text
stringlengths
8
5.77M
(CNN) -- When Samantha Hessel heard about the risks associated with tanning beds, she ignored them. When her mom cautioned her not to tan so much, Hessel shrugged it off. Her friends and peers were doing the same thing. What was the harm of lying in a tanning bed three to four times a week? It's an activity the nation's pediatricians say is dangerous. Laws should ban minors from going to tanning parlors, the American Academy of Pediatrics announced Monday. This echoes positions of the World Health Organization, the American Medical Association and the American Academy of Dermatology. For Hessel, appearance was important."I wanted to look good and have that darker skin color," said the student at the University of Wisconsin at Oshkosh. "I think society makes you feel being tanned is prettier than being pasty white." Hessel, who has porcelain features, started tanning during her freshman year of high school. By the time she was a freshman in college, Hessel had melanoma -- the deadliest form of skin cancer. Guide for kids and tanning "It felt so surreal," she said. "I'm healthy. I was 19. I couldn't understand. How could I be so young and deal with this?" In 2009, Hessel felt an elevated mole in the back of her left arm. It was cancerous. Doctors froze a portion of her arm and removed the mole. The surgery left a 4-inch gash. Samantha Hessel, in her natural complexion, now advocates on behalf of the Melanoma Research Foundation. Melanoma affects the deepest layer of the skin and poses dangers because it spreads rapidly. Since 1992 it has been increasing by 3% each year in women between the ages of 15 and 39. "We are looking for legislation that prohibits kids from going to tanning salons. It's protecting our youth from something potentially harmful," said Dr. Sophie Balk, lead author of the statement written by an American Academy of Pediatrics committee. The Indoor Tanning Association disagrees that tanning should be legislated. "We're talking about getting a sun tan," said John Overstreet, the association's spokesman. "This is a decision best left for parents, not the government. Let parents make the decision." He added that there is no scientific evidence that tanning is any worse at a younger age. While kids may not be more vulnerable to skin cancers, they are less capable of making responsible decisions, said Dr. David Fisher, chief of dermatology at Massachusetts General Hospital and professor of pediatrics at Harvard Medical School. "The industry has exploited this fact," he said. "They have packaged deals for repeat use." The ads appear before prom season and offer student discounts. "There have been a few instances where statements have been made that [ultraviolet rays] are healthy because of vitamin D. That's an extremely irresponsible concept that leads children or parents to think, 'It isn't so bad. What's wrong with looking good for prom?'" Tanning is a poor method of getting vitamin D, doctors say. The safer methods are supplements or incidental sun exposure. There are two types of radiation. UVA rays cause deeper damage to the skin, leading to wrinkles and DNA damage that causes the darkening. UVB rays cause sunburns. Sunlamps and tanning beds emit UVA rays that give customers a glow without a sunburn. The intensity of the UVA radiation from tanning beds "may be 10 to 15 times higher than that of the midday sun," according to the report published in the journal Pediatrics. While very young melanoma cases like Hessel's are rare, about a quarter of white teenagers between the ages of 13 to 19 reported using a tanning facility at least once. Hessel's ritual would begin in late February to get ready for the prom. She paid $30 to $55 a month for unlimited tanning and would lie inside the beds for up to 20 minutes. "It hides your pimples," she said. "It makes you feel like your skin looks less imperfect, a little bit. It makes you feel good, like a false feeling good." Tanning "changes the sequence of DNA and carries the potential to produce different types of skin cancer," Fisher said. It causes the production of melanin, which darkens the skin. The scar on Samantha Hessel's left arm from surgery to remove a cancerous mole. There is "overwhelming data" to suggest that melanoma (cancer of the deepest layer of skin), basal cell carcinoma (middle layer) and squamous cell carcinoma (surface layer) are related to tanning bed use and exposure to the sun, he said. In their quest for a glowing tan, teenagers are pre-aging their skin by 10 to 20 years, Fisher warned. "It causes them to wrinkle later on and increases risk of skin cancer," said Balk, an attending pediatrician at the Children's Hospital at Montefiore, New York. "It doesn't mean everyone develops skin cancer, but it increases the risk." Sunlight exposure is also a risk. Pediatricians recommend wearing clothes, hats with brims, sunscreen (at least SPF 15) and avoiding exposure during peak hours of 10 a.m. to 4 p.m. Sitting in the shade is not always helpful because sand, snow, concrete and water can reflect up to 85% of the sunlight. Hessel used to slather sun tan lotion instead of sunscreen when she was outdoors. Now, she wears sunscreen all the time -- even in the Wisconsin winters. "I feel much more OK with being pale," she said. The risks of tanning are no longer worth the benefits -- especially after her skin cancer experience left her scarred.
/* global runHeuristicsTest */ "use strict"; runHeuristicsTest( [ { fixturePath: "heuristics_cc_exp.html", expectedResult: [ [ [ { section: "", addressType: "", contactType: "", fieldName: "cc-name", }, { section: "", addressType: "", contactType: "", fieldName: "cc-number", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp-month", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp-year", }, ], ], [ [ { section: "", addressType: "", contactType: "", fieldName: "cc-number", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp", }, ], ], [ [ { section: "", addressType: "", contactType: "", fieldName: "cc-number", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp", }, ], ], [ [ { section: "", addressType: "", contactType: "", fieldName: "cc-number", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp-month", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp-year", }, ], ], [ [ { section: "", addressType: "", contactType: "", fieldName: "cc-exp-month", }, { section: "", addressType: "", contactType: "", fieldName: "cc-exp-year", }, ], ], ], }, ], "../../fixtures/" );
1. Field of Invention The present invention is directed to monitor water quality and, more particularly, to a water-monitoring apparatus for detecting water quality parameters at constant depths. 2. Related Prior Art While developing, the world is encountering a more and more serious problem of pollution. Water pollution could be the worst among all kinds of pollution. More and more pollutants are dumped to reservoirs and open channels from fixed sources, e.g., factories and farms, or from mobile sources, e.g., vehicles. Such pollutants may be released into water directly, or may be washed into the water by rain. Once introduced into the water, such pollutants inevitably increase costs in treating the water and very often harm human bodies, life stock and aquatic lives. Before any proper measure can be taken to solve the problem of water pollution, by what pollutants and to what extent the water is polluted must be figured out. In other words, various quality parameters of the water must be monitored. Some water analyses are performed manually, however they are cumbersome. As to continuous water analysis, there have been installed some conventional monitoring stations into which water is automatically pumped through pipes. It, however, is found difficult to have the pipes catch up with the water level changing vigorously from season to season. When the water level becomes too low for the pipes to reach, it is impossible to pump water through the pipes. To make sure that the water can be monitored continuously, there have been devised some water-monitoring apparatuses in which sensors are carried by means of a buoy tied to a bank or a well by means of a cable. To have the buoy float on the water when the water level is low, a sufficiently long cable is used. However, the cable allows the buoy to drift for a long distance in any direction when the water level is high. As the buoy drifts, the cable often tangles with miscellaneous objects, e.g., twigs. This could seriously affect the operation of the sensors. For example, the buoy and therefore the sensors may be kept away from the water due to the cable tangling with a twig reaching out from the water, thus causing a failure. To prevent the cable from tangling with miscellaneous objects, there has been devised a length control device in which the cable is wound on a reel operatively connected with a motor. The motor can be activated to rotate the reel to adjust a length of the cable extending from the reel so that the sensors can always be immersed in water. However, the motor consumes a lot of energy. In addition, to transmit signals from the sensors to a monitoring station, the cable is connected to the monitoring station through a signal relay including a mandrel electrically connected with the cable. The mandrel rotates together with the reel. The signal relay further includes a brush electrically connected with the monitoring station. The brush does not rotate. The mandrel is in rotational engagement with the brush, thus allowing the mandrel to rotate with respect to the brush while allowing the signals to be transmitted from the mandrel to the brush. However, friction between the mandrel and the brush interferes with the rotation of the reel and wears out the brush after serving for a period of time. Therefore, the present invention is intended to alleviate or even obviate the drawbacks that are encountered in the prior art. It is the primary objective of the present invention to provide a water-monitoring apparatus capable of automatically tracing water level. It is another objective of the present invention to provide a water-monitoring apparatus with a tangle-free sensor-carrying cable. It is another objective of the present invention to provide a water-monitoring apparatus with a sensor-carrying cable of an automatically adjustable length. It is another objective of the present invention to provide a water-monitoring apparatus with a sensor-carrying cable wound on a reel capable of automatic rotation for adjusting a length of the sensor-carrying cable extending from the reel. It is another objective of this invention to provide a non-contact signal relay for use in a reel structure to facilitate transmitting electric signals from an electric information source attached to the reel structure to a monitoring station without a rotational intervention. In accordance with an aspect of the present invention, a water-monitoring apparatus includes a frame installed on a well or a bank by water. A reel is mounted on the frame. A constant torque device is used to exert a constant torque on the reel. A cable including a lower end and an upper end is wound on the reel. A buoy is connected with the cable. A detecting device includes at least one sensor. The detecting device is carried via the buoy and electrically connected with the lower end of the cable. The detecting device is used for detecting at least one water quality parameter. A signal relay is electrically connected with the upper end of the cable for receiving an electric signal from the detecting device. In accordance with another aspect of the present invention, a non-contact signal relay is used in a water-monitoring apparatus. In the water-monitoring apparatus, a frame is installed in a proper position by water. A reel is mounted on the frame. A cable is wound on the reel so that the reel rotates as the cable travels. The cable includes lower and upper ends. A buoy is connected with the cable. At least one sensor is used to detect a water quality parameter and to produce a signal representative of the water quality parameter. The at least one sensor is carried via the buoy and electrically connected with the lower end of the cable. The reel can be rotated to adjust a length of the cable extending from the reel so that the at least one sensor can always be immersed in the water. The non-contact signal relay includes a first block electrically connected with the at least one sensor and a second block electrically connected with a monitoring station wherein the first and second blocks are connected with each other in a non-contact electric manner. The first block of the signal relay includes an emitter for emitting the signals. The second block of the signal relay includes a second circuit board attached to the frame and electrically connected with a monitoring station and a receiver installed on the second circuit board for receiving the signals.
The developers of the highly anticipated Divinity Original Sin video game, that was successfully funded by the Kickstarter crowd funding campaign that raised just shy of $1 million for the team at Larian Studios. Larian Studios has this week announced that the release date for the old school RPG game has slipped a little further, by 10 days to be exact. Pushing the Divinity Original Sin release date back until June 30th 2014. The delay has been caused by very few outstanding finishing touches that need to be applied to the game before it is able to leave Valve’s Steam Early Access, Larian Studios explained to backers : “Because of the voice recordings (and a few other things which will become clear soon) we have to delay the release of Divinity: Original Sin by 10 days. This is going to give us the time we need to get everything integrated. We know we’re testing your patience, but you can rest assured that we’re as keen as you to release– it’s high time we get this game out of our hands and into yours!;) Those extra days, are strictly necessary; we promise!” Check out how far the game has come since it published the original Kickstarter crowd funding trailer to whet backers appetites and secure funding to create what they will be launching at the end of this month. For more information on the new Divinity: Original Sin game jump over to the official website for details and to purchase a copy for yourself if you missed out on the Kickstarter campaign.
MHC class I-restricted lysis of human oligodendrocytes by myelin basic protein peptide-specific CD8 T lymphocytes. Multiple sclerosis (MS) is considered to be an autoimmune disease that is directed either at myelin or at its cell of origin, the oligodendrocytes (OL). The inflammatory lesions in the central nervous system contain multiple myelin Ag-restricted and nonrestricted cell populations with the potential to mediate tissue injury. Previous studies indicate that it is possible to generate MHC class I-restricted myelin peptide-specific cytotoxic CD8 T cells, and that human adult OLs express MHC class I molecules in vitro. The purpose of this study was to demonstrate that myelin basic protein peptide-specific CD8 T cells could induce OL injury. We generated CD8 T cell lines from six healthy donors and five MS patients, and all cell lines were HLA-A2 positive. The obtained CD8 cell lines induced lysis of HLA-A2- but not HLA-A3-transfected HMy2.C1R cells in the presence of myelin basic protein peptide 110-118. In the absence of exogenous peptide, the CD8 T cell lines were cytotoxic to HLA-A2 but not to non-HLA-A2 OLs. Cytotoxicity was blocked with anti-MHC class I-blocking Ab. These results support the postulate that autoreactive CD8 cytotoxic T cells can contribute to the tissue injury in MS.
IN THE UNITED STATES COURT OF APPEALS FOR THE FIFTH CIRCUIT ______________ No. 02-60077 _____________ PATRICK S ELLIOTT; DONNA J ELLIOTT Petitioners - Appellants v. COMMISSIONER OF INTERNAL REVENUE Respondent - Appellee ______________ No. 02-60078 _____________ LARRY ELLIOTT; JULIE F ELLIOTT Petitioners - Appellants v. COMMISSIONER OF INTERNAL REVENUE Respondent - Appellee _________________________________________________________________ Appeals from the Decision of the United States Tax Court (19425-98 & 19433-98) _________________________________________________________________ November 7, 2002 Before KING, Chief Judge, and JOLLY and HIGGINBOTHAM, Circuit Judges. PER CURIAM:* * Pursuant to 5TH CIR. R. 47.5, the court has determined that this opinion should not be published and is not precedent The notices of deficiency were not so inadequate as to deprive the Tax Court of jurisdiction, and they were sufficient to inform the Elliotts that their claimed business expense deductions had not been allowed. That said, the Internal Revenue Service clearly could have done considerably better and thereby saved all involved, including the Tax Court and this court, from this wasteful exercise. AFFIRMED. except under the limited circumstances set forth in 5TH CIR. R. 47.5.4. 2
170 P.3d 601 (2007) In re the Parentage of M.F., (DOB: 12-15-93), Child, and John Corbin, Respondent/Step-Father, Patricia Reimen, Appellant/Mother, Edward Frazier, Respondent/Father. No. 58658-1-I. Court of Appeals of Washington, Division 1. November 5, 2007. *602 Rebecca Jill Torgerson, Brewe Layman, Everett, WA, Catherine Wright Smith, Valerie A. Villacin, Edwards, Sieh, Smith & Goodfriend PS, Seattle, WA, for Appellant. James Davis Shipman, Podrasky Shipman & Shields, Everett, WA, Patricia S. Novotny, Attorney at Law, Seattle, WA, for Respondents. Edwin Frazier, pro se. Christine Wakefield Nichols, pro se. COX, J. ¶ 1 The primary issue in this case is whether John Corbin has a cause of action as a de facto parent for residential time with M.F., his former stepdaughter.[1] We hold that he does not. We must also decide whether the existing parenting plan governing residential time with M.F. may be modified without the statutorily required showing of adequate cause.[2] We hold that a showing of adequate cause is required, and none has been shown here. We reverse and dismiss. ¶ 2 The parties do not substantially dispute the material facts. Patricia Reimen and Edwin Frazier are the biological parents of M.F., whose date of birth was December 15, 1993. The parental rights and obligations of Reimen and Frazier with respect to M.F., their daughter, are set forth in the parenting plan entered on August 2, 1995, as part of the dissolution of their marriage. ¶ 3 The parenting plan provides that M.F. will reside primarily with Reimen, with alternating weekend residential time and some holidays with Frazier. The plan also provides that Frazier and Reimen shall have joint decision making power. Frazier, who lives in Wenatchee, has consistently paid his child support obligation to Reimen, who lives in Monroe. While Reimen and Frazier have not always strictly adhered to the residential schedule, the plan has never been modified by court order. ¶ 4 Reimen and Corbin were married in October 1995. They are the parents of two sons. Reimen and Corbin separated in 2000. The parental rights and obligations of Reimen and Corbin with respect to their two sons are set forth in the parenting plan entered on December 13, 2002, as part of the dissolution of their marriage. This parenting plan does not apply to M.F. Nevertheless, Corbin continued to have regular contact with M.F. and his two sons with Reimen until August 2005. ¶ 5 In August 2005, Corbin moved to modify the parenting plan governing the two sons he had with Reimen. After this, M.F. abruptly stopped spending time with Corbin. Reimen and Corbin dispute why M.F. stopped seeing him. *603 ¶ 6 In November 2005, the supreme court decided In re Parentage of L.B.[3] In March 2006, Corbin commenced this proceeding, seeking to be declared a de facto parent of M.F. and seeking residential time with her based solely on that case.[4] Reimen and Frazier are both named as parties. ¶ 7 The record that is before us does not show whether Frazier appeared below. He has not participated in this appeal. ¶ 8 Reimen, pursuant to CR 12(b)(6), moved to dismiss the petition. The trial court denied the motion in its oral decision of June 7, 2006.[5] The court entered its order on August 8, 2006.[6] ¶ 9 Following the court's oral decision in June, a superior court commissioner entered two orders. One was a temporary order that made a threshold determination that Corbin is a de facto parent and ordered a reunification process between him and his former stepdaughter. The other order appointed a guardian ad litem for M.F. and directed further actions. A superior court judge denied Reimen's motion to revise these two orders. ¶ 10 We granted discretionary review. DE FACTO PARENT ¶ 11 Reimen argues that the trial court erred in denying her CR 12(b)(6) motion to dismiss Corbin's action. We hold that L.B. does not create a common law cause of action for a former stepparent as a de facto parent of a former stepchild where statutory remedies are available. ¶ 12 To prevail, the moving party in a CR 12(b)(6) motion has the burden to establish beyond doubt that the claimant can prove no set of facts consistent with the complaint that would justify recovery.[7] Factual allegations and any reasonable inferences are taken as true.[8] The motion should be "granted sparingly so that a plaintiff is not improperly denied adjudication on the merits."[9] ¶ 13 Interpretation and application of common law causes of action are questions of law that we review de novo.[10] ¶ 14 Here, Corbin did not assert any of the statutory bases for seeking contact with M.F., his former stepdaughter.[11] Rather, Corbin alleges only that he is a de facto parent of M.F. Reimen moved for dismissal of this action, arguing that Corbin had no right to relief on the basis of his sole claim that he is a de facto parent of his former stepdaughter.[12] ¶ 15 The trial court agreed with Corbin. In making its oral ruling, it purported to focus on the test for establishing de *604 facto parenthood, a factual determination.[13] After quoting the test for a de facto parent from L.B., the court stated that "[T]here's a prima facie showing [in this case] of that, just from the fact of the marriage and the length of the marriage."[14] This was error. ¶ 16 Assuming for purposes of argument only that the proper focus of the threshold inquiry for this motion is the test stated in L.B., the trial court misapplied that test. De facto parent status does not exist merely by the fact of marriage and the length of the marriage. Rather, as the four elements of the test state, more is required. Among the additional elements is the requirement that the natural or legal parent consents to and fosters the parent-like relationship. The petitioner and child must also live together in the same household. The petitioner must also assume parental obligations without expectation of financial compensation. And petitioner must show that the parental role has existed for sufficient time to establish the required relationship with the child. The trial court's statement of what constitutes a prima facie case for de facto parenthood omitted reference to these other necessary factors. Accordingly, it was incorrect. ¶ 17 Regardless, there is a more basic reason why the trial court's denial of the dismissal motion was incorrect. The correct starting point for analysis of the motion is not whether the de facto parent test has been met. Rather, the question is whether de facto parenthood may be applied at all to the circumstances of this case. For the reasons stated below, we conclude that it cannot. ¶ 18 We start with the observation that existing statutes permit a former stepparent to assert rights for residential time with a former stepchild. For example, RCW 26.10.030 permits a nonparent to petition for custody of a child.[15] Provisions for child custody, visitation, and support are considered when a court enters an order under Chapter 26.10 RCW.[16] The state supreme court found no constitutional infirmity with RCW 26.10.030(1), permitting a person other than a parent to petition for child custody.[17] ¶ 19 We also note that RCW 26.09.240 arguably would have provided a means by which Corbin could have obtained visitation with his former stepdaughter had he pursued that remedy during the 2002 dissolution of his marriage to Reimen.[18] The supreme court declared that statute unconstitutional in 2005 in In re Parentage of C.A.M.A.[19] But a Division Two case recently held that C.A.M.A. applies prospectively only.[20] Thus, at the time Corbin and Reimen dissolved their marriage, this statutory remedy was available to Corbin. For reasons that are unexplained in this record, he did not seek visitation with M.F. at that time. ¶ 20 Although Corbin argues that the de facto parent cause of action should be available to him, he offers no persuasive argument *605 why the statutes dealing with this subject matter are inadequate to address his situation. Rather, he relies solely on L.B. to avoid the requirements of these statutes. ¶ 21 In an attempt to persuade this court that the statutory procedures need not be followed here, Corbin urges that where a child's well-being requires recognition of three parents, the court should endorse a flexible approach. He emphasizes legal developments recognizing that a child has an interest in maintaining relationships independent of parental interests. Further, Corbin argues that under Washington's Parenting Act, there is no impediment to a three-way parenting plan. The parties give differing significance to the fact that Washington statutes generally adhere to the two-parent/mother-father paradigm. Corbin argues that the mother-father paradigm is merely descriptive of most situations but not injunctive as statutes for multiple-parent adoption and childbearing reflect. ¶ 22 Even if we assume that some or all of the above assertions are correct, we are not persuaded that they support disregarding existing statutes dealing with this subject matter. Moreover, these arguments do not compel courts to fashion a remedy. ¶ 23 We are also concerned about the constitutional implications of permitting a former stepparent and the courts to intervene in the decision-making process of a fit parent. Here, Corbin does not claim and no court has determined that Reimen is an unfit parent. Moreover, there is no claim and no court determination that there is any detriment to the child. ¶ 24 As Troxel v. Granville and other cases indicate, there is a fundamental right that a fit parent has in the care, custody, and control of a child.[21] Intervention by others, including courts, in that process is permitted only under limited circumstances. And the heightened standard that controls such intervention requires a showing of detriment to the child, not the more lenient best interests of the child standard. Significantly, the former standard controls under Washington's current nonparental child custody statute.[22] ¶ 25 We have no reason in this case to either adopt or reject principles set out in the American Law Institute's Principles of the Law of Family Dissolution. But we note that Corbin may be foreclosed from now bringing a de facto parent action under those principles. They provide that "[a]ll of the following individuals should be given a right to bring an action: . . . (c) a de facto parent of the child, . . . who has resided with the child within the six-month period prior to the filing of the action or who has consistently maintained or attempted to maintain the parental relationship since residing with the child."[23] ¶ 26 Assuming for purposes of argument only that Corbin qualified as a de facto parent under ALI Principles, his action would arguably be barred because he failed to bring it within the requisite six-month period stated above.[24] Whether Corbin would qualify under the other clause stated in the principle sufficient to exempt him from the six-month requirement is uncertain. Parentage of L.B. ¶ 27 We turn to Corbin's reliance on L.B. for authority to bring his petition. We conclude that case is distinguishable and does not control this matter. ¶ 28 There, the parties became romantically involved in a same-sex relationship during which they cohabited.[25] They decided to conceive a child, and a male friend donated sperm to assist the insemination.[26] Both parties attended prenatal medical appointments *606 and birthing classes.[27] Both were present during the birth of L.B.[28] They co-parented the child until their relationship acrimoniously ended six years later, and litigation over access to L.B. began.[29] ¶ 29 One of the members of the relationship petitioned for the establishment of parentage under the statutes. She also sought to be declared a parent by estoppel or as a de facto parent.[30] A court commissioner dismissed the petition, and a superior court judge "reluctantly" affirmed.[31] This court reversed, holding that a common law claim of de facto parentage existed.[32] The supreme court granted a petition for review.[33] ¶ 30 The supreme court framed the issue before it as whether "[l]n the absence of a statutory remedy, the equitable power of our courts in domestic matters permits a remedy outside of the statutory scheme."[34] The court reviewed legislative enactments regarding child custody and visitation to discern state policy and to determine whether clear legislative intent existed to preempt common law rights in that situation.[35] The court concluded that the Uniform Parentage Act and corresponding statutes do not purport to preclude operation of the common law in addressing situations left unanswered after a strict statutory inquiry.[36] ¶ 31 The L.B. court's exhaustive review of the State's legislative enactments and case law revealed that Washington courts have a recognized and accepted role in resolving family law disputes, especially when the legislative enactments speak to an issue incompletely.[37] The common law provides a means for the court, in the absence of governing statutes, to "administer justice according to the promptings of reason and common sense."[38] ¶ 32 Acknowledging that the State's current statutory scheme fails to contemplate all potential scenarios that could arise in the changing and evolving notion of family relations, the court found that State statutes failed to speak to the particular situation presented in L.B. Therefore, in order to "fill the interstices that our current legislative enactment fails to cover in a manner consistent with our laws and stated legislative policy," the supreme court fashioned an equitable remedy.[39] It recognized a common law de facto parent cause of action. ¶ 33 L.B. is distinguishable. There, the court framed the issue in terms of whether an equitable remedy was required in the absence of a statutory procedure regulating the subject matter. Here, there is a statutory framework that is designed to address custody and visitation under the circumstances of this case. As we have already observed, Corbin has failed to persuade us that the statutory procedures are inadequate or incomplete. That it may be difficult for him to fulfill the statutory requirements does not persuade us that those requirements are inadequate or incomplete in the sense that requires application of the de facto parent doctrine. ¶ 34 We also note that both L.B. and the cases on which it relied involved providing access to the courts to those who might otherwise have been barred from visitation with the child. Here, there is no such similar bar. Rather, this is a case of disputes arising in a blended family resulting from consecutive marriages. The legislature contemplated *607 this situation in the existing statutory framework. ¶ 35 To summarize, there is no cause of action of de facto parentage that supports the petition of Corbin for residential time with his former stepdaughter. MODIFICATION OF PARENTING PLAN ¶ 36 Reimen argues that even if Corbin could establish that he is a de facto parent, he must still meet the adequate cause threshold to modify the existing parenting plan. She also argues that he has failed to do so. We agree with both contentions. ¶ 37 The statutory procedures for establishing adequate cause and requesting modification of a parenting plan are set out in Chapter 26.09 RCW. The party petitioning for modification must submit an affidavit supporting the requested modification, and the non-moving party may file opposing affidavits.[40] Unless the court finds that the affidavits establish adequate cause for a full hearing of the modification petition, the court shall deny the petition.[41] ¶ 38 A court may not modify a parenting plan unless it finds (1) that there has been a substantial change in the circumstances of the child or the non-moving party, (2) modification is in the best interests of the child, and (3) modification is necessary to serve the best interest of the child.[42] ¶ 39 Here, the declaration in support of Corbin's motion did not address the adequate cause threshold standard of RCW 26.09.260. Moreover, the court failed to make any of the statutorily required findings for adequate cause. ¶ 40 Although Corbin argues that the adequate cause determination was implicit in the court's order, a review of the relevant parts of the order shows otherwise. The superior court commissioner stated: 3. This is a new area of law and it would seem that there needs to be a threshold determination in this case, which was what was contemplated in L.B. By way of comparison, the closest thing the court can look at is an adequate cause determination, which is more than a prima facie case; there has to be solid factual basis for sending the matter to trial. It is not conclusively determinative on a trial court regarding the outcome of the case but sets it into a procedural posture and allows temporary orders to proceed and allows it to go to trial where that may be affirmed or dismissed. That is the proper process in this case. If there is no threshold, there would be no purpose in continuing the matter.[[43]] ¶ 41 These observations do not fulfill the adequate cause requirements of the statutes. Failure to apply the modification requirements of RCW 26.09.260 constitutes an abuse of discretion.[44] We must reverse. OTHER ORDERS ¶ 42 The remaining orders that are before us for review are the superior court's order denying Reimen's motion for revision of the commissioner's two orders and the order appointing the guardian ad litem. We apply the usual standard of review to these orders.[45] ¶ 43 There is no cause of action to support this case. Accordingly, these orders are improper. ¶ 44 We reverse the order denying Reimen's CR 12(b)(6) motion, the order on revision, and the two underlying orders of the commissioner. We dismiss Corbin's petition seeking visitation. WE CONCUR: COLEMAN and BECKER, JJ. NOTES [1] See In re Parentage of L.B., 155 Wash.2d 679, 122 P.3d 161 (2005), cert. denied, ___ U.S. ___, 126 S.Ct. 2021, 164 L.Ed.2d 806 (2006) (holding that a common law claim of de facto parentage existed such that a woman had standing to petition for rights and responsibilities of shared parentage with her former partner). [2] RCW 26.09.260(1) provides: "[T]he court shall not modify a . . . parenting plan unless it finds . . . a substantial change has occurred in the circumstances of the child or the nonmoving party and that the modification is in the best interest of the child and is necessary to serve the best interests of the child." [3] 155 Wash.2d 679, 122 P.3d 161 (2005). [4] Petition for De Facto Parent Rights, Clerk's Papers at 313-15. [5] Report of Proceedings (June 7, 2006) at 22-25. [6] Clerk's Papers at 15-18. [7] San Juan County v. No New Gas Tax, 160 Wash.2d 141, 164, 157 P.3d 831 (2007). [8] Reid v. Pierce County, 136 Wash.2d 195, 201, 961 P.2d 333 (1998); see also L.B., 155 Wash.2d at 684 n. 2, 122 P.3d 161. [9] Gaspar v. Peshastin Hi-Up Growers, 131 Wash. App. 630, 635, 128 P.3d 627 (2006), review denied, 158 Wash.2d 1029, 152 P.3d 1033 (2007). [10] Hudon v. W. Valley Sch. Dist. No. 208, 123 Wash.App. 116, 123, 97 P.3d 39 (2004). [11] RCW 26.10.030 permits a nonparent to petition for child custody, subject to the requirements of the statutes. RCW 26.09.240 authorizes a nonparent to petition for visitation with a child, subject to case authority dealing with the constitutionality of that statute and the prospective application of that constitutional rule. See, e.g., In re Parentage of C.A.M.A., 154 Wash.2d 52, 66, 109 P.3d 405 (2005) (declaring unconstitutional RCW 26.09.240, which presumed grandparent visitation was in best interests of child); In re Marriage of Anderson, 134 Wash.App. 506, 512, 141 P.3d 80 (2006) (holding that former stepfather could enforce an existing parenting plan that gave him visitation rights with his former stepdaughter because C.A.M.A. applies prospectively only). [12] While Reimen is the biological parent of M.F., we use the word "parent" to include biological and adoptive parents as well as those who properly fall within the scope of de facto parents under L.B. See also In re Custody of H.S.H.-K, 193 Wis.2d 649, 533 N.W.2d 419, 421 (1995) (referring to biological or adoptive parent's constitutionally protected interests). [13] The de facto parent test requires: (1) the natural or legal parent consented to and fostered the parent-like relationship; (2) the petitioner and the child lived together in the same household; (3) the petitioner assumed obligations of parenthood without expectation of financial compensation; and (4) the petitioner has been in a parental role for a sufficient time to have established with the child a bonded, dependent relationship, parental in nature. Additionally, recognition of a de facto parent is "limited to those adults who have fully and completely undertaken a permanent, unequivocal, committed, and responsible parental role in the child's life." L.B., 155 Wash.2d at 708, 122 P.3d 161. [14] Clerk's Papers at 86. [15] The statute provides: "[A] child custody proceeding is commenced in the superior court by a person other than a parent, by filing a petition seeking custody of the child in the county where the child is permanently resident or where the child is found, but only if the child is not in the physical custody of one of its parents or if the petitioner alleges that neither parent is a suitable custodian." RCW 26.10.030(1). We note that the legislature has largely abandoned the term "custody" in favor of defining relative levels of residency time with the child. L.B., 155 Wash.2d at 700 n. 21, 122 P.3d 161; see also RCW 26.09.184(5). [16] See RCW 26.10.040(1)(a). [17] In re Custody of Shields, 157 Wash.2d 126, 137, 144, 136 P.3d 117 (2006). [18] RCW 26.09.240. [19] 154 Wash.2d 52, 66, 109 P.3d 405 (2005). [20] In re Marriage of Anderson, 134 Wash.App. 506, 512, 141 P.3d 80 (2006). [21] 530 U.S. 57, 60, 120 S.Ct. 2054, 147 L.Ed.2d 49 (2000). [22] See Shields, 157 Wash.2d at 144, 136 P.3d 117. [23] PRINCIPLES OF THE LAW OF FAMILY DISSOLUTION: ANALYSIS AND RECOMMENDATIONS § 2.04(1)(c) (emphasis added). [24] See Id. [25] L.B., 155 Wash.2d at 683, 122 P.3d 161. [26] Id. at 683-84, 122 P.3d 161. [27] Id. at 684, 122 P.3d 161. [28] Id. [29] Id. [30] Id. at 685, 122 P.3d 161. [31] Id. [32] Id. at 686, 122 P.3d 161; In re Parentage of L.B., 121 Wash.App. 460, 485, 89 P.3d 271 (2004). [33] L.B., 155 Wash.2d at 687, 122 P.3d 161. [34] Id. at 688, 122 P.3d 161 (emphasis in original). [35] Id. at 694-95, 122 P.3d 161. [36] Id. at 696, 122 P.3d 161. [37] Id. at 701, 122 P.3d 161. [38] Id. at 689, 122 P.3d 161. [39] Id. at 707, 122 P.3d 161. [40] RCW 26.09.270. [41] Id. [42] RCW 26.09.260(1). [43] Clerk's Papers at 21. [44] In re Parentage of Jannot, 110 Wash.App. 16, 22, 37 P.3d 1265 (2002). [45] State v. Wicker, 105 Wash.App. 428, 432-33, 20 P.3d 1007 (2001).
Wednesday, March 21, 2012 Resources for Medical Research – We’re Gonna Need a Bigger Boat By Margaret Anderson, Executive Director, FasterCures It’s appropriations season in Washington, DC, and we are having an early spring. Why does that make me think of Jaws (the movie)? Because I love the beach and sometimes have nagging anxiety about what swims beneath me when I swim in the ocean? Perhaps. (And yes, I know that sharks attack rarely and they are minding their own business.) More so because I think we have allowed ourselves to forget what the real issue is out there lurking in the water. Resources and the future. Yesterday, the House Appropriations subcommittee on labor, health and human services, and education chaired by Rep. Denny Rehberg (R-Mont.) convened a distinguished panel that focused on investments at the National Institutes of Health (NIH) and the newly created National Center for Advancing Translational Sciences (NCATS). A lot of the discussion centered on NCATS’ value proposition. And some discussion was about the pros and cons of the NCATS approach. (Let’s remember that NCATS is exactly 2 and a half months old now.) NIH Director Francis Collins reiterated that NIH support for basic research remains consistent and strong at about 54 percent of the agency’s budget. He said he does not expect that percentage to change. He also emphasized that 98 percent the $575 million funding for NCATS comes from preexisting NIH programs. “We believe we could do a lot with modest resources at this point simply by putting the focus on bottlenecks in the drug development pipeline,” said Collins. Threading the needle? That sounds pretty rational. Acting NCATS Director Thomas Insel has emphasized that NCATS was created to “complement—not compete with—the private sector.” NCATS pools together existing NIH resources and capacity in translational research to foster greater efficiency. It does not develop drugs; instead, it streamlines and improves processes to increase the odds of getting to therapies faster. Todd Sherer, CEO of Michael J. Fox Foundation for Parkinson’s Research (MJFF), also providing testimony, noted that in pursuit of a Parkinson's cure, MJFF has funded more than $285 million in research since inception, of which 90 percent has gone straight to translational research. "Based on my experience of what can happen when substantive investments are made in translation, the total contributions NCATS can make to drug development may well be greater than the sum of the parts," he said. At FasterCures, we support NIH’s efforts to create NCATS. Solutions can be tough to develop, and tougher to implement. Groups like MJFF and other outcomes-driven medical research foundations that are part of our TRAIN network, have demonstrated that innovative approaches to disease research are critical to speeding the R&D process. We must try new, promising avenues. NCATS is one tangible way to get moving. So what about the bigger picture? We should not forget the larger menace on the horizon, the one that should cause the famousJohn Williams tune from Jaws to be playing in your head now. And that is the need to continue to keep our eye on the overall NIH budget, and the implications of flat or negative funding for NIH, as well as the threat of sequestration in January 2013. NCATS, new and important as it is, only accounts for a very thin slice of the NIH budget. Our national investment at the 27 institutes and centers at the NIH have yielded great scientific discoveries that have and will continue to improve health. NIH also plays an essential role in sustaining our economy. A report released yesterday by United for Medical Research found that in 2011, the NIH directly and indirectly supported 432,094 jobs around the country. While significant, this is actually 55,000 fewer jobs than in 2010 – which, according to the report, “demonstrates that the lack of sustained investment in the agency is beginning to have an impact.” The ripple effects of a constrained NIH budget go far and wide. Should sequestration (mandatory budget cuts should Congress not reach a budget agreement) happen, the NIH will lose 7.8 percent of its budget – $2.5 billion. Collins said that this means that “2,300 grants we had planned to give in fiscal year 2013 would not be able to be awarded. It would be devastating.” Do we need to keep innovating our research system? Of course, but we also need resources. Resources feed that important basic science part of the continuum. Resources keep our young investigators in the field. As the appropriations season unfolds, we urge all members of Congress and the medical research community to keep our eyes on the prize: a strong NIH will not only protect and sustain nearly half a million high quality jobs. This agency is also our biggest chance of having more “shots on goal” in the search for treatments and cures. This is about resources. This is also about patients – patients today and tomorrow. This is also about the future. Let’s get our priorities straight. There are big fish – maybe even some really big ones – out there we need to be focused on, and as Roy Scheider who played Amity Police Chief Brody told us in Jaws, “We’re gonna need a bigger boat.”
970 F.2d 728 UNITED STATES of America, Plaintiff-Appellee,v.James Garry HORN, Defendant-Appellant. No. 91-4136. United States Court of Appeals,Tenth Circuit. July 21, 1992. Cheryl I. Jolley, Salt Lake City, Utah, for defendant-appellant. David J. Jordan, U.S. Atty., and Mark K. Vincent, Asst. U.S. Atty., Salt Lake City, Utah, for plaintiff-appellee. Before LOGAN, BARRETT, and EBEL, Circuit Judges. LOGAN, Circuit Judge. 1 Defendant James Garry Horn entered a plea of guilty to violation of 18 U.S.C. §§ 922(g) and 924(a)(2), possession of a firearm by a felon, conditioned on appeal of the district court's denial of his motion to suppress evidence of his possession of a handgun and a rifle.1 Defendant argues for suppression on several grounds: (1) the initial stop of defendant's car was improper; (2) the trooper's investigation and defendant's detention were not reasonably related in scope to the initial stop under the circumstances; (3) defendant's consent to search the vehicle was not voluntary, and in any event exceeded the scope of any consent given; (4) the roadside search of defendant's car was constitutionally invalid; and (5) defendant's Miranda warnings were insufficient. 2 * Defendant was stopped by a state highway patrolman (the trooper) while traveling west-bound on Interstate Highway 80 in Utah, close to the Nevada border. He was driving a car without a front license plate, which is required in Utah and Nevada but not in Oklahoma, the state issuing the license plate for defendant's car. All three states issue license plates with light colored backgrounds. The trooper stopped defendant because the trooper noticed the absence of the front license plate and noticed that defendant did not appear to be wearing a seatbelt.2 3 When defendant stopped the car beside the highway, he steered it such that it came to rest not parallel to the highway, but at an angle heading back toward the highway. The trooper felt constrained to approach the rear of defendant's car from the passenger side of the patrol car because this unusual parking position made the trooper concerned about his safety. Defendant nervously craned his neck and twisted in his seat to keep the trooper in sight as the trooper approached defendant's car. After examining the rear license plate, the trooper approached defendant, seated in the driver's seat of the car, and asked for defendant's driver's license and car registration. Defendant produced his driver's license, but instead of a car registration, he turned over what he described as a bill of sale for the car, which was handwritten on the back of an envelope without a notary seal. After the trooper asked for further proof of ownership, defendant produced the title to the car, which was not signed over to defendant. The trooper requested that defendant stand in front of the car while the trooper checked the vehicle identification number (VIN). After checking the VIN number but before running a computer check on defendant's driver's license and ownership documents, the trooper asked defendant if he had any drugs, guns, or large amounts of cash in the car. Defendant replied that he did not. Still holding defendant's driver's license and title documents to the car, the trooper asked defendant again whether he had any weapons in the car. Defendant replied that he did not and told the trooper he could search the car if he wanted to. 4 Although the trooper told defendant that the trooper did not have a search warrant and that defendant did not have to consent to having the trooper search the car, defendant reiterated, "Feel free to look if you want to," II R. at 30, and turned to the car to retrieve a backpack laying on the car's seat. Defendant asserts that he consented solely to a search of the backpack. The trooper, however, suggested that they begin by looking in the trunk of the car. Defendant got his keys from the ignition and walked to the rear of the car with the trooper. He attempted to hand the keys to the trooper, who refused them, asking defendant to open the trunk. Defendant did so. Among the contents of the trunk was an antique fifty caliber Hawkins black powder rifle in a case and a box of 30/30 cartridges. 5 While defendant returned to the driver's seat of the car, the trooper returned to the patrol car and called in for a National Crime Computer Information Center (NCIC) check on the defendant's driver's license and vehicle. He was informed that there was a warrant for defendant's arrest for parole violation and that he should use caution because defendant was considered dangerous. The trooper requested backup and arrested defendant at gun-point. After the backup officer arrived, defendant was detained, hand-cuffed and held at gun-point, while the trooper searched the interior and the trunk of defendant's car. It was during this search that the trooper discovered a loaded .38 caliber handgun under the driver's seat and a Winchester 30/30 rifle in the trunk. The trooper referred to this search as an "inventory search" of the car. The backup officer completed the inventory report for defendant's car later in the day; the trooper did not fill out or sign the inventory report. 6 Defendant was transported some miles to the highway patrol station in the trooper's car. As the trooper began driving, he read defendant his Miranda rights from a card. Subsequently, during the drive, defendant discussed with the trooper his ownership of the weapons that were in the car. II 7 We review the factual findings supporting district court action in response to a motion to suppress in the light most favorable to the district court findings under a clearly erroneous standard. United States v. Ibarra, 955 F.2d 1405, 1409 (10th Cir.1992). However, "the ultimate determination of the reasonableness of [the] seizure and search is a question of law to be reviewed by this court de novo." Id.; accord United States v. Pena, 920 F.2d 1509, 1513-14 (10th Cir.1990), cert. denied, --- U.S. ----, 111 S.Ct. 2802, 115 L.Ed.2d 975 (1991); United States v. McKinnell, 888 F.2d 669, 672 (10th Cir.1989). 8 Defendant asserts that the initial stop of his car was pretextual, that it did not meet the probable cause standard which defendant claims is required to justify a Fourth Amendment seizure, and that the evidence that weapons were seized from the car during the stop should be suppressed as fruit of the poisonous tree. Defendant argues that the trooper could have determined that the rear license plate was from Oklahoma, a state which does not require a front plate, before stopping defendant's car on the highway. The court below held: "I think the initial stop is a close question but I believe there was a reasonable suspicion based upon the totality of the circumstances to stop the vehicle." II R. at 85. 9 We divide defendant's assertions into three questions: was the stop pretextual? If not, what is the appropriate standard for determining whether there was sufficient justification for the trooper to make the stop? And, under that standard, was the initial stop justified? 10 First, under the circumstances of this case the stop was not pretextual. "A pretextual stop occurs when the police use a legal justification to make the stop in order to search a person or place, or to interrogate a person, for an unrelated serious crime for which they do not have the reasonable suspicion necessary to support a stop." United States v. Guzman, 864 F.2d 1512, 1515 (10th Cir.1988). We use "an objective test to determine whether a traffic stop [is] pretextual." United States v. Corral, 899 F.2d 991, 994 (10th Cir.1990); see also Guzman, 864 F.2d at 1515-18 (explaining and adopting objective test). There is no evidence in the record that the trooper made the stop for any reason other than violation of Utah's license plate rule and a seat belt violation. Absent introduction of any rationale for the stop outside the parameters of the traffic violations, the stop cannot, by definition, be called "pretextual." 11 Second, "reasonable suspicion" of illegal conduct is the proper standard to justify stopping a car for a routine traffic violation. Under Fourth Amendment analysis, a routine traffic stop is a limited seizure. Guzman, 864 F.2d at 1519. The police must have reasonable suspicion of a traffic violation to justify the stop. See United States v. Sokolow, 490 U.S. 1, 7, 109 S.Ct. 1581, 1585, 104 L.Ed.2d 1 (1989); United States v. Walker, 933 F.2d 812, 815, 817 (10th Cir.1991), cert. denied, --- U.S. ----, 112 S.Ct. 1168, 117 L.Ed.2d 414 (1992). "This approach entails a determination of 'whether the officer's action was justified at its inception, and whether it was reasonably related in scope to the circumstances which justified the interference in the first place.' " United States v. Dewitt, 946 F.2d 1497, 1501 (10th Cir.1991) (quoting Terry v. Ohio, 392 U.S. 1, 20, 88 S.Ct. 1868, 1879, 20 L.Ed.2d 889 (1968)), cert. denied, --- U.S. ----, 112 S.Ct. 1233, 117 L.Ed.2d 467 (1992); see also Walker, 933 F.2d at 815. 12 And third, using the "reasonable suspicion" standard, there was sufficient evidence to support the trooper's assertion of reasonable suspicion of a traffic violation, justifying the initial investigative detention. Although defendant argues that the trooper should have discerned that the license plate was from Oklahoma and used his patrol car radio to verify that a front license plate is not required in Oklahoma, there is no evidence in the record that the trooper could determine the state of origin of the license plate prior to the stop. Under an objective standard, the trooper's suspicion about a traffic violation for lack of a front license plate, combined with his observation that defendant was not wearing a seat belt, provided sufficient context for a valid traffic violation stop. III 13 Defendant argues that, once stopped, the trooper's investigation exceeded the scope of the reason for the initial stop and that circumstances did not justify widening the scope of the investigation. The district court held: "The officer was entitled to ask for the registration and the driver's license, ownership evidence. That made him more suspicious when he got what he got. He was certainly acting reasonably in checking out the VIN number and in checking out with NCIC." II R. at 85. 14 Even after he had ascertained that the license plate on the back of defendant's car was from Oklahoma, the trooper's request for defendant's driver's license and registration for the car was justified by the unusual and provocative way defendant pulled his car to a stop at an angle to the highway. The trooper's suspicions were heightened and his investigation was correspondingly widened during his examination of the documents purporting to show that defendant owned the car. 15 When defendant presented the trooper with the unnotarized bill of sale, handwritten on the back of an envelope, and title to the car in another individual's name, the trooper had a "reasonable and articulable suspicion," see United States v. Turner, 928 F.2d 956, 958 (10th Cir.), cert. denied, --- U.S. ----, 112 S.Ct. 230, 116 L.Ed.2d 187 (1991), based on facts and reasonable inferences from those facts, to support further questioning about drugs, money or weapons in the car. This expansion of questioning sprang directly from the combination of defendant's unusual and provocative manner of bringing his car to a stop beside the highway and his production of the suspicious-looking ownership documents. The trooper did not widen the scope of the questioning until after defendant produced these irregular documents. We hold that the trooper's widening of his investigation was reasonable under these circumstances. IV 16 Defendant asserts that such consent as he may have given to search the car was not freely given, and that if he did consent, the search exceeded the scope of the consent. Because this search of the automobile did not uncover either the handgun or the 30/30 rifle which defendant was accused of possessing in violation of 18 U.S.C. §§ 922(g) and 924(a)(2), we need not, and do not, discuss these issues. 17 The warrantless inventory search of the car beside the highway revealed the loaded handgun under the driver's seat of the car and the operable 30/30 rifle in the trunk. Defendant asserts that this search did not fall within the boundaries of an impound inventory and was thus constitutionally infirm. We note that this search was conducted after defendant, who was traveling alone, was arrested under a warrant for parole violation and after the trooper had been informed that defendant should be considered dangerous. 18 The question whether or not the trooper conducted a proper inventory search is moot. "[I]f evidence seized unlawfully would have been inevitably discovered in a subsequent inventory search, such evidence would be admissible." Ibarra, 955 F.2d at 1410. Defendant was traveling alone and was placed under arrest under a warrant for parole violation; his car, of necessity, had to be impounded. Even assuming arguendo that the post-arrest search beside the highway was improper and should have been conducted in a different manner, had the search been conducted in the manner defendant suggests is proper, it was inevitable that the weapons would have been discovered and that defendant would have been charged with their possession. Under Ibarra, this evidence is admissible. V 19 Defendant argues that any and all statements he made in the patrol car after being read the Miranda warning should be suppressed because the government did not carry its burden of proving that the statements were an intervening act of free will. The district court found "no reason to disbelieve the officer" that a proper Miranda warning was given prior to any post-arrest incriminating statements. II R. at 86. 20 Defendant has not identified, nor can we discern from the record, a specific statement that he made either before or after the arrest and Miranda warning upon which the government would necessarily rely for its prosecution of this case. Under these circumstances, we find this contention to be without merit. 21 AFFIRMED. 1 After examining the briefs and appellate record, this panel has determined unanimously that oral argument would not materially assist the determination of this appeal. See Fed.R.App.P. 34(a); 10th Cir.R. 34.1.9. The case is therefore ordered submitted without oral argument 2 Under Utah statute, enforcement of the seat belt requirement may only be secondary to detention of a driver for other offenses. See Utah Code Ann. § 41-6-184
Former Preston cop takes chief spot ST. ANTHONY – Terry Harris, a former police officer with Preston City, was unanimously approved by the city council as Police Chief of St. Anthony in the city’s last council meeting. Harris started his law enforcement career with the Preston Police Department as a reserve from 1998-99 then was hired full-time in 1999. He left in 2006 to go to work as a Fremont County Sheriff’s Deputy. He was later hired by St. Anthony as a city policeman. Terry Harris Harris said Preston and St. Anthony are about the same as far as crime goes. This story is sponsored by Flags West Truck Stop. For the full story subscribe to The Preston Citizen: in print or online.
Step 3: Finished! Step 4: Label your Bottle Now you can just add a label giving refill and application instructions so you can't forget. I would also black out any old instructions on the bottle... Here is a simple way to get all of the water out of your ears after swimming! This is not expensive to do and you should have all of the ingredients in your home. This idea came from my doctor and I thought that I should share the idea. I use it every time I go for a swim. I would not use this product if you have an already existing ear infection. "This trick is also good to use before/after wearing earplugs for an extended time (i.e. on a plane flight, all night in a noisy hotel). I think it helps by creating a sterile environment, preventing nasty bacterial activity that could otherwise occur in a sealed environment. Also kills bacteria on your fingers that you use to roll up the earplugs.Be sure the drops in your ear have evaporated completely (wave your hands) before inserting earplugs." - comment submitted by jaime9999. Oh, so you TELL people to put this combo in an eye drop bottle?!?!Note to self: in the morning, the words on the bottle aren't easy to read, but the shape is--now my hubby burned his eye with this stuff!!PLease specify that users use a DIFFERENT bottle...thank you!! I found out my ear canals are "deformed" about 35 yrs. ago and used to get horrible swimmers ear even after showers. The Dr. told my mother to use this formula and the reason he told us that it works is that the alcohol helps to dry the water and the vinegar kills infection. My Ear, Nose, Throat surgeon specifically recommends alcohol combined with white vinegar. The vinegar is also anti-bacterial (as is the alcohol). I add a few drops of generic Debrox (the earwax removal drops), to avoid the excess drying effect of the alcohol on earwax. Remember, earwax amounts & issues are genetic and vary racially, so your mileage may vary. Hi! My 4 year old daughter recently has been complaining of water stuck in her ear after her bath. She FREAKS out because it makes her dizzy. We have been using a blowdryer on low to dry up the water. But would love to have this solution on hand too! So, my question is..This will help dry up that water? She also has a couple deep black heads in one of her ears..I don't know why, her ears are clean and always dried after bath. But I am thinking the anti-bacterial properties in both Alcohol and Vinegar may help..Any thoughts? Thank You! my daughter complained of water in her ear - she went to bed hoping it would go away, but it was still there when she woke up. I searched my trusty instructable site, tried this trick this morning and voila! all better!!. This trick is also good to use before/after wearing earplugs for an extended time (i.e. on a plane flight, all night in a noisy hotel). I think it helps by creating a sterile environment, preventing nasty bacterial activity that could otherwise occur in a sealed environment. Also kills bacteria on your fingers that you use to roll up the earplugs. Be sure the drops in your ear have evaporated completely (wave your hands) before inserting earplugs. The alcohol doesn't just make the solution flow better, but evaporate readily. You can wave your hands at your ears and feel the evaporation in your ears. This is the same reason why you rinse your just-cleaned beakers in Chemistry Lab with Acetone. I first read about this "natural" treatment for swimmer's ear several years ago after suffering through more than a decade of on-again/off-again earaches in one ear or the other after our twice-weekly swimming sessions. I use this after baths and showers, too, and haven't had an earache for any reason in several years. Just straight rubbing-alcohol is really harsh on the skin and risks irritating it quite a lot, especially in normally "untouched" areas like the ear-canal. The vinegar not only helps dilute it, but also helps -- as someone else has noted -- the natural "acid balance" of the area. I put a drop or two of Tea Tree oil into every batch as well, "just in case". Have turned several people onto this one, and am regularly asked to make someone a batch since I always seem to have an extra dropper bottle lying around. Great instructable! :o) great idea to stop urself from getting ear infections if u clean the wax out ur ears the day u swim could make the possiblite of infection more if u kno ur going swimming dont clean them yea sounds gross but the wax is there for a reason great instructable Yes, it really works. My daughter used to get swimmer's ear and then her doctor told us about the alcohol/vinegar combination and we've been using it for the last 10 years or so. And we have our friends use it, too. Our daughter will still get swimmer's ear but its only because she forgets to use the drops. After she starts using the drops again, the swimmer's ear goes away. Excellent, simple Instructable. Nice work. My mom's a nurse and always did this for us kids before swimming in a pond. We had swimmer's ear for the first half of summer but after she learned this trick none of us got anymore the rest of the year. Definitely works. About This Instructable Bio:Welcome! Please take some time to take a look at the instructables that I have made. Computer slow? Want to learn how to use Craigslist? Tired of knocking the water out of your ears after swimming? Wa...read more »
featured Friday, May 23, 2008 the best laid plans... sorry for not chatting more, things are still hectic around here! my husband is finally off of his night schedule after almost three months, so he took off the entire week. and strangely, i find i am more productive when he's not around! is anyone else like that? he's been the crafty one, building the kids a wood fort complete with slide, climbing wall, and picnic table! we still need to put on the roof, the sandbox and the trapeze bar. anyways, we've also been preparing for a big weekend. first, a fishing tournament and camp-out on the lake. then our kids are getting baptised on sunday, followed by lunch at our house. then tuesday i am hosting bunco here. which means i have been planning menus and cleaning like a mad woman! i made two pies today, and have two to make tomorrow. i tried a new recipe, for cranberry pie. i threw in a sprinkle of dried cherries and a dash of almond extract. i think it could use something else, but it's pretty tasty as it is. tart and full of flavor, the taste lingers on your tongue. but in a pleasant way, not in that cloying perfume kind of way. i think i added a 1/4 c. more sugar, and had a few less cranberries than it wanted. we'll see what the verdict is tomorrow. i am thinking it also needs to be warm with a big scoop of breyer's vanilla. the other pie i made was a pecan pie and this is the third time i've made it. the first two, i didn't get to taste before they were all gone! i like that it doesn't use karo, too messy! i am also going to make a sour cream apple, and a chocolate cream pie. yummo! it's been so long since i got to just bake. the potato and dessert recipes are in the latest everyday food magazine, and they are all make ahead dishes i can do tomorrow. i already made the pasta salad for the bbq saturday. we're smoking ribs and pork roasts, and mom's bringing beans and who knows what else. we always have so much food. and finally, for bunco - i know this is fascinating stuff, right! - i am thinking of a platter of little sandwiches, cut in quarters with toothpicks in them. and then spinach dip because i never get sick of that. and for dessert, i may try the new one kraft is pimping everywhere, the strawberry cool whip oreo one that is advertised all over the place?! it's a make ahead frozen dessert and sounds super easy. i just hope that easy=delish.
INTRODUCTION {#s1} ============ Mitochondria are organelles in the cytoplasm within a cell whose main functions include energy metabolism, free-radical production, calcium homeostasis, and apoptosis \[[@R1]\]. Mitochondria are also the primary site for the degradation of fatty acids, through β-oxidation \[[@R2]\]. Mitochondrial DNA (mtDNA) located close to the source of reactive oxidative stress (ROS) production is extremely susceptible to oxidative damage due to its lack of either protective histones or introns and the scarcity of efficient DNA repair mechanisms \[[@R3], [@R4]\]. Associations between leukocyte mtDNA copy number (mtCN) and various health outcomes have been demonstrated in multiple prospective studies, where lower mtCN was significantly associated with poorer cognitive abilities, physical strength, and self-rated health as well as higher prevalent frailty and all-cause mortality \[[@R5]--[@R7]\]. MtCN has also been suggested as a contributor to many cancer types \[[@R8]\]. This body of evidence suggests that mtCN in leukocytes may serve as a candidate biomarker for oxidative stress-related general health outcomes. Obesity, defined as a body mass index (BMI) of 30kg/m^2^ or higher, is a major risk factor in the pathogenesis of many chronic diseases such as cardiovascular diseases, diabetes, and some cancers (e.g., endometrial, breast, and colon) \[[@R9]\]. An important pathway through which obesity contributes to these conditions is by increasing systemic inflammation and oxidative stress \[[@R10]\]. Adipose tissue is a main source of cytokines and adipokines, which increase systemic oxidative stress. It has been suggested that the activation of the innate immune system in adipose tissue can also trigger a systemic acute-phase inflammation response, which can be further promoted by free radicals generated by activated immune cells \[[@R11], [@R12]\]. A previous study among insulin-resistant subjects showed that markers of mitochondrial biogenesis and metabolism are lower in those who are overweight and obese \[[@R13]\]. Furthermore, a study of 94 healthy young Korean individuals identified an independent association between mtDNA content and visceral adiposity \[[@R14]\]. Telomere length is a key marker of cellular and biologic aging \[[@R15], [@R16]\]. Though both mtCN and telomere length can reflect the cumulative burden of oxidative stress and inflammation, it remains unclear how they differ in their sensitivities to oxidative stress. A biological connection between telomere damage and mitochondrial dysfunction was recently discovered in mouse models; it has been shown that inhibition of telomere shortening-induced activators (e.g., PGC1α and PGC1β) may consequently impair mitochondrial biogenesis and function \[[@R17]--[@R19]\]. Nevertheless, population-based studies investigating the interaction of mtCN and telomere length are lacking. Given the available evidence of associations between telomere length and anthropometric measurements \[[@R20]--[@R22]\] and the simultaneous availability of mtCN and telomere length measurements in our dataset, we prospectively assessed the associations among leukocyte mtCN, telomere length, and commonly used anthropometric measures as well as weight changes in 1,700 healthy women from the Nurses\' Health Study (NHS). Furthermore, we also compared the sensitivity of mtCN and telomere length in relation to age and obesity. RESULTS {#s2} ======= The descriptive characteristics of the 1,700 women in our population according to the mtCN quartiles are provided in Table [1](#T1){ref-type="table"}. In general, mtCN z score quartiles were similar with respect to age, postmenopausal status, postmenopausal hormone use, oral contraceptive use, parity, total activity/week, alcohol consumption, and total calorie intake. A higher percentage of current smokers was found in the lower mtCN quartiles. ###### Basic characteristics of the study population at blood collection[^a^](#tfn_001){ref-type="table-fn"} Quartiles of mtCN z score ----------------------------------------------------------------------------------- --------------------------- ------------------ ------------------ ------------------ Age at blood draw, mean (SD) 58.03 (6.91) 57.96 (6.56) 57.43 (6.99) 57.75 (6.71) Postmenopausal status, n (%) 335 (78.63) 345 (80.90) 332 (77.74) 331 (77.61) Age at menopause 49.96 (8.82) 50.65 (10.05) 51.22 (9.66) 50.53 (7.90) Postmenopausal hormone use  Never, n (%) 175 (41.37) 188 (44.34) 207 (49.40) 190 (45.82)  Past, n (%) 71 (16.78) 65 (15.33) 62 (14.80) 71 (16.95)  Current, n (%) 177 (41.84) 171 (40.33) 150 (35.80) 158 (37.71) Oral contraceptive use, n (%) 196 (45.93) 195 (45.62) 200 (46.87) 190 (44.56) Parity, n (%) 27 (6.26) 21 (4.87) 26 (6.11) 35 (8.31) Smoking status  Never, n (%) 171 (40.24) 171 (40.05) 191 (44.84) 171 (40.24)  Past, n (%) 154 (36.24) 171 (40.05) 168 (39.44) 178 (41.88)  Current, n (%) 100 (23.53) 85 (19.91) 67 (15.73) 76 (17.88) Physical activity (MET hours/week)[^b^](#tfn_002){ref-type="table-fn"}, mean (SD) 15.08 (17.08) 12.87 (15.23) 15.14 (18.12) 15.41 (18.07) Alcohol intake, gm/day, mean (SD) 6.09 (10.14) 5.16 (8.90) 4.79 (8.23) 6.11 (11.06) Total Calories, kcal/day, mean (SD) 1749.42 (468.66) 1746.08 (460.26) 1783.67 (501.00) 1728.59 (468.80) All variables are measured at blood draw and are standardized to the age distribution of the study population. MET denotes metabolic equivalent. Met-hours = sum of the average time/week in each activity x MET value of each activity. One MET, the energy spent sitting quietly, is equal to 3.5 ml of oxygen uptake per kilograms of body weight per minute for a 70-kg adult. We calculated the Spearman correlation coefficients (*r~s~*) between mtCN z score and anthropometric variables as well as other demographic and lifestyle factors (Table [2](#T2){ref-type="table"}). There were significant inverse associations between mtCN and weight (*r~s~*= -0.09, *P*=0.0002), waist measurement (*r~s~*= -0.06, *P*=0.01), BMI (*r~s~*= -0.10, *P*\<0.0001), and waist-to-hip ratio (*r~s~*= -0.05, *P*=0.03). In addition, mtCN was inversely correlated with pack years of smoking (*r~s~*= -0.07, *P*=0.03) among current smokers and positively correlated with telomere length (*r~s~*=0.12, *P*=0.0001). ###### Age-adjusted Spearman correlations between relative mitochondrial DNA copy number (z score) and various characteristics at blood collection Characteristic (n=1,700) *r*~s~[^a^](#tfn_003){ref-type="table-fn"} *p*-value ----------------------------------------------------------- -------------------------------------------- ----------- Weight, kg[^b^](#tfn_004){ref-type="table-fn"} −0.09 0.0002 Height at baseline, inches −0.03 0.27 Waist measurement, inches −0.06 0.01 Hip measurement, inches −0.04 0.10 BMI, kg/m^2^ −0.10 \<.0001 Waist to hip ratio −0.05 0.03 Waist to height ratio −0.05 0.05 Age −0.02 0.48 Pack years of smoking[^c^](#tfn_005){ref-type="table-fn"} −0.07 0.03 Physical activity, MET hours/week 0.02 0.33 Total calories, kcal/day −0.02 0.42 Alcohol intake, gm/day 0.01 0.70 Relative telomere length 0.12 0.0001 Spearman correlation coefficient, adjusted for age at blood collection Adjusted for age at blood collection and height Among current smokers The associations of mtCN with common anthropometric variables categories including weight, waist circumference, BMI, and waist-to-hip ratio are presented in Table [3](#T3){ref-type="table"}. Inverse associations were observed between mtCN and categories of weight (LS means Q1-Q4: 0.07, 0.04, 0.03, −0.17; *P~trend~*=0.002), waist circumference (LS means Q1-Q4: 0.06, 0.05, −0.04, −0.06; *P~trend~*=0.04), BMI (LS means normal light, normal heavy, overweight, pre-obese, obese: 0.11, −0.01, −0.04, 0.04, −0.25; *P~trend~*\<0.0001), and waist-to-hip ratio (LS means Q1-Q4: 0.06, 0.08, −0.04, −0.06; *P~trend~*=0.03). We excluded the underweight group because of potential differences in their etiology. In addition, linear regression indicated that a one-unit decrease in mtCN z score was equivalent to approximately 3.5 pounds of weight gain for an adult of 5′10″ (*P*\<0.0001). ###### Associations of mtCN z score with anthropometric measurements and telomere length Anthropometric variables Relative mtCN z score ----------------------------------------------------- ----------------------- ---------------------- ---------- ---------- Weight (kg)[^a^](#tfn_006){ref-type="table-fn"}  Q1 (\<59.5) 433 0.07 (−0.06, 0.20) Ref 0.002  Q2 (59.5-65.5) 375 0.04 (−0.09, 0.17) 0.64  Q3 (65.5-74.5) 452 0.03 (−0.10, 0.16) 0.52  Q4 (74.5\>) 428 −0.17 (−0.30, −0.04) 0.0008 Waist (inch)[^a^](#tfn_006){ref-type="table-fn"}  Q1 (\<28) 357 0.06 (−0.07, 0.20) Ref 0.04  Q2 (29-31) 349 0.05 (−0.08, 0.19) 0.90  Q3 (31-32) 600 −0.04 (−0.16, 0.08) 0.11  Q4 (\>33) 382 −0.06 (−0.19, 0.08) 0.10 BMI[^b^](#tfn_007){ref-type="table-fn"}  Normal light (18.5-23) 527 0.11 (−0.01, 0.23) Ref \<0.0001  Normal heavy (23-25) 366 −0.01 (−0.15, 0.13) 0.07  Overweight (25-27.5) 337 −0.04 (−0.18, 0.09) 0.02  Pre-obese (27.5-30) 193 0.04 (−0.13-0.20) 0.36  Obese (\>30) 240 −0.25 (−0.41, −0.10) \<0.0001 Waist-hip ratio[^b^](#tfn_007){ref-type="table-fn"}  Q1 (\<0.735) 436 0.06 (−0.07, 0.19) Ref 0.03  Q2 (0.737-0.775) 249 0.08 (−0.07, 0.24) 0.73  Q3 (0.778-0.822) 581 −0.04 (−0.16, 0.08) 0.12  Q4 (\>0.824) 422 −0.06 (−0.19, 0.07) 0.09 Telomere[^b^](#tfn_007){ref-type="table-fn"}  Q1 (\<0.696) 250 −0.02 (−0.18, 0.14) Ref \<0.0001  Q2 (−0.689-0.026) 256 0.09 (−0.07, 0.25) 0.19  Q3 (−0.020-0.701) 254 0.11 (−0.05, 0.28) 0.11  Q4 (\>0.707) 251 0.33 (0.17, 0.50) \<0.0001 Generalized linear models are adjusted for age at blood draw, height, smoking, menopausal status, PMH use, and alcohol consumption. Generalized linear models are adjusted for age at blood draw, smoking, menopausal status, PMH use, and alcohol consumption. We further examined the bi-directional associations between mtCN and weight changes with different lag time (5 years and 10 years). As shown in Table [4](#T4){ref-type="table"}, women with more than 20kg of weight gain since age 18, more than 10kg of weight gain since baseline (1976 to 1989), more than 10kg of weight gain 10 years prior to blood collection (1979-1989), and more than 5kg of weight gain 5 years prior to blood collection (1984-1989) had significantly lower levels of mtCN compared to women with stable weight, defined as ±2kg of weight change (weight change since age 18, LS means from weight maintenance to weight gain\>20kg=0.07, 0.02, −0.13; *P~trend~*=0.02; weight change since baseline, LS means from weight maintenance to weight gain\>10kg=0.05, 0.01, −0.16; *P~trend~*=0.01; weight change since 10 years prior to the blood collection, LS means from weight maintenance to weight gain \>10kg=0.03, 0.03, −0.21; *P~trend~*=0.03; weight change since 5 years prior to the blood collection, LS means from weight maintenance to weight gain\>5kg=0.06, −0.02, −0.11; *P~trend~*=0.01). Lower mtCN at blood collection was also found to be inversely associated with future weight gain: women with lower mtCN gained more weight in the next 5 years and 10 years after blood collection (weight gain in the next 5 years, mtCN Q1-Q4 weight gain in pounds =4.13, 4.05, 3.42, 3.23; *P~trend~*=0.003; weight gain in the next 10 years, mtCN Q1-Q4 weight gain in pounds=5.63, 5.24, 4.91, 4.45; *P~trend~*=0.01). We excluded the weight-loss members from the trend test, because weight loss may be due to a variety of reasons and take place via other physiological pathways besides weight gain. ###### Associations between mtCN z score and weight changes[^a^](#tfn_008){ref-type="table-fn"} Weight change n Relative mtCN z score or weight change in pounds *P* for trend --------------------------------------------- ------ -------------------------------------------------- --------------- Weight change since 18  Weight loss 155 0.04 (−0.14, 0.21)  Weight maintenance 134 0.07 (−0.12, 0.26) 0.02  Weight gain between 2-20kg 1028 0.02 (−0.09, 0.13)  Weight gain \>20kg 292 −0.13 (−0.28, 0.01) Weight change since baseline (1976 to 1989)  Weight loss 186 0.05 (−0.12, 0.23)  Weight maintenance 362 0.05 (−0.08, 0.19) 0.01  Weight gain between 2-10kg 816 0.01 (−0.10, 0.12)  Weight gain \>10kg 307 −0.16 (−0.30, −0.01) Weight change from 1979-1989  Weight loss 257 0.01 (−0.15, 0.16)  Weight maintenance 420 0.03 (−0.10, 0.17) 0.03  Weight gain between 2-10kg 764 0.03 (−0.08, 0.15)  Weight gain \>10kg 173 −0.21 (−0.38, −0.04) Weight change from 1984 to 1989  Weight loss 279 −0.001 (−0.15, 0.15)  Weight maintenance 531 0.06 (−0.06, 0.19) 0.01  Weight gain between 2-5kg 423 −0.02 (−0.15, 0.11)  Weight gain \>5kg 317 −0.11 (−0.25, 0.03) Weight change from 1989 to 1994  mtCN Q1 326 4.13 (3.45, 4.80) 0.003  mtCN Q2 326 4.05 (3.37, 4.74)  mtCN Q3 356 3.42 (2.75, 4.09)  mtCN Q4 333 3.23 (2.55, 3.91) Weight change from 1989-1999  mtCN Q1 287 5.63 (4.75, 6.50) 0.01  mtCN Q2 288 5.24 (4.35, 6.13)  mtCN Q3 313 4.91 (4.04, 5.78)  mtCN Q4 295 4.45 (3.57, 5.32) Linear regression models are adjusted for age at blood draw, smoking, menopausal status, PMH use, and alcohol consumption. Blood collection year: 1989. Because telomere length was found to be associated with BMI in previous studies of the NHS \[[@R21], [@R22]\], we examined the association between mtCN and telomere length, and found a strong positive association as presented in Table [3](#T3){ref-type="table"} (mtCN LS means across Q1-Q4 of telomere length: −0.02, 0.09, 0.11, 0.33; *P~trend~* \<0.0001). In Table [5](#T5){ref-type="table"}, we showed a comparison of mtCN and telomere length with respect to their associations with BMI and age in the year of blood collection. In our data, mtCN was associated with BMI even after adjusting for telomere length (LS means normal, overweight, and obese: 0.18, 0.10, −0.09; *P~trend~*=0.003), while telomere length was not associated with BMI. On the other hand, telomere length was inversely associated with age after adjusting for mtCN (LS means \<50, 50-55, 55-60, 60-65, \>65: 0.22, −0.02, −0.07, −0.09, −0.15; *P~trend~*=0.04), while mtCN was not associated with age. ###### Comparative analyses between mtCN and telomere length in relation to age and anthropometric variables Anthropometric variables N MtCN z score MtCN z score[^a^](#tfn_009){ref-type="table-fn"} Telomere z score Telomere z score[^b^](#tfn_010){ref-type="table-fn"} --------------------------------------------------------------- ----- --------------------- ------- -------------------------------------------------- ------- --------------------- ------ ------------------------------------------------------ ------ BMI at the baseline[^c^](#tfn_011){ref-type="table-fn"}  Normal (\<25) 538 0.18 (0.04, 0.32) 0.004 0.18 (0.05, 0.32) 0.003 −0.03 (-0.18, 0.11) 0.79 −0.04 (−0.19, 0.10) 0.56  Overweight (25-30) 314 0.10 (−0.05, 0.26) 0.10 (−0.05, 0.26) −0.01 (−0.17, 0.14) −0.02 (−0.17, 0.14)  Obese (\>30) 145 −0.09 (−0.29, 0.10) −0.09 (−0.29, 0.10) −0.01 (−0.22, 0.19) 0.005 (−0.20, 0.21) Age group at the baseline[^d^](#tfn_012){ref-type="table-fn"}  \<50 163 0.01 (−0.17, 0.20) 0.75 −0.01 (−0.20, 0.18) 0.59 0.21 (0.01, 0.40) 0.05 0.22 (0.02, 0.41) 0.04  50-55 192 0.15 (−0.01, 0.31) 0.15 (−0.01, 0.31) −0.01 (−0.18, 0.15) −0.02 (−0.19, 0.14)  55-60 222 0.25 (0.06, 0.45) 0.26 (0.06, 0.45) −0.05 (−0.26, 0.15) −0.07 (−0.28, 0.13)  60-65 265 0.15 (−0.04, 0.35) 0.16 (−0.03, 0.35) −0.08 (−0.28, 0.12) −0.09 (−0.29, 0.11)  \>65 168 0.15 (−0.06, 0.37) 0.17 (−0.04, 0.38) −0.14 (−0.36, 0.08) −0.15 (−0.37, 0.07) In the mtCN analysis, models were also adjusted for telomere length along with other variables indicated below. In the telomere analysis, models were also adjusted for mtCN along with other variables indicated below. General linear models are adjusted for age at blood draw, smoking, menopausal status, PMH use, and alcohol consumption. General linear models are adjusted for smoking, menopausal status, PMH use, and alcohol consumption. Other demographic and lifestyle factors that are indicative of oxidative stress (including age, physical activity, alcohol consumption, and total calorie intake) were also examined in our study in relation to mtCN level, but no significant trend was detected (data not shown). Although we found an inverse correlation between mtCN and pack years of smoking in the Spearman test, no significant association was found for mtCN and smoking status (never, past, or current) (data not shown). DISCUSSION {#s3} ========== Our study suggests that leukocyte mtCN is inversely associated with weight, waist size, BMI, and waist-hip ratio. Furthermore, weight gain was bi-directionally associated with decreased mtCN. Moreover, although mtCN was positively correlated with telomere length, mtCN appeared to be a stronger marker for obesity, while telomere length was more sensitive to age. Oxidative stress is known to be a systemic problem in obese individuals. Cellular and molecular studies have revealed that obesity generates oxidative stress by mechanisms including hyperglycemia, elevated tissue-lipid levels, inadequate antioxidant defenses, chronic inflammation, excessive leukocyte infiltration and activation, endothelial ROS production, excessive renin-angiotensin system (RAS) hormone production, and hyperleptinemia. In every mechanism listed above, there is either elevated free-radical production or lowered antioxidant levels \[[@R28]\]. Oxidative stress may be directly caused by increased adiposity and fat distribution or consequent to behavioral changes associated with being obese. Population-based studies showed higher oxidative stress biomarkers in obese adults and children, especially among those with central or abdominal obesity. For instance, oxidation of LDL was found to be consistently and linearly associated with adiposity \[[@R28]\]; malondialdehyde (MDA) and F~2~-isoprostane concentrations, lipid peroxidation markers, were positively associated with BMI, body fat weight, visceral fat area, and total fat area \[[@R29], [@R30]\]; and plasma Thiobarbituric Acid Reactive Substances (TBARS) and urinary 8-epi-PGF~2~α were positively correlated with BMI and waist circumference \[[@R29]\]. The correlation between oxidative stress and leukocyte mtDNA copy number in healthy individuals was first evaluated in 2003, when positive correlations were observed between mtCN and various oxidative stress biomarkers in Chinese populations \[[@R31]\]. However, these findings could not be replicated in other ethnic groups \[[@R32]\]. In addition, *in vitro* experiments have shown that total mtDNA copy number in lymphocytes and whole blood did not increase in response to exogenous H~2~O~2~ treatments \[[@R33]\]. In epidemiologic studies, decreased mtCN levels are consistently found to be deleterious for many health outcomes, such as poorer self-rated health and cognitive ability, diminished physical strength, and higher prevalent frailty and all-cause mortality \[[@R5]--[@R7]\]. To date, the only association study between leukocyte mtCN and obesity was conducted among 94 young Korean subjects (mean age: 32.26±9.14 years), and found similar inverse associations between blood mtDNA copy number and BMI as well as waist circumference \[[@R34]\]. Our study revealed for the first time a bi-directional link between lower mtCN and weight gain. Although a causal relationship has not yet been established, there is an element common to both increased mtCN and efficient fatty acid metabolism: healthy, intact mitochondria. On one hand, mitochondria cannot remove or repair DNA damage caused to them by ROS. To compensate for the damage, healthy mitochondria increase their copy number in response to trans-acting factors encoded by nuclear DNA, possibly as a feedback mechanism to counterbalance the metabolic defects in mitochondria carrying mutated mtDNA and the resulting impaired respiratory system \[[@R8], [@R35]\]. On the other hand, mitochondria are the main sites for fatty acid β-oxidation (FAO) \[[@R2]\]. Loss of mitochondrial enzymes can cause obesity in mice \[[@R36]\]. Therefore, our finding that mtCN was bi-directionally and inversely associated with BMI might indicate a defect in mitochondrial function, by which mtCN can no longer be increased to cope with the stress caused by fatty acid metabolism. Telomere length, another key marker reflecting the cumulative burden of oxidative stress and inflammation resulting from cellular and biological aging, was found to be a prime instigator of p53-mediated mitochondrial dysfunction in mouse models \[[@R18]\]. This evidence supports our finding that mtCN was positively associated with telomere length. However, our study did not replicate findings from previous studies that telomere length was inversely associated with anthropometric measurements, such as BMI and waist circumference \[[@R20]--[@R22]\]. To verify whether the inverse associations of mtCN with BMI identified in our study were due to differences in telomere length, we adjusted for it in our statistical models. However, the results remained significant, suggesting that mtCN might serve as a more sensitive biomarker for BMI than telomere length does. Regarding the effect of age on mtDNA alteration, several previous population-based studies demonstrated that mtDNA copy number was stable or positively correlated with age before an individual reached middle age (i.e., around 50). However, there may be a plateau stage after middle age, followed by a negative correlation \[[@R7], [@R31]\]. A similar pattern was observed in our data, though it was not statistically significant. In the meanwhile, our data also demonstrated a robust inverse correlation of telomere length with age even after adjustment for mtCN, as has been shown in previous studies \[[@R20]--[@R22]\]. Taken together, the evidence suggests that mtCN may be a stronger biomarker than telomere length with respect to obesity, while telomere length is more sensitive to age. To the best of our knowledge, this is the first population-based study to examine the relationship between natural weight changes and leukocyte mtCN, and the inverse association between weight gain and mtCN level found in this study is in line with previous findings in previous telomere-length studies using similar age groups \[[@R37]\]. In conclusion, our results suggest that mtCN is inversely associated with weight, waist circumference, BMI, and weight-hip ratio, and that weight gain is bi-directionally associated with lower mtCN. In addition, although telomere length and mtCN are positively correlated, mtCN might serve as a more sensitive biomarker for BMI, while telomere length may be a stronger biomarker for age. The bi-directional temporal relationship between mitochondrial-mediated oxidative stress-defense mechanisms and weight change may suggest future strategies for weight management via reducing oxidative stress. For instance, in our study, lower mtCN is associated with weight gain and higher BMI, which may suggest a defective oxidative stress coping mechanism through mtCN. Reducing oxidative stress via lifestyle and dietary modification therefore could potentially protect mtDNA from cumulative damage, and thus maintain a functional fatty acid beta-oxidation. Future studies are warranted to confirm these findings and investigate the mechanisms. MATERIALS AND METHODS {#s4} ===================== Study population and recruitment {#s4_1} -------------------------------- Detailed descriptions of the NHS have been published elsewhere \[[@R23]\]. In brief, 121,700 registered nurses aged 30-50 years in 11 US states enrolled in the NHS in 1976. Participants completed a baseline questionnaire regarding risk factors for cancer and cardiovascular diseases and updated their information on lifestyle, medical history, and diet biennially. Between 1989 and 1990, blood samples were collected from 32,826 participants in the NHS. We included healthy controls from both lung- and skin-cancer case-control studies nested within the NHS in our study population (supplementary material). In the lung cancer study (n=321), one control per confirmed lung cancer case was selected, matching on age (±1 year), race, and smoking status and quantity at blood collection. In the skin cancer study (n=1,385), one control was matched to each confirmed skin cancer case by year of birth (±1 year) and self-reported race. The samples were limited to Caucasian women. Anthropometric measurements and other covariates {#s4_2} ------------------------------------------------ Exposures such as various anthropometric measurements as well as reproductive and lifestyle factors were included in the initial questionnaire and updated every two years in the NHS. Physical activity during the past year was assessed by questionnaire in 1988 and updated in 1992. The validity and reproducibility of these questions have been verified elsewhere \[[@R24]\]. Dietary intake in alternate cycles was assessed with a food frequency questionnaire (FFQ) and validated previously \[[@R25], [@R26]\]. Measurement of telomere length for the participants in this study has been published elsewhere \[[@R27]\]. BMI was calculated as weight in kilograms divided by the square of height in meters and was categorized as underweight (0 \< BMI \< 18.5), normal light (18.5\<=BMI\<23), normal heavy (23\<=BMI\<25), overweight (25\<=BMI\<27.5), pre-obese (27.5\<=BMI\<30), or obese (30\<=BMI). Weight change since age 18 was defined as the difference between weight at blood collection (1989-1990) and the weight at age 18, categorized into four groups: weight loss (weight loss \>2kg), weight maintenance (weight change −2kg to 2kg), weight gain 2-20kg, and weight gain \>20kg. Weight change since baseline was defined as the difference between weight at blood collection and the weight recorded at the beginning of the NHS (1976), categorized into four groups: weight loss (weight loss \>2kg), weight maintenance (weight change −2kg to 2kg), weight gain 2-10kg, and weight gain \>10kg. Weight change since 1984 was defined as the difference between weight at blood collection and weight in 1984 (five years prior to blood collection), categorized into four groups: weight loss (weight loss \>2kg), weight maintenance (weight change −2kg to 2kg), weight gain 2-5kg, and weight gain \>5kg. MtDNA copy number ascertainment and validation {#s4_3} ---------------------------------------------- For quantitative PCR (qPCR)-based assay of relative mtDNA copy number, total DNA was extracted from buffy-coat fractions using the QIAmp (Qiagen, Chatsworth, CA) 96-spin blood protocol. DNA concentrations were determined via pico-green quantitation using a Molecular Devices 96-well spectrophotometer. Relative mtDNA copy number was assessed using a qPCR-based method in a high-throughput 384-well format with an Applied Biosystems 7900HT Real Time PCR system. DNA concentration was standardized to 5ng/μL. Genomic DNA (10ng per reaction) was added to a 384-well reaction plate and dried down. DNA was reconstituted in 10μL of multiplex ND2 (single-copy mitochondrial gene) and AluYb8 (nuclear repeat element) PCR reaction mixture. The 20 x multiplex reaction mixture consisted of 18μM each of the ND2-forward primer (5′-tgttggttatacccttcccgtacta-3′), ND2-reverse primer (5′-cctgcaaagatggtagagtagatga-3′), AluYb8-forward primer (5′-cttgcagtgagccgagatt -3′), and AluYb8-reverse primer (5′- gagacggagtctcgctctgtc -3′), and 5μM each of the 'actgcagtccgcagtccggcct' probe with VIC on the 5′ end and 'MGBNFQ' on the 3′ end, 'ccctggcccaaccc' with 6FAM on the 5′ end and 'MGBNFQ' on the 3′ end, plus 20 x multiplex Taqman genotyping mastermix (Taqman). The multiplex reaction thermal cycling profile was as follows: 95°C for 10 minutes, then 30 cycles of 95°C for 15 seconds and 60°C for 1 minute. Triplicate reactions of multiplex reactions were performed on each sample on different plates. The average slope of the standard curves for both reactions was −3.5+/−0.3. The R^2^ coefficient of determination was 0.97 or higher for each reaction. The cycle threshold (Ct) value for each reaction represents the number of PCR cycles required to detect a signal over background fluorescence and is inversely proportional to the amount of DNA. The qPCR-based assay determined the mitochondrial ND2 gene copy number to genomic single-copy gene copy number (N/S) ratio, a value proportional to the average number of mtDNA copy number. The N/S ratio (−dCt) for each sample was calculated by subtracting the average AluYb8 Ct value from the average ND2 Ct value. The 10ng DNA standard curve point included on every 384-well plate was used as a calibrator to help adjust for inter-assay variability. The relative N/S ratio (−ddCt) was calculated by subtracting the N/S ratio of the calibrator DNA from the N/S ratio of each sample. Quality-control procedures {#s4_4} -------------------------- In addition to the samples, each 384-well plate contained a 6-point standard curve from 0.625ng to 20ng using pooled buffy coat-derived DNA. The purpose of the standard curve is to assess and compensate for inter-plate variation in PCR efficiency. We included 10% replicate quality control (QC) samples in the dataset to assess inter-plate and intra-plate variability of threshold cycle (Ct) values. The average inter-plate coefficients of variation for the ND2 and AluYb8 Ct values were 0.40% and 0.79% (respectively) among the quality-control samples. The average intra-plate coefficients of variation for the ND2 and AluYb8 Ct values were 0.50% and 0.90% (respectively) among the quality-control samples. The coefficent of variation for repeated samples was 7%, while within-person stability within one year showed a Spearman correlation of 0.4 and an ICC of 0.29. Statistical analysis {#s4_5} -------------------- In this study, mtCN was assayed in various batches corresponding to each dataset. To minimize the impact of potential batch effect on leukocyte mtCN measurements across different datasets, we calculated z scores of log transformed leukocyte mtCN for each sample by standardizing the leukocyte mtCN in comparison with the mean within controls in each dataset. Levene\'s test for homogeneity and Welch\'s ANOVA test showed statistically homogeneous distributions of the z score from different datasets (*P*=1.00). We examined age-adjusted correlations among different anthropometric measurements, smoking, physical activity, alcohol consumption, and mtCN z scores using Spearman partial rank correlation coefficients. To evaluate the potential dose-response relationships, adjusted least-squares mean mtCN z scores by categories of anthropometric measurements such as weight, height, waist and hip measurements, BMI (\<25, 25\<BMI\<30 and \>30), and waist-hip ratio were calculated using a generalized linear regression model controlling for age, menopausal status, postmenopausal hormone use, pack-years of smoking, physical activity (METs), and alcohol consumption (gm/day). We further examined the relationships between mtCN and weight changes. We also calculated adjusted least-squares mean mtCN z scores by categories of age at blood collection (\<50, 50-55, 55-60, 60-65, and 65-71), smoking status (never, past, and current), and alcohol consumption (None, \<5gm/day, 5-15gm/day, and 15+ gm/day). In addition, quartiles of telomere length z score and total calories were also calculated using generalized linear regression models, adjusting for menopausal status, postmenopausal hormone use, and lifestyle factors. We tested for linear trend across categories by including them as ordinal predictors in multivariate linear regression models. All analyses in this study were performed using SAS (Cary, NC), and statistical significance was set at *p*\<0.05 (two-sided). We thank Drs. Jason Wong and Tricia Li for their statistical and programming support, and the participants in the Nurses\' Health Study for their dedication and commitment. **CONFLICTS OF INTEREST** The authors declare no conflict of interest. **GRANT SUPPORT** This work was supported in part by NIH R01 CA49449, P01 CA87969, and UM1 CA186107 [^1]: Co-senior authors
776 F.Supp. 144 (1991) UNITED STATES of America, Plaintiff, v. INTERNATIONAL BROTHERHOOD OF TEAMSTERS, CHAUFFEURS, WAREHOUSEMEN AND HELPERS OF AMERICA, AFL-CIO, et al., Defendants. No. 88 CIV. 4486 (DNE). United States District Court, S.D. New York. October 29, 1991. *145 *146 Otto Obermaier, U.S. Atty. for the Southern District of New York (Edward T. Ferguson, III, Asst. U.S. Atty., of counsel), for U.S. Frederick B. Lacey, the Independent Adm'r of the Intern. Broth. of Teamsters, (Stuart Alderoty, of counsel). Elliot, Bray & Riley, Philadelphia, Pa. (Robert J. Bray, Jr. and Henry F. Siedzikowski, of counsel), for Star Market. OPINION AND ORDER EDELSTEIN, District Judge: This decision arises from the implementation of the rules for the International Brotherhood of Teamsters ("IBT") International Union Delegate and Officer Election (the "Election Rules"), promulgated by the Election Officer and approved as modified by this Court and the Court of Appeals. July 10, 1991 Opinion & Order, 742 F.Supp. 94 (S.D.N.Y.1990), aff'd, 931 F.2d 177 (2d Cir.1991). The Government brought an Order to Show Cause why this Court should not: (1) affirm the September 18, 1991 decision of the Independent Administrator in Election Appeal 91 — Elec.App.-187, which affirmed the September 9, 1991 decision of the Election Officer in Election Office Case No. P-760-LU25-ENG; (2) enter an order *147 directing Star Market, Inc. ("Star Market") to comply fully, within twenty-four hours, with the September 18, 1991 decision of the Independent Administrator in Election Appeal 91 — Elec.App.-187; (3) in the event that Star Market fails to comply with this Court's order, adjudge Star Market in civil contempt and impose coercive sanctions, including substantial daily fines of at least $10,000 per day until Star Market complies as directed; and (4) award the Government, the Election Officer and the Independent Administrator such other relief, including attorney's fees, as this Court deems appropriate. I. BACKGROUND The Election Officer was appointed by the Court pursuant to its March 14, 1989 Order (the "Consent Decree"), which was agreed to by the plaintiff United States of America (the "Government") and the defendant IBT in settlement of the bulk of this civil racketeering action. The Election Officer is empowered to supervise the implementation of the Consent Decree's electoral provisions, culminating in the first-ever direct rank and file election of IBT International officers. See Consent Decree, ¶ 12(D); October 18, 1989 Opinion & Order, 723 F.Supp. 203, 206-07 (S.D.N.Y.), appeal dismissed, No. 89-6252 (2d Cir. Dec. 13, 1989), cert. denied, ___ U.S. ___, 110 S.Ct. 2618, 110 L.Ed.2d 639 (1990). Pursuant to his supervisory authority, the Election Officer promulgated the Election Rules, which were approved as modified by this Court and the Court of Appeals. July 10, 1991 Opinion & Order, 742 F.Supp. 94 (S.D.N.Y.1990), aff'd, 931 F.2d 177 (2d Cir. 1991). The Election Rules are the linchpin of the Consent Decree's efforts to cleanse the IBT of La Cosa Nostra's corrupt influences. October 18, 1989 Opinion & Order, 723 F.Supp. at 206-07; October 25, 1991 Order, slip opinion at 1 (S.D.N.Y.1991). The Election Rules protect, inter alia, the rights of IBT members to participate in union election campaign activities, see Art. VIII, § 10(a), and enable the Election Officer to respond to violations of the Election Rules, or any other conduct preventing a fair, honest, and open election, with a wide range of remedial measures. See Art. XI, § 2. This matter involves the election protest of Neal J. Henderson, who is a member of IBT Local 25 in Boston, Massachusetts.[1] The principle officer of Local 25 is IBT General President William J. McCarthy. Before his discharge, Henderson had been employed by Star Market since 1977 as a warehouseman in the perishables department of one of its Boston-area facilities. Henderson has been a union steward at Star Market since 1986. Last spring Henderson was elected as a delegate to the IBT International Union Convention on a slate supporting the candidacy of Ron Carey for IBT General President. Henderson and his slate were opposed by an incumbent-officer slate headed by McCarthy, which supported the candidacy of R.V. Durham for IBT General President. After winning election as a Local 25 delegate to the International Union Convention, Henderson continued to engage openly, and with Star Market's knowledge, in pro-Carey campaign activities at his place of employment. Star Market's supervisors made disparaging remarks to Henderson about his candidacy for delegate and his other pro-Carey campaign activities. On May 2, 1991 Henderson and ten other employees accepted a pre-shift overtime assignment that was to begin at 7:00 p.m. and end at 9:25 p.m. Henderson's regular shift was to begin at 10:00 p.m. Star Market *148 employees who work pre-shift overtime are entitled to a rest period or break between the end of the overtime period and the start of the regular shift. Employees at Star Market may leave the premises during their rest periods without requesting their supervisors' permission. It was the practice of Star Market employees working pre-shift overtime to leave early for their break if they completed their work. At about 9:00 p.m., Henderson completed his pre-shift overtime assignment. After checking with his fellow employees whether his services were needed, he left the Star Market facility to buy some cold medicine, get something to eat, and conduct some union business. Upon returning for his regular shift at 10:00 p.m., Star Market supervisory personnel suspended Henderson. On May 13, 1991, Star Market management terminated Henderson because he "stole company time" by leaving the facility before his pre-shift overtime period ended. Henderson filed a grievance pursuant to the collective bargaining agreement between Local 25 and Star Market. On June 12, 1991, an arbitrator held a hearing on Henderson's grievance. In a decision dated July 17, 1991, that was based solely upon the terms of the collective bargaining agreement, the arbitrator found that Star Market was justified in discharging Henderson and therefore denied his grievance. Henderson also filed a protest under the Election Rules, asserting that his discharge was politically motivated. The Election Officer deferred action on Henderson's protest pending the arbitrator's decision. Because the arbitrator's decision did not address Henderson's claims of retaliation in violation of the Election Rules, the Election Officer decided to go forward with Henderson's protest. The Election Officer's investigation of the protest revealed that on May 2, 1991, Star Market employees other than Henderson who worked pre-shift overtime in the perishables department left their work stations before the overtime period ended. Only Henderson, however, was terminated for doing so. The investigation further revealed that the discipline imposed on Henderson was far more severe than that imposed on others who had committed similar infractions. In his September 9, 1991 decision, the Election Officer found that Star Market had retaliated against Henderson for engaging in Union Election campaign activity that is protected by the Election Rules. Accordingly, the Election Officer directed Star Market to reinstate Henderson to his former position with full seniority, full back pay, and full restoration of all other benefits, and to cease and desist from discriminating against Henderson or any other employee on account of campaign or other activities protected by the Election Rules. Exercising its rights under the Election Rules, Star Market appealed the Election Officer's September 9, 1991 decision to the Independent Administrator. See Election Rules, Art. XI, § 1(a)(5). On September 18, 1991, the Independent Administrator issued a decision affirming the Election Officer's decision in all respects. In that decision, the Independent Administrator found that "[g]iven the background here, there can be only one explanation for Star Market's actions. It was retaliating against Mr. Henderson because of his political activity and his support of Carey. The Election Rules simply do not tolerate such action." (Ind.Admin.Dec. at 10.) Star Market has neither complied with the Independent Administrator's directive to reinstate Henderson, nor has it appealed the Independent Administrator's decision to this Court. Pursuant to Article XI, § 1(a)(8), the Independent Administrator's decision "must be followed unless it is stayed or overturned by the Court." In a letter to the Government dated September 26, 1991, counsel for Star Market expressly stated that Star Market would not comply, whereupon the Election Officer requested that the Government initiate appropriate contempt proceedings against Star Market. By letter dated October 3, 1991, the Government informed Star Market's counsel that unless the company complied with *149 the Election Officer's directives by October 7, the Government would initiate civil contempt proceedings before this Court. By letter dated October 10, 1991, Star Market's counsel informed the Government that the company would not comply. On October 24, 1991, the Government brought an Order to Show Cause why this Court should not: (1) affirm the September 18, 1991 decision of the Independent Administrator in Election Appeal 91 — Elec. App.-187, which affirmed the September 9, 1991 decision of the Election Officer in Election Office Case No. P-760-LU25-ENG; (2) enter an order directing Star Market to comply fully, within twenty-four hours, with the September 18, 1991 decision of the Independent Administrator in Election Appeal 91 — Elec.App.-187, which affirmed the September 9, 1991 decision of the Election Officer in Election Office Case No. P-760-LU25-ENG; (3) in the event that Star Market fails to comply with this Court's order, adjudge Star Market in civil contempt and impose coercive sanctions, including substantial daily fines of at least $10,000 per day until Star Market complies as directed; and (4) award the Government, the Election Officer and the Independent Administrator such other relief, including attorney's fees, as this Court deems appropriate. This Court signed the Order to Show Cause and made it returnable for October 28, 1991, at which time this Court heard argument from both the Government and Star Market. II. DISCUSSION Star Market, although it did not appeal the Independent Administrator's decision to this Court, now objects to that decision. Specifically, Star Market asserts that: (1) this Court lacks subject matter jurisdiction because Star Market is not subject to the Consent Decree; (2) this Court lacks personal jurisdiction over Star Market; (3) the Election Officer and the Independent Administrator's handling of this matter deprived Star Market of due process; (4) the arbitrator's decision is a final and binding adjudication of this matter that pre-empts the decisions of the Election officer and the Independent Administrator; and (5) the Election Officer violated the Election Rules. This Court finds that Star Market waived its objections to the Independent Administrator's decision, and, in the alternative, that Star Market's objections are wholly without merit. A. Waiver Pursuant to the Election Rules, Article XI, § 1(a)(8), the Independent Administrator's decision "must be followed unless it is stayed or overturned by the Court." The Election Rules have the force of Court Orders and are "enforceable upon pain of contempt." July 10, 1990, Opinion & Order, 742 F.Supp. 94, 108 (S.D.N.Y.1990), aff'd, 931 F.2d 177 (2d Cir.1991). Star Market did not take the opportunity to appeal the Independent Administrator's decision to this Court. Rather, it brazenly disregarded that decision. Only now that the Government has moved for an order directing compliance under pain of contempt does Star Market argue the merits of the Independent Administrator's decision to this Court. By failing to appeal that decision to this Court, Star Market waived its rights to contest the merits of the decision. To hold otherwise would encourage parties to disregard the Independent Administrator's decisions until the Government seeks compliance in this Court upon pain of contempt. This Court will not reward parties who flout the Independent Administrator's decisions by allowing them to delay compliance until the Government incurs the expense, time, and effort involved in seeking an order in this Court directing compliance. Furthermore, such a rule promotes enforcement and speedy resolution of Election Rule violations, which helps to ensure an "honest, fair, and free election completely secure from harassment, intimidation, coercion, hooliganism, threats, or any variant of these no matter under what guise." July 10, 1990 Opinion & Order, 742 F.Supp. 94, 94 (S.D.N.Y.1990), aff'd, 931 F.2d 177 (2d Cir.1991). *150 B. Star Market's Objections Even if Star Market had not waived its right to contest the merits of the Independent Administrator's decision, Star Market's objections are wholly without merit. 1. Subject Matter Jurisdiction Star Market argues that this Court lacks subject matter jurisdiction because the Consent Decree is not binding on non-parties. This Court has rejected identical arguments on several occasions. See October 25, 1991 Order, slip op. at 6 (S.D.N.Y.1991); April 3, 1991 Opinion & Order (S.D.N.Y.1991) ("Yellow Freight"), appeal pending, No. 91-6096 (2d Cir.); May 13, 1991 Memorandum & Order, 764 F.Supp. 817 (S.D.N.Y.1991), appeal pending, 91-6140 (2d Cir.). In Yellow Freight, this Court determined that pursuant to its authority under the All Writs Act, 28 U.S.C. § 1651, the Election Rules extend to entities that could jeopardize the IBT membership's right to a free, fair and honest election. Specifically, this Court ruled that Yellow Freight, a company employing IBT members but not itself affiliated with the IBT, was subject to the election rules because it was in a position to "frustrate the implementation of the Consent Decree and the election rules." Id.; October 25, 1991 Order, slip op. at 6 (S.D.N.Y.1991); May 13, 1991, Memorandum & Order, 764 F.Supp. 817, 821 (S.D.N.Y.1991). As in Yellow Freight, the Government does not seek to bind Star Market to the Consent Decree, but simply seeks to prevent it from interfering with the election process. Like the employer in Yellow Freight, Star Market is in a position to "frustrate the implementation of the Consent Decree and the Election Rules." This case presents an even greater threat to the IBT membership's right to a free, fair, and honest election than did the employer's conduct in Yellow Freight. Star Market injected itself into the election process by terminating a union member for exercising his campaign rights under the Election Rules.[2] Such conduct threatens to chill the future exercise of such rights and ultimately threatens the integrity of the election process. Accordingly, the All Writs Act gives this Court subject matter jurisdiction for the limited purpose of preventing such interference with the Election Rules. 2. Personal Jurisdiction Star Market argues that this Court lacks personal jurisdiction because it does not have minimum contacts with the State of New York or this District. In making such an argument, Star Market ignores the holdings of the Second Circuit and this Court to the contrary. Personal jurisdiction is not required to bind non-parties under the All Writs Act. January 17, 1990 Opinion & Order, 728 F.Supp. 1032, 1048 (S.D.N.Y.), aff'd, 907 F.2d 277 (2d Cir.1990). "The All Writs Act gives the Court the power to bind those who are `not parties to the original suit.'" Id. (quoting In re Baldwin-United Corp., 770 F.2d 328, 338 (2d Cir.1985)). Moreover, the Racketeer Influenced Corrupt Organizations Act ("RICO"), 18 U.S.C. § 1965(d), "provides for nationwide personal jurisdiction, and this ultimately is a RICO matter." Id. In cases where Congress authorizes nationwide federal jurisdiction, the district court's jurisdiction is co-extensive with the boundaries of the United States. Mariash v. Morrill, 496 F.2d 1138, 1143 (2d Cir.1974). All that is required is sufficient minimum contacts with the United States, not this State or District. See United States v. IBT, 907 F.2d at 281. Thus, a defendant who resides within the territorial boundaries of the United States is subject to personal jurisdiction under nationwide service of process without regard to state jurisdictional statutes. See Mariash, 496 F.2d at 1143. Further, it is not necessary that the defendant have the requisite minimum contacts with the state that would exercise jurisdiction. See, e.g., F.T.C. v. *151 Jim Walter Corp., 651 F.2d 251, 256 (5th Cir.1981) ("a resident corporation necessarily has sufficient contacts with the United States to satisfy the requirements of due process"). Accordingly, as a corporation that resides in the United States, Star Market is subject to personal jurisdiction in this action. Star Market's objection to personal jurisdiction is therefore without merit. 3. Due Process Star Market stressed in its papers and at oral argument that the Court Officers are private parties, and not state actors. (Star Market's Mem. at 10). Star Market also stressed in its papers and at oral argument that the hearings conducted by the Election Officer and the Independent Administrator constituted "State Action." (Id. at 12-13). The inconsistency between these two arguments seems to elude Star Market's counsel. Because the United States Constitution regulates the Government, not private parties, a litigant claiming that his constitutional rights have been violated must first establish the challenged conduct constitutes "state action." United States v. IBT, 941 F.2d 1292, 1295 (2d Cir.1991). In this case, the Election Officer and the Independent Administrator acted pursuant to the IBT Constitution — a private agreement — and not pursuant to a right or privilege created by the State. Id. at 1296. In addition, neither the Election Officer nor the Independent Administrator may fairly be said to be state actors in this case. Id. at 1296. Accordingly, because Star Market can not establish the requisite "state action," its constitutional claims must fail. Even if the Election Officer and Independent Administrator's conduct did establish "state action," Star Market's due process claim is frivolous. Due process is "flexible and calls for such procedural protections as the particular situation demands." Morrisey v. Brewer, 408 U.S. 471, 481, 92 S.Ct. 2593, 2600, 33 L.Ed.2d 484 (1972). In this case, Star Market received all the process that it was due. Star Market had the opportunity to present its case to the Election Officer, to appeal the Elections Officer's decision to the Independent Administrator, and to appeal that decision to this Court. The Election Officer, the Independent Administrator, and now this Court, have set forth their factual findings and legal reasoning in written opinions. Furthermore, Star Market had over three months to prepare and submit to the Election Officer evidence and arguments in support of its position. As stated previously, Star Market did not avail itself of the opportunity to appeal to this Court. It is inconsistent for Star Market to argue that it did not receive due process, when it failed to take full advantage of the process it was afforded. This inconsistency also seems to elude Star Market's counsel. Accordingly, Star Market's due process claim is frivolous. 4. Arbitrator's Decision Star Market argues that because an arbitrator ruled that Star Market did not violate its collective bargaining agreement with IBT Local 25 when it discharged Henderson, the Election Officer may not consider whether the company's action violated the Election Rules. This Court has previously rejected a similar pre-emption argument. In Yellow Freight, this Court rejected the assertion that alleged violations of the Election Rules which might also constitute unfair labor practices under the National Labor Relations Act may be adjudicated only by the National Labor Relations Board. April 3, 1991 Opinion & Order, slip opinion at 7-8 (S.D.N.Y.1991). As the Election Officer and the Independent Administrator pointed out, whether Star Market violated the collective bargaining agreement's overtime provisions and whether the company violated the election campaign activity provisions of the Election Rules are two entirely separate inquiries. The Election Officer, the Independent Administrator, and this Court need not defer to an arbitration award that interprets a collective bargaining agreement when adjudicating adjudicate a claim based on an independent source of rights. See, e.g., Barrantine v. Arkansas Best Freight Systems, 450 U.S. 728, 101 S.Ct. 1437, 67 *152 L.Ed.2d 641 (1981) (an employee who submitted to arbitration under a collective bargaining agreement could still bring an action under the Fair Labor Standards Act in federal district court based on the same facts); Alexander v. Gardener-Denver Co., 415 U.S. 36, 94 S.Ct. 1011, 39 L.Ed.2d 147 (1974) (employee who submitted to arbitration under a collective bargaining agreement could still bring a Title VII action in federal district court based on the same facts). Henderson's rights under the Election Rules are entirely independent of his rights under Star Market's collective bargaining agreement with Local 25. In Barrantine v. Arkansas Best Freight Systems, 450 U.S. at 737, 101 S.Ct. at 1443, the Supreme Court stated: Not all disputes between an employee and his employer are suited for binding resolution in accordance with procedures established by collective bargaining. While courts should defer to an arbitral decision where the employee's claim is based on rights arising out of the collective bargaining agreement, different considerations apply where the employee's claim is based on rights arising out of a statute designed to provide substantive guarantees to individual workers. Henderson's situation is analogous to Barrantine. Henderson's protest arises out of a violation of the Election Rules, which constitute a different source of rights than those arising out of the collective bargaining agreement between Star Market and Local 25. Just as Henderson was entitled to file a grievance under the collective bargaining agreement, he was also entitled, as an IBT member, to assert his rights under the court-approved Election Rules, which derived from the court-approved Consent Decree settling the Government's case against the IBT under RICO. Accordingly, Star Market's argument is wholly without merit. 5. The Election Rules Star Market argues that the Election Officer violated Article XI, § 1(a)(4), which provides that "within five days of receipt of the [election] protest, the Election Officer ... shall determine the merits of the protest and ... the appropriate remedy, [or] defer making a determination until after the election." Star Market argues that by waiting to decide the case pending the outcome of the arbitration, the Election Officer can not address this protest until after the election. As with all of Star Market's arguments, this argument misses the point. First, the Election Officer's decision not to proceed on this election protest pending the outcome of arbitration was an appropriate "remedy" under the first prong of Article XI, § 1(a)(4). Second, the Election Officer may initiate an investigation without a protest. Article XI, § 2 provides that: If as a result of any protest filed or any investigation undertaken by the Election Officer with or without a protest, the Election Officer determines that these Rules have been violated, or that any other conduct has occurred which may prevent or has prevented a fair, honest and open election, the Election Officer may take whatever remedial action is appropriate. (emphasis added). The Election Officer's investigation after the arbitrator's decision can therefore be considered an investigation undertaken by the Election Officer without an election protest. Such an investigation is appropriate in this case and consistent with the purpose of ensuring a fair, honest and open election. Accordingly, Star Market's argument is without merit. C. The Independent Administrators' Decision The Government asks this Court to affirm the September 18, 1991 decision of the Independent Administrator. It is well settled that the findings of the Independent Administrator "are entitled to great deference." United States v. International Brotherhood of Teamsters, 905 F.2d 610, 616 (2d Cir.1990), aff'g March 13, 1990 Opinion & Order, 743 F.Supp. 155 (S.D.N.Y.1990). This Court will overturn the findings of the Independent Administrator when it determines that they are, on the basis of all the evidence, "arbitrary or *153 capricious." Id. at 622; October 25, 1991, Order, slip opinion, at 4-5 (S.D.N.Y.1991); October 24, 1991 Memorandum & Order, slip opinion, at 4-5 (S.D.N.Y.1991); October 16, 1991 Memorandum & Order, slip opinion, at 4-5 (S.D.N.Y.1991); October 11, 1991 Memorandum & Order, slip opinion, at 3 (S.D.N.Y.1991); October 9, 1991 Memorandum & Order, slip opinion, at 5 (S.D.N.Y.1991); August 14, 1991 Memorandum & Order, slip opinion, at 4 (S.D.N.Y.1991); July 31, 1991 Memorandum & Order, slip opinion at 3-4 (S.D.N.Y.1991); July 18, 1991 Memorandum & Order, slip opinion at 3-4 (S.D.N.Y.1991); July 16, 1991 Opinion & Order, slip opinion, at 3-4 (S.D.N.Y.1991); June 6, 1991 Opinion & Order, slip opinion, at 4-5 (S.D.N.Y.1991); May 13, 1991 Memorandum & Order, 764 F.Supp. 817, 820-21 (S.D.N.Y.1991); May 9, 1991 Memorandum & Order, 764 F.Supp. 797, 800 (S.D.N.Y.1991); May 6, 1991 Opinion & Order, 764 F.Supp. 787, 789 (S.D.N.Y.1991); December 27, 1990 Opinion & Order, 754 F.Supp. 333, 337 (S.D.N.Y.1990); September 18, 1990 Opinion & Order, 745 F.Supp. 189, 191-92 (S.D.N.Y.1990); August 27, 1990 Opinion & Order, 745 F.Supp. 908, 911 (S.D.N.Y.1990); March 13, 1990 Opinion & Order, supra, 743 F.Supp. at 159-60, aff'd, 905 F.2d at 622; January 17, 1990 Opinion & Order, 728 F.Supp. 1032, 1045-57, aff'd, 907 F.2d 277 (2d Cir.1990); November 2, 1989 Memorandum & Order, 725 F.Supp. 162, 169 (S.D.N.Y.1989). Star Market argues that the decision of the Independent Administrator was arbitrary and capricious. Notwithstanding Star Market's contention, the decision of the Independent Administrator was fully supported by the record and was neither arbitrary nor capricious. Applying the mixed motive analysis standard established in NLRB v. Wright Line, 251 NLRB 10182, 105 LRRM 1169 (1980), aff'd, 662 F.2d 899 (1st Cir.1981), cert. denied, 455 U.S. 989, 102 S.Ct. 1612, 71 L.Ed.2d 848 (1982), the Independent Administrator found that Henderson made a prima facie showing that his support of Carey was a motivating factor in his discharge. (Ind.Admin.Dec. at 8). Further, the Independent Administrator found that Star Market did not rebut its burden of demonstrating that it would have discharged Henderson regardless of his campaign activity. (Id. at 8-9). Two major considerations support the finding that Star Market discharged Henderson because of his campaign activities; the Independent Administrator found that there was no evidence of an employee ever having been terminated for "stealing time," and that other employees who left their work stations before the overtime period ended were not disciplined. Based on these considerations and a review of all the evidence, the Independent Administrator determined that the only explanation for Star Market's actions was that "[i]t was retaliating against Mr. Henderson because of his political activity and his support of Carey." (Ind.Admin.Dec. at 10). The decision of the Independent Administrator is fully supported by the record and is neither arbitrary nor capricious. Star Market's arguments to the contrary are wholly without merit. Accordingly, the decision of the Independent Administrator is affirmed. Star Market is therefore ordered to comply fully with the September 18, 1991 decision of the Independent Administrator in Election Appeal 91 — Elec. App.-187, which decision affirmed the September 9, 1991 decision of the Election Officer in Election Office Case No. P-760-LU25-ENG. Full compliance must take place within twenty-four hours of the filing of this opinion and order. D. Civil Contempt A court may exercise its inherent power to hold a party in civil contempt when: (1) the order the party allegedly failed to comply with is clear and unambiguous; (2) the proof of noncompliance is clear and convincing; and (3) the party has not diligently attempted in a reasonable manner to comply. New York State Nat'l Organ. for Women v. Terry, 886 F.2d 1339, 1351 (2d Cir.1989). A civil contempt sanction may serve either to coerce the contemnor into future compliance or to compensate the complainant for losses resulting from the contemnor's past noncompliance. *154 Id. at 1352. A person charged with civil contempt is entitled to notice of the allegations, the right to counsel, and a hearing at which the plaintiff bears the burden of proof and the defendant has an opportunity to present a defense. United States v. City of Yonkers, 856 F.2d 444, 452 (2d Cir.1988), rev'd on other grounds, 493 U.S. 265, 110 S.Ct. 625, 107 L.Ed.2d 644 (1990). As this Court has previously stated, the Election Rules are the linchpin of the Consent Decree's attempt to cleanse the IBT of the hideous influence of Organized Crime. July 10, 1990 Opinion & Order, 742 F.Supp. at 97. Star Market has violated the Election Rules by firing Henderson, a political opponent of Teamster's officials whom the company apparently favors, for engaging in clearly protected union election activity. In addition, Star Market's scorn for the dispute resolution process established by the Election Rules, and approved by this Court and the Second Circuit, has been as egregious as the company's discriminatory treatment of Henderson. In the event that Star Market fails to comply with this Court's order, Star Market shall be adjudged in civil contempt, and will incur a coercive sanction of $10,000 per day until Star Market complies as directed by this Court. In addition, an award of attorney's fees and other expenses to the Government and the court-appointed officers will serve to compensate them for Star Market's baseless refusal either to comply with the Election Officer's order as affirmed by the Independent Administrator or to appeal that decision to this Court. To this end, the Government, the Election Officer and the Independent Administrator are directed to submit affidavits, within ten days of the filing of this opinion and order, of attorneys' fees and other expenses incurred in connection with Star Market's refusal to comply with the Election Officer's decision as affirmed by the Independent Administrator. Further, Star Market shall submit to this Court an affidavit by a person in a senior management position stating that it has complied with this Court's order and shall also submit to this Court a copy of the letter it sends to Henderson which states that he is reinstated with full seniority, full back pay and benefits. E. The Stay In the event that this Court granted the Government's application, Star Market petitioned this Court for a stay of its order. In this circuit, the standards for issuing a stay encompass the following considerations: (a) Whether the stay applicant has made a strong showing that he is likely to succeed on the merits; (b) Whether the applicant will be irreparably injured absent a stay; (c) Whether the issuance of a stay will substantially injure other parties interested in the proceedings; and (d) Where the public interest lies. Hilton v. Braunskill, 481 U.S. 770, 776, 107 S.Ct. 2113, 2119, 95 L.Ed.2d 724 (1987). Applying these criteria to the instant application, I find that the request for a stay is denied. First, as fully set forth above, the movants have not made a strong showing that they are likely to succeed on the merits. Second, I find that the movants will face no irreparable harm from the remedies ordered to correct the retaliatory action taken by Star Market in violation of the Election Rules. The third criteria is whether staying the ruling will cause injury to any other interested party. Granting a stay will prejudice Henderson, the candidates for IBT office, and the IBT rank and file in general. Finally, the public interest lies in furthering the noble goal of promoting a fair, honest and open IBT election. Over the years, the IBT has been tarnished with a patina of corruption, thus actions to clear this ignominious and sordid history seem indubitably in the interest of IBT officials, the IBT rank and file, and the public as well. The petition for a stay is hereby denied. CONCLUSION In sum, the orders of this Court are as follows: IT IS HEREBY ORDERED that the September 18, 1991 decision of the Independent *155 Administrator in Election Appeal 91 — Elec.App.-187, which decision affirmed the September 9, 1991 decision of the Election Officer in Election Office Case No. P-760-LU25-ENG, is affirmed; and IT IS FURTHER ORDERED that Star Market must comply fully, within twenty-four hours of the filing of this opinion and order, with this Court's order which affirms the September 18, 1991 decision of the Independent Administrator in Election Appeal 91 — Elec.App.-187, which decision affirmed the September 9, 1991 decision of the Election Officer in Election Office Case No. P-760-LU25-ENG; and IT IS FURTHER ORDERED that in the event that Star Market fails to comply with this Court's order, Star Market shall be adjudged in civil contempt, and will incur a coercive sanction of $10,000 per day until Star Market complies as directed by this Court; and IT IS FURTHER ORDERED that Star Market shall compensate the Government, the Election Officer and the Independent Administrator for their attorney's fees and other expenses incurred in connection with Star Market's baseless refusal to comply with the Election Officer's decision as affirmed by the Independent Administrator; and IT IS FURTHER ORDERED that the Government, the Election Officer and the Independent Administrator submit affidavits, within ten days of the filing of this opinion and order, of attorneys fees and other expenses incurred in connection with Star Market's baseless refusal to comply with the Election Officer's decision as affirmed by the Independent Administrator; and IT IS FURTHER ORDERED that Star Market shall submit to this Court an affidavit by a person in a Senior Management position stating that it has complied with this Court's order, and Star Market shall also submit to this Court a copy of the letter it sends to Henderson in which it indicates that he is reinstated with full seniority, full back pay and benefits; and IT IS FURTHER ORDERED that Star Market's petition for a stay is denied. SO ORDERED. NOTES [1] The following account is based on the findings of the Independent Administrator. As set forth more fully below, the findings of the Independent Administrator "are entitled to great deference." United States v. International Brotherhood of Teamsters, 905 F.2d 610, 616 (2d Cir. 1990), aff'g, March 13, 1990 Opinion & Order, 743 F.Supp. 155 (S.D.N.Y.1990). This Court will overturn findings of the Independent Administrator when it determines that they are, on the basis of all the evidence, arbitrary and capricious. Id. at 622; see, e.g., October 24, 1991 Opinion & Order, slip opinion, at 4-5 (S.D.N.Y.1991); May 13, 1991 Memorandum & Order, 764 F.Supp. 817, 820-21 (S.D.N.Y.1991); August 27, 1990 Opinion & Order, 745 F.Supp. 908, 911 (S.D.N.Y.1990). [2] The Election Rules state that "[a]ll Union members retain the right to participate in campaign activities, including the right to run for office, to openly support or oppose any candidate, to aid or campaign for any candidate, and to make personal campaign contributions." Article VIII, § 10(a).
Parallel Bible results for John 13:16 Scripture Formatting Font Size Extra Small Small Medium Large Font Helvetica Open Sans Merriweather American Standard Version New International Version John 13:16 ASV 16 Verily, verily, I say unto you, a servant is not greater than his lord; neither one that is sent greater than he that sent him. NIV 16 I tell you the truth, no servant is greater than his master, nor is a messenger greater than the one who sent him.
LEGO Jurassic World Video Game Spinosaurus First Look As we slowly get closer to the release of the LEGO Jurassic World video game, we’ve been teased with various clips and images of the upcoming game. Today, another small reveal has been released with our first look at the LEGO version of the Spinosaurus from Jurassic Park III. As you can see from the image above, Alan Grant, in an alternate outfit from JP3, and Billy is being chased by one of the main dinosaurs in the film. If you didn’t hear from last week, various retailers will have different exclusives with Gamestop having the Gallimimus Trap (30320) polybag while Target has the Dr. Wu minifigure polybag. I have a feeling other retailers like Walmart, Best Buy, and Amazon will have pre-order bonuses as well. The release date is tentatively scheduled for June 12.
Q: Extract the IP from a log file I am writing code that extracts all the IP addresses from a log file. (The log file contains a list of domain names, IP addresses and MAC addresses.) Here's my code: open(CONF, '<', 'dhcpd.conf') or die "\n"; my @ip; while(my $line = <CONF> ) { if ( $line =~ /(\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3})/ ) { @ip = $1; } print "@ip,\n"; } close CONF; The problem is that each IP address is printing 5 times. The output looks like: 10.0.0.158 10.0.0.158 10.0.0.158 10.0.0.158 10.0.0.158 10.0.0.159 10.0.0.159 10.0.0.159 10.0.0.159 10.0.0.159 ... Is the problem at @ip = $1, or is it somewhere else? A: You've got several problems, but the main one seems to be that you're printing the contents of @ip regardless of whether the line matches. If you just want to use your script as a filter and print IP addresses as you find them, this is a better way to express that: perl -ne 'print "$1\n" if /(\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3})/' dhcpd.conf Or the equivalent code that's not a one-liner: use strict; use warnings; while (<>) { next unless /(\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3})/; print "$1\n"; } Which you would run like this: $ perl script.pl dhcpd.conf If you want to save every IP address you find and do something with them later, you'd push onto an array: my @ips; while (<>) { next unless /(\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3})/; push(@ips, $1); } # doing something else... for (@ips) { print "$_\n"; } If you only want unique IP addresses throughout the file, you'd use a hash: my %ips; while (<>) { next unless /(\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3})/; $ips{$1} = 1; } for (keys(%ips)) { print "$_\n"; }
# For help using pythonnet: # https://pythonnet.github.io/ # To stop the debugger in .NET code, follow the instructions at: # https://mail.python.org/archives/list/pythonnet@python.org/message/AZ4BKHN72PIRAG32ERFY3XS52NVNCL47/ import clr from System import Boolean, Double, Int32, Array folder = "../Tests/bin/DebugFull/net461/" clr.AddReference(folder+"Microsoft.ML.Probabilistic") clr.AddReference(folder+"Microsoft.ML.Probabilistic.Compiler") from Microsoft.ML.Probabilistic import * from Microsoft.ML.Probabilistic.Distributions import VectorGaussian, Beta, Bernoulli, Discrete from Microsoft.ML.Probabilistic.Math import Rand, Vector, DenseVector, PositiveDefiniteMatrix from Microsoft.ML.Probabilistic.Models import Variable, InferenceEngine, Range, VariableArray from Microsoft.ML.Probabilistic.Compiler.Reflection import Invoker def TwoCoins(): firstCoin = Variable.Bernoulli(0.5) secondCoin = Variable.Bernoulli(0.5) bothHeads = firstCoin.op_BitwiseAnd(firstCoin, secondCoin) engine = InferenceEngine() print("Probability both coins are heads: %s" % engine.Infer(bothHeads)) bothHeads.ObservedValue = False print("Probability distribution over firstCoin: %s" % engine.Infer(firstCoin)) def TruncatedGaussianEfficient(): threshold = Variable.New[Double]() x = Variable.GaussianFromMeanAndVariance(0.0, 1.0) Variable.ConstrainTrue(x.op_GreaterThan(x,threshold)) engine = InferenceEngine() for thresh in [i*0.1 for i in range(11)]: threshold.ObservedValue = thresh print("Dist over x given thresh of %s = %s" % (thresh, engine.Infer(x))) def LearningAGaussian(): # Restart the infer.NET random number generator Rand.Restart(12347) data = [Rand.Normal(0.0, 1.0) for i in range(100)] mean = Variable.GaussianFromMeanAndVariance(0.0, 1.0).Named("mean") precision = Variable.GammaFromShapeAndScale(1.0, 1.0).Named("precision") for i in range(len(data)): x = Variable.GaussianFromMeanAndPrecision(mean, precision) x.ObservedValue = data[i] engine = InferenceEngine() print("mean=%s" % engine.Infer(mean)) print("precision=%s" % engine.Infer(precision)) def LearningAGaussianWithRanges(): # Restart the infer.NET random number generator Rand.Restart(12347) data = [Rand.Normal(0.0, 1.0) for i in range(100)] mean = Variable.GaussianFromMeanAndVariance(0.0, 1.0).Named("mean") precision = Variable.GammaFromShapeAndScale(1.0, 1.0).Named("precision") data_range = Range(len(data)).Named("n") x = Variable.Array[Double](data_range) v = Variable.GaussianFromMeanAndPrecision(mean, precision).ForEach(data_range) x.set_Item(data_range, v) x.ObservedValue = data engine = InferenceEngine() print("mean=%s" % engine.Infer(mean)) print("precision=%s" %engine.Infer(precision)) def BayesPointMachine(incomes, ages, w, y): j = y.Range xData = [Vector.FromArray(income, age, 1) for income, age in zip(incomes, ages)] x = VariableObserved(xData, j) # The following does not work in pythonnet: #x = Variable.Observed[Vector](Array[Vector](xData)) noise = 0.1 ip = Variable.InnerProduct(w, x.get_Item(j)) v = Variable.GaussianFromMeanAndVariance(ip, noise) v = v.op_GreaterThan(v, 0.0) y.set_Item(j, v) def BayesPointMachineExample(): incomes = [63, 16, 28, 55, 22, 20] ages = [38, 23, 40, 27, 18, 40] will_buy = [True, False, True, True, False, False] # The following does not work in pythonnet: #y = Variable.Observed[bool](will_buy) #y = Variable.Observed[bool].Overloads[Array[bool]](will_buy) y = VariableObserved(will_buy) eye = PositiveDefiniteMatrix.Identity(3) m = Vector.Zero(3) vg = VectorGaussian(m, eye) w = Variable.Random[Vector](vg) BayesPointMachine(incomes, ages, w, y) engine = InferenceEngine() wPosterior = engine.Infer(w) print("Dist over w=\n%s" % wPosterior) incomesTest = [ 58, 18, 22 ] agesTest = [ 36, 24, 37 ] ytest = Variable.Array[bool](Range(len(agesTest))) BayesPointMachine(incomesTest, agesTest, Variable.Random[Vector](wPosterior), ytest) print("output=\n%s" % engine.Infer(ytest)); def ClinicalTrial(): # Data from clinical trial control_group_data = [False, False, True, False, False] control_group = VariableObserved(control_group_data) treated_group_data = [True, False, True, True, True] treated_group = VariableObserved(treated_group_data) i = control_group.Range j = treated_group.Range # Prior on being effective treatment is_effective = Variable.Bernoulli(0.5) # if block if_var = Variable.If(is_effective) # Model if treatment is effective probIfControl = Variable.Beta(1.0, 1.0) t = Variable.Bernoulli(probIfControl).ForEach(i) control_group.set_Item(i, t) probIfTreated = Variable.Beta(1.0, 1.0) t = Variable.Bernoulli(probIfTreated).ForEach(j) treated_group.set_Item(j, t) if_var.Dispose() # A bit of background if_var = Variable.IfNot(is_effective) # Model if treatment is not effective prob_all = Variable.Beta(1.0, 1.0) control_group.set_Item(i, Variable.Bernoulli(prob_all).ForEach(i)) treated_group.set_Item(j, Variable.Bernoulli(prob_all).ForEach(j)) if_var.Dispose() # Clinical accuracy engine = InferenceEngine() print("Probability treatment has an effect = %s" % engine.Infer(is_effective)) print("Probability of good outcome if given treatment = %s" % engine.Infer[Beta](probIfTreated).GetMean()) print("Probability of good outcome if control = %s" % engine.Infer[Beta](probIfControl).GetMean()) def MixtureOfGaussians(): # Define a range for the number of mixture components k = Range(2) # Mixture component means means = Variable.Array[Vector](k) means_k = Variable.VectorGaussianFromMeanAndPrecision(Vector.FromArray(0.0, 0.0), PositiveDefiniteMatrix.IdentityScaledBy(2, 0.01)).ForEach(k) means.set_Item(k, means_k) # Mixture component precisions precs = Variable.Array[PositiveDefiniteMatrix](k).Named("precs") precs_k = Variable.WishartFromShapeAndScale(100.0, PositiveDefiniteMatrix.IdentityScaledBy(2, 0.01)).ForEach(k) precs.set_Item(k, precs_k) # Mixture weights weights = Variable.Dirichlet(k, [ 1.0, 1.0 ]).Named("weights") # Create a variable array which will hold the data n = Range(300).Named("n") data = Variable.Array[Vector](n).Named("x") # Create latent indicator variable for each data point z = Variable.Array[Int32](n).Named("z") # The mixture of Gaussians model forEachBlock = Variable.ForEach(n) z.set_Item(n, Variable.Discrete(weights)) switchBlock = Variable.Switch(z.get_Item(n)) data.set_Item(n, Variable.VectorGaussianFromMeanAndPrecision(means.get_Item(z.get_Item(n)), precs.get_Item(z.get_Item(n)))) switchBlock.CloseBlock() forEachBlock.CloseBlock() # Attach some generated data data.ObservedValue = GenerateData(n.SizeAsInt) # Initialise messages randomly to break symmetry zInit = Variable.Array[Discrete](n).Named("zInit") zInit.ObservedValue = [Discrete.PointMass(Rand.Int(k.SizeAsInt), k.SizeAsInt) for i in range(n.SizeAsInt)] # The following does not work in pythonnet: #z.get_Item(n).InitialiseTo[Discrete].Overloads[Variable[Discrete]](zInit.get_Item(n)) InitialiseTo(z.get_Item(n), zInit.get_Item(n)) # The inference engine = InferenceEngine(); print("Dist over pi=%s" % engine.Infer(weights)) print("Dist over means=\n%s" % engine.Infer(means)) print("Dist over precs=\n%s" % engine.Infer(precs)) def GenerateData(nData): trueM1 = Vector.FromArray(2.0, 3.0) trueM2 = Vector.FromArray(7.0, 5.0) trueP1 = PositiveDefiniteMatrix(ToClr([ [ 3.0, 0.2 ], [ 0.2, 2.0 ] ])) trueP2 = PositiveDefiniteMatrix(ToClr([ [ 2.0, 0.4 ], [ 0.4, 4.0 ] ])) trueVG1 = VectorGaussian.FromMeanAndPrecision(trueM1, trueP1) trueVG2 = VectorGaussian.FromMeanAndPrecision(trueM2, trueP2) truePi = 0.6 trueB = Bernoulli(truePi) # Restart the infer.NET random number generator Rand.Restart(12347) return [trueVG1.Sample() if trueB.Sample() else trueVG2.Sample() for j in range(nData)] def VariableObserved(list, range=None): t = type(list[0]) array = Array[t](list) if range == None: args = [array] else: args = [array, range] return Invoker.InvokeStatic(Variable, "Observed", args) def InitialiseTo(variable, distribution): Invoker.InvokeInstance("InitialiseTo", variable, distribution) def ToClr(matrix): # See https://github.com/pythonnet/pythonnet/blob/ec424bb0a8f0217c496898395880cf9b99d073e6/src/tests/test_array.py#L1112 nr = len(matrix) nc = len(matrix[0]) if nr > 0 else 0 t = type(matrix[0][0]) items = Array.CreateInstance(t, nr, nc) for i in range(nr): for j in range(nc): items.SetValue(t(matrix[i][j]), (i, j)) return items def __list_methods(obj): for m in dir(obj): try: print(m) except: pass def __list_method_overloads(method): for m in f'{method.__overloads__}'.split('\n'): print(' '.join(m.split(' ')[1:])) # Using pytest in Visual Studio: # https://devblogs.microsoft.com/python/whats-new-for-python-in-visual-studio-16-3-preview-2/ # pytest searches for tests in files named test_*.py or *_test.py # pytest collects functions with names prefixed by "test", either outside a class or in a class with name prefixed by "Test" def test_tutorials(): TwoCoins() TruncatedGaussianEfficient() LearningAGaussian() LearningAGaussianWithRanges() BayesPointMachineExample() ClinicalTrial() MixtureOfGaussians() if __name__ == '__main__': test_tutorials()
k = 6 for n. 4 Let q(h) = 2*h**2 + h - 8. Let j be q(-4). Solve -4*b - j = -p + 3*p, 2*p - 20 = 4*b for b. -5 Let s be 4/(1 + 1)*5/2. Solve 2*u + 35 = -s*q, -q + 6*q = -25 for u. -5 Suppose 4*i + 2*c - 6 = -3*c, 2*c = -i. Solve 4*u = -s + 17, -i*s = -0*s + 4*u - 32 for s. 5 Let u(m) = 2*m - 2. Let r = 4 - 0. Let q be u(r). Solve -3*c = 2*p - 2, 12 + q = 5*p + c for p. 4 Let y = -5 - -8. Suppose -28*k = -25*k - 9. Solve y*g - 6 = -4*c, -g - k*c + 4 = 2 for g. 2 Suppose -3*o - 2 - 4 = 0. Let x be 13 - o/(-1) - 3. Let g be 6/15 + (-8)/(-5). Solve -c + 18 = 4*p + 2, x = g*p + 5*c for p. 4 Suppose 0 = 6*w - 0*w - 30. Solve w*j = -4*y + 31, 0 = 2*y + 2*y - 3*j - 7 for y. 4 Let o(p) = p. Let k be o(9). Solve k = -2*a - w, -w - w = 5*a + 23 for a. -5 Suppose -4*t + c = 2 - 6, 3*t - 18 = -3*c. Solve 4*w + 2*g - 28 = 0, 3*g - 25 = -w - t*g for w. 5 Let l = -11 + 1. Suppose 5*o = 5*p + 40, 4*o + 23 = -4*p - o. Let n = p - l. Solve -n*x - 17 = -4*t, -5*t + 3*t = 5*x + 11 for x. -3 Let d(o) = -3 + o**3 + 4*o**2 + o**2 + 4*o - 3*o. Let h be d(-4). Solve h = 3*w - 2*t - t, t - 3 = 4*w for w. -2 Let y(q) = 6*q - 20. Let z be y(4). Solve 2*o + 15 = 5*v - o, -z*v = -3*o - 12 for v. 3 Suppose 110 = 3*m - 4*u, 0*m - m + 50 = -4*u. Let n = m - 28. Solve -4*g - 20 = z, -9 = -4*z + n*g + 1 for z. 0 Let o = -9 - -21. Let j be (4/o)/((-3)/(-36)). Let n be ((-2)/(-3))/((-1)/(-12)). Solve -5*m + j = -k, -2*k - m - n = m for k. -4 Let x(y) = 2*y + 4. Let n be x(-5). Let s = n - -9. Solve 2*w - w = -s*v - 1, 2*v + 29 = 5*w for w. 5 Let q(s) = 5*s**2 - 2*s. Let b be -6*(-2)/(-12)*2. Let f be q(b). Let y = 0 - -5. Solve -f = -y*n - 4*v, 5*n - 4*v - 23 = -7*v for n. 4 Let x(v) = -v**3 - 5*v**2 + 2*v - 3. Let o(i) = 2*i**2 - i + 1. Let r(s) = 5*o(s) + 2*x(s). Let p be r(-1). Solve -5*d - p*q = -16, 3 - 21 = -4*d + q for d. 4 Let a(v) = 15*v**2 - 4*v - 1. Let o(m) = 45*m**2 - 11*m - 3. Let u(j) = -11*a(j) + 4*o(j). Let z be u(-1). Solve -7*c - z = -3*c + 2*h, -5*c - 5*h = 15 for c. -4 Let c be (8 + -8)*2/4. Solve 4*k + 3*j = 5*k + 7, c = 2*k + 5*j - 19 for k. 2 Suppose -p + 12 = -5*q - 9, -5*p + 4*q = -42. Suppose -6*v + 15 = -v, -3*c + p = -v. Solve 4*d = -4*r - 5 + 13, -c*d = -15 for r. -3 Let d be 10 + -3 - (-1 - 0). Suppose a - d = 7. Solve -2*c - c + 4*p = -a, 0 = 3*c - 5*p - 18 for c. 1 Let b be (1 - -1 - -4) + (12 - 13). Solve o + o = -4*y + 2, 2*y = -b*o - 3 for o. -1 Let w(u) = u**3 - 5*u**2 + u - 5. Let x be w(5). Suppose x = -0*d - 2*d + 10. Let t = -10 + 14. Solve -2*a = t*s - 2, -s = -0*s + d*a + 13 for s. 2 Suppose -5 = -5*a - 4*y, 2*a + y + 15 = -4*y. Solve 4*l + 3*v = 4, 0*l = -a*l - 5*v for l. 4 Let c be (-15)/(-10)*(-4 + 6). Solve 3*r = -5*j + 14, -5*r = -c*j - 16 + 4 for r. 3 Let f(i) = i**3 - 6*i**2 + 6*i + 5. Let z be (-3)/12 + 63/12. Let n be f(z). Let l = -6 + n. Solve 0*b = b + l*a - 17, -4*b = 4*a - 32 for b. 5 Suppose -5*i + 8 = -3*i. Solve -4*n - k = -9, -i*n - 2*k - 8 + 22 = 0 for n. 1 Let n be (-63)/(-14) - -1*(-3)/(-6). Solve 4*o = n*c + 9, c + 4 = 5*o - 2 for c. -1 Let m be 5 + ((-6)/(-3) - 3) + -2. Solve m*x - 11 = -0*x + 5*a, 4*a = x - 7 for x. 3 Let f = 4 + -6. Let z be 1*3/(-2)*f. Solve p + 3*v - 6 = 0, z*p - v + 2 = 6*p for p. 0 Let y(g) = -g**2 + 6*g + 6. Let t be y(7). Let z be t - (0 - 6/3). Suppose n - 2 = z. Solve 5*r = -n*a + 12, 0*r + 12 = -3*r + 3*a for r. 0 Let s = -36 - -36. Solve -4*b - 21 = -5*m, -b - b - m - 7 = s for b. -4 Suppose h = 5 - 0. Suppose 11*x - 88 = 44. Solve -s + h*t + 10 = 0, -5*s - 3*t = x + 22 for s. -5 Let p be 0/(-6 - 6/(-3)). Solve p = 2*k - 3*k + 5*t - 21, 6 = 4*k - 2*t for k. 4 Let j = 17 - 7. Let p = j + -8. Solve -2*o + 18 = -2*y, -p*y + o + 16 = -6*y for y. -5 Suppose -2*v - 48 = 2*v - 4*q, 0 = -4*q + 16. Let h(d) = d + 8. Let y be h(v). Solve 2*c = -4*t + 18, y*t + 7 = t + 3*c for t. 4 Let b = -46 - -51. Solve -b = -2*o - 3*x, -4*o + x = -x + 30 for o. -5 Suppose -5*x - 5 = -5*k - 0, 3*k + 29 = -5*x. Let r(j) = -j**2 - 6*j + 1. Let l be r(x). Let c = l - 7. Solve -4*q - 5*w - 18 = 0, c = -q + 5*w + 10 for q. -2 Let y(m) = 2*m**3 - 3*m**2 - m + 2. Let h be y(2). Solve 0*b - 16 = h*o + b, 2*o - 6 = 3*b for o. -3 Let x be (-3 + 4)*3*1. Let t = -12 + 19. Suppose 4*n + 1 = 21. Solve -g - g + n*r = 1, t = 2*g + x*r for g. 2 Suppose 2*y + 16 = 4*y. Let m = -6 + y. Solve -2*z = -m*l + 6 + 4, -5*l + z = -5 for l. 0 Let o be ((-15)/(-12))/(3/72). Solve -5 = -2*p - 0*j - j, 0 = -4*p + 2*j + o for p. 5 Let z = 4 + 0. Suppose -z*w - 6 = -14. Solve -9 = u + 4*h, 0 = -5*u - h + 10 + w for u. 3 Let p be (-4)/(-3)*(-3)/(-1). Suppose -p*d + 2*k + 69 = -d, k - 28 = -d. Solve 0 = -0*l + 4*l + q - d, -4*q + 25 = l for l. 5 Let c(n) be the second derivative of 5*n**3/6 - 2*n. Let y be c(1). Solve -3*j - 10 = -j - 3*l, -4*j = -y*l + 18 for j. -2 Let s be (-22)/(-12) - (-1)/6. Solve -s*n + 7 = x, 0 = -x + 3*x + 6 for n. 5 Suppose -n - 4*g - 13 = -1, 2*g + 10 = 0. Let c be (14/(-4)*n)/(-2). Solve s + q = 3*s + c, 17 = -5*s - 2*q for s. -5 Let x(v) = v + 3. Let g be x(4). Let q(d) = d**3 - 6*d**2 - 7*d. Let j be q(g). Suppose -y - 1 + 4 = j. Solve 0 = y*o - 4*s - 16, -1 = -5*o + s + 3 for o. 0 Let v(y) be the first derivative of -y**2/2 - 4*y + 9. Let g be v(-7). Solve -2*t + 5*j + 10 = g*t, 0 = -t - 2*j + 11 for t. 5 Suppose -36 = 3*g - 7*g. Suppose 21 = 5*n - g. Solve s - 3*s = -3*x - 23, n = -2*x - s for x. -5 Suppose 3*d - 2*z = 45, 2*d = -d + 4*z + 45. Suppose 0 = 5*u + 20, 0 - 4 = 4*s + 2*u. Let g = s + 3. Solve 0 = 3*r - d, -20 = g*b - 0*b - 4*r for b. 0 Let t(s) be the second derivative of -s**3/6 + 11*s**2/2 + 4*s. Let y be t(6). Solve y*r + 21 = 4*d, 4*d = -4*r + 3*r - 9 for d. -1 Let r = -7 - 1. Let j be (r/12)/((-2)/45). Solve -3*s + j = -3*u, -2*u - 4 = 2 for s. 2 Let v(x) = x + 105. Let p be v(0). Suppose 3*q = 2*o + o + p, -5*q + 3*o + 165 = 0. Let d be q/8 - (-3)/12. Solve 7 = 4*m + 2*s - 3, -5*m = d*s - 14 for m. 2 Let r(m) = -m - 2. Let l be r(5). Let c = l + 10. Solve -2*b + c = 3*j, 0*b - b = -4*j + 15 for j. 3 Suppose 2*h + 5*s + 0 - 14 = 0, -s = -4*h + 6. Suppose -9 = 4*m + 2*f - 1, -4*m - 16 = 4*f. Solve 13 = 2*k - 3*g, 2*g + 2 = -h*k - m for k. 2 Let p = 100 - 67. Solve -4*z = -5*r + 5, 4*z + 4*r - 7 = p for z. 5 Suppose 0 = 5*v + 5*x - 25, 4*x - 15 = -3*v + 4*v. Solve -v = 2*u - 3*s, 10 = -3*u + 3*s - 7*s for u. -2 Suppose 2*p = 3*o + 25, 5*p + 5*o - 6 = 4*p. Solve 3*v = 5*a - 30, p*a + 5*v + 13 = 7*a for a. 3 Suppose 4*f - 7 = -3*b, 0 = -5*b - 3*f + 12 + 7. Let a(k) = -k**3 + 5*k**2 + 4*k - 3. Let d be a(b). Solve -3*v - 11 - 1 = 0, m + 5*v = -d for m. 3 Suppose -o - 11 = -3*f, 3*o = -4*f + 1 + 18. Solve -8*w = -3*w - x - 6, 0 = 4*w - x - f for w. 2 Let v = 21 + -14. Solve 4*q - v = -p, 2*q - 2*p + 6*p = 0 for q. 2 Suppose -3*t + 46 = 5*u, -u + 1 = -2*t + 2*u. Solve -2*f + 0*f - 13 = -5*k, -3*k = -f - t for f. -4 Let b(j) be the third derivative of -j**6/20 - j**5/60 + j**3/6 - 2*j**2. Let n be b(-1). Solve 3*r = 5*m + 22, -r - n = -3*r - m for r. 4 Let z be (-16)/4*1/(-2). Suppose -x + 5*c + 12 = 0, 0*x + z*c - 2 = -3*x. Suppose 6*y - x*y = 76. Solve 2*a - 6 = 2*l, 3*a - 3*l = -2*a + y for a. 5 Suppose 0 = -2*m - 2. Let w be 0 + (-4)/m + 0. Suppose 4*i + w = 20, 0 = 2*n - 3*i + 2. Solve -n*r + 2*b = 7, 0*r - 3*r - b - 2 = 0 for r. -1 Let f(t) = -5*t - 2 + 0*t + 0*t**2 + t**2 + 0*t**2. Let h be f(6). Solve -i + 4*i = a + 1, -h*i + 8 = 2*a for i. 1 Suppose -i - 21 = 2*z, -6*z - 69 = -z - 3*i. Let t be 2/4 - z/8. Let b be 5/2 - t/4. Solve 0 = -3*c - 3*a - 3, 0*c - 2*a = c - b for c. -4 Let v(u) = -u**2 + 6*u - 3. Suppose -o = 3*o. Let g = o + 5. Let w be v(g). Solve w*d = 3*d - 5*j, 2*d = -5*j for d. 0 Let u(v) = 4*v**2 + v. Let r be u(-1). Let k be r/(-2) + 9/2. Solve 25 = -5*b + k*h, -b = 4*h - 0 + 5 for b. -5 Let p be 24/10*80/24. Let z = p + -8. Suppose z = d + 4*d. Solve -2*n + 3*x = 13, d = -3*n + 4*x - 5 - 14 for n. -5 Let f be (0 + (1 - 0))*3. Solve 4*g - l = f*l + 16, -14 = -5*g - l for g. 3 Let d(b) be the third derivative of 0 - 1/24*b**4 + 0*b**3 - b**2 + 0*b. Let h be d(-6). Solve -4*u + 5*a = 28, -3*u = a + 2*a - h for u. -2 Let f be -3 - (4/12)/(3/(-45)). Solve 8 = -2*i + 2*g, -i = -0*i + 2*g - f for i. -2 Suppose 5*y + 0*y = 35. Let d = -3 + y. Suppose -2*a + d*a - 6 = -5*i, 0 = -2*i
Q: Any widget that builds several widgets horizontally and changes lines automatically? I am trying to build things like tags from a List<String> using Chip widget, which would line up from left to right if there is space left horizontally, and if not, render them in the next line. Is there any specific widget that could do this? A: Wrap is the widget for you! Wrap( children:[ *Insert your chips here* ])
Q: Checking for nil before releasing an object Is this good or bad practice? if (!theConnection && !receivedData) { // release the connection, and the data object [theConnection release]; // receivedData is declared as a method instance elsewhere [receivedData release]; } A: Sending any message to nil object has no effect, so you can safely remove that check. Moreover your code leaks memory in case only 1 of the object is non-nil.
Q: Error on BulkSaveChanges with Entity Framework I'm trying out Entity Framework Classic to batch the SaveChanges() operations with BulkSaveChanges. It succeeds for certain records, but it fails for others (I've been breaking down the call to individual operations, and I've run the profiler). The operation that makes it fail is: exec sp_executesql N'CREATE TABLE #ZZZProjects_26190111_a15e_47d7_b253_2cc24510b3f8z ( [$action] VARCHAR(100) NULL, ZZZ_Index INT NULL, [Id] [sys].[int] NULL ); MERGE INTO [dbo].[MyEntityContact] AS DestinationTable USING ( SELECT TOP 100 PERCENT * FROM (SELECT @0_0 AS [externalField], @0_1 AS [MyEntityId], @0_2 AS [CreatedDate], @0_3 AS [UpdateUser], @0_4 AS [UpdateDate], @0_5 AS [Id], @0_6 AS ZZZ_Index UNION ALL SELECT @1_0 AS [externalField], @1_1 AS [MyEntityId], @1_2 AS [CreatedDate], @1_3 AS [UpdateUser], @1_4 AS [UpdateDate], @1_5 AS [Id], @1_6 AS ZZZ_Index UNION ALL SELECT @2_0 AS [externalField], @2_1 AS [MyEntityId], @2_2 AS [CreatedDate], @2_3 AS [UpdateUser], @2_4 AS [UpdateDate], @2_5 AS [Id], @2_6 AS ZZZ_Index UNION ALL SELECT @3_0 AS [externalField], @3_1 AS [MyEntityId], @3_2 AS [CreatedDate], @3_3 AS [UpdateUser], @3_4 AS [UpdateDate], @3_5 AS [Id], @3_6 AS ZZZ_Index UNION ALL SELECT @4_0 AS [externalField], @4_1 AS [MyEntityId], @4_2 AS [CreatedDate], @4_3 AS [UpdateUser], @4_4 AS [UpdateDate], @4_5 AS [Id], @4_6 AS ZZZ_Index UNION ALL SELECT @5_0 AS [externalField], @5_1 AS [MyEntityId], @5_2 AS [CreatedDate], @5_3 AS [UpdateUser], @5_4 AS [UpdateDate], @5_5 AS [Id], @5_6 AS ZZZ_Index) AS StagingTable ORDER BY ZZZ_Index ) AS StagingTable ON 1 = 2 WHEN NOT MATCHED THEN INSERT ( [externalField], [MyEntityId], [CreatedDate], [UpdateUser], [UpdateDate] ) VALUES ( [externalField], [MyEntityId], [CreatedDate], [UpdateUser], [UpdateDate] ) OUTPUT $action, StagingTable.ZZZ_Index, INSERTED.[Id] INTO #ZZZProjects_26190111_a15e_47d7_b253_2cc24510b3f8z ; SELECT A.* ,B.[Id] AS [Id_zzzinserted] FROM #ZZZProjects_26190111_a15e_47d7_b253_2cc24510b3f8z AS A INNER JOIN [dbo].[MyEntityContact] AS B ON A.[Id] = B.[Id] ; DROP TABLE #ZZZProjects_26190111_a15e_47d7_b253_2cc24510b3f8z;',N'@0_0 int,@0_1 int,@0_2 smalldatetime,@0_3 nvarchar(50),@0_4 datetime,@0_5 int,@0_6 int,@1_0 int,@1_1 int,@1_2 smalldatetime,@1_3 nvarchar(50),@1_4 datetime,@1_5 int,@1_6 int,@2_0 int,@2_1 int,@2_2 smalldatetime,@2_3 nvarchar(50),@2_4 datetime,@2_5 int,@2_6 int,@3_0 int,@3_1 int,@3_2 smalldatetime,@3_3 nvarchar(50),@3_4 datetime,@3_5 int,@3_6 int,@4_0 int,@4_1 int,@4_2 smalldatetime,@4_3 nvarchar(50),@4_4 datetime,@4_5 int,@4_6 int,@5_0 int,@5_1 int,@5_2 smalldatetime,@5_3 nvarchar(50),@5_4 datetime,@5_5 int,@5_6 int',@0_0=34,@0_1=1297,@0_2='2014-09-16 17:05:00',@0_3=N'MyDomain\myUser',@0_4='2019-12-11 17:45:05.057',@0_5=NULL,@0_6=0,@1_0=35,@1_1=1297,@1_2='2014-09-16 17:33:00',@1_3=N'MyDomain\myUser',@1_4='2019-12-11 17:45:05.073',@1_5=NULL,@1_6=1,@2_0=37,@2_1=1297,@2_2='2014-09-17 16:27:00',@2_3=N'MyDomain\myUser',@2_4='2019-12-11 17:45:05.073',@2_5=NULL,@2_6=2,@3_0=47,@3_1=1297,@3_2='2014-09-19 11:55:00',@3_3=N'MyDomain\myUser',@3_4='2019-12-11 17:45:05.073',@3_5=NULL,@3_6=3,@4_0=54,@4_1=1297,@4_2='2014-09-22 10:49:00',@4_3=N'MyDomain\myUser',@4_4='2019-12-11 17:45:05.090',@4_5=NULL,@4_6=4,@5_0=66,@5_1=1297,@5_2='2014-09-29 13:59:00',@5_3=N'MyDomain\myUser',@5_4='2019-12-11 17:45:05.090',@5_5=NULL,@5_6=5 The reported error is SqlTypeException: SqlDateTime overflow. Must be between 1/1/1753 12:00:00 AM and 12/31/9999 11:59:59 PM. I've been using a different id for MyEntityId while running the query, and it passed. The debugger could not point out much more information about what column was making this fail. Any idea? A: I had some operations executing before the SaveChanges method (populating the audit columns). By performing the same operations before the BulkSaveChanges everything went fine (and faster!).
Q: How to scroll one widget at a time in flutter how to achieve this stepwise widget scroll in flutter A: Use the widget PageView https://www.youtube.com/watch?v=J1gE9xvph-A You insert a list children and set the axis to horizontal
The present invention relates to a thin, biaxially oriented polyester film which is asymmetrically oriented by stretching 1.0-2.0 times in the machine direction in the plane of the film and about 3.0 to 5.0 times in the transverse direction in the plane of the film, said film having a birefringence of at least 0.085, an optical retardation of at least 9000 nanometers, a shrinkage of less than 2% in any direction at 150.degree. C., which is substantially free of color fringes upon viewing in partially polarized light. This invention also relates to two processes for the production of said biaxially oriented film. The film of the invention may be bonded to materials, such as polyvinyl butyral, to form a two-ply or three-ply laminated structure, which further may be bonded to a glass layer or layers of a glazing structure to provide the desired optical and mechanical characteristics. The film of the invention can also be primed with adhesion promoters or other surface modifiers at any suitable stage during manufacture of the film, i.e. before or during the stretching operation, or it may also be applied to the finished film. Polyester films such as disclosed in U.S. Pat. No. 4,898,786 are contemplated. The use of polymeric films in glazing applications is well-known. Oriented polyester film, particularly biaxially oriented film composed of polyethylene terephthalate (PET) has been widely used as a packaging material or as a base for microfilm, reprographic films, proofing films and the like. It has good optical clarity and toughness which renders it extremely suitable for such applications. Polyester films can also be used as transparent and translucent layers applied to solid substrates and particularly to transparent substrates. Another more recent application for polyester film involves its use as an antilacerative layer in the construction of automotive glazing products such as windshields, rear windows, sun roof panels and the like, and in architectural safety glass. One of the simpler automotive glazing products may comprise a flexible interlayer of polyvinyl butyral sandwiched between glass on one side and a high modulus film, such as polyester film, on the opposite side. The introduction of laminated safety glass for automotive glazing structures substantially reduced the hazard from flying glass shards. Such structures consist of two layers of glass bonded to a central layer of a tough, stretchable material such as plasticized polyvinyl butyral. These structures are designed to have the strength to allow bending but not penetration by the head of an occupant upon impact in a collision. Lacerations may occur if the head slides over the fragmented surface of the inner glass layer after impact; therefore, a layer of this tough, stretchable material used as the inner layer can prevent this source of injury. One of the major problems in laminated safety glass is the "rainbow effect". If the material of any component of the glazing structure in the viewing system is slightly anisotropic to partially polarized light, color distortions are possible. These distortions are known as color fringes or the "rainbow effect". The requirement of freedom from color fringes when viewed in partially polarized daylight is a critical one. Additionally, an "elephant skin" effect is possible when there is excessive shrinkage of the film during the lamination process. The preferred film of this invention has a higher birefringence then similar films known; it is this property that helps solve the problems of the "rainbow effect". Although the use of polymeric films in glazing applications is known, the problem of manufacturing films possessing the properties of optical clarity, thermal stability, formability and the like, has not been successfully addressed. Canadian Patent No. 596,193 to Gore et al., discloses one attempt at addressing these problems. This patent is directed to a safety glass laminate having a number of layers, one of which is a sheet of biaxially oriented polyethylene terephthalate. While the film disclosed therein possesses a number of the desired properties sought in windshield use applications, it lacks other properties, such as frangibility and freedom from color fringes or "rainbow" effects as well as "elephant skin" effects. U.S. Pat. No. 4,072,779 to Knox et al. discloses a polyethylene terephthalate film which claims to have some of the desired properties however the film produced under the conditions of this patent but is extremely difficult to make as a heat stabilized film. The film produced is difficult to manufacture, process and handle because of the poor machine direction mechanical properties resulting from the conditions specified therein. Means and materials for achieving this required optical property, in combination with other desired mechanical, thermal and optical properties, are the goals the present invention seeks and achieves.
The past 40 years have seen an enormous amount of change in Treasury, but in the past 3-5 years a number of new disruptive developments, particularly Fintech and Blockchain, may have an impact on corporate treasury and drive further evolution. What happened to start his change and why is it so different today compared to prior years? Which, if any, of the largely retail/consumer innovations we can see in the market today, will begin to gain traction in the corporate space? Countdown toTEXPO 2018 The Sheraton Dallas Hotel registration will open in the Fall 2017 Please check back later.
List of 2000 UCI Women's Teams Listed below are the 2000 UCI Women's Teams that competed in 2000 women's road cycling events organized by the International Cycling Union (UCI). Source: References 2000 UCI
Q: PHP comment box using a txt file I need to make a comment box using a txt file or anything else that can be queried passively, without using a database server. As I'm fairly new to PHP programming the first idea was to use a text file. The code in general to accomplish this, as far as I can think of logically would be : <html> <head></head> <body> <form method = "post"> <textarea name = "txt" cols = "25" rows = "5"> Place your comment here ... </textarea><br><br> <input type = "submit" value = "Submit" onclick = "<?php $com = $_POST["txt"]; $file = fopen("inrg.txt", "a"); fwrite($file, "<br>"); for($i=0; $i <= strlen($com) - 1; $i++) { fwrite($file, $com[$i]); if($i % 37 == 0 && $i != 0) fwrite($file, "<br/>"); } fwrite($file, "<br>------------------------------------------"); fclose($file); ?>"> <br> </form> <font face = "Times New Roman"><b><p>Textul introdus este: </p></b></font> <font face = "Comic Sans MS" color = "red" size = "2" > <?php $file = fopen("inrg.txt", "r"); echo fread($file, filesize("inrg.txt")); fclose($file); ?> </font> </body> </html> Nothing fancy yet, and it does needs some improvements on the esthetics side. The thing is after I submit something in the comment box, it shows properly but if I do reload in the web browser, the last posted comment it's posted again as many times as I reload the page. Also if there's a way with PHP to make the initial "Place your comment here ..." disappear A: Here is one way to do it redirecting the page to itself: <html> <head></head> <body> <form method="post"> <textarea name="txt" cols="25" rows="5"></textarea> <br><br> <input type="submit" value="Submit" name="submit" /> <?php if ( isset( $_POST[ 'submit' ] ) ) { $com = $_POST[ "txt" ]; $file = fopen( "inrg.txt", "a" ); fwrite( $file, "<br>" ); for ( $i = 0; $i <= strlen( $com ) - 1; $i++ ) { fwrite( $file, $com[ $i ] ); if ( $i % 37 == 0 && $i != 0 ) fwrite( $file, "<br/>" ); } fwrite( $file, "<br>------------------------------------------" ); fclose( $file ); echo '<script type="text/javascript">window.location ="";</script>'; // Add here } ?> <br> </form> <font face="Times New Roman"><b><p>Textul introdus este: </p></b></font> <font face="Comic Sans MS" color="red" size="2"> <?php if (file_exists("inrg.txt")) { $file = fopen( "inrg.txt", "r" ); echo fread( $file, filesize( "inrg.txt" ) ); fclose( $file ); } ?> </font> </body> </html>
Q: Posts and Pages not showing on admin, but showing in theme I've just transferred a WordPress install over from and old IIS server set up by our client, to our new Lunix based VPS. Whether that is relevant or not, i'm not sure. I've changed all the usual settings and database options i'd usual do on moving a website to a new/live server environment.. This has worked perfectly other than the data doesn't show in the WordPress admin specifically, but does if you visit www.lenstec.co.uk. That suggest the data is being successfully pulled in as it normally would. My initial thoughts are that this may be a global variable somewhere within the theme that WordPress does not like? Unfortunately, i've check through my function file and corresponding theme files and not come across anything. Can anyone suggest something I may have missed? A: That is Core code trying to use a Core function. You have almost certainly had a problem with the transfer. Very carefully, re-upload all of the files. I expect some file is missing or corrupt. And make sure that all of your permissions are correct. It would probably be a good idea to disable plugins and switch to a default theme as well. Since you can't get into the backend you will need to remove or rename the theme and plugin folders via FTP. Since you just transfered, I am assuming that you have good backups.
1. Field of the Invention The present invention relates to an image forming apparatus and a power supply control method performed in the image forming apparatus. 2. Description of the Related Art In recent years, image forming apparatuses such as printers have become common that can be driven not only by supply of power from a commercial power supply outside of an apparatus body via an AC adapter, but also by supply of power from a battery removably installed in the apparatus body. To reduce power consumption as much as possible, the image forming apparatuses have a power-saving mode in which power supply is small until a print command is received while a print operation is stopped. A switching time is preset from when the print operation is finished in the normal mode allowing image formation until the mode changes to the power-saving mode, and a user can freely change the preset switching time. In general, so as to prevent defective ejection of ink due to drying of nozzles, an inkjet printer performs maintenance operations for the nozzles after a print head has stood by for printing without being driven for a preset time or longer. Japanese Laid-open Patent Publication No. 2009-222824 discloses a technology in which the mode is switchable between the power-saving mode and the normal mode, and a power source is supplied by using a secondary battery in accordance with the switched mode (operating state). Japanese Laid-open Patent Publication No. 2012-140003 discloses a technology in which a head maintenance condition varies between when power is supplied from a commercial power supply and when an inkjet printer is driven by a battery, in order to extend the duration of the battery. In an image forming apparatus disclosed in Japanese Laid-open Patent Publication No. 2009-222824 that can be driven by a battery, however, the switching time to the power-saving mode is set to the same value both while the image forming apparatus is driven by the commercial power supply and while the apparatus is driven by the battery. This causes a problem in that the user needs to manually reset the preset switching time to the power-saving mode to a shorter time so as to reduce the power consumption when the image forming apparatus is driven by the battery. The inkjet printer disclosed in Japanese Laid-open Patent Publication No. 2012-140003 performs the maintenance operations for the nozzles when the inkjet printer is driven by the battery at the same frequency as when the printer is driven by the commercial power supply. This causes a problem in that the power consumption cannot be reduced when the inkjet printer is driven by the battery. Therefore, there is a need to provide an image forming apparatus and a power supply control method that are capable of reducing the power consumption when the apparatus is driven by an auxiliary power supply.
present invention concerns the use of caffeic acid phenethyl esters as radiation sensitizers in the treatment of tumors in subjects in need thereof. Adenocarcinoma of the prostate is the most commonly diagnosed non-skin cancer and the second leading cause of cancer deaths in the United States (F. Keely and L. Gomella, Epidemiology of Prostate Cancer, in Prostate Cancer, M. Ernstoff, J. Heany, and R. Peschel, Eds., 1998, p.2-14). Currently, the only therapies that have shown significant promise for curability of localized disease are radical prostatectomy and radiation therapy (RT). Selection of each type of treatment depends mainly upon tumor stage, with the majority of patients with A2 and B1 tumors receiving surgery, while those with stages B2, or C and higher-grade tumors are treated with radiation (R. Peschel, External Beam Radiation Therapy for Local Prostate Cancer, in Prostate Cancer, p. 117-136). Studies have suggested that adjuvant radiotherapy following prostatectomy provides superior results in terms of biochemical relapse (Prostate Specific Antigen levels) than surgery alone (R. Peschel, supra). Radiation therapy can consist of Conventional External Beam Radiotherapy, Three-Dimensional Conformal Radiation Therapy, or Radioactive Implant therapy. The latter modality, which was first developed in the early 1970""s and is currently experiencing a resurgence, offers the advantage of delivery of relatively high-dose radiation therapy in a localized area. Despite the effectiveness of these different RT modalities in achieving local control of the disease and reducing the mortality rate of prostate cancer patients, approximately 20-40% of patients with local disease receiving irradiation will relapse at the site of irradiation (P. Scardino and T. Wheeler, NCI Monogr, 7, 95-103 (1988); J. Crook et al., Urology 45, 624-31 (1995); J. Crook et al., Cancer 79, 81-9 (1997)). Moreover, studies have shown that cells that survive initial irradiation treatments are the ones most likely to form clones that will eventually repopulate the irradiated area and potentially metastasize (Z. Fuks et al., Int. J. Radiat. Oncol. Biol. Phys. 21, 537-547 (1991)). Thus, new combined modalities using agents that increase the lethal effects of ionizing radiation have the potential of reducing the probability of tumor recurrence and to increase disease-free survival times in patients treated with RT. Though a number of such agents have been shown to be effective in sensitizing prostate tumor cells to Ionizing Radiation (IR) in vitro, these results have not yet translated into effective combined modalities in the clinic, either because of lack of effectiveness in vivo, or because of potential toxicity or unknown long-term effects of such agents (M. Garzotto et al., Cancer Res. 59, 5194-201 (1999); K. Kimura et al., Cancer Res. 59, 1606-14 (1999)). Accordingly, there is a need for new ways to potentiate the activity of ionizing radiation in therapies for the treatment of cancers such as prostate cancer. A first aspect of the present invention is a method of potentiating radiation therapy in a subject in need thereof, comprising administering caffeic acid phenethyl ester (CAPE) or an analog thereof (a potentiating agent or active compound) to said subject in an amount effective to potentiate radiation therapy in said subject. By xe2x80x9cpotentiating radiation therapyxe2x80x9d is meant increasing or enhancing (e.g., synergistically enhancing) the activity of radiation therapy on a tumor in said subject. A second aspect of the present invention is a method of treating a tumor in said subject, comprising concurrently administering a potentiating agent as described above (i.e., CAPE or an analog thereof) to said subject while also administering radiation therapy (e.g., ionizing radiation) to said tumor, the potentiating agent being administered to said subject in an amount effective to potentiate the activity or efficacy of the radiation therapy (e.g., by increasing or enhancing, particularly synergistically enhancing) the activity of the radiation therapy on said subject). A third aspect of the present invention is a method of potentiating antineoplastic therapy in a subject in need thereof, comprising administering caffeic acid phenethyl ester (CAPE) or an analog thereof (a potentiating agent) to said subject in an amount effective to potentiate antineoplastic therapy in said subject. By xe2x80x9cpotentiating antineoplastic therapyxe2x80x9d is meant increasing or enhancing (e.g., synergistically enhancing) the activity of an antineoplastic agent administered to said subject on a tumor in said subject. A fourth aspect of the present invention is a method of treating a tumor in said subject, comprising concurrently administering a potentiating agent as described above (i.e., CAPE or an analog thereof) to said subject while also an antineoplastic agent to said subject, the potentiating agent being administered to said subject in an amount effective to potentiate the activity or efficacy of the antineoplastic agent (e.g., by increasing or enhancing, particularly synergistically enhancing) the activity of antineoplastic agent on a tumor in said subject). A further aspect of the present invention is a composition for treating a tumor in a subject, comprising, in combination in a pharmaceutically acceptable carrier, (i) a potentiating agent comprising CAPE or an analog thereof, and (ii) an antineoplastic agent. The potentiating agent is included in the composition in an amount effective to potentiate the activity of the antineoplastic agent. A still further aspect of the present invention is the use of an active compound as described above for the preparation of a medicament for the treatment of a disorder as described above, or carrying out a method as described above. The present invention is explained in greater detail in the specification set forth below and the drawings herein.
Yelp’s Hottest New Restaurant in Louisiana is … Yelp’s “hottest new restaurant in Louisiana” in 2017 isn’t in New Orleans, and it isn’t cajun or creole. It’s Greek, and it’s in Lafayette, which may be surprising to some. But Greek and Mediterranean restaurants opening throughout the country was a trend in 2017. Zorbas earned the distinction of the “hottest new” restaurant in 2017 in Louisiana. Its five star rating is due to the quality and taste of its food but also its huge portions. At the end of 2017 Yelp announced its “hottest new restaurants” in each state based on reviews it received. It stated, … we look back at all the good things that happened in the big 2-0-1-7 and pay tribute to all the wonderful local businesses that opened this year. To create this list, our experts in the Yelp Data Lab identified the restaurants that were added to Yelp in 2017 and ranked the highest in their state, based on a formula that takes into account the number of reviews and star ratings. Trending on The Hayride No trending posts were found. Subscribe to The Nooner! Email AddressPostal Code Quote of the Day "'My AR is ready for you, Robert Francis." - Texas Republican State Representative Briscoe Cain, in response to Democrat presidential candidate Robert Francis "Beto" O'Rourke's demand for a mandatory gun buyback, to be conducted by force if necessary.
Washington State Patrol Says It Has Arrested State’s Child Porn Download King UPDATE: On Friday the Pierce County Prosecutor’s Official formally charged 46-year-old Elwood Anthon Anderson with four counts of possession of depictions of minors engaged in sexually explicit conduct. You can find the full press release from Pierce County Prosecutor Mark Lindquist after our initial post below. laptop computer side view Related Content *Original Post* According to Washington State Patrol Lieutenant Ron Mead, a Gig Harbor man accused of being the state’s most prolific downloader of child pornography was arrested this morning. The arrest was the culmination of an investigation that started back in May after the State Patrol’s Missing and Exploited Children’s Task Force got a tip from the Seattle Internet Crimes Against Children Task Force. According to Stacia Glenn of The News Tribune in Tacoma, a search warrant served July 13 uncovered over 9,000 images of child porn on several computers and digital media devices that were seized by police. However, according to Mead, it’s not the 9,000 images that make the man the most prolific downloader of child porn in Washington. Mead explains to Seattle Weekly that the National Center for Missing and Exploited Children in Virginia tracks all known images of child porn on the web - each with an individual “fingerprint” - and through this technology investigators have concluded that the man arrested this morning had downloaded more pornographic images depicting children than anyone else in the state. “Based on the [image’s fingerprint] we have tools that track the exchange of them,” says Mead. “Basically, it keeps track of how many of these images are coming and going from specific IP addresses.” According to Mead, the State Patrol - via its Missing and Exploited Children’s Task Force - is one of the few agencies in the state capable of handling such an investigation. “These types of investigations require expertise that not a lot of agencies have,” he says, calling child porn a “huge problem” in our state. While Mead admits that through online fingerprinting and the work of the National Center for Missing and Exploited Children law enforcement authorities have access to information on any number of individual child porn downloads, the State Patrol only has the resources to “target the most prolific offenders.” And, according to Mead, the man arrested this morning in Gig Harbor certainly qualifies. He says that forensic testing on the man’s various computers and devices continues, and that the 9,000 images already found likely represents only a “snapshot” of the man’s activities. “In his line of work he deals with computers extensively,” says Mead of the Gig Harbor man, noting that authorities believe the suspect went to “extensive” lengths to cover up his crimes. The man was booked into Pierce County Jail after his arrest. According to the Pierce County Prosecutor’s Office charges are expected as early as tomorrow. Seattle Weekly is not naming the man as he has yet to be charged. TACOMA, WA – Today Pierce County Prosecutor Mark Lindquist charged Elwood Anthon Anderson, 46, with four counts of Possession of Depictions of Minors Engaged in Sexually Explicit Conduct, for thousands of images of child pornography he viewed on his computer. On December 21, 2012, Seattle Police began an investigation into the excessive use of a known child pornography file sharing site by one specific IP address. During the course of the investigation, the IP address was traced to the defendant’s Gig Harbor residence. In May 2013, the Washington State Patrol sent 570 images to the National Center for Missing and Exploited Children for analysis. Many of the images contained previously identified victims, and all were classified as child pornography. The images depict young children in various states of undress, and some are engaged in sexual activity with adults. On July 11, 2013, a search warrant was executed at the Anderson residence. Among the items seized were two computers and an external hard drive. Initially, detectives could not locate any child pornography on the computer, but a forensic analysis of the defendant’s external hard drive revealed thousands of images of child pornography and more than 200 videos had been accessed using a “virtual” computer, which is software that allows images to be viewed without creating a record. According to a witness, the defendant indicated that he was not worried that law enforcement would find sexually explicit images on his computer because of his high level of technical knowledge and the methods he used to view the images, including “ghost drives.” Anderson is married and is a father of four daughters. All family members living in the home said they had no knowledge the defendant was viewing child pornography. He told a neighbor, “In a way I’m glad I got caught ... I’m glad it’s out there so I don’t have to hide it anymore.” Anderson is scheduled to be arraigned today at 1:30pm in Courtroom 270 of the County-City Building in Tacoma. Charges are only allegations and a person is presumed innocent unless he or she is proven guilty beyond a reasonable doubt.
Q: Why am I allowed to initialize object of class Test by assigning integer constant in C++? Here is my C++ code #include<iostream> class Test{ int i; public: Test() { } Test(int i){ std::cout << "Constructor called" << std::endl; this->i = i; } void print(){ std::cout << i << std::endl; } }; int main(){ Test t = 3; t.print(); return 0; } I was amused when Test t = 3; worked. I do not understand why it is not giving compilation error. I was under the impression that object of class Test should be created in one of the following ways. Are there other ways of creating object of class Test which are not covered in following list? Test t1; Test t2(2); Test t3 = Test(3); Test t4(t3); Test t5 = Test(t4); Test t6{2}; Test t7 = Test{3}; Test t8{t3}; Test t9 = Test{t4}; Test t10 = {10}; A: This syntax: Test t = 3; is a form of copy-initialization. The effect of this is that the best user-defined-conversion-sequence is selected to initialize t. In this particular case, you have provided a conversion constructor Test(int) which is the best match and gets called.
The other side of trust in health care: prescribing drugs with the potential for abuse. Defining a nonpaternalistic yet achievable form of trust in medicine in an era of simultaneous patient empowerment and institutional control has been and remains an important task of bioethics. The 'crisis of trust' in medicine has been viewed mainly as the problem of getting patients to trust their health care providers, especially physicians. However, since paradigmatic cases of trust are mutual, bioethicists must pay more attention to physician trust in patients. A physician's view of the reasonableness of trust in a particular patient is affected not just by his or her relationship with that patient, but also by what is going on institutionally, professionally, legally and politically with regard to a given treatment or intervention. Since general moral principles are insufficient in determining the moral value and reasonableness of trust in particular instances, I discuss in detail the role of trust and distrust in the specific case of treating patients with medications implicated in drug abuse. I conclude that it is important to become aware, first, of the clinical significance of physician trust and distrust in patients, and second, of the many factors which inform both of these moral attitudes. These two claims together suggest that a central, but overlooked, virtue of medical practice is reflective, context-responsive trust in patients.
Laparoscopic treatment of ectopic pregnancies--reports of two cases. Two cases with ectopic pregnancy were successfully treated by laparoscopic injection of methotrexate (MTX). Case 1: A 29 year-old housewife was laparoscopically treated with a 15 mg MTX injection to the left Fallopian tube. After the laparoscopy, the human chorionic gonadotropin (HCG) was reduced to the normal range. Case 2: A 34 year-old housewife was also laparoscopically treated with a 35 mg MTX injection to the right Fallopian tube. After the laparoscopy, the HCG was quickly reduced to the normal range. The endoscopic approach can be used as the surgical treatment of choice for ectopic pregnancies.
Q: reverse with accumulator in prolog - error Could you help me solve some error ? I don't understand this error. reverse(L, R) :- reverse(L, [], R). reverse([], R, R). reverse([Head|Tail], Acc, R) :- NewAcc is [Head|Acc], reverse(Tail, NewAcc, R). ?- reverse[1,2,3], X). Type error: `[]' expected, found `[2|1]' (a compound) ("x" must hold one character) A: Your predicate works in principle but you probably want to use unification (=)/2 instead of arithmetic evaluation is/2 in your recursive goal: reverse(L, R) :- reverse(L, [], R). reverse([], R, R). reverse([Head|Tail], Acc, R) :- NewAcc = [Head|Acc], % <- here reverse(Tail, NewAcc, R). With this small modification your predicate works: ?- reverse([1,2,3],R). R = [3,2,1] As pointed out by @lurker in the comments, you can express the recursive rule more compactly by incorporating [Head|Acc] into its recursive goal like so: reverse([Head|Tail], Acc, R) :- reverse(Tail, [Head|Acc], R). However, you might like to consider using DCGs for this task as they yield easier readable code: reverse(L,R) :- phrase(invlist(L),R). invlist([]) --> []. invlist([H|T]) --> invlist(T), [H]. With the respective query: ?- reverse([1,2,3],R). R = [3,2,1]
Q: What does a "Full" server mean? I have a friend who played Star Wars: The Old Republic during the prerelease window. His characters are on one of the really early servers. Now that the game has been released and other people are joining up, we of course want to play together. However, I noticed that the early server in question is now "Full." I understand that this means there are lots of people on the server, but I don't know in detail what this might mean. Some questions: What kind of queue times can we expect when attempting to log in to a Full server? Are we in any danger of being locked out from that server (IE prevented from creating characters on it)? Is there any way for my friend to move his characters off the server if we decide we'd rather go to a less populated one after all? A: Full is a term they use to mean that the population is very high and will likely create queue times during peak hours. What kind of queue times can we expect when attempting to log in to a Full server? This is hard to answer since its very server dependent I've seen servers in full status go in queue from 10 mins to 2 hours. So for this you may need to monitor it some to see how "full" the server is during peak hours and your play times. A lot of times during off or non peak hours there is no waits. Are we in any danger of being locked out from that server (IE prevented from creating characters on it)? I have not seen any information stating they would lock out any servers at all based on population, and it would need to get very very bad before i see this happening or even being considered, as they don't want to break up groups. Is there any way for my friend to move his characters off the server if we decide we'd rather go to a less populated one after all? Currently right now no there is not. In the future I'd expect them to offer this service, though most likely it will be a paid service as most other MMOs offer. Source: I have played in the beta, pre-release and release.
Introduction {#aft193_s1} ============ Circulating serum and plasma levels of the inflammatory marker C-reactive protein (CRP) have been associated with cognitive decline and risk of dementia in ageing populations \[[@AFT193C1]--[@AFT193C3]\]. However, recent studies have questioned the nature of this relationship in the very old (\>75 years). For example, Silverman *et al.* \[[@AFT193C4]\] found that increased concentrations of CRP were linked cross-sectionally to improved memory performance in later life, but only in subjects without an *APOE* (apolipoprotein) e4 allele. However, null findings were observed for a global measure of cognition (Mini-Mental State Examination, MMSE) and for measures of language/executive function. Moreover, in a separate study \[[@AFT193C5]\], Silverman *et al*. also showed that parents and siblings of older adults with high CRP but no cognitive impairment, had a reduced risk of dementia compared with relatives with low CRP and no cognitive impairment. Associations between raised levels of other cardiovascular risk factors and more favourable cognitive trajectories have also been observed for body mass index and blood pressure \[[@AFT193C6]\]. The aim of this paper was to investigate the relationship between late-life CRP, its interaction with *APOE* e4 and drop in longitudinal cognitive performance in a population-based sample of older subjects. Methods {#aft193_s2} ======= Population {#aft193_s2a} ---------- The analysis cohort is a subset of the Medical Research Council Cognitive Function and Ageing Study (CFAS). The population frame comprised 13,004 individuals aged 65 years or over living in five geographic areas of the UK, who were selected from local Family Health Service Authority lists. The response rate was 81% and data collection began in the early 1990s \[[@AFT193C7]\]. The specific subset analysed in this study comprises 1,733 participants \[mean age 80.0 (SD 6.8), 64% female\] with the mean follow-up of 4.1 years between years 1997 and 2001 (6- and 10-year follow-up, respectively). We analysed data from 273 participants who had data on both serum CRP concentrations and MMSE, and who were free from dementia at the 6-year 'baseline'. CFAS has multi-centre research ethics committee\'s approval and ethical approval from the relevant local research ethics committees. Exposure and covariates {#aft193_s2b} ----------------------- CRP was the main exposure of interest and was measured on a Dade-Behring Dimension analyser by the Nutritional Biolanalysis Laboratory, MRC Human Nutrition Research Unit, Elsie Widdowson Laboratory, Cambridge. Information on age, gender, average weekly intake of alcohol, *APOE* genotype, education, regular medication use and cardiovascular risk factors, such as a history of stroke, myocardial infarction requiring medical attention and smoking status, were available for most individuals. These variables were assessed once at the baseline wave. Genotyping for *APOE* was carried out in line with Wenham *et al.* \[[@AFT193C8]\]. Outcome {#aft193_s2c} ------- Cognitive function was assessed by the MMSE \[[@AFT193C9]\], which has a discrete value range between 0 and 30 points. Cognitive decline was defined as a decrease of 3-or-more points over the 4-year follow-up period (1997--2001). Statistical analysis {#aft193_s2d} -------------------- Logistic regression was used to test the association between log-transformed CRP and cognitive decline. Prior to performing the analysis, we excluded individuals who had a baseline MMSE score \<18, which is compatible with severe cognitive impairment (*n* = 2). We also trimmed the CRP data for outliers that were \>3 SD beyond the mean (*n* = 5). This left an analysis sample of 266 subjects. An initial model adjusted for age and sex, followed by models stratifying by *APOE* status (e4 carrier or not). A saturated model was also built to allow for adjustment for potential confounders. Owing to a lack of observations in the *APOE* e4 carriers subpopulation, this step was only performed for those without an e4 allele. Analyses were performed using the statistical software 'R'. Results {#aft193_s3} ======= Data from 266 participants (56% female), mean age 77 (SD 5.4, range 69.6 to 96.5) years at baseline were analysed (Table [1](#AFT193TB1){ref-type="table"}). The majority of the population were non-smokers (80%) with low-to-moderate alcohol consumption (65%). Approximately 41% of subjects had high blood pressure, 13% (4%) had a history of myocardial infarction (stroke), 8% had diabetes mellitus and almost all were on regular medication. Over a mean of 4.1 years of follow-up, 86 participants developed cognitive decline (64% females).Table1.Descriptive statistics at baseline: maximum *n* = 266MedianIQRSerum CRP (mg/l)3.8(2.6, 6.0)MeanSDAge at baseline (years)77.15.5Education (years)9.61.7*n*%Sex (F)14855.6*APOE* e4 carrier (*n* = 258)5420.9Alcohol (normal/moderate) (*n* = 232)15064.7Alcohol (severe)5222.4Smoking (current/ex)5319.9Medication (*n* = 264)24392.0Diabetes mellitus207.5Myocardial infarction3513.2High blood pressure11041.4Stroke114.1 Age- and sex-adjusted odds ratios for log(CRP) in relation to cognitive decline are displayed in Table [2](#AFT193TB2){ref-type="table"}. For every unit increase in log(CRP), there was an 21% decrease in the risk of decline in cognition (OR: 0.79, 95% CI: 0.51--1.20). However, this association was not statistically significant (*P* = 0.28). In accordance with the analyses by Silverman *et al.*, we stratified by the *APOE* e4 status. In the group without an e4 allele, log(CRP) was associated with a decreased risk of longitudinal cognitive decline (OR: 0.57, 95% CI: 0.33--0.96, *P* = 0.04). In the group carrying an e4 allele, log(CRP) was not significantly associated with cognitive decline, although the point estimate for the relationship was in the opposite direction from those without an e4 allele (OR: 1.54, 95% CI: 0.65--3.79, *P* = 0.32). Sensitivity analyses excluding those with a CRP level \>10 mg/l (acute inflammation) resulted in minor changes to the magnitude of the associations for those without an e4 allele (OR: 0.54, 95% CI: 0.26--1.12, *P* = 0.10). For those with an e4 allele, the association remained non-significant but the point estimate changed direction (OR: 0.72, 95% CI: 0.15--3.04, *P* = 0.65). A final model was built to covary for potential confounders in those without an e4 allele; there were too few observations to do this for the e4 allele subgroup. After adjusting for diabetes, education, medication, alcohol consumption, blood pressure, stroke, smoking and MI, the strength of the association between log(CRP) and cognitive decline remained similar to the crude age- and sex-adjusted model (OR: 0.57, 95% CI: 0.30--1.04, *P* = 0.08).Table 2.Logistic regression analyses of CRP on cognitive decline (3 or more point drop on the MMSE)Basic model (*n* = 266)*APOE* e4 non-carriers (*n* = 204)*APOE* e4 carriers (*n* = 54)OR^a^95% CI*P*-valueOR95% CI*P*OR95% CI*P*Intercept2.6 × 10^−4^4.9 × 10^−6^0.012\<0.0013.1 × 10^−5^2.3 × 10^−7^0.003\<0.0010.061.1 × 10^−5^231.440.50log(serum CRP)0.790.511.200.280.570.330.960.041.540.653.790.32Age at baseline (years)1.101.051.16\<0.0011.141.081.22\<0.0011.010.911.130.78Sex (F)1.380.802.410.251.000.521.920.993.220.9712.040.06[^1] Discussion {#aft193_s4} ========== In this prospective study, we found increased concentrations of serum CRP to be associated with a decreased risk of drop in cognitive performance (measured as a decline of 3 or more points on the MMSE over a 4-year period) in the very old. However, this association was only seen in those without an *APOE* e4 allele. The magnitude of the finding remained consistent after comprehensive adjustment for potential confounders. For those with an e4 allele, the relationship with cognitive decline was neither statistically significant nor in a consistent direction after controlling for acute inflammation. These findings are broadly in line with recent papers \[[@AFT193C4], [@AFT193C5], [@AFT193C10]\] that describe an association between raised CRP and better cognitive outcomes in the very old. One study also found the associations to only be present in those without an *APOE* e4 allele \[[@AFT193C4]\]. However, different from our study, Silverman *et al.* \[[@AFT193C4]\] found a link with a measure of memory, but not general cognition (MMSE scores). One possible explanation for these differences is the cross-sectional design of their study. A strength of our study is its prospective design which enabled us to evaluate differences in cognition (MMSE) over time. Limitations include only one measurement of CRP, which could contribute to regression dilution bias. Survival bias may have occurred since those with lower cognitive scores are more likely to die. A further limitation is the small subpopulation of *APOE* e4 allele carriers. The number and proportion of carriers were similar to that from Silverman\'s study \[[@AFT193C4]\] \[*n* = 50 (29%) versus *n* = 54 (21%)\]. Much larger studies are needed to investigate the direction and magnitude of this association. This study draws attention to the concept of reverse epidemiology, where traditional risk factors may actually be protective within a population subset. Silverman *et al.* \[[@AFT193C5]\] hypothesised that an active immune system in later life may be important in protecting against dementia. The findings from our analysis imply that this hypothesis may also be relevant in non-pathological cognitive ageing. In conclusion, while elevated levels of CRP in mid- and early late-life predict subsequent cognitive impairment and dementia, this role appears to be reversed in the very old. However, this association was only observed in older people who do not carry an *APOE* e4 allele. Nonetheless, the magnitude of the association is not influenced by cardiovascular disease, and lifestyle factors such as smoking and drinking. ###### Key points Cross-sectional evidence suggests that elevated CRP in late-life is linked to better cognition.We show, longitudinally, that raised CRP is linked to a lower risk of cognitive decline in those without an *APOE* e4 allele.In the very old, the relationship between CRP and cognitive decline in those carrying an *APOE* e4 allele is unclear. Conflicts of interest {#aft193_s5} ===================== None declared. Funding {#aft193_s6} ======= This work was supported by a Medical Research Council (MRC) project grant (MRC G9901400). F.E.M. is funded under MRC programme grant UC_US_A030_0031. R.E.M. is an Alzheimer\'s Research UK Fellow (ART-RF2010-2) and a member of the University of Edinburgh Centre for Cognitive Ageing and Cognitive Epidemiology, part of the cross council Lifelong Health and Wellbeing Initiative (G0700704/84698), for which funding from the Biotechnology and Biological Sciences Research Council, Engineering and Physical Sciences Research Council, Economic and Social Research Council is gratefully acknowledged. We thank the CFAS population, their families, and carers for their participation. The study is part of the Cambridge and Peterborough CLAHRC. Medical Research Council is gratefully acknowledged. [^1]: ^a^Odds ratio.
Q: How to get number of columns which are blank or null values or 0 from mysql table I want to get the number of column from MySQL table which has no values, means which are blank or zero. Actually, I want to measure the employee profile that how many fields he has filled and how many are left? I am using MySQL with PHP. A: I don't see any way of doing this other than to manually sum every column. Here is a somewhat concise way of doing this: SELECT empId, IF(COALESCE(col1, '') = '', 1, 0) + IF(COALESCE(col2, '') = '', 1, 0) + ... IF(COALESCE(colN, '') = '', 1, 0) AS num_cols_missing FROM yourTable; We can replace NULL columns values with empty string, and then compare that result to empty string. This means we can check for both NULL and empty with a single logical expression.
Period 4 element A period 4 element is one of the chemical elements in the fourth row (or period) of the periodic table of the elements. The periodic table is laid out in rows to illustrate recurring (periodic) trends in the chemical behaviour of the elements as their atomic number increases: a new row is begun when chemical behaviour begins to repeat, meaning that elements with similar behaviour fall into the same vertical columns. The fourth period contains 18 elements beginning with potassium and ending with krypton – one element for each of the eighteen groups. It sees the first appearance of d-block (which includes transition metals) in the table. Properties Every single one of these elements is stable, and many are extremely common in the Earth's crust and/or core; it is the last period with no unstable elements at all. Many of the transition metals in period 4 are very strong, and therefore commonly used in industry, especially iron. Three adjacent elements are known to be toxic, with arsenic one of the most well-known poisons, selenium being toxic to humans in large quantities, and bromine, a toxic liquid. Many elements are essential to humans' survival, such as calcium being what forms bones. Atomic structure Progressing towards increase of atomic number, the Aufbau principle causes elements of the period to put electrons onto 4s, 3d, and 4p subshells, in that order. However, there are exceptions, such as chromium. The first eleven elements—K, Ca, and transition metals—have from 1 to 11 valence electrons respectively, which are placed on 4s and 3d. Twelve electrons over the electron configuration of argon reach the configuration of zinc, namely 3d10 4s2. From this element, the filled 3d subshell effectively withdraws from chemistry and the subsequent trend looks much like trends in the periods 2 and 3. The p-block elements of period 4 have their valence shell composed of 4s and 4p subshells of the fourth () shell and obey the octet rule. For quantum chemistry namely this period sees transition from the simplified electron shell paradigm to research of many differently-shaped subshells, relative disposition of whose energy levels is governed by interplay of various physical effects. The period's s-block metals put their differentiating electron onto 4s having vacancies among nominally lower states – a phenomenon unseen in lighter elements. Contrary, seven elements from zinc to krypton are the heaviest where all electron shells below the valence shell are filled completely. This isn't possible in further periods due to existence of f-subshells starting from . List of elements {| class="wikitable sortable" ! colspan="3" | Chemical element ! Chemical series ! Electron configuration |- !   ! ! ! ! |- style="background:#f66;" || 19 || K || Potassium || Alkali metal || [Ar] 4s1 |- style="background:#ffdead;" || 20 || Ca || Calcium || Alkaline earth metal || [Ar] 4s2 |- style="background:#ffc0c0;" || 21 || Sc || Scandium || Transition metal || [Ar] 3d1 4s2 |- style="background:#ffc0c0;" || 22 || Ti || Titanium || Transition metal || [Ar] 3d2 4s2 |- style="background:#ffc0c0;" || 23 || V || Vanadium || Transition metal || [Ar] 3d3 4s2 |- style="background:#ffc0c0;" || 24 || Cr || Chromium || Transition metal || [Ar] 3d5 4s1 (*) |- style="background:#ffc0c0;" || 25 || Mn || Manganese || Transition metal || [Ar] 3d5 4s2 |- style="background:#ffc0c0;" || 26 || Fe || Iron || Transition metal || [Ar] 3d6 4s2 |- style="background:#ffc0c0;" || 27 || Co || Cobalt || Transition metal || [Ar] 3d7 4s2 |- style="background:#ffc0c0;" || 28 || Ni || Nickel || Transition metal || [Ar] 3d8 4s2 |- style="background:#ffc0c0;" || 29 || Cu || Copper || Transition metal || [Ar] 3d10 4s1 (*) |- style="background:#ccc;" || 30 || Zn || Zinc || Post-transition metal || [Ar] 3d10 4s2 |- style="background:#ccc;" || 31 || Ga || Gallium || Post-transition metal || [Ar] 3d10 4s2 4p1 |- style="background:#cc9;" || 32 || Ge || Germanium || Metalloid || [Ar] 3d10 4s2 4p2 |- style="background:#cc9;" || 33 || As || Arsenic || Metalloid || [Ar] 3d10 4s2 4p3 |- style="background:;" || 34 || Se || Selenium || Reactive nonmetal || [Ar] 3d10 4s2 4p4 |- style="background:;" || 35 || Br || Bromine || Reactive nonmetal || [Ar] 3d10 4s2 4p5 |- style="background:#c0ffff;" || 36 || Kr || Krypton || Noble gas || [Ar] 3d10 4s2 4p6 |} (*) Exception to the Madelung rule s-block elements Potassium Potassium (K) is an alkali metal, placed under sodium and over rubidium, and is the first element of period 4. It is one of the most reactive elements in the periodic table, therefore usually only found in compounds. It tends to oxidize in air very rapidly, thus accounting for its rapid reaction with oxygen when freshly exposed to air. When freshly exposed, it is rather silvery, but it quickly begins to tarnish as it reacts with air. It is soft enough to be cut with a knife and it is the second least dense element. Potassium has a relatively low melting point; it will melt just by putting it under a small open flame. It also is less dense than water, and can, in turn, float. Calcium Calcium (Ca) is the second element in the period. An alkali earth metal, calcium is almost never found in nature due to its high reactivity with water. It has one of the most widely known and acknowledged biological roles in all animals and some plants, making up bones and teeth, and used in some applications in cells, such as signals for cellular processeses. It is regarded as the most abundant mineral in the body's mass. d-block elements Scandium Scandium (Sc) is the third element in the period, and is the first transition metal in the periodic table. Scandium is quite common in nature, but difficult to isolate because it is most prevalent in rare earth compounds, which are difficult to isolate elements from. Scandium has very few commercial applications because of the aforementioned facts, and currently its only major application is in aluminium alloys. Titanium Titanium (Ti) is an element in group 4. Titanium is both one of the least dense metals and one of the strongest and most corrosion-resistant, and as such has many applications, especially in alloys with other elements, such as iron. Due to its aforementioned properties, it is commonly used in airplanes, golf clubs, and other objects that must be strong, but lightweight. Vanadium Vanadium (V) is an element in group 5. Vanadium is never found in pure form in nature, but is commonly found in compounds. Vanadium is similar to titanium in many ways, such as being very corrosion-resistant, however, unlike titanium, it oxidizes in air even at room temperature. All vanadium compounds have at least some level of toxicity, with some of them being extremely toxic. Chromium Chromium (Cr) is an element in group 6. Chromium is, like titanium and vanadium before it, extremely resistant to corrosion, and is indeed one of the main components of stainless steel. Chromium also has many colorful compounds, and as such is very commonly used in pigments, such as chrome green. Manganese Manganese (Mn) is an element in group 7. Manganese is often found in combination with iron. Manganese, like chromium before it, is an important component in stainless steel, preventing the iron from rusting. Manganese is also often used in pigments, again like chromium. Manganese is also poisonous; if enough is inhaled, it can cause irreversible neurological damage. Iron Iron (Fe) is an element in group 8. Iron is the most common on Earth among elements of the period, and probably the most well-known of them. It is the principal component of steel. Iron-56 has the lowest energy density of any isotope of any element, meaning that it is the most massive element that can be produced in supergiant stars. Iron also has some applications in the human body; hemoglobin is partly iron. Cobalt Cobalt (Co) is an element in group 9. Cobalt is commonly used in pigments, as many compounds of cobalt are blue in color. Cobalt is also a core component of many magnetic and high-strength alloys. The only stable isotope, cobalt-59, is an important component of vitamin B-12, while cobalt-60 is a component of nuclear fallout and can be dangerous in large enough quantities due to its radioactivity. Nickel Nickel (Ni) is an element in group 10. Nickel is rare in the Earth's crust, mainly due to the fact that it reacts with oxygen in the air, with most of the nickel on Earth coming from nickel iron meteorites. However, nickel is very abundant in the Earth's core; along with iron it is one of the two main components. Nickel is an important component of stainless steel, and in many superalloys. Copper Copper (Cu) is an element in group 11. Copper is one of the few metals that is not white or gray in color, the only others being gold and caesium. Copper has been used by humans for thousands of years to provide a reddish tint to many objects, and is even an essential nutrient to humans, although too much is poisonous. Copper is also commonly used as a wood preservative or fungicides. Zinc Zinc (Zn) is an element in group 12. Zinc is one of the main components of brass, being used since the 10th century BCE. Zinc is also incredibly important to humans; almost 2 billion people in the world suffer from zinc deficiency. However, too much zinc can cause copper deficiency. Zinc is often used in batteries, aptly named carbon-zinc batteries, and is important in many platings, as zinc is very corrosion resistant. p-block elements Gallium Gallium (Ga) is an element in group 13, under aluminium. Gallium is noteworthy because it has a melting point at about 303 kelvins, right around room temperature. For example, it will be solid on a typical spring day, but will be liquid on a hot summer day. Gallium is an important component in the alloy galinstan, along with tin. Gallium can also be found in semiconductors. Germanium Germanium (Ge) is an element in group 14. Germanium, like silicon above it, is an important semiconductor and is commonly used in diodes and transistors, often in combination with arsenic. Germanium is fairly rare on Earth, leading to its comparatively late discovery. Germanium, in compounds, can sometimes irritate the eyes, skin, or lungs. Arsenic Arsenic (As) is an element in group 15. Arsenic, as mentioned above, is often used in semiconductors in alloys with germanium. Arsenic, in pure form and some alloys, is incredibly poisonous to all multicellular life, and as such is a common component in pesticides. Arsenic was also used in some pigments before its toxicity was discovered. Selenium Selenium (Se) is an element in group 16. Selenium is the first nonmetal in period 4, with properties similar to sulfur. Selenium is quite rare in pure form in nature, mostly being found in minerals such as pyrite, and even then it is quite rare. Selenium is necessary for humans in trace amounts, but is toxic in larger quantities. Bromine Bromine (Br) is an element in group 17 (halogen). It does not exist in elemental form in nature. Bromine is barely liquid at room temperature, boiling at about 330 kelvins. Bromine is also quite toxic and corrosive, but bromide ions, which are relatively inert, can be found in halite, or table salt. Bromine is often used as a fire retardant because many compounds can be made to release free bromine atoms. Krypton Krypton (Kr) is a noble gas, placed under argon and over xenon. Being a noble gas, krypton rarely interacts with itself or other elements; although compounds have been detected, they are all unstable and decay rapidly, and as such, krypton is often used in fluorescent lights. Krypton, like most noble gases, is also used in lighting because of its many spectral lines and the aforementioned reasons. Biological role Many period 4 elements find roles in controlling protein function as secondary messengers, structural components, or enzyme cofactors. A gradient of potassium is used by cells to maintain a membrane potential which enables neurotransmitter firing and facilitated diffusion among other processes. Calcium is a common signaling molecule for proteins such as calmodulin and plays a critical role in triggering skeletal muscle contraction in vertebrates. Selenium is a component of the noncanonical amino acid, selenocysteine; proteins which contain selenocysteine are known as selenoproteins. Manganese enzymes are utilized by both eukaryotes and prokaryotes, and may play a role in the virulence of some pathogenic bacteria. Vanabins, also known as vanadium-associated proteins, are found in the blood cells of some species of sea squirts. The role of these proteins is disputed, although there is some speculation that they function as oxygen carriers. Zinc ions are used to stabilize the zinc finger milleu of many DNA-binding proteins. Period 4 elements can also be found complexed with organic small molecules to form cofactors. The most famous example of this is heme: an iron-containing porphyrin compound responsible for the oxygen-carrying function of myoglobin and hemoglobin as well as the catalytic activity of cytochrome enzymes. Hemocyanin replaces hemoglobin as the oxygen carrier of choice in the blood of certain invertebrates, including horseshoe crabs, tarantulas, and octopuses. Vitamin B12 represents one of the few biochemical applications for cobalt. References Category:Periods (periodic table) Category:Pages containing element color directly
using Ultraviolet.Graphics; using Ultraviolet.Input; using Ultraviolet.Platform; using Ultraviolet.Shims.Android.Graphics; using Ultraviolet.Shims.Android.Input; using Ultraviolet.Shims.Android.Platform; namespace Ultraviolet.Shims.Android { /// <summary> /// Initializes factory methods for the Android platform compatibility shim. /// </summary> internal sealed class AndroidFactoryInitializer : IUltravioletFactoryInitializer { /// <inheritdoc/> public void Initialize(UltravioletContext owner, UltravioletFactory factory) { factory.SetFactoryMethod<SurfaceSourceFactory>((stream) => new AndroidSurfaceSource(stream)); factory.SetFactoryMethod<SurfaceSaverFactory>(() => new AndroidSurfaceSaver()); factory.SetFactoryMethod<IconLoaderFactory>(() => new AndroidIconLoader()); factory.SetFactoryMethod<FileSystemServiceFactory>(() => new FileSystemService()); factory.SetFactoryMethod<ScreenRotationServiceFactory>((display) => new AndroidScreenRotationService(display)); factory.SetFactoryMethod<ScreenDensityServiceFactory>((display) => new AndroidScreenDensityService(display)); factory.SetFactoryMethod<AssemblyLoaderServiceFactory>(() => new AndroidAssemblyLoaderService()); var softwareKeyboardService = new AndroidSoftwareKeyboardService(); factory.SetFactoryMethod<SoftwareKeyboardServiceFactory>(() => softwareKeyboardService); } } }
Q: NodeJS: How to convert 'aggregation'(cursor) object to CSV and return a CSV response from a request using Express? I want to convert the result from aggregate to a csv. In the code (or pseudocode) below the results of the aggregate are stored in variable cursor I want to return a csv as a response ( res.send(csv) ). Do I have to use res.set('Content-Type', 'content-type: text/csv') ? The code below is a mix of NodeJs and pseudocode. Function covert_to_csv indicates my ignorance about the subject. const express = require('express') const app = express(); app.get('/', (req, res) => { let agg=[ /* a query in MongoDB */] MongoClient.connect(URL,(err, client) => { res.set('Content-Type', 'content-type: text/csv'); let collection = client.db('db').collection('col') let cursor = collection.aggregate(agg) let csv_file = covert_to_csv(cursor) csv_file.toArray((error, result) => { res.send(result); }); }); app.listen(port, () => console.log(`listening on port ${port}!`)); Edit: In my original code i am getting a response in json.I run the following code: let agg=[ /* a query in MongoDB */] let cursor = collection.aggregate(agg) cursor.toArray((error, result) => { if(error) { return res.status(500).send(error); res.send(result); I am getting this response from Postman in JSON : [ { "Source": "entso-e", "Dataset": "ActualTotalLoad", "AreaName": "Germany", "AreaTypeCode": "CTY", "MapCode": "DE", "ResolutionCode": "PT15M", "Year": "2018", "Month": "1", "Day": "2", "DateTimeUTC": "2018-01-02 00:00:00.0000000", "ActualTotalLoadValue": "41412.38", "UpdateTimeUTC": "2018-01-02 13:16:19.0000000" }, { "Source": "entso-e", "Dataset": "ActualTotalLoad", "AreaName": "Germany", "AreaTypeCode": "CTY", "MapCode": "DE", "ResolutionCode": "PT15M", "Year": "2018", "Month": "1", "Day": "2", "DateTimeUTC": "2018-01-02 00:45:00.0000000", "ActualTotalLoadValue": "40785.17", "UpdateTimeUTC": "2018-01-02 13:16:19.0000000" }, ..... (more documents) ] A: You can use a module like json2csv to do the job for you. Your example will look something like that const { Parser } = require('json2csv'); app.get('/', function(req, res) { let agg = [/* mongo aggregation */] res.setHeader('Content-Type', 'text/csv'); res.setHeader('Content-Disposition', 'attachment; filename=\"' + 'download-' + Date.now() + '.csv\"'); let cursor = collection.aggregate(agg) const fields = ['Source', 'Dataset', 'Areaname'];//all your field names const json2csvParser = new Parser({ fields }); cursor.toArray((error, result) => { res.send(json2csvParser.parse(result)) }) })
Q: Exit from For loop I want to exit from the for loop after getting the first string. How can I do that? Should I use for loop or something else? for /F "delims=" %%c in ('dumpbin "%%i" /headers ^| findstr "(x86)"') do set Result3=%%c A: You can use GOTO to exit a FOR loop prematurely. Both FOR and FOR /F are terminated immediately when GOTO is executed. for /F "delims=" %%c in ('dumpbin "%%i" /headers ^| findstr "(x86)"') do set Result3=%%c&goto :break :break The FOR /L will sort of exit immediately upon GOTO in that the contents of the DO clause will no longer be executed. But the FOR /L will silently continue to count until it reaches its end condition. If your intent is to immediately leave not only the FOR loop but also exit out of a subroutine or batch script, then it is more efficient to use EXIT /B instead of GOTO :LABEL.
The Morris Ring says there are more than 14,000 morris dancers in the UK Morris dancing could be "extinct" within 20 years because young people are too embarrassed to take part, a UK Morris association has warned. The number of people taking part in the English folk dance is falling while the average age of the dancers is going up. The Morris Ring, which represents 200 troupes, hopes a recruitment drive will revive the flagging tradition. "There is still time for new blood to get ready for the spring fertility offensive," said the ring's Paul Reece. Morris dancing involves teams of dancers - often wearing hats and bells on their legs - wielding handkerchiefs, sticks or swords, to the accompaniment of folk music. It dates back centuries, though its origins are unclear. Once we've lost this part of our culture it will be almost impossible to revive it Charlie Corcoran The Morris Ring Charlie Corcoran, bagman of the Morris Ring, said: "There's a distinct possibility that in 20 years' time there will be nobody left. "It worries me a great deal. Young people are just too embarrassed to take part. "This is a serious situation. The average age of Morris dancing sides is getting older and older. "Once we've lost this part of our culture, it will be almost impossible to revive it." Dancing season The Morris Ring aims to encourage the performance of Morris dancing and maintain its traditions. It says there are more than 14,000 Morris dancers in the UK dancing for more than 800 sides. There is a serious danger that, in less than a few decades, Morris dancing will be confined to the history books Paul Reece The Morris Ring The association hopes younger people will join over the coming months in time for the main dancing season in the spring. Mr Reece, chairman of the ring's advisory council, said: "Such customs and activities were once a common sight around the country. "Today they are carried out by an ever-dwindling stalwart band of enthusiasts who are determined to keep them alive. "But there is a serious danger that, in less than a few decades, Morris dancing will be confined to the history books." Bookmark with: Delicious Digg reddit Facebook StumbleUpon What are these? E-mail this to a friend Printable version
Treatment of anterior skeletal open-bite deformity. Two patients with severe skeletal anterior open-bite have been presented. Treatment of these patients was accomplished mainly by mandibular repositioning (Case 1 by orthodontic means and Case 2 by a combination of surgery and orthodontics) and by an orthodontic change in the mandibular occlusal plane. A review and a discussion of the cause of this deformity were presented.
Familial aggregation of tumors in the three-year experience of a population-based colorectal cancer registry. The familial occurrence of tumors has been investigated in 389 subjects with colorectal cancer by reviewing the clinical data and the genealogical tree of all patients registered in 1984-1986, in the Local Health District, for malignancies of the large bowel. Among first-degree relatives of the registered patients there were 89 cases of colorectal cancer as opposed to 19 in a hospital-based control group matched for age and sex [odds ratio (OR), 7.5, P less than 0.001]. This excess of neoplasms among relatives was particularly evident in siblings (60 versus 7, OR 14.7, P less than 0.001) but it was observed also in parents (27 versus 12, OR 4.2, P less than 0.01). Besides colorectal cancer there was no significant excess of other types of tumor in case families, whereas lung tumors tended to be more frequent in control relatives (32 versus 17). Almost half of the registered patients (182 out of 389) had one or more cases of cancer of any sites among relatives; similarly, in 68 there were one or more relatives affected by (or deceased for) colorectal cancer. Moreover, in 27 patients (7.0%) there were at least three cancers of any sites among relatives and in 15 the excess (two or more) was limited to neoplasms of the large bowel. In patients without or with only one neoplasm among relatives, cancers were mainly located in the left colon; however, cancer of the right colon became relatively more frequent in patients with two or more tumors in close relatives. In conclusion, the present study suggests that in approximately 15-20% of patients registered for colorectal cancer one or more first-degree relatives are affected by neoplasms of the large bowel. This familial occurrence of intestinal malignancies (but not of tumors of other organs) strongly suggests a genetic susceptibility to colorectal cancer in a fraction of these patients. Moreover, in a further subgroup of individuals (approximately 5% of all cases) the familial aggregation of two or more cases of colorectal cancer among relatives (besides the proband) and the frequent location of tumors in the right colon make the diagnosis of Lynch syndrome extremely probable.
--- title: 'Progress Towards Determining the Density Dependence of the Nuclear Symmetry Energy Using Heavy-Ion Reactions' --- Introduction {#intro} ============ The Equation of State (EOS) of isospin asymmetric nuclear matter can be written within the well-known parabolic approximation, which has been verified by all many-body theories, as $$\label{ieos} E(\rho ,\delta )=E(\rho ,\delta =0)+E_{sym}(\rho )\delta ^{2}+\mathcal{O}% (\delta^4),$$ where $\delta\equiv(\rho_{n}-\rho _{p})/(\rho _{p}+\rho _{n})$ is the isospin asymmetry and $E_{sym}(\rho)$ is the density-dependent nuclear symmetry energy. The latter is very important for many interesting astrophysical problems[@lat01], the structure of radioactive nuclei[brown,stone]{} and heavy-ion reactions[@ireview98; @ibook01; @dan02; @ditoro]. Unfortunately, the density dependence of symmetry energy $E_{sym}(\rho)$, especially at supranormal densities, is still poorly known. Predictions based on various many-body theories diverge widely at both low and high densities. In fact, even the sign of the symmetry energy above $3\rho_0$ remains uncertain[@bom1]. Fortunately, heavy-ion reactions, especially those induced by radioactive beams, provide a unique opportunity to pin down the density dependence of nuclear symmetry energy in terrestrial laboratories. Significant progress in determining the symmetry energy at subnormal densities has been made recently both experimentally and theoretically[@betty04; @chen05]. High energy radioactive beams to be available at GSI and RIA will allow us to determine the symmetry energy at supranormal densities. In this talk, we highlight the recent most exciting progress in determining the symmetry energy at subnormal densities and present our predictions on several most sensitive probes of the symmetry energy at supranormal densities. An isospin- and momentum-dependent transport model for nuclear reactions induced by radioactive beams ===================================================================================================== Crucial to the extraction of critical information about the $E_{\mathrm{sym}% }(\rho )$ is to compare experimental data with transport model calculations. We outline here the major ingredients of the version IBUU04 of an isospin- and momentum-dependent transport model for nuclear reactions induced by radioactive beams[@lidas03]. The single nucleon potential is one of the most important inputs to all transport models. Both the isovector (symmetry potential) and isoscalar parts of this potential should be momentum dependent due to the non-locality of strong interactions and the Pauli exchange effects in many-fermion systems. In the IBUU04, we use a single nucleon potential derived from the Hartree-Fock approximation using a modified Gogny effective interaction (MDI)[@das03], i.e., $$\begin{aligned} U(\rho ,\delta ,\vec{p},\tau ,x) &=&A_{u}(x)\frac{\rho _{\tau ^{\prime }}}{% \rho _{0}}+A_{l}(x)\frac{\rho _{\tau }}{\rho _{0}} \nonumber \label{mdi} \\ &+&B(\frac{\rho }{\rho _{0}})^{\sigma }(1-x\delta ^{2})-8\tau x\frac{B}{% \sigma +1}\frac{\rho ^{\sigma -1}}{\rho _{0}^{\sigma }}\delta \rho _{\tau ^{\prime }} \nonumber \\ &+&\frac{2C_{\tau ,\tau }}{\rho _{0}}\int d^{3}p^{\prime }\frac{f_{\tau }(% \vec{r},\vec{p}^{\prime })}{1+(\vec{p}-\vec{p}^{\prime })^{2}/\Lambda ^{2}} \nonumber \\ &+&\frac{2C_{\tau ,\tau ^{\prime }}}{\rho _{0}}\int d^{3}p^{\prime }\frac{% f_{\tau ^{\prime }}(\vec{r},\vec{p}^{\prime })}{1+(\vec{p}-\vec{p}^{\prime })^{2}/\Lambda ^{2}}.\end{aligned}$$In the above $\tau =1/2$ ($-1/2$) for neutrons (protons) and $\tau \neq \tau ^{\prime }$; $\sigma =4/3$; $f_{\tau }(\vec{r},\vec{p})$ is the phase space distribution function at coordinate $\vec{r}$ and momentum $\vec{p}$. The parameters $A_{u}(x),A_{l}(x),B,C_{\tau ,\tau },C_{\tau ,\tau ^{\prime }}$ and $\Lambda $ were obtained by fitting the momentum-dependence of the $% U(\rho ,\delta ,\vec{p},\tau ,x)$ to that predicted by the Gogny Hartree-Fock and/or the Brueckner-Hartree-Fock calculations, the saturation properties of symmetric nuclear matter and the symmetry energy of 30 MeV at normal nuclear matter density $\rho _{0}=0.16$ fm$^{-3}$[@das03]. The incompressibility $K_{0}$ of symmetric nuclear matter at $\rho _{0}$ is set to be 211 MeV. The parameters $A_{u}(x)$ and $A_{l}(x)$ depend on the $x$ parameter according to $A_{u}(x)=-95.98-x\frac{2B}{\sigma +1}$ and $% A_{l}(x)=-120.57+x\frac{2B}{\sigma +1}$. The parameter $x$ can be adjusted to mimic predictions on the $E_{sym}(\rho )$ by microscopic and/or phenomenological many-body theories. The last two terms contain the momentum-dependence of the single-particle potential. The momentum dependence of the symmetry potential stems from the different interaction strength parameters $C_{\tau ,\tau ^{\prime }}$ and $% C_{\tau ,\tau }$ for a nucleon of isospin $\tau $ interacting, respectively, with unlike and like nucleons in the background fields. More specifically, we use $C_{unlike}=-103.4$ MeV and $C_{like}=-11.7$ MeV. As an example, shown in Fig. 1 is the density dependence of the symmetry energy for $x=-2$, $-1$, $0$ and $1$. Systematic analyses of a large number of nucleon-nucleus and (p,n) charge exchange scattering experiments at beam energies below about 100 MeV indicate undoubtedly that the symmetry potential at $\rho _{0}$, i.e., the Lane potential, decreases approximately linearly with increasing beam energy $E_{kin}$ according to $U_{Lane}=a-bE_{kin}$ where $a\simeq 22-34$ MeV and $% b\simeq 0.1-0.2$[@data1; @data2]. This provides a stringent constraint on the symmetry potential. The potential in eq.\[mdi\] meets this requirement very well as seen in Fig. 2 where the symmetry potential $(U_{n}-U_{p})/2\delta $ as a function of momentum and density for the parameter $x=-1$ is displayed. One characteristic feature of the momentum dependence of the symmetry potential is the different effective masses for neutrons and protons in isospin asymmetric nuclear matter, i.e., $$\frac{m_{\tau }^{\ast }}{m_{\tau }}=\left\{ 1+\frac{m_{\tau }}{\hbar ^{2}k}% \frac{dU_{\tau }}{dk}\right\} _{k=k_{\tau }^{F}}^{-1}, \label{mstar}$$where $k_{\tau }^{F}$ is the nucleon Fermi wave number. With the potential in eq. \[mdi\], we found that the neutron effective mass is higher than the proton effective mass and the splitting between them increases with both the density and isospin asymmetry of the medium[@lidas03]. Since both the incoming current in the initial state and the level density of the final state in nucleon-nucleon (NN) scatterings depend on the effective masses of colliding nucleons in medium, the in-medium nucleon-nucleon cross sections are expected to be reduced by a factor $% \sigma _{NN}^{medium}/\sigma _{NN}=(\mu _{NN}^{\ast }/\mu _{NN})^{2}$, where $\mu _{NN}$ and $\mu _{NN}^{\ast }$ are the reduced mass of the colliding nucleon pairs in free-space and in medium, respectively[@sigma]. Thus, because of the reduced in-medium nucleon effective masses and their dependence on the density and isospin asymmetry of the medium, the in-medium NN cross sections are not only reduced compared to their free-space values, the nn and pp cross sections are split and the difference between them grows in more asymmetric matter. We expect the isospin-dependence of the in-medium NN cross sections to play an important role in nuclear reactions induced by neutron-rich nuclei[@li05]. Probing the symmetry energy at subnormal densities with isospin diffusion {#diffusion} ========================================================================= Tsang et al.[@betty04] recently studied the degree of isospin diffusion in the reaction $^{124}$Sn + $^{112}$Sn by measuring[@gsi] $$R_{i}=\frac{2X_{^{124}{Sn}+^{112}{Sn}}-X_{^{124}{Sn}+^{124}{Sn}}-X_{^{112}{Sn% }+^{112}{Sn}}}{X_{^{124}{Sn}+^{124}{Sn}}-X_{^{112}{Sn}+^{112}{Sn}}} \label{Ri}$$where $X$ is the average isospin asymmetry $\left\langle \delta \right\rangle $ of the $^{124}$Sn-like residue. The data is indicated in Fig. 3 together with the time evolutions of $R_{i}$ and the average central densities calculated with $x=-1$ using both the MDI and the soft Bertsch-Das Gupta-Kruse (SBKD) interactions are also shown. It is seen that the isospin diffusion process occurs mainly from about $30$ fm/c to $80$ fm/c corresponding to an average central density from about $1.2\rho _{0}$ to $0.3\rho _{0}$. The experimental data from MSU are seen to be reproduced nicely by the MDI interaction with $x=-1$, while the SBKD interaction with $x=-1$ leads to a significantly lower $R_{i}$ value[@chen05]. Effects of the symmetry energy on isospin diffusion were also studied by varying the parameter $x$[@chen05]. Only with the parameter $x=-1$ the data can be well reproduced. The corresponding symmetry energy can be parameterized as $E_{sym}(\rho )\approx 31.6(\rho /\rho _{0})^{1.05}$. In the present study on isospin diffusion, only the free-space NN cross sections are used and thus effects completely due to the different density dependence of symmetry energy are investigated. As the next step we are currently investigating effects of the in-medium NN cross sections on the isospin diffusion. Probing the symmetry energy at supranormal densities ==================================================== Several probes that are sensitive to the high density behavior of the symmetry energy have been proposed. As an illustration, we present here three most sensitive observables that can be measured in future experiments at RIA and GSI. Pions yields and $\protect\pi ^{-}/\protect\pi ^{+}$ ratio at RIA and GSI {#RIA1} ------------------------------------------------------------------------- At the highest beam energy at RIA, pion production is significant. Pions may thus carry interesting information about the EOS of dense neutron-rich matter[@lipi; @gaopi]. Shown in Fig.4 are the $\pi ^{-}$ and $\pi ^{+}$ yields as a function of the $x$ parameter. It is interesting to see that the $\pi ^{-}$ multiplicity depends more sensitively on the symmetry energy. The $\pi ^{-}$ multiplicity increases by about 20% while the $\pi ^{+}$ multiplicity remains about the same when the $x$ parameter is changed from -2 to 1. The multiplicity of $\pi ^{-}$ is about 2 to 3 times that of $\pi ^{+}$. This is because the $\pi ^{-}$ mesons are mostly produced from neutron-neutron collisions. Moreover, with the softer symmetry energy the high density region is more neutron-rich due to isospin fractionation[@gaopi]. The $\pi ^{-}$ mesons are thus more sensitive to the isospin asymmetry of the reaction system and the symmetry energy. However, one should notice that it is well known that pion yields are also sensitive to the symmetric part of the nuclear EOS. It is thus hard to get reliable information about the symmetry energy from $\pi ^{-}$ yields alone. Fortunately, the $\pi ^{-}/\pi ^{+}$ ratio is a better probe since statistically this ratio is only sensitive to the difference in the chemical potentials for neutrons and protons[@bertsch]. This expectation is well demonstrated in Fig. 5. It is seen that the pion ratio is quite sensitive to the symmetry energy, especially at low transverse momenta. Thus, it is promising that the high density behavior of nuclear symmetry energy $% E_{sym}(\rho )$ can be probed using the $\pi ^{-}/\pi ^{+}$ ratio. Isospin fractionation and n-p differential flow at RIA and GSI {#RIA2} -------------------------------------------------------------- The degree of isospin equilibration or translucency can be measured by the rapidity distribution of nucleon isospin asymmetry $\delta _{free}\equiv (N_{n}-N_{p})/(N_{n}+N_{p})$ where $N_{n}$ ($N_{p}$) is the multiplicity of free neutrons (protons)[@li04a]. Although it might be difficult to measure directly $\delta _{free}$ because it requires the detection of neutrons, similar information can be extracted from ratios of light clusters, such as, $^{3}H/^{3}He$, as demonstrated recently within a coalescence model[@chen03b; @chen04a]. Shown in Fig. 6 are the rapidity distributions of $\delta _{free}$ with (upper window) and without (lower window) the Coulomb potential. It is interesting to see that the $\delta _{free}$ at midrapidity is particularly sensitive to the symmetry energy. As the parameter $x$ increases from $-2$ to $1$ the $\delta _{free}$ at midrapidity decreases by about a factor of 2. Moreover, the forward-backward asymmetric rapidity distributions of $\delta _{free}$ with all four $x$ parameters indicates the apparent nuclear translucency during the reaction[@ligao]. Another observable that is sensitive to the high density behavior of symmetry energy is the neutron-proton differential flow[@li00] $$F_{n-p}^{x}(y)\equiv \sum_{i=1}^{N(y)}(p_{i}^{x}w_{i})/N(y),$$where $w_{i}=1(-1)$ for neutrons (protons) and $N(y)$ is the total number of free nucleons at rapidity $y$. The differential flow combines constructively effects of the symmetry potential on the isospin fractionation and the collective flow. It has the advantage of maximizing the effects of the symmetry potential while minimizing those of the isoscalar potential. Shown in Fig. 7 is the n-p differential flow for the reaction of $^{132}Sn+^{124}Sn$ at a beam energy of 400 MeV/nucleon and an impact parameter of 5 fm. Effects of the symmetry energy are clearly revealed by changing the parameter $x$. Conclusions =========== The density dependence of the symmetry energy is very important for both nuclear physics and astrophysics. Significant progress has been made recently by the heavy-ion community in determining the density dependence of the nuclear symmetry energy. Based on transport model calculations, a number of sensitive probes of the symmetry energy have been found. The momentum dependence in both the isoscalar and isovector parts of the nuclear potential was found to play an important role in extracting accurately the density dependence of the symmetry energy. Comparing with recent experimental data on isospin diffusion from NSCL/MSU, we have extracted a symmetry energy of $E_{sym}(\rho )\approx 31.6(\rho /\rho _{0})^{1.05}$ at subnormal densities. It would be interesting to compare this conclusion with those extracted from studying other observables. More experimental data including neutrons with neutron-rich beams in a broad energy range are needed. Looking forward to experiments at RIA and GSI with high energy radioactive beams, we hope to pin down the symmetry energy at supranormal densities in the near future. This work was supported in part by the US National Science Foundation of the under grant No. PHY 0098805, PHYS-0243571 and PHYS0354572, Welch Foundation grant No. A-1358, and the NASA-Arkansas Space Grants Consortium award ASU15154. L.W. Chen was supported by the National Natural Science Foundation of China grant No. 10105008. The work of G.C. Yong and W. Zuo was supported in part by the Chinese Academy of Science Knowledge Innovation Project (KECK2-SW-N02), Major State Basic Research Development Program (G2000077400), the National Natural Science Foundation of China (10235030) and the Important Pare-Research Project (2002CAB00200) of the Chinese Ministry of Science and Technology. [99]{}
The National Rifle Association appears to be sailing into some uncharted legal waters this week with a lawsuit targeting the Governor of New York and the state’s Department of Financial Services (DFS). The NRA claims that recent “regulatory” actions and advisories issued to banks doing business in New York represent a violation of the group’s First Amendment rights. While attacking the NRA is a proven winner politically for liberals like Cuomo (who is currently engaged in a primary battle, faces a general election in November and has 2020 presidential aspirations), the Governor may have gone too far this time and run afoul of the law. (NRA-ILA) The National Rifle Association of America (“NRA”) today announced that it filed a lawsuit against the New York State Department of Financial Services (“DFS”), New York Governor Andrew Cuomo, and DFS Superintendent Maria T. Vullo alleging violations of the NRA’s First Amendment rights. Filed on May 11, 2018, in the United States District Court for the Northern District of New York, the lawsuit claims that Cuomo, Vullo, and DFS engaged in a “campaign of selective prosecution, backroom exhortations, and public threats” designed to coerce banks and insurance companies to withhold services from the NRA. The NRA argues that such tactics vastly overstep DFS’s regulatory mandate, and seek to suppress the speech of Second Amendment supporters and retaliate against the NRA and others for their political advocacy. The lawsuit seeks millions of dollars in damages to redress harms inflicted by the DFS campaign. “Political differences aside, our client believes the tactics employed by these public officials are aimed to deprive the NRA of its First Amendment right to speak freely about gun-related issues and in defense of the Second Amendment,” says William A. Brewer III, partner at Brewer, Attorneys & Counselors and counsel to the NRA. I’m still not entirely clear how this adds up to a First Amendment issue rather than some sort of suppression of trade question. The maneuvers in question involved an advisory letter sent by DFS to most of the banks and insurance companies doing business in the Empire State. The letter suggested the institutions should take action to avoid “reputational risk” which could supposedly arise from doing business with “gun promotion organizations.” The same day, the Governor himself issued a press release quoting DFS Superintendent Maria T. Vullo in which she urged all insurance companies and banks doing business in New York” to “discontinue their arrangements with the NRA.” The New York Post adds some additional background to the story, citing a recent $7M fine on the NRA’s insurance broker, Lockton Cos. The state claims that Lockton doesn’t have a license to do business in New York. But even if that’s the case, how would that justify an effort to blacklist the NRA from any business with banks and other insurance companies? Perhaps the better question is whether or not it’s legal for a state government to actively press businesses such as banks and insurance companies to cut ties with a group which is engaged in political activism and not breaking any laws. It certainly sounds like New York is doing something illegal here, but I’m hard pressed to say exactly what law is being violated. I’m not finding any similar examples to go by, possibly because this may be entirely unprecedented. Maybe there isn’t a specific law against it because nobody ever expected a state government to act in such a fashion. But a First Amendment violation? We’ll have to wait and see.
Factors predicting survival in advanced T-staged hepatocellular carcinoma patients treated with reduction hepatectomy followed by transcatheter arterial chemoembolization. To evaluate the efficacy of reduction hepatectomy followed by transcatheter arterial chemoembolization (TACE) for advanced T-Staged hepatocellular carcinomas (HCCs). A retrospective analysis of 39 consecutive patients who underwent reduction hepatectomy followed by TACE for advanced T-Staged HCCs was undertaken. Reduction hepatectomies, including 20 major ones, were performed. After a median interval of 30 days, the hepatectomies were followed by TACE using farmorubicin. Actual overall 3-year survival after surgery was 32%. Indocyanine green R(15) > or =15%, preoperative AFP > or =2000 ng/ml, and tumour reduction rate <98% were predictive of decreased overall survival. When the three prognostic factors were used in a scoring system, with one point assigned for each factor, the 3-year survival rates of patients with scores of 0, 1, 2, and 3 were 71%, 40%, 0%, and 0% respectively. Reduction hepatectomy followed by TACE is effective in patients with advanced T-Staged HCCs who have none of the 3 poor prognostic factors. Reduction surgery followed by TACE is one of the options for controlling advanced T-Staged HCCs in patients who are not candidates for curative resection or TACE alone.
My goodness, this is bad. We should expect a lot more from the political class who are voting on important issues such as making major changes to the internet. This is another example of why Americans dislike politicians and think they all deserve to be voted out of office. Senator Feinstein somehow believes that the tech industry supports SOPA/PIPA despite the long list of industry giants who are against it. Co-founders of Netscape, Mozilla Firefox, Google, Twitter, Flickr, Yahoo!, LinkedIn, Huffington Post, YouTube, PayPal, Craigslist, eBay, Wikipedia, and Blogger have all come out against it. Microsoft is against it. Facebook has said that it’s against it. In the debates over SOPA and PROTECT IP (PIPA), one thing that has been clear is that neither California Senator has been any help at all. When asked about this, I’ve been told, multiple times, that despite both being from Northern California, as long-term politicians they’re completely ignorant of technology issues, and “follow the money” down to Southern California. We’ve already written about Zach Carter’s excellent behind the scenes report on the politicking behind SOPA and PROTECT IP, but there’s one ridiculous tidbit that was worth highlighting to show just how incredibly out of touch Senator Dianne Feinstein is. When asked about this issue, Feinstein appeared totally clueless, believing that the tech industry was fine with the bills: When HuffPost asked Feinstein, a Protect IP co-sponsor, if it was difficult for her to navigate the bill with Silicon Valley and Hollywood on opposite sides, she responded: “I don’t believe that they are. I thought we had reconciled the issues. The bill’s been passed out of committee.” The response seems incredible given the outcry from Silicon Valley, and Google in particular, but the complexity of the legislation has left many lawmakers vulnerable to K Street spin. Is she blinded by campaign contributions or is she and her staff oblivious to the world around them? Either way, this is bad news.
Welcome back Nolen. I bet everyone is excited for IB2. Make sure you join the impossible bosses group so you can meet up with everyone. I, myself, won't be around all the time because SC2 overheats my computer generally so I can't leave it open all the time but I'll join games here and there.
A storage system is a computer that provides storage service relating to the organization of information on storage devices, such as disks. The storage system may be deployed within a network attached storage (NAS) environment and, as such, may be embodied as a file server. The file server or filer includes a storage operating system that implements a file system to logically organize the information as a hierarchical structure of directories and files on the disks. Each “on-disk” file may be implemented as a set of data structures, e.g., disk blocks, configured to store information. A directory, on the other hand, may be implemented as a specially formatted file in which information about other files and directories are stored. A filer may be further configured to operate according to a client/server model of information delivery to thereby allow many clients to access files stored on a server, e.g., the filer. In this model, the client may comprise an application, such as a database application, executing on a computer that “connects” to the filer over a computer network, such as a point-to-point link, shared local area network (LAN), wide area network (WAN), or virtual private network (VPN) implemented over a public network such as the Internet. Each client may request the services of the file system on the filer by issuing file system protocol messages to the filer over the network. A common type of file system is a “write-in-place” file system, an example of which is the conventional Berkeley fast file system. In a write-in-place file system, the locations of the data structures, such as inodes and data blocks, on disk are typically fixed. An inode is a data structure used to store information, such as meta-data, about a file, whereas the data blocks are structures used to store the actual data for the file. The information contained in an inode may include, e.g., ownership of the file, access permission for the file, size of the file, file type and references to locations on disk of the data blocks for the file. The references to the locations of the file data are provided by pointers, which may further reference indirect blocks that, in turn, reference the data blocks, depending upon the quantity of data in the file. Changes to the inodes and data blocks are made “in-place” in accordance with the write-in-place file system. If an update to a file extends the quantity of data for the file, an additional data block is allocated and the appropriate inode is updated to reference that data block. Another type of file system is a write-anywhere file system that does not overwrite data on disks. If a data block on disk is retrieved (read) from disk into memory and “dirtied” with new data, the data is stored (written) to a new location on disk to thereby optimize write performance. A write-anywhere file system may initially assume an optimal layout such that the data is substantially contiguously arranged on disks. The optimal disk layout results in efficient access operations, particularly for sequential read operations, directed to the disks. A particular example of a write-anywhere file system that is configured to operate on a filer is the SpinFS file system available from Network Appliance, Inc. of Sunnyvale, Calif. The SpinFS file system utilizes a write anywhere technique for user and directory data but writes metadata in place. The SpinFS file system is implemented within a storage operating system having a protocol stack and associated disk storage. Disk storage is typically implemented as one or more storage “volumes” that comprise physical storage disks, defining an overall logical arrangement of storage space. Currently available filer implementations can serve a large number of discrete volumes (150 or more, for example). Each volume is associated with its own file system and, for purposes hereof, volume and file system shall generally be used synonymously. The disks within a volume may be organized as one or more groups of Redundant Array of Independent (or Inexpensive) Disks (RAID). RAID implementations enhance the reliability/integrity of data storage through the redundant writing of data “stripes” across a given number of physical disks in the RAID group, and the appropriate caching of parity information with respect to the striped data. As described herein, a volume typically comprises at least one data disk and one associated parity disk (or possibly data/parity) partitions in a single disk) arranged according to a RAID 4, or equivalent high-reliability, implementation. In other examples, disk storage may be organized in non-RAID configurations including, for example, just a bunch of disks (JBOD). As such, the description of RAID should be taken as exemplary only. A common feature of a write-anywhere file systems is the ability to create a point in time image of a data container, such as a file system or some subset thereof. One example of the creation of point in time persistent images is described in U.S. Pat. No. 5,819,292, entitled, METHOD FOR MAINTAINING CONSISTENT STATES OF A FILE SYSTEM AND FOR CREATING USER-ACCESSIBLE READ-ONLY COPIES OF A FILE SYSTEM, by David Hitz et al, the contents of which are hereby incorporated by reference. Another example of the creation of point-in-time persistent images of a file system (a “clone”) is a conventional cloning process utilized in file systems, such as the exemplary Spin FS file system available from Network Appliance, Inc. In the Spin FS file system, disk storage is organized into storage pools, which are further divided into virtual file systems (VFS). Each VFS contains, at its top level, a VFS inode that includes pointers to additional data blocks containing inodes and to indirect blocks that, in turn, reference additional data blocks containing inodes. These inodes are, in turn, the top-level data structures of individual files and/or directories within the VFS. The conventional cloning process for use with the Spin FS File System is described in U.S. Pat. No. 6,868,417, issued on Mar. 15, 2005, entitled, MECHANISM FOR HANDLING FILE LEVEL AND BLOCK LEVEL REMOTE FILE ACCESSES USING THE SAME SERVER, by Michael L. Kazar, et al, the contents of which are hereby incorporated by reference. Here, when a VFS is cloned, all inodes in the VFS are copied to create the clone, including all indirect blocks pointing to (referencing) inodes. These inode blocks referenced by the VFS inode comprise an inode file describing the VFS. The inode file comprises a plurality of inodes, each of which represents a file or directory. A VFS may contain a very large number (e.g., millions or billions) of individual files. Accordingly, the time required to copy each inode of a file (and/or directory) during the cloning process may be on the order of tens of seconds, during which time the file data is inaccessible by clients. Loss of data access for such a relatively long period of time (e.g., tens of seconds) is undesirable, especially in systems wherein a clone is created on a regular basis, e.g., every hour.
Car 0.00 0 1.7845810065653662 449.07 181.95 477.69 198.76 1.5368458315549802 1.6981685825349235 3.8811684941277886 -14.17 2.44 69.92 1.5846288918213285 0.99999785 Truck 0.00 3 -1.4383072266962866 344.43 153.85 409.86 204.27 3.1160348257603836 2.627757258526637 11.173461257878447 -20.51 2.63 64.17 -1.7476652130149928 0.89951116 Truck 0.00 1 -1.7920579771187644 384.36 157.25 436.12 200.61 2.9954598745885086 2.5713861557185935 10.684592831346894 -20.48 2.73 74.53 -2.0602277108933955 0.7473338 DontCare -1 -1 1.958500520386968 510.60 175.02 574.18 186.52 1.476933233794422 1.7520652257563019 4.253406899176635 -1000 -1000 -1000 2.7438986837844164 0.556388 DontCare -1 -1 -1.2097174982216696 644.98 175.02 652.31 190.69 1.5313663728354883 1.5881231569410705 3.760980377100506 -1000 -1000 -1000 -0.42431933482422135 0.86901116
part of '../module.dart'; // 评论 Handler msg_comment = (query, cookie) { final data = { 'beforeTime': query['beforeTime'] ?? "-1", 'limit': query['limit'] ?? 30, 'total': "true", 'uid': query['uid'] }; return request('POST', 'https://music.163.com/api/v1/user/comments/${query['uid']}', data, crypto: Crypto.weapi, cookies: cookie); }; // @我 Handler msg_forwards = (query, cookie) { final data = { 'offset': query['offset'] ?? 0, 'limit': query['limit'] ?? 30, 'total': "true" }; return request('POST', 'https://music.163.com/api/forwards/get', data, crypto: Crypto.weapi, cookies: cookie); }; // 发送私信 Handler send_msg = (query, cookie) { final data = { 'id': 0, 'type': 'text', 'msg': query['msg'], 'userIds': '[' + query['userId'] + ']' }; return request('POST', 'https://music.163.com/weapi/msg/private/send', data, crypto: Crypto.weapi, cookies: cookie); }; // 通知 Handler msg_notice = (query, cookie) { final data = { 'offset': query['offset'] ?? 0, 'limit': query['limit'] ?? 30, 'total': "true" }; return request('POST', 'https://music.163.com/api/msg/notices', data, crypto: Crypto.weapi, cookies: cookie); }; // 私信内容 Handler msg_private_history = (query, cookie) { final data = { 'userId': query['uid'], 'offset': query['offset'] ?? 0, 'limit': query['limit'] ?? 30, 'total': "true" }; return request('POST', 'https://music.163.com/api/msg/private/history', data, crypto: Crypto.weapi, cookies: cookie); }; // 私信 Handler msg_private = (query, cookie) { final data = { 'offset': query['offset'] ?? 0, 'limit': query['limit'] ?? 30, 'total': "true" }; return request('POST', 'https://music.163.com/api/msg/private/users', data, crypto: Crypto.weapi, cookies: cookie); };
Glutamic acid decarboxylase mRNA in the suprachiasmatic nucleus of rats housed in constant darkness. This study demonstrates that the levels of the mRNAs encoding the two isoforms of glutamic acid decarboxylase (GAD) (i.e., GAD65 and GAD67) do not differ over the circadian activity cycle in the suprachiasmatic nucleus (SCN) of rats housed in constant darkness. These data indicate that the rhythmic expression of GAD56 mRNA previously observed in animals housed in a light:dark cycle [K.L. Huhman, A.C. Hennessey, H.E. Albers, Rhythms of glutamic acid decarboxylase mRNA in the suprachiasmatic nucleus, J. Biol. Rhythms 11 (1996) 311-316.] is the result of the activity of retinal afferents.
Q: How can I get ServerAlias to work? I have an Ubuntu server with apache2, where I host a small community. The domain for this is (as an example) domain.tld. I Try to add a simple ServerAlias that allow users to append a www-prefix, like this: www.domain.tld I have read all documentation I could find, but can not get it to work. Here is the default file in Apache (slightly modified from the original default): <VirtualHost *:80> ServerAdmin admin@localhost ServerName domain.tld ServerAlias www.domain.tld DocumentRoot /var/www <Directory /> Options FollowSymLinks AllowOverride None </Directory> <Directory /var/www/> Options Indexes FollowSymLinks MultiViews AllowOverride None Order allow,deny allow from all </Directory> ScriptAlias /cgi-bin/ /usr/lib/cgi-bin/ <Directory "/usr/lib/cgi-bin"> AllowOverride None Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch Order allow,deny Allow from all </Directory> ErrorLog /var/log/apache2/error.log # Possible values include: debug, info, notice, warn, error, crit, # alert, emerg. LogLevel warn CustomLog /var/log/apache2/access.log combined Alias /doc/ "/usr/share/doc/" <Directory "/usr/share/doc/> Options Indexes MultiViews FollowSymLinks AllowOverride None Order deny,allow Deny from all Allow from 127.0.0.0/255.0.0.0 ::1/128 </Directory> </VirtualHost> Any help with this problem is highly appreciated! A: Try setting it like this .... ServerName domain.tld ServerAlias www.domain.tld ServerName being the "main" name and ServerAlias being any additional names you want the vhost to respond to.
Different predictors of neurological worsening in different causes of stroke. To investigate clinical determinants of neurological worsening and to delineate its predictors. Restrospective analysis of the data from the Lausanne Stroke Registry. A total of 3038 patients with first-ever stroke consecutively admitted to a primary-care stroke center. Neurological worsening in the acute phase of stroke. Neurological worsening was observed in 38% of 300 patients with brain hemorrhage, 34% of 1968 patients with noncardioembolic infarction, and 15% of 770 patients with cardioembolic infarction (P<.001). Neurological worsening was significantly less frequent in patients with small-artery disease than in those with large-artery atherosclerosis or other causes. A logistic multiple regression model in patients with noncardioembolic infarction showed age less than 65 years, hypertension, lesion outside the superficial anterior circulation, absence of transient ischemic attack, and reduced level of consciousness as the independent factors in the patients with small-artery disease, while it showed involvement of the posterior circulation and reduced level of consciousness in the patients with large-artery atherosclerosis. Severe functional disability or death was more common in patients with neurological worsening, both in patients with large-artery atherosclerosis and in those with small-artery disease (18% vs 9%; P<.001). Determinants of neurological worsening may include causative aspects rather than just the evolution of the ischemic or hemorrhagic process itself. For a better comprehension and treatment of neurological worsening, the causative and pathophysiological conditions underlying stroke should be differentiated as early as possible.
Q: How much did a transatlantic telegram cost in 1914? How much did it cost to send a transatlantic telegram – if the specifics matter, say from New York to Berlin – in 1914? (Early 1914, before the war disrupted communications.) How much per word, and was there a minimum number of words? A: The first book google hit for "cablegram price" is The Bolsheviks: Twilight of the Romanov Dynasty by John D. Loscher which contains a discussion of the prices and comparison to today's money. If I understand it correctly, it is one shilling a word and "five letters in conjunction counted as one word". One shilling (1/20 of pound sterling) was $3.11 of "American money" at the time of writing (published 2009). So a fifteen word cablegram from England to America was worth $46.65 in "today's money". According to this commerce report from 1915 the minimum charge for week-end messages from Australia to USA 12s2d ($2.94) for 19 words. Deferred cablegrams cost 1s2d (28 cents) per word and full-rate messages 2s4d (57 cents) per word. Note that s is a shilling and d is a penny. This citation agree with the rate in the first quote which was for 1914. A thorough discussion of various pricing options is available in Cable Services by Bill Glover (link by Pieter Geerkens). It will explain what deferred and weekend, as well as other types of telegrams and the associated rates mean. They appeared just before the first world war. For example, the weekend telegram a minimum of 20 or 25 words paid for and in plain language. This telegram would only be delivered (posted) on the Monday following the day it was handed in. while the deferred telegram A minimum of five words must be paid for, they must be in plain language and in the language of the country of origin or destination or of a language specified by the relevant telegraph company. This link also affirms the rate as 1s0d per word. A reduction to 9d came in 1923 because of competition from wireless. Further discussion of the evolution of the pricing agreements is available in The cost of a telegram: the evolution of the international regulation of the telegraph regulation of the telegraph by Alan J. Richardson (link also by courtesy of Pieter Geerkens). But I did not find the actual numbers for transatlantic cable messages there. A: Partial answer. Source for information would be postal agreements of the Universal Postal Union, where rates and conditions were set for international fees. Telegrams fees were often based on a combination of local, (possible) transit and end country fees, which changed with time. The rates are given in gold (French) francs (FF) 1.25 FF = 1 Mark (M) = 1 Shilling = 1.17 Kronen (Austria- Hungry) 20 M = 1 £ = 20 Schillings = 25 FF (Standard Gold coins) 4.20 M = 1 US$ 1 US$ = 5.25 FF In Germany the minimum was 10 words (or a base fee plus a word fee). 1 word had a maximum of 15 letters. So finding a postal agreement valid 1914 should give you the needed information to work out a realistic cost. Sources: Liste der Wechselkurse (Goldstandard) – Wikipedia A: Partial answer. Here are the telegram rates from Austria in 1913, found on page 226 of Józef Czech's Krakow Calendar for 1913 (the rates in the 1914 edition are the same), expressed in Austro–Hungarian hellers (1/100 of a krone) for telegrams 3–30 words long and for each subsequent word. The telegram form cost 2 hellers. According to a table on page 223, 1 US dollar was worth 4.96 Austro–Hungarian kronen. However, there are no trans-Atlantic rates in the table, whose columns read: local, Principality of Liechtenstein, Austria, Hungary, Bosnia, Herzegovina, Germany England, Ireland, Algeria, Tunisia Denmark, Luxembourg Bulgaria, Monaco, France, Corsica, Italy, Andorra, the Netherlands Montenegro, Serbia, Romania, Switzerland Asiatic Turkey, Cyprus Spain, European Turkey via Bosnia Corfu via Trieste, Belgium Malta Norway Portugal, Gibraltar continental Greece, Poros, Euboea, European Russia, Sweden, Caucasus. [
//----------------------------------------------------------------------- // <copyright file="Wmi.cs">(c) http://www.codeplex.com/MSBuildExtensionPack. This source is subject to the Microsoft Permissive License. See http://www.microsoft.com/resources/sharedsource/licensingbasics/sharedsourcelicenses.mspx. All other rights reserved.</copyright> //----------------------------------------------------------------------- namespace MSBuild.ExtensionPack.Management { using System; using System.Collections.Generic; using System.Globalization; using System.Linq; using System.Management; using Microsoft.Build.Framework; using Microsoft.Build.Utilities; /// <summary> /// <b>Valid TaskActions are:</b> /// <para><i>Execute</i> (<b>Required: </b> Class, Namespace, Method <b> Optional: </b>Instance, MethodParameters <b>Output: </b>ReturnValue)</para> /// <para><i>Query</i> (<b>Required: </b> Class, Properties <b>Output: </b>Info (ITaskItem))</para> /// <para><b>Remote Execution Support:</b> Yes</para> /// </summary> /// <example> /// <code lang="xml"><![CDATA[ /// <Project ToolsVersion="4.0" DefaultTargets="Default" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> /// <PropertyGroup> /// <TPath>$(MSBuildProjectDirectory)\..\MSBuild.ExtensionPack.tasks</TPath> /// <TPath Condition="Exists('$(MSBuildProjectDirectory)\..\..\Common\MSBuild.ExtensionPack.tasks')">$(MSBuildProjectDirectory)\..\..\Common\MSBuild.ExtensionPack.tasks</TPath> /// </PropertyGroup> /// <Import Project="$(TPath)"/> /// <Target Name="Default"> /// <ItemGroup> /// <WmiProps Include="BIOSVersion"/> /// <WmiProps Include="CurrentLanguage"/> /// <WmiProps Include="Manufacturer"/> /// <WmiProps Include="SerialNumber"/> /// <Wmi2Props Include="InstanceName"/> /// <!-- Note that #~# is used as a separator--> /// <WmiExec Include="Description#~#ExtensionPack Description"/> /// <WmiExec2 Include="Name#~#MyNewShare;Path#~#C:\demo;Type#~#0"/> /// <WmiExec3 Include="CommandLine#~#calc.exe"/> /// </ItemGroup> /// <!-- Start the Calculator --> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Execute" Class="Win32_Process" Method="Create" MethodParameters="@(WmiExec3)" Namespace="\root\CIMV2"> /// <Output TaskParameter="ReturnValue" PropertyName="Rval2"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="ReturnValue: $(Rval2)"/> /// <!-- Create a share --> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Execute" Class="Win32_Share" Method="Create" MethodParameters="@(WmiExec2)" Namespace="\root\CIMV2"> /// <Output TaskParameter="ReturnValue" PropertyName="Rval2"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="ReturnValue: $(Rval2)"/> /// <!-- Set share details using the WmiExec ItemGroup info--> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Execute" Class="Win32_Share" Method="SetShareInfo" Instance="Name='ashare'" MethodParameters="@(WmiExec)" Namespace="\root\CIMV2"> /// <Output TaskParameter="ReturnValue" PropertyName="Rval"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="ReturnValue: $(Rval)"/> /// <!-- Stop a service --> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Execute" Class="Win32_Service" Method="StopService" Instance="Name='SQLSERVERAGENT'" Namespace="\root\CIMV2"> /// <Output TaskParameter="ReturnValue" PropertyName="Rval2"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="ReturnValue: $(Rval2)"/> /// <!-- Query the Bios properties --> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Query" Class="Win32_BIOS" Properties="@(WmiProps)" Namespace="\root\cimv2"> /// <Output TaskParameter="Info" ItemName="Info"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="WMI Info for Win32_BIOS on %(Info.Identity): BIOSVersion=%(Info.BIOSVersion), CurrentLanguage=%(Info.CurrentLanguage), Manufacturer=%(Info.Manufacturer), SerialNumber=%(Info.SerialNumber)"/> /// <!-- Query the server settings properties --> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Query" Class="ServerSettings" Properties="@(Wmi2Props)" Namespace="\root\Microsoft\SqlServer\ComputerManagement"> /// <Output TaskParameter="Info" ItemName="Info2"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="WMI Info for ServerSettings on %(Info2.Identity): InstanceName=%(Info2.InstanceName)"/> /// <!-- Query a remote server --> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Query" MachineName="AREMOTESERVER" UserName="ADOMAIN\AUSERNAME" UserPassword="APASSWORD" Class="Win32_BIOS" Properties="@(WmiProps)" Namespace="\root\cimv2"> /// <Output TaskParameter="Info" ItemName="Info2"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="WMI Info for %(Info2.Identity): BIOSVersion=%(Info2.BIOSVersion), CurrentLanguage=%(Info2.CurrentLanguage), Manufacturer=%(Info2.Manufacturer), SerialNumber=%(Info2.SerialNumber)"/> /// <!-- Let's stop Paint.net --> /// <ItemGroup> /// <WmiProps2 Include="Name"/> /// <WmiProps2 Include="ProcessID"/> /// </ItemGroup> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Query" Class="Win32_Process WHERE Name='paintdotnet.exe'" Namespace="\root\CIMV2" Properties="@(WmiProps2)" MachineName="192.168.0.6"> /// <Output TaskParameter="Info" ItemName="Info"/> /// </MSBuild.ExtensionPack.Management.Wmi> /// <Message Text="WMI Info for Win32_Processes: Name: %(Info.Name), ProcessID: %(Info.ProcessID)"/> /// <Message Text="Stopping Paint.NET" Condition="%(Info.ProcessID) != ''"/> /// <MSBuild.ExtensionPack.Management.Wmi TaskAction="Execute" Class="Win32_Process" Method="Terminate" Namespace="\root\CIMV2" Instance="Handle=%(Info.ProcessID)" MachineName="192.168.0.6" Condition="%(Info.ProcessID) != ''"/> /// </Target> /// </Project> /// ]]></code> /// </example> public class Wmi : BaseTask { private List<ITaskItem> info; private List<ITaskItem> properties; /// <summary> /// Sets the namespace. /// </summary> [Required] public string Namespace { get; set; } /// <summary> /// Gets the WMI info. /// </summary> [Output] public ITaskItem[] Info { get { return this.info.ToArray(); } set { this.info = new List<ITaskItem>(value); } } /// <summary> /// Sets the WMI class. /// </summary> [Required] public string Class { get; set; } /// <summary> /// Gets the ReturnValue for Execute /// </summary> [Output] public string ReturnValue { get; set; } /// <summary> /// Sets the Method used in Execute /// </summary> public string Method { get; set; } /// <summary> /// Sets the MethodParameters. Use #~# separate name and value. /// </summary> public ITaskItem[] MethodParameters { get; set; } /// <summary> /// Sets the Wmi Instance used in Execute /// </summary> public string Instance { get; set; } /// <summary> /// An Item Collection of Properties to get /// </summary> public ITaskItem[] Properties { get { return this.properties.ToArray(); } set { this.properties = new List<ITaskItem>(value); } } /// <summary> /// Performs the action of this task. /// </summary> protected override void InternalExecute() { switch (this.TaskAction) { case "Execute": this.ExecuteWmi(); break; case "Query": this.Query(); break; default: this.Log.LogError(string.Format(CultureInfo.CurrentCulture, "Invalid TaskAction passed: {0}", this.TaskAction)); return; } } private void ExecuteWmi() { this.GetManagementScope(this.Namespace); string managementPath = this.Class; if (!string.IsNullOrEmpty(this.Instance)) { managementPath += "." + this.Instance; using (var classInstance = new ManagementObject(this.Scope, new ManagementPath(managementPath), null)) { // Obtain in-parameters for the method ManagementBaseObject inParams = classInstance.GetMethodParameters(this.Method); this.LogTaskMessage(MessageImportance.Low, string.Format(CultureInfo.CurrentCulture, "Method: {0}", this.Method)); if (this.MethodParameters != null) { // Add the input parameters. foreach (string[] data in this.MethodParameters.Select(param => param.ItemSpec.Split(new[] { "#~#" }, StringSplitOptions.RemoveEmptyEntries))) { this.LogTaskMessage(MessageImportance.Low, string.Format(CultureInfo.CurrentCulture, "Param: {0}. Value: {1}", data[0], data[1])); inParams[data[0]] = data[1]; } } // Execute the method and obtain the return values. ManagementBaseObject outParams = classInstance.InvokeMethod(this.Method, inParams, null); if (outParams != null) { this.ReturnValue = outParams["ReturnValue"].ToString(); } } } else { using (ManagementClass mgmtClass = new ManagementClass(this.Scope, new ManagementPath(managementPath), null)) { // Obtain in-parameters for the method ManagementBaseObject inParams = mgmtClass.GetMethodParameters(this.Method); this.LogTaskMessage(MessageImportance.Low, string.Format(CultureInfo.CurrentCulture, "Method: {0}", this.Method)); if (this.MethodParameters != null) { // Add the input parameters. foreach (string[] data in this.MethodParameters.Select(param => param.ItemSpec.Split(new[] { "#~#" }, StringSplitOptions.RemoveEmptyEntries))) { this.LogTaskMessage(MessageImportance.Low, string.Format(CultureInfo.CurrentCulture, "Param: {0}. Value: {1}", data[0], data[1])); inParams[data[0]] = data[1]; } } // Execute the method and obtain the return values. ManagementBaseObject outParams = mgmtClass.InvokeMethod(this.Method, inParams, null); if (outParams != null) { this.ReturnValue = outParams["ReturnValue"].ToString(); } } } } /// <summary> /// Gets the remote info. /// </summary> private void Query() { this.info = new List<ITaskItem>(); this.GetManagementScope(this.Namespace); this.LogTaskMessage(string.Format(CultureInfo.CurrentCulture, "Executing WMI query: SELECT * FROM {0}", this.Class)); ObjectQuery query = new ObjectQuery("SELECT * FROM " + this.Class); using (ManagementObjectSearcher searcher = new ManagementObjectSearcher(this.Scope, query)) { ManagementObjectCollection queryCollection = searcher.Get(); foreach (ManagementObject m in queryCollection) { ITaskItem item = new TaskItem(this.MachineName); foreach (ITaskItem prop in this.Properties) { try { this.LogTaskMessage(string.Format(CultureInfo.CurrentCulture, "Extracting Property: {0}", prop.ItemSpec)); string value = string.Empty; // sometimes the properties might be arrays..... try { string[] propertiesArray = (string[])m[prop.ItemSpec]; value = propertiesArray.Aggregate(value, (current, arrValue) => current + (arrValue + "~~~")); value = value.Remove(value.Length - 3, 3); } catch { value = m[prop.ItemSpec].ToString(); } item.SetMetadata(prop.ItemSpec, value + string.Empty); } catch { this.LogTaskWarning(string.Format(CultureInfo.CurrentCulture, "Property Not Found: {0}", prop.ItemSpec)); } } this.info.Add(item); } } } } }
Q: User privilege considerations when executing terminal code in Objective-C I am writing an application that will update the firmware on a piece of particular hardware. This application will therefore be run on a large number of different OSX systems around the world, so it'd like to make sure I get it right first time. The application will simply run a series of terminal commands quietly, in the background. What I'd like to know is: what user privilege/access issues should I be considering when writing an application that will be run on a number of different systems? It's not a very specific question, I know, but I'm trying to gauge what sort of issues I should be expecting. A: For anyone that reads this, I needed to consider root access, for which i wrote a helper tool that has admin rights: http://www.bdunagan.com/2008/11/23/sudo-nstasks-with-mac-os-xs-security-framework/
Use of biotinylated 17beta-estradiol in enzyme-immunoassay development: spacer length and chemical structure of the bridge are the main determinants in simultaneous streptavidin-antibody binding. 17beta-estradiol (E2) concentrations are in the low pg/ml range in plasma. To develop a sensitive enzyme immunoassay (EIA) for E2-determination a highly specific antibody raised against a 6-carboxymethyl (CMO)-E2-bovine serum albumine conjugate was used. Based on 6-CMO-E2 and 6-amino-E2, four biotinylated tracers with two different spacer lengths between E2 and biotin were synthesized using biotinylation reagents in one step reactions. All amino-based tracers were unsuitable for assay development because the antibody binding was too weak compared to the analyte E2. For 6-CMO-based tracers the simultaneous binding of the tracer to the antibody and streptavidin seems to be the determining step in the procedure depending on incubation temperature and spacer lengths. While a short spacer of 9 carbon atoms was susceptible to room temperature, a longer spacer of 16 carbon atoms showed nearly the same results for incubation at 4 degrees C or at room temperature. The absolute detection limit of this system was 0.63 pg/well. For sample clean-up, porcine plasma was solvent-extracted and depending on the initial plasma volume further purified by solvent partition. Determination of reproducibility resulted in intraassay coefficients of variation of 13% and 5.3% for samples with E2-levels of 15 pg/ml and 236 pg/ml, respectively. Measurement of E2-spiked blood plasma revealed recoveries of 83% up to 100% for E2 concentrations between 50 pg/ml and 1000 pg/ml. Only for the lowest concentration (20 pg/ml) a recovery of 58% was observed. Correlation of the EIA with an established radio immunoassay resulted in r=0.991 using the same antibody.
Listening to the sounds of gravity A new effort put forth at Syracuse University seeks to build a supercomputer … One of the more interesting predictions of Einstein's general relativity is the existence of gravity waves. Relativity predicts that not only will massive objects warp the very fabric of spacetime, but that sudden variations will result in waves in spacetime—gravity waves—that will propagate outward at the speed of light. According to the Gravitational Wave Group at Syracuse University: "By measuring gravitational waves, we hope to learn about systems that cannot be observed with existing means, such as optical, radio, infrared, etc." "Hey, as long as you don't make me smell Uranus." Sounds great, until one tries to figure out how exactly to measure perturbations in the fabric of the universe itself. Scientists from around the world hope to detect this phenomenon by attempting to measure minute differences in the time it takes light to travel down two perpendicular arms of a large scale interferometer (LIGO). Even with one such instrument, one must analyze the immense amounts of data produced. According to Duncan Brown, assistant professor of physics at Syracuse, "Looking for gravitational waves is like listening to the universe. Different kinds of events produce different wave patterns. We want to try to extract a wave pattern—a special sound—that matches our model from all of the noise in the LIGO data." To do this, Syracuse is building a dedicated supercomputer to listen to the sounds of the Universe. The supercomputer will be dubbed SUGAR—SU Gravitational and Relativity Cluster—and will exist to process data from the LIGO observatories. SUGAR will consist of 80 systems containing 320 CPUs, 640GB of RAM, and a whopping 96TB of disk space to store the raw data. The team hopes to have the system up and running by the end of the month. However, before they can start listening for black holes, they need to figure out what a black hole sounds like. Working in collaboration with the Simulating eXtreme Spacetimes project, the researchers plan to simulate the sounds of two black holes colliding. With an idea of what to look or listen for, researchers can begin to examine the universe in a whole new light—or octave. Matt Ford / Matt is a contributing writer at Ars Technica, focusing on physics, astronomy, chemistry, mathematics, and engineering. When he's not writing, he works on realtime models of large-scale engineering systems.
Markspersons have long used targets for honing their marksmanship skills and competing with other markspersons. While target devices exist, there is a need for a mechanical target device that is accurate, easy to transport and set up and requires no power source (other than the force of a projectile) to operate. The lone marksperson utilizes a target to hone his/her skills and has a need for a field target that can be easily activated and reset from a remote location. These same needs are shared by markspersons participating in a target competition. In addition, competition participants need a device that accurately records the first target hit and thus limits the opportunity for error and dispute.
1. Technical Field The present invention relates to electrical beverage makers, and is particularly, although not exclusively, applicable to electric coffee makers. 2. Background Information The type of electric beverage maker with which the invention is broadly concerned is exemplified in the Applicant's WO 00/30514, and comprises, a first chamber for receiving a liquid to be heated. A second chamber is arranged on top of this first chamber, and receives the e.g. coffee grounds. A fluid transfer pipe extends between the first and the second chambers such that they are in fluid communication with one another. In operation, liquid placed in the first chamber is heated by an electric heater associated with the base of the chamber. As the temperature of the liquid rises, the pressure in that chamber increases, until the liquid is forced to rise up the liquid transfer tube into the second chamber, where it infuses with the grounds. After a time, the level of the liquid in the first chamber drops to the extent that a portion of the base becomes exposed. In the absence of any liquid to cool the base or heater in that region, the temperature of the base or heater rises rapidly, causing a thermally sensitive control associated with the base to operate and reduce or interrupt the power supply to the heater. The temperature of the first chamber then begins to decrease and steam begins to condense on the inside of the chamber. A partial vacuum is formed in the first chamber causing the infused beverage to be sucked back from the second chamber down the liquid transfer tube into the first chamber. Although the arrangements of WO 00/30514 may be implemented using any type of electric heater, the application describes a number of specific arrangements which are particularly suitable for use in connection with a thick film heater. The Applicants have now developed certain further modifications to the apparatus which are specifically adapted for use in conjunction with sheathed element heaters.
INTRODUCTION {#sec1-1} ============ Medicinal plants in India have been screened for contraceptive potential and anti-fertility effects, since the country has always been concerned about population explosion. The probable male/female antifertility effects arising from short or long term exposure of certain common and valuable Indian medicinal plants are published in scientific literature; but unfortunately, the outcomes of research investigations are more often complicated by scientists' compulsions to report positive results. As Rob Verpoorte (Editor-in-Chief, *Journal of Ethnopharmacology*) emphasizes, "We must be objective in reporting our results, if one measures an activity in the mM range for a pure compound or mg/ml range for an extract, that is a finding, a number, but it does not mean that we can say that a compound or extract is active, or has an activity. That can only be discussed by comparing the results with proper controls and also taking into account the assays used."\[[@ref1]\] A cursory look at the published reproductive toxicity studies on a few medicinal herbs not only draws attention to the contradictory findings by various investigators, but also the startling differences in terms of test substances used, their standardization, and adopted test methodologies etc.\[[@ref2]--[@ref7]\] Detailed description of herbal extract/formulation in scientific papers now seems to be essential, and no longer "add-on information," since peer-reviewed journals of international repute consider them mandatory requirements. The journal *Phytomedicine* (*International Journal of Phytotherapy and Phytopharmacology*), in its "instructions to authors," explains that "the extract being reported with pharmacological activity must have some type of standardization. The standardization can be carried out by means of a High Performance Liquid Chromatography (HPLC) fingerprint or quantitative assessment of known bioactive compounds. A qualitative HPLC-fingerprint analysis for extracts whose bioactive constituents are unknown may be used". Without standardization of an extract, the journal further states that results cannot be accepted for publication.\[[@ref8]\] *Planta Medica*, another leading journal in the field of medicinal plants, considers papers for publication only if preparation of the extracts is clearly described and supported with adequate analytical studies. \[[@ref9]\] Researchers should ensure that herbal extracts and formulations are prepared properly and well standardized for contents of pesticides, heavy metals, mycotoxin, solvent, and microbial residues, since these may create doubts as to whether adverse reproductive effects are induced by herbal constituents or by contaminants. Significantly, a good number of published articles that have "declared" certain herbs to be antifertility agents sorely lack this vital information. Such seemingly well-intended research papers have done more harm than good to ethnopharmacology and traditional medicine. Fransworth and Waller (1982) reviewed the status of a number of plant products reported to inhibit sperm and observed contradictions that existed between findings of different researchers, "*in-vitro*" vs. "*in-vivo*" data, and also between scientific studies and traditional knowledge. They also summarized insufficient numbers of vehicle controls, poor experimental design, difficulties encountered in dissolving crude herbal extracts, different routes of administration, and variations in reproductive function among different experimental animals, as important aspects complicating the accurate assessment of effects of herbs on male fertility.\[[@ref7]\] Since several reproductive toxicity studies of the recent past were conducted according to a custom-made approach, and many times not in conformity with internationally accepted guidelines for reproductive/fertility studies, the aforementioned factors could potentially have influenced study outcomes either way. In addition, such misleading information often attracts the attention of regulators since, in the regulatory framework, toxicity evaluation can have direct impact on restriction or removal of the herbal ingredients. Alternatively, they may lead to demands for additional safety data. Due to the lack of adequate toxicity data or existence of contrary reports on the substance under consideration, international regulatory agencies generally adopt a cautious approach, until enough scientific information is generated which can mitigate the uncertainty associated with the safety of consumption of such herbal preparations.\[[@ref10]\] In Australia, the Complementary Medicine Evaluation Committee (CMEC) of Therapeutic Goods Administration (TGA), once objected to registration of Triphala, a polyherbal Ayurvedic formulation, based on a study which reported male reproductive toxicity on oral use of *Terminalia bellirica* extract (one of the three ingredients of the traditional formulation).\[[@ref11]\] Although the findings of the study were "successful demonstration" of contraceptive efficacy, the practical outcome turned out to be quite contrary. Consistent efforts towards generation of scientific data in subsequent years finally saw the TGA permitting inclusion of *T. bellirica* in the Australian Register of Therapeutic Goods (ARTG), thereby enabling export of such Ayurvedic products to Australia. Another classical example is Brahmi (*Bacopa monnieri*), a popular herb with a cognition enhancing effect. Evaluation of antifertility potential of an aqueous extract of Brahmi in male mouse revealed *reversible* male infertility; but, as stated elsewhere, the phytochemcial and analytical specifications were not mentioned. Also, the study observed that the percentage of affected seminiferous tubules in the testis was 96.27% after 28 days of Brahmi treatment vs. 54.13% after 56 days of treatment and this observation, as a result, leads to contention.\[[@ref12]\] Effects of *Ocimum sanctum* on reproductive systems of laboratory animals have attracted scientists globally, and extensive toxicological studies have been carried out, particularly on rats of both sexes. The early abortifacient effect of *O. sanctum* supplementation recorded by researchers during 1950s was later shown to be non-reproducible.\[[@ref13]\] As discussed earlier, some studies on *O. sanctum* or isolated compounds of *O. sanctum* were conducted using test material not properly standardized for purity, adopted the route of administration that is not commonly intended for the test material, or lack the rationale for appropriateness of the doses and duration of treatment used.\[[@ref14]--[@ref17]\] From established guidelines for reproductive toxicity studies, it can be observed that confirmation of the toxic potential of a test substance on fertility requires treatment of sufficient duration, a fact that seems to be "conveniently forgotten" by some investigators. Also, adverse effects in terms of transient, reversible or irreversible nature, need to be given due consideration before declaring unsafe herbs, which are otherwise relatively safe. The observations on published literature on *Andrographis paniculata* may provide noteworthy insights in this regard. Even though *A. paniculata* is used in many hepatoprotective formulations in India, global acceptance warranted published scientific evidence in reputed journals. For quite some time, preclinical studies on *A. paniculata* have reported probable male and female antifertility effects following oral administration. However, previous investigations of rats/mice were based on oral administration of crude leaf powder of *A. paniculata* for 60 days. The phytochemical and analytical specifications of the test materials were found to be lacking in most of the published articles. Furthermore, the data on critical endpoints like sperm concentration, sperm motility, and testosterone levels were not available for possible comparison with such similar works.\[[@ref2]\] Burgos *et al*. (1998), with the aid of electron microscopic observations, disproved the earlier, conventional microscopic findings of disruption of testicular histology by treating male rats with *A. paniculata* extract (containing 6.1% andrographolide) up to 1000 mg/kg for 60 days,\[[@ref3]\] while a phase I clinical study by Mkrtchyan *et al*. (2005) found the semen quality of healthy male subjects remained unaffected upon treatment with three times the therapeutic dose level of *A. paniculata* fixed combination (180 mg of andrographolide daily for 10 days) and validated the safety of the herb. \[[@ref4]\] In another study, female mice were administered with feed mixed-sundried powder of *A. paniculata* and the dose employed was 2 g/kg per day for 6 weeks\[[@ref6]\] -- a dose level that OECD recommends for testing of substances in acute oral toxicity studies!\[[@ref18]\] Similar observations indicated that several authors of reproductive toxicity studies often do not correlate doses that can produce reproductive toxicity from dose levels normally administered in Ayurveda, Siddha and Unani (ASU) medicine. The famous dictum of Paracelsus (1493--1541) that "the dose makes the poison" should always be remembered before declaring any substance as unsafe. Considering the importance of *A. paniculata* as a precious herbal remedy, Allan *et al*. (2009) reported in *International Journal of Toxicology* the findings of a study conducted taking into consideration internationally accepted guidelines. The authors reported that male rats orally administered with an extract of *A. paniculata* (≥10% andrographolide) up to the dose level of 1000 mg/kg daily for 86 days did not show any adverse effects in sperm parameters such as sperm concentration and sperm motility. The serum testosterone levels of treated rats were comparable to that of control rats and there were no gross and histopathological changes in testes and epididymides. The male rats, after 65 days of treatment with *A. paniculata* extract, were mated with females and produced healthy offspring.\[[@ref5]\] It appears that similar corrective studies are essential for other important medicinal plants as well. In summary, publishing dubious antifertility effects of beneficial herbs not only leads to huge economic impact on industry for disproving the same, but also adversely affects traditional medicine\'s credibility. If so many plants were found to have antifertility effects, then where are the drugs made from them? Dose--response relationship is indeed crucial; however, convincing regulatory authorities after someone publishes conflicting reports, may be a phenomenal task. Hence, sufficient efforts should be directed to draw attention to this perplexing problem. Steps should be taken to prevent its recurrence. Adequate awareness has to be created among researchers toward developing the concept, designing, executing, interpreting, and reporting the findings of reproductive/antifertility studies in accordance with internationally accepted guidelines. This critical issue needs attention of all the funding agencies supporting research on natural products with an ethnomedical basis. Overall there is a need to promote genuine, reproducible findings based on sound scientific principles, and, at the same time, discourage publication of outcomes of studies falling short of basic and reliable research requirements. In addition to researchers and funding agencies, this point needs attention from custodians of published scientific research viz. editors, reviewers, and editorial board members of scientific journals. If such precautions are exercised at the level of researchers, funding agencies, and the publishing community, we shall together ensure that research declaring herbs to be "safe" or "toxic" is responsible and reliable. **Source of Support:** Nil **Conflict of Interest:** None declared.
As we come on the air an incredible drama is still unfolding at a shopping mall taken over by terrorists in kenya. It happened in the city of nairobi, the kind of mall familiar to all of us. Filled with stores and restaurants. Dozens of people have been killed. 1,000 were rescued. Many of them children at the mall for a special event. And tonight we'll try to answer some big questions. Who are these terrorists and could they target the united states? And where did all those people hide before they escaped? We have team coverage of the mall massacre and we'll begin with abc's linsey davis right there on the scene tonight. Linsey. Reporter: A moment of terror. Parents clutched their children running as fast as they could. Those small scared face, those frantic hug, a saturday shattered by the calculated attack. Explosions rang out and today, more than 48 hours into the siege, black smoke billowed. I am crouched ducking for cover. I'm not sure if you can hear but we're hearing some heavy gunfire. Some screams just now just if you look over this building right here in the direction of the mall, you can see the dark billowing smoke in the midst of this. The mall is a 300,000-square-foot upscale family oasis as big as many american malls with 80 stores, a movie theater, supermarket and food court. Authorities now say as many as 15 members of al shabab, the al qaeda affiliated somali terrorist organization stormed the building saturday afternoon armed with guns and grenades some dressed as women. Near the entrance arnold was working near a burger bar when it began. I thought we were going to die. I covered and covered my face so when they come there they see like I'm dead. Reporter: American nick handler was separated from his pregnant wife when the shooting began and rushed to find an exit carrying his daughter julia in had is arms. Felt a loud explosion followed by gunshots and immediately grabbed her and luckily was right by the door so I could sprint out. Reporter: A few doors down, shoppers in the supermarket took cover among the shelves of food. Searching desperately for loved ones. They are shooting. It was pop, pop, pop, pop. And the families and people are not waking up. Reporter: While some militants hunkered down inside the supermarket, others made their way to upper floors. All the way to the roof where children's cooking contest was under way trampolines were set up outside. Special forces descended on the mall making their way to upper floors engaging in gunfire with the terrorists, evacuating pan ined shoppers down escalators with their hands in the air. Rescuing people in hiding like this woman in an upstairs restaurant who took cover inside an air vent. American elaine dang was rushed to a local hospital. I just got out of surgery. I'm okay. I'm very grateful to be alive. Reporter: You can still smell the smoke in the air but kenyan officials say the fire has been contained. They have spent a large part of the day clearing the mall, going through every square foot searching for additional hostages, terrorists and bodies, This transcript has been automatically generated and may not be 100% accurate.
package io.appium.java_client; import java.io.IOException; import java.net.DatagramSocket; import java.net.InetAddress; import java.net.SocketException; import java.net.URL; import java.net.UnknownHostException; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; public class TestUtils { public static String getLocalIp4Address() throws SocketException, UnknownHostException { // https://stackoverflow.com/questions/9481865/getting-the-ip-address-of-the-current-machine-using-java try (final DatagramSocket socket = new DatagramSocket()) { socket.connect(InetAddress.getByName("8.8.8.8"), 10002); return socket.getLocalAddress().getHostAddress(); } } public static Path resourcePathToLocalPath(String resourcePath) { URL url = ClassLoader.getSystemResource(resourcePath); if (url == null) { throw new IllegalArgumentException(String.format("Cannot find the '%s' resource", resourcePath)); } return Paths.get(url.getPath()); } public static String resourceAsString(String resourcePath) { try { return new String(Files.readAllBytes(resourcePathToLocalPath(resourcePath))); } catch (IOException e) { throw new RuntimeException(e); } } }
Q: Web Project vs. class library Is there any performance difference between the two? I have a web project that only has some classes, but not UI specific items like aspx pages or ascx controls. Should I consider to move those in a Class Library rather thank keep them as a web project ? Thanks. A: Just to clarify, you have phrased you question as if you have a web project without any ASPX or ASCX files. I assume that what you mean that you have a web project with ASPX files, but also some classes that have no dependency to the ASPX files, and you are wondering if you should extract those classes to a new class library project. As to the question, should you divide the project up, then that depends. There is no run-time performance benefit the code in a single project. There might be a minor delay when starting the application, but once the assemblies are loaded, then the performance will be identical. There might be a small development penalty however. I am of the impression that it takes longer to compile a system, if it is split up into many smaller projects, rather than one big one. But I have no data to back this up. But I would not use that as a determining factor. The important question is, how is your code best structured. Is it a larger application, I would split it up to have domain logic in one assembly and the presentation logic (web application) in another. Is it just a tiny application I would not. Except perhaps if you want to run unit tests on the domain logic, in which case I would split it up, so I have one test assembly that tests the functionality of the domain logic assembly.
Strong is the New Sexy (26 Photos) Long gone is the trend for stick-thin limbs and gaunt faces. Nowadays it’s all about being strong, fit and functional. Pounding the treadmill for hours everyday and living on salad is not the way to a happy body and mind! Lifting and eating well (clean, as some like to say) is what’s it’s all about now. Strong is the new skinny for both guys and girls! So say goodbye to skinny and head on down to your local gym to kick your lazy butt into action. It doesn’t matter how slow you go, you are still lapping everyone else sitting on the couch! Remember, even if takes longer than you thought, learn to enjoy the process. Fitness is a journey not a destination and getting up off your ass and going for it, is something to be proud of. Push forward and reap those rewards, we say. Bacon is always the answer. Currently working towards an MBA with an emphasis in fantasy football. I have friends in spite of myself. Probably the best meat eater in the world. Trying to change the name from Tweeting to Gregging. Recommended by 4 out of 5 people that recommend things. I’m here to avoid friends on Facebook.
685 F.Supp.2d 318 (2010) UNITED STATES of America, v. Sandra HATFIELD, David H. Brooks, Patricia Lennex, Defendants. No. 06-CR-0550 (JS). United States District Court, E.D. New York. January 11, 2010. *319 Richard Thomas Lunger, Jr., Esq., Christopher Allen Ott, Esq., James Halleron Knapp, Esq., James M. Miskiewicz, Esq., United States Attorneys Office, Central Islip, NY, for Government. Roland G. Riopelle, Esq., Maurice H. Sercarz, Esq., Sercarz & Riopelle, LLP, New York, NY, for Defendant, Sandra Hatfield. John C. Meringolo, Esq., Meringolo and Associates, P.C., Zaki I. Tamir, Esq., Gofer Tamir and Assoc., Richard Ware Levitt, Esq., Yvonne Shivers, Esq., Law Offices of Richard W. Levitt, Ira Lee Sorkin, Esq., Mauro Michael Wolfe, Esq., Dickstein Shapiro LLP, James M. LaRossa, Esq., New York, NY, Kenneth Ravenell, Esq., The Murphy Firm, Baltimore, MD, for Defendant, David Brooks. Michael F. Bachner, Esq., Bachner & Herskovits, P.C., New York, NY, for Defendant, Patricia Lennex. SEYBERT, District Judge: Pending before the Court is the Government's motion in limine to preclude Defendants David Brooks and Sandra Hatfield from introducing, or alluding to, a purported copy of a March 31, 1997 Resolution of the Compensation Committee of DHB Capital Group Inc. ("the '97 Resolution") during their upcoming criminal trial. For the foregoing reasons, that motion is DNIED. DISCUSSION This dispute concerns an alleged resolution of DHB's Compensation Committee. On March 31, 1997, DHB's Compensation Committee allegedly resolved to permit Mr. Brooks to use corporate funds to pay "any business and personal expenses" up to 10% of the Company's net income, supposedly in lieu of a bonus that Mr. Brooks was otherwise entitled to. DHB did not, however, incorporate this '97 Resolution, or its contents, in any of its contemporaneous public filings. Likewise, Mr. Brooks' 2000 employment agreement did not mention the supposed resolution or its contents. And DHB failed to produce the original '97 Resolution to the Government. Indeed, there is no trace of the '97 Resolution until 2004, when the SEC began investigating DHB's payment of Mr. Brooks' personal expenses. The Government seeks to prevent Mr. Brooks from "using or referring to the '97 Resolution or its contents at trial." In this regard, the Government relies on Fed. R.Evid. 1003, which precludes introducing a "duplicate" document if "a genuine question is raised as to the authenticity of the original." The Government contends that, under this rule, Mr. Brooks cannot introduce *320 a copy of the '97 Resolution because "it is clear that the '97 Resolution is a fraudulent document created as a cover-up to conceal Brook[s'] looting of DHB." Mr. Brooks responds that the Government's position is illogical, given that the Government "has indicted Mr. Brooks for alleged frauds that include the creation and dissemination of the 2004 Audit Committee Report, which, in turn, repeatedly mentions, relies upon and attaches the '97 Resolution as Exhibit L." Mr. Brooks response is relevant, but ultimately not central to resolving the Government's motion. In arguing that the '97 Resolution "is a fraudulent document," the Government is expressly denying that an authentic original of the '97 Resolution ever existed. And, in so doing, the Government has precluded the Court from barring the '97 Resolution's admission. Under Federal Rule of Evidence 1008(a), "when an issue is raised" regarding "whether the asserted writing ever existed," the "issue is for the trier of fact to determine." This is because "it is often true that these questions determine outcome" and "few would doubt that the jury should decide whether a written [document] existed for purposes of deciding the case on the merits." Christopher B. Mueller and Laird C. Kirkpatrick, 5 FED. EVID. § 10:40 (3d ed.). Consequently, the jury, and not the Court, must determine whether the '97 Resolution is genuine. And, accordingly, Mr. Brooks must be permitted to introduce both a copy of the '97 Resolution, and any evidence he has supporting the '97 Resolution's legitimacy. See Hill v. City of Houston, 235 F.3d 1339 (Table), 2000 WL 1672663, *7 (5th Cir. 2000) (unpublished) (given Rule 1008, "the question of whether exhibit eight is a fake or rather, authentic copy was a fact question which was properly submitted to the jury"); Tinley v. Poly-Triplex Technologies, Inc., 07-CV-1136, 2009 WL 812150, *7 (D.Colo. Mar. 26, 2009) (permitting copy of agreement to be admitted into evidence, despite genuine questions concerning whether an original ever existed, because "evidence suggesting that the Tinley Agreement never existed, as well as the credibility of the parties' testimony regarding the existence of the Tinley Agreement are questions for the jury to decide under Rule 1008"). The Government may, of course, attack the legitimacy of the '97 Resolution, and the credibility of any evidence Mr. Brooks uses to try to substantiate it. But "these questions go to the weight, rather than the admissibility of the evidence." Tinley, 2009 WL 812150 at *7. CONCLUSION The Government's motion in limine to preclude Defendants from "using or referring to the '97 Resolution or its contents at trial" is DENIED. SO ORDERED.
// // main.m // Daysquare // // Created by 杨弘宇 on 16/6/7. // Copyright © 2016年 Cyandev. All rights reserved. // #import <UIKit/UIKit.h> #import "AppDelegate.h" int main(int argc, char * argv[]) { @autoreleasepool { return UIApplicationMain(argc, argv, nil, NSStringFromClass([AppDelegate class])); } }
University of Exeter University of Exeter researchers are working with a team of UK scientists to explore the use of satellites and meteorological data to monitor and forecast water quality events that could threaten shellfish farms. The results ... A series of remarkable new camera trap videos has revealed some of the first ever footage of a critically endangered bird, the Sira Currasow, and has confirmed the presence of the vulnerable spectacled bear, on which the ... Fishermen in the Turks and Caicos Islands could be increasing the local prevalence of a disease that is affecting turtle populations worldwide, by selectively harvesting healthy creatures and throwing back infected animals.
Fine Art Course Introduction This is a studio'based, research'centred programme with a critical studies component, supported by studio'led seminars arising from the creative and critical interests of students and staff. Students are admitted into painting, sculpture or fine art media (which includes electronic media, photography, print, film and video). Course Additional Entry Applicants should normally be of graduate standing with evidence of a high level of achievement in the chosen studio discipline also being required. Exceptionally, an applicant may be considered whose previous education and professional experience are deemed by the university to be equivalent to graduate level. London & Partnersis registered in England under no. 7493460. Registered Office:London & Partners, 2 More London Riverside, LondonSE1 2RR. London & Partners is the official promotional company for London. We promote London and attract businesses, events, congresses, students and visitors to the capital.
Steven Patrick Garvey (born December 22, 1948), nicknamed "Mr. Clean" because of the squeaky clean image he held throughout his career in baseball, is a former Major League Baseball first baseman and current Southern California businessman. Garvey was the 1974 NL MVP, 10-time All-Star, and holds the National League record for consecutive games played (1,207). Playing career Born in Tampa, FL to parents who had recently relocated from Long Island, New York,WFAN radio interview Steve Garvey on Mike and the Mad Dog, April 18, 2008 from 1956 to 1961, Garvey was a bat boy for the Brooklyn Dodgers, New York Yankees and Detroit Tigers. Garvey played football and baseball at Michigan State University after graduating from Chamberlain High School. Garvey played his entire career in the National League West for two teams; the Los Angeles Dodgers (1969–82) and the San Diego Padres (1983–87). He batted right and threw right. In a 19-year career, Garvey was a .294 hitter with 272 home runs and 1308 RBI in 2332 games played. Los Angeles Dodgers Garvey was part of the most enduring infield in baseball along with third baseman Ron Cey, shortstop Bill Russell and second baseman Davey Lopes. The four infielders stayed together as the Dodgers' starters for eight and a half years. Garvey is one of only two players to have started an All-Star Game as a write-in vote He won the NL MVP award, and had the first of six 200-hit seasons. Only 15 players in all of Major League Baseball history have had six or more 200 hit seasons (as of the end of 2010). Garvey set a National League record with 1207 consecutive games played, from September 3, 1975, to July 29, 1983. The streak ended when he broke his thumb in a collision at home plate against the Atlanta Braves. In the 1978 National League Championship Series, Garvey hit four home runs, and added a double for five extra base hits, both marks tying Bob Robertson's 1971 NLCS record; Jeffrey Leonard would tie the NLCS home run record in the 1987 National League Championship Series. At a point in his career when it looked like he would one day rank among the game's all-time greats, Lawrence Ritter and Donald Honig included him in their book The 100 Greatest Baseball Players of All Time. San Diego Padres On his first trip to Los Angeles as a Padre, he took out a full-page newspaper ad in the Los Angeles Times thanking fans for their past support. On October 6, 1984, during Game 4 of the National League Championship Series, Garvey hit a two-run walk-off home run off Lee Smith in the 9th inning to give the Padres a 7 to 5 victory over the Chicago Cubs. The next day, the Padres won the National League pennant for the first time in franchise history. Garvey wound up being named the 1984 NLCS' Most Valuable Player. Garvey's jersey #6, worn when he was both a Padre and Dodger is retired by the Padres. His number 6 was displayed at the site of his 1984 NLCS home run in right field at Qualcomm Stadium. Post-baseball career Garvey, a Republican who harbored political ambitions after baseball, earned the nickname "Senator" from teammates. Those aspirations diminished after the public learned embarrassing details of his personal life. Also, starting in the mid 1980s he began the Steve Garvey celebrity Blue Marlin tournament, as well as the Steve Garvey celebrity skiing challenge. These were featured on episodes of the ESPN Classic show Cheap Seats during its four season run. Since 1988 he has been running Garvey Communications mainly involved in television production including infomercials. He is also the host of Baseball's Greatest Games. In addition he is hired out to do motivational speaking, mainly for corporations. Currently, Garvey works as a greeter for VIP season ticket holders and as a consultant for the Los Angeles Dodgers. He currently resides in Los Angeles and Palm Desert, California. Garvey currently serves as a member of the board of the Baseball Assistance Team, a 501(c)(3) non-profit organization dedicated to helping former Major League, Minor League, and Negro League players through financial and medical hardships. He is a member of the Irish American Hall of Fame. Personal Garvey has been married twice. He was married to Cyndy Garvey from 1971 to 1983. He married Candace Thomas in 1989. He also has a school named for him, Steve Garvey Junior High School, in Lindsay, California. Steve Garvey - Brooks International Speakers & Entertainment Bureau In 1989, Cyndy Garvey published a tell-all book in which she revealed the details of her marriage with Steve. This included details regarding his sexual affairs. Coincidentally, two paternity suits were filed against Steve at the time, and he admitted to fathering children by two women. Virginian Pilot Garvey made a number of television appearances from 1977 through 2006. TV.com - Steve Gavey television credits Steve Gavey Biography
/* * File : stack.c * This file is part of RT-Thread RTOS * COPYRIGHT (C) 2006, RT-Thread Development Team * * The license and distribution terms for this file may be * found in the file LICENSE in this distribution or at * http://openlab.rt-thread.com/license/LICENSE * * Change Logs: * Date Author Notes */ #include <rtthread.h> #include <i386.h> /** * @addtogroup I386 */ /*@{*/ /** * This function will initialize thread stack * * @param tentry the entry of thread * @param parameter the parameter of entry * @param stack_addr the beginning stack address * @param texit the function will be called when thread exit * * @return stack address */ rt_uint8_t *rt_hw_stack_init(void *tentry, void *parameter, rt_uint8_t *stack_addr, void *texit) { unsigned long *stk; stk = (unsigned long *)stack_addr; *(--stk) = (unsigned long)parameter; *(--stk) = (unsigned long)texit; *(--stk) = 0x200; /*flags*/ *(--stk) = 0x08; /*cs*/ *(--stk) = (unsigned long)tentry; /*eip*/ *(--stk) = 0; /*irqno*/ *(--stk) = 0x10; /*ds*/ *(--stk) = 0x10; /*es*/ *(--stk) = 0; /*eax*/ *(--stk) = 0; /*ecx*/ *(--stk) = 0; /*edx*/ *(--stk) = 0; /*ebx*/ *(--stk) = 0; /*esp*/ *(--stk) = 0; /*ebp*/ *(--stk) = 0; /*esi*/ *(--stk) = 0; /*edi*/ /* return task's current stack address */ return (rt_uint8_t *)stk; } /*@}*/
Q: Close a MySQL connection using PHP OOP I'm trying to learn PHP OOP and have come upon a problem. I'm trying to open and close connection using OOP like this class db{ public function opendb(){ $server = mysql_connect("localhost","root","") or die ("Couldn't connect to server"); $db = mysql_select_db("test",$server) or die ("Couldn't connect to database"); mysql_query("set character_set_server='utf8'"); mysql_query("set names 'utf8'"); } public function closedb(){ mysql_close($server); } } and use this code in my PHP page $x = new db; $x->closedb(); and make queries like this $x = new db; $x->opendb(); but I get an error because the $server is not accessible from inside the second function. How can I do that? A: Ok, since you're learning, I'll keep this quite basic. Ask yourself these questions: What does my class do? what methods will go into this class, and what binds them together (what do they have in common) How is my class going to be used, and how will it communicate its state with the user The answer to the first question is simple: your class will manage the DB connection and queries. This also answers the second question, to some extent: the DB connection is required by each method, if those methods are to work. All the methods need access to a db connection, hence, the connection must have class scope (ie: it must be a property). The last question, I'm not going to discuss in great detail, but common sense dictates that a back-end class doesn't communicate to the client directly (classes like this shouldn't echo, exit or die). A serious problem (like not being able to connect to the DB) should be communicated to the user (the code that invokes your class) in such a way that it cannot be ignored: throw Exception's: the calling code can't ignore those. Now we have the basics lined out, let's get to the actual code (following the conventions I linked to in my comment, and not using mysql_* because it's depreacted): class Db { /** * @var \PDO */ protected $conn = null; public function __construct($dsn, $user, $pass, array $options = array()) { $this->conn = new PDO($dsn,$user,$pass,$options); if (!isset($options[PDO::ATTR_ERRMODE])) $this->conn->setAttribute( PDO::ATTR_ERRMODE, PDO::ERRMODE_EXCEPTION ); } public function closeConnection() { if ($this->conn->inTransaction()) $this->conn->commit(); $this->conn = null; return $this; } } Now, if you don't understand all of this code, then don't worry: The manual explains all of the methods I've used Also be aware of the fact that the code I posted here is, IMHO, utterly pointless. I've already explained why in great detail on codereview.stackexchange. here, also here, and here... But if you care/want to, you can read through a couple of other code-reviews of mine concerning wrappers, which is essentially, what you are writing. They may be verbose, and not directly related to what you're trying to do, but who knows: they may be useful to you in the future.
Why I Believe Friday, January 31, 2014 Number One Misconception about Mormons Mormons are not Christian As a member of The Church of Jesus Christ of Latter-day Saints (Mormon), I would answer, "Yes, I am a Christian." From the scriptures... "And we talk of Christ, we rejoice in Christ, we preach of Christ, we prophesy of Christ, and we write according to our prophecies, that our children may know to what source they may look for a remission of their sins" (Nephi 25:26). But of course I'm going to say that. I'm a Mormon. I guess we need to back up a little and define what Christianity is. Wikipedia defines Christianity as "a monotheistic religion based on the life and oral teachings of Jesus as presented in the New Testament." Based on that definition, yes, Mormons are Christians. We read the Bible and are encouraged to study the life and teachings of Jesus Christ. We are encouraged to pattern our lives after His and to seek out opportunities to lift and serve others, so that others will come to know Jesus Christ. So why is there a question about whether or not Mormons are Christians? A few Christians of other denominations have told me: "You worship a different Jesus Christ." I think their belief is based on the LDS Church's use of The Book of Mormon. The Book of Mormon is a record of God's dealings with some Israelites who left Jerusalem and traveled to the Americas. It details their belief in Jesus Christ and includes an account of His visit to those people after His resurrection. Remember the scripture from the New Testament in which Jesus Christ refers to His "other sheep"? John 10:16 And other sheep I have, which are not of this fold: them also I must bring, and they shall hear my voice; and there shall be one fold, and one shepherd. Mormons believe that Jesus Christ visited these Israelites, His "other sheep", in the Americas after His resurrection. Monday, April 15, 2013 I have heard a lot of talk lately about women and their desire to be ordained to the Priesthood in The Church of Jesus Christ of Latter-day Saints (aka LDS Church or Mormon Church). Why can't women hold the priesthood? It's archaic that the priesthood is a "male only" institution. Bishops and Relief Society presidents are supporting this. How can it be bad if they feel it's the right thing and the natural next step? What do women do when they don't have a worthy priesthood holder in their house? They should be able to bless their own children. What's wrong with asking the Prophet to receive a revelation asking for women to receive the priesthood? It used to be that only white men could hold the priesthood, and now all worthy men can receive it. Women are next. As civilization progresses, we realize that women are as good as men and should be able to have all the same opportunities. I could go on and on. First, if you aren't LDS (Mormon), here's a little background. The Priesthood is the authority to act in God's name with His power to help others: perform saving ordinances, provide blessings, etc. Beginning in Old Testament times, God bestowed His priesthood on worthy men. When Jesus Christ was on the Earth, He bestowed the priesthood on worthy men. While there is some information in the Bible about righteous, worthy women, they were not Priesthood holders. When The Church of Jesus Christ of Latter-day Saints was established, it was not simply a church that was made up by a mortal individual or group of individuals. It was restored by God through His chosen servant (Joseph Smith, Jr.) and is His church. God established His church on the Earth to help His children return home to live with Him. How do we do that: return to live with our Heavenly Father? We need to do the best we can to draw closer to God, to gain a testimony of Jesus Christ and His atonement, to learn to rely upon God and our Savior, Jesus Christ, and to live what we believe to the best of our ability trusting in Jesus Christ's atonement. Each child of God is unique. We have unique talents, attributes, and opportunities. God created each of us as a unique son or daughter. Gender is an integral part of our identity. As a daughter of God, I have had the privilege to give birth to 4 wonderful sons. Giving birth is a human trait unique to females. Is it unfair that men can't give birth? Men have the opportunity to bear the priesthood. Is that the same as being able to bear life? No, but the priesthood can only be used to serve others, not oneself. I believe that both of these unique opportunities (women to bear children and men to bear the priesthood) are necessary for our growth during this mortal experience. They teach us to care more about others' needs than our own and push us to our limits. In today's society, the media is mindful about making fun of women, minorities, etc., but if you watch any sitcom, men are usually the bumbling fools who need to be saved by the women in their lives. In schools, boys are failing at a higher rate then girls. More girls than boys attend and complete college. More young men are in prison, and the rate seems to be increasing. Is there are correlation between the media portrayal of men and these alarming facts? I don't know. But I do know that people, especially children, tend to live up to whatever expectations you have of them. If you expect them to fail, they usually will. What does this have to do with the Priesthood? If a man's only role model is the clown on TV, he has no true role model. My husband is a righteous priesthood holder. He sets such a wonderful example for my sons. As a bearer of the priesthood, I know he feels the weight of this responsibility, and, as good a man as he is, he is even better because he wants to be a righteous priesthood holder. If women held the priesthood, many men would not feel they needed to live up to the standards they should, because the women could do it for them. (Sorry if that sounds sexist.) So... Back to the original questions. Why can't women hold the priesthood? It's archaic that the priesthood is a "male only" institution. Because it is the priesthood of God, and God determines who holds it, not man (or woman). "For my thoughts are not your thoughts, neither are your ways may ways, saith the Lord. For as the heavens are higher than the earth, so are my ways higher than your ways, and my thoughts higher than your thoughts" (Isaiah 55:8-9). Do you trust God enough to trust in Him and His servants,even if it doesn't match current political or social theories and trends? Bishops and Relief Society presidents are supporting this. How can it be bad if they feel it's the right thing and the natural next step? Matthew 24:24 reads, "For there shall arise... false prophets, and... they shall deceive the very elect." A prophet is defined as one chosen by God to speak for Him or one who claims to receive divine inspiration on behalf of others. The "Ordain Women" movement's leader, Kate Kelly, seems to be claiming divine inspiration on behalf of the Church of Jesus Christ of Latter-day Saints and that she believes deeply that it's time for women to receive the Priesthood. It sounds to me as if she is putting her inspiration, knowledge, and enlightenment above that of the Prophet of God. To put this in perspective, President Ezra Taft Benson gave an address at BYU in 1980 speaking about prophets. He said, "The prophet is not required to have any particular earthly training or diplomas to speak on any subject or act on any matter at any time.Sometimes there are those who feel their earthly knowledge on a certain subject is superior to the heavenly knowledge which God gives to his prophet on the same subject" (emphasis added). In order not to be deceived, we must study, ponder, and pray. We must listen to God's chosenprophet, not a self appointed one. If we have questions, we must continue the same pattern: study, ponder, and pray. Listen to God and to the answers you receive from Him. He will confirm what His chosen prophet says. What do women do when they don't have a worthy priesthood holder in their house? They should be able to bless their own children. The Church of Jesus Christ of Latter-day Saints provides Home Teachers to all families, and they can bless those without a priesthood holder in their home. Also, prayers are not the sole domain of men. God hears all righteous prayers and answers them. What's wrong with asking the Prophet to receive a revelation asking for women to receive the priesthood? This is being put forth, because Emma Smith asked her husband, Joseph Smith, Jr., about tobacco and alcohol, and He went to the Lord and received the revelation on the Word of Wisdom. First, Emma was his wife. It was appropriate for a wife to ask her husband such things. We no longer have intimate connections with the prophet as the Church of Jesus Christ is so large. If you believe that President Monson is the Prophet, a prophet of God, you should know that God will inspire him to ask the right questions. If you have questions, you are to go to your Bishop or Branch President. If they cannot give you the answers you seek, go to your Stake or Mission President. They can seek answers from General Authorities, as needed. Second, you can (and should) pray and ask God for that which you need including answers to your questions. If you have a question about the priesthood and women, pray and ask God. Study the scriptures. Ponder. Pray again.He willanswer you, and His answer will be correct. It used to be that only white men could hold the priesthood, and now all worthy men can receive it. Women are next. As civilization progresses, we realize that women are as good as men and should be able to have all the same opportunities. The Gospel of Jesus Christ has been restored in the Church of Jesus Christ of Latter-day Saints. Not everything was restored at once when the church was re-established. However, things are done in God's time. While I personally do not believe that God will extend the priesthood to women, if it is God's will, it will be done in His due time. Also, we will not be given additional knowledge and responsibilities without study of existing knowledge (scriptures, conference talks), improving our ability to fulfill the responsibilities we currently have, and sincere prayer. We must be mindful that God is a God of order and He will reveal things through His chosen servants, not self-appointed ones. Finally, I believe that one of the most helpful and inspiring revelations is The Family: A Proclamation to the World. Careful study and prayer will answer questions about gender roles and the priesthood (among other things). I have a testimony that the Church of Jesus Christ of Latter-day Saints is true, and that Jesus Christ is the Savior of all mankind. I know that President Thomas S Monson is a prophet of God. I know that all can receive their own testimonies and answers to difficult questions through scripture study, deep thought, obedience to the principles of God, and sincere, heartfelt, and humble prayer. Thursday, July 12, 2012 Here's the text of a story about the exhibit at the Washington DC Temple Visitor Center (and the link http://www.mormonnewsroom.org/article/mormon-beliefs-explained-at-washington--dc-temple-visitors-center-exhibit). What do Mormons believe? Are they Christian? How do they worship? Those are a sampling of questions answered by a new exhibit in The Church of Jesus Christ of Latter-day Saints’ (Mormons) visitors’ center in Washington, D.C. The visitors’ center, which draws thousands of people each year, is adjacent to the Washington D.C. Temple. “If people are going to ask questions, we need to do everything we can to give them the answers,” said Elder Don Olsen, visitors’ center director. “The Church has many resources to provide people with answers to their questions. We have a beautiful exhibit space and decided we should use it to help in that effort.” The exhibit, entitled “We Follow Jesus Christ,” will be on display at the visitors’ center through the end of August. It provides answers to 24 questions about the Church that seem to have captured most people’s interest. Among the answers are explanations of Latter-day Saints’ belief in God, the role of men and women in the Church, if Mormons are Christian, political neutrality, religious freedom and the importance of marriage. Volunteers are assigned to visitors’ centers to help people gain a basic understanding of the Church. The display helps visitors get answers to specific questions on various topics related to the Church. (See the link We Follow Jesus Christ, in the Additional Resources section at the right.) Much of the material is taken from the Church’s MormonNewsroom.org website, which is a resource for frequently asked questions and official news and statements of the Church. “Our missionaries love it,” exclaimed Elder Olsen. “They are using it to supplement the wonderful resources and interactive displays already available in the Visitors’ Center.” The display has been very popular with visitors in the few days since its opening. Elder Olsen said a woman who had questions about the Church came into the visitors’ center just after the exhibit opened. “Our missionaries escorted her to the display. She was impressed with the Church’s openness in dealing with the issues and as a result of her experience she asked for more information about the Church.” The Washington D.C. Temple is located just off the Capital Beltway in Kensington, Maryland. At night the temple, which has become an important landmark, is well lit and easy to spot. It was dedicated in 1974. The Washington D.C. Temple Visitors’ Center has produced a video of their exhibit which can be seen on its Facebook page. Friday, April 8, 2011 If you've ever been curious about (Mormon) Temples, here is an opportunity to go inside! The Church of Jesus Christ of Latter-day Saints Atlanta, Georgia temple was closed for extensive renovation in 2009. Before it reopens later this year, there is a free, no obligation open house and tour. If you're near Atlanta, please take the time to check it out. Wednesday, March 30, 2011 In the Old Testament, God spoke to prophets. He instructed them, inspired them, and gave them authority to act in His name, so they could teach and lead the people righteously. "[H]e spake by the mouth of his holy prophets, which have been since the world began..." (Luke 1:70). “Surely the Lord God will do nothing, but he revealeth his secret unto his servants the prophets” (Amos 3:7). After the Savior's death and resurrection, many taught righteous principles based upon the Savior's teachings. However, due to the death of the apostles, the authority to act in God's name and to receive revelation on behalf of the people was lost from the earth. Individuals could certainly receive answers to their own prayers and receive inspiration (revelation) in their own realm of stewardship (how to raise their families, what was the right choice for them as individuals, etc.), but there was no representative chosen by God to represent Him on the earth. Without a prophet on the earth, we could not receive instruction and guidance as it relates to the gospel in today's society. In 1830, the fullness of the gospel of Jesus Christ was restored to the earth when The Church of Jesus Christ of Latter-day Saints was established. To find out more details about the restoration, please view the following video. Thursday, January 27, 2011 I've had an interesting week pondering the beginning and the end of life. Monday morning, I held a beautiful newborn baby. I was privileged to hold that sweet, little infant who only recently left his Heavenly Father's presence. When I held him, I could feel deep in my heart and soul how precious he is, and how precious we all are as spirit children of God. Today, a member of my congregation died. There's nothing like the beginning and the end of life to remind one that God is in charge of all the things that matter. As I think of this good man who has returned to his heavenly home, I picture a loving reunion taking place. God intended for families to be eternal units. Father, Mother, children, grandparents, etc. Families are made up of not people we associate with only in this life with whom all bonds are severed at death. Family relationships are eternal relationships which can be continued beyond the grave. "In 'The Family: A Proclamation to the World,' the First Presidency and Quorum of the Twelve Apostles proclaim that 'marriage between a man and a woman is ordained of God and that the family is central to the Creator's plan for the eternal destiny of His children.' God's plan enables families who live the gospel and receive the necessary ordinances to be together forever with Him... When a man and woman are married in the temple, their family can be together forever. This is a common goal of Latter-day Saints." (lds.org) I look forward to the day when we all will be reunited with our loved ones beyond the grave in complete families with "no empty chairs." Thursday, January 13, 2011 I love the scriptures. I am so grateful to my Heavenly Father for preserving the words of His prophets, so I can read them, and learn about what He wants me to do. I was reading some of the scriptures listed under the topic "the value of scriptures" in the Bible's topical guide. The first one was quite profound. Psalm 19:7 - “The law of the Lord is perfect, converting the soul: the testimony of the Lord is sure, making wise the simple.” I also love this quote from David M. McConkie. It lists a couple of reasons why everyone should read the scriptures: “[I]t is contrary to the economy of heaven for the Lord to repeat to each of us individually what He has already revealed to us collectively. The scriptures contain the words of Christ. They are the voice of the Lord. Studying the scriptures trains us to hear the Lord’s voice.” When I read the scriptures, it strengthens my testimony that the Church of Jesus Christ of Latter-day Saints (a.k.a. the Mormon church) contains the fulness of the gospel of Jesus Christ. All the components of Christ's church as listed in the Bible are part of the Church of Jesus Christ of Latter-day Saints. I am grateful that Heavenly Father hears and answers prayers, so that I can pray about what I read and receive personal answers, and know of God's will for me and my family. About Me I am a happily married, stay at home mom with four sons, ages 23, 20, 16, and 12. We currently live in Southern California and enjoy it immensely. While I miss my family (most of whom live in Maryland), you can't beat the wonderful weather we have 3 seasons a year! I've started a new Food Storage blog, and I'd love it if you'd check it out. http://forayintofoodstorage.com
Accumulation of surfactant phospholipids in lipid pneumonia induced with methylnaphthalene. Lipid analyses were carried out on the lungs of female B6C3F1 mice treated with methylnaphthalene. Cholesteryl ester, which could not be detected in lungs of control animals, was present in lungs of treated animals. Cholesterol and dipalmitoylglycerophosphocholine (DPPC) content was increased about five times in lungs of treated mice compared with control mice, and the content of a minor phospholipid was increased six times. The latter phospholipid was purified by high performance liquid chromatography and identified as phosphatidylglycerol by thin layer chromatography and by fast atom bombardment-mass spectrometry. Both DPPC and phosphatidylglycerol are known to be pneumonal surfactants produced from type II pneumocytes. Therefore, the accumulation of these lipids in lung tissue was assumed to be caused by the proliferation of type II cells induced by the administration of methylnaphthalene. The results provide important information concerning the underlying mechanism of endogenous lipid pneumonia in mice.
We warrant that this umbrella will be free from defects in material and workmanship for a period of two (2) years from the date of purchase (the “Warranty Period”). If, during the Warranty Period, this umbrella proves to be defective during normal use, we will remedy the defect by either repairing or replacing the umbrella or any of its defective parts, at our option. The remedy of the defect will only be done when sending us the product postage prepaid.
275 S.W.3d 329 (2008) Darnicah OWENS, Appellant, v. DIVISION OF EMPLOYMENT SECURITY, Respondent. No. WD 69543. Missouri Court of Appeals, Western District. December 9, 2008. Motion for Rehearing and/or Transfer to Supreme Court Denied January 27, 2009. Appellant Acting Pro Se, Kansas City, MO, for appellant. Marilyn Gail Green, Esq., Jefferson City, MO, for respondent. Before JOSEPH P. DANDURAND, P.J., HAROLD LOWENSTEIN and JAMES SMART, JJ. ORDER Darnicah Owens appeals the order of the Labor and Industrial Relations Commission affirming the Appeals Tribunal's determination that Ms. Owens was ineligible for waiting week credit and benefits. Because a published opinion would have no precedential value, a memorandum has been provided to the parties. The judgment is affirmed. Rule 84.16(b).
/** * Internal dependencies */ import { toggleFeature, setTemplate, addTemplate, removeTemplate, setTemplatePart, setPage, showHomepage, setHomeTemplateId, } from '../actions'; describe( 'actions', () => { describe( 'toggleFeature', () => { it( 'should return TOGGLE_FEATURE action', () => { const feature = 'name'; expect( toggleFeature( feature ) ).toEqual( { type: 'TOGGLE_FEATURE', feature, } ); } ); } ); describe( 'setTemplate', () => { it( 'should return the SET_TEMPLATE action', () => { const templateId = 1; expect( setTemplate( templateId ) ).toEqual( { type: 'SET_TEMPLATE', templateId, } ); } ); } ); describe( 'addTemplate', () => { it( 'should yield the DISPATCH control to create the template and return the SET_TEMPLATE action', () => { const template = { slug: 'index' }; const newTemplate = { id: 1 }; const it = addTemplate( template ); expect( it.next().value ).toEqual( { type: 'DISPATCH', storeKey: 'core', actionName: 'saveEntityRecord', args: [ 'postType', 'wp_template', template ], } ); expect( it.next( newTemplate ) ).toEqual( { value: { type: 'SET_TEMPLATE', templateId: newTemplate.id, }, done: true, } ); } ); } ); describe( 'removeTemplate', () => { it( 'should yield the API_FETCH control and yield the SELECT control to set the page by yielding the DISPATCH control for the SET_PAGE action', () => { const templateId = 1; const page = { path: '/' }; const it = removeTemplate( templateId ); expect( it.next().value ).toEqual( { type: 'API_FETCH', request: { path: `/wp/v2/templates/${ templateId }`, method: 'DELETE', }, } ); expect( it.next().value ).toEqual( { type: 'SELECT', storeKey: 'core/edit-site', selectorName: 'getPage', args: [], } ); expect( it.next( page ).value ).toEqual( { type: 'DISPATCH', storeKey: 'core/edit-site', actionName: 'setPage', args: [ page ], } ); expect( it.next().done ).toBe( true ); } ); } ); describe( 'setTemplatePart', () => { it( 'should return the SET_TEMPLATE_PART action', () => { const templatePartId = 1; expect( setTemplatePart( templatePartId ) ).toEqual( { type: 'SET_TEMPLATE_PART', templatePartId, } ); } ); } ); describe( 'setPage', () => { it( 'should yield the FIND_TEMPLATE control and return the SET_PAGE action', () => { const page = { path: '/' }; const templateId = 1; const it = setPage( page ); expect( it.next().value ).toEqual( { type: 'FIND_TEMPLATE', path: page.path, } ); expect( it.next( templateId ).value ).toEqual( { type: 'SET_PAGE', page, templateId, } ); expect( it.next().done ).toBe( true ); } ); } ); describe( 'showHomepage', () => { it( 'should calculate and set the homepage if it is set to show posts', () => { const templateId = 1; const it = showHomepage(); expect( it.next().value ).toEqual( { args: [ 'root', 'site' ], selectorName: 'getEntityRecord', storeKey: 'core', type: 'SELECT', } ); const page = { path: '/', context: {}, }; expect( it.next( { show_on_front: 'posts' } ).value ).toEqual( { type: 'FIND_TEMPLATE', path: page.path, } ); expect( it.next( templateId ).value ).toEqual( { type: 'SET_PAGE', page, templateId, } ); expect( it.next( templateId ).value ).toEqual( { type: 'SET_HOME_TEMPLATE', homeTemplateId: templateId, } ); expect( it.next().done ).toBe( true ); } ); it( 'should calculate and set the homepage if it is set to show a page', () => { const templateId = 2; const pageId = 2; const it = showHomepage(); expect( it.next().value ).toEqual( { args: [ 'root', 'site' ], selectorName: 'getEntityRecord', storeKey: 'core', type: 'SELECT', } ); const page = { path: '/', context: { postType: 'page', postId: pageId, }, }; expect( it.next( { show_on_front: 'page', page_on_front: pageId } ) .value ).toEqual( { type: 'FIND_TEMPLATE', path: page.path, } ); expect( it.next( templateId ).value ).toEqual( { type: 'SET_PAGE', page, templateId, } ); expect( it.next( templateId ).value ).toEqual( { type: 'SET_HOME_TEMPLATE', homeTemplateId: templateId, } ); expect( it.next().done ).toBe( true ); } ); } ); describe( 'setHomeTemplateId', () => { it( 'should return the SET_HOME_TEMPLATE action', () => { const homeTemplateId = 90; expect( setHomeTemplateId( homeTemplateId ) ).toEqual( { type: 'SET_HOME_TEMPLATE', homeTemplateId, } ); } ); } ); } );
While the International Practical Shooting Confederation ponder its bid for the rights to host IPSC Level 2 and 3 matches in Britain, the UK National Rifle Association has now resorted to telling UKPSA members they might be in breach of firearm certificate conditions. Andrew Mercer, the NRA chief executive, seems to have suggested (in an official NRA Facebook post) that the UKPSA doesn’t offer sufficient insurance for its members, implying that UKPSA members relying on its insurance arrangements are – effectively – in breach of the conditions on their firearm and shotgun certificates. At least, that’s my personal reading of the words “I would urge all UKPSA members who think they are covered by public liability policies arranged through their membership of the UKPSA to contact them as a matter of urgency”. Readers without a firearm or shotgun certificate of their own may not know that the majority of FACs and SGCs have a legal condition which states that the holder may only shoot where he has “adequate financial arrangements to meet any injury or damage claims” in place – generally meaning insurance. Not meeting that condition could be a criminal offence under section 1(2) of the Firearms Act 1968. The UKPSA website’s insurance page was last updated in 2010. The membership page of the site does not mention insurance at all. Absence of public information, however, does not mean the UKPSA doesn’t have adequate insurance for its members. These are strong words with serious intent from the NRA. Will the UKPSA fire back? Mercer’s Facebook post is copied below in full. UKPSA Members – Insurance Notice It has come to our attention that some members of the UKPSA may be under the impression that they are covered by the NRA’s insurance policies. Our records indicate this is not the case; we have attempted to seek clarification on a number of occasions from the UKPSA Chairman but to date no satisfactory response has been forthcoming. Insurance is a routine condition for most FAC’s; I would urge all UKPSA members who think they are covered by public liability etc. policies arranged through their membership of the UKPSA to contact them as a matter of urgency to confirm what cover has been / is in place. For the avoidance of doubt this notice refers solely to UKPSA members who are not full members of the NRA. Contact details for the UKPSA can be found at www.ukpsa.co.uk Andrew Mercer Group Chief Executive and Secretary General If you know more about what’s going on in the background here, head to the about page of UKSN and drop us a line. Update: A previous version of this blog post said the NRA had lost its IPSC bid. That is not the case and we’re happy to make that clear.
[Molecular adaptation of the heart to hypertension]. Because myocardial hypertrophy is an independent risk factor for sudden death and cardiac failure, it is important to understand its molecular mechanisms to be able to devise new treatment strategies in the future. Stretch is the putative primary stimulus triggering hypertrophy. Further signal transduction steps such as auto- and paracrine secretion of growth factors or transmission via the cytoskeleton are beginning to be unravelled. Subsequent to hypertrophic stimuli some important proteins undergo an isoform switch; questitatively, however, the most important step is an increase in translational capacity for each mRNA. Myocardial specific gene expression is achieved by coordinate interaction of several transcription factors, some of which may be involved in nuclear transmission of hypertrophic signals. One of the genes capable of transmitting hypertrophic signals is the "early growth response gene-1 (Egr-1)". We have also shown that nuclear estrogen receptors act as transcription factors in the myocardium and may therefore be involved in the sex-specific modulation of cardiac hypertrophy. At present, pharmacological interventions aiming at reduction of hypertrophy by interfering with the signal transduction pathway from the membrane to the nucleus are actively being sought. These transduction pathways are composed of a series of proteinkinases which may be amenable to drugs. In the future, gene transfer may become an option for treatment.
Introduction {#j_jomb-2017-0009_s_001} ============ Obesity is a complex metabolic disorder, but also one of the most common modern health problems. Over the last thirty years, increased obesity prevalence has been noted worldwide. Obesity is characterized by a low-level chronic inflammation condition, which leads to an accelerated development of atherosclerosis, and is, thus, considered a risk factor for cardiovascular disease. The increase in the number of obese people in the world is followed by the increase of the most common modern human diseases, such as coronary heart disease, hypertension, insulin resistance and diabetes mellitus type 2 ([@j_jomb-2017-0009_ref_001]). There is a need to explain the molecular link between obesity and chronic metabolic diseases. In this context, low-level chronic inflammation, mediated by the innate and adaptive immune cells, participates in creating this link between obesity and diseases ([@j_jomb-2017-0009_ref_002]). Numerous studies point to the positive association between persistent chronic low-level inflammation and obesity indices ([@j_jomb-2017-0009_ref_003]). In the obese, the adipose tissue is the primary site of inflammation as the proinflammatory cells (macrophages) of the visceral adipose tissue secrete different cytokines and have an important role in inflammation ([@j_jomb-2017-0009_ref_004]). The presence of a large number of macrophages in the adipose tissue of obese is probably caused by the reaction of adipose tissue to stress signals released by adipocytes ([@j_jomb-2017-0009_ref_005]), but the molecular events that initiate the recruitment and activation of immune system cells in adipose tissue of the obese are not yet fully known. Multiple inflammatory stimuli such as the increase in circulating cytokines, the reduction of protective factors (e.g. adiponectin) and the communication between inflammatory and metabolic cells, contribute to the onset of metabolic disorders in the body of the obese people. Myeloperoxidase that is present in neutrophils may also be involved in the initiation of an inflammatory response in the adipose tissue of the obese. Myeloperoxidase (MPO; E.C. 1.11.1.2.) is one of the most prevalent proteins in human neutrophilic leukocytes but is less present in monocytes and tissue macrophages ([@j_jomb-2017-0009_ref_006]). The function of this enzyme is to catalyze a two-electron oxidation of chlorine ions in the presence of hydrogen peroxide. Myeloperoxidase together with H~2~O~2~ forms an enzyme-substrate complex that is able to oxidize halides (e.g. chloride, iodide), thus producing reactive products. The most important product in this reaction is hypochlorous acid (HOCl) due to the high concentration of chlorine ions (Cl^−^) in biological systems ([@j_jomb-2017-0009_ref_007]). Under *in vivo* conditions, the sources of hydrogen peroxide that serves as an MPO substrate are numerous, for example, leukocyte NADPH oxidase, xanthine oxidase, nitric oxide synthase and others ([@j_jomb-2017-0009_ref_008]). The production of reactive (chlorinating) species, such as HOCl, is important during the anti microbial activity of MPO in the innate immune response. During the activation of leukocytes, MPO in creases the oxidative potential of the respiratory burst by using hydrogen peroxide as a cosubstrate to form more reactive oxidant species ([@j_jomb-2017-0009_ref_009]). This can lead to the formation of numerous potent oxidant compounds capable of promoting oxidative modification of biomolecules. The generation of oxidized bioactive lipids is an important mechanism that connects MPO with inflammatory processes, while a heightened activity of MPO may be significant in inflammatory tissue injury ([@j_jomb-2017-0009_ref_010]). Many studies have shown that MPO and its reactive oxidants participate in the pathogenesis of many acute and chronic inflammatory conditions, particularly cardiovascular disease ([@j_jomb-2017-0009_ref_006], [@j_jomb-2017-0009_ref_011]). Adipose tissue functions as an endocrine organ as well, due to the ability of adipocytes to produce numerous biologically active substances, adipocytokines. The increase in the number of adipocytes in the body of obese people leads to greater production of adipokines and contributes to the development of the metabolic syndrome ([@j_jomb-2017-0009_ref_012]). The presence of a number of related metabolic disorders in the human body, such as dysregulation of lipid metabolism, hyperglycemia, insulin insensitivity, increased blood pressure and abdominal obesity, is a characteristic of the metabolic syndrome. The mentioned metabolic disorders present significant risk factors for the occurrence of many complications. The constant increase in the number of obese people imposes the need for finding reliable biomarkers in routine diagnosis and the assessment of the severity of metabolic disorders, as well as the possibility to predict the risks of any related complications. The aim of the study was to monitor the concentrations of apolipoprotein A and B, their interrelation (apoB/apoA1 ratio) and myeloperoxidase enzyme activity, as early inflammatory markers in the serum of obese and the subjects with the metabolic syndrome. Material and Methods {#j_jomb-2017-0009_s_002} ==================== Samples {#j_jomb-2017-0009_s_002_s_001} ------- The study included 175 subjects from the student population who, after getting familiar with the goals of the study, voluntarily agreed to be involved in it. The study protocol was approved by the Ethics Committee of the Medical Faculty in accordance with the Helsinki Declaration. The criteria for the selection of patients were: that they were older than 18 years of age, did not have a diagnosed cardiovascular disease, as well as liver, kidney, central nervous system, endocrine and/or metabolic disorders; that they were not under a medical drug therapy that could affect the level of lipids and glycemic regulation and that their levels of the measured high-sensitivity C-reactive protein (hsCRP) were not higher than 10 mg/L. The anthropometric indicators were measured for all of the subjects: body weight (kg), body height (cm), waist and hip circumferences (cm), and systolic and diastolic blood pressure (mmHg). Body Mass Index (BMI) was determined based on these results, as well as the ratio between waist (cm) and hips (cm) circumference (WC/HC). Body mass index was calculated as weight in kilograms (kg) divided by height in meters squared (m^2^). Venous blood was obtained from each of the subjects in the study via peripheral venipuncture on an empty stomach (after at least 12--14 hours of night fasting) for laboratory tests to determine: erythrocytes count, leukocytes count, platelet count, erythrocyte sedimentation rate (SE), and the levels of fibrinogen (g/L) and high-sensitivity C-reactive protein (hsCRP) (mg/L), glycosylated hemoglobin (HbA1c, %), total cholesterol (mmol/L), triacylglycerol (mmol/L), HDL (mmol/L), LDL (mmol/L), VLDL-cholesterol (mmol/L), apolipoprotein A1 (ApoA1) and apolipoprotein B (ApoB), ApoB/ApoA1 ratio, the levels of glucose (mmol/L), urea (mmol/L), creatinine (mmol/L), and uric acid (mmol/L), and the myeloperoxidase enzyme (MPO) activity (kU/L). *Methods*. The methods used for laboratory tests were as follows: erythrocyte sedimentation rate (SE) was determined according to the Westergren method, leukocytes count, platelet count as well as hemoglobin and hematocrit levels were determined using an automated blood cell counter (Sysmex K 21). By means of automatic spectrophotometric methods, the biochemical analyzer Architect 4000c (Abbott, USA), and commercial test reagents, we determined the levels of total cholesterol, triacylglycerol, lipoprotein cholesterol (HDL, VLDL), glucose, urea, creatinine and uric acid. The LDL-cholesterol levels were determined using Friedewald's formula ([@j_jomb-2017-0009_ref_013]). Levels of hsCRP were measured by a high-sensitivity automated immunoturbidimetric method with a measuring range from 0.1 to 160 mg/L on an Architect c4000 analyzer (Abbott, USA) using fully prepared test reagents made by the same company. To quantitatively determine the glycosylated hemoglobin A1c levels (HbA1c) in blood, we used an Architect System analyzer (Abbott, USA) for a chemiluminescent immunoassay test with fully prepared test reagents. Apoprotein B and A1 (Apo B and apoA1) levels were determined by an immunoturbidimetric test, based on the degree of turbidity due to the formation of insoluble immune complexes, after adding ApoB/ApoA1 antibodies to the sample. Atherogenic index was calculated as the ratio between the individual lipid fractions: total cholesterol -- HDL/HDL. The reference value for this index is 2.3. We calculated the apoB/apoA1 ratio, whose value greater than 0.60 indicates an increased atherogenic risk. Chlorinating myeloperoxidase activity was spectrophotometrically determined in a system consisting of hydrogen peroxide, taurine, and TNB (2-nitro-5-thiobenzoyl acid) at 25 °C and pH 7.4 ([@j_jomb-2017-0009_ref_014]). Hypochlorous acid is generated as a result of MPO activity, which then reacts with taurine to form taurine chloramine that oxidizes TNB into DTNB (5,5'-dithiobis-\[2-nitrobenzoic acid\]), detected by measuring the absorbance at 412 nm. One unit of MPO activity is defined as the amount of enzyme that catalyzes the production of HOCl to the extent that is sufficient to lead to the formation of 1.0 nmol of taurine chloramine at 25 °C and pH 7.4 per 30 min in the presence of 100 nmol of chloride and 100 mmol H~2~O~2~. Chlorinating MPO activity was expressed as kU/L. Statistics {#j_jomb-2017-0009_s_002_s_002} ---------- With the data obtained in the study and using the IBM SPSS 20 Statistics program, we created a data file which helped with analyzing the gathered data. The descriptive methods we used in statistical analysis were frequencies, percentages, mean values and the variability range while the analytical methods used were chi-square test, Kruskal-Wallis test, Mann-Whitney U test, linear correlation, One-factor Analysis of Variance and Sidak's multiple comparisons test in cases when the analysis of variance showed statistically significant differences between groups. Results {#j_jomb-2017-0009_s_003} ======= In accordance with the criteria of the International Diabetes Federation (IDF) ([@j_jomb-2017-0009_ref_015]) and based on the measured anthropometric parameters and biochemical indicators, the subjects were divided into 3 groups. The first group consisted of normal weight respondents with a BMI 18.5--24.9 kg/m^2^, waist circumference \<94 cm in men, and \<80 cm in women. For this group of subjects, the measured level of triacylglycerol was up to 1.70 mmol/L, HDL cholesterol above 1.03 mmol/L in men, and above 1.29 mmol/L in women, blood glucose was below 5.6 mmol/L, systolic blood pressure was lower than 130 mmHg and diastolic lower than 85 mmHg. The second group consisted of subjects with abdominal obesity whose measured waist circumference was over 94 cm in men, and over 80 cm in women. The blood analysis of this group of subjects showed levels of triacylglycerol up to 1.70 mmol/L, HDL cholesterol over 1.03 mmol/L in men, and over 1.29 mmol/L in women, blood glucose below 5.6 mmol/L, systolic blood pressure lower than 130 mmHg and diastolic pressure lower than 85 mmHg. The third group consisted of subjects with the metabolic syndrome in which the measured waist circumference was higher than 94 cm in men, or higher than 80 cm in women. More specifically, the respondents in this group had abdominal obesity and two or more parameters including triglycerides levels above 1.70 mmol/L, HDL cholesterol levels lower than 1.03 mmol/L in men, and lower than 1.29 mmol/L in women, glucose levels above 5.6 mmol/L, systolic blood pressure higher than 130 mmHg and/or diastolic blood pressure higher than 85 mmHg. Of the 175 subjects involved in the study, 30% (N=53) were men, while 70% (N=122) were women. Women were predominant in the group of subjects with normal weight, and the one with abdominal obesity, while there was a higher number of men in the group with the metabolic syndrome, which was confirmed by a chi-square test (chi-square=14.533; p=0.001) (*[Table I](#j_jomb-2017-0009_tab_001){ref-type="table"}*). The study found that the measurements for body weight, body mass index (BMI), waist circumference and hip circumference were significantly lower in the group with normal weight subjects compared to obese and the subjects with the metabolic syndrome (p\<0.001), whereas among obese and subjects with the metabolic syndrome no significant differences were established for the above mentioned parameters (*[Table I](#j_jomb-2017-0009_tab_001){ref-type="table"}*). By analyzing the ratio between the waist and hips circumferences (WC/HC), we established a significant difference between obese and subjects with the metabolic syndrome compared to normal weight subjects (p\<0.001) (*[Table I](#j_jomb-2017-0009_tab_001){ref-type="table"}*). The measured values of systolic and diastolic blood pressure were significantly higher in subjects with the metabolic syndrome compared to normal weight and obese subjects (p\<0.001) (*[Table I](#j_jomb-2017-0009_tab_001){ref-type="table"}*). ###### Descriptive characteristics of subjects. Normal weight (NW) Overweight (OW) Metabolic syndrome (MS) p\* -------------------- -------------------- ----------------- ------------------------- --------- --------- --------- Number of subjects 106 37 32 NW-OW NW-MS MS-OW Gender, n (%) male 32 (30.2%) 4 (10.8%) 17 (53.1%) \<0.001 \<0.001 0.001 female 74 (69.8%) 33 (89.2%) 15 (46.9%) \<0.001 \<0.001 0.001 BMI (kg/m^2^) 21.2 ± 2.2 25.2 ± 5.5 26.6 ± 3.5 \<0.001 \<0.001 0.293 WC (male) (cm) 79.9 ± 5.8 101.7 ± 4.9 96.9 ± 7.2 \<0.001 \<0.001 0.372 WC (female) (cm) 68.8 ± 5.2 87.5 ± 8.7 89.7 ± 6.6 \<0.001 \<0.001 0.621 HC (male) (cm) 101.3 ± 5.0 114.4 ± 3.8 109.9 ± 6.7 \<0.001 \<0.001 0.468 HC (female) (cm) 95.6 ± 5.5 105.5 ± 11.3 103.5 ± 5.6 0.000 0.016 0.919 WC/HC (male) 0.8 ± 0.07 0.9 ± 0.03 0.9 ± 0.04 0.024 \<0.001 0.993 WC/HC (female) 0.7 ± 0.05 0.8 ± 0.04 0.9 ± 0.05 \<0.001 \<0.001 0.042 SBP (mmHg) 112.6 ± 8.6 109.9 ± 10.5 120.3 ± 11.8 0.364 \<0.001 \<0.001 DBP (mmHg) 74.5 ± 6.7 72.8 ± 7.5 80.6 ± 9.1 0.567 \<0.001 \<0.001 Data are presented as mean ± SD, or n (%). Body mass index (BMI), waist circumference (cm) (WC), hip circumference (cm) (HC), waist to hip ratio (WC/HC), systolic blood pressure (SBP), diastolic blood pressure (DBP). p value (p\*) refers to the statistical significance of the differences between: normal weight and obese subjects (NW-OW) and normal weight subjects with metabolic syndrome (NW-MS), and obese subjects with metabolic syndrome (MS-OW). We measured significantly higher levels of total cholesterol, LDL-cholesterol, VLDL-cholesterol (mmol/L) and triacylglycerol (mmol/L) in the serum of subjects with the metabolic syndrome compared to normal weight and obese subjects. Also, the atherogenic index values were the highest in the group of subjects with the metabolic syndrome (p\<0.001) (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). Through the analysis of the measured levels of HDL-cholesterol in serum, we determined significantly lower levels in patients with the metabolic syndrome compared to normal weight and obese subjects (p\<0.001), whereas we could not establish a significant difference between normal weight and obese subjects (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). The levels of glycosylated hemoglobin (HbA1c) were significantly lower in the blood of normal weight subjects compared to obese and the subjects with the metabolic syndrome (p\<0.001), whereas there were no significant differences found between obese and the subjects with the metabolic syndrome (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). By analyzing the measured levels of blood glucose (mmol/L), urea (mmol/L), creatinine (mmol/L) in the serum of subjects, as well as the erythrocyte count (x1012/L), leukocyte count (x109/L), platelet count (x109/L) and hematocrit levels, we found no significant differences between the two groups (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). ###### Biochemical characteristics of subjects. Normal weight (NW) Overweight (OW) Metabolic syndrome (MS) p\* ---------------------------- -------------------- ----------------- ------------------------- --------- --------- --------- Fasting glucose (mmol/L) 4.3±0.5 4.3±0.4 4.4±0.6 0.365 0.256 0.289 HbA1c (%) 5.3±0.2 5.6±0.2 5.6±0.3 \<0.001 \<0.001 0.710 Total cholesterol (mmol/L) 4.5±0.6 4.7±0.8 5.1±1.1 0.289 \<0.001 0.115 Triglyceride (mmol/L) 0.9±0.3 1±0.3 2±1.2 0.991 \<0.001 \<0.001 HDL (mmol/L) 1.5±0.2 1.5±0.3 1.1±0.2 0.499 \<0.001 \<0.001 LDL (mmol/L) 2.8±0.5 3.1±0.8 3.6±0.9 0.098 \<0.001 0.005 VLDL (mmol/L) 0.2±0.07 0.2±0.07 0.4±0.2 0.989 \<0.001 \<0.001 Atherogenic index 1.9±0.3 2.3±0.7 3.8±1.1 0.001 \<0.001 \<0.001 ApoA1 (g/L) 1.8±0.1 1.3±0.09 1.1±0.09 \<0.001 \<0.001 \<0.001 ApoB (g/L) 0.7±0.1 1.5±0.1 1.8±0.08 \<0.001 \<0.001 \<0.001 The ApoB/ApoA1 ratio 0.4±0.07 1.2±0.1 1.6±0.2 \<0.001 \<0.001 \<0.001 Erythrocytes (x 10^12^/L) 4.9±0.4 4.7±0.4 4.9±0.4 0.200 0.548 0.047 Hemoglobin (g/L) 137.9±15.5 133.3±10.5 143.4±13.1 0.441 0.075 0.011 Leukocytes (x 10^9^ / L) 5.8±1.4 6.6±1.7 6.6±2.2 0.254 0.059 0.012 Hematocrit (%) 0.4±0.03 0.4±0.03 0.4±0.03 0.019 0.019 0.018 Platelets (x 10^9^/L) 238.9±53.2 243.5±56.6 249.4±51.1 0.032 0.035 0.028 Urea (mmol/L) 4.2±1.1 3.9±1.0 4.0±0.8 0.156 0.186 0.187 Creatinine (mmol/L) 78.9±11.9 75.6±8.5 79.7±12.0 0.034 0.039 0.046 Data are presented as mean±SD. p value (p\*) refers to the statistical significance of the differences between: normal weight and obese subjects (NW-OW) and normal weight subjects with metabolic syndrome (NW-MS), and obese subjects with metabolic syndrome (MS-OW). The apolipoprotein B/apolipoprotein A1 ratio (the ApoB/apoA-I ratio), low-density lipoprotein cholesterol (LDL-c), high-density lipoprotein cholesterol (HDL-c). We determined no significant differences between the measured values of erythrocyte sedimentation rate (mm/h), uric acid (mmol/L) and fibrinogen (g/L) within the tested groups ([Table III](#j_jomb-2017-0009_tab_003){ref-type="table"}). By analyzing the myeloperoxidase enzyme activity (kU/L) and high-sensitivity C-reactive protein (hsCRP) levels in the blood of the subjects, we determined differences between the three groups of subjects, namely significantly higher MPO activity and hsCRP values measured in subjects with the metabolic syndrome as compared to normal weight subjects (p\<0.001) (*[Table III](#j_jomb-2017-0009_tab_003){ref-type="table"}*). ###### The indicators of inflammation in the blood of subjects. Normal weight (NW) Overweight ( OW) Metabolic syndrome (MS) p\* ------------------------ -------------------- ------------------ ------------------------- --------- --------- --------- Myeloperoxidase (kU/L) 9.5±1.4 18.2±2.4 26.5±2.8 \<0.001 \<0.001 \<0.001 Fibrinogen (g/L) 3.2±0.5 3.9±1.1 3.6±0.7 0.001 0.117 0.518 Uric acid (mmol/L) 238.4±72.7 239.4±83.3 387.6±79.4 0.512 \<0.001 0.000 SE (mm/h) (median) 8 (1--36) 13 (2--48) 9 (1--42) 0.007 0.338 0.559 hsCRP (mg/L) (median) 0.2 (0.1--0.8) 1.0 (0.1--4.3) 1.2 (0.2--3.4) \<0.001 \<0.001 0.486 Data are presented as mean±SD. p value (p\*) refers to the statistical significance of the differences between: normal weight and obese subjects (NW-OW) and normal weight subjects with metabolic syndrome (NW-MS), and obese subjects with metabolic syndrome (MS-OW). The erythrocyte sedimentation rate (SE). Discussion {#j_jomb-2017-0009_s_004} ========== Obesity is associated with a low-level chronic inflammation condition, caused by progressive infiltration of macrophages in adipose tissue. The increasing volume of adipose tissue and the accumulation of macrophages in it increase the production of proinflammatory cytokines and acute-phase molecules that contribute to pathological changes in obesity. Cytokines produced by macrophages and adipokines produced by the adipose cells cause inflammation ([@j_jomb-2017-0009_ref_016]). The increased levels of high-sensitivity C-reactive protein (hsCRP), fibrinogen, amyloid-A, monocyte-chemoattractant protein-1 (MCP-1), plasminogen inhibitors (PAI-1), cytokines (TNF-α, IL-6, etc.) and other biological markers of inflammation in the blood of obese subjects confirmed the presence of chronic inflammation ([@j_jomb-2017-0009_ref_017]). The action of these inflammatory molecules may represent the molecular link between adipose tissue and the metabolic and cardiovascular complications in obese. During our study, we measured significantly higher values of systolic and diastolic blood pressure (p\<0.001) in subjects with the metabolic syndrome (p\<0.001) compared to obese and normal weight subjects (*[Table I](#j_jomb-2017-0009_tab_001){ref-type="table"}*). It is possible that the inflammatory condition that occurs in obesity may contribute to an increase in blood pressure. High blood pressure may increase cardiovascular risk by causing chronic endothelial damage leading to structural and functional vascular changes, especially in the micro-vascular (capillary) network. During our tests, we measured higher levels of hsCRP in the blood of obese and the subjects with the metabolic syndrome compared to those with optimal body weight (p\<0.001) (*[Table III](#j_jomb-2017-0009_tab_003){ref-type="table"}*). C-reactive protein is an acute phase protein produced by hepatocytes stimulated by cytokines (IL-1, IL-6). Interleukin-6 (IL-6) is expressed in adipose tissue in inflammatory conditions and it regulates CRP expression in hepatocytes at the transcriptional level. Several studies have pointed to obesity as the main predictor of increased hsCRP blood levels. Also, the results of the Ebrahimi M. et al. ([@j_jomb-2017-0009_ref_018]) study showed that increased hsCRP levels represent a predictive factor for the development of the metabolic syndrome, while the Maffeis et al. ([@j_jomb-2017-0009_ref_019]) study confirmed that high hsCRP levels in the blood of young people point to greater future risks of coronary artery disease. A disorder of blood lipid levels is usually present in the blood of obese people, and it is manifested as greater levels of triglycerides and LDL cholesterol, as well as reduced levels of HDL-cholesterol ([@j_jomb-2017-0009_ref_020]). During our study, dyslipidemia was also observed in the form of elevated levels of triacylglycerol, LDL, VLDL and total cholesterol in the blood of obese and subjects with the metabolic syndrome (p\<0.001) (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). Also, the obese and the subjects with the metabolic syndrome had higher levels of atherogenic index and lower levels of HDL-cholesterol in blood (p\<0.001) (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). We detected significantly lower levels of apoA1 (g/L) (p\<0.001), while the apoB levels (g/L), and apoB/apoA1 ratio were significantly higher (p\<0.001) in obese and subjects with the metabolic syndrome (p\<0.001) (*[Table II](#j_jomb-2017-0009_tab_002){ref-type="table"}*). It is likely that HDL modification and/or the suppression of its synthesis in the liver is mediated by MPO generated oxidants, which results in reduced levels of HDL particles in blood. The reduced level of HDL-cholesterol in blood is seen as a risk factor for the development of pathological changes in the cardiovascular system due to its important role in the metabolism of cholesterol, and its antiinflammatory and atheroprotective effects ([@j_jomb-2017-0009_ref_021]). The elevated levels of LDL-cholesterol and apo B, the increased apoB/apoA1 ratio and/or reduced levels of HDL-cholesterol and apoA1 indicate a higher risk of a cardiovascular disease. Numerous studies have shown that the apoB/apoA1 ratio is a stronger risk predictor for development of a cardiovascular disease compared to levels of other lipids and lipoproteins. As a component of atherogenic lipoproteins, apolipoprotein B directly reflects elevated levels of atherogenic lipoproteins in plasma. Apolipoprotein A is the main protein component of high-density lipoprotein, and reflects the level of antiatherogenic lipoproteins in plasma, while the ApoB/ApoA1 ratio reflects the balance of potentially atherogenic and antiatherogenic lipoprotein particles. It is believed that apoB levels and the apoB/apoA1 ratio may be useful predictors of cardiovascular events and that elevated levels of plasma apoB and/or apoB/apoA1 ratio may be the reason for the in creased hsCRP levels and the onset of inflammation in the vasculature ([@j_jomb-2017-0009_ref_022]). Data obtained in the Lu M. et al. ([@j_jomb-2017-0009_ref_023]) study show that the subjects with higher BMI, waist/hips circumference ratio, SBP and DBP mean values and triglycerides and total cholesterol levels in the blood, have a higher risk of cardiovascular events ([@j_jomb-2017-0009_ref_024], [@j_jomb-2017-0009_ref_025]). The study in our patients revealed a significant negative correlation between the apoB/apoA1 ratio and HDL (r=-0.478, p\<0.001) and a positive correlation between apoB/apoA1 ratio and the levels of LDL (r=0.365, p\<0.001), total cholesterol (r=0.261, p\<0.001) and triglycerides (r=0.465, p\<0.001) (*[Table IV](#j_jomb-2017-0009_tab_004){ref-type="table"}*). Also, a significant positive correlation was established between the apoB/apoA1 ratio and hsCRP levels (r=0.612, p\<0.001), MPO activity (r=0.921, p\<0.001) and the atherogenic index (r=0.600, p \<0.001) (*[Table IV](#j_jomb-2017-0009_tab_004){ref-type="table"}*), which indicates that apoB/apoA1 ratio is related not only to the lipids level, but also to chronic inflammation caused by obesity. ###### Correlation between ApoB/ApoA1 ratio and different variables. ApoB/ApoA1 Ratio TC mmol/L HDL mmol/L LDL mmol/L TG mmol/L hs-CRP mmol/L MPO kU/L Atherogenic index ------------------ ----------- ------------ ------------ ----------- --------------- ----------- ------------------- r 0.261\*\* -0.478\*\* 0.365\*\* 0.465\*\* 0.612\*\* 0.921\*\* 0.600\*\* p 0.001 0.001 0.001 0.001 0.001 0.001 0.001 The results of our study show an increase in myeloperoxidase activity in the serum of obese and the subjects with the metabolic syndrome (p\<0.001) (*[Table III](#j_jomb-2017-0009_tab_003){ref-type="table"}*). These results are consistent with the results of Zur B. et al. ([@j_jomb-2017-0009_ref_026]) that showed a significantly higher myeloperoxidase activity in obese compared with the subjects with optimal body weight (p\<0.001), as with the results of the Andrade VL et al. ([@j_jomb-2017-0009_ref_027]) study, the research that involved female subjects and where a significant increase in myeloperoxidase activity was measured in obese compared to normal weight women (p\<0.05). Olza J. et al. ([@j_jomb-2017-0009_ref_026]) study that examined overweight and normal weight children showed that myeloperoxidase may be an early marker associated with the risk of developing cardiovascular disease in obese children in the period before puberty. The increased MPO activity in obese subjects indicates that the activation of neutrophils likely leads to inflammatory conditions (low-level inflammation) associated with obesity. The role of MPO and its reactive oxidant species in the promotion of pathological events involved in the development of atherosclerotic changes and coronary artery disease was confirmed by several research studies ([@j_jomb-2017-0009_ref_029], [@j_jomb-2017-0009_ref_030], [@j_jomb-2017-0009_ref_031]). By analyzing the interdependent relationship that exists between MPO activity and lipid profile in the blood of the subjects, the total cholesterol levels (r=0.283, p\<0.001), LDL (r=0.397, p\<0.001) and the atherogenic index (r=0.636, p\<0.001) (*[Table V](#j_jomb-2017-0009_tab_005){ref-type="table"}*), we determined a significant positive correlation. This suggests a possible role of the MPO and its reactive oxidant species in the development of endothelial dysfunction through the modification of lipoproteins. ###### Correlation between myeloperoxidase and different variables. MPO kU/L BW (kg) BMI kg/m^2^ WC cm SBP mm/Hg HT mmol/L LDL mmol/L Atherogenic index hsCRP mmol/L UA μ mmol/L ---------- ----------- ------------- ----------- ----------- ----------- ------------ ------------------- -------------- ------------- r 0.496\*\* 0.556\*\* 0.719\*\* 0.212\*\* 0.283\*\* 0.397\*\* 0.636\*\* 0.563\*\* 0.312\*\* p 0.001 0.001 0.001 0.005 0.001 0.001 0.001 0.001 0.001 Body weight (BW), uric acid (UA). Through the study of the links between MPO activity (kU/L) and the indicators of nutritional status of the organism, BMI (r=0.556, p\<0.001), body weight (r=0.496, p\<0.001) and waist circumference (r=0.719, p\<0.001), we determined a significant positive correlation (*[Table V](#j_jomb-2017-0009_tab_005){ref-type="table"}*). This correlation confirmed that, with increasing amounts of adipose tissue in the body of obese, there is an increased accumulation of macrophages in adipose tissue and the MPO production. We established a significant positive correlation between the indicators of inflammation such as erythrocyte sedimentation rate (r=0.147, p\<0.001), fibrinogen (r=0.204, p\<0.001) and hsCRP (r=0.563, p\<0.001) and the MPO activity (*[Table V](#j_jomb-2017-0009_tab_005){ref-type="table"}*), which indicates that with increasing amounts of adipose tissue and the accumulation of macrophages in it, there is an increased production of acute phase proteins in obese subjects. Also, we revealed a significant positive correlation between MPO activity and uric acid levels in our subjects (r=0.312, p\<0.001) (*[Table V](#j_jomb-2017-0009_tab_005){ref-type="table"}*). We believe that this association indicates a probable role of MPO in the pathophysiological mechanism of endothelial dysfunction, more so since the uric acid levels in the serum were higher in obese with the metabolic syndrome. Hyperuricemia is a known risk factor for atherosclerotic events and is associated with other cardiovascular risk factors such as dyslipidemia and hypertension. Determining the inflammatory markers such as MPO and hsCRP levels in the blood of obese can be important in deciding on the antiinflammatory therapy and the prevention of the development of CVD events in obese subjects. Monitored MPO activity in the blood of obese subjects may be a significant marker indicating cardiovascular risks, a mediator of atherogenesis and a potential factor for the prevention of a cardiovascular disease. Namely, it is confirmed that the application of statins causes the repression of MPO gene expression and reduces systemic levels of protein modification by MPO-catalyzed pathways ([@j_jomb-2017-0009_ref_032]). The importance of MPO was also confirmed by detecting myeloperoxidase inhibitors that can prevent myeloperoxidase dependent inflammation and oxidative stress and possibly serve as a new therapeutic method in delaying the development of cardiovascular and other complications in obese patients ([@j_jomb-2017-0009_ref_033]). Observations of the association of MPO activity in circulation and future cardiovascular risks indicate that monitoring MPO may prove significant in predicting clinical risks. Also, the MPO is a potential factor in the development of new therapeutic methods which would delay the development of cardiovascular complications in obese patients. Conclusion {#j_jomb-2017-0009_s_005} ========== Based on our results, we can conclude that MPO activity in serum increases progressively with the development of obesity and the metabolic syndrome, suggesting that this prooxidant enzyme may have a role in the pathophysiological mechanisms of the obesity and metabolic syndrome related complications. Our results suggest examining parameters that are indicators of atherosclerotic changes in obese patients which can lead to earlier application of treatment in patients with a high risk of developing a cardiovascular disease. **Conflict of Interest Statement**: The authors stated that they have no conflicts of interest regarding the publication of this article.
Travis Finkel | November 27th, 2018 Here we are. It’s the final week of the fantasy regular season. This season has come and gone in the blink of an eye and sadly it will be the end of the line for some of us. For others, this week means everything. Win or go home. In or out. Hopefully, last week’s options brought you closer to the playoffs and hopefully this week’s options lock you into the playoff picture. Let’s check out those options from last week and then look ahead to Week 13. By the way, David Moore my boom play from last week went off this week, as per usual with my deep selections. Week 12 Recap (Half PPR) Jameis Winston: 22.9 pts, 312 yds, 2 TD, 7 rush, 24 yds – No interceptions! Lamar Jackson: 20.2 pts, 178 yds, 1 TD, 2 INT, 11 rush, 71 yds, 1 TD – QB rushing is supremely valuable Cameron Brate: 10.1 pts, 3 receptions, 26 yds, 1 TD – TE1 ROS because of redzone usage Jonnu Smith: 13.3 pts, 2 receptions, 63 yds, 1 TD – Finally becoming part of the offense Chris Herndon: 9.2 pts, 7 receptions, 57 yds – Rookie TE on the rise. Might be the last TE worthy of starting on the waiver wire Dallas Cowboys: 9 pts Buffalo Bills: 7 pts Robbie Gould: 3 pts Elijah McGuire: 3.1 pts, 6 rush, 19 yds, 1 reception, 7 yds – Weird usage for McGuire this game Adam Humphries: 14.4 pts, 6 receptions, 54 yds, 1 TD – Is he Tampa Bay’s #2 fantasy receiver? Week 13 Streaming Options Quarterback Lamar Jackson* – BAL | @Atlanta Falcons (49.1% owned) Lamar Jackson continues to roll for the Ravens. He is now 2-0 as a starter and had another good fantasy day in Week 12. His rushing ability provides him with a very high floor and his expanded passing attack from Week 12 allowed him to eclipse 20 fantasy points for the first time. A matchup with the Kansas City Chiefs should force Jackson to continue to gain massive yardage on the ground as well as step up in the passing game. *If Joe Flacco remains OUT and is not named the starter Dak Prescott – DAL | vs. New Orleans Saints (43.5% owned) Dak Prescott will attempt to keep up with Drew Brees and the New Orleans Saints offense this Thursday. Tasked with the impossible, Dak offers fantasy upside nonetheless. The New Orleans run defense is one of the best in the league so Dak will certainly have plenty of opportunities to throw the ball. On a lesser scale than Jackson, Dak offers a nice rushing element to his fantasy outlook with five rushing touchdowns in his past six games. The Saints defense is playing much better as of late, but so is the Cowboys offense. In Jerry World, Dak should have a nice day as a streamer. Honorable Mentions: Marcus Mariota (TEN) vs. NYJ, Baker Mayfield (CLE) @ HOU Tight End Chris Herndon – NYJ | @ Tennessee Titans (9.9% owned) Chris Herndon is slowly becoming the best tight end streaming option left in fantasy football. He is producing at a high level averaging 9.2 fantasy points in his past six games including 9.2 points in Week 12 against the Patriots (see above for stat line). Herndon hasn’t scored in three games after scoring in three straight prior to that, but he is producing in yardage and receptions now. It should only be a matter of time before the touchdowns and the receptions and the yardage all come together at once to make Herndon a rock-solid TE1. That may not come to fruition until next season, but for now, Herndon is producing as a top end streamer, at least. The Titans defend tight ends well, but Herndon has been the most consistent Jets passing option for the last few weeks so his role seems secured. Jack Doyle had 4 receptions for 46 yards against the Titans in Week 11 and I would expect something similar to that for Herndon. Jonnu Smith – TEN | vs. New York Jets (5.5% owned) Jonnu Smith is finally becoming a part of the offense. He has been the starter since Week 2 after Delanie Walker went down in Week 1 but has only just recently started getting attention. The Titans offense turned a corner against the Dallas Cowboys in Week 9 on Monday Night Football and by no coincidence, Jonnu Smith has been fantasy relevant in those weeks since. In that span, Smith has averaged 10.8 fantasy points, including touchdowns in three of those four games. Smith has solidified a role in the offense making him a worthy streamer. Honorable Mentions: C.J. Uzomah (CIN) vs. DEN, Gerald Everett (LAR) @ DET D/ST Tennessee Titans | vs. New York Jets (39.8% owned) The Titans defense struggled against the Houston Texans in Week 12 and against the Indianapolis Colts but they have been one of the stouter defenses on the season. In Week 13 they will get the chance to regain their form against a lowly New York Jets offense in Tennessee. The strength of the Titans is their run defense, which means if Sam Darnold returns, there is a good chance for one or two interceptions as the Jets will likely be stymied on the ground all game long. The Titans can load the box and force the Jets to throw the ball, there aren’t any weapons that riddle you with fear as a Titans owner. The Jets may score one or two touchdowns but they haven’t scored more than 17 points in their last five games. Green Bay Packers | vs. Arizona Cardinals (20.0% owned) Josh Rosen on the road in Lambeau Field in the winter. A southern California kid who plays in a dome in Arizona might not like the weather he encounters up in Wisconsin in this matchup. Rosen is T-4th in interceptions thrown this season with 11 and the Packers are T-3rd in the league for sacks. Getting Rosen under pressure early and often in a hostile environment in a must-win game for the Pack smells like a recipe for success for their defense. Honorable Mentions: Miami Dolphins | vs. Buffalo Bills, New Orleans Saints | @ Dallas Cowboys, Kansas City Chiefs | @ Oakland Raiders (43.8% owned) Kicker: Graham Gano – TB | @ Tampa Bay Buccaneers (49.8% owned) The Panthers are in a must-win game on the road against Tampa Bay, the league’s worst defense so there should be plenty of scoring opportunity for Gano. He made six extra points against Tampa Bay earlier in the season. It should be almost impossible for Carolina to find that much success getting into the end zone without needing to attempt a field goal or two this time. Honorable Mention: Sebastian Janikowski – SEA | vs. San Francisco 49ers (7.4% owned) Deep Boom Flex Plays Josh Doctson – WSH | @ Philadelphia Eagles (15.6% owned) Colt McCoy is now the starter in Washington and that may just be a good thing for the Redskins pass-catchers. McCoy is more of a gunslinger than Alex Smith; meaning, outside receivers, like Doctson, are going to get more opportunity. In McCoy’s first start last week, Doctson had six catches for 66 yards against a good Dallas secondary, good for his best performance of the season. This week he will face the most depleted secondary in football in the Philadelphia Eagles and should get his fair share of chances. As the main red zone target for the Redskins, he offers touchdown upside as well. Ty Montgomery – BAL | @ Atlanta Falcons (11.3% owned) Ty Montgomery had 8 rushes for 51 yards and 3 receptions for 13 yards in Week 12. His rush attempts came in garbage time, but it seems that he has taken over the third-down back role from Javorius Allen so he is now the receiving back in Baltimore. Gus Edwards has zero targets in his two starts; meaning, that if the Ravens fall behind this week against the Falcons, Montgomery could be in for a major workload in the passing game. Jackson is still an unproven downfield passer so he could look to check down often. Montgomery is a playmaker and against the Falcons defense, he could turn his chances into a fine fantasy day. Questions and comments? thescorecrowsports@gmail.com Follow Us on Twitter @thescorecrow Follow Us on Reddit at u/TheScorecrow Follow Travis Finkel on Twitter @TravisFinkel Main Credit Image: Embed from Getty Images
--- dub.json.orig 2019-02-15 12:03:10.000000000 +0000 +++ dub.json 2019-03-06 06:21:07.432750000 +0000 @@ -11,14 +11,9 @@ "built_with_dub", "StdLoggerDisableWarning" ], - "dependencies" : { - "libdparse": "~>0.11.0", - "dsymbol" : "~>0.6.0", - "inifiled" : "~>1.3.1", - "emsi_containers" : "0.8.0-alpha.11", - "libddoc" : "~>0.6.0", - "stdx-allocator" : "~>2.77.5" - }, + + "lflags":["-L%%LOCALBASE%%/lib/d"], + "libs" : ["dparse","inifiled","dsymbol","emsi_containers","ddoc","mir-core","stdx-allocator"], "targetPath" : "bin", "stringImportPaths" : [ "bin"
See, if the Cutie Mark Crusaders had asked Granny Smith for help, everything would have been resolved in a much more timely manner. Also, with slightly less violence. Spoiler: You can't actually win no matter how much you slap her. This is not because I'm too lazy to get more assets and code in remorse and victory, but because slapping children doesn't actually solve any problems. See, this game makes a social statement. It's an art game, whoa! So yeah, don't actually slap your children. Oh, height is measured in SM or Scootameter, which is defined here: [link] --- And here's the third game in the Season 3 minigame series! I started the game on Friday after seeing the song spoiler preview thing, so I didn't actually know how the show would go when I made most of the game. Lots of planned features weren't able to make it into the game. For example, Babs was going to say things when you smacked her, but since I couldn't find a copy of the episode with separate audio channels I couldn't grab the assets to toss in. Also, I was going to have a Blueblood Mode for those of you who wanted to smack Blueblood around, but there aren't very many vectors of him around so that didn't work out either. Maybe I'll update the game and release version 2 at some point, but don't count on it. --- If you like my work, consider buying some buttons or other random things from my store! [link]While I'm not going hungry or anything, proceeds from my store lets me bring more pony buttons to more conventions, and they also go towards supporting other artists as well as making me feel like I'm a productive member of society by making stupid pony fan games. Thanks!
.\" Copyright 2002 Walter Harms (walter.harms@informatik.uni-oldenburg.de) .\" .\" %%%LICENSE_START(GPL_NOVERSION_ONELINE) .\" Distributed under GPL .\" %%%LICENSE_END .\" .TH CEXP2 3 2020-06-09 "" "Linux Programmer's Manual" .SH NAME cexp2, cexp2f, cexp2l \- base-2 exponent of a complex number .SH SYNOPSIS .B #include <complex.h> .PP .BI "double complex cexp2(double complex " z ");" .br .BI "float complex cexp2f(float complex " z ");" .br .BI "long double complex cexp2l(long double complex " z ");" .PP Link with \fI\-lm\fP. .SH DESCRIPTION The function returns 2 raised to the power of .IR z . .SH CONFORMING TO These function names are reserved for future use in C99. .PP As at version 2.31, these functions are not provided in glibc. .\" But reserved in NAMESPACE. .SH SEE ALSO .BR cabs (3), .BR cexp (3), .BR clog10 (3), .BR complex (7)
GOP frontrunner Donald Trump touted his support from unions and the workers across America during a campaign stop in Salem, New Hampshire on Monday morning where he took questions from voters. “The workers of this country are with me because I’m going to create jobs,” Trump said to a union worker who asked how Trump could pitch his campaign message to obtain union votes. “I’ve done very well with unions,” Trump responded, referencing building projects in Manhattan where he has worked with the unions in the past. “My support is really with those workers – those people,” Trump said, referencing policemen, plumbers and construction workers. “My weakest support [is] with rich people, isn’t that funny?” Trump joked that he doesn’t even like rich people. “The unions are almost all Democrat,” Trump said, adding that is their problem. “The men and people of the Teamsters want to vote for me,” he said, adding, the leadership is always stuck with the Democrats, “but the workers want to vote for Trump.”
Introduction {#S1} ============ Reproductive system development and control in mammals is dependent on specific neurons located in the hypothalamus that secrete gonadotropin-releasing hormone-1 (GnRH-1) and control the pituitary--gonadal axis (Figure [1](#F1){ref-type="fig"}). During embryogenesis, these neurons originate in the nasal placode and migrate into the forebrain along the olfactory-vomeronasal nerves ([@B1]--[@B3]). Alterations in this migratory process lead to defective GnRH-1 secretion, resulting in heterogeneous genetic disorders such as idiopathic hypogonadotropic hypogonadism (IHH), and other reproductive diseases characterized by the reduction in or failure of sexual maturation and competence. Another consequence of these migratory neuronal defects can be olfactory dysfunction. Depending of the affected genes, other neurological developmental disorders can also be encountered ([@B1]--[@B4]). ![**Schematic representation of the reproductive axis and the different genes invalidating mutations participating in Kallman syndrome and nIHH**. GnRH neurons migrate from nasal placode to hypothalamus in the first weeks of fetal life. Several genes are represented in the left column: their invalidating mutations are responsible for Kallmann syndrome and olfactory dysfunction. Kiss1 neurons integrate different hormonal, metabolic, circadian inputs from other hypothalamic and brain areas and thus stimulate GnRH neurons firing. Several genes are represented in the right black column, including KISS1-GPR54 system, which invalidating mutations lead to normosmic idiopathic hypogonadotropic hypogonadism. GnRH secretion leads to gonadotropins FSH and LH pituitary release. LH and FSH control sex steroids secretion and gametogenesis \[adapted from Valdes-Socin et al. ([@B1]), with permission\].](fendo-05-00109-g001){#F1} Thus, idiopathic hypogonadotropic hypogonadism (IHH) is a genetic disease that can occur with a normal sense of smell (normosmic IHH) or in association with anosmia (Kallmann syndrome; KS). To date, mutations in many genes have been described in relations to KS and/or normosmic IHH (nIHH) (Tables [1](#T1){ref-type="table"} and [2](#T2){ref-type="table"}). Hypogonadotropic hypogonadism (HH) can also be found in association with other distinctive clinical syndromic conditions, such as Prader Willi syndrome, that are outside the scope of the current review. ###### **Genes and phenotype related only with normosmic IHH**. Genes Locus Inheritance Phenotype Comment ---------- ----------- ---------------------------------------------------------- --------------- ---------------- *GNRH1* 8p21-11.2 Autosomal recessive Normosmic IHH Cryptorchidism *GNRH-R* 4q13.2-3 -- *KISS1* 1q32 Autosomal recessive Normosmic IHH -- *KISS1R* 19p13.3 -- *LEP* 7q31.3 Autosomal recessive Normosmic IHH Severe obesity *LEPR* 1p31 *TAC3* 12q13.3 Autosomal recessive Normosmic IHH -- *TACR3* 4q25 -- *DUSP6* 12q21.33 Complex trait Normosmic IHH -- *LHB* 19q13.32 Polymorphism and mutations (homozygous and heterozygous) Normosmic IHH -- *FSHB* 11p13 Polymorphism and mutations Normosmic IHH -- ###### **Genes, genes product, function, and phenotypes associated to congenital hypogonadism hipogonadotropic with anosmia/hyposmia (KS, Kallmann syndrome)**. Genes Locus Gene product Function Inheritance Type of hypogonadism Clinical phenotype ----------------- -------------- ---------------------------------------------------------------------------- ----------------------------------------- ----------------------------------------------------- ------------------------------------ ----------------------------------------------------------------------- *KAL-1 (KS-1)* Xp22.3 Anosmin-1 Migration of GnRH and olfactory neurons X-linked Kallmann syndrome or normosmic IHH Unilateral renal agenesis, synkinesia *FGF8 (KS-6)* 10q24 Fibroblast growth factor 8 Migration of GnRH neurons Autosomal dominant Kallmann syndrome or normosmic IHH Cleft lip/relatively common (mid-line defects) *FGFR1 (KS-2)* 8p11.22 Fibroblast growth factor receptor Migration of GnRH neurons Autosomal dominant Kallmann syndrome or normosmic IHH *FGF 17* 8p2.3 Fibroblast growth factor 17 Migration of GnRH neurons Autosomal recessive Kallmann syndrome or normosmic IHH *FLRT3* 20p12.1 Fibronecting like domain containing leucine enrich transmembrane protein 3 Interaction with FGFR Complex trait Kallmann syndrome FGF network KO mouse is embryonic lethal *DUSP6* 12q21.33 Dual specific inhibitor phosphatases Inhibitor of MAPK pathway Autosomal recessive Kallmann syndrome FGF network *IL17RD* 3p14.3 Interleukin-17 receptor Early stage of GnRH specification Autosomal recessive Kallmann syndrome FGF network *SPRY4* 5q31.3 Sprouty homolog interactor with FGFR1 Inhibitor of MAPK pathway Autosomal recessive Kallmann syndrome FGF network *CHD7 (KS-5)* 8q12.1-q12.2 Chromatin remodelating factor Autosomal dominant Kallmann syndrome or normosmic IHH CHARGE Syndrome *SEMA3A* 7q21.11 Semaphorine 3A Axonal path finding of GnRH neurons Autosomal dominant Kallmann syndrome -- *PROK2 (KS-3)* 3p21.1 Prokineticin-2 Migration of GnRH neurons Autosomal dominant and recessive Kallmann syndrome or normosmic IHH Obesity, epilepsy, sleep disorders, fibrous dysplasia, and synkinesia *PROKR2 (KS-4)* 20p13 Prok receptor Kallmann syndrome or normosmic IHH *NELF* 9q34.3 Nasal embrionic LHRH factor Migration of GnRH neurons Digenic model (in association wth FGFR1 and HS6ST1) Kallmann syndrome or normosmic IHH -- *WDR11* 10q WD repeat containing protein family Development of neurons Autosomal dominant Kallmann syndrome or normosmic IHH -- *HS6ST1* 2q21 Heparan sulfate 6-O Sulfotransferase HS modifier Complex trait Kallmann syndrome or normosmic IHH -- Regulates neural branching In this review, we focus on genetic central hypogonadism, which is more frequently encountered in males than in females. Congenital IHH is a clinically and genetically heterogeneous disorder ([@B3], [@B4]). Although sporadic cases predominate, families with congenital IHH have been reported with X-linked, autosomal dominant (AD) or autosomal recessive (AR) inheritance patterns ([@B1]--[@B4]). In some families, high variability in reproductive and non-reproductive phenotypic features suggests the presence of complex inheritance. In particular, polygenic (digenic or oligogenic) forms and variable forms of transmission can be found in selected cases ([@B6]--[@B11]). Indeed, further complexity is added by the remarkable observation of reversibility of the phenotype in some cases of genetically determined hypogonadism ([@B12]--[@B16]). The Human Reproductive Axis {#S2} =========================== Normal human reproduction and sexual characteristics rely on an intact hypothalamic--pituitary--gonadal axis (HPG; Figure [1](#F1){ref-type="fig"}). Hypogonadism is defined as the insufficient production of sex hormones with or without disturbed gametogenesis. HH results from a dysfunction of the hypothalamic--pituitary axis interfering with control of gonadotropin secretion ([@B1]--[@B3], [@B16]). During life, the activity of the HPG axis has a tri-phasic pattern of "on-off-on." A first phase of activity occurs from the 16th week of intrauterine life as well as in the period between the 4th and 10th weeks of postnatal life (or "mini-puberty"). Mini-puberty is characterized by an increase in gonadotropin and steroid hormone secretion. Gonadotropins and sex hormones levels rise to a lesser extent than in true puberty. After mini-puberty, the HPG axis is repressed ("off") until puberty, when the system is reactivated ("on"). HPG axis activity is maintained throughout adult life in men whereas in women, menopause intervenes, and low sex steroids and compensatory high gonadotropin levels are characteristic ([@B1]--[@B3]). The immediate postnatal period can be a window of opportunity for pediatricians and neonatologists to diagnose certain forms of HH. The congenital gonadotropin deficiency phenotype is variable and depends on the gender, the magnitude of the deficit, and the specific genetic abnormalities (Figure [1](#F1){ref-type="fig"}). At the time of puberty, the diagnosis of HH may be suspected due to the absence in the onset of puberty and development of secondary sex characteristics in both sexes. In adulthood, gonadotropin deficiency can be suspected in a woman without breast development or who presents with primary amenorrhea. In adult men, gynecomastia, small testes (\<14 mL), penile hypoplasia, and/or oligo-azoospermia raise the clinical suspicion of congenital hypogonadism ([@B1]--[@B3]). Normosmic idiopathic hypogonadotropic hypogonadism {#S2-1} -------------------------------------------------- The genetic abnormalities described below are infrequent or rare (see Table [1](#T1){ref-type="table"}). In contrast to KS, patients with nIHH have a normal sense of smell and tend not to have other clinical signs. From a biological point of view, sex steroids secretion and gametogenesis are compromised, but to varying degrees. As it would be expected, reproductive phenotypes are more pronounced in subjects in whom the receptor is inactivated as compared to those harboring hormone inactivating mutations. ### GNRH-1 and GNRHR mutations {#S2-1-1} Gonadotropin-releasing hormone (GnRH) is encoded by the *GNRH1* gene, which is located on chromosome 8p21-11.2. GNRH-1 mutations are rare and have been described in only two families ([@B17], [@B18]). A single homozygous mutation (c.18-19insA) affecting the peptide precursor preproGnRH was described in a Romanian family ([@B17]). It encoded a truncated and biologically inactive peptide in a male patient and his sister, both of whom had delayed puberty and normal sense of smell. The phenotype was reversed by pulsatile GnRH administration. Another homozygous *GNRH1* mutation was identified in a prepubertal boy from Armenia, with cryptorchidism and microphallus ([@B18]). The *GNRHR* gene (locus on chromosome 4q13.2-3) encodes for the GNRH receptor. There is some variability in clinical expression of *GnRHR* mutations that is due to a partial loss of function. *GNRHR* mutations have been described in about 40--50% of familial AR nIHH cases, and in around 17% of sporadic nIHH ([@B1]--[@B3]). ### KISS1 and GFPR54 mutations {#S2-1-2} The gene *KISS1* was described originally as a metastasis suppressor gene but it is a key gene in reproduction. It is localized on chromosome 1q32, encoding a protein called kisspeptin, which is, in turn, processed in four peptides Kp10, Kp13, Kp14, and Kp54. Kisspeptins stimulate GnRH neuronal firing and GnRH secretion, which then triggers an increased release of LH and FSH (Figure [1](#F1){ref-type="fig"}). The *KISS1R* gene (locus 19p.13.3), a G-protein-coupled receptor, is also known as the *GPR54* gene, and it is the receptor for kisspeptins. *GPR54* mutations can be compound heterozygous or homozygous ([@B19]--[@B22]). Loss of function mutations in *KISS1* ([@B20]) and *GPR54* cause HH in mice and men ([@B19], [@B21], [@B22]). Moreover, higher serum kisspeptins levels are found in obese hypogonadal men and in central hypogonadism than in controls ([@B23]). In patients with *GPR54* mutations, GnRH deficiency can be partial or complete, permanent, or reversible, and can have a congenital or adult onset. Six homozygous inactivating mutations have been described in 19 individuals with nIHH: their LH and FSH secretion was blunted but normal secretion was restored after exogenous GnRH stimulation ([@B19], [@B21], [@B22]). Kisspeptins are highly expressed in placenta during pregnancy; different patterns of spatiotemporal expression of *KISS1* and *KISSR* were described in normal and pathological placentas ([@B24]). ### TAC3R and TAC3 mutations {#S2-1-3} The *TACR3* gene (chromosome 4q25) encodes the neurokinin 3 receptor (NK3R) and the *TAC3* gene (chromosome 12q13.3) encodes neurokinin B (NKB), its endogenous ligand. nIHH caused by mutations in *TAC3* and *TAC3R* have an AR heritance ([@B25]). As well as the *GPR54/Kisspeptin* system, *TACR3/TAC3* pathway stimulates GnRH neurons. In initial studies, defects in either *TAC3* or *TACR3* were found in 11 patients from 5 of 10 families studied, but in none of 50 sporadic cases ([@B25]--[@B27]). Francou et al. studied the gonadotropin axis dysfunction associated with nCHH due to TAC3/TACR3 mutations: it was related to a low GnRH pulsatile frequency leading to a low frequency of alpha-subunit pulses and to an elevated FSH/LH ratio ([@B27]). They suggested that this ratio might be useful for pre-screening nCHH patients for TAC3/TACR3 mutations. In another broad cohort of normosmic IHH patients, 7 of the 16 males and 5 of the 7 females with *TACR3/TAC3* mutations were assessed after discontinuation of therapy: 6 of the 7 males and 4 of the 5 females demonstrated evidence for reversibility of their hypogonadotropism ([@B14]). ### Leptin (Ob) and leptin receptor mutations {#S2-1-4} Leptin is an adipocyte secreted protein that ensures a link between body fat and the reproductive axis. HH and severe obesity are seen in humans and ob/ob mice with genetic leptin deficiency. There are at least 12 patients with leptin deficiency and homozygous mutations. In such cases, recombinant leptin administration restores gonadotropin secretion and dramatically reduces body mass index. Defects in the leptin receptor are more common, being identified in 3% of severe early onset obesity patients. Interestingly, the leptin receptor is expressed on kisspeptin neurons whereas leptin administration induces the expression of *Kiss-1* in *ob/ob* mice ([@B3], [@B28]). ### LHB mutations {#S2-1-5} The *LHB* subunit gene is located at chromosome 19q13.32. Five mutations have been published up to now; clinical and molecular data are summarized in Table [3](#T3){ref-type="table"}. The syndrome of preserved spermatogenesis with androgenic failure (now known to be due to LH deficiency) was described for the first time by Pasqualini and Bur in 1950 ([@B29]). The term "fertile eunuch" was then coined to describe these men. ###### **Clinical, biological, pathological, and genetic studies in patients with LH deficiency**. Weiss et al. ([@B30]) Valdes-Socin et al. ([@B31]) Lofrano-Porto et al. ([@B32]) Achard et al. ([@B33]) Basciani et al. ([@B34]) ----------------------- ------------------------ ------------------------------ ------------------------------- ---------------------------------- -------------------------- Mutation LH beta Glut54Arg Glyc36Asp IVS + 1G \> C Del10HisProlLeu IVS + 1G \> C Homozygous Homozygous Homozygous Homozygous 12-bp deletion in Exon 2 Heterozygous Exon localization Exon 2 Exon 2 Intron 2 Exon 2 Exon 2 LH Functional Studies Reduced LH bioactivity Knot cysteine Abnormal tertiary structure Reduced LH bioactivity No LH secretion No LH dimerization No LH dimerization Plasma LH LH = 64 LH undetectable LH undetectable No detectable LH LH undetectable Women No No 1, amenorrhea 1, amenorrhea 1, oligomenorrhea Men One man, impuberism One man, impuberism Two men, high FSH et SUα One man, impuberism One man FSH = 113 Hypoandrogenism FSH = 20.7 FSH = 8.7 FSH = 23 SUα = 1.28 αSU = 0.8 inhB = N inhB = N inhB = N High AMH Testis biopsy Leydig = 0 Leydig+ Leydig = 0 Leydig± (after hCG) Leydig+ Arrested SPG SPG diminished Arrested SPG SPG+ SPG+ Fertility -- Azoospermia Azoospermia Normospermia but abnormal forms. Oligospermia Treatment T2 then hCG T2 then hCG T2 T2 then hCG T2 then hCG *All but one patient (Basciani et al.) are homozygotes for an inactivating βLH mutation*. *SU α, alpha subunit; inhB, inhibin B; AMH, antimullerian hormone; SPG, spermatogenesis; T2, testosterone; N, normal; Anorm, abnormal; Dim, dimerization*. *Normal values: FSH (2--14 UI/L), LH (2--10 UI/L), alpha subunit (\<1.2 mUI/L)*. In affected men, sexual differentiation was normal, but the absence of or significantly reduced LH secretion restrained the induction of puberty and altered Leydig cell proliferation and maturation ([@B30]--[@B34]). These males have impaired spermatogenesis, ranging from azoospermia to oligospermia, which has been linked to the lack of LH stimulation and low intratesticular testosterone action ([@B5], [@B30]--[@B35]). In 2004, we described a man with a homozygous missense mutation (G36D) in the *LHB* subunit gene that abrogated subunit dimerization and rendered LH biologically and immunologically inactive ([@B31]). Treatment with human chorionic gonadotropin (hCG) induced near normalization of testicular structure ([@B5]). The patient and his wife conceived a child by intracytoplasmic sperm injection from ejaculated sperm. The male heterozygous child had normal LH, FSH, and testosterone levels, at the age of 4 weeks ([@B5], [@B35]). In women, *LHB* mutations lead to a normal pubertal development but they can have primary amenorrhea and micropolycystic ovaries ([@B32]--[@B34]). ### FSHB mutations {#S2-1-6} The β subunit of FSH (*FSHB*) is located at chromosome 11p13. Three men and four women with inactivating FSH mutations have been reported. Men have normal pubertal development although they have azoospermia, whereas women have abnormal pubertal maturation; in these patients high level of LH are found whereas FSH is low/undetectable. Estrogen and progesterone concentrations are low ([@B1], [@B2]). ### Gonadotropins receptor (LHR and FSHR) mutations {#S2-1-7} Inactivating mutations affecting the gonadotropin receptors contrast with those affecting their ligands in that they are invariably associated with hypergonadotropic hypogonadism; hence, they are not discussed here. Kallmann syndrome {#S2-2} ----------------- Kallmann syndrome, involving the characteristic features of HH and anosmia was noted in the historical literature long before being properly characterized as a genetic disorder. A man with delayed puberty and the lack of olfactory bulbs was reported over 150 years ago by the Spanish doctor Aureliano Maestre de San Juan (1828--1890). The German Franz Kallmann (1897--1965) completed in the 1940s a description of hypogonadism and anosmia in two families, establishing the genetic basis of transmission. The Swiss scientist, Georges de Morsier (1894--1982) provided the neuropathological description of the syndrome. KS has a prevalence of 1/5000, with a clear male predominance ([@B1]--[@B3], [@B36], [@B37]). Several mechanisms of inheritance and molecular mutations are described here after and summarized in Table [2](#T2){ref-type="table"}. ### Anosmin-1 (KAL-1) mutations {#S2-2-8} The *KAL-1* gene is located on the X chromosome at Xp22.3. *KAL-1* encodes anosmin-1, a glycoprotein playing an in important role in kidney, respiratory tract, digestive system, and brain embryogenesis ([@B1]--[@B3], [@B37], [@B38]). Anosmin-1 is an adhesion molecule located on cell surface, consistent with the underlying defect of embryonic neuronal migration in KS. Anosmin-1 is mainly involved in growth and migration of GnRH, mitral olfactory cells, and Purkinje cerebellum neurons. Mutations in *KAL-1* gene cause 14% of familial cases of KS and 11% of cases of sporadic cases ([@B1]--[@B3], [@B38]). *KAL-1* mutations lead to HH with or without anosmia and may include synkinesis (mirror movements), unilateral renal aplasia, and mid-line abnormalities such as cleft lip/palate ([@B37], [@B38]). ### FGF8 (KAL-6), FGF17, and FGFR1 (KAL-2) mutations {#S2-2-9} The *FGF8* gene (also known as *KAL-6*) is located on chromosome 10q24. Fibroblast growth factors (FGF) interact with FGF tyrosine kinase receptors to mediate growth and development. *FGF8* participates in gastrulation, regionalization of the brain, and organogenesis of the limb and face as an embryonic epithelial factor. *FGF8* and its receptor *FGFR1* are involved in GnRH neuron migration. *FGF8* inactivating mutations can lead to both KS and nIHH with an AD inheritance. Triallelic inheritance has also been described. In addition, cleft lip or palate and other mid-line defects have been described in patients with *FGF8* and *FGFR1* mutations. Other features such as corpus callosum hypoplasia-agenesis or nose, ear, and finger abnormalities are more specific of *FGFR1* defects ([@B37], [@B39], [@B40]). *FGF17* is located at chromosome 8p2.3 and *FGF17* has a strong sequence identity with *FGF8*. *FGF17* might be implicated in GnRH neuron biology as an alternative to ligand *FGF8b*. Miraoui et al. have identified FGF17 heterozygous mutations in three patients with congenital HH and anosmia and in another individual. In a sporadic male patient with congenital, HH without anosmia ([@B41]). *FGFR1* is located at 8p11.22-p11.23 and *FGFR1* mutations have been identified in 10% of KS. *FGFR1* related KS has an AD inheritance, associated with incomplete penetrance and interfamilial variability. FGFR1 encodes for type 1 FGF receptor, which is expressed in several embryonic tissues. The activation of the FGF--FGFR complex requires two FGF ligands. FLRT3 (Fibronecting like domain containing leucine enrich transmembrane protein 3) also interacts with FGFR (see Table [2](#T2){ref-type="table"}). In addition, the binding of heparin or HS: heparan sulfate proteoglycan (see HS6ST1 gene later) have been shown to be essential for FGF receptor dimerization and function ([@B38]). Mice with Fgfr1^−/−^ mutations and patients with loss-of-function mutations in *FGFR1* have defective GnRH neuron migration ([@B31]). Thus, loss of function mutations in *FGFR1* which is involved in the development of the face, lead to the abnormal morphogenesis of the olfactory bulb, while specific gain-of function mutations in *FGFR1* cause craniosynostosis ([@B37], [@B39]--[@B41]). ### PROK2 and PROKR2 mutations {#S2-2-10} *PROK2* (locus 3p21.1) and *PROKR2* (locus 20p13) genes encode for prokineticin-2 and its receptor ([@B42]). Prok2 and prokr2 gene knockout mice both have agenesis or hypoplasia of the olfactory bulbs, in association with HH. In this model, there is also abnormal GnRH neuron migration ([@B43]). Its heritance can be AD or AR. Mutations in these genes are described in up to 6% of KS and 3% of nIHH ([@B1]--[@B3], [@B42]). In pituitary deficits associated with septo-optical dysplasia, McCabe et al. ([@B44]), described a patient with a heterozygous L173R mutation in *PROKR2* gene, while its healthy mother is homozygous for this mutation. As some controversy exists on the pathogenic role of some PROKR2 mutations, the prevalence given should be interpreted cautiously. Indeed, digenic mutations are encountered (i.e., *PROKR2* and *KAL1*), while heterozygous patients (i.e., AD transmission) are present in families with healthy relatives presenting the same genotype. There are no reliable accessory pathognomonic features of *PROK2/PROKR2* function loss: patients have been described with obesity, sleep disorder, fibrous dysplasia, epilepsy, and synkinesia ([@B2], [@B3], [@B43], [@B44]). ### NELF mutations {#S2-2-11} The *NELF* gene is located at chromosome 9q34.3. This gene encodes the nasal embryonic LHRH factor. The *NELF* gene is detected in olfactory sensory cells and GnRH cells during embryonic development. It constitutes a guidance molecule for the olfactory axon and GnRH neurons across the nasal region ([@B45]). *NELF* mutations have been described in patients with KS, in association with mutations in *FGFR1* or *HS6ST1*, indicating digenic inheritance. More studies are necessary to confirm a relationship between *NELF* and any reproductive and olfactory disorders ([@B2]). ### WDR11 mutations {#S2-2-12} The *WDR11* locus is at chromosome 10q26.12 and its heritance is AD. It encodes murine Wdr11 that is expressed in the developing olfactory and GnRH migratory pathway and in the adult hypothalamus. *WDR11* biological function is not well understood: however, Kim et al. identified five different heterozygous mutations in nIHH and KS patients. WDR11 probably also plays an important role in puberty ([@B46]). ### CHD7 mutations {#S2-2-13} The *CHD7* gene that encodes a chromatin-remodeling factor is located on chromosome 8q12.1. Mutations (AD inheritance) of this gene can cause CHARGE syndrome (Colobomata, Heart Anomalies, Choanal Atresia, Retardation, Genital, and Ear anomalies). *CHD7* was screened in nearly 200 patients: 7 KS and nIHH patients were found, 3 of them with olfactory abnormalities. CHD7 mutations were identified in 6% of KS and 6% of nIHH, respectively ([@B1], [@B2], [@B47], [@B48]). Laittinen et al. described in 2012, a KS patient with a truncating CHD7 mutation that underwent a reversal of central hypogonadism after therapy discontinuation ([@B15]). ### HS6ST1 mutations {#S2-2-14} The *HS6ST1* gene (locus 2q.21) encodes a 6-*O*-sulfation enzyme, which is a member of the heparan sulfate enzyme family. The protein is involved in normal neuronal development and may play a role in limb development. In nematodes, HS 6-*O*-sulfate interacts with anosmin-1 and it is involved in function of FGFR1 and FGF8. *HS6ST1* shows complex inheritance patterns, not following autosomal or recessive transmission. *HS6ST1* mutations were found in KS patients in combination with mutations affecting the FGFR1 gene. *HS6ST1* mutations were found in patients who had nIHH or variable degrees of olfactory dysfunction (KS) as well as with either normal or abnormal olfactory structures ([@B49]). ### IL17RD, DUSP6, and SPRY4 mutations {#S2-2-15} The *IL17RD* gene (locus 3p14.3) encodes a membrane protein belonging to the interleukin-17 receptor (*IL-17R*) protein family. In a study with eight patients with congenital hypogonadism all had KS, 7/8 had absent puberty, 6/8 showed congenital hearing loss. One *IL17RD* allelic defect is likely to be insufficient, meaning that additional affected alleles in the same and/or other genes must be present to create the phenotype of KS with hearing loss ([@B41]). *DUSP6* (locus 12q22-q23) encodes a member of the dual specificity protein phosphatase subfamily. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily ([@B25]) Three patients were described with DUSP6 and *FGFR1* heterozygous mutation; they were hypogonadic, while one had hearing loss and the two others had abnormal speech. DUSP6^−/−^ mice are however viable and fertile ([@B41]). *SPRY4* (locus 5q.31.3) gene encodes a protein (sprouty homolog 4), which is an inhibitor of the receptor-transduced mitogen-activated protein kinase (MAPK) signaling pathway. It is positioned upstream of RAS gene activation and impairs the formation of active GTP-RAS. Diseases associated with SPRY4 include germ cell cancer, and testicular cancer. Miraoui et al. identified four anosmic patients with congenital HH (three females and one male) with heterozygosity for a c.530A-G transition in exon 3 of the SPRY4 gene. Another female patient had a heterozygosity for a c.910G-A transition in exon 3 of the SPRY4 gene. These mutations were not found in 155 controls. One of the patients also had hearing loss and another one had abnormal dentition ([@B41]). ### HESX1 mutations {#S2-2-16} The *HESX1* gene (locus 3p14.3) encodes a protein that is a transcriptional repressor in the developing forebrain and pituitary gland ([@B27]). *HESX1* plays an important role in the temporal and sequential development of the forebrain, hypothalamus, optic nerve, and posterior pituitary ([@B28]). Mutations in *HESX1* have also been described in isolated growth hormone deficiency and combined pituitary deficiency ([@B50], [@B51]). *HESX1* mutations have been described in 1.4% of IHH/KS patients ([@B50], [@B51]), but as in *PROKR2* mutations this prevalence should be interpreted cautiously. ### SEMA3A mutations {#S2-2-17} The *SEMA3A* gene (7q21.11) encodes the semaphorin 3A protein, which regulates axonal path finding and participates in GnRH migration. Deletions and mutations of the *SEMA3A* gene validate a role for *SEMA3A* in KS. Moreover, SEMA3A knockout mice exhibit GnRH dependent hypogonadism and abnormal olfactory bulb innervation ([@B52]). Conclusion and Perspectives {#S3} =========================== Kallmann syndrome and nIHH have the potential to unravel the processes behind normal embryonic development and reproductive neuroendocrine maturation ([@B2]). The complex biological path from childhood to the onset of human puberty is still incompletely understood ([@B1]--[@B3]). The molecular mechanism behind IHH remains unknown in a large number of cases. Over the past decade, the same genetic mutations have been described in associated with both KS and nIHH. Moreover, a significant clinical heterogeneity is seen in isolated GnRH deficiency, which might be explained to some extent by oligogenicity ([@B6], [@B7], [@B9]). In addition, over 60% of central hypogonadic patients have no identifiable mutations, suggesting that yet more disease loci remain to be discovered ([@B1]--[@B3]). These unidentified genes warrant an integrated research including clinicians, geneticists, and biological investigators to pursue further understanding of these fascinating cases. Conflict of Interest Statement {#S4} ============================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. We acknowledge the National Fund of Scientific Research (FNRS, Brussels, Belgium), for their financial support and Dr AF Daly for kindly reviewing the manuscript. [^1]: Edited by: Gianluca Tamagno, St Columcille's Hospital, Ireland [^2]: Reviewed by: Alexandru Saveanu, Aix Marseille University, France; Thomas King, Mater Misericordiae University Hospital, Ireland [^3]: This article was submitted to Neuroendocrine Science, a section of the journal Frontiers in Endocrinology.
1. Field of the Invention The present invention relates to a nail magazine for use in a power nailing hand tool and, more particularly, to such a nail magazine, which is practical for use to feed L-shaped nails for fastening asbestos slats or light angle bars. 2. Description of the Related Art FIG. 1 shows a conventional L-shaped nail for use in a power nailing hand tool to which the invention pertained. The L-shaped nail has a flat elongated nail body, an angled head extended from the top end of the nail body, a point extended from the bottom end of the nail body, and an upwardly extended and biased toothed strip on the middle. This design of L-shaped nail is suitable for fastening asbestos slats, thin-layer angle bars, and other thin-layer sheet materials. The flat body can easily be driven into the workpiece, preventing breaking of the workpiece. The toothed strip enhances the positioning of the nail body in the workpiece. When in use, L-shaped nails are fastened together by a belt or tape, and then the belt of nails is rolled up and loaded in the nail magazine of a power nailing hand tool for fastening. FIG. 2 shows a nail magazine constructed according to the prior art and adapted to hold and feed round nails as shown in FIG. 3. This structure of nail magazine comprises a casing with an upright center shaft, and a cover hinged to the casing and adapted to hold down a belt of nails in the casing around the upright center shaft. The casing has a nail feed hole for output of nails one after another. When viewed from one side after a belt of round nails has been rolled up, the heads of the nails at an outer layer are respectively supported below the heads of the nails of at an inner layer (see FIG. 3). However, when a belt of L-shaped nails rolled up, the angled heads of the nails at an outer layer are respectively rested on the angled heads of the nails at an inner layer. Therefore, the conventional nail magazine shown in FIG. 2 is not practical for feeding L-shaped nails.
There was an interesting sight at Raiders OTA practice today -- Darren McFadden was fielding kicks. This is something that was unthinkable in the past as he was too valuable to the team as a running back. He was also getting paid well to be that feature back. Neither of those are the case anymore and it opens the door for the Raiders to try to use him in a multitude of different ways. Dennis Allen was asked about the possibility of McFadden returning kicks, to which his response was "Anything is an option." It was a similar sentiment when it was noted that veteran free agent signee, Maurice Jones-Drew was back fielding punts. "We're considering anything. That's what this time of year is for. Yeah, we're going to look at a lot of different things." Both running backs have struggled with injuries of late. McFadden has always struggled with injuries even without kick return duties. The Raiders won't be out much financially if McFadden gets injured but they would be out the player. He and Maurice Jones-Drew are expected to share carries this season. Follow @LeviDamien
April Update This article was originally posted by Ed at the original HillRunner.com Blogs. April was, overall, a good month. I got in some hard training but yet, some inconsistency and a great race. Out of the 30 days I ran 26 days and missed four days. I had wanted to average at least 200 miles per month this year. I did that Jan, Feb and March in April I ran 199.18 miles – yes that’s right, less than 1 mile shy. That’s ok because the quality of the 199.18 miles was very good. I averaged a 7:48 per mile pace for the month and ran a total of 25 hours and 45 minutes. This training set me up for a race on the last day of the month. A race that was well executed and netted me a new PR in the 5K. My new 5K PR is down to 18:16 – not bad for a 45 year old with adult onset running disorder. I did have an issue with needing to move the Tuesday workouts to Wednesday feeling that one more easy day would put my legs in the best condition to get the most out of the workout. That is something that I will correct this month especially because Coach Hill has dangled a very tempting carrot in front me. He is giving me the option to do a progression run on Thursdays if I feel good (not more than two Thursdays in a row though.) The prospect of more hard work is very tantalizing – I want that! I am ready, willing and able to work myself to tears if it means achieving my goals of a sub 18:00 5K, sub 30:00 8K, a sub 1:21:00 ½ marathon and a sub 3:00:00 marathon.
The study of forest structure is one of the basic requirements to achieve the objectives of close to nature silviculture. The purpose of this study was to identify the structural characteristics of coppice forest stands in Fandoghlou forest, Ardebil province. Three representative sites were carefully selected after detailed field survey. In each site, 3 sample plots with one hectare area (100×100 m) were established according to a random systematic design. In addition, in each sample plot, 25 subplots (4×5m) were determined for regeneration study. In each microplot, the frequency of regeneration was recorded in different diameter and height classes. Data were analyzed using appropriate softwares (Excel and SPSS). Results showed that, Fagus orientalis Lipesky, is the dominant species in one of the sites and in two other sites, beech accompanied hornbeam and hazelnut. The situation of stand structure and regeneration in site one and two were better than site three. Distribution charts of number in diagonal classes showed uneven-aged and irregular stands. Mean comparison of structural parameters in studied sites showed a significant difference at 5% confidence level for various sites.
Comparison of rat brain and heart mitochondrial hexokinase solubilized by methohexital. The purpose of the present investigation was to compare the solubilizing effect of methohexital on the mitochondrially bound hexokinase activity in brain and heart tissue of the rat. Experiments were performed using intact rats, the isolated perfused rat brain and heart as well as mitochondrial fractions from rat brain and heart tissue. It was shown that bound hexokinase activity was significantly solubilized by methohexital in brain tissue in vivo and in the isolated perfused rat brain but no effect was demonstrable in heart tissue. When mitochondrial fractions were incubated with methohexital in vitro, hexokinase activity was significantly solubilized from brain mitochondria but only slightly from heart mitochondria although glucose-6-phosphate was able to displace hexokinase also from heart mitochondria. The results suggest that mitochondrially bound hexokinase activity in brain tissue is particularly sensitive against the solubilizing effect of anesthetics. This effect could contribute to the sensitivity of brain function and metabolism against anesthetic drugs.
Specially designed ponds for rearing of prawns can be treated as a Plant Victory Aqua Farm Ltd vs ACIT (Supreme Court) The assessee has claimed depreciation in respect of these ponds by contending that these prawn ponds are tools to its business and therefore constitute ‘plant’ within the meaning of Section 32 of the Income-tax Act, 1961. Brief Facts- The assessee is a company doing business of ‘Aqua Culture’. It grows prawns in specially designed ponds. Question of Law- Whether ‘natural pond’ which as per the assessee is specially designed for rearing prawns would be treated as ‘Plant’ within Section 32 of the Income-tax Act, 1961. Contention of the Assessee The assessee has claimed depreciation in respect of these ponds by contending that these prawn ponds are tools to its business and therefore constitute ‘plant’ within the meaning of Section 32 of the Income-tax Act, 1961. Contention of the Revenue The Assessing Officer disallowed the claim of the assessee. Before the Apex Court, the Revenue attempted to effect that the pond in question was natural and not constructed/ specially designed by the assessee. Held by the Apex Court Background The Apex Court at the outset mentioned that one Division Bench of the High Court of Kerala in the case of the same assessee had on earlier occasion decided the question of law in the negative by holding that it is not ‘plant’. The Apex Court also mentioned that another Division Bench by the impugned judgement dated 14.10.2014, even after noticing the earlier judgement, has not agreed with the earlier opinion and has rendered contrary decision. The Apex Court decided to decide these appeals on merits (after the filing of appeals with the Apex Court against both the High Court judgements), rather than remanding the case back to the High Court for consideration by a larger bench. Decision of the Apex Court a. The Apex Court at the outset put forth that if these ponds are ‘plants’, then they are eligible for depreciation at the rates applicable to plant and machinery and the case would be covered by provisions Section 32 of Income-tax Act, 1961. The Apex Court also chose not to deal with this aspect in detail with reference to various judgements including its own judgement in the case of CIT , Karnataka vs Karnataka Power Corporation [ 2002 (9) SCC 571]. The Apex Court in the course of rendering this judgement made reference to certain portions of its own judgement in the case of Karnataka Power Corporation, the crux of the same is as under In the Karnataka Power Corporation case, the electricity generating station buildings had to be treated as a plant for the purpose of granting investment allowance given the special technical requirements attached to the building and also it being an integral part of its generating system. The Apex Court differentiated the facts of Karnataka Power Corporation case with its decision in the case of CIT vs Anand Theatres 224 ITR 192 by mentioning that that the question basically is a question of fact and where it is found as a fact that a building has been so planned and constructed to serve an assessee’s special technical requirements, it will qualify to be treated as a plant for the purpose of investment allowance. b. The High Court vide its judgement dated 14.10.2014 while deciding the case in favour of the assessee, specifically mentioned that prawns are grown in specially designed ponds. c. Finally , the Apex Court held that the High Court judgement dated 14.10.2014 rightly rested the case on ‘functional test’ and since the ponds were specially designed for rearing/ breeding of the prawns, they have to be treated as tools of the business and depreciation was admissible on these ponds. The question of law was decided in favour of the assessee.
Buddy has 1000 acre ranch near Commanche...Some really nice massy bucks, difficulty of hunting hinges on acorn crops, lots of oaks in the county. Quite a bit of hunting pressure but I have seen some really nice bucks come off his place over the last few years. We hunt NW of Rising Star. A few nice bucks, a nice 9 pt. & 8 pt. taken last year. Lots of pigs now _________________________ Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, beer in the other, body thoroughly used up, totally worn out and screaming.
Subscribe to Spiritual Questions Bulletin Get 6 times a year emails about new posts. We will not pass on your address elsewhere. You may want to prevent the email from us going into your spam/junk folder by adding mail@spiritualquestions.org.uk to your contacts list. Categories Categories Pages Tag: self-confidence John was going through an inner life crisis. But he could not fathom what was wrong. He and his wife were comfortably well off and had got the house as they wanted it. He had always been a confident person. Outwardly in their lives nothing much had changed. Inner life problems But, now for the … Continue reading Inner life crisis – What does it mean? Do you lack confidence when it comes to certain situations? It could be anything: dancing, playing sport, chatting with strangers, doing your job, making love. Yet, even confident people can get unstuck somewhere along the line. Calamities oblige us to reconsider the bigger picture. So when it comes down to it, in what can we place our confidence? In our own abilities? In the ideas of others? Or in something beyond all of us? One example of the last of these three possibilities is to do with what the psychologist Abraham Maslow called `the whole of Being’.
Q: Entity Framework NullReferenceException calling ToList? I'm very new to WPF and the EF, and I'm trying to display some data from a table in a datagrid. I've got the entity model pulled from an existing database and simple operations seem to work (getting row counts, using 'first'). I'm running against Firebird 2.5.0 using the 2.0.5 DDEX provider and 2.5.2 ADO NETProvider. When I try to get the data into the grid or simply into a list, I get a null reference exception. Possibly I just don't understand how to use the entity framework, but the examples I see on the net make it look really easy. public partial class Page1 : Page { Entities context; public Page1() { context = new Entities(); InitializeComponent(); // This works to get a row into the grid var arep = context.SALESREPs.First(); var alist = new List<SALESREP>(); alist.Add( arep ); gridUserList.ItemsSource = alist; // These both fail with null ref exception var allreps = context.SALESREPs.ToList(); gridUserList.ItemsSource = context.SALESREPs; } } Here's the exception detail: System.NullReferenceException was unhandled by user code Message=Object reference not set to an instance of an object. Source=System.Data.Entity StackTrace: at System.Data.EntityKey.AddHashValue(Int32 hashCode, Object keyValue) at System.Data.EntityKey.GetHashCode() at System.Collections.Generic.GenericEqualityComparer`1.GetHashCode(T obj) at System.Collections.Generic.Dictionary`2.FindEntry(TKey key) at System.Collections.Generic.Dictionary`2.TryGetValue(TKey key, TValue& value) at System.Data.Objects.ObjectStateManager.TryGetEntityEntry(EntityKey key, EntityEntry& entry) at System.Data.Common.Internal.Materialization.Shaper.HandleEntityAppendOnly[TEntity](Func`2 constructEntityDelegate, EntityKey entityKey, EntitySet entitySet) at lambda_method(Closure , Shaper ) at System.Data.Common.Internal.Materialization.Coordinator`1.ReadNextElement(Shaper shaper) at System.Data.Common.Internal.Materialization.Shaper`1.SimpleEnumerator.MoveNext() at System.Collections.Generic.List`1..ctor(IEnumerable`1 collection) at System.Linq.Enumerable.ToList[TSource](IEnumerable`1 source) at PSUserMaintenanceWebUI.Page1..ctor() in C:\Documents and Settings\d...\my documents\visual studio 2010\Projects\UserMaintenance\UserMaintenanceWebUI\Page1.xaml.cs:line 36 at System.Xaml.Schema.XamlTypeInvoker.DefaultCtorXamlActivator.InvokeDelegate(Action`1 action, Object argument) at System.Xaml.Schema.XamlTypeInvoker.DefaultCtorXamlActivator.CallCtorDelegate(XamlTypeInvoker type) at System.Xaml.Schema.XamlTypeInvoker.DefaultCtorXamlActivator.CreateInstance(XamlTypeInvoker type) at System.Xaml.Schema.XamlTypeInvoker.CreateInstance(Object[] arguments) at MS.Internal.Xaml.Runtime.ClrObjectRuntime.CreateInstanceWithCtor(XamlType xamlType, Object[] args) at MS.Internal.Xaml.Runtime.ClrObjectRuntime.CreateInstance(XamlType xamlType, Object[] args) InnerException: A: My table has a multi-field primary key with some of the fields being nullable. The entity framework doesn't like nullable fields in the primary key. I removed those rows and it works fine. I'm already in the process of finding a different solution to the requirement that prompted us to allow nulls in some of the primary key fields.
Categories Statistics View count: 20,387 Likes: 773 Dislikes: 9 Comments: 75 Duration: 06:43 Uploaded: 2016-10-04 Last sync: 2017-07-12 09:50 Studies report that hundreds of thousands of people die from preventable medical errors in the US each year. But is that right? This week we talk about times when smart people come to different conclusions from the same facts. It makes headlines to claim medical errors are killing more people than guns, but we should look beyond the headlines.