)
* @method string formMultiCheckbox($name, $value = null, $attribs = null, $options = null, $listsep = "<br />\n")
* @method string formNote($name, $value = null)
* @method string formPassword($name, $value = null, $attribs = null)
* @method string formRadio($name, $value = null, $attribs = null, $options = null, $listsep = "<br />\n")
* @method string formReset($name = '', $value = 'Reset', $attribs = null)
* @method string formSelect($name, $value = null, $attribs = null, $options = null, $listsep = "<br />\n")
* @method string formSubmit($name, $value = null, $attribs = null)
* @method string formText($name, $value = null, $attribs = null)
* @method string formTextarea($name, $value = null, $attribs = null)
* @method Zend_View_Helper_Gravatar gravatar($email = "", $options = array(), $attribs = array())
* @method Zend_View_Helper_HeadLink headLink(array $attributes = null, $placement = Zend_View_Helper_Placeholder_Container_Abstract::APPEND)
* @method Zend_View_Helper_HeadMeta headMeta($content = null, $keyValue = null, $keyType = 'name', $modifiers = array(), $placement = Zend_View_Helper_Placeholder_Container_Abstract::APPEND)
* @method Zend_View_Helper_HeadScript headScript($mode = Zend_View_Helper_HeadScript::FILE, $spec = null, $placement = 'APPEND', array $attrs = array(), $type = 'text/javascript')
* @method Zend_View_Helper_HeadStyle headStyle($content = null, $placement = 'APPEND', $attributes = array())
* @method Zend_View_Helper_HeadTitle headTitle($title = null, $setType = null)
* @method string htmlFlash($data, array $attribs = array(), array $params = array(), $content = null)
* @method string htmlList(array $items, $ordered = false, $attribs = false, $escape = true)
* @method string htmlObject($data, $type, array $attribs = array(), array $params = array(), $content = null)
* @method string htmlPage($data, array $attribs = array(), array $params = array(), $content = null)
* @method string htmlQuicktime($data, array $attribs = array(), array $params = array(), $content = null)
* @method Zend_View_Helper_InlineScript inlineScript($mode = Zend_View_Helper_HeadScript::FILE, $spec = null, $placement = 'APPEND', array $attrs = array(), $type = 'text/javascript')
* @method string|void json($data, $keepLayouts = false, $encodeData = true)
* @method Zend_View_Helper_Layout layout()
* @method Zend_View_Helper_Navigation navigation(Zend_Navigation_Container $container = null)
* @method string paginationControl(Zend_Paginator $paginator = null, $scrollingStyle = null, $partial = null, $params = null)
* @method string partial($name = null, $module = null, $model = null)
* @method string partialLoop($name = null, $module = null, $model = null)
* @method Zend_View_Helper_Placeholder_Container_Abstract placeholder($name)
* @method void renderToPlaceholder($script, $placeholder)
* @method string serverUrl($requestUri = null)
* @method string translate($messageid = null)
* @method string url(array $urlOptions = array(), $name = null, $reset = false, $encode = true)
* @method Zend_Http_UserAgent userAgent(Zend_Http_UserAgent $userAgent = null)
*/
class Zend_View extends Zend_View_Abstract
{
/**
* Whether or not to use streams to mimic short tags
* @var bool
*/
private $_useViewStream = false;
/**
* Whether or not to use stream wrapper if short_open_tag is false
* @var bool
*/
private $_useStreamWrapper = false;
/**
* Constructor
*
* Register Zend_View_Stream stream wrapper if short tags are disabled.
*
* @param array $config
* @return void
*/
public function __construct($config = array())
{
$this->_useViewStream = (bool) ini_get('short_open_tag') ? false : true;
if ($this->_useViewStream) {
if (!in_array('zend.view', stream_get_wrappers())) {
stream_wrapper_register('zend.view', 'Zend_View_Stream');
}
}
if (array_key_exists('useStreamWrapper', $config)) {
$this->setUseStreamWrapper($config['useStreamWrapper']);
}
parent::__construct($config);
}
/**
* Set flag indicating if stream wrapper should be used if short_open_tag is off
*
* @param bool $flag
* @return Zend_View
*/
public function setUseStreamWrapper($flag)
{
$this->_useStreamWrapper = (bool) $flag;
return $this;
}
/**
* Should the stream wrapper be used if short_open_tag is off?
*
* @return bool
*/
public function useStreamWrapper()
{
return $this->_useStreamWrapper;
}
/**
* Includes the view script in a scope with only public $this variables.
*
* @param string The view script to execute.
*/
protected function _run()
{
if ($this->_useViewStream && $this->useStreamWrapper()) {
include 'zend.view://' . func_get_arg(0);
} else {
include func_get_arg(0);
}
}
}
|
RandInt: For all your application random number needs... - gacba
http://randint.com
======
gdl
Awesome. I've been a longtime random.org user but have always complained about
the lack of a Comic Sans interface. It seems my prayers have finally been
answered:
<http://randint.com/labs/comicsans.php>
(My first Comic Sans number was 17 - it even _feels_ more random than the
competition!)
~~~
acqq
Also useful:
<http://dilbert.com/strips/comic/2001-10-25/>
~~~
gdl
Of course those digits are random, they're straight out of pi!
<http://en.wikipedia.org/wiki/Feynman_point>
------
deutronium
Does anyone know how these are generated?
Could anyone explain what this paragraph means from their FAQ:
"Since 1992 at least 24 companies have set out to solve the random integer
problem. Most fail for obvious reasons. It is rumored that a few of our
competitors may have a 1-5 algo that works approximately 40% of the time. Our
1-100 algo is rock solid. In short, there is a consumer need for a random
integer but the problem isn't easy. Even Google is rumored to be 2 years away
from a reliable 1-50 algo."
I'm probably being stupid but I don't understand what 'works approximately 40%
of the time' means in this respect.
Also this is cool : <https://www.fourmilab.ch/hotbits/secure_generate.html>
~~~
ggchappell
> Could anyone explain what this paragraph means from their FAQ:
I think that's a joke.
~~~
deutronium
Heh, I didn't even think about that. Doh. And also the 'fabled' '1-50' alg.
they mention would easily be got using modulo.
------
adammichaelc
And sometimes it takes a break... <http://i55.tinypic.com/1zr2743.png>
~~~
adammichaelc
I guess nobody else took the time to keep refreshing the page to see the
lolcat.
------
dholowiski
Cool, but I think your API is too complicated ;)
------
r11t
A command line version:
_curl -silent randint.com | grep " </h1>" | sed 's/\<\/h1\>//'_
------
hugh3
I got 88 on my first try. That's not very random at all.
Seriously though, are these true random or pseudorandom? There's nothing to
say how they're generated. I personally want a true quantum random number
generator, so that I can use it to make decisions and be guaranteed that an
alternate-universe counterpart of myself made the opposite decision. That way
at least one of me is going to be right.
------
dmn001
<http://www.random.org/>
------
ronnoch
Cool. Would be even cooler if you could specify a range.
------
aston
No JSONP?
~~~
Duilen
JSONP coming soon!
-randint co-founder
~~~
bobds
Can we also get HTTPS?
|
package eu.kanade.tachiyomi.extension.ko.navercomic
import android.annotation.SuppressLint
import eu.kanade.tachiyomi.network.GET
import eu.kanade.tachiyomi.source.model.SChapter
import eu.kanade.tachiyomi.source.model.SManga
import eu.kanade.tachiyomi.util.asJsoup
import okhttp3.Response
import org.jsoup.nodes.Element
import java.text.SimpleDateFormat
import java.util.Calendar
import java.util.Locale
class NaverWebtoon : NaverComicBase("webtoon") {
override val name = "Naver Webtoon"
override fun popularMangaRequest(page: Int) = GET("$baseUrl/$mType/weekday.nhn")
override fun popularMangaSelector() = ".list_area.daily_all .col ul > li"
override fun popularMangaNextPageSelector() = null
override fun popularMangaFromElement(element: Element): SManga {
val thumb = element.select("div.thumb img").first().attr("src")
val title = element.select("a.title").first()
val manga = SManga.create()
manga.url = title.attr("href").substringBefore("&week")
manga.title = title.text().trim()
manga.thumbnail_url = thumb
return manga
}
override fun latestUpdatesRequest(page: Int) = GET("$baseUrl/$mType/weekday.nhn?order=Update")
override fun latestUpdatesSelector() = ".list_area.daily_all .col.col_selected ul > li"
override fun latestUpdatesNextPageSelector() = null
override fun latestUpdatesFromElement(element: Element) = popularMangaFromElement(element)
}
class NaverBestChallenge : NaverComicChallengeBase("bestChallenge") {
override val name = "Naver Webtoon Best Challenge"
override fun popularMangaRequest(page: Int) = GET("$baseUrl/genre/$mType.nhn?m=main&order=StarScore")
override fun latestUpdatesRequest(page: Int) = GET("$baseUrl/genre/$mType.nhn?m=main&order=Update")
}
class NaverChallenge : NaverComicChallengeBase("challenge") {
override val name = "Naver Webtoon Challenge"
override fun popularMangaRequest(page: Int) = GET("$baseUrl/genre/$mType.nhn")
override fun latestUpdatesRequest(page: Int) = GET("$baseUrl/genre/$mType.nhn?m=list&order=Update")
// Chapter list is paginated, but there are no mobile pages to work with
override fun chapterListRequest(manga: SManga) = GET("$baseUrl${manga.url}", headers)
override fun chapterListSelector() = "tbody tr:not([class])"
override fun chapterListParse(response: Response): List<SChapter> {
var document = response.asJsoup()
val chapters = mutableListOf<SChapter>()
document.select(chapterListSelector()).map { chapters.add(chapterFromElement(it)) }
while (document.select(paginationNextPageSelector).hasText()) {
document.select(paginationNextPageSelector).let {
document = client.newCall(GET(it.attr("abs:href"))).execute().asJsoup()
document.select(chapterListSelector()).map { element -> chapters.add(chapterFromElement(element)) }
}
}
return chapters
}
override val paginationNextPageSelector = "div.paginate a.next"
override fun chapterFromElement(element: Element): SChapter {
val chapter = SChapter.create()
element.select("td + td a").let {
val rawName = it.text()
chapter.url = it.attr("href")
chapter.chapter_number = parseChapterNumber(rawName)
chapter.name = rawName
chapter.date_upload = parseChapterDate(element.select("td.num").text().trim())
}
return chapter
}
@SuppressLint("SimpleDateFormat")
private fun parseChapterDate(date: String): Long {
return if (date.contains(":")) {
Calendar.getInstance().timeInMillis
} else {
return try {
SimpleDateFormat("yyyy.MM.dd", Locale.KOREA).parse(date)?.time ?: 0L
} catch (e: Exception) {
e.printStackTrace()
0
}
}
}
}
|
Have you tried every diet under the sun, and still wish you could lose the weight?
Does it feel like caffeine and sugar rule your life, where you can't function without either (or both)?
Are you a slave to your scale, constantly checking the number and then beating yourself up for gaining or not losing enough?
Do you go out to eat with friends and feel uncomfortable around food, eyeing everyone else's plates and obsessing about how much is "too much" to eat, and whether you're eating faster than others?
Even through all the juice cleanses, 30-day food challenges, weight loss programs, gym packages, and fad diets, you know deep down there has to be an easier way. You're done with the struggle. You're sick and tired of feeling sick and tired. You're ready to get off the never-ending hamster wheel.
Consider this your very own invitation to start a new path. One where you will learn how to listen to your body's deepest needs. Where you will begin to not only see the blocks that are keeping you from the healthiest life you want to live, but also bust those blocks down and begin transforming how you live your life. Introducing:
FOOD Coaching
Where we'll transform your world to live your healthiest life possible. We'll explore your relationship to food, your body, and all the areas of your life that are important to you. The focus will shift from overwhelm to joy, from chaos to serenity, and from forceful obsession to absolute freedom. You will learn how to use food as medicine and as a pathway to connect to the juiciest parts of your life. You will come home to yourself.
Curious how food coaching works?
Your sessions are all about you. You choose how long we work together -- either a 90-Minute Deep Dive session, or 1 Month of Food Coaching. Each call will shine light on your biggest road blocks, and leave you with actionable next steps for healing that area of your life.
While our sessions will be nothing short of eye-opening, the real transformation happens outside our calls when you get to practice your healthiest life in action. I've got your back 24/7 -- whether by email, phone call, or text, I will provide that extra support you need whenever you need it.
When I find something I love, I share it with my people. Coaching with me means I'll be sharing books, and other materials to help guide you along your journey. Just a little something extra to make your transformation all the more delicious.
You choose how long we work together:
OR
This one-time 90-minute deep dive phone session will give you the laser coaching you need to get you back on track and kick-start your health journey. We'll identify key areas that make the biggest impact on your vitality, and break through your biggest road blocks to getting you to your healthiest self.
These 4 one-hour phone sessions will span over the course of 1 month. We'll dive deeper into your biggest health hurdles and what's holding you back from your dream life. You'll be left with real-life, easy-to-implement strategies to living your delicious life to the fullest.
Do you feel deep down that food coaching is for you?
Or do you have some questions about working together?
Schedule a FREE session with me now and I'll answer all your questions. I can't wait to connect with you LIVE, my dear! |
1. Let j(c) = -c. Give n(j(r)).
5*r
Let u(y) = -20*y. Let l(v) = -21*v**2. Calculate l(u(j)).
-8400*j**2
Let y(v) = 2*v + 2 + 0 - 2. Let l = -27 - -58. Let u(w) = 31 + 3*w - l. Determine u(y(n)).
6*n
Let n(m) = -m**2. Let u(x) be the first derivative of -2 + 0*x + 1/2*x**2. What is n(u(c))?
-c**2
Let r(b) = 71 - 7*b**2 - 71. Let s(c) = -2*c**2 + 5*c**2 + 0*c**2. Give s(r(t)).
147*t**4
Suppose -3*q + 3 + 6 = 0. Let v(p) = q*p**2 + p**2 - 2*p**2. Let s(r) be the first derivative of 2*r**3/3 + 2. Determine v(s(x)).
8*x**4
Let r(t) = -11*t. Let u(k) = -4*k. Let m(j) = -j. Let p(w) = -22*m(w) + 6*u(w). Give p(r(a)).
22*a
Let g(k) be the third derivative of -k**5/30 + 36*k**2 - 2. Let h(n) = 8*n. Give h(g(j)).
-16*j**2
Let s(g) = -3042*g. Let o(y) = 4*y. Give s(o(b)).
-12168*b
Let i(p) = -2*p. Let f(t) be the first derivative of 2*t**3/3 - 2. Determine i(f(j)).
-4*j**2
Let n = 75 - 72. Let z(v) be the third derivative of 0*v**4 + v**2 - 1/30*v**5 + 0*v**n + 0*v + 0. Let t(f) = -7*f**2. Calculate z(t(g)).
-98*g**4
Let p(i) = 3*i. Let b(n) = n**2 + 2*n. Let s(y) = 3*b(y) - 2*p(y). Let v(r) = r**2 - 5*r. Let a(z) = 2*z**2 - 8*z. Let d(c) = -5*a(c) + 8*v(c). Give s(d(u)).
12*u**4
Let m(c) = -93 - 5*c**2 + 46 + 47. Let u(w) = 11*w. Determine m(u(v)).
-605*v**2
Let i(z) = -3*z - 2. Let r(u) = 4*u + 3. Suppose -o = o + 6. Let l(h) = o*i(h) - 2*r(h). Let j(k) = -4*k**2. Calculate j(l(v)).
-4*v**2
Let t(y) = -3*y**2. Let r(p) = 358*p. Determine r(t(z)).
-1074*z**2
Let k(b) = -12 - 4*b**2 + 2*b**2 + 45 - 7. Let f(p) = 2*p. Determine f(k(i)).
-4*i**2 + 52
Let k(w) = w. Let h(p) = -20*p**2 - 2. Calculate k(h(o)).
-20*o**2 - 2
Let f(u) be the third derivative of u**7/2520 + u**5/60 - 3*u**2. Let a(k) be the third derivative of f(k). Let r(y) = -3*y. Determine a(r(l)).
-6*l
Let m(d) = -12*d. Let a(v) = -7*v**2 + 6*v. Suppose -5*p + g + 26 = -55, p + 5*g = 37. Let l(h) = 20*h**2 - 17*h. Let b(x) = p*a(x) + 6*l(x). What is m(b(i))?
-12*i**2
Let l(h) = 2*h - 3. Let d(i) be the second derivative of 7*i**3/6 - 4*i**2 + 3*i. Let k(f) = -3*d(f) + 8*l(f). Let m(z) = 2*z. Determine k(m(b)).
-10*b
Let u(n) = -2*n + 2*n + 3 + 4*n**2 + 3*n. Let k(z) = 7*z**2 + 5*z + 5. Let j(l) = -6*k(l) + 10*u(l). Let m(c) = 2*c**2. What is j(m(s))?
-8*s**4
Let c(i) = 6*i**2 + 10*i**2 - 14*i**2. Let o(w) = -28*w. Give c(o(f)).
1568*f**2
Let h(c) = 7*c - 6. Let i(f) = f - 1. Let a(m) = -h(m) + 6*i(m). Let y(k) = 4*k. What is a(y(g))?
-4*g
Let o(m) = 2*m**2. Let b(w) be the first derivative of 13*w**3/3 - 22. Calculate o(b(r)).
338*r**4
Let b(h) be the second derivative of -h**5/60 - 3*h**2/2 - 3*h. Let y(s) be the first derivative of b(s). Let c(g) = -3*g**2. What is y(c(m))?
-9*m**4
Let g(k) = -37*k**2 + 3. Let i(n) = 4*n. Determine g(i(v)).
-592*v**2 + 3
Let p(n) = -2*n. Let u(q) = -5437*q. What is p(u(j))?
10874*j
Let r(p) = -2*p. Let o(w) = 8*w**2 - 6. Let a(d) = -7*d**2 + 5. Let n(q) = -6*a(q) - 5*o(q). What is n(r(g))?
8*g**2
Let d be (-6)/(-3) - (-8)/(-2). Let m be (-1 - d) + 1 + 0. Let l(i) = 11*i - i**m - 11*i. Let s(g) = 2*g. Give l(s(x)).
-4*x**2
Let p(o) = -51*o**2. Let q(d) = -10*d. Determine q(p(t)).
510*t**2
Let q(f) = -13*f - 18*f - 12*f. Let z(x) = 2*x. Calculate q(z(m)).
-86*m
Let h(j) = 20*j**2 + 5. Let x(y) = y**2 - 1. Let a(n) = h(n) + 5*x(n). Let s(k) = -k**2. Give s(a(o)).
-625*o**4
Let l(h) = -411*h. Let u(a) = -a. What is u(l(w))?
411*w
Let z(d) = -3*d**2. Let r(o) = 6*o + 4. Let q(m) be the third derivative of -m**4/24 - m**3/6 - m**2. Let g(w) = 4*q(w) + r(w). What is g(z(y))?
-6*y**2
Suppose -6 = -0*j - 2*j. Let n(h) = h**3 - 4*h**2 + 4*h - 1. Let v be n(j). Let z(s) = -3 + v - 5*s + 1. Let u(w) = 2*w. Calculate u(z(x)).
-10*x
Let a(m) = 18*m. Let f(u) be the second derivative of 0*u**2 + 1/3*u**3 + 0 + 9*u. What is f(a(r))?
36*r
Let b(o) be the third derivative of -o**5/10 + 7*o**2. Let d(f) = -f. Determine d(b(s)).
6*s**2
Let b(o) be the first derivative of o**2/2 + o - 2. Let r(h) = h**2 - h - 1. Let k(p) = 2*b(p) + 2*r(p). Let z(x) = -3*x. What is z(k(y))?
-6*y**2
Let d(t) = t**3 + 4*t**2 - t - 2. Let j be d(-4). Let l(k) = 5 - 3 + k**2 - j. Let v(b) = 2*b. Calculate l(v(g)).
4*g**2
Let h(c) = 4*c - 8. Let o(r) = -r + 1. Let l(v) = 5*h(v) + 40*o(v). Let p(d) = 2*d. Give l(p(q)).
-40*q
Let y(v) = 4 - 4 + 2*v**2. Let u(c) = -c**2 + 2. Let t(m) = m - 4. Let x be t(2). Let a(p) = 2*p**2 - 3. Let d(j) = x*a(j) - 3*u(j). Give d(y(s)).
-4*s**4
Let w(f) = 1 + 2*f - 1 - f. Let t(y) = 0*y + 3*y + 4*y. Calculate t(w(d)).
7*d
Let l(p) = p**2. Let c(b) = 10*b**2 + 1. Give c(l(u)).
10*u**4 + 1
Let j(i) = 0*i**2 - 63*i + 63*i - 3*i**2. Let g(c) be the third derivative of -c**4/12 + c**2. Determine j(g(d)).
-12*d**2
Let t(c) = -2 - 4 + 6 - 12*c. Let u(h) = h**2. Determine u(t(p)).
144*p**2
Let f(g) = 8*g**2. Let b(y) = 22*y**2. What is b(f(w))?
1408*w**4
Let z(p) = p. Let o(g) = -7*g. Let b(x) = o(x) + 5*z(x). Let u(j) = 8*j. Determine u(b(k)).
-16*k
Let c(w) = -42*w**2 - w. Let h(s) = -3*s. Give c(h(u)).
-378*u**2 + 3*u
Let z be (-1)/4 - 126/(-56). Let h(q) = -3*q**2 - q**z - 6*q**2. Let p(u) be the third derivative of -u**5/30 - u**2. Determine p(h(i)).
-200*i**4
Let t(f) = 3*f**2. Let h(q) = 4*q + 43. Calculate h(t(o)).
12*o**2 + 43
Let h(a) be the third derivative of -11*a**4/24 - 63*a**2. Let r(z) = -5*z. Give h(r(s)).
55*s
Let t(f) = -f**2 - f. Let b(r) = 26*r**2 + 22*r. Let z(u) = 2*b(u) + 44*t(u). Let s(w) = w. Determine s(z(k)).
8*k**2
Let f(a) = -5*a**2 + 0*a**2 - a**2. Let j(k) = 4*k**2. Calculate j(f(r)).
144*r**4
Let q = 11 + -8. Let j(m) = -q*m**2 + 6*m**2 + 2*m**2 + 4*m**2. Let a(i) = 2*i**2. What is a(j(n))?
162*n**4
Let o(y) = -y + 1. Let u(x) = x**2 + 3*x - 3. Let w(k) = -6*o(k) - 2*u(k). Let i(r) = -r**2 - 1. Let q(t) = 5. Let f(v) = -5*i(v) - q(v). Give w(f(p)).
-50*p**4
Let x(a) = a**2. Let n(w) = -3015*w**2 + 2. What is n(x(o))?
-3015*o**4 + 2
Let h(q) = -q**2. Let g(x) be the third derivative of 13*x**4/12 + 33*x**2. Give g(h(u)).
-26*u**2
Let w(a) = 6*a**2. Let l(r) = 35*r. Give l(w(v)).
210*v**2
Let o(b) = -3*b - 4. Let r be o(-3). Let n(w) = r*w - 4*w - 2*w. Let x(d) = 5*d + 11. Let f(y) = -y - 2. Let i(t) = 11*f(t) + 2*x(t). What is i(n(c))?
c
Let r(q) = 4*q**2. Let u(z) = 4*z**2 + 3*z + 3. Let o(a) = -9*a**2 - 7*a - 7. Let b(k) = 6*o(k) + 14*u(k). Determine b(r(c)).
32*c**4
Let u(g) = 3*g**2 + 7*g + 7. Let n(s) = s**2 + 2*s + 2. Let y(d) = -7*n(d) + 2*u(d). Let f(i) = -52*i. What is y(f(z))?
-2704*z**2
Let r(t) = -5*t**2. Let z(o) be the third derivative of -1/24*o**4 + 0*o + 0*o**3 - 4*o**2 + 0. Give r(z(x)).
-5*x**2
Let u(n) = 3*n. Let i(r) be the second derivative of -r**4/12 + 14*r. Determine u(i(v)).
-3*v**2
Let x(a) = 7 - 4 - 2*a**2 + 3*a + 0*a + a**2. Let j(b) = 2*b**2 - 7*b - 7. Let k(m) = -3*j(m) - 7*x(m). Let g(o) = 4*o**2. Determine g(k(d)).
4*d**4
Let h(v) = 3*v**2. Let m(n) = 17*n**2 - 11*n. Let k(x) = 9*x**2 - 6*x. Let r(d) = 11*k(d) - 6*m(d). Calculate h(r(a)).
27*a**4
Let y(s) = -9*s. Let v(c) = 23*c - 3*c + 16*c. Let q(h) = -2*v(h) - 9*y(h). Let t(f) = -2*f**2. Give t(q(a)).
-162*a**2
Let w(j) = 4*j + 3 - 6*j - 3. Let x(h) = h**2. Give w(x(g)).
-2*g**2
Let g(v) = 2*v. Let h(k) be the first derivative of -2 + 0*k**2 + 2/3*k**3 + 0*k. Determine g(h(z)).
4*z**2
Let d(f) = -f - 13. Let x(l) = 8*l**2. Calculate x(d(v)).
8*v**2 + 208*v + 1352
Let x(n) = n**2. Let k be (0 - 0)/((-2)/1). Suppose -5*a - 10 = -5*b, k*a - 5*a - 2*b + 11 = 0. Let t(f) = -4*f**2 - a + 1. Give t(x(y)).
-4*y**4
Let u(c) = -c**3 + 17*c**2 - 15*c - 12. Let j be u(16). Let d(y) = -7*y + 7*y + 5*y**2 - j*y**2. Let q(f) = 12*f**2. Give q(d(n)).
12*n**4
Let g(i) = -2*i. Let m(q) = 3*q**2. What is g(m(j))?
-6*j**2
Let h(p) = -p**2. Let y(d) be the third derivative of -d**5/60 + 19*d**4/24 - 9*d**2. Calculate h(y(l)).
-l**4 + 38*l**3 - 361*l**2
Let s(i) = i - 2. Let q(t) = -2*t + 5. Let r(p) = -2*q(p) - 5*s(p). Let h(j) = j**2 + 3*j - 3. Let v(b) = b - 1. Let y(g) = h(g) - 3*v(g). What is y(r(d))?
d**2
Suppose -f = -3*c - 16, 0 = 5*f - 7*f - c + 4. Let w(u) = 4*u - 2*u + 3*u - f*u. Let d(b) be the third derivative of -b**4/24 + 2*b**2. What is d(w(a))?
-a
Let l(i) = -4*i - 6. Let m(r) = -24*r**2. What is l(m(n))?
96*n**2 - 6
Let g(v) = 6*v**2. Let o(j) = 7*j**2 - 13 |
Bobby Humphreys, a competitive bodybuilder from Boonsboro, Maryland, has always loved dogs, but until two years ago, he never really cared for small breeds. He always felt that his pets should fit his own image, and even made fun of his male friends who owned small dogs. But one day everything changed and today Bobby shares his home with no less than 37 adorable chihuahuas.
Humphreys used to be a “Big Dog Guy” and he and his wife of 17 years had owned three Rottweilers. He loved their tough, imposing look and never even considered the idea of ever owning a small dog. In fact, he went as far as to poke fun at his male friends if they ever allowed themselves to be seen walking their girlfriends’ small canines. It was an ego thing, but one that Bobby quickly put behind him when he fell in love with Lady, a tiny Chihuahua that he now credits for getting him through the darkest period of his life. She opened his eyes to the love and support that small dogs are capable of offering unconditionally, and the big, strong bodybuilder is now what many would call a Small Dog Guy who looks after dozens of chihuahuas.
The Animal Ark is a special wild animal sanctuary, in Maharashtra, India, that takes in orphaned animals whose parents get hunted by villagers for food. It was set up by a local doctor who understood the necessity of hunting, but couldn’t bare to let the young animals starve to death.
One day, during the early 70s, Dr. Prakash Amte and his wife were taking a walk in the Dandarayana forest of Gadchiroli, when they encountered a group of tribal people carrying a dead monkey that they had hunted. They noticed that there was a baby monkey clinging to its dead mother’s body and trying to suckle her breast. It was heartbreaking sight, and Dr. Prakash decided he couldn’t let the hunters kill the baby as well. He asked them what they intended to do with it, and they said they were going to eat it, just like its mother. He knew the tribe killed out of necessity, not for sport, so he offered them rice and clothing in exchange for the baby monkey. They reluctantly accepted, and the small animal became the first member of their big animal family.
If there is such a place as heaven for farm animals, it must be a lot like Santuario Igualdad Interspecies, an incredible sanctuary for domestic animals destined for slaughter or left for dead. Here, not only do they get to live in perfect peace and harmony, but they receive all the love and affection they deserve.
A couple of days ago, I cam across this incredible video of a man cuddling with a grown cow. The animal seemed to be enjoying the human affection immensely, and responded by gently laying its head on the man’s chest and closing its eyes in delight as he petted and kissed its neck. It was very touching, and I decided that I had to learn more about it. I soon discovered an entire YouTube channel full of similar videos of two people affectionately interacting with various farm animals, like pigs, goats or ducks. They were shot at Santuario Igualdad Interspecie, a small animal sanctuary, in Chile, where tending to the emotional needs of rescued farm animals is of the utmost importance.
For the last 22 years, the Promised Land of Pigs, a unique farm in Amstelveen, the Netherlands, has been a haven for hundreds of pigs that would have otherwise been slaughtered and sold piece by piece at a supermarket. Here, they enjoy a peaceful, comfortable existence complete with hugs and weekly massages until the end of their natural lives.
The Promised Land of Pigs (Beloofde Varkensland) is a non-profit organization founded by Dafne Westerhof, an activist militating for the humane treatment of farm animals. For over two decades she has saved hundreds of pigs, either by buying them straight from slaughterhouses, or taking them in from breeders who no longer had use for them or had become too attached to them to have them butchered. Whatever the reason, she’s always been more than happy to accept new pigs into her “Lucky Family” (Familie Bofkont) and give them the life she thinks they deserve.
79-year-old Werner Freund has a unique gift. The ex-paratrooper and now wolf-researcher from Germany can get along with wolves so well, it’s almost like he’s a member of their pack. In fact, it’s been 40 long years since he started living among wolves and rearing them from pups at his ‘Wolfspark’ sanctuary , located in Merzig, in the German province of Saarland. The close relationship between Werner and his wolves is quite obvious from pictures of him leaning back on his haunches and howling, and of the wild beasts eating meat straight from his mouth.
Wolves are generally a feared species; come into close quarters and your chances of making it out alive are quite slim. But things are different in the case of Werner. It’s like they’ve accepted him as one of their own. When Werner is around, his wolves are actually playful, docile and submissive towards him. Perhaps it’s because he’s successfully asserted his dominance as the alpha male in the pack. The park is inhabited by wolves from six different packs around the world, including Siberian, Arctic, Canadian, European and Mongolian ones. They were mostly acquired as cubs from animal parks or zoos and hand-reared by Werner. |
/* linux/drivers/mtd/nand/bf5xx_nand.c
*
* Copyright 2006-2008 Analog Devices Inc.
* http://blackfin.uclinux.org/
* Bryan Wu <bryan.wu@analog.com>
*
* Blackfin BF5xx on-chip NAND flash controller driver
*
* Derived from drivers/mtd/nand/s3c2410.c
* Copyright (c) 2007 Ben Dooks <ben@simtec.co.uk>
*
* Derived from drivers/mtd/nand/cafe.c
* Copyright © 2006 Red Hat, Inc.
* Copyright © 2006 David Woodhouse <dwmw2@infradead.org>
*
* Changelog:
* 12-Jun-2007 Bryan Wu: Initial version
* 18-Jul-2007 Bryan Wu:
* - ECC_HW and ECC_SW supported
* - DMA supported in ECC_HW
* - YAFFS tested as rootfs in both ECC_HW and ECC_SW
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation; either version 2 of the License, or
* (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with this program; if not, write to the Free Software
* Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
*/
#include <linux/module.h>
#include <linux/types.h>
#include <linux/kernel.h>
#include <linux/string.h>
#include <linux/ioport.h>
#include <linux/platform_device.h>
#include <linux/delay.h>
#include <linux/dma-mapping.h>
#include <linux/err.h>
#include <linux/slab.h>
#include <linux/io.h>
#include <linux/bitops.h>
#include <linux/mtd/mtd.h>
#include <linux/mtd/nand.h>
#include <linux/mtd/nand_ecc.h>
#include <linux/mtd/partitions.h>
#include <asm/blackfin.h>
#include <asm/dma.h>
#include <asm/cacheflush.h>
#include <asm/nand.h>
#include <asm/portmux.h>
#define DRV_NAME "bf5xx-nand"
#define DRV_VERSION "1.2"
#define DRV_AUTHOR "Bryan Wu <bryan.wu@analog.com>"
#define DRV_DESC "BF5xx on-chip NAND FLash Controller Driver"
/* NFC_STAT Masks */
#define NBUSY 0x01 /* Not Busy */
#define WB_FULL 0x02 /* Write Buffer Full */
#define PG_WR_STAT 0x04 /* Page Write Pending */
#define PG_RD_STAT 0x08 /* Page Read Pending */
#define WB_EMPTY 0x10 /* Write Buffer Empty */
/* NFC_IRQSTAT Masks */
#define NBUSYIRQ 0x01 /* Not Busy IRQ */
#define WB_OVF 0x02 /* Write Buffer Overflow */
#define WB_EDGE 0x04 /* Write Buffer Edge Detect */
#define RD_RDY 0x08 /* Read Data Ready */
#define WR_DONE 0x10 /* Page Write Done */
/* NFC_RST Masks */
#define ECC_RST 0x01 /* ECC (and NFC counters) Reset */
/* NFC_PGCTL Masks */
#define PG_RD_START 0x01 /* Page Read Start */
#define PG_WR_START 0x02 /* Page Write Start */
#ifdef CONFIG_MTD_NAND_BF5XX_HWECC
static int hardware_ecc = 1;
#else
static int hardware_ecc;
#endif
static const unsigned short bfin_nfc_pin_req[] =
{P_NAND_CE,
P_NAND_RB,
P_NAND_D0,
P_NAND_D1,
P_NAND_D2,
P_NAND_D3,
P_NAND_D4,
P_NAND_D5,
P_NAND_D6,
P_NAND_D7,
P_NAND_WE,
P_NAND_RE,
P_NAND_CLE,
P_NAND_ALE,
0};
#ifdef CONFIG_MTD_NAND_BF5XX_BOOTROM_ECC
static int bootrom_ooblayout_ecc(struct mtd_info *mtd, int section,
struct mtd_oob_region *oobregion)
{
if (section > 7)
return -ERANGE;
oobregion->offset = section * 8;
oobregion->length = 3;
return 0;
}
static int bootrom_ooblayout_free(struct mtd_info *mtd, int section,
struct mtd_oob_region *oobregion)
{
if (section > 7)
return -ERANGE;
oobregion->offset = (section * 8) + 3;
oobregion->length = 5;
return 0;
}
static const struct mtd_ooblayout_ops bootrom_ooblayout_ops = {
.ecc = bootrom_ooblayout_ecc,
.free = bootrom_ooblayout_free,
};
#endif
/*
* Data structures for bf5xx nand flash controller driver
*/
/* bf5xx nand info */
struct bf5xx_nand_info {
/* mtd info */
struct nand_hw_control controller;
struct nand_chip chip;
/* platform info */
struct bf5xx_nand_platform *platform;
/* device info */
struct device *device;
/* DMA stuff */
struct completion dma_completion;
};
/*
* Conversion functions
*/
static struct bf5xx_nand_info *mtd_to_nand_info(struct mtd_info *mtd)
{
return container_of(mtd_to_nand(mtd), struct bf5xx_nand_info,
chip);
}
static struct bf5xx_nand_info *to_nand_info(struct platform_device *pdev)
{
return platform_get_drvdata(pdev);
}
static struct bf5xx_nand_platform *to_nand_plat(struct platform_device *pdev)
{
return dev_get_platdata(&pdev->dev);
}
/*
* struct nand_chip interface function pointers
*/
/*
* bf5xx_nand_hwcontrol
*
* Issue command and address cycles to the chip
*/
static void bf5xx_nand_hwcontrol(struct mtd_info *mtd, int cmd,
unsigned int ctrl)
{
if (cmd == NAND_CMD_NONE)
return;
while (bfin_read_NFC_STAT() & WB_FULL)
cpu_relax();
if (ctrl & NAND_CLE)
bfin_write_NFC_CMD(cmd);
else if (ctrl & NAND_ALE)
bfin_write_NFC_ADDR(cmd);
SSYNC();
}
/*
* bf5xx_nand_devready()
*
* returns 0 if the nand is busy, 1 if it is ready
*/
static int bf5xx_nand_devready(struct mtd_info *mtd)
{
unsigned short val = bfin_read_NFC_STAT();
if ((val & NBUSY) == NBUSY)
return 1;
else
return 0;
}
/*
* ECC functions
* These allow the bf5xx to use the controller's ECC
* generator block to ECC the data as it passes through
*/
/*
* ECC error correction function
*/
static int bf5xx_nand_correct_data_256(struct mtd_info *mtd, u_char *dat,
u_char *read_ecc, u_char *calc_ecc)
{
struct bf5xx_nand_info *info = mtd_to_nand_info(mtd);
u32 syndrome[5];
u32 calced, stored;
int i;
unsigned short failing_bit, failing_byte;
u_char data;
calced = calc_ecc[0] | (calc_ecc[1] << 8) | (calc_ecc[2] << 16);
stored = read_ecc[0] | (read_ecc[1] << 8) | (read_ecc[2] << 16);
syndrome[0] = (calced ^ stored);
/*
* syndrome 0: all zero
* No error in data
* No action
*/
if (!syndrome[0] || !calced || !stored)
return 0;
/*
* sysdrome 0: only one bit is one
* ECC data was incorrect
* No action
*/
if (hweight32(syndrome[0]) == 1) {
dev_err(info->device, "ECC data was incorrect!\n");
return -EBADMSG;
}
syndrome[1] = (calced & 0x7FF) ^ (stored & 0x7FF);
syndrome[2] = (calced & 0x7FF) ^ ((calced >> 11) & 0x7FF);
syndrome[3] = (stored & 0x7FF) ^ ((stored >> 11) & 0x7FF);
syndrome[4] = syndrome[2] ^ syndrome[3];
for (i = 0; i < 5; i++)
dev_info(info->device, "syndrome[%d] 0x%08x\n", i, syndrome[i]);
dev_info(info->device,
"calced[0x%08x], stored[0x%08x]\n",
calced, stored);
/*
* sysdrome 0: exactly 11 bits are one, each parity
* and parity' pair is 1 & 0 or 0 & 1.
* 1-bit correctable error
* Correct the error
*/
if (hweight32(syndrome[0]) == 11 && syndrome[4] == 0x7FF) {
dev_info(info->device,
"1-bit correctable error, correct it.\n");
dev_info(info->device,
"syndrome[1] 0x%08x\n", syndrome[1]);
failing_bit = syndrome[1] & 0x7;
failing_byte = syndrome[1] >> 0x3;
data = *(dat + failing_byte);
data = data ^ (0x1 << failing_bit);
*(dat + failing_byte) = data;
return 1;
}
/*
* sysdrome 0: random data
* More than 1-bit error, non-correctable error
* Discard data, mark bad block
*/
dev_err(info->device,
"More than 1-bit error, non-correctable error.\n");
dev_err(info->device,
"Please discard data, mark bad block\n");
return -EBADMSG;
}
static int bf5xx_nand_correct_data(struct mtd_info *mtd, u_char *dat,
u_char *read_ecc, u_char *calc_ecc)
{
struct nand_chip *chip = mtd_to_nand(mtd);
int ret, bitflips = 0;
ret = bf5xx_nand_correct_data_256(mtd, dat, read_ecc, calc_ecc);
if (ret < 0)
return ret;
bitflips = ret;
/* If ecc size is 512, correct second 256 bytes */
if (chip->ecc.size == 512) {
dat += 256;
read_ecc += 3;
calc_ecc += 3;
ret = bf5xx_nand_correct_data_256(mtd, dat, read_ecc, calc_ecc);
if (ret < 0)
return ret;
bitflips += ret;
}
return bitflips;
}
static void bf5xx_nand_enable_hwecc(struct mtd_info *mtd, int mode)
{
return;
}
static int bf5xx_nand_calculate_ecc(struct mtd_info *mtd,
const u_char *dat, u_char *ecc_code)
{
struct bf5xx_nand_info *info = mtd_to_nand_info(mtd);
struct nand_chip *chip = mtd_to_nand(mtd);
u16 ecc0, ecc1;
u32 code[2];
u8 *p;
/* first 3 bytes ECC code for 256 page size */
ecc0 = bfin_read_NFC_ECC0();
ecc1 = bfin_read_NFC_ECC1();
code[0] = (ecc0 & 0x7ff) | ((ecc1 & 0x7ff) << 11);
dev_dbg(info->device, "returning ecc 0x%08x\n", code[0]);
p = (u8 *) code;
memcpy(ecc_code, p, 3);
/* second 3 bytes ECC code for 512 ecc size */
if (chip->ecc.size == 512) {
ecc0 = bfin_read_NFC_ECC2();
ecc1 = bfin_read_NFC_ECC3();
code[1] = (ecc0 & 0x7ff) | ((ecc1 & 0x7ff) << 11);
/* second 3 bytes in ecc_code for second 256
* bytes of 512 page size
*/
p = (u8 *) (code + 1);
memcpy((ecc_code + 3), p, 3);
dev_dbg(info->device, "returning ecc 0x%08x\n", code[1]);
}
return 0;
}
/*
* PIO mode for buffer writing and reading
*/
static void bf5xx_nand_read_buf(struct mtd_info *mtd, uint8_t *buf, int len)
{
int i;
unsigned short val;
/*
* Data reads are requested by first writing to NFC_DATA_RD
* and then reading back from NFC_READ.
*/
for (i = 0; i < len; i++) {
while (bfin_read_NFC_STAT() & WB_FULL)
cpu_relax();
/* Contents do not matter */
bfin_write_NFC_DATA_RD(0x0000);
SSYNC();
while ((bfin_read_NFC_IRQSTAT() & RD_RDY) != RD_RDY)
cpu_relax();
buf[i] = bfin_read_NFC_READ();
val = bfin_read_NFC_IRQSTAT();
val |= RD_RDY;
bfin_write_NFC_IRQSTAT(val);
SSYNC();
}
}
static uint8_t bf5xx_nand_read_byte(struct mtd_info *mtd)
{
uint8_t val;
bf5xx_nand_read_buf(mtd, &val, 1);
return val;
}
static void bf5xx_nand_write_buf(struct mtd_info *mtd,
const uint8_t *buf, int len)
{
int i;
for (i = 0; i < len; i++) {
while (bfin_read_NFC_STAT() & WB_FULL)
cpu_relax();
bfin_write_NFC_DATA_WR(buf[i]);
SSYNC();
}
}
static void bf5xx_nand_read_buf16(struct mtd_info *mtd, uint8_t *buf, int len)
{
int i;
u16 *p = (u16 *) buf;
len >>= 1;
/*
* Data reads are requested by first writing to NFC_DATA_RD
* and then reading back from NFC_READ.
*/
bfin_write_NFC_DATA_RD(0x5555);
SSYNC();
for (i = 0; i < len; i++)
p[i] = bfin_read_NFC_READ();
}
static void bf5xx_nand_write_buf16(struct mtd_info *mtd,
const uint8_t *buf, int len)
{
int i;
u16 *p = (u16 *) buf;
len >>= 1;
for (i = 0; i < len; i++)
bfin_write_NFC_DATA_WR(p[i]);
SSYNC();
}
/*
* DMA functions for buffer writing and reading
*/
static irqreturn_t bf5xx_nand_dma_irq(int irq, void *dev_id)
{
struct bf5xx_nand_info *info = dev_id;
clear_dma_irqstat(CH_NFC);
disable_dma(CH_NFC);
complete(&info->dma_completion);
return IRQ_HANDLED;
}
static void bf5xx_nand_dma_rw(struct mtd_info *mtd,
uint8_t *buf, int is_read)
{
struct bf5xx_nand_info *info = mtd_to_nand_info(mtd);
struct nand_chip *chip = mtd_to_nand(mtd);
unsigned short val;
dev_dbg(info->device, " mtd->%p, buf->%p, is_read %d\n",
mtd, buf, is_read);
/*
* Before starting a dma transfer, be sure to invalidate/flush
* the cache over the address range of your DMA buffer to
* prevent cache coherency problems. Otherwise very subtle bugs
* can be introduced to your driver.
*/
if (is_read)
invalidate_dcache_range((unsigned int)buf,
(unsigned int)(buf + chip->ecc.size));
else
flush_dcache_range((unsigned int)buf,
(unsigned int)(buf + chip->ecc.size));
/*
* This register must be written before each page is
* transferred to generate the correct ECC register
* values.
*/
bfin_write_NFC_RST(ECC_RST);
SSYNC();
while (bfin_read_NFC_RST() & ECC_RST)
cpu_relax();
disable_dma(CH_NFC);
clear_dma_irqstat(CH_NFC);
/* setup DMA register with Blackfin DMA API */
set_dma_config(CH_NFC, 0x0);
set_dma_start_addr(CH_NFC, (unsigned long) buf);
/* The DMAs have different size on BF52x and BF54x */
#ifdef CONFIG_BF52x
set_dma_x_count(CH_NFC, (chip->ecc.size >> 1));
set_dma_x_modify(CH_NFC, 2);
val = DI_EN | WDSIZE_16;
#endif
#ifdef CONFIG_BF54x
set_dma_x_count(CH_NFC, (chip->ecc.size >> 2));
set_dma_x_modify(CH_NFC, 4);
val = DI_EN | WDSIZE_32;
#endif
/* setup write or read operation */
if (is_read)
val |= WNR;
set_dma_config(CH_NFC, val);
enable_dma(CH_NFC);
/* Start PAGE read/write operation */
if (is_read)
bfin_write_NFC_PGCTL(PG_RD_START);
else
bfin_write_NFC_PGCTL(PG_WR_START);
wait_for_completion(&info->dma_completion);
}
static void bf5xx_nand_dma_read_buf(struct mtd_info *mtd,
uint8_t *buf, int len)
{
struct bf5xx_nand_info *info = mtd_to_nand_info(mtd);
struct nand_chip *chip = mtd_to_nand(mtd);
dev_dbg(info->device, "mtd->%p, buf->%p, int %d\n", mtd, buf, len);
if (len == chip->ecc.size)
bf5xx_nand_dma_rw(mtd, buf, 1);
else
bf5xx_nand_read_buf(mtd, buf, len);
}
static void bf5xx_nand_dma_write_buf(struct mtd_info *mtd,
const uint8_t *buf, int len)
{
struct bf5xx_nand_info *info = mtd_to_nand_info(mtd);
struct nand_chip *chip = mtd_to_nand(mtd);
dev_dbg(info->device, "mtd->%p, buf->%p, len %d\n", mtd, buf, len);
if (len == chip->ecc.size)
bf5xx_nand_dma_rw(mtd, (uint8_t *)buf, 0);
else
bf5xx_nand_write_buf(mtd, buf, len);
}
static int bf5xx_nand_read_page_raw(struct mtd_info *mtd, struct nand_chip *chip,
uint8_t *buf, int oob_required, int page)
{
bf5xx_nand_read_buf(mtd, buf, mtd->writesize);
bf5xx_nand_read_buf(mtd, chip->oob_poi, mtd->oobsize);
return 0;
}
static int bf5xx_nand_write_page_raw(struct mtd_info *mtd,
struct nand_chip *chip, const uint8_t *buf, int oob_required,
int page)
{
bf5xx_nand_write_buf(mtd, buf, mtd->writesize);
bf5xx_nand_write_buf(mtd, chip->oob_poi, mtd->oobsize);
return 0;
}
/*
* System initialization functions
*/
static int bf5xx_nand_dma_init(struct bf5xx_nand_info *info)
{
int ret;
/* Do not use dma */
if (!hardware_ecc)
return 0;
init_completion(&info->dma_completion);
/* Request NFC DMA channel */
ret = request_dma(CH_NFC, "BF5XX NFC driver");
if (ret < 0) {
dev_err(info->device, " unable to get DMA channel\n");
return ret;
}
#ifdef CONFIG_BF54x
/* Setup DMAC1 channel mux for NFC which shared with SDH */
bfin_write_DMAC1_PERIMUX(bfin_read_DMAC1_PERIMUX() & ~1);
SSYNC();
#endif
set_dma_callback(CH_NFC, bf5xx_nand_dma_irq, info);
/* Turn off the DMA channel first */
disable_dma(CH_NFC);
return 0;
}
static void bf5xx_nand_dma_remove(struct bf5xx_nand_info *info)
{
/* Free NFC DMA channel */
if (hardware_ecc)
free_dma(CH_NFC);
}
/*
* BF5XX NFC hardware initialization
* - pin mux setup
* - clear interrupt status
*/
static int bf5xx_nand_hw_init(struct bf5xx_nand_info *info)
{
int err = 0;
unsigned short val;
struct bf5xx_nand_platform *plat = info->platform;
/* setup NFC_CTL register */
dev_info(info->device,
"data_width=%d, wr_dly=%d, rd_dly=%d\n",
(plat->data_width ? 16 : 8),
plat->wr_dly, plat->rd_dly);
val = (1 << NFC_PG_SIZE_OFFSET) |
(plat->data_width << NFC_NWIDTH_OFFSET) |
(plat->rd_dly << NFC_RDDLY_OFFSET) |
(plat->wr_dly << NFC_WRDLY_OFFSET);
dev_dbg(info->device, "NFC_CTL is 0x%04x\n", val);
bfin_write_NFC_CTL(val);
SSYNC();
/* clear interrupt status */
bfin_write_NFC_IRQMASK(0x0);
SSYNC();
val = bfin_read_NFC_IRQSTAT();
bfin_write_NFC_IRQSTAT(val);
SSYNC();
/* DMA initialization */
if (bf5xx_nand_dma_init(info))
err = -ENXIO;
return err;
}
/*
* Device management interface
*/
static int bf5xx_nand_add_partition(struct bf5xx_nand_info *info)
{
struct mtd_info *mtd = nand_to_mtd(&info->chip);
struct mtd_partition *parts = info->platform->partitions;
int nr = info->platform->nr_partitions;
return mtd_device_register(mtd, parts, nr);
}
static int bf5xx_nand_remove(struct platform_device *pdev)
{
struct bf5xx_nand_info *info = to_nand_info(pdev);
/* first thing we need to do is release all our mtds
* and their partitions, then go through freeing the
* resources used
*/
nand_release(nand_to_mtd(&info->chip));
peripheral_free_list(bfin_nfc_pin_req);
bf5xx_nand_dma_remove(info);
return 0;
}
static int bf5xx_nand_scan(struct mtd_info *mtd)
{
struct nand_chip *chip = mtd_to_nand(mtd);
int ret;
ret = nand_scan_ident(mtd, 1, NULL);
if (ret)
return ret;
if (hardware_ecc) {
/*
* for nand with page size > 512B, think it as several sections with 512B
*/
if (likely(mtd->writesize >= 512)) {
chip->ecc.size = 512;
chip->ecc.bytes = 6;
chip->ecc.strength = 2;
} else {
chip->ecc.size = 256;
chip->ecc.bytes = 3;
chip->ecc.strength = 1;
bfin_write_NFC_CTL(bfin_read_NFC_CTL() & ~(1 << NFC_PG_SIZE_OFFSET));
SSYNC();
}
}
return nand_scan_tail(mtd);
}
/*
* bf5xx_nand_probe
*
* called by device layer when it finds a device matching
* one our driver can handled. This code checks to see if
* it can allocate all necessary resources then calls the
* nand layer to look for devices
*/
static int bf5xx_nand_probe(struct platform_device *pdev)
{
struct bf5xx_nand_platform *plat = to_nand_plat(pdev);
struct bf5xx_nand_info *info = NULL;
struct nand_chip *chip = NULL;
struct mtd_info *mtd = NULL;
int err = 0;
dev_dbg(&pdev->dev, "(%p)\n", pdev);
if (!plat) {
dev_err(&pdev->dev, "no platform specific information\n");
return -EINVAL;
}
if (peripheral_request_list(bfin_nfc_pin_req, DRV_NAME)) {
dev_err(&pdev->dev, "requesting Peripherals failed\n");
return -EFAULT;
}
info = devm_kzalloc(&pdev->dev, sizeof(*info), GFP_KERNEL);
if (info == NULL) {
err = -ENOMEM;
goto out_err;
}
platform_set_drvdata(pdev, info);
spin_lock_init(&info->controller.lock);
init_waitqueue_head(&info->controller.wq);
info->device = &pdev->dev;
info->platform = plat;
/* initialise chip data struct */
chip = &info->chip;
mtd = nand_to_mtd(&info->chip);
if (plat->data_width)
chip->options |= NAND_BUSWIDTH_16;
chip->options |= NAND_CACHEPRG | NAND_SKIP_BBTSCAN;
chip->read_buf = (plat->data_width) ?
bf5xx_nand_read_buf16 : bf5xx_nand_read_buf;
chip->write_buf = (plat->data_width) ?
bf5xx_nand_write_buf16 : bf5xx_nand_write_buf;
chip->read_byte = bf5xx_nand_read_byte;
chip->cmd_ctrl = bf5xx_nand_hwcontrol;
chip->dev_ready = bf5xx_nand_devready;
nand_set_controller_data(chip, mtd);
chip->controller = &info->controller;
chip->IO_ADDR_R = (void __iomem *) NFC_READ;
chip->IO_ADDR_W = (void __iomem *) NFC_DATA_WR;
chip->chip_delay = 0;
/* initialise mtd info data struct */
mtd->dev.parent = &pdev->dev;
/* initialise the hardware */
err = bf5xx_nand_hw_init(info);
if (err)
goto out_err;
/* setup hardware ECC data struct */
if (hardware_ecc) {
#ifdef CONFIG_MTD_NAND_BF5XX_BOOTROM_ECC
mtd_set_ooblayout(mtd, &bootrom_ooblayout_ops);
#endif
chip->read_buf = bf5xx_nand_dma_read_buf;
chip->write_buf = bf5xx_nand_dma_write_buf;
chip->ecc.calculate = bf5xx_nand_calculate_ecc;
chip->ecc.correct = bf5xx_nand_correct_data;
chip->ecc.mode = NAND_ECC_HW;
chip->ecc.hwctl = bf5xx_nand_enable_hwecc;
chip->ecc.read_page_raw = bf5xx_nand_read_page_raw;
chip->ecc.write_page_raw = bf5xx_nand_write_page_raw;
} else {
chip->ecc.mode = NAND_ECC_SOFT;
chip->ecc.algo = NAND_ECC_HAMMING;
}
/* scan hardware nand chip and setup mtd info data struct */
if (bf5xx_nand_scan(mtd)) {
err = -ENXIO;
goto out_err_nand_scan;
}
#ifdef CONFIG_MTD_NAND_BF5XX_BOOTROM_ECC
chip->badblockpos = 63;
#endif
/* add NAND partition */
bf5xx_nand_add_partition(info);
dev_dbg(&pdev->dev, "initialised ok\n");
return 0;
out_err_nand_scan:
bf5xx_nand_dma_remove(info);
out_err:
peripheral_free_list(bfin_nfc_pin_req);
return err;
}
/* driver device registration */
static struct platform_driver bf5xx_nand_driver = {
.probe = bf5xx_nand_probe,
.remove = bf5xx_nand_remove,
.driver = {
.name = DRV_NAME,
},
};
module_platform_driver(bf5xx_nand_driver);
MODULE_LICENSE("GPL");
MODULE_AUTHOR(DRV_AUTHOR);
MODULE_DESCRIPTION(DRV_DESC);
MODULE_ALIAS("platform:" DRV_NAME);
|
//
// asio.hpp
// ~~~~~~~~
//
// Copyright (c) 2003-2018 Christopher M. Kohlhoff (chris at kohlhoff dot com)
//
// Distributed under the Boost Software License, Version 1.0. (See accompanying
// file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
//
// See www.boost.org/libs/asio for documentation.
//
#ifndef BOOST_ASIO_HPP
#define BOOST_ASIO_HPP
#if defined(_MSC_VER) && (_MSC_VER >= 1200)
# pragma once
#endif // defined(_MSC_VER) && (_MSC_VER >= 1200)
#include <boost/asio/associated_allocator.hpp>
#include <boost/asio/associated_executor.hpp>
#include <boost/asio/async_result.hpp>
#include <boost/asio/basic_datagram_socket.hpp>
#include <boost/asio/basic_deadline_timer.hpp>
#include <boost/asio/basic_io_object.hpp>
#include <boost/asio/basic_raw_socket.hpp>
#include <boost/asio/basic_seq_packet_socket.hpp>
#include <boost/asio/basic_serial_port.hpp>
#include <boost/asio/basic_signal_set.hpp>
#include <boost/asio/basic_socket_acceptor.hpp>
#include <boost/asio/basic_socket_iostream.hpp>
#include <boost/asio/basic_socket_streambuf.hpp>
#include <boost/asio/basic_stream_socket.hpp>
#include <boost/asio/basic_streambuf.hpp>
#include <boost/asio/basic_waitable_timer.hpp>
#include <boost/asio/bind_executor.hpp>
#include <boost/asio/buffer.hpp>
#include <boost/asio/buffered_read_stream_fwd.hpp>
#include <boost/asio/buffered_read_stream.hpp>
#include <boost/asio/buffered_stream_fwd.hpp>
#include <boost/asio/buffered_stream.hpp>
#include <boost/asio/buffered_write_stream_fwd.hpp>
#include <boost/asio/buffered_write_stream.hpp>
#include <boost/asio/buffers_iterator.hpp>
#include <boost/asio/completion_condition.hpp>
#include <boost/asio/connect.hpp>
#include <boost/asio/coroutine.hpp>
#include <boost/asio/datagram_socket_service.hpp>
#include <boost/asio/deadline_timer_service.hpp>
#include <boost/asio/deadline_timer.hpp>
#include <boost/asio/defer.hpp>
#include <boost/asio/dispatch.hpp>
#include <boost/asio/error.hpp>
#include <boost/asio/execution_context.hpp>
#include <boost/asio/executor.hpp>
#include <boost/asio/executor_work_guard.hpp>
#include <boost/asio/generic/basic_endpoint.hpp>
#include <boost/asio/generic/datagram_protocol.hpp>
#include <boost/asio/generic/raw_protocol.hpp>
#include <boost/asio/generic/seq_packet_protocol.hpp>
#include <boost/asio/generic/stream_protocol.hpp>
#include <boost/asio/handler_alloc_hook.hpp>
#include <boost/asio/handler_continuation_hook.hpp>
#include <boost/asio/handler_invoke_hook.hpp>
#include <boost/asio/handler_type.hpp>
#include <boost/asio/high_resolution_timer.hpp>
#include <boost/asio/io_context.hpp>
#include <boost/asio/io_context_strand.hpp>
#include <boost/asio/io_service.hpp>
#include <boost/asio/io_service_strand.hpp>
#include <boost/asio/ip/address.hpp>
#include <boost/asio/ip/address_v4.hpp>
#include <boost/asio/ip/address_v4_iterator.hpp>
#include <boost/asio/ip/address_v4_range.hpp>
#include <boost/asio/ip/address_v6.hpp>
#include <boost/asio/ip/address_v6_iterator.hpp>
#include <boost/asio/ip/address_v6_range.hpp>
#include <boost/asio/ip/bad_address_cast.hpp>
#include <boost/asio/ip/basic_endpoint.hpp>
#include <boost/asio/ip/basic_resolver.hpp>
#include <boost/asio/ip/basic_resolver_entry.hpp>
#include <boost/asio/ip/basic_resolver_iterator.hpp>
#include <boost/asio/ip/basic_resolver_query.hpp>
#include <boost/asio/ip/host_name.hpp>
#include <boost/asio/ip/icmp.hpp>
#include <boost/asio/ip/multicast.hpp>
#include <boost/asio/ip/resolver_base.hpp>
#include <boost/asio/ip/resolver_query_base.hpp>
#include <boost/asio/ip/resolver_service.hpp>
#include <boost/asio/ip/tcp.hpp>
#include <boost/asio/ip/udp.hpp>
#include <boost/asio/ip/unicast.hpp>
#include <boost/asio/ip/v6_only.hpp>
#include <boost/asio/is_executor.hpp>
#include <boost/asio/is_read_buffered.hpp>
#include <boost/asio/is_write_buffered.hpp>
#include <boost/asio/local/basic_endpoint.hpp>
#include <boost/asio/local/connect_pair.hpp>
#include <boost/asio/local/datagram_protocol.hpp>
#include <boost/asio/local/stream_protocol.hpp>
#include <boost/asio/packaged_task.hpp>
#include <boost/asio/placeholders.hpp>
#include <boost/asio/posix/basic_descriptor.hpp>
#include <boost/asio/posix/basic_stream_descriptor.hpp>
#include <boost/asio/posix/descriptor.hpp>
#include <boost/asio/posix/descriptor_base.hpp>
#include <boost/asio/posix/stream_descriptor.hpp>
#include <boost/asio/posix/stream_descriptor_service.hpp>
#include <boost/asio/post.hpp>
#include <boost/asio/raw_socket_service.hpp>
#include <boost/asio/read.hpp>
#include <boost/asio/read_at.hpp>
#include <boost/asio/read_until.hpp>
#include <boost/asio/seq_packet_socket_service.hpp>
#include <boost/asio/serial_port.hpp>
#include <boost/asio/serial_port_base.hpp>
#include <boost/asio/serial_port_service.hpp>
#include <boost/asio/signal_set.hpp>
#include <boost/asio/signal_set_service.hpp>
#include <boost/asio/socket_acceptor_service.hpp>
#include <boost/asio/socket_base.hpp>
#include <boost/asio/steady_timer.hpp>
#include <boost/asio/strand.hpp>
#include <boost/asio/stream_socket_service.hpp>
#include <boost/asio/streambuf.hpp>
#include <boost/asio/system_context.hpp>
#include <boost/asio/system_executor.hpp>
#include <boost/asio/system_timer.hpp>
#include <boost/asio/thread_pool.hpp>
#include <boost/asio/time_traits.hpp>
#include <boost/asio/use_future.hpp>
#include <boost/asio/uses_executor.hpp>
#include <boost/asio/version.hpp>
#include <boost/asio/wait_traits.hpp>
#include <boost/asio/waitable_timer_service.hpp>
#include <boost/asio/windows/basic_handle.hpp>
#include <boost/asio/windows/basic_object_handle.hpp>
#include <boost/asio/windows/basic_random_access_handle.hpp>
#include <boost/asio/windows/basic_stream_handle.hpp>
#include <boost/asio/windows/object_handle.hpp>
#include <boost/asio/windows/object_handle_service.hpp>
#include <boost/asio/windows/overlapped_handle.hpp>
#include <boost/asio/windows/overlapped_ptr.hpp>
#include <boost/asio/windows/random_access_handle.hpp>
#include <boost/asio/windows/random_access_handle_service.hpp>
#include <boost/asio/windows/stream_handle.hpp>
#include <boost/asio/windows/stream_handle_service.hpp>
#include <boost/asio/write.hpp>
#include <boost/asio/write_at.hpp>
#endif // BOOST_ASIO_HPP
|
In the case of tire-related breakdowns, there is generally the problem that—as has hitherto been conventional for example in a passenger motor vehicle—a filled spare tire mounted on a wheel rim must be carried on board, which spare tire is then fitted in place of the wheel with the defective tire, following which the defective tire must be fastened in the stowage space provided in the vehicle for the spare tire and later taken for repair. For this purpose, it is not only often necessary to unload a laden vehicle in order to access the corresponding stowage space, but it is also necessary for the vehicle itself to be raised using vehicle jacks, and for cumbersome repair work to be performed.
To avoid these disadvantages, repair sets or breakdown kits are already known which include a compressor, a sealant which coagulates in the tire, normally a latex milk mixture, the corresponding connecting hoses and the required cable connections for the supply of energy, and also a switch, manometer and operating element, and which thus provide a permanently usable and complete repair set, with which it is possible to dispense with carrying on board a spare wheel fitted on a wheel rim, or with the constant inspection of other repair materials such as hoses, various tool wrenches, vehicle jacks, et cetera.
Accordingly, DE 29812740 U1 discloses a repair set with a portable container for accommodating on-board tools and working appliances for vehicles, in particular for accommodating a compressor, tools, working appliances and accessories for repairing tires, wherein the container is in the form of a luggage case and contains multiple compartments for the accessories and switching, control and display devices.
The operation of such repair sets is however not entirely simple, in particular if, depending on the operating state, it is firstly necessary for a sealant container and various hose connections to be attached or refitted. Specifically, most repair sets are also very highly suitable for being used, without a sealant insert, merely for inflating tires, inflatable boats, air mattresses et cetera. Owing to the fact that tire-related breakdowns nowadays occur only rarely, the repair sets are generally used more frequently for such leisure purposes than for emergencies. If this however does occur, the user is in an unfamiliar and unpractised situation.
To facilitate the handling of the appliances/repair sets in such different usage situations, solutions are already known in the prior art which substantially involve a simplified switchover from one to the other operation type. Solutions also exist which have plug-type connections between individual parts of the appliances/repair sets.
Aside from this actual object of sealing a damaged tire, the described air compressors are self-evidently frequently also used for inspecting and possibly adapting the tire pressure in a non-damaged tire. In this operating state, it is normally the case that no sealant bottle is connected to the connection piece of the air compressor, and the connector provided for this purpose is closed off in air-tight fashion, often via a cap. Accordingly, by connecting the air compressor to the vehicle tire, the end user can read off the air pressure thereof on a manometer that is normally integrated into the air compressor, and can if necessary increase the air pressure in the tire by activating the air compressor.
This all has the effect that, not only in the event of tire repairs but also in the other applications mentioned, in practical use, a function of lowering the tire pressure is self-evidently also necessary in addition to the increasing of the pressure/tire pressure. Normally, for this purpose, a discharge valve that can be actuated by the user is integrated into the air compressor or into the feed line to the tire.
Here, in the prior art, it is customary for a discharge valve to be permanently installed into the line system, such that the discharge valve can be manually operated by the user in all operating states of the air compressor. Since sealant is however also delivered through the line system when sealing tire damage, inadvertent opening of the discharge valve, or opening of the discharge valve performed with unawareness, in this operating state can result in sealant emerging into the surroundings at high pressure.
Aside from the possible contamination of articles of clothing and the surroundings, irreparable damage to the compressor may also occur depending on the present structural arrangement of the discharge valve. Such incorrect operation by the user is not as unlikely as one might presume, because a typical average user tends to be unfamiliar with handling the air compressor to be used, and is additionally distracted by increased stress when performing sealing in the event of a tire-based breakdown. |
Today’s teens are tomorrow’s voters, helping to shape the political trajectory of the country. So what do young Americans see when they look to the future?
A new Associated Press-NORC Center for Public Affairs Research survey of teens ages 13-17 presents a complex picture. Like adults, many teenagers are pessimistic about the current situation: Just 16 percent say they believe the federal government is looking out for the interests of all Americans, while 8 in 10 say Americans are divided on important issues. At the same time, teenagers are uniquely optimistic about the possibilities of the future, with 56 percent indicating that America’s best days are ahead.
Amid concerns about disillusionment and undue influence on the political process, from fake news to hacking allegations, today’s teens provide some with a thread of hope. America’s youth are engaged and increasingly media-savvy – traits they will carry into adulthood, observers suggest.
“I think once these teens grow up and get older, they're actually going to have a much better insight into what it means to have things published online than their adult counterparts do now,” Jennifer Golbeck, an associate professor of information studies at the University of Maryland, College Park, told The Christian Science Monitor’s Gretel Kauffman in a November phone interview, speaking about how young people will meet the challenge of fake news.
For young people, the 2016 election served to highlight the extent of the political challenges facing America as much as it did for other generations. Disillusionment with the candidates of both political parties was clearly present, the AP-NORC poll found: Less than one-third of teens surveyed were favorable to President Trump, and former Democratic presidential candidate Hillary Clinton fared little better in their assessment. The teens also said that they had little in common with peers of differing political views. Just 1 in 4 reported having a lot in common with people who had different party preferences.
And just as the influence of fake news met with concerns among the wider community, educators were concerned about what it meant for young people. In a Stanford University study released in November, researchers found that 82 percent of middle school students surveyed could not distinguish between an ad labeled “sponsored content” and a news story.
Education is already helping address the challenge of fake news, observers say. And teens themselves seem to have some ideas about how to overcome apparent political divisions, the AP-NORC survey suggested.
For some, like Caroline Millsaps of Garner, N.C., it’s a question of trying to see the other side. The self-described liberal Democrat told the AP she watches Fox News and talks with friends who support Mr. Trump to understand others’ perspectives on the issues.
"I try to see both sides of the situation and see which side fits my view best,” she said.
Jessi Balcom, a Green Party supporter from Bend, Ore., said she believes people can work together to address problems rather than letting their divisions push them into conflict.
"It's not you versus me, it's us versus the problem and the problem isn't other people," she told the AP.
According to Sophie Svigel, a Dallas teenager who described herself as a conservative Republican, one of those problems is the way in which politicians discuss issues.
"I feel like the politicians and people in politics speak very vaguely about the problems that we're facing,“ she said. An overwhelming majority of teens surveyed agreed that the federal government is not doing a good job of looking out for the interests of all Americans.
Teens are active in their communities, working hard to make a difference. Nine in 10 teens said they had volunteered or raised money for a cause.
Underlying teens’ work to improve their world is a fundamental belief that they will ultimately succeed, whatever the odds against them. Fifty-seven percent are optimistic about the possibility of achieving the American Dream, the poll found.
"Sometimes it does get you down, but I try not to focus on it too much because I see myself as someone who despite all the odds that are against me, I'm still going to prevail," said Nyles Adams, a New York teenager whose grandparents were Trinidadian immigrants.
Get the Monitor Stories you care about delivered to your inbox. By signing up, you agree to our Privacy Policy
The AP-NORC poll was conducted online and by phone between December 7 and December 31. NORC’s AmeriSpeak panel, which is designed to be representative of the US population, produced a probability-based sample of parents with teenage children, and parents then gave permission for their children to be interviewed.
This report includes material from the Associated Press. |
梁悦信
This Gif entitled 梁悦信 was created from the youtube video 3 years ago by SeungHyunSenior.
It uses 14 frames per second and is displayed at 640px resolution.
This animated image plays for 10 seconds, was built with high quality and an estimated weight of 16.11 MB for download.
This animation was originally created from the 梁悦信 Max Sleigh: 你的一切 Everything About You video from 01:17 to 01:27.
Any third party products, brands or trademarks listed above are the sole property of their respective owner.No affiliation or endorsement is intended or implied. Our product has no affiliation with YouTube. |
Q:
in sts embeded apache tomcat server can not start
I'm quite new to spring and spring boot application. Getting the error creating bean with name 'entityManagerFactory' defined in class path resource. It says unable to build EntityManagerFactory. Error displayed in console:
when i tried to run embeded apache tomcat i got this erroe
please tell me what is problem
SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder".
SLF4J: Defaulting to no-operation (NOP) logger implementation
SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details.
. ____ _ __ _ _
/\\ / ___'_ __ _ _(_)_ __ __ _ \ \ \ \
( ( )\___ | '_ | '_| | '_ \/ _` | \ \ \ \
\\/ ___)| |_)| | | | | || (_| | ) ) ) )
' |____| .__|_| |_|_| |_\__, | / / / /
=========|_|==============|___/=/_/_/_/
:: Spring Boot :: (v2.1.4.RELEASE)
Apr 23, 2019 1:44:19 PM org.apache.catalina.core.StandardService startInternal
INFO: Starting service [Tomcat]
Apr 23, 2019 1:44:19 PM org.apache.catalina.core.StandardEngine startInternal
INFO: Starting Servlet engine: [Apache Tomcat/9.0.17]
Apr 23, 2019 1:44:20 PM org.apache.jasper.servlet.TldScanner scanJars
INFO: At least one JAR was scanned for TLDs yet contained no TLDs. Enable debug logging for this logger for a complete list of JARs that were scanned but no TLDs were found in them. Skipping unneeded JARs during scanning can improve startup time and JSP compilation time.
Apr 23, 2019 1:44:20 PM org.apache.catalina.core.ApplicationContext log
INFO: Initializing Spring embedded WebApplicationContext
Apr 23, 2019 1:44:25 PM org.apache.catalina.core.StandardService stopInternal
INFO: Stopping service [Tomcat]
Exception in thread "main" org.springframework.beans.factory.BeanCreationException: Error creating bean with name 'entityManagerFactory' defined in class path resource [org/springframework/boot/autoconfigure/orm/jpa/HibernateJpaConfiguration.class]: Invocation of init method failed; nested exception is java.lang.NoClassDefFoundError: org/hibernate/metadata/ClassMetadata
at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.initializeBean(AbstractAutowireCapableBeanFactory.java:1778)
at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.doCreateBean(AbstractAutowireCapableBeanFactory.java:593)
at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.createBean(AbstractAutowireCapableBeanFactory.java:515)
at org.springframework.beans.factory.support.AbstractBeanFactory.lambda$doGetBean$0(AbstractBeanFactory.java:320)
at org.springframework.beans.factory.support.DefaultSingletonBeanRegistry.getSingleton(DefaultSingletonBeanRegistry.java:222)
at org.springframework.beans.factory.support.AbstractBeanFactory.doGetBean(AbstractBeanFactory.java:318)
at org.springframework.beans.factory.support.AbstractBeanFactory.getBean(AbstractBeanFactory.java:199)
at org.springframework.context.support.AbstractApplicationContext.getBean(AbstractApplicationContext.java:1105)
at org.springframework.context.support.AbstractApplicationContext.finishBeanFactoryInitialization(AbstractApplicationContext.java:867)
at org.springframework.context.support.AbstractApplicationContext.refresh(AbstractApplicationContext.java:549)
at org.springframework.boot.web.servlet.context.ServletWebServerApplicationContext.refresh(ServletWebServerApplicationContext.java:142)
at org.springframework.boot.SpringApplication.refresh(SpringApplication.java:775)
at org.springframework.boot.SpringApplication.refreshContext(SpringApplication.java:397)
at org.springframework.boot.SpringApplication.run(SpringApplication.java:316)
at org.springframework.boot.SpringApplication.run(SpringApplication.java:1260)
at org.springframework.boot.SpringApplication.run(SpringApplication.java:1248)
at com.amol.location.LocationwebApplication.main(LocationwebApplication.java:10)
Caused by: java.lang.NoClassDefFoundError: org/hibernate/metadata/ClassMetadata
at java.lang.ClassLoader.defineClass1(Native Method)
at java.lang.ClassLoader.defineClass(ClassLoader.java:763)
at java.security.SecureClassLoader.defineClass(SecureClassLoader.java:142)
at java.net.URLClassLoader.defineClass(URLClassLoader.java:467)
at java.net.URLClassLoader.access$100(URLClassLoader.java:73)
at java.net.URLClassLoader$1.run(URLClassLoader.java:368)
at java.net.URLClassLoader$1.run(URLClassLoader.java:362)
at java.security.AccessController.doPrivileged(Native Method)
at java.net.URLClassLoader.findClass(URLClassLoader.java:361)
at java.lang.ClassLoader.loadClass(ClassLoader.java:424)
at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:331)
at java.lang.ClassLoader.loadClass(ClassLoader.java:357)
at java.lang.ClassLoader.defineClass1(Native Method)
at java.lang.ClassLoader.defineClass(ClassLoader.java:763)
at java.security.SecureClassLoader.defineClass(SecureClassLoader.java:142)
at java.net.URLClassLoader.defineClass(URLClassLoader.java:467)
at java.net.URLClassLoader.access$100(URLClassLoader.java:73)
at java.net.URLClassLoader$1.run(URLClassLoader.java:368)
at java.net.URLClassLoader$1.run(URLClassLoader.java:362)
at java.security.AccessController.doPrivileged(Native Method)
at java.net.URLClassLoader.findClass(URLClassLoader.java:361)
at java.lang.ClassLoader.loadClass(ClassLoader.java:424)
at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:331)
at java.lang.ClassLoader.loadClass(ClassLoader.java:357)
at org.hibernate.persister.internal.StandardPersisterClassResolver.singleTableEntityPersister(StandardPersisterClassResolver.java:59)
at org.hibernate.persister.internal.StandardPersisterClassResolver.getEntityPersisterClass(StandardPersisterClassResolver.java:39)
at org.hibernate.persister.internal.PersisterFactoryImpl.createEntityPersister(PersisterFactoryImpl.java:74)
at org.hibernate.metamodel.internal.MetamodelImpl.initialize(MetamodelImpl.java:154)
at org.hibernate.internal.SessionFactoryImpl.<init>(SessionFactoryImpl.java:295)
at org.hibernate.boot.internal.SessionFactoryBuilderImpl.build(SessionFactoryBuilderImpl.java:467)
at org.hibernate.jpa.boot.internal.EntityManagerFactoryBuilderImpl.build(EntityManagerFactoryBuilderImpl.java:939)
at org.springframework.orm.jpa.vendor.SpringHibernateJpaPersistenceProvider.createContainerEntityManagerFactory(SpringHibernateJpaPersistenceProvider.java:57)
at org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean.createNativeEntityManagerFactory(LocalContainerEntityManagerFactoryBean.java:365)
at org.springframework.orm.jpa.AbstractEntityManagerFactoryBean.buildNativeEntityManagerFactory(AbstractEntityManagerFactoryBean.java:390)
at org.springframework.orm.jpa.AbstractEntityManagerFactoryBean.afterPropertiesSet(AbstractEntityManagerFactoryBean.java:377)
at org.springframework.orm.jpa.LocalContainerEntityManagerFactoryBean.afterPropertiesSet(LocalContainerEntityManagerFactoryBean.java:341)
at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.invokeInitMethods(AbstractAutowireCapableBeanFactory.java:1837)
at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.initializeBean(AbstractAutowireCapableBeanFactory.java:1774)
... 16 more
Caused by: java.lang.ClassNotFoundException: org.hibernate.metadata.ClassMetadata
at java.net.URLClassLoader$1.run(URLClassLoader.java:370)
at java.net.URLClassLoader$1.run(URLClassLoader.java:362)
at java.security.AccessController.doPrivileged(Native Method)
at java.net.URLClassLoader.findClass(URLClassLoader.java:361)
at java.lang.ClassLoader.loadClass(ClassLoader.java:424)
at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:331)
at java.lang.ClassLoader.loadClass(ClassLoader.java:357)
... 54 more
Caused by: java.util.zip.ZipException: invalid LOC header (bad signature)
at java.util.zip.ZipFile.read(Native Method)
at java.util.zip.ZipFile.access$1400(ZipFile.java:60)
at java.util.zip.ZipFile$ZipFileInputStream.read(ZipFile.java:717)
at java.util.zip.ZipFile$ZipFileInflaterInputStream.fill(ZipFile.java:419)
at java.util.zip.InflaterInputStream.read(InflaterInputStream.java:158)
at sun.misc.Resource.getBytes(Resource.java:124)
at java.net.URLClassLoader.defineClass(URLClassLoader.java:462)
at java.net.URLClassLoader.access$100(URLClassLoader.java:73)
at java.net.URLClassLoader$1.run(URLClassLoader.java:368)
... 60 more
**The pom.xml file
**
pom.xml
<?xml version="1.0" encoding="UTF-8"?>
<project xmlns="http://maven.apache.org/POM/4.0.0"
xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd">
<modelVersion>4.0.0</modelVersion>
<parent>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-parent</artifactId>
<version>2.1.4.RELEASE</version>
<relativePath /> <!-- lookup parent from repository -->
</parent>
<groupId>com.amol.location</groupId>
<artifactId>locationweb</artifactId>
<version>0.0.1-SNAPSHOT</version>
<name>locationweb</name>
<description>Location Module</description>
<properties>
<java.version>1.8</java.version>
</properties>
<dependencies>
<dependency>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-data-jpa</artifactId>
</dependency>
<dependency>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-web</artifactId>
</dependency>
<!-- https://mvnrepository.com/artifact/org.apache.tomcat.embed/tomcat-embed-jasper -->
<dependency>
<groupId>org.apache.tomcat.embed</groupId>
<artifactId>tomcat-embed-jasper</artifactId>
<scope>provided</scope>
</dependency>
<dependency>
<groupId>mysql</groupId>
<artifactId>mysql-connector-java</artifactId>
<scope>runtime</scope>
</dependency>
<dependency>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-starter-test</artifactId>
<scope>test</scope>
</dependency>
</dependencies>
<build>
<plugins>
<plugin>
<groupId>org.springframework.boot</groupId>
<artifactId>spring-boot-maven-plugin</artifactId>
</plugin>
</plugins>
</build>
</project>
application.properties
spring.datasource.url=jdbc:mysql://localhost:3306/projectdb
spring.datasource.username=root
spring.datasource.password=root
spring.jpa.show-sql=true
spring.mvc.view.prefix=/WEB-INF/jsps/
spring.mvc.view.suffix=.jsp
A:
Usually, invalid LOC header means your local maven repository got corrupted.
Go to ~/.m2/repository directory, find the hibernate directory, delete it, and rebuild the project.
|
The coat protein is required for the elicitation of the Capsicum L2 gene-mediated resistance against the tobamoviruses.
In Capsicum, the resistance against tobamoviruses conferred by the L2 gene is effective against all but one of the known tobamoviruses. Pepper mild mottle virus (PMMoV) is the only virus which escapes its action. To identify the viral factors affecting induction of the hypersensitive reaction (HR) mediated by the Capsicum spp. L2 resistance gene, we have constructed chimeric viral genomes between paprika mild mottle virus (PaMMV) (a virus able to induce the HR) and PMMoV. A hybrid virus with the PaMMV coat protein gene substituted in the PMMoV-S sequences was able to elicit the HR in Capsicum frutescens (L2L2) plants. These data indicate that the sequences that affect induction of the HR mediated by the L2 resistance gene reside in the coat protein gene. Furthermore, a mutant that codes for a truncated coat protein was able to systemically spread in these plants. Thus, the elicitation of the host response requires the coat protein and not the RNA. |
Postoperative Radiographic Evaluation Following Adult Spine Deformity Correction: The Impact on Subsequent Management and Associated Risk of Radiation Exposure.
During the follow-up visits after Adult Spine Deformity (ASD) surgery, obtaining surveillance radiographs is a usual practice, and this study tried to identify evidence to support or refute such practice. This is a retrospective, diagnostic case series (Level IV) of 49 patients. We identified the abnormal radiographic findings and their association with need for revision surgery. We determined the odds of obtaining an abnormal radiographs that lead to revision surgery at each of the given time intervals of follow-up. We also estimated the risk versus benefit of obtaining radiographs at each of the given time intervals of follow-up. We identified a total of 11 individual types of abnormal postoperative radiographic findings. Of them, the two radiographic findings that always needed revision surgery because of the associated clinical presentation were pedicle screw pullout and bilateral rod fracture. One abnormal radiographic finding that was never associated with revision surgery was the halo around a pedicle screw. In each of the given postoperative time intervals of follow-up at which the routine radiographs were obtained, we noted that the odds of noticing abnormal radiographic finding that lead to revision surgery was always >1. We found that the cumulative hazard rate for exposure to radiation was significantly higher during the initial follow-up visits when compared to subsequent follow-up visits. This study finds evidence to support the practice of routine postoperative radiographic evaluation of patients who come for follow-up after ASD surgery. |
In Canada, driverless cars learn to see in the snow
STRATFORD, Ontario (Reuters) - A Canadian town known for its annual theater festival is emerging as a hub of “snowtonomous” research, as automakers face demands to produce self-driving cars that can perform in snow and sleet.
But testing driverless cars in cold climates brings added challenges to an industry grappling with the first fatality involving an autonomous vehicle.
On Sunday, an Uber Technologies Inc self-driving sport utility vehicle hit and killed a woman crossing the street in Arizona.
Blackberry (BB.TO) said on Wednesday it will continue testing its self-driving concept car on the road in Ottawa.The Canadian province of Ontario, which allows autonomous vehicles on roads only if there is a human driver behind the wheel, has said it would follow the Arizona investigation and take “action if warranted.”
Canada’s largest city, Toronto, is one of three places where Uber tests driverless technology - the other cities are Phoenix, Arizona, and Pittsburgh, Pennsylvania.
Automakers, ride services companies and others are investing in self-driving technology said to reduce accidents, and the costs of a driver, with robo-taxis expected to hit the road as early as this year.
A wider rollout, however, is expected to take years, if not decades, as companies work to prove autonomous vehicles can run not just in balmy U.S. states, where they are mostly tested, but in colder areas like Ontario and Michigan where snow and sleet can render cameras and sensors ineffective.
Ross McKenzie, managing director of the Waterloo Centre of Automotive Research, recalled how a vehicle’s lidar, which uses laser light to help autonomous cars “see” nearby objects, once mistook an ice patch for a pothole.
Related Coverage
McKenzie’s research team at the University of Waterloo responded by tweaking the sedan’s software so it would factor in the time of year and weather when driving in the snow and ice, conditions that autonomous vehicles will have to navigate to be commercially viable.
The car needs to consider “we have winter driving conditions because I’m in Canada, it’s November and it’s 15 below,” McKenzie said by phone.
Ontario, which has lost automaking jobs to lower-cost Mexico in recent years, is counting on the lure of its snowy winters and the strength of its automotive and software engineering sectors to establish a “Silicon North.” Since 2016, Ontario has attracted about C$1 billion ($765 million) in private-sector investment for autonomous and connected cars.
In Stratford, where the theater festival is an important employer of its 31,000 residents, the city-wide wireless network and weather are helping to attract companies researching connected driving technologies. Ubiquitous Wi-Fi gives companies the option to test vehicle-to-vehicle communication over a 4G band, McKenzie said.
HARSH WINTERS
Japanese semiconductor manufacturer Renesas Electronics Corp (6723.T) chose Ontario as the site of its only autonomous test-track because of the harsh winters, along with its proximity to Blackberry’s QNX unit which produces the operating system.
The use of high-definition maps helps self-driving vehicles more easily navigate in the snow, even when road markings are not visible, said John Buszek, Renesas’ Michigan-based director of the company’s autonomous and advanced driver-assistance division.
Renesas’ Lincoln MKZ sedan, which does not currently drive autonomously on public roads, is still equipped with enough backup cameras and sensors to keep running even if one gets covered in sludge, Buszek said.
“In order for the car to have enough sensors to be robust against all different types of climates it means there are going to be a lot of sensors,” he said during at a recent demonstration at the chipmaker’s track in Stratford, Ontario.
While extra cameras, sensors and lidar work well on the track, consumers are less keen on the cost, appearance and inefficiency of a car covered with such lenses. Some automakers are looking at protective coatings to keep a smaller number of lenses free of sludge.
“Ultimately those sensors that you would see on the car today have to be integrated into the car system,” said Justin Gammage, industry liaison manager at the University of Ontario Institute of Technology’s Automotive Centre of Excellence (ACE) in Oshawa, Ontario.
“Customers will pretty much want a car to look like a car looks today, even if has all the autonomous features.”
Gammage, formerly General Motors Co’s (GM.N) chief scientist in Canada, said researchers are still looking at non-stick coatings as a cost-effective way to protect lenses.
He has yet to find a one-size-fits-all-coating.
“They all have varying degrees of performance. And it’s really dependent on what type of conditions they are working in,” he said. “One coating might work really well in snow, but not as well in rain. And vice versa.”
When self-driving vehicles fail to receive enough data through their cameras, sensors and lidar due to bad weather, they simply will not be able to drive autonomously, McKenzie said.
The public should not expect self-driving vehicles to hit the road in conditions that humans would avoid.
Slideshow (19 Images)
“If I’m not able to get into a car because we’re two steps short of a monsoon, why would we expect an autonomous vehicle to operate?” |
Image caption Hospitals in Calcutta are overflowing with patients suffering from alcohol-related ailments
More than 100 people have died after drinking toxic alcohol in the Indian state of West Bengal, in the latest example of fatal poisoning in the country. So why does it happen?
Stomach ache, vomiting, fits and even death.
The consequences of drinking illegal alcohol sold on India's streets could not be more serious. An estimated 126 people have died this week in West Bengal, but it's a problem that has blighted the country for years.
In 2008, at least 107 deaths were recorded in Karnataka, with another 41 in Tamil Nadu. The following year, more than 100 died in Gujarat, where alcohol is prohibited - the authorities last week introduced the death penalty for those supplying it.
One of the fatal ingredients is believed to be methyl alcohol, or methanol, a substance which sweetens it but which has industrial purposes as a solvent and antifreeze. Another is ammonium nitrate.
So why are such harmful substances being used to make alcoholic drinks?
One reason is the huge unfulfilled demand for booze which drives supply underground into an unregulated industry, says Aniruddha Mookherjee, who is writing a book about indigenous Indian alcohol.
"The state controls the alcohol business in India, almost completely. In many states, the alcohol is produced by state-appointed groups of people who are friends of the political parties that rule various states. West Bengal is one of the few states where this doesn't happen but in Delhi, for example, all alcohol is sold in government shops," he says.
The answer Demand for cheap alcohol provides huge black market
But errors of judgement in distillation can be fatal
Ingredients like methanol and ammonium nitrate can increase strength of flavour but can be fatal
Just 30ml of methanol is enough to kill a person
Known as IMFL - Indian made foreign liquor - the legal supply is produced from molasses, a by-product of India's huge sugar industry. But a heavy duty means it's priced beyond the reach of about 80% of Indians, he says, so about 700ml of whisky or rum can cost as much as 400 rupees (£4.81).
In contrast, the illegal stuff, known as "hooch", derived from cane sugar, is sold for a fraction of the price, about 25 or 30 rupees for a plastic pouch or glass. It's sold discreetly by word of mouth. And without a culture of social drinking, says Mr Mookherjee, people are looking for something that can offer them a cheap kick.
But distilling it safely requires a precise control of the temperature, because if that rises above a certain level then methyl alcohol can form. Sometimes, certain herbs or chemicals might be added to increase the strength or improve the flavour, and these can react badly with other chemicals.
"It's usually a mistake because no-one who does this business wants people killed, because they end up with no business. There's sometimes an error of judgement or sometimes it's deliberately spiked by a rival. These are usually the two reasons why this happens."
Alcohol poisoning - symptoms confusion
loss of co-ordination
vomiting
irregular or slow breathing
blue-tinged or pale skin
low body temperature (hypothermia)
stupor (being conscious but unresponsive)
unconsciousness (passing out) Source: Institute of Psychiatry, London
So what do these kind of ingredients do to the body?
"When swallowed in high concentrations, ammonium nitrate may cause headache, dizziness, abdominal pain, vomiting, heart irregularities, convulsions, collapse, and death," says Dr Bob Patton of the Addictions Department at the Institute of Psychiatry at King's College, London.
"Methyl alcohol, or methanol, which is commonly used for antifreeze, can also be added to illicit liquor to increase its alcohol content. Methanol is highly toxic to humans, and ingestion of just 10ml can result in blindness, and 30ml or more is usually fatal."
There have also been cases in Europe of deaths resulting from illegal alcohol production. In Italy in 1986, 23 people died from drinking methanol-adulterated wine, and a year previously, diethylene glycol was found to have been added to Austrian white wine to make it sweeter, but fortunately no-one died.
Alcohol is a poison and in large doses it can kill, says Dr Patton, and the danger with alcohol produced illicitly is that the consumer does not know what substances have been used to produce the liquor, or indeed how much alcohol is present.
In the UK alone, about 500 people go to accident and emergency departments each week with alcohol poisoning, he adds. |
Q:
How to change list Item appearance on item click.
In my application i have horizontal list view. On Item select I want to change that selected Item background color and it's text view color. i have figured out that part. But how to reset background color and text view color of previously selected item. here's my adapter class.
public class DateRangeListViewAdapter extends RecyclerView.Adapter<DateRangeListViewAdapter.ContentViewHolder> {
private ItemClickListener itemClickListener;
private LayoutInflater inflater;
private ArrayList<String> data;
private Context context;
private int dataType;
private int previousSelectedPosition;
private static final int DATE_TYPE = 1;
private static final int STATUS_TYPE = 2;
public DateRangeListViewAdapter(ArrayList<String> data, Context context,int dataType) {
this.data = data;
this.context = context;
this.dataType = dataType;
inflater = LayoutInflater.from(context);
previousSelectedPosition = -1;
}
public void setItemClickListener(ItemClickListener itemClickListener) {
this.itemClickListener = itemClickListener;
}
@Override
public ContentViewHolder onCreateViewHolder(ViewGroup parent, int viewType) {
View view = inflater.inflate(R.layout.custom_date_range_list_item,parent,false);
return new ContentViewHolder(view);
}
@Override
public void onBindViewHolder(ContentViewHolder holder, int position) {
String name = data.get(position);
holder.dateText.setText(name);
}
@Override
public int getItemCount() {
return data.size();
}
public class ContentViewHolder extends RecyclerView.ViewHolder implements View.OnClickListener {
private FrameLayout main;
private TextView dateText;
public ContentViewHolder(View itemView) {
super(itemView);
itemView.setOnClickListener(this);
main = (FrameLayout) itemView.findViewById(R.id.main_layout);
dateText = (TextView) itemView.findViewById(R.id.date_name);
}
@Override
public void onClick(View v) {
//Selected item color change
main.setBackground(ContextCompat.getDrawable(context,R.drawable.date_range_selected_item_background));
dateText.setTextColor(ContextCompat.getColor(context,R.color.colorPrimary));
if(itemClickListener!=null){
itemClickListener.onItemClick(v,this.getLayoutPosition(),dataType,getOldPosition());
}
}
}
public interface ItemClickListener{
public void onItemClick(View v, int position,int dataType,int oldPosition);
}
}
A:
You basically want to make good use of your int flag, previousSelectedPosition, to keep track of the list item's position that was clicked, invoke notifyDataSetChanged(), and then set the flag as part of a conditional statement within onBindViewHolder() to update ViewHolder's views accordingly as they continuously get binded. Try the following changes:
ViewHolder's onClick():
@Override
public void onClick(View v) {
if (itemClickListener!=null) {
previousSelectedPosition = getAdapterPosition();
notifyDataSetChanged();
itemClickListener.onItemClick(v,this.getLayoutPosition(),dataType,getOldPosition());
}
}
RecyclerView.Adapter's onBindViewHolder():
@Override
public void onBindViewHolder(ContentViewHolder holder, int position) {
String name = data.get(position);
holder.dateText.setText(name);
if (previousSelectedPosition == position) {
main.setBackground(ContextCompat.getDrawable(context,R.drawable.date_range_selected_item_background));
dateText.setTextColor(ContextCompat.getColor(context,R.color.colorPrimary));
} else {
// TODO: Configure the FrameLayout and TextView here for initial runtime as well as back to default
}
}
... and yes, make sure to keep previousSelectedPosition initialized as -1 for the initial runtime just so the condition in onBindViewHolder() wouldn't matter until the flag updates (after a list item is clicked, that is).
|
Industrial Shredder |
How to buy the best garden shredder - Which?
Take a look at our garden shredder Best Buys, to discover the models that we recommend. . have to shred, how you're going to dispose of the shredded garden waste . The roller action draws material through the machine, which can make it.
Shredders, Grinders and Shredder Systems for Recycling
WasteCare Corporation - Shredders, Grinders and other Waste and . the types of machines available and how to determine what type of shredder or grinder .. offer substantial discounts for prepared scrap and some will purchase and collect.
Waste Shredders - Untha UK Shredding Technologies
The UK's most comprehensive range of waste shredders designed to increase . UNTHA's machinery innovations have very much been marketplace-driven; the.
Build a Shredder — Precious Plastic
About the shredder. Plastic waste is shredded into flakes which will be used in the other machines to create new things. You can select the output size of these.
TWIN SHAFT SHREDDER - Agricultural Waste Shredder Exporter .
Applicable for shredding the waste plastic bags, these machines ensure safe and healthy environment as the plastic is not biodegradable. The shredding.
Shredding Construction and Demolition (C&D) Waste - Tana Oy
TANA Shark waste shredders can even produce high quality SRF from this . rotor screens and overband magnet this can be done with one machine in one.
Agriculture and Garden Waste Shredder Machines - Agri Waste .
Backed by rich industry experience, we are manufacturing and supplying high quality Agri Waste Chipper/shredder Machine (Engine Operated). Based on.
Industrial Shredders | C&D Shredders | MSW Shredders | Waste .
From the frame up, CBI builds industrial shredders to handle 100+ tons/hour of the most contaminated, co-mingled MSW waste streams you can throw at it.
Industrial Shredders equipment (Waste and Recycling) in Canada .
Results for industrial shredders equipment from UNTHA, Taskmaster, Ameri-Shred and other leading brands for waste and recycling. Compare and contact a. |
Q:
Selenium made a sendKeys for two fields instead of one for some reason
I made a pretty simple selenium test, where I want to open web page, clear field value, start entering text for this field, select first value from the hint drop down.
Web site is aviasales.com (I just found some site with a lot of controls, this is not an advertisement)
I did
DriverFactory.getDriver().findElement(By.id("flights-origin-prepop-whitelabel_en")).clear();
and it was working perfectly, I also checked via console that this is the only one object on a page like:
document.getElementById('flights-origin-prepop-whitelabel_en')
So, in next line I'm sending value:
DriverFactory.getDriver().findElement(By.id("flights-origin-prepop-whitelabel_en")).sendKeys("LAX");
but it send LAX value for both "flights-origin-prepop-whitelabel_en" and "flights-destination-prepop-whitelabel_en" for some reason, then i tried
DriverFactory.getDriver().findElement(By.id("//input[@id='flights-destination-prepop-whitelabel_en'][@placeholder='Destination']")).sendKeys(destinationAirport);
but I got the same result:
What could be a reason and how to fix this?
Thank you!
A:
Yep... there's some weird behavior going on there. The site is copying whatever is entered into the first field into the second for reason I don't understand. I gave up trying to understand it and found a way around it.
Whenever I write code that I know I'm going to reuse, I put them into functions. Here's the script code
driver.navigate().to(url);
setOrigin("LAX");
setDestination("DFW");
...and since you are likely to use these repeatedly, the support functions.
public static void setOrigin(String origin)
{
WebElement e = driver.findElement(By.id("flights-origin-prepop-whitelabel_en"));
e.click();
e.clear();
e.sendKeys(origin);
e.sendKeys(Keys.TAB);
}
public static void setDestination(String dest)
{
WebElement e = driver.findElement(By.id("flights-destination-prepop-whitelabel_en"));
e.click();
e.clear();
e.sendKeys(dest);
e.sendKeys(Keys.TAB);
}
You can see the functions but basically I click in the field, clear the text (because usually there's something already in there), send the text, and then press to move out of the field and choose the default (first choice).
|
This Deck is Smokin’ – Be Inspired By Matt Moran’s Rooftop Deck
#1 Decks recently installed the outdoor decking in Matt Moran’s Restaurant Smoke, a stunning rooftop bar with an outlook over the city and water’s edge, and the restaurant beneath known as ‘Bea’.
These stunning restaurants, both located at Barangaroo House in Sydney, are part of an award winning structure that incorporates the beauty of nature, with the outside clad in charcoaled timber, and a stunning explosion of greenery across three levels.
The deck at Barangaroo House is equally suited to residential projects. There are many long-lasting, quality products you can choose from to achieve this look, including both timber and composite options. Photo thanks to Cole Bennetts and Barangaroo House.
The Project
#1 Decks built 340 sqm of outdoor deck using Tallowood, which is a eucalypt wood native to NSW and Queensland. It is a highly durable and dense timber, which is resistant to decay due to its ability to withstand damp and wet conditions well.
The job was complex in accommodating the curved walls around the perimeter and had tight timeframes with many tradespeople working concurrently to complete the restaurant in time for Christmas.
We pre-oiled the boards prior to installation, ensuring moisture would not affect the boards from underneath. This, combined with the aluminium subframe, ensures longevity of the deck.
The deck at Barangaroo House is equally suited to residential projects. There are many long-lasting, quality products you can choose from to achieve this look, including both timber and composite options. Photo thanks to Cole Bennetts and Barangaroo House.
Non-Slip Surface
We were able to achieve a P4 Non-Slip Rating, the highest rating available, by using an eco crystal protective coating. This commercial grade product is also an excellent choice for residential projects, especially around pool areas.
Would you like a stunning outdoor deck in your home?
Tallowood was chosen for Barangaroo House as it is beautiful and durable wood. We have many other natural timber options that can achieve an equally impressive silhouette and also, an abundance of long-lasting highly durable and attractive composite products, which have become incredibly popular in recent years.
–
Request a callback today. We will discuss the best options for creating the ideal outdoor deck that suits your lifestyle and budget.
#1 Decks were very professional. They helped us design our deck, gave feedback about our ideas – what would work and what might be the most cost-effective – and then did everything they promised in the time in the time promised. The en…
Greg & Renee Peddie
Hi Darren, Just letting you know that we’re thrilled with the deck. It’s exactly what I was after and he did an amazing job. Thank you also for everything, you guys were super reliable and on time. Thanks Again….
Bec & Pete
#1 Decks exhibited professionalism, knowledge, punctuality and flexibility. They did a truly outstanding job and I would use him again and would recommend them to friends and family….
Steve & Vivian Pollard
#1 Decks did a great job with our project. From the first appointment to the final payment, they arrived when they said they would and did what they said they would do.It was a great experience dealing with them, and I would definitely reco…
Neil & Lauren Moodley
We chose #1 Decks because of their level of knowledge we realised they had, after that first meeting. It was also nice to see a tradesman stay true to his word and keep turning up when he said he would. The finished pergola was of the highe…
Geoff & Barbra Spotswood
We had a fantastic experience with #1 Decks. My husband and I are very busy with work and Darren and his team made this a very smooth project. The team were very polite and were there on time every day. We are thrilled with our new outdoor … |
Q:
Variable is not in scope error when relay-compiling Relay Modern code
I have the following simple Relay Modern code:
import React, { Component } from 'react';
import PropTypes from 'prop-types';
import {
QueryRenderer,
graphql
} from 'react-relay'
import environment from '../../../../../environment'
const CompanyItemQuery = graphql`
query CompanyItem_Query {
node(id: $companyId) {
id
...on Company {
id
name
}
}
}
`
class CompanyItem extends Component {
render() {
return (
<QueryRenderer
environment={environment}
query={CompanyItemQuery}
variables={{
companyId: 'test',
}}
render={({error, props}) => {
<div>
<p>Relay loaded {props.name} company</p>
</div>
}}
/>
);
}
};
export default CompanyItem;
I'm trying to relay-compile the code before running and I'm getting the following error:
> relay-compiler --src ./src --schema ./src/data/schema.graphql
HINT: pass --watch to keep watching for changes.
Parsed default in 0.08s
Writing default
Invariant Violation: RelayApplyFragmentArgumentTransform: variable `companyId` is not in scope.
at invariant (D:\DEV\WORKSPACE\client\node_modules\fbjs\lib\invariant.js:44:15)
at transformValue (D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4505:28)
at D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4497:18
at Array.map (native)
at transformArguments (D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4496:16)
at transformField (D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4417:15)
at D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4476:24
at Array.forEach (native)
at transformSelections (D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4461:15)
at transformNode (D:\DEV\WORKSPACE\client\node_modules\relay-compiler\bin\relay-compiler:4385:21)
npm ERR! Windows_NT 10.0.14393
npm ERR! argv "C:\\Program Files\\nodejs\\node.exe" "C:\\Program Files\\nodejs\\node_modules\\npm\\bin\\npm-cli.js" "run" "relay"
npm ERR! node v6.9.2
npm ERR! npm v3.10.9
npm ERR! code ELIFECYCLE
npm ERR! mom-client@3.0.0 relay: `relay-compiler --src ./src --schema ./src/data/schema.graphql`
npm ERR! Exit status 1
npm ERR!
npm ERR! Failed at the mom-client@3.0.0 relay script 'relay-compiler --src ./src --schema ./src/data/schema.graphql'.
npm ERR! Make sure you have the latest version of node.js and npm installed.
npm ERR! If you do, this is most likely a problem with the mom-client package,
npm ERR! not with npm itself.
npm ERR! Tell the author that this fails on your system:
npm ERR! relay-compiler --src ./src --schema ./src/data/schema.graphql
npm ERR! You can get information on how to open an issue for this project with:
npm ERR! npm bugs mom-client
npm ERR! Or if that isn't available, you can get their info via:
npm ERR! npm owner ls mom-client
npm ERR! There is likely additional logging output above.
npm ERR! Please include the following file with any support request:
npm ERR! D:\DEV\WORKSPACE\client\npm-debug.log
I can't find out why my variable companyId is not in scope, as it is defined in the variables section of the QueryRenderer as stated in the documentation.
If I use a fixed value for id (example node id: "Company:59b2cda12504b914cc398100") code is relay-compiled and I can get my data fetched normally. The problem arises when I need to choose the id dynamically.
A:
It looks like you missed declaring the variable (and type) in the query name - so this:
query CompanyItem_Query($companyId: ID!) {
instead of this:
query CompanyItem_Query {
You can see more context in the example on the relay site -
https://facebook.github.io/relay/docs/query-renderer.html
|
Q:
Lazy property loading in Nhibernate and Spring
I'm using NHibernate 2.1.2 and Spring 1.3
I have two Text columns (blobs) in one of my classes. I'm trying to use lazy="true" for the mapping of those properties but NHProfiler still shows the two columns being added to the SELECT statement when the main object is loaded.
I'm using Spring.NHibernate session factory and have configured ProxyFactory with both Castle and Spring with no luck.
A:
So far I know that's something NOT included on the version 2.1.2
According this url, lazy properties is something quite new and it's already on the trunk ready to be released on next version
http://ayende.com/Blog/archive/2010/01/27/nhibernate-new-feature-lazy-properties.aspx
You can download the current trunk code or wait to 3.0 version :-)
https://nhibernate.jira.com/secure/ReleaseNote.jspa?projectId=10000&version=10293
|
If this is your first visit, be sure to
check out the FAQ by clicking the
link above. You may have to register
before you can post: click the register link above to proceed. To start viewing messages,
select the forum that you want to visit from the selection below.
One line summary - Windows installed in Master drive, use BIOS to boot Slave ahead of Master, install Linux in the slave and use the slave's MBR to multi boot- to go back just reverse the boot sequence
Assuming the Windows is in the Master drive and boots up as normal to start with.
Use Bios to select the slave to boot ahead of the master drive so that Linux can be installed into the slave
Create a partition for the Linux and also a swap partition.
Instruct the installer to intall the Linux in pre-arranged partitions. Ask the bootloader to be install into the MBR which now goes only to the Slave disk. Linux can be installed and booted from either a primary or logical partition.
On reboot the Linux will be booted by its boot loader in the Slave's MBR. The Windows may need the disk order "re-mapped" before it can be booted.
If the Linux uses Grub make sure the following lines are in /boot/grub/menu.lst
The red statements "re-map" the 1st and 2nd disks "on-the-fly". Grub counts from 0 so (hd0) is the 1st bootable disk.
Anytime you don't want to see a trace of Linux just reverse the boot sequence in the BIOS.
Your Windows MBR in the master disk is untouched like a virgin.
Section B : Single hard disk with a floppy drive
One line summary - Use a fllopy or a CD to boot Linux. Windows automatically booted without the floppy or CD
Try to squeeze two partitions out of the hard drive. One for Linux in the second primary partition after Windows and one for swap which can be in a primary or logical partition. The write-up assumes Linux is in the second primary partition of the disk and so adjustment to the partition reference is needed if your case differs.
Assuming Windows installed first and working normally in the first primary partition.
Boot up the CD and install the Linux in the created second primary partition.
Must not allow Linux to place bootloader in MBR, instruct the installer to install its boot loader inside its root partition.
After the Linux installation completed and rebooted there should be no trace of Linux.
Having satisfied that only Windows is available without Linux go to distowatch to download a Live CD from either Mepis, Puppy, Ubuntu or Damn Small Linux and burn it into a CD.
Boot up this Live CD and ask Linux to report to you the directory it stores Grub's stage1 and stage2 files by this command
Code:
find / -name stage1
You then change directory to it and create a Grub bootable floppy unattached to an operating system by using Linux's dd command. I am using the directory location from Mepis Live CD but do adjust the directory name if you source the stage1 and stage2 from another Linux.
This Grub floppy can boot any PC system manually. I have not been able to find a PC operating system that cannot be booted by it. For laptop user you can generate the Grub floppy using a friends PC and burn the floppy into a CD using the method described at this site.
The Grub floppy (or CD) boot up a Grub prompt only but your Windows can be booted by the following instruction
Code:
root (hd0,0)
chainloader +1
boot
and your Linux too with the same instructions except you advance the partition reference by 1 as follow (Grub counts from 0 so (hd0,1) is the 2nd partition of the 1st disk)
Code:
root (hd0,1)
chainloader +1
boot
There may come a time you no longer wish to type the instruction manually. In such a case you put the Linux's own boot loader in a floppy when you are using the Linux.
Pop a floppy into the drive. If it uses Lilo your type
Code:
lilo -b /dev/fd0
If the Linux uses only Grub the equivalent command is
Code:
grub-install /dev/fd0
The second floppy can boot up the Linux without any typing.
So without the use of a floppy or CD Windows will boot. Put in the floppy or CD Linux boots up instead.
Your Windows MBR is untouched like a virgin.
Section C : Single hard disk and no fllopy drive
This is a technique of using Windows MBR to boot Linux ( or BSD or Solaris)
One line summary – Put Grub in a data-only Fat primary partition and switch on its booting flag. Windows MBR will faithfully load Grub into memory. Grub can then boot all systems installed in the PC
(A) Introduction
Windows MBR does not have a target to boot. It only searches from the 4 primary partitions of the bootable hard disk and loads the first one that has the booting flag switched on. One can make use of this behaviour to let it boot up GNU/Grub, a boot loader developed for Linux but can be installed without an operating system. If we put Grub into an “active” data-only Fat primary partition then Grub becomes available to multi boot other systems.
The write-up below is mainly for Linux as Grub is sourced from it. By expanding its booting menu Grub can be used boot 100+ systems. The booting of BSD and Solaris is not fully described here because the method is identical to the case of Grub booting a Windows. See above link for more explanations.
(B) Theoretical explanations of why the scheme works
(1) As a boot loader Grub is in binary pattern. It has no filing structure so it can be put into any filing system. Windows MBR boots a Fat partition which Linux can read and write.
(2) A data-only primary partition has no operating system inside and its reserved boot sector is unused and empty. Putting Grub there does no harm and creates no inconvenience.
(3) All Windows versions have a facility for marking another partition “active” and so it is possible to switch the booting alternative to a data-only primary partition. The data partition boots if Grub is installed inside.
(4) Grub is a rare boot loader that can be installed without an operating system.
(C) Necessary conditions
(1) The partition hosting Grub must be a primary type.
(2) The partition hosting Grub must be in Fat12, Fat16 or a Fat32 format. Linux does not yet write on NTFS partitions. Put Grub in a non-MS partition will not attract Windows MBR attention.
(D) Some known features
(1) For the purpose of hosting Grub the primary Fat partition can be very small. Only 3 files are needed; stage1 is 512 bytes, stage2 is less than 150 k bytes and menu.lst is a text file with only a few lines.
(2) For the hosting Grub only the fat partition is not subjected to the usual DOS restrictions, as no Dos system is used. Thus the Fat data-only partition can be created in a Sata disk and at the end of a 300Gb disk.
(3) The menu.lst in the data-only partition if omitted will force Grub to boot to a Grub prompt whereby the user has to boot up each system manually. The optional menu.lst is just a script file to execute the same commands automatically.
(E) Application area
The method outlined here enables a Windows user to install and boot up Linux , BSD and Solaris systems with absolutely no alteration to the Windows system and its MBR.
The method has been written to suit for PC users without access to a floppy drive.
(F) Implementation
(1) Resize the hard disk to make available unallocated space for about 6Gb. For first-timer a 5Gb partition for Linux, 0.5 Gb for Swap partition and 0.5 Gb for a data-only primary Fat partition. The latter can be omitted if there is an existing data-only primary partition available. Both Linux and Swap can be in logical partitions. Linux comes in more than one CD or in a DVD may need 10Gb on its own. Solaris may need 15Gb. Partition for a BSD is similar to a Linux. Solaris and BSD systems needed to be installed in primary partitions. The only exception I am aware of is NetBSD which can be accommodated in a logical partition.
(2) Download a Linux Live CD iso image and burn it into a CD. Ideal one should have “Grub” and “Qtparted” inside, like Kanotix or Knoppix. The Live CD can be used just as a tool and different to the one finally installed. The “Qtparted” can be used for resizing the hard disk and creating the necessary partitions. For the purpose of description I assume the disk is IDE type and so hda1 is the Windows, hda2 the data-only Fat partition, hda3 the Linux partition and hda4 the swap. Had the Linux and Swap been formed as logical partition it would be named automatically as hda5 and hda6, as the first 4 are reserved for primaries only. If the disk is a Sata type then all “hda” will have to change to “sda”. It is a good practice to reboot the system after partitions have been created. The other partitioning tools in Linux are the “fdisk” and “cfdisk” in command mode and they are more versatile in supporting Solaris and various BSD partition types.
(3) There is no need to format the two Linux partition as every Linux installer will want to do itself. Only the data-partition if created new will need to be formatted. This can either be done in Windows or in Linux Live CD. To format a Fat16 partition of hda2 in Linux terminal command is
Code:
mkdosfs –F16 /dev/hda2
(4) Install Grub into the data partition hda2. This is done by booting up with the Kantotix, which uses Grub as the boot loader, made a /mnt/hda2 directory, mount it and ask Kanotix to tell us where has it stored Grub’s stage1 (stage2 is always stored together with stage1).
Code:
mkdir /mnr/hda2
mount /dev/hda2 /mn/hda2
find / -name stage1
Kanotix should report back the files found in /KNOPPIX/lib/grub/x86_64-pc, so made a /boot/grub directory in /mnt/hda2 and copied the two files across.
if another Live CD is used just change the directory reported by your Live CD in the above two lines. It is essential that stage1 and stage2 to be stored only in the /boot/grub directory of hda2 because that is where Grub will look for them.
Now is the time to invoke a Grub shell inside Kanotix
Code:
grub
Grub can be formally set up inside hda2 by these commands in Grub shell
Code:
root (hd0,1)
setup (hd0,1)
makeactive
The last statement makes the PC boot hda2 instead of Windows in hda1.
(5) The system should be tested so that a user knows the basic steps to survive in booting. Reboot the system at this point will fire up Grub to a command prompt without any trace of Windows. Don’t panic as this is precisely what it should be. You can get your Windows back immediately by booting it manually with these line in Grub prompt
Code:
root (hd0,0)
makeactive
chainloader +1
boot
Since Windows partition becomes active rebooting the PC will return back to Windows and not Grub in the data-only hda2 partition. If you want to boot back to Grub in hda2 just do the following before you exit Windows
Click My Computer/Manage/Storage/Disk Management and then right click hda2 to select “to make partition active”
When you boot to Grub there is no system available except the commands in Grub prompt. You can make Windows partition active any time by the commands
Code:
root (hd0,0)
makeactive
To look at what commands you can use in Grub the command is “help”. To view the partitioning scheme of your hard disk you type “geometry (hd0)", to reboot just type “reboot” and to power down is “halt”.
(6) Although not straightly necessary it would be a “cool” thing to do by writing a booting menu yourself and have it ready before you even install the Linux. You can do this in Windows, use notepad only as the booting menu must be a text file called menu.lst in the \boot\grub directory of hda2 which should be your drive “D”. So just create \boot\grub\menu.lst with the following lines
This file should be in your “D” drive. If created it will be seen the next time when you boot up hda2. You can still use the Grub prompt by press “c”. Hda3 is not yet bootable because you have not yet installed a Linux inside hda3 yet.
(7) Now install a Linux (or Solaris or BSD) of your choice. Pay attention to the questions and instruct the installer to install the Linux into hda3. This is usually asking the installer using hda3 as the root “/” of the Linux. The installer should automatically know what to do with the swap partition. The critical issue in a Linux installation is to insist the boot loader to be installed in its root partition. Under no circumstance allow the boot loader go to the MBR. On completion of a full installation your Linux can be booted by the menu.lst you have created. Linux is born to multi boot. During installation it will check hda1 and hda2 and realise Windows MBR and Grub are inside respectively and so it could build up a menu to both these two partitions inside hda3. Thus you may end up hooping between hda2 and hda3 partitions and able to fire up Windows from either of them.
(8) The Linux you choose can have any type of boot loader. It can be a BSD, a Solaris or a Darwin x86. As long as you deny the system to install its boot loader into the MBR it has no alternative but to put the boot loader inside its root partition. That makes the system “chainloadable” by Grub. A Linux partition does not need to be active in order to be booted up. Neither does a BSD or a Solaris if it is booted by Grub. Windows is the only exception that needs its boot flag “switched on” when being booted.
(9) There is no harm done if you do make a mistake overwriting Windows MBR with a Linux (or another system’s) boot loader because you can always restore the Windows MBR either by a Windows installation CD (any one from Win2k or XP) or a Freedos CD downloadable from the Internet.
With the former you boot up the installation CD and wait until you can press R to opt for the Recovery Console where you just type
Code:
fixmbr
exit
The Freedos offers a CD ios image which you can burn and boot up to a Dos prompt. You can then type
Code:
fdisk /mbr
Either method will get your Windows MBR back. If the user has an access to a bootable floppy drive the Windows MBR can also be restored using the command identical to the Freedos CD.
A bootloader is put into the first block of a Linux partition and its location is known as the superblock. When the superblock is the first primary partition it is the MBR.
Each method is in fact very simple and seen fully in two lines of red text. There is no amendment at all to either the installed Windows or Linux.
The Section B is a old DOS trick used by a program called System Commander which activates/deactivates partitions during booting.
Method A is even simpler by using the BIOS boot sequence to achieve switching away from Windows.
The long text are exact steps to achieve the objective. The switching is semi-permanent and done only once. It is needed again only when one wants to dispose one of the systems. Funny enough I wrote only Section A initally but added Section B for the laptop users.
These methods are based on the characteristic of the hdd and nothing else.
I do agree the simplest method is to have a bootable floppy for the Linux but the hdd booting does opens the door for adding unlimited number of distros and have all of them bootable from one menu.
Do you guys think I should erase the long steps and leave just the red summaries in?
I think the "long text" is needed. After all, these tips are primarily for people not so familiar with things like this, don't give them just a command but tell them how things work.
I also agree that it's best to leave that virgin untouched - she's so picky she could easily wreck your Windows for no reason.
I always preferred mature women...
I was just wondering if fdisk for DOS actually allows you to set a second primary partition active?
I haven't tried that, the reason for me wondering is that as far as I know DOS doesn't allow more than one primary partition.
If you've tried it and it works, please conform it here. It's good to know.
I confirm that it works. Got 7 PCs at home with 18 hdds to play with (most on mobile racks/caddies) so I did a test to satisfy myself because there is nothing new in it. I got the inspiration from you and convinced that there is another way to leave Windows alone. The suggested methods can also leave the Linux untouched so we are getting lazier all the time.
DOS doesn't allow more than one partition active.
Linux can mark two active partitions but DOS switches off the other one as soon as I order a target partition to be made active.
The system works fine for Knoppix as I installed Version 3.3 on a slave and later installed Version 3.4 in the master at the rear of Windows just to prove both Section A and B are workable.
The method may runs into trouble with some distros that needs to reboot to finish the second part of the installation. In such a case it could find itself boot to Windows because Windows' MBR has not been touched. That is the case for Suse. To overcome the problem one has to install another distro in like Knoppix to get the system working first.
Regardless whether newbies are interested in the proposed methods they will find out sooner of later that this is how the a hard disk actually behaves. Thus the information is beneficial to know.
Well, I would have loved to have seen this thread before I just tried installing my first Linux, but now I have screwed things up it seems.
I installed Mandrake 10.0 (for no particular reason I chose that one) on my second harddrive, which I had swiped. Installation goes fine, and at the end of install it askes a question about MBR. So I say put it on primary? harddrive, I think. Anyway, I think that's where it did it, because it messed up the crappin' DDO on my primary harddrive with Windows on it, which I need.
Now I have heard that with Lilo (which I think is installed on my system, I get choices like linux, failsafe, 263-7, and some other one) you can choose to boot to Windows. I don't see that option, so I unplug Linux drive (which is becoming the bane of my existance) and try booting from only the one Windows harddrive. Unfortunately, as stated above, something is messed up there. Lilo and DDO not made to be partners?
What happens is that I get the "Now loading OS..." BIOS message, and then about 103 "99s" in a row. WTF? Obviously, Windows is not going to load.
I think to myself, oh sh*t, now I'm going to lose a lot of time reinstalling everything, which I am perfectly capable of doing. However, I don't want the hassle of doing that, plus losing whatever I didn't have backed up. What can I do?
I would be happy booting Windows, and don't care about anything else at the moment. Linux will be more fiddled with at a later date, using methods described above.
What happens is that I get the "Now loading OS..." BIOS message, and then about 103 "99s" in a row. WTF? Obviously, Windows is not going to load.
No need to reinstall everything just insert cd#1 in cd-drive when it boots up hit f1 then type rescue then select either reinstall boot loader or reinstall win bootloader hit enter and reboot remove cd all should be ok then. I have had this hapen a few times lilo didn't get installed properly during install no biggie.
A fair comment. I am lucky in using a 200Gb hdd not knowing what the heck of the limitation of the 1024 cylinders in Lilo is all about because all the hard work has been done before I started learning Linux. Grub does seem to have the same trouble though.
DimGR
I will try your suggestion later on but I love the Linux bootloaders because they are so simple. Either Lilo or Grub can chainload as many systems as I want. I have about 13 now including a XP and I frequently switch the Linux to take over as the boot manager for the rest by amending its /boot/grub/menu.lst (for Grub) or /etc/lilo.conf (for Lilo).
In practical term it is easier to use the MBR because many Linux systems have a two stages installation and need a reboot to complete. Thus one need to know how to deal with booting and have a few floppies to switch things around.
In playing around with 15 to 18 Linux distros with XP in the hard disk I have the MBR overwitten by Grub and Lilo countless number of times. So far I have never experienced any difficulty to restore the MBR for my XP. In fact I no longer bother with the original XP CD and just use a old DOS floppy to Fdisk /mbr. Therefore losing the MBR temporary cannot be a big deal.
Well, I just got booted into Windows finally. I'm going to enjoy that for a while, and then come back to Linux.
How I did it: Put in CD1 of Linux, reinstalled bootloader and bootloader for Windows, then tried rebooting. No OS to boot from is the report. So, in goes Windows boot disk, go to c: which is nice to be able to see, and snoop around in those directories a little. Or at least try to. It gives me an unreadable sector error, so I decide to try scandisk. Scandisk gives me warnings about IDE translation no being set up correctly, so I quit that and go to BIOS. There, IDE transaltion was set to CHS, so I set to automatic detection. Restart, voila, Windows screen. Yay.
I hope to experiment with Linux again soon, and will try to get that working. I'm thinking I will just use a boot disk designed to boot Linux. That is a common method, no?
hi saikee
i have 2 hddisk. 1st hddisk is XP and the 2nd gonna be mandrake 10. is it ok if I unplugged the 1st hddsik. and then install mandrake in 2nd hdd.? will the LILO/grub in the 2nd hdd(primary slave drive)? |
As a physician, you may be experienced at managing clinical outcomes, but how adept are you at billing? It can mean the difference between getting reimbursed for the correct amount or getting denied. DECA Health provides third party billing excellence that will improve your financial performance and reduce your stress. |
[Mutation BRCA1 gene in 186 breast cancer patients].
To analysis the mutation of BRCA1 gene in 186 breast cancer patients. Polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP) and sequential were used in this analysis. 13/186 of patients showed mutation which comprised 7% of the total number of patients. In 8 patients, the mutation was observed in the intron splicing region and in 5 patients, the mutation was on the exon. Mutation analysis of BRCA1 gene is helpful in the determination of developmental potential, early diagnosis and gene therapy for breast cancer. |
Q:
Odd BJT circuit
This circuit came in my today's exam. It asked to find every base, emitter and source current.Base emitter voltage .8 and \$\beta\$ for both BJT is 49.
first I tried normally where \$I_B\$ found that it is coming out from n type BJT and go into p type BJT which is not possible.
simulate this circuit – Schematic created using CircuitLab
I also try for \$Q_p\$ saturation \$Q_n\$ active ; \$Q_n\$ saturation \$Q_p\$ active and both saturation. Every time I've found some impossible values which cancel that option.
same thing happen to my other friends.
Is there any other condition I didn't consider?
Is there any other situation or special situation happen?
A:
Note that Qp is flipped collector to emitter from normal operation. However, it is still a P-N-P sandwich, so will still function as a PNP transistor with collector and emitter flipped, although its gain will be lower. It's C-B junction is forward biased, so you can assume the usual junction drop.
I'd start to analyze this assuming the gain of both transistors is infinite with something like 700 mV B-E drop and 200 mV in saturation. For this purpose, simply pretend the E and C of Qp are swapped. As I said above, it will still function as a transistor that way, just with lower gain than if used normally.
After you get a good idea what this circuit is doing with the above simplifying assumptions, you can go back and use some plausible finite values for the gain, if you think the answer is expected to have that level of detail.
Real transistor circuits usually need to be designed to work with transistor gain from some minimum value to infinity. Good circuits won't change their operating points much over that range. A really good answer to this question would be showing what the range of operating points are as the gain of Qp varies from 20 to inifinity and Qn from 50 to infinity, unless of course you were given more specific parameters you haven't told us about.
A:
The collector junction of Qp and emitter junction of Qn - forward biased.
The collector junction of Qn and emitter junction of Qp - reverse biased.
now the base current of Qn is, $$I_{Bn} = \frac{V_1 - V_{BEn} - V_{CBp}}{R1+R5+(\beta+1)R4}$$
then,
$$I_{Cn} = \mathrm{min}(\beta I_{Bn}, I_{Csat})$$
where $$I_{Csat} = \frac{V_1-V_{CEn}}{R_4+R_3}$$
The voltages you can calculate as.
$$V_{En} = R4\times(I_{Bn}+I_{Cn})$$
$$V_{Cn} = V_1 - R3\times(I_{Cn})$$
$$\text{so on ...}$$
|
That shouldn’t be a surprise. For years, our increasingly polarized political system has been culling moderate members. To see this in video form, click the clip below. It’s a visualization of congressional polarization beginning with the very first Congress and running right through today. And if you fast forward toward the end, where we are, you’ll see the pattern progress right in front of you: The Ds and the Rs in the middle — those are the centrists — keep disappearing, and the masses of Ds and Rs keep moving farther away from each other.
That’s American politics today: two parties, no touching. And that’s part of why Snowe is retiring. “[W]hat I have had to consider is how productive an additional term would be,” Snowe said in a statement. “Unfortunately, I do not realistically expect the partisanship of recent years in the Senate to change over the short term.”
She’s right. The partisanship of recent years is not likely to change over the short term. In fact, it’s likely to get worse. Snowe will probably be replaced by a liberal Democrat. Nelson will probably hand his seat to a conservative Republican. The parties will become that much more unified, disciplined and polarized. And that’s okay. Or, at least, it would be okay if America’s political institutions were prepared for it.
We use “polarization” as an epithet. It’s what’s wrong with America’s politics. It’s what’s wrong with America’s political parties. It’s what’s wrong with America’s politicians. It’s what’s wrong, finally, with America.
And polarization is certainly bad for moderate legislators who want to wield influence by brokering deals between the two parties. But for the political system as a whole, “polarization” is a neutral term. It simply means the two parties disagree, and clearly. It doesn’t mean they disagree angrily or unproductively or in service of extreme ideologies.
To imagine this, consider two political systems. In one, the two parties aren’t polarized, because the Democratic Party is filled with conservative arch-segregationists. In another, the parties are very polarized, but it’s because everyone agrees segregation was a moral blight, and with that out of the way, the conservative Democrats who kept their seats by appealing to racism were replaced by Republicans. Which system is more extreme? Or unproductive? Or hateful?
Polarization doesn’t describe people’s opinions. It just describes how those same people, with those same opinions, sort themselves. For political scientists, it was long a puzzle and a frustration that the Democratic Party contained so many conservatives and the Republican Party so many liberals. But race was the reason for much of that, and as race has receded as a driving force in American politics, the two parties have sorted themselves in a more sensible way. The problem is, the political system hasn’t responded.
Our system, as any historian will tell you, was built by men who hated parties and anticipated their absence from American politics. That didn’t quite work out. But for much of American history, and particularly for much of the 20th century, our political parties have been unusually diffuse and unable to act as organized, ideological units. That left them well-suited to a system that, for reasons ranging from the division of powers to the filibuster, required an unusual level of consensus to function.
But as the two parties have polarized, we’ve learned that a system built for consensus is not able to properly function amid constant partisan competition. The filibuster has gone from a rarity to a constant. Compromise has become rare. Crises of gridlock, such as the recent showdown over the debt ceiling, have become common. And no one can say that this is what the American people want: The approval ratings of Congress have been on a downward slide for decades, and they have never been lower than they are today.
Snowe’s retirement will have many lamenting the endangered moderate and wondering how we can turn back the clock. But we can’t. About that, Snowe is right. Polarization is with us now and will be with us for the foreseeable future. The question is whether we will permit it to paralyze our political system and undermine our country or whether we will accept it and make the necessary accommodations.
Doing so would require taking on cherished, consensus-promoting features of the old system, like the filibuster. But in today’s girdlocked world, those features no longer promote consensus. They simply promote gridlock. |
/// Copyright (c) 2012 Ecma International. All rights reserved.
/**
* @path ch15/15.2/15.2.3/15.2.3.6/15.2.3.6-3-24.js
* @description Object.defineProperty - 'enumerable' property in 'Attributes' is own data property that overrides an inherited data property (8.10.5 step 3.a)
*/
function testcase() {
var obj = {};
var accessed = false;
var proto = {};
Object.defineProperty(proto, "enumerable", {
value: false
});
var ConstructFun = function () { };
ConstructFun.prototype = proto;
var child = new ConstructFun();
Object.defineProperty(child, "enumerable", {
value: true
});
Object.defineProperty(obj, "property", child);
for (var prop in obj) {
if (prop === "property") {
accessed = true;
}
}
return accessed;
}
runTestCase(testcase);
|
I came across an article about how the SA government was tracking women in hiding by tracing their IMEI number on their GSM cell phones. IMEI is similar to a MAC address for mobile and is tied to a device regardless of SIM card changes.
On CDMA phones there is an equivalent, the Mobile Equipment Identifier (MEID) string. |
Q:
Matlab move image
How would I move an image along the x or y axis by clicking a button?
I have imported the image with 'image = imread('image.jpg');' and then use 'Left = uicontrol('Parent', gcf, 'Style', 'pushbutton', 'String','Left',...', but I am stuck there. I would like to move the image in any direction.
A:
You can create a simple callback function for the pushbutton, that changes XLim and YLim properties of axes showing the image.
Save the original limits:
xl = xlim;
yl = ylim;
For example to move image to the left:
step = 5; %# move by 5 pixels
xlim(xlim+step)
To move up:
ylim(ylim+step)
To restore the original position:
xlim(xl)
ylim(yl)
UPDATE:
Here is a working sample code (without using GUIDE):
im = imread('pout.tif');
imshow(im);
step = 5;
xl = xlim;
yl = ylim;
pbLeft = uicontrol('Parent', gcf, 'Style', 'pushbutton', 'String','Left', ...
'Units','norm', 'Position', [0.4 0.05 0.1 0.05], 'Callback', 'xlim(xlim+step)');
pbReset = uicontrol('Parent', gcf, 'Style', 'pushbutton', 'String','Reset', ...
'Units','norm', 'Position', [0.5 0.05 0.1 0.05], 'Callback', 'xlim(xl);ylim(yl);');
pbRight = uicontrol('Parent', gcf, 'Style', 'pushbutton', 'String','Right', ...
'Units','norm', 'Position', [0.6 0.05 0.1 0.05], 'Callback', 'xlim(xlim-step)');
pbUp = uicontrol('Parent', gcf, 'Style', 'pushbutton', 'String','Up', ...
'Units','norm', 'Position', [0.5 0.1 0.1 0.05], 'Callback', 'ylim(ylim+step)');
pbDown = uicontrol('Parent', gcf, 'Style', 'pushbutton', 'String','Down', ...
'Units','norm', 'Position', [0.5 0.0 0.1 0.05], 'Callback', 'ylim(ylim-step)');
|
Last updated on .From the section Football
Tottenham exited the Europa League despite staging a second-half fightback against Benfica that put them close to taking the tie to extra time.
Ezequiel Garay headed in to put the hosts 4-1 up on aggregate.
But with the tie seemingly over, Nacer Chadli scored twice in a minute.
Spurs almost grabbed another as Gylfi Sigurdsson's injury-time header was saved, but Benfica made it 2-2 on the night and 5-3 overall when Lima scored from the penalty spot.
Brilliant Benfica Tottenham were within seconds of becoming the first side to beat Benfica since Olympiakos's Champions League victory on 5 November 2013
Having been outclassed in the first leg of the last-16 tie and looking weary in Lisbon, Tottenham's late surge almost inflicted Benfica's first defeat in 23 games in all competitions.
But Sandro's barge on Lima gifted the hosts a chance to level the scores and the Brazilian substitute sent Brad Friedel the wrong way with the last kick of the game.
Despite the aggregate defeat, Tottenham at least showed the character that boss Tim Sherwood desired prior to kick-off.
With late chances for Sigurdsson and substitute Harry Kane, who also had a penalty appeal turned down, Spurs could have taken victory but they will look back on their 3-1 first-leg defeat as the reason for their exit.
The fact they salvaged a draw with an injury-hit squad against last season's runners-up will be pleasing for Sherwood, who saw his team end a run of three successive defeats.
Benfica survive a late Harry Kane penalty appeal which would have taken the tie to extra time
Spurs are fifth in the Premier League, on course to qualify for next season's Europa League, but it remains to be seen if Sherwood will be at White Hart Lane after the club was strongly linked with Louis van Gaal.
Sherwood has publicly criticised his players in recent weeks and he called for leadership from his side, who were without a recognised centre-back - midfielder Sandro and full-back Ezekiel Fryers deputising in the heart of the defence.
But they began slowly and, after Roberto Soldado scuffed a shot at the back post and then fired over from close range, Garay's first-half goal put a technically superior Benfica in control.
Sherwood decided to watch from the stands after his fall-out with Benfica manager Jorge Jesus in the first leg. He was still infuriated after his side wasted a good free-kick opportunity a minute before the opener, with captain Aaron Lennon making a feeble challenge on Eduardo Salvio, who chipped a cross to team-mate Garay.
In the first half, there were signs of promise from a young Spurs side on the counter attack and Andros Townsend shot wide in one decent opportunity after the break.
Then, with 12 minutes left, Chadli cut in from the right before firing a shot past Benfica keeper Jan Oblak.
A minute later, the Belgian winger pounced on Kane's header from Lennon's cross to put Spurs within reach of extra time.
Three excellent chances followed but Oblak made two good stops before Lima equalised for the relieved hosts. |
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development programs, an active, caring owner and players lining up around the block to play with this prestigious organization.
Nowadays, however, the Red Wings are a mere shell of the former empire they had. Where did everything go wrong? This video will attempt to explain their decline over the past decade. Even worse, what the future may hold for this once-great organization.
My condolences, Red Wings fans.
As of 2016, the Red Wings have won the most Stanley Cup championships (11) of any NHL franchise based in the United States, and are third overall in total NHL championships, behind the Montreal Canadiens (24) and Toronto Maple Leafs (13). They play home games in the 20,066 capacity Joe Louis Arena after having spent over 40 years playing in Olympia Stadium. The Red Wings are one of the most popular franchises in the NHL, and fans and commentators refer to Detroit and its surrounding areas as "Hockeytown," which has been a registered trademark owned by the franchise since 1996.
Malcolm X
MalcolmX (/ˈmælkəmˈɛks/; May19, 1925–February21, 1965), born Malcolm Little and also known as el-Hajj Malik el-Shabazz (Arabic:الحاجّ مالك الشباز), was an American Muslim minister and a human rights activist. To his admirers he was a courageous advocate for the rights of blacks, a man who indicted white America in the harshest terms for its crimes against black Americans; detractors accused him of preaching racism and violence. He has been called one of the greatest and most influential African Americans in history.
MalcolmX was effectively orphaned early in life. His father was killed when he was six and his mother was placed in a mental hospital when he was thirteen, after which he lived in a series of foster homes. In 1946, at age 20, he went to prison for larceny and breaking and entering. While in prison, MalcolmX became a member of the Nation of Islam, and after his parole in 1952, quickly rose to become one of the organization's most influential leaders. He served as the public face of the controversial group for a dozen years. In his autobiography, MalcolmX wrote proudly of some of the social achievements the Nation made while he was a member, particularly its free drug rehabilitation program. In keeping with the Nation's teachings, he promoted black supremacy, advocated the separation of black and white Americans, and rejected the civil rights movement for their emphasis on integration.
Detroit is the center of a three-county urban area (population 3,734,090, area of 1,337 square miles (3,460km2), a 2010 United States Census) six-county metropolitan statistical area (2010 Census population of 4,296,250, area of 3,913 square miles [10,130km2]), and a nine-county Combined Statistical Area (2010 Census population of 5,218,852, area of 5,814 square miles [15,060km2]). The Detroit–Windsor area, a commercial link straddling the Canada–U.S. border, has a total population of about 5,700,000. The Detroit metropolitan region holds roughly one-half of Michigan's population.
The Detroit Red Wings: Decline and Fall of an Empire
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development programs, an active, caring owner and players lining up around the block to play with this prestigious organization.
Nowadays, however, the Red Wings are a mere shell of the former empire they had. Where did everything go wrong? This video will attempt to explain their decline over the past decade. Even worse, what the future may hold for this once-great organization.
My condolences, Red Wings fans.
Detroit Red Wings Players on 10-1 loss to the habs
The Detroit Red Wings: Decline and Fall of an Empire
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development programs, an active, caring owner and players lining up around the block to play with this prestigious organization.
Nowadays, however, the Red Wings are a mere shell of the former empire they had. Where did everything go wrong? This video will attempt to explain their decline over the past decade. Even worse, what the future may hold for this once-great organization.
My condolences, Red Wings fans.
The Detroit Red Wings: Decline and Fall of an Empire
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development prog...
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development programs, an active, caring owner and players lining up around the block to play with this prestigious organization.
Nowadays, however, the Red Wings are a mere shell of the former empire they had. Where did everything go wrong? This video will attempt to explain their decline over the past decade. Even worse, what the future may hold for this once-great organization.
My condolences, Red Wings fans.
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development programs, an active, caring owner and players lining up around the block to play with this prestigious organization.
Nowadays, however, the Red Wings are a mere shell of the former empire they had. Where did everything go wrong? This video will attempt to explain their decline over the past decade. Even worse, what the future may hold for this once-great organization.
My condolences, Red Wings fans.
The Detroit Red Wings: Decline and Fall of an Empire
Today, we mourn the death of a once-mighty dynasty in the hockey world. The RedWings were formerly at the cutting-edge: Excellent scouting and development programs, an active, caring owner and players lining up around the block to play with this prestigious organization.
Nowadays, however, the Red Wings are a mere shell of the former empire they had. Where did everything go wrong? This video will attempt to explain their decline over the past decade. Even worse, what the future may hold for this once-great organization.
My condolences, Red Wings fans.
8:55
12/05/17 Condensed Game: Jets @ Red Wings
Extended highlights of the Winnipeg Jets at the Detroit Red Wings
For the latest, exclusi...
Nov.15/1986 Detroit Red Wings -Toronto Maple Leafs...
NHL 18 Franchise Mode #1 l TRADING EVERYONE l Detr...
LONDON (AP) — A British surgeon has admitted assaulting two patients by burning his initials into their livers during transplant operations ...Bramhall used an argon beam coagulator, which seals bleeding blood vessels with an electric beam, to mark his initials on the organs ... ....
District JudgeTed Stewart said during a hearing in Salt Lake City that Lyle Jeffs deserved the 57-month prison sentence because his behavior showed he doesn't respect U.S ... Jeffs is an adult. He knows right from wrong." ... He was ordered to pay $1 million in restitution ... "I do humbly accept my responsibly for my actions ... The FBI put up a $50,000 reward....
Norway made the official switch to become the first country in the world to shut down national broadcasts of its FM networks and made to switch to all digital audio broadcasting (DAB), according to The Guardian... 11. DAB allows for a higher quality sound with more channels and functions for an eighth of the cost of FM radio, according to authorities ... -WN.com, Maureen Foody....
Orlando, Fla ... would pay him $11 million ... He would rejoin his former teammate in Detroit and close friend Justin Upton ... In four seasons in Detroit, Kinsler hit .275 with a .328 on-base and .436 slugging percentages ... Neither team has officially confirmed the trade. ....
"The holidays should be a special time for kids and their families, filled with hope and happiness," said Gores, a 1982 Genesee High graduate. "We are proud to support Toys for Tots and the important work they do in Michigan." ... ....
Adding to Detroit’s beer landscape, the Packard PlantBrewery plans to open at the historic site by mid-2019, officials say ... Kari Smith, director of development of the Packard Plant Project through ArteExpressDetroit, confirmed renovations are underway ... The Packard Automotive Plant on Detroit’s east side was built in 1903 by famed architect Albert Kahn....
The Bears play at Detroit on Saturday hoping for a third straight strong defensive effort ... The Bears (4-9) are at Detroit (7-6) on Saturday with a defense healthier than it's been in several weeks, but still drastically depleted ... Chicago's defense comes into a rematch with Detroit after one of its strongest outings this season in a 33-7 victory at Cincinnati ... The defense played a solid game against Detroit on Nov.... |
Recipe Tips
Preparation
Heat a large dry cast-iron skillet over medium-high heat. Alternatively, build a medium-hot charcoal fire, or heat a gas grill to high. Season short ribs generously with salt and pepper. Working in batches, sear ribs until browned, 4–5 minutes per side for medium-rare. Transfer to a plate and let rest for 5 minutes.
Meanwhile, place 1 cup cold water and 2 ice cubes in a medium bowl. Add onion; stir, then discard ice and immediately drain well. Transfer onion to a small bowl.
Trim meat from bones; chop into ¼-inch–1/2-inch cubes. Transfer to a serving platter (reserve bones for those who like to gnaw on them). Serve with onion and lime. |
Veganism and vegetarianism in heavy metal has become a significant trend. This always interested me, partially because I credit my own interest in punk and heavy metal with my gradual conversion to vegetarianism (and hopefully one day soon, veganism) Of course – this made me wonder, why? Why is it that heavy metal seems to be so strongly affiliated, statistically speaking, with what is, objectively speaking, a fairly minor, and, in today's society, kind of weird lifestyle choice? That is not to say that metal is dominated by vegetarianism, but rather that bands like GWAR who released a memorable video for PETA have helped to codify its role in the scene. As with anything else tied into old school underground metal, it can be hard to find any sort of accurate documentation, especially since most of this stuff got started before the days of online webzines codifying everything and making it painfully clear who did what first. So I put on my investigators cap to try and figure out why this lifestyle is so important to me, and so many of our favorite extreme music musicians.
Advertisement. Scroll to continue reading.
Of course, metal icons who identify with vegetarianism were present even in the earliest days of the genre. One need look no further than the gods themselves, Black Sabbath to find out that Geezer Butler is a longtime committed veggie. Butler though never made a big deal about his eating habits and shouldn't be credited with too much of an influence on the eating choices of future metalheads. Perhaps the true root of the growth of vegetarian comes from groups like Napalm Death and Carcass who took the whole thing to a very political place – and that's where it started to matter, in metal at least. Meanwhile in hardcore we certainly can find political vegetarians making moves early on. Minor Threat's Ian MacKaye is perhaps the most famous example in that particular scene, and he definitely had some influence on the guys in both Napalm Death and Carcass. Considering the early material from both of those bands was considered to be a crossover between punk and metal it makes sense that they would be the ones to bring it to the metal world. In a more modern context we see bands like Between The Buried And Me coming out in strong support for PETA, and Cattle Decapitation using their lyrics as a way to communicate a pro-veg message.
I don't want to write an entire article about Carcass's influence on the food politics of metal though, even if the cover of Reek Of Putrefaction did change everything for me, and countless others. Looking at that album art when I was 12 was the first time that I realized that humans are meat, just as much as pigs or cows. What's interesting to consider is that there's been a handful of other influential bands who had ideologies to match that never got nearly as far, and I'm not just talking about the radical right wing groups who dominate the European scene.
What drove me forward was the question, 'Why is it that vegetarianism should reign as an ideology in metal over say, Buddhism?' With that example there certainly have been a wide range of influential bands who supported Buddhist ideologies, like Cynic, and yet they never seemed to end up deeply embedded into the world of heavy metal the way that vegetarianism is.
Advertisement. Scroll to continue reading.
I feel part of why vegetarianism has really taken off in the metal community is that vegetarianism is a rather extreme ideology. It's one that, like metal, admits that the world is an inherently fucked up place and that we need to work together to carry forward. Furthermore, just like metal's general ideology, vegetarianism is something that requires a fair bit of dedication to really pull off. The one prepares you for the other. If you're already used to having to dig to find the sickest black metal bands, (Or perhaps just the quasi-legendary Vegan Black Metal Chef) the weird inconveniences that sustainable eating choices can force upon you are not going to seem to be as much of a struggle. It is a lot easier to qualify it as just another part of a metalheads life, and an individuals responsibility to mankind.
Don't get me wrong though, I'm not trying to come off as preachy, even if I do genuinely believe that a balanced vegetarian lifestyle is a better option for nearly everyone. Despite how I may make it sound, vegetarianism still isn't especially dominant in the metal scene. It just so happens to be more prevalent than in most other music communities I have observed. If you want to eat meat that's totally your own choice, and vegetarianism is not something that should be undertaken lightly, I fucked it up my first few months as a vegetarian and that almost caused some serious damage. That might be part of why veg lifestyles are still in the minority, Converge only have so much power after all. While it is a good and important life choice to make, I don't want people to dive in unready. Of course, the sooner you dive in, the sooner you will get to realize that a ton of your metal friends have probably already made similar choices and are going to be willing to help you move forward with the lifestyle, creating a better more sustainable future for all of us.
As Morbid Angel famously put it, this is extreme music for extreme people. Metal as a whole implies a level of extremity and dedication that has been wrought by a long history of dedicated and passionate individuals who are working on a largely volunteer basis to create what they genuinely believe will be a better tomorrow. Veganism has its long history in heavy metal because it is coming into a world that embraces that exact kind of thing. Metal, like vegetarianism is about ultimately about a minority fighting against the world. If it's not your cup of tea so be it, but for those of us who seek to make a difference then let your freak flag fly, and let your eating habits reflect that. Metal needs veganism because it gives us another great thing to rally around and prove that we are here to help change the world, and beyond that, it makes you a better Devin Townsend fan, and who doesn't want that? So even if you are an avowed meat eater, I encourage you to consider these ties and see if maybe metal has been priming you for veganism all along. |
Withdrawal of Medicare Provision for End of Life Counseling MP3
Now you have it, now you don’t. It’s the Medicare policy that would have paid for end of life counseling as part of an annual wellness visit. John Carney of the Center for Practical Bioethics explains what led to the withdrawal of the provision and where end of life counseling goes from here. (January 6, 2011) |
Northern Gully
This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows a gully formed in the wall of a north middle-latitude crater. Similar gullies are common at the middle and polar latitudes of Mars, and might have formed by the action of liquid water. Others have argued for carbon dioxide or dry mass movement for the genesis of such landforms. This particular image was acquired during northern autumn, when the sky over the terrain of the martian northern mid-latitudes is typically hazy. MGS MOC Release No. MOC2-1234, 28 September 2005 |
# Copyright (C) 1995-2019, Rene Brun and Fons Rademakers.
# All rights reserved.
#
# For the licensing terms see $ROOTSYS/LICENSE.
# For the list of contributors see $ROOTSYS/README/CREDITS.
############################################################################
# CMakeLists.txt file for building ROOT math/smatrix package
############################################################################
ROOT_STANDARD_LIBRARY_PACKAGE(Smatrix
HEADERS
Math/BinaryOperators.h
Math/BinaryOpPolicy.h
Math/CholeskyDecomp.h
Math/Dfact.h
Math/Dfactir.h
Math/Dfinv.h
Math/Dinv.h
Math/Dsfact.h
Math/Dsinv.h
Math/Expression.h
Math/Functions.h
Math/HelperOps.h
Math/MatrixFunctions.h
Math/MatrixRepresentationsStatic.h
Math/MConfig.h
Math/SMatrixDfwd.h
Math/SMatrixFfwd.h
Math/SMatrix.h
Math/StaticCheck.h
Math/SVector.h
Math/UnaryOperators.h
NO_SOURCES
LINKDEF
LinkDef.h
DICTIONARY_OPTIONS
-writeEmptyRootPCM
DEPENDENCIES
Core
MathCore
)
ROOT_GENERATE_DICTIONARY(G__Smatrix32
Math/SMatrix.h
Math/SMatrixDfwd.h
Math/SMatrixFfwd.h
Math/SVector.h
MULTIDICT
MODULE
Smatrix
LINKDEF
LinkDefD32.h
OPTIONS
-writeEmptyRootPCM
DEPENDENCIES
Core
MathCore
)
|
Public health accreditation and metrics for ethics: a case study on environmental health and community engagement.
As public health departments around the country undergo accreditation using the Public Health Accreditation Board standards, the process provides a new opportunity to integrate ethics metrics into day-to-day public health practice. While the accreditation standards do not explicitly address ethics, ethical tools and considerations can enrich the accreditation process by helping health departments and their communities understand what ethical principles underlie the accreditation standards and how to use metrics based on these ethical principles to support decision making in public health practice. We provide a crosswalk between a public health essential service, Public Health Accreditation Board community engagement domain standards, and the relevant ethical principles in the Public Health Code of Ethics (Code). A case study illustrates how the accreditation standards and the ethical principles in the Code together can enhance the practice of engaging the community in decision making in the local health department. |
Q:
Cannot connect to Access using VB.net
i want to create a login page for my application. and when everything has finished and i want to login it always shows
Error :
The Microsoft Jet database engine cannot open the file 'C:\Users\Gio\Documents\Visual Studio 2012\Projects\CSS\CSS\bin\Debug'. It is already opened exclusively by another user, or you need permission to view its data.
Code :
Imports System.Data.OleDb
Public Class Login
Dim path = System.Windows.Forms.Application.StartupPath
Private Sub Login_Load(sender As Object, e As EventArgs) Handles MyBase.Load
End Sub
Private Sub loginbtn_Click(sender As Object, e As EventArgs) Handles loginbtn.Click
Dim connection As New OleDbConnection("Provider=Microsoft.Jet.OLEDB.4.0;Data Source=C:\Users\Gio\Documents\Visual Studio 2012\Projects\CSS\CSS\bin\Debug;")
Dim command As New OleDbCommand("SELECT [ID] FROM [User] WHERE [usernameField] = Username AND [passwordField] = Password", connection)
Dim usernameparam As New OleDbParameter("Username", Me.usernamebox.Text)
Dim passwordparam As New OleDbParameter("Password", Me.passwordbox.Text)
command.Parameters.Add(usernameparam)
command.Parameters.Add(passwordparam)
command.Connection.Open()
Dim reader As OleDbDataReader = command.ExecuteReader()
If reader.HasRows Then
MessageBox.Show("Login Succesful!")
passwordbox.Text = ""
Me.Hide()
Main.Show()
Else
MessageBox.Show("Username and Password are incorrect!")
passwordbox.Text = ""
End If
command.Connection.Close()
End Sub
Private Sub exitbtn_Click(sender As Object, e As EventArgs) Handles exitbtn.Click
Me.Close()
End Sub
End Class
A:
Change this line
Dim connection As New OleDbConnection("Provider=Microsoft.Jet.OLEDB.4.0;Data Source=C:\Users\Gio\Documents\Visual Studio 2012\Projects\CSS\CSS\bin\Debug;")
to
Dim connection As New OleDbConnection("Provider=Microsoft.Jet.OLEDB.4.0;Data Source=C:\Users\Gio\Documents\Visual Studio 2012\Projects\CSS\CSS\bin\Debug\YourMSAccessDB.mdb;")
or to load the db in your output directory
Dim connection As New OleDbConnection("Provider=Microsoft.Jet.OLEDB.4.0;Data Source=.\YourMSAccessDB.mdb;")
'".\" is equivalent to your output directory or where your application (exe file) is located.
|
Abstract
We demonstrate highly efficient inverted bottom-emission organic light-emitting diodes (IBOLEDs) by using cesium hydroxide (CsOH) doped tris-(8-hydroxyquinoline) aluminum as the electron injection layer on indium tin oxide cathode, which could significantly enhance the electron injection, resulting in a large increase in luminance and efficiency. The maximum luminance, current efficiency, and power efficiency reach , , and , respectively, which are 40%–50% higher in efficiency than that of IBOLEDs with cesium carbonate doped as the electron injection layer, where the efficiencies are only and . Our results indicate that CsOH doped should be an effective electron injection layer on a wide range of electrodes to fabricate high performance OLEDs.
Received 05 April 2008Accepted 14 June 2008Published online 03 July 2008
Acknowledgments:
We would like to thank the Foundation of Jilin Research Council (20050517), the Foundation of Changchun Research Council (2007GH06), the Science Fund for Creative Research Groups of NSFC (20621401), and the Ministry of Science and Technology of China (863 Program No. 2006AA03A161) for financial support.
Abstract
We demonstrate highly efficient inverted bottom-emission organic light-emitting diodes (IBOLEDs) by using cesium hydroxide (CsOH) doped tris-(8-hydroxyquinoline) aluminum as the electron injection layer on indium tin oxide cathode, which could significantly enhance the electron injection, resulting in a large increase in luminance and efficiency. The maximum luminance, current efficiency, and power efficiency reach , , and , respectively, which are 40%–50% higher in efficiency than that of IBOLEDs with cesium carbonate doped as the electron injection layer, where the efficiencies are only and . Our results indicate that CsOH doped should be an effective electron injection layer on a wide range of electrodes to fabricate high performance OLEDs. |
Phytate reduces age-related cardiovascular calcification.
The aim of this research was to evaluate the effect of dietary phytate on cardiovascular calcification in rats during aging. Male Wistar rats (10 weeks old) were randomly assigned to four diet groups. The control group was fed with a balanced diet (UAR-A04) containing phytate. The AIN group was fed a purified diet (AIN-76A) with an undetectable level of phytate. The PHY group was fed with a purified diet (AIN-76A) enriched with phytate (phytin, as the calcium magnesium salt). The MOD group was fed with the AIN-76A diet (phytate undetectable) enriched with MgO, inositol and CaHPO4. At 76 weeks of age all rats were sacrificed, and the aortas, hearts, kidneys, livers and femurs were removed for chemical analysis. The most significant differences were found in the aorta calcium content. Phytate-treated rats (the control and PHY groups) had significantly lower levels of calcium in the aorta compared to nonphytate-treated rats (AIN and MOD groups). The present study demonstrated that dietary phytate treatment significantly reduced age-related aorta calcification. |
Gander Mountain is an online extension of the popular sporting goods store. It sells almost everything that an outdoorsman or woman would need for his or her next adventure. The offerings include camping equipment; fishing and hunting supplies; outdoor clothing and accessories; kayaks and canoes; and ATV accessories, including garages and shelters.
Each of the Gander Mountain subsections includes a wide variety of products and brands. Someone who is shopping in the camping and accessories section will find such camping products as special lights, generators, portable heaters, stoves and tents. In each of these camping gear categories, shoppers can choose from different brands. They can find gear that has been branded as Gander Mountain and is only sold by Gander Mountain websites and stores, or they can find other popular brands. In the tent section, for example, they can find brands such as Big Agnes, Shelter Logic and Montana Canvas.
In the Gander Mountain hunting section, hunters can find everything that they need for their next hunting expedition. They can buy everything from guns to ammo to special clothing, and even soap that has been specially made for washing hunting clothes. Hunters can even browse through products that are specially manufactured to help in the pursuit of one particular animal. For example, someone who wants to hunt turkeys can look for turkey calls, decoys, and even special clothing that is made to hide the hunter in a turkey's unique terrain. Hunters of other creatures will appreciate that they can find products that will help them, regardless of their prey.
Individuals who are seeking adventure will love all of the water sports gear that they can buy at Gander Mountain. They can buy things like skis, new motors for their boats, life jackets, and many other water sports products. They can even buy tubes and wet suits. When winter arrives, these adventure seekers can buy everything that they need to complement their snowmobile, including trailer guides and handle grips. They can also buy sleds and toboggans.
Shoppers who love the outdoors but who do not crave as much adventure can also find things that they like on the Gander Mountain website. They can even find gardening supplies like greenhouses. Shoppers who look at clothes and shoes on the Gander Mountain website will find the largest range of brands. Its shoe brands include everything from Keen to Merrell to LaCrosse to Sorel. Whether shoppers want to buy a pair of socks, a gun or a tent, they can find it on the Gander Mountain website.
Whether you are preparing for your first outdoor adventure or taking your one hundredth vacation into the wild, you will be able to find the accessories that you need at Gander Mountain. Their extensive range of fishing, camping, hunting, gardening and other outdoor products will provide you with the right tools to increase your enjoyment of the great outdoors. Regardless of what your hobby tends to be, Gander Mountain has you covered! |
UD promotes Neil Sullivan to vice president and director of athletics
The University of Dayton introduced Neil Sullivan as the next vice president and director of athletics during a press conference Friday at Boesch Lounge, high above the court at UD Arena.
Sullivan, 35, will become the youngest current athletic director in the Atlantic 10 Conference and the second youngest in UD history, only older than UD Athletics Hall of Famer Tom Frericks.
Sullivan has worked in the university’s athletic department since 2006, and most recently served as the deputy director of athletics under outgoing director Tim Wabler, who announced his retirement in July. His main duties the last few years have focused on helping the men’s basketball program in many different areas, including game scheduling and resource management.
As a member of the Dayton community for nine years, Sullivan knows the important role the student body plays in UD athletics.
“It’s the students’ program,” Sullivan said. “It’s a college campus, and that’s why we’re here. It’s really important for me that the students feel engaged and part of the program. The students are very important to us now, and they’ll be important to us in the future.”
Dayton Flyers athletic programs have experienced a good run of success in the last few years, most recently with four teams (men’s and women’s basketball, volleyball and women’s soccer) qualifying for the NCAA Tournament last year.
“I’m confident that we’re on a good path,” Sullivan said. “I look at it as an opportunity to add to a great foundation that’s already here. I look at that, what’s been done before me, as a great sense of responsibility moving forward, but it also gives you a great starting point.”
“Our staff,” he continued, “is focused on accelerating and advancing that momentum for the future.”
Could that future be one in which the men’s basketball rivalry with Xavier, now a member of the Big East Conference, is reignited?
“We’d look forward to playing Xavier,” Sullivan said. “As leagues have changed and schedules have changed, a lot of things have to match up for that to happen. There’s certainly interest on our end of playing Xavier at some point in the future.”
That question, and many others, will surely be on Sullivan’s brain as he transitions into his new position. But he said one thing will always be constant.
“That’s always been my focus: [to] do what’s right for the University of Dayton,” Sullivan said. “[To] do what’s right for the people that work here, the students here [and] the community.” |
share:
DVDs from TCM Shop
Screenplay Info
powered by AFI
Based on the musical play Cabaret , book by Joe Masterhoff, music by John Kander, lyrics by Fred Ebb, produced on the New York stage by Harold Prince (New York, 20 Nov 1966) and the play I Am a Camera by John Van Druten (New York, 28 Nov 1951), both of which were based on short stories by Christopher Isherwood in his The Last of Mr. Norris (New York, 1935) and Goodbye to Berlin (New York, 1939). |
#include "AlchemyPoolTier3.h"
#include "cocos/base/CCValue.h"
#include "Engine/Inventory/ItemChance.h"
#include "Scenes/Platformer/Inventory/Items/PlatformerItems.h"
using namespace cocos2d;
AlchemyPoolTier3* AlchemyPoolTier3::create(SampleMethod sampleMethod, int min, int max)
{
AlchemyPoolTier3* instance = new AlchemyPoolTier3(sampleMethod, min, max);
instance->autorelease();
return instance;
}
AlchemyPoolTier3::AlchemyPoolTier3(SampleMethod sampleMethod, int min, int max) : super(ValueMap(), "alchemy-pool-t3", sampleMethod, min, max)
{
this->addItemToPool(ItemChance::create(DarkSeed::create(), ItemChance::Probability::Common));
this->addItemToPool(ItemChance::create(Clover::create(), ItemChance::Probability::Common));
this->addItemToPool(ItemChance::create(Honey::create(), ItemChance::Probability::Reasonable));
this->addItemToPool(ItemChance::create(Feather::create(), ItemChance::Probability::Reasonable));
}
AlchemyPoolTier3::~AlchemyPoolTier3()
{
}
|
Background {#Sec1}
==========
Clinically, ticagrelor and clopidogrel, antiplatelet agglutination agents, are commonly used in combination with percutaneous coronary intervention (PCI) for acute coronary syndrome (ACS) \[[@CR1]\]. They cure ACS by targeting the platelet P2Y~12~ adenosine diphosphate (ADP) receptor to inhibit platelet aggregation and reduce thrombosis, and the inhibitory effect of ticagrelor on the P2Y~12~ receptor is reversible, whereas inhibitory effect of clopidogrel is irreversible \[[@CR2]\].
Some studies have indicated that inflammatory cytokines are involved in the initiation and progression of atherosclerosis which is one of the pathological features of ACS \[[@CR3]\]. In addition to triggering thrombus formation at the site of atherosclerotic plaque rupture, platelets also release proinflammatory mediators and interact with other related cells, while antiplatelet therapy can reduce the levels of inflammatory cytokines \[[@CR4]\]. Thus, inflammation plays an important role in ACS. Further research showed that NF-ΚB, a central regulator of inflammation, which is involved in various inflammatory diseases, is associated with susceptibility to ACS \[[@CR4]\]. Furthermore, long-term administration of clopidogrel after severe coronary artery injury reduces inflammation via inhibition of NF-ΚB and activator protein 1 activation in pigs \[[@CR1]\]. There are few reports on the mechanism of P2Y~12~ receptor antagonist-mediated inhibition of inflammation. Therefore, we wanted to know how P2Y~12~ receptor antagonist, including ticagrelor and clopidogrel, can regulate the NF-ΚB signaling pathway and reduce inflammation.
In the study, we detected the mRNA levels of related inflammatory factors, the protein level and subcellular localization of molecules in the NF-ΚB signaling pathway, cell viability, apoptosis, the cell cycle, cell migration, and vascular formation, after treating human umbilical vein endothelial cells (HUVECs)stimulated by lipopolysaccharide (LPS) and CD14 with ticagrelor or clopidogrel.
Methods {#Sec2}
=======
Preliminary experiment {#Sec3}
----------------------
### Cell proliferation assay {#Sec4}
HUVECs (FuHeng Cell Center, Shanghai, China, FH0278) were incubated with ticagrelor (0 μM, 5 μM, 10 μM, 20 μM, 50 μM, 100 μM) clopidogrel (0 μM, 5 μM, 10 μM, 20 μM, 50 μM, 100 μM), separately, for 12 h, 24 h or 48 h. Then cell viability was determined by CCK-8 (Biosharp, BS350B).
Formal experiment {#Sec5}
-----------------
### Cell culture and treatment {#Sec6}
HUVECs were cultured in complete growth medium that was F12K containing 10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin Solution at 37 °C with 5% CO~2~.
HUVECs were treated with complete growth medium supplemented with DMSO (as control), ticagrelor, clopidogrel, DMSO plus LPS and CD14, ticagrelor plus LPS and CD14, or clopidogrel plus LPS and CD14, separately, for 16 h. The concentrations of these compounds are shown in the Table [1](#Tab1){ref-type="table"}. Table 1The concentrations of these compoundsCompoundsConcentrationsTicagrelor20 μMClopidogrel20 μMLPS10 ng/mLCD141 μg/mL
### Cell proliferation assay {#Sec7}
Cells were seeded in 96 well culture plates (2000 cells/well). After the cells were incubated with the indicated compounds for 16 h. Finally, cell viability was tested with CCK8 reagent. We evaluated cell viability by measured the absorbance at 450 nm.
### Western blot assay {#Sec8}
Whole cell extracts were lysed in RIPA Lysis buffer (Beyotime, P0013B) containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Then protein concentration of lysates was determined by BCA protein concentration determination kit (Beyotime, P0010). Cell lysates containing equal amount protein were resolved on a 10--12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to a PVDF membrane (Millipore, IPVH00010). After separate incubation with rabbit anti-p65 (CST, \#8242), rabbit anti-p-p65 (CST, \#3033), rabbit anti-MMP2 (proteintech, 10,373--2-AP), rabbit anti-MMP9 (proteintech, 10,375--2-AP), rabbit anti-E-cadherin (proteintech, 20,874--1-AP), rabbit anti-IKBα (abcam, Ab32518), rabbit anti-ICAM-1 (proteintech, 10,831--1-AP), rabbit anti-VCAM-1 (Affinity, DF6082), rabbit anti-E-selectin (proteintech, 20,894--1-AP), rabbit anti-GAPDH, mouse anti-P-selectin (proteintech, 60,322--1-Ig), mouse anti-MCP-1 (Affinity, BF0678), followed by horseradish peroxidase-conjugated secondary antibody, the membranes were visualized by ECL chemiluminescence.
### RNA extraction and quantitative polymerase chain reaction (qPCR) {#Sec9}
Total RNA was extracted using TRIzol reagent (Ambion, 15,596--026), and reverse transcription was accomplished with HiScript Reverse Transcriptase (VAZYME, R101--01/02). The reverse transcription products were amplified with SYBR Green Master Mix (VAZYME, Q111--02) according to the manufacturer's instructions. The data were normalized according to the level of GAPDH expression in each individual sample. The qPCR primers are listed in Table [2](#Tab2){ref-type="table"}. Table 2The qPCR primersNamePrimerSequencehomo GAPDHForward5′- TCAAGAAGGTGGTGAAGCAGG − 3′Reverse5′- TCAAAGGTGGAGGAGTGGGT − 3'Homo TNFαForward5′-CCCATGTTGTAGCAAACCCTC − 3'Reverse5′-AGAGGACCTGGGAGTAGATGA − 3'Reverse5′-GTGCCTCTTTGCTGCTTTC − 3'Homo IL-1Forward5′-CGAATCTCCGACCACCACTA − 3'Reverse5′-AGCCTCGTTATCCCATGTGT − 3'Homo IL-6Forward5′-GGTCCAGTTGCCTTCTCCC − 3'Reverse5′-GTGCCTCTTTGCTGCTTTC − 3'Homo IL-2Forward5′-CAACTCCTGTCTTGCATTGC-3'Reverse5′-TGTGAGCATCCTGGTGAGTT − 3'Homo IL-8Forward5′-GACATACTCCAAACCTTTCCACCCC-3'Reverse5′-CAAAAACTTCTCCACAACCCTCTGC −3'
### Immunofluorescence assay {#Sec10}
The cells were incubated with the indicated compounds and then fixed for 15 min in 4% paraformaldehyde in 1 × phosphate-buffered saline (PBS) pH 7.4. The fixed cells were permeabilized for 20 min with 0.5% Triton X-100 in 1 × PBS and then blocked in 1× PBS with 1% bovine serum albumin for 30 min. The cells were incubated with the appropriate primary rabbit anti-p65 (CST, 8242S) and then stained with Alexa Fluor Cy3-labeled goat anti-rabbit immunoglobulin G (BOSTER, BA1032) and DAPI (Beyotime, C1002), separately. The subcellular localization of p65 was visualized using inverted fluorescence microscope (magnification, × 400).
### Apoptosis assay {#Sec11}
After incubated with the indicated compounds for 16 h, the cells were harvested and stained with APC/7-AAD apoptosis kit (SUNGENE BIOTECH, AO2001-11A-H), and then were analyzed by flow cytometry.
### Cell cycle assay {#Sec12}
After incubated with the indicated compounds for 16 h, the cells were harvested and stained with cell cycle kit (KeyGEN BioTECH, KGA512), and then were analyzed by flow cytometry.
### Cell migration assay {#Sec13}
After treated with the indicated compounds for 16 h, HUVECs were resuspended in serum-free F12K (2.5 × 105 cells/mL), 200 μL was added to the upper chambers, and complete growth medium was added to the lower chamber. After 24 h incubation, cells which migrated to the lower face of the membrane were fixed with 70% ethanol solution and stained by 0.5% crystal violet. After washed by PBS for 3 times, the migrating cells were observed under a microscope and photographed (magnification, × 200).
### Matrigel assay {#Sec14}
The cells were incubated with the indicated compounds for 16 h, and then cultured for 6 h in 24-well plates coated with matrigel. The cells were imaged under an inverted microscope (Nikon, ECLIPSE Ts2) at 100 magnification and the network length and width was quantified.
Statistical analyses {#Sec15}
--------------------
All data were expressed as the mean ± S.D. The statistical significance of data was assessed by an unpaired two-tailed t-test. A value of *p* \< 0.05 was used as the standard for statistical significance. All experiments were repeated 3 times or more.
Results {#Sec16}
=======
Ticagrelor and clopidogrel inhibit the expression of inflammatory cytokines induced by LPS {#Sec17}
------------------------------------------------------------------------------------------
Inflammation plays an important role in the initiation and progression of atherosclerosis, indicating the involvement of inflammatory cytokines in ACS \[[@CR5]\]. To test whether ticagrelor and clopidogrel affect the production of inflammatory cytokines, HUVECs were incubated with ticagrelor and clopidogrel at different concentrations (0 μM, 5 μM, 10 μM, 20 μM, 50 μM, 100 μM) for 12, 24 and 48 h separately, without affecting cell viability (Fig. [1](#Fig1){ref-type="fig"}a). Then, HUVECs were cultured with different combinations of compounds, DMSO, ticagrelor, clopidogrel, DMSO plus LPS and CD14, ticagrelor plus LPS and CD14, and clopidogrel plus LPS and CD14, separately, for 16 h. The results showed that ticagrelor and clopidogrel inhibited the expression of TNFα, IL-1, IL-6, IL-8, and IL-2 induced by LPS (Fig. [1](#Fig1){ref-type="fig"}b-f). These data suggested that ticagrelor and clopidogrel inhibited the production of inflammatory cytokines. Fig. 1Ticagrelor and clopidogrel inhibit the LPS-induced expression of TNFα, IL-1, IL-6, IL-8, and IL-2. **a**: HUVECs were treated with different concentrations of ticagrelor and clopidogrel, separately, for 12 h, 24 h or 48 h. Cell viability was detected by CCK-8 assays at the indicated time points. **b**-**c**: HUVECs were treated with DMSO, ticagrelor, clopidogrel, DMSO plus LPS and CD14, ticagrelor plus LPS and CD14, and clopidogrel plus LPS and CD14, separately, for 16 h. The mRNA levels of TNFα (**b**), IL-1 (**c**), IL-6 (**d**), IL-8 (**e**), and IL-2 (**f**) were detected by qPCR (*n* = 3; \*, *p* \< 0.05; \*\*, *p* \< 0.01; and \*\*\*, *p* \< 0.001)
Ticagrelor and clopidogrel suppress NF-ΚB signaling {#Sec18}
---------------------------------------------------
Studies have shown that NF-ΚB is closely related to ACS, and NF-ΚB plays a key role in inflammation \[[@CR4], [@CR6]\]. We wondered if ticagrelor and clopidogrel acted on NF-ΚB. The variations of molecules in the NF-ΚB pathway were tested after HUVECs were stimulated with LPS and given ticagrelor or clopidogrel. As a consequence, ticagrelor and clopidogrel inhibited p65 phosphorylation (Fig. [2](#Fig2){ref-type="fig"}a-b) and IKBα degradation (Fig. [2](#Fig2){ref-type="fig"}c-d). After HUVECs were treated with ticagrelor and clopidogrel, the amount of nuclear-translocated p65 was significantly reduced (Fig. [2](#Fig2){ref-type="fig"}e). These findings demonstrated that ticagrelor and clopidogrel inhibited the production of inflammatory factors by suppressing the NF-ΚB pathway. Fig. 2Ticagrelor and clopidogrel inhibit p65 phosphorylation. **a**-**d**: The cells were incubated with the indicated compounds for 16 h, and the cell lysates were analyzed by western blotting. **e**: The cells were incubated with the indicated compounds for 16 h. The localization of p65 in the nuclear and cytoplasmic compartments was detected by fluorescence microscopy. (*n* = 3; ns, not significant, *p* \> 0.05; \*, *p* \< 0.05; \*\*, *p* \< 0.01; and \*\*\*, *p* \< 0.001)
Ticagrelor and clopidogrel alleviate cellular dysfunction through suppressing NF-ΚB signaling {#Sec19}
---------------------------------------------------------------------------------------------
NF-ΚB was shown to be involved in various biological processes, such as cell proliferation, the cell cycle, apoptosis and cell migration, by regulating the expression of various genes \[[@CR3], [@CR7]--[@CR9]\]. Thus, we tested the cell proliferation, cell cycle, apoptosis and cell migration of HUVECs after culture with the indicated compounds (Fig. [3](#Fig3){ref-type="fig"}a-g). As shown in Fig. [3](#Fig3){ref-type="fig"}a-g, ticagrelor and clopidogrel inhibited apoptosis and the decrease in cell viability caused by LPS (Fig. [3](#Fig3){ref-type="fig"}a-c) and restored the cell migration (Fig. [3](#Fig3){ref-type="fig"}d-e) and the cell cycle disrupted by LPS (Fig. [3](#Fig3){ref-type="fig"}f-g). These data implied that ticagrelor and clopidogrel prevented LPS from damaging cells. Fig. 3Ticagrelor and clopidogrel inhibit the LPS-induced changes in cell apoptosis, cycle and migration ability. **a**: HUVECs were incubated with the indicated compounds for 16 h, and then, cell viability was determined by CCK-8 assays. **b**-**c**: Flow cytometric analysis of APC/7-AAD staining was used to analyze apoptosis in HUVECs following incubation with the indicated compounds for 16 h. **d**-**e**: After HUVECs were incubated with the indicated compounds for 16 h, cell migration was assessed using a transwell assay, and cells were stained using hexamethylpararosaniline solution. **f**-**g**: HUVECs were incubated with the indicated compounds for 16 h and stained with propidium iodide. DNA content was analyzed by flow cytometry (*n* = 3; ns, not significant, *p* \> 0.05; \*, *p* \< 0.05; \*\*, *p* \< 0.01; and \*\*\*, *p* \< 0.001)
Activated NF-ΚB regulates the expression of a range of genes, including intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule (VCAM-1), E-selectin, P-selectin, and monocyte chemoattractant protein-1 (MCP-1), which can act directly or indirectly on microvascular endothelial cells or blood cells or mediate their interactions, leading to microcirculation disorders \[[@CR5], [@CR10]\]. Therefore, we detected their expression level and the angiogenic capacity of HUVECs treated with DMSO, ticagrelor, clopidogrel, DMSO plus LPS and CD14, ticagrelor plus LPS and CD14, and clopidogrel plus LPS and CD14. We found that ticagrelor and clopidogrel reduced the expression of ICAM-1, E-selectin, P-selectin, VCAM-1 and MCP-1 induced by LPS. (Fig. [4](#Fig4){ref-type="fig"}a-d). Furthermore, HUVECs incubated with DMSO, ticagrelor, clopidogrel, ticagrelor plus LPS and CD14, and clopidogrel plus LPS and CD14 formed complex tubular structures, whereas the total width of the tubes was significantly increased in the cells compared with those incubated with DMSO plus LPS and CD14 (Fig. [4](#Fig4){ref-type="fig"}g). Our data indicated that ticagrelor and clopidogrel restored the ability of HUVECs to generate blood vessels. Fig. 4Ticagrelor and clopidogrel restored the LPS-caused reduced ability of HUVECs to form tubular networks. HUVECs were incubated with DMSO (as a control), ticagrelor (20 μM), clopidogrel (20 μM), DMSO plus LPS (10 ng/mL) and CD14 (1 μg/mL), ticagrelor (20 μM) plus LPS (10 ng/mL) and CD14 (1 μg/mL), and clopidogrel (20 μM) plus LPS (10 ng/mL) and CD14 (1 μg/mL), separately, for 16 h. Then, the cell lysates were immunoblotted with the indicated antibodies (**a**-**d**), and tube formation assays were performed using Matrigel as described in the Materials and Methods (**e**). (*n* = 3; ns, not significant, *p* \> 0.05; \*, *p* \< 0.05; \*\*, *p* \< 0.01; and \*\*\*, *p* \< 0.001)
In addition, E-cadherin plays a crucial role in mediating cell adhesion and maintaining the integrity of the vascular endothelial layer. In contrast, MMP2 and MMP9 can degrade the extracellular matrix and basal membrane, damaging the vascular endothelial layer \[[@CR9], [@CR11], [@CR12]\]. Hence, we also tested the expression of E-cadherin, MMP2 and MMP9. As shown in Fig. [2](#Fig2){ref-type="fig"}a-d, ticagrelor and clopidogrel increased the expression of E-cadherin, which was reduced by LPS and restrained the expression of MMP2 and MMP9 induced by LPS. Ticagrelor and clopidogrel protected the endothelial layer from damage by NF-ΚB.
Overall, our findings reveal that ticagrelor and clopidogrel alleviate cellular dysfunction by suppressing NF-ΚB signaling.
Discussion {#Sec20}
==========
Currently, ticagrelor and clopidogrel are antiplatelet agents and are often used to treat ACS \[[@CR13], [@CR14]\]. Ticagrelor reversibly interacts with the P2Y~12~ ADP receptor, which inhibits ADP-induced platelet aggregation by blocking P2Y~12~ receptors, and does not need to be metabolically activated in the liver \[[@CR15], [@CR16]\]. Clopidogrel is a prodrug. The metabolite 2-epoxy-clopidogrel is formed by the oxidation of clopidogrel and then forms active metabolites (mercaptan derivatives) through hydrolysis. Clopidogrel selectively inhibits the binding of ADP to its platelet receptor and the subsequent activation of ADP-mediated glycoprotein GPlllb/llla complex, thus inhibiting platelet aggregation \[[@CR4]\]. Clopidogrel must undergo biological transformation to inhibit platelet aggregation, but relevant active metabolites have not been isolated. In addition, it was reported that clopidogrel reduces inflammation via inhibition of NF-ΚB activation after severe coronary artery injury in pigs \[[@CR1]\]. It can be seen that ticagrelor and clopidogrel can affect other life activities in addition to acting on the P2Y~12~ receptor leading to anticoagulation. We discovered that ticagrelor and clopidogrel protect the endothelial layer by increasing the expression of E-cadherin decreased by LPS and restraining the expression of MMP2 and MMP9 induced by LPS. Thus, ticagrelor and clopidogrel not only inhibit platelet aggregation but also protect endothelial cells. This finding is consistent with the fact that in clinical practice, ticagrelor and clopidogrel are used to prevent thrombosis and improve the nursing care of patients with ACS after PCI.
In recent years, studies have shown that NF-ΚB and VCAM-1 are closely related to the formation of atherosclerosis, causing deviant cell proliferation and inflammatory response, thereby affecting the stability of plaques. Moreover, NF-ΚB was found to be increased in ACS patients. NF-ΚB can transcriptionally regulate key proinflammatory cytokines, chemokines, adhesion molecules, immune recognition receptors and some enzymes in the inflammatory response and directly participate in inflammatory processes, such as inflammatory cell infusion and aggregation \[[@CR5]\], injuring vascular endothelial cells \[[@CR9], [@CR11], [@CR12]\]. Our study demonstrated that ticagrelor and clopidogrel negatively regulate the NF-ΚB pathway via inhibiting IKBα degradation and p65 phosphorylation, markedly reducing the amount of nuclear-translocated p65, thereby inhibiting cell apoptosis and restoring the cell cycle, cell proliferation, cell migration and formation of blood vessels, protecting cells from the damage by NF-ΚB. Therefore, we speculated that, in addition to inhibiting platelet aggregation, ticagrelor and clopidogrel can reduce the functional impairment of vascular endothelial cells through suppressing NF-ΚB signaling pathway.
Campo et al. found that ticagrelor is superior to clopidogrel in the biological effects of patients with stable coronary artery disease (SCAD) or chronic obstructive pulmonary disease (COPD) \[[@CR17]\], while our results suggested that compared with clopidogrel, ticagrelor did not have this advantage in improving LPS-induced endothelial dysfunction. Compared with clopidogrel, there may be another more effective mechanism for ticagrelor relieving cell dysfunction to cure SCAD and COPD. We didn't have a relevant disease model and cannot directly explain the effects of ticagrelor and clopidogrel inhibiting the NF-ΚB signaling pathway on the treatment of disease. The role of ticagrelor and clopidogrel inhibiting the NF-ΚB signaling pathway in the treatment of disease requires further research. However, the study provided a direction for future research.
Conclusions {#Sec21}
===========
Ticagrelor and clopidogrel negatively regulate the NF-ΚB signaling pathway via inhibiting the degradation of IKBα and the phosphorylation and entry into the nucleus of p65 to alleviate cellular dysfunction, which provides a new theoretical basis for ticagrelor and clopidogrel curing cardiovascular diseases, such as ACS and COPD.
ACS
: Acute coronary syndrome
ADP
: Adenosine diphosphate
HUVECs
: Human umbilical vein endothelial cells
LPS
: Lipopolysaccharide
PCI
: Percutaneous coronary intervention
qPCR
: Quantitative polymerase chain reaction
**Publisher's Note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Not applicable.
ZJ and GF conceived the study and designed the experiments. ZJ performed the cell proliferation assay, western blot, qRT-PCR, apoptosis, and cell cycle assay with assistance from YH and XJ, and was a major contributor in writing the manuscript. YH performed the immunofluorescence assay, JS performed the migration and invasion assay. ZJ and GF wrote the manuscript. All authors discussed the results and implications and commented on the manuscript at all stages. All authors read and approved the final manuscript.
This work was supported by Wenzhou Science & Technology Bureau (2018Y1205) and Zhejiang Provincial Department of health (General Research Program Foundation, 2016154751). These the funding bodies only provide funding and have no role in research design, data collection, analysis and interpretation, and writing manuscripts.
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
{
"css": {
"properties": {
"align-items": {
"flex_context": {
"__compat": {
"description": "Supported in Flex Layout",
"mdn_url": "https://developer.mozilla.org/docs/Web/CSS/align-items",
"support": {
"chrome": [
{
"version_added": "52"
},
{
"version_added": "29",
"partial_implementation": true,
"notes": "Older versions of the specification treat absolute positioned children as though they are a 0 by 0 flex item. Later specification versions take the children out of the flow and set their positions based on align and justify properties. Chrome implements the new behavior beginning with Chrome 52."
},
{
"prefix": "-webkit-",
"version_added": "21"
}
],
"chrome_android": [
{
"version_added": "52"
},
{
"version_added": "29",
"partial_implementation": true,
"notes": "Older versions of the specification treat absolute positioned children as though they are a 0 by 0 flex item. Later specification versions take the children out of the flow and set their positions based on align and justify properties. Chrome implements the new behavior beginning with Chrome 52."
},
{
"prefix": "-webkit-",
"version_added": "25"
}
],
"edge": [
{
"version_added": "12"
},
{
"prefix": "-webkit-",
"version_added": "12"
}
],
"firefox": [
{
"version_added": "20",
"notes": "Multi-line flexbox has been supported since Firefox 28."
},
{
"prefix": "-webkit-",
"version_added": "49"
},
{
"version_removed": "20",
"version_added": "18",
"flags": [
{
"type": "preference",
"name": "layout.css.flexbox.enabled",
"value_to_set": "true"
}
]
},
{
"prefix": "-webkit-",
"version_added": "48",
"flags": [
{
"type": "preference",
"name": "layout.css.prefixes.webkit",
"value_to_set": "true"
}
]
}
],
"firefox_android": [
{
"version_added": "20",
"notes": "Multi-line flexbox has been supported since Firefox 28."
},
{
"prefix": "-webkit-",
"version_added": "49"
},
{
"version_removed": "20",
"version_added": "18",
"flags": [
{
"type": "preference",
"name": "layout.css.flexbox.enabled",
"value_to_set": "true"
}
]
},
{
"prefix": "-webkit-",
"version_added": "48",
"flags": [
{
"type": "preference",
"name": "layout.css.prefixes.webkit",
"value_to_set": "true"
}
]
}
],
"ie": {
"version_added": "11",
"notes": "In Internet Explorer 10 and 11, if column flex items have <code>align-items: center;</code> set on them and their content is too large, then they will overflow the bounds of their container. See <a href='https://github.com/philipwalton/flexbugs#2-column-flex-items-set-to-align-itemscenter-overflow-their-container'>Flexbug #2</a>."
},
"opera": {
"version_added": "12.1"
},
"opera_android": {
"version_added": "12.1"
},
"safari": [
{
"version_added": "9"
},
{
"prefix": "-webkit-",
"version_added": "7"
}
],
"safari_ios": [
{
"version_added": "9"
},
{
"prefix": "-webkit-",
"version_added": "7"
}
],
"samsunginternet_android": [
{
"version_added": "6.0"
},
{
"version_added": "2.0",
"partial_implementation": true,
"notes": "Older versions of the specification treat absolute positioned children as though they are a 0 by 0 flex item. Later specification versions take the children out of the flow and set their positions based on align and justify properties. Chrome implements the new behavior beginning with Samsung Internet 6.0."
},
{
"prefix": "-webkit-",
"version_added": "1.5"
}
],
"webview_android": [
{
"version_added": "52"
},
{
"version_added": "4.4",
"partial_implementation": true,
"notes": "Older versions of the specification treat absolute positioned children as though they are a 0 by 0 flex item. Later specification versions take the children out of the flow and set their positions based on align and justify properties. Chrome implements the new behavior beginning with Chrome 52."
},
{
"prefix": "-webkit-",
"version_added": "≤37"
}
]
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
},
"first_last_baseline": {
"__compat": {
"description": "<code>first baseline</code> and <code>last baseline</code>",
"support": {
"chrome": {
"version_added": "59"
},
"chrome_android": {
"version_added": "59"
},
"edge": {
"version_added": "79"
},
"firefox": {
"version_added": "45"
},
"firefox_android": {
"version_added": "45"
},
"ie": {
"version_added": false
},
"opera": {
"version_added": "46"
},
"opera_android": {
"version_added": "43"
},
"safari": {
"version_added": "11"
},
"safari_ios": {
"version_added": "11"
},
"samsunginternet_android": {
"version_added": "7.0"
},
"webview_android": {
"version_added": "59"
}
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
}
},
"left_right": {
"__compat": {
"description": "<code>left</code> and <code>right</code>",
"support": {
"chrome": {
"version_added": false
},
"chrome_android": {
"version_added": false
},
"edge": {
"version_added": false
},
"firefox": {
"version_added": "45"
},
"firefox_android": {
"version_added": "45"
},
"ie": {
"version_added": false
},
"opera": {
"version_added": false
},
"opera_android": {
"version_added": false
},
"safari": {
"version_added": "9"
},
"safari_ios": {
"version_added": "9"
},
"samsunginternet_android": {
"version_added": false
},
"webview_android": {
"version_added": false
}
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
}
},
"safe_unsafe": {
"__compat": {
"description": "<code>safe</code> and <code>unsafe</code>",
"support": {
"chrome": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"chrome_android": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"edge": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"firefox": {
"version_added": "63"
},
"firefox_android": {
"version_added": "63"
},
"ie": {
"version_added": false
},
"opera": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"opera_android": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"safari": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"safari_ios": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"samsunginternet_android": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
},
"webview_android": {
"version_added": false,
"notes": "This value is recognized, but has no effect."
}
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
}
},
"start_end": {
"__compat": {
"description": "<code>start</code> and <code>end</code>",
"support": {
"chrome": {
"version_added": false
},
"chrome_android": {
"version_added": false
},
"edge": {
"version_added": false
},
"firefox": {
"version_added": "45"
},
"firefox_android": {
"version_added": "45"
},
"ie": {
"version_added": false
},
"opera": {
"version_added": "44"
},
"opera_android": {
"version_added": "43"
},
"safari": {
"version_added": false
},
"safari_ios": {
"version_added": false
},
"samsunginternet_android": {
"version_added": false
},
"webview_android": {
"version_added": false
}
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
}
}
},
"grid_context": {
"__compat": {
"description": "Supported in Grid Layout",
"mdn_url": "https://developer.mozilla.org/docs/Web/CSS/align-items",
"support": {
"chrome": {
"version_added": "57"
},
"chrome_android": {
"version_added": "52"
},
"edge": {
"version_added": "16"
},
"firefox": {
"version_added": "52"
},
"firefox_android": {
"version_added": "52"
},
"ie": {
"version_added": false
},
"opera": {
"version_added": "44"
},
"opera_android": {
"version_added": "43"
},
"safari": {
"version_added": "10.1"
},
"safari_ios": {
"version_added": "10.3"
},
"samsunginternet_android": {
"version_added": "6.2"
},
"webview_android": {
"version_added": "57"
}
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
},
"start_end": {
"__compat": {
"description": "<code>start</code> and <code>end</code>",
"support": {
"chrome": {
"version_added": "57"
},
"chrome_android": {
"version_added": "57"
},
"edge": {
"version_added": "79"
},
"firefox": {
"version_added": "52"
},
"firefox_android": {
"version_added": "52"
},
"ie": {
"version_added": false
},
"opera": {
"version_added": "44"
},
"opera_android": {
"version_added": "43"
},
"safari": {
"version_added": "11"
},
"safari_ios": {
"version_added": "11"
},
"samsunginternet_android": {
"version_added": "7.0"
},
"webview_android": {
"version_added": "57"
}
},
"status": {
"experimental": false,
"standard_track": true,
"deprecated": false
}
}
}
}
}
}
}
}
|
Texas Rangers third baseman Adrian Beltre has been ruled out for Friday’s Game 2 of the AL Division Series after suffering a back strain during the series opener. Beltre was hurt in the first inning of Thursdays 5-3 win over the Toronto Blue Jays.
The loss of Beltre even for one game is significant. Beltre hit .287 with 18 homers and 87 RBIs this season. His two-out single in the third gave the Rangers a 2-0 lead over David Price and the Blue Jays.
Beltre will get treatment for his back strain today and be reevaluated.
“There...
The Pittsburgh Pirates are expected to announced that All-Star center fielder Andrew McCutchen will be placed 15-day disabled list due to an oblique muscle injury, according to the the Pittsburgh Post-Gazette.
McCutchen may miss up to a month of playing time, significantly impacting the Pirates run at a playoff spot.
The injury occurred during Sundays game with the Arizona Diamondbacks during an eighth inning at bat.
McCutchen has never been on the disabled list in his Major League career. He’s played in 843 of 868 games since his debut...
The Houston Astros placed George Springer on the 15 day DL, technically with a right quad injury, although he has been experiencing right knee discomfort as well. The hope is his stay on the DL will not be an extended one. To take his place, the team recalled Marc Krauss from Class AAA Oklahoma City.
Springer sat out the last two Astros games and the Astros are taking the cautious approach in dealing with his injury.
“I just got to get through it,” Springer said on Tuesday. “Whatever happens, happens. I just have overall kind of discomfort.”
Springer...
Time for the truth. I wasn’t sure what Chikungunya virus was, but it didn’t sound like something I would want. Tampa Bay Rays reliever Joel Peralta thinks he may have contacted the virus during the All-Star break while visiting the Dominican Republic.
The virus is transferred by mosquitoes in Africa, Asia, Europe, and the Indian and Pacific Oceans. It has also recently been found in Caribbean countries.
The symptoms of the chikungunya virus include virus infection, fever and joint pain. Headache, muscle pain, joint swelling, and rashes...
Doctors confirmed New York Yankees ace Masahiro Tanaka has a partially torn UCL in his right elbow and will miss a minimum of six weeks. He rehab his elbow during the next few weeks to see if he can avoid Tommy John elbow surgery, which would keep him sidelined until 2016.
In his first MLB season Tanaka. 25, has posted a 12-4 record and a 2.51 ERA in his first 18 starts, making the All-Star team.
The Yankees invested $175 million in Masahiro Tanaka before this season, giving him a seven-year, $155 million contract while also paying a $20 million...
St. Louis Cardinals catcher Yadier Molina one of the most durable catchers in baseball, has a torn ligament in his right thumb and will miss 8-12 weeks following surgery, the team announced. Molina suffered injury after sliding into third base, though it was a foot-first slide in a game Wednesday night.
“I almost cried,” Molina said, when he was told the news.In 83 games and 335 plate appearances this season, Molina is hitting .287/.341/.409 (109 OPS+) with 16 doubles and seven home runs.
Tony Cruz, Molina’s backup, will be the...
New York Yankees ace Masahiro Tanaka has been placed on the disabled list with a sore elbow, the club announced Wednesday. The Yankees invested $175 million in Masahiro Tanaka before this season, giving him a seven-year, $155 million contract while also paying a $20 million posting fee to his Japanese club, the Rakuten Golden Eagles, and up until this point it was a good investment.
Tanaka has posted a 12-4 record and a 2.51 ERA in his first 18 starts, making the All-Star team.
Tanaka will have an MRI on the tender elbow and the team will anxiously...
Cincinnati Reds first baseman Joey Votto was not in the lineup today leading to speculation that he may be headed back to the disabled list with the same injury that put him there there the first time earlier this season, a left quad problem.
He’s 1-for-his-last-11 and 6-for-37 over his last 11 games. In 23 games since his return from the DL, Votto is batting .250 with 11 RBIs. He hasn’t homered since May 10.
“For Joey, it’s just a day off,” Reds manager Bryan Price said.
According to Ken Rosenthal at Fox Sports sources...
The Minnesota Twins announced first baseman Joe Mauer has been placed on the 15-day disabled list with a strained oblique . First baseman/outfielder Chris Colabello has been recalled from Triple-A Rochester in a corresponding move. Mauer suffered the injury on the game against Kansas City Wednesday night.
Mauer, 31, is hitting .271/.342/.353 with 17 doubles, two homers and 28 RBI in 76 games this season. In 40 games for the Twins this year, Colabello is hitting .232/.280/.377 with 10 doubles, four homers and 30 RBI.
Most oblique injuries require...
The Washington Nationals Bryce Harper has been activated from the 15 day DL. Harper missed 59 games because of a torn ligament in his left thumb. Coincidentally, or not, tonight is Bryce Harper bobblehead night at Nationals Park. Left-handed reliever Xavier Cedeno was optioned to Triple-A Syracuse.
The 21-year-old Harper is batting .289/.352/.422 with one homer in 21 games. In a rehab appearance for the Triple-A Harrisburg Senators Harper’s bat launched three home runs in a 4-for-5/ 5 RBI night.
“We’ll all seen the impact he can make,”...
Houston Astros top prospect Carlos Correa will miss the remainder of 2014 after undergoing surgery Wednesday to repair a fracture of his fibula just above his right ankle, general manager Jeff Luhnow said.
The injury spoils a spectacular season for Correa who was hitting .325/.416/.510, 16 doubles, six triples, six homers, 57 RBI, 50 runs and 20 stolen bases in 62 games, putting him line to be promoted to Double-A Corpus Christi later this year.
Correa played the entire 2013 season at Class A Quad Cities at 18 years old and was impressive....
The Pittsburgh Pirates have placed young ace Gerrit Cole on the 15-day disabled list with right shoulder fatigue. The move is retroactive to June 4. The Pirates called up lefty Jeff Locke from Triple-A Indianapolis to start Sunday’s game against the Milwaukee Brewers.
In 12 starts and 76 2/3 innings this season, Cole has gone 6-3 with a 3.64 ERA and a 1.30 WHIP. He has a 3.39 ERA in 194 MLB innings since making his debut last summer.
Manager Clint Hurdle said there have been some signs in his past several starts that fatigue may have set in....
Texas Rangers DH/1B Mitch Moreland will undergo ankle survey that will keep him out of action for at least he next three months and may miss the rest of the season. Moreland is batting .246/.297/.347 (77 OPS+) in 52 games. For his career, he owns an OPS+ of 98 across parts of five big-league seasons.
The Rangers have been decimated with injuries already having lost Prince Fielder, LHP Derek Holland, C Geovany Soto, 2B Jurickson Profar, LHP Matt Harrison, LHP Martin Perez, RHP Alexi Ogando and 3B Kevin Kouzmanoff to injuries.
“It’s to the...
Tampa Bay Rays second baseman Ben Zobrist dislocated his thumb sliding head first into second base on a steal attempt in the top of the fifth against the Seattle Mariners today and will likely be head to the disabled list. Rays manager Joe Maddon said the team will using Sean Rodriguez and Logan Forsythe at 2B in Zobrist’s absence.
Durham infielder Cole Figueroa could also figure into the Rays plans. The 26-year-old has a .299 average in 32 games at Durham this season. Over the last three seasons for the Bulls, he’s hitting .288. Figueroa...
Cincinnati Reds first baseman Jay Bruce was placed on the 15 day disabled list and will require knee surgery that will sideline the 27 year old for 3-4 weeks. Bruce has hit .218/.355/.366 (99 OPS+) with only three home runs in 29 games this season.
Bruce was not in the Reds starting lineup on Sunday due to soreness in the knee but apparently there was no indication surgery would be required. Bruce did pinch-hit Sunday and struck out.
“I was ready to keep him out,” Reds manager Bryan Price said. “He came up to me and said: ‘I...
The New York Yankees sent starter Michael Pineda to the 15 day disabled list after suffering a strain in a muscle in his back. Pineda said his right lat muscle suddenly felt tight after a pitch in the first inning of the simulated game he pitched Tuesday in Florida and an MRI confirmed it.
Pineda was et to come off suspension for using pine tar in a game against Boston, but the injury looks like it may force Pineda to miss 3-4 weeks. Reliever David Phelps will replace Pineda in a rotation that has already lost Ivan Nova for the season due to...
Tampa Bay Rays former number one draft pick Tim Beckham sustained an a torn ACL in his right leg while working out and will miss most of the 2014 season, accruing to Marc Topkin of the Tampa Bay Times.
Beckham finally got his big league call up in September of last year going 3-for-7 (.429) in five games, and was expected to compete for a reserve infielder spot in the spring.
Beckham, 24, has been in the Rays organization and has 2700 minor league plate appearances and a career .266/.332/.381 slash line during that time. Baseball America recently...
Baltimore Orioles third baseman Manny Machado was carted off the field with an apparent left knee injury after running through the first base bag awkwardly on Monday afternoon in a game against the Tampa Bay Rays.
Machado spent several minutes on the field in obvious pain before being carted off by the Orioles training staff.
In 155 games coming into Monday, Machado has hit .282/.313/.431 (99 OPS+) with 14 home runs and a league-leading 51 doubles. He also leads the league in at-bats (663) and plate appearances (706), another testament to his...
The Tampa Bay Rays will get left-hander Matt Moore back on Sept 3 with a start against the Los Angels Angels according to Marc Topkin of the Tampa Bay Times.
Moore was 14-3 with a 3.41 ERA before Tampa Bay put him on the disabled list July 31 with a tender elbow.
Moore threw 49 pitches in a simulated game on Sunday and pronounced himself ready.He said Sunday, according to the Tampa Tribune, that he had felt the normal soreness he would after pitching in a regular game and would try to talk Maddon into letting him return this week.
Tampa Bay...
According to reports New York Mets ace Matt Harvey is headed to the disabled list with a partially torn ulnar collateral ligament and could be facing Tommy John Surgery. Marc Carig of Newsday originally reported that Harvey underwent an MRI on Monday morning.
Harvey has pitched to a 2.27 ERA this season , his first full season in the major leagues and started the All-Star Game at Cit Field in July. Teh team had planned to shut Harvey down at 200 innings.
Mets manager Terry Collins and general manager Sandy Alderson are expected to provide further...
Tampa Bay Rays center-fielder Desmond Jennings (fractured left middle finger) is expected to be activated from the disabled list today and rejoin the team in Baltimore. Jennings has been out since breaking the finger Aug. 3, played for Class A Charlotte on Sunday and went 1-for-3.
In 104 games before the injury, Jennings was hitting .258/.326/.419 (107 OPS+) with 11 home runs and a team-leading 17 stolen bases.
Reliever Brandon Gomes is expected to be optioned back to Durham to make room on the roster. The Rays start a three game series with...
The Tampa Bay Rays activated Alex Cobb off the 60 day DL and designated infielder Ryan Roberts for assignment to clear space on the roster.
Cobb has been on the DL since being hit by a line drive off the bat of Kansas City’s Eric Hosmer in July.
Cobb, 25, is 6-2 with a 3.01 ERA, 1.16 WHIP and 76 strikeouts in 83 2/3 innings this season. He made two minor-league rehab starts, most recently going 4 1/3 innings (giving up five hits and three earned runs) for the High-A Charlotte Stone Crabs.
Roberts was acquired last season from the Arizona Diamondbacks,...
Tampa Bay Rays lefty Matt Moore will not return to the rotation this weekend and the team isn’t sure when he will rejoin the rotation.
The All-Star is out with a sore left elbow. He had hoped to return this weekend, but reportedly was not feeling 100% after bullpen session before Wednesdays game against the Seattle Mariners. Moore said he won’t throw again until Sunday.
“I felt good, but good isn’t great, and great is 100 percent,” Moore said. “What we’re really aiming for is to be back out there and...
According to Marc Topkin of the Tampa Bay Times Alex Cobb is set to come off the DL and will start Thursday against the Seattle Mariners at Tropicana Field.
Cobb made his third rehab start (first one cut short after two pitches due to a blister) for the High-A Charlotte Stone Crabs against the Fort Myers Miracle working 4.1 innings allowing 3R/ER on five hits striking out five and walking two last night.
Cobb has been on the DL since being struck in the head by a line drive off the bat of Eric Hosmer of the Kansas City Royals on June 15th....
Los Angeles Dodgers Matt Kemp took batting practice before yesterday’s game against the St. Louis Cardinals and reported afterwards that things went well and he was progressing towards a return to the Dodgers line-up sooner rather than later.
“[It’s] a start, it’s better than where I was,” Jim Peltz of the Los Angeles Times quotes Kemp. “Felt good to get back out there and hit a little bit. Felt like a real baseball player.
Kemp came off the DL for one game after nursing his sore shoulder back to health and...
Tampa Bay Rays rookie right-hander Chris Archer left his start in Arizona in the second inning with tightness in his right forearm.
Archer allowed a run in the first and got two outs in the second before leaving with a 2-1 count against Didi Gregorius.
Catcher Jose Molina went out to the mound after the pitch and signaled to the Rays staff.
After a brief discussion with trainer Ron Porterfield and Rays skipper Joe Maddon Archer left the game and was replaced by Alex Torres.
Archer was the AL pitcher of the month in July after going 4-0 with a...
The Boston Red Sox have placed reliever Matt Thornton on the 15 day disabled list with an oblique strain. Thorton was acquired from the Chicago White Sox after losing left-hander Andrew Miller for the rest of the season, and has made 10 appearances for Boston, giving up two runs on 12 hits over 8 1/3 innings with two walks and six strikeouts.
In 50 total appearances this year, he has a 3.47 ERA, holding left-handed hitters to a .221 average.
“Talking to the guys that have had it — I’ve never had anything like this in my career...
Colorado Rockies outfielder Carlos Gonzalez has been placed on the disabled list with a finger sprain. Gonzalez has suffered with the sprain on his right middle finger off and on for the past month.
He will be eligible to return on August 20, although the Rockies are not in contention and there is no need to hurry him back until he is 100% healed.
“I don’t want to go on the DL. But I can’t swing. I am just a slap hitter, that’s all I can do right now,” said Gonzalez after the Rockies’ 5-1 loss to the Pirates.
Gonzalez...
The Tampa Bay Rays placed center-fielder Desmond Jennings on the 15 day DL with a fractured middle finger on his left hand.
Jennings hurt the finger Saturday on a slide against the Giants in extra innings and it was thought to be a relatively minor sprain.
Jason Bourgeois was recalled from Triple-A Durham to take his place on the roster.
Sam Fuld played center field for Tampa Bay on Sunday and could find himself in platoon situation with Bourgeois.
Bourgeois has a career slash line of .261/.306/.324 over parts of five major league seasons and...
New York Yankees shortstop Derek Jeter has been diagnosed with a right calf strain and may require another stint the on disabled list.
An MRI was performed on Saturday where a Grade 1 calf strain was revealed.
The Yankees have not made a decision on whether Jeter, 39, is headed back to the disabled list.
Jeter said he first felt the injury on Monday, the morning after his first game back from his latest DL stint for a strained right quad.
“It feels like you were hit with a ball or something,” he said. “It’s like a deep...
Atlanta Braves right-hander Tim Hudson was carted off the field after being stepped on by New York Mets outfielder Eric Young Jr. accidentally stepped on his right ankle/foot at first base.
Young stepped on the back of Hudson’s ankle near his Achilles attempting to beat the throw by Braves first baseman Freddie Freeman. Hudson took Freeman’s toss at the bag just before Young arrived. Young immediately went over to Hudson to see if he was ok.
Hudson , 38, stayed down in obvious pain before being carted off by medical staff. Hudson had gone...
The top pitching prospect in the Tampa Bay Rays organization, Taylor Guerrieri, underwent Tommy John surgery today and will most likely be out until the 2015 season.
Guerrieri was slated to pitch in the 2013 Futures Game, but was scratched due to fatigue, which appeared to follow him into his most recent start on July 15, where he was pulled in the third inning with elbow soreness.
Guerrieri visited with Dr. James Andrews on Wednesday morning and the decision was made to have the surgery that afternoon, which was a reported success.
The Rays’...
The Pittsburgh Pirates placed RHP Jason Grilli on the 15-day disabled list with a right forearm strain. Grilli was forced to exit Monday’s game after he hurt his forearm on a pitch.
The 36-year-old All-Star closer came into the game with a 1.94 ERA in 41 2/3 innings. He had gone 30-for-31 in save chances.
Grilli is scheduled to head back to Pittsburgh for tests. Mark Melancon should fill the closer role for now and makes for a must-own in mixed fantasy leagues.
Melancon has a 0.97 ERA this season, and saved 20 games for the Astros in 2011.
Read More »
St. Louis Cardinals will be without slugger Matt Holliday for at least another week as the team placed the left fielder on the 15 day disabled list. He’s hitting .268/.351/.448 with 13 homers and 47 RBI this season.
First baseman/outfielder Brock Peterson Was called up to take holidays roster spot. Peterson was hitting .306 with a league-high 22 home runs in 93 games for Triple-A Memphis, and represented the team in the AAA All-Star game earlier this week.
Holliday has been out since suffering a hamstring strain running out a ground...
Los Angeles Dodgers starter Josh Beckett will undergo season-ending surgery to relieve pressure on the nerves in both his neck and shoulder region, after experiencing tingling in his fingers following a throwing session on Friday.
Beckett was originally placed on the 15-day disabled list in mid-May following a nerve entrapment in his shoulder that caused the Los Angeles starter difficulty in gripping a baseball. Due to such, the Dodgers shut down Beckett for four weeks as means to allow him to work his way back to the rotation in a slow and efficient...
The Cleveland Indians have activated Chris Perez from the 15-day disabled list after the closer missed just over a month due to a strained right rotator cuff. Perez will join the Indians in the middle of a series with the Baltimore Orioles and will retake the reigns as primary closer from Vinnie Pestano, who performed solidly in Perez’s absence.
Pestano was five-for-five in save opportunities, posting a 2.45 ERA in 11.0 innings of work in his time as the fill-in closer.
Prior to his shoulder injury, Perez was coming off of a three-game period...
The little lingering chance of season ending surgery appears to be a painful reality for New York Yankees first baseman and slugger Mark Teixeira. With the trade deadline just over a month away, it is now apparent the Yankees will be on the hunt for a first baseman as Lyle Overbay struggles against lefties and David Adams has not been able to cut it in the majors offensively so far.
For Tex, it has been recommended he seek surgery as the final option for repairing his right wrist, the same wrist he initially injured the first day of spring training...
The Baltimore Orioles will not see an expected callup of its top pitching prospect in 2013. Dylan Bundy, the phenom expected to help boost a struggling rotation or average bullpen at some point this year, will now miss the remainder of it when he undergoes Tommy John Surgery.
Bundy entered 2013 as the top pitching prospect in all of baseball, and a tear in his elbow will delay his MLB appearance by at least one season.
Due to the poor timing of the necessary surgery, this knocks Bundy out for at least the first half of 2014, likely sidelining him...
San Francisco Giants outfielder Angel Pagan will undergo surgery on Tuesday and is expected to miss 10-12 weeks recovering from an injured right hamstring tendon. Pagan has been the starting center fielder for the defending champion, San Francisco Giants and was having a solid year until his injury.
While the loss of production is a big blow for a Giants’ team already struggling, they do have internal options to plug in for the injury.
Pagan was hitting .262/.314 with three home runs and 24 RBI to go with six stolen bases. While not the...
New York Yankees third baseman Alex Rodriguez has been given medical clearance by doctors to begin rehab games beginning July 1. Rodriguez hasn’t played at all in 2013, having undergone surgery on his left hip in January.
It was projected that he could return after the All-Star break, and that timeline seems to be accurate at this point.
He would likely need 20 or so games of rehab before returning to the major leagues. Rodriguez, 37, hit .272/.353/.430 with 18 homers and 57 RBIs in 122 games last season.
A-Rod also faces an investigation...
San Diego Padres Clayton Richard will be headed to the disabled list after feeling pain in his AC joint (down his neck and into the upper part of his chest) in Friday’s game against the Los Angeles Dodgers.
Richard had only thrown two pitches (the first a ball and the second a strike to leadoff hitter Mark Ellis) before he felt discomfort in his shoulder.
Padres manager Bud Black came out to meet with the southpaw, which ended with Richard being pulled from the game.
Tim Stauffer came into the game in relief of Richard, pitching four innings...
Derek Jeter, New York Yankees captain and future hall of famer, took on-field batting practice on Wednesday for the first time since fracturing his ankle for the second time in mid-April.
The Wednesday session serves as a positive step in the right direction for Jeter and the Yankees organization, as he continues to work out and strengthen his ankle at New York’s spring training complex in Tampa, Florida.
Jeter took the field for the first time a week and a half ago, fielding grounders, taking swings, and completing a long toss session.
Since...
The Boston Red Sox have placed Clay Buchholz on the 15-day disabled list due to a strained trapezius muscle in his neck, retroactive to June 9. Buchholz has been nagged by the injury since his last start on June 8 and has battled health issues over the past few weeks, as he has only made two starts since May 22.
Buchholz threw a bullpen session before the second game of Tuesday’s doubleheader against the Tampa Bay Rays, but was clearly not ready to start on Tuesday evening.
As a result, Buchholz will make a stint on the DL and will not be...
The Detroit Tigers have placed right-hander Anibal Sanchez and catcher Alex Avila on the 15 day disabled list. Sanchez has been battling shoulder problems and is expected to miss at least two starts.
Sanchez signed a five-year $88 million deal in the off-season and is pitching to a 2.76 ERA, with a 6-5 record.
Avila has a bruised left forearm the result of being hit by a pitch and is hitting .172/.271/.288 with five home runs in 48 games.
In corresponding move , the Tigers recalled outfielder Avisail Garcia and catcher Bryan Holaday.
The Tigers...
The New York Yankees placed first baseman Mark Teixeira back on the 15 day disabled list general manager Brian Cashman said Monday.
Teixeira was pulled from the game on Saturday at Los Angeles at his request with a sore wrist. Later that day Teixeira headed back to New York to consult with Yankees team physicians.
Teixeira received a cortisone shot and will be reevaluated next week.
He was diagnosed with inflammation in his right wrist although not directly related to the issue that put him on the disabled list for the first two months of the...
Washington Nationals starting pitcher Stephen Strasburg returned from the 15-day DL on Sunday to face the Cleveland Indians in his first start since injuring his oblique in a May 31 start against the Atlanta Braves.
Strasburg worked five innings, surrendering just one run and one hit, along with four strikeouts and four walks. Strasburg was held to just 82 pitches and was pulled after the fifth inning as precaution in avoiding a potential re-injury of his oblique or other complications.
Strasburg, although allowing just one hit, did not have good...
In a 2013 season in which he has baffled hitters in a talent-heavy Midwest League and risen to the status as the top prospect in the Cincinnati Reds organization, Robert Stephenson has been placed on the disabled list with what is being called a strained hamstring, which he recently suffered while running in between starts.
Coming into the season, Stephenson was ranked second behind outfield prospect Billy Hamilton as the top prospect in the Reds organization by both Baseball America and MLB.com; however, a lackluster season for Hamilton who has...
Texas Rangers second baseman Ian Kinsler has been activated from the Disabled List and bat leadoff for the Rangers in Toronto. Kinsler, no stranger to injury has missed nearly a month with an intercostal strain and will return to face RA Dickey and the Blue Jays.
The 30-year-old second baseman has stayed healthy the past two seasons, playing in 155 and 157 games after playing in 130 or less the previous four out of five seasons.
In 2013, Kinsler had 7 HR and 20 RBI, with an above norm .302 BA and .389 OBP in 180 ABs. In response to reactivating...
The Cincinnati Reds placed setup man, Jonathan Broxton, on the DL with a right elbow flexor strain. Broxton’s stint is retroactive to June 14th and it is unclear at this time whether he will be back by his eligible return date.
With the move, the Reds’ bullpen is a little thinner for the time being but Broxton had struggled of late, likely due to the injury.
Cincinnati has World Series aspirations again this season and are currently 2.5 games behind the division leading Cardinals for the top record in the National League. The Reds...
The Milwaukee Brewers put outfielder Ryan Braun on the 15 day disabled list following a 4-3 loss to the Cincinnati Reds on Friday night.
Braun had missed the last four games with a sore right thumb and attempted a batting practice session that did not go well.
The Brewers are hopeful Braun will be able to return as soon as he is eligible.
It was then that the decision was made to place Braun on the disabled list.
Braun is batting .304 with nine homers and 36 RBIs. He won the NL’s Most Valuable Player award in 2011 and finished second to... |
---
abstract: 'The elementary excitations of fractional quantum Hall (FQH) fluids are vortices with fractional statistics. Yet, this fundamental prediction has remained an open experimental challenge. Here we show that the cross current noise in a three-terminal tunneling experiment of a two dimensional electron gas in the FQH regime can be used to detect directly the statistical angle of the excitations of these topological quantum fluids. We show that the noise also reveals signatures of exclusion statistics and of fractional charge. The vortices of Laughlin states should exhibit a “bunching” effect, while for higher states in the Jain sequences they should exhibit an “anti-bunching” effect.'
author:
- 'Eun-Ah Kim'
- Michael Lawler
- Smitha Vishveshwara
- Eduardo Fradkin
title: Signatures of fractional statistics in noise experiments in quantum Hall fluids
---
The classification of fundamental particles in terms of their quantum statistics, Bose-Einstein (bosons) and Fermi-Dirac (fermions), is a fundamental law of Nature enshrined in the Principles of Quantum Mechanics. In the form of the [*Spin-Statistics Theorem*]{} it is also one of the basic [*axioms*]{} of Quantum Field Theory (and String Theory as well). However, it has long been known that other types of quantum statistics are also possible if the physical system has a reduced dimensionality. Indeed, the possible existence of [*anyons*]{}[@leinaas77; @wilczek82], particles with [*fractional or braid* ]{} statistics, interpolating between bosons and fermions, is one of the most startling predictions of Quantum Mechanics in two space dimensions.
The best experimental candidates for anyons presently known are the vortices (or quasiparticles (qp)) of a strongly interacting 2D electron gas (2DEG) in a strong magnetic field in the FQH regime[@tsui82; @laughlin83; @haldane83; @halperin84; @arovas84]. In this regime, the 2DEG behaves as an incompressible dissipationless topological fluid exhibiting the FQH effect [@tsui82; @laughlin83]. The quasiparticles of FQH fluids have remarkable properties[@laughlin83; @haldane83; @halperin84; @arovas84]: they are finite energy vortices (or solitons) which carry fractional charge and fractional (braid) statistics. Although by now there is strong experimental evidence for fractional charge [@goldman95; @picciotto97; @saminadayar97; @reznikov99; @Yacoby04], similar evidence is still lacking for fractional statistics (such experimental evidence has been reported very recently [@camino05].)
There are two ways to think about statistics. A first way is through the concept of [*braiding (fractional) statistics*]{}, in which the two particle wave function $\Psi({\bf r}_1, {\bf r}_2)$ acquires a statistical angle $\theta$ upon an adiabatic exchange process, $$\Psi({\bf r}_1, {\bf r}_2)=e^{i\theta}\Psi({\bf r}_2, {\bf r}_1).
\label{eq:exchange}$$ For fractional statistics to occur, the statistical angle $\theta$ should take values intermediate between that of bosons ($\theta\!=\!0$, particles commute) and fermions ($\theta\!=\!\pi$, particles anti-commute)[@wilczek82; @arovas84]. The other way is to consider, in a finite size system, the effect of the presence of particles to the subsequent addition of another particle. The Pauli Exclusion Principle dictates that each fermion in a system reduces the available states to add extra fermions by $1$. In contrast, the presence of a boson does not affect the later addition of bosons at all. The natural consequence of the presence of an anyon is an intermediate effect, [*i.e.*]{} a generalized exclusion principle[@haldane91; @vanelburg98]. Unfortunately, neither braiding nor exclusion of anyons have been unequivocally observed to date.
The difficulty in detecting fractional statistics lies in the extended nature of these quantum vortices. The adiabatic transport of one vortex around another is a conceptually nice [*gedanken*]{} experiment which is difficult to realize in practice. A number of interesting interferometers have been proposed to detect fractional statistics in FQH fluids [@jain93; @chamon-freed-kivelson-sondhi-wen97; @Kane03], none of which has yet been realized experimentally, except possibly for the recent experiments of Ref.[@camino05]. Theoretical schemes to measure non-Abelian statistics have also been proposed.[@fradkin98; @freedman05]
Here we propose an interferometer designed to detect [*noise correlations*]{} of the charge currents in a three-terminal experiment (a “T- junction”) of a 2DEG in the FQH regime. We will show that the structure of the noise in the charge current cross-correlations in this T-junction provides a unique way to detect the fractional statistics of the vortices directly in realistic experimental conditions. This study was inspired by Refs. [@safi01; @vishveshwara03] and we will compare our results with these references below.
A zoo of different anyonic qp’s have long been predicted to exist for each filling factor $\nu$ (the number of electrons per flux quanta) exhibiting the FQH effect (See Table 1 for examples). At each allowed $\nu$ the 2DEG displays a precise (fractional) quantization of the Hall conductance $\sigma_{xy}=\nu e^2/h$. These quantum states are distinct phases of the 2DEG distinguished by a non-trivial internal or [*topological order*]{}, which is robust against arbitrary local perturbations [@wen-niu90; @wen95]. The measurement of fractional statistics will directly prove the existence of topological order. In fully polarized 2DEGs the most prominent states lie in the Jain sequences [@jain89], with filling fractions $\nu=p/(2np\!+\!1)$, including the Laughlin states[@laughlin83] (for $p\!=\!1$). The statistical angle of vortices of Laughlin states lie in the range $\theta/\pi\!<\!1/2$, and are closer to that of bosons. In contrast, for the higher states in the Jain sequence, with $p\!>\!1$, the statistical angle of their vortices lie in the range $\theta/\pi\!>\!1/2$, which is closer to that of fermions [@lopez99; @comment-wen] (See Table \[table:T1\]). We show below that this difference leads to a “bunching” effect for Laughlin states and to an “anti-bunching” effect for non-Laughlin states. In particular, in these sequences there are pairs of FQH states , [*e.g.*]{} $\nu=1/5$ and $\nu=2/5$, whose qp’s have the same fractional charge but different fractional statistics. Hence, their qp’s exhibit either bunching or anti-bunching behavior while having the same charge.
[|Y||Y|Y|C|Y|]{} & & p=1 & p>1&\
e\^\*/e& 0,2,& & & 1\
/& 0 & & 1\
\[table:qn\]
Since the FQH liquids are incompressible, it costs a finite amount of energy (the [*gap*]{}) to create a qp excitation in the 2D bulk of the 2DEG. However, these liquids support gapless one-dimensional chiral excitations at the edge [@wen90; @wen95], opening a window for experimental probes. In particular, tunneling between edges allows a practical access to single qp properties, provided the tunneling paths lie inside the FQH liquid (as the qp’s can only exist within the FQH liquid). Single-point contact tunneling has been successfully used for the detection of fractional charge through shot noise measurements[@picciotto97; @saminadayar97; @reznikov99]. However, in order to stage an exchange between two qp’s from multiple independent edges, one needs at least two point contacts. Further, if multiple edges are in point contacts with a single edge each adding/removing qp’s to one edge, the generalized exclusion principle can manifest itself. A T-junction interferometer of the type shown in Fig.\[fig:hbt\] is a minimal realization of such a situation.
![The proposed T-junction[@comment] and virtual processes for currents in the same ($S$) and opposite ($O$) orientations. Blue lines represent edge states where the edge state $0$ is held at potential $V$ relative to edges $1$ and $2$, [*i.e.*]{} $V_0-V_1=V_0-V_2=V$. Red solid lines show paths of two quasiparticle tunneling through a FQH liquid from one edge state to two others and magenta dashed lines represent virtual tunneling events.[]{data-label="fig:hbt"}](T-HBT-total.eps){width="44.00000%"}
In this T-junction interferometer, the qp’s are driven to tunnel between one edge and two other edges. Top gates can be used to define and bring together three edges which are attached to external leads by ohmic contacts. Upon setting the edge $0$ at relative voltage $V$ to the two others, qp’s are driven to tunnel between these edge states. The resulting tunneling current operator is $$I_j(t)\!=\!i\frac{e}{\hbar}^*\Gamma_j
(e^{i\omega_0t}\psi_j^\dagger\psi_0 -e^{-i\omega_0t}\psi_0^\dagger\psi_j) ,
\label{eq:current}$$ where $\Gamma_j$ is the tunneling amplitude between edges $0$ and $j\!=\!1,2$ respectively, and $\psi_0^\dagger$ and $\psi_j^\dagger$ are qp creation operators at the respective edges. The Josephson frequency $\omega_0=e^*V/\hbar$ depends explicitly on the fractional charge. Each edge state, labelled by $l=0,1,2$, is a 1D chiral Luttinger liquid[@wen90; @wen95], whose equal-position qp propagator, at time $t$ and temperature $T$, is given by[@lopez99] $$\langle\psi_l(t)\psi^\dagger_l(0)\rangle =
\bigg|\frac{\pi\tau_0k_B T}{\sinh(\pi k_BTt)}\bigg|^{
K}e^{-i\frac{\theta}{2}{\textrm{sign}(t)}}. \label{eq:prop}$$ Here $\psi^\dagger_l(t)$ is the qp creation operator for edge $l$, $\tau_0$ is a short time cutoff, and $k_B$ is the Boltzmann constant. Eq. defines the scaling dimension of the qp operator ${\frac{K}{2}=\frac{1}{2p(2np+1)}}$. The fractional statistics, defined in Eq. for qp’s of the same edge, is encoded in this propagator, through its explicit dependence on the statistical angle $\theta$. For qp’s of different edges, $l$ and $m$, the qp operators obey the (inter-edge) commutation rules $$\psi^\dagger_l\psi^\dagger_m\!=\!e^{-i\alpha_{lm}}\psi^\dagger_m\psi^\dagger_l,
\label{eq:klein}$$ with $\alpha_{02}\!=\!\alpha_{21}\!=\!\alpha_{01}\!=\!\theta$ and $\alpha_{lm}\!=
\!-\alpha_{ml}$. Our goal is to find a measurable quantity which reflects the $\theta$ dependence in Eqs. and .
The normalized charge current cross-correlation $S(t)$ (noise) ($\Delta I_l=I_l-\langle I_l \rangle$): $$S(t)\equiv\frac{ \langle \Delta I_1(t)\Delta I_2(0)\rangle}
{\langle I_1\rangle\langle I_2\rangle} .
\label{eq:St}$$ turns out to be the simplest quantity that can exhibit the subtle signatures of fractional statistics[@safi01], and distinguish them from those of fractional charge. We have calculated this non-equilibrium noise, using the Schwinger-Keldysh technique[@Chamon93; @Chamon94] to lowest order in the tunneling amplitudes $\Gamma_j$. The two virtual tunneling events in Fig. \[fig:hbt\] are the lowest order non-vanishing contributions to the correlator $S(t)$ and they take place at all times allowed by causality. Depending on the relative orientations of the currents, the virtual tunneling processes leave two distinct pairs of objects at edge $0$, as shown in Fig. \[fig:hbt\]. When the currents $I_1$ and $I_2$ have the same orientation (case $S$), a qp-qp pair (or a qh-qh pair) is left behind, while when they have opposite orientations (case $O$), qp-qh pairs are left behind. Comparing the statistical phase gain upon exchange of qp-qp pairs (or qh-qh pairs) in case $S$ and exchange of qp-qh pair in case $O$ prescribed in Eqs. and , we find that [*all* ]{} the dependence in fractional statistics is captured by a factor of $\cos\theta$ coming from contributions of case $S$.
The frequency spectrum of $S(t)$ in Eq. can be written as a sum of two functions, a “direct” and an “exchange” term, with a dependence on $\theta$ which is both simple and explicit:[@kim-prep] $$\widetilde S\left(\frac{\omega}{\omega_0}\right)=A\left(\frac{\omega}{\omega_0}, \frac{\displaystyle T}{\displaystyle T_0}, K\right) +
{\cos\theta}\ B\left(\frac{\omega}{\omega_0} , \frac{\displaystyle T}{\displaystyle T_0}, K\right),
\label{eq:ab}$$ where $\omega$ is the frequency and $T_0\!=\!\hbar\omega_0/k_B$.[@comment] This expression displays a number of remarkable properties:
1. This universal form, which applies for all Jain states, is the lowest order in perturbation theory in the tunneling amplitude. It is accurate provided the tunneling current is small (compared with the Hall current). Non-universal terms contribute at higher orders.
2. Fractional charge and statistics play fundamentally distinct roles: fractional charge enters Eq. through the Josephson frequency $\omega_0=e^*V/\hbar$ and fractional statistics through the $\cos\theta$ factor.
3. Given that for Laughlin states $\theta<\pi/2$ and $\cos\theta>0$, the exchange term in Eq (\[eq:ab\]) provides largely positive (“bunching” ) contributions to the noise whereas for non-Laughlin states with $\theta>\pi/2$, its contribution is largely negative (“anti-bunching”).
4. That only case $S$ (Fig. \[fig:hbt\]) contributes to this factor can be viewed as a manifestation of a generalized exclusion principle[@haldane91] since the virtual processes in this case involves adding a qp to edge $0$ in the presence of another. This is an intriguing observation given that Eq. was derived using anyonic commutation rules prescribed by [*braiding*]{} statistics[@arovas84].
We have studied (numerically) the behavior of the functions $\widetilde A(\omega/\omega_0, T/T_0,K)$ and $\widetilde B (\omega/\omega_0,T/T_0,K)$, whose details will be reported in a future publication[@kim-prep]. The salient results of this study, for $\omega\ll\omega_0$ and $\omega\sim\omega_0$, are as follows. For $\omega\ll\omega_0$, both $\widetilde A$ and $\widetilde B$ show white noise-like behavior, and hence we focus on zero frequency values $\widetilde A(\omega\!=\!0)\equiv\widetilde A_0$ and $\widetilde B(\omega\!=\!0)\equiv\widetilde B_0$ which depend only on the temperature (See Fig. \[fig:Sw0\]). $\widetilde A_0$ is negative due to the opposite orientation of the currents in case $O$ of Fig. \[fig:hbt\] while $\widetilde B_0$ is positive as it only involves case $S$. Hence, $\widetilde S(\omega\!\!=\!\!0)\!=\!-|\widetilde A_0|\!+\!\cos\theta|\widetilde B_0|$. As shown in Fig. \[fig:Sw0\], $-|\widetilde A_0|$ dominates the spectrum at low temperatures ($T\ll T_0$) due to divergent contributions from case $O$ ($T^{-K}$ power law divergence). Nonetheless, $\cos\theta|\widetilde B_0|$ significantly contributes to the total noise for higher temperatures of $2\lesssim T/T_0\lesssim4$. Thus, the statistical angle $\theta$ can be measured directly at a finite temperature.
![\[fig:Sw0\] The temperature dependence the direct term $\widetilde A_0$ (orange dashed line) and the exchange term $\widetilde B_0$ (green solid line) defined in the text, for $\nu=2/5$ with $T_0\sim80{\text m}K$ ( $V\!=\!40\mu V$). This qualitative behavior is generic to all fractions. ](Sw0.eps){width="36.00000%"}
Near the Josephson frequency $\omega\!\sim\!\omega_0$, $\widetilde A$ and $\widetilde B$ have qualitatively different sharp features at low temperatures ($T\ll T_0$): $\widetilde A(\omega/\omega_0)$ changes sign and crosses the frequency axis steeply, while $\widetilde B(\omega/\omega_0)$ develops a peak of width $2K k_BT/\hbar\omega_0$. These sharp features provide a direct way to measure the fractional charge[@Chamon93; @Chamon94], through the Josephson frequency. They can be used to distinguish between two filling factors with the same fractional charge but different statistics, [*e.g.*]{} $\nu=1/5$ and $\nu=2/5$. Since the direct term nearly vanishes close to the Josephson frequency, the exchange term plays a significant role in the total correlation $\widetilde S(\omega/\omega_0\!=\!1)$ by shifting it to a positive (negative) value for Laughlin (non-Laughlin) states as shown in Fig. \[fig:Sw-peak\](a). The information on statistics and charge contained in the noise near the Josephson frequency is summarized in Fig. \[fig:Sw-peak\](b), where we introduced the “effective charge” $\bar e \equiv\hbar\bar\omega/V$ obtained from the crossing point of $\widetilde S$ [*i.e.* ]{} $\widetilde S(\bar\omega/\omega_0)=0$. Comparing $\bar e$’s for $\nu\!=\!1/5$ and for $\nu\!=\!2/5$ we find them satisfying $\bar e_{1/5}\!<\!e^*\!<\!\bar e_{2/5}$ over a broad range of (low) temperatures, however both approaching the fractional charge $e^*\!=\!e/5$ as $T\to 0$. This different asymptotic behavior is a consequence of their different statistical angles: $\theta\!=\!\pi/5$ (bunching) for $\nu=1/5$ and $\theta\!=\!3\pi/5$ (anti-bunching) for $\nu\!=\!2/5$. This (weak) effect also shows that the vortices of these FQH states have different fractional statistics in spite of having the same fractional charge.
In summary, we have shown that the cross-current noise in a T-junction can be used to directly measure the statistical angle $\theta$ independently from the fractional charge, and conceptually, from the filling factor $\nu$. The low temperature and low frequency results show that there is a quantitatively significant statistics-dependence of this noise. We have shown how to measure both fractional charge and statistics near the Josephson frequency. Our results are independent of non-universal short time physics. @safi01 considered a similar setup for Laughlin states at $T=0$, and obtained an expression for $\widetilde S(\omega\!=\!0)$ for case $O$ alone as a function of $\nu$ (for Laughlin states one cannot distinguish $\nu$ from $K$ or $e^*/e$ or $\theta/\pi$). At [*finite temperatures*]{}, case $S$ (whose contribution is negligible next to case $O$ at zero temperature) brings in an explicit statistics dependence which can be distinguished from the effect of the fractional charge and the scaling dimension for non-Laughlin states. A closely related setup is the four terminal case studied (only for Laughlin states at $T=0$) by Vishveshwara \[\]. Even in this case, an actual measurement of the cross-correlation functions will involve the quantity $S(t)$ we calculated here.
The current state-of-the-art noise experiments [@reznikov99; @chung03] operate at bias voltages of $10-150 \mu V$ (corresponding to a Josephson frequency $\omega_0 \sim 1$ GHz), and temperatures of $10-100mK$. These parameters access the ratios of $T/T_0$ in the range shown here, making our proposal quite feasible. To remain in the perturbative regime the voltage $V$ has to be large compared to a crossover scale determined by the tunneling amplitudes, so that the current is a small fraction ($\sim 0.1$ ) of the Hall current at the same voltage, but still with a measurable noise. Some recent experiments are consistent with fractional statistics. A somewhat large qp charge, extracted in recent shot noise experiments, suggests bunching behavior.[@chung03] Aharonov-Bohm oscillations in an anti-dot with a super-period have been interpreted as evidence for fractional statistics.[@camino05]
[**Acknowledgments**]{}: This work was supported in part by the National Science Foundation through the grants DMR 0442537 (EK, ML, EF), DOE-MRL DEFG02-91-ER45439 (SV). We thank F.D.M. Haldane, M. Heiblum, and especially C. Chamon for important comments.
[33]{} natexlab\#1[\#1]{}bibnamefont \#1[\#1]{}bibfnamefont \#1[\#1]{}citenamefont \#1[\#1]{}url \#1[`#1`]{}urlprefix\[2\][\#2]{} \[2\]\[\][[\#2](#2)]{}
, ****, ().
, ****, ().
, , , ****, ().
, ****, ().
, ****, ().
, ****, ().
, , , ****, ().
, ****, ().
, , , , , , ****, ().
, , , , ****, ().
, , , , , ****, ().
, , , , , , , , , ****, ().
, , , .
, ****, ().
, ****, ().
, , , ****, ().
, , , , , ****, ().
, ****, ().
, , , , ****, ().
, , , ****, ().
, , , ****, ().
, ****, ().
, ****, ().
, ****, ().
, ****, ().
, ****, ().
, ****, ().
, , , ****, ().
, , , ****, ().
, , , (), .
, , , ****, ().
|
Collaboration with Architect Bill Lindburg (then PRA Firm) in redesinging alleys in Salem, Oregon as part of an urban renewal project. This also resulted in a water feature near the Chemeketa Overpark. Designed the homes for Emerald Valley Resort in Creswell and worked with Architect Wallace Ruff and developer Ron Petitti in the site development. Desing and Construction of sculpture studio for Dr. Roger Hall. Design of private residence for Sculptor Tom Morandi in Corvallis (completed in 1985) and the Stobie Residenc on the McKenzie River (design completion 1999). |
Trust in the context of patient safety problems.
This paper considers some implications of recent developments relating to patient safety for understandings of trust in health care contexts. Conceptual analysis focusing on patients' trust in health care providers and health care providers' trust in patients. Growing awareness of the scale of the problem of iatrogenic harm has prompted concerns that patients' trust in health care providers may be threatened and/or become inappropriate or dysfunctional. In principle, however, patients' trust may be both well placed and compatible with current understandings of safety problems and efforts to address these. Contemporary understandings of patient safety suggest that, to be deemed trustworthy, health care providers should make vigorous efforts to improve patient safety, be honest about safety issues, enable patients to contribute effectively to their own safety, and provide appropriate care and support after safety incidents. Patients who trust health care providers need not be ignorant of patient safety problems and may be vigilant in the course of their care. Iatrogenic harms do not necessarily reflect breeches of trust (not all such harms are yet preventable), and patients who are harmed might in some circumstances appropriately forgive and resume trusting. Health care providers may feel vulnerable to patients in several respects. From their perspective, trustworthy patients will act competently to optimise the outcomes of their health care efforts and to preserve health care providers' good reputations where those are justified. Providers' trust in patients may strengthen patients' trust in them and facilitate safety improvement work. Shows how, in principle, trust can be compatible with current understandings of patient safety issues and may enhance efforts to improve patient safety. |
Michael Brissenden presents AM Monday to Friday from 8:00am on ABC Local Radio and 7:10am on Radio National. Join Elizabeth Jackson for the Saturday edition at 8am on Local Radio and 7am on Radio National.
More Current Affairs:
Program Archive:
Tuesday 2 January 2007
AM is Australia's most informative morning current affairs. It covers the stories each morning that the other current affairs teams follow for the rest of the day. Below is the program summary with links to transcripts and audio (if available).
US death toll in Iraq hits 3,000
In the United States President George Bush has yet to come up with a new strategy for Iraq. While the headlines have been dominated by the execution of Saddam Hussein, the number of American dead has climbed to over 3,000, with the deaths of two soldiers killed in an explosion in Iraq's Diyala province, northeast of Baghdad. The grim new milestone will put added pressure on a President who's been meeting with his war cabinet at his ranch in Texas over the Christmas-New Year break.
Government pushes for bi-lateral child abduction agreement
More than 500 children have been illegally taken from Australia over the past six years, usually by one of their parents. The number of stolen children could be much higher, because the Federal Government only tracks those taken to countries that are signatories to an international agreement on child abduction.
Githabul people to secure major native title agreement
After a decade of negotiations and legal wrangling, an Aboriginal group and the New South Wales Government are just weeks away from signing off on the state's biggest native title deal. The Indigenous Land Use Agreement will cover parts of the 6,000 square kilometre area in the northeast of the state. It will give the Githabul people a joint managerial control of World Heritage Listed national parks and control over future development on some areas of crown and leasehold land.
Catholic group wins pregnancy counselling contract
The Federal Government has awarded part of a $51-million pregnancy counselling contract to the health and welfare arm of the Catholic Church, known as the Centacare group. Prime Minister John Howard last year announced a four-year scheme to offer pregnancy support counselling through a new Medicare payment and a 24-hour, seven day a week telephone help line for women, their partners and their families.
Romania and Bulgaria join the EU
In Romania and Bulgaria they're still nursing hangovers after wild celebrations greeted both nations' entry into the European Union. It brings the total to 27 countries. Thousands of people have already made use of relaxed travel restrictions that came in at the stroke of midnight.
Bootleg Russian vodka kills thousands
While the poisoning of a former Russian spy in London has made headlines across the world, in Russia another kind of poisoning has gained the attention of the authorities. Thousands of Russians have died over the past year and many more have become very ill after drinking bootleg vodka laced with industrial spirit. It's prompted some lawmakers in Russia to suggest the state should once again take over the multi-billion dollar alcohol industry to ensure the quality of the country's favourite tipple.
Deportation of Swedish-Australian man to be raised with UN
The case of an Australian-raised man deported to Sweden is being raised with the United Nations. Thirty-three-year-old Stefan Nystrom arrived in Sweden on Saturday. He'd been deported after the High Court upheld Immigration Minister Amanda Vanstone's decision to cancel his visa because of his extensive criminal history. Mr Nystrom has lived all but three weeks of his life in Australia.
Eye hospital to remember Bali bombing victims
This year will see the opening of an eye health centre in Bali which will also serve as a working memorial to the victims of the 2002 bombings on the island. The Australia-Bali Memorial Eye Centre, ABMEC, will be funded by the Australian Government and The John Fawcett Foundation for Humanitarian Projects. The Foundation currently helps an estimated 20,000 people every year.
Australia and England prepare for final Ashes test
Australia and England head onto the pitch at the Sydney Cricket Ground this morning for the fifth and final test of the Ashes series. It's been a disappointing tour for the English team, which will be desperate not to be the first since 1921 to go down five-nil. The thousands of barmy army supporters are vowing to keep their spirits high as they prepare for this, their last hurrah. |
Quick Facts
26 million are registered but didn’t vote in 2012, the last presidential election.
Dr. James Dobson estimates that:
Half of the Christians in America are registered to vote—and only half of those registered actually vote.
“…only 53% of Americans who were eligible to vote did so in 2000, and only 39.9% voted in 2002.” In the 2008 Presidential Election, according to a report from the Census, this percentage rose to 64% (www.census.gov).
Recent polls have estimated that the number of voters declined in the 2014 elections. Voter trends show that turnout typically increases with Presidential election years, such as this year, 2016. We want to make sure that Christians, value voters, are among the increase. |
Q:
Are there 'higher order moments' in physics?
This may be a rather noob question but please let me clarify: I'm struggling to understand the use of the word 'moments' w.r.t., probability distributions. It seems after some research and poking around it seems to have been derived from physics when trying to solve/prove something about/related to binomial distribution and the method was called method of moments. I've asked the corresponding question here: https://stats.stackexchange.com/q/17595/4426
Now 'Pearson' (one of the very famous statisticians) comments:
We shall now proceed to find the first four moments of the system of
rectangles round GN. If the inertia of each rectangle might be
considered as concentrated along its mid vertical, we should have for
the sth moment round NG, writing d = c(1 + nq).
Here are some of the details of the proof (as in the above post):
Now Pearson talks about calculating the 'rth' moment and uses a derivative function to do so:
Question: I'm not aware of such a function from my knowledge of elementary physics. What kind of moments are being calculated here? How do you calculate 'higher order moments'? Is there any such thing?
Basically looking to clarify something in statistics but was historically alluded to physics and hence just want to get it ironed out :)
UPDATE: Intent of question: What I want to know is does the above derivation have anything at all to do with the concept of moments in physics and how is it related? Since the 'word' moment (and its intent) seem to be borrowed from physics when the author is making the derivation. I personally want to know if something like this does exist in the field of physics and how are these two derivations (and 'moments' related)
A:
I have to start by saying I don't know anything about the derivative method shown in this excerpt. I tried some calculations but it doesn't even seem to give the same result as the standard definition, so I'm guessing he is calculating something different from what we call "moments" in modern physics. Anyway, by way of explanation:
The word "moment" is used for several different purposes in physics, so it can be kind of a confusing term because you have to know what is meant by the context. But all the various meanings of moment stem from its definition in math.
In math, a moment is a way of characterizing some distribution. It could be a probability distribution, a mass distribution, a charge distribution, or anything similar; all you need is some function $f(x)$ which defines the density of the quantity (mass/charge/probability) in question. In other words, $\int_a^b f(x)\;\mathrm{d}x$ is the amount of "stuff" between $a$ and $b$.
The $n$th mathematical moment of a distribution with density function $f(x)$ around a point $c$ is computed by a very simple formula:
$$I^{(n)}(x_0) = \int (x - c)^n f(x)\ \mathrm{d}x$$
This generalizes to higher-dimensional spaces, but then the moment becomes an $n$-index tensor:
$$I_{i_1\cdots i_n}^{(n)}(\mathbf{r}_0) = \idotsint \prod_{j=1}^{d}(r_{i_j} - c_{i_j}) f(\mathbf{r})\ \mathrm{d}^d\mathbf{r}$$
In physical applications, the definitions used are a little different, but in general an $n$th moment involves the integral of some $n$th power of position multiplied by the distribution function $f(\mathbf{r})$. (The aforementioned differences show up in how you use the various components of $\mathbf{r}$ to compute that $n$th power.)
Many typical measures used to describe physical systems or mathematical distributions can be represented as moments. For example:
If $f(x)$ is a 1D probability distribution:
The normalization constant (which is 1) is $I^{(0)}$
The mean value is $\langle x\rangle = I^{(1)}(0)$
The variance is $I^{(2)}(\langle x\rangle)$
If $f(\mathbf{r})$ is a mass distribution:
The total mass is $I^{(0)}$
The center of mass is $I^{(1)}(0)$ (from which comes the term "weighted average")
The moment of inertia around any point $\mathbf{c}$ is a second moment
If $f(\mathbf{r})$ is a charge distribution:
The total charge, or monopole moment, is $I^{(0)}$
The dipole moment is $I^{(1)}(0)$
The quadrupole moment is a second moment
and so on
For charge distributions, the quantities $I^{(n)}(0),\ n=0,1,2,\ldots$ (as modified with the required extra terms) are called the electric multipole moments $Q^{(n)}$. These quantities are of particular interest because you can expand the electric potential of an arbitrary charge distribution in terms involving successive moments:
$$\Phi(\mathbf{r}) = \sum_{n=0}^{\infty} \sum_{\{i_j\}}\frac{C_n Q_{i_1\cdots i_n}^{(n)}x_{i_1}\cdots x_{i_n}}{r^{2n+1}} \sim \sum_n \frac{C_n Q^{(n)}}{r^{n+1}}$$
In many situations, $r$ is relatively large so it's sufficient to use only the first nonzero term of this series in a calculation. In a sense, higher moments incorporate more detailed features of the charge distribution, which "blur out" and thus have little effect at large distances.
For the example you're looking at here, it sounds like Pearson is calculating the moments of area in the $x$ dimension around the origin - in other words, the density function $f(x)$ is the function that would trace along the tops of the rectangles.
$$f(x) = a\binom{n}{k}p^{n-k}q^k,\quad \tfrac{(2k + 1)c}{2} \le x < \tfrac{(2k + 3)c}{2}$$
(you could think of this as calculating the moments of mass of a cardboard cutout of the binomial distribution, assuming the cardboard is uniform density).
You can plug this into the integral definition of a moment, although the resulting expression is rather complicated, and as I said, it doesn't seem to give the same results as the derivative method Pearson is using. So I believe he's calculating something different.
|
City Council cancels contract with seawall contractor
The Belleville City Council is anxious to get started on its seawall repair and is tired of waiting for successful bidder E.C. Korneffel Co. of Trenton to firm up contract details so they can get started on the estimated two-month project.
The city accepted the Korneffel bid on May 21 at a cost of $339,000, but that apparently included the seawall for the condominiums next door to Doane’s Landing park. It turned out Korneffel wanted to deal only with the city and have the city get the condo cost from the condos.
At its July 2 meeting, the council also learned Korneffel wished to change the materials and scope of the project.
At Monday’s regular meeting, the council voted 4-0 to notify Korneffel that it considered the company’s proposals to no longer be in the scope of the the project and the company has been non-responsive, so the contract is no more.
Councilman Jack Loria was present at the beginning of the meeting, but left before this vote was taken.
The council also agreed to proceed to a second bidder, C&R Lakeside Landscaping, which actually was lower in cost — $295,000 — and highly recommended for the work. The city will see if C&R can keep the price it bid and do the work.
The council also will have its Building Official Rick Rutherford ask the city’s geo-technical engineers, McDowell & Associates, to design an option for a return, which would end the city’s seawall where the condominium seawall begins instead of having the seawall all one piece.
“We need to get that work done,” said Mayor Kerreen Conley, referring to the seawall repair.
“It gives me nightmares!” City Manager Diana Kollmeyer agreed.
Councilman Jesse Marcotte, who made the motion to move on from the Korneffel contract, pointed out the engineers’ recommendation on the project said there were benefits to having C&R do the project.
C&R planned to use a barge for the work and Korneffel said it would use a crane from the shore over the condo roofs for the work.
City Manager Kollmeyer said the city went with Korneffel because it had a good reputation with many years of experience and was bigger. Both consultant McDowell & Associates and the city’s engineering consultant Hennessey recommended Korneffel.
At its May 21 meeting, Belleville attorney John Day was present to represent four neighbors in the condos. He asked the city to work on a common solution.
At that time Rutherford said, “I still have hopes it will be done together. So far we had hoped that the original cooperation will continue.”
At the beginning of the discussion on Monday, Rutherford gave a “quick recap” of the situation with the seawall. He said in a meeting after the bid was awarded Korneffel proposed the change of reusing the existing sheeting, which is thicker than what was specified in the contract.
Rutherford said the present sheeting was driven in and hit things. The city’s engineer said the cause of the seawall problem was at the toe, at the bottom.
“I told Korneffel that the council had approved the original specifications,” Rutherford said.
Rutherford said the former director [Keith Boc] had refused to inspect the seawall because there was no engineering report. He saw them cutting the seawall parts at random, Rutherford said.
Korneffel said they don’t know if they cut off a foot or more, Rutherford said.
“I said that’s the problem,” Rutherford said, noting the seawall failed after 22 years.
“What I urged was following the scope of work and their quick response,” Rutherford said, noting “our window – we’re in it.”
He said for Korneffel this is a small project, but “for the City of Belleville it’s not a small project.”
Rutherford said he asked for a response before Monday’s meeting or for them to come to the meeting to discuss it and nothing happened.
“It’s too big a project for the City of Belleville for us to just take their word for it, no matter how big they are,” Rutherford said.
“Eyewitness account of 22 years ago saw them cutting the sheets. What if they’re five feet short?” Rutherford asked.
“I’d like that project to be done more than anyone else in this room,” Rutherford said.
When Mayor Conley asked how much of the project was the city’s, Rutherford said $40,000 to $50,000 is the responsibility of the condo owners.
He said Korneffel wants to do business with the City of Belleville, not the condo association, and let the city get the money back from the condos. It was supposed to be a joint effort, he said.
Mayor Conley said the city should go out for bids with option 1 and option 2 to make it clear to the bidder what the city’s doing.
“At first the condos used the same geo-technic engineer we did,” he said, adding when the developer put in the condos, he severed one of the tiebacks. “Our section should end at the corner, so our sheets are not interlocking with their sheets.”
City Manager Kollmeyer said the city was working with the state to possibly get money for the project and the state wanted to know how much of the project was the city’s, so they figured out the size.
Rutherford said it was engineered as a joint project.
“Any reason we couldn’t enter into an agreement with the condos and deal with the contractor?” asked Mike Renaud from the audience.
“We started off to do it, but at one meeting they brought an attorney,” Mayor Conley said. “They may want us to bear the whole cost.”
“We had an agreement and then they hired an attorney,” Rutherford said, noting the attorney may be “an exploratory option.”
“If they’re not following the scope of the bid by our geotec engineer, we could explore other bids and see if they would be able to do the work,” Councilman Marcotte said.
Rutherford said C&R was one of the only bids to accept the scope of the bids and it’s cheaper.
Kollmeyer pointed out the city council approved the bid.
“They are not honoring that bid, so we don’t have them under contract,” Rutherford said.
Councilman Tom Fielder said the contract approved was with the condo work and so that would have to be changed. He asked if they could change the contract to put in the seawall return.
Mayor Conley said the city bid out the specifications and, “We could have chosen to have an option of return in and could have split the numbers.”
Rutherford said, Korneffel wanted to do business only with the City of Belleville.
In other business at Monday’s meeting, the council:
• Approved the Battle of Belleville in downtown Belleville for 6-7 p.m. Friday, Aug. 24, which includes a military vehicle display and World War II battle reenactment. Main Street and Roys Street will be closed for the event. Michael Luther from the Yankee Air Museum was present to explain the project. Police Chief Hal Berriman said 30-40 vehicles will be brought in, including some with tracks. If they can’t put new rubber tracks on the vehicles in time for the event, they will be left at the airport, Luther said. The event is to promote the annual Air Show at Willow Run Airport;
• Approved accounts payable of $281,362.72 and the following purchases in excess of $500: to Emergency Reporting, $2,176 for software for the fire department, annual fee; to Work-N-Gear, $1,600 for uniforms for DPS; to Osborne Concrete, $1,065 for water/storm structure repair and $869 for cemetery footings; to Carlisle Wortman, $1,100 for library plan review; to Wise Technologies, $806.24 for computer/phone support; to Michigan State Police, $598.75 for fire department Hazmat training;
• Heard Renaud ask about the weeds and signs at the High Street/W. Huron River Drive intersection. “It’s disgusting the way it looks,” he said, referring to the entryway to the city. Rutherford said he will contact the county, which said it owns that corner, and if it’s not responsive his crew will cut the growth and remove the signs. Kollmeyer suggested calling County Commissioner Al Haidous for help;
• Heard Kollmeyer say last Thursday she cut the check for the property next to city hall and got it signed and mailed to Wayne County. She said the city will be getting the deeds soon. Mayor Conley said the city has four parcels that can be sold for a development. She said the city has wanted those two parcels next door for many years. She said they will see what developments are out there now and who is interested in the property;
• Heard Marcotte refer to the boat accident over the week end, noting the rules of the lake are being disregarded, especially as it gets darker. He said the amount of traffic and the speed is increasing and he has seen wave runners without life jackets. He said they seem to be getting more loose with obeying the rules;
• Heard Fielder thank Juli Balestrieri of Parks and Recreation for the recent pop-up storytime event at Village Park. He said after the event, he and Balestrieri took participants for a walk along the trail to show them what else is in the park. He said the next meeting of Parks and Rec is 4 p.m. Aug. 20 and they plan to talk about a community garden for next summer; and
• Heard Renaud note that Horizon Park is horrible and the bushes at the gazebo are dead. He said there is one lone tree in the middle of the park that makes Charlie Brown’s tree look good. He said weeds are taller than some of the bushes and then there are the weeds along the lake. Fielder said Laura Nichols, president of Parks and Rec, has been talking to the Rotary Club about helping with the landscaping work at the park. Rutherford said there have been questions about drawing water from the lake to water the park, but he said a new pumping system is necessary and the underground sprinkler system is not working. Mayor Conley said summer is almost over and asked him to get a price to present to the council so they can consider it. |
Influence of glucuronidation and reduction modifications of resveratrol on its biological activities.
Resveratrol (3,5,4'-trihydroxystilbene, RES), a star among dietary polyphenols, shows a wide range of biological activities, but it is rapidly and extensively metabolized into its glucuronide and sulfate conjugates as well as to the corresponding reduced products. This begs the question of whether the metabolites of RES contribute to its in vivo biological activity. To explore this possibility, we synthesized its glucuronidation (3-GR and 4'-GR) and reduction (DHR) metabolites, and evaluated the effect of these structure modifications on biological activities, including binding ability with human serum albumin (HSA), antioxidant activity in homogeneous solutions and heterogeneous media, anti-inflammatory activity, and cytotoxicity against various cancer cell lines. We found that 1) 4'-GR, DHR and RES show nearly equal binding to HSA, mainly through hydrogen bonding, whereas 3-GR adopts a quite different orientation mode upon binding, thereby resulting in reduced ability; 2) 3-GR shows comparable (even equal) ability to RES in FRAP- and AAPH-induced DNA strand breakage assays; DHR, 3-GR, and 4'-GR exhibit anti-hemolysis activity comparable to that of RES; additionally, 3-GR and DHR retain some degree activity of the parent molecule in DPPH.-scavenging and cupric ion-initiated oxidation of LDL assays, respectively; 3) compared to RES, 4'-GR displays equipotent ability in the inhibition of COX-2, and DHR presents comparable activity in inhibiting NO production and growth of SMMC-7721 cells. Relative to RES, its glucuronidation and reduction metabolites showed equal, comparable, or some degree of activity in the above assays, depending on the specific compound and test model, which probably supports their roles in contributing to the in vivo biological activities of the parent molecule. |
1,25-Dihydroxyvitamin D3 restores fertility of vitamin D-deficient female rats.
Vitamin D deficiency reduces mating success and fertility in female rats, but it is not known if the reduction in reproductive performance is a direct action of vitamin D or the hypocalcemia associated with vitamin D deficiency. The effect of vitamin D deficiency with normocalcemia on fertility and reproductive capacity in female rats was investigated. Female weanling rats were maintained on vitamin D-deficient or vitamin D-replete diets until maturity and mated to age-matched, normal, vitamin D-replete males. Three groups of vitamin D-deficient females were maintained on diets varying in calcium and Pi concentrations to test the effect of vitamin D deficiency with different serum calcium and Pi concentrations on reproductive performance. Vitamin D-deficient females were capable of reproduction, but successful matings by all groups of vitamin D-deficient females were markedly reduced regardless of serum calcium concentration, when compared with matings with vitamin D-replete females. Fertility was also drastically reduced in litters from all groups of vitamin D-deficient females regardless of serum calcium concentration, when compared with litters from vitamin D-replete females. Vitamin D-deficient female rats that received vitamin D or 1,25-dihydroxyvitamin D3 were capable of successfully mating and giving rise to normal, healthy litters. These results indicate that vitamin D and not hypocalcemia is directly responsible for reduced reproductive capacity and fertility in vitamin D-deficient female rats. |
// Copyright (c) 2013 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#ifndef CHROME_BROWSER_MEDIA_GALLERIES_WIN_MTP_DEVICE_OBJECT_ENTRY_H_
#define CHROME_BROWSER_MEDIA_GALLERIES_WIN_MTP_DEVICE_OBJECT_ENTRY_H_
#include <stdint.h>
#include <vector>
#include "base/strings/string16.h"
#include "base/time/time.h"
// MTPDeviceObjectEntry contains the media transfer protocol device object
// property values that are obtained using
// IPortableDeviceProperties::GetValues().
struct MTPDeviceObjectEntry {
MTPDeviceObjectEntry(); // Necessary for STL.
MTPDeviceObjectEntry(const base::string16& object_id,
const base::string16& object_name,
bool is_directory,
int64_t size,
const base::Time& last_modified_time);
// The object identifier obtained using IEnumPortableDeviceObjectIDs::Next(),
// e.g. "o299".
base::string16 object_id;
// Friendly name of the object, e.g. "IMG_9911.jpeg".
base::string16 name;
// True if the current object is a directory/folder/album content type.
bool is_directory;
// The object file size in bytes, e.g. "882992".
int64_t size;
// Last modified time of the object.
base::Time last_modified_time;
};
typedef std::vector<MTPDeviceObjectEntry> MTPDeviceObjectEntries;
#endif // CHROME_BROWSER_MEDIA_GALLERIES_WIN_MTP_DEVICE_OBJECT_ENTRY_H_
|
A witness called police about 2 a.m. saying he saw a car leave the road and go into the pond, but he hasn't seen anyone surface, according to Orlando police. |
Dopaminergic behaviour stereospecific promoted by the D1 agonist R-SK & F 38393 and selectively blocked by the D1 antagonist SCH 23390.
The selective D1 dopamine receptor agonist R-SK & F 38393 (20 mg/kg), but not its S- antipode , stereospecifically promoted episodes of prominent grooming behaviour. Typical stereotyped behaviour, such at that induced by apomorphine, was not seen. Grooming responses to 20 mg/kg R-SK & F 38393 were blocked by 0.1-0.5 mg/kg of the selective D1 antagonist SCH 23390 but not by 1.0-5.0 mg/kg of the selective D2 antagonist metoclopramide, while stereotyped behaviour induced by 0.5 mg/kg apomorphine was blocked by both antagonists. These results are consistent with certain individual dopaminergic behaviours such as grooming being mediated by D1 receptors. Other dopaminergic syndromes may involve complex functional interactions between D1 and D2 receptors. |
The comfortable 3-star Towneplace Suites By Marriott Sierra Vista offers quick access to San Pedro Riparian National Conservation Area, which is about 1250 meters away. Towneplace Suites By Marriott Sierra Vista has been welcoming guests to its non-smoking rooms since 2007.
The city center is 30 minutes' walk of the property.
Rooms at Towneplace Suites By Marriott Sierra Vista feature modern touches such as a laptop safe, multi-channel television, a dining area, a seating area and ironing facilities. They also have a dishwasher, a freezer and a stove available for self-catering.
A complimentary continental breakfast is served daily. Guests will enjoy a variety of American and healthy dishes in the area.
Details & Rates
Rooms at Towneplace Suites By Marriott Sierra Vista feature modern touches such as a laptop safe, multi-channel television, a dining area, a seating area and ironing facilities. They also have a dishwasher, a freezer and a stove available for self-catering. |
When I was thirty-five, I came to a conclusion that I was never going to be able to get married unless I changed myself. At thirty-six, I concluded that I was either too old to change my ways, or change was just impossible. Now, here I am at thirty-nine, and I have realized that I don’t want to change. I want to be myself. Granted, I want to grow in faith and godliness, allowing myself to be transformed by a deepening relation with God. But as for the person God made me to be, I want to leave her alone.
As with most of us women who remain single into our thirties, I have gone through my phases of self-evaluation to try to pinpoint what is wrong with me that makes me unacceptable to men. I have gone through periods of self-loathing and discouragement that I couldn’t change those things about myself that seem the most objectionable. In all of this, I encountered the truth about self-loathing: it is still all about self. Self-help, self-pity, self-improvement, whatever name you give it, it is all about self.
What if I stop focusing on myself and focus instead on God and what he has called me to do? There is freedom and joy in obedience and service. At thirty-seven, I finally got down to the business of what God had been calling me to do: write. I am a communicator, and this strength is also my biggest flaw. I talk too much and say things I shouldn’t. I have an opinion about everything and a bad habit of speaking it. Yet, answering God’s call to use my gift of communication has helped me to grow and learn to speak more as God would want me to. I doubt I will ever totally bridle my tongue, but God and I will keep working on it together. I am going to stop focusing on what I don’t like about myself and instead focus on being a child of my Heavenly Father. I want to be His Girl.
In the last year, I have worked earnestly on finishing a book about what I have learned in the last decade of singleness. To me, this is in direct obedience to what I feel that God is calling me to do. As a result, I have found myself more content than ever with who I am. Last week, I was looking over pictures that my sister, our friend, and I had taken when out hiking. At first, I thought that I had been stupid to wear what I did when I knew there would be pictures. The clothes I had chosen were not figure-flattering. Then it occurred to me: who cares? I need to stop caring. The pictures are of me; that is what I look like. I had fun with my sister and my friend and pictures record our time together. What freedom, if I can just be okay with being myself and not worry about how other people perceive me. The only opinion that matters is God’s. He is the one who knows me best and knows my heart.
I have been reading 2 Samuel, lately. I was contemplating 2 Samuel 6:16: “As the ark of the LORD came into the city of David, Michal the daughter of Saul looked out of the window and saw King David leaping and dancing before the LORD, and she despised him in her heart.” David danced for joy before the LORD without regard to what other people might think. And, as often happens in this world, there was someone who did not feel that his display was appropriate. In this case, it was one of David’s wives. David knew that he had done no wrong, and when Michal confronted him he stood his ground. It was not his job to please Michal, but rather to please God. Verses 21 and 22 record David’s response to her: “It was before the LORD, who chose me above your father and above all his house, to appoint me as a prince over Israel, the people of the LORD-and I will make merry before the LORD. I will make myself yet more contemptible than this, and I will be abased in your eyes.”
I want to follow David’s example. There are always people who will look down on us, but if we are delighting ourselves in the LORD and walking in obedience to Him, we should not be ashamed if this makes us contemptible to others. Let’s free ourselves from all of our self-focused desire for change, and instead look to please the God of our salvation.
Published by leahbbentley
Post navigation
2 thoughts on “Me, Myself, and I Am”
I am super excited about your blog, Leah! Your words have been such an encouragement to me even in the brief conversations we’ve shared. Thank you for sharing your heart and your struggle so honestly with other women who are struggleing. May your words be a faithful witness to others to delight themselves fully in the Lord and find him precious above all else. |
Honeymoon time is the best time for a newlywed couple. One gets to understand each other a lot and those who are madly in love already, they get to celebrate their love and start a new beginning in their lives.The best honeymoon destinations is that where you tend to spend time with each other all alone without any kind of disturbance or interference. A honeymoon destination is mending to be a romantic one for sure so that as a couple you get to create beautiful and unforgettable memories which you will relish for the lifetime. Right after their marriage, every couple looks forward to celebrating hi marriage in a unique and different way.
Honeymoon and romance always go hand in hand, so you must keep in mind that your honeymoon destination should be the most romantic one where you get to explore a wide variety of things and of course the accommodation should be romantic and luxurious as well. One more thing which should be kept in mind while selecting your honeymoon destination is that the backdrop of the location should be perfect so that your pictures come out to be awesome and get to post them on social networking sites to make other people envy you! So, if you are getting confused as to which destination is the best for your honeymoon, then here we are providing you a list of 25 best honeymoon destinations out of which you can select the one which suits you. Do check out the list.
25 Best Honeymoon Destinations in the World:-
Bora Bora
Bora Bora is one of the best honeymoon destinations in the world. You will find the place so beautiful as if you are actually living in a world of fantasies. On other words, it is just like heaven on Earth. The scenery is breathtaking with the aqua blue water, the beautiful mountains, the coral reefs and of course the marine life. The resorts here are stunningly built up. So, you can book your accommodation at The Four Season Resort Bora Bora which offers you quite luxurious amenities and is located on the beach. Other places to explore at Bora Bora include the Mount Otemanu and the beautiful Vanilla Bean Farm having the perfect backdrop.
Bali, Indonesia
Before it was actually listed among the best honeymoon destinations in the world, Bali was already famous among the romantic couples due to its extremely beautiful location which includes the mountains, the shrouded temples and of course the scenery. This place was earlier known as the “Isle of the Gods’ which it is actually. The best hotel to book for your honeymoon out here is The Mulia Resort and Villas situated at the Nusa Dua Coastline. At Bali, you must visit the famous Pura Luhur Uluwatu Temple which is located quite high and you can get the best sunset view from there.
Sonoma, California
Sonoma situated in California is the best romantic place to visit for due to its extremely breathtaking view which actually looks like as if you are watching a scenery. The place is mostly famous for its mouth-watering food; an exclusive range of wine flavors and of course the pretty farms. The best honeymoon destinations to stay at is the Forestville’s Farmhouse which gives you a proper vintage feeling due to its classic interiors and it is surrounded by the beautiful wineries like the Kistler and the Kosta Browne. The chefs here in the resort cook some really amazing food which will blow your mind.
Paris, France
Popularly known as the city of love and romance, Paris is the best honeymoon destinations for your honeymoon. It is a place that every girl dreams of as her honeymoon destination. The city is famous for it’s beautifully built up architecturally designed buildings especially the Eifel Tower which is still among the Seven Wonders of the World. The food here is also a must try for sure. You can book your accommodation at Hotel Plaza Athenee which gives you quite exciting honeymoon packages and one of the best hospitality you could ever experience. You can visit places like the Musee d’Orsay, the Pont des Art Bridge which is a symbol of love actually.
Orkney, Scotland
At Orkney, Scotland, you will get to experience one of the most beautiful islands and even beautiful sandstone cliffs. For your best honeymoon destinations, you can book a suite at Kirkwall Hotel which is beautifully constructed and is just like a Victorian building. The place is also famous for shopping as well. Apart from this you can explore the Neolithic Ring of Brodgar which is quite old and the stones here are standing tall in a ring but nobody could ever find out how these got built up actually. But they are actually unbelievable to watch.
Venice, Italy
Italy is one of the best romantic destinations in the world and if it’s the city of Venice, then surely your honeymoon will be the most unforgettable one. Famous for its Grand Canal that passes within the city’s historic buildings, this place will actually make you stunned. The best honeymoon destinations place to book your suites is the JW Marriot in Venice which will give you quite a royal kind of a feeling. You must also ensure the free or complimentary ferry ride to Venice provided by the hotel authorities. You must also explore the famous domes of Basilica di San Marco and the Palazzo Ducale. A visit to the city is actually a dream come true for any couple.
Harbour Islands, Bahamas
Harbour Islands situated in the Bahamas is the most loved best honeymoon destinations among the celebrities. The crystal clear blue water of the island and the pink sandy beaches is the perfect combination for a romantic getaway. Visit the Perfect Sand Beach get a perfect view of the beach. You can go for shopping at the Hicks Sugar Mill Trading Co where you will find beautiful souvenirs. Book your suites at the famous Tingum Village Hotel and enjoy your honeymoon in the Bahamas.
Cape Town, South Africa
Cape Town comprises of everything that a newlywed couple wants for. Right from the beautiful beaches, breathtaking landscapes, the amazing wineries and the city life, and of course not to forget the safari rides, everything here is worth exploring. Do visit the extraordinary Cape of Good Hope and Cape Agulhas and to interact and experience the world of penguins, you must visit the Boulders Beach as well. For your accommodation, you can book a room at the Atlantic House which is perfect for a romantic couple to enjoy their privacy.
Savannah, Georgia
This is one of best honeymoon destinationsSituated in Georgia, this place is quite serene, calm and peaceful, so you can fully enjoy your privacy out here. Surrounded by the best natural beauty with green forests and the amazing wildlife, you can even plan your wedding out here. The hotels or inns are quite cozy and beautifully built up. You must take a horse carriage to explore the city and yes don’t forget to visit the Tybee Island for the dolphin show. The Mansion situated on the Forsyth Park provides you with the best accommodations with the amenities like a private pool and the delicious food at the restaurant.
10. Santorini, Greece
This beautifully structured small city situated in Greece is famous for its white-washed houses situated right on the coastline. You will experience the world’s most gorgeous sunset in this volcanic city. In order to explore the city, just hire a scooter and visit the various ancient buildings like the Bronze Age of Akrotiri. You can even explore the beautiful wineries of the city and go for a hiking trail as well. Book your suites at the Perivolas Hotel which gives you an amazing view of the Aegean Sea.
Koh Tao, Thailand
Koh Tao will let you experience a number of beaches all at one place with the most breathtaking view you could have ever experienced in your lifetime. You just need to hire a scooter and you are ready to explore the place. Book a private hut at the Koh Tao Bamboo Huts facing the water and also have beautiful balconies. Along with that, you can enjoy a private pool as well. On your honeymoon, you can either explore or relax and the beach or if you are kind of adventurous, then try scuba diving at the nearest dive center.
Rio de Janeiro, Brazil
You will simply fall in love with the city of Rio de Janeiro in Brazil especially due to its amazing beaches it has which are surrounded by rugged mountains and the moving vendor stalls selling amazing street food. Don’t forget to visit and explore the famous statue of Christ the Redeemer. To enjoy a luxurious stay, book the Belmond Copacabana Palace which is serving the best since 90 years.
Florida Keys, Florida
The Florida Keys ahs around more than 1000 islands which are extremely beautiful and perfect for your honeymoon. The best out of them is the Key West island which is quite in demand as it is considered as the most luxurious and royal place for a honeymoon. Other islands include the Ernest Hemingway and the Tennessee Williams. All you need to do is hire a scooter or a bike and explore the ancient architecture of the old city. You can even explore the Mallory Square and also get to see the amazing street dance as well. Book the Marker Waterfront Resort for your perfect accommodation.
Fiji
He beaches here at Fiji are actually breathtaking with the beautiful coral reefs and the green forests are just ideal for a honeymoon destination. Likuliku Lagoon Resort situated on the Malolo Island which has some beautifully constructed thatched roof bungalows which are built with local material which in turn gives you a traditional Fiji kind of a feeling. The place has some amazing hiking trails and you got to explore the ancient buildings and sites of the place as well.
Myanmar
Myanmar is one of the most divine honeymoon destinations in the South Asia. The atmosphere here is quite pure, calm and fresh. This country is mostly famous for its religious Buddhist temples which are quite old and beautifully built up. You can even try a hot air balloon ride at the Bagan plains. For best accommodation, you can book the Belmond and can also travel through the hotel’s cruiser as well.
Panama City, Panama
The City of Panama has almost everything that you need to explore while you are on your honeymoon tour. Right from the beautiful mountains, the extremely dense rain forests, the marvelous beaches, the city life, beautiful historic buildings and yes the nightlife of the city are the famous things you got to explore here. A perfect romantic getaway can be Lake Gatun where you will get to explore extensive wildlife as well. You can even go hiking at the famous Cerro Ancon. To enjoy the nightlife, visit the famous Danilo’s Jazz Club with an amazing atmosphere. Book your suites at the American Trade Hotel which provides you with the best amenities.
Marrakesh, Morocco
This ancient North African city is famous for its fashion, belly dancing, horse carriage rides and the amazing street markets. The market of the city is full of chaos comprising of snake charmers, clothes vendors, and exclusive jewelry. This city is actually an inspiration for top fashion designers and best honeymoon destinations. The city has some beautiful gardens like Yves Saint Laurent’s garden. Book your suites at the Selman Marrakech having amazing ancient interiors.
Sri Lanka
Sri Lanka is one of the most beautiful islands to visit or plan your honeymoon as it is actually quite romantic. Located in South Indian Region, this place has a lot many things to explore. The River House Resort has some amazing suites with luxury accommodations with private pools and sea facing view. To enjoy a private honeymoon, this place is the best for you.
Dubai, United Arabs Emirates
Dubai is the most famous and best honeymoon destinations around the world. It basically comprises of two things, one is the amazing city’s skyscrapers and secondly, the desert safari. The hotels here are extremely luxurious and are quite cheap as well. So, you can book the Al Maha which is a Desert Resort and Spa having private pool facility. Visit the city’s market to buy gold as its quite cheap there. Then you can try a camel ride at the sand dunes as well.
Maldives
Situated in the Indian Ocean, the islands of Maldives are considered to be the best honeymoon destinations among the newlywed. The aqua blue water and the white sandy beaches, plus the exclusively designed luxurious resorts are the highlights of this place. You must explore the underwater marine life out here especially during the night. Get your accommodation booked at the Niyama Maldives which provides you almost everything like a spa, a couple massage, delicious food and lot more.
Cappadocia, Turkey
Cappadocia is kind of a unique place due to its extremely different landscapes. Located just a four-hour drive from the city of Turkey, this place also comes in the top when it comes to the honeymoon destination. You must try a ride in the famous hot air balloon out here and of course, horse riding as well through which you can explore the beautiful place craved with the Rocky Mountains. You can book your room at the famous Argos in Cappadocia situated in an ancient monastery and all the rooms are in underground tunnels and caves.
Udaipur, India
Also known as the city of palaces, this city situated in the Eastern state of Rajasthan is an extremely beautiful city for your honeymoon. Apart from that, there is Lake Pichola which is beautifully built up. Most of the places are converted into hotels and resorts and are especially booked for destination weddings and by honeymoon couples as well. The Oberoi Udaivilas is one of them and you will get the best hospitality out here for sure.
Kyoto, Japan
If you want your honeymoon to a peaceful and religious one, then Kyoto is the place for you to plan your honeymoon. It is a city of temples and shrines and the atmosphere here is totally calm and composed. You must plan your honeymoon during the spring season to experience the beautiful cherry blossom trees which are in full bloom at that time. You must also explore the tea gardens and the Shirakawa canal. For your stay, you can book the Hoshino Kyoto which is situated on the Ooi River.
Hayman Island, Australia
Hayman Island in Australia is one of the best honeymoon destinations around the world. Located at the Great Barrier Reef, this island is kind of very private. The place is famous for hiking a swell at the Blue Pearl Bay and Dolphin Point. You can plan a Whitsunday Dream Tour by hiring a private helicopter. Book your suites at the One &Only Hayman Island where the staff will guide and pamper you to the fullest.
Iceland
This Volcanic landscape is so fluctuating that it changes its views quite frequently. The best things to explore here are the green landscapes, the beautiful waterfalls, and the Blue Lagoon. Apart from that, you may also visit the Snaefellsjokull National Park to ensure the wildlife out there and of course the couple massages in the middle of the water which sounds quite romantic. You can stay at the Hotel Budir which is quite beautifully built up.
So, these are the top 25 honeymoon destinations around the world out of which you have to choose your favorite one.
Pin 100 138 Shares |
Piaggio P.148
The Piaggio P.148 was a 1950s Italian two-seat primary or aerobatic training monoplane designed and built by Piaggio Aero.
Design and development
The P.148 was an all-metal low-wing cantilever monoplane with fixed tailwheel landing gear. It offered room for two occupants in side-by-side seating as well as an optional third seat. The prototype first flew on the 12 February 1951 and after testing by the Italian Air Force was ordered into production for the air force primary training schools. A four-seat variant was developed as the P.149.
Operational history
Although successfully introduced into the Italian Air Force service, the P.148 was withdrawn from use with the introduction of an all-jet training programme. In 1970, the aircraft was re-introduced into the Italian Air Force Service, when the basic piston-engine aircraft regained a role in the selection of pilots. Some aircraft were sold by the Air Force to the Somali Air Corps as trainers.
Operators
Italian Air Force operated 70 aircraft from 1951 until 1979
Somali Air Corps - Retired
Specifications (P.148)
See also
References
The Illustrated Encyclopedia of Aircraft (Part Work 1982-1985), 1985, Orbis Publishing, Page 2714
External links
Category:1950s Italian military trainer aircraft
P.148
Category:Aircraft first flown in 1951
Category:Low-wing aircraft
Category:Single-engined tractor aircraft |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.