text stringlengths 8 5.77M |
|---|
Calcium-induced intracellular cross-linking of lipocortin I by tissue transglutaminase in A431 cells. Augmentation by membrane phospholipids.
Covalently cross-linked multimers of lipocortin I are shown to be present in human epidermoid carcinoma A431 cells treated with epidermal growth factor or the calcium ionophore A23187. This intracellular cross-linking of lipocortin I is suggested to be mediated by the action of tissue transglutaminase, a Ca2(+)-dependent protein cross-linking enzyme. Cross-linking of lipocortin I competes with proteolytic digestion of the protein, and pretreatment of the cells with inhibitors for calpain (Ca2(+)-dependent intracellular protease) markedly enhanced the cross-linking of lipocortin I. Cross-linked lipocortin I is shown to be present in the soluble fraction of A431 cells as well as in the particulate fraction; a 34-kDa fragment of lipocortin I was solubilized successfully by plasmin digestion of the latter fraction. Immunofluorescence microscopy using specific antilipocortin-I antibody showed that cross-linked lipocortin I forms an envelope-like structure, which is not extracted with [ethylenebis(oxyethylenenitrilo)]tetraacetic acid (EGTA) or Triton X-100. In vitro incubation of purified lipocortin I with tissue transglutaminase resulted in the formation of covalently cross-linked lipocortin I dimer, tetramer, and so on. Amine incorporation and cross-linking studies using lipocortin I and its N-terminal truncated derivatives indicated that the cross-linking site is localized within the plasmin-susceptible N-terminal 29 amino acids of lipocortin I. The cross-linking of lipocortin I is shown to be accelerated more than 10 times by the addition of phosphatidylserine vesicles, on which lipocortin I molecules are most likely aligned in a conformation suitable for cross-linking. Collectively, these findings suggest that an increase of intracellular calcium concentration results in the attachment of lipocortin I onto the plasma membrane phospholipids through the C-terminal domain of the molecule where the membrane-bound lipocortin I is cross-linked by the action of tissue transglutaminase through the N-terminal domain. |
Kastraki, Phocis
Kastraki (, before 1927: Ομέρ Εφένδη - Omer Efendi) is a village in Phocis, Greece, part of the municipal unit Efpalio. It is near the left bank of the river Mornos and 3 km from the Gulf of Corinth. It is west of the village Efpalio and northeast of the town of Nafpaktos.
History
Kastraki is near the site of the ancient town of Oineon in Ozolian Locris of ancient Greece. Oineon was famous for the temple of Nemean Zeus and the site of Hesiod's death. Hesiod was the second most ancient Greek poet after Homer; he lived between 750 BC and 700 BC. He was born in Ascra of Boeotia and is known as the father of the didactic epic. He spent a good part of his life in Hesperia Locris that inspired him to write his epics. According to the story while Hesiod was a guest at the place of the Nafpaktian priest Ganyctora he insulted his daughter. Her brothers Ktimenos and Antifos killed him in the temple of Nemean Zeus where he asked for asylum. He was buried in all likelihood in Oineon or, as others claim, in Nafpaktos.
Although there is not absolute certainty, many believe that the temple of Nemean Zeus was located where the Orthodox church of Panagia Faneromene is today by the national road and the intersection of the Hiliadou provincial road. In fact, the temple was converted into a Christian church when people of the area accepted Christianity as their new religion. However, others think that the temple was - east, not west, of Efpalio in the village of New Koukoura where today the church of Analypsis is built.
In the history of ancient Greece, Oineon is referred to in 426 BC when the Athenian General Demosthenes with 30 ships sailed to Locris and camped in Oineon. His plans were to bring under the Athenian authority Aitolea and eventually the all areas of Locris and Phokis. In spite some early military success, his gradual but continuous losses of his hoplites forced him to make a treaty with the Aeolians and retreat back at Oineon and Nafpaktos with the remnants of his army. While his remaining army sailed back to Athens, Demosthenes remained in the vicinity of Nafpaktos fearing a punishment by the state of Athens for his failure.
During the 400 years of Turkish occupation the most fertile lands of Greece were given to prominent Turkish families or officials. As a result, Greeks out of necessity were located in non-prime agricultural lands — mainly mountainous areas where they were not bothered as much by Turkish authorities. Phocis was not any different; Turks had taken from Greeks most fertile areas of Mornos plains as it is evidenced by the township names of Omer Efendi (Kastraki), Hasan–Aga (Agios Polykarpos), Sule (short for Suleiman) today’s Efpalio.
According to the 1827 writings Trip around Greece by the French counselor to Ioannina Pouqueville, at the early 1800 there were 25 families living in Omar Effendi. Omar Effendi was part of the vilaeti (administration) of Lidoriki. The vilaeti of Lidoriki was under the Pasha of Nafpaktos for some time and also under the authority of the Albanian Ali Pasha (1750-1821) of Ioannina from Tepeleni, known as "Ali the Tepelenis".
Omar Effendi was the battle site several times over the 1821 Greek struggle for independence. The location of the village at the east side of the Mornos River on the road of Nafpaktos to Amfissa place it in a strategic position and a natural place to resist advancing troops between Aitolia and Phokis in either direction. In June 1822 a division of Omar Vryoni moved from Nafpaktos with destination Salona. A couple of kilometers east of Mornos River near Omar Effendi they met the troops of Triantafyllos Apokoritis and were forced to retreat.
At the end of January 1826 near Omar Effendi, 5,000 the Greek forces of Skaltsodemos fought against the Turkish troops causing them many losses, preventing them from advancing east, and forcing them back to Nafpaktos. In December 1826 about 1500 Turks and Albanians rushing to Amfissa to assist to break the siege of Turkish troops in Amfissa by Greek freedom fighters never made it there. About 2 km east of Mornos river near Omar Effendi, they were surprised by the cavalry of Hatzimichales (under Karaiskakis leadership although he was not there) killing 53, capturing 22, and turning the troops back to Nafpaktos.
The new and current name of the village Kastraki (little castle) was given in 1927 when many Turkish-given names to villages and towns were changed into Greek ones. The name Kastraki was justified by the remnants of a Locric ancient castle at the borders of Locris and Aetolia about 3 km south west of the village Trikorfo.
References
Category:Populated places in Phocis |
News:
Good day, denizens of OC.net! Per our tradition, the forum will shut down for Clean Monday, beginning around 9pm Sunday evening (2/18) and ending around 9pm Monday evening (2/19). In the spirit of the coming Forgiveness Sunday, I ask you to forgive me for the sins I have committed against you. At the end of Great and Holy Week, the Forum will also shut down for Holy Friday and Holy Saturday (times TBA).
I don't often ask for prayers for my patients, but Peter is a special case.Peter is 30 and a survivor of childhood abuse. Peter was hospitalized on Friday night due to suicidality. He has attempted suicide 3 times in the last 12 months. Last night, Peter tried to hang himself with a cord he had secreted into the hospital and was miraculously found by one of the nurses by chance, who rescued him. Peter was immediately placed on suicide watch with someone watching him continually, yet he managed to make another noose with another cord under the cover of the bedclothes and tie one end around his neck, and the other to the bed and turn over to put enough pressure on the noose to make himself fall unconscious. The observing nurse noted the unusual position of his head, and found the second noose and cut him free and he was resuscitated again. This was his second attempt at suicide in less than 3 hours after his first attempt.In my world view, the existence of chocolate is, in itself, is enough reason to go on living, but in Peter's world, there is nothing to live for, and living is too painful. Peter is the highest level of risk of suicide I have ever come across, so much so, that I'm not sure he will still be alive when I commence my on-call again tonight. Please keep Peter in your prayers.
Logged
If you're living a happy life as a Christian, you're doing something wrong.
Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth
As a result of a thousand million years of evolution, the universe is becoming conscious of itself, able to understand something of its past history and its possible future.-- Sir Julian Sorell Huxley FRS
Lord, have mercy on this man, Peter. Holy Martyr Cyprian, Holy Fathers Nikita of Pereyaslav, Makarius of Egypt, Antony the Great, intercede for him. Most Holy Theotokos, protect him. Let God arise, let His enemies be scattered. As smoke vanishes, so let them vanish; just as wax melts before fire, so the demons will perish from the presence of those who love God and who sign themselves with the sign of the Cross. Lord, have mercy on Peter, and let al the demons who beseige him vanish!
By your prayers, Peter is still alive despite a third attempt on his own life yesterday afternoon, this time by smashing his head against the wall. He is going to have a black eye as a result, but thankfully there are no fractures. Because of his head injury, he couldn't be sedated, so he had to be moved to a soft room with padded walls and a mattress.
Logged
If you're living a happy life as a Christian, you're doing something wrong.
By your prayers, Peter is still alive despite a third attempt on his own life yesterday afternoon, this time by smashing his head against the wall. He is going to have a black eye as a result, but thankfully there are no fractures. Because of his head injury, he couldn't be sedated, so he had to be moved to a soft room with padded walls and a mattress.
I am a caseworker for mentally ill adults, and last year I had a client who was such a danger to herself that she was admitted to the state lockdown facility for the forseeable future. I pray that Peter can get the right kind of help (human and divine) to keep him from a similar fate. Lord have mercy on the work of your hands!
By your prayers, Peter is still alive despite a third attempt on his own life yesterday afternoon, this time by smashing his head against the wall. He is going to have a black eye as a result, but thankfully there are no fractures. Because of his head injury, he couldn't be sedated, so he had to be moved to a soft room with padded walls and a mattress.
Why is he so determined to die? Why does he have no hope?
I know you said he suffered abuse as a child, but is there more to this we are not aware of?
Logged
"For I know the thoughts that I think toward you, says the LORD, thoughts of peace and not of evil, to give you a future and a hope." Jer 29:11
This morning, Peter woke from a deep sleep and seemed visibly relaxed, and cheerful. At first I was concerned because this is often a sign that someone who is suicidal has formulated a plan and resolved to die. I spent two hours with Peter after breakfast at his request to talk, and we seem to have got to the root cause of his suicidality, the cause which, up until today he had never told anyone. He had been carrying a burden which, up until today he felt he could never tell anyone. After we spoke for some time and he wept with relief for a while, I asked him what had caused him to pluck up the courage to tell me, and he said that he had an "amazing dream" where he was in a garden and he met a "tall, thin man with a long beard dressed in black and wearing a nun's veil" who smiled at him, then the man held up and touched Peter's lips "with his thumb an two fingers" and simply said "Open!" then vanished. Peter woke up and understood that he had to tell someone what had been troubling him for so many years.
I have a strong suspicion the "man" in Peter's dream was St. Ephrem of Nea Makri, the patron of the despairing and suicidal. Whoever he was, thank you all for your prayers!
« Last Edit: January 23, 2009, 07:40:52 PM by ozgeorge »
Logged
If you're living a happy life as a Christian, you're doing something wrong.
As a result of a thousand million years of evolution, the universe is becoming conscious of itself, able to understand something of its past history and its possible future.-- Sir Julian Sorell Huxley FRS
Glory to God in His saints! May He continue to heal the work of His hands.
Logged
Question a friend, perhaps he did not do it; but if he did anything so that he may do it no more.A hasty quarrel kindles fire,and urgent strife sheds blood.If you blow on a spark, it will glow;if you spit on it, it will be put out; and both come out of your mouth |
COUNTDOWN TO MEXICO (11) 2009: U.S. bests Mexico by a familiar score in WCQ
Father and son, Bob and Michael Bradley. Bob coached the U.S. to victory over Mexico in 2009, while Michael scored both goals. (Andy Mead/YCJ Photo)
With the United States and Mexico preparing for their World Cup qualifying encounter in Mexico City June 11, FrontRowSoccer.com is looking back at some of the most memorable matches between these two archrivals. Today, we look at the game when Michael Bradley scored twice under the direction of his father, head coach Bob Bradley.
By Michael Lewis
BigAppleSoccer.com Editor
COLUMBUS, Ohio — After the U.S. national team vanquished Mexico yet again, it was left to Sam’s Army to put the exclamation point and make a poignant point to the victory.
After sitting in the rain and the wind at Columbus Crew Soccer Stadium, the ardent fans of the U.S. team proudly sang the national anthem for the second time — the first time was prior to the game. They might not have realized it, but they were sending a not so-subtle message to the Mexicans: two, as in yet another 2-0 victory in a match that counted on Feb. 11, 2009.
The history is indisputable.
Three qualifiers played here and all three results were two-zip (the other games were in 2001 and 2005). Add the Americans’ 2-0 victory over Mexico at the 2002 World Cup in Korea and there is a trend
With former MetroStars midfielder Michael Bradley leading the way with a goal in each half, the U.S. started the final round of CONCACAF qualifying on the right foot with three points. Bradley became only the fourth U.S. player to score twice in a match in 55 games against Mexico and the first since former Cosmos forward Steve Moyers did the trick in a 2-1 win on Nov. 23, 1980.
The win also improved the Americans’ unbeaten streak against their archrivals to 11 (9-0-2).
“Great to start the final round with a win against Mexico,” U.S. coach Bob Bradley said. “It’s never easy to beat Mexico.”
The game was not a total victory for the U.S. Another former MetroStar, goalkeeper Tim Howard, who survived a dirty challenge by Mexican defender Rafael Marquez in the 65th minute (he was red-carded), received his second yellow card of qualifying. He will miss the March 28 qualifier in El Salvador due to a yellow-card suspension.
It was a night to remember for the 21-year-old Bradley, the son of the U.S. coach. The younger Bradley played another strong game as a defensive midfielder before 23,776 spectators. Bradley entered the match with three international goals in 25 appearances.
When asked about his performance, Bradley replied, “I’m happy with the win. We have three points. We beat Mexico. It’s the best part.”
Like it or not, controversy has always followed the Bradley’s, first when the two were with the MetroStars from 2004-05 and now with the National Team.
There were whispers of favoritism, although Michael Bradley’s performance has put that all to rest.
During the post-game press conference, the senior Bradley was asked if he was the father or coach.
“Right now I’m the coach,” he said. “It’s about the team. When you coach at the professional level there is a way you want to do the work, the environment that you create. Michael . . . gets a steady dose of that when he’s with the team, but also in terms of the father-son relation that we have.”
After squandering virtually the first half after the U.S. took the wind behind their backs, Bradley saved his team much embarrassment by connecting in the 43rd minute.
DaMarcus Beasley sent a corner kick from the right corner to the far side of the penalty area to Landon Donovan, who headed the ball to defender Oguchi Onyewu. Standing some six yards out, Onyewu fired a shot on the net that goalkeeper Oswaldo Sanchez knocked away. Bradley, standing on the doorstep three yards out, slotted the ball home.
“Landon did a great job of heading the ball across the goal,” Bradley said. “There were a bunch of guys there. It bounced loose for me.”
Two minutes into second-half stoppage time, Bradley struck again. This time former Red Bulls forward Jozy Altidore sent Landon Donovan the ball. Donovan feed Bradley, who beat Sanchez from just outside the penalty area.
“Jozy and Landon made a good play to get behind the defense,” Bradley said. “Landon played a good ball.”
The 2001 qualifier here forever will be remembered for the 29-degree temperatures, the 2005 encounter for the match in which the U.S. booked a spot in Germany. Wednesday night will be remembered for an incessant wind. Prior to the kickoff, there were gusts recorded up to 61 miles per hour.
The U.S. won the coin toss and picked the south goal to attack, with the win at their backs. Until Michael Bradley scored, the U.S. had squandered most of the first half. Playing against the wind in the second half, the U.S. controlled the ball for most of the time, taking valuable time off the clock.
“On nights when the conditions are bad, when the wind is like this, it’s important the team moves well together,” the senior Bradley said. “You have to feel tactically that you are disciplined.”
The loss left Mexico coach Sven-Goran Eriksson on the hot seat. Combined with only one win in the team’s last seven games, a loss to the U.S. could mean the end for Eriksson.
“Football is a big sport and, face it, sometimes it’s not a friend of [patience],” Eriksson said. “But I’m optimistic because I think we have a good team. We have to score goals. That’s our biggest problem.”
About The Author
Front Row Soccer editor Michael Lewis has covered eight World Cups, seven Olympics and all 21 MLS Cups. He writes about New York City FC, New York Cosmos and the U.S. national team for Newsday and pens a soccer history column for the Guardian.com. Lewis, who has been honored by the Press Club of Long Island and National Soccer Coaches Association of America, is the former editor of BigAppleSoccer.com. He has written seven books about the beautiful game and has two more in the works, including one about the Rochester Lancers. |
Q:
There be no doing
Plot:
A is a fat woman, and there is a B fatter than A.
A asked her husband,
"B's bigger than me, right?"
Her husband answered, "Yeah, there's no getting around her on the sidewalk."
What is the meaning of the answer? It probably means
Yes, she is bigger than you only if you are all standing on the
sidewalk.
or
Yes. So, don't stand on the sidewalk with B.
A:
Both are incorrect.
It means
Yes, she is fat. People can't pass her when they are coming across her on
the sidewalk.
|
Q:
Confused on the Euclidean formula yet AGAIN
I'm confused on what the formula is to get $s_2$ as well as $t_2$ as well as $s_3$ and $t_3$ ... I can't seem to crack it no matter how hard I try.By the way $s_0 = 1$
A:
$s_i=s_{i-2}-s_{i-1}\cdot q_{i-1}$
$t_i=t_{i-2}-t_{i-1}\cdot q_{i-1}$
|
Transient postnatal increases in excitatory amino acid binding sites in rat ventral mesencephalon.
The developmental profile of three sub-types of excitatory amino acid (EAA) binding sites was determined in the ventral mesencephalon and the striatum of rats from prenatal day 19 to adult (3 months) using membrane binding assays. In the ventral mesencephalon, there was a transient increase of EAA receptor binding sites beyond adult levels, which peaked at postnatal day 7 (P7) for [3H]glutamate binding to NMDA receptors and at P14 for [3H]AMPA and [3H]kainate binding. In the striatum, [3H]glutamate/NMDA and [3H]kainate binding reached adult levels during the early postnatal period, stabilizing at this level with no transient overexpression beyond adult levels. [3H]AMPA binding also showed an increase above adult levels at P14 in the striatum. These results raise the possibility that the transient overexpression of EAA receptors in the ventral mesencephalon may affect the developmental fate of dopaminergic and other neurons in this region. |
The idea: Girls get a set of pastel-colored pieces that they can assemble into a building or any other type of structure. Once the building is built, they can decorate it with the included paper and other embellishments and use the motor to add electrical appliances, fans or anything else that uses power. How to
While a six-figure starting salary might be common for someone coming straight out of a doctoral program, data scientists with just two years’ experience can earn between $200,000 and $300,000 a year, according to recruiters. Academic Researchers Find Lucrative Work as Big Data Scientists – WSJ.
Republican gubernatorial candidate Asa Hutchinson discussed state education issues on Thursday as he toured the campus of the Arkansas School for Mathematics, Sciences, and the Arts. The Greater Hot Spring Chamber of Commerce welcomed Hutchinson Thursday morning for the Good Morning Hot Springs breakfast-speaker series for the business community. The program was held in the
The high tech innovation model is based on mastering the underlying digital technologies, platforms and tools and then turning them into practical applications. But, are there other kind of innovation models? Can you become an innovation hub if you are not a high-tech center? In years past, that would have been very difficult, because so
WHEN LaTisha Styles graduated from Kennesaw State University in Georgia in 2006 she had $35,000 of student debt. This obligation would have been easy to discharge if her Spanish degree had helped her land a well-paid job. But there is no shortage of Spanish-speakers in a nation that borders Latin America. So Ms Styles found
To a notable extent, the experts agree on the technology change that lies ahead, even as they disagree about its ramifications. Most believe there will be: * A global, immersive, invisible, ambient networked computing environment built through the continued proliferation of smart sensors, cameras, software, databases, and massive data centers in a world-spanning information fabric
A revolution is under way. In recent years, Google’s autonomous cars have logged thousands of miles on American highways and IBM’s Watson trounced the best human Jeopardy! players. Digital technologies—with hardware, software, and networks at their core—will in the near future diagnose diseases more accurately than doctors can, apply enormous data sets to transform retailing,
Like many professions today, software development is developing new rules for education and status identification. At one point, a degree from MIT or Stanford was the key ticket to a major Silicon Valley company, and from there, a start-up or a management role. The new culture around hackathons and open source projects is going to
Schumpeter: Those who can’t, teach | The Economist. IN EVERY profession there are people who fail to practise what they preach: dentists with mouths full of rotten teeth, doctors who smoke 40 a day, accountants who forget to file their tax returns. But it is a rare profession where failure to obey its own rules
Equality of Opportunity. Is America the “Land of Opportunity”? In two recent studies, we find that: (1) Upward income mobility varies substantially within the U.S. [summary][paper] Areas with greater mobility tend to have five characteristics: less segregation, less income inequality, better schools, greater social capital, and more stable families. (2) Contrary to popular perception, economic mobility has not
The report is a groundbreaking investigation into the millions of women who are doing it all and barely scraping by, struggling to provide and parent in a nation that hasn’t kept pace with the modern realities of their lives. It combines research, analysis and ideas from the nation’s top academic institutions and think tanks, essays by
Girls start using technology at a younger age, on average, than boys, but women represent less than 20% of those graduating from college with computer science degrees. Computer-related fields are among the fastest growing in the U.S., to the tune of approximately 1.4 million job openings by 2020, and yet we’re producing fewer than half
Udacitys Sebastian Thrun, Godfather Of Free Online Education, Changes Course HE CAPTIVATED THE WORLD WITH VISIONS OF SELF-DRIVING CARS AND GOOGLE GLASS AND HAS SIGNED UP 1.6 MILLION STUDENTS FOR ONLINE CLASSES. SO WHY IS HE PIVOTING AWAY FROM MOOCS? “WE DONT EDUCATE PEOPLE AS OTHERS WISHED, OR AS I WISHED,” THRUN SAYS. via Udacitys
Elite business-school graduates are increasingly heading to work in technology over finance as the lingering aftereffects of the financial crisis—along with Wall Street’s long hours and scaled-back pay—sends newly minted M.B.A.s elsewhere. At Harvard Business School, 18% of job-seeking students landed tech-sector spots this year, up from 12% in 2012. A similar shift is under
In the working world, a degree in computer science is linked to enviable paychecks. PayScale, which analyzes salary data, ranked 129 college majors based on earning potential. Engineering, math, science and technology fields dominated the highest rankings in the College Salary Report, which provides the median starting pay and median mid-career pay for the alumni of
Maintaining strong enrollment is becoming a bigger worry for college administrators as cash-strapped families begin to balk at rising tuition bills, according to a survey. Colleges Worry Their Big Bills Will Keep Students Away – WSJ.com. |
WASHINGTON – The new health overhaul law will start producing savings for Medicare right away, and over time add 12 years of solvency to the program's giant trust fund for inpatient care, the Obama administration says in a report to be released Monday.
Medicare will save about $8 billion by the end of next year, and $575 billion over the rest of the decade, the report said.
Release of the analysis comes ahead of the official annual financial checkup for Social Security and Medicare from the program's trustees, expected as early as this week. It provides support for the administration's position that the health care law secures and strengthens health care for seniors.
Republicans have argued that spending cuts called for in the law will undermine Medicare, and the government's own nonpartisan analysts have questioned whether some of the reductions are unrealistic. Polls show that seniors are more skeptical of the health overhaul than younger people, a political dilemma for Democrats in the fall congressional elections.
The Obama administration report says Medicare will be stronger as a result of the health care law.
"The passage of the Affordable Care Act marks a turning point in the unsustainable rate of cost growth in our health care system," said an advance copy of the administration's analysis. The new law "reforms the Medicare program's payment and delivery systems to incentivize high-quality care, appropriately price services, modernize the health care sector and fight waste, fraud and abuse."
The spending cuts will help to lower seniors' monthly premiums by nearly $200 annually by 2018.
Medicare spending will keep increasing, only not as fast. Under the law, spending will rise by 5.3 percent a year on average over the next decade, compared to 6.8 percent without the cuts.
The Medicare trust fund will remain solvent until 2029, a gain of more than a decade from 2017. However, critics say trust fund solvency will only improve on paper, since actual savings from the Medicare cuts would have been spent to provide coverage for more than 30 million uninsured Americans.
The single biggest slice of the Medicare cuts is from reductions in projected payment increases to hospitals and other providers over the next 10 years. That's followed by cuts to private insurance plans that now cover about 1 out of 4 seniors. Nonpartisan government experts say those so-called Medicare Advantage plans are overpaid when compared to the cost of care in traditional Medicare.
But the insurance industry says the cuts will mean steep premium increases for millions of seniors in the plans. That could trigger an exodus, with seniors returning to traditional Medicare.
Cuts to the private insurance plans start right away, while reductions to providers phase in more gradually. The report says Medicare Advantage cuts account for $5.3 billion through 2011, more than 60 percent of the total estimated two-year savings of $7.8 billion.
Some of the savings are expected to come from efforts to improve quality and combat fraud.
For example, a program to reduce hospital readmissions due to preventable infections and other problems is estimated to save $8 billion over 10 years. And a new, team-based approach to providing medical care for seniors is estimated to save $5 billion over the same period, by keeping patients with chronic health problems healthier and avoiding hospitalization.
Health and Human Services Sec. Kathleen Sebelius has scheduled a teleconference Monday to discuss the report. |
Q:
Scripting github commands with no SSH Key password
If I do not set a passphrase for the SSH Key generation what risks do I run?
The reason I am choosing not to use a password is ease of configuration for scripting git pull and push events on a windows laptop with python.
A:
The risk that if someone gets a hold of your key (Via malware, for instance) they can impersonate you, check in to your repo, etc.
That said, I would really nervous about leaving a non-passworded key on a Windows machine. I do it all the time on unix (including OS X) machines I control, but I feel much better about the security of those systems.
|
{
"_args": [
[
"css-parse@1.0.4",
"E:\\WebstormProjects\\fuck\\node_modules\\css"
]
],
"_cnpm_publish_time": 1347907450126,
"_from": "css-parse@1.0.4",
"_id": "css-parse@1.0.4",
"_inCache": true,
"_installable": true,
"_location": "/css-parse",
"_npmUser": {
"email": "tj@vision-media.ca",
"name": "tjholowaychuk"
},
"_npmVersion": "1.1.61",
"_phantomChildren": {},
"_requested": {
"name": "css-parse",
"raw": "css-parse@1.0.4",
"rawSpec": "1.0.4",
"scope": null,
"spec": "1.0.4",
"type": "version"
},
"_requiredBy": [
"/css"
],
"_resolved": "https://registry.npmjs.org/css-parse/-/css-parse-1.0.4.tgz",
"_shasum": "38b0503fbf9da9f54e9c1dbda60e145c77117bdd",
"_shrinkwrap": null,
"_spec": "css-parse@1.0.4",
"_where": "E:\\WebstormProjects\\fuck\\node_modules\\css",
"author": {
"email": "tj@vision-media.ca",
"name": "TJ Holowaychuk"
},
"dependencies": {},
"description": "CSS parser",
"devDependencies": {
"mocha": "*",
"should": "*"
},
"directories": {},
"dist": {
"noattachment": false,
"shasum": "38b0503fbf9da9f54e9c1dbda60e145c77117bdd",
"size": 2838,
"tarball": "http://registry.npm.taobao.org/css-parse/download/css-parse-1.0.4.tgz"
},
"keywords": [
"css",
"parser",
"stylesheet"
],
"main": "index",
"maintainers": [
{
"email": "antshort@gmail.com",
"name": "anthonyshort"
},
{
"email": "clint@anotherway.co.za",
"name": "clintwood"
},
{
"email": "me@conradz.com",
"name": "conradz"
},
{
"email": "ian@ianstormtaylor.com",
"name": "ianstormtaylor"
},
{
"email": "jonathanrichardong@gmail.com",
"name": "jonathanong"
},
{
"email": "jonathanrichardong@gmail.com",
"name": "jongleberry"
},
{
"email": "simon.lydell@gmail.com",
"name": "lydell"
},
{
"email": "m@moox.io",
"name": "moox"
},
{
"email": "nicolasgallagher@gmail.com",
"name": "necolas"
},
{
"email": "alexsexton@gmail.com",
"name": "slexaxton"
},
{
"email": "tj@vision-media.ca",
"name": "tjholowaychuk"
}
],
"name": "css-parse",
"optionalDependencies": {},
"publish_time": 1347907450126,
"readme": "ERROR: No README data found!",
"version": "1.0.4"
}
|
IN THE SUPREME COURT OF MISSISSIPPI
NO. 1999-KA-00522-SCT
ROOSEVELT WASHINGTON
v.
STATE OF MISSISSIPPI
DATE OF JUDGMENT: 06/30/1995
TRIAL JUDGE: HON. KEITH STARRETT
COURT FROM WHICH APPEALED: LINCOLN COUNTY CIRCUIT COURT
ATTORNEYS FOR APPELLANT: PRO SE
LESA HARRISON BAKER
ATTORNEYS FOR APPELLEE: OFFICE OF THE ATTORNEY GENERAL
BY: BILLY L. GORE
DISTRICT ATTORNEY: DUNN LAMPTON
NATURE OF THE CASE: CRIMINAL - FELONY
DISPOSITION: AFFIRMED - 10/11/2001
MOTION FOR REHEARING FILED: 10/26/2001; denied 12/13/2001
MANDATE ISSUED: 12/20/2001
BEFORE PITTMAN, C.J., COBB AND DIAZ, JJ.
DIAZ, JUSTICE, FOR THE COURT:
¶1. In September 1994, Roosevelt Washington (Washington) was indicted in the Lincoln County Circuit
Court for armed robbery and burglary of an inhabited dwelling. These charges were actually Count 3 and
Count 6, respectively, of a multi-count indictment. Washington waived arraignment, and Jack Ainsworth,
Washington's attorney at the time, subsequently filed numerous motions on Washington's behalf, including
motions to suppress evidence, sever trials, and a motion in limine. An omnibus hearing and a suppression
hearing were conducted. The motions to suppress were overruled, but the motion to sever trials was
granted. On June 28, 1995, a jury trial was held on Counts 3 and 6, and the jury returned guilty verdicts on
both counts.
¶2. On June 30, 1995, the trial court sentenced Washington, as a habitual offender, to a term of forty-five
(45) years for armed robbery and fifteen (15) years for burglary of an inhabited dwelling in the custody of
the Mississippi Department of Corrections (MDOC) to run consecutively, as well as to run consecutively
with any other sentences.
¶3. Subsequently, Washington filed a motion for judgment notwithstanding the verdict or, in the alternative,
for a new trial. Ainsworth then withdrew as Washington's counsel, and Jack Price was appointed to handle
the appeal. Washington later filed a petition for a writ of mandamus to overturn his conviction, which this
Court granted in March 1999. Later that same month, the trial court entered an order denying the motion
for jnov or new trial, but the court did grant Washington an out-of-time appeal. Around this time, Price also
withdrew as counsel for Washington. Lesa Baker of the Lincoln County Public Defender's office was then
appointed as new counsel. On January 12, 2000, a notice of appeal was filed and later amended on March
14, 2000. Finally, in response to a pro se supplemental brief filed by Washington, the State was granted
time to file a response to Washington's supplemental brief. Now, the case is properly before this Court on
appeal, and Washington raises the following issues: (1) whether the trial court erred in failing to grant a
mistrial due to State's witness testifying that when she identified Washington, she was sitting with another
woman who had been robbed; (2) whether the trial court erred in denying the motion for a directed verdict
or the motion for jnov; (3) whether the trial court erred in allowing testimony at trial which did not conform
to the indictment without amending the indictment to conform to the evidence, when such evidence was
alleged prejudicial; (4) whether Washington was denied effective assistance of counsel; (5) whether the
exclusion of testimony by a defense witness is reversible error; and (6) whether Washington was tried and
convicted on a "multiplicitous" and duplicitous indictment in violation of his constitutional rights.
¶4. As for the other counts of the indictment, Washington was tried and convicted of burglary of a dwelling,
Count 4, on January 24, 1995. The Count 4 conviction was affirmed by the Mississippi Court of Appeals
on December 17, 1996. As for Count 2, Washington was found not guilty of armed robbery on January
24, 1995. Counts 1 and 5 have not been tried.
FACTS
¶5. Washington was indicted for several separate incidents occurring in 1994. However, the present appeal
deals solely with those facts that form the bases for Counts 3 and 6. The pertinent facts are set out below.
¶6. On September 9, 1994, Leo Nettles (Leo) was busy mowing the front lawn of his home on Auburn
Drive in Bogue Chitto. His wife, Mildred Nettles (Mildred), was inside and did not feel well. She retired to
the front bedroom where she lay down to rest. While lying down, Mildred heard the front door slam shut
and assumed it was her husband. Curious why Leo would leave the lawn mower running, she called out to
him. In response, a man armed with a silver pistol ran up to the bed and demanded money. The assailant
threatened Mildred numerous times during the incident. Struck with fear, Mildred handed over roughly
$210. After finding the backdoor nailed shut, the intruder made his escape out a side window.
¶7. During trial, Mildred positively identified Washington as the person who robbed her that September.
Leo never saw anyone enter or leave the house; however, several other witnesses testified to seeing a
suspicious looking man driving around the area about the same time. In addition, through the testimony of
Officer Robert Berry, a written statement and an oral recorded statement, made by Washington, were
introduced into evidence. The statements were essentially confessions to the crime; each giving varying
detail.
DISCUSSION
I. WHETHER THE TRIAL COURT ERRED IN FAILING TO GRANT A MISTRIAL
DUE TO STATE'S WITNESS TESTIFYING THAT WHEN SHE IDENTIFIED
WASHINGTON, SHE WAS SITTING WITH ANOTHER WOMAN THAT HAD BEEN
ROBBED.
¶8. Washington argues against nearly every aspect of Mildred's identification of him. He spends much time
in his brief discussing the fact that Mildred said she remembered his face from dreams and that she could
not remember whether the intruder had facial hair. Washington argues that such an identification is not
appropriate evidence for a conviction. However, the weight and sufficiency of the evidence will be dealt
with under the next issue. On the other hand, Washington feels that an inadvertent statement made by
Mildred, one of the State's witnesses, unfairly prejudiced the jury, violated a motion in limine, and
warranted a mistrial. Washington argues that the failure of the trial judge to grant a mistrial amounts to
reversible error. The specific statement that Washington takes issue with is an exchange between the State
and Mildred concerning her identification of Washington:
Q: All right. [Defense] [c]ounsel asked you if someone assisted you when you came here, did they
point the defendant. Just tell us in your own words, as best you can, where were you at and just the
circumstances surrounding you seeing the defendant the first time after you said he came into your
house.
A: I was sitting back here and he was over here, and when I got a good look at him, and then one
time he was sitting over there, and he turned back and looked toward me, and there was no doubt in
my mind that it was him.
Q: Was there a police officer or somebody from the District Attorney's Office out there helping you,
pointing toward him, showing you who he was?
A: No. One of the other ladies - - one lady was sitting with me that he robbed.
(emphasis added). Washington promptly objected, and the trial judge heard arguments at the bench.
Washington contends that the statement implies that Mildred received guidance in her identification. In
addition, Washington argues that not only is the statement in violation of the pretrial order disallowing
mention of any other crimes, it is also so prejudicial as to warrant mistrial.
¶9. However, a review of the record leads to a different conclusion. First, there is no evidence of
prosecutorial misconduct or deceit, an important consideration. Branch v. State, 347 So. 2d 957, 959
(Miss. 1977). Also, the authority to declare a mistrial is left largely to the sound discretion of the trial judge.
Pulphus v. State, 782 So. 2d 1220, 1223 (Miss. 2001). Here, the judge listened to arguments and took
remedial measures. Specifically, the trial judge instructed the jurors to disregard the statement; then, he
polled the jury to ensure that all could disregard the statement. This Court has repeatedly held that when a
trial judge instructs the jury, we must assume that the panel followed the instruction. Puckett v. State, 737
So. 2d 322, 347 (Miss. 1999). Furthermore, "[a]bsent unusual circumstances, where objection is sustained
to improper questioning or testimony, and the jury is admonished to disregard the question or testimony, we
will not find error." Wright v. State, 540 So. 2d 1, 4 (Miss. 1989). We find no abuse of discretion. Thus,
this issue is without merit.
II. WHETHER THE TRIAL COURT ERRED IN DENYING THE MOTION FOR A
DIRECTED VERDICT OR THE MOTION FOR JNOV.
¶10. Through this assignment of error, Washington is essentially challenging the sufficiency and weight of the
evidence that forms the basis for his conviction. When the sufficiency and weight of the evidence are being
questioned, the accuracy of the jury's verdict is under attack. May v. State, 460 So. 2d 778, 780-82
(Miss. 1984). Both the motion for directed verdict and the motion for jnov or a new trial are predicated
upon the idea that the evidence simply does not justify a verdict of guilt beyond a reasonable doubt. A
fundamental principle of law is that jury verdicts will not be disturbed except under the most extreme of
situations. Manning v. State, 735 So. 2d 323, 333 (Miss. 1999). Accordingly, in our review of criminal
convictions, we view the evidence in a light most favorable to the verdict. Id. If after our review we decide
that no reasonable person could have found the accused guilty beyond a reasonable doubt, the verdict will
be set aside. Id. However, if our examination reveals that "reasonable and fair-minded jurors in the exercise
of impartial judgment might have reached different conclusions, the verdict of guilty is thus placed beyond
our authority to disturb." Id.
¶11. Washington raises a litany of examples where he feels the evidence to be lacking. He takes issue with
Mildred's identification. Washington suggests that she may have received guidance and that her recollection
was inappropriately based upon dreams. He also points out the lack of physical evidence and suggests that
without any his conviction is unsubstantiated. Finally, Washington attacks the veracity and quality of his
statements. Among the alleged problems with the statement, Washington contends that it is vague and
against his constitutional rights because he asked for counsel. Furthermore, in his pro se brief, Washington
asserts that the voice in his recorded oral statement is actually an imposter and that he never made a
statement.
¶12. A review of the record not only shows ample evidence to support a conviction, it also reveals many of
Washington's examples as being purely baseless. Mildred repeatedly and unquestionably identified
Washington as her assailant. Furthermore, the record does not support Washington's allegations against the
confessions. True, there was little or no physical evidence, but Washington's confessions, the identification
of Washington by the victim, and the testimony of other witnesses were sufficient bases for a conviction.
there was still an abundance of material to base a conviction on. Per our charge, a review of the record
guided by the long-accepted high standard of review does not reveal a verdict so wanting for evidence as to
warrant a reversal. As such, this assignment of error is without merit.
III. WHETHER THE TRIAL COURT ERRED IN ALLOWING TESTIMONY AT TRIAL
WHICH DID NOT CONFORM TO THE INDICTMENT WITHOUT AMENDING THE
INDICTMENT TO CONFORM TO THE EVIDENCE, WHEN SUCH EVIDENCE WAS
ALLEGED PREJUDICIAL.
¶13. While the issue may seem complicated at first, the situation it addresses is actually quite simple. The
indictment lists August 9, 1994, as the relevant date of the incident at the Nettleses' home. The trial judge
also repeated this date as the time of the alleged incident. In actuality as evinced by the testimony of all of
the witnesses, the incident for which Washington was being charged occurred on September 9, 1994.
Furthermore, the prosecution did not amend the indictment to reflect the proper date. While this may seem
insignificant, Washington asserts that he was severely prejudiced by the mix up in that he was not informed
of the details of the alleged crime. Without an accurate date, Washington contends that he was not given an
opportunity to accurately investigate an alibi. As such, Washington asserts that this is a fatal error in the
indictment.
¶14. The State rebuts the argument by pointing out that there was never an objection to the discrepancy
until now. This Court has held that a variance not objected to at trial is waived. Ellis v. State, 254 So. 2d
902, 903 (Miss. 1971); Kellum v. State, 213 Miss. 579, 582, 57 So. 2d 316, 318 (1952). Furthermore,
the defect did not affect the merits of Washington's case effect the essence of the crime and was, therefore,
amendable and not fatal. See Miss. Code Ann. § 99-17-13 (2000). As the State points out, to hold
otherwise would be placing form over substance. Finally, Washington does not actually allege prejudice; he
merely states that the corrected date address "may" have helped his case. "May" is not good enough to
warrant reversal of a conviction. Therefore, we find this issue to be without merit.
IV. WHETHER WASHINGTON WAS DENIED EFFECTIVE ASSISTANCE OF
COUNSEL.
¶15. Via a pro se supplemental brief, Washington alleges that none of his three attorneys provided effective
assistance in his defense and appeal. Accusations of ineffective assistance of counsel are subject to the
requirements set forth under Osborn v. State, 695 So. 2d 570, 575 (Miss. 1997), and Strickland v.
Washington, 466 U.S. 668, 104 S. Ct. 2052, 80 L.Ed. 2d 674 (1984). Under both cases, this Court will
not find counsel's assistance ineffective unless the accused (1) cites specific instances in which the attorney
was so deficient that he essentially was not acting as counsel, and (2) shows that those errors deprived the
accused of a fair trial. Id.
¶16. As evidence of his attorneys' deficient conduct, Washington points to a few specific instances. Namely,
Washington accuses his counsel of not conducting a thorough independent investigation of the charges. He
goes on to assert that his court-appointed attorney should have procured experts on handwriting analysis
and voice verification to challenge the veracity of the "confessions." (Washington claims that he never gave
any statement to the police). In addition, Washington takes issue with his attorney not objecting to the
indictment, which will be dealt with separately as Issue VI. Washington also claims that counsel did not file
an appeal on his behalf, would not call Washington and his girlfriend as witnesses, and should have objected
to jury selection partly being conducted without Washington's presence. Washington claims that these
examples more than illustrate ineffective assistance of counsel.
¶17. Washington's argument has two fatal flaws. First, he does not show how any of the alleged deficiencies
deprived him of a fair trial, which is an essential element in the Strickland analysis. Thus, Washington's
argument already fails. In addition, all of the alleged examples either can be easily explained or are frankly
fictional. Time, money, and feasibility likely weighed against acquiring the suggested experts; plus, the
allegations that the statements were fabricated are not supported by any evidence, save Washington's own
word. As previously mentioned, the questions concerning the indictment will be discussed under another
issue. Washington fired one attorney and specifically instructed him to not take action on this matter. His
new attorney did file an appeal, so this claim is baseless. The failure to call witnesses can be chalked up to
trial strategy.
¶18. Washington asserts in his supplemental brief before this Court that his trial counsel advised him it
would be in Washington's best interest not to testify. Washington merely claims that he requested to testify
on his own behalf. Also, There is no evidence to support this contention, and a review of Washington's
argument does not reveal what the excluded testimony would have accomplished. However, at the
conclusion of the State's case-in-chief, and after Washington rested his case without calling any witnesses,
the trial court made no record regarding Washington's decision not to testify. This Court has previously
suggested to trial judges that "in any case where a defendant does not testify, before the case is submitted to
the jury, the defendant should be called before the court out of the presence of the jury, and advised of his
right to testify ... A record should be made of this so that no question about defendant's waiver of his right
to testify should ever arise in the future." Culberson v. State, 412 So. 2d 1184, 1186-87 (Miss. 1982).
This issue was also considered in Jaco v. State, 574 So. 2d 625, 636 (Miss. 1990).
¶19. In Jaco, this Court acknowledged that the defendant should be allowed "an evidentiary hearing where
he presents a substantial and detailed affidavit to the effect that his attorney denied and affirmatively
preventing him from testifying." Id. at 636. Similar to the case sub judice, the Jacos rested their case and the
trial court failed to advise the Jacos of their right to testify. Id. at 633. However, this Court found that there
was no evidence that the Jacos questioned their attorney concerning the advice not to testify and there was
no dubious legal advice given to the Jacos; therefore, the Jacos were not allowed a evidentiary hearing on
that point. The record in the case sub judice suggests that Washington merely followed the advice of his
attorney. Washington had a record of convictions for prior felonies. If Washington had elected to take the
stand, the jury would have learned about his previous convictions. Also, Washington does not allege that he
was not aware of his right to testify in his own behalf. Furthermore, Washington provides no insight or
argument as to how testifying on his own behalf would have given him a more favorable outcome. To be
sure, a decision to testify would have been complete folly because the jury could verify the authenticity of
the voice-recorded statement of Washington against his trial testimony. See Bracey v. State, 724 So. 2d
1028, 1032 (Miss. Ct. App. 1998).
¶20. Finally, Washington's presence for the entire jury selection process was not necessary and did not
cause an unfair trial. Therefore, we find this issue without merit.
V. WHETHER THE EXCLUSION OF TESTIMONY BY A DEFENSE WITNESS IS
REVERSIBLE ERROR.
¶21. Although this issue was briefly discussed above, Washington adds something for this issue. He claims
that Officer Berry lied concerning the confession and the procurement of the gun. Furthermore, there is a
vague allegation that the State withheld exculpatory evidence in the form of an oral statement (which one is
unclear). Finally, he reiterates the argument that his girlfriend should have been allowed to testify.
¶22. A review of the record reveals that the State committed no discovery violation nor did it withhold
exculpatory evidence. Again, we are left with Washington's unsupported word against the actual evidence
and judgment of the trial judge and the jury. The confession and exclusion of Washington's girlfriend have
already been discussed. There is nothing to indicate that the written and oral statements were given by
anyone except Washington. Washington's girlfriend was never offered as a witness and cannot, therefore,
be properly called "excluded." Furthermore, Washington merely claims that she would testify in a rebuttal
capacity, which would not materially alter the charges, defense, or evidence. Without evidence that the
outcome would have been affected, we cannot reverse.
VI. WHETHER WASHINGTON WAS TRIED AND CONVICTED ON A
"MULTIPLICITOUS" AND DUPLICITOUS INDICTMENT IN VIOLATION OF HIS
CONSTITUTIONAL RIGHTS.
¶23. Washington's final assignment of error charges that the indictment against him violates his constitutional
rights. Miss. Code Ann. § 99-7-2 (2000) and Rule 7.07 of the Uniform Circuit and County Court Rules
authorize multiple count indictments when the alleged crimes arise out of the same transaction or are parts
of a common scheme. Washington correctly points out that his indictment was based on burglaries
occurring on different days at different homes with different victims. Washington cites McCarty v. State,
554 So. 2d 909 (Miss. 1989), in which a conviction for multiple burglaries was reversed because the
incidents did not arise out of a single transaction and actually took place days apart.
¶24. Washington also claims that charging him with both armed robbery and burglary of an inhabited
dwelling is tantamount to double jeopardy. He asserts that the charges are essentially an attempt to punish
him twice for the same conduct.
¶25. Again, Washington neglects to apply the appropriate law to the appropriate facts. While McCarty
does not allow single convictions on multiple count indictments, Counts 3 and 6, which arose did arise out
of a single transaction, were severed from the other counts and tried separately. In fact, all of the counts
were separated from each other, except for those intimately connected (like Counts 3 and 6). In McCarty,
the motion to sever was denied. Id. at 914. If Washington had faced a single trial on all six counts, then he
may have had a viable McCarty argument.
¶26. As for Washington's duplicity argument, one simply need examine the elements of the two charges to
see that they are independent and distinct crimes. The crime of burglary was complete when Washington
broke into and entered the Nettles residence with the intent to commit some crime while inside. At the same
time, the armed robbery occurred when Washington took money from Mildred with force or threat of force
while armed. Each crime could have occurred without the other, and different facts support each.
Therefore, we find this issue to be without merit.
CONCLUSION
¶27. Despite Washington's litany of assignments of error, we find his arguments without merit. Any harm
that the inadvertent statement by Mildred Nettles might have caused was properly addressed by the trial
judge, and we do not feel compelled to second guess both him and the jury. Furthermore, the record
contains ample evidence to support a conviction in the present case. The final issue his counsel raised
concerning the inaccurate indictment was waived by failure to object. In any case, the error was harmless.
¶28. As for Washington's pro se issues, the bulk of his allegations are unfounded, unsupported by evidence,
and legally unsound. Therefore, we affirm the conviction and sentence imposed by the Lincoln County
Circuit Court.
¶29. CONVICTION OF ARMED ROBBERY AND SENTENCE OF FORTY-FIVE YEARS
AND CONVICTION OF BURGLARY AND SENTENCE OF FIFTEEN YEARS AS A
HABITUAL OFFENDER IN THE CUSTODY OF THE MISSISSIPPI DEPARTMENT OF
CORRECTIONS AFFIRMED. SAID SENTENCES ARE TO RUN CONSECUTIVELY AND
CONSECUTIVELY TO ANY OTHER SENTENCES PREVIOUSLY IMPOSED.
PITTMAN, C.J., BANKS AND McRAE, P.JJ., SMITH, MILLS, WALLER, COBB AND
EASLEY, JJ., CONCUR.
|
Saturday, 23 December 2017
The Explanation of Mata's Goal Celebration
Juan Mata has explained the significance of his prayer symbol in his free kick goal celebration against Leicester City on Saturday.
The midfielder netted with a precise finish to cancel out Jamie Vardy’s opener before curling home a sublime free-kick to put United ahead in the second half, but the Reds were denied victory by a last-gasp Harry Maguire equaliser in a 2-2 draw at the King Power Stadium.
Speaking to MUTV after the game, the Spaniard explained his celebration: “It was because when the kids from the OSCAR Foundation that we work with for Common Goal came to Old Trafford to visit me, they asked if I could do this kind of celebration for them.
Following his visit to Mumbai in the summer, Juan helped to launch the new global initiative Common Goal which aims to convince players to donate one per cent of their salary to Football For Good charities such as the OSCAR Foundation.
Back in October, a group of 14 youngsters, aged 11 to 14, from the OSCAR Foundation, travelled from Mumbai, along with coach Maruti Chauhan and OSCAR Foundation founder Ashok Rathod, for a behind-the-scenes tour of Old Trafford with Mata and to attend a unique photography exhibition at the National Football Museum Hall of Fame in Manchester.
Giving his thoughts on the game, he said: "Now we feel frustrated and angry, but we need to keep going and from tomorrow, rest and think about the next game. Obviously we aim to finish the next one with a much better feeling."
About Foski DefomaTemplatesyard is a blogger resources site is a provider of high quality blogger template with premium looking layout and robust design. The main mission of templatesyard is to provide the best quality blogger templates. |
As 25-year-old Hadiya returned to her college in Salem to complete her house surgency, she told media persons that although the Supreme Court had granted her freedom from her parents' confinement, she was not able to exercise that freedom in its entirety.
In a gesture aimed at proving that the college was not going to curtail Hadiya's fundamental rights, she was allowed to speak to her husband Shafin Jahan, twice. |
/**
* Licensed to the Apache Software Foundation (ASF) under one
* or more contributor license agreements. See the NOTICE file
* distributed with this work for additional information
* regarding copyright ownership. The ASF licenses this file
* to you under the Apache License, Version 2.0 (the
* "License"); you may not use this file except in compliance
* with the License. You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing,
* software distributed under the License is distributed on an
* "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY
* KIND, either express or implied. See the License for the
* specific language governing permissions and limitations
* under the License.
*/
package org.apache.cxf.configuration.foo;
import javax.xml.bind.JAXBElement;
import javax.xml.bind.annotation.XmlElementDecl;
import javax.xml.bind.annotation.XmlRegistry;
import javax.xml.namespace.QName;
/**
* This object contains factory methods for each
* Java content interface and Java element interface
* generated in the org.apache.cxf.configuration.foo package.
* <p>An ObjectFactory allows you to programatically
* construct new instances of the Java representation
* for XML content. The Java representation of XML
* content can consist of schema derived interfaces
* and classes representing the binding of schema
* type definitions, element declarations and model
* groups. Factory methods for each of these are
* provided in this class.
*
*/
@XmlRegistry
public class ObjectFactory {
private static final QName POINT_QNAME = new QName("http://cxf.apache.org/configuration/foo",
"point");
private static final QName ADDRESS_QNAME = new QName("http://cxf.apache.org/configuration/foo",
"address");
private static final QName FOO_QNAME = new QName("http://cxf.apache.org/configuration/foo",
"foo");
/**
* Create a new ObjectFactory that can be used to create new instances of schema derived
* classes for package: org.apache.cxf.configuration.foo
*
*/
public ObjectFactory() {
}
/**
* Create an instance of {@link Address }
*
*/
public Address createAddress() {
return new Address();
}
/**
* Create an instance of {@link Foo }
*
*/
public Foo createFoo() {
return new Foo();
}
/**
* Create an instance of {@link Point }
*
*/
public Point createPoint() {
return new Point();
}
/**
* Create an instance of {@link JAXBElement }{@code <}{@link Point }{@code >}}
*
*/
@XmlElementDecl(namespace = "http://cxf.apache.org/configuration/foo", name = "point")
public JAXBElement<Point> createPoint(Point value) {
return new JAXBElement<Point>(POINT_QNAME, Point.class, null, value);
}
/**
* Create an instance of {@link JAXBElement }{@code <}{@link Address }{@code >}}
*
*/
@XmlElementDecl(namespace = "http://cxf.apache.org/configuration/foo", name = "address")
public JAXBElement<Address> createAddress(Address value) {
return new JAXBElement<Address>(ADDRESS_QNAME, Address.class, null, value);
}
/**
* Create an instance of {@link JAXBElement }{@code <}{@link Foo }{@code >}}
*
*/
@XmlElementDecl(namespace = "http://cxf.apache.org/configuration/foo", name = "foo")
public JAXBElement<Foo> createFoo(Foo value) {
return new JAXBElement<Foo>(FOO_QNAME, Foo.class, null, value);
}
}
|
Cryptocurrency is at its peak these days due to the features provided by this digital asset as it doesn’t involve any third party vendor while processing the payments. Thus, We may notice the usage of few words very frequently, but those investors who are new to the market may not be aware regarding the usage of these words. They may be blank when these terms are used by people around them. One term among that is “HODL”
From where did the Term “HODL” coin ??
The term “HODL” is actually “HOLD” that got misspelled. Basically, this word got birth on the Bitcointalk forum in 2013 and it was used by one of the members named “GameKyuubi”. He used that word when he was writing the post regarding the loss in holding the BTC. Instead of mentioning “I AM HOLDING”, he mentioned, “I AM HODLING”. Though, it was a typo error because he was drunk while typing.
But, that is the day when this word become popular and it is basically used by those investors who are facing the market fluctuations which impacts the coin values they are holding. This term “HODL” represents that their investor believes that the coin will be in profit one day if not today.
That’s why this term got the description as “HOLD ON FOR DEAR LIFE”. As it encourages its investors to resist till the market is not stable.
When is HODL used exactly??
The usage of this word was too high around last December and starting of January 2018 due to the unstable market conditions. This word has earned a considerate status as people mention #HODL in their comments on Twitter, Reddit, and other social platforms. As the months passed and the market was doing better than earlier, the usage of HODL decreased.
So, basically, this term prompts the user to avoid selling the Bitcoins or other cryptocurrencies when prices start rising. Not every investor or trader is good at trading, only a few of them know when to buy/sell and are smart enough to bear such kind of situations.
The Aim behind using HODL!!
The overall aim of using HODL is to Keep Calm and Hold On. In 2017, Bitcoin and Ethereum investors made huge returns on their currencies just because the investors were adopting the ‘HODL’ lifestyle. They refused to sell any of their Bitcoin at any cost in the past and later on, those were the only investors who saw huge returns.
Thus, most of the traders want to hold their currencies forever without even selling the penny of it and some investors follow the approach to make profits by selling on a periodic basis at regular intervals.
So, it all depends upon the investor's wishes to either HODL until the market goes up or sell immediately when the market is fluctuating.
This term makes sense when we're seeing the losses but can't take any action to overcome the situation and instead will wait until that phase passes as it makes the investor HODL on their currencies for the time being.
How is HODL impacting the overall crypto market?
Yes, this term impacts the overall market as the usage of this term gets affected as per the price fluctuations in the BTC. Thus, If we ask bankers why they hate bitcoin and Cryptocurrency, the only reason they mention is they threaten their business.
To avoid this, make sure to never stop learning and keep updating yourself every single day to make yourself aware. Instead of selling and buying the currency without good knowledge puts the investor in trouble which forces them to hold onto it if it’s not profitable or either sell at lower prices than the actual prices.
Conclusion
People can’t save money from their daily jobs, that’s why Tony Robbins says “ If you do what you have always done, you will get what you have always gotten.” Thus, to overcome the limitations what average people are having, you've to start doing what average people doesn't do.
Start investing in Crypto, stocks, bonds etc. Take a step forward towards by learning about it first and then move ahead. “Don’t chase the money, let the money Comes to you.”
JUST HODL it, you never lose anything until you hit the sell button. Crypto is all about having patience. Until the investor has that, he can stay in the market. Once he starts losing it, he can no longer survive in that environment. Focus on what is coming.
Cryptocurrency is the emerging technology which provides the new direction to the digital industry but it requires a lot of patience.
So keep CALM and keep HODLING!! |
Orientation was held for our new teachers yesterday at Owensville Elementary. It was exciting getting to meet everyone and work with them as they prepare for a new year. We are very excited about the upcoming school year. We are looking forward to working together and ensuring our students are ready to succeed.
It is great seeing all of the teachers new and veteran walking the hallways and preparing their classrooms for a new school year. The time is quickly approaching when the sound of our students will be filling the hallway. We are fortunate to have great teachers and students in our schools. |
Malthus’ nightscape is nigh, yo-
Frugal survivalism as if prepping is time sensitive
daily ad
Tuesday, May 31, 2016
sliders
SLIDERS
No, today we are not
talking about some cheesy 90’s sci-fi show about sliding along the space-time
continuum, which, okay, honestly, I did rather enjoy tremendously when it first
came out but it seems like whenever I come across an episode recently such as
on cable ( in the short period of time I watched it moving back into town,
before I talked the New Old Lady into canceling commercial laden DirectTV and
just getting Netflix and saving $50 a month ) it didn’t seem to jibe with my
memories of the show-perhaps I was watching the ones which were aired after the
show “jumped the shark” ( a term taken from the Happy Days episode when Fonzi
jumped a pool with a shark in it on his motorcycle, the first gimmick used in a
desperate attempt to revive slumping ratings and the point the show really went
downhill in quality ).I wouldn’t doubt
it, the foul bastards experiencing orgasmic joy whenever they can cheat anyone,
and exponentially increasing that feeling whenever they know I personally am
being violated.
*
Speaking of which, and I’ll
spare all of you too much of a detailed repeat of my recent years long shoe
shopping angst and just quickly say ( for the benefit of any new reader ) that
nobody, and I mean almost nobody, seems to want to put out a shoe that lasts
any period of time-not within any affordable parameter.Yes, I know a $250 boot that lasts five
years is far better than a $25 one that lasts five months-but the trick is
knowing which brand to trust, not knowing which has “gone Maytag” on us (
suddenly substituting cheap quality on a once trusted brand ).It really does seem that shoe companies feel
one of two ways.They enjoy humping me,
personally, or they feel justified jacking the crap out of the price of their
shoes if they are quality made ( what?I
mean, seriously, there are no more cows around since Texas lost the use of the
Aquifer?Leather is THAT expensive?I think not, great snot ).I don’t know about you, sitting in your
concrete bunker atop a mountain fondling your freeze dried Yak testicle dinner
and one of many HK-91‘s, but I can’t afford to stockpile shoes for post-apocalypse
at the new prices.You might as well
expect me to be able to afford health insurance ( speaking of which, did you
hear about the few states still offering “affordable” entry level plans-one of
the chief selling points convincing the public they weren’t actually getting
humped-planning on raising the minimum pricing 20 to 30%?Friggin priceless!Suck it, Democrats and Demopublicans ).
*
I probably shouldn’t
worry, as I have at least a dozen pair ofboots made way back in the day before the new non-quality issue came
along, but it is in my nature to worry and constantly reevaluate how many of
everything I actually need ( the bar keeps getting raised on just about
everything except wheat and ammo.Mostly
because those two items got priority for ten years and since then I’ve
concentrated on everything else.Which
is a much longer list than I had anticipated ).To me, even though cobblers will reintroduce themselves quick enough, I
simply don’t have enough shoes.Even
though I rationally tell myself otherwise, I can’t stop the neurotic
shopping.So, how can I apply a frugal
priority to my post-apocalyptic footwear stash?I modernize the standard survivalist advice on making tire sandals.Which, okay, is good enough advice as far as
it goes.It isn’t all too difficult to
figure out how to do it, even if you forget to download an article on it or
lose your paper printout.It is one of
those handy skills to have.However, I’d
like an intermediate product I can utilize prior to resorting to making my own
( and if you can’t afford it, no big deal-there aren’t all that many uses for
tires that they should be in huge demand.Growing potatoes and underground houses come to mind, but that isn’t a
universal.Perhaps shoring up earth
walls to absorb cannon fire?Regardless,
there should be enough tires around cheap enough come the time.This advice can be filed under “nice if you
have the spare coin” ).
*
Family Dollar stores sell
two types of men’s sandals, both at $6 a pair.Clogs, or Soccer Slides ( hence the article title ).Clogs are like the “Crocs”, and sliders are
an improvement on flip-flops ( which, despite the cheaper price, I advise
against strongly unless you live in a year round mild climate-otherwise you
want socks along with your footwear ).Instead of the toes holding the sandal in place-making sock wearing
close to impossible-the flat piece has a bar of “rubber” going across the
middle of your upper foot.Thus, you “slide”
the foot in to wear.My last pair of
Slides lasted several years of regular use-except during the three winter
months-and I just now put a few drops of Shoe Goo on them and expect them to
last several more.Now, of course there
are caveats.Sandals are NOT the same as
boots or shoes.I completely understand
that, and I urge you to remember it also.I’m NOT advocating completely eliminating shoes and wearing sandals- I’m
saying that wearing sandals at every conceivable opportunity to prolong the
life of shoes will work out quite nicely.
*
Also, be aware that Family
Dollar likes to play a little game of Bait And Switch.They offer a vast improvement over Wal-Mart,
get you hooked, then raise the price or decrease quality.I put up with this because even then, they
are better than Wally ( per square foot, 2-ply toilet paper at Family in a four
roll pack is cheaper than Wally with its 12 pack.Also, wooden matches, 500 count at under $2,
is far superior in quality to the crap recycled paper hard to ignite paper
matches both Wally and Kroger push ), but just beware of this tendency.The Sliders I buy today may not be the same
as the ones I’m raving about.Yet, even
so, they should still provide a good return on your money.If you go with the Clogs, the top plastic
seems a bit thin, but they are more comfortable and leave more room for sock
wearing.The Sliders seem better built,
except for a tighter fit, but make sure to stock the Shoe Goo.But I’d only recommend them for summer
wear-the Clogs seem to win out in the pros and cons.$6 seems to be a fair amount to pay for
stockpiling footwear.
END
Please support Bison by buying through the Amazon ad graphics at
the top of the page.IF YOU DON’T SEE
THE AD, DISABLE AD BLOCK ( go to the Ad Blocker while on my page and scroll
down the menu to “disable this site” ). You can purchase anything, not just the
linked item. Enter Amazon through my item link and then go to whatever other
item you desire. As long as you don’t leave Amazon until after the order is
placed, I get credit for your purchase. For those that can’t get the
ads because they are blocked by your software, just PayPal me occasionally or
buy me something from my Amazon Wish List once a year.Pay your author-no one works for free.I’m nice enough to publish for mere Book
Money, so do your part.****Contact Information* Links
To Other Blogs * Land In Elko* Lord Bison* my bio & biblio* my web site is
www.bisonprepper.com*Link To All
My Published Books*By the by, all my writing is copyrighted. For the obtuse out there
8 comments:
Warning Will Robinson!Everything is in the downward *slide* now so I have no allegiance to any retail establishments. Walmart still gets a fair amount of my routine coin but it is up to me to get the best value for the dollar, and this requires more time on my part because the retailers are very cunning. Even with my deeper levels of scrutiny I get it stuck in my ass frequently. But worse is the online purchases, which I am cutting back on drastically. There is something to be said about seeing a perspective item with your own eyes and holding it in your own hands. The only people getting happy about online purchases, because they always win, are the shipping companies.
So, my goal is to spend less, spend smart, and spend local.Mama didn't raise a complete idiot over here, I can see the patterns when I'm focused on them.
Tire treads seem to be lacking in traction for human purposes. The treads are too big. But because the composition is so dense I wonder if the treads can be modified with a Dremel so as to create a more human friendly tread pattern?
Also, because the rubber is so dense, I wonder if holes could be countersunk in the treads and flat rivets used to secure the tire tread (along with contact cement) to the bottom of an otherwise decent leather boot?
Since the quality of leather has not gone down (I don't think, unless I'm missing something?) that pretty much leaves either poor stitching or crappy soles I'm thinking? I wonder if you could restitch them for improved durability? If it's bad soles, one thing that you might try is to add an additional sole to the boot and glue it with the Barge rubber cement. I actually do this with my cheap slip on Walmart shoes, because the soles are so thin that it hurts to step on the rocks lying about our yard. I made the soles from old tires.
I'm going to see if I can come up with an improved variation on the simple tire sandal. I'm hoping for a complete rubber shoe when I'm done, that provides full protection to the feet.
I must moderate-trust me. You don't want to see what happens otherwise. Sometimes it takes awhile to respond as I only check two or three times a day. No N-Bombs, nothing to get me libeled. Otherwise, have at it. If you criticize me, make sure to praise my hair first. |
1. Technical Field
The present disclosure relates to an intercom system and a communication method thereof.
2. Description of the Related Art
Recently, an intercom system has been widely used in a house and the like. The intercom system is configured by, for example, a slave device (referred to as “an entrance slave device” below) and a master device (referred to as “an intercom master device” below). The slave device is installed at an entrance on the outside of a house, and has a camera attached thereto. The master device is installed in the house, and displays an image captured by the camera of the entrance slave device, on a monitor. A monitor (referred to as “an additional monitor” below) may be additionally installed in the intercom system.
Generally, in the intercom system, the entrance slave device and the intercom master device are connected to each other by using a two-wire cable. The intercom master device and the additional monitor are connected to each other by using a two-wire cable. The publication of Japanese Patent Unexamined Publication No. 2007-124227 discloses an intercom system in which packets are transmitted and received between an entrance slave device and an intercom master device which are connected to each other by using a two-wire cable. |
Southern California Home Prices Climb In April
LOS ANGELES (AP) — Southern California home prices increased in April as the supply of properties for sale — especially low-cost homes in foreclosure — remained tight, a research firm said Wednesday.
The median price for new and existing homes and condominiums in the six-county region climbed to $290,000, up 3.6 percent from the same period last year, DataQuick said.
It was the first annual increase in 16 months and matched the highest price since December 2010.
There were 19,284 homes sold, up 5.1 percent from a year earlier.
DataQuick said there were fewer sales of foreclosed properties, which tend to go for lower prices. Higher-priced coastal markets also showed signs of improvement.
“The housing market continued its painfully slow crawl back toward normalcy last month,” DataQuick President John Walsh said.
Properties that were foreclosed upon in the previous year made up 28.6 percent of existing-home sales in April, down from 33.8 percent in the year-ago period and the lowest since January 2008. In February 2009, foreclosed properties accounted for 56.7 percent of existing-home sales.
Short sales — in which the price was less than the amount the seller owed on the mortgage — accounted for 18.4 percent of existing-home sales last month, up from 17.3 percent a year earlier.
Sales of homes between $300,000 and $800,000 rose 3.5 percent in April from the same period last year. while sales for less than $200,000 fell 4.7 percent last month.
The four coastal counties — Los Angeles, Orange, San Diego and Ventura — accounted for 71.5 percent of sales last month, up 68 percent from April 2011. The two inland counties — Riverside and San Bernardino — had been driving much of the gradual rebound. |
In the book Stargirl, what is Leo Borlock's connection to porcupine neckties?
In the very first chapter in the book, Leo Borlocks says that when he was little, his uncle in Pennsylvania had a porcupine necktie, and Leo had thought it was "just about the neatest thing in the world". When Leo's family had moved to Arizona, his uncle had given him the tie, prompting Leo to start a collection of them. Unfortunately, he had never been able to find any more porcupine ties. On his fourteenth birthday, Leo's mother had called in a short feature about Leo to the local paper, and in it, she mentioned that he collected porcupine neckties as a hobby. A few days later, he found an annonymous gift at his front door - a porcupine necktie. It was a couple of years before he actually met the giver of the gift, but even then, Stargirl was watching him.
Stargirl had a habit of learning about people's wants and needs through quiet observation. She then would go out of her way to meet those wants and needs, just for the joy of making someone happy. Her intentions were not always interpreted as she meant them, but her heart was definitely in the right place. It was she who sent Leo a porcupine tie, before he ever knew who she was.
The very last chapter of the book takes place many years after Leo has seen Stargirl for the the last time. When they were in the eleventh grade together, they were friends for awhile, and even started a relationship, but he had been unable to accept her for what she was, and the relationship lasted only a short while. No one ever knew where Stargirl went when she disappeared from the area with her family, but Leo knows that somehow, she is still watching over him. As proof, he notes that last month, a day before his birthday, he had received an annonymous gift in the mail - a porcupine necktie. Somewhere, Stargirl still remembers him, and is looking out for his happiness. |
Q:
MySQL Pivot Table Column Data as Rows
I'm struggling to find a solution this MySQL problem. I just can't seem to get my head around how to do it. I have the following tables.
Question table
+----+-------------+
| id | question |
+----+-------------+
| 1 | Is it this? |
| 2 | Or this? |
| 3 | Or that? |
+----+-------------+
Results Table
+----+---------+--------+
| id | user_id | job_id |
+----+---------+--------+
| 1 | 1 | 1 |
| 2 | 1 | 3 |
| 3 | 2 | 3 |
+----+---------+--------+
Answers table
+----+-------------------------+--------------+
| id | answer | fk_question_id | fk_result_id |
+----+-------------------------+--------------+
| 1 | Yes | 1 | 1 |
| 2 | No | 2 | 1 |
| 3 | Maybe | 3 | 1 |
| 4 | Maybe | 1 | 2 |
| 5 | No | 2 | 2 |
| 6 | Maybe | 3 | 2 |
| 7 | Yes | 1 | 3 |
| 8 | Yes | 2 | 3 |
| 9 | No | 3 | 3 |
+----+-------------------------+--------------+
If possible I'd like to display the question answers as columns for each result set, like this.
+-----------+---------+--------+-------------+----------+----------+
| result_id | user_id | job_id | Is it this? | Or this? | Or that? |
+-----------+---------+--------+-------------+----------+----------+
| 1 | 1 | 1 | Yes | No | Maybe |
| 2 | 1 | 3 | Maybe | No | Maybe |
| 3 | 2 | 3 | Yes | Yes | No |
+-----------+---------+--------+-------------+----------+----------+
Any help would be much appreciated.
Thanks
A:
SELECT a.ID,
a.user_ID,
a.job_id,
MAX(CASE WHEN c.question = 'Is it this?' THEN b.answer END) 'Is it this?',
MAX(CASE WHEN c.question = 'Or this?' THEN b.answer END) 'Or this?',
MAX(CASE WHEN c.question = 'Or that? ' THEN b.answer END) 'Or that? '
FROM Results a
INNER JOIN Answers b
ON a.id = b.fk_result_id
INNER JOIN Question c
ON b.fk_question_id = c.ID
GROUP BY a.ID,
a.user_ID,
a.job_id
SQLFiddle Demo
If you have unknow number of questions (specifically 1000 like Matei Mihai said), a dynamic version is much required.
SET @sql = NULL;
SELECT
GROUP_CONCAT(DISTINCT
CONCAT(
'MAX(CASE WHEN c.question = ''',
question,
''' then b.answer end) AS ',
CONCAT('`',question,'`')
)
) INTO @sql
FROM Question;
SET @sql = CONCAT('SELECT a.ID,
a.user_ID,
a.job_id, ', @sql, '
FROM Results a
INNER JOIN Answers b
ON a.id = b.fk_result_id
INNER JOIN Question c
ON b.fk_question_id = c.ID
GROUP BY a.ID,
a.user_ID,
a.job_id');
PREPARE stmt FROM @sql;
EXECUTE stmt;
DEALLOCATE PREPARE stmt;
SQLFiddle Demo
OUTPUT
╔════╦═════════╦════════╦═════════════╦══════════╦══════════╗
║ ID ║ USER_ID ║ JOB_ID ║ IS IT THIS? ║ OR THIS? ║ OR THAT? ║
╠════╬═════════╬════════╬═════════════╬══════════╬══════════╣
║ 1 ║ 1 ║ 1 ║ Yes ║ No ║ Maybe ║
║ 2 ║ 1 ║ 3 ║ Maybe ║ No ║ Maybe ║
║ 3 ║ 2 ║ 3 ║ Yes ║ Yes ║ No ║
╚════╩═════════╩════════╩═════════════╩══════════╩══════════╝
|
Podcast sponsorship revenue continues to fuel NPR’s financial growth - smollett
https://current.org/2019/09/podcast-sponsorship-revenues-continue-to-fuel-nprs-financial-growth/
======
e1ven
I love NPR. I'm glad they're doing well, and hope they will continue to make
quality programs.
But one of the major advantages which has set them apart for me is that they
aren't as advertising dependent as so many of their alternatives.
Avoiding ads makes it easier for them to be independent, and able to report
without fear of corporations withdrawing their support.
It's also just much more pleasant to listen to. I try to avoid advertising as
much as possible, and it's sad that they are one more place it's invading.
I know they've had corporate sponsors for some time, but the podcasts really
feel like an escalation.
I don't blame them; I'm sure they felt this was the best choice for them to
grow and survive, but it feel like a disappointing loss.
~~~
pembrook
> _I try to avoid advertising as much as possible, and it 's sad that they are
> one more place it's invading._
It's unfortunate that internet people have been falsely conditioned to believe
the people who create the media we consume shouldn't be paid.
Oh, but you will gladly pay for quality, ad-free content, you say?
Unfortunately, based on the numbers I've seen at media companies I've
freelanced for, this only works out for a tiny minority of creators. Unless
you are the NYT (housing 1000+ journalists) or Ben Thompson (an outlier with a
super high income audience), the number of listeners/readers/etc willing to
pay is astonishingly low.
When people say they will pay in surveys, most of them are flat out _lying._
Here's a recent example:
[https://tim.blog/2019/07/11/why-im-stopping-the-fan-
supporte...](https://tim.blog/2019/07/11/why-im-stopping-the-fan-supported-
podcast-experiment/)
It turns out, a vast majority of people who complain about ads will not put
their money where their mouth is.
I say bravo to NPR for looking out for the sustainability of their excellent
work. I happily listen to ads to sustain their content. I have full confidence
they will continue to report with the same independence they've always had.
~~~
Dylan16807
> It turns out, a vast majority of people who complain about ads will not put
> their money where their mouth is.
Not quite.
If the baseline is that ads can provide enough revenue, and you're
specifically paying to remove the ads, then that's a much smaller number. He
has what, two ad slots, repeated at start and end? If that's $30 CPM at two
per week, that's 26 cents a month.
The minimum subscription was $9.95 a month.
As somewhat of a tangent, I would like a way to pay $5 a month in a single
spot and have it be apportioned to all the podcasts I listened to in that
time, but that doesn't really exist as a service. Even though that's _much_
more money than my listens are worth in ad revenue.
~~~
NickNameNick
I think your tangent is describing youtube red. Assuming all your favorite
podcasts are also on youtube.
~~~
Dylan16807
Yeah, if they were on youtube. Youtube red is a good model, and there's a
reason I've complained in the past about how the very broken 'google
contributor' should just copy it.
------
nashashmi
I used to love NPR but then I realized their content is exclusively liberal.
Now I am disgusted by how partison they are. It's like if you listen to the
news you don't get a fair report on things but a one sided view, mainly those
who suffer under conservative government.
~~~
nabla9
It can be argued that large majority of Americans have liberal values. Many of
them have non-liberal identity that makes them think they are non-liberal.
For example:
61 percent of Americans, 42 percent of Republicans, approve of labor unions
66 percent of Americans think money and wealth should be distributed more
evenly.
80 percent of Americans think some corporations don’t pay their fair share of
taxes.
78 percent think some wealthy people don’t pay their fair share of taxes.
76 percent believe the wealthiest Americans should pay higher taxes.
60 percent of registered voters believe corporations pay too little in taxes.
87 percent of Americans say it is critical to preserve Social Security, even
if it means increasing Social Security taxes paid by wealthy Americans.
67 percent of Americans support lifting the cap to require higher-income
workers to pay Social Security taxes on all of their wages.
[https://prospect.org/power/americans-liberal-even-
know/](https://prospect.org/power/americans-liberal-even-know/)
~~~
yostrovs
Amazingly, when voting time comes, the country tends to appear center right.
Could there polls be wrong?
~~~
scarface74
No the polls are correct. Many people’s overriding concerns don’t show up in
any of the parent poster’s numbers. Poll after poll shows the majority of
Republican voters concerns are for more “cultural” than economic. Especially
when you take into account how electoral votes are distributed.
------
xref
If you want a contrary take on NPR and particularly how their political
coverage is awful, Erik Loomis, a professor of union labor history and about
as far left as you can get, has a number of articles on how NPR fails the
national discussion
[http://www.lawyersgunsmoneyblog.com/2019/07/our-worthless-
me...](http://www.lawyersgunsmoneyblog.com/2019/07/our-worthless-media)
~~~
viburnum
I think the main problem with NPR news is they always play dumb. If somebody
tells them "2+2=5," they just repeat it, if even it's been proven a lie, even
if they've been saying the same lie for 30 years. It's not objectivity, it's
just enabling liars.
~~~
colordrops
Yes. Recently they've been corrolating the deaths from bootleg THC cartridges
with the banning of flavored nicotine vapes, which is nonsensical but they've
parroted it multiple days in a row. There's clearly a propaganda campaign
against vaping by big tobacco, with anti-vaping ads everywhere, Trump speaking
about it, etc. they are playing along.
~~~
rwmurrayVT
Big tobacco owns a hefty minority share of the major nicotine vape companies.
~~~
fkdo
They could just be hedging their bets.
------
GWSchulz
Listening to NPR with my dad on the weekends growing up in Tulsa was my
favorite thing on the planet and basically the reason I wanted to become a
journalist.
But like everything else in digital disruption that seeks to “make the world a
better place,” there are unintended consequences.
NPR’s immense success with podcasting could come at the expense of local
public radio affiliates around the country. They pay great sums of your
donated dollars to NPR (and American Public Media and Public Radio
International and BBC, etc — NPR is sort of the Kleenex of public radio in the
United States) for the rights to shows a whole lot of Americans still listen
to the ol’ fashioned way in their cars or at work over the air.
Eventually we’ll listen to only streamed or internet-based content, I’m
assuming. So the question is what happens to the affiliates most people are
far less familiar with than the NPR brand?
(“I heard it on NPR.” You technically heard it on KQED, or KUT, or WGBH, or
whatever.)
One suggestion for their future is to take advantage of the strong community
trust and ties many of them enjoy and beef up local coverage where newspapers
are fading away. Stream the content and broadcast it over the air.
Share resources between stations like several have done in Texas for the
morning program Texas Standard. There are numerous stations in other states
doing this or attempting to do it. And of course, be savvy with social, and
even consider experimenting with targeted ads and paid (or donated) search.
Support these efforts, or better yet, join them. Digital affords an enormous
amount of local potential with a relatively small team and budget where
newspapers traditionally faced gargantuan printing and operational costs.
~~~
war1025
As far as I can tell, IPR (Iowa Public Radio) is doing basically exactly what
you are suggesting. Their big thing during pledge drives is that they are
currently growing their team rather than cutting back like traditional news
media.
I think IPR used to maybe be several different stations that conglomerated a
decade or so ago. Not sure.
------
duxup
NPR is such a national treasure.
Here in Minnesota, Minnesota Public Radio is one of the few places that does
detailed stories on rural area outside the cities.
~~~
TylerE
That's MPR, not NPR. NPR is basically just a content provider, much like when
you read a national AP story in your local paper.
~~~
war1025
Isn't that like saying that CBS is a content provider? Obviously the big
parent company is the one providing content for the local stations.
~~~
wahern
NPR isn't the only content provider. There's also Public Radio International
(PRI) and American Public Media (APM), both of which were apparently founded
by several public radio stations. And many public radio stations produce and
syndicate their own shows independently.
Suffice it to say, NPR doesn't own any of these companies or stations.
~~~
dredmorbius
Just to fill out the confusion roster, there's CPB, NPR, APR, PRI, and PRX, at
least:
CPB: Corporation for Public Broadcasting.
NPR: National Public Radio.
APM: American Public Media.
PRI: Public Radio International.
PRX: Public Radio Exchange.
I won't go into histories and distinctions, but those are the major
organisations within the US.
------
glenvdb
I've been thinking for a while that the podcasting business is ripe for
disruption in terms for revenue models.
From my understanding, podcast creators have to track down and get potential
sponsors to sign on (if you're lucky and already have a big audience maybe
they come to you). Then you splice in the audio of their ad into your podcast.
Whereas I've thought that an easier model for everyone would be to have an ad
service that automatically serves ads into your podcast. Similar to how web
site advertising currently works. As a creator you simply tag locations in
your podcast where you want ads to appear and the duration of the ads. You
also give the ad service a set of key words it uses to serve the most relevant
ads to listeners. No chasing money and negotiating payments. Just sign up to
the service, tag the audio stream, and provide relevant keywords.
An argument against this way of using ads in podcasts is that you lose control
over the content and quality of the ads. I think we've all seen the broad
range of quality in ads seen on websites...
The other revenue model is a packaged subscription model through some kind of
syndicate. It's difficult to get people to pay for a single podcast, but if
you packaged up a few under a small monthly fee maybe keen podcast listeners
would be more willing to pay. Could be a good way to capture people who want
an ad free experience, but don't want to pay for each podcast individually.
Perhaps I'm not aware and these models have been tried already?
~~~
masklinn
> I've been thinking for a while that the podcasting business is ripe for
> disruption in terms for revenue models.
Don't worry, your widely known ideas for making podcasts bad have already been
considered and implemented.
> Perhaps I'm not aware and these models have been tried already?
Yes. The former is DI / DAI through podcasting platforms (rather than the more
artisanal and self-hosed podcasts, whether it's baked-in or DI). The latter is
subscription platforms like Acast Access, Spotify (which bought several
podcasting studios like Gimlet and Parcast) or Luminary, or "premium podcasts"
features (with either subs or one-off buys).
~~~
glenvdb
Spotify bought Gimlet? Wow. I haven't listened to podcasts for a while. Sounds
like a lot has changed.
~~~
scarface74
Gimlet has become NPR lite. Overly scripted, no spontaneity and everything is
over produced.
------
domenicd
I really wish there was some option to pay for ad-free NPR podcasts. I do this
with a few others via Patreon, but some quick Googling didn't find anything
similar for NPR.
~~~
rc_kas
I'd do this for my fav podcasts.
------
diafygi
I have mixed feelings about this, since on several NPR podcasts Exxon has
sponsored and advertised their carbon capture investment, despite it being a
greenwashing campaign that comprises such a tiny percent of their overall new
investment.
How can NPR not ultimately be captured by corporate interests with for-profit
sponsorships?
~~~
alrs
Because it's already a state-media propaganda apparatus?
[https://en.wikipedia.org/wiki/Psychological_operations_(Unit...](https://en.wikipedia.org/wiki/Psychological_operations_\(United_States\)#CNN_and_NPR_interns_incident)
~~~
gbrown
NPR is not perfect - in particular, I have some issues with the artifical
equivalency between our two major parties implied by NPR interview programs.
With that being said, your claim is 100% complete and utter bullshit,
unsupported by even your own source.
~~~
sidlls
Claiming they're a PYSOPS unit is overcomplicating the matter. NPR basically
practices access journalism
([https://en.wikipedia.org/wiki/Access_journalism](https://en.wikipedia.org/wiki/Access_journalism))
and claims not to.
~~~
crispyambulance
Access journalism ??
Oh, you mean Terry Gross' excellent and astonishingly comprehensive interviews
with virtually all movers and shakers of the last 3-4 decades?
That's what I like about NPR the most. Prairie home companion, wait-wait don't
tell me... BORING. it's time to change the station.
~~~
alrs
Terry Gross' excellent and astonishingly comprehensive interview of each and
every member of the E Street Band.
------
dest
Shameless plug: I built adblock radio, for radio and podcast ads
[https://github.com/adblockradio/adblockradio](https://github.com/adblockradio/adblockradio)
Support is mainly for radio streams though, more work is needed to make it
work on podcasts.
------
dgaudet
this pleases me in so many ways.
as a former public radio listener, who grew increasingly tired of finding
something else to listen to during the all-too-regular fund drives, i very
much appreciate the ability to skip forward on podcasts.
i'm also happier paying for good audio content than i am willing to pay for a
dozen different news site subscriptions. my regular day is full of visual-
attention-required tasks, and having an audio-only source of information and
entertainment is worth paying for.
it's nice to know that it appears to be a successful business model for NPR.
~~~
gbrown
They've experimented with "silent" fund drives lately in Iowa, where if they
raise a target amount then the full fund drive is skipped. I like that a lot,
as well as the fact that their programs are all podcasted.
~~~
war1025
I find the silent drive to be soooo painful. It's the most passive aggressive
form of fundraising. I think they've gotten better at it the last couple times
around, but the first one was rough.
"We're just going to keep this silent drive going until we get the money!" ...
A month later "Come on people, going to have to do a real pledge drive since
no one is paying up..."
------
DoofusOfDeath
One beef I have with NPR podcasts is that they often crank up the loudness of
the ads way higher than the rest of the podcast.
When I already have the volume adjusted so I can hear the podcast over local
background noise, the commercials are genuinely painful. Especially when I'm
wearing earbuds and can't instantly lower the volume.
I'm sure they have reasons, but it really pisses me off.
------
countryqt30
I love NPR since I was a little kid. High quality information, also and
especially on financial topics.
[GERMAN] I also love listening to the German counterpart of NPR/ SeekingAlpha
> AlleAktien.de ( [https://www.alleaktien.de](https://www.alleaktien.de) )
|
Facebook App Devs Can See Your Private Parts
Facebook has insisted its members review their privacy settings to control what other Facebook members can see about them. However, the site has done little to address the issue of privacy in terms of what Facebook application developers can know. In fact, one option that allowed users to not share info with app devs seems to have disappeared.
By Renay San Miguel
12/10/09 12:04 PM PT
You may have taken time out from playing "Mafia Wars," "FarmVille" or answering that "Which Muppet Are You?" quiz to update your privacy settings on Facebook this week. However, when you were clicking on your choices for who could see your updates and personal data, did you happen to notice any mention of those third-party applications involving games, quizzes and other outside software linking up to the world's largest social media network? How much access to your personal info do the developers of these apps have?
"This is the big, looming privacy issue that most users still don't know about," Marc Rotenberg, executive director of the Electronic Privacy Information Center, told TechNewsWorld. "Most folks are good about making decisions about information they disclose on their Wall. They have some reasonable understanding about who's going to have access to it. But that whole approach breaks down with third-party apps."
Indeed, while the way Facebook allows those outside developers to have users' data got the company in trouble this summer with the Canadian Privacy Commission, there's very little mention in this current privacy push of third-party apps. A Wednesday post on the Facebook Blog addresses applications, but only in regard to Wall posts. "There's been some confusion about whether you can still limit access to Wall posts from friends and applications. The answer is yes," the post reads. "You can also control whether applications you use can post stories to your Wall on the Applications Settings page. Just click 'Edit Settings' next to an application's name and choose the settings that are right for you."
Application Anxiety
Those settings, however, still rely on the same categories as other privacy settings: Everyone, Friends of Friends, etc. There has been no direct discussion on the Facebook blog or in the three-step process that users have faced this week with regard to their settings.
This apparent lack of detail is a point addressed by the Electronic Frontier Foundation's Kevin Bankston in a Dec. 9 post on the EFF's site titled "Facebook's New Privacy Changes: The Good, the Bad and the Ugly." The network's third-party app strategy falls under the "ugly" part of the post.
"Facebook previously offered a solution to users who didn't want their info being shared with app developers over the Facebook Platform every time one of their friends added an app: Users could select a privacy option telling Facebook to 'not share any information about me through the Facebook API,'" Bankston's post reads.
"That option has disappeared, and now apps can get all of your 'publicly available information' whenever a friend of yours adds an app," it continues.
"Most people don't know that their entire profile -- and all this stuff that their friends have posted, and their friendships -- gets pushed off to the app developers," Rotenberg said. "And all Facebook does is give you a little screen that says this is necessary. They make it sound like if you don't let them do it, you're not going to get to use that program."
Facebook did not respond for a request for comment by press time.
Possible Security Solutions
Facebook should be much more open about what info is given to third-party developers, according to both Bankston and Rotenberg. Instead of removing the "do not share" option for apps, Facebook should have made it bigger and publicized it better, Bankston argued.
"Instead, the company has sent a clear message: If you don't want to share your personal data with hundreds or even thousands of nameless, faceless Facebook app developers -- some of whom are obviously far from honest -- then you shouldn't use Facebook," he wrote.
"We've made several specific recommendations. They need to be more open about what's really going on with third-party apps," Rotenberg said. "They need to show users specifically the information that flows when users choose an app. Ironically, there's a Facebook app that does that. You can install an app to see the problems with apps."
Facebook also should take responsibility for limiting that data, making less access the default option for its relationship with developers, Rotenberg said. He's not referring to some of the raw demographic data available to advertisers; most of that is faceless, nameless age and gender information.
"We're a little less critical about that," he said. "Advertisers want to be able to target demographics. We're talking about when Facebook says, 'This user wants to use your program, here's everything that they have.'" |
Q:
How to RETRIEVE a cookie in coldfusion?
The Situation:
I know how to set a cookie like this:
<cfcookie name="firstName" expires="never" value="#url.firstName#">
The Question:
Using coldfusion, how can I RETRIEVE the value of this cookie later? Saw many resources online about setting but nothing useful about retrieving.
A:
You would use the cookie scope like this:
<cfoutput>#cookie.firstName#</cfoutput>
More information on scopes is at http://livedocs.adobe.com/coldfusion/8/htmldocs/help.html?content=Variables_30.html
|
1. Field of the Invention
The present invention relates to a server and client system, which selects only one object from multiple objects.
2. Description of the Background Art
In this specification and drawings, the background data, the foreground data and the mask data are also respectively referred to in abbreviated form as the background, the foreground and the mask.
Generally, a document is made up of a mixture of characters, lines and images. Recently, in order to efficiently encode such a mixed document, a technique has been proposed to decompose the document (original image data) into background data, and one or a plurality of pairs of foreground data and mask data, and to independently encode these data.
For example, according to the Mixed Raster Content (MRC), the original image data is decomposed into the foreground data that is the color information of the characters, the mask data that is the character region information, and the background data that is the image information. The background data, the foreground data and the mask data are independently encoded. When reproducing the original image data, the foreground data or the background data is selected according to the mask data for each pixel. It is also possible to decompose the original image data into the background data and two or more pairs of the foreground data and the mask data, and to encode each of these data.
Since the recent proposal of the new encoding technique JPEG2000, the JPM (JPEG2000 Multi Layer) has been proposed to select the JPEG2000 for the compression technique that is to be used for the foreground data, the mask data and the background data of the MRC model. In addition, the JPIP (JPEG2000 Interactive Protocol) has been proposed to encode, transmit and receive only the codes of the desired region within the image that has been encoded by the JPEG2000 in a network environment. A brief description will be given with respect to such proposed techniques.
First, a description will be given of the JPM. According to the JPM, the original image data is decomposed into one background data (Base Page), and one or a plurality of layout objects that are called “pairs of foreground data and mask data”. The background data of the JPM is treated as an initial page in which the layout object is plotted. The background data, the foreground data and the mask data are independently encoded, and the JPEG2000 can be selected as the encoding technique.
For example, when reproducing the original image data that has been decomposed into the background data, and the pair of foreground data and mask data, the original image data is formed from the foreground data and the background data according to the mask data. In this particular example, the background data that is formed becomes the reproduced image data. The original image can be reproduced by repeating a similar image combining procedure, even if the pairs of foreground data and mask data increase.
As a method of combining the background data and the foreground data, it is possible to employ a method (i) that selects the foreground data or the background data for each pixel or, a method (ii) that obtains a weighted average of the foreground data and the background data for each pixel.
According to the method (i), the mask data may be binary data, and the foreground data may be selected at the pixel position where the value of the mask data is “1”, while the background data may be selected at the pixel position where the value of the mask data is “0”. According to the method (ii), the mask data may be a positive 8-bit value, and the weighted average of the foreground data and the background data may be obtained for each pixel. In other words, the pixel value of the combined image may be calculated from (combined image)={(mask value)/255)}×(foreground)+[{255−(mask value)}/255]×(background). One of the methods (i) and (ii) to be employed can be specified for each pair of the foreground data and the mask data, and the method is specified in a header for each pair. The header will be described later in the specification.
The JPIP (JPEG2000 Interactive Protocol) is a forwarding protocol of a code data of the JPEG2000 in server client environment. The JPIP can access a JPM code data. The JPIP first outputs an image data according to user's request such as user understands an outline of an entire image. For example, an image data with a low resolution is displayed. The user watches the displayed image data, and changes the request. As a result, a code data of one particular area is read and decoded again.
A conventional technique extracts a code data from a code data composed of a multi object (JPM file) and partially transmits the JPM file.
However, the above technique needs to decode plural objects, when a system displays a low resolution image data because the code data is composed of a multi object. As a result, the system requires quite a lot of time for forwarding a code data and a decoding a code data. |
Articles life dear prudence datinga swinger
Get Dear Prudence delivered to your inbox each week; click here to sign up. Please I don't want to cut my late wife's family out of my life, and they are very happy I've found someone, but I fear an . “Am I Dating a Swinger?.
Get Dear Prudence delivered to your inbox each week; click here to sign up. Please send You two were set to go through life feeling frustrated and rejected because of a silly misunderstanding. . “Am I Dating a Swinger?.
Get Dear Prudence delivered to your inbox each week; click here to sign A few months ago, in order to spice up our sex lives, I persuaded my..
Articles life dear prudence datinga swinger - travel Seoul
Y told me X was fired from the unpaid job because of his laziness and terrible work habits. But can we put this in context, finally, and move ahead? Am I overacting to his behavior or am I right to be concerned? Discuss this column with Emily Yoffe on her Facebook page. Load Comments Powered by Livefyre. I've never in my life been attracted to an older guy before—so I don't really know what to think!
But you should try to straighten things out with. I recently learned that my mother-in-law has been taking my daughter to see Tim without my knowledge. Please send your questions for publication to prudence hapag-lloyd-line.info. Happiness truly is about an attitude of gratitude, and if you get everything you want, you won't be grateful for what you. I totally understand the appeal of a mature, dashing older man over fellow twentysomethings who are still figuring things .
Going easy: Articles life dear prudence datinga swinger
Articles life dear prudence datinga swinger
Free mature adult dating sites
671
Articles life dear prudence datinga swinger - expedition Seoul
Emily Yoffe: Good afternoon, everyone. You do not have to have long discussions about what you're eating or not eating. If he tries to pump you for where you heard about his problems or what was said, refuse to elaborate or divulge specifics. If your grandfather had been prosecuted for his crimes, owned up to them, and been punished, that would have made it easier for you to take pity on him now. I don't want to hurt my future mother-in-law, but I do want Zeke to be able to free himself from the worry of a family history that is probably not his. Am I being horrid and selfish if I encourage her to seek treatment at the facility closer to her home? |
Q:
App is ignoring my orientation when it changed
I have a problem. I solved this problem here (https://stackoverflow.com/questions/34870418/app-crashes-if-the-orientation-is-changing-in-uiwebview)
But now my app is ignoring my orientation. If I entered the login data and the new website is loaded but the orientation is not the same the app is ignoring the new orientation.
dispatch_async(dispatch_get_main_queue(), ^{
NSNumber *value = [NSNumber alloc];
NSLog(@"Inside!");
NSLog(@"Orientation: %@", [self orientNr]);
if( [[self orientNr] isEqualToNumber:@1] ) value = [NSNumber numberWithInt:UIInterfaceOrientationUnknown];
else if( [[self orientNr] isEqualToNumber:@2] ) value = [NSNumber numberWithInt:UIInterfaceOrientationLandscapeRight];
else if( [[self orientNr] isEqualToNumber:@3] ) value = [NSNumber numberWithInt:UIInterfaceOrientationPortrait];
[[UIDevice currentDevice] setValue:value forKey:@"orientation"];
});
The app is going inside this block because I got the two logs at my console. The orientation is the correct one but it won't execute.
Why is the app ignoring my orientation? If I restart the app it's always portrait although it should be landscape.
EDIT:
In my file plist.info I have configured Supported Interface Orientation
info.plist http://fs5.directupload.net/images/160119/7g9g3e9x.png
EDIT 2:
My code looks like
dispatch_async http://fs5.directupload.net/images/160119/jhr84am4.png3
consoleLog http://fs5.directupload.net/images/160119/5w3mpbyf.png
A:
I've tested you code in a new project and it works.
Please check on your info.plist if you configured "Supported Interface orientations" entry correctly:
There's a alternate way to force the rotation:
#import <objc/message.h>
Then when you want to force landscapeLeft orientation use this:
((void (*)(UIDevice *, SEL, int))objc_msgSend)([UIDevice currentDevice],@selector(setOrientation:),UIInterfaceOrientationLandscapeLeft);
|
Q:
Grouping collections of lines into array elements by a delimiter
I am attempting to take output from a command that looks like this:
Thing ID: 1234
Object_Name = MyObject1
Object_Owner = MeMyselfAndI
Thing ID: 5678
Object_Name = MyObject2
Object_Owner = MeMyselfAndI
and throw these collections of lines into their own elements in an array like this (where the brackets delimit an element of the array):
MyArray =
[ Thing ID: 1234
Object_Name = MyObject1
Object_Owner = MeMyselfAndI ]
[ Thing ID: 5678
Object_Name = MyObject2
Object_Owner = MeMyselfAndI ]
such that retrieval of an element, like
${MyArray[0]})
would result in the following:
Thing ID: 1234
Object_Name = MyObject1
Object_Owner = MeMyselfAndI
In other words, I'd like to use "Thing ID:" as a delimiter here (of sorts), but keep it in each of the array elements. Is this possible in bash?
Thanks in advance!
A:
You can use awk to insert \0 after each block and use that output to create array:
arr=()
while IFS= read -rd '' line; do
arr+=("${line#$'\n'}")
done < <(awk -v RS= '{print $0 "\0"}' file)
Check output:
echo "${arr[0]}"
Thing ID: 1234
Object_Name = MyObject1
Object_Owner = MeMyselfAndI
echo "${arr[1]}"
Thing ID: 5678
Object_Name = MyObject2
Object_Owner = MeMyselfAndI
|
Q:
HTML CSS jQuery 2-Tier Menu Issue
So I made this super stripped down version of a html css jquery navigation menu, and given the code below, it handles submenu items as if it were the containing li. I suppose I can understand that it see the submenu ul as part of the li. The question becomes how do I separate that behavior, such that the submenu links will actually be followed and not preventDefault'ed.
<html>
<head>
<style type="text/css">
#content ul {margin:0;}
#content ul li {float:left; background:#000; list-style:none;}
#content ul li a {display:block; text-decoration:none; padding:10px 40px;}
#content ul li ul {position:absolute; padding:0;}
#content ul li ul li {float:none; background:#ccc;}
</style>
</head>
<body>
<div id="content">
<ul>
<li><a href="#">1</a></li>
<li><a href="#">2</a></li>
<li>
<a href="#">3</a>
<ul>
<li><a href="#">A</a></li>
<li><a href="#">B</a></li>
<li><a href="#">C</a></li>
<li><a href="#">D</a></li>
</ul>
</li>
<li><a href="#">4</a></li>
</ul>
</div>
</body>
</html>
<script type="text/javascript" src="https://ajax.googleapis.com/ajax/libs/jquery/1.7.0/jquery.min.js"></script>
<script type="text/javascript">
$('#content ul li').has('ul').click(function(e) {
/* code to show/hide submenus */
console.log(e);
e.preventDefault();
});
</script>
Edit: I want all the top level links and submenu links to work as normal. The only things I am trying to manipulate are the top level li's that have a submenu.
A:
If you change your initial selector so it targets the first child anchors of 'content' like this:
$('#content > ul > li > a').click(function(e) {
/* code to show/hide submenus */
console.log(e);
e.preventDefault();
});
It will work. I would recommend simply adding a css class to each anchor tag you want to bind the click event to instead. That will be much cleaner and will be less likely to break when the markup changes.
<div id="content">
<ul>
<li><a class="mainNav" href="#">1</a></li>
<li><a class="mainNav" href="#">2</a></li>
<li>
<a class="mainNav" href="#">3</a>
<ul>
<li><a href="#">A</a></li>
<li><a href="#">B</a></li>
<li><a href="#">C</a></li>
<li><a href="#">D</a></li>
</ul>
</li>
<li><a class="mainNav" href="#">4</a></li>
</ul>
</div>
and
$("#content .mainNav").click(function(e) { e.preventDefault(); });
Update
Your original answer was really close. The issue was that you were selecting all descendant li elements. I added the children selector to fix this.
$('#content ul li').has('ul').children('a').click(function(e) {
/* code to show/hide submenus */
console.log(e);
e.preventDefault();
});
|
Alerts & emails from Albert Mohler
The Re-paganization of the West: A Glimpse of the Future
“In the beginning there was the Church,” explains Carol Midgley. “And people liked to dress up in their best clothes and go there on Sundays and they praised the Lord and it was good. But it came to pass that people grew tired of the Church and they stopped going, and began to be uplifted by new things such as yoga and t’ai chi instead. And, lo, a spiritual revolution was born.”
“In the beginning there was the Church,” explains Carol Midgley. “And people liked to dress up in their best clothes and go there on Sundays and they praised the Lord and it was good. But it came to pass that people grew tired of the Church and they stopped going, and began to be uplifted by new things such as yoga and t’ai chi instead. And, lo, a spiritual revolution was born.”
Reporting in the November 4, 2004 edition of The Times of London, Midgley announced the results of a major research project conducted in Great Britain. According to the data assembled in this report, England is returning to its pagan roots.
If that seems unlikely, just consider the fact that only 7.9 percent of the British population attends church with any regularity. On the European continent, those percentages are generally much lower, with rates of churchgoing in Scandinavian nations running less than three percent.
The research was conducted by a team of British sociologists who looked at the small village of Kendal in Cumbria as a laboratory. As it happens, the statistics on religious participation in Kendal mirror almost precisely the national statistics in Great Britain. Led by sociologist Linda Woodhead and Paul Heelas, the researchers found that organized Christianity will be eclipsed by New Age spirituality within the next generation, if current trends continue. Their new book, The Spiritual Revolution, documents this incredible transformation of Great Britain–a reversion of a largely Christianized culture to its pagan roots.
As Midgley explains, “Study after study appears to prove that people are increasingly losing faith in the church and the Bible and turning instead to mysticism in guises ranging from astrology to reiki and holistic healing. The Government, significantly, said this week that older people should be offered t’ai chi classes on the NHS [National Health Service] to promote their physical and mental well-being.”
Professor Heelas, a well-known specialist on the New Age movement, describes the trend toward new forms of paganism as a response to larger cultural shifts. “It’s a shift away from (the idea of) a hierarchical all-knowing institution and a move towards (having) the freedom to grow and develop as a unique person rather than going to church and being led.”
Beyond this, Heelas argues that the idea of life after death is receding in the minds of most modern persons. With Heaven gone from the horizon, individuals must find full satisfaction in this life. “A lot of the comfort of religion is in postponement–a better life after death,” Heelas explains. “But belief in Heaven is collapsing, so people believe it is more important to know themselves and make themselves better people now.”
The self stands at the very center of the New Age worldview, and an unembarrassed focus on the self is the driving force behind much of the new paganism. In an earlier work, The New Age Movement, Heelas described New Age philosophies as “the celebration of the self.” Most famously, this unapologetic worship of the self was illustrated by the New Age ramblings of actress Shirley MacLaine, who simply declared: “I am God. I am God. I am God.”
This is the inevitable result of the increasingly therapeutic worldview that marks the postmodern age. In a very real sense, humanistic psychology has become for the culture the direct route to repaganization. A focus on the centrality of the self has always been essential to the framework of humanistic psychology. As expressed by Carl Rogers, among the most influential of modern psychologists, “Experience for me is the highest authority.” Of course, that experience was mediated through nothing more authoritative than himself.
Accordingly, many modern persons are, as Roy Wallis explains, “epistemological individualists,” trusting only their own individualistic concept of “truth.” As Heelas summarizes, “The New Age shows what ‘religion’ looks like when it is organized in terms of what is taken to be the authority of the Self.”
This individualistic redefinition of religion is evident in the Kendal study. Residents of Kendal revealed a weakening of commitment to traditional Christianity–especially the Church of England–and a general willingness to reconceptualize religion in terms of self-esteem. As one woman explained her discovery of the New Age movement: “A one-hour service on a Sunday? It’s not really enough time to address your self-esteem issues, is it? I didn’t find any help in the churches. I found it in a 12-step program. That was the start of my personal journey.”
Julie Wise, a 44-year-old mother of two, explained that she left the Church of England because she no longer found her childhood faith meaningful. She explained that she discovered t’ai chi while visiting the city of Manchester. “It was like divine intervention,” she related. “It was one of the most beautiful, meaningful things I had ever seen.” As the researchers now report, Julie has become “an Infinite T’ai Chi practitioner” who performs “soul readings” as a way of seeing new patterns of life and releasing new energies. As if Anglicanism was not sufficiently mired in trouble already, the researchers report that Victor de Waal, a former Dean of Canterbury Cathedral, is a regular visitor to a New Age center located in the town of Dent. “I don’t see it as an alternative; I see it as deepening one’s faith,” the former dean explained. He went on to argue that his dabbling in the New Age was in no way inconsistent with his Christian commitments, because the “spirituality” he now practiced is “not committed to a particular tradition,” but open to all.
One of the fascinating aspects of this new study is the extent to which the researchers indicate that a desire to avoid particularistic truth claims lies at the heart of New Age appeal. Elizabeth Forder, who leads the spirituality center at Dent, describes this aspect of the movement: “We are not affiliated to any religion and there is no belief system imposed on anybody here. I was brought up a Christian, but it held no real meaning for me. I would class myself as a universalist, believing that all religions offer the same end. At its simplest, meditation is giving the body and mind a very deep level of rest, freeing us to be ourselves.”
As sociologist Steve Bruce explains, the New Age worldview “solves the problem of cultural pluralism.” This new model of “spirituality” offers meaning without doctrine, transcendence without dogma, and religious experience without any particular religious commitment. In other words, it is perfectly suited for those who have been drinking deeply from the wells of postmodernism and have accepted the basic worldview of humanistic psychology.
Writing just a few years ago, William Bloom, one of the major figures behind the rise of the new spirituality in Britain, spoke of the widening popularity of New Age consciousness. “Twenty-five years ago, when I first became involved in New Age thinking, it was distinctly embarrassing to talk locally about it. It was like being a vegetarian at a rugby club dinner . . . . Twenty-five years later, the movement is growing in strength and is in many ways an established part of contemporary culture . . . . Cherie Blair wears a pendant to ward off bad vibes in her final days of pregnancy. Prince Charles talks to plants. Oprah Winfrey leads a television revolution in which anyone and everyone can talk about their innermost secrets and seek instant healing.”
Not all are going along with this, of course. Pastor Brian Maiden of Parr Street Evangelical Church in Kendal told Carol Midgley, “The people of Britain have been inoculated with a dead, mild form of Christianity, which has given them resistance to the real thing. It has been diluted with human philosophy. People want to be told what to do and how to do it. Often they don’t realize that’s what they want until they hear it.”
Responding to the self-centered worldview of New Age spirituality, Maiden corrected the misrepresentations of Christianity made by so many in the movement. “Christianity isn’t about us trying to make ourselves better people,” the pastor explained. “It is about God trying to do something for us 2,000 years ago which redeemed people.”
As for his church: “The message here is traditional Protestantism,” he retorted. “We teach the message of the Gospels and that there will be a Judgment.”
Well, hats off to Pastor Maiden, whose bold and courageous ministry offers the only ray of light found in this picture. He knows the difference between biblical Christianity and the narcissistic worldview of New Age spirituality.
Clearly, Pastor Maiden is bucking the trend even as he holds fast to the historic Christian faith. In so doing, he and his church now serve as a missionary outpost in the midst of a land quickly becoming repaganized in the early years of the twenty-first century.
The wide scale rejection of Christianity and the eager embrace of humanistic psychology and the new religion of the self marks a turning point in Western culture and serves as a wake up call to the Christian church.
We must now realize that, in this increasingly paganized age, our Christian task is to talk about God and tell persons of the redeeming work of Jesus Christ, knowing that many of these people now believe that they are gods.
Visitors to Britain love to visit Stonehenge and other ancient monuments to the nation’s pagan past. Tragically enough, the old paganisms are now resurgent, as a tepid and compromising Christianity is in retreat. Don’t think it can’t happen here.
R. Albert Mohler Jr.
I am always glad to hear from readers. Write me at mail@albertmohler.com
Dr. Mohler is the president of Southern Seminary & Boyce College.
Get Dr. Mohler’s New Book: We Cannot Be Silent
Dr. Mohler helps Christians in their understanding of the underlying issues of this significant cultural shift and how to face the challenge of believing faithfully, living faithfully, and engaging the culture faithfully in light of this massive change.
Ask Anything: Weekend Edition
Dr. Mohler answers select questions in special “Ask Anything” editions of The Briefing.
“I think the honest answer is that I loved the fantasies and I loved the revolutionary illusions. I truly loved them…. I was one of those who was way out on the far left edge of accommodating to modernity. And I don’t know how but the Holy Spirit found me.” |
There is a great difference between CHURCHIANITY and
CHRISTIANITY. Many are GOING TO CHURCH but few are GOING
DOWN THE ROAD WHICH LEADS TO LIFE (Matthew 7:13-14). Many name the Name of Christ
(2 Tim. 2:19) and claim to be Christians but few understand what a Christian
really is. Many are RELIGIOUS but few are RIGHT WITH GOD. May
God help us to understand the difference between RELIGION and true CHRISTIANITY
as set forth in the Word of God, the Holy Bible.
The following chart may be helpful:
RELIGION
CHRISTIANITY
"Salvation is something I must do. I
must somehow earn or gain salvation by the way I live."
"Salvation is something only God
can do. Salvation is of the LORD!" (Eph. 2:8-9; Jonah 2:9).
Religion is summed up in one word: DO--man
trying to DO different things to please God and earn His favor.
Christianity is summed up in one word: DONE--Christ
dying on the cross to save sinful man (John 19:30).
The religious man is busy "working"
(doing good works) in order to be saved.
The saved person is "not working"
(Rom. 4:5) but is RESTING upon the finished work of Another.
TRYING
TRUSTING (Acts 16:31)
A Work to Do which is never done (How
can anyone work well enough and hard enough to earn salvation?)
A Word to Believe (1 Pet. 1:25) about
a Work that is Done (1 Pet. 1:18-19).
CHRISTIANITY is Christ BRINGING US
TO GOD on the basis of what He did for us on the cross (1 Peter 3:18).
Religion is man trusting his own good works
(Titus 3:5).
Salvation is man trusting the good work which
the Lord Jesus did on the cross (Rom. 3:22-26).
A religious ritual
A real relationship (John 17:3)
Following rules
Enjoying life (John 6:47; 10:10).
"I must reform my life and turn over
a new leaf"
"I must be born again" (John 3:7).
Doing Something
Knowing Someone (John 17:3)
Man trying to please God in the wrong way
(Rom. 8:8--"So then they that are in the flesh cannot please God").
Man truly pleasing God in the only way (Hebrews
11:6--"But without faith it is impossible to please him: for he
that cometh to God must believe that he is, and that he is a rewarder
of them that diligently seek him").
Seeking to earn God's favor by works
Receiving God's favor by grace through faith
(Eph. 2:8 and see Eph. 1:6).
"I can work my way to heaven and earn
my salvation" (Romans 6:23 teaches that we have earned our way
to hell: "the wages of sin is death")
"I could never live well enough to earn
my way to heaven. Christ had to pay the price for my salvation (1 Cor.
6:20; 1 Pet. 1:18-19).
"I have kept the law! I have done that
which God has required" (Matthew 19:16-20).
"I have broken the law but I am trusting
the One who came into this world to save guilty lawbreakers" (1
Tim. 1:15).
A religious man trying to earn his way to
heaven by works may be likened to a man trying to swim from New York
to London by his own efforts and energy and strength. He will never
make it!
The person who is saved by faith is likened
to a man getting on a ship in New York and trusting that ship to bring
him safely to London. This man simply rests upon the ship and lets the
ship do all the work.
The religious man is seeking to establish
his own righteousness (Rom. 10:3).
The saved man is satisfied with the perfect
righteousness of Jesus Christ (2 Cor. 5:21).
Religion is pictured in Genesis 3 by the
fig leaves that Adam and Eve made for themselves--a terrible
covering (Gen. 3:7 and see Isaiah 64:6).
Salvation is pictured in Genesis 3 by the
coats of skin which God provided by way of the shedding of blood--a
perfect covering (Gen. 3:21; Rev. 19:8).
CAIN'S RELIGION--"I bring to God the
labour of my own hands" (Gen. 4:3). |
Inhibition of CYP3A, CYP1A and CYP2E1 activities by resveratrol and other non volatile red wine components.
Resveratrol (RESV), present at concentrations of about 10 microM in red wine, has been found to inhibit events associated with tumor initiation, promotion and progression. The mechanism involved could be the inhibition of activities catalyzed by cytochromes P450 (CYPs), which activate procarcinogens. This led us to investigate the inhibitory effect of RESV on CYP1A, CYP2E1 and CYP3A enzymatic activities and to compare it to that of non volatile compounds present in red wine. Red wine solids (RWS) were prepared by evaporating one volume of red wine to dryness followed by reconstitution with five volumes of buffer (20% natural strength). CYP activities were determined in microsomes from rat liver, human liver or cells containing cDNA-expressed CYPs. Testosterone, chlorzoxazone, and ethoxyresorufin were used as selective substrates for CYP3A, CYP2E1 and CYP1A1/1A2, respectively. RESV and RWS were found to be irreversible (probably mechanism-based) inhibitors for CYP3A4 and non competitive reversible inhibitors for CYP2E1. Their inhibitory potency was assessed using IC(50) values that were found within 4-150 microM for RESV and 0.3-9% natural strength for RWS. Non volatile compounds of other beverages such as white wine, grape juice or Xtra Old Cognac(R) displayed lower inhibitory effect on CYP activities than RWS. When considering the concentration of RESV in red wine (2 microM for 20% natural strength), it appears that RSW inhibitory effect was not only due to RESV, but also to other compounds whose identification would prove to be worthwhile because of their possible chemopreventive properties. |
Q:
Crash report. Cycles shader graph connect: can only connect closure to closure
My Blender model keeps crashing and I don't really know why when I render it get to between 80% and 95% on updating BVH and just flat out crashes. I am using cycles with 2.78c
Crash report-Cycles shader graph connect: can only connect closure to closure (Bump.Normal to Add Shader.Closure2).
Cycles shader graph connect: can only connect closure to closure (Bump.Normal to Add Shader.Closure2).
Malloc returns null: len=16 in Cycles Alloc, total 2348295728
Malloc returns null: len=8 in Cycles Alloc, total 2348295664
Malloc returns null: len=8 in Cycles Alloc, total 2348295672
Error: Unrecognized Exception
Error: Unrecognized Exception
Anyone Got Any idea this is all I got from the command prompt thing.
A:
If the crash is reporting an issue with shaders then investigate into how the materials are created. Are you connecting a bump map to an add shader node? Nodes have colors that determine what kind of information should be plugged: purple should connect to purple, yellow with yellow and grey with grey... A green input is expecting a green output.
Read: What is the meaning of the color of the node sockets in the node editor?
|
Q:
Issues continuing a dialog created proactively
I have been able to start a dialog proactively with an adaptive card using the code below.
[HttpGet]
[Route("proactivetest")]
public async Task ProactiveTest()
{
try
{
await _frameworkAdapter.CreateConversationAsync(
TeamsChannelId,
ServiceUrl,
new MicrosoftAppCredentials(MicrosoftAppId, MicrosoftAppPassword),
new ConversationParameters(true, null, null, string.Empty,
new Activity(
type: ActivityTypes.Message,
text: "test",
serviceUrl: ServiceUrl,
channelId: TeamsChannelId
),
new Dictionary<string, string> { ["teamsChannelId"] = TeamsChannelId }),
Callback, default);
}
catch(Exception Ex)
{
Console.WriteLine($"Exception: {Ex.Message}");
}
}
public async Task Callback(ITurnContext turnContext, CancellationToken cancellationToken)
{
DialogContext dialogContext = await _DialogSet.CreateContextAsync(turnContext, cancellationToken);
await dialogContext.BeginDialogAsync(nameof(AdaptiveCardTests), null, cancellationToken);
await _Accessors.ConversationState.SaveChangesAsync(turnContext, false, cancellationToken);
return;
}
But when replying with values in the adaptive card I am unable to continue the dialog. I have tried to Create a DialogContext from the DialogSet but it always returns DialogContext["null"] and then runs a new dialog.
protected override async Task OnMessageActivityAsync(ITurnContext<IMessageActivity> turnContext, CancellationToken cancellationToken)
{
DialogContext dialogContext = await _DialogSet.CreateContextAsync(turnContext, cancellationToken);
if (dialogContext.ActiveDialog != null)
{
await dialogContext.ContinueDialogAsync(cancellationToken);
return;
}
_Logger.LogInformation("Running dialog with Message Activity.");
await dialogContext.BeginDialogAsync(nameof(AdaptiveCardTests), null, cancellationToken);
}
If you then reply to this new dialog the above code works correctly and continues the dialog as expected.
Any assistance would be greatly appreciated.
A:
Can you please see this document for Send proactive notifications to users. Also have a look into the C# sample code for proactive message
A:
I have been able to solve this problem, the channelId parameter on BotFrameworkAdapter.CreateConversationAsync() need to be set to "msteams" and not the Teams Channel Id which I originally had this set to.
Below is the updated code that was working correctly.
[HttpGet]
[Route("proactivetest")]
public async Task ProactiveTest()
{
try
{
await _frameworkAdapter.CreateConversationAsync(
"msteams",
ServiceUrl,
new MicrosoftAppCredentials(MicrosoftAppId, MicrosoftAppPassword),
new ConversationParameters(true, new ChannelAccount($"28:{MicrosoftAppId}", BotName, null, null), null, string.Empty,
new Activity(
type: ActivityTypes.Message,
text: "test",
serviceUrl: ServiceUrl,
channelId: "msteams"
),
new Dictionary<string, string> { ["teamsChannelId"] = TeamsChannelId }),ProactiveCallback, default);
}
catch(Exception Ex)
{
Console.WriteLine($"Exception: {Ex.Message}");
}
}
public async Task ProactiveCallback(ITurnContext turnContext, CancellationToken cancellationToken)
{
DialogContext dialogContext = await _DialogSet.CreateContextAsync(turnContext, cancellationToken);
await dialogContext.BeginDialogAsync(nameof(AdaptiveCardTests), null, cancellationToken);
await _Accessors.ConversationState.SaveChangesAsync(turnContext, false, cancellationToken);
}
|
Note: Some functions of this site require your browser to support JavaScript. JavaScript is not enabled in your browser. Without JavaScript, you will not be able to use some features of this site. Either enable JavaScript in your browser or use another computer in which JavaScript is enabled.
Physiology Quiz -Skeletal Muscle Physiology - Part 3
Skeletal muscle cells are characterized by their striated appearance when visualized under the light and electron microscopes. Collectively, skeletal muscle cells make up approximately 50% of the body’s wet (i.e., soft tissue) weight. Skeletal muscle cells perform highly important functions including generating force, motion, and even heat. Test your basic knowledge of skeletal muscle physiology by taking this simple quiz.
(1) Action potentials travel along the skeletal muscle cell plasma membrane as well as along the t-tubules by saltatory conduction.
True
False
(2) The refractory period (total; absolute + relative) in a skeletal muscle cell is about:
(A) 1 ms
(B) 5 ms
(C) 10 ms
(D) 50 ms
(E) 100 ms
(3) At the neuromuscular junction (NMJ), the end-plate potential:
(A) Is at the end of the plate.
(B) Results from the activation of the nicotinic acetylcholine receptors.
(C) Results from the opening of the voltage-gated Na+ channels.
(D) Results from the opening of the voltage-gated K+ channels.
(E) All of the above.
(4) Arrival of an action potential at the axon terminal of a motor neuron causes the fusion of acetylcholine-containing synaptic vesicles with the pre-synaptic plasma membrane of the axon terminal. Acetylcholine then diffuses across the synaptic cleft to bind to and activate nicotinic acetylcholine receptors. Activation of the nicotinic acetylcholine receptors leads to an initial depolarization before a skeletal muscle action potential is initiated. The initial depolarization of the skeletal muscle plasma membrane at the neuromuscular junction (NMJ) is referred to as the: |
176 F.3d 441
Randall STEINKUEHLER, Petitioner-Appellee,v.Herb MESCHNER, Respondent-Appellant.
Nos. 98-2451, 98-2526.
United States Court of Appeals,Eighth Circuit.
Submitted March 8, 1999.Filed May 6, 1999.
1
Bridget Chambers, Des Moines, Iowa, argued (Thomas J. Miller and Thomas D. McGraine, on the brief), for Appellant.
2
Thomas R. Eller, Denison, Iowa, argued, for Appellee.
3
Before: RICHARD S. ARNOLD and HANSEN, Circuit Judges, and STROM,* Senior District Judge.
4
STROM, Senior District Judge.
5
Randall Steinkuehler (petitioner), an Iowa inmate, filed a petition for writ of habeas corpus pursuant to 28 U.S.C. § 2254 in the United States District Court for the Northern District of Iowa after being convicted of first degree murder in an Iowa state court. Petitioner asserted eleven separate claims for relief. The District Court granted petitioner relief on two ineffective assistance of counsel claims and denied the remaining claims. Randall N. Steinkuehler v. Meschner, No. C94-4027 DEO (N.D.Iowa May 5, 1998) (judgment). Herb Meschner, warden of the Iowa State Penitentiary, appeals that part of the judgment granting relief, claiming the trial court erred in finding that petitioner received ineffective assistance of counsel. Petitioner cross-appeals the denial of his other claims. For reasons stated below, we affirm in part, reverse in part, and remand for entry of judgment in accordance with this opinion.
I. BACKGROUND
6
The district court thoroughly set forth the factual and procedural background of this case in its decision below. See Id. (order). Briefly, the background necessary to begin our discussion is as follows. At approximately 9:30 P.M. on December 9, 1987, after a long day of consuming large amounts of alcohol, petitioner shot and killed his girlfriend's ex-husband, DeWayne Mohr, at a bar in Denison, Iowa. Less than one-half hour later, petitioner went to the Crawford County Law Enforcement Center and turned himself in. At trial, petitioner did not deny killing the victim. Rather, he alleged his level of intoxication negated the specific intent required for first-degree murder. Witnesses who either had observed the petitioner prior to or after the shooting testified regarding petitioner's level of intoxication. The jury found petitioner guilty of first-degree murder.
7
Petitioner unsuccessfully appealed his conviction, State v. Steinkuehler, No. 88-1093 (Iowa Ct.App. Nov.11, 1989), and was later denied state postconviction relief. Steinkuehler v. State, 507 N.W.2d 716 (Iowa Ct.App.1993).
II. DISCUSSION
A. Failure to Present Evidence
8
The District Court granted petitioner's first claim for habeas relief. In that claim, petitioner asserts his trial counsel provided ineffective assistance by failing to question the jailer supervisor regarding pressure placed on her by the county sheriff to alter her testimony, and by then failing to impeach the sheriff.
9
When petitioner went to the Law Enforcement Center after the shooting, he told Sharon Shields (Shields), the jailer supervisor, the police were looking for him. Shields contacted the police and, while awaiting their arrival, observed the petitioner. Prior to trial, petitioner's attorney deposed Shields. At the deposition, Shields testified petitioner appeared dazed and incoherent when he arrived at the Law Enforcement Center. She detected a strong alcohol odor and concluded he must have been intoxicated. Shields had booked petitioner into jail on three prior occasions, yet he did not recognize her. Ultimately, she concluded, based on her training and experience, petitioner was in fact drunk and testified that a statement petitioner made to a fellow employee would be thrown out of court.
10
Immediately after the deposition, Thomas Gustafson (Gustafson), the county attorney, informed Shields that Don Stehr (Stehr), the county sheriff and Shields' boss, would hear about her testimony. Later that day, Gustafson wrote Shields a letter regarding her testimony and sent a copy of the letter to Stehr. The next day, Stehr confronted Shields about the letter. Stehr told Shields he was not happy about her testimony and indicated she should have said she "forgot" when asked about seeing petitioner. Stehr told her, "he forgets in court all the time." Tr. of Hr'g on Postconviction Relief at 34; J.A. at 116. Shields immediately informed petitioner's trial counsel about Gustafson's letter and Stehr's remarks.
11
At trial, several witnesses testified regarding petitioner's condition on the night of the killing. The witnesses who observed petitioner prior to the killing, namely, his drinking associates, other bar patrons, and bar employees, all testified petitioner was drunk. Those who observed petitioner after the killing gave varying statements. The police officers that questioned petitioner at the Law Enforcement Center gave inconclusive statements, indicating they smelled alcohol on him, but did not find any chemical testing necessary. Shields indicated she thought he was drunk, while Stehr testified he determined petitioner had been drinking, but was not drunk. Notwithstanding, petitioner's trial counsel did not question either Shields or Stehr about the pressure placed on Stehr to "forget" and the sheriff's practice of forgetting unfavorable evidence. The District Court determined trial counsel's inaction constituted ineffective assistance of counsel.
12
There being no factual disputes, we review the District Court's determination de novo. United States v. Craycraft, 167 F.3d 451, 454 (8th Cir.1999); McGurk v. Stenberg, 163 F.3d 470, 473 (8th Cir.1998).1 The Sixth Amendment grants criminal defendants the right to have effective assistance of counsel. The Supreme Court in Strickland v. Washington, 466 U.S. 668, 104 S.Ct. 2052, 80 L.Ed.2d 674 (1984), set forth the now familiar standard for establishing ineffective assistance of counsel.
13
First, the defendant must show that counsel's performance was deficient. This requires showing that counsel made errors so serious that counsel was not functioning as the "counsel" guaranteed by the Sixth Amendment. Second, the defendant must show that the deficient performance prejudiced the defense. This requires showing that counsel's errors were so serious as to deprive the defendant of a fair trial, a trial whose result is reliable.
14
Id. at 687. Counsel's performance was deficient if it "fell below an objective standard of reasonableness." Id. at 688. Our review of a counsel's performance is "highly deferential." Id. at 689. Prejudice is established if there is "a reasonable probability that," but for counsel's errors, "the result would have been different." Id. at 694. Both deficient performance and resulting prejudice must be established to satisfy the Strickland standard. Id. at 697.
15
We agree with the District Court's reasoning and determination that trial counsel's performance was deficient. By not denying shooting Mohr, petitioner's primary defense was his intoxication. Trial counsel did elicit strong evidence from the individuals who observed petitioner prior to the shooting. However, the last point in time any of these lay witnesses observed petitioner was one and one-half hours before the shooting. The law enforcement personnel, on the other hand, saw petitioner beginning approximately one-half hour after the shooting. A jury could reasonably conclude petitioner sobered up during the one and one-half hours before the shooting. Thus, the testimony of law enforcement personnel was especially critical.
16
The only law enforcement officers to offer an actual opinion as to petitioner's intoxication level were Shields and Stehr, and their testimony was in direct conflict. Thus, the relative credibility of Stehr and Shields was pivotal to petitioner's defense. As the District Court noted, at this point, "[t]rial counsel had in his hands material for a devastating cross-examination of Sheriff Stehr on critical issues in the case, Steinkuehler's level of intoxication and the Sheriffs policy of forgetting things that would help a defendant." Order at 36-7. Stehr's "routine forgetfulness" clearly impacted his credibility. It evidenced a willingness by the only law enforcement officer who testified petitioner was not drunk to do whatever was necessary to get a conviction.
17
Appellant argues trial counsel's decision not to develop any testimony in this area was a strategic choice within the reasonable professional judgment allowed under Strickland. At petitioner's postconviction hearing, trial counsel could not recall why he did not pursue this area, and only speculated as to what he may have been thinking. While we are aware our review of counsel's performance is highly deferential, "[i]t borders on the inconceivable that a trial attorney would fail to inform a jury of Sheriff Stehr's dishonesty and win at all costs attitude." Order at 37.
18
We also agree with the District Court's determination that trial counsel's deficient performance prejudiced petitioner. Petitioner faced a first-degree murder conviction unless he could convince the jury he was intoxicated. The testimony of Stehr and Shields on that issue was contradictory. Destroying Stehr's credibility would have placed into question the veracity of the only opinion that petitioner was not intoxicated. Appellant asserts attacking Stehr's testimony would not have affected the jury because other law enforcement officers' testimony was actually more persuasive than Stehr's. App.Br. at 14. However, the testimony appellant refers to consists of inconsistent statements of petitioner's intoxication level, mere observations of petitioner's condition, and a refusal to speculate as to whether petitioner was intoxicated. Thus, as the District Court correctly concluded, petitioner's conviction of first-degree murder primarily rested on Stehr's testimony that petitioner was not drunk. Presenting evidence of the county attorney's letter and the sheriff's ensuing remarks would have certainly provided the jury with a basis for reasonable doubt. We therefore conclude a reasonable probability exists that the result of petitioner's first-degree murder conviction would have been different if trial counsel would have presented evidence of the county attorney's letter and the sheriff's subsequent statements.2 Petitioner was denied his Sixth Amendment right to effective assistance of counsel.
B. Confessions Instruction
19
The District Court also found trial counsel was ineffective for failing to request a jury instruction regarding confessions. At trial, a law enforcement officer testified petitioner, shortly after turning himself in, voluntarily stated, "I am a jealous son of a bitch." J.A. 37. The pattern Iowa Criminal Jury Instructions include a confessions instruction.3 Trial counsel did not request the instruction be given. Petitioner argues the instruction was necessary to guide the jury as to the statement's proper weight and credibility given petitioner's level of intoxication. The District Court agreed, finding the statement was an indirect confession and the only direct evidence of petitioner's motive. We again review the District Court's decision de novo, applying the Strickland standard.
20
At the postconviction hearing, trial counsel testified he did not request the cautionary instruction because he did not believe petitioner's statement was a confession. Using the instruction would have drawn attention to the statement and characterized it as a confession. Finally, trial counsel believed there were enough other instructions on intoxication for the jury to consider in evaluating the statement.
21
Whether trial counsel was legally correct or not, we find he was justified in believing the statement was not a confession. Petitioner did not expressly admit anything other than being a jealous person and clearly did not admit to all of the elements of the crime of first-degree murder. Under Iowa law, "[a] confession is an acknowledgment in express terms by a party in a criminal case of guilt of the crime charged." State v. Schomaker, 303 N.W.2d 129, 130 (Iowa 1981). A confession, unlike an admission, refers to acknowledgment of all the essential elements of the crime charged. State v. Capper, 539 N.W.2d 361, 364 (Iowa 1995); State v. Saltzman, 241 Iowa 1373, 44 N.W.2d 24, 26 (Iowa.1950). "Whereas, an 'admission' relates only to a particular fact or circumstance covered thereby." State v. Davis, 212 Iowa 131, 235 N.W. 759, 761 (Iowa 1931). Including the instruction would have indicated to the jury that petitioner's statement was in fact a confession. Furthermore, there was other evidence at trial that petitioner and the victim had several previous run-ins, including a discussion about petitioner's girlfriend only hours before the shooting. Characterizing petitioner's jealousy statement as a confession would have allowed the jury to reasonably infer that petitioner may have been meditating about the killing well before the time of the shooting. Such inference would be inimical to petitioner's intoxication defense. In light of these factors, we believe trial counsel's decision was a permissible tactical decision falling "within the wide range of reasonable professional assistance." See Strickland, 466 U.S. at 689. There being no deficiency, we do not need to consider if defendant was prejudiced. Id.
C. Other Claims
22
Finally, petitioner appeals the District Court's denial of his nine additional claims for habeas relief. Having carefully reviewed the record and the parties' briefs, we affirm dismissal of petitioner's remaining claims for the reasons stated by the District Court. See 8th Cir.R. 47B.
D. Relief
23
The District Court's order granting petitioner habeas relief provided the State of Iowa with the option of re-trying petitioner for murder or releasing him. The habeas relief granted herein relates solely to petitioner's intoxication defense. Under Iowa law, voluntary intoxication is not a defense to a crime, but it may negate the specific intent required for first degree murder. See State v. Caldwell, 385 N.W.2d 553 (Iowa 1986). However, voluntary intoxication does not affect the lesser included offense of second-degree murder because second-degree murder does not require the specific intent potentially negated by intoxication. See State v. Hall, 214 N.W.2d 205 (Iowa 1974). Thus, we find the appropriate relief in this case is to remand the matter to the District Court for entry of an order granting the State of Iowa the option of retrying petitioner for first-degree murder or sentencing him for second-degree murder.
CONCLUSION
24
For the above reasons, we reverse the District Court with respect to petitioner's second claim and affirm with respect to all other claims. This matter is remanded for entry of judgment in accordance with this opinion.
*
The HONORABLE LYLE E. STROM, Senior United States District Judge for the District of Nebraska, sitting by designation
1
The substantive review standards of the Antiterrorism and Effective Death Penalty Act of 1996 do not apply to this appeal because Steinkuehler filed his habeas petition before the effective date of the Act. See Roe v. Delo, 160 F.3d 416, 418 n. 1 (8th Cir.1998) (citing Lindh v. Murphy, 521 U.S. 320, 117 S.Ct. 2059, 138 L.Ed.2d 481 (1997))
2
The District Court also determined petitioner was prejudiced because the jury was not allowed to consider the overall fairness and reliability of the entire prosecution as well as Gustafson's credibility and vindictiveness. Having already concluded prejudice exists, we need not address this issue any further
3
The cautionary instruction states:
The defendant cannot be convicted by a confession alone. There must be other evidence the defendant committed the crime.
In determining the weight and believability of the confession, you should consider:
1
Defendant's mental capacity and intelligence
2
Defendant's mental and emotional state at the time it was made
3
Whether it was knowingly and intelligently made
4
Whether the defendant understood it
5
Any other evidence relating to the confession
I.C.J.I. 200.16.
|
Introduction {#s1}
============
In an effort to restore and maintain biodiversity, the European Union has directed efforts towards the conservation of habitats and species through the designation of protected areas \[[@B1]\]. Many of these habitats are located in heterogeneous anthropogenic landscapes \[[@B2],[@B3]\] and the intended nature values often result from traditional land-use practices \[[@B4]\]. During the last decades, many of these practices have been abandoned or have been strongly modified as the result of a variety of socio-economic developments \[[@B5]\]. Current European biodiversity conservation programs in anthropogenic landscapes therefore often involve the maintenance or imitation of traditional land use practices \[[@B6]\]. Most of these programs are directed towards terrestrial landscapes, but also in standing waters traditional management practices have been lost, and restoring these may potentially contribute to local and regional biodiversity.
Although important efforts have been made for the conservation of semi-natural habitats, research on the impact of specific management practices on biodiversity is remarkably sparse \[[@B7],[@B8]\] and typically focuses on one or a very limited number of taxonomic groups \[[@B9]\], such as birds \[[@B10],[@B11]\] or butterflies \[[@B12]\]. This is surprising since the focus of conservation efforts tends to increasingly shift from single to multispecies approaches \[[@B13],[@B14]\]. Indeed, low congruency among the diversity of multiple organism groups has often been observed \[[@B15]--[@B17]\] and the use of indicator taxa is increasingly being questioned \[[@B18]--[@B20]\]. Conservation schemes should generally aim at maintaining biodiversity of a broad variety of organism groups. Furthermore, while most studies are geared at evaluating restoration measures at relatively small, local scales, conservation schemes should take a regional perspective and try to ensure the long-term maintenance of biodiversity at the landscape scale. Such aims require a profound knowledge of how different groups of organisms respond to different management regimes and which combinations of these regimes may ensure a maximization of biodiversity at larger spatial scales.
Several studies have highlighted the importance of ponds for aquatic biodiversity at regional scales \[[@B21]--[@B24]\]. Ponds often contain rare, protected and endemic species \[[@B25],[@B26]\]. In Western Europe ponds are often of anthropogenic origin \[[@B27]\] and traditional management practices, such as low-intensity fish farming, often allowed the persistence of high nature values, such as high levels of biodiversity and the occurrence of rare and endangered species. However, eutrophication and pollution combined with the abandonment or modification of management practices has resulted in a considerable decrease in habitat quality and the loss of species \[[@B28],[@B29]\]. Although important efforts to restore and maintain aquatic biodiversity have been made, evaluations on management measures have mainly focused on their effects on the physical and chemical environment or on food web structure and dynamics \[[@B30]--[@B32]\]. Studies on the impact of management practices on diversity at local and regional spatial scales remain scarce (but see [@B33]).
With this study, we aimed to investigate the impact of different management practices on biodiversity in ponds. We evaluate their effect on the diversity of multiple taxonomic groups (e.g. phytoplankton, zooplankton, several groups of macro-invertebrates, submerged and emergent macrophytes) simultaneously. To accomplish this, we surveyed a total of 39 shallow ponds, representing five major pond management types differing in fish stock management and in the frequency of pond drainage. Rather than focusing solely on the effects of management at the level of individual ponds, we also took a broader approach by evaluating the relative contribution of different management types to regional biodiversity in the studied pond network, with special attention for the occurrence of rare and endangered species.
Methods {#s2}
=======
1: Ethics statement {#s2.1}
-------------------
We sampled in accordance to the European directive 2010/63/EU and had explicit permission of respective owners (fish farmers and the Agency for Nature and Forests) to enter private property. No additional permissions were required for this study.
2: Study area {#s2.2}
-------------
This study was performed in the region called "Vijvergebied Midden-Limburg", which is situated in the North-eastern part of Belgium (50°59\'00.92″ N; 5°19\'55.85″ O and surroundings) ([Figure 1](#pone-0072538-g001){ref-type="fig"}) and is part of \"De Wijers\" area. The region comprises more than 1000 shallow ponds \[[@B34]\], many of which originated from the extraction of iron ore (between 1850 and 1900) and peat (until 1930) \[[@B35]\]. For the purpose of fish farming, additional ponds were created after 1950. The main water sources are two streamlets (Oude and Nieuwe Roosterbeek). Ponds are connected to each other by a complex network of rivulets. Fish farming, still an important local practice, has strongly intensified during the last three decades. In ponds used for intensive fish culture, the use of artificial feeds (up to 1400 kg ha^-1^) and fertilizers have resulted in a strong increase in fish biomass (up to 1200 kg ha^-1^) and habitat degradation, such as the disappearance of submerged macrophytes and the frequent occurrence of cyanobacteria blooms. Yet the pond complex is still highly reputed for its biological diversity and it is currently protected by several national and international legislations (Natura 2000 status, Birds directive \[79/409/EEC\] and Habitats directive \[92/43/ECC\]). Recently, a considerable number of ponds were acquired by the Flemish government (Agency for Nature and Forests) and are now managed for purposes of nature conservation.
{ref-type="table"} for a detailed description of each pond management type. Note that one NF-pond, situated approximately 2 kilometers east of the depicted ponds, is not drawn on the map.](pone.0072538.g001){#pone-0072538-g001}
3: Pond selection and data collection {#s2.3}
-------------------------------------
We identified five major pond management practices in the area ([Table 1](#tab1){ref-type="table"}). Two of these practices target nature conservation goals and are applied by the governmental agency responsible for the area (Agency for Nature and Forests, ANB): a small number of ponds are managed with the intention to keep them fishless (NF), while a larger set of ponds are exposed to irregular and low-intensity management (LI), the latter mainly involving occasional dry-stands (approximately every five years, but irregularly spaced in time). Two practices are commercial and performed by local fish farmers. The most common of these practices is the intensive farming of common carp *Cyprinus* *carpio* (L.) (further referred to as carp ponds, CF). Some ponds are also used for raising juvenile cyprinids, such as common carp and ide *Leuciscus* *idus* (L.) (YF). Finally, a large proportion of the ponds in the area remains unmanaged for long periods of time (NM). The management practices differ not only in fish stock management, but also in the frequency of drainage and in measures to prevent fish immigration and emigration. Carp farming ponds (CF), fishless ponds (NF) and ponds with young-of-the-year fish (YF) are drained annually during winter. Carp farming ponds are initially stocked with relatively high biomasses of common carp, often accompanied by other species, such as tench *Tinca* *tinca* (L.). Initial stocking biomasses are approximately 100 kg ha^-1^. The management of NF-ponds is entirely focused on preventing the establishment of fish populations, whereas YF-ponds are initially stocked with low densities of young-of-the-year fish. These ponds are only stocked with fish around May, allowing the development of lush emergent and submersed vegetation in the months prior to stocking. During the filling of NF- and YF-ponds, the inlets are covered with stainless steel grids (mesh size, 2mm) to prevent immigration of fish from outside the pond. Ponds with low intensity management (LI) are only occasionally drained (every three to six years); the last time these ponds were drained prior to the present study varied from two to three years. After drainage, LI-ponds were stocked with intermediate densities of pike *Esox* *lucius* (L.), roach *Rutilus* *rutilus* (L.), rudd *Scardinius* *erythrophthalmus* (L.) and tench (total fish biomass, 40 kg ha^-1^), whose population development was subsequently not controlled. Ponds without management (NM) were never stocked and are seldom or never drained. They haven't been drained in more than 10 years prior to our study. For our survey, we randomly selected replicate ponds for each management type (n = 7, except for CF where n = 11) ([Figure 1](#pone-0072538-g001){ref-type="fig"}). The ponds were surveyed either in 2006 or 2007 (2006, n = 22; 2007, n = 17), making sure that all management types were more or less equally represented in both years (2006: NF, n = 3; YF, n = 4; NM, n = 4; LI, n = 4; CF, n = 8 and 2007: NF, n = 4; YF, n = 3; NM, n = 3; LI, n = 3; CF, n = 3).
###### Description of the pond management types in the order of increasing fish biomass.
Pond Management Type Main Purpose Pond Drainage Fish Stock Management
--------------------------------------------------- ------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------ -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
No fish (NF) To create fishless ponds as nature conservation measure (mainly for amphibians). Ponds are drained annually in autumn and refilled in early spring. There is no stocking of fish and nets are placed on the inlets to prevent immigration of fish.
Commercial farming of young of the year fish (YF) The extensive rearing of young-of-the-year-fish (typically common carp and ide). Ponds are drained in autumn and refilled in spring. Nets are placed on the inlets to prevent immigration of wild fish. The ponds are stocked with fish fry in late spring when vegetation has already developed. Fish is harvested in autumn.
No management (NM) No specific purpose. No drainage for more than ten years. No fish stock management. Fish can freely move in and out the ponds via rivulets.
Low intensive management (LI) To create ponds with indigenous fish communities for nature conservation purposes. Ponds are occasional drained (approximately every five years, but irregularly spaced in time). Two or three years prior to this study, ponds were drained, refilled and initially stocked with adult rudd, tench and pike (40 kg ha^-1^). Fish can freely move in and out the ponds.
Carp farming (CF) Commercial semi-intensive farming (mainly common carp, 1000 kg ha^-1^ year^-1^). Annual or bi-annual winter drainage to harvest fish. Ponds are stocked with 100 kg ha^-1^ of fish in spring. Ponds are partly or completely covered with wire netting to minimize predation by piscivorous birds. Use of artificial feeds (ca. 1400 kg ha^-1^ year^-1^) to increase fish production.
Pond surfaces were calculated with the GIS software package ArcView GIS 3.2a (ESRI, Inc.). We measured maximum pond depths once during summer with a graduated stick at the deepest point of each pond (nearby the outlet). At the same moment, we estimated the thickness of the silt layer from the profile of sediment cores taken at 2 random chosen spots in the deeper part of the ponds. We used electrodes (WTW multiline F meter, Geotech ©) to measure pH and daytime oxygen concentration in spring (May) and summer (July). Water transparency was determined during spring and summer campaigns using a Snell tube \[[@B36]\]. Using a tube-sampler (length 1.2 m; diameter 75 mm), we took depth-integrated samples in the open water at five locations in each pond during spring (May) and summer (July). The samples were pooled and subsamples of 1 L were immediately stored on ice in the dark for further analysis of suspended solids, chlorophyll *a* and nutrient concentrations. Suspended solids were determined gravimetrically in the laboratory by filtering a known volume of pond water on pre-weighed GF/F filters (Whatmann). Chlorophyll a concentrations were measured spectrophotometrically according to Ritchie \[[@B37]\] after methanol extraction \[[@B38]\]. We measured total concentrations of nitrogen (TN) and phosphorus (TP) after alkaline persulfate digestion \[[@B39]\] on a Technicon Autoanalyzer II (Technicon, Tarrytown, New York, USA).
Fish community characteristics were determined by placing multiple (n =3-5, dependent on pond surface area) double fyke nets (length 7.7 m, mesh size 8 mm) in each pond for 24 hours. Specimens were identified, measured (fork length) and weighted. The total biomass of each species per pond was expressed as catch per unit effort (CPUE; kg per fyke net).
Zooplankton and phytoplankton communities were sampled quantitatively during summer in the littoral and pelagic zone of each pond. Using a tube sampler, we collected depth-integrated samples (25 L) at five randomly chosen locations in both mesohabitats separately. At very shallow locations we used a 5 L-beaker. Samples from both habitats were pooled together. For zooplankton samples, we filtered 40 L of this combined sample through a conical plankton net (mesh size, 64 µm). We used 250 mL from the pooled sample to characterize the phytoplankton community. Zooplankton and phytoplankton samples were preserved in formaldehyde (4%).
Cladocerans were identified to species level using Flössner \[[@B40]\] and counted. *Daphnia* *galeata* (Sars) and *D* *. longispina* (Müller) were considered as one taxon. Copepods were divided in two main groups (Cyclopoids and Calanoids) and counted. Taxon richness in zooplankton was estimated through rarefaction, with cut off values at 300 individuals using the software Primer v5 \[[@B41]\]. For the analysis of phytoplankton taxon richness, we identified 200 cells, coenobia or colonies from each sample to genus level using John et al. \[[@B42]\].
Aquatic macro-invertebrates were sampled twice a year (May and July) by intensive sweeping in the littoral zone of each pond with a D-shaped net (23 cm x 23 cm, 500 µm mesh size). The time effort of sampling was standardized to 10 minutes for each pond and the time of sampling within different mesohabitats (emergent, floating and submerged vegetation) was proportional to their relative abundance in each individual pond. Samples were fixed immediately on 70% ethanol. In the laboratory, samples were sieved over a mesh of 1 mm and all animals retained by the sieve were sorted, identified and counted using a stereomicroscope by using De Pauw and Vannevel \[[@B43]\]. Ephemeropterans, hemipterans and molluscs were identified to species level. Determination of dipterans was done up to family level. Other organisms were only sorted to higher taxomic level and counted (Acari and Hirudinaea to subclass, Trichoptera and Lepidoptera to order).
During August, we estimated the percentage of pond area covered by submerged, floating and emergent macrophytes and we inventoried the species composition of each of these vegetation types.
4: Data analysis {#s2.4}
----------------
We used non-parametric Kruskall Wallis tests to test for an effect of pond management on total fish biomass and the relative biomass of dominant fish species. Furthermore, we applied parametric one-way ANOVA analyses and Tukey post-hoc tests to compare major pond characteristics (i.e. TN, TP, suspended matter, phytoplankton chlorophyll a, oxygen saturation, water transparency, cover by submerged and emergent vegetation, pond surface, water depth, thickness of the silt layer and pH) across different pond management types. For variables that were measured twice a year (spring and summer), we used averaged values from both sampling campaigns.
Taxon richness of each of the studied organism groups was used as measure of biological diversity. We defined 'local richness' as the average number of taxa recorded for an organism group in all ponds that belong to a specific management type. 'Total richness' was calculated as the total number of taxa found for a given management type. We based this calculation on a total of five randomly selected ponds per management type to standardize for pond number. We tested for differences in local richness among management types with parametric ANOVA and applied Tukey post-hoc tests to compare pairs of management types. Similarly, we analyzed the true Shannon index for local and total diversity (calculated as the exponent of the Shannon diversity indices) in order to also incorporate the evenness component of diversity in the evaluation of pond management \[[@B44]\].
We explored associations among the taxon richness (local and total) of organism groups using Principal Component Analyses (PCA) and we applied redundancy analysis (RDA) to formally test the overall effects of management. In addition, both for local and total richness, we applied Wilcoxon signed-rank tests to explore for consistent differences among pairs of management types across organism groups.
We defined 'regional richness' of an organism group as the total number of taxa recorded in a set of 20 randomly chosen ponds equally representing the five management types (4 ponds per management type). To evaluate the unique contribution of a management type to regional richness, we simulated the percentage change in regional richness that would result from the replacement of this management type by a random mixture of ponds belonging to the other management types. In order to assess the reproducibility of the result, this procedure was repeated 100 times for each pond management type per organism group.
National Red Lists of threatened species were used to count the number of rare plant \[[@B45]\] and hemipteran \[[@B46]\] species in each management type. These counts included species listed as 'threatened', 'vulnerable', 'endangered', 'rare' and 'very rare'. For zooplankton, we counted the number of nationally rare species as listed by Louette et al. \[[@B47]\].
With the exception of pH, all variables were logarithmically transformed prior to analysis. All univariate analyses were performed in STATISTICA 9.1 (StatSoft, Inc., Tulsa, Oklahoma). We used CANOCO 4.5 \[[@B48]\] for the multivariate analyses. The significance of the RDA models was evaluated with 999 random Monte Carlo permutations \[[@B49]\]. The simulations were written and performed in R \[[@B50]\]. One pond with NF management dried out unexpectedly during the summer of 2006 and was excluded from all analyses.
Results {#s3}
=======
1: Fish community {#s3.1}
-----------------
Pond management was strongly associated with total fish biomass and fish community composition (see [Table S1](#pone.0072538.s004){ref-type="supplementary-material"}). CF-ponds were characterized by a high total fish biomass ([Figure 2 a](#pone-0072538-g002){ref-type="fig"}) compared to the other management types and their communities were mainly dominated by common carp and tench ([Figure 2 b](#pone-0072538-g002){ref-type="fig"}). Fish communities in NF-ponds were dominated by topmouth gudgeon *Pseudorasbora* *parva* (Temminck and Schlegel), while NM-ponds contained more pumpkinseed sunfish *Lepomis* *gibbosus* (L.). YF-ponds were characterized by a relatively high abundance of small sized gibel carp *Carassius* *gibelio* (Bloch) and juvenile common carp. Despite the initial stocking of LI-ponds with rudd, roach, tench and pike, fish communities in these ponds tended to be dominated by gibel carp. Over the total set of ponds, piscivorous fish were not abundant. Only two ponds contained pike (one individual caught in a NM-pond and four individuals caught in a CF-pond) and over the total set of investigated ponds only small size classes of perch *Perca* *fluviatilis* (L.) (\< 12 cm) were found. All management types were characterized by a strong proliferation of non-native fish species (60 to 80% of the total fish biomass, e.g. American brown bullhead *Ameiurus* *nebulosus* (Lesueur), common carp, gibel carp, pumpkinseed sunfish and topmouth gudgeon).
{#pone-0072538-g002}
2: Pond characteristics {#s3.2}
-----------------------
Ponds exposed to different management types strongly differed with respect to a variety of important pond characteristics ([Figure 3](#pone-0072538-g003){ref-type="fig"}, see also [Table S2](#pone.0072538.s005){ref-type="supplementary-material"}). CF-ponds deviated most from other management types by a combination of very high TP and TN levels, high concentrations of suspended matter, chlorophyll *a* and daytime oxygen, low transparency and a low cover by submerged and emergent macrophytes ([Figure 3](#pone-0072538-g003){ref-type="fig"}). Conversely, NF and YF-ponds were typically characterized by well-developed submerged vegetation and high water transparency. Similar to CF-ponds, NM and LI-ponds were relatively turbid and contained no or only poorly developed submerged macrophyte vegetations, but tended to be more similar to NF and YF-ponds than to CF-ponds for nutrient concentrations and coverage by emergent vegetation. Pond size and thickness of the silt layer were not associated with pond management type ([Figure 3](#pone-0072538-g003){ref-type="fig"}). CF-ponds, however, tended to be deeper than NF and LI-ponds.
{#pone-0072538-g003}
3: Local and total richness {#s3.3}
---------------------------
With the exception of phytoplankton, management type significantly explained a large fraction of the variation in local richness of submerged and floating vegetation (63%), emergent vegetation (50%), aquatic macro-invertebrates (59%), hemipterans (70%), molluscs (45%) and zooplankton (48%) ([Figure 4a](#pone-0072538-g004){ref-type="fig"}; [Table S3](#pone.0072538.s006){ref-type="supplementary-material"}). Except for phytoplankton, local richness was consistently lowest in CF-ponds. The number of submerged macrophyte species was very low in LI-ponds ([Figure 4 a](#pone-0072538-g004){ref-type="fig"}). Tukey-tests performed for each organism group separately lacked power to reveal other differences among management types, but Wilcoxon signed rank tests on group means revealed consistent differences among management types across organism groups ([Table S4](#pone.0072538.s007){ref-type="supplementary-material"}). Local richness in NF, YF and NM-ponds proved to be consistently higher than in LI and CF-ponds. Similar patterns were observed for the differences in total richness of the different organism groups across management types ([Figure 4 b](#pone-0072538-g004){ref-type="fig"}, see also [Table S4](#pone.0072538.s007){ref-type="supplementary-material"}). Total richness indeed showed strong correlations with mean local richness (overall correlation: r = 0.85, p \< 0.001; see also [Figure S1](#pone.0072538.s001){ref-type="supplementary-material"}), indicating a low impact of management type on beta diversity (data not shown). Very similar results were obtained for true Shannon diversity ([Figure S2](#pone.0072538.s002){ref-type="supplementary-material"} and [Table S5](#pone.0072538.s008){ref-type="supplementary-material"}).
{#pone-0072538-g004}
With the exception of phytoplankton, both local and total richness tended to be positively associated among groups ([Figure 5](#pone-0072538-g005){ref-type="fig"}). RDA-analysis showed an overall strong negative association of the richness of most organism groups with fish biomass (local richness: R^2^ = 33.1 %, F = 11.402, p = 0.001; total richness: R^2^ = 85.0 %, F = 16.994, p = 0.028) ([Figure 5](#pone-0072538-g005){ref-type="fig"}).
{#pone-0072538-g005}
4: Contribution of pond management types to regional richness {#s3.4}
-------------------------------------------------------------
Pond management types differed strongly in the degree to which they contributed with unique species to regional richness ([Table S6](#pone.0072538.s009){ref-type="supplementary-material"}). For a hypothetical region consisting of 20 ponds with each management type being equally represented by 4 ponds, [Figure 6](#pone-0072538-g006){ref-type="fig"} represents for each management type the estimated percentage of regional species loss or gain that would result from the replacement of this management type by a random selection of ponds of the other management types. Our simulations suggest that replacement of the NF management would result in a considerable reduction in the regional richness of most of the considered organism groups, especially submerged and emergent macrophytes, hemipterans, mollusks and zooplankton ([Figure 6](#pone-0072538-g006){ref-type="fig"}). Replacement of the YF management would mainly result in a reduction of the regional richness of submerged and emergent macrophytes, whereas replacement of the NM management would mainly lead to a loss of diversity in emergent macrophytes and zooplankton. CF and LI managed ponds contributed little to regional species richness. Conversely, for several organism groups replacement of these management practices would rather increase regional richness as a result of a stronger representation by other management types.
{#pone-0072538-g006}
5: Occurrence of protected or rare species {#s3.5}
------------------------------------------
Ponds exposed to different management types differed in the number of rare and threatened species they harbor ([Figure S3](#pone.0072538.s003){ref-type="supplementary-material"}). The highest number of protected species was consistently found in NF-ponds, and rare zooplankton species were only found in this management type. High numbers of rare and threatened plant species (submerged and emergent) were also found in YF-ponds. NM-ponds had relatively high numbers of threatened submerged plants. CF and LI-ponds contained no or only very low numbers of threatened species.
Discussion {#s4}
==========
A profound understanding of the relation between management practices of ecosystems and biodiversity is crucial for the planning of effective nature conservation efforts \[[@B7],[@B8]\]. Rather than being focused solely on the conservation of biodiversity in local communities, conservation ecology should be geared at maintaining biodiversity at larger spatial scale \[[@B51]\]. An understanding of the contribution of specific management practices to regional scale biodiversity is therefore pivotal. Given that the biodiversity responses of multiple organisms often tend to show low concordance \[[@B17],[@B18],[@B20]\], there is also a strong need for the simultaneous evaluation of management practices on local and regional diversity of multiple groups.
Our study shows that both the local and regional biodiversity of a broad variety of aquatic organism groups in a pond cluster are strongly determined by the way how ponds are managed. We also observed a strong concordance in the diversity response of the different organism groups to pond management, although the pattern observed for phytoplankton deviated from this general response. Management types differed in several aspects (fish stocking, biomass and composition of fish communities, frequency of pond drainage, nutrient addition through feeding), which complicated the interpretation of our results. Nevertheless, we found a strong negative association between overall community diversity in most organism groups and fish biomass. This is most clearly exemplified by the difference among the no fish (NF) and carp (CF) ponds. Although both types of ponds are drained annually during the winter, carp ponds were characterized by very high levels of nutrients, suspended matter and chlorophyll a, and by a low transparency and cover of submerged and emergent macrophytes. Local and total diversity of carp ponds were consistently low in all organism groups (except for phytoplankton) and contributed with almost no unique taxa to the regional diversity of the area. The poor ecological quality and low diversity of carp ponds is probably the result of a variety of mechanisms that act simultaneously. Through benthic foraging, large size classes of common carp and tench resuspend sediments \[[@B52],[@B53]\] and algae \[[@B54]\], and enhance water turbidity and internal eutrophication \[[@B55],[@B56]\], which ultimately result in the loss of submerged and emergent macrophytes. The concomitant loss of habitat structure and refuges combined with high predation pressure by the fish are most probably responsible for the loss of invertebrate diversity \[[@B28],[@B57],[@B58]\]. Such effects are enhanced if fish farmers add artificial food, strengthening eutrophication and associated phytoplankton blooms.
A management that was directed at maximally preventing the establishment of fish populations in the ponds (NF) yielded clear water with well-developed aquatic vegetation, with high levels of local and total richness in almost all of the investigated organism groups. NF-ponds also contained relatively high numbers of rare and protected species and our simulations suggest that omission of this management type in the area would result in a substantial reduction of the regional richness of a variety of organism groups, such as macrophytes, hemipterans, mollusks and zooplankton. The high conservation value of NF-ponds probably resulted from a combination of very low fish densities with annual drainage during winter. Periodic pond drainage can stimulate the development of submerged vegetation \[[@B59],[@B60]\] and strengthen the mechanisms that stabilize the clear water macrophyte dominated state, especially in systems that are subjected to eutrophication (cf. theory of alternative stable states \[[@B28],[@B58],[@B61],[@B62]\]:). Through increased habitat complexity, food availability and shelter for prey against predation \[[@B28],[@B61],[@B63],[@B64]\] the development of macrophyte vegetations can contribute to a higher biodiversity in other groups of aquatic biota. In addition, regular drainage stimulates the decomposition of organic matter in the sediments and promotes the establishment of typical pioneering Littoretea vegetation of which many members are considered of high conservation concern in Western Europe \[eg. *Elatine* *triandra* (Schkuhr), *Baldellia* *repens* (Lam.), *Apium* *inundatum* (L.)\] \[[@B65],[@B66]\]. Although CF-ponds are also drained annually, these ponds lacked high levels of diversity. The positive effects of drainage in these ponds are seemingly offset by their high fish biomass.
Ponds in use for the commercial farming of young-of-the-year fish (YF) were characterized by extensive macrophyte stands and a high water transparency, and contributed disproportionally to the regional richness of emergent and submerged macrophytes. Biodiversity levels for most groups in YF-ponds were consistently high. As in NF-ponds, the high ecological quality and biodiversity of YF-ponds is likely the result of a combination of annual drainage during winter and stocking of low biomasses of fish in late spring.
In the absence of any management (NM), ponds contained no or only a sparse vegetation of submerged macrophytes. The local and total diversity of most organism groups were relatively high. The absence of management is a cheap option that seems to be associated with reasonable levels of biodiversity in most groups. Despite its low short term costs, we would advise against this option for several reasons. First, the absence of submerged macrophyte vegetation is striking and is probably related to the permanency of high water levels. Fish were probably not responsible for the absence of submerged macrophytes, given the relatively low total fish biomass and dominance by small-bodied species. The absence of macrophytes results in poor habitat heterogeneity and we suspect that this would lead to an impoverishment of most of the invertebrate and zooplankton fauna on a longer term \[[@B61],[@B64]\]. Second, we expect that the absence of periodic drainage would inevitably result in the loss of the ponds due to succession and filling. We therefore do not consider zero management as a valid management option for the longer term.
Surprisingly, the ecological quality of ponds with low intensity management (LI) proved to be low. Limnological characteristics were similar for LI-ponds and ponds without management (NM), and submerged vegetation was nearly absent in both types of ponds. In addition, a considerable fraction of LI-ponds contained very high levels of suspended matter and phytoplankton chlorophyll a. Levels of taxon richness were systematically lower in the LI than in the NF, YF and NM-ponds. Most probably, this poor quality was the result of a combination of low drainage frequency combined with a high biomass of relatively large-bodied benthic fish, mostly gibel carp. The observed fish communities failed to reflect the composition of the initially stocked fish (i.e. rudd, roach, tench and pike), and tended to be higher in fish biomass than the NF and YF-ponds, probably as the result of inadequate drainage. In contrast to the NF and YF-ponds, where drainage was carefully performed and where considerable efforts were done to keep out fish from nearby rivulets, the winter drainage of LI-ponds is often carried out with less care. Some species, like gibel carp, are robust and can survive extended periods in harsh conditions in small puddles and pools \[[@B67]\]. Careful drainage may therefore be a prerequisite for any management type aiming at sustaining pond biodiversity.
Conclusion {#s5}
==========
We observed a remarkable concordance in the diversity response of organism groups to pond management types in the studied pond cluster. A management focusing on keeping ponds free of fish via repeated and carefully applied pond drainage combined with additional measures aimed at preventing fish from entering ponds through inlets appeared to be the best guarantee for high local diversity across organism groups. Such management also resulted in the strongest contribution to regional biodiversity and supported high numbers of rare and endangered species. Based on these results we conclude that such management forms an important tool for the maintenance of aquatic biodiversity in ponds and should therefore be regarded as an essential part of regional conservation plans for pond areas, at least in eutrophied regions like Flanders where fish populations often spontaneously develop to high densities. Alternative management types, such as the commercial farming of juvenile cyprinids, also resulted in good ecological quality and high levels of biodiversity, presumably due to the combination of regular periodic drainage and stocking of only a low fish biomass relatively late in the season, allowing for the development of aquatic vegetation. Although zero management is by far the cheapest non-commercial option on the short term, we do not recommend this management type because it does not support the development of submerged macrophytes vegetations. Furthermore, this management involves a serious risk of losing valuable ponds on a longer time scale due to succession and filling. Zero or low-intensity pond management is often applied by nature conservation organizations in Europe because of lack of financial resources, but involves a risk of gradual deterioration of ponds on a longer term. When strictly regulated, specific types of commercial fish farming have considerable potential to contribute to the conservation of regional nature values in semi-natural meso- to eutrophic pond clusters, especially when such activities combine regular pond drainage with low fish stock biomass and when the use of fertilizers and artificial feeds are avoided.
Supporting Information
======================
######
Association between mean local and total richness across management types for all investigated biota together (r = 0.85, p \<0.001) (a) and for organism groups separately; SUBM = submerged and floating vegetation (r = 0.99, p = 0.002) (b), EMERG = emergent vegetation (r = 0.99, p = 0.001) (c), MI = all taxa of macro-invertebrates (r = 0.91, p = 0.030) (d), HEMI = hemipterans (r = 0.96, p = 0.008) (e), MOLL = molluscs (r = 0.95, p = 0.013) (f), ZP = zooplankton (r = 0.92, p = 0.027) (g), PP = phytoplankton (r = 0.28, p = 0.65) (h).
(TIF)
######
Click here for additional data file.
######
**Box plots with the median local true Shannon diversity (a) and bar plots of total true Shannon diversity (b) for the studied organism groups in relation to pond management type.**
SUBM = submerged and floating vegetation, EMERG = emergent vegetation, MI = macro-invertebrates, HEMI = hemipterans, MOLL = molluscs, ZP = zooplankton and PP = phytoplankton. All groups are presented at the species level, except MI and PP where the number of families and number of genera are shown, respectively. Pond management types with average local diversity values that do not differ significantly from each other (Tukey HSD test, P\<0.05) are indicated by identical letters (a, b, c). Boxes represent the 25th and 75th percentile.
(TIF)
######
Click here for additional data file.
######
**The number of protected species of submerged/floating plants (SUBM), emergent plants (EMERG), aquatic macro-invertebrates (without Diptera and Molluscs), and the number of national rare zooplankton species (ZP) observed in each pond management type.**
(TIF)
######
Click here for additional data file.
######
**Results of Kruskal-Wallis analyses testing for effects of pond management type on total fish biomass and the relative biomass of the dominant fish species.**
Df = degrees of freedom, H = H-values, P = p-value.
(XLSX)
######
Click here for additional data file.
######
**Results of one-way ANOVA analyses testing for effects of pond management type on pond characteristics.**
Df = degrees of freedom, SS = Sum of Squares, MS = Mean Squares, F = F-ratio, P = p-values.
(XLSX)
######
Click here for additional data file.
######
**Results of ANOVA-analyses testing for effects of pond management type on the local richness of each of the studied organism groups.**
All groups are represented as species richness, except MI and PP where the number of families and number of genera are shown, respectively. Df = degrees of freedom, SS = Sum of Squares, MS = Mean Squares, F = F-ratio, P = p-values.
(XLSX)
######
Click here for additional data file.
######
**Results of Wilcoxon signed-rank tests testing for differences in local richness and total richness among pairs of pond management types across organism groups.**
(XLSX)
######
Click here for additional data file.
######
**Results of ANOVA-analyses testing for effects of pond management type on the true local diversity of each of the studied organism groups.**
Df = degrees of freedom, SS = Sum of Squares, MS = Mean Squares, F = F-ratio, P = p-values.
(XLSX)
######
Click here for additional data file.
######
**List of taxa uniquely found to be present in each of the management types during the course of the study.**
(XLSX)
######
Click here for additional data file.
We cordially thank the local fish farmers for allowing access to their ponds and acknowledge Dirk Ercken for his assistance with the practical work. We are grateful to Lily Gora and Tom Verschraegen from the Agency for Nature and Forests for their logistic support and additional information on the management types.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: PL JM TDB LDM SAJD. Performed the experiments: PL JM TDB JVW. Analyzed the data: PL SAJD. Contributed reagents/materials/analysis tools: SAJD LDM. Wrote the manuscript: PL JM TDB JVW LDM SAJD.
|
22 April 2017
The Peachy Pink Makeup Edit
Peachy Keen
Whether it be a glossy lip tint, a glowy coral blush, or a peachy sheen on the eye lids, I'm all for the peach trend we've been seeing makeup wise lately. Too Faced has been one of the contributors to this trend with their Sweet Peach collection, which features a highlighting palette, blush, lip glosses, and of course, the eyeshadow palette. The best thing is the entire range smells like artificial peaches. So in celebration of all things dewy, here's a makeup look I've been wearing recently.TheBalm Time Balm Face Primer
I can barely go without this primer at the moment, and this is the first step to achieving a fresh, flawless look. I find my foundation separates on the skin if I don't use this. It glides over pores and blemishes so your skin is more smooth and less bumpy.
NARS Sheer Glow
I'm certainly sounding like a broken record these days with this one, but this NARS foundation is simply the only base I use. Maybe I'm too scared to venture elsewhere, but I'm satisfied with the glowy effect it gives and it has decent coverage too.
Eye of Horus Goddess Mascara
This has been one of my favourite mascaras as of late because of its ability to curl the lashes upwards and define every lash. This one is definitely more of a lengthening mascara more than volumising, but its the perfect thing to wack on when you're having a no-makeup, makeup day.
Too Faced Sweet Peach Eyeshadow Palette
Eyeshadows and I are definitely having a moment. This palette is a welcome addition, with enough subtle pink and orange shades to shake a stick at... or an eyeshadow brush. My favourite shades include Candied Peach (pink with subtle gold shimmer), Bellini (lighter pink shimmer with a rose gold feel) and Summer Yum which is a rich orange brown. Warm toned eyeshadows - that must be where my heart lies. The palette isn't strictly peachy tones - there are some other interesting colours that stray away from everything pretty pink. While the quality of the shadows don't quite meet that of my Anastasia Beverley Hills' palette, they still have good pigment and are easy to blend.
TheBalm Hot Mama Shadow & Blush All-in-One
The perfect accompaniment to a peachy pink eye is this applied to the cheeks. It leaves behind a glowy shimmer and is the perfect peachy coral. Looking well-used and a tad worse for wear, I've had this lying around for at least a couple of years, but I'm not showing any sign of letting go. As well as a blush, like I did for this look, you can use it for eyeshadow which is a bonus.Nude by Nature Finishing Brush 05
This has been my go-to powder product brush for about a year. I doesn't pick up a load of product at once so it's hard to go overboard with this one; I like applying my powder, bronzer and/or blush with this. It's also a very soft brush which is always a good thing...
NYX Soft Matte Lip Cream in London
Another product I could enthuse about for days, and I clearly already do looking at how many times I've featured the soft matte lip creams in blog posts. Recently I've taken a shine to the London shade because it looks nice with more pared back looks. I would describe this shade as a brownish nude without being too dark - on my pale skin tone at least. As you'll probably know, these lip creams dry down to a matte but I find them not too drying and very light-feeling.
Now that I've gone on and on about my favourite glowy, peachy products plus what I've been wearing alongside them, tell me, are you a fan of the peach trend? |
β-glucan enriched bath directly stimulates the wound healing process in common carp (Cyprinus carpio L.).
Wound healing is a complex and well-organized process in which physiological factors and immune mechanisms are involved. A number of different immune modulators have been found to enhance the non-specific defence system in vertebrates, among which β-glucans are the most powerful and extensively investigated. The aim of the present study was to investigate the biological impact of two different commercially available β glucan containing products on the wound healing process in carp. Throughout a two week experiment fish were kept either untreated (control), or in water supplemented with the two different types of β-glucans. The wound healing process was monitored using a multispectral visualisation system. The correlation between wound closure and immune response was investigated by measuring the gene expression patterns of IL-1β, IL-6 family member M17, IL-8 and Muc5b, and measurement of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1β, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1β, IL-6 family member M17 and IL-8 were activated in all wounds regardless of treatment. Expression of all three interleukins was highly up regulated in control wounded muscle already at day 1 post-wounding and decreased at subsequent time-points. The reverse was the case with control wounded skin, where expression increased from day 1 through day 14. The results for the β-glucan treated wounds were more complex. The images showed significantly faster wound contraction in both treated groups compared to the control. The obtained results clearly demonstrated that a β glucan enriched bath promotes the closure of wounds in common carp and induce a local change in cytokine expression. |
Q:
TensorFlow program sometimes works, sometimes throws different errors related to reshape nodes at different points in training using same random seed
I'm having difficulty with a particularly spooky-looking TensorFlow issue. (TensorFlow 1.4.1 and Python 2.7)
Errors
I'm seeing a couple different errors when running the same program. Here is an example of one:
W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.377745: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.378256: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.378753: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.379193: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.379692: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.380208: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.380709: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.381166: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.381654: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.382138: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.382601: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.383111: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.383601: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.384107: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.384551: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018-03-15 18:52:25.384792: W tensorflow/core/framework/op_kernel.cc:1192] Invalid argument: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
2018/03/15 18:52:25 ERROR|--|Traceback (most recent call last):
File "experiment_runner.py", line 140, in experimentset
results = e.run()
File "experiment_runner.py", line 69, in run
results = run_fn()
File "experiment_runner.py", line 100, in traintest
return tt.run(self.exp_specs, self.data, model)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/experiment/train_test.py", line 149, in run
return self._fit_model(exp_specs, data, model)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/experiment/train_test.py", line 56, in _fit_model
self.train_proteins_epoch(data["train"], model, exp_specs["args"]["minibatch_size"])
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/experiment/train_test.py", line 186, in train_proteins_epoch
model.train(minibatch)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/tf_model.py", line 169, in train
results = self._train(data, options=run_options, run_metadata=run_metadata, **kwargs)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/tf_model.py", line 113, in _train
results = self.run_graph([self.train_op, self.loss], data, "train", **kwargs)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/protnet.py", line 135, in run_graph
return self.sess.run(outputs, feed_dict=feed_dict, options=options, run_metadata=run_metadata)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/client/session.py", line 889, in run
run_metadata_ptr)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/client/session.py", line 1120, in _run
feed_dict_tensor, options, run_metadata)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/client/session.py", line 1317, in _do_run
options, run_metadata)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/client/session.py", line 1336, in _do_call
raise type(e)(node_def, op, message)
InvalidArgumentError: Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
Caused by op u'optimizer/gradients/energy_2/map/while/Gather_grad/Reshape', defined at:
File "experiment_runner.py", line 332, in <module>
main()
File "experiment_runner.py", line 328, in main
e.run()
File "experiment_runner.py", line 69, in run
results = run_fn()
File "experiment_runner.py", line 140, in experimentset
results = e.run()
File "experiment_runner.py", line 69, in run
results = run_fn()
File "experiment_runner.py", line 99, in traintest
model = tt.build_model(self.exp_specs, self.data)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/experiment/train_test.py", line 141, in build_model
model = eval(hparams["name"] + "(exp_specs, data['train'])")
File "<string>", line 1, in <module>
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/protnet.py", line 110, in __init__
self.setup_loss()
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/tf_model.py", line 90, in setup_loss
self.train_op = self.hparams["optimizer"](self.loss, **self.hparams["optimizer_args"])
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/optimizers.py", line 9, in tf_sgd
return tf.train.GradientDescentOptimizer(learning_rate).minimize(loss)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/training/optimizer.py", line 343, in minimize
grad_loss=grad_loss)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/training/optimizer.py", line 414, in compute_gradients
colocate_gradients_with_ops=colocate_gradients_with_ops)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/gradients_impl.py", line 581, in gradients
grad_scope, op, func_call, lambda: grad_fn(op, *out_grads))
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/gradients_impl.py", line 353, in _MaybeCompile
return grad_fn() # Exit early
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/gradients_impl.py", line 581, in <lambda>
grad_scope, op, func_call, lambda: grad_fn(op, *out_grads))
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/array_grad.py", line 373, in _GatherGrad
values = array_ops.reshape(grad, values_shape)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/gen_array_ops.py", line 3938, in reshape
"Reshape", tensor=tensor, shape=shape, name=name)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/framework/op_def_library.py", line 787, in _apply_op_helper
op_def=op_def)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/framework/ops.py", line 2956, in create_op
op_def=op_def)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/framework/ops.py", line 1470, in __init__
self._traceback = self._graph._extract_stack() # pylint: disable=protected-access
...which was originally created as op u'energy_2/map/while/Gather', defined at:
File "experiment_runner.py", line 332, in <module>
main()
[elided 6 identical lines from previous traceback]
File "<string>", line 1, in <module>
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/protnet.py", line 77, in __init__
dtype=tf.float32, parallel_iterations=32)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/functional_ops.py", line 389, in map_fn
swap_memory=swap_memory)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/control_flow_ops.py", line 2816, in while_loop
result = loop_context.BuildLoop(cond, body, loop_vars, shape_invariants)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/control_flow_ops.py", line 2640, in BuildLoop
pred, body, original_loop_vars, loop_vars, shape_invariants)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/control_flow_ops.py", line 2590, in _BuildLoop
body_result = body(*packed_vars_for_body)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/functional_ops.py", line 379, in compute
packed_fn_values = fn(packed_values)
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/protnet.py", line 75, in <lambda>
], None, in_dims=nv, in_dists=self.in_dists, **args)[0],
File "/s/chopin/a/grad/jonbyrd/protqa/protqa/modeling/models/nn_components.py", line 447, in energy
return tf.reshape(tf.reduce_mean(tf.einsum('abi,abj->abij', (tf.expand_dims(verts, axis=1) * tf.gather(verts, hood_indices)), dists), axis=[0,1]), [in_dims*in_dists]), None
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/array_ops.py", line 2486, in gather
params, indices, validate_indices=validate_indices, name=name)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/ops/gen_array_ops.py", line 1834, in gather
validate_indices=validate_indices, name=name)
File "/s/jawar/j/nobackup/protein_learning/virtualenv/lib/python2.7/site-packages/tensorflow/python/framework/op_def_library.py", line 787, in _apply_op_helper
op_def=op_def)
InvalidArgumentError (see above for traceback): Input to reshape is a tensor with 122496 values, but the requested shape has 0
[[Node: optimizer/gradients/energy_2/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_2/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_2/map/while/Gather_grad/concat)]]
However, I'm getting several different errors. For this node in my graph:
[[Node: optimizer/gradients/energy_1/map/while/Gather_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_1/map/while/mul_grad/tuple/control_dependency_1, optimizer/gradients/energy_1/map/while/Gather_grad/concat)]]
Here are some of the errors I've seen:
Size 1 must be non-negative, not -1231271574
Size 1 must be non-negative, not -1225669337
Input to reshape is a tensor with 122496 values, but the requested shape has 0
Input to reshape is a tensor with 122496 values, but the requested shape has 1715491170492
Input to reshape is a tensor with 122496 values, but the requested shape has 1693172050944
Input to reshape is a tensor with 122496 values, but the requested shape has 1706639062128
For this node in my graph:
[[Node: optimizer/gradients/energy_1/map/while/Mean_grad/Reshape = Reshape[T=DT_FLOAT, Tshape=DT_INT32, _device="/job:localhost/replica:0/task:0/device:GPU:0"](optimizer/gradients/energy_1/map/while/TensorArrayWrite/TensorArrayWriteV3_grad/tuple/control_dependency, optimizer/gradients/energy_1/map/while/Mean_grad/DynamicStitch/_203)]]
I've seen these errors for example:
Size 0 must be non-negative, not -1237175937
Input to reshape is a tensor with 512 values, but the requested shape has 0
I also had a "Nan in summary histogram" error, but I'm going to assume that was due to model divergence.
I don't understand why I'm getting these reshape-related errors at runtime, halfway through the training process. I also don't understand why the values in these errors change each run.
Circumstances
When running the same program with the same hyperparameters on the same data with the same numpy and tensorflow random seeds, the program will sometimes run without issues, but usually throw one of these errors at different points in the training process. Sometimes this happens at the very first epoch, sometimes after many training epoch (even after 40+ epochs, shortly before the training finishes).
The strange thing is that this seems to be very dependent on the number of latent features/convolution filters in the layer before the one that throws the error. Smaller numbers of filters like 16, 32, 64, and 128 will almost always get errors related to the first computation graph node I mentioned, while a 512 filters will mostly get errors related to the second node. These hyperparameter numbers failed 7-10/10 runs.
However, running the program with that number of filters being either 1 or 1024 was successful 10/10 runs, which confuses me.
Program
The program is part of a research framework for deep learning on protein structures. The part that is giving me errors is part of a graph convolutional/message-passing network that downsamples a variable-size/shape graph to a single latent representation. The number of filters in the previous section corresponds to the number of latent features per node in the graph.
Here is the downsampling method:
def energy(input, _, in_dims, in_dists, **kwargs):
'''Params:
input: a tuple representing a single graph containing:
a 2d tensor of vertex representations(vertices x features)
a 3d tensor of distance metrics between nodes (vertices x neighbors x distances)
a 2d tensor containing indices of the neighbors of each vertex in the first tensor(vertices x neighbor indices)
in_dims: number of incoming features for each vertex
in_dists: number of distance metrics
Returns: a 1d tensor of size [in_dims*in_dists] which is the sum over all pairs of neighboring vertices of
(the outer product of (the elementwise product of the two vertices) and the distances).
'''
verts, dists, hood_indices = input
return tf.reshape(tf.reduce_mean(tf.einsum('abi,abj->abij', (tf.expand_dims(verts, axis=1) * tf.gather(verts, hood_indices)), dists), axis=[0,1]), [in_dims*in_dists]), None
Here is the map_fn where that method is called, where layer_fn is the above method:
# downsample each graph using layer_fn
input = tf.map_fn(
lambda ind, data=input[0], merge_fn=layer_fn, nv=input[0].get_shape().as_list()[-1], args=args: merge_fn(
[tf.slice(data, [tf.squeeze(tf.slice(ind, [0], [1])), 0],
[tf.squeeze(tf.slice(ind, [1], [1])), nv], name="merge_vertex_slice"),
tf.slice(self.distances, [tf.squeeze(tf.slice(ind, [0], [1])), 0, 0],
[tf.squeeze(tf.slice(ind, [1], [1])), self.in_nhood_size, self.in_dists], name="merge_distance_slice"),
tf.slice(tf.squeeze(self.in_hood_indices), [tf.squeeze(tf.slice(ind, [0], [1])), 0],
[tf.squeeze(tf.slice(ind, [1], [1])), self.in_nhood_size], name="merge_index_slice"),
], None, in_dims=nv, in_dists=self.in_dists, **args)[0],
tf.stack([tf.cumsum(self.graph_orders, exclusive=True), self.graph_orders], axis=-1),
dtype=tf.float32, parallel_iterations=32)
Stack Overflow will not allow me to post the class that builds the computation graph as it brings my post over the character limit.
The program runs without errors when using a top_k method to downsample the graph.
Confusion
I don't understand why I would get these reshape errors after successful training epochs, or why the number of filters is affecting the issue in such a way. I also don't understand why I'm getting different values in the reshape errors each time. The tensor dimensions should all be fixed except for the number of examples in a minibatch (which I handle via the map_fn) and the number of vertices in each example graph.
I'm having considerable difficulty figuring this out and would be very grateful for outside input. Thank you!
A:
My issue ended up being that I was passing indices to tf.gather() that were larger than the size of the tensor I was trying to gather from (the hood_indices within the energy function). I'm not exactly sure how that led to the errors I was seeing, but it fixed my problem.
|
= 6*b**2 - b**2 - 2*b**s. Determine j(a(r)).
12*r**2
Let y(j) = j + 136671. Let a(b) = -4*b. Give a(y(m)).
-4*m - 546684
Let j(b) = b. Suppose 3*i - 5*q - 32 = 0, -2*i - 2*q = -6*i + 24. Suppose -y + i*y - 204 = 0. Let k(m) = 9*m**2 - 68*m + y*m. Calculate j(k(h)).
9*h**2
Let r(a) be the first derivative of a**2/2 + 10. Let v(y) be the third derivative of -y**4/12 + 2*y**2 - 14*y. Give r(v(d)).
-2*d
Let c(k) = 324*k. Let d(h) = 5098*h**2. What is c(d(y))?
1651752*y**2
Let z(i) = 9*i - 98. Let g(k) = -24*k**2. Give g(z(y)).
-1944*y**2 + 42336*y - 230496
Let g(w) = -2. Let h(q) = -2*q + 12. Let i(b) = 6*g(b) + h(b). Let p(o) = -o**2 + 0*o**2 - 6*o**2. Calculate p(i(x)).
-28*x**2
Let k(r) = -19*r - 2. Let h(s) be the first derivative of s**3 + 71. Calculate h(k(q)).
1083*q**2 + 228*q + 12
Let i be 2 - (5 - 4) - 0. Let p(k) = 9*k - 1 - 5*k + i. Let r(j) = 12*j**2 - 11*j**2 - 4*j**2. Calculate p(r(s)).
-12*s**2
Let h(q) = q. Let g(s) be the third derivative of -14*s**2 + 0*s - 7/30*s**5 + 0*s**4 + 0*s**3 + 0. Determine g(h(m)).
-14*m**2
Let s(j) be the third derivative of j**5/60 - 323*j**2. Let n = 6 - 4. Let x(l) = -l**2 + 3*l**2 + l**n. Calculate x(s(g)).
3*g**4
Let c(u) be the second derivative of u**3/3 - 264*u**2 - 11*u - 15. Let t(m) = m**2. Give t(c(b)).
4*b**2 - 2112*b + 278784
Let o(b) = 8*b**2. Let h(s) = -54 + 7*s + 54 + 10*s. Calculate o(h(z)).
2312*z**2
Let p(w) = -w**2. Let c(g) be the second derivative of -35*g**4/2 + 4*g + 18. Give c(p(z)).
-210*z**4
Let a(p) = 4*p**2 - 7. Let c(f) = 16 - 40 - 2*f**2 + 16 + 11. Let l(s) = -6*a(s) - 14*c(s). Let b(i) = 11*i**2. Calculate b(l(q)).
176*q**4
Let k(f) be the second derivative of 0 + 0*f**2 - 30*f - 2/3*f**3. Let x(z) = 17*z**2. Determine k(x(i)).
-68*i**2
Let r(g) = -2*g**2 + 5*g + 5. Let q(p) = -2*p**2 + 6*p + 6. Let w(x) = 5*q(x) - 6*r(x). Let t(a) be the second derivative of a**3/3 + 30*a + 1. Give w(t(z)).
8*z**2
Let b(s) = -s**2. Suppose -5*l + 4 = -6. Suppose 8 = -5*x - l*m + 28, 21 = 3*x + 3*m. Let k(v) = 5*v**2 - 7*v**x - 2*v**2. Give k(b(n)).
-4*n**4
Let a(o) = -12*o. Let h(p) = 21986*p. Give a(h(i)).
-263832*i
Let h(z) = -18*z**2. Let y(c) = -16 + 36 - 19*c**2 + 31*c**2 - 20. Determine h(y(q)).
-2592*q**4
Let s(z) be the second derivative of -4*z + 0*z**2 + 0 - 1/3*z**3. Let h(l) = -30*l. Determine h(s(a)).
60*a
Let k(j) be the first derivative of -j**2 + 2. Let c(p) be the first derivative of -3*p**3 + 3. Determine k(c(y)).
18*y**2
Let p(x) be the second derivative of x**4/2 - x. Let z(v) be the first derivative of 3*v**2/2 + 237. Calculate z(p(g)).
18*g**2
Let m(a) = 9760*a**2 + 3. Let n(s) = -5*s. Give m(n(t)).
244000*t**2 + 3
Let j(d) = -d**2. Let y(t) = 469408*t. Determine j(y(b)).
-220343870464*b**2
Let k(j) = -j**2 - 10*j - 14. Let f be k(-7). Let n(g) = -2*g**2 + 14*g**2 + f*g**2. Let s(c) = c. What is n(s(r))?
19*r**2
Let q(g) = -g**2. Let p be (-2 - -8) + -59 + 55. Let y(o) be the first derivative of -9/2*o**p + 0*o - 3. What is q(y(j))?
-81*j**2
Let v(q) be the third derivative of q**5/12 + 250*q**2 - q. Let u(d) = -33*d**2. Give u(v(x)).
-825*x**4
Let t(y) = 26*y**2. Let p(o) = -109 + 36 + 37 + 36 + 16*o**2. Determine p(t(a)).
10816*a**4
Let c(v) = -2*v**2. Let j(h) = -648347*h. Calculate c(j(p)).
-840707664818*p**2
Let i(s) be the third derivative of 0*s + 0*s**3 - 1/4*s**5 + 0*s**4 + 14*s**2 + 0. Let o(r) = -5*r. Calculate i(o(u)).
-375*u**2
Let y(d) = 2*d**2. Let f(h) = 2*h**2. Let g(q) = -4*f(q) + 3*y(q). Let p(n) = -4*n - 652 - 636 + 1285 + 14*n. Determine g(p(l)).
-200*l**2 + 120*l - 18
Let d(b) = 11*b + 1. Let a(t) = -509*t. What is d(a(w))?
-5599*w + 1
Let t(f) be the third derivative of -f**4/12 - 3*f**2 - 64*f. Let r(c) = 74*c**2. Give t(r(a)).
-148*a**2
Let k(y) be the first derivative of y**2 - 3 + 7 - 7. Let i(t) = 3 - 3 - 2*t. Give i(k(o)).
-4*o
Suppose -4*s = -s + 27. Let n(a) = 17*a**2. Let l(x) = -4*x**2. Let q(m) = s*l(m) - 2*n(m). Let w(z) = 6*z. What is w(q(k))?
12*k**2
Let l(u) = 26*u**2. Let f(m) = 11*m**2 + 9 + 1 - 12 + 2. Determine l(f(t)).
3146*t**4
Let l(s) be the first derivative of 9*s**2/2 - 8. Let b be (-3)/(1*(-12)/8). Let h(w) = -3*w + 0*w + b*w. What is h(l(c))?
-9*c
Let n(j) = -8*j**2 - 3*j. Let x(u) = -22*u**2 - 8*u. Let k(f) = 8*n(f) - 3*x(f). Let t(a) be the third derivative of -2*a**5/5 + 3*a**2. Determine k(t(q)).
1152*q**4
Let q(i) = -26 - i + 113 - 42 - 45. Let m(k) = -k**2 + 3*k**2 - 4*k**2. Calculate m(q(a)).
-2*a**2
Let f(s) = -4*s - 403263 + 403263. Let l(v) = -v**3 + v**2 + 3. Let h be l(0). Let n(q) = -3*q + h*q - 2*q**2. Give f(n(d)).
8*d**2
Let v(r) = -8496*r. Let k(p) = 14*p**2 - 2. Calculate v(k(d)).
-118944*d**2 + 16992
Let a(w) = -215636*w - 3. Let r(k) = -2*k**2. Determine a(r(y)).
431272*y**2 - 3
Let r(n) = 37*n**2 - 384*n - 2. Let d(f) = 99*f. What is d(r(z))?
3663*z**2 - 38016*z - 198
Let v(s) be the second derivative of -s**3/3 - 14*s. Let c(j) be the second derivative of -23*j**4/6 - 10*j. Determine c(v(x)).
-184*x**2
Let d(j) = 1 - 1342*j - 1 + 1329*j. Let b(n) = 10*n - 3. What is d(b(o))?
-130*o + 39
Let r(s) = 2*s**2. Let c = 21 + -19. Let n(y) = -y**3 + 10*y**2 + y - 8. Let i be n(10). Let b(j) = -c*j + i*j + j. Calculate r(b(z)).
2*z**2
Let z(l) be the first derivative of -l**2 + 198. Let u(c) = -27*c + 1. What is u(z(m))?
54*m + 1
Let l(t) = -2*t. Let j = 150 - 150. Let m(u) be the third derivative of -3*u**2 + 0*u + 0 - 1/12*u**4 + j*u**3. Calculate l(m(q)).
4*q
Let q(y) = y**3 - 9*y**2 + 8*y + 5. Let i be q(8). Let s be (-4 + 0)*6/(-4). Let m(z) = 2*z + i*z - s*z. Let w(a) = -2*a**2. Give m(w(u)).
-2*u**2
Let p(v) = -160*v. Let m(r) = -12*r**2 + 34. Give m(p(q)).
-307200*q**2 + 34
Let m(w) = -1019 + 2032 - 6*w + 4*w - 1013. Let n(s) = -7*s**2 - 3. Give m(n(t)).
14*t**2 + 6
Let y(c) = 82*c + 2. Let i(p) = -p**2. Calculate i(y(v)).
-6724*v**2 - 328*v - 4
Let b(x) be the third derivative of -11/24*x**4 + 0 + 0*x - 18*x**2 + 0*x**3. Let o(f) = -f**2. Determine b(o(s)).
11*s**2
Let x(z) be the second derivative of -11*z**6/240 + z**4/6 - 11*z. Let c(i) be the third derivative of x(i). Let v(h) = -2*h**2. What is c(v(g))?
66*g**2
Let g(t) = 246 - 77 + 4*t**2 - t**2 - 4*t**2. Let m(n) = 2*n**2. Determine m(g(x)).
2*x**4 - 676*x**2 + 57122
Let r(z) be the second derivative of 14*z**3/3 + 17*z + 5. Let o(u) = -18*u. What is r(o(q))?
-504*q
Let s(b) = 11*b**2 - 14. Let i(h) = -8*h**2 + 10. Let y(g) = -7*i(g) - 5*s(g). Let t(l) = 73*l**2. Determine y(t(f)).
5329*f**4
Let m(h) = 6*h. Let o(n) = 3*n. Let d = -16 + 31. Suppose -i = 2*j + 15, -3*j + 0*i - 6 = -4*i. Let f(u) = d*o(u) + j*m(u). Let w(k) = -k**2. Calculate w(f(b)).
-81*b**2
Let d(b) = b**3 + 2*b**2 + 12*b + 11. Let n be d(-1). Let x(j) be the first derivative of n*j - 3 + 3/2*j**2. Let y(i) = -i. Give x(y(r)).
-3*r
Let b(k) = -11*k. Let v(t) = -164*t**2 - 267. Determine b(v(a)).
1804*a**2 + 2937
Let s(p) = 116*p + 3. Let y(g) = 2*g - 2. Let q(x) = s(x) + 2*y(x). Let r(m) = -m. Calculate q(r(h)).
-120*h - 1
Let j(w) = -w**2. Let x(s) = 27359*s**2. Give x(j(t)).
27359*t**4
Let u(z) = 83072*z. Let r(s) = 3*s. Determine u(r(c)).
249216*c
Let g(q) = q**2 - q - 1. Let j(l) be the first derivative of 50*l**3 - 50*l**2 - 100*l - 32. Let p(u) = -100*g(u) + j(u). Let x(c) = -c. Give x(p(m)).
-50*m**2
Let g(w) = 8*w**2 + 0*w**2 - w**2 - 6*w**2. Let r(b) = -130*b. Determine g(r(c)).
16900*c**2
Let q(d) = -8095*d - 3. Let v(b) = b. Give q(v(m)).
-8095*m - 3
Let n(y) = -y. Let r(w) = 3 - 455*w**2 + 918*w**2 - 458*w**2 - 3. Calculate r(n(p)).
5*p**2
Let o(d) = -7*d**2. Let z(i) = -7*i - 6. Let p = -55 + 50. Let w(h) = 2*h + 3 + 4*h + 2. Let f(m) = p*z(m) - 6*w(m). Determine f(o(v)).
7*v**2
Let u(b) be the first derivative of -38*b**3/3 + 114. Let j(m) = -9*m**2. What is u(j(s))?
-3078*s**4
Let f(j) = -311*j**2 - 6*j - 6. Let o(x) = -312*x**2 - 4*x - 4. Let z(p) = -2*f(p) + 3*o(p). Let d(t) = 2*t. Give d(z(i)).
-628*i**2
Let r(b) = -5*b**2. Let k(o) = -10*o - 4*o + 10*o. Determine r(k(p)).
-80*p**2
Let c(h) = h. Let k(g) = 2*g. Let u(r) = r. Let q(p) = 3*k(p) - 10*u(p). Determine q(c(j)).
-4*j
Let o(s) be the first derivative of -2*s**3/3 + 1. Let h(u) = -22*u - 7. Let k(x) = -1. Let g(v) = 5*h(v) - 35*k(v). What is g(o(a))?
220*a**2
Let h(a) = -a**2. Let m(l) |
Jonathan Potter
Jonathan Potter
Coach
Jonathan hails from Virginia where he grew up playing soccer and wrestling; and was first introduced to Crossfit in early 2005 at Crossfit Virginia Beach. By late 2010 he was a CF instructor; and competing in local competitions in the Northern Virginia and Washington D.C. area and soon after went to the Crossfit Regionals Mid Atlantic Games with his team in 2012. After having the experience of competition but school taking the lead; Jonathan began to delve into programming, bringing the team back to regionals along with individuals the following years. By 2014 Jonathan obtained his L2 and proceeded to continue with learning to how to be a better coach in all things CrossFit.
– CrossFit Level 2
– CrossFit Endurance
– CrossFit Weightlifting
– Associate in Psychology
– B.S. in Psychology with Neuroscience concentration
– Coached Athletes Without Limits (AWLS)
Philosophy:
Jonathan has over a decade of CF experience as a competitor, member, coach, programmer, and manager. Because of this, he believes in the old quote “we all differ by degree not kind”; meaning we all come into CrossFit at different times of our lives; a former athlete who just got done with training, a mom wanting to get their energy back, to the elders who want to be able to pick their self-off of the floor if they fall. Regardless we all need to learn how to move and use our own bodies in a natural way; and when CrossFit is taught professionally and well, we can allow people from all walks of life begin (or start again) a journey into using the most complex and wonderful tool you will be ever given. Your body. |
Q:
c++17 add class with deleted copy constructor to std::vector at compile time
Below is a class that I've defined with a deleted copy constructor and copy assignment operator. This is the only assumption that has to be made.
class MyClass
{
public:
explicit MyClass(int i) : i(i) {}
MyClass(const MyClass&) = delete;
MyClass& operator=(const MyClass&) = delete;
MyClass(MyClass&& other) :
i(std::move(other.i))
{}
MyClass& operator=(MyClass&& other) {
i = std::move(other.i);
return *this;
}
private:
int i;
};
The goal is then to add my class to a std::vector at compile time.
int main()
{
std::vector<MyClass> v{MyClass{0}, MyClass{1}, MyClass{2}};
return 0;
}
My compiler is telling me that the STL requires the use of my deleted copy constructor MyClass::MyClass(const MyClass&) but is there any way around this?
I am already aware of a possible way to add values at runtime but the below is a poor solution in my opinion because I've lost the compile time check.
int main()
{
std::vector<MyClass> v;
v.emplace_back(MyClass{0});
v.emplace_back(MyClass{1});
v.emplace_back(MyClass{2});
return 0;
}
A:
My compiler is telling me that the STL requires the use of my deleted copy constructor MyClass::MyClass(const MyClass&) but is there any way around this?
No, you can't.
initializer_list creates a hidden array for you, which is declared const, being estimated like this:
// pseudo code
const MyClass __arr[3] = { MyClass(1), MyClass(2), MyClass(3) };
std::vector<MyClass> v{ std::initializer_list<MyClass>{ __arr, __arr + 2 } };
If you want to avoid copying, you'll have to stick to emplace_back like you said.
I am already aware of a possible way to add values at runtime ...
By the way, the example you gave is not a proper way to use emplace_back:
std::vector<MyClass> v;
v.emplace_back(MyClass{0});
v.emplace_back(MyClass{1});
v.emplace_back(MyClass{2});
You're still creating MyClass and then move it to v, which is quite a common mistake when using emplace-ish functions.
What you really wanted to do is probably as follows:
v.reserve(3);
v.emplace_back(0);
v.emplace_back(1);
v.emplace_back(2);
This way you're avoiding accidentally invoking move constructor, and just constructing the object at the right place only once with no move, and no copy.
The goal is then to add my class to a std::vector at compile time.
If you want to create an array at compile time, use std::array instead.
std::array is exactly designed for that purpose:
std::array<MyClass, 3> v = { 1, 2, 3 };
|
Q:
Best way to handle this VS2010 question now that SP1 was released
I have a question here that I've used lobby for fixes in VS2010 SP1. I haven't yet gone through the release notes to determine what has been fixed in SP1 or not.
What is the best action that should be taken on a question that refers to a product that is one version behind current?
A:
I would edit the body of the question to note which issues have been fixed in SP1 and edit the title to reflect the fact that it applies to the stock version of VS2010. At that point, the question could be locked to prevent further edits/new answers. You'll have to flag it for a moderator to have that done.
I think since SP1 doesn't come bundled with VS2010, it may still be beneficial to keep the question around in case anyone needs help justifying an upgrade to their boss or something along those lines.
|
20th Century Fox announce Deadpool movie!
It would appear that Christmas has come early for fans of a certain comic-book motor-mouthed merc, as 20th Century Fox and Marvel have confirmed that a Deadpool movie is scheduled to be released February 12th 2016!
The movie will see Ryan Reynolds return to the role that he first portrayed back in 2009 as part of the movie X-Men Origins: Wolverine and he will be directed by Tim Miller.
There is no news yet as to whether the movie’s announcement is due to the phenomenal response that the recent leaked footage from a planned film received, but you can bet that the response certainly helped. Additionally, the fact that Miller is attached to the project as the director would seem to suggest that there could be some connection, and may also explain why the footage, which was originally made by his studio, was quickly removed from sites after it leaked online in July.
The character was created by writer Fabian Nicieza and artist Rob Liefeld back in 1991 and has gone on to become a fan favourite due in part to his witty dialogue, fantastic comebacks and his tendency to break the fourth wall. Deadpool, for those who do not know, is the alter ego of Wade Winston Wilson and has the power to heal at an accelerated rate, making him, among other things, very hard to kill.
There is no news on the plot for the movie or who else is due to star in it, all we can hope is that it is better than Reynolds’s last superhero outing as Green Lantern in 2011. Oh the horror!
What do you think of this news? Who would like to see Deadpool square off against in the movie? Let us know your thoughts in the comments below. |
The major objectives of this research are to systematically analyze the effects on behavior of alcohol alone and in combination with other drugs. Using squirrel monkeys as subjects, the research will focus on an examination of alcohol's effect on various behaviors controlled by different environmental events. Once these effects are determined for alcohol alone, further experiments will be conducted to examine the effects on behavior of other drugs alone and, most importantly, in combination with alcohol. Of particular interest in this research are studies which specifically examine the development of behavioral tolerance to alcohol and then assess the effects of drug interactions once tolerance to alcohol has developed. Such experiments will provide a detailed analysis not only of how alcohol alone affects behavior but will also permit a more adequate understanding of the consequences of alcohol-drug interactions. |
Christiania: 11 Things to Know About Copenhagen’s Hippie “Free Town”
If you’ve heard of Freetown Christiania, the autonomous anarchist district in Denmark’s capital, it is probably due to the open cannabis trade that took place there for close to half a century. There’s a lot more to it than that, however. Below, Culture Trip give you a run-down of the must-know things when it comes to visiting Copenhagen’s most hippie neighborhood.
Getting there
Freetown Christiania is located in the Christianshavn area and you can get there by metro, bus or bike. Cars are not allowed within the district, so don’t bother driving. Get off at Christianshavn St and head southeast towards Dronningensgade; in approximately 15 minutes you’ll be entering the bohemian district. If you don’t want to walk all the way there, take bus 9A from Christianshavn St and get off at the next stop (Bodenhoffs Plads). Another way to reach Christianshavn St from the city center is to take bus 350S from Nørreport St.
What is Freetown Christiania?
Christiania is a former military base that sat abandoned for many years before becoming the neighborhood we know today. In 1971, a group of hippies broke down the barricades and began squatting there. Nowadays, approximately 900 people live in the area, comprising a community that has its own rules and regulations completely independent of the Danish government. During its relatively short history, Freetown Christiania has faced a certain amount of turmoil. This is mainly due to the cannabis trade taking place in its famous “Green Light District.” At one time, police officers regularly invaded the neighborhood, occasionally arresting dealers. In August 2016, a shooting in Christiania injured three people, including one police officer.
The Green Light District
Christiania has been famous for many years thanks to the permanent stalls along Pusher Street—or ‘The Green Light District’, as it was once known—that sold all types of cannabis (illegal elsewhere in Denmark). Don’t get your hopes up about seeing this type of thing today, however, as the stalls have been forced to close due to conflicts surrounding drugs in the area. Violence has no place in the hippy community and many residents are campaigning to clear Christiania of all drug activity. Although whispers of marijuana deals can still be heard within The Green Light District, locals have appealed to the people of Copenhagen, asking them not to buy drugs in Christiania. After Pusher Street was closed, the city was covered in posters, created by the inhabitants, with the words reading, “help Christiania—buy your hash elsewhere”.
Photography
Up until recently, a sign confronted you the moment you entered Christiania. It read: “Dear friends, There are three rules in the green light district: have fun; don’t run—it causes panic; no photos—buying and selling hash is still illegal.” Taking photos at the Green Light District is now allowed but you should always ask people before photographing them, even if they’re just in the frame.
Souvenirs
If you want to buy a little token to remember Christiania by, there are many options. T-shirts with the symbol of Christiania, jewelry, smoking pipes and many more items are sold at relatively low prices within the neighborhood. If these stands don’t satisfy your appetite for shopping, roam the pedestrian alleys and rummage through the clothes stores.
Cafés and restaurants
From breakfast and brunch to hamburgers and vegetarian restaurants, Christiania is a place to suit all food tastes. If you’re in the mood for pastries, head to Sunshine Bakery and taste a typical Danish kage (cake). Prices are quite low and all of the products are super tasty. Café Nemoland is famous for its juicy burgers and sandwiches, and you can also find coffee and desserts there. Vegans should definitely taste the dishes at Morgenstedet and at Grønsagen. Taste their delicious recipes, all made with fresh vegetables, while you relax in the super cozy atmosphere. Café Loppen serves vegetarian dishes inspired by Thai cuisine. All the dishes and drinks are organic, as this restaurant believes in healthy food without frills. Månefiskeren, open from Tuesday to Sunday, is a spacious café with quirky paintings on the walls. For the warm sunny days, the café has an outdoor area with large wooden tables you can share with locals. Smoking is allowed at Månefiskeren and there is even a pool table for those who want to brush up on their skills.
Music venues
There are plenty of live music venues in Freetown Christiania, each one with its own special atmosphere. Jazz lovers should definitely check out Jazzklubben. The small smoky bar hosts professional and amateur musicians, while on the Sunday jam sessions everyone is welcome to go on stage and play their favorite instrument. From Thursday to Sunday, the district is filled with music spilling out of Operaen café. DJs, acoustic concerts and jam sessions take place in the colorful café until after midnight. For concerts and performances, keep an eye on Music Loppen’s official website. Finally, if you want to enjoy a drink and listen to music at the oldest bar in Christiania, look out for Woodstock at the end of Pusher Street.
Science & Cocktails
Every second Tuesday evening, Christiania cinema (Byens Lys) gets packed with people who want to enjoy a chilled cocktail while listening to scientific presentations. Science & Cocktails has been running since 2010 and still holds a place in locals’ hearts. Experienced mixologists create unique cocktails, while researchers and scientists go on stage presenting intriguing topics. As it’s a non-profit organization, all the people who are involved in these special Tuesday evenings work on a voluntary basis and the result is awesome. The presentations are held in English and they often evolve into conversations between the guest speakers and the audience.
ALIS Wonderland
Skate Park
ALIS Wonderland | Courtesy of ALIS
Among the restaurants, cafés and music venues in Freetown Christiania stands ALIS Wonderland, one of the Copenhagen’s most famous skateparks. Constructed 20 years ago by two friends that were born and raised in the hippie district, Wonderland instantly became a meeting point for Copenhagen’s skate community. Nowadays, not only does it continue to attract the city’s underground crowd, but many renowned skaters, photographers and street artists travel from abroad to attend events and competitions that take place in the wooden skate bowl.
What to see
Once you pass the area where the cafés and the restaurants are, there is an entirely different world to discover within Freetown Christiania. A canal, surrounded by trees and small colorful houses, separates Christinia from Copenhagen‘s mainland. In a moment you will feel like you’re not in the middle of the city. Walk or bike along the water or simply sit down and relax on its banks.
Christmas market
In December, Christiania hosts its own Christmas market and is one of the best in town. Luckily for visitors, it takes place indoors. The smell of baked almonds and mulled wine from the stands welcomes you once you step inside. There you’ll find numerous stalls with clothes, jewelry, and handicraft décor items, while a band fills the place with tunes. When you’re done shopping, taste the local cuisine at one of the food stands. |
[018] What Do The
Chinese People Really Want? (01/31/2009) First of all, you
can forget about getting the answer to the question from the western media.
This does not mean to say that the western media are biased as such.
Rather, the western media are writing for a western audience and must
therefore cater to their tastes, values, attitudes, beliefs and lifestyles.
Thus, we have articles about
Hip Hop
in China which is virtually unknown over there. Meanwhile, the
"real" China is silently and invisibly (as far as western media reports go)
moving on ahead.
Here is a couple of photos (via NetEase)
that will show you what the Chinese people really want. This is an
impressive sight. Reportedly more than 600,000 Chinese people were out
there (source:
Changjiang Daily). More than 3,000 police officers were out
there to maintain public order.
If this was a mass incident or a demonstration, the western
media would be there instantaneously. As it stands, here is the only
report that I can find in Google News:
(AP via
SFGate) Burning stuff brings good luck:
A man carrying flaming incense sticks prays to the god of fortune,
Cai Shen, at the Guiyuan Temple in Wuhan, China.
On the fifth day of the lunar new year, devotees traditionally
welcome Cai Shen back to earth with fire and pyrotechnics. (AP)
The fact that 600,000 Chinese citizens of one city went out
to pray for fortune does not have much news value for the western media.
That is perhaps understandable. But if you want to write a story about
what the Chinese people really want, then this number does not lie.
Q. Which international incident(s) was(were) most
significant in terms of raising China's international position?85%: The successful hosting of the Beijing Olympics
36%: The economic power of China in coping with the global financial tsunami
15%: The influence of China in major diplomatic affairs
15%: The development model of China
10%: Manned Shenzhou 7 space mission
10%: The unity shown in the Wenchuan earthquake
Q. Do you think that China is a strong nation in the
world now?27%: Yes
44%: Not fully
20%: No
10%: Not sure
Q. Which of the attributes of a strong nation does China
already have?56%: Economic power
48%: Military power
45%: Political and diplomatic influence
29%: Cultural influence
7%: None of these
Q. Which of these attributes affect the international
image of China negatively?52%: Corruption of certain government officials
44%: Poor quality and fakery in products
33%: Environmental pollution
23%: Work safety accidents
22%: Uncivilized behavior of Chinese people
19%: Human rights problems
12%: Lack of freedom of speech
6%: Lack of progress in developing medical care system
6%: An unjust government
6%: Urban traffic congestion
Q. Do you think that the West is trying to stem the
development of China?21%: There have been clear and obvious actions
41%: The intent is there, but there have been clear and obvious actions
11%: No, it is just our imagination
12%: This is something that people say
15%: Hard to tell
Q. How do you think the "China Threat Theory" should be
handled?30%: Object without any hesitation
25%: Respond to the specific charges by retutation and explanation
24%: We will listen to them and improve ourselves
24%: We will ignore them
11%: Don't know
Q. With the increasing power of China, how will its
international position change in the future?49%: Increasingly better
11%: Not much change overall
3%: Increasingly worse
37%: Better overall, but there will still be some friction
For the longest time, I have been the person who wants to
look at 'sea change' as opposed to sharp breaks in the Chinese Internet.
Some time ago, I noted the phenomenon of "human flesh search" in China.
I wrote back then that these "human flesh searchers" might seem to care only
about a kitten-crushing sadist or an unfaithful wife, but someday they will
have perfected the rules and techniques and turn their attention onto
government officials. I was promptly denounced by some blogger as 'nuts'
and/or 'Chinese Communist Party apologist' or something like that. But
at the end of year 2008, there was a flurry of Internet exposÚs
against local government officials in the form of surveillance videos (of the
Shenzhen official who may have molested a young girl); expense reports of
government officials going to Las Vegas, getting European-style massages, and
10,000+ yuan meals; smoking 1,800 RMB/per carton cigarettes. All those
government officials were dismissed from their positions as a result of the
outbursts of public opinion. It is foreseeable that the Internet will
become a formidable force of monitoring/supervision/watchdog at least at the
local (and observable) level.
At the same time, I note that I have
detected another phenomenon that is on the rise rapidly. This is about
the ability by some Chinese netizens to make up seemingly credible stories and
gain acceptance. During the monthly of January, the following cases are
noteworthy:
What Kind Of Communist Party Member Is Chen Hua?
I believe that this case is false, because of certain telltale signs (e.g.
poor writing with grammatical mistakes unbecoming of a Xinhua reporter;
inability to provide any details that would substantiate the case (if Chen
Hua drove a luxury car that was beyond his means, then what make/model is
it?); revelations of details that could place the principals under
peril/retaliation (the writer's daughter had dinner with Chen Hua with a
female friend who was looking to get a job at Sina.com; etc).
The Murder Of
Yang Xin As soon as
the news story came out that Zhu Haiyang decapitated Yang Xin at Virginia
Tech, someone came up with a fake blog to explain the motive. This was
a fake because netizens were able to retrieve the Google cache and showed
that the blog had been registered to a female living in Haidian district
(Beijing) instead of Zhu Haiyang of Virginia Tech before the incident.
A lot of other obviously false information was also spread (including
personal smears against Yang Xin to suggest that she deserved to die
anyway).
Television Ratings Rumors On The Internet
After the CCTV Spring Gala Festival show, someone made up some fake
television audience measurement data from AC Nielsen to rouse suspicion that
CCTV has been manipulating the popularity of the show. This is false
because the author could not get the name of the company right and failed to
understand the coverage of the measurement area of the company.
We have to look at the sad fact that
whenever something happens, there will be some nutcases out there trying to
cause trouble. For example, after the Sichuan earthquake, there were
some people spreading rumors about "there will be an earthquake in Beijing
this evening" and so on. The ultra-liberal view is that people should be
allowed to spread rumors if they wish, because those rumors will be dispelled
in time as the truth emerges. In the cases listed above, someone was
able to point out the gaps and flaws. But what is the social cost when
hundreds of thousands of people have to sleep in the streets because of the
earthquake rumor?
In terms of the 'sea change' that I
brought up in the beginning, I must say that I am really concerned that the
Chinese netizens are getting better at "making shit up" through practice.
At some point, people are going to get so good at it that there is no way you
can tell that one way or the other. It wouldn't be that difficult,
really. It involves running a "human flesh search" on someone beforehand
and then filling in the pieces so that the latter day "human flesh searchers"
would find exactly what you hinted at. Chen Hua? You figure out
what car he owns first and then you drop the hint that he might be driving a
luxury car. AC Nielsen? You track the corporate history and you
research the coverage area before you announce their 'ratings.' If that
should happen, then people will never know what is real or fake anymore.
Isn't that scary?
The converse to this story is actually
positive. Nowadays why would you believe anything on the Internet?
It is therefore incumbent upon you when you run across anything exercise
commonsense (and that works most of the imte) and due diligence. This is
not different from what ever you see in the newspapers.
In recent days, there has been a Rashomon incident over
the the television ratings for CCTV's Spring Festival Gala. As soon as
the show was over, the CSM television audience measurement service (in which
CCTV holds a stake) announced that it had achieved a 95.6% share of the
audience.
This is currently a hot topic at mainland Internet forums.
People are accusing CSM of being biased since CCTV is part owner whereas the
AC Nielsen service is likely to be more objective.
What's the deal here?
This is a fabricated story. PERIOD.
The name of the other television audience measurement
company is not AC Nielsen. It is
AGB Nielsen Media Research. Furthermore, for the results to come
out so quickly, it could only have come from the people meter service (and not
from the diary service which would take a long time to collect). AGB
Nielsen Media Research does not even have people meter systems in some of the
provinces listed above (e.g. Gansu, Ningxia, Inner Mongolia, Guizhou, Guangxi,
Hainan, etc). Therefore, this is a fake story.
(Link, in Chinese)
There is a background behind AGB Nielsen Media Research and CSM (CCTV-Sofres).
Once upon a time, the AC Nielsen company ran a television audience measurement
service in China. In 2005, a global deal was struck with WPP and a new
joint venture known as AGB Nielsen Media Research was created (note: WPP owned
the separate entity AGB Italia at the time). Together they provide
television audience measurement in dozens of countries around the world
(including China). In China, their main competitor is CSM, which is
owned by CCTV and TNS (Taylor Nelson Sofres). CSM has a 90% of the
market while AGB Nielsen Media Research only has about 10%.
In 2008, WPP acquired TNS, which would therefore include its
stake in CSM. The European Union determined that WPP's ownership in AGB
Nielsen Media Research as well as as TNS would be anti-competitive.
Therefore, WPP is selling off its AGB Nielsen Media Research back to AC
Nielsen. Today, it is not clear if AGB Nielsen Media Research will be a
viable business since its major clients are WPP advertising and media buying
agencies. It is ironic that a Euroepan Union decision against
monopolistic power in Europe would result in a monoploly in China.
All of this business intrigue is hard to keep up with unless
one is personally involved. Whoever produced that list of AC Nielsen
ratings by city/province is not in the television audience measurement
industry. That person may have heard of the AC Nielsen company a while
ago and has no idea of the coverage area.
[Full disclosure: This blogger is an employee of WPP and is
involved in television audience measurement. I have previously discussed
The
Statistical Reliability of Television Ratings in China. The
kinds of discrepancies in the fake story here cannot possibly occur in real
life, because the client base would have rebelled first.]
On December 16, 2008, the Haidian district (Beijing city)
People's Middle Court found three defendants guilty of running an "illegal
business." Chen Zhao was sentenced to 18 months in jail (but suspended
for two years) and fined 15,000 RMB; Cheng Wei was sentenced to 15 months in
prison and fined 15,000 RMB; Luo Jianshan was sentenced to 15 months in
prison and fined 15,000 RMB. Normally, people deserve to be punished
when they break the law. But in this case, all those who knew about
the details were sympathetic to the defendants.
How they end up running an "illegal business"?
According to the court, they were guilty of "selling politically sensitive
books that are banned by the state." They were distributing
photocopies of certain books that had been published overseas, including Gao
Hua's <How The Red Sun Rose Up -- the details of the Yenan rectification
campaign>, Gao Wenqian's <The Later Zhou Enlai> and <He Fang's <Notes on the
History of the Party -- from the Zunyi conference to the Yenan
rectification> and others.
In mainland China, it is hard for readers to learn about
the historical truths, especially those truths that the Chinese Communist
Party deliberately covers up. All the mainland publishers are
government-owned, so that there is no way that any books about historical
narratives deviating from the official conclusions can pass scrutiny and be
published. The authors of such books have no choice but to publish
their works in places such as Hong Kong. Afterwards, it is not so easy
for these books to flow back into mainland China. The Customs have a
black list of books that they will confiscate. Certain old readers
have been deceived most of their lies and when they realize what happened,
their yearning to learn about the truths is all the more urgent. Thus,
books that dare to discuss Party history in a bold and open manner such as
those three titles named above became their spiritual food. Actually,
even the senior government officials today will privately consult these
"politically sensitive books."
Today, the Internet is very convenient for young and
middle-aged people to use. But some older people are not used to
reading on the Internet. Besides, there are always some difficulties
with getting through the firewall that the government has built at huge
expense. Therefore, they often look for photocopies of these books.
Chen Zhao is an old man. In his youth, he was with
the Air Force. As a result of the Lin Biao affair, he lost his job and
has no source of income even now. His unfortunate experience caused
him to study the Cultural Revolution. Together with Wang Ninyi and
others, he has published essays about the Lin Biao affair. During the
process, he observed how people around him longed to know the historical
truths. Therefore, he made copies of the books in his collection to
share. At first, he supplied them for free. When it became
economically unviable, he began to charge money. In 2005, he was
visiting family members overseas. His daughter Cheng Wei helped him to
carry on with his business. Meanwhile, Luo Jianshan was the owner of a
small photocopy shop and he really neither understood nor care about
ideological issues and he was only concerned about a business.
Through Chen's help, many middle-aged and old citizens
manage to read some good books for which they are grateful. At the
same time, they were also worried that this may lead to trouble. After
all, this type of action is ripping up a hole in the carefully built
cultural wall. So some friends advised Chen Zhao to quit.
Meanwhile Chen Zhao himself was also worried that the authorities may catch
on to him with so many strangers coming to him for the books. So he
quit the business. But the authorities came after him all the same.
On October 7, 2007 Chen Zhao and his daughter Cheng Wei were arrested.
[013] Does Hu Jintao
Want TO Look At This Kind Of Photo? (01/30/2009) (DWnews
blog)
This is the photo of Zhu Yaiyang, a Virginia Tech student who
decapitated a female student named Yang Xin. This photo shows Zhu
waving the Chinese national flag with the long banner "Warm welcome to
Chairman Hu Jintao" in the background.
Here are the selected comments to the forum post of that
title:
- Basically, the angry young people are all mental
patients and deserve sympathy.
- A murder holds a Chinese flag and therefore all those
who have ever held a Chinese flag are murders. This is a terrific
inference. Have you ever held anything? Just tell me what you
held and I will send you a photo that will sure that you won't be able to
sleep at night.
- This incident is an isolated individual act, so there is
no need to raise it up to the collective level. We oppose feudalism,
of which a prominent aspect is guilty by association. At Virginia
Tech, a student of Korean origin killed more than 20 people in a shooting
spree. If the Americans believed in guilty by association as well,
shouldn't they declare war on South Korean? [Correction: He shot 32
shot and killed 32 persons.]
- When Zhu Haiyang raised the flag, he was killing anyone.
Is there any causal relationship between murder and flag-waving?
- The problem is not with the flag itself. It is the
bloody red flag of the culture of violence that exist in people's hearts.
The culture of violence is distorting the human character.
- This brutal distortion of human character is the product
of the corruption of the Chinese Communist Party and the evil party
culture/education.
- Sick people show up to criticize what other sick people
do. So sad!
- I only want to show everybody that anyone who waves the
party flag is almost surely psychologically warped. You have to accept
that.
- Your logic is so powerful because you can derive
regularities from rare events: A psycho once raised the flag, and therefore
all those who raise the flag are psychos. I congratulate your
democratic movement and may it be as strong as your logic. I pray that
you powerful logic will destroy the Chinese Communist Party and build a new
world of democracy.
- When a person who raises a Chinese flag commits murder,
it does not mean that all those who raise the Chinese flag are murderers.
And there is nothing so controversial about a Chinese person loving China.
There is nothing wrong with a Chinese person welcoming a visit from the
chairman of China. Therefore, these is no causal relationship.
But Zhu Haiyang is a Ph.D. candidate. He should know
what the Chinese Communist Party have wrought but nevertheless he went out
there with a Chinese flag in hand. Then I must conclude that he is a
psychologically warped bookworm. It is no surprise that this mentally
retarded bookworm would kill someone. Thus, this forum post is
reasonable -- far too reasonable. Now I understand why my heart chills
whenever I see a Ph.D. holding a Chinese flag in hand. This blog post
made me realize that all Ph.D.'s who hold Chinese flags in their hands are
killers. Just take a look at Qian Xueshen and Guo Moruo and you will
know that it is a wonder that they didn't kill anyone.
- I puke when I see the five-star flag. This person
is either really ignorant (and therefore used by the Communist Party to
kill) or else they are Communist Party members who will kill people anytime.
- When someone kills, it has nothing to do with his
educational level. It makes no different if he was a Ph.D. or not.
Do you think anyone who has received higher education won't commit crimes?
What is the relationship between education and committing crime? With
respect to his case, I would rather read the speculation from the
psychologists rather than read the rubbish coming from a bunch of political
hacks. At this point, I am disappointed with the quality of the
opponents of the Chinese Communist Party.
- A fake photo that was composed by computer generated so
many comments. This piece of fakery is a waste of time. The
Chinese people must be quite stupid.
- Hu Jintao visited America in June 2006, whereas Zhu
Haiyang arrived in the United States in the fall of 2008. How was Zhu
supposed to greet Hu?
- The photo may be technically fake, but the reality of
the violence of the Chinese Communist Party cannot be denied.
[012] Coal Mine Toll
Statistics (01/28/2009) Can you say confusion? I think
that they are writing news reports based upon these numbers (which I pieced
together).
In 2007, traffic and work-related accidents resulted in 101,528 fatalities (of
which 3,786 were due to coal mine accidents).
In 2008, traffic and work-related accidents resulted in 91,172 fatalities (of
which 3,214 were due to coal mine accidents).
Instead the headlines became "91,172 Deaths in China Coal Mines in 2008."
Why not just show the two lines above?
(Xinhua)
Accidents kill over 91,100 in China in 2008. January 16, 2009.
China's top work safety official said here
Friday that 91,172 people were killed in 413,752 traffic and work-related
accidents last year. The number of deaths was down 10.2 percent from 2007
and that of accidents was down 18.3 percent as the country stepped up
efforts to ensure work safety.
Luo Lin, head of the State Administration of
Work Safety, said the 2008 death toll fell below 100,000 for the first time
since 1995 as work safety conditions improved in various sectors, including
coal mines. Fatalities from coal mine accidents fell 15.1 percent and deaths
from road accidents dropped 10 percent, Luo said, without providing the
specific figures. Figures released by the Ministry of Public Security on
Jan. 4 showed that 73,484 people were killed in 265,204 road accidents last
year. Death toll from coal mine accidents in 2007 was 3,786, according to
the work safety agency.
The death toll in China's coal mines last year was 91,172,
down 15.1 percent from 2007, the State Administration of Work Safety (SAWS)
said Tuesday. It was the first time since 1995 the figure fell below
100,000,the chief work safety regulator said. The number of accidents fell
19.3 percent to 413,700 in 2008. The death rate in coal mine accidents, per
1 million tonnes of coal produced, dropped 20.4 percent year-on-year to
1.182, SAWS also said.
The death toll in China's coal mines last year was 91,172,
down 15.1 percent from 2007, the State Administration of Work Safety (SAWS)
said Tuesday. It was the first time since 1995 the figure fell below
100,000, the chief work safety regulator said. The number of accidents fell
19.3 percent to 413,700 in 2008. The death rate in coal mine accidents, per
1 million tonnes of coal produced, dropped 20.4 percent year-on-year to
1.182, SAWS also said.
[Note: The third story changed the title, but the body of
the text was still wrong.]
The number of people killed in China's notoriously
dangerous coal mines dropped in 2008, the government and state media
reported, indicating the total amount of fatalities was more than 3,200.
Coal mine deaths dropped 15.1 percent in 2008 compared to the previous year,
the official Xinhua news agency late on Tuesday quoted the country's State
Administration of Work Safety as saying. The report made no mention of the
actual number of deaths in 2008, but Xinhua said at the beginning of last
year that 3,786 miners lost their lives in 2007 -- a 15.1 percent drop from
3,786 equates to 3,214.
However independent labour groups have long maintained
that China's mining death toll is much higher than the government says as
local mine bosses and regional leaders cover up accidents to avoid fines and
costly mine shut downs.
Even after the above has been noted, other western media
have boldly piled insult on idiotic re-writing as if they don't know.
China's State Administration of Work Safety
office has said the death toll among coal mine workers fell 15% last year,
compared to that of 2007. The official death toll last year was 91,172, the
first time since 1995 that the figure fell below 100,000. The death rate in
coal mine accidents, per 1 million tonnes of coal produced, dropped 20.4%
year-on-year to 1.182, the work safety office added.
A Virginia Tech graduate student accused of beheading a
fellow student displayed erratic and standoffish behavior in the months
before the attack on campus this week, his landlord said Friday. Also on
Friday, police filed court papers listing items found in a searches of the
off-campus town house occupied by Haiyang Zhu, who is charged with
first-degree murder in the slaying of Xin Yang, and the room where Yang
lived on campus.
Yang, of Beijing, was slain with a large kitchen knife as
she had coffee with the 25-year-old Zhu on Wednesday night at a cafe in the
building where she lived, a hotel converted into graduate student housing. A
Tech police officer arrived Wednesday night to find Zhu holding 22-year-old
Yang's head in his hands, according to a court affidavit filed Thursday.
...
Virginia Tech Police were trying to verify the
authenticity of a posting on a Chinese-language blog earlier this month
under the name Haiyang Zhu that expressed frustration over problems
including stock losses, Chief Wendell Flinchum said Friday. The Jan. 7
posting said, "Recently I've been so frustrated I think only of killing
someone or committing suicide."
The lack of concrete information about the two principals
created fertile ground for Chinese certain netizens to display their worst
behaviors. The first blog purported to be written by Zhu Yaiyang was a
piece of forgery. How so? Other netizens were able to go to the
Google cache and recovered the archived January 7 post -- it was something
completely different written by a female blogger living in the Haidian
district of Beijing. After the murder, someone had modified the blog
posts and identity of the blogger (from female to a man with Zhu Haiyang's
photo). Next, another forum post appeared by someone who purports to be
a classmate of Yang Xin in Canada. This person claimed that Yang Xin was
a slut who simultaneously dated four guys while they paid for all her
expenses. However, the post was clearly false because it could not even
specify which university Yang Xin was attending and what she majored in.
This is just a sample of many other posts that represent the worst of human
behavior.
This Tianya
forum post comments on the sad state of affairs: "It is your personal choice
to sympathize with the killer and I won't object at all. But it is very
scary when someone with no conscience can create smears to come up with
reasons why the victim deserves to die." The title of the post was:
"Gossip is a fearful thing. Yang Xin, thankfully you can't hear them
anymore."
(SCMP)
Short straw dims New Year glow. By Mary Ann Benitez, Danny Mok and Amy
Nip. January 28, 2009.
As if recession and the
prospect of a worsening economic downturn were not enough, Hong Kong
yesterday drew the worst possible fortune stick in a ceremony at a Sha Tin
temple. Lau Wong-fat, chairman of rural affairs body the Heung Yee Kuk, drew
the stick numbered 27 on the city's behalf in the Taoist ceremony at the Che
Kung temple.
A fortune-teller at the temple who read the stick said it
showed the city could not isolate itself from the global economic
turbulence, but that Hongkongers should nevertheless be cautiously
optimistic. Fung shui masters interpreted the stick's meaning differently.
James Lee Shing-chak said it signified possible conflicts between the
government and its people.
Mr Lau said: "It is a warning to all of us that only a
harmonious society with people staying united can enable us to get through
our challenges." The last time that stick was drawn, 1992, saw, among other
things, the arrival of last governor Chris Patten - who unleashed fierce
political strife.
At the Che Kung Temple, there are a total of 96 different
fortune sticks. Of these, 35 are considered favorable signs, 27 are
neutral signs and 17 are unfavorable signs. Lau Wong-fat picked up
fortune stick number 27, which is considered unfavorable.
The four sentences in the poem are:
You should not have to worry about the people being
unworthy
Because all the troops in front of you are actually demons
The Emperor Qin wasted his efforts to build the Great Wall
Your misfortunes come and go on account of you
The associated interpretation on the stick is:
Because you have traitors inside your home
You won't have a restful time
Because your house is unlucky
You will fail to make money
Who are these traitors or demons on the inside?
Various interpretations are listed below. To the extent that the
different interpretations are different ways of finger-pointing, this is
part of the message.
- According to Master Li who sets up outside the temple,
this fortune stick means to say that Hong Kong is bound to be affected by the
global economic recession. Fortunately, Hong Kong is a wonderful place
and its people are great too. Things are expected to become better in
the second half year provided that the people keep their fighting spirit and
a cautious optimism.
- According to Master Leung who sets up outside the
temple, he said that the first two lines of the poem refer to people who
appear to devoted and respectful, but in truth they will secretly go and
lodge complaints with the central government. As for the last two
lines in the poem, it means that the government departments hold different
ideas and do not communicate with each other. As a result, this
administrative effectiveness is poor and the treasury receipts are being
wasted.
- Fortuneteller Mak Lingling said that while Hong Kong
Chief Executive Donald Tsang is not necessarily like Emperor Qin who failed
in spite of building the Great Wall, it is still necessary to be cautious
how government money is being spent.
- Master Chen said that the so-called talents within the
government are actually second-rate and more interested in fighting against
each other. When Donald Tsang and the officials all harbor private
interests and are not united for the sake of Hong Kong, troubles will arrive
one after another.
- The fortuneteller named Tian Tung Tse said that this
fortune stick says that the government is not sufficiently united and ought
to hold repeated consultations to attain social consensus first before
proceeding with its policies.
- Fortune teller Master Lee said that Qin Emperor was
courageous when he united the six nations, but he was too strong-willed and
opinionated. Therefore he called for the government to work closer
with the people. The Great Wall refers to the ten large infrastructure
projects which will use up lots of money but may not win public
appreciation. As for internal traitors, it may refer either to
internal government office politics or clashes between government and
citizens.
- Astrologer Master Yeung said that the fortune stick
clearly showed that Hong Kong is affected by "internal factors." The
troops clearly refer to government officials who fail to perform their jobs
and thus cause the Great Wall (=government policies) to be implemented.
The economic woes are therefore caused by Hong Kong itself.
- Chinese University of Hong Kong School of Chinese vice
president Shi Zhongmou said that the key is that "your misfortunes comes out
of your own doing." The Qin Emperor built the Great Wall to defend
against foreign enemies, but the dynasty ended due to internal problems that
came out of his own doing. "Hong Kong is facing an economic crisis due
to external factors in the United States and Europe. But the fortune
stick text says that internal politics are even more important than the
external factors. He believes that the fortune stick is reminding the
people of Hong Kong to remain united to overcome the crisis.
- Hong Kong Legco member Lee Cheuk-yan said that the China
Liaison Office, the Political Assistants to the Secretaries of the
Government, the Democratic Alliance for the Betterment of Hong Kong are all
internal demons. Lee said that this year will be the 20th anniversary
of June 4th and the 60th anniversary of the People's Republic of China, and
therefore he expects the central government will increase political
oppression in Hong Kong. Furthermore, the Chief Executive Donald Tsang
has recently postponed the consultation on political reform until the end of
the year, which is expected to see some heated debated.
On the 114th birthday of the Kuomintang, the Party Central
History Exhibition Hall was formally established with 250 historical
photographs and more than 90 historical documents. Included were
posters and descriptions of the Kuomintang spy Zheng Pingru, who was the
original model of the female character Wang Jiazhi in the movie <Lust,
Caution>.
Cheng Pingru was born in 1918 and she was the original
model for the female lead character Wang Jiazhi in the movie <Lust,
Caution>. When the War of Resistance broke out, 19-year-old Zheng
Pinru was a spy. On account of the fluent Japanese taught by her
Japanese mother, she was able to mix with senior Japanese government
officials. The KMT government sent her to entrap the Chinese traitor
Ding Muchuan. She pretended to be an innocent young girl. She
failed in her mission, but Ding could not bear to execute her.
Instead, Ding's wife sent someone in to kill her. Zheng was only 23
years old when she died.
Oy! This goes to show the problem with
passivity. Before the movie <Lust, Caution> was exhibited, there was
already a book published that claimed the fictional character Wang Jizzhi was
based upon a real-life heroine Zheng Pingru. This was refuted totally
and completely in the Chinese-language article The Spyring and 'Lust, Caution'based
upon the correspondence of Eileen Chang with my parents. A longer
version of this article appeared in the Taiwan literary magazine INK later on.
Whatever else, the correspondence showed that my father told Eileen Chang
that she could not possibly publish <Lust, Caution> under the premise that
Wang Jiazhi was a KMT agent. Under the prevailing climate of political
correctness in Taiwan at the time, a KMT spy could not waver and fail to carry
out her mission. Eileen Chang took his advice and created an elaborate
identity (i.e. she attended Hong Kong University, she met with a group of
patriotic students, they decided to become an amateur spy ring, she had to
sacrifice her virginity in order to entire the target as a married woman,
etc). The only thing for certain is: Wang Jiazhi was not the Zheng
Pringru character.
For me, the long-term problem is that I am holding on to the correspondence
between Eileen Chang and my parents. If I had release this information
long before the movie <Lust, Caution> appeared, this news story could never
have appeared. Alternately I can insist on protecting her privacy and
not publish any of the letters, and that may cause her to be victimized by
many misreadings. But, of course, she was accustomed to being misread --
according to her letters!
On January 18, the <Xuzhou City Computer Information
System Security Protection Regulations> were approved by the provincial
People's Congress Standing Committee. Under these regulations, it will
be a crime to disclose private information no other persons without their
permissions or to provide or disclose information about other people on the
other net. The originators and propagators may face a fine of up to
5,000 yuan. In more serious cases, the offenders may be barred from
using a computer or accessing the Internet for six months.
The media reports drew strong Internet reaction.
Many netizens were concerned that these regulations will inhibit the ability
of "human flesh search" to stop corruption. "Corrupt officials must
love this piece of legislation." On January 19, the Xuzhou city
People's Congress Standing Committee clarified that the law is not a total
ban on "human flesh search." Denunciation of corruption and exposure
of bad conditions are allowed by the law already, and they will not be
banned on the Internet.
...
The reporter noticed that People's Net ran a survey on the
same day: "What do you think about the Xuzhou ban on human flesh search?"
Mo0re than 90% of the netizens said that they opposed the legislation,
because it was "working against monitoring of government officials by
grassroots citizens." Only 4% agreed that the legislators did more
good than bad.
Interestingly, NetEase ran a survey on the same day: "Are
you worried about being the target of human flesh search?" More than
80% of the netizens said "I am not worried because I haven't done anything
wrong." Almost 15% of the netizens said that they are worried and
wanted laws that would ban the procedure.
...
"We ban certain 'human flesh searches' but not others."
During the interview, the Xuzhou city People's Congress Standing Committee
leader emphasized, "Netizens are most concerned about whether they can
expose bad social behavior, or report the illegal activities of leaders and
cadres, or criticize uncivilized behavior in society. These actions
are not banned in these regulations. They are permitted under state
law and it is the right of the public to monitor the government. For
example, in 2008, the former Xuzhou city Quanshan district party secretary
Dong Feng was denounced on the Internet, and that drew the attention of the
party disciplinary committee which eventually ended with his being
prosecuted. This sort of 'human flesh search' is not banned by these
regulations." This spokesperson also said if netizens found people
going through red traffic lights, or steal things, or beat up elementary
school students, it is acceptable to expose and criticize them on the
Internet.
"The regulations are intended to ban searches about the
normal privacy of citizens and information security." This
spokesperson explained such searches usually serve no public interest while
harming the legal rights of others. They harm personal life, work,
family and state of mind of citizens. Under the civil laws,
administrative laws and criminal laws of China, personal privacy is
protected under by law. Presently, personal privacy include
information such as the age of a woman, the composition of
personal/household wealth, income situation, residence, salary, etc.
'Human flesh search' frequently includes some of these kinds of information.
Therefore, it is illegal to willfully disseminate such information. "I
believe that the majority of netizens will understand what we have to ban
these activities, because we are trying to protect each and every one of
us."
[007] The Chongqing
Shootout (01/25/2009) (Tianya)
Four photos on a hostage situation were loaded onto the Internet.
A man charged into a beauty salon and started screaming:
"They want to kill me." He grabbed a knife and held the pregnant
female
owner hostage in the street. The police set up cordons to keep the
crowds
away and offered bottled water to the hostage taker. Plainclothes
police men
stood afar from the man, but you can see that they put their arms behind
their
back while holding handguns in their hands.
One plainclothesman approached the hostage taker from the
left to talk while another
one pretended to go up to listen in on the conversation.
The man on the right then pulled out his handgun and shot the
hostage
taker dead. The female hostage was safely rescued.
The body of the hostage taker was then taken away.
Is this going to the another Yang Jia case where the rights
of the hostage taker were ignored? Why did they just execute him?
Why couldn't they negotiate with him? Why couldn't they have a
heart-to-heart, soul-to-soul dialogue with him?
The southern city of
Chongqing, which had recently
experienced a strong earthquake, was rocked three times on January 8 by a
strange sound that resembled an explosion. Rumors had it that the noises
were a chain explosions set off by the crash of a fighter jet from the
Chengdu military base. This was
officially denied three days later. Flight training happened as usual at
that day, said the head of the base, and no problems were encountered in the
mission, according to a report on Xinhua Net. He went further, adamantly
denying that base had anything to do with an explosion or the sounds.
According to witnesses, the noises shook the city around 3
p.m., reverberating through three districts in the north of the city. The
sound was so loud that some citizens thought another earthquake was
happening and ran from their houses into the street. Afterward, people found
they could not make a telephone call until around 6 p.m. A police officer
announced later that night that dead lines were the result of a switch
error, not the sounds.
There local news attempted to find the cause of the sounds,
but every possibility was ruled out. The civil aviation department said no
air crash happened, and the fire department received no reports of the
incident. The government of
Chongqing also claimed they did
not received no reports. And so the source of the sounds remains unclear,
with still no official explanation offered.
I personally searched for all information about the three
loud booms that were heard and felt in Chongqing earlier. Then we
analyzed and interpreted the information and their interrelationship.
We found the following information:
(1) There were three loud booms.
(2) The booms were sufficient powerful that windows were shaking.
Certain drivers could even feel their cars vibrating on bridges.
Certain people felt the air move around them due to pressure waves.
(3) When the booms occurred, no eyewitness reported seeing any flying
objects in the sky
(4) An eyewitness reported seeing white smoke in the sky
(5) There were no apparent eyewitness report about anyone seeing an airplane
crashing, or being at the scene of a crash or seeing debris on the ground.
(6) Eyewitnesses reported airplanes taking off immediately after the booms
and many military vehicles on the road.
(7) The various government departments deny there is anything and they ask
the citizens not to be scared.
(8) The latest military announcement: "Xinhua from Chengdu on January 11:
With respect to the loud booms in Chongqing, the spokesperson for the
Chengdu military district air force training programme was interviewed by
the Xinhua military reporter and said that regular flight training took
place on January 8 with all activities ceasing by 17:26. All training
aircrafts landed safely and there were no safety problems during the
training."
(9) Mobile telephone communication was interrupted after the loud booms.
(10) American media said that there was anomalous electromagnetic phenomena
in Chongqing, and they found out that China had forced a flying saucer to
land.
Let us analyze the various explanations:
Theory 1: Military airplane crashReasons against
(1) Military aircraft training should not be taking place over a
high-density city because it incurs extra risk.
(2) Nobody spotted any military airplanes when the booms occurred
(3) If an military airplane crashed, there should not be three loud booms.
An incident with one loud boom would have caused the airplane to be split
into multiple parts.
(4) A midair explosion would have caused debris to scatter over a loud area,
but there are no debris reports.
(5) If a military airplane exploded midair, why is it necessary to sent a
large number of airplanes out to watch the skies?
(6) The military has stated that there was no military airplane crash.
In the past, whenever an airplane crashed, the military may not admit it but
they won't come out to deny it.
Conclusion: This theory is not valid
Theory 2: Sonic boom from a low-flying airplaneReasons against
(1) If a pilot flies this way over a densely populated city, it would be a
serious violation of discipline.
(2) There is a video clip on the Internet that shows the sonic boom when an
airplane passes over a ship on the seas. It seemed that the sound was
heard at the same time that the airplane was spotted. The sound of the
engine was also audible. This is inconsistent with the suddenness of
the Chongqing booms and the absence of visual detection of lying objects.
(3) It is doubtful whether the sonic boom from low-altitude flying could
cause buildings and cars to feel the tremor.
(4) If an airplane caused some sonic booms, why is necessary to create a
military alert afterwards?
Conclusion: This theory is not valid
Theory 3: The testing of an aerospace planeReason against
(1) Why is a dangerous aerospace plane being tested in densely populated
Chongqinq? This is totally unreasonable.
Conclusion: This theory is not valid
Theory 4: SU 27 were fighting intruding F22 jetsReasons against
(1) The intruding F22 jets should be detected by the coastline defense
already
(2) It would be very gutsy for a F22 jet to intrude into inland China
(3) If a F22 jet was shot down, it would be a major political incident since
international relationships are different today than several decades ago.
(4) There is no statements from the United States
Conclusion: This theory is not valid
Theory 5: The most likely explanationWe saw that the military got very nervous after the loud booms occurred
and their airplanes went into the air to keep guard. This proves
that the military knew something before the booms occurred and that
hostility could be involved. Who is the most likely hostile force?
The United States of America. We know that the American Dawn Goddess
can fly at very high altitude. But at that altitude, no booms would
result and guided missiles cannot reach it. Apart from the United
States, the only possibility is extraterrestrial flying saucers. So we
imagine the following scene took place:
At 3pm on the afternoon of January 8, a Chinese SU 27 was conducting routine
military training when the aircraft radar or the ground control radar or the
pilot spotted an unidentified flying object. The ground command center
ordered the aircraft to follow and lock on the UFO, which was warned to
identify itself. When no response came, the commander center ordered
the SU 27 to shoot the UFO down. During the chase, they passed over
the city of Chongqing.
The two loud booms are the sounds of the explosion of the two air-to-air
missiles fired by the SU 27, or else they are the sounds of the explosion of
ground-to-air anti-aircraft missiles, or else they are the sounds of the
flying saucer being hit, or else the flying saucer set off special equipment
that caused the ground to shake.
The third and last boom is the sound of the flying saucer falling on the
ground, or the successful escape of the flying saucer or the sound of a
third guided missile.
So what did the military do after the firefight?
(1) They immediately sent their airplanes into the sky.
(2) They sent ground troops out to seal the scene.
(3) Mobile telephony in the area was interrupted at the request of the
military to seal off information, or else the flying saucer caused the
disruption to occur. This interruption in telecommunications caused
the Americans to get curious. They have the capability to direct their
high-resolution spy satellites to aim at their air and hence discover that
China has forced a flying saucer to land.
(4) All eyewitnesses were told not to say anything.
(5) All government departments were ordered to say that it was not due to
artillery, or earthquake, or thunder, or civilian airplanes, and that the
citizens should not be scared.
(6) Please note that the Chengdu military district statement says: "All
training warplanes landed safely." This says that no airplanes were
shot down during the fight with the flying saucer. "There were no
safety problems during the training" but a fight with an UFO is obviously
not part of training.
(7) When a UFO is obtained, there is a lot of research values with respect
to materials, structure and propeller theory. Obviously, this must be
kept top secret and not publicized.
The above are my analyses which are intended purely for
entertainment. If they happen to coincide with the top secrets, then
it was through sheer lucky guessing.
Hong Kong SAR Chief Executive Donald Tsang arrived at the
scene of the accident about three hours later. The father of one of the
six killed by a drunk driver cried out aloud from the crowd: "Give me back my
son, Chief Executive! My son was killed by that big truck, Chief
Executive! Chief Executive! The driver was drunk! Punish him
severely! Severe punishment, Chief Executive, he killed my son! He
was drunk driving! You must not let him come back after only three
years!"
The uncle of the deceased also called out to Donald Tsang
from the crowd: "Mr. Tsang, give me back my relative!" Donald Tsang
walked up to him, held his hand and spoke to him. The uncle spoke with a
trembling voice: "Mr. Tsang, how can you explain this! What kind of job
does the Secretary for Transportation do? I am very scared! The
next time, the same driver is going to kill again." In his attempts to
respond, Mr. Tsang was interrupted many times.
The uncle continued: "He gets into a car accident and he has
to spend two year in jail. Then he comes back out again and gets into
another car accident! You have to suspend his driver's license
permanently. He was driving a heavy truck. Who is he going to kill
next? ... Ten years in jail not enough because five lives were involved!"
Although Donald Tsang explained that the law has been recently amended, the
uncle only got more agitated. He cried and said, "That was not your
relative. He was my nephew! How can you get him back for me!
Money is useless! I can give you the money and you give me back his
life!" Donald Tsang can only say "I can get you his life back, I am
sorry. There is no way! You are right! Nothing will ever be
enough. I agree with what you say!"
The uncle then aimed right at Donald Tsang: "You are the
leader of Hong Kong at a time when the economy is in a critical stage.
You are the leader. You are the Chief Executive, but you won't help!
The law is so simple, but you won't enact it. This was a heavy truck.
You can amend the law because it does not suit the times. When my
daughter is wrong, I tell her to change. You tell me that you want to do
your job well. Will you please do your job well, okay! Chief
Executive! I beg you. I get down on my knees to beg you, please!"
Then he got down on his knees in front of the Chief Executive. He said:
"You cannot be so lax with respect to those who work for you. The
Secretary of Transportation treats the law lightly. You must change!"
Donald Tsang explained: "The law is quite stern right now,
but if he wants to get drunk, then there is nothing doing!" The uncle
countered: "Then you ought to suspend his license. It would be
permanently!" This forced Donald Tsang to reply: "Yes! I agree
with what you say!" The uncle then pressed him: "So you agree with a new
legislation! Do it immediately! Convene a meeting! I don't
have another nephew! How can I accept this! All five of the
passengers are my brothers!" Donald Tsang could only sad: "I will try my
best to help. I will check the laws very carefully. The court will
follow up on this matter. I promise that I will do this."
Q1. At the moment, many reporters are worried and do not
dare to conduct incisive investigative reporting. What do you think are
the reasons?A. According to what I know, some media have decided that when they lose a
libel lawsuit, the reporter will be responsible for paying the compensation.
Under such circumstances, any reporter doing exposÚs and
watchdog journalism must be treading on thin ice. Therefore, we are
seeing more scenes of prosperity and hearing songs of praises.
Alternately, we are reading reports that skirt the issues. We got
so-called critical reports in the tainted milk powder cases in which the
reporters didn't even dare to name "Sanlu."
Q2. In a series of related cases during
2008, are now being arrested for "suspicion of taking bribes" whereas they
used to be "suspected of committed libel" before. What is the reason?A. When state governments and officials need to counter critical oversight
and watchdog journalism, it is an effective step to accuse the reporter of
"accepting bribes."
Q3. How you view the discussions that
were triggered by the arrest of reporters for "suspected bribe-taking"?A. This is a truly worrisome phenomenon: whenever a reporter files a
watchdog report, he will objectively be defending the rights of certain
interest groups. Certain cynical people will think that he "received
certain advantages in order to obtain interest for certain persons."
This satisfies the requirements for bribe-taking.
Q4. Some journalism scholars believe that
"when a reporter received some advantages, he has committed the crime of
bribery." Do you think so?A. I think that this fully shows the "pan-moral" way of thinking, in which
there is no justification for a reporter to accept anything. Actually,
the crime of bribery depends on whether the person (who is usually a state
employee) is engaged in "official business." If journalistic activities
such as interviewing and reporting are "official business," then surely
refusals to be interviewed, or interfering with news gathering, or using
"public relations" to kill off negative stories must all be classified as
crimes of "interfering with the conduct of official business." This is
obviously unjustified. Reporters are not state workers, which means that
they cannot be the subject of bribery. Therefore, there is no bribery.
Q5. Concerning the "paid news stories"
that abound nowadays, should laws be enacted to ban reporters from receiving
benefits?A: It is not necessary. No matter how well-intended the laws may be
to ban reporters from receiving benefits from the subjects of interviews, the
goals are hard to realize. On the contrary, it may have all sorts of bad
consequences.
Q6. Why is that?A: I study media laws. I have never seen any country criminalizing
the act of reporters receiving benefits. I have never seen any country's
prosecutors charging reporters with taking bribes.
Q7. If reporters can take bribes to
produce "paid reporting" or "paid non-reporting," aren't the bad reporters
being given a free hand?A: This can be dealt with by industry self-discipline. We should
trust this piece of commonsense: A reporter with lousy professional ethics
will not be accepted by the industry. Most reporters will stick to good
professional ethics and not fool around with their professional careers.
Q8. Why is there chaos now which no
longer exist in western journalism anymore?A: This is a symptom of the state of ill health within our journalism
industry. But it can also be said that this was bound to happen whenever
society is undergoing rapid big changes.
Q9. In your people, how can things be
cleaned up in the absence of legislation?A: The media market should be opened up even more. Private capital
should be allowed to be invested in media companies including roles in
operations. When the media companies become genuine market
sovereignties, market competition will regulate media behavior. It is
useless otherwise even if you criminalize the activities by legislation.
Q10. What are the revelations of this
string of incidents for us?A: First all, we must put the Constitution into effect, and provide legal
protection for the reporters as citizens in accordance with the law.
Secondly, we must restrain the powers of the state organizations and workers
to protect civil rights. I understand that the Xifeng incident is being
treated as an important case study during cadre training. I think that
this should not be about letting officials learn how to face the media and the
public and resolve the public relations crisis. This should be about
teaching them to learn how to properly handle the criticisms, complaints,
charges and denunciations and to properly deal with expectations and
supervision.
In my father's new book, he mentioned certain little
secrets in the fight between himself and Frank Hsieh. Although these
matters are quite familiar to me, this whole thing has become something of a
Rashomon, for which I feel wistful and resentful.
My father is absolutely telling the truth, but he is
speaking out too late. Today, the principals can deny everything.
Who cares about a former president in trouble when there are political
interests at stake? If he wanted to talk about it, he should have done
so when he was at the peak of his powers. I can fully understand the
resentment that my father feels. There are two other matters which my
father told me not to speak out. But if my father is going die without
being at peace with himself, he might as well as write down the truth
instead of bringing it into his grave.
Firstly, during the 2008 presidential election, Frank
Hsieh suddenly called up my father one day. He said that he had just
suffered a mild stroke. But he was afraid to seek treatment because it
could affect his campaign negatively. Then he stayed out of sight for
a while and lied that he had injured his leg. He was lucky because the
stroke only caused weakness in one leg. Thus, he was able to lie his
way through. However, he was in poor physical shape and his campaign
was listless for that reason. In retrospect, if he wasn't so selfish
and he ceded the candidacy to Su Tseng-chang, the Democratic Progressive
Party may have lost but not in such a rout. Afterwards, I saw him
insisting that his physical health was normal during a television interview.
This really makes me sigh with emotion.
Secondly, I had said at the time that everybody within the
Democratic Progressive Party took money from my father. Afterwards,
people swore that they did not take a cent. This kind of talk makes me
totally contemptuous of these people. Simply put, my father gave more
than the maximum limit on political contribution and the people who took the
money never filed accurate reports. The excess money has gone to who
knows where, and therefore they had to swear that they did not take a cent.
Back then, the Democratic Progressive Party had an
election campaign advertisement that moved me every time that I saw it.
It was about the Formosa magazine era. There was the silhouette of a
prisoner and a photo of the defendant's lawyer. It was a dark era back
then, but everybody still had ideals and dreams. Today, everybody
wants to get away. In order to cover up their own mistakes, they lie,
they make up stories, they give up their ideals and they sell their souls.
I have never been locked up before. I cannot
understand why people are willing to sell themselves out because of the fear
of being locked up. I also hope for my father: "Even though the path
ahead is dark, I hope that you will not abandon your initial ideals.
Even though your involvement politics brought many setbacks to our family,
you have the strength to continue. In my heart, I will be proud of you
forever."
Based upon my understanding, the so-called "human flesh
serach" is to use the force of netizens to expose certain facts that were
previously unknown. By its nature, it is no different from the verbal
communication in our daily lives. The search is conducted by
individual netizens. However, the open nature of the Internet means
that the search results can become public information in an instant.
Compared to the self-restraints proposed by netizens in
the "human flesh search treaty," the local laws enacted by the People's
Congress of Xuzhou city "against human flesh search" not only showed a
failure to understand the nature of the problem, they also defy commonsense
with respect to the Internet. Given the open nature of the Internet
and the size of the netizen population, how can a city ban "human flesh
search" on its own? People outside of Xuzhou can continue to run
"human flesh searches" on people and things in Xuzhou.
"Human flesh search" certain needs to be regulated, but to
ban or eliminate "human flesh searches" is to a large extent a false issue.
When Xuzhou city enacted the law to ban "human search engine," we can just
laugh it off and pay it no mind. But what really deserves our
attention is that the Xuzhou city People's Congress wanted to punish people
for their transgressions by banning them from accessing the Internet for six
months."
This is probably unheard of to prohibit someone from
accessing the Internet as punishment. For now, let us not even worry
about whether this is feasible. This policy of banning Internet access
is ten times more absurd as banning "human flesh searches." In the
Internet era, this kind of ban is a ban on the citizens' right to know about
public information, as well as their right to speak about their views on
various policies and public issues. It is also a ban on the right to
be entertained, the right to communicate with others and so on.
Therefore, this is an absolute violation of personal freedom. I do not
believe that a local People's Congress has the right to deprive the
citizens' right for Internet access. |
Q:
Rounded corners in ggplot2?
This feels like it has to be possible, but I cannot figure out if I can do it relatively simply in a theme() or have to dig deeper.
I would like to round the corners on the plot areas of my ggplot2 plots. How would I go about doing that?
Question inspired by: https://twitter.com/Hoog10HK/status/951305194809143296
A:
You can replace the background grob with a round rectangle:
library(ggplot2)
library(grid)
# make a plot with blue background
p <- ggplot(iris, aes(Sepal.Length, Sepal.Width)) + geom_point() +
theme(plot.background = element_rect(fill = "#C4E7FF"),
panel.background = element_blank(),
plot.margin = margin(20, 20, 20, 20))
# switch out background grob
g <- ggplotGrob(p)
bg <- g$grobs[[1]]
round_bg <- roundrectGrob(x=bg$x, y=bg$y, width=bg$width, height=bg$height,
r=unit(0.1, "snpc"),
just=bg$just, name=bg$name, gp=bg$gp, vp=bg$vp)
g$grobs[[1]] <- round_bg
# draw both plots side by side
cowplot::plot_grid(p, g, labels = c("rectangular", "rounded"),
scale = 0.85, hjust = 0.5, label_x = 0.5)
The same trick could be applied to the panel background, legend background, etc., if you wanted other aspects of the plot to be rounded.
|
--
-- Licensed to the Apache Software Foundation (ASF) under one
-- or more contributor license agreements. See the NOTICE file
-- distributed with this work for additional information
-- regarding copyright ownership. The ASF licenses this file
-- to you under the Apache License, Version 2.0 (the
-- "License"); you may not use this file except in compliance
-- with the License. You may obtain a copy of the License at
--
-- http://www.apache.org/licenses/LICENSE-2.0
--
-- Unless required by applicable law or agreed to in writing, software
-- distributed under the License is distributed on an "AS IS" BASIS,
-- WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-- See the License for the specific language governing permissions and
-- limitations under the License.
--
select YEAR_START, count(*) as cnt, min(EXPERIENCE) as min_exp from STREAMING_V2_USER_INFO_TABLE group by YEAR_START |
{"whToggleConfig":{"cardsList":{}},"enableGeolocation":false,"fragmentIdMap":{"c4":{"uuid":"44e446c9-4d5b-4b48-a7b7-ee91bb1f6705","section_title":"Categories","content":{"categoryList":[{"count":138,"friendlyName":"Beauty & Spas","friendlyNameShort":"Beauty & Spas","id":"beauty-and-spas","chain":["beauty-and-spas"],"slug":"beauty-and-spas","uuid":"beauty-and-spas","shortName":"Beauty & Spas","level":0,"isHighlighted":false,"isParent":false,"isChild":false},{"count":82,"friendlyName":"Massage","friendlyNameShort":"Massage","id":"massage","chain":["beauty-and-spas","massage"],"slug":"massage","uuid":"massage","shortName":"Massage","level":1,"isHighlighted":false,"isParent":false,"isChild":false},{"count":6,"friendlyName":"All Hot Stone","friendlyNameShort":"Hot Stone","id":"hot-stone-massage","chain":["beauty-and-spas","massage","hot-stone-massage"],"slug":"hot-stone-massage","uuid":"hot-stone-massage","shortName":"Hot Stone","level":2,"isHighlighted":true,"isParent":true,"isChild":false},{"count":15,"friendlyName":"Full Body Massage","friendlyNameShort":"Full Body Massage","id":"full-body-massage","chain":["beauty-and-spas","massage","full-body-massage"],"slug":"full-body-massage","uuid":"full-body-massage","shortName":"Full Body Massage","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":11,"friendlyName":"Sports","friendlyNameShort":"Sports","id":"sports-massage","chain":["beauty-and-spas","massage","sports-massage"],"slug":"sports-massage","uuid":"sports-massage","shortName":"Sports","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":6,"friendlyName":"Deep Tissue","friendlyNameShort":"Deep Tissue","id":"deep-tissue-massage","chain":["beauty-and-spas","massage","deep-tissue-massage"],"slug":"deep-tissue-massage","uuid":"deep-tissue-massage","shortName":"Deep Tissue","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":5,"friendlyName":"Swedish","friendlyNameShort":"Swedish","id":"swedish-massage","chain":["beauty-and-spas","massage","swedish-massage"],"slug":"swedish-massage","uuid":"swedish-massage","shortName":"Swedish","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":3,"friendlyName":"Reflexology","friendlyNameShort":"Reflexology","id":"reflexology","chain":["beauty-and-spas","massage","reflexology"],"slug":"reflexology","uuid":"reflexology","shortName":"Reflexology","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":1,"friendlyName":"Thai","friendlyNameShort":"Thai","id":"thai-massage","chain":["beauty-and-spas","massage","thai-massage"],"slug":"thai-massage","uuid":"thai-massage","shortName":"Thai","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":1,"friendlyName":"Couples","friendlyNameShort":"Couples","id":"couples-massage","chain":["beauty-and-spas","massage","couples-massage"],"slug":"couples-massage","uuid":"couples-massage","shortName":"Couples","level":2,"isHighlighted":false,"isParent":false,"isChild":false},{"count":63,"friendlyName":"Spas","friendlyNameShort":"Spas","id":"spa","chain":["beauty-and-spas","spa"],"slug":"spa","uuid":"spa","shortName":"Spas","level":1,"isHighlighted":false,"isParent":false,"isChild":false},{"count":2,"friendlyName":"Skin Care","friendlyNameShort":"Skin Care","id":"skin-care","chain":["beauty-and-spas","skin-care"],"slug":"skin-care","uuid":"skin-care","shortName":"Skin Care","level":1,"isHighlighted":false,"isParent":false,"isChild":false}],"selectedUUID":"ea2ebf3b-fbd9-46f4-b8c8-a16527564ce3","locationURL":"rochdale","category":{"guid":"ea2ebf3b-fbd9-46f4-b8c8-a16527564ce3","depth":0,"uuidPath":["c09790ba-a6b9-40fc-ad81-4cdf25260b5e","294ea30b-dd37-49a1-9805-e9e6c7617902","8e89c6d5-bc8a-48ad-8cf0-3a675f651009"],"name":"Hot Stone","shortName":null,"singular":null,"plural":null,"permalink":"hot-stone-massage","seo_name":null,"root":{"guid":null,"depth":0,"uuidPath":null,"name":"Local","shortName":null,"singular":null,"plural":null,"permalink":"local","seo_name":null,"root":null,"chain":null},"chain":["beauty-and-spas","massage","hot-stone-massage"],"id":"hot-stone-massage"},"locale":"en_GB","local":"/vouchers","i18n":{"locale":"en_GB","country":"GB","brandId":"groupon","translations":{"modules":{"wh_templates_controller":null}},"scope":"modules.wh_templates_controller"}}},"c9":{"uuid":"323f3e91-1504-49f1-8360-b650fdb5fd5f","content":{"category":"Hot Stone Massage","locationName":"Rochdale","categoryLinks":{"links":[{"anchorText":"Hot Stone in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/hot-stone-massage","indexed":true},{"anchorText":"Full Body Massage in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/full-body-massage","indexed":true},{"anchorText":"Beauty & Spas in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/beauty-and-spas","indexed":true},{"anchorText":"Reflexology in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/reflexology","indexed":true},{"anchorText":"Deep Tissue in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/deep-tissue-massage","indexed":true},{"anchorText":"Sports in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/sports-massage","indexed":true},{"anchorText":"Massage in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/massage","indexed":true},{"anchorText":"Swedish in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/swedish-massage","indexed":true},{"anchorText":"Foot in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/foot-massage","indexed":true},{"anchorText":"Thai in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/thai-massage","indexed":true}],"listHeading":"Popular Searches","tag":"CrosslinksCategoryLink"},"geoLinks":{"links":[{"anchorText":"Cosmetic Procedures in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/cosmetic-procedures","indexed":true},{"anchorText":"Full Body Massage in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/full-body-massage","indexed":true},{"anchorText":"Beauty & Spas in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/beauty-and-spas","indexed":true},{"anchorText":"Nails in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/nail-salon","indexed":true},{"anchorText":"Hair Removal in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/hair-removal","indexed":true},{"anchorText":"Hair Removal in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/hair-removal","indexed":true},{"anchorText":"Hair in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/hairdressers","indexed":true},{"anchorText":"Massage in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/massage","indexed":true},{"anchorText":"Cosmetic Procedures in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/cosmetic-procedures","indexed":true},{"anchorText":"Hair in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/hairdressers","indexed":true},{"anchorText":"Foot in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/foot-massage","indexed":true},{"anchorText":"Salons in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/salon","indexed":true}],"listHeading":"Searches Nearby","tag":"CrosslinksGeoLink"},"columnLayout":"two-up"}},"c5":{"uuid":"e62c6513-ed49-4d92-893b-f813e4a45b64","content":{"locale":"en_GB","rapi":[{"uuid":"6e060077-98b3-4fc1-a871-28da6ff407d5","dealUrl":"https://www.groupon.co.uk/deals/nikki-leigh-studio-2","grid4ImageUrl":"https://img.grouponcdn.com/deal/MuBpUNWy7iZ5dYm7aTdbTL9oZdB/Mu-1200x720/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/MuBpUNWy7iZ5dYm7aTdbTL9oZdB/Mu-1200x720/v1/t440x300.jpg","title":"Choice of 30-Minute or 60-Minute Massage at Nikki-Leigh Studio (Up to 53% Off)","announcementTitle":"Choice of 30-Minute Massage","shortAnnouncementTitle":"Choice of 30-Minute Massage","badges":[{"uuid":"84fbb816-3fec-4693-b0a6-ec2f9fb4e400","primaryColor":"#6650D7E6","text":"TRENDING","secondaryColor":"#FFFFFFFF","mustDisplay":false,"badgeType":"TRENDING","displayLocation":"RIBBON","iconImageUrl":"https://img.grouponcdn.com/ums/39VVa8PrANEVKdpMVm1uN6RbmEj6/Trending-32x22"}],"redemptionLocation":"Shaw","merchant":{"id":"nikki-leigh-studio","uuid":"6f1b66bd-506d-4d06-acf0-4c40dc887e2f","name":"Nikki-Leigh Studio","websiteUrl":"http://www.nikkileighstudio.co.uk","recommendations":[{"ratingDistribution":{"1":1,"2":2,"3":2,"4":3,"5":38},"rating":4.63,"source":"groupon-users","totalMessage":"46","percentMessage":"93","prominentDisplay":true,"total":46,"percent":93}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":53,"minimumPurchaseQuantity":1,"price":{"amount":1400,"currencyCode":"GBP","formattedAmount":"£14","currencyExponent":2},"value":{"amount":3000,"currencyCode":"GBP","formattedAmount":"£30","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"d00332d9-4e9f-4ab0-9553-023cf9aeb6fe","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":30,"soldQuantityMessage":"30+","locations":[{"uuid":"d510cefe-3cd6-b06a-9299-0152ebd8dfcb","id":null,"lng":-2.098102,"lat":53.5841196,"distance":3.3084684604888195,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers can have tense muscles worked on in a choice of massage methods for 30 or 60 minutes</p>"}],"features":{"showFullTitle":true,"captionPadding":true,"showPriceBadging":true,"showStarRatingsOnDealCard":true},"isTouch":false}},"c1":{"uuid":"d84fc92a-f86d-4bdb-9974-443eb90a277a","content":{"parents":[{"url":"https://www.groupon.co.uk/vouchers","anchor":"Vouchers"},{"url":"https://www.groupon.co.uk/vouchers/england","anchor":"England"},{"url":"https://www.groupon.co.uk/vouchers/rochdale","anchor":"Rochdale"},{"url":"https://www.groupon.co.uk/vouchers/rochdale/beauty-and-spas","anchor":"Beauty & Spas"},{"url":"https://www.groupon.co.uk/vouchers/rochdale/massage","anchor":"Massage"},{"url":"https://www.groupon.co.uk/vouchers/rochdale/hot-stone-massage","anchor":"Hot Stone"}],"pageUrl":"https://www.groupon.co.uk/vouchers/rochdale/hot-stone-massage","pageName":"Hot Stone","pageType":"local-category-serp","keywordPage":null,"location":{"uuid":"71549723-6521-4f11-80ff-13cf7b9937ab","searchLocale":"en_GB","name":"Rochdale","fullName":"Rochdale, England","shortName":"Rochdale","localName":"Rochdale","type":"city","url":"rochdale","timeZone":"Europe/London","attributes":{},"center":{"lat":53.61766,"lng":-2.1552},"lat":53.61766,"lng":-2.1552},"category":{"uuid":"ea2ebf3b-fbd9-46f4-b8c8-a16527564ce3","name":"Hot Stone","shortName":"Hot Stone","singular":"Hot Stone Massage","plural":"Hot Stone Massages","url":"hot-stone-massage","path":["beauty-and-spas","massage","hot-stone-massage"],"uuidPath":["c09790ba-a6b9-40fc-ad81-4cdf25260b5e","294ea30b-dd37-49a1-9805-e9e6c7617902","8e89c6d5-bc8a-48ad-8cf0-3a675f651009"]},"showPage":true,"showKeywords":false,"links":[{"href":"https://www.groupon.co.uk/vouchers","anchor":"Vouchers","bloodhound":"breadcrumbs-2","hideForMobile":true},{"href":"https://www.groupon.co.uk/vouchers/england","anchor":"England","bloodhound":"breadcrumbs-3","hideForMobile":true},{"href":"https://www.groupon.co.uk/vouchers/rochdale","anchor":"Rochdale","bloodhound":"breadcrumbs-4","hideForMobile":false},{"href":"https://www.groupon.co.uk/vouchers/rochdale/beauty-and-spas","anchor":"Beauty & Spas","bloodhound":"breadcrumbs-5","hideForMobile":true},{"href":"https://www.groupon.co.uk/vouchers/rochdale/massage","anchor":"Massage","bloodhound":"breadcrumbs-6","hideForMobile":false},{"href":"https://www.groupon.co.uk/vouchers/rochdale/hot-stone-massage","anchor":"Hot Stone","bloodhound":"breadcrumbs-7","hideForMobile":true}],"localHome":"/vouchers"}},"c3":{"uuid":"e6a8e3d3-ca91-4a83-bda8-0bb0593c0c5d","content":{}},"c6":{"uuid":"ed7b4aac-d8e0-4b13-988d-5c94e28d27be","content":{"locale":"en_GB","rapi":[{"uuid":"1ac20951-e580-40a5-9e6b-cdb210e1ea7a","dealUrl":"https://www.groupon.co.uk/deals/jadore-beauty-and-more-3","grid4ImageUrl":"https://img.grouponcdn.com/iam/4GsShBFcbsfS7raWZmubHgPC4kZ4/4G-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/4GsShBFcbsfS7raWZmubHgPC4kZ4/4G-2048x1229/v1/t440x300.jpg","title":"30- or 60-Minute Hot Stone Couples Massage at Jadore Beauty and More (Up to 56% Off)","announcementTitle":"30-Minute Hot Stone Couples Massage","shortAnnouncementTitle":"30-Minute Hot Stone Couples Massage","badges":[{"uuid":"84fbb816-3fec-4693-b0a6-ec2f9fb4e400","primaryColor":"#6650D7E6","text":"TRENDING","secondaryColor":"#FFFFFFFF","mustDisplay":false,"badgeType":"TRENDING","displayLocation":"RIBBON","iconImageUrl":"https://img.grouponcdn.com/ums/39VVa8PrANEVKdpMVm1uN6RbmEj6/Trending-32x22"}],"redemptionLocation":"Huddersfield","merchant":{"id":"jadore-beauty-and-more","uuid":"66a28b88-f703-460e-bc7a-d6c2e1bb04ca","name":"Jadore Beauty and More","websiteUrl":"https://app.shedul.com/online_bookings/84348/link","recommendations":[{"ratingDistribution":{"1":8,"2":4,"3":16,"4":28,"5":92},"rating":4.3,"source":"groupon-users","totalMessage":"148","percentMessage":"92","prominentDisplay":true,"total":148,"percent":92}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":52,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":4000,"currencyCode":"GBP","formattedAmount":"£40","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"d8c1b9c9-e65f-4778-83fe-eaeb6634df57","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":390,"soldQuantityMessage":"390+","locations":[{"uuid":"153e7540-5816-b6fc-710c-015ba150f675","id":null,"lng":-1.7841267,"lat":53.6455178,"distance":15.330054663718572,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Relax and unwind with a 30- or 60-minute hot stone massage designed to soothe sore muscles and improve circulation</p>"},{"uuid":"d3496d2a-c72c-4811-96e5-953ad23ff8fc","dealUrl":"https://www.groupon.co.uk/deals/brown-cow-salon-5-24478715","grid4ImageUrl":"https://img.grouponcdn.com/deal/5v8ctJJhfPNekHNQSd1T/Uz-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/5v8ctJJhfPNekHNQSd1T/Uz-2048x1229/v1/t440x300.jpg","title":"Hot Stone Massage Plus Facial For One or Two from £19 at Brown Cow Salon (Up to 60% Off)","announcementTitle":"Hot Stone Massage Plus Facial","shortAnnouncementTitle":"Hot Stone Massage Plus Facial","badges":[{"uuid":"84fbb816-3fec-4693-b0a6-ec2f9fb4e400","primaryColor":"#6650D7E6","text":"TRENDING","secondaryColor":"#FFFFFFFF","mustDisplay":false,"badgeType":"TRENDING","displayLocation":"RIBBON","iconImageUrl":"https://img.grouponcdn.com/ums/39VVa8PrANEVKdpMVm1uN6RbmEj6/Trending-32x22"}],"redemptionLocation":"Bolton","merchant":{"id":"brown-cow-salon","uuid":"20bcf3c7-5ff2-5277-b69e-49cd853183ed","name":"Brown Cow Salon","websiteUrl":"http://www.browncowsalon.com","recommendations":[{"ratingDistribution":{"1":7,"2":2,"3":2,"4":8,"5":21},"rating":3.85,"source":"groupon-users","totalMessage":"40","percentMessage":"78","prominentDisplay":false,"total":40,"percent":78}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":59,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":4600,"currencyCode":"GBP","formattedAmount":"£46","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"da319e3f-2a9e-42ca-a3f8-69288daa50f7","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":940,"soldQuantityMessage":"940+","locations":[{"uuid":"38aaf3c3-6e63-b06a-9052-013e687d6da3","id":null,"lng":-2.4441298,"lat":53.5943609,"distance":11.978141463957266,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>A one-hour session will see heated stones relieve stress, and can be booked until 8pm on Thursday and Friday evenings</p>"},{"uuid":"97d79ee0-f7cb-4ce2-b165-6900683431ce","dealUrl":"https://www.groupon.co.uk/deals/cahm-therapies-1","grid4ImageUrl":"https://img.grouponcdn.com/deal/2c3m5zBo2eVUParLvW8YU4CpLSqh/2c-6000x3593/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/2c3m5zBo2eVUParLvW8YU4CpLSqh/2c-6000x3593/v1/t440x300.jpg","title":"Choice of One-Hour Massage with an Optional Facial Massage, or a Massage Package at Cahm Therapies (Up to 37% Off*)","announcementTitle":"One-Hour Massage","shortAnnouncementTitle":"One-Hour Massage","redemptionLocation":"Greater Manchester","merchant":{"id":"cahm-therapies","uuid":"b7bf1556-63ed-407b-a99d-a1dcb4831b3e","name":"Cahm Therapies","websiteUrl":"http://www.cahmtherapies.com","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":1,"4":3,"5":20},"rating":4.79,"source":"groupon-users","totalMessage":"24","percentMessage":"100","prominentDisplay":true,"total":24,"percent":100}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":0,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"477abfeb-a263-462d-9307-5867d0d3cff2","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":170,"soldQuantityMessage":"170+","locations":[{"uuid":"5f3f48fb-4a34-b04c-3266-015b35d61520","id":null,"lng":-2.2990334,"lat":53.59261369999999,"distance":6.1666227413128745,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Clients can be pampered with a one-hour massage, opt to include a facial massage, or combine an Indian head massage with Reflexology</p>"},{"uuid":"17ff938c-1934-40b7-83b4-8659a4ea0a59","dealUrl":"https://www.groupon.co.uk/deals/crystal-holistic-and-beauty-2","grid4ImageUrl":"https://img.grouponcdn.com/iam/2FqWyFDNCuh4kHHbvAPrP3C5uH19/2F-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/2FqWyFDNCuh4kHHbvAPrP3C5uH19/2F-2048x1229/v1/t440x300.jpg","title":"One-Hour Hot Stone Massage at Crystal Holistic And Beauty (46% Off)","announcementTitle":"One-Hour Hot Stone Massage","shortAnnouncementTitle":"One-Hour Hot Stone Massage","redemptionLocation":"Stockport","merchant":{"id":"crystal-holistic-and-beauty","uuid":"050c3386-4331-4451-abc7-fda1afa340e3","name":"Crystal Holistic And Beauty","websiteUrl":"https://www.facebook.com/pg/crystalholisticandbeauty/about/?ref=page_internal","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":0,"4":0,"5":4},"rating":5,"source":"groupon-users","totalMessage":"4","percentMessage":"100","prominentDisplay":true,"total":4,"percent":100}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":46,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":3500,"currencyCode":"GBP","formattedAmount":"£35","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"6b3eb1dc-6be3-42a2-b173-cadfb15ad136","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":20,"soldQuantityMessage":"20+","locations":[{"uuid":"f61578c4-07f8-b1fa-d5e8-0166eddeb518","id":null,"lng":-2.2143727,"lat":53.39509529999999,"distance":15.610378506852681,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers may enjoy one-hour hot stone massage that aims to ease muscle tension and influence the body’s energy flow</p>"},{"uuid":"557ab998-de31-4a50-be6d-14913994cfed","dealUrl":"https://www.groupon.co.uk/deals/yorkshire-beauty-2","grid4ImageUrl":"https://img.grouponcdn.com/iam/4JrE9w9yG7t9nHsmhmgRUhGRzJCq/4J-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/4JrE9w9yG7t9nHsmhmgRUhGRzJCq/4J-2048x1229/v1/t440x300.jpg","title":"Aromatherapy Back, Neck and Head Massage with Optional Facial, or Full-Body Massage at Yorkshire Beauty (Up to 50% Off)","announcementTitle":"Back, Neck and Head Massage","shortAnnouncementTitle":"Back, Neck and Head Massage","redemptionLocation":"Leeds and Bradford","merchant":{"id":"yorkshire-beauty","uuid":"1a6e8c39-ff1d-4b64-8e5a-2ee52b89c65d","name":"Yorkshire Beauty","websiteUrl":"http://www.yorkshirebeauty.co.uk","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":0,"4":1,"5":7},"rating":4.88,"source":"groupon-users","totalMessage":"8","percentMessage":"100","prominentDisplay":true,"total":8,"percent":100}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":25,"minimumPurchaseQuantity":1,"price":{"amount":1495,"currencyCode":"GBP","formattedAmount":"£14.95","currencyExponent":2},"value":{"amount":2000,"currencyCode":"GBP","formattedAmount":"£20","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"709d12fd-b438-46ea-9e4b-b60095c56875","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":120,"soldQuantityMessage":"120+","locations":[{"uuid":"8e695bff-2515-b6fc-710c-015b8b68aee4","id":null,"lng":-1.72772,"lat":53.7774349,"distance":20.68284605850868,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Indulge in an aromatherapy back, neck and head massage with an optional moisturising facial or opt for a choice of full-body treatment</p>"},{"uuid":"b510f50a-3516-4495-9ee8-af83f792906a","dealUrl":"https://www.groupon.co.uk/deals/adorez-10","grid4ImageUrl":"https://img.grouponcdn.com/iam/V38Zz77haP2ks6QUKSL5EQ268ML/V3-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/V38Zz77haP2ks6QUKSL5EQ268ML/V3-2048x1229/v1/t440x300.jpg","title":"Hot Stone Massage Plus Facial and Optional Indian Head Massage at Adorez (Up to 56% Off)","announcementTitle":"Hot Stone Massage Plus Facial","shortAnnouncementTitle":"Hot Stone Massage Plus Facial","redemptionLocation":"East Didsbury, Greater Manchester","merchant":{"id":"adorez","uuid":"aaba0d03-2403-3f17-31fa-6244d5428c6b","name":"Adorez","websiteUrl":"https://www.facebook.com/adorezlaserandbeauty/","recommendations":[{"ratingDistribution":{"1":5,"2":1,"3":2,"4":8,"5":8},"rating":3.54,"source":"groupon-users","totalMessage":"24","percentMessage":"75","prominentDisplay":false,"total":24,"percent":75}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":47,"minimumPurchaseQuantity":1,"price":{"amount":2100,"currencyCode":"GBP","formattedAmount":"£21","currencyExponent":2},"value":{"amount":3950,"currencyCode":"GBP","formattedAmount":"£39.50","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"7de93e63-c113-445f-9089-4b2e6f1b7e2f","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":460,"soldQuantityMessage":"460+","locations":[{"uuid":"77050fa2-577e-b06a-9053-014d2f04787a","id":null,"lng":-2.2572326,"lat":53.4082338,"distance":15.106370129309749,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers can treat themselves to some special attention with a hot stone massage and facial plus an optional Indian head massage</p>"},{"uuid":"24ca2f48-5b45-4d6c-ad6c-c7346dd91743","dealUrl":"https://www.groupon.co.uk/deals/elegance-hair-and-beauty-uk-9","grid4ImageUrl":"https://img.grouponcdn.com/iam/3xoaKGa63nMmHHYyc8vjin6wdgaX/3x-2048x1228/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/3xoaKGa63nMmHHYyc8vjin6wdgaX/3x-2048x1228/v1/t440x300.jpg","title":"60-Minute Deep Tissue and Hot Stone Massage for One or Two at Elegance Hair and Beauty UK","announcementTitle":"60-Minute Massage","shortAnnouncementTitle":"60-Minute Massage","redemptionLocation":"Manchester","merchant":{"id":"elegance-hair-and-beauty-uk","uuid":"3046127b-b911-5560-7f7d-c1978352e796","name":"Elegance Hair and Beauty","websiteUrl":"http://www.elegancehairnbeauty.com/","recommendations":[{"ratingDistribution":{"1":8,"2":7,"3":8,"4":20,"5":36},"rating":3.87,"source":"groupon-users","totalMessage":"79","percentMessage":"81","prominentDisplay":false,"total":79,"percent":81}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":0,"minimumPurchaseQuantity":1,"price":{"amount":1995,"currencyCode":"GBP","formattedAmount":"£19.95","currencyExponent":2},"value":{"amount":1995,"currencyCode":"GBP","formattedAmount":"£19.95","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"074ca008-3403-41bd-9d6b-4dd1d3325f08","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"deea3d14-4472-b06a-9298-01439394c5fc","id":null,"lng":-2.242838,"lat":53.421315,"distance":14.075924467822064,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>A relaxing session for one or two people includes a deep tissue and hot stone massage which helps to relieve tension</p>"},{"uuid":"40516f69-f67e-4971-9d4c-1ebabdf4645f","dealUrl":"https://www.groupon.co.uk/deals/e-careers-lifestyle-25","grid4ImageUrl":"https://img.grouponcdn.com/bynder/33NBDBJRrZoPGEWBDznNQJEZsRei/33-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/bynder/33NBDBJRrZoPGEWBDznNQJEZsRei/33-2048x1229/v1/t440x300.jpg","title":"Online Course: Remedial or Hot Stone Massage or Massage Therapy from E-Careers Lifestyle (Up to 91% Off)","announcementTitle":"Massage Online Course","shortAnnouncementTitle":"Massage Online Course","redemptionLocation":null,"merchant":{"id":"e-careers-com-uk","uuid":"a9c768cb-e8ac-4238-b9cb-a5cc213afe07","name":"E-Careers Lifestyle","websiteUrl":"https://www.e-careers.courses/","recommendations":[{"ratingDistribution":{"1":1,"2":0,"3":2,"4":1,"5":4},"rating":3.88,"source":"groupon-users","totalMessage":"8","percentMessage":"88","prominentDisplay":true,"total":8,"percent":88}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":90,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":20000,"currencyCode":"GBP","formattedAmount":"£200","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"7533fb1c-160b-4d4a-8e77-ede6e51c4e7a","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":10,"soldQuantityMessage":"10+","locations":[],"highlightsHtml":"<p>Customers can learn about a remedial or hot stone massage or opt for a massage therapy online course</p>"},{"uuid":"e690f8ec-b32d-8148-8027-fade7267877d","dealUrl":"https://www.groupon.co.uk/deals/butterflies-beauty-holistic-therapy-2-4","grid4ImageUrl":"https://img.grouponcdn.com/deal/fJYDXoyyzabbLHc8UC6L/Zj-1000x600/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/fJYDXoyyzabbLHc8UC6L/Zj-1000x600/v1/t440x300.jpg","title":"Hot-Stone Massage Plus Facial (£21) and Head Massage (£24) at Butterflies Beauty & Holistic Therapy (Up to 79% Off)","announcementTitle":"Hot-Stone Massage Plus Facial","shortAnnouncementTitle":"Hot-Stone Massage Plus Facial","redemptionLocation":"Manchester","merchant":{"id":"butterflies-beauty-holistic-therapy","uuid":"19fa170f-595a-25e5-1d85-86afad3b6ac3","name":"Butterflies Beauty & Holistic Therapy","websiteUrl":"http://www.butterfliesbeautyholistic.co.uk","recommendations":[{"ratingDistribution":{"1":1,"2":3,"3":3,"4":7,"5":52},"rating":4.61,"source":"groupon-users","totalMessage":"66","percentMessage":"94","prominentDisplay":true,"total":66,"percent":94}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":75,"minimumPurchaseQuantity":1,"price":{"amount":2100,"currencyCode":"GBP","formattedAmount":"£21","currencyExponent":2},"value":{"amount":8500,"currencyCode":"GBP","formattedAmount":"£85","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"f7aa5e99-3143-4ae3-8ba0-e76d2a2c2c0c","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"34d67d91-3a50-b06a-768a-0141a4eb8f79","id":null,"lng":-2.2660967,"lat":53.4395942,"distance":13.158436378920337,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>A 30-minute Icelandic basalt hot-stone massage plus a deep cleansing, hydrating facial can relax bodies and refresh skin</p>"},{"uuid":"1dc6889e-99a9-4d6c-8485-4266ced421a8","dealUrl":"https://www.groupon.co.uk/deals/unique-beauty-for-you-2","grid4ImageUrl":"https://img.grouponcdn.com/iam/3guA6oHaPZcmGLvhUtrFo5NWC2S7/3g-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/3guA6oHaPZcmGLvhUtrFo5NWC2S7/3g-2048x1229/v1/t440x300.jpg","title":"Full-Body or Hot Stone Massage with Optional Indian Head Massage at Unique Beauty For You (Up to 68% Off)","announcementTitle":"Full-Body or Hot Stone Massage","shortAnnouncementTitle":"Full-Body or Hot Stone Massage","redemptionLocation":"Multiple Locations","merchant":{"id":"unique-beauty-for-you","uuid":"7c5c22f7-9244-44f5-ab56-bbc9d7b59c35","name":"Unique Beauty For You","websiteUrl":"http://uniquebeauty4u.co.uk/","recommendations":null,"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":62,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":5000,"currencyCode":"GBP","formattedAmount":"£50","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"3135d40b-4280-4759-b8a9-8ee5eaeded98","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":100,"soldQuantityMessage":"100+","locations":[{"uuid":"269678b5-4b2b-ba14-57ce-015f927b7397","id":null,"lng":-2.4824106,"lat":53.7491945,"distance":16.193731897343238,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers can be pampered with a full-body or hot stone massage, which can be paired with an Indian head massage for a boosted indulgence</p>"},{"uuid":"f3d77421-9781-4660-9db4-2306675882ae","dealUrl":"https://www.groupon.co.uk/deals/norden-beauty-and-well-being-1","grid4ImageUrl":"https://img.grouponcdn.com/deal/hwtWaYECBnpdDv44PiQ3/jx-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/hwtWaYECBnpdDv44PiQ3/jx-2048x1229/v1/t440x300.jpg","title":"Massage Packages with Facial at Norden Beauty And Wellbeing (Up to 51% Off)","announcementTitle":"Back, Neck and Shoulder Massage","shortAnnouncementTitle":"Back, Neck and Shoulder Massage","redemptionLocation":"Rochdale","merchant":{"id":"norden-beauty-and-well-being","uuid":"1e3dedda-caac-4aeb-b00a-5d57776b966a","name":"Norden Beauty And Wellbeing","websiteUrl":"http://nordenbeauty.simplesite.com/","recommendations":[{"ratingDistribution":{"1":2,"2":1,"3":1,"4":8,"5":34},"rating":4.54,"source":"groupon-users","totalMessage":"46","percentMessage":"93","prominentDisplay":true,"total":46,"percent":93}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":30,"minimumPurchaseQuantity":1,"price":{"amount":1400,"currencyCode":"GBP","formattedAmount":"£14","currencyExponent":2},"value":{"amount":2000,"currencyCode":"GBP","formattedAmount":"£20","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"943301b8-da14-478f-bb29-6a137bce9dfc","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":280,"soldQuantityMessage":"280+","locations":[{"uuid":"bccd9bfb-364b-b178-4875-015a89b40c1e","id":null,"lng":-2.2268906,"lat":53.6296848,"distance":3.057908417952957,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Clients can relieve built-up muscle tension with the choice of numerous massage packages and an optional facial</p>"},{"uuid":"0cf799e9-e342-45d5-b0a6-451a20da3a75","dealUrl":"https://www.groupon.co.uk/deals/norden-beauty-and-well-being-5","grid4ImageUrl":"https://img.grouponcdn.com/deal/xHrocDhALXxEPvj9taNCiekHEFm/xH-700x421/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/xHrocDhALXxEPvj9taNCiekHEFm/xH-700x421/v1/t440x300.jpg","title":"Spa Package for One or Two at Norden Beauty and Wellbeing (Up to 42% Off)","announcementTitle":"Spa Package","shortAnnouncementTitle":"Spa Package","redemptionLocation":"Rochdale","merchant":{"id":"norden-beauty-and-well-being","uuid":"1e3dedda-caac-4aeb-b00a-5d57776b966a","name":"Norden Beauty And Well Being","websiteUrl":"http://nordenbeauty.simplesite.com/","recommendations":[{"ratingDistribution":{"1":2,"2":1,"3":1,"4":8,"5":34},"rating":4.54,"source":"groupon-users","totalMessage":"46","percentMessage":"93","prominentDisplay":true,"total":46,"percent":93}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":42,"minimumPurchaseQuantity":1,"price":{"amount":3500,"currencyCode":"GBP","formattedAmount":"£35","currencyExponent":2},"value":{"amount":6000,"currencyCode":"GBP","formattedAmount":"£60","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"9094cb8c-0521-4346-8e4b-d03d251274da","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":150,"soldQuantityMessage":"150+","locations":[{"uuid":"bccd9bfb-364b-b178-4875-015a89b40c1e","id":null,"lng":-2.2268906,"lat":53.6296848,"distance":3.057908417952957,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>One or two visitors can pamper themselves from head to toe with treatments including nail polish, facials and massages</p>"},{"uuid":"7c44ea56-2f7c-4a18-b38e-93475965596d","dealUrl":"https://www.groupon.co.uk/deals/bodyjoy-massage-and-beauty-services","grid4ImageUrl":"https://img.grouponcdn.com/iam/3dD3qCbapaj5eWtZSvxstzCtKhFZ/3d-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/3dD3qCbapaj5eWtZSvxstzCtKhFZ/3d-2048x1229/v1/t440x300.jpg","title":"Classic Facial, Choice of One-Hour Massage, or Both at Bodyjoy Massage and Beauty Services (Up to 57%)","announcementTitle":"Classic Facial","shortAnnouncementTitle":"Classic Facial","redemptionLocation":"ROCHDALE","merchant":{"id":"bodyjoy-massage-and-beauty-services","uuid":"65388549-371b-49b3-af58-cfbe917023e1","name":"Bodyjoy Massage and Beauty Services","websiteUrl":"http://www.bjoymassage.org","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":0,"4":0,"5":1},"rating":5,"source":"groupon-users","totalMessage":"1","percentMessage":"100","prominentDisplay":true,"total":1,"percent":100}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":40,"minimumPurchaseQuantity":1,"price":{"amount":1195,"currencyCode":"GBP","formattedAmount":"£11.95","currencyExponent":2},"value":{"amount":2000,"currencyCode":"GBP","formattedAmount":"£20","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"09a29ecc-680c-4c88-8465-6e1a69648120","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1,"soldQuantityMessage":"1","locations":[{"uuid":"f5981133-07f8-b1fa-d5e8-016701e86f86","id":null,"lng":-2.1552878,"lat":53.6132453,"distance":0.329090458058042,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Guests may indulge in a one-hour massage of their choice or classic facial treatment, or opt for both options</p>"},{"uuid":"33f88b08-d61d-4ea4-a370-13961d28e973","dealUrl":"https://www.groupon.co.uk/deals/hua-hin-leisure-ryton-ltd","grid4ImageUrl":"https://img.grouponcdn.com/iam/3QESUVjfJXVBvNfAT5G3fLaPbCxP/3Q-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/3QESUVjfJXVBvNfAT5G3fLaPbCxP/3Q-2048x1229/v1/t440x300.jpg","title":"One-Hour Massage for One or Two at Hua Hin Thai Spa (Up to 50% Off)","announcementTitle":"One-Hour Massage","shortAnnouncementTitle":"One-Hour Massage","redemptionLocation":"Royton","merchant":{"id":"hua-hin-thai-spa","uuid":"e1b53a2e-8942-4b2a-8c17-2e22f03b214f","name":"Hua Hin Thai Spa","websiteUrl":"http://www.huahinthaispa.co.uk","recommendations":[{"ratingDistribution":{"1":1,"2":0,"3":0,"4":6,"5":7},"rating":4.29,"source":"groupon-users","totalMessage":"14","percentMessage":"93","prominentDisplay":true,"total":14,"percent":93}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":46,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":3500,"currencyCode":"GBP","formattedAmount":"£35","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"4aeb6acd-6686-43aa-802f-bc1373dab2e8","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":150,"soldQuantityMessage":"150+","locations":[{"uuid":"50ef1df3-616f-b7e3-dbce-016464976e81","id":null,"lng":-2.1333885,"lat":53.5735653,"distance":3.1989857231038075,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Indulge in a choice of massage that was designed to alleviate strains and aches from the body and promote relaxation</p>"},{"uuid":"929d974e-7412-4fd9-9028-08bf277ffc97","dealUrl":"https://www.groupon.co.uk/deals/liv-spa-6","grid4ImageUrl":"https://img.grouponcdn.com/deal/e7icKCPSVA7km8N61n2c/tX-1000x600/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/e7icKCPSVA7km8N61n2c/tX-1000x600/v1/t440x300.jpg","title":"Spa Day with Treatments for One or Two at Liv Spa (Up to 62% Off)","announcementTitle":"Spa Day with Treatments","shortAnnouncementTitle":"Spa Day with Treatments","redemptionLocation":"Burnley","merchant":{"id":"liv-spa","uuid":"06f6cbe9-cc77-a4de-5f32-0db1b7b321a3","name":"Liv Spa","websiteUrl":"http://www.livspa.co.uk","recommendations":[{"ratingDistribution":{"1":3,"2":2,"3":6,"4":14,"5":49},"rating":4.41,"source":"groupon-users","totalMessage":"74","percentMessage":"93","prominentDisplay":true,"total":74,"percent":93}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":55,"minimumPurchaseQuantity":1,"price":{"amount":2900,"currencyCode":"GBP","formattedAmount":"£29","currencyExponent":2},"value":{"amount":6500,"currencyCode":"GBP","formattedAmount":"£65","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"28fd320b-0330-42b2-ad29-f4e93abd7e71","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":340,"soldQuantityMessage":"340+","locations":[{"uuid":"f0eebffc-6e63-b06a-9052-013e68aac90b","id":null,"lng":-2.2355057,"lat":53.8164399,"distance":14.115942189379853,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Make use of spa facilities such as a pool and Jacuzzi, and indulge in a back and foot massage, complemented with a facial</p>"},{"uuid":"e10d8c8a-1a20-e667-39a6-b9fa8831368a","dealUrl":"https://www.groupon.co.uk/deals/wigan-chiropractic-clinic-3-5441179","grid4ImageUrl":"https://img.grouponcdn.com/deal/uWGy1NNGt4ueSHpDjV9L/WT-1000x600/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/uWGy1NNGt4ueSHpDjV9L/WT-1000x600/v1/t440x300.jpg","title":"Wigan Chiropractic Clinic: Consultation With Two (£19) or Three (£29) Treatments (Up to 82% Off)","announcementTitle":"Chiropractic Treatments","shortAnnouncementTitle":"Chiropractic Treatments","redemptionLocation":"Multiple Locations","merchant":{"id":"wigan-chiropractic-clinic","uuid":"5861555e-8ac0-14b4-8872-bad00a85c051","name":"Wigan Chiropractic Clinic","websiteUrl":"http://wiganchiro.co.uk","recommendations":[{"ratingDistribution":{"1":2,"2":1,"3":0,"4":7,"5":74},"rating":4.79,"source":"groupon-users","totalMessage":"84","percentMessage":"96","prominentDisplay":true,"total":84,"percent":96}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":82,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":10500,"currencyCode":"GBP","formattedAmount":"£105","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"5a8ab30a-9bd4-4352-9372-c32bbcf117ec","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"60429b86-4546-b06a-9298-014266119fb6","id":null,"lng":-2.4660736,"lat":53.6998339,"distance":13.95051990765026,"distanceSource":"external:lat_lng_param"},{"uuid":"41cc88a6-0d7e-b06a-747e-013e68966b13","id":null,"lng":-2.630281,"lat":53.5439329,"distance":20.178486299428783,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Chiropractors use gentle manual adjustments or soft tissue manipulation, designed to treat spinal misalignment and musculoskeletal issues</p>"},{"uuid":"4123e1ed-b906-49b4-809e-b5b939084009","dealUrl":"https://www.groupon.co.uk/deals/jade-spa-7","grid4ImageUrl":"https://img.grouponcdn.com/deal/tbstSGxLvnm9CvACZSkh/kf-1000x600/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/tbstSGxLvnm9CvACZSkh/kf-1000x600/v1/t440x300.jpg","title":"Spa Entry with Five Treatments and Afternoon Tea for One or Two at Jade Spa (Up to 65% Off)","announcementTitle":"Spa Entry and Tea, Manchester","shortAnnouncementTitle":"Spa Entry and Tea, Manchester","redemptionLocation":"Manchester","merchant":{"id":"jade-spa-1","uuid":"bb4df4e3-99fe-7714-9e19-de11c6534e85","name":"Jade Spa","websiteUrl":"http://www.jadespamanchester.com/","recommendations":[{"ratingDistribution":{"1":6,"2":4,"3":6,"4":29,"5":51},"rating":4.2,"source":"groupon-users","totalMessage":"96","percentMessage":"90","prominentDisplay":true,"total":96,"percent":90}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":64,"minimumPurchaseQuantity":1,"price":{"amount":3900,"currencyCode":"GBP","formattedAmount":"£39","currencyExponent":2},"value":{"amount":10750,"currencyCode":"GBP","formattedAmount":"£107.50","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"761a5626-7249-4a8c-b833-dd82fce96e45","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"55c4cdf9-179e-b06a-768b-014a5c804133","id":null,"lng":-2.2520016,"lat":53.4846068,"distance":10.050941978436185,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Be pampered with five treatments from a massage to a foot ritual, plus tuck into an afternoon tea</p>"},{"uuid":"934be96a-f7ad-44b7-9ef7-a406f39e59a3","dealUrl":"https://www.groupon.co.uk/deals/bannatyne-s-health-club-h-o-14","grid4ImageUrl":"https://img.grouponcdn.com/deal/3KXraH9MSZHHmsEVzybR1HXH1WSW/3K-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/3KXraH9MSZHHmsEVzybR1HXH1WSW/3K-2048x1229/v1/t440x300.jpg","title":"Spa Package with Lunch for Two at Bannatyne's Health Club (Up to 45% Off)","announcementTitle":"Bannatyne's: Spa Package with Lunch for Two","shortAnnouncementTitle":"Bannatyne's: Spa Package with Lunch for Two","redemptionLocation":"Multiple Locations","merchant":{"id":"bannatyne-s-health-club-h-o","uuid":"0f5b4658-1996-eeae-a9bb-471fd70e0694","name":"Bannatyne's Health Club","websiteUrl":"https://www.bannatyne.co.uk/spa","recommendations":[{"ratingDistribution":{"1":70,"2":44,"3":78,"4":187,"5":428},"rating":4.06,"source":"groupon-users","totalMessage":"807","percentMessage":"86","prominentDisplay":true,"total":807,"percent":86}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":45,"minimumPurchaseQuantity":1,"price":{"amount":7500,"currencyCode":"GBP","formattedAmount":"£75","currencyExponent":2},"value":{"amount":13760,"currencyCode":"GBP","formattedAmount":"£137.60","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"ce51ac1f-86e3-4b61-9ee5-026a06608e4c","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"22eb4bfe-6e63-b06a-9052-013e687895f6","id":null,"lng":-2.249633,"lat":53.478719,"distance":10.389328101581842,"distanceSource":"external:lat_lng_param"},{"uuid":"1ce557fe-3c0a-b06a-9052-014666c09cce","id":null,"lng":-2.2452983,"lat":53.4753667,"distance":10.54070286307308,"distanceSource":"external:lat_lng_param"},{"uuid":"f5cbb751-5701-b06a-768a-013e687f04ac","id":null,"lng":-1.5255867,"lat":53.545477,"distance":26.328380794330215,"distanceSource":"external:lat_lng_param"},{"uuid":"379122d5-0c49-b2b5-0ade-015d36d248fa","id":null,"lng":-1.5100828,"lat":53.6993484,"distance":27.026684529629517,"distanceSource":"external:lat_lng_param"},{"uuid":"9a6301fc-0c49-b2b5-0ade-015d36d3efa5","id":null,"lng":-2.4194167,"lat":53.0932082,"distance":37.905191770338305,"distanceSource":"external:lat_lng_param"},{"uuid":"140b2aff-0d7e-b06a-747e-013e68c8ae87","id":null,"lng":-3.0519408,"lat":53.8087731,"distance":39.016671825610885,"distanceSource":"external:lat_lng_param"},{"uuid":"03b159fd-3718-b06a-747f-0150ce49fbb3","id":null,"lng":-1.1338642,"lat":53.9810136,"distance":48.689118851716,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Indulge in a Swedish back, neck and shoulder massage or an energising facial, sit down to a light two-course lunch, and enjoy spa facilities</p>"},{"uuid":"5f43479c-dd02-4400-8bf2-f9495cb0647f","dealUrl":"https://www.groupon.co.uk/deals/cahm-therapies-2","grid4ImageUrl":"https://img.grouponcdn.com/deal/gQaeNGsMTxLkjmdVtezP/9H-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/gQaeNGsMTxLkjmdVtezP/9H-2048x1229/v1/t440x300.jpg","title":"One-Hour Foot Spa Package at Cahm Therapies*","announcementTitle":"One-Hour Foot Spa Package","shortAnnouncementTitle":"One-Hour Foot Spa Package","redemptionLocation":"Greater Manchester","merchant":{"id":"cahm-therapies","uuid":"b7bf1556-63ed-407b-a99d-a1dcb4831b3e","name":"Cahm Therapies","websiteUrl":"http://www.cahmtherapies.com","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":1,"4":3,"5":20},"rating":4.79,"source":"groupon-users","totalMessage":"24","percentMessage":"100","prominentDisplay":true,"total":24,"percent":100}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":0,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"c46d1094-897a-417e-96d2-8b8530f4dce3","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":70,"soldQuantityMessage":"70+","locations":[{"uuid":"5f3f48fb-4a34-b04c-3266-015b35d61520","id":null,"lng":-2.2990334,"lat":53.59261369999999,"distance":6.1666227413128745,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers can treat themselves to this one-hour package designed to relax and soothe tired feet and relieve foot soreness</p>"},{"uuid":"4c1a6ac3-f2ee-4cbc-b16f-ced13ec99bb9","dealUrl":"https://www.groupon.co.uk/deals/bannatyne-s-health-club-h-o-13","grid4ImageUrl":"https://img.grouponcdn.com/deal/hDVujZx7PaffxZJA75gL/pw-1500x900/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/hDVujZx7PaffxZJA75gL/pw-1500x900/v1/t440x300.jpg","title":"Choice of Spa Day for Two at Bannatyne's Health Club, 40 Locations (Up to 53% Off)","announcementTitle":"Choice of Spa Day for Two","shortAnnouncementTitle":"Choice of Spa Day for Two","redemptionLocation":"Multiple Locations","merchant":{"id":"bannatyne-s-health-club-h-o","uuid":"0f5b4658-1996-eeae-a9bb-471fd70e0694","name":"Bannatyne's Health Club","websiteUrl":"http://www.bannatyne.co.uk/","recommendations":[{"ratingDistribution":{"1":69,"2":44,"3":78,"4":188,"5":429},"rating":4.07,"source":"groupon-users","totalMessage":"808","percentMessage":"86","prominentDisplay":true,"total":808,"percent":86}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":53,"minimumPurchaseQuantity":1,"price":{"amount":5900,"currencyCode":"GBP","formattedAmount":"£59","currencyExponent":2},"value":{"amount":12600,"currencyCode":"GBP","formattedAmount":"£126","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"dc842fcd-b47e-45fa-8c78-954123d35612","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":5000,"soldQuantityMessage":"5,000+","locations":[{"uuid":"22eb4bfe-6e63-b06a-9052-013e687895f6","id":null,"lng":-2.249633,"lat":53.478719,"distance":10.389328101581842,"distanceSource":"external:lat_lng_param"},{"uuid":"1ce557fe-3c0a-b06a-9052-014666c09cce","id":null,"lng":-2.2452983,"lat":53.4753667,"distance":10.54070286307308,"distanceSource":"external:lat_lng_param"},{"uuid":"f5cbb751-5701-b06a-768a-013e687f04ac","id":null,"lng":-1.5255867,"lat":53.545477,"distance":26.328380794330215,"distanceSource":"external:lat_lng_param"},{"uuid":"379122d5-0c49-b2b5-0ade-015d36d248fa","id":null,"lng":-1.5100828,"lat":53.6993484,"distance":27.026684529629517,"distanceSource":"external:lat_lng_param"},{"uuid":"9a6301fc-0c49-b2b5-0ade-015d36d3efa5","id":null,"lng":-2.4194167,"lat":53.0932082,"distance":37.905191770338305,"distanceSource":"external:lat_lng_param"},{"uuid":"12db4242-7831-bcaa-016d-015d36d20a71","id":null,"lng":-3.0519408,"lat":53.8087731,"distance":39.016671825610885,"distanceSource":"external:lat_lng_param"},{"uuid":"03b159fd-3718-b06a-747f-0150ce49fbb3","id":null,"lng":-1.1338642,"lat":53.9810136,"distance":48.689118851716,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>A choice of three specially designed spa days with treatments and access to facilities await customers at 40 locations across the UK</p>"},{"uuid":"31ee8efb-c2a4-44a1-a096-4213cd8c79f4","dealUrl":"https://www.groupon.co.uk/deals/argana-hamam-1","grid4ImageUrl":"https://img.grouponcdn.com/deal/3jHZD3rwDaWjwuQ5k11ksJs2tRv5/3j-1000x600/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/3jHZD3rwDaWjwuQ5k11ksJs2tRv5/3j-1000x600/v1/t440x300.jpg","title":"Two-Hour Hammam Spa Ritual Including Massage and Facial for One or Two at Argana Hammam Manchester (Up to 48% Off)\n\n","announcementTitle":"Two-Hour Hammam Spa Ritual","shortAnnouncementTitle":"Two-Hour Hammam Spa Ritual","redemptionLocation":"Manchester","merchant":{"id":"argana-hamam","uuid":"bc836189-2657-3408-2ab2-c4f4781a9070","name":"Argana Hamam","websiteUrl":"https://www.facebook.com/argana.hamam/info/?section=hours&tab=page_info","recommendations":[{"ratingDistribution":{"1":4,"2":1,"3":2,"4":7,"5":35},"rating":4.39,"source":"groupon-users","totalMessage":"49","percentMessage":"90","prominentDisplay":true,"total":49,"percent":90}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":46,"minimumPurchaseQuantity":1,"price":{"amount":3500,"currencyCode":"GBP","formattedAmount":"£35","currencyExponent":2},"value":{"amount":6500,"currencyCode":"GBP","formattedAmount":"£65","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"5be7217f-71b1-4144-a022-7ddf62b4ed2f","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":800,"soldQuantityMessage":"800+","locations":[{"uuid":"0f4374d3-6409-b06a-9298-0145dd2094c1","id":null,"lng":-2.2013038,"lat":53.4425651,"distance":12.283108459134853,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Treat the body to a traditional Moroccan Hamam at a Moroccan spa, including a hammam bath with exfoliation, a back massage and a facial</p>"},{"uuid":"af38e979-2761-47c1-996b-80501af9f780","dealUrl":"https://www.groupon.co.uk/deals/spa-urban-oasis-at-hilton-manchester-deansgate-1","grid4ImageUrl":"https://img.grouponcdn.com/deal/wRfPmxY3mefud5FJrPtf7n5Tukf/wR-700x420/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/wRfPmxY3mefud5FJrPtf7n5Tukf/wR-700x420/v1/t440x300.jpg","title":"Luxury Spa Day for One or Two at Spa Urban Oasis with Use of Facilities at Hilton Hotel Manchester Deansgate (46% Off) ","announcementTitle":"Luxury City Centre Spa Day","shortAnnouncementTitle":"Luxury City Centre Spa Day","redemptionLocation":"Manchester","merchant":{"id":"spa-urban-oasis-at-hilton-manchester-deansgate","uuid":"6f37c758-b0ab-4495-ba91-0d4001fafd91","name":"Spa Urban Oasis at Hilton Hotel Manchester Deansgate","websiteUrl":"http://www.spaurbanoasis.com/","recommendations":[{"ratingDistribution":{"1":2,"2":5,"3":2,"4":8,"5":34},"rating":4.31,"source":"groupon-users","totalMessage":"51","percentMessage":"86","prominentDisplay":true,"total":51,"percent":86}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":46,"minimumPurchaseQuantity":1,"price":{"amount":4900,"currencyCode":"GBP","formattedAmount":"£49","currencyExponent":2},"value":{"amount":9000,"currencyCode":"GBP","formattedAmount":"£90","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"e6495d90-16e3-499e-b9f3-d2c6016b08f2","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"4ed34ab1-1010-b663-a2bd-015726f14c14","id":null,"lng":-2.2506818,"lat":53.475417,"distance":10.617385333976184,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Indulge in a choice of spa treatments and take advantage of a two-hour pool, gym, sauna, steam room, and hot tub use</p>"},{"uuid":"a4c80b1a-5be8-4c0e-985c-3de6ee7f46ce","dealUrl":"https://www.groupon.co.uk/deals/shrigley-hall-hotel-11","grid4ImageUrl":"https://img.grouponcdn.com/deal/3NANsniLpuWaoBFx2bMr8PX7ASnD/3N-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/3NANsniLpuWaoBFx2bMr8PX7ASnD/3N-2048x1229/v1/t440x300.jpg","title":"Spa Day with Two Treatments and Glass of Prosecco for One or Two at 4* Shrigley Hall Hotel (Up to 41% Off)","announcementTitle":"4* Spa Day with Treatments","shortAnnouncementTitle":"4* Spa Day with Treatments","redemptionLocation":"Manchester","merchant":{"id":"shrigley-hall-hotel-non-accommodation","uuid":"6d0a78f8-76e5-4381-8e67-e1516fcc3b6f","name":"Shrigley Hall Hotel","websiteUrl":"https://www.shrigleyhallhotelandspa.co.uk/","recommendations":[{"ratingDistribution":{"1":26,"2":24,"3":55,"4":102,"5":194},"rating":4.03,"source":"groupon-users","totalMessage":"401","percentMessage":"88","prominentDisplay":true,"total":401,"percent":88}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":40,"minimumPurchaseQuantity":1,"price":{"amount":4500,"currencyCode":"GBP","formattedAmount":"£45","currencyExponent":2},"value":{"amount":7470,"currencyCode":"GBP","formattedAmount":"£74.70","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"cd0b9857-5eab-476e-ae51-88427e054e09","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":850,"soldQuantityMessage":"850+","locations":[{"uuid":"c47ddbfb-78bc-b06a-9052-0145654932e8","id":null,"lng":-2.0913,"lat":53.3156556,"distance":21.076740348806585,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>One or two guests can unwind with a pamper day at the spa featuring two beauty treatments, leisure facilities access and a glass of Prosecco</p>"},{"uuid":"31e57284-31e5-40eb-9f75-c58f35a05100","dealUrl":"https://www.groupon.co.uk/deals/active-care-clinic-8","grid4ImageUrl":"https://img.grouponcdn.com/deal/k4bezi8cFqR7rK9zMn9FqDQefQ6/k4-1692x1016/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/k4bezi8cFqR7rK9zMn9FqDQefQ6/k4-1692x1016/v1/t440x300.jpg","title":"Choice of Acupuncture or Cupping Session at Active Care Clinic (53% Off).","announcementTitle":"Choice of Acupuncture Session","shortAnnouncementTitle":"Choice of Acupuncture Session","redemptionLocation":"Manchester","merchant":{"id":"active-care-clinic","uuid":"1765b61d-fa80-712b-de52-d0ef0385f4c2","name":"Active care clinic","websiteUrl":"http://www.activecareclinicpro.uk/","recommendations":[{"ratingDistribution":{"1":1,"2":0,"3":0,"4":4,"5":22},"rating":4.7,"source":"groupon-users","totalMessage":"27","percentMessage":"96","prominentDisplay":true,"total":27,"percent":96}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":52,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":4000,"currencyCode":"GBP","formattedAmount":"£40","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"a73f17e7-ac08-4baf-97c4-c7515c58852b","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":130,"soldQuantityMessage":"130+","locations":[{"uuid":"acd9cb97-65ad-b7e3-dbce-015e6077bcb8","id":null,"lng":-2.2392464,"lat":53.4736726,"distance":10.566394567010843,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers can undergo an acupuncture session preceded by a consultation, designed to help with smoking cessation or weight management</p>"},{"uuid":"07b0a256-3c72-453c-823e-48d6eb1afc03","dealUrl":"https://www.groupon.co.uk/deals/cahm-therapies-4","grid4ImageUrl":"https://img.grouponcdn.com/deal/a6WLrCghLtgjAkFunDoX/Tf-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/a6WLrCghLtgjAkFunDoX/Tf-2048x1229/v1/t440x300.jpg","title":"Mix and Match Pamper Package Perfect For a Gift with Two or Three Treatments at Cahm Therapies (Up to 53% Off)","announcementTitle":"Mix and Match Pamper Package","shortAnnouncementTitle":"Mix and Match Pamper Package","redemptionLocation":"Greater Manchester","merchant":{"id":"cahm-therapies","uuid":"b7bf1556-63ed-407b-a99d-a1dcb4831b3e","name":"Cahm Therapies","websiteUrl":"http://www.cahmtherapies.com","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":1,"4":3,"5":20},"rating":4.79,"source":"groupon-users","totalMessage":"24","percentMessage":"100","prominentDisplay":true,"total":24,"percent":100}],"ratings":null,"facebookUrl":null,"twitterUrl":null},"reviews":null,"priceSummary":{"discountPercent":52,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":4000,"currencyCode":"GBP","formattedAmount":"£40","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"e20f0076-1f6d-4a87-841f-abc35fc25268","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":90,"soldQuantityMessage":"90+","locations":[{"uuid":"5f3f48fb-4a34-b04c-3266-015b35d61520","id":null,"lng":-2.2990334,"lat":53.59261369999999,"distance":6.1666227413128745,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Choose from a range of pampering services and create a personalised package; treatments include Reflexology, Reiki and Revitalizing Facial</p>"},{"uuid":"f37ab774-8a36-424a-b318-9e64673d5726","dealUrl":"https://www.groupon.co.uk/deals/buxton-palace-hotel-21","grid4ImageUrl":"https://img.grouponcdn.com/deal/foGmvkKHZ2vhYxEo3rr2/zk-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/foGmvkKHZ2vhYxEo3rr2/zk-2048x1229/v1/t440x300.jpg","title":"Spa Access with Two Treatments, Cream Tea and Prosecco for Up to Four at Buxton Palace Hotel and Spa (Up to 62% Off)","announcementTitle":"Spa Access with Two Treatments","shortAnnouncementTitle":"Spa Access with Two Treatments","redemptionLocation":"Buxton","merchant":{"id":"buxton-palace-hotel","uuid":"734e0c2c-7982-6893-d0e6-505a7c8df715","name":"Buxton Palace Hotel","websiteUrl":"http://www.britanniahotels.com","recommendations":[{"ratingDistribution":{"1":15,"2":15,"3":33,"4":38,"5":47},"rating":3.59,"source":"groupon-users","totalMessage":"148","percentMessage":"80","prominentDisplay":false,"total":148,"percent":80}],"twitterUrl":null,"facebookUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":58,"minimumPurchaseQuantity":1,"price":{"amount":6200,"currencyCode":"GBP","formattedAmount":"£62","currencyExponent":2},"value":{"amount":14900,"currencyCode":"GBP","formattedAmount":"£149","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"4be4b878-db52-489a-8542-09bf5fe84b78","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"8daae037-6e63-b06a-9052-013e68c598ab","id":null,"lng":-1.913662,"lat":53.26154,"distance":26.585584828183492,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Up to four guests can enjoy a full spa day with two 25-minute treatments each, as well as a cream tea to complement the experience</p>"},{"uuid":"a927335b-d131-4237-8250-467312fc8261","dealUrl":"https://www.groupon.co.uk/deals/portland-hall-spa-3-24181050","grid4ImageUrl":"https://img.grouponcdn.com/iam/xg5yq6d681BnR4KuGAfC/J1-1000x600/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/xg5yq6d681BnR4KuGAfC/J1-1000x600/v1/t440x300.jpg","title":"Spa Package or VIP Spa Package for Two With Three Treatments and a Light Lunch at Portland Hall Spa (Up to 70% Off)","announcementTitle":"Spa Package for Two With Treatments","shortAnnouncementTitle":"Spa Package for Two With Treatments","redemptionLocation":"Southport","merchant":{"id":"portland-hall-spa","uuid":"80a9785d-980f-7313-c8c6-384a320d1dd8","name":"Portland Hall Spa","websiteUrl":"http://www.portlandhallspa.com","recommendations":[{"ratingDistribution":{"1":12,"2":9,"3":9,"4":17,"5":54},"rating":3.91,"source":"groupon-users","totalMessage":"101","percentMessage":"79","prominentDisplay":false,"total":101,"percent":79}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":70,"minimumPurchaseQuantity":1,"price":{"amount":6900,"currencyCode":"GBP","formattedAmount":"£69","currencyExponent":2},"value":{"amount":23388,"currencyCode":"GBP","formattedAmount":"£233.88","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"ac10b81d-88be-4d81-9f31-597199430b3e","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":10000,"soldQuantityMessage":"10,000+","locations":[{"uuid":"75b423ff-6e63-b06a-9052-013e6878eff9","id":null,"lng":-3.0073807,"lat":53.6441934,"distance":35.00828632083434,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>The Moroccan-themed spa awaits for a day of decadence, with three treatments per guest, a light lunch and the option to include Champagne</p>"},{"uuid":"d78679c1-8060-4b0c-b7df-bef92487d1eb","dealUrl":"https://www.groupon.co.uk/deals/stockport-chiropractic-wellness-centre-4","grid4ImageUrl":"https://img.grouponcdn.com/deal/kWqSkxHYTX5caG1xj4Dn/fT-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/kWqSkxHYTX5caG1xj4Dn/fT-2048x1229/v1/t440x300.jpg","title":"Consultation, Neurological Scan and Two Treatments at Stockport Chiropractic Health Centre (71% Off)","announcementTitle":"Consultation and Two Treatments","shortAnnouncementTitle":"Consultation and Two Treatments","redemptionLocation":"Multiple Locations","merchant":{"id":"greater-manchester-chiropractic-clinics-ltd","uuid":"fec3c1f1-7744-7427-8d67-5348bc38178b","name":"Stockport Chiropractic Health Centre","websiteUrl":"http://www.chiropractichealthsolutions.co.uk","recommendations":[{"ratingDistribution":{"1":1,"2":1,"3":2,"4":8,"5":47},"rating":4.68,"source":"groupon-users","totalMessage":"59","percentMessage":"97","prominentDisplay":true,"total":59,"percent":97}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":71,"minimumPurchaseQuantity":1,"price":{"amount":2700,"currencyCode":"GBP","formattedAmount":"£27","currencyExponent":2},"value":{"amount":9300,"currencyCode":"GBP","formattedAmount":"£93","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"18cc7fbe-9efc-4fd8-b356-59372e8eb366","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[{"uuid":"9d6ca2f8-0d7e-b06a-747e-013e68877300","id":null,"lng":-2.205543,"lat":53.4122463,"distance":14.382824438758465,"distanceSource":"external:lat_lng_param"},{"uuid":"f79905fd-65db-b06a-9052-0140c5b10bd1","id":null,"lng":-2.064568,"lat":53.3937051,"distance":15.954077976363001,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Clients receive a consultation including a medical history, a number of tests and a neurological scan, before two treatments are applied</p>"},{"uuid":"26bbd5ba-72a3-42a4-af63-ea89a1ec0cc1","dealUrl":"https://www.groupon.co.uk/deals/vasl-1","grid4ImageUrl":"https://img.grouponcdn.com/deal/iRcTmC9UuLcp6rSqe3uRBAPv61R/iR-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/deal/iRcTmC9UuLcp6rSqe3uRBAPv61R/iR-2048x1229/v1/t440x300.jpg","title":"30-Minute Swedish Massage or 60-Minute Full Body Swedish Massage at VASL (Up to 58% Off)","announcementTitle":"30-Minute Swedish Massage","shortAnnouncementTitle":"30-Minute Swedish Massage","redemptionLocation":"Bury","merchant":{"id":"vasl","uuid":"84fe94f8-3bb0-4d96-9b93-6c3a0be54571","name":"VASL","websiteUrl":"https://www.facebook.com/VASLBeautySalon/?ref=py_c","recommendations":[{"ratingDistribution":{"1":0,"2":0,"3":0,"4":0,"5":4},"rating":5,"source":"groupon-users","totalMessage":"4","percentMessage":"100","prominentDisplay":true,"total":4,"percent":100}],"facebookUrl":null,"twitterUrl":null,"ratings":null},"reviews":null,"priceSummary":{"discountPercent":44,"minimumPurchaseQuantity":1,"price":{"amount":1400,"currencyCode":"GBP","formattedAmount":"£14","currencyExponent":2},"value":{"amount":2500,"currencyCode":"GBP","formattedAmount":"£25","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"c2d438bf-005c-45db-b513-5cb1ac206ebe","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":40,"soldQuantityMessage":"40+","locations":[{"uuid":"0c19b525-1a73-b4f3-b550-0164f1677a5b","id":null,"lng":-2.2868927,"lat":53.5930451,"distance":5.681489244401174,"distanceSource":"external:lat_lng_param"}],"highlightsHtml":"<p>Customers can relax with a 30-minute Swedish massage or an hour long full-body Swedish massage</p>"},{"uuid":"09044606-8dd9-488d-9db7-f95a56de7fe3","dealUrl":"https://www.groupon.co.uk/deals/new-skills-academy-5","grid4ImageUrl":"https://img.grouponcdn.com/iam/kb7MZ21e48siow4JDSUs/Mu-2048x1229/v1/t300x182.jpg","largeImageUrl":"https://img.grouponcdn.com/iam/kb7MZ21e48siow4JDSUs/Mu-2048x1229/v1/t440x300.jpg","title":"Massage Online Course at New Skills Academy (94% Off)","announcementTitle":"Massage Online Course","shortAnnouncementTitle":"Massage Online Course","redemptionLocation":null,"merchant":{"id":"british-cleaning-certificate","uuid":"9b6e6866-63d4-aefc-aec2-b722d207a32a","name":"New Skills Academy","websiteUrl":"https://newskillsacademy.co.uk/","recommendations":[{"ratingDistribution":{"1":34,"2":11,"3":28,"4":91,"5":365},"rating":4.4,"source":"groupon-users","totalMessage":"529","percentMessage":"91","prominentDisplay":true,"total":529,"percent":91}],"ratings":null,"twitterUrl":null,"facebookUrl":null},"reviews":null,"priceSummary":{"discountPercent":94,"minimumPurchaseQuantity":1,"price":{"amount":1900,"currencyCode":"GBP","formattedAmount":"£19","currencyExponent":2},"value":{"amount":29900,"currencyCode":"GBP","formattedAmount":"£299","currencyExponent":2},"regularPrice":null,"pricingMetadata":null,"redemptionOffer":{"minimumPurchaseValue":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"maximumDiscount":{"amount":0,"currencyCode":"GBP","formattedAmount":"£0.00","currencyExponent":2},"redemptionCount":null},"quoteId":"1a64d1b2-6424-4f72-92b6-e37c7f1e560e","additionalRedemptionOffers":[]},"uiTreatment":[{"uuid":"03567e7f-40b5-4743-9466-2ec2d75631af","slug":null,"name":"Local","description":"Default template","logoImage":null}],"isTravelBookableDeal":false,"soldQuantity":1000,"soldQuantityMessage":"1,000+","locations":[],"highlightsHtml":"<p>With this online course participants can learn the indispensable basics of different massage techniques </p>"}],"features":{"showFullTitle":true,"captionPadding":true,"showSEOListView":true,"showPriceBadging":true,"showStarRatingsOnDealCard":true},"isTouch":false,"classNames":"block-grid cui-two-up cui-medium-two-up cui-small-one-up two-up"}},"c2":{"uuid":"e34de00e-f716-4448-abfb-5d911c3859c6","content":{"title":"Hot Stone Massage Rochdale"}},"c12":{"uuid":"e868587f-34c9-4fcb-b665-51b188d9e273","content":{"category":"Hot Stone Massage","locationName":"Rochdale","categoryLinks":{"links":[{"anchorText":"Hot Stone in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/hot-stone-massage","indexed":true},{"anchorText":"Full Body Massage in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/full-body-massage","indexed":true},{"anchorText":"Beauty & Spas in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/beauty-and-spas","indexed":true},{"anchorText":"Reflexology in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/reflexology","indexed":true},{"anchorText":"Deep Tissue in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/deep-tissue-massage","indexed":true},{"anchorText":"Sports in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/sports-massage","indexed":true},{"anchorText":"Massage in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/massage","indexed":true},{"anchorText":"Swedish in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/swedish-massage","indexed":true},{"anchorText":"Foot in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/foot-massage","indexed":true},{"anchorText":"Thai in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/thai-massage","indexed":true}],"listHeading":"Popular Searches","tag":"CrosslinksCategoryLink"},"geoLinks":{"links":[{"anchorText":"Cosmetic Procedures in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/cosmetic-procedures","indexed":true},{"anchorText":"Full Body Massage in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/full-body-massage","indexed":true},{"anchorText":"Beauty & Spas in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/beauty-and-spas","indexed":true},{"anchorText":"Nails in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/nail-salon","indexed":true},{"anchorText":"Hair Removal in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/hair-removal","indexed":true},{"anchorText":"Hair Removal in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/hair-removal","indexed":true},{"anchorText":"Hair in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/hairdressers","indexed":true},{"anchorText":"Massage in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/massage","indexed":true},{"anchorText":"Cosmetic Procedures in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/cosmetic-procedures","indexed":true},{"anchorText":"Hair in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/hairdressers","indexed":true},{"anchorText":"Foot in Leeds","url":"https://www.groupon.co.uk/vouchers/leeds/foot-massage","indexed":true},{"anchorText":"Salons in Manchester","url":"https://www.groupon.co.uk/vouchers/manchester/salon","indexed":true}],"listHeading":"Searches Nearby","tag":"CrosslinksGeoLink"},"columnLayout":"two-up"}},"c8":{"uuid":"7ff8003e-e6d5-11e5-9730-9a79f06e9478","content":{"meta":[],"editorial":null}}},"translations":{"all":"All {{categoryName}}","article_by":"BY: ","article_url":"articles","bought":"bought","browseByRegion":"Browse {{country}}","categories":"Categories","categoryDealsInLocationHeader":"{{categoryName}} Deals in {{locationName}}","citiesUrl":"cities","close":"Close","dealsInPopularCities":"Deals in Popular Cities","discoverLocalDeals":"Discover Local Deals","events_path":"events","facebook_like":"Like it!","featured_video":"Featured Video: ","googleplus_share":"Share this on Google+","home":"Vouchers","local":"Vouchers","localDealsBlurb":"Make any day special with deals on the latest things to do, eat and see in and around your city.","more":"More","more_resources":"More Resources","moreCitiesLink":"More Cities","popularCategories":"Popular Categories","popular_deal":"Popular Deal","multiple_locations":"Multiple Locations","top_deals_heading":"Top Deals On {{categoryName}} In {{currentMonth}} In & Around {{locationName}}","popular_deals_heading":"Most Popular {{categoryName}} In & Around {{locationName}}","top_events_heading":"Events In {{currentMonth}} & {{nextMonth}} In & Around {{locationName}}","columbus_top_reviewed_heading":"Best Reviewed {{categoryName}} in {{locationName}}","readLess":"Read Less","readMore":"Read More","recommendedMerchants":"Recommended Merchants","regionGuideHeading":"{{regionName}} Guide and Deals","regionType":" ","relatedContent":"Related Reads","selectLocalMerchants":"Select Local Merchants","twitter_share":"Share with Twitter","video_home":"Videos","widgetTitle":"Learn More","view_deal":"View Deal","view_all":"View All","online_deal":"Online Deal","hide_deals_like_this":"Hide Deals Like This","show":"Show","hide":"Hide","backTo":"Back to","book_now":"Book Now","claim":"Claim","get_coupon":"Get Coupon","free_to_claim":"Free to Claim","cash_back":"Cash Back","free_event":"Free Event","discount_off":"OFF","local_path":"vouchers"}} |
Dead of Summer canceled after one season
Freeform has axed the summer camp horror drama from Once Upon a Time executive producers Adam Horowitz and Edward Kitsis after one season, EW has confirmed.
Set in the late ’80s, the series followed the counselors at Camp Stillwater, a seemingly idyllic Midwestern summer camp whose dark and ancient mythology led to the deaths of just about everyone, including seeming final girl Amy (Elizabeth Lail), who ultimately turned out to be the villain.
The series never quite caught on with Freeform viewers, drawing an average of 500,000 viewers and 0.2 in the 18–49 demographic. |
Q:
Convergence of an improper integral: coordinate change
I have to study the convergence of the following integral
$$
\iint_D \frac{1}{x^2+(y-1)^2} dxdy
$$
on the domain $D=\{(x,y): x+y \ge 1\}$.
My problem concerns the coordinate change. I put $u=x+y$ and $v=y$, so $u \in (1,+\infty)$ and $v \in \mathbb{R}$. But this is impossible, since when $v \to -\infty$, $u$ must tend to the same limit, contradicting my choice. How can I solve the problem?
A:
That is just
$$\int_{-\infty}^{+\infty}\int_{1-x}^{+\infty}\frac{1}{x^2+(1-y)^2}\,dy\,dx =\int_{-\infty}^{+\infty}\frac{\pi+2\pi\,\text{sign}(x)}{4x}\,dx$$
that is diverging.
|
Fast Plants
Radish (Raphanus sativus L) is fast, but not as fast as Rapid Cycling
Brassicas (RCBr) if you want to go from seed to seed.
Under 24 hour fluorescent lighting (which is what RCBr require for their 5
week life cycle), you can get a harvestable plant (with good leaves and an
edible tap-root) inside 2 weeks, anytime of the year. Full growing
instructions in reference below.
They are easy to grow and will also function reasonably on a windowsill in
summer if you are happy with medium-fast plants.
Ref:- Hewitson and Price (1994) Plant mineral nutrition in the classroom:
the radish, Raphanus sativus L is a good plant for such studies. School
Science Review Sept 1994, vol 76, p 274
__________________________________________________________________________
| Dr. John Hewitson
|| Berrystead Barn +44 (0)1832 272 209 phone/fax
|| Oundle,
|| Peterborough, PE8 4DY, UK e-mail 100600.70 at compuserve.com||__________________________________________________________________________
|
(Oundle School) |
New York (CNN Business) Competition between Amazon's livestreaming platform Twitch and Microsoft's Mixer is heating up. Mega Twitch star Shroud announced Thursday he will stream exclusively on Mixer, starting at 8PM ET.
Shroud is the second big Twitch streamer to leave the platform for Mixer, after "Fortnite" star Ninja made the move in August. Michael "Shroud" Grzesiek, 25, often beat out Ninja's Twitch streams over the year in hours watched. He often plays shooter games like "Counter Strike," "Apex Legends" and "PlayerUnknown's Battlegrounds."
Mixer, after making millions of dollars from advertising and donations on Twitch, propelling himself and the platform into stardom. He said he was returning to his "streaming roots," a vague statement many took to mean getting back to a smaller platform where he is the star. In October, his wife, Jessica Blevins, In August, Tyler "Ninja" Blevins said he would stream exclusively on three-year-oldMixer, after making millions of dollars from advertising and donations on Twitch, propelling himself and the platform into stardom. He said he was returning to his "streaming roots," a vague statement many took to mean getting back to a smaller platform where he is the star. In October, his wife, Jessica Blevins, told media that the contract with Mixer allowed Ninja to take on more brand deals.
Shroud wouldn't say whether Ninja's move influenced his decision and whether his Mixer contract had better terms than his deal with Twitch. His team declined to share financials of the deal.
"The move to Mixer allows me to focus on what I love: gaming," Shroud told CNN Business on Thursday, "It allows me to focus on livestreaming for my fans and directly engage with more interactivity and variety."
Read More |
Robots to 3D Print Steel Bridge in Mid-air | MX3D
3D steel bridge MX3D
Dutch 3D printing R&D startup MX3D has invented a 3D printing technique whereby multi-axis industrial robots are able to print strong, complex structures anywhere without needing a print bed. The multi-axis 3D printing technique works by 3D printing metal that melts, then solidifies within a second. Aided by the geometry of the overall bridge design, the strength of the metal and support from the edge of the canal and the robot, the material is able to print horizontally without bending and falling into the water due to gravity.
“We start with a piece of metal attached to the canal bank. The robots start from one side of the canal, they print their own support structure, so essentially it prints its own bridge. It stands on the floor of the bridge, 3D prints out more and keeps moving,” MX3D’s CTO Tim Geurtjens told IBTimes UK. “We have the same physics as everyone else, but it looks like it’s gravity-defying. We put a drop of metal, drop by drop at a time and it solidifies. But you could also print tubes, and then print layer over layer of tubes.”
The robot arms are similar to those used in the car industry and they can print metals and plastics from single extruders, as well as combinations of the two materials together. The 3D printed bridge project is a collaboration between MX3D, designer Joris Laarman, Autodesk, construction firm Heijmans and several other partners, including French welding specialists Air Liquide.
There could be concerns about how strong 3D printed metal is compared with traditionally welded metal but stress tests conducted by Delft University of Technology (TU Delft) proved MX3D’s 3D printed steel retains 90% of the strength of normal stainless steel.
The 3D printed steel is able to retain 90% of the strength of regularly welded steel – Courtesy of MX3D
“What distinguishes our technology from traditional 3D printing methods is that we work according to the ‘Printing Outside the box’ principle. By printing with 6-axis industrial robots, we are no longer limited to a square box in which everything happens. Printing a functional, life-size bridge is of course the ideal way to showcase the endless possibilities of this technique.” MX3D’s CTO Tim Geurtjens told IBTimes UK.
The robotic arm is able to 3D print metal and weld printed pieces together at the same time – Courtesy of MX3D
Joris Laarman, designer, added: “This bridge will show how 3D printing finally enters the world of large-scale, functional objects and sustainable materials while allowing unprecedented freedom of form. The symbolism of the bridge is a beautiful metaphor to connect the technology of the future with the old city, in a way that brings out the best of both worlds.” |
Q:
How to append the word count at the end of 10 digit number in unix
I need to display the line count of the file at the end of the file as a trailer.
I have 0000000000 (10 0's) , so if the line count is 2 then the string should be 0000000002, if the number of lines in the file are 120 then string should be 0000000120. I need to display this string at the end of the file as a trailer. Please help how this can be done in unix.
A:
you can try awk
awk '{print}END{printf("%010i\n", NR)}' file
|
package com.intellij.util.text;
import com.intellij.openapi.util.text.StringUtil;
import junit.framework.Assert;
import junit.framework.TestCase;
import java.util.Collection;
public class VersionComparatorTest extends TestCase {
public void testNulls() {
assertVerGreater("a", null);
assertVerLess(null, "null");
assertVerEquals(null, null);
}
public void testSplit() {
assertStrsEquals(new String[]{"a", "b"}, VersionComparatorUtil.splitVersionString("a b"));
assertStrsEquals(new String[]{"1", "2", "3", "4", "5", "6", "7", "8", "9", "10", "11", "12", "#ab"},
VersionComparatorUtil.splitVersionString("1(2)3.4.5_6;7:/8,9 10+11~12#ab"));
assertStrsEquals(new String[]{"ab", "12", "ba", "6"}, VersionComparatorUtil.splitVersionString("ab12ba6"));
assertStrsEquals(new String[]{"ab", "12", "ba"}, VersionComparatorUtil.splitVersionString("ab12ba"));
assertStrsEquals(new String[]{"12", "ba"}, VersionComparatorUtil.splitVersionString("12ba"));
assertStrsEquals(new String[]{"12", "ba", "9"}, VersionComparatorUtil.splitVersionString("12ba9"));
assertStrsEquals(new String[]{"1", "0", "RC", "2"}, VersionComparatorUtil.splitVersionString("1.0RC2"));
assertStrsEquals(new String[]{"1", "0", "M", "1"}, VersionComparatorUtil.splitVersionString("1.0M1"));
assertStrsEquals(new String[]{"000123456789"}, VersionComparatorUtil.splitVersionString("000123456789"));
assertStrsEquals(new String[]{""}, VersionComparatorUtil.splitVersionString(""));
}
public void testExamples() {
assertVerEquals("1", "1");
assertVerLess("1", "2");
assertVerEquals("1.0.", "1.0");
assertVerLess("1.0", "2.0");
assertVerGreater("1.2", "1.02");
assertVerGreater("1.1", "1.02");
assertVerLess("1.1e", "1.1f");
assertVerGreater("1.1", "1.02");
assertVerGreater("1.01", "1.002");
assertVerLess("1.01", "1.02");
assertVerLess("1.35", "1.36");
assertVerGreater("2.35", "1.36");
assertVerLess("1.0rc1", "1.0release");
assertVerGreater("1.0", "1.0rc");
assertVerGreater("1.0.1", "1.0sp3");
assertVerLess("1.02", "1.12");
assertVerGreater("1.0sp", "1.0");
assertVerLess("1.0bred", "1.0.1");
assertVerEquals("1.3.0", "1.3");
assertVerLess("r.1", "r.666");
assertVerGreater("1.6-beta-1", "1.5.6");
assertVerLess("2.7.1.final", "2.7.2.rc1");
assertVerGreater("2.7.1.final", "2.7.1.rc1");
assertVerLess("1.0M1", "1.0RC2");
assertVerGreater(
"11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111112",
"11111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111");
}
public void testFormal() {
assertVerEquals("7-snapshot", "7-sNaP");
assertVerEquals("7-alpha", "7-a");
assertVerEquals("7-beta", "7-b");
assertVerEquals("7-rel", "7-release");
assertVerEquals("7-rel", "7-r");
assertVerEquals("7-rel", "7-final");
assertVerLess("snapshot", "m");
assertVerLess("m", "eap");
assertVerLess("eap", "alpha");
assertVerLess("alpha", "beta");
assertVerLess("beta", "rc");
assertVerLess("rc", "");
assertVerLess("", "sp");
assertVerLess("sp", "release");
assertVerLess("release", "trash");
assertVerLess("trash", "1");
assertVerLess("preview", "p");
}
private void assertStrsEquals(String[] expected, Collection<String> actual) {
Assert.assertEquals(StringUtil.join(expected, "^"), StringUtil.join(actual, "^"));
}
private void assertVerEquals(final String v1, final String v2) {
assertEquals(0, VersionComparatorUtil.compare(v1, v2));
}
private void assertVerLess(final String v1, final String v2) {
assertTrue(VersionComparatorUtil.compare(v1, v2) < 0);
assertTrue(VersionComparatorUtil.compare(v2, v1) > 0);
assertVerEquals(v1, v1);
assertVerEquals(v2, v2);
}
private void assertVerGreater(final String v1, final String v2) {
assertTrue(VersionComparatorUtil.compare(v1, v2) > 0);
assertTrue(VersionComparatorUtil.compare(v2, v1) < 0);
assertVerEquals(v1, v1);
assertVerEquals(v2, v2);
}
}
|
Sunday, October 18, 2015
Phillip
Baker was born October 11, 1821, in Edding Greene, East Dereham, Norfolk,
England. He and his mother, Anne Bone, joined the Mormon Church and he
was baptized on Christmas Day of 1848 or 1849. His father, Philip Baker,
Sr., was very unhappy about his conversion and expelled him from his home.
Phillip was 27 or 28 years of age at this time. Phillip emigrated
to America in 1851, sailing on the old-time sailing vessel named Golconda, the
same ship on which his future bride would come over two years later. He
landed at New Orleans, then traveled up the river to St. Louis, and from there
traveled overland to Council Bluffs. He was taken on by Orson Pratt to drive
his team across the plains. After arriving in Utah, Phillip stayed one month in
Salt Lake City and then went on to California. He helped to plant and
raise the first wheat crop in the San Bernadino Valley. He also lived for
a time in Bakersfield, California, which town was evidently named after
him. While in California, he panned a bag of gold worth $500.
Phillip
returned to Utah in 1857 or 58, and settled in Beaver, where he met and married
the pretty Harriet Ann Phillipo Thompson. Phillip was 23 years older than
Harriet Ann. They were later sealed in the Endowment House in Salt Lake
City by Amasa Lyman. Phillip was ordained a High Priest in 1873 and was set
apart as a counselor to Bishop Shepherd in Beaver, which position he held until
the Beaver Stake was reorganized, at which time he was ordained a High
Councilman under the hands of Apostle Erastus Snow.
Phillip Baker was an
Indian War Veteran, and he became very friendly with some of the Indians in the
Beaver area.On one occasion, he helped
with the burial of an Indian.They went
up east of Beaver on a hillside, dug the grave, wrapped the Indian in his
blanket and placed his gun and his belongings in with him.Phillip would often loan his horse and saddle
to the Indians, and he also often fed them.They would come to his house and ask for “Baker.” Phillip was a good
farmer in Beaver.He had fine horses,
many cows, pigs, chickens, and he raised all of his own hay, grain, and
potatoes.He hauled poles from a canyon
for building purposes, and it came to be called Baker Canyon, after him.Phillip passed away at the age of 79, leaving
Harriett Ann with eight children.
Typed by Edith Baker, Mar. 1990
Sources:
1) History of Phillip Baker by Zelnora Nielson, a daughter of Phillip
and Harriet Baker.
2) History written by Harriet Marintha Pendleton in May, 1942. Typed
by Johanna Baker in 1961.
3) Letter obtained by Marintha Pendleton from the Daughters of Utah
Pioneers, Nov. 1959. It is a letter written by Phillip Baker prior to
his departure from Council Bluffs to Salt Lake Valley.
4) History written by a sister of Marintha Edwards Pendleton.
The following letter was obtained by Historic Letters of the Past from
Daughters of Utah Pioneers, November 1959, obtained from Harriet
Marintha Edwards Pendleton, 1961. The letter was written by Phillip
Baker, son of Phillip Baker and Anne Bone prior to his departure from
Council Bluffs to Salt Lake Valley.
Council Bluffs, May 30, 1851 Dear Parents:
I take this opportunity of writing to you, hoping to find you in good
health, as it leaved me at the present, that God for it. Our vessel set
sail February 1st and landing in Orleans on the 6th of April. We left
Orleans on the 9th of April and reached St. Louis on the 15th of April.
We left Saint Louis on the 25th of April and reached Council Bluffs May
20th. Dear Mother, I am glad to inform you that I am going through to
the valley with Brother Pratt (Orson) to drive for him. The reason I
did not write sooner was because I wanted to know whether I was going
through to the valley or not.
Give my love to all my brothers and sisters and tell them I expect to
soon meet them in the valley of the mountains. Give my respects to
Mister Stains and tell him I am quite satisfied with this country. Land
is very cheap in this country and it does not cost much to keep cattle
for there is plenty of land laying waste, no one to own it. Give my
respects to Mister Bates and tell him it is a good land for him. It is a
good place for tailoring, for people wear coats here. From your affectionate son,
Phillip Baker
Harriett Ann Phillipo Thompson
Harriett was the daughter of William Phillipo Thompson and Ann Mariah
Fellows. She was born March 28, 1844, at East Dereham, Norfolk,
England, and immigrated with her parents to Utah in 1853. She wrote the
following on April 13, 1913, when she was 69 years old:
"I crossed the sea in the old-style sailing vessel, "Golconda" by name,
with Mr. Kerr as our sea captain, and was 70 days sailing from Liverpool
to New Orleans. We were delayed by the dismantling of the vessel at
sea through a severe storm. We went from New Orleans to Keokuk (a city
opposite Nauvoo, Illinois), then waited three weeks for teams to be
fitted up for crossing the plains, then started out for Salt Lake City.
The teams were divided into companies of tens, each ten having a
captain under the main captain, who was Joseph W. Young. Thus my father
started on the long journey across the plains with four young children
and a crippled wife. She was sick all the way. Father had to drive the
ox team by day and stand guard against the Indians at night, and herd
the cattle. Mother, being sick and a cripple had to ride all the way.
"Myself and two brothers, one older and one younger, had to walk.
[Harriet would have been nine years old, her brother William ten, and
brother James eight.] The baby [Sarah Ann] was ten months old. Well do
I remember our feet being sore and blistered, how the Indians attacked
us and stole my father's watch, how my mother lay sick in the wagon at
the point of death, apparently with Mountain Fever, and how we one day
camped at noon on the Platte River and Brother Joseph W. Young, our
captain, administered to her and blessed her that she should live to see
the Valley of Salt Lake City. We arrived in Salt Lake in the month of
October, after a hard and tedious journey of a little over nine months
[from the time they left England].
"My father went to work for President Brigham Young as a miller at the
grist mill. We stayed there a few years. He was there at the time of
the great grasshopper war. Then we went to the ninth ward and worked at
Bnners [sp?] grist mill, stayed there until the great move in 1858
[when the saints moved south at the time of the coming of Johnston's
Army], then went to Beaver City, where I was married to Phillip Baker,
March 2, 1860. I am the mother of eight children, three sons and five
daughters, have buried two daughters [Mariah Elender and Mary Jessamine]
and one son [Phillip William], and have been a widow since 1901."
Life History of Harriett Ann Phillipo Thompson Baker by her great-granddaughter, Norene Baker Sharp, 1956
"Grandfather, because of Indian troubles took his turn with other
settlers as picket guard, thus leaving his wife alone part of the time. No modern
conveniences had this noble woman in her home, and at this trying time,
she only a girl of seventeen, went through the pains of childbirth, with
no doctor, only a midwife to give what little and simple aid she could.
With only the little that pioneer women had, grandmother really made
her house a home. She had a wonderful personality. She was very handy
with a needle, both in plain and fancy sewing, also as a cook. I used
to think no one could cook quite as well as mother and grandmother. She
knew how to prepare and arrange many appetizing dishes. Grandmother experienced many experiences with the Indians. One day,
two large Indians came to her home. Grandfather was off guarding the
town against Indians. The Indians went to the grindstone and began
sharpening two large knives, which took them about an hour. They often
would flourish the knives in the air. They then came begging for food,
and grandmother gave them all she could spare, and they were still not
satisfied. So she put my mother, Harriet Marintha, out of the window on
the opposite side of the house from where they were and told her to run
across for Mary Mayes, for her to come. Sister Mayes was not at home.
So she ran another block to Sister Cecil Pollick, a very large Scotch
lady. She hurried to Grandmother. The Indians were back at the
grindstone. Sister Pollick went up to the grindstone and took off the
handle and told them to go, and did it in such a brave way that the
Indians left. She had brought her gun with her and pointed it at
them. For years she was secretary in Relief Society, a "block" teacher [now
called visiting teacher], chorister, besides her numerous duties as a
pioneer woman. She still had time to compose poetry. One side of her
nature I must mention was her humorous one. She was very witty, the life of
a crowd, and a good mixer and a real leader.
Harriett was the mother of eight children, three sons and five daughters.
She was a hard working woman. She washed and corded wool, spun yarn,
and made her own dye for her cloth. She used an old-fashioned loom for
many years, and wove carpets and rugs for other people. She gleaned
wheat, and her husband would crush it between two big flat stones for
mush. Harriet made straw hats for her children and once received a
first prize in a contest for a sailor hat she had made by hand for her
daughter Nora.
Harriett's husband died in 1901, leaving her a widow for 16 years. She
worked so hard, she got rheumatism in her arms. Her son Cliff finally
had to dress her and comb her hair in the last days of her life. Harriet
Ann lived out the rest of her days in Beaver. Her grandchildren
remembered that she was a very short woman and quite frail. She
evidently had two buggies. One of them was a white-topped buggy with
fringe on the top, and it was used as a hearse to carry the dead.
Daniel Ray Baker was carried in this buggy after he died.
Harriet Ann died July 1, 1917 at the age of 73, and was buried in the
Beaver cemetery. It was only a few months later that her son Daniel Ray (Glen's great grandfather)
followed her in death."
The above photo was taken at a Baker family reunion about 1957. Raymond
O. Baker, son of Daniel Ray Baker, and his wife, Elma June Smith Baker
are in front of the two tree trunks on the back row in the center of
this picture. Their son, Philip Baker, stands between his parents and
their daughter, Bonnie, stands on her mother's left and the viewer's
right.
Friday, October 9, 2015
Last April my husband and I celebrated our 40th wedding anniversary. As part of that celebration, our children gave us a gift card to be used at the Blue Boar Inn in Midway, Utah. This lovely Inn sits just south of Wasatch State Park and has beautiful mountain views. We decided to save our gift for a stay during Fall color time.
The Inn has old world charm (lots of it) and they serve wonderful food. The complimentary breakfast was beautifully presented and expertly cooked by the on site chef.
We loved our two night stay in this beautifully appointed Inn.
We were greeted in our charming suite with a rose, chocolates, terry cloth robes, and of course, a stuffed boar.
We also received a little gift book featuring selected readings from several authors. You see, every room is given an author's name with decor hinting at the time period in which they lived. We were in the Elizabeth Barret/Robert Browning Suite which included a cozy fireplace and four poster high up bed with a lovely canopy. Gohere for photos of the rooms and suites.
After a leisurely late breakfast on our final morning, we decided to take the long way home. We crossed the road into Wasatch State Park and headed north up the mountain side. This was our view looking back at the Inn and Midway. The Heber Valley cloud cover was stunning.
We were on Guardsman Pass road which took us into the mountain tops with mountain meadows heralding fall.
It was lovely. The road came to a junction where one could choose to go to Park City or west to Big Cottonwood Canyon.
We chose to descend into Brighton and Silver Lake at the top of Big Cottonwood Canyon and then on down the canyon to the Salt Lake freeway system and home. The aspens were beautiful. It was a glorious day following a few days of rain. It was a wonderful weekend. Special thanks to our very generous and special children and their spouses. |
<?php
/*
* This file is part of Cachet.
*
* (c) Alt Three Services Limited
*
* For the full copyright and license information, please view the LICENSE
* file that was distributed with this source code.
*/
return [
'component' => [
'status_update' => [
'mail' => [
'subject' => 'Component Status Updated',
'greeting' => 'A component\'s status was updated!',
'content' => ':name status changed from :old_status to :new_status.',
'action' => 'View',
],
'slack' => [
'title' => 'Component Status Updated',
'content' => ':name status changed from :old_status to :new_status.',
],
'sms' => [
'content' => ':name status changed from :old_status to :new_status.',
],
],
],
'incident' => [
'new' => [
'mail' => [
'subject' => 'New Incident Reported',
'greeting' => 'A new incident was reported at :app_name.',
'content' => 'Incident :name was reported',
'action' => 'View',
],
'slack' => [
'title' => 'Incident :name Reported',
'content' => 'A new incident was reported at :app_name',
],
'sms' => [
'content' => 'A new incident was reported at :app_name.',
],
],
'update' => [
'mail' => [
'subject' => 'Incident Updated',
'content' => ':name was updated',
'title' => ':name was updated to :new_status',
'action' => 'View',
],
'slack' => [
'title' => ':name Updated',
'content' => ':name was updated to :new_status',
],
'sms' => [
'content' => 'Incident :name was updated',
],
],
],
'schedule' => [
'new' => [
'mail' => [
'subject' => 'New Schedule Created',
'content' => ':name was scheduled for :date',
'title' => 'A new scheduled maintenance was created.',
'action' => 'View',
],
'slack' => [
'title' => 'New Schedule Created!',
'content' => ':name was scheduled for :date',
],
'sms' => [
'content' => ':name was scheduled for :date',
],
],
],
'subscriber' => [
'verify' => [
'mail' => [
'subject' => 'Verify Your Subscription',
'content' => 'Click to verify your subscription to :app_name status page.',
'title' => 'Verify your subscription to :app_name status page.',
'action' => 'Verify',
],
],
'manage' => [
'mail' => [
'subject' => 'Manage Your Subscription',
'content' => 'Click to manage your subscription to :app_name status page.',
'title' => 'Click to manage your subscription to :app_name status page.',
'action' => 'Manage subscription',
],
],
],
'system' => [
'test' => [
'mail' => [
'subject' => 'Ping from Cachet!',
'content' => 'This is a test notification from Cachet!',
'title' => '🔔',
],
],
],
'user' => [
'invite' => [
'mail' => [
'subject' => 'Your invitation is inside...',
'content' => 'You have been invited to join :app_name status page.',
'title' => 'You\'re invited to join :app_name status page.',
'action' => 'Accept',
],
],
],
];
|
---
title: Porting NDIS 6.x drivers to NDIS 6.60
description: NDIS 6.60 is substantially the same as NDIS 6.50. For detailed information about new features for NDIS 6.60, see Introduction to NDIS 6.60.
ms.assetid: EEDB1D20-BF50-4970-ACCB-FA289C8A7065
ms.date: 06/01/2017
ms.localizationpriority: medium
---
# Porting NDIS 6.x drivers to NDIS 6.60
NDIS 6.60 is substantially the same as NDIS 6.50. For detailed information about new features for NDIS 6.60, including implementation and compilation details specific to this version of NDIS, see [Introduction to NDIS 6.60](introduction-to-ndis-6-60.md).
If you are porting an NDIS 6.x driver to NDIS 6.60, you should be familiar with the changes to each version between your driver's version and 6.60. For more information about previous NDIS 6.x versions, see the following topics:
- [Introduction to NDIS 6.50](introduction-to-ndis-6-50.md)
- [Introduction to NDIS 6.40](introduction-to-ndis-6-40.md)
- [Introduction to NDIS 6.30](introduction-to-ndis-6-30.md)
- [Introduction to NDIS 6.20](introduction-to-ndis-6-20.md)
- [Introduction to NDIS 6.1](introduction-to-ndis-6-1.md)
- [Introduction to NDIS 6.0](introduction-to-ndis-6-0.md)
|
Initiating research in a private dental practice.
Research is an intrinsic part of both academia and clinical best practice. Within an academic environment, this can include access to advice and guidance from trained professionals. Similarly, while sometimes overly risk-averse, within the NHS there is a structured and systematic approach to healthcare research. However, in the UK, a large number of specialist dental procedures take place within the private healthcare system, which does not have access to such support and guidance. How, then, can we generate our own dental research from private dental primary care settings? With a number of phrases becoming part of everyday vocabulary in dental primary care, such as practice-based research, patient-centred outcomes, evidence-based dentistry, it is time to consider this. From research ethics to writing papers, via GCP, IRAS, HEIs and MOOCs, this article summarises the experiences of one non-affiliated (non-academic, non-NHS) private dental practice attempting to enter the world of research. The authors discuss their experiences, share the multiple sources of support encountered along the way, and demonstrate the benefits to everyday practice gained by initiating research studies. |
Introduction {#S0001}
============
Head and neck squamous cell carcinoma (HNSCC) is a type of cancer that occurs in the oral cavity, nasal cavity, pharynx, and larynx. It ranks as the sixth most aggressive malignancy worldwide, with a five-year survival rate of only approximately 50%.[@CIT0001]--[@CIT0003] More than 90% of HNSCC patients die, not from the rupture and bleeding of their primary cancer, but rather from cancer metastases.[@CIT0004] The continued growth, invasion, and migration of cancer depends, not only on genetic mutations in cancer cells but also on the support and regulation of the tumor microenvironment. Therefore, exploration of the relationship between the tumor microenvironment and the tumor could help to identify novel cancer treatments.
The tumor microenvironment comprises endothelial, immune, tumor, and other cells, which interact in complex ways in the tumor microenvironment.[@CIT0005],[@CIT0006] Tumor-associated macrophages (TAMs) are an important type of immune cell, and their roles in the tumor microenvironment are mainly determined by their M1 or M2 phenotype.[@CIT0007] Recent studies on oral and colon cancers have shown that M2-like TAMs can promote cell matrix decomposition, cancer cell migration, and blood and lymphatic vessel formation, all of which are necessary for tumor metastasis.[@CIT0008]--[@CIT0010] Clinical studies of glioblastoma and oral squamous cell carcinoma have also shown that the presence of large numbers of M2-like TAMs is positively correlated with poor prognosis; therefore, M2-like TAMs represent a new therapeutic target, and inhibition of the polarization of M2 macrophages is an effective approach.[@CIT0011]--[@CIT0013]
Dihydroartemisinin (DHA) is a semisynthetic derivative extracted from *Artemisia annua* using modern technology and has antimalarial, anti-inflammatory, and anti-tumor effects.[@CIT0014]--[@CIT0017] DHA has significant effects on various human tumors, including hepatocellular carcinoma and ovarian cancer; however, whether DHA can inhibit cancer progression and metastasis by regulating TAMs in the tumor microenvironment has not been reported.[@CIT0016],[@CIT0017] Therefore, we investigated the relationship between DHA and macrophage polarization in the tumor microenvironment using in vitro experiments. Our data demonstrate that DHA inhibits the invasion, migration, and angiogenesis of HNSCC by blocking the phosphorylation of STAT3 to prevent M2 macrophage polarization.
Materials and Methods {#S0002}
=====================
Cell Culture and Drugs {#S0002-S2001}
----------------------
The HNSCC cell line Fadu, established a hypopharyngeal tumor from an Indian individual, was purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). Human Thp-1 monocytes, derived from peripheral blood of a 1-year-old boy, were purchased from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). The Cal-27 cell line, established from a primary tongue cancer, was donated by the Institute of Stomatology, Nanjing Medical University, and purchased from American Type Culture Collection (ATCC; Manassas, USA). The human umbilical vein endothelial cell line (HUVECs) was donated by Dr. Hong Ji of Fudan University and purchased from ATCC (Manassas, USA). Fadu and Cal-27 cells were cultured in DMEM, while HUVECs were maintained in M199 medium (Solarbio, Beijing, China). Thp-1 cells were cultured in RPMI-1640 medium (Solarbio, Beijing, China). All cultures were supplemented with 10% fetal bovine serum (Gibco, Rockville, MD) and 1% penicillin and streptomycin (Gibco), and maintained at 37°C in 5% CO~2~. DHA was purchased from Tokyo Chemical Industry (Tokyo, Japan).
Polarization and Drug Treatment of Macrophages {#S0002-S2002}
----------------------------------------------
As shown in [Figure 1B](#F0001){ref-type="fig"}, to obtain M0 macrophages, 200 ng/mL phorbol 12-myristate 13-acetate (PMA; Sigma, MO, USA) were added to Thp-1 monocytes, cells cultured for 24 h, and then 20 ng/mL IL-6 and IL-4 added to stimulate the cells for 24 h to obtain M2 macrophages. Cells were divided into four groups, according to the culture media used, as follows: M0, M0DHA, M2, and M2DHA. During M0 induction, suspended Thp-1 cells began to become adherent after 8 to 12 h; hence, 50 μM DHA was added at 12 h in the M0DHA group. In the M2DHA group, DHA was added, along with IL-6 and IL-4 to obtain M2 macrophages.Figure 1Thp-1 cells were induced to become M2-like TAMs. (**A**) Thp-1 cells were differentiated from macrophages (with or without drugs, polarized or unpolarized). (**B**) A diagrammatic illustration for the M2 macrophage polarization and DHA treatment of Thp-1 cells. (**C**) mRNA expression levels of some M0 and M2 genes differed. (**D**) Flow cytometry was used to determine the expression of M2 macrophage marker, CD163.**Notes:** Results are presented as mean ± SD. \#\#p \< 0.01, compared with M0.
MTT Assays {#S0002-S2003}
----------
M0 monocytes were inoculated into 96-well plates at a density of 1 × 10^4^/well and different concentrations of DHA or dimethyl sulfoxide (DMSO) added. After 24 h of treatment, 10 μL freshly prepared 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent was added to each well and the cells incubated at 37°C for 4 h. Then, 100 μL of DMSO was added to each well and oscillated on a shaker at a low speed for 10 min, room temperature. The absorbance value (OD, 490 nm) of each well was measured using an enzyme-linked immunodetector (Model 550, Bio-Rad, Hercules, USA).
Flow Cytometry {#S0002-S2004}
--------------
Cells were detached from a six-well plate by trypsinization and a cell suspension (1 × 10^6^/mL) prepared. An anti-CD163 antibody (1:60, Abcam Cambridge, UK) was added and incubated at room temperature for 30 min. Then, the cells were washed three times and resuspended in 1 mL of phosphate-buffered saline (PBS). Cells were sorted using a FACSCalibur flow cytometer (BD Biosciences, USA) and analyzed with BD FACSDiva software (BD Biosciences, USA).
Quantitative Real-Time PCR Assay (qRT-PCR) {#S0002-S2005}
------------------------------------------
TRIzol reagent (Invitrogen, Carlsbad, USA) was used to extract total RNA from a variety of cells. Prime Script RT reagent kit (Takara, Dalian, China) was used for reverse transcription, and a TB green Premix Ex Taq (Takara, Dalian, China) was used for amplification. Glyceraldehyde-3-phosphate dehydrogenase (*GAPDH)* was used as an endogenous control for mRNA expression detection. Data were compared and analyzed using the 2^−ΔΔCt^ method. All primer sequences are listed in [Table 1](#T0001){ref-type="table"}.Table 1qRT-PCR Primers Used in This PaperGeneForward PrimersReverse Primers*VEGFA*AGGGCAGAATCATCACGAAGTAGGGTCTCGATTGGATGGCA*MMP9*AGACCTGGGCAGATTCCAAACGGCAAGTCTTCCGAGTAGT*MMP10*TTTGGCTCATGCCTACCCACTCTTGCGAAAGGCGGAACTG*CD206*CAGGTGTGGGCTCAGGTAGTTGTGGTGAGCTGAAAGGTGA*IL-10*GGTTGCCAAGCCTTGTCTGAAGGGAGTTCACATGCGCCT*CCL18*CTCTGCTGCCTCGTCTATACCTCTTGGTTAGGAGGATGACACCT*GAPDH*TCCAAAATCAAGTGGGGCGAAGTAGAGGCAGGGATGATGT
Preparation of Macrophage Medium {#S0002-S2006}
--------------------------------
Culture medium was removed from macrophages in different states (with or without drugs and polarized or unpolarized), and the cells washed three times with PBS, followed by the addition of serum-free RPMI-1640 medium for 24 h. The obtained medium was centrifuged at 10,000 rpm for 5 min and stored at −80°C (hereafter referred to as macrophage conditioned medium (CM)).
Enzyme-Linked Immunosorbent Assay (ELISA) {#S0002-S2007}
-----------------------------------------
Levels of the cytokine, interleukin-10 (IL-10), in conditioned medium from M0 macrophages with or without DHA treatment, conditioned medium from M2 macrophages with or without DHA treatment, conditioned medium from M0 with DMSO treatment, and conditioned medium from M2 macrophages with DMSO treatment were detected using a human IL-10 ELISA kit (BIKW BioCo, Ltd., Beijing, China) as per manufacture's instruction.
Wounding-Healing Assay {#S0002-S2008}
----------------------
Fadu/Cal-27 cells were inoculated into 6-well plates at a density of 8 × 10^5^/well. The next day, a vertical scratch was made in the center of the cells using a pipette tip (200 μL), and the detached cells were washed away with PBS. Each of the four kinds of macrophage CM or RPMI-1640 medium was mixed 1:1 with complete DMEM and then added to the 6-well plates. After 24 h in an incubator, cells were photographed using an inverted electron microscope (Olympus, Tokyo, Japan) with a digital camera (Canon, Tokyo, Japan) and analyzed using ImageJ software (National Institutes of Health, MD, USA).
Transwell Invasion Assay {#S0002-S2009}
------------------------
A transwell chamber coated with 40 μL Matrigel (Corning, NY, USA) at a concentration of 200 μg/mL, was placed in a 24-well plate, and Fadu/Cal-27 cells inoculated at a density of 5.0 × 10^5^/mL. Each of four kinds of macrophage medium or RPMI-1640 medium was mixed 1:1 with complete DMEM and then added into the low chambers of the culture plate. After 48 h cells were washed with PBS, fixed in paraformaldehyde for 20 min, and dyed with crystal violet. A visual field was randomly selected under a microscope and analyzed using ImageJ software.
Tube Formation Assay {#S0002-S2010}
--------------------
Each of four kinds of CM was mixed 1:1 with M199 complete medium and then stored for use. Matrigel (70 μL, 8 mg/mL), was plated in 96-well plates and placed in an incubator for 30 min, followed by addition of the medium and 1.5 × 10^4^/well HUVECs. After 6 h, three fields were randomly observed at 200× magnification, and the lumens of formed tubes analyzed and cells counted using Axiovision Rel 4.1 software (Zeiss, Germany).First, Fadu/Cal-27 cells were inoculated into 6-well plates at a density of 1 × 10^6^/well. Then, each of the four kinds of macrophage CM or RPMI-1640 medium was mixed 1:1 with complete DMEM and added to the 6-well plates. After 24 h in an incubator, the obtained medium was centrifuged at 10,000 rpm for 5 min and stored at −80°C. Each of the four kinds of CM or RPMI-1640 medium was mixed 1:1 with M199 complete medium and then stored for use. Matrigel (70 μL, 8 mg/mL), was plated in 96-well plates and placed in an incubator for 30 min, then medium and 1.5 × 10^4^/well HUVECs added to the 96-well plate. After 6 h, three fields were randomly observed at 200× magnification, and the lumens of formed tubes analyzed and cells counted using Axiovision Rel 4.1 software.
Western Blot {#S0002-S2011}
------------
HNSCC cells and other cells from 6-well plates or tissue specimens were harvested in a lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) and incubated for 30 min at 4°C. Proteins were obtained after centrifugation at 13,000 rpm for 10 min and then quickly frozen. Equivalent amounts of proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene fluoride membranes (Millipore Corporation, Temecula, CA). After blocking with TBS plus 5% nonfat milk for 3 h at room temperature, membranes were incubated with primary antibodies, including anti-STAT3 (1:2,000; Cell Signaling Technology, Boston, USA), anti-p-STAT3 (1:2,000; Cell Signaling Technology, Boston, USA), anti-E-cadherin (1:1000; Proteintech Group Inc., Chicago, USA), anti-Vimentin (1:1000; Proteintech Group Inc., Chicago, USA), and anti-rabbit-β-actin (1:3,000; Proteintech, Wuhan, China), overnight in a refrigerator. Membranes were then incubated with a secondary antibody (1:5,000; Golden Bridge Co., Ltd., Beijing, China) for 1 h at room temperature. After washing in TBST, membranes were incubated with SuperSignal™ West Dura Extended Duration Substrate (Thermo Fisher Scientific, Waltham, USA). Immunoreactive proteins were visualized using the Chemiluminescence Detection System (GE Healthcare Life Sciences, Amersham, UK) or Fusion FX5 Spectra (Vilber, French).
Lentivirus Infection of Target Cells {#S0002-S2012}
------------------------------------
According to the manufacturer's suggestion (Hanbio, Shanghai, China), cells in good condition at a density of 3 × 10^5^/well were inoculated into 12-well plates, treated with a multiplicity of infection of 50 using the lentivirus vectors, rlv-hstat3-hygro and rlv-luciferase-puro (Hanbio), and cultured overnight at 37°C in a 5% CO~2~ incubator. After 24 h, fresh complete RPMI-1640 medium was added for 24 h. After the cells had been incubated with the lentiviruses for 48 h, 5 µg/mL puromycin and 500 µg/mL hygromycin (Hanbio) were used for drug screening. Finally, p-STAT3 expression was detected by Western blotting.
Statistical Analysis {#S0002-S2013}
--------------------
Data are expressed as the mean ± SD. Student's *t*-test or one-way ANOVA were used for statistical analyses, as appropriate. All results were considered statistically significant at p \< 0.05. All graphs were plotted using GraphPad Prism 7 (GraphPad Software Inc, CA, USA).
Results {#S0003}
=======
Thp-1 Cells Were Induced to Become M2-Like TAMs {#S0003-S2001}
-----------------------------------------------
As shown in [Figure 1](#F0001){ref-type="fig"}, stimulation with PMA induced Thp-1 cells to become macrophages; cell morphology changed from suspension cells to adherent cells with obvious pseudopodia ([Figure 1A](#F0001){ref-type="fig"}). After continuous stimulation with PMA and IL-4/IL-6, the expression of CD163, a surface marker of M2-like TAMs, increased significantly ([Figure 1D](#F0001){ref-type="fig"}). As expected, levels of IL-10, CD206, matrix metalloproteinase-9 (MMP-9), and chemokine ligand-18 (CCL-18) mRNA were upregulated with the increase in CD163 ([Figure 1C](#F0001){ref-type="fig"}). IL-10 and CD206 expression levels were in direct proportion to the number of M2 macrophages.[@CIT0018],[@CIT0019] These data indicate that Thp-1 monocytes were successfully polarized into M2-like macrophages using PMA, IL-6, and IL-4.
DHA Inhibited M2-Like TAM Polarization in vitro {#S0003-S2002}
-----------------------------------------------
To test whether DHA can inhibit M2-like TAM polarization, we first determined the appropriate concentration of DHA. A toxicity study showed that DHA and DMSO did not kill macrophages ([Figure 2A](#F0002){ref-type="fig"}). Based on previous MTT results for the Fadu and Cal-27 cell lines generated in our laboratory, the concentration of DHA was set at 50 μM.[@CIT0020] We used the levels of the M2-like TAM surface marker, CD163, to represent the number of M2-like TAMs. As shown in [Figure 2C](#F0002){ref-type="fig"}, the number of M2-like TAMs clearly increased significantly with the addition of IL-4 and IL-6, while addition of DHA led to a significant decrease in the number of M2-like TAMs. ELISA results also demonstrated a reduction in IL-10 expression on addition of DHA ([Figure 2B](#F0002){ref-type="fig"}). Evaluation of mRNA expression further confirmed the effect of DHA, which significantly decreased the expression levels of vascular endothelial growth factor A (VEGFA), MMP-9, and matrix metalloproteinase-10 (MMP-10) ([Figure 2D](#F0002){ref-type="fig"}). Moreover, tube formation assays demonstrated that M2-like TAMs promoted vascular formation, which decreased with DHA treatment ([Figure 2E](#F0002){ref-type="fig"}). Given the expression levels of IL-10, determined by ELISA and MTT results ([Figure 2A](#F0002){ref-type="fig"} and [B](#F0002){ref-type="fig"}), our results demonstrate that DMSO did not reduce the quantity of M2-like TAMs.Figure 2DHA inhibited M2-like TAM polarization in vitro. (**A**) MTT was used to evaluate the toxicity of DHA and DMSO against macrophages. (**B**) Levels of IL-10 in the cell culture medium were measured by ELISA. (**C**) Flow cytometry was used to evaluate the expression of the M2 macrophage marker, CD163. (**D**) qRT-PCR was used to detect the expression levels of *CD206, MMP9, MMP10*, and *VEGFA* genes in M2 macrophages. (**E**) The tube formation assay was used to examine the effect of conditioned medium on angiogenesis.**Notes:** Results are presented as mean ± SD. ^\#\#^p \< 0.01, ^\#^p \< 0.05, ns = not significant, compared with M0; \*\*\*p \< 0.01, \*p \< 0.05, ns = not significant, compared with M2.
DHA Inhibited HNSCC Cells Invasion, Metastasis, and Angiogenesis by Inhibiting M2-Like TAM Polarization {#S0003-S2003}
-------------------------------------------------------------------------------------------------------
Previous studies have identified M2-like TAMs as contributing to the migration, invasion, and angiogenesis of various cancers, including breast, liver, and gynecological cancers.[@CIT0020]--[@CIT0022] To determine the relationship between M2-like TAMs and HNSCC cells, as well as the effect of DHA, we conducted several experiments. Wounding-healing experiments and Western blot analysis showed that CM from M2-like TAMs significantly promoted HNCSS cells migration, while in the M2DHA group, CM decreased this effect ([Figure 3A](#F0003){ref-type="fig"}). A transwell invasion assay demonstrated that M2-CM had stronger invasion-promoting effects on Fadu and Cal-27 cells than M0-CM, while M2-DHA-CM significantly reduced tumor invasion ([Figure 3B](#F0003){ref-type="fig"}). In addition, Fadu and Cal-27 cells had an increased effect on tumor angiogenesis in response to M2-like TAMs, and an inhibitory effect of DHA on angiogenesis was also detected ([Figure 3C](#F0003){ref-type="fig"}).Figure 3DHA medium inhibited the migration, invasion, and angiogenesis of HNSCC cells. (**A**) The effect of DHA on HNSCC cells migration was evaluated by wound-healing, and expression of EMT-associated proteins, E-cadherin and Vimentin, was detected by Western blot analysis. (**B**) The effect of DHA on HNSCC cells invasion was evaluated by transwell assays. (**C**) The angiogenesis effects of DHA in HNSCC cells were evaluated by tube formation assay.**Notes:** Results are present as mean ± SD. ^\#\#^p \<0.01, \#p \<0.05, compared with M0. \*\*\*p \<0.01, \*p \<0.05, ns = not significant, compared with M2; ^++^p \<0.01, ns = not significant, compared with controls.
DHA Inhibited M2-Like TAM Polarization by Inhibiting STAT3 Phosphorylation {#S0003-S2004}
--------------------------------------------------------------------------
To explore the mechanism by which DHA inhibits M2-like TAM polarization, we made our conjecture based on the following findings: i) IL-6 can activate the STAT3 pathway, which is initiated by phosphorylation of the STAT3 protein;[@CIT0023] ii) DHA inhibits phosphorylation of the STAT3;[@CIT0024] iii) phosphorylation of the STAT3 is closely associated with differentiation of M2 macrophages.[@CIT0025],[@CIT0026] Therefore, we postulated that DHA could inhibit the M2-like TAMs polarization by inhibiting STAT3 phosphorylation. Western blot analysis confirmed our hypothesis, as p-STAT3 levels were upregulated by IL-4/IL-6 stimulation in M2-like TAMs, and this effect was reduced by DHA. Moreover, STAT3 expression did not change in response to IL-4/IL-6 treatment, whereas p-STAT3 levels were elevated in a time-dependent manner; however, DHA inhibited this increase, particularly 24 h after its addition ([Figure 4A](#F0004){ref-type="fig"}). Lentiviruses were used to activate the phosphorylation of macrophage STAT3 and Western blot analysis showed that p-STAT3 levels were significantly higher in the lentivirus group than those in the control group ([Figure 4B](#F0004){ref-type="fig"}), while STAT3 protein levels were not increased. As shown in [Figure 4C](#F0004){ref-type="fig"}, flow cytometry results demonstrated that IL-4/IL-6 stimulation led to higher CD163 expression levels in the lentivirus-treated group relative to the control group; however, after DHA treatment, CD163 expression levels in the control group decreased more significantly. The data showed that the lentivirus continued to activate the STAT3 pathway and competitively prevented DHA inhibition of macrophage polarization ([Figure 4C](#F0004){ref-type="fig"} and [D](#F0004){ref-type="fig"}). These results indicate that activation of the STAT3 pathway is directly related to the inhibitory effect of DHA on M2-like TAM polarization.Figure 4DHA inhibited STAT3 signaling in M2-like TAMs. (**A**) p-STAT3 and STAT3 protein expression levels during polarization or inhibition of polarization. (**B**) Macrophages were transfected and p-STAT3 protein expression activated and detected by Western blot. (**C**) Lentivirus treatment attenuated the inhibitory effects of DHA on M2-like TAMs. (**D**) Lentiviral treatment prevented complete inhibition of STAT3 phosphorylation by DHA, as determined by Western blot.**Notes:** Results are present as mean ± SD. ^\#\#^p \< 0.01, ns=not significant, compared with M0; \*\*\*p \< 0.01, ns = not significant, compared with M2; ^++^p \< 0.01, ns = not significant, compared with control.
Discussion {#S0004}
==========
Surgery, radiotherapy, and chemotherapy are the cornerstones of head and neck cancer therapy; however, they all have many limitations and side effects in clinical practice. For chemoradiation therapy, it affects not only tumor cells but also normal cells of the body. To minimize the toxic and side effects caused by chemoradiation, we may need a new approach that targets some non-tumor cell populations in the tumor microenvironment, like TAMs.
With breakthroughs in our understanding of the tumor microenvironment, TAMs have become a focus of cancer research, as they can produce various specific chemokines and cytokines in the tumor microenvironment which are necessary for cancer growth and metastasis.[@CIT0018],[@CIT0027] TAMs can promote progression and metastasis of breast, ovarian, lung, gastric, endometrial, and other cancers.[@CIT0020]--[@CIT0022],[@CIT0028]--[@CIT0030] In HNSCC, TAMs are recruited into the tumor microenvironment and directly contact squamous cell carcinoma cells to promote cancer progression, metastasis, and angiogenesis.[@CIT0031]--[@CIT0033] M2-like TAMs are the predominant type of TAMs, and numbers are directly related to cancer angiogenesis, radiotherapy, and chemotherapy responses, as well as overall survival rate.[@CIT0034]--[@CIT0038] Our in vitro experiments also showed that an increase or decrease in M2-like TAMs was positively associated with the invasion, migration, and angiogenesis of Fadu and Cal-27 cell lines. Hence, M2-like TAMs are the targets for treatment.
Currently, targeting treatments for TAMs are as follows: i) reduce the total number of TAMs or macrophages; ii) repolarize M2-like macrophages into M1-like macrophages; iii) reduce or inhibit tumor recruitment of TAMs; and iv) inhibit TAM activation, particularly of M2-like macrophages. Therefore, traditional Chinese medicine, particularly traditional Chinese medicine monomers, provides many promising options for TAM-targeting treatments. For example, resveratrol kills macrophages and reduces the production of blood vessels and lymphatic vessels in the tumor microenvironment.[@CIT0025] Hesperetin derivative-12 can regulate the polarization of macrophages and upregulate the number and activity of M1-like macrophages.[@CIT0039] *Celastrus orbiculatus* can reduce the expression of MMP-9 in gliomas, thereby reducing the recruitment of macrophages by primary cancers.[@CIT0040] Astragaloside can inhibit the polarization of M2-like macrophages and reduce the proportion of M2-like TAMs by modulating macrophage polarization through adenosine 5'-monophosphate-activated protein kinase (AMPK) signaling.[@CIT0041] Apart from these, IL-6 has been proven to promote polarization of M2-like TAMs through activation of STAT3.[@CIT0025],[@CIT0026] In view of the fact that DHA could block phosphorylation and thus activation of STAT3,[@CIT0024] we turned to test DHA as a potential TAM-targeted agent that is capable of inhibiting the polarization of M2-like TAMs.
Macrophages have various properties that can be altered by changes in the tumor environment.[@CIT0041] In many tumors, IL-6 is a highly abundant cytokine in the tumor microenvironment.[@CIT0042]--[@CIT0044] IL-6 increases the amount of IL-4 receptor (IL-4R) on the cell surface, making macrophages more sensitive to IL-4 and thus more likely to be polarized into M2 macrophages. This pathway is regulated by STAT3 phosphorylation activation via IL-6 receptor.[@CIT0045] *Il4ra* is sensitive to STAT3 stimulation by any STAT3-activating receptor, leading to increased IL-4R expression and increased sensitivity to IL-4. Our flow cytometry and qRT-PCR assays showed that IL-4 and IL-6 can induce polarization of M2 macrophages. These results are consistent with the findings of Chen et al and Fu et al.[@CIT0046],[@CIT0047]
In the tumor microenvironment, STAT3 play roles in the tumor progression and metastasis. STAT3 is activated in numerous primary tumors and exerts multiple protumor effects by regulating its downstream genes.[@CIT0040]--[@CIT0045] We found that DHA as a putative STAT3 inhibitor could inhibit HNSCC by blocking STAT3 activation, and thus downregulates a series of its downstream genes including cyclin D1, B-cell lymphoma-xl (Bcl-xL), B-cell lymphoma-1 (Bcl-1), E-cadherin, matrix metalloproteinase-2 (MMP2), MMP9, etc., of which proteins are associated with regulation of cell cycle, apoptosis, and epithelial--mesenchymal transition (EMT).[@CIT0024] Wang et al showed that DHA could prevent cancer stem cell (CSCs) metastasis by inhibiting EMT.[@CIT0048] In vivo, they found that DHA reduce lung metastasis formation caused by CSC and prolong survival of metastasis-bearing mice, with inhibition of STAT3 activation and downregulation of MMP-9, MMP-2, N-cadherin and upregulate E-cadherin in lung metastatic tumors. Hence, DHA is an effective drug suppressing migration and invasion of HNSCC. The effect of DHA on M2-like TAM polarization as well as tumor progression deserves to be further elucidated.
In many tumors, activation of macrophage STAT3 promotes M2 macrophage polarization.[@CIT0049]--[@CIT0051] We found that levels of p-STAT3 in macrophages increased in a time-dependent manner under stimulation with IL-4/IL-6, while the expression of CD163, an M2-like TAM marker, was also increased. When phosphorylation was inhibited, CD163 expression decreased. These results suggest that STAT3 phosphorylation is involved in M2-like TAM polarization. DHA is a semisynthetic derivative of artemisinin, a drug that blocks the phosphorylation of tyrosine residue 705 in the STAT3 protein, which is essential for STAT3 activation.[@CIT0024] By transducing macrophages using lentiviruses, we demonstrated that DHA inhibits M2-like macrophage polarization and reduced the number of M2-like TAMs by blocking phosphorylation of STAT3 in macrophages. In vitro, STAT3 expression levels were related to the number of macrophages and did not change with increased or decreased M2-like TAM numbers. These results indicate that inactivation of the STAT3 pathway is directly related to the inhibitory effect of DHA on M2-like TAM polarization.
In 1893, Rudolf Virchow proposed a relationship between tumor and inflammation based on his clinical observations; however, the molecular mechanism underlying this association has yet to be fully elucidated. Chronic inflammatory stimulation has always been the basis of tumor formation and is regarded as an epidemiological risk factor for most solid tumors. NF-κB is one of the most important inflammatory signals, while tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and other inflammatory factors can promote the growth and angiogenesis of head and neck cancer, and other cancers, through activation of NF-κB.[@CIT0052],[@CIT0053] Huang et al showed that, in an inflammatory environment, DHA inhibits NF-κB pathway activation in an Nrf2-dependent manner, thus preventing the production of TNF-α and IL-1β by primary macrophages.[@CIT0054] In a study of the parasitic disease malaria, the malarial pigment hemoglobin (Hz), a heme metabolite produced by *Plasmodium*, was found to induce human M0 macrophages to polarize into M2 macrophages under physiological conditions.[@CIT0055] Further, the combination of chloroquine and artemisinin can inhibit M2 macrophage polarization by blocking activation of the NF-κB and PI3K/Akt pathways. These findings suggest that dihydroartemisinin as a derivative of artemisinin could inhibit M2 macrophage polarization by blocking activation of the NF-κB and PI3K/Akt pathways, which might also be happening in tumor microenvironment.
Noori et al showed that DHA can shift the Th2 immune response toward a Th1 response, significantly reducing the number of CD4(+) T cells in animal spleen and physiological IL-4 levels in the animal model.[@CIT0056] In the breast cancer model, CD4(+) T cells release IL-4 and interleukin-13 (IL-13), and IL-4 induces macrophage polarization into M2-like TAMs via AMPK signaling in the tumor microenvironment.[@CIT0039],[@CIT0057] When IL-4 expression is greatly reduced in vivo, its ability to polarize M2 macrophages through the AMPK pathway will inevitably decrease, thereby also reducing M2-like TAM numbers, consistent with our experimental findings. Cho et al showed that artemisinin (also a derivative of *Artemisia annua*) significantly stimulates M1 macrophage induction by lipopolysaccharide (LPS), as well as interleukin-12β (IL-12β) production.[@CIT0058] Artemisinin stimulates the production of IL-12β by inhibiting JNK signaling pathway activation and IL-12β has an important role in generation of the Th1 immune response, triggering NK cell activation, CD4(+) Th1 cell production, CD8(+) T cell responses, and other anti-tumor activities.[@CIT0059],[@CIT0060] Production of reactive oxygen species (ROS) downstream of LPS signaling in macrophages mediates the production of inflammatory cytokines. Upregulation mitochondrial ROS (mROS) expression is key to the antibacterial activity of M1 macrophages, and ROS production may be important for the activation and function of M1 macrophages.[@CIT0061] DHA promotes ROS production in cancer;[@CIT0062] therefore, we further addressed whether DHA can induce M2-like TAMs to polarize into M1-type macrophages, which can participate in the Th1 immune response and kill tumor cells.
Cyclooxygenase-2 (COX-2) is an inducible enzyme that catalyzes the synthesis of prostaglandins and a common target for chemotherapy. Abrahão et al and Lin et al demonstrated that COX-2 is involved in proliferation of head and neck cancer cells. The expression of COX-2 is significantly increased in HNSCC. Therefore, COX-2 could be used as a treatment target for HNSCC.[@CIT0063],[@CIT0064] Kim et al reported that dihydroartemisinin can effectively inhibit COX-2 production in macrophages by downregulating PI3K/Akt and MAPK pathway activity.[@CIT0065] These findings suggest that dihydroartemisinin could inhibit proliferation of head and neck cancer cells by reducing the expression of COX-2 in M2-like TAMs in tumor microenvironment.
In vitro experiments showed that DHA can inhibit M2-like TAM polarization; however, the generation, progression, and metastasis of human tumors is an extended inflammatory process, where the induced inflammatory factors are persistent and promote constant changes in the tumor environment, resulting in macrophages receiving various activation signals over an extended period, during which polarization may occur at any time. Polarization may not occur alone; however, it will be a continuous process. Insoluble inflammatory factors may be present for hours, days, months, or years; however, the accompanying immune response maybe stopped at any time, leading to considerable uncertainty. Macrophage polarization is a dynamic process that involves the balance between various cytokines and chemokines and the recruitment of other immune or cancer cells. Therefore, our experiments can only reflect the changes in this dynamic process at a particular time point or under specific conditions.
In conclusion, our experiments show that DHA can partially block the polarization of M2-like macrophages by inhibiting STAT3 signaling activation in macrophages, thereby reducing the invasion, migration, and angiogenesis of HNSCC. Our study suggests that M2-like TAMs are a potential target for cancer therapy and provide a new sight regarding therapeutic potential of DHA in HNSCC treatment.
This study was supported by the Key Research and Development Project Plan of Hebei Province Science and Technology Department (No. 18277736D), and Key Subject of Medical Science Research in Hebei Province of China (No. 20170201).
Disclosure {#S0005}
==========
The authors report no conflicts of interest in this work.
|
Sam Gagner in Historical Context
Sam Gagner is one of two players that qualify for that distinction this season (if anyone knows how to make it into a nice little chart as Tyler has done, while still being able to import it to Blogger, please let me know):
Gagner compares very favourably with the best 18-year old NHL seasons, sitting between Marleau and Kovalchuk. This is encouraging. It's obvioius that most players in the NHL at age 18 are very good and that most of them only get better. I included Perron and Lucic even though this is their 19-year-old season since they came from the same draft. I think that their results probably speak to just how much of a difference there is between an 18-year-old NHL player and a 19-year-old NHL player and what might be expected of them. Perron's numbers are tied with Gaborik and Milan Lucic is outdoing Scott Hartnell and, of course, they're both outperforming Joe Thornton. If Perron and Lucic turn out to be as good at age 25 as Gaborik and Hartnell, I think that will say a ton about the potential of the NHL as a good place to develop young players. Having said that, I don't think either player can cover the bet. Given that Kane is also seven and a half months older than Gagner (is it really an 18-year-old season if your birthday is in November?), I think Gagner's season is even more impressive. He is a special player and is starting to make a difference at the NHL level today. I think the Oilers should feel compelled to build towards competing for the Cup in the last year of his (and Cogliano's) entry level contract. That ought to be the target. |
'use strict';
Object.defineProperty(exports, "__esModule", {
value: true
});
var _promise = require('babel-runtime/core-js/promise');
var _promise2 = _interopRequireDefault(_promise);
var _getPrototypeOf = require('babel-runtime/core-js/object/get-prototype-of');
var _getPrototypeOf2 = _interopRequireDefault(_getPrototypeOf);
var _classCallCheck2 = require('babel-runtime/helpers/classCallCheck');
var _classCallCheck3 = _interopRequireDefault(_classCallCheck2);
var _createClass2 = require('babel-runtime/helpers/createClass');
var _createClass3 = _interopRequireDefault(_createClass2);
var _possibleConstructorReturn2 = require('babel-runtime/helpers/possibleConstructorReturn');
var _possibleConstructorReturn3 = _interopRequireDefault(_possibleConstructorReturn2);
var _inherits2 = require('babel-runtime/helpers/inherits');
var _inherits3 = _interopRequireDefault(_inherits2);
var _nullthrows = require('nullthrows');
var _nullthrows2 = _interopRequireDefault(_nullthrows);
var _prosemirrorState = require('prosemirror-state');
var _prosemirrorTables = require('prosemirror-tables');
var _prosemirrorTransform = require('prosemirror-transform');
var _prosemirrorView = require('prosemirror-view');
var _ColorEditor = require('./ui/ColorEditor');
var _ColorEditor2 = _interopRequireDefault(_ColorEditor);
var _PopUpPosition = require('./ui/PopUpPosition');
var _UICommand2 = require('./ui/UICommand');
var _UICommand3 = _interopRequireDefault(_UICommand2);
var _createPopUp = require('./ui/createPopUp');
var _createPopUp2 = _interopRequireDefault(_createPopUp);
function _interopRequireDefault(obj) { return obj && obj.__esModule ? obj : { default: obj }; }
var setCellBorderBlack = (0, _prosemirrorTables.setCellAttr)('borderColor', '#000000');
var TableBorderColorCommand = function (_UICommand) {
(0, _inherits3.default)(TableBorderColorCommand, _UICommand);
function TableBorderColorCommand() {
var _ref;
var _temp, _this, _ret;
(0, _classCallCheck3.default)(this, TableBorderColorCommand);
for (var _len = arguments.length, args = Array(_len), _key = 0; _key < _len; _key++) {
args[_key] = arguments[_key];
}
return _ret = (_temp = (_this = (0, _possibleConstructorReturn3.default)(this, (_ref = TableBorderColorCommand.__proto__ || (0, _getPrototypeOf2.default)(TableBorderColorCommand)).call.apply(_ref, [this].concat(args))), _this), _this._popUp = null, _this.shouldRespondToUIEvent = function (e) {
return e.type === _UICommand3.default.EventType.MOUSEENTER;
}, _this.isEnabled = function (state) {
return setCellBorderBlack(state.tr);
}, _this.waitForUserInput = function (state, dispatch, view, event) {
if (_this._popUp) {
return _promise2.default.resolve(undefined);
}
var target = (0, _nullthrows2.default)(event).currentTarget;
if (!(target instanceof HTMLElement)) {
return _promise2.default.resolve(undefined);
}
var anchor = event ? event.currentTarget : null;
return new _promise2.default(function (resolve) {
_this._popUp = (0, _createPopUp2.default)(_ColorEditor2.default, null, {
anchor: anchor,
position: _PopUpPosition.atAnchorRight,
onClose: function onClose(val) {
if (_this._popUp) {
_this._popUp = null;
resolve(val);
}
}
});
});
}, _this.executeWithUserInput = function (state, dispatch, view, color) {
if (dispatch && color !== undefined) {
var cmd = (0, _prosemirrorTables.setCellAttr)('borderColor', color);
cmd(state, dispatch, view);
return true;
}
return false;
}, _temp), (0, _possibleConstructorReturn3.default)(_this, _ret);
}
(0, _createClass3.default)(TableBorderColorCommand, [{
key: 'cancel',
value: function cancel() {
this._popUp && this._popUp.close(undefined);
}
}]);
return TableBorderColorCommand;
}(_UICommand3.default);
exports.default = TableBorderColorCommand; |
Federal transportation policy stands at a crossroads. Will transportation continue to be a system funded essentially by user fees? And, if so, will those fees be devoted exclusively to roads and highways or support surface transportation more broadly? Alternatively, one could imagine a system that relies much more heavily on general revenue and is treated much like other programs funded in discretionary appropriations. In recent years, a greater and greater share of the federal role in surface transportation is supported by general revenues. Overall, between 25 and 30 percent of federal surface transportation programs are currently paid by general funds, and that percentage continues to grow. These budget realities suggest that the future could be very different from the past. If so, it is important that future transportation policy be debated and set intentionally, and not merely as the consequence of inaction. |
Q:
ActionBarSherlock: OnOptionsItemSelected doesn't recognize R.id.home
I'm using the ActionBarSherlock library and I'm following the exact steps as suggested here and here to enable navigation to the previous screen.
My code looks like this:
getSupportActionBar().setDisplayHomeAsUpEnabled(true);
and
@Override
public boolean onOptionsItemSelected(MenuItem item) {
// This callback is used only when mSoloFragment == true (see
// onActivityCreated above)
switch (item.getItemId()) {
case android.R.id.home:
// App icon in Action Bar clicked; go up
Intent intent = new Intent(this, MainActivity.class);
intent.addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP); // Reuse the
// existing
// instance
startActivity(intent);
return true;
default:
return super.onOptionsItemSelected(item);
}
But R.id.home is not recognized and home shows up in red. :-/ If I use the native actionbar the home declaration takes me to ids.xml file. But here the declaration is not found while I use the ActionBarSherlock Activity. Am I missing something?
A:
just replace this
android.R.id.home
to
R.id.home
and check your code... run it
because
R.layout.* are layouts you provide (in res/layout, for example).
android.R.layout.* are layouts that ship with the Android SDK.
A:
I know this is an old question but I believe the right answer is missing.
It should be be android.R.id.home because it is a platform resource, so your code is fine.
Make sure your minSdkVersion is 11 or higher since home was introduced in 11.
|
The Best Natural Sweeteners & Sugar Alternatives
“Sugar is poison at the right dose,” says Mark Hyman, MD, in Food: What the Heck Should I Eat?. “Most adults consume an average of 22 teaspoons a day, and kids consume up to 35 teaspoons.”
Most humans have a sweet tooth, and we’re well familiar with how easy overeating sugary foods can be. For years, manufacturers positioned artificial sweeteners like saccharin, aspartame, and sucralose as the ideal guilt-free alternative to sugar. With artificial sweeteners, you could supposedly enjoy all of sugar’s sweetness without the calories and its detrimental side effects.
Recent studies reveal the darker side of artificial sweeteners — how they might not be the cure-all solution for weight loss or a safer alternative to people with diabetes and other blood sugar issues. Some people complained about migraines or other side effects after they consumed an aspartame-sweetened soda or ate cookies sweetened with sucralose.
Over time, accumulating research revealed that artificial sweeteners aren’t a free pass and could even create weight gain, gut imbalances, and other health problems. Studies appeared with titles like “Gain weight by ‘going diet?’” or “Artificial sweeteners and the neurobiology of sugar cravings.” It turns out that artificial sweeteners probably aren’t that free pass after all.
If sugar is bad for you and artificial sweeteners are potentially worse, what’s the solution to satisfy your sweet tooth? Manufacturers have skillfully positioned natural sweeteners as that healthier alternative. Many (but not all) of these sweeteners, which you’ll find at your health food store or local grocer, don’t carry problems associated with artificial sweeteners. They may even be able to provide certain nutrients or benefits table sugar can’t provide. Emphasis on may. Natural sweeteners fall under a broad category, and some are better than others. A few examples include:
Honey: Perhaps the original go-to healthy table sugar alternative, honey, has been used for thousands of years for its medicinal and therapeutic benefits. It provides small amounts of proteins, enzymes, amino acids, minerals, vitamins, and antioxidants. However, honey still breaks down to the same simple sugars (glucose and fructose) as regular sugar and therefore carries similar adverse effects as table sugar. Clever marketing surrounds honey, and you might not be buying what you think you’re getting. If you opt for honey as a sweetener, research the company, preferably look for raw, organic, unfiltered honey, and treat it like sugar.
Molasses: This is another old-school sugar alternative that can actually provide some health benefits. “Molasses is the by-product of sugar refining that contains all the nutrients from the raw sugarcane plant,” says Jonny Bowden, PhD, in The 150 Healthiest Foods on Earth. He recommends blackstrap molasses, which contains the lowest sugar content of the molasses, but with many more nutrients found naturally in the sugarcane plant. As with honey, treat molasses as a slightly more nutrient-dense form of sugar; which is to say, use it sparingly.
Coconut sugar: Coconut in all its many forms — oil, butter, milk, and flour — has a stellar health reputation. Unfortunately, coconut sugar doesn’t make the pass. Besides providing a few nutrients, coconut sugar has essentially the same chemical makeup as table sugar. That doesn’t make it bad, but treat organic coconut sugar like you would regular sugar.
Agave: Agave containsup to 90 percent fructose, the most metabolically damaging sweetener. Table sugar, on the other hand, contains aboutequal amounts of fructose and glucose. “Agave nectar, which sounds like it should be good for us, is almost pure fructose, a giant metabolic red flag,” says Hyman. “Even raw cane sugar has more going for it.” In other words, despite its healthy glow, skip this one.
Yacon syrup: Derived from the roots of the yacon plant, yacon syrup provides a rich source of the prebiotic fiber fructooligosaccharides (FOS). Studies show FOScan increase satiety to help manage weight, as well as conditions like diabetes. MaxLiving Essential Bars contain small amounts of yacon syrup.
With a few exceptions (such as monk fruit), most of these natural sweeteners behave like regular sugar and contain some calories. Natural sugar alternatives, on the other hand, taste sweet and provide some nutrients while having very few or zero calories. The most popular ones include sugar alcohols and stevia.
Researchers define these sweeteners as, “compounds which have a sweet taste and contain no calories or those which sweetness is so intense so can be used at very low concentrations, thus, their impact on the total caloric value of the product is negligible.” You’ll find these sweeteners at many health food stores and even conventional supermarkets, and the right ones can provide health benefits while enjoying the pleasure of sweetness without the problems of sugar and artificial sweeteners.
Sugar Alcohols
Sugar alcohols, also called polyols, are naturally occurringzero- or very-low-calorie sweeteners include sorbitol, xylitol, mannitol, lactitol, maltitol, and erythritol. Your body cannot metabolize sugar alcohols so you mostlyexcrete them in urine. Researchers find they have a minimal (if at all) impact on blood sugar and insulin levels, making them ideal for people with blood sugar imbalances or type 2 diabetes. Among the healthiest sugar alcohols are erythritol and xylitol:
Erythritol. Whereas artificial sweeteners like sucralose are often many times sweeter than sugar, ounce-for-ounce erythritolcarries about 60–80 percent of sugar’s sweetness. Erythritol worksas an antioxidant, and one study found it helpsmaintain and improve oral health better than sorbitol and xylitol. “As sugar alcohols go, there’s one that may be better than the rest,” says Hyman. “Erythritol is… the only sugar alcohol that doesn’t cause digestive distress because your intestines absorb it rather than sending it to your colon to ferment and cause trouble.” Hyman notes that erythritol also won’t raise your blood sugar or insulin levels. “There seems to be only one problem,” he continues. “New research links it to weight gain because it can be absorbed and metabolized. Sorry, no free lunch, or free cookies, as the case may be.”
While some products contain small amounts of xylitol or erythritol, most commercial foods and beverages contain maltitol, one of thebiggest sweetener offenders for gastric distress including gas, bloating, and diarrhea. Actually, any sugar alcohol can create these problems because they are not digested until they reach your colon, which has a field day fermenting them (hence the gastric side effects). A little xylitol, erythritol, or other sugar alcohol goes a long way. Some products contain excessive amounts (which can cause gastrointestinal issues), so always read ingredients and labels to know how much you’re getting.
You can find xylitol or erythritol in packets or a powder, but be aware some commercial brands combine these sugar alcohols with undesirable ingredients like dextrose (sugar). Always read labels and look for an organic powder that contains no other ingredients. Taste is subjective, and some people might not find xylitol or erythritol pleasant. Worth repeating: a little of these sugar alcohols goes a very long way.
Stevia
Another popular natural sweetener is stevia, extracted and purified from the Stevia rebaudiana Bertoni plant, native to South America where it has been used as a sweetener for hundreds of years. Stevia is about200 times sweeter than sugar, with minimal, if any, impact on blood sugar levels. In fact, research shows stevia canhave therapeutic benefits including lowering blood glucose and normalizing blood pressure, potentially making itan ideal sweetener for people who want to manage their weight or type 2 diabetes.
As with sugar alcohols, buying stevia can become especially confusing because they rarely just contain that sweetener. Stevia in the Raw®, a commercial brand of stevia, ironically contains dextrose (sugar) as its first ingredient. Truvia® combines stevia with erythritol and dubious natural flavors, while Splenda® Naturals combines erythritol with stevia leaf extract. Combining sweeteners is more cost-effective and “bulks up” the tiny stevia molecule.
If you’re looking for a stevia powder, find a product that contains only that sweetener (such as 100 percent pure organic stevia leaf extract). The only way to truly know what you are getting is by reading the ingredients. Do not pay attention to what the label promises. Meaningless terms like “all-natural” could include lactose, dextrose, or other undesirable additives. Because pure stevia cannot be labeled a sweetener, you might find these products in your supplement aisle. A tiny bit of stevia goes a long way, and using too much can create a bitter taste. Some people complain that stevia has an awkward aftertaste. While stevia in small amounts is safe for most people, those oncertain medications(including blood-pressure and cholesterol-lowering drugs) should talk with a healthcare professional before using stevia.
What’s the Healthiest Sweetener?
Simply put: there is no perfect sweetener, even if some natural sweeteners (including stevia) can potentially provide health benefits. A better solution is to learn to appreciate the natural sweetness in foods like berries, vegetables, and nuts.
“There’s only one long-term solution to the sugar problem: We all need to wean ourselves off sweetness as much as possible,” says Hyman. “As long as we keep eating sweets, we’ll keep wanting more. Learning to live without them may take some time. It requires cultivating an appreciation for all the other tastes that make food so delicious—the savory, the sour, even the bitter. But it’s possible.”
Some people discover a newfound awareness of sweetness after they reduce or eliminate added sweeteners, realizing how overstimulated their taste buds became by using them. At the same time, some foods and beverages taste better with a little sweetener. You may want to, occasionally, enjoy a healthy snack that contains added sweeteners. On those occasions, small amounts of pure stevia, erythritol, or xylitol should be perfectly fine for most people, although please check with your healthcare professional with any specific concerns.
Alternately, you might choose products that contain a small amount of raw organic honey or yacon syrup. These are fine too. Just remember to treat these sweeteners as you would sugar and enjoy them moderately.
Disclaimer: The information provided on this website, by MaxLiving, is for general use only. Any statement or recommendation on this website does not take the place of medical advice nor is meant to replace the guidance of your licensed healthcare practitioner. These statements have not been evaluated by the Food and Drug Administration. MaxLiving information is and products are not intended to diagnose, cure, treat, or prevent any disease or provide medical advice. Decisions to use supplements to support your specific needs should be considered in partnership with your licensed healthcare practitioner. |
Jeff Bezos donned a robot suit over the weekend, and he looked pretty happy about it.
The Amazon (AMZN) CEO tweeted a photo of himself testing out a giant mechanical robot suit at the company's exclusive MARS conference late Sunday night. The conference focuses on machine-learning, home automation, robotics and space.
"Why do I feel so much like Sigourney Weaver?" Bezos asked the audience, referring to the actress's lead role in "Alien."
The robot was designed by South Korean company Hankook Mirae Technology and is almost 14 feet tall, according to the company's website.
I just got to pilot an awesome (and huge) robot thanks to Hankook Mirae Technology. Nice! #MARS2017 pic.twitter.com/MvN6ghEYFi — Jeff Bezos (@JeffBezos) March 20, 2017
One MARS attendee tweeted a video of Bezos causing the robot's arms to flail.
Others took to Twitter comparing Bezos to everything from a super villain to something out of "Iron Man" to being ready for "world domination." |
Hello members can anyone identify this plant - it is growing in the little orchard where i keep our chickens,
i would really like to move it as its not in the best spot for us but it seems very happy in the semi shaded area it is in.The second photo shows the same plant , self seeded maybe? growing behind one of our garden sheds again quite a semi shhaded spot too.Naturally i dont want to risk losing it so i await your replies.
Cheers :)
It is a lily, most likely Lilium martagon. No problem in moving it, just remember that it is a bulb and that it should be dug up just after all the foliage has died down, probably August/September. Replant the bulb in a similar situation to what it is now growing in.
Many thanks to you all for clearing up the mystery, my wife did think it was a lily but had no idea which one.Thanks to your prompt replies i just googled it & found this interesting link http://www.telegraph.co.uk/gardening/howtogrow
/3321833/How-to-grow-Martagon-lily.html
Cheers
@saeburngirl- Gosh 20 of them that must be a lovely sight ...a picture posted please ;)
@Moongrowe- yes we need to make sure if we move it that its in a like for like place, my wife has suggested that it i get a move on with my next project ie; building the Pergola garden swing it can go along side their so we can enjoy the fragrance.So ho ho ho its off to work i go :)
Now I've grown a variety very similar to this from seed last year ,Lilium Michauxii,or is it the same plant?, was a bit disappointed when they arrived as I swapped the seeds and they we're crushed in the post so didn't hold out much hope,but every seed germinated last year they had 2 leaves this year they're over 3ft tall and think I can see buds, just planted them in the wood yesterday, even more excited after seeing your picture Iagojames:-)
No they are two different species Simbad. Lilium Michauxii comes from the southeastern States whilst Lilium Martagon is native to central Europe east through northern Asia to Mongolia and Korea, we collected seed in the Pyrenees. L. michauxii has larger flowers than L. Martagon and the flowers range from yellow through orange to red. L. Martagon flowers are a mauve shade or white when it is called L. Martigon alba. |
French cruiser Guichen
Guichen was a protected cruiser of the French Navy launched in 1897, commissioned in 1899 and retired in 1921. She was constructed by Ateliers et Chantiers de la Loire at Saint-Nazaire.
Guichen first steamed from Saint-Nazaire to undergo sea trials out of Toulon. In September 1903 she carried President Émile Loubet to Britain for an official visit. In 1913 she was converted into a training ship for boatswains at Brest. She was in the Channel at the start of the First World War, but in 1915 she was transferred to the 3rd blockading squadron off Syria. In September, under Captain Joseph Brisson, she helped evacuate Armenian resistors from Musa Dagh after one of her crew spotted an Armenian flag flying over the fortress. She conveyed her refugees to Port Said. It was, according to Lord Bryce, "the only story ... with a happy ending" in his report on the treatment of Armenians in the Ottoman Empire. The ship's evacuation role was depicted in the historical drama film The Promise.
In November 1916 Guichen and Lutétia transported a Russian expeditionary force to the Salonika Front. In 1917 Guichen transported some of the Armée d'Orient from Taranto to Bizerte. In 1919 she was sent to the Black Sea as part of the Allied intervention in the Russian Civil War, where she suffered a mutiny, led by Charles Tillon (future leader of the Communist Party of France), on 26 June 1919. She was retired in 1921, and condemned and sold at Brest in 1922.
Notes
Category:Cruisers of the French Navy
Category:Ships built in France
Category:1897 ships
Guichen |
Q:
Difference in the variance between multiply a random variable and the sum of the same random variable
I suppose this is a pretty simple question but i can't figure out what i don't understand
Let's say we have X, a random variable representing the result of flipping a coin, 1 for head and -1 for tail.
If we have Y the sum of 10 throws and if we assume each throw is independent, we have $Var(Y) = 10 * Var(X) = 10$
But I also saw that $ Var(10 * X) = 10^2 * Var(X) = 100$
Why can't we consider that $Var(Y) = Var(10 * X)$ ?
I know it works mathematically but i would like to understand why it's not the same.
A:
The random variable $Y$ is the sum of 10 coin flips.
$$Y = X_1 + \dots + X_{10}$$
The coin flips are independent, therefore, we can write the variance of $Y$ as
$$Var(Y) = Var(X_1 + \dots + X_{10}) = Var(X_1) + \dots + Var(X_{10}) = 10*Var(X_1)$$
The last equality comes because each flip has the same probability mass function and they have the same variance.
Each flip corresponds to an independent random variable with its own probability mass function. Each flip is a different random event and you cannot simply treat them the same.
For example, to be $X_1 = X_2$, the outcome of the first flip should be the same as the second flip's outcome. That is to say, two coin flips have to be correlated perfectly. But it violates the assumption of flip's independence. Because each flip is independent of each other, it's possible that the first coin flip results in the head but the second coin flip's outcome is the tail. And in the case, $ X_{1} \neq X_{2} $ because $X_1 = 1$ and $X_2 = -1$.
That is to say,
$$ X_{1} \neq X_{2} \neq \dots \neq X_{10}$$
and,
$$Y = X_1 + \dots + X_{10} \neq 10*X_1$$
|
using System;
using NHibernate.Persister.Entity;
using NHibernate.Type;
using NHibernate.Util;
namespace NHibernate.Persister.Collection
{
/// <summary>
/// Summary description for ElementPropertyMapping.
/// </summary>
public class ElementPropertyMapping : IPropertyMapping
{
private readonly string[] elementColumns;
private readonly IType type;
public ElementPropertyMapping(string[] elementColumns, IType type)
{
this.elementColumns = elementColumns;
this.type = type;
}
#region IPropertyMapping Members
public IType ToType(string propertyName)
{
if (propertyName == null || "id".Equals(propertyName))
{
return type;
}
else
{
throw new QueryException(string.Format("cannot dereference scalar collection element: {0}", propertyName));
}
}
public bool TryToType(string propertyName, out IType outType)
{
try
{
outType = ToType(propertyName);
return true;
}
catch (Exception)
{
outType = null;
return false;
}
}
public string[] ToColumns(string alias, string propertyName)
{
if (propertyName == null || "id".Equals(propertyName))
{
return StringHelper.Qualify(alias, elementColumns);
}
else
{
throw new QueryException(string.Format("cannot dereference scalar collection element: {0}", propertyName));
}
}
public string[] ToColumns(string propertyName)
{
throw new System.NotSupportedException("References to collections must be define a SQL alias");
}
public IType Type
{
get { return type; }
}
#endregion
}
} |
ZEUS BARSTOOL
The Zeus winged back barstool with detailed decorative studding, will look stunning in any kitchen or bar area. Superbly finished on a solid beech wood frame, this is a style that was built to last in quality and design. |
salam
Assalamu'alaikum...
Senin, 28 Maret 2011
INTERNET EXPLORER and MOZILLA FIREFOX
It has moved from being a novelty into a necessity for most people. Most office jobs nowadays require some access to the internet in order to do research, send communications, or validate inventories. The range of tasks that can be done over the internet is very wide and so is the range of tools available. Even a single task like browsing has a lot of competing software available. Two of these are Internet Explorer and Firefox. Internet Explorer is a program developed by Microsoft to be included in every Windows operating system that is sold. It is the most widely used browser due to the fact that has been around the longest and it is included with Windows and most people do not bother with finding another one. The features of Internet Explorer are pretty basic and straightforward, and most of the time you won't have to do anything special in order to use it aside from installing plug-ins. Firefox is an internet browser from the software maker Mozilla. It is the primary threat to the dominance of Internet Explorer since it holds the biggest market share next to Internet Explorer. It is also preferred by most people who have tried it due to the fact that it is more stable and faster than Internet Explorer. It is also one of the first browsers to offer tabbed browsing that cleaned up the taskbar, unlike IE that opened a lot of windows and cluttered the taskbar. One great advantage that Firefox has over IE is the fact that it has an eager community behind it that creates a lot of add-ons that are compatible for Firefox. These add-ons extend the capability of Firefox and make it a lot more customizable to the user. When you come to think of it, it all boils down to preference. If you are not bothered by the less than stellar performance of IE and you don't want to go through installing a new browser then IE should be your best bet. It already comes preinstalled and you would only need to download patches every now and then, which IE should automatically do. But if you don't care about the added hassle of installing a new browser and you prefer to be up to date with the most recent features then you should look into Firefox. It is updated regularly with security patches and new features which you might like. |
Q:
Preventing the user to click a div when its fading out
I'm trying to create a filtering system where the user can filter for answers using more than one category, but the user can't choose more than one option from each category, so upon clicking an option from any category, that category will fade out ... I have the following little problem, if the user clicks on another option from the same category while it's fading out, he will be able to choose two options from the same category ... How can I disable any click on the category when it's fading out ??
Here is the code I'm using:
HTML:
<div class="search-list" id="program-list">
<span class="search-title">Category 1</span>
<a href="javascript:void(0)" class="search-option"><span data="program-list">Option 1</span></a>
<a href="javascript:void(0)" class="search-option"><span data="program-list">Option 2</span></a>
<a href="javascript:void(0)" class="search-option"><span data="program-list">Option 3</span></a>
<a href="javascript:void(0)" class="search-option"><span data="program-list">Option 4</span></a>
<a href="javascript:void(0)" class="search-option"><span data="program-list">Option 5</span></a>
<a href="javascript:void(0)" class="search-option"><span data="program-list">Option 6</span></a>
</div> <!-- search-list -->
<div class="search-list" id="trainer-list">
<span class="search-title">Category 2</span>
<a href="javascript:void(0)" class="search-option"><span data="trainer-list">Option 1</span></a>
<a href="javascript:void(0)" class="search-option"><span data="trainer-list">Option 2</span></a>
<a href="javascript:void(0)" class="search-option"><span data="trainer-list">Option 3</span></a>
<a href="javascript:void(0)" class="search-option"><span data="trainer-list">Option 4</span></a>
</div> <!-- search-list -->
<div class="search-list" id="issue-date">
<span class="search-title">Category 3</span>
<a href="javascript:void(0)" class="search-option"><span data="issue-date">Option 1</span></a>
<a href="javascript:void(0)" class="search-option"><span data="issue-date">Option 2</span></a>
<a href="javascript:void(0)" class="search-option"><span data="issue-date">Option 3</span></a>
<a href="javascript:void(0)" class="search-option"><span data="issue-date">Option 4</span></a>
<a href="javascript:void(0)" class="search-option"><span data="issue-date">Option 5</span></a>
<a href="javascript:void(0)" class="search-option"><span data="issue-date">Option 6</span></a>
</div> <!-- search-list -->
JQuery:
$('.search-option').click(function(){
var x = $(this).html();
$('#filtered-items').append(x);
$(this).parent('.search-list').fadeTo('slow', 0);
$('#filtered-items > span').click(function(){
$('#'+$(this).attr('data')).fadeTo('slow', 100);
$(this).hide();
});
});
I tried using the following JQuery code but it didn't work:
$('.search-option').click(function(e) {
e.preventDefault();
});
Thanks in advance...
A:
Hey everyone ... I finally solved it, I had to change the whole structure of the function and use the methods "unbind" and "bind" ... Here is the solution if anyone is interested in it:
$('.search-option').click(work);
});
function work(){
var x = $(this).html();
$('#filtered-items').append(x);
$(this).unbind('click');
$(this).siblings('a').unbind('click');
$(this).parent('.search-list').fadeOut('slow');
$('#filtered-items > span').click(function(){
$('#'+$(this).attr('data')).fadeIn('slow');
$('#'+$(this).attr('data')).children('a').bind('click',work );
$(this).remove();
});
};
Now the user can't choose more than one option at each category ....
|
Q:
SGE output and notification to the mail
in a SGE script with
#$ -M my_mail@gmail.com
#$ -m aes
SGE send notify of job complete.
how I can receive the output of the job with the this notification ?
A:
By default GridEngine will not send the job output via email.
The only way I can think of to achieve this is to write a custom epilogue script that runs after a job and emails the output to the user.
|
1. Field of the Invention
This invention relates to an electric stapler for binding chiefly sheets of paper placed one upon another by driving staples therethrough.
2. Description of the Prior Art
In the art of this type of electric stapler is known, for instance, the mechanism disclosed in Japanese Patent Laid-Open No. 137570/83. The electric stapler disclosed in this patent is essentially as outlined below. A magazine containing a strip of staples is provided movably up and down relative to the anvil and a slider arranged to push said strip of staples is elastically held by said magazine so as to be movable forwardly and backwardly. Above said magazine is swingably provided a working arm having a blade for driving the staples in said magazine one by one. The proximal end of said arm is elastically held by a compression spring which can expand and contract in the vertical direction. Substantially L-shaped drive arms are pivotally provided on both sides of said working arm, each of said drive arms being so arranged that the end of its horizontal portion is engaged with a roller disposed close to the fore end of said working arm. At the lower end of the vertical portion of each of said drive arms is rotatably mounted an eccentric roller secured to the corresponding one of a pair of pivotally supported crank discs which are operatively connected through gearing to a motor connected to a commercial power source by a cord.
The electric stapler of said mechanism is suited for binding pamphlets, booklets, etc., having a thickness in a certain range, but it has many problems in practical use. For instance, the mechanism for vertically moving the blade for driving the staples from the staple magazine is complicated and also necessitates many parts, which necessarily leads to a high manufacturing cost. Further, since the staple driver blade is moved up and down by the circular movements of the working arm and the drive arms on both sides thereof, the up and down movement of said blade in a vertical state may not be made smoothly, and a special mechanism is required for effecting such up and down movement of said blade in a vertical state. Moreover, since a commercial power source is required for the motor, the stapler is unusable where no commercial power source is available, and further handling of the cord makes trouble. |
The resurgence of Hormone-Sensitive Lipase (HSL) in mammalian lipolysis.
The ability to store energy in the form of energy-dense triacylglycerol and to mobilize these stores rapidly during periods of low carbohydrate availability or throughout the strong metabolic demand is a highly conserved process, absolutely essential for survival. In the industrialized world the regulation of this pathway is viewed as an important therapeutic target for disease prevention. Adipose tissue lipolysis is a catabolic process leading to the breakdown of triacylglycerols stored in fat cells, and release of fatty acids and glycerol. Mobilization of adipose tissue fat is mediated by the MGL, HSL and ATGL, similarly functioning enzymes. ATGL initiates lipolysis followed by the actions of HSL on diacylglycerol, and MGL on monoacylglycerol. HSL is regulated by reversible phosphorylation on five critical residues. Phosphorylation alone, however, is not enough to activate HSL. Probably, conformational alterations and a translocation from the cytoplasm to lipid droplets are also involved. In accordance, Perilipin functions as a master regulator of lipolysis, protecting or exposing the triacylglycerol core of a lipid droplet to lipases. The prototype processes of hormonal lipolytic control are the β-adrenergic stimulation and suppression by insulin, both of which affect cytoplasmic cyclic AMP levels. Lipolysis in adipocytes is an important process in the management of body energy reserves. Its deregulation may contribute to the symptoms of type 2 diabetes mellitus and other pathological situations. We, herein, discuss the metabolic regulation and function of lipases mediating mammalian lipolysis with a focus on HSL, quoting newly identified members of the lipolytic proteome. |
Q:
Bitwise operator in pseudo-code
I am translating a C++ program into pseudo-code using the algorithmicx package.
Do you know how I can represent the C bitwise operator like the shifts (<< and >>) ?
Until now I used power of 2 but it's not very convenient.
A:
I advise against Andrey’s solution. He is right that in general pseudocode should be independent of a specific machine or language.
But this breaks down with bit operations. Bit operations do suggest a specific underlying architecture, and the bit operators follow an established nomenclature.
You don’t make the code more readable by ignoring this convention – in fact, you do the opposite.
I have the following commands defined in my thesis template:
\newcommand*\BitAnd{\mathbin{\&}}
\newcommand*\BitOr{\mathbin{|}}
\newcommand*\ShiftLeft{\ll}
\newcommand*\ShiftRight{\gg}
\newcommand*\BitNeg{\ensuremath{\mathord{\sim}}}
(The command names follow the naming convention of the algorithmicx package which I can recommend for typesetting algorithms.)
That said, you should second-guess your reason for using bit operations in the first place – often they are only used to achieve specific optimisations, in which case they have no place in a pseudo-code. On the other hand, sometimes (and it sounds as if this may be the case for you) they have a legitimate purpose.
A:
Pseudocode has a different purpose compared to the actual programs. It should convey ideas, not implementation, and as such should be as close to the natural language as possible. Therefore I think it's not good to introduce programming language-specific syntax in the algorithm listing.
I suggest one of these options:
continue using algorithmicx and select a human-readable name for the operation: \State $x \gets \Call{ShiftLeft}{x, 3}$;
use the listings package and typeset the actual C++ program with comments.
A:
For symbols, you can use \ll and \gg for shifting, and \lll, \ggg for rotating.
\documentclass{article}
\usepackage{amssymb}
\begin{document}
$a\land b$, $a\lor b$, $\lnot a$, $a\oplus b$
$a\ll b$, $a\gg b$, $a\lll b$, $a\ggg b$
\end{document}
You can also define some functions:
\usepackage{amsmath}
\DeclareMathOperator\shl{shl}% shift left
\DeclareMathOperator\shr{shr}% shift right
\DeclareMathOperator\rol{rol}% rotate left
\DeclareMathOperator\ror{ror}% rotate right
and use $\shl(a,n)$ etc. in the algorithm.
|
Pakistan at the 2010 Summer Youth Olympics
Pakistan participated at the 2010 Summer Youth Olympics in Singapore
Medalists
Field hockey
Swimming
Taekwondo
Weightlifting
References
External links
Competitors List: Pakistan
Category:2010 in Pakistani sport
Category:Nations at the 2010 Summer Youth Olympics
Category:Pakistan at the Youth Olympics |
Q:
Change NA values in raster layers and loop in several layers
I would like to change -1 values to NA values (-9999) in my ascii layers using the raster package in R.
I know how to do this with one ascii layer, but would like to repeat this in multiple layers. I would like the output files to be named as the input files.
Here is my code:
asc <- raster("DAAC_AWC_CLASS.asc")
NAvalue(asc) <- -1
writeRaster(asc, filename="C:/Users/xblajo/Desktop/New folder/2/DAAC_AWC_CLASS.asc",
format="ascii", na.value=-9999)
A:
I don't know anything about this package but you should be able to do what you want with a loop:
setwd("C:/Users/xblajo/Desktop/New folder/2")
file_names <- list.files(pattern = '*.asc')
for (i in 1:length(file_names)){
asc <- raster(file_names[i])
NAvalue(asc) <- -1
writeRaster(asc,
filename = file_names[i],
format="ascii",
na.value=-9999)
}
|
Read More
The number of enterprises receiving venture capital funding dipped slightly, from 27 to 25. But t he number of companies receiving expansion funding tumbled by more than a third, down 37 per cent to £68m.
According to the index, there were only 171 high-growth companies in Scotland in 2016, accounting for 4 per cent of the UK total. That was down from 221 in the previous year.
Scotland is currently home to 58 private equity-backed companies, down from 72 previously.
However, that compares well with other parts of the UK in terms of the ratio of private-equity backed companies per 1,000. At 0.27, Scotland was behind only Wales (0.41) and London (0.38).
"Scotland has always had a strong start-up culture , even in this challenging environment for Scottish entrepreneurs," Barclays wealth and investment director John Godfrey said.
“It’s positive to see funding in our region has picked up on last year, however despite this uplift, investment is down on previous years and the number of high-growth companies has fallen."
Scotland’s figures reflect national trends, with the number of companies receiving venture capital and expansion funding both down year-on-year at a UK level.
Growth levels among young enterprises are also down at an all-time low, 33 per cent below its peak in 2013. The number of companies receiving venture capital investment is the lowest it has been in the report’s history.
Sandy Kennedy, Chief Executive of Entrepreneurial Scotland, said: “Scale-ups are vital to the Scottish economy as they create jobs, wealth and increased ambition and confidence.
"This research highlights how important it is that organisations across the public and private sectors work together to support leaders who are seeking to scale their businesses. No one organisation can do this alone.
"That’s why we are working together with partners such as Scottish Enterprise, Highlands and Islands Enterprise, Scottish Government, universities, investors, banks, advisers - and above all the entrepreneurs - to establish a collaborative scale-up movement.” |
Q:
Llamada a función de controlador desde vista - Laravel
Tengo una vista que me muestra los datos de un pedido.
Para finalizar el pedido tengo un botón de Paypal que, mediante script, se conecta y se hace el pago del pedido.
Lo que quiero es que si el pago se ha realizado correctamente, desde la vista llamar a una función del controlador que actualiza su estado y redirecciona al home de la aplicación.
He probado dentro del script hacer la llamada de la siguiente forma:
onAuthorize: function(data, actions) {
return actions.payment.execute().then(function() {
window.alert('Pago Completo!');
<?php echo PedidoDetalleController::finalizar_pedido($idpedido);?>
});
Pero me da error diciendo que no encuentra la clase:
Class 'PedidoDetalleController' not found (View: C:\TrastosyTesoros\trastos\resources\views\pedidodetalle\index.blade.php)
Tengo en el fichero de rutas definida la ruta:
Route::get('finaliza_pedido/{id}', 'PedidoDetalleController@finalizar_pedido');
También estoy probando con ajax haciéndolo de la siguiente forma:
onAuthorize: function(data, actions) {
return actions.payment.execute().then(function() {
window.alert('Pago Completo!');
$.ajax({
url: "finaliza_pedido'",
data: "id={{ $idpedido }}",
dataType: "json",
method: "GET"});
});
}
Pero en este caso, se carga la vista, pulso el botón de Paypal, se registra el pago tanto para el comprador como para el vendedor, pero es como si no llamara a la función del controlador ya que no se actualiza el estado del pedido.
La función del controlador lo que hace es lo siguiente:
public function finalizar_pedido($id){
DB::table('pedidos')
->where('idPEDIDOS',$id)
->update(['ESTADO' => 'T']);
return Redirect::to('home');
}
¿Alguna idea de qué estoy haciendo mal o cómo puedo hacer esta llamada de la vista a la función del controlador?
A:
No puedes llamar a la controladora de la manera que lo hicistes con un echo, ya que esta es llamada solo cuando el router de laravel encuentra que tu ruta en el navegador coincide con la que configurastes en el archivo web.php de tu carpeta routes. Por tanto lo que tienes que hacer es redireccionar tu página hacia la ruta de esa acción desde javascript luego de que te devuelva el success Paypal. Es decir:
onAuthorize: function(data, actions) {
return actions.payment.execute().then(function() {
window.alert('Pago Completo!');
document.location.replace("finaliza_pedido/{{ $idpedido }}");
}
|
2 alarm fire burns Renton home
Share this story
RENTON, Wash. -- A 2-alarm fire burned a home in Renton early Monday morning.
The fire broke out around 12:30 a.m. in the 11100 block of SE 162nd Street, Renton fire officials said. It quickly spread to two alarms and the fire was brought under control about an hour later. No one was hurt. |
Q:
Equal borders on touching div container "table"
I have a makeshift table of items that are rounded and equal borders by removing the bottom border from every container that ins't the first or the last.
What I'm trying to achieve, is when I hover, I'd like to have the entire "container" have a white border but it's not really possible at the moment because of the zero border. Does anyone have any suggestions? I'm assuming I have to do this with javascript.
Here is what I have so far (jsfiddle)
HTML
<div id="container">
<div class="item-container">
1
</div>
<div class="item-container">
2
</div>
<div class="item-container">
3
</div>
<div class="item-container">
4
</div>
<div class="item-container">
5
</div>
</div>
CSS
body {
background-color:#000;
}
#container { width:500px;}
.item-container { border:3px solid #7F7F7F;color:#7F7F7F;padding:10px;width:100%;border-bottom:0 }
.item-container:not(:first-child) { border-bottom:0; }
.item-container:hover { border:3px solid #fff;cursor:pointer;color:#fff; }
.item-container:first-child { border-top-right-radius:3px;border-top-left-radius:3px; }
.item-container:last-child { border-bottom:3px solid #7F7F7F;border-bottom-right-radius:3px;border-bottom-left-radius:3px; }
A:
You may create the border differently:
body {
background-color: #000;
}
#container {
width: 500px;
color: #7F7F7F;
border-radius: 3px;
border-bottom: 3px solid;
}
.item-container {
border: 3px solid #7F7F7F;
border-bottom: 0;
padding: 10px;
position: relative;
}
.item-container:after {
content: "";
position: absolute;
bottom: -3px;
right: -3px;
left: -3px;
height: 3px;
background-color: #7F7F7F;
}
#container .item-container:hover {
border-color: #fff;
z-index: 2;
transition: 1s;
}
#container .item-container:hover::after {
background-color: #fff;
z-index: 2;
transition: 1s;
}
<div id="container">
<div class="item-container">
1
</div>
<div class="item-container">
2
</div>
<div class="item-container">
3
</div>
<div class="item-container">
4
</div>
<div class="item-container">
5
</div>
</div>
|
The establishment of minority affairs offices in schools of dentistry: pros and cons.
The establishment of Minority Affairs Offices in dental schools following the American Association of Medical Colleges' model is discussed as one method of addressing the declining enrollment and compounding oral health disparities of underrepresented minorities African Americans, Hispanics, and Native Americans in U.S. dental schools. The pros and cons of the approach are discussed, with recommendations. |
Tuesday, November 15, 2016
Guillaume Chabot-Couture Interviewed by WIRED
Guillaume Chabot-Couture, Sr. Research Manager Polio team at IDM was featured in WIRED article Why It’s So Hard to Tell If a Country Is Really Rid of Polio ---written by Chelsea Leu.
At the time when the article was published, two cases of polio in Nigeria had been confirmed by the WHO, and efforts to quickly ramp back up vaccination efforts were underway. These cases had come approximately two years since the last case, a time when Nigeria appeared to be only a year away from being declared polio free.
A period of three years without cases was recommended in 1996 by the Global Commission for the Certification of Polio, and it requires that surveillance had been working well, without gaps or lapses, during that period of time for a country to be eradicated of polio. At the time, this recommendation was based on modeling work that suggested that if there were three years without cases within a population of 200,000 people, there were approximately 95% chances that transmission had been interrupted. However, the model used in this study assumed perfect information would be collected by health workers, and thus they would know exactly when cases were reported. In practice, however, perfect data is only an ideal.
One of Chabot-Couture’s colleagues conducted a study of the probability of Nigeria being eradicated of polio. The results of the model simulation predicted that the odds of wild poliovirus still in circulation would be very small by mid-2016, if there had not been any lapses in surveillance sensitivity.
The discovery of polio cases in Nigeria after 2 years suggest there were serious gaps in surveillance. Furthermore, an analysis of the genetic sequence of these cases showed that they were most closely related to cases even further back in time, which implied that the gaps in surveillance had been even more severe.
The ongoing insurgency of Boko Haram against the Nigerian army is likely to blame for this surveillance failure. This conflict has created grave population displacement in the region, and vaccination efforts have been interrupted for many years now in certain areas.
Recently, the IDM polio team has modeled what is the minimal population within which the poliovirus can circulate indefinitely, and they found that a population of approximately 200,000 would be sufficient. This is well below the size of the currently inaccessible population in Borno state in Nigeria, and this supports the idea that poliovirus circulated undetected within the inaccessible areas of Borno state.
As Chabot-Couture states in the article the world has achieved the difficult of eradicating a disease only twice so far: smallpox and rinderpest. Since polio cases are only a small fraction of all polio infections, it is difficult to track and stop the circulation of this virus. Nonetheless, much has been achieved so far and there are reasons to be optimistic that this outbreak will be controlled like others have been in the past. |
Bespoke Flowers
The products above are just some examples of designs we can create. If you can't see what you are looking for we can create a bespoke bouquet/arrangement especially for you, call us on 01279 658876 or chose our Bespoke Flowers.
We're often setting up a wedding so please call in advance rather than just popping in.
We're available at other times by appointment, evening appointments welcome for wedding, event and funeral consultations. Please call to arrange a meeting. |
Obviously, Breaking Bad was a massive hit for AMC that spawned a successful spin-off with Better Call Saul. With a massive cult following that remains dedicated to the show's characters and story, the cable network is still working on more projects that exist in that universe. After being off the air for four years, the show is being turned into a new VR immersive world by show creator Vince Gilligan.
He's calling this new project a "non-game, virtual reality experience" based on the television show. He's working hand in hand with Sony's Playstation PS4 to release his new work. There's no word yet an what form the Breaking Bad VR experience will take quite yet, but it will be extremely interesting to see where they go with this.
|
<?php
/**
* Copyright (c) Enalean, 2016. All Rights Reserved.
*
* This file is a part of Tuleap.
*
* Tuleap is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation; either version 2 of the License, or
* (at your option) any later version.
*
* Tuleap is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Tuleap. If not, see <http://www.gnu.org/licenses/>.
*/
namespace Tuleap\PullRequest\Exception;
use Exception;
class PullRequestNotCreatedException extends Exception
{
public function __construct()
{
parent::__construct("There was an error while creating the pull request");
}
}
|
More than 500 people taken to medical centers due to the leak of toxic fumes.
Malaysia's Ministry of Education has shut down 111 schools on Wednesday, March 13 in Johor after a suspected chemical leak last week. Due to the incident more than 200 children, teachers and other residents of that area suffered from serious health issues, as they received treatments for poisoning.
As per the reports, the Malaysian authority believes that the poisoning was caused by toxic waste dumped into Sungai Kim Kim in Pasir Gudang last Thursday, March 7.
Reuters reported that Education Minister Maszlee Malik said, "Based on the current situation and advisory from the state's disaster management committee, the Ministry of Education has decided to shut all 111 schools in the Pasir Gudang area immediately."
The minister had posted on Facebook that the situation is getting more critical. Maszlee also wrote that the Ministry of Education (KPM) has decided to close "111 schools in Pasir Gudang District effective immediately today (13 March 2019) up to one date that will be notified soon."
"According to that, all students, teachers, staff and employees in all schools regarding no need to attend to their respective school until the situation is back to heal.
"The Malaysian Education Ministry is asking for all parties to take precautions and always be alert with the authorities of the authorities from time to time."
Bernama reported that over 500 people received immediate treatment, while 166 people were hospitalized and nine individuals were shifted to ICU due to their exposure to the toxic fumes.
The poisonous smoke cases have increased after the authority was notified about the increased number of affected students from the surrounding area. Those students were taken to the Taman Pasir Putih community hall for shortness of breath, nausea and vomiting.
Khairuddin Aman Razali, who is a PAS lawmaker, also asked the government to declare a state emergency, due to the escalating situation and wrote in a Facebook post that "Does the government wish to wait for more victims to come forward... before announcing more drastic measures, and not just treatment?" |
20 for h.
4
Suppose -2*i + q + 0*q + 1 = 0, -4*i + 17 = 3*q. Solve -2 = -4*h + 2*h, 4*b + i*h - 22 = 0 for b.
5
Suppose 1 = -d + 2*r, -d - r + 4 = -4. Suppose 0 = 3*y - 2*y + 3*o + 9, -5*o = 5*y + 5. Solve h - d*z = -7, 2*h + y*z - 9 = 5*h for h.
-2
Let j = -3 + 5. Let y be 4*(1 + 1 + -1). Let h = j + y. Solve -3*k + h = 0, 0*k - k = 5*f - 27 for f.
5
Let l(f) = -2*f + 2*f + 13 - 3*f - 3*f**2. Let s(u) = 4*u**2 + 4*u - 19. Let r(x) = -7*l(x) - 5*s(x). Let w be r(0). Solve 0*z + z - 1 = -t, -w*z = 12 for t.
4
Let v be -2 + 4 + -14 + -2. Let f = v + 14. Solve o + 3*h - 5 = f, -3*o + 15 = 3*h - 0*h for o.
5
Suppose 0*q - 10 = -5*q. Solve -5*a - q*t + 4*t = -16, -2*t = -2*a + 4 for a.
4
Suppose -42 = -2*o + 4*n, -5*n - 5 - 1 = -o. Solve -2*q + 9 - 3 = 2*s, -3*s - o = -5*q for s.
-2
Let d be (-5)/(1*(3 + (-16)/4)). Solve -3*c + n - 8 = 0, 0 = c - d*c - 4*n - 16 for c.
-3
Let z be (6/5)/3*10. Let x(w) = -w**3 + 6*w**2 + 6*w + 8. Let b be x(7). Let s be 2 + 2/b + -1. Solve -z*j + 5*r + 0*r + 7 = 0, 3 = 2*j - s*r for j.
3
Let w be (-1)/(-6) + (-209)/(-6). Solve 4*u + 5*g = -w, 4*g + 2 = -10 for u.
-5
Let v be 4/10 - (-138)/30. Suppose -2*j = j - v*i - 5, -3*i = -j - 1. Solve -j*l + 11 = -5*p - 4, 0 = 5*l - p - 3 for l.
0
Suppose 7 + 0 = h. Solve 5*f = h*r - 4*r - 2, 2*f = 3*r + 1 for f.
-1
Suppose -4*a - b + 8 = -0*a, 0 = -5*b - 20. Suppose -4*r = -a*o, 3*o - 15 = -0*o - r. Solve 4*k + o = -2*i - 0, 4*i - 2*k + 8 = 0 for i.
-2
Suppose -2*q = q - 12. Suppose -4*l + 2*s = 3*s - 13, 0 = 5*s - 5. Suppose 2*f + 3 - 24 = l*i, -3*i = -f + 18. Solve q*k + c = f, -k - 4*c = -3*k - 12 for k.
0
Let m be 5 + 0 + (9 - 12). Let w = 13 + -8. Solve w*v = -5*q - 15, 2*v + 11 = -m*v - 5*q for v.
-4
Suppose 10 = -4*m - 2. Suppose k = 0, -2*h - k = -5*h - 24. Let x = m - h. Solve x*d + 2*y + 33 = 0, -5*y = -4*y + 4 for d.
-5
Suppose 4 = -2*u + 3*u. Solve -u*v - 3*p = -2*p - 20, -3*p = 5*v - 32 for v.
4
Suppose -3*q + 9 = -3*j, -3*q - j = -6*j - 15. Suppose s + 2*u - 15 = q, -u + 2*u + 2 = 0. Solve 4*f = 3*y + s, 4*f - 2*y - 15 = -f for f.
1
Let y = -22 - -29. Solve -k = -3*s - y, 2*s = k - 6*k - 16 for k.
-2
Suppose -5 = -5*y, 0 = -5*b - y - 4*y + 85. Solve u - b = -u + 4*k, -3*u + 3*k + 18 = 0 for u.
4
Suppose 3*m - 5 = g + 12, 0 = 2*g + 10. Solve m*w - 17 + 2 = 5*n, 0 = w - 2*n - 3 for w.
5
Let o = -66 + 69. Solve o*i + 22 = 2*q, 4*q - 45 = 2*i - 17 for i.
-4
Let a = 0 + 1. Let d(n) = 15*n**3 - n + 1. Let s be d(a). Suppose -f + 7 = -s. Solve 3*z = -2*o + 1, -5*o + 0*z - z + f = 0 for o.
5
Suppose 3*c = 5*c - 6. Let o(p) = 9*p - 4. Let j be o(6). Let t be (-3)/((-3)/j*2). Solve 0*g - g - 15 = -c*b, -5*g + t = 5*b for b.
5
Let y be 85/20 - 4 - 1/4. Solve l + 3*m + 4 = -0*m, y = 2*l + 2*m + 8 for l.
-4
Let j be (2/3)/((-6)/(-27)). Let d(f) = f - 3. Let o be d(3). Solve -j*a - 12 = -x, -4*x + 2*x + 2*a + 8 = o for x.
0
Suppose -3 = 2*j - 3*q, 3*j = -2*q + 4 - 2. Solve 0 = -3*a - 0*a + 2*k - 9, j = a + 3*k + 3 for a.
-3
Let a = 14 + -13. Let x be (-10)/(a + -2) - 1. Solve 5*d = 2*b + x, 3 = -3*b - 3*d - 0 for b.
-2
Let b = 11 + -5. Suppose -2*g + b*g - 8 = 0. Suppose -3*l = 5*c - 0*l - 58, 0 = -5*c + g*l + 53. Solve -4*x + 2*a - a + c = 0, -13 = -3*x - 4*a for x.
3
Let k be 3/5 + (-119)/(-35). Solve 0 = 2*z - 2*f + 6, -k = -3*z - f + 3 for z.
1
Let z = -12 - -18. Let r be (-2)/(-7) - 10/(-14). Suppose 0 = u - 0*u - r. Solve -z*c + 3*c = n - 4, u = c for n.
1
Let d = 7 + -8. Let r be 5 - (-1)/d - 1. Solve u - 2*g + r = 12, 3*u = -g - 1 for u.
1
Let m = -1 - 2. Let x = 11 - 14. Let w be m + 4/2 - x. Solve 3*f + 3*o = 6, w*f - 6 = -f + o for f.
2
Suppose 0 = 31*h - 28*h. Solve h = -4*p + 3*m + 2, 3*p - 2*m - 2 = -0 for p.
2
Let o = 21 + -7. Suppose -t = r + t - o, 5*r - 57 = 3*t. Solve 3*c + 3*b = 18, -5*b = -2*c + c - r for c.
3
Let u(x) = -x**2 - 3*x + 2. Let j be u(-2). Solve -2 = j*b - 3*v, 2*b = b - 2*v + 5 for b.
1
Suppose -1 = 6*g - 5*g - i, -i + 5 = 0. Let d be -2 - -2 - 2 - -4. Solve -g*c + 2*r = 18, -c + r - d = 5 for c.
-2
Let f(w) = -7*w + 4. Let k(u) = -3*u + 2. Let r(i) = 2*f(i) - 5*k(i). Let q be r(2). Solve q = 4*j + 5*v + 29, -9 = -3*j + 2*v - 2 for j.
-1
Let t(v) = -2*v**3 - 2*v**2 + 2*v. Let i be t(-2). Suppose i*b - 3*b - 2 = 0. Let u = -3 - -9. Solve -3*k + 15 = -b*p, -u = -5*k + 19 for p.
0
Suppose 0 = -2*g + 2 - 0. Let h = g - -2. Suppose 0 = -4*f + 2*a + 136, 2*f - a = a + 72. Solve 5*u - 13 = -h*r, -4*u + f = -2*r - r for u.
5
Let s be (9/6)/((-1)/2). Let w be (0 + s + 0)*-1. Solve 7*q + 16 = 2*q + 4*a, w*a = -q + 12 for q.
0
Suppose -5*s + 54 = 4. Solve -n + s = -5*z - 0*n, 2*z + n - 3 = 0 for z.
-1
Let a = -3 - -4. Let t be 47/4 - a/(-4). Suppose -6*c + t = -2*c. Solve -4*o - 2*i - 2 = -0, -c = -4*o - i for o.
2
Let v be 1 - 2*(0 - 1). Let q be (5 - 2)/(21/14). Solve 4*h - x + 12 = 0, -q*h + v = -3*h - 3*x for h.
-3
Let s be ((-20)/25)/(2/(-15)). Let d be s + 0 + -1 + -2. Solve -4*l = d*i + 20, 2*i + 11 + 7 = -5*l for i.
-4
Let t = 9 + -4. Solve -t*r + 4*s - 23 = 0, -2*r + 3*s = 6*s for r.
-3
Let h(r) be the second derivative of -r**3/3 - r**2 + 3*r. Let a be h(-3). Solve -4*i + a*p + 28 = 0, -8 = -4*i - 5*p + 4*p for i.
3
Let s(z) = -z**2 - 21*z + 26. Let w be s(-22). Solve -5*j - 7 = w*f, 4*j + 2*f + 3*f + 2 = 0 for j.
-3
Let d = 6 + -11. Let a(u) = u**2 + 4*u - 2. Let p be a(d). Solve -2*k = 3*x + 7, 5*k + x + 27 = p*x for k.
-5
Suppose 7 + 13 = s. Suppose 7*m - 3*m = s. Solve -3*g + 10 = y, 0*g + 2*g + 2 = -m*y for y.
-2
Suppose -3*z + 5*z - 8 = 0. Solve -5*l = -2*b + 17 + 4, -27 = 5*l - z*b for l.
-3
Let d = 25 + -68. Let j be d/(-5) + (-22)/(-55). Solve -2*u + 3*u - j = 3*m, 5*m - 3*u + 11 = 0 for m.
-4
Let h(o) = 2*o**2 + 3*o + 2. Let s be h(-2). Let y be 11/5 - s/20. Solve y*b = -4*p + 2, 5*p + 3 = 5*b - 17 for b.
3
Let f(y) = y**2 + 16*y + 19. Let i be f(-15). Let o be 4/3*(1 - -2). Suppose 2*n + 2*n + 5 = 5*h, -n + i = o*h. Solve j - 4*p + 0 + h = 0, 3*j + 3 = 5*p for j.
-1
Let l be (7 + -5)/(4/6). Let w(d) = -d - 6. Let n be w(-5). Let p = n + l. Solve -p*q - 4*h = -16, 6*q - 3*q + 2*h = 16 for q.
4
Suppose -3 = -3*v + 24. Solve -4*u + 4 = 0, 2*h + h + v = 3*u for h.
-2
Let b(g) = g**3 - 6*g**2 + 4*g + 7. Let w be b(5). Let v = 0 + w. Let t = 3 + 1. Solve 0*p - 4*p + t*f = -24, 3*p = v*f + 17 for p.
5
Let q(t) = -t**2 + t + 8. Let d be q(0). Let v be (-2)/(d/(-4))*0. Solve -4*f = 20, v = 3*k + f + 3 - 13 for k.
5
Let s(v) = v**3 + 4*v**2 - 5*v + 3. Suppose -3*b + 8*b + 25 = 0. Let c be s(b). Solve 4*l = -2*g + 26, -c*l + 31 = 2*l + 2*g for l.
5
Let l = 6 - 4. Suppose -5 = -l*p + p. Solve -g - p = 6*b - 2*b, 3*g + 15 = -3*b for b.
0
Let o be (-60)/(-28) - 4/28. Solve -r - 20 = 5*q + o*r, 5*q - 4*r = -20 for q.
-4
Let s(z) = z**2 + 8*z - 1. Let j be s(-9). Solve -4*t + n - j = 13, 5*n = 5*t + 30 for t.
-5
Let p(g) = g - 5. Let z be p(3). Let s be (4/(-6))/(z/12). Solve -y + 5 + 5 = -5*t, -s*t - 5*y + 21 = 0 for t.
-1
Let s = 11 - 9. Solve -2*y = 2*u, 4*u + s*y = 2 + 6 for u.
4
Let j(o) = o**3 + 5*o**2 + o - 1. Let q be j(-5). Let f be 3/q + 60/8. Solve 2*a = 5*n + f*a + 35, 3*n + a + 17 = 0 for n.
-5
Suppose -7*z = -4*z - 9. Solve 2*w + 4 = z*a, 3*a = -0*a + 5*w + 10 for a.
0
Let v = 1 - -1. Suppose 2*s - 4 = -3*b + v, 6 = 2*s - 4*b. Suppose -2*z = 4*t - 18, s*t + 2*z + 3*z = 17. Solve 0 = 4*o - w - 7, 4*o = -0*o + t*w + 16 for o.
1
Let c(k) = -k**3 + 13*k**2 + 13*k + 16. Let n be c(14). Solve 4*x + 5 = 5*b, x = n*b - 1 - 1 for b.
1
Let t = -9 - -11. Suppose -7*z = -2*z - 10. Suppose -d = z*d - 21. Solve t*n = 4*w - 8, -14 = -2*n - w - d for n.
2
Suppose 0*b - 3*b = -2*b. Solve -20 = 2*z - 4*i - b*i, 0 = -z + 5*i - 25 for z.
0
Suppose -u = -1 - 2. Solve 11 = i + 5*q, 3*i = -q - u - 6 for i.
-4
Let x be (72/20)/((-3)/(-10)). Solve 4*u + 3*s - 28 = 0, -4*s + x = -s for u.
4
Let n(g) = g - 8. Let h be n(10). Solve -3*l + 3*s = 0, h*l + s + 5 = 4*l for l.
5
Let n = -1 - -1. Let k(o) = o**2 + 4*o. Let u be k(-4). Let r be u - -7 - (-16 - -14). Solve n = -4*y + p + r, 2*p - 3 = -2*y + p for y.
2
Suppose 10*v - 13*v = -18. Suppose 6*l = 3*l + v. Solve -9*u + 4*h = -6*u + 9, 0 = -4*u - l*h - 12 for u.
-3
Suppose -3*k = -5*h + 13, -6*h + 3*h = -5*k - 11. Solve 0*i - 6 = -3*q - 4*i, -h*q + 5*i = 19 for q.
-2
Let r be (-38)/(-3) - 4/6. Let x be 6 |
Lille Laboratory of Electrical Engineering and Power Electronics
Lille Laboratory of Electrical Engineering and Power Electronics (L2EP - ) is a French research laboratory (CNRS EA 2697) focused on electrical engineering. It is located in Lille and is a part of Institut Carnot ARTS and COMUE Lille Nord de France.
L2EP research teams support academic activities in the following institutes of the COMUE Lille Nord de France :
Arts et Métiers ParisTech
École centrale de Lille
HEI
University of Lille
It supports doctoral researches and hosts PhD doctoral candidates in relationship with the European Doctoral College Lille Nord de France.
Research area
Research area focuses on :
Power electronics, converters, energy storage
modeling and control
power electronics optimisation
modeling electrical grids
electromagnetic simulations
L2EP Labs are the core of the Centre national de recherche technologique de Lille FUTURELEC « Réseaux et machines électriques du futur ».
External links
L2EP labs site
Institut CARNOT ARTS
Category:Université Lille Nord de France
Category:Laboratories of Arts et Métiers ParisTech
Category:Laboratories in France
Category:French National Centre for Scientific Research |
Q:
send textBox values to controller from cshtml (asp.net mvc)
I want get a values from web client and save it in database, but I don't know how call my controller methods from cshtml
@{
@ViewBag.Title;
@model Homi.Controllers.HomeController
Homi.Controllers.HomeController obj = (Homi.Controllers.HomeController)ViewData["h"];
}
<!DOCTYPE html>
<html>
<head>
<meta charset="UTF-8">
@Styles.Render("~/Content/style.css")
@Styles.Render("~/Content/rest.css")
@Styles.Render("~/Content/font.css")
@Styles.Render("~/Content/font2.css")
</head>
<body>
Register
<div>
<input type="username" id="Username required="required" />
</div>
<div>
<input type="password" id="Password" required="required" />
<label for="Password">Password</label>
</div>
<div>
<input type="password" id="Repeat Password" required="required"/>
<label for="Repeat Password">Repeat Password</label>
</div>
<div>
<button><span>Next</span></button>
</div>
@Scripts.Render("~/Content/index.js")
@Scripts.Render("~/Content/jquery.js")
</body>
</html>
for example I have this code on my mind but you know it's doesn't work:
<div onclick=@obj.setp(username.text, password.text)>
<button><span>Next</span></button>
</div>
I want when I click on "Next" button my method calling.
and this is part of my controller, the method that I want to call:
namespace Homi.Controllers{
public class HomeController : Controller
{
public ActionResult setp(string usename, string password)
{
WebAdmin wa = new WebAdmin();
wa.InsertToDb(username, password);
return View("userAccess");
}}}
it's very important to me that I don't change my html code style
thank you for your help
A:
Keep your input fields inside a form tag and submit the form
@using(Html.BeginForm("setp","home"))
{
<input type="text" name="Username" required="required" />
<input type="text" name="Password" required="required" />
<input type="submit" value="Next"/>
}
When razor executes the page, it will generate a form tag in the place of @using(Html.BeginForm line where the action is set to "home/setp"(Check the view source in browser). As long as your form element name's matches with your HttpPost action method parameter name's, values of the textboxes will be available in those when the form is submitted.
[HttpPost]
public ActionResult setp(string Username, string password)
{
//do something
}
|
Q:
Android - ClassCastException in publishResults method in Custom ArrayAdapter
I'm currently creating an activity where you can select users from a list and filter them by typing a part of their name. I'm making use of a custom ArrayAdapter with input coming from a UserSelect-class (int id, String name, boolean selected).
My current problem is that I get a ClassCastException in method publishResults and more specific in this line:
users = (ArrayList<UserSelect>)filterResults.values;
Any idea how to fix this? Previously I worked with a string[] and that worked, but since I need the id from the object I'm currently changes this to ArrayList.
Full code:
public class CCSelectAdapter extends ArrayAdapter<String> {
private final Context context;
private List<UserSelect> users = new ArrayList<UserSelect>();
public CCSelectAdapter(Context context, List<UserSelect> values) {
super(context, R.layout.listview_cc_select);
this.context = context;
this.users = values;
}
@Override
public View getView(int position, View convertView, ViewGroup parent) {
LayoutInflater inflater = (LayoutInflater) context
.getSystemService(Context.LAYOUT_INFLATER_SERVICE);
View rowView = inflater.inflate(R.layout.listview_cc_select, parent, false);
TextView textView = (TextView) rowView.findViewById(R.id.ccName);
textView.setText(users.get(position).getName());
return rowView;
}
public int getCount()
{
return users.size();
}
public String getItem(int position)
{
return users.get(position).getName();
}
public long getItemId(int position)
{
return position;
}
@Override
public Filter getFilter()
{
return new Filter()
{
@Override
protected FilterResults performFiltering(CharSequence charSequence)
{
FilterResults results = new FilterResults();
if(charSequence == null || charSequence.length() == 0)
{
results.values = users;
results.count = users.size();
}
else
{
List<String> filterResultsData = new ArrayList<String>();
for (int i = 1 ; i < users.size() ; i++) {
if(users.get(i).getName().toLowerCase().contains(((String) charSequence).toLowerCase()))
{
filterResultsData.add(users.get(i).getName());
}
}
String[] arr = filterResultsData.toArray(new String[filterResultsData.size()]);
results.values = arr;
results.count = arr.length;
}
return results;
}
@Override
protected void publishResults(CharSequence charSequence, FilterResults filterResults)
{
users = (ArrayList<UserSelect>)filterResults.values;
notifyDataSetChanged();
}
};
}
}
Solution (thanks to Elltz):
I changed:
List<String> filterResultsData = new ArrayList<String>();
to:
List<UserSelect> filterResultsData = new ArrayList<UserSelect>();
A:
check my answer here from another different tag question
your problem is your arraylist is a string generic type and you are casting it to
filterResults.values
which im thinking is a
UserSelect object
so change your arraylist to
<UserSelect>
|
Here’s an eloquently simple fashion solution for your holiday travel from Greg Leuch of F.A.T. fame — boxers and pasties with metallic arrows. They point at your junk. It’s patriotism… in your pants!
They’re like Evan Roth’s bag inserts that flip off x-ray machines, but better, giving you another way to fight the invasion of your privacy ‘n’ privates with jubilant enthusiasm, though they won’t win you any favors from the TSA, except for, maybe, the fondling kind. |
Republican presidential hopeful, Donald Trump, has said the US has now become a “third world country” when compared to infrastructures in Dubai and China. He also promised that things would change once he is elected President.
“We have become a third world country, folks!,” Trump, 69, told his supporters at an election rally at Sal Lake City in Utah, which goes to presidential primary elections on Tuesday.
|
The Senate held a marathon session beginning Friday to wrap up votes on critical measures before the holiday weekend. After a series of votes overnight, Senate Majority Leader Mitch McConnell, R-Ky., announced early Saturday that the Senate would begin a weeklong Memorial Day break and return on Sunday, May 31.
Here's a look at what was voted on:
NSA Bill
The Senate blocked both a House-passed bill and a short-term extension of the USA Patriot Act during an early Saturday vote. The bill would have moved the bulk collection of domestic phone records from the National Security Agency to being held by telecom companies.
The vote on the bill was 57-42, and the extension was 45-54, both short of the 60 votes needed to move forward. The provision is on its way to expiring on June 1 with no real path to being reauthorized before it lapses for at least a brief period of time.
Let our news meet your inbox. The news and stories that matters, delivered weekday mornings. This site is protected by recaptcha
The bill's most vocal opponent has been Sen. Rand Paul, R-Ky., who took to the Senate floor Wednesday and spoke in a 10 ½-hour filibuster-like speech in opposition of the government's bulk collection of data. Paul has vowed to oppose not only any clean extension of the program, but also the USA Freedom Act, which he says does not go far enough.
The Senate has refused to reauthorize bulk data collection. I am proud to have stood up for the Bill of Rights. But our fight is not over — Dr. Rand Paul (@RandPaul) May 23, 2015
Justice and National Security officials warned that if the Senate did not pass the compromise replacement legislation for the Patriot Act before the holiday recess, the NSA will have to start dismantling bulk collection of metadata records to avoid both practical and legal problems.
'Fast-Track' Trade Bill
Earlier in the session, the Senate passed a bill that would give President Barack Obama "fast-track" authority to negotiate the massive 12-nation Trans-Pacific Partnership trade pact without the threat of Congress adding amendments or filibustering the final deal.
The hotly contested bill, called Trade Promotion Authority (TPA), passed 62-37.
The legislation passed Friday night also includes a re-authorization of Trade Adjustment Assistance (TAA), which is a federal aid program for American workers who have lost their jobs as a result of foreign trade.
The bill now goes to the House, where Ways and Means Committee Chairman Paul Ryan, R-Wis., is working on garnering the support to pass it in that chamber. Many believe passage in the House will be a harder pull than it was in the Senate.
The bill put Republicans in the rare position of being on the same side of an issue as Obama, who has requested the fast-track authority. Those who oppose the measure believe trade deals lower middle class wages and cost jobs in the United States. Many Democrats also wanted provisions included in the bill which would help address currency manipulation, provisions that many Republicans considered a poison pill to the deal.
"I want to thank Senators of both parties for sticking up for American workers by supporting smart trade and strong enforcement, and I encourage the House of Representatives to follow suit by passing TPA and TAA as soon as possible," Obama said prepared statement.
Highway and Transit Aid Bill
The Senate also approved a House-passed two month extension of federal funding for highway and transit programs before program funding expired at the end of this month. The measure was approved by voice vote early Saturday and will be sent to Obama, who is expected to sign. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.